Sample records for confer protective effects

  1. Joint American Nuclear Society and Health Physics Society Conference: Applicability of Radiation Response Models to Low Dose Protection Standards.

    PubMed

    Glines, Wayne M; Markham, Anna

    2018-05-01

    Seventy-five years after the Hanford Site was initially created as the primary plutonium production site for atomic weapons development under the Manhattan Project, the American Nuclear Society and the Health Physics Society are sponsoring a conference from 30 September through 3 October 2018, in Pasco, Washington, titled "Applicability of Radiation Response Models to Low Dose Protection Standards." The goal of this conference is to use current scientific data to update the approach to regulating low-level radiation doses; i.e., to answer a quintessential question of radiation protection-how to best develop radiation protection standards that protect human populations against detrimental effects while allowing the beneficial uses of radiation and radioactive materials. Previous conferences (e.g., "Wingspread Conference," "Arlie Conference") have attempted to address this question; but now, almost 20 y later, the key issues, goals, conclusions, and recommendations of those two conferences remain and are as relevant as they were then. Despite the best efforts of the conference participants and increased knowledge and understanding of the science underlying radiation effects in human populations, the bases of current radiation protection standards have evolved little. This 2018 conference seeks to provide a basis and path forward for evolving radiation protection standards to be more reflective of current knowledge and understanding of low dose response models.

  2. NATIONAL CONFERENCE ON TOOLS FOR URBAN WATER RESOURCE MANAGEMENT AND PROTECTION: PROCEEDINGS, CHICAGO, IL, FEBRUARY 7-10, 2000

    EPA Science Inventory

    A wide array of effective water quality management and protection tools have been developed for urban environments, but implementation is hindered by a shortage of technology transfer opportunities. This National Conference on Tools for Urban Water Resource Management and Protec...

  3. 75 FR 66752 - ILP Effectiveness Evaluation 2010; Additional Notice of Multi-Stakeholder Technical Conference on...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-29

    ... Licensing Process October 21, 2010. As announced in the May 18, 2010, ``Notice of Interviews... at [email protected]com by October 29, 2010 to receive the toll-free telephone number and password... Stephanie Obadia at [email protected]com by October 29, 2010. For more information about this conference...

  4. TolC plays a crucial role in immune protection conferred by Edwardsiella tarda whole-cell vaccines.

    PubMed

    Wang, Chao; Peng, Bo; Li, Hui; Peng, Xuan-Xian

    2016-07-12

    Although vaccines developed from live organisms have better efficacy than those developed from dead organisms, the mechanisms underlying this differential efficacy remain unexplored. In this study, we combined sub-immunoproteomics with immune challenge to investigate the action of the outer membrane proteome in the immune protection conferred by four Edwardsiella tarda whole-cell vaccines prepared via different treatments and to identify protective immunogens that play a key role in this immune protection. Thirteen spots representing five outer membrane proteins and one cytoplasmic protein were identified, and it was found that their abundance was altered in relation with the immune protective abilities of the four vaccines. Among these proteins, TolC and OmpA were found to be the key immunogens conferring the first and second highest degrees of protection, respectively. TolC was detected in the two effective vaccines (live and inactivated-30-F). The total antiserum and anti-OmpA titers were higher for the two effective vaccines than for the two ineffective vaccines (inactivated-80-F and inactivated-100). Further evidence demonstrated that the live and inactivated-30-F vaccines demonstrated stronger abilities to induce CD8+ and CD4+ T cell differentiation than the other two evaluated vaccines. Our results indicate that the outer membrane proteome changes dramatically following different treatments, which contributes to the effectiveness of whole-cell vaccines.

  5. Vaccination with human amniotic epithelial cells confer effective protection in a murine model of Colon adenocarcinoma.

    PubMed

    Tabatabaei, M; Mosaffa, N; Ghods, R; Nikoo, S; Kazemnejad, S; Khanmohammadi, M; Mirzadeghan, E; Mahmoudi, A R; Bolouri, M R; Falak, R; Keshavarzi, B; Ramezani, M; Zarnani, A H

    2018-04-01

    As a prophylactic cancer vaccine, human amniotic membrane epithelial cells (hAECs) conferred effective protection in a murine model of colon cancer. The immunized mice mounted strong cross-protective CTL and antibody responses. Tumor burden was significantly reduced in tumor-bearing mice after immunization with hAECs. Placental cancer immunotherapy could be a promising approach for primary prevention of cancer. In spite of being the star of therapeutic strategies for cancer treatment, the results of immunotherapeutic approaches are still far from expectations. In this regard, primary prevention of cancer using prophylactic cancer vaccines has gained considerable attention. The immunologic similarities between cancer development and placentation have helped researchers to unravel molecular mechanisms responsible for carcinogenesis and to take advantage of stem cells from reproductive organs to elicit robust anti-cancer immune responses. Here, we showed that vaccination of mice with human amniotic membrane epithelial cells (hAECs) conferred effective protection against colon cancer and led to expansion of systemic and splenic cytotoxic T cell population and induction of cross-protective cytotoxic responses against tumor cells. Vaccinated mice mounted tumor-specific Th1 responses and produced cross-reactive antibodies against cell surface markers of cancer cells. Tumor burden was also significantly reduced in tumor-bearing mice immunized with hAECs. Our findings pave the way for potential future application of hAECs as an effective prophylactic cancer vaccine. © 2017 UICC.

  6. Immune Protection of Nonhuman Primates against Ebola Virus with Single Low-Dose Adenovirus Vectors Encoding Modified GPs

    PubMed Central

    Geisbert, Joan B; Shedlock, Devon J; Xu, Ling; Lamoreaux, Laurie; Custers, Jerome H. H. V; Popernack, Paul M; Yang, Zhi-Yong; Pau, Maria G; Roederer, Mario; Koup, Richard A; Goudsmit, Jaap; Jahrling, Peter B; Nabel, Gary J

    2006-01-01

    Background Ebola virus causes a hemorrhagic fever syndrome that is associated with high mortality in humans. In the absence of effective therapies for Ebola virus infection, the development of a vaccine becomes an important strategy to contain outbreaks. Immunization with DNA and/or replication-defective adenoviral vectors (rAd) encoding the Ebola glycoprotein (GP) and nucleoprotein (NP) has been previously shown to confer specific protective immunity in nonhuman primates. GP can exert cytopathic effects on transfected cells in vitro, and multiple GP forms have been identified in nature, raising the question of which would be optimal for a human vaccine. Methods and Findings To address this question, we have explored the efficacy of mutant GPs from multiple Ebola virus strains with reduced in vitro cytopathicity and analyzed their protective effects in the primate challenge model, with or without NP. Deletion of the GP transmembrane domain eliminated in vitro cytopathicity but reduced its protective efficacy by at least one order of magnitude. In contrast, a point mutation was identified that abolished this cytopathicity but retained immunogenicity and conferred immune protection in the absence of NP. The minimal effective rAd dose was established at 1010 particles, two logs lower than that used previously. Conclusions Expression of specific GPs alone vectored by rAd are sufficient to confer protection against lethal challenge in a relevant nonhuman primate model. Elimination of NP from the vaccine and dose reductions to 1010 rAd particles do not diminish protection and simplify the vaccine, providing the basis for selection of a human vaccine candidate. PMID:16683867

  7. Bioavailable Concentrations of Delphinidin and Its Metabolite, Gallic Acid, Induce Antioxidant Protection Associated with Increased Intracellular Glutathione in Cultured Endothelial Cells

    PubMed Central

    Goszcz, Katarzyna; Deakin, Sherine J.; Duthie, Garry G.; Stewart, Derek

    2017-01-01

    Despite limited bioavailability and rapid degradation, dietary anthocyanins are antioxidants with cardiovascular benefits. This study tested the hypothesis that the antioxidant protection conferred by the anthocyanin, delphinidin, is mediated by modulation of endogenous antioxidant defences, driven by its degradation product, gallic acid. Delphinidin was found to degrade rapidly (t1/2 ~ 30 min), generating gallic acid as a major degradation product. Both delphinidin and gallic acid generated oxygen-centred radicals at high (100 μM) concentrations in vitro. In a cultured human umbilical vein endothelial cell model of oxidative stress, the antioxidant protective effects of both delphinidin and gallic acid displayed a hormesic profile; 100 μM concentrations of both were cytotoxic, but relatively low concentrations (100 nM–1 μM) protected the cells and were associated with increased intracellular glutathione. We conclude that delphinidin is intrinsically unstable and unlikely to confer any direct antioxidant activity in vivo yet it offered antioxidant protection to cells at low concentrations. This paradox might be explained by the ability of the degradation product, gallic acid, to confer benefit. The findings are important in understanding the mode of protection conferred by anthocyanins and reinforce the necessity to conduct in vitro experiments at biologically relevant concentrations. PMID:29081896

  8. Protective Immunity and Reduced Renal Colonization Induced by Vaccines Containing Recombinant Leptospira interrogans Outer Membrane Proteins and Flagellin Adjuvant

    PubMed Central

    Monaris, D.; Sbrogio-Almeida, M. E.; Dib, C. C.; Canhamero, T. A.; Souza, G. O.; Vasconcellos, S. A.; Ferreira, L. C. S.

    2015-01-01

    Leptospirosis is a global zoonotic disease caused by different Leptospira species, such as Leptospira interrogans, that colonize the renal tubules of wild and domestic animals. Thus far, attempts to develop effective leptospirosis vaccines, both for humans and animals, have failed to induce immune responses capable of conferring protection and simultaneously preventing renal colonization. In this study, we evaluated the protective immunity induced by subunit vaccines containing seven different recombinant Leptospira interrogans outer membrane proteins, including the carboxy-terminal portion of the immunoglobulinlike protein A (LigAC) and six novel antigens, combined with aluminum hydroxide (alum) or Salmonella flagellin (FliC) as adjuvants. Hamsters vaccinated with the different formulations elicited high antigen-specific antibody titers. Immunization with LigAC, either with alum or flagellin, conferred protective immunity but did not prevent renal colonization. Similarly, animals immunized with LigAC or LigAC coadministered with six leptospiral proteins with alum adjuvant conferred protection but did not reduce renal colonization. In contrast, immunizing animals with the pool of seven antigens in combination with flagellin conferred protection and significantly reduced renal colonization by the pathogen. The present study emphasizes the relevance of antigen composition and added adjuvant in the efficacy of antileptospirosis subunit vaccines and shows the complex relationship between immune responses and renal colonization by the pathogen. PMID:26108285

  9. 40 CFR 304.31 - Pre-hearing conference.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 27 2010-07-01 2010-07-01 false Pre-hearing conference. 304.31 Section 304.31 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SUPERFUND, EMERGENCY... CLAIMS Hearings Before the Arbitrator § 304.31 Pre-hearing conference. (a) The Arbitrator and the parties...

  10. Proceedings: Conference on asbestos control and replacement for electric utilities

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    An EPRI conference on Asbestos Control and Replacement for Electric Utilities was held April 6--7, 1993 in conjunction with the Environmental Information Association`s (formerly National Asbestos Council) Environmental Management `93 Conference and Exposition. The high cost and potential liabilities of asbestos removal projects, compounded by concerns over the health effects of asbestos replacement materials, was the main motivation for the conference. The objective of the conference was to assemble guidance and information that will help utilities manage asbestos and to effectively prioritize EPRI research in this area. Eleven papers covered such topics as changes in the Environmental Protection Agency`s (EPA)more » ban on asbestos, utility experience with asbestos management and abatement, asbestos monitoring and disposal, and asbestos replacement materials. Utility feedback received at the conference indicates that present and planned EPRI research activities in this area will effectively meet industry needs.« less

  11. Immunization with plasmid DNA encoding the hemagglutinin and the nucleoprotein confers robust protection against a lethal canine distemper virus challenge.

    PubMed

    Dahl, Lotte; Jensen, Trine Hammer; Gottschalck, Elisabeth; Karlskov-Mortensen, Peter; Jensen, Tove Dannemann; Nielsen, Line; Andersen, Mads Klindt; Buckland, Robin; Wild, T Fabian; Blixenkrone-Møller, Merete

    2004-09-09

    We have investigated the protective effect of immunization of a highly susceptible natural host of canine distemper virus (CDV) with DNA plasmids encoding the viral nucleoprotein (N) and hemagglutinin (H). The combined intradermal and intramuscular routes of immunization elicited high virus-neutralizing serum antibody titres in mink (Mustela vison). To mimic natural exposure, we also conducted challenge infection by horizontal transmission from infected contact animals. Other groups received a lethal challenge infection by administration to the mucosae of the respiratory tract and into the muscle. One of the mink vaccinated with N plasmid alone developed severe disease after challenge. In contrast, vaccination with the H plasmid together with the N plasmid conferred solid protection against disease and we were unable to detect CDV infection in PBMCs or in different tissues after challenge. Our findings show that DNA immunization by the combined intradermal and intramuscular routes can confer solid protective immunity against naturally transmitted morbillivirus infection and disease.

  12. 40 CFR 78.13 - Scheduling orders and pre-hearing conferences.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 17 2013-07-01 2013-07-01 false Scheduling orders and pre-hearing conferences. 78.13 Section 78.13 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) APPEAL PROCEDURES § 78.13 Scheduling orders and pre-hearing conferences. (a) If a...

  13. Mechanisms of Cross-protection by Influenza Virus M2-based Vaccines.

    PubMed

    Lee, Yu-Na; Kim, Min-Chul; Lee, Young-Tae; Kim, Yu-Jin; Kang, Sang-Moo

    2015-10-01

    Current influenza virus vaccines are based on strain-specific surface glycoprotein hemagglutinin (HA) antigens and effective only when the predicted vaccine strains and circulating viruses are well-matched. The current strategy of influenza vaccination does not prevent the pandemic outbreaks and protection efficacy is reduced or ineffective if mutant strains emerge. It is of high priority to develop effective vaccines and vaccination strategies conferring a broad range of cross protection. The extracellular domain of M2 (M2e) is highly conserved among human influenza A viruses and has been utilized to develop new vaccines inducing cross protection against different subtypes of influenza A virus. However, immune mechanisms of cross protection by M2e-based vaccines still remain to be fully elucidated. Here, we review immune correlates and mechanisms conferring cross protection by M2e-based vaccines. Molecular and cellular immune components that are known to be involved in M2 immune-mediated protection include antibodies, B cells, T cells, alveolar macrophages, Fc receptors, complements, and natural killer cells. Better understanding of protective mechanisms by immune responses induced by M2e vaccination will help facilitate development of broadly cross protective vaccines against influenza A virus.

  14. Early protection events in swine immunized with an experimental live attenuated classical swine fever marker vaccine, FlagT4G

    USDA-ARS?s Scientific Manuscript database

    Prophylactic vaccination using live attenuated classical swine fever (CSF) vaccines has been a very effective method to control disease in endemic regions and during outbreaks in previously disease-free areas. These vaccines confer effective protection against the disease at early times post-vaccina...

  15. NATIONAL CONFERENCE ON URBAN STORM WATER: ENHANCING PROGRAMS AT THE LOCAL LEVEL - PROCEEDINGS CHICAGO, IL FEBRUARY 17-20, 2003

    EPA Science Inventory

    A wide array of effective storm water management and resource protection tools have been developed for urban environments, but their implementation continues to be hampered by a lack of technology transfer opportunities. At the national conference Urban Storm Water: Enhancing Pro...

  16. Eighteenth annual offshore technology conference. Volume 1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1986-01-01

    These sixty papers were given at a conference on offshore technology. Topics covered include friction effects of driving piles into sea beds of various compositions, wave forces on offshore platforms, stability, materials testing of various components such as plates, legs, wellheads, pipe joints, and protection of offshore platforms against ice and collision with icebergs.

  17. Exogenous Gene Transmission of Isocitrate Dehydrogenase 2 Mimics Ischemic Preconditioning Protection.

    PubMed

    Kolb, Alexander L; Corridon, Peter R; Zhang, Shijun; Xu, Weimin; Witzmann, Frank A; Collett, Jason A; Rhodes, George J; Winfree, Seth; Bready, Devin; Pfeffenberger, Zechariah J; Pomerantz, Jeremy M; Hato, Takashi; Nagami, Glenn T; Molitoris, Bruce A; Basile, David P; Atkinson, Simon J; Bacallao, Robert L

    2018-04-01

    Ischemic preconditioning confers organ-wide protection against subsequent ischemic stress. A substantial body of evidence underscores the importance of mitochondria adaptation as a critical component of cell protection from ischemia. To identify changes in mitochondria protein expression in response to ischemic preconditioning, we isolated mitochondria from ischemic preconditioned kidneys and sham-treated kidneys as a basis for comparison. The proteomic screen identified highly upregulated proteins, including NADP+-dependent isocitrate dehydrogenase 2 (IDH2), and we confirmed the ability of this protein to confer cellular protection from injury in murine S3 proximal tubule cells subjected to hypoxia. To further evaluate the role of IDH2 in cell protection, we performed detailed analysis of the effects of Idh2 gene delivery on kidney susceptibility to ischemia-reperfusion injury. Gene delivery of IDH2 before injury attenuated the injury-induced rise in serum creatinine ( P <0.05) observed in controls and increased the mitochondria membrane potential ( P <0.05), maximal respiratory capacity ( P <0.05), and intracellular ATP levels ( P <0.05) above those in controls. This communication shows that gene delivery of Idh2 can confer organ-wide protection against subsequent ischemia-reperfusion injury and mimics ischemic preconditioning. Copyright © 2018 by the American Society of Nephrology.

  18. The Role of Social Connectedness and Sexual Orientation in the Prevention of Youth Suicide Ideation and Attempts Among Sexually Active Adolescents.

    PubMed

    Stone, Deborah M; Luo, Feijun; Lippy, Caroline; McIntosh, Wendy LiKamWa

    2015-08-01

    The impact of types of social connectedness-family, other adult, and school-on suicide ideation and attempts among all youth, the relative impact of each type, and effect modification by sexual orientation was assessed. Data were from the 2007-2009 Milwaukee Youth Risk Behavior Surveys. Multivariable logistic regression analyses calculated the risk of suicide ideation and attempts by sexual orientation, types of social connectedness, and their interaction. Among all youth, each type of connectedness modeled singly conferred protective effects for suicide ideation. Family and other adult connectedness protected against suicide attempts. When modeled simultaneously, family connectedness protected against ideation and attempts. Sexual orientation modified the association between other adult connectedness and suicide ideation. Findings suggest that family connectedness confers the most consistent protection among all youth and sexual orientation does not generally modify the association between connectedness and suicidal behavior. © Published 2014. This article is a U.S. Government work and is in the public domain in the USA.

  19. 40 CFR 305.26 - Prehearing conference.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 29 2012-07-01 2012-07-01 false Prehearing conference. 305.26 Section 305.26 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SUPERFUND, EMERGENCY... LIABILITY ACT (CERCLA) ADMINISTRATIVE HEARING PROCEDURES FOR CLAIMS AGAINST THE SUPERFUND Prehearing...

  20. 40 CFR 305.26 - Prehearing conference.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 29 2013-07-01 2013-07-01 false Prehearing conference. 305.26 Section 305.26 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SUPERFUND, EMERGENCY... LIABILITY ACT (CERCLA) ADMINISTRATIVE HEARING PROCEDURES FOR CLAIMS AGAINST THE SUPERFUND Prehearing...

  1. Vaccine-induced protection against anthrax in cheetah (Acinonyx jubatus) and black rhinoceros (Diceros bicornis).

    PubMed

    Turnbull, P C B; Tindall, B W; Coetzee, J D; Conradie, C M; Bull, R L; Lindeque, P M; Huebschle, O J B

    2004-09-03

    Institution of a policy of vaccination in endangered species with a vaccine not previously administered to it cannot be undertaken lightly. This applies even more in the case of cheetah (Acinonyx jubatus) with their unusually monomorphic gene pool and the potential restrictions this places on their immune responses. However, the recently observed mortalities from anthrax in these animals in the Etosha National Park, Namibia, made it imperative to evaluate vaccination. Black rhinoceros (Diceros bicornis), another endangered species in the park, have been vaccinated for over three decades but the effectiveness of this has never been evaluated. Passive protection tests in A/J mice using sera from 12 cheetahs together with enzyme immunoassay indicated that cheetah are able to mount seemingly normal primary and secondary humoral immune responses to the Sterne 34F2 live spore livestock vaccine. Overall protection rates in mice injected with the sera rose and fell in concert with rises and declines in antibody titres, although fine analysis showed that the correlation between titre and protection was complex. Once a high level of protection (96% of mice 1 month after a second booster in the cheetahs) had been achieved, the duration of substantial protection appeared good (60% of the mice 5 months after the second booster). Protection conferred on mice by sera from three of four vaccinated rhino was almost complete, but, obscurely, none of the mice receiving serum from the fourth rhino were protected. Sera from three park lions with naturally acquired high antibody titres, included as controls, also conferred high levels of protection. For the purposes of wildlife management, the conclusions were that vaccination of cheetah with the standard animal anthrax vaccine causes no observable ill effect in the animals and does appear to confer protective immunity. At least one well-separated booster does appear to be desirable. Vaccination of rhino also appears to be justified from the limited data obtained.

  2. Using Private Demand Studies to Calculate Socially Optimal Vaccine Subsidies in Developing Countries

    ERIC Educational Resources Information Center

    Cook, Joseph; Jeuland, Marc; Maskery, Brian; Lauria, Donald; Dipika, Sur; Clemens, John; Whittington, Dale

    2009-01-01

    Although it is well known that vaccines against many infectious diseases confer positive economic externalities via indirect protection, analysts have typically ignored possible herd protection effects in policy analyses of vaccination programs. Despite a growing literature on the economic theory of vaccine externalities and several innovative…

  3. Protective-antigen (PA) based anthrax vaccines confer protection against inhalation anthrax by precluding the establishment of a systemic infection

    PubMed Central

    Merkel, Tod J; Perera, Pin-Yu; Lee, Gloria M; Verma, Anita; Hiroi, Toyoko; Yokote, Hiroyuki; Waldmann, Thomas A; Perera, Liyanage P

    2013-01-01

    An intense effort has been launched to develop improved anthrax vaccines that confer rapid, long lasting protection preferably with an extended stability profile amenable for stockpiling. Protective antigen (PA)-based vaccines are most favored as immune responses directed against PA are singularly protective, although the actual protective mechanism remains to be unraveled. Herein we show that contrary to the prevailing view, an efficacious PA-based vaccine confers protection against inhalation anthrax by preventing the establishment of a toxin-releasing systemic infection. Equally importantly, antibodies measured by the in vitro lethal toxin neutralization activity assay (TNA) that is considered as a reliable correlate of protection, especially for PA protein-based vaccines adjuvanted with aluminum salts appear to be not absolutely essential for this protective immune response. PMID:23787486

  4. Protective-antigen (PA) based anthrax vaccines confer protection against inhalation anthrax by precluding the establishment of a systemic infection.

    PubMed

    Merkel, Tod J; Perera, Pin-Yu; Lee, Gloria M; Verma, Anita; Hiroi, Toyoko; Yokote, Hiroyuki; Waldmann, Thomas A; Perera, Liyanage P

    2013-09-01

    An intense effort has been launched to develop improved anthrax vaccines that confer rapid, long lasting protection preferably with an extended stability profile amenable for stockpiling. Protective antigen (PA)-based vaccines are most favored as immune responses directed against PA are singularly protective, although the actual protective mechanism remains to be unraveled. Herein we show that contrary to the prevailing view, an efficacious PA-based vaccine confers protection against inhalation anthrax by preventing the establishment of a toxin-releasing systemic infection. Equally importantly, antibodies measured by the in vitro lethal toxin neutralization activity assay (TNA) that is considered as a reliable correlate of protection, especially for PA protein-based vaccines adjuvanted with aluminum salts appear to be not absolutely essential for this protective immune response.

  5. 40 CFR 304.31 - Pre-hearing conference.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 29 2012-07-01 2012-07-01 false Pre-hearing conference. 304.31 Section 304.31 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SUPERFUND, EMERGENCY PLANNING, AND COMMUNITY RIGHT-TO-KNOW PROGRAMS ARBITRATION PROCEDURES FOR SMALL SUPERFUND COST RECOVERY...

  6. 40 CFR 304.31 - Pre-hearing conference.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 29 2013-07-01 2013-07-01 false Pre-hearing conference. 304.31 Section 304.31 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SUPERFUND, EMERGENCY PLANNING, AND COMMUNITY RIGHT-TO-KNOW PROGRAMS ARBITRATION PROCEDURES FOR SMALL SUPERFUND COST RECOVERY...

  7. 40 CFR 304.31 - Pre-hearing conference.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 28 2011-07-01 2011-07-01 false Pre-hearing conference. 304.31 Section 304.31 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SUPERFUND, EMERGENCY PLANNING, AND COMMUNITY RIGHT-TO-KNOW PROGRAMS ARBITRATION PROCEDURES FOR SMALL SUPERFUND COST RECOVERY...

  8. Effects of wine, alcohol and polyphenols on cardiovascular disease risk factors: evidences from human studies.

    PubMed

    Chiva-Blanch, Gemma; Arranz, Sara; Lamuela-Raventos, Rosa M; Estruch, Ramon

    2013-01-01

    The aim of this review was to focus on the knowledge of the cardiovascular benefits of moderate alcohol consumption, as well as to analyze the effects of the different types of alcoholic beverages. Systematic revision of human clinical studies and meta-analyses related to moderate alcohol consumption and cardiovascular disease (CVD) from 2000 to 2012. Heavy or binge alcohol consumption unquestionably leads to increased morbidity and mortality. Nevertheless, moderate alcohol consumption, especially alcoholic beverages rich in polyphenols, such as wine and beer, seems to confer cardiovascular protective effects in patients with documented CVD and even in healthy subjects. In conclusion, wine and beer (but especially red wine) seem to confer greater cardiovascular protection than spirits because of their polyphenolic content. However, caution should be taken when making recommendations related to alcohol consumption.

  9. 2007 Joint Chemical Biological, Radiological and Nuclear (CBRN) Conference and Exhibition - Combating Weapons of Mass Destruction

    DTIC Science & Technology

    2007-06-27

    Selected CB Defense Systems SHAPESENSE Joint Warning and Reporting Network JSLIST CB Protected Shelter Joint Vaccine Acquisition Program Joint Effects...military can operate in any environment, unconstrained by chemical or biological weapons. 21 SHIELD SUSTAIN Selected CB Defense Systems SHAPESENSE Joint...28070625_JCBRN_Conference_Reeves UNCLASSIFIED Decontamination Vision Strippable Barriers Self-Decontaminating Fabrics/Coatings Reduce Logistics Burden

  10. The Report of the National Invitational Conference on Consumer Protection in Postsecondary Education. Report No. 53.

    ERIC Educational Resources Information Center

    Education Commission of the States, Denver, CO.

    This report covers the background, major issues, major recommendations, and agencies and associations represented at the National Invitational Conference on Consumer Protection in Postsecondary Education held at Denver, Colorado in June 1974. Major recommendations of the conference suggest that: (1) The states should provide by legislation or by…

  11. [The protective efficacy of BCG against leprosy in São Paulo, Brazil].

    PubMed

    Lombardi, C; Pedrazzani, E S; Pedrazzani, J C; Ferreira Filho, P; Zicker, F

    1995-11-01

    The protection against leprosy conferred by BCG vaccination was evaluated in a case-control study. Selected for the study were 97 patients under 16 years of age who had been diagnosed with leprosy (cases) and 385 healthy persons (controls), who were matched according to sex, age, place of residence, and type of contact (intra- or extradomicilliary). The cases were selected from a register of active cases as well as a series of new leprosy patients treated in 50 centers in the city of São Paulo, Brasil. To estimate the protective effect of BCG, the prevalences of BCG scars among cases and controls were compared. The presence of one or more scars was associated with a protective efficacy of 90% (95% confidence interval: 78%-96%). Stratified analysis by age group, sex, socioeconomic level, and clinical form of leprosy did not reveal any important differences in the protection conferred by the vaccine. The significance of these findings and the appropriateness of using BCG in leprosy control programs is discussed.

  12. Vaccine approaches conferring cross-protection against influenza viruses

    PubMed Central

    Vemula, Sai V.; Sayedahmed, Ekramy E; Sambhara, Suryaprakash; Mittal, Suresh K.

    2018-01-01

    Introduction Annual vaccination is one of the most efficient and cost-effective strategies to prevent and control influenza epidemics. Most of currently available influenza vaccines are strong inducer of antibody responses against viral surface proteins, hemagglutinin (HA) and neuraminidase (NA), but are poor inducers of cell-mediated immune responses against conserved internal proteins. Moreover, due to the high variability of viral surface proteins because of antigenic drift or antigenic shift, many of the currently licensed vaccines confer little or no protection against drift or shift variants. Areas covered Next generation influenza vaccines that can induce humoral immune responses to receptor-binding epitopes as well as broadly neutralizing conserved epitopes, and cell-mediated immune responses against highly conserved internal proteins would be effective against variant viruses as well as a novel pandemic influenza until circulating strain-specific vaccines become available. Here we discuss vaccine approaches that have potential to provide broad spectrum protection against influenza viruses. Expert opinion Based on current progress in defining cross-protective influenza immunity, it seems that the development of a universal influenza vaccine is feasible. It would revolutionize the strategy for influenza pandemic preparedness, and significantly impact the shelf-life and protection efficacy of seasonal influenza vaccines. PMID:28925296

  13. Virus-like Particles Containing Multiple M2 Extracellular Domains Confer Improved Cross-protection Against Various Subtypes of Influenza Virus

    PubMed Central

    Kim, Min-Chul; Song, Jae-Min; O, Eunju; Kwon, Young-Man; Lee, Youn-Jeong; Compans, Richard W; Kang, Sang-Moo

    2013-01-01

    The extracellular domain of M2 (M2e), a small ion channel membrane protein, is well conserved among different human influenza A virus strains. To improve the protective efficacy of M2e vaccines, we genetically engineered a tandem repeat of M2e epitope sequences (M2e5x) of human, swine, and avian origin influenza A viruses, which was expressed in a membrane-anchored form and incorporated in virus-like particles (VLPs). The M2e5x protein with the transmembrane domain of hemagglutinin (HA) was effectively incorporated into VLPs at a several 100-fold higher level than that on influenza virions. Intramuscular immunization with M2e5x VLP vaccines was highly effective in inducing M2e-specific antibodies reactive to different influenza viruses, mucosal and systemic immune responses, and cross-protection regardless of influenza virus subtypes in the absence of adjuvant. Importantly, immune sera were found to be sufficient for conferring protection in naive mice, which was long-lived and cross-protective. Thus, molecular designing and presenting M2e immunogens on VLPs provide a promising platform for developing universal influenza vaccines without using adjuvants. PMID:23247101

  14. Prevention of mammary carcinogenesis by short-term estrogen and progestin treatments

    PubMed Central

    Rajkumar, Lakshmanaswamy; Guzman, Raphael C; Yang, Jason; Thordarson, Gudmundur; Talamantes, Frank; Nandi, Satyabrata

    2004-01-01

    Introduction Women who have undergone a full-term pregnancy before the age of 20 have one-half the risk of developing breast cancer compared with women who have never gone through a full-term pregnancy. This protective effect is observed universally among women of all ethnic groups. Parity in rats and mice also protects them against chemically induced mammary carcinogenesis. Methods Seven-week-old virgin Lewis rats were given N-methyl-N-nitrosourea. Two weeks later the rats were treated with natural or synthetic estrogens and progestins for 7–21 days by subcutaneous implantation of silastic capsules. Results In our current experiment, we demonstrate that short-term sustained exposure to natural or synthetic estrogens along with progestins is effective in preventing mammary carcinogenesis in rats. Treatment with 30 mg estriol plus 30 mg progesterone for 3 weeks significantly reduced the incidence of mammary cancer. Short-term exposure to ethynyl estradiol plus megesterol acetate or norethindrone was effective in decreasing the incidence of mammary cancers. Tamoxifen plus progesterone treatment for 3 weeks was able to confer only a transient protection from mammary carcinogenesis, while 2-methoxy estradiol plus progesterone was effective in conferring protection against mammary cancers. Conclusions The data obtained in the present study demonstrate that, in nulliparous rats, long-term protection against mammary carcinogenesis can be achieved by short-term treatments with natural or synthetic estrogen and progesterone combinations. PMID:14680498

  15. Is new always better than old?: The development of human vaccines for anthrax.

    PubMed

    Baillie, Leslie W

    2009-12-01

    Anthrax is caused by a Gram-positive aerobic spore-forming bacillus called Bacillus anthracis. Although primarily a disease of animals, it can also infect man, sometimes with fatal consequences. As a result of concerns over the illicit use of this organism, considerable effort is focused on the development of therapies capable of conferring protection against anthrax. while effective concerns over the toxicity of the current vaccines have driven the development of second-generation products. Recombinant Protective Antigen (rPA), the nontoxic cell-binding component of anthrax lethal toxin, is the principal immunogen of the vaccines currently undergoing human clinical trials. While these new vaccines are likely to show reduced side effects they will still require multiple needle based dosing and the inclusion of the adjuvant alum which will make them expensive to administer and stockpile. To address these issues, researchers are seeking to develop vaccine formulations capable of stimulating rapid protection following needle-free injection which are stable at room temperature to facilitate stockpiling and mass vaccination programs. Recent concerns over the potential use of molecular biology to engineer vaccine resistant strains has prompted investigators to identify additional vaccine targets with which to extend the spectrum of protection conferred by rPA. While the injection of research dollars has seen a dramatic expansion of the anthrax vaccine field it is sobering to remember that work to develop the current second generation vaccines began around the time of the first gulf war. Almost two decades and millions of dollars later we still do not have a replacement vaccine and even when we do some argue that the spectrum of protection that it confers will not be as broad as the vaccine it replaces. If we are to respond effectively to emerging biological threats we need to develop processes that generate protective vaccines in a meaningful time frame and yield products in months not decades!

  16. Main problems and suggested solutions for improving radiation protection in medicine in Ibero-American countries. Summary of an International Conference held in Madrid, 2016.

    PubMed

    Vano, Eliseo; Jimenez, Pablo; Ramirez, Raul; Zarzuela, Javier; Larcher, Ana Maria; Gallego, Eduardo; Gonzalez, Santiago; Del Rosario Perez, Maria

    2018-03-01

    During the International Conference on Radiation Protection in Medicine held in Bonn in 2012, several areas for improvement were identified, including specific actions related with justification, optimization, role of manufacturers, radiation protection education and training, strategic research, data collection on medical and occupational exposures, prevention of incidents and accidents, radiation safety culture, risk-benefit dialogue and implementation of the radiation safety standards. The outcomes of the Bonn Conference were summarized in the so-called 'Bonn Call for Action', identifying 10 priority actions to enhance RP in medicine. Trying to analyse the progress in the implementation of this 'Call for Action' in the Ibero-American region, several international organizations organized the 'Ibero-American Conference on Radiation Protection in Medicine' (Conferencia Iberoamericana sobre Protección Radiológica en Medicina, CIPRaM) held in Madrid, in October 2016. CIPRaM was structured in eight thematic sessions dealing with: diagnostic and dental radiology, image guided interventional radiology, nuclear medicine, radiation therapy, health authorities and radiation protection regulators, professional associations of technologists and nurses, professional associations of medical physicists and radiation protection experts, and universities and researchers in radiation protection in medicine. This paper summarizes the main results of that Conference based on the consensus achieved about main problems, solutions, and indicators to evaluate the implementation of the proposed solutions.

  17. Protective Role of Dietary Berries in Cancer

    PubMed Central

    Kristo, Aleksandra S.; Klimis-Zacas, Dorothy; Sikalidis, Angelos K.

    2016-01-01

    Dietary patterns, including regular consumption of particular foods such as berries as well as bioactive compounds, may confer specific molecular and cellular protection in addition to the overall epidemiologically observed benefits of plant food consumption (lower rates of obesity and chronic disease risk), further enhancing health. Mounting evidence reports a variety of health benefits of berry fruits that are usually attributed to their non-nutritive bioactive compounds, mainly phenolic substances such as flavonoids or anthocyanins. Although it is still unclear which particular constituents are responsible for the extended health benefits, it appears that whole berry consumption generally confers some anti-oxidant and anti-inflammatory protection to humans and animals. With regards to cancer, studies have reported beneficial effects of berries or their constituents including attenuation of inflammation, inhibition of angiogenesis, protection from DNA damage, as well as effects on apoptosis or proliferation rates of malignant cells. Berries extend effects on the proliferation rates of both premalignant and malignant cells. Their effect on premalignant cells is important for their ability to cause premalignant lesions to regress both in animals and in humans. The present review focuses primarily on in vivo and human dietary studies of various berry fruits and discusses whether regular dietary intake of berries can prevent cancer initiation and delay progression in humans or ameliorate patients’ cancer status. PMID:27775562

  18. Protective Role of Dietary Berries in Cancer.

    PubMed

    Kristo, Aleksandra S; Klimis-Zacas, Dorothy; Sikalidis, Angelos K

    2016-10-19

    Dietary patterns, including regular consumption of particular foods such as berries as well as bioactive compounds, may confer specific molecular and cellular protection in addition to the overall epidemiologically observed benefits of plant food consumption (lower rates of obesity and chronic disease risk), further enhancing health. Mounting evidence reports a variety of health benefits of berry fruits that are usually attributed to their non-nutritive bioactive compounds, mainly phenolic substances such as flavonoids or anthocyanins. Although it is still unclear which particular constituents are responsible for the extended health benefits, it appears that whole berry consumption generally confers some anti-oxidant and anti-inflammatory protection to humans and animals. With regards to cancer, studies have reported beneficial effects of berries or their constituents including attenuation of inflammation, inhibition of angiogenesis, protection from DNA damage, as well as effects on apoptosis or proliferation rates of malignant cells. Berries extend effects on the proliferation rates of both premalignant and malignant cells. Their effect on premalignant cells is important for their ability to cause premalignant lesions to regress both in animals and in humans. The present review focuses primarily on in vivo and human dietary studies of various berry fruits and discusses whether regular dietary intake of berries can prevent cancer initiation and delay progression in humans or ameliorate patients' cancer status.

  19. Glutathione S-transferases as antioxidant defence agents confer pyrethroid resistance in Nilaparvata lugens.

    PubMed Central

    Vontas, J G; Small, G J; Hemingway, J

    2001-01-01

    Selection of a laboratory colony of the brown planthopper Nilaparvata lugens with the pyrethroids permethrin and lambda-cyhalothrin increased its resistance to both insecticides. Biochemical analysis and synergistic studies with metabolic inhibitors indicated that elevated glutathione S-transferases (GSTs) with a predominant peroxidase activity conferred resistance to both pyrethroids, whereas esterases conferred part of the resistance to permethrin. Purified esterases hydrolysed permethrin at a slow rate, but incubation of either pyrethroid or their primary metabolites with partially purified GSTs had no effect on the metabolic profile. Although GSTs were sensitive to inhibition by both pyrethroids, they did not serve as binding proteins, as previously hypothesized [Grant and Matsumura (1988) Insect Biochem. 18, 615-622]. We demonstrate that pyrethroids, in addition to their neurotoxic effect, induce oxidative stress and lipid peroxidation in insects. Pyrethroid exposure induced lipid peroxides, protein oxidation and depleted reduced glutathione. Elevated GSTs in the resistant strains attenuated the pyrethroid-induced lipid peroxidation and reduced mortality, whereas their in vivo inhibition eliminated their protective role. We therefore hypothesize that the main role of elevated GSTs in conferring resistance in N. lugens is through protecting tissues from oxidative damage. Our study extends the GSTs' range of efficacy to pyrethroid insecticides and possibly explains the role of elevated GSTs in other pyrethroid-resistant insects. PMID:11415437

  20. Children and Parent Participation in Child Protection Conferences: A Study in One English Local Authority

    ERIC Educational Resources Information Center

    Muench, Kerry; Diaz, Clive; Wright, Rebecca

    2017-01-01

    The overall purpose of a child protection conference is to safeguard children. The conferences are multi-agency meetings that aim to ensure children's safety, promote children's health and development, and identify when a child is at continuing risk of significant harm. Law and policies in the United Kingdom highlight that parents and children…

  1. The Report of the Second National Conference on Consumer Protection in Postsecondary Education. Report No. 64.

    ERIC Educational Resources Information Center

    Education Commission of the States, Denver, CO.

    The second National Conference on Consumer Protection in Postsecondary Education was a series of seminars on specific issues. The topics under discussion were (1) protecting the student financial interest; (2) student information needs and systems; (3) postsecondary education institutional responses; (4) regulations and safeguards; and (5) full…

  2. Identification of Western Equine Encephalitis Virus Structural Proteins That Confer Protection after DNA Vaccination▿

    PubMed Central

    Gauci, Penelope J.; Wu, Josh Q. H.; Rayner, George A.; Barabé, Nicole D.; Nagata, Leslie P.; Proll, David F.

    2010-01-01

    DNA vaccines encoding different portions of the structural proteins of western equine encephalitis virus were tested for the efficacy of their protection in a 100% lethal mouse model of the virus. The 6K-E1 structural protein encoded by the DNA vaccine conferred complete protection against challenge with the homologous strain and limited protection against challenge with a heterologous strain. PMID:19923571

  3. Immunological correlates for protection against intranasal challenge of Bacillus anthracis spores conferred by a protective antigen-based vaccine in rabbits.

    PubMed

    Weiss, Shay; Kobiler, David; Levy, Haim; Marcus, Hadar; Pass, Avi; Rothschild, Nili; Altboum, Zeev

    2006-01-01

    Correlates between immunological parameters and protection against Bacillus anthracis infection in animals vaccinated with protective antigen (PA)-based vaccines could provide surrogate markers to evaluate the putative protective efficiency of immunization in humans. In previous studies we demonstrated that neutralizing antibody levels serve as correlates for protection in guinea pigs (S. Reuveny et al., Infect. Immun. 69:2888-2893, 2001; H. Marcus et al., Infect. Immun. 72:3471-3477, 2004). In this study we evaluated similar correlates for protection by active and passive immunization of New Zealand White rabbits. Full immunization and partial immunization were achieved by single and multiple injections of standard and diluted doses of a PA-based vaccine. Passive immunization was carried out by injection of immune sera from rabbits vaccinated with PA-based vaccine prior to challenge with B. anthracis spores. Immunized rabbits were challenged by intranasal spore instillation with one of two virulent strains (strains Vollum and ATCC 6605). The immune competence was estimated by measuring the level of total anti-PA antibodies, the neutralizing antibody titers, and the conferred protective immunity. The results indicate that total anti-PA antibody titers greater than 1 x 10(5) conferred protection, whereas lower titers (between 10(4) and 10(5)) provided partial protection but failed to predict protection. Neutralizing antibody titers between 500 and 800 provided partial protection, while titers higher than 1,000 conferred protection. In conclusion, this study emphasizes that regardless of the immunization regimen or the time of challenge, neutralizing antibody titers are better predictors of protection than total anti-PA titers.

  4. KEYNOTE ADDRESS

    EPA Science Inventory

    Over the past two decades an environmental conference series has emerged in Poland to become one of the premier forums on the chemical aspects of environmental protection. The forum is called Chemistry for the Protection of the Environment CPE). The first conference of this serie...

  5. Cognitive and Neuroplasticity Mechanisms by Which Congenital or Early Blindness May Confer a Protective Effect Against Schizophrenia

    PubMed Central

    Silverstein, Steven M.; Wang, Yushi; Keane, Brian P.

    2013-01-01

    Several authors have noted that there are no reported cases of people with schizophrenia who were born blind or who developed blindness shortly after birth, suggesting that congenital or early (C/E) blindness may serve as a protective factor against schizophrenia. By what mechanisms might this effect operate? Here, we hypothesize that C/E blindness offers protection by strengthening cognitive functions whose impairment characterizes schizophrenia, and by constraining cognitive processes that exhibit excessive flexibility in schizophrenia. After briefly summarizing evidence that schizophrenia is fundamentally a cognitive disorder, we review areas of perceptual and cognitive function that are both impaired in the illness and augmented in C/E blindness, as compared to healthy sighted individuals. We next discuss: (1) the role of neuroplasticity in driving these cognitive changes in C/E blindness; (2) evidence that C/E blindness does not confer protective effects against other mental disorders; and (3) evidence that other forms of C/E sensory loss (e.g., deafness) do not reduce the risk of schizophrenia. We conclude by discussing implications of these data for designing cognitive training interventions to reduce schizophrenia-related cognitive impairment, and perhaps to reduce the likelihood of the development of the disorder itself. PMID:23349646

  6. International Aerospace and Ground Conference on Lightning and Static Electricity, 10th, and Congres International Aeronautique, 17th, Paris, France, June 10-13, 1985, Proceedings

    NASA Astrophysics Data System (ADS)

    1985-12-01

    The conference presents papers on statistical data and standards, coupling and indirect effects, meteorology and thunderstorm studies, lightning simulators, fuel ignition hazards, the phenomenology and characterization of lightning, susceptibility and protection of avionics, ground systems protection, lightning locators, aircraft systems protection, structures and materials, electrostatics, and spacecraft protection against static electricity. Particular attention is given to a comparison of published HEMP and natural lightning on the surface of an aircraft, electromagnetic interaction of external impulse fields with aircraft, of thunderstorm currents and lightning charges at the NASA Kennedy Space Center, the design of a fast risetime lightning generator, lightning simulation tests in FAA CV-580 lightning research aircraft, and the energy requirements of an aircraft triggered discharge. Papers are also presented on aircraft lightning attachment at low altitudes, a new form of transient suppressor, a proving ground for lightning research, and a spacecraft materials test in a continuous, broad energy-spectrum electron beam.

  7. Interaction of colicin E7 with the major coat protein (g8p) may confer limited protection on colicinogenic Escherichia coli against M13 bacteriophage infection.

    PubMed

    Chen, Yuh-Ren; Yang, Tsung-Yeh; Lei, Guang-Sheng; Liao, Chen-Chung; Chak, Kin-Fu

    2010-11-01

    Colicin release provides producer strains with a competitive advantage under certain circumstances. We found that propagation of M13 bacteriophage in cells producing colicin E7 is impaired, without alteration in the efficiency of bacteriophage adsorption, as compared with non-producing cells. In contrast to the protective effect of the colicin against M13 bacteriophage infection, the endogenously expressed colicin does not confer limited protection against transfection with M13 bacteriophage DNA. Furthermore, it was found that the translocation-receptor-binding domain and toxicity domain of the colicin are able to interact with the M13 major coat protein, g8p, during bacteriophage infection. Based on these observations, we propose that interaction between colicin E7 and g8p during infection interferes with g8p depolymerizing into the cytoplasmic membrane during bacteriophage DNA penetration, thus resulting in the limited protection against M13 bacteriophage infection.

  8. Serum- and Glucocorticoid-Inducible Kinase 1 Confers Protection in Cell-Based and in In Vivo Neurotoxin Models via the c-Jun N-Terminal Kinase Signaling Pathway

    PubMed Central

    Iqbal, Sarah; Howard, Shannon

    2015-01-01

    Serum glucocorticoid kinase 1 (SGK1) has been shown to be protective in models of Parkinson's disease, but the details by which it confers benefit is unknown. The current study was designed to investigate the details by which SGK1 confers neuroprotection. To do this we employed a cellular neurodegeneration model to investigate c-Jun N-terminal kinase (JNK) signaling and endoplasmic reticulum (ER) stress induced by 6-hydroxydopamine. SGK1-expressing adenovirus was created and used to overexpress SGK1 in SH-SY5Y cells, and dexamethasone was used to increase endogenous expression of SGK1. Oxidative stress, mitochondrial dysfunction, and cell death were monitored to test the protective effect of SGK1. To investigate the effect of SGK1 overexpression in vivo, SGK1-expressing adenovirus was injected into the striatum of mice treated with 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine, and protection of dopaminergic neurons was quantitatively assessed by tyrosine hydroxylase immunohistochemistry. SGK1 overexpression was found to decrease reactive oxygen species generation, alleviate mitochondrial dysfunction, and rescue cell death in vitro and in vivo by inactivating mitogen-activated protein kinase kinase 4 (MKK4), JNK, and glycogen synthase kinase 3β (GSK3β) and thereby decreasing ER and oxidative stress. These results suggest that therapeutic strategies for activation of SGK1 may have the potential to be neuroprotective by deactivating the JNK and GSK3β pathways. PMID:25825522

  9. Male killing Spiroplasma protects Drosophila melanogaster against two parasitoid wasps

    PubMed Central

    Xie, J; Butler, S; Sanchez, G; Mateos, M

    2014-01-01

    Maternally transmitted associations between endosymbiotic bacteria and insects are diverse and widespread in nature. Owing to imperfect vertical transmission, many heritable microbes have evolved compensational mechanisms to enhance their persistence in host lineages, such as manipulating host reproduction and conferring fitness benefits to host. Symbiont-mediated defense against natural enemies of hosts is increasingly recognized as an important mechanism by which endosymbionts enhance host fitness. Members of the genus Spiroplasma associated with distantly related Drosophila hosts are known to engage in either reproductive parasitism (i.e., male killing) or defense against natural enemies (the parasitic wasp Leptopilina heterotoma and a nematode). A male-killing strain of Spiroplasma (strain Melanogaster Sex Ratio Organism (MSRO)) co-occurs with Wolbachia (strain wMel) in certain wild populations of the model organism Drosophila melanogaster. We examined the effects of Spiroplasma MSRO and Wolbachia wMel on Drosophila survival against parasitism by two common wasps, Leptopilina heterotoma and Leptopilina boulardi, that differ in their host ranges and host evasion strategies. The results indicate that Spiroplasma MSRO prevents successful development of both wasps, and confers a small, albeit significant, increase in larva-to-adult survival of flies subjected to wasp attacks. We modeled the conditions under which defense can contribute to Spiroplasma persistence. Wolbachia also confers a weak, but significant, survival advantage to flies attacked by L. heterotoma. The host protective effects exhibited by Spiroplasma and Wolbachia are additive and may provide the conditions for such cotransmitted symbionts to become mutualists. Occurrence of Spiroplasma-mediated protection against distinct parasitoids in divergent Drosophila hosts suggests a general protection mechanism. PMID:24281548

  10. Environmental Assessment for Wildland Fire Prevention Activities at Joint-Base Elmendorf-Richardson (JBER), Alaska

    DTIC Science & Technology

    2015-04-01

    adjacent to water sources used for human water consumption should be avoided to protect fish habitat and water quality. If feasible in these areas, the...fire. The Lead PIO1 conferred with ADFG (Regional Supervisor, Sport Fish Division) and had someone calculate the effects of suppression related...threaten the northern containment line. 4. Protect anadromous fish habitat in the Richardson Clearwater and Delta River drainages from the effects of fire

  11. A Recombinant Rabies Virus Encoding Two Copies of the Glycoprotein Gene Confers Protection in Dogs against a Virulent Challenge

    PubMed Central

    Sun, Zhaojin; Chen, Jing; Ai, Jun; Dun, Can; Fu, Zhen F.; Niu, Xuefeng; Guo, Xiaofeng

    2014-01-01

    The rabies virus (RABV) glycoprotein (G) is the principal antigen responsible for the induction of virus neutralizing antibodies (VNA) and is the major modality of protective immunity in animals. A recombinant RABV HEP-Flury strain was generated by reverse genetics to encode two copies of the G-gene (referred to as HEP-dG). The biological properties of HEP-dG were compared to those of the parental virus (HEP-Flury strain). The HEP-dG recombinant virus grew 100 times more efficiently in BHK-21 cell than the parental virus, yet the virulence of the dG recombinant virus in suckling mice was lower than the parental virus. The HEP-dG virus can improve the expression of G-gene mRNA and the G protein and produce more offspring viruses in cells. The amount of G protein revealed a positive relationship with immunogenicity in mice and dogs. The inactivated HEP-dG recombinant virus induced higher levels of VNA and conferred better protection against virulent RABV in mice and dogs than the inactivated parental virus and a commercial vaccine. The protective antibody persisted for at least 12 months. These data demonstrate that the HEP-dG is stable, induces a strong VNA response and confers protective immunity more effectively than the RABV HEP-Flury strain. HEP-dG could be a potential candidate in the development of novel inactivated rabies vaccines PMID:24498294

  12. CARDIAC MOLECULAR EFFECTS INDUCED BY AIR POLLUTION PARTICLES

    EPA Science Inventory

    Abstract Submitted to the American Thoracic Society 98th International Conference, May 17 - 22, 2002, Atlanta, GA

    CARDIAC MOLECULAR EFFECTS INDUCED BY AIR POLLUTION PARTICLES
    K. Dreher1, R. Jaskot1, J. Richards1, and T. Knuckles2. 1U. S. Environmental Protection Agency,...

  13. Leptin confers protection against TNF-α-induced apoptosis in rat cardiomyocytes.

    PubMed

    Yu, Lu; Zhao, Yanbo; Xu, Shengjie; Jin, Chongying; Wang, Min; Fu, Guosheng

    2014-12-05

    Leptin, an important adipose-derived hormone, is recognized as a crucial protein in energy homeostasis. Recent studies indicated that leptin is associated with cardiac pathophysiology, however, the role and mechanisms of leptin in cardiomyocytes apoptosis are poorly understood. Here we investigated whether leptin exerted protective effect on cardiomyocytes exposed to tumor necrosis factor-alpha (TNF-α) and the possible mechanisms. Neonatal rat cardiomyocytes were subjected to TNF-α in the presence or absence of leptin. By FITC/Annexin V flow cytometry and Western blot, we noticed that TNF-α increased Annexin V binding and cleaved caspase-3/PARP, which were attenuated by leptin pretreatment. Moreover, leptin protected cardiomyocytes against mitochondrial apoptosis by inhibiting cytochrome C elevation and Bcl-2 decreasing. TNF-α-induced P38 MAPK and NF-κB activation were abolished by leptin addition, and the P38 and NF-κB inhibitor, SB203580 and Bay117082, also mitigated the apoptotic effect of TNF-α, indicating that their activation might be responsible for the apoptosis in TNF-α-treated cardiomyocytes. Therefore, leptin conferred anti-apoptotic effect in cardiomyocytes exposed to TNF-α possibly by inhibiting TNF-α-activated P38 MAPK and NF-κB pathways.

  14. Heterogeneous alleles comprising G6PD deficiency trait in West Africa exert contrasting effects on two major clinical presentations of severe malaria.

    PubMed

    Shah, Shivang S; Rockett, Kirk A; Jallow, Muminatou; Sisay-Joof, Fatou; Bojang, Kalifa A; Pinder, Margaret; Jeffreys, Anna; Craik, Rachel; Hubbart, Christina; Wellems, Thomas E; Kwiatkowski, Dominic P

    2016-01-07

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency exhibits considerable allelic heterogeneity which manifests with variable biochemical and clinical penetrance. It has long been thought that G6PD deficiency confers partial protection against severe malaria, however prior genetic association studies have disagreed with regard to the strength and specificity of a protective effect, which might reflect differences in the host genetic background, environmental influences, or in the specific clinical phenotypes considered. A case-control association study of severe malaria was conducted in The Gambia, a region in West Africa where there is considerable allelic heterogeneity underlying expression of G6PD deficiency trait, evaluating the three major nonsynonymous polymorphisms known to be associated with enzyme deficiency (A968G, T542A, and C202T) in a cohort of 3836 controls and 2379 severe malaria cases. Each deficiency allele exhibited a similar trend toward protection against severe malaria overall (15-26% reduced risk); however, in stratifying severe malaria to two of its constituent clinical subphenotypes, severe malarial anaemia (SMA) and cerebral malaria (CM), the three deficiency alleles exhibited trends of opposing effect, with risk conferred to SMA and protection with respect to CM. To assess the overall effect of G6PD deficiency trait, deficiency alleles found across all three loci were pooled. G6PD deficiency trait was found to be significantly associated with protection from severe malaria overall (OR 0.83 [0.75-0.92], P = 0.0006), but this was limited to CM (OR 0.73 [0.61-0.87], P = 0.0005), with a trend toward increased risk for SMA, especially in fully-deficient individuals (OR 1.43 [0.99-2.08], P = 0.056). Sex-stratified testing largely comported with these results, with evidence suggesting that protection by G6PD deficiency trait is conferred to both males and females, though susceptibility to SMA may be restricted to fully-deficient male hemizygotes. In a part of Africa where multiple alleles contribute to expression of G6PD deficiency trait, these findings clarify and extend previous work done in populations where a single variant predominates, and taken together suggest a causal role for G6PD deficiency trait itself with respect to severe malaria, with opposing effects seen on two major clinical subphenotypes.

  15. An adenovirus-vectored nasal vaccine confers rapid and sustained protection against anthrax in a single-dose regimen.

    PubMed

    Zhang, Jianfeng; Jex, Edward; Feng, Tsungwei; Sivko, Gloria S; Baillie, Leslie W; Goldman, Stanley; Van Kampen, Kent R; Tang, De-chu C

    2013-01-01

    Bacillus anthracis is the causative agent of anthrax, and its spores have been developed into lethal bioweapons. To mitigate an onslaught from airborne anthrax spores that are maliciously disseminated, it is of paramount importance to develop a rapid-response anthrax vaccine that can be mass administered by nonmedical personnel during a crisis. We report here that intranasal instillation of a nonreplicating adenovirus vector encoding B. anthracis protective antigen could confer rapid and sustained protection against inhalation anthrax in mice in a single-dose regimen in the presence of preexisting adenovirus immunity. The potency of the vaccine was greatly enhanced when codons of the antigen gene were optimized to match the tRNA pool found in human cells. In addition, an adenovirus vector encoding lethal factor can confer partial protection against inhalation anthrax and might be coadministered with a protective antigen-based vaccine.

  16. An Adenovirus-Vectored Nasal Vaccine Confers Rapid and Sustained Protection against Anthrax in a Single-Dose Regimen

    PubMed Central

    Jex, Edward; Feng, Tsungwei; Sivko, Gloria S.; Baillie, Leslie W.; Goldman, Stanley; Van Kampen, Kent R.; Tang, De-chu C.

    2013-01-01

    Bacillus anthracis is the causative agent of anthrax, and its spores have been developed into lethal bioweapons. To mitigate an onslaught from airborne anthrax spores that are maliciously disseminated, it is of paramount importance to develop a rapid-response anthrax vaccine that can be mass administered by nonmedical personnel during a crisis. We report here that intranasal instillation of a nonreplicating adenovirus vector encoding B. anthracis protective antigen could confer rapid and sustained protection against inhalation anthrax in mice in a single-dose regimen in the presence of preexisting adenovirus immunity. The potency of the vaccine was greatly enhanced when codons of the antigen gene were optimized to match the tRNA pool found in human cells. In addition, an adenovirus vector encoding lethal factor can confer partial protection against inhalation anthrax and might be coadministered with a protective antigen-based vaccine. PMID:23100479

  17. Genoprotective effect of the Chinese herbal decoction xiao jian zhong tang.

    PubMed

    Szeto, Yim-Tong; Cheng, Ngok-Fung; Pak, Sok-Cheon; Kalle, Wouter

    2013-03-01

    The Chinese herbal decoction formula Xiao Jian Zhong Tang (XJZT) is one of the classic formulas from the classic traditional Chinese medicine (TCM). Previous studies on XJZT found that it is effective for treating peptic ulcer, irritable bowel syndrome, functional gastroenteritis and similar psychosomatic disorders of the digestive organs. It has also been shown that all the herbs used in XJZT contain antioxidants. In this study, we investigated the in vitro DNA protection effect of the individual herb extracts and the whole formula. Water extract of the herbs and XJZT were used to pre-treat human lymphocytes. The lymphocytes were then exposed to hydrogen peroxide. The in vitro DNA protection effect of the herbs was investigated by comet assay. No DNA protective effect (P < 0.05) was found for individual herb extracts, but XJZT showed protection of human lymphocytic DNA upon oxidative stress (P < 0.05). The in vitro DNA protection effect of XJZT was conferred by the synergistic effect of the herbs, while the individual herbs had no such effect.

  18. Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

    PubMed Central

    Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

    2001-01-01

    Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

  19. 40 CFR 179.50 - Conduct at oral hearings or conferences.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... conferences. 179.50 Section 179.50 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... dignity and observe the same standards of practice and ethics that would be required of parties in a... directions, use of dilatory tactics, or refusal to adhere to reasonable standards of orderly and ethical...

  20. 76 FR 43658 - Marine Protected Areas Federal Advisory Committee; Public Meetings

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-07-21

    ... Areas Federal Advisory Committee; Public Meetings AGENCY: Department of Commerce, National Ocean Service... conference call of the Marine Protected Areas Federal Advisory Committee (Committee). The web conference... are being given. Members of the public wishing to listen in should contact Denise Ellis-Hibbett at the...

  1. Alum adjuvanted rabies DNA vaccine confers 80% protection against lethal 50 LD50 rabies challenge virus standard strain.

    PubMed

    Garg, Rajni; Kaur, Manpreet; Saxena, Ankur; Prasad, Rajendra; Bhatnagar, Rakesh

    2017-05-01

    Rabies is a serious concern world-wide. Despite availability of rabies vaccines for long; their efficacy, safety, availability and cost effectiveness has been a tremendous issue. This calls for improvement of rabies vaccination strategies. DNA vaccination has immense potential in this regard. The DNA vaccine pgp.LAMP-1 conferred 60% protection to BALB/c mice against 20 LD 50 rabies challenge virus standard (CVS) strain challenge. Upon supplementation with Emulsigen-D, the vaccine formulation conferred complete protection against lethal challenge. To assess the feasibility of this vaccine formulation for human use, it was tested along with other FDA approved adjuvants, namely, Alum, Immuvac, Montanide ISA720 VG. Enhanced immune response correlated with high IgG antibody titer, Th2 biased response with a high level of rabies virus neutralizing antibodies (RVNAs) and IgG1/IgG2a ratio >1, observed upon alum supplementation of the rabies DNA vaccine. The total IgG antibody titer was 2IU/ml and total RVNA titer was observed to be 4IU/ml which is eight times higher than the minimum protective titer recommended by WHO. Furthermore, it conferred 80% protection against challenge with 50 LD 50 of the rabies CVS strain, conducted in compliance with the potency test for rabies recommended by the National Institutes of Health (NIH), USA. Previously, we have established pre-clinical safety of this vaccine as per the guidelines of Schedule Y, FDA as well as The European Agency for evaluation of Medicinal Products. The vaccine showed no observable toxicity at the site of injection as well as at systemic level in Wistar rats when administered with 10X recommended dose. Therefore, supplementation of rabies DNA vaccine, pgp.LAMP-1 with alum would lead to development of a non-toxic, efficacious, stable and affordable vaccine that can be used to combat high numbers of fatal rabies infections tormenting developing countries. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Comparative Efficacy of Hemagglutinin, Nucleoprotein, and Matrix 2 Protein Gene-Based Vaccination against H5N1 Influenza in Mouse and Ferret

    PubMed Central

    Rao, Srinivas S.; Kong, Wing-Pui; Wei, Chih-Jen; Van Hoeven, Neal; Gorres, J. Patrick; Nason, Martha; Andersen, Hanne; Tumpey, Terrence M.; Nabel, Gary J.

    2010-01-01

    Efforts to develop a broadly protective vaccine against the highly pathogenic avian influenza A (HPAI) H5N1 virus have focused on highly conserved influenza gene products. The viral nucleoprotein (NP) and ion channel matrix protein (M2) are highly conserved among different strains and various influenza A subtypes. Here, we investigate the relative efficacy of NP and M2 compared to HA in protecting against HPAI H5N1 virus. In mice, previous studies have shown that vaccination with NP and M2 in recombinant DNA and/or adenovirus vectors or with adjuvants confers protection against lethal challenge in the absence of HA. However, we find that the protective efficacy of NP and M2 diminishes as the virulence and dose of the challenge virus are increased. To explore this question in a model relevant to human disease, ferrets were immunized with DNA/rAd5 vaccines encoding NP, M2, HA, NP+M2 or HA+NP+M2. Only HA or HA+NP+M2 vaccination conferred protection against a stringent virus challenge. Therefore, while gene-based vaccination with NP and M2 may provide moderate levels of protection against low challenge doses, it is insufficient to confer protective immunity against high challenge doses of H5N1 in ferrets. These immunogens may require combinatorial vaccination with HA, which confers protection even against very high doses of lethal viral challenge. PMID:20352112

  3. Intra-muscular and oral vaccination using a Koi Herpesvirus ORF25 DNA vaccine does not confer protection in common carp (Cyprinus carpio L.).

    PubMed

    Embregts, Carmen W E; Tadmor-Levi, Roni; Veselý, Tomáš; Pokorová, Dagmar; David, Lior; Wiegertjes, Geert F; Forlenza, Maria

    2018-03-19

    Koi Herpes Virus (KHV or Cyprinid Herpesvirus 3, CyHV-3) is among the most threatening pathogens affecting common carp production as well as the highly valuable ornamental koi carp. To date, no effective commercial vaccine is available for worldwide use. A previous study reported that three intramuscular injections with an ORF25-based DNA vaccine, led to the generation of neutralizing antibodies and conferred significant protection against an intraperitoneal challenge with KHV. In the present study, we set out to optimize an ORF25-based DNA vaccination protocol that required fewer injections and would confer protection upon a challenge that better resembled the natural route of infection. To this end, ORF25 was cloned in pcDNA3 either as a soluble protein or as a full-length transmembrane GFP-fusion protein. We tested our ORF25-based DNA vaccines in multiple vaccination trials using different doses, vaccination routes (i.m. injection and oral gavage) and challenge methods (bath and cohabitation). Furthermore, we analysed local and systemic responses to the i.m. injected DNA vaccine through histological and RT-qPCR analysis. We observed a strong protection when fish received three injections of either of the two DNA vaccines. However, this protection was observed only after bath challenge and not after cohabitation challenge. Furthermore, protection was insufficient when fish received one injection only, or received the plasmid orally. The importance of choosing a challenge model that best reflects the natural route of infection and the possibility to include additional antigens in future DNA vaccination strategies against KHV will be discussed. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  4. Vaccination with NS1-truncated H3N2 swine influenza virus primes T cells and confers cross-protection against an H1N1 heterosubtypic challenge in pigs

    USDA-ARS?s Scientific Manuscript database

    The diversity of contemporary swine influenza virus (SIV) strains impedes effective immunization of swine herds. Mucosally delivered, attenuated virus vaccines are one approach with potential to provide broad cross-protection. Reverse genetics-derived H3N2 SIV virus with truncated NS1 (NS1delta126 T...

  5. [Human milk, immune responses and health effects].

    PubMed

    Løland, Beate Fossum; Baerug, Anne B; Nylander, Gro

    2007-09-20

    Besides providing optimal nutrition to infants, human milk contains a multitude of immunological components. These components are important for protection against infections and also support the development and maturation of the infant's own immune system. This review focuses on the function of some classical immunocomponents of human milk. Relevant studies are presented that describe health benefits of human milk for the child and of lactation for the mother. Relevant articles were found mainly by searching PubMed. Humoral and cellular components of human milk confer protection against infections in the respiratory--, gastrointestinal--and urinary tract. Human milk also protects premature children from neonatal sepsis and necrotizing enterocolitis. There is evidence that human milk may confer long-term benefits such as lower risk of certain autoimmune diseases, inflammatory bowel disease and probably some malignancies. Human milk possibly affects components of the metabolic syndrome. Recent studies demonstrate long-term health benefits of lactation also for the mother. A reduced incidence of breast cancer is best documented. An increasing number of studies indicate protection against ovarian cancer, rheumatoid arthritis and type II diabetes.

  6. Hyperoxic preconditioning fails to confer additional protection against ischemia-reperfusion injury in acute diabetic rat heart.

    PubMed

    Pourkhalili, Khalil; Hajizadeh, Sohrab; Akbari, Zahra; Dehaj, Mansour Esmaili; Akbarzadeh, Samad; Alizadeh, Alimohammad

    2012-01-01

    Experimental studies show that detrimental effects of ischemia-reperfusion (I/R) injury can be attenuated by hyperoxic preconditioning in normal hearts, however, there are few studies about hyperoxia effects in diseased myocardium. The present study was designed to assess the cardioprotective effects of hyperoxia pretreatment (≥ 95 % O2) in acute diabetic rat hearts. Normal and one week acute diabetic rats were either exposed to 60 (H60) and 180 (H180) min of hyperoxia or exposed to normal atmospheric air (21 % O2). Then hearts were isolated immediately and subjected to 30 min of regional ischemia followed by 120 min of reperfusion. Infarct size, cardiomyocyte apoptosis, enzymes release and ischemia induced arrhythmias were determined. Heart of diabetic control rats had less infarct size and decreased LDH and CK-MB release compared to normal hearts. 60 and 180 min of hyperoxia reduced myocardial infarct size and enzymes release in normal hearts. 180 min of hyperoxia also decreased cardiomyocytes apoptosis in normal state. On the other hand, protective values of hyperoxia were not significantly different in diabetic hearts. Moreover, hyperoxia reduced severity of ventricular arrhythmias in normal rat hearts whereas; it did not confer any additional antiarrhythmic protection in diabetic hearts. These findings suggest that diabetic hearts are less susceptible to ischemia-induced arrhythmias and infarction. Hyperoxia greatly protects rat hearts against I/R injury in normal hearts, however, it could not provide added cardioprotective effects in acute phase of diabetes.

  7. Does Early Paternal Parenting Promote Low-Income Children's Long-Term Cognitive Skills?

    ERIC Educational Resources Information Center

    Coley, Rebekah Levine; Lewin-Bizan, Selva; Carrano, Jennifer

    2011-01-01

    Although scholars and policy makers herald the promotive influence of fathers' parenting involvement, limited research has carefully delineated effects of fathers' parenting on low-income children's development and whether early contributions from fathers confer long-term protective effects. Using data from the Three-City Study (N = 261), analyses…

  8. Mangiferin protects mitochondrial function by preserving mitochondrial hexokinase-II in vessel endothelial cells.

    PubMed

    Song, Junna; Li, Yi; Song, Junmei; Hou, Fangjie; Liu, Baolin; Li, Aiying

    2017-07-01

    Hexokinase-II (HK-II) confers protection against cell death and this study was designed to investigate the effect of mangiferin on the regulation of mitochondrial HK-II. In vessel endothelial cells, saturated fatty acid palmitate (PA) stimulation induced HK-II detachment from mitochondria due to cellular acidification. Mangiferin reduced lactate accumulation by improving pyruvate dehydrogenase activity, promoted Akt translocation to HK-II and prevented HK-II detachment from mitochondria. Knockdown of Akt2 diminished the protective effect of mangiferin on mitochondrial HK-II, confirming the role of Akt in the regulation of HK-II. Mangiferin prevented mitochondrial permeability transition pore opening, restored mitochondrial membrane potential and thereby protected cell from apoptosis. In high-fat diet fed mice, oral administration of mangiferin induced Akt phosphorylation, increased HK-II binding to mitochondria and resultantly protected vessel endothelial function, demonstrating its protective effect on endothelial integrity in vivo. This finding provided a novel strategy for the protection of mitochondrial function in the endothelium. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Titan Cells Confer Protection from Phagocytosis in Cryptococcus neoformans Infections

    PubMed Central

    Okagaki, Laura H.

    2012-01-01

    The human fungal pathogen Cryptococcus neoformans produces an enlarged “titan” cell morphology when exposed to the host pulmonary environment. Titan cells exhibit traits that promote survival in the host. Previous studies showed that titan cells are not phagocytosed and that increased titan cell production in the lungs results in reduced phagocytosis of cryptococcal cells by host immune cells. Here, the effect of titan cell production on host-pathogen interactions during early stages of pulmonary cryptococcosis was explored. The relationship between titan cell production and phagocytosis was found to be nonlinear; moderate increases in titan cell production resulted in profound decreases in phagocytosis, with significant differences occurring within the first 24 h of the infection. Not only were titan cells themselves protected from phagocytosis, but titan cell formation also conferred protection from phagocytosis to normal-size cryptococcal cells. Large particles introduced into the lungs were not phagocytosed, suggesting the large size of titan cells protects against phagocytosis. The presence of large particles was unable to protect smaller particles from phagocytosis, revealing that titan cell size alone is not sufficient to provide the observed cross-protection of normal-size cryptococcal cells. These data suggest that titan cells play a critical role in establishment of the pulmonary infection by promoting the survival of the entire population of cryptococcal cells. PMID:22544904

  10. Titan cells confer protection from phagocytosis in Cryptococcus neoformans infections.

    PubMed

    Okagaki, Laura H; Nielsen, Kirsten

    2012-06-01

    The human fungal pathogen Cryptococcus neoformans produces an enlarged "titan" cell morphology when exposed to the host pulmonary environment. Titan cells exhibit traits that promote survival in the host. Previous studies showed that titan cells are not phagocytosed and that increased titan cell production in the lungs results in reduced phagocytosis of cryptococcal cells by host immune cells. Here, the effect of titan cell production on host-pathogen interactions during early stages of pulmonary cryptococcosis was explored. The relationship between titan cell production and phagocytosis was found to be nonlinear; moderate increases in titan cell production resulted in profound decreases in phagocytosis, with significant differences occurring within the first 24 h of the infection. Not only were titan cells themselves protected from phagocytosis, but titan cell formation also conferred protection from phagocytosis to normal-size cryptococcal cells. Large particles introduced into the lungs were not phagocytosed, suggesting the large size of titan cells protects against phagocytosis. The presence of large particles was unable to protect smaller particles from phagocytosis, revealing that titan cell size alone is not sufficient to provide the observed cross-protection of normal-size cryptococcal cells. These data suggest that titan cells play a critical role in establishment of the pulmonary infection by promoting the survival of the entire population of cryptococcal cells.

  11. An initial examination of the potential role of T-cell immunity in protection against feline immunodeficiency virus (FIV) infection.

    PubMed

    Aranyos, Alek M; Roff, Shannon R; Pu, Ruiyu; Owen, Jennifer L; Coleman, James K; Yamamoto, Janet K

    2016-03-14

    The importance of vaccine-induced T-cell immunity in conferring protection with prototype and commercial FIV vaccines is still unclear. Current studies performed adoptive transfer of T cells from prototype FIV-vaccinated cats to partial-to-complete feline leukocyte antigen (FLA)-matched cats a day before either homologous FIVPet or heterologous-subtype pathogenic FIVFC1 challenge. Adoptive-transfer (A-T) conferred a protection rate of 87% (13 of 15, p < 0.001) against FIVPet using the FLA-matched T cells, whereas all 12 control cats were unprotected. Furthermore, A-T conferred protection rate of 50% (6 of 12, p<0.023) against FIVFC1 using FLA-matched T cells, whereas all 8 control cats were unprotected. Transfer of FLA-matched T and B cells demonstrated that T cells are needed to confer A-T protection. In addition, complete FLA-matching and addition of T-cell numbers > 13 × 10(6) cells were required for A-T protection against FIVFC1 strain, reported to be a highly pathogenic virus resistant to vaccine-induced neutralizing-antibodies. The addition of FLA-matched B cells alone was not protective. The poor quality of the anti-FIV T-cell immunity induced by the vaccine likely contributed to the lack of protection in an FLA-matched recipient against FIVFC1. The quality of the immune response was determined by the presence of high mRNA levels of cytolysin (perforin) and cytotoxins (granzymes A, B, and H) and T helper-1 cytokines (interferon-γ [IFNγ] and IL2). Increased cytokine, cytolysin and cytotoxin production was detected in the donors which conferred protection in A-T studies. In addition, the CD4(+) and CD8(+) T-cell proliferation and/or IFNγ responses to FIV p24 and reverse transcriptase increased with each year in cats receiving 1X-3X vaccine boosts over 4 years. These studies demonstrate that anti-FIV T-cell immunity induced by vaccination with a dual-subtype FIV vaccine is essential for prophylactic protection against AIDS lentiviruses such as FIV and potentially HIV-1. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. An initial examination of the potential role of T-cell immunity in protection against feline immunodeficiency virus (FIV) infection

    PubMed Central

    Aranyos, Alek M.; Roff, Shannon R.; Pu, Riuyu; Owen, Jennifer L.; Coleman, James K.; Yamamoto, Janet K.

    2016-01-01

    The importance of vaccine-induced T-cell immunity in conferring protection with prototype and commercial FIV vaccines is still unclear. Current studies performed adoptive transfer of T cells from prototype FIV-vaccinated cats to partial-to-complete feline leukocyte antigen (FLA)-matched cats a day before either homologous FIVPet or heterologous-subtype pathogenic FIVFC1 challenge. Adoptive-transfer (A–T) conferred a protection rate of 87% (13 of 15, p<0.001) against FIVPet using FLA-matched T cells, whereas all 12 control cats were unprotected. Furthermore, A-T conferred protection rate of 50% (6 of 12, p<0.023) against FIVFC1 using FLA-matched T cells, whereas all 8 control cats were unprotected. Transfer of FLA-matched T and B cells demonstrated that T cells are needed to confer A-T protection. In addition, complete FLA-matching and addition of T-cell numbers >13×106 cells were required for A-T protection against FIVFC1 strain, reported to be a highly pathogenic virus resistant to vaccine-induced neutralizing-antibodies. The addition of FLA-matched B cells alone was not protective. The poor quality of the anti-FIV T-cell immunity induced by the vaccine likely contributed to the lack of protection in an FLA-matched recipient against FIVFC1. The quality of the immune response was determined by the presence of high mRNA levels of cytolysin (perforin) and cytotoxins (granzymes A, B, and H) and T helper-1 cytokines (interferon-γ [IFNγ] and IL2). Increased cytokine, cytolysin and cytotoxin production was detected in the donors which conferred protection in A-T studies. In addition, the CD4+ and CD8+ T-cell proliferation and/or IFNγ responses to FIV p24 and reverse transcriptase increased with each year in cats receiving 1X-3X vaccine boosts over 4 years. These studies demonstrate that anti-FIV T-cell immunity induced by vaccination with a dual-subtype FIV vaccine is essential for prophylactic protection against AIDS lentiviruses such as FIV and potentially HIV-1. PMID:26802606

  13. JNK1 ablation in mice confers long-term metabolic protection from diet-induced obesity at the cost of moderate skin oxidative damage.

    PubMed

    Becattini, Barbara; Zani, Fabio; Breasson, Ludovic; Sardi, Claudia; D'Agostino, Vito Giuseppe; Choo, Min-Kyung; Provenzani, Alessandro; Park, Jin Mo; Solinas, Giovanni

    2016-09-01

    Obesity and insulin resistance are associated with oxidative stress, which may be implicated in the progression of obesity-related diseases. The kinase JNK1 has emerged as a promising drug target for the treatment of obesity and type 2 diabetes. JNK1 is also a key mediator of the oxidative stress response, which can promote cell death or survival, depending on the magnitude and context of its activation. In this article, we describe a study in which the long-term effects of JNK1 inactivation on glucose homeostasis and oxidative stress in obese mice were investigated for the first time. Mice lacking JNK1 (JNK1(-/-)) were fed an obesogenic high-fat diet (HFD) for a long period. JNK1(-/-) mice fed an HFD for the long term had reduced expression of antioxidant genes in their skin, more skin oxidative damage, and increased epidermal thickness and inflammation compared with the effects in control wild-type mice. However, we also observed that the protection from obesity, adipose tissue inflammation, steatosis, and insulin resistance, conferred by JNK1 ablation, was sustained over a long period and was paralleled by decreased oxidative damage in fat and liver. We conclude that compounds targeting JNK1 activity in brain and adipose tissue, which do not accumulate in the skin, may be safer and most effective.-Becattini, B., Zani, F., Breasson, L., Sardi, C., D'Agostino, V. G., Choo, M.-K., Provenzani, A., Park, J. M., Solinas, G. JNK1 ablation in mice confers long-term metabolic protection from diet-induced obesity at the cost of moderate skin oxidative damage. © FASEB.

  14. 1987 Oak Ridge model conference: Proceedings: Volume 2, Environmental protection

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1987-01-01

    See the abstract for Volume I for general information on the conference. Topics discussed in Volume II include data management techiques for environmental protection efforts, the use of models in environmental auditing, in emergency plans, chemical accident emergency response, risk assessment, monitoring of waste sites, air and water monitoring of waste sites, and in training programs. (TEM)

  15. Heme oxygenase/carbon monoxide signaling pathways: regulation and functional significance.

    PubMed

    Ryter, Stefan W; Otterbein, Leo E; Morse, Danielle; Choi, Augustine M K

    2002-01-01

    Carbon monoxide (CO), a gaseous second messenger, arises in biological systems during the oxidative catabolism of heme by the heme oxygenase (HO) enzymes. HO exists as constitutive (HO-2, HO-3) and inducible isoforms (HO-1), the latter which responds to regulation by multiple stress-stimuli. HO-1 confers protection in vitro and in vivo against oxidative cellular stress. Although the redox active compounds that are generated from HO activity (i.e. iron, biliverdin-IXalpha, and bilirubin-IXa) potentially modulate oxidative stress resistance, increasing evidence points to cytoprotective roles for CO. Though not reactive, CO regulates vascular processes such as vessel tone, smooth muscle proliferation, and platelet aggregation, and possibly functions as a neurotransmitter. The latter effects of CO depend on the activation of guanylate cyclase activity by direct binding to the heme moiety of the enzyme, stimulating the production of cyclic 3':5'-guanosine monophosphate. CO potentially interacts with other intracellular hemoprotein targets, though little is known about the functional significance of such interactions. Recent progress indicates that CO exerts novel anti-inflammatory and anti-apoptotic effects dependent on the modulation of the p38 mitogen activated protein kinase (MAPK)-signaling pathway. By virtue of these effects, CO confers protection in oxidative lung injury models, and likely plays a role in HO-1 mediated tissue protection.

  16. Vaccination with Recombinant Microneme Proteins Confers Protection against Experimental Toxoplasmosis in Mice.

    PubMed

    Pinzan, Camila Figueiredo; Sardinha-Silva, Aline; Almeida, Fausto; Lai, Livia; Lopes, Carla Duque; Lourenço, Elaine Vicente; Panunto-Castelo, Ademilson; Matthews, Stephen; Roque-Barreira, Maria Cristina

    2015-01-01

    Toxoplasmosis, a zoonotic disease caused by Toxoplasma gondii, is an important public health problem and veterinary concern. Although there is no vaccine for human toxoplasmosis, many attempts have been made to develop one. Promising vaccine candidates utilize proteins, or their genes, from microneme organelle of T. gondii that are involved in the initial stages of host cell invasion by the parasite. In the present study, we used different recombinant microneme proteins (TgMIC1, TgMIC4, or TgMIC6) or combinations of these proteins (TgMIC1-4 and TgMIC1-4-6) to evaluate the immune response and protection against experimental toxoplasmosis in C57BL/6 mice. Vaccination with recombinant TgMIC1, TgMIC4, or TgMIC6 alone conferred partial protection, as demonstrated by reduced brain cyst burden and mortality rates after challenge. Immunization with TgMIC1-4 or TgMIC1-4-6 vaccines provided the most effective protection, since 70% and 80% of mice, respectively, survived to the acute phase of infection. In addition, these vaccinated mice, in comparison to non-vaccinated ones, showed reduced parasite burden by 59% and 68%, respectively. The protective effect was related to the cellular and humoral immune responses induced by vaccination and included the release of Th1 cytokines IFN-γ and IL-12, antigen-stimulated spleen cell proliferation, and production of antigen-specific serum antibodies. Our results demonstrate that microneme proteins are potential vaccines against T. gondii, since their inoculation prevents or decreases the deleterious effects of the infection.

  17. Toll-like Receptor 4 Signaling Confers Cardiac Protection Against Ischemic Injury via Inducible Nitric Oxide Synthase- and Soluble Guanylate Cyclase-dependent Mechanisms

    PubMed Central

    Wang, E; Feng, Yan; Zhang, Ming; Zou, Lin; Li, Yan; Buys, Emmanuel S.; Huang, Peigen; Brouckaert, Peter; Chao, Wei

    2011-01-01

    Background Prior administration of a small dose of lipopolysaccharide confers a cardiac protection against ischemia-reperfusion injury. However, the signaling mechanisms that control the protection are incompletely understood. We tested the hypothesis that TLR4 mediates the ability of lipopolysaccharide to protect against cardiac ischemia-reperfusion injury through distinct intracellular pathways involving myeloid differentiation factor 88 (MyD88), TIR-domain-containing adaptor protein inducing interferon-β–mediated transcription-factor (Trif), inducible nitric-oxide synthase (iNOS), and soluble guanylate cyclase (sGC). Methods Wild-type mice and the genetically modified mice, i.e., TLR4-deficient (TLR4-def), TLR2 knockout (TLR2−/−), MyD88−/−, Trif−/−, iNOS−/−, and sGCα1−/−, were treated with normal saline or 0.1 mg/kg of lipopolysaccharide, intraperitoneally. Twenty-four hours later, isolated hearts were perfused in a Langendorff apparatus and subsequently subjected to 30 min of global ischemia and reperfusion for up to 60 min. Left ventricular function and myocardial infarction sizes were examined. Results Compared to saline-treated mice, lipopolysaccharide-treated mice had markedly improved left ventricular developed pressure and dP/dtmax (P < 0.01) and reduced MI sizes (37.2 ± 3.4% vs. 19.8 ± 4.9%, P < 0.01) after ischemia-reperfusion. The cardiac protective effect of lipopolysaccharide was abolished in the TLR4-def and MyD88−/− mice, but remained intact in TLR2−/− or Trif−/− mice. iNOS−/− mice or wild-type mice treated with the iNOS inhibitor 1400W failed to respond to the TLR4-induced nitric oxide production and were not protected by the lipopolysaccharide preconditioning. While sGC 1−/− mice had robust nitric oxide production in response to lipopolysaccharide, they were not protected by the TLR4-elicited cardiac protection. Conclusions TLR4 activation confers a potent cardiac protection against ischemia-reperfusion injury via a MyD88-dependent, but Trif-independent mechanism. iNOS/sGC are essential for the TLR4-induced cardiac protection. PMID:21270629

  18. Protective efficacy of a novel recombinant Marek's disease virus vector vaccine against infectious bursal disease in chickens with or without maternal antibodies.

    PubMed

    Li, Kai; Liu, Yongzhen; Zhang, Yanping; Gao, Li; Liu, Changjun; Cui, Hongyu; Qi, Xiaole; Gao, Yulong; Zhong, Li; Wang, Xiaomei

    2017-04-01

    Infectious bursal disease (IBD) causes significant clinical and economic losses to the poultry industry worldwide. Current vaccine programs using live attenuated and inactivated vaccines have numerous drawbacks. As an alternative solution to control IBD, a Marek's disease virus (MDV) vector vaccine (rMDV-VP2) expressing the VP2 gene of infectious bursal disease virus (IBDV) has been developed. In this study, the protective efficacy of rMDV-VP2 was evaluated in a dose-related experiment which showed that a single dose of 1000 PFU was sufficient to fully protect chickens against IBDV infection. Chickens inoculated with lower doses of rMDV-VP2 (250 or 500 PFU) conferred 80 and 90% protection against IBDV. Next, rMDV-VP2 vaccine provided 90% protection against IBDV in commercial layer chickens with maternal antibodies, which was higher than the protective efficacy using the B87 live vaccine of IBDV. Additionally, rMDV-VP2 conferred effective protection against very virulent MDV challenge in chickens (95% for chickens vaccinated with 250 or 500 PFU and 100% for chickens vaccinated with 1000 or 2000 PFU). These results demonstrated that rMDV-VP2 may be a novel bivalent vaccine against IBD and Marek's disease in chickens. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. International Aerospace and Ground Conference on Lightning and Static Electricity. 1984 technical papers. Supplement

    NASA Technical Reports Server (NTRS)

    1984-01-01

    The indirect effects of lightning on digital systems, ground system protection, and the corrosion properties of conductive materials are addressed. The responses of a UH-60A helicopter and tactical shelters to lightning and nuclear electromagnetic pulses are discussed.

  20. Post-exposure treatment of Ebola virus disease in guinea pigs using EBOTAb, an ovine antibody-based therapeutic.

    PubMed

    Dowall, Stuart D; Bosworth, Andrew; Rayner, Emma; Taylor, Irene; Landon, John; Cameron, Ian; Coxon, Ruth; Al Abdulla, Ibrahim; Graham, Victoria A; Hall, Graham; Kobinger, Gary; Hewson, Roger; Carroll, Miles W

    2016-07-28

    Ebola virus (EBOV) is highly pathogenic, with a predisposition to cause outbreaks in human populations accompanied by significant mortality. An ovine polyclonal antibody therapy has been developed against EBOV, named EBOTAb. When tested in the stringent guinea pig model of EBOV disease, EBOTAb has been shown to confer protection at levels of 83.3%, 50% and 33.3% when treatment was first started on days 3, 4 and 5 post-challenge, respectively. These timepoints of when EBOTAb treatment was initiated correspond to when levels of EBOV are detectable in the circulation and thus mimic when treatment would likely be initiated in human infection. The effects of EBOTAb were compared with those of a monoclonal antibody cocktail, ZMapp, when delivered on day 3 post-challenge. Results showed ZMapp to confer complete protection against lethal EBOV challenge in the guinea pig model at this timepoint. The data reported demonstrate that EBOTAb is an effective treatment against EBOV disease, even when delivered late after infection.

  1. Proceedings of the Conference Arctic '85; Civil Engineering in the Artic offshore

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bennett, F.L.; Machemehl, J.L.

    1985-01-01

    Topics of the 1985 Conference included: Arctic construction, Arctic foundation, Arctic structures, and ocean effects. Arctic terminals and coastal offshore bases, protecting the Arctic environment, and probabilistic methods in Arctic offshore engineering were also discussed. Ice mechanics, marine pipelines in the Arctic, and the role of universities in training civil engineers for Arctic offshore development were highlighted. Sessions on remote sensing, surveying, and mapping were included, and offshore installations in the Bering Sea were discussed. Another topic of discussion was research in Civil Engineering for development of the Arctic offshore. The overall thrust of the conference was the application ofmore » Arctic offshore engineering principles and research in the field of oil and gas exploration and exploitation activity.« less

  2. [Omentin: Role in insulin resistance, inflammation and cardiovascular protection].

    PubMed

    Hernández-Díaz, Adrián; Arana-Martínez, Julio C; Carbó, Roxana; Espinosa-Cervantes, Román; Sánchez-Muñoz, Fausto

    2016-01-01

    The omentin is an adipokine, which role is due to the capacity of regulate metabolic (insulin sensitivity) and anti-inflammatory activities, thus conferring vascular protection during obesity and diabetes mellitus type 2. By this, it is important to know the mechanisms by which omentin confers cardiovascular protection, with the purpose of establish omentin a possible therapeutic target or molecule on this scenario. Copyright © 2015 Instituto Nacional de Cardiología Ignacio Chávez. Publicado por Masson Doyma México S.A. All rights reserved.

  3. Ameliorative effect of the cinnamon oil from Cinnamomum zeylanicum upon early stage diabetic nephropathy.

    PubMed

    Mishra, Awanish; Bhatti, Rajbir; Singh, Amarjit; Singh Ishar, Mohan Paul

    2010-03-01

    The current study was designed to evaluate the ameliorative effect of the cinnamon oil upon early stage diabetic nephropathy owing to its antioxidant and antidiabetic effect. Cinnamon oil was extracted by hydro-distillation of the dried inner bark of Cinnamomum zeylanicum Blume. Further characterization of the extracted oil was carried out using IR, (1)H-NMR, and (13)C-NMR techniques. Early stage of diabetic nephropathy was induced by administration of alloxan (150 mg/kg, I. P.). Cinnamon oil was administered at varying doses (5, 10, 20 mg/kg; I. P.) while the level of fasting blood glucose, total cholesterol, high density lipoprotein, urea, thiobarbituric acid reactive substances, reduced glutathione, and catalase were determined. These parameters in cinnamon oil treated groups were compared with those of standard (glipizide; 10 mg/kg) and vehicle treated groups in order to investigate if cinnamon oil confers a significant protection against diabetic nephropathy. Histological studies of the kidney proved the protective effect of cinnamon oil by reducing the glomerular expansion, eradicating hyaline casts, and decreasing the tubular dilatations. Our results indicate that the volatile oil from cinnamon contains more than 98 % cinnamaldehyde and that it confers dose-dependent, significant protection against alloxan-induced renal damage, the maximum decrease in fasting blood glucose having been achieved at the dose of 20 mg/kg. (c) Georg Thieme Verlag KG Stuttgart . New York.

  4. Increased leptin by hypoxic-preconditioning promotes autophagy of mesenchymal stem cells and protects them from apoptosis.

    PubMed

    Wang, LiHan; Hu, XinYang; Zhu, Wei; Jiang, Zhi; Zhou, Yu; Chen, PanPan; Wang, JianAn

    2014-02-01

    Autophagy is the basic catabolic progress involved in cell degradation of unnecessary or dysfunctional cellular components. It has been proven that autophagy could be utilized for cell survival under stresses. Hypoxic-preconditioning (HPC) could reduce apoptosis induced by ischemia and hypoxia/serum deprivation (H/SD) in bone marrow-derived mesenchymal stem cells (BMSCs). Previous studies have shown that both leptin signaling and autophagy activation were involved in the protection against apoptosis induced by various stress, including ischemia-reperfusion. However, it has never been fully understood how leptin was involved in the protective effects conferred by autophagy. In the present study, we demonstrated that HPC can induce autophagy in BMSCs by increased LC3-II/LC3-I ratio and autophagosome formation. Interestingly, similar effects were also observed when BMSCs were pretreated with rapamycin. The beneficial effects offered by HPC were absent when BMSCs were incubated with autophagy inhibitor, 3-methyladenine (3-MA). In addition, down-regulated leptin expression by leptin-shRNA also attenuated HPC-induced autophagy in BMSCs, which in turn was associated with increased apoptosis after exposed to sustained H/SD. Furthermore, increased AMP-activated protein kinase phosphorylation and decreased mammalian target of rapamycin phosphorylation that were observed in HPC-treated BMSCs can also be attenuated by down-regulation of leptin expression. Our data suggests that leptin has impact on HPC-induced autophagy in BMSCs which confers protection against apoptosis under H/SD, possibly through modulating both AMPK and mTOR pathway.

  5. American Council on Consumer Interests. Annual Conference. The Proceedings. Convention Theme: Ideas/Commitment/Action (22nd, Atlanta, Georgia, April 7-10, 1976).

    ERIC Educational Resources Information Center

    Mohr, Lillian Holmen

    These proceedings consist of 25 conference papers on consumer interests: (1) Consumer Leaders of Yesteryear, (2) Potentials for Professionalism in Consumer Affairs, (3) Legislative Priorities--The Washington Scene, (4) Consumer Protection--The Municipal Approach, (5) Virginia Approach to Consumer Protection, (6) An Explanation of Electric Utility…

  6. 76 FR 76713 - California Independent System Operator Corporation; Notice of Technical Conference

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-12-08

    ...) proposal to eliminate convergence bidding at intertie scheduling points. Take notice that such conference...'s proposal to eliminate convergence bidding at intertie scheduling points. A subsequent notice... Act of 1973. For accessibility accommodations please send an email to [email protected] or call...

  7. CONFERENCE SUMMARY: PRACTICAL ASPECTS OF THE DESIGN AND USE OF GAC

    EPA Science Inventory

    This article is based on papers presented at a 1989 conference on the design and use of granular activated carbon (GAC) systems. The conference was cosponsored by the AWWA Research Foundation and the US Environmental Protection Agency. Topics covered include reasons for the use...

  8. FERRITIN EXPRESSION AFTER IN VITRO EXPOSURES OF HUMAN ALVEOLAR MACROPHAGES TO SILICA IS IRON-DEPENDENT

    EPA Science Inventory

    The increased availability of catalytically active iron after silica exposure can present an oxidative injury to a living system. Sequestration of reactive iron would, therefore, confer a protective effect. The intracellular storage of iron by ferritin within macrophages can limi...

  9. Facial protection conferred by cycle safety helmets: use of digitized image processing to develop a new nondestructive test.

    PubMed

    Harrison, M; Shepherd, J P

    1997-07-01

    Cycle safety helmets are designed to prevent head injury. Although most commercially available helmets conform to one of several national and international standards, individual designs differ widely, particularly in relation to face coverage. A method was developed to assess the potential for the differing designs to protect the face from injury. A nonimpact test was assessed, using digitized image-processing software (Digithurst Ltd.) to measure the shadow cast by a helmet rim under a collimated plane light source onto the face of a mannequin headform. Twelve helmet designs available internationally were tested and ranked with respect to the direct protection conferred (area of the face directly covered by the helmet) and indirect protection (area of the face shaded). The three highest-ranking helmets for direct protection (Rosebank Stackhat, Asphalt Warrior, and Lazer Voyager) also ranked the highest for indirect protection. These helmets were more inferiorly extended and were of a more bulky construction. It was concluded that the dimensions of cycle helmets in relation to face coverage are crucial in influencing the extent to which facial protection is conferred. International test standards need urgent revision to ensure that face coverage is optimized. Lower-face protection could be achieved through incorporation of a lower-face bar to cycle helmets.

  10. Fourth conference on radiation protection and dosimetry: Proceedings, program, and abstracts

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Casson, W.H.; Thein, C.M.; Bogard, J.S.

    This Conference is the fourth in a series of conferences organized by staff members of Oak Ridge National Laboratory in an effort to improve communication in the field of radiation protection and dosimetry. Scientists, regulators, managers, professionals, technologists, and vendors from the United States and countries around the world have taken advantage of this opportunity to meet with their contemporaries and peers in order to exchange information and ideas. The program includes over 100 papers in 9 sessions, plus an additional session for works in progress. Papers are presented in external dosimetry, internal dosimetry, radiation protection programs and assessments, developmentsmore » in instrumentation and materials, environmental and medical applications, and on topics related to standards, accreditation, and calibration. Individual papers are indexed separately on EDB.« less

  11. Co-Expression of Monodehydroascorbate Reductase and Dehydroascorbate Reductase from Brassica rapa Effectively Confers Tolerance to Freezing-Induced Oxidative Stress

    PubMed Central

    Shin, Sun-Young; Kim, Myung-Hee; Kim, Yul-Ho; Park, Hyang-Mi; Yoon, Ho-Sung

    2013-01-01

    Plants are exposed to various environmental stresses and have therefore developed antioxidant enzymes and molecules to protect their cellular components against toxicity derived from reactive oxygen species (ROS). Ascorbate is a very important antioxidant molecule in plants, and monodehydroascorbate reductase (MDHAR; EC 1.6.5.4) and dehydroascorbate reductase (DHAR; EC 1.8.5.1) are essential to regeneration of ascorbate for maintenance of ROS scavenging ability. The MDHAR and DHAR genes from Brassica rapa were cloned, transgenic plants overexpressing either BrMDHAR and BrDHAR were established, and then, each transgenic plant was hybridized to examine the effects of co-expression of both genes conferring tolerance to freezing. Transgenic plants co-overexpressing BrMDHAR and BrDHAR showed activated expression of relative antioxidant enzymes, and enhanced levels of glutathione and phenolics under freezing condition. Then, these alteration caused by co-expression led to alleviated redox status and lipid peroxidation and consequently conferred improved tolerance against severe freezing stress compared to transgenic plants overexpressing single gene. The results of this study suggested that although each expression of BrMDHAR or BrDHAR was available to according tolerance to freezing, the simultaneous expression of two genes generated synergistic effects conferring improved tolerance more effectively even severe freezing. PMID:24170089

  12. The 1991 International Aerospace and Ground Conference on Lightning and Static Electricity, volume 2

    NASA Technical Reports Server (NTRS)

    1991-01-01

    The proceedings of the conference are reported. The conference focussed on lightning protection, detection, and forecasting. The conference was divided into 26 sessions based on research in lightning, static electricity, modeling, and mapping. These sessions spanned the spectrum from basic science to engineering, concentrating on lightning prediction and detection and on safety for ground facilities, aircraft, and aerospace vehicles.

  13. 48 CFR 1552.223-71 - EPA Green Meetings and Conferences.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true EPA Green Meetings and Conferences. 1552.223-71 Section 1552.223-71 Federal Acquisition Regulations System ENVIRONMENTAL PROTECTION... provision or language substantially the same as the provision in solicitations for meetings and conference...

  14. 1 CFR 301.1 - Establishment and location.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... information about the Conference either by accessing its Web site at http://www.acus.gov, by calling the Conference offices at (202) 480-2080, or by contacting [email protected]gov. The Conference's recommendations may be obtained by accessing its Web site or by visiting the reading room at its offices. ...

  15. Affinity Maturation of an Anti-V Antigen IgG Expressed In Situ Via Adenovirus Gene Delivery Confers Enhanced Protection Against Yersinia pestis Challenge

    PubMed Central

    Van Blarcom, Thomas J.; Sofer-Podesta, Carolina; Ang, John; Boyer, Julie L.; Crystal, Ronald G.; Georgiou, George

    2013-01-01

    Genetic transfer of neutralizing antibodies has been shown to confer strong and persistent protection against bacterial and viral infectious agents. While it is well established that for many exogenous neutralizing antibodies increased antigen affinity correlates with protection, the effect of antigen affinity on antibodies produced in situ following adenoviral gene transfer has not been examined. The mouse IgG2b monoclonal antibody 2C12.4 recognizes the Yersinia pestis Type III secretion apparatus protein LcrV (V antigen) and confers protection in mice when administered as an IgG intraperitoneally or, following genetic immunization with engineered, replication-defective serotype 5 human adenovirus (Ad) 1. 2C12.4 was expressed as a scFv fragment in E. coli and was shown to display a KD=3.5 nM by surface plasmon resonance (SPR) analysis. The 2C12.4 scFv was subjected to random mutagenesis and variants with increased affinity were isolated by flow cytometry using the Anchored Periplasmic Expression (APEx) bacterial display system. After a single round of mutagenesis, variants displaying up to 35-fold lower KD values (H8, KD=100 pM) were isolated. The variable domains of the H8 scFv were used to replace those of the parental 2C12.4 IgG encoded in the Ad vector, AdαV giving rise to AdαV.H8. The two adenoviral vectors resulted in similar titers of anti-V antigen antibodies 3 days post-immunization with 109, 1010 or 1011 particle units. Following intranasal challenge with 363 LD50Y. pestis CO92, 54% of the mice immunized with 1010 pu of AdαV.H8 survived at the 14 day end point compared to only 15% survivors for the group immunized with AdαV expressing the lower affinity 2C12.4 (P<0.04, AdαV versus AdαV.H8). These results indicate that affinity maturation of a neutralizing antibody delivered by genetic transfer may confer increased protection not only for Y. pestis challenge but possibly for other pathogens. PMID:20393511

  16. Intranasal boosting with an adenovirus-vectored vaccine markedly enhances protection by parenteral Mycobacterium bovis BCG immunization against pulmonary tuberculosis.

    PubMed

    Santosuosso, Michael; McCormick, Sarah; Zhang, Xizhong; Zganiacz, Anna; Xing, Zhou

    2006-08-01

    Parenterally administered Mycobacterium bovis BCG vaccine confers only limited immune protection from pulmonary tuberculosis in humans. There is a need for developing effective boosting vaccination strategies. We examined a heterologous prime-boost regimen utilizing BCG as a prime vaccine and our recently described adenoviral vector expressing Ag85A (AdAg85A) as a boost vaccine. Since we recently demonstrated that a single intranasal but not intramuscular immunization with AdAg85A was able to induce potent protection from pulmonary Mycobacterium tuberculosis challenge in a mouse model, we compared the protective effects of parenteral and mucosal booster immunizations following subcutaneous BCG priming. Protection by BCG prime immunization was not effectively boosted by subcutaneous BCG or intramuscular AdAg85A. In contrast, protection by BCG priming was remarkably boosted by intranasal AdAg85A. Such enhanced protection by intranasal AdAg85A was correlated to the numbers of gamma interferon-positive CD4 and CD8 T cells residing in the airway lumen of the lung. Our study demonstrates that intranasal administration of AdAg85A represents an effective way to boost immune protection by parenteral BCG vaccination.

  17. Combined virus-like particle and fusion protein-encoding DNA vaccination of cotton rats induces protection against respiratory syncytial virus without causing vaccine-enhanced disease

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hwang, Hye Suk; Lee, Young-Tae; Kim, Ki-Hye

    A safe and effective vaccine against respiratory syncytial virus (RSV) should confer protection without causing vaccine-enhanced disease. Here, using a cotton rat model, we investigated the protective efficacy and safety of an RSV combination vaccine composed of F-encoding plasmid DNA and virus-like particles containing RSV fusion (F) and attachment (G) glycoproteins (FFG-VLP). Cotton rats with FFG-VLP vaccination controlled lung viral replication below the detection limit, and effectively induced neutralizing activity and antibody-secreting cell responses. In comparison with formalin inactivated RSV (FI-RSV) causing severe RSV disease after challenge, FFG-VLP vaccination did not cause weight loss, airway hyper-responsiveness, IL-4 cytokines, histopathology, andmore » infiltrates of proinflammatory cells such as eosinophils. FFG-VLP was even more effective in preventing RSV-induced pulmonary inflammation than live RSV infections. This study provides evidence that FFG-VLP can be developed into a safe and effective RSV vaccine candidate. - Highlights: • Combined RSV FFG VLP vaccine is effective in inducing F specific responses. • FFG VLP vaccine confers RSV neutralizing activity and viral control in cotton rats. • Cotton rats with RSV FFG VLP vaccination do not show vaccine-enhanced disease. • Cotton rats with FFG VLP vaccine induce F specific antibody secreting cell responses. • Cotton rats with FFG VLP do not induce lung cellular infiltrates and Th2 cytokine.« less

  18. Public Policy on Ground-Water Quality Protection. Proceedings of a National Conference (Virginia Polytechnic Inst. and State University, Blacksburg, Virginia, April 13-16, 1977).

    ERIC Educational Resources Information Center

    Kerns, Waldon R., Ed.

    This publication contains the papers presented at a National Conference on Ground Water Quality Protection Policy held in April of 1977. Paper titles include: (1) Magnitude of the Ground-Water Contamination Problem; (2) Limited Degredation as a Ground-Water Quality Policy; (3) Surface and Subsurface Mining: Policy Implications; (4) Oil Well…

  19. Vaccination with Leishmania histone H1-pulsed dendritic cells confers protection in murine visceral leishmaniasis.

    PubMed

    Agallou, Maria; Smirlis, Despina; Soteriadou, Ketty P; Karagouni, Evdokia

    2012-07-20

    Visceral leishmaniasis is the most severe form of leishmaniases affecting millions of people worldwide often resulting in death despite optimal therapy. Thus, there is an urgent need for the development of effective anti-infective vaccine(s). In the present study, we evaluated the prophylactic value of bone marrow-derived dendritic cells (BM-DCs) pulsed with the Leishmania (L.) infantum histone H1. We developed fully mature BM-DCs characterized by enhanced capacity of IL-12 production after ex vivo pulsing with GST-LeishH1. Intravenous administration of these BM-DCs in naive BALB/c mice resulted in antigen-specific spleenocyte proliferation and IgG1 isotype antibody production and conferred protection against experimental challenge with L. infantum independently of CpG oligonucleotides (ODNs) co-administration. Protection was associated with a pronounced enhancement of parasite-specific IFNγ-producing cells and reduction of cells producing IL-10, whereas IL-4 production was comparable in protected and non-protected mice. The polarization of immune responses to Th1 type was further confirmed by the elevation of parasite-specific IgG2a/IgG1 ratio in protected mice. The above data indicate the immunostimulatory capacity of Leishmania histone H1 and further support its exploitation as a candidate protein for vaccine development against leishmaniasis. Copyright © 2012 Elsevier Ltd. All rights reserved.

  20. Green Infrastructure for Stormwater Control: Gauging its Effectiveness with Community Partners, Summary of EPA GI Reports

    EPA Science Inventory

    This document is a summary of the green infrastructure reports, journal articles, and conference proceedings published to date. This summary will be updated as more reports are completed. The Environmental Protection Agency’s Office of Research and Development has an ambitious ...

  1. Pest protection conferred by A Beta vulgaris serine proteinase inhibitor gene

    USDA-ARS?s Scientific Manuscript database

    Proteinase inhibitors provide a means of engineering plant resistance to insect pests. A Beta vulgaris serine proteinase inhibitor gene (BvSTI) was fused to the constitutive CaMV35S promoter for over-expression in Nicotiana benthamiana plants to study its effect on lepidopteran insect pests. Indep...

  2. Synergistic effect of the combination of gallic acid and famotidine in protection of rat gastric mucosa.

    PubMed

    Asokkumar, K; Sen, Saikat; Umamaheswari, M; Sivashanmugam, A T; Subhadradevi, V

    2014-08-01

    Antioxidant supplements with existing drugs may confer better therapeutic efficacy in oxidative stress related diseases. The purpose of the present work was to characterize the interaction and investigate the protective effect of H2 blocker famotidine and gallic acid in combination against experimentally induced peptic ulcer. Preventive effect of gallic acid and famotidine in different combinations was investigated against aspirin plus pyloric ligation induced ulcer in rat. Ulcer index, gastric juice volume, pH, other biochemical parameters of gastric juice and antioxidant activity using stomach tissue were estimated. Pretreatment with gallic acid and famotidine in combinations for 7 days, protected the gastric mucosa significantly (p<0.05, 0.01), which was evidenced by decrease in ulcer index, gastric juice volume, free and total acidity, total protein, pepsin and DNA content, and increase in pH, carbohydrates concentration in gastric juice. Combination treatment increases levels of superoxide dismutase, catalase, reduced glutathione, glutathione reductase and glucose-6-phosphate dehydrogenase, and decreases lipid peroxidation, myloperoxidase in stomach tissue. Along with higher dose combination, lower dose combinations like gallic acid (50mg/kg) plus famotidine (10mg/kg) also offered better antiulcer activity than their individual effect. Histopathological studies confirmed their antiulcer activity. Combination treatments confer synergistic protective effect against peptic ulcer in rats, which was related to the gastroprotective, antisecratory and antioxidant activity of combination treatment. Results proved that use of gallic acid with existing antiulcer drug will be more useful in the prevention/management of peptic ulcer. Copyright © 2014 Institute of Pharmacology, Polish Academy of Sciences. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

  3. PREFACE: Inhaled Particles X: 23-25 September 2008, Sheffield UK

    NASA Astrophysics Data System (ADS)

    Kenny, Lee; Hurley, Fintan

    2009-07-01

    Multi-disciplinary research is vital to the science of particle-mediated lung disease and a distinctive feature of the Inhaled Particles Conference series. Continuing this tradition, Inhaled Particles X brought together world-renowned and up-and-coming researchers from a wide range of specialist disciplines, but with a common interest and purpose: to understand better the nature of inhalable particles and their effects once inhaled, for the protection of workers' and public health. IPX was an integrative Conference, in three ways. First, as usual with Inhaled Particles, IPX welcomed the full range of disciplines and scientists concerned with protection of health from inhaled particles. This included engineers concerned with dust control; scientists characterising and modelling emissions; exposure measurement, in the field and in the laboratory; experts in particle deposition and clearance; toxicologists discovering mechanisms of damage; epidemiologists developing and applying methods to link exposure with risk; and those concerned with policy - with setting standards, with protection of individuals. Secondly, IPX was concerned with particles in the workplace, in outdoor air, and in the general indoor environment; and tried to find common threads and encourage cross-over of ideas between these three broad fields. And thirdly, IPX integrated experience and perspectives internationally, including issues such as silicosis and pneumoconiosis that are now unfashionable as research topics in the developed Western economies but still constitute a major public health risk internationally. Contributors to IPX were invited to submit extended abstracts for publication in these Proceedings; in addition, all authors were asked to prepare a short abstract. These short abstracts (including those attached to extended abstracts and papers) are collected and published together in this Conference Overview, to maintain the integrity of the Proceedings as a record of the Conference as a whole.

  4. 75 FR 8719 - Notice of Agreements Filed

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-02-25

    ...) 523-5793 or [email protected] . Agreement No.: 011346-020. Title: Israel Trade Conference... Integrated Shipping Services, Ltd. Filing Party: Howard A. Levy, Esq.; Chairman; Israel Trade Conference; 80...

  5. International Conference on Harmonisation; guidance on S7A safety pharmacology studies for human pharmaceuticals; availability. Notice.

    PubMed

    2001-07-13

    The Food and Drug Administration (FDA) is announcing the availability of a guidance entitled "S7A Safety Pharmacology Studies for Human Pharmaceuticals." The guidance was prepared under the auspices of the International Conference on Harmonisation of Technical Requirements for Registration of Pharmaceuticals for Human Use (ICH). The guidance provides a definition, general principles, and recommendations for the nonclinical safety pharmacology studies. The guidance is intended to help protect clinical trial participants and patients receiving marketed products from potential adverse effects of pharmaceuticals, while avoiding unnecessary use of animals and other resources.

  6. Aerospace Environmental Technology Conference

    NASA Technical Reports Server (NTRS)

    Whitaker, A. F. (Editor)

    1995-01-01

    The mandated elimination of CFC's, Halons, TCA, and other ozone depleting chemicals and specific hazardous materials has required changes and new developments in aerospace materials and processes. The aerospace industry has been involved for several years in providing product substitutions, redesigning entire production processes, and developing new materials that minimize or eliminate damage to the environment. These activities emphasize replacement cleaning solvents and their application verifications, compliant coatings including corrosion protection systems, and removal techniques, chemical propulsion effects on the environment, and the initiation of modifications to relevant processing and manufacturing specifications and standards. The Executive Summary of this Conference is published as NASA CP-3297.

  7. A missing voice: the human rights of children to a tobacco-free environment.

    PubMed

    Toebes, Brigit; Gispen, Marie Elske; Been, Jasper V; Sheikh, Aziz

    2018-01-01

    In this commentary, we flag the importance of taking a child-rights approach in the context of tobacco control, which is thus far unprecedented. This text was written in response to the Seventh Conference of States Parties of WHOs Framework Convention on Tobacco Control held in India from 7 to 12 November 2016.While the links between tobacco control and human rights were emphasised at this conference, a child-rights approach was missing. We argue that this novel angle provides important legal tools to protect the health and well-being of children. Because children are seen as 'replacement smokers' by the tobacco industry, protecting children in this context is key to haltering the devastating effects of tobacco use and exposure worldwide. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  8. Identification of viral genes associated with the interferon-inducing phenotype of a synthetic porcine reproductive and respiratory syndrome virus strain.

    PubMed

    Sun, Haiyan; Pattnaik, Asit K; Osorio, Fernando A; Vu, Hiep L X

    2016-12-01

    We recently generated a fully synthetic porcine reproductive and respiratory syndrome virus strain (designated as PRRSV-CON), which confers unprecedented levels of heterologous protection. We report herein that the synthetic PRRSV-CON possesses a unique phenotype in that it induces type-I interferons (IFNs) instead of suppressing these cytokines as most of the naturally occurring PRRSV isolates do. Through gain- and loss- of-function studies, the IFN-inducing phenotype of PRRSV-CON was mapped to the 3.3kb genomic fragment encoding three viral nonstructural proteins: nsp1α, nsp1β and the N-terminal part of nsp2. Further studies indicated that a cooperation among these 3 proteins was required for effective induction of IFNs. Collectively, this study constitutes the first step toward understanding the mechanisms by which the synthetic PRRSV-CON confers heterologous protection. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Teamwork and team decision-making at multidisciplinary cancer conferences: barriers, facilitators, and opportunities for improvement.

    PubMed

    Lamb, Benjamin W; Sevdalis, Nick; Arora, Sonal; Pinto, Anna; Vincent, Charles; Green, James S A

    2011-09-01

    Anecdotally, multidisciplinary cancer conferences (MCCs) do not always function optimally. MCC members' experiences with and attitudes toward MCCs are explored, and barriers to and facilitators of effective team-working are identified. A total of 19 semistructured interviews were conducted with surgeons, oncologists, nurses, and administrators. Interviews explored participants' opinions on MCC attendance, information presentation, case discussion, leadership, team decision-making, and possible improvements to MCC meetings. Nonattendance was associated with not having protected time to attend the MCC. Contributions to MCC discussions were unequal among the participants, and patient-centered information was ignored. Good leadership was necessary to foster inclusive case discussion. Members were positive about MCCs, but protected time, improved case selection, and working in a more structured way were possible improvements. Results are consistent with previous research: Members of the MCC are positive about the benefits of MCCs, although improving the way MCCs work is a goal.

  10. Effect of Mucuna pruriens Seed Extract Pretreatment on the Responses of Spontaneously Beating Rat Atria and Aortic Ring to Naja sputatrix (Javan Spitting Cobra) Venom

    PubMed Central

    Fung, Shin Yee; Tan, Nget Hong; Sim, Si Mui; Aguiyi, John C.

    2012-01-01

    Mucuna pruriens Linn. (velvet bean) has been used by native Nigerians as a prophylactic for snakebite. Rats pretreated with M. pruriens seed extract (MPE) have been shown to protect against the lethal and cardiovascular depressant effects of Naja sputatrix (Javan spitting cobra) venoms, and the protective effect involved immunological neutralization of the venom toxins. To investigate further the mechanism of the protective effect of MPE pretreatment against cobra venom toxicity, the actions of Naja sputatrix venom on spontaneously beating rat atria and aortic rings isolated from both MPE pretreated and untreated rats were studied. Our results showed that the MPE pretreatment conferred protection against cobra venom-induced depression of atrial contractility and atrial rate in the isolated atrial preparations, but it had no effect on the venom-induced contractile response of aortic ring preparation. These observations suggested that the protective effect of MPE pretreatment against cobra venom toxicity involves a direct protective action of MPE on the heart function, in addition to the known immunological neutralization mechanism, and that the protective effect does not involve action on blood vessel contraction. The results also suggest that M. pruriens seed may contain novel cardioprotective agent with potential therapeutic value. PMID:21785646

  11. Resveratrol Confers Protection against Rotenone-Induced Neurotoxicity by Modulating Myeloperoxidase Levels in Glial Cells

    PubMed Central

    Chang, Chi Young; Choi, Dong-Kug; Lee, Dae Kee; Hong, Young Jun; Park, Eun Jung

    2013-01-01

    Myeloperoxidase (MPO) functions as a key molecular component of the host defense system against diverse pathogens. We have previously reported that increased MPO levels and activity is a distinguishing feature of rotenone-exposed glial cells, and that either overactivation or deficiency of MPO leads to pathological conditions in the brain. Here, we provide that modulation of MPO levels in glia by resveratrol confers protective effects on rotenone-induced neurotoxicity. We show that resveratrol significantly reduced MPO levels but did not trigger abnormal nitric oxide (NO) production in microglia and astrocytes. Resveratrol-induced down-regulation of MPO, in the absence of an associated overproduction of NO, markedly attenuated rotenone-triggered inflammatory responses including phagocytic activity and reactive oxygen species production in primary microglia and astrocytes. In addition, impaired responses of primary mixed glia from Mpo −/− mice to rotenone were relieved by treatment with resveratrol. We further show that rotenone-induced neuronal injury, particularly dopaminergic cell death, was attenuated by resveratrol in neuron-glia co-cultures, but not in neurons cultured alone. Similar regulatory effects of resveratrol on MPO levels were observed in microglia treated with MPP+, another Parkinson’s disease-linked neurotoxin, supporting the beneficial effects of resveratrol on the brain. Collectively, our findings provide that resveratrol influences glial responses to rotenone by regulating both MPO and NO, and thus protects against rotenone-induced neuronal injury. PMID:23593274

  12. Long-term evaluation of mucosal and systemic immunity and protection conferred by different polio booster vaccines.

    PubMed

    Xiao, Yuhong; Daniell, Henry

    2017-09-25

    Oral polio vaccine (OPV) and Inactivated Polio Vaccine (IPV) have distinct advantages and limitations. IPV does not provide mucosal immunity and introduction of IPV to mitigate consequences of circulating vaccine-derived polio virus from OPV has very limited effect on transmission and OPV campaigns are essential for interrupting wild polio virus transmission, even in developed countries with a high coverage of IPV and protected sewer systems. The problem is magnified in many countries with limited resources. Requirement of refrigeration for storage and transportation for both IPV and OPV is also a major challenge in developing countries. Therefore, we present here long-term studies on comparison of a plant-based booster vaccine, which is free of virus and cold chain with IPV boosters and provide data on mucosal and systemic immunity and protection conferred by neutralizing antibodies. Mice were primed subcutaneously with IPV and boosted orally with lyophilized plant cells containing 1μg or 25μg polio viral protein 1 (VP1), once a month for three months or a single booster one year after the first prime. Our results show that VP1-IgG1 titers in single or double dose IPV dropped to background levels after one year of immunization. This decrease correlated with >50% reduction in seropositivity in double dose and <10% seropositivity in single dose IPV against serotype 1. Single dose IPV offered no or minimal protection against serotype 1 and 2 but conferred protection against serotype 3. VP1-IgA titers were negligible in IPV single or double dose vaccinated mice. VP1 antigen with two plant-derived adjuvants induced significantly high level and long lasting VP1-IgG1, IgA and neutralizing antibody titers (average 4.3-6.8 log2 titers). Plant boosters with VP1 and plant derived adjuvants maintained the same level titers from 29 to 400days and conferred the same level of protection against all three serotypes throughout the duration of this study. Even during period, when no plant booster was given (∼260days), VP1-IgG1 titers were maintained at high levels. Lyophilized plant cells expressing VP1 can be stored without losing efficacy, eliminating cold chain. Virus-free, cold-chain free vaccine is ready for further clinical development. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  13. Meta-analyses of the association of HLA-DRB1 alleles with rheumatoid arthritis among Arabs.

    PubMed

    Bizzari, Sami; Nair, Pratibha; Al Ali, Mahmoud Taleb; Hamzeh, Abdul Rezzak

    2017-07-01

    Various studies incorporating Arab populations have reported on specific associations between HLA-DRB1 variants and rheumatoid arthritis (RA). We sought to provide an overview on the association of HLA-DRB1 with RA in Arabs using meta-analysis tools. Data on allele counts and frequencies were compiled from the relevant literature (published before 16 February 2016) and the associations of 13 -DRB1 variants with RA were assessed; relationships were defined in terms of odds ratios (ORs) with a 95% confidence interval. Based on a collection of six studies, risk conferring or protective allele associations were derived from allele counts in 475 RA patients and 1213 controls. Two HLA-DRB1 alleles (-DRB1*04, *10) significantly conferred an increased risk for RA (OR > 2; P < 0.0001). Conversely, four alleles (-DRB1*03, *07, *11 and *13) significantly conferred a protective effect against RA (OR < 1; P < 0.05). No significant associations with RA were found for seven -DRB1 variants (-DRB1*01, *08, *09, *12, *14, *15 and *16). With increased statistical power and effect size over individual studies, we present a more robust profile on the association of HLA-DRB1 variants with RA in the Arab ethnicity, and contribute to the global geo-ethnic picture in this context. © 2016 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

  14. 75 FR 6397 - Notice of Agreements Filed

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-02-09

    ...)-523-5793 or tradeanalysi[email protected] . Agreement No.: 011346-019. Title: Israel Trade Conference.... Filing Party: Howard A. Levy, Esq.; Chairman; Israel Trade Conference; 80 Wall Street, Suite 1117; New...

  15. 2010 Defense Industrial Base Critical Infrastructure Protection Conference (DIBCIP) Risk Reduction and Mitigation in the Defense Industrial Base

    DTIC Science & Technology

    2010-04-28

    Base Critical Infrastructure Protection Conference (DIBCIP) “Risk Reduction & Mitigation in the Defense Industrial Base ” April 26-28, 2010...Philadelphia, PA Agenda Tuesday, April 27, 2010 Keynote Address: The Economic Crisis and Its Impact on the DIB: Defense Industrial Base Forecasts 2010...Ms. Nancy Pomerleau, Exercise Director, Partnership Outreach Division, DHS-IP DIB 2010 DIB CIP DEFENSE INDUSTRIAL BASE CRITICAL

  16. Alpha-crystallin-mediated protection of lens cells against heat and oxidative stress-induced cell death.

    PubMed

    Christopher, Karen L; Pedler, Michelle G; Shieh, Biehuoy; Ammar, David A; Petrash, J Mark; Mueller, Niklaus H

    2014-02-01

    In addition to their key role as structural lens proteins, α-crystallins also appear to confer protection against many eye diseases, including cataract, retinitis pigmentosa, and macular degeneration. Exogenous recombinant α-crystallin proteins were examined for their ability to prevent cell death induced by heat or oxidative stress in a human lens epithelial cell line (HLE-B3). Wild type αA- or αB-crystallin (WT-αA and WT-αB) and αA- or αB-crystallins, modified by the addition of a cell penetration peptide (CPP) designed to enhance the uptake of proteins into cells (gC-αB, TAT-αB, gC-αA), were produced by recombinant methods. In vitro chaperone-like assays were used to assay the ability of α-crystallins to protect client proteins from chemical or heat induced aggregation. In vivo viability assays were performed in HLE-B3 to determine whether pre-treatment with α-crystallins reduced death after exposure to oxidative or heat stress. Most of the five recombinant α-crystallin proteins tested conferred some in vitro protection from protein aggregation, with the greatest effect seen with WT-αB and gC-αB. All α-crystallins displayed significant protection to oxidative stress induced cell death, while only the αB-crystallins reduced cell death induced by thermal stress. Our findings indicate that the addition of the gC tag enhanced the protective effect of αB-crystallin against oxidative but not thermally-induced cell death. In conclusion, modifications that increase the uptake of α-crystallin proteins into cells, without destroying their chaperone-like activity and anti-apoptotic functions, create the potential to use these proteins therapeutically. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Antibody treatment against pulmonary exposure to abrin confers significantly higher levels of protection than treatment against ricin intoxication.

    PubMed

    Sabo, Tamar; Gal, Yoav; Elhanany, Eitan; Sapoznikov, Anita; Falach, Reut; Mazor, Ohad; Kronman, Chanoch

    2015-09-02

    Abrin, a potent plant-derived toxin bearing strong resemblance to ricin, irreversibly inactivates ribosomes by site-specific depurination, thereby precipitating cessation of protein synthesis in cells. Due to its high availability and ease of preparation, abrin is considered a biological threat, especially in context of bioterror warfare. To date, there is no established therapeutic countermeasure against abrin intoxication. In the present study, we examined the progress of pulmonary abrin intoxication in mice, evaluated the protective effect of antibody-based post-exposure therapy, and compared these findings to those observed for ricin intoxication and therapy. Salient features of abrin intoxication were found to be similar to those of ricin and include massive recruitment of neutrophils to the lungs, high levels of pro-inflammatory markers in the bronchoalveolar lavage fluid and damage of the alveolar-capillary barrier. In contrast, the protective effect of anti-abrin antibody treatment was found to differ significantly from that of anti-ricin treatment. While anti-ricin treatment efficiency was quite limited even at 24h post-exposure (34% protection), administration of polyclonal anti-abrin antibodies even as late as 72h post-exposure, conferred exceedingly high-level protection (>70%). While both anti-toxin antibody treatments caused neutrophil and macrophage levels in the lungs to revert to normal, only anti-abrin treatment brought about a significant decline in the pulmonary levels of the pro-inflammatory cytokine IL-6. The differential ability of the anti-toxin treatments to dampen inflammation caused by the two similar toxins, abrin and ricin, could explain the radically different levels of protection achieved following antibody treatment. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  18. Gene therapy strategy for long-term myocardial protection using adeno-associated virus-mediated delivery of heme oxygenase gene.

    PubMed

    Melo, Luis G; Agrawal, Reitu; Zhang, Lunan; Rezvani, Mojgan; Mangi, Abeel A; Ehsan, Afshin; Griese, Daniel P; Dell'Acqua, Giorgio; Mann, Michael J; Oyama, Junichi; Yet, Shaw-Fang; Layne, Matthew D; Perrella, Mark A; Dzau, Victor J

    2002-02-05

    Ischemia and oxidative stress are the leading mechanisms for tissue injury. An ideal strategy for preventive/protective therapy would be to develop an approach that could confer long-term transgene expression and, consequently, tissue protection from repeated ischemia/reperfusion injury with a single administration of a therapeutic gene. In the present study, we used recombinant adeno-associated virus (rAAV) as a vector for direct delivery of the cytoprotective gene heme oxygenase-1 (HO-1) into the rat myocardium, with the purpose of evaluating this strategy as a therapeutic approach for long-term protection from ischemia-induced myocardial injury. Human HO-1 gene (hHO-1) was delivered to normal rat hearts by intramyocardial injection. AAV-mediated transfer of the hHO-1 gene 8 weeks before acute coronary artery ligation and release led to a dramatic reduction (>75%) in left ventricular myocardial infarction. The reduction in infarct size was accompanied by decreases in myocardial lipid peroxidation and in proapoptotic Bax and proinflammatory interleukin-1beta protein abundance, concomitant with an increase in antiapoptotic Bcl-2 protein level. This suggested that the transgene exerts its cardioprotective effects in part by reducing oxidative stress and associated inflammation and apoptotic cell death. This study documents the beneficial therapeutic effect of rAAV-mediated transfer, before myocardial injury, of a cytoprotective gene that confers long-term myocardial protection from ischemia/reperfusion injury. Our data suggest that this novel "pre-event" gene transfer approach may provide sustained tissue protection from future repeated episodes of injury and may be beneficial as preventive therapy for patients with or at risk of developing coronary ischemic events.

  19. Formalin-Inactivated Coxiella burnetii Phase I Vaccine-Induced Protection Depends on B Cells To Produce Protective IgM and IgG

    PubMed Central

    Peng, Ying; Schoenlaub, Laura; Elliott, Alexandra; Mitchell, William; Zhang, Yan

    2013-01-01

    To further understand the mechanisms of formalin-inactivated Coxiella burnetii phase I (PI) vaccine (PIV)-induced protection, we examined if B cell, T cell, CD4+ T cell, or CD8+ T cell deficiency in mice significantly affects the ability of PIV to confer protection against a C. burnetii infection. Interestingly, compared to wild-type (WT) mice, PIV conferred comparable levels of protection in CD4+ T cell- or CD8+ T cell-deficient mice and partial protection in T cell-deficient mice but did not provide measurable protection in B cell-deficient mice. These results suggest that PIV-induced protection depends on B cells. In addition, anti-PI-specific IgM was the major detectable antibody (Ab) in immune sera from PIV-vaccinated CD4+ T cell-deficient mice, and passive transfer of immune sera from PIV-vaccinated CD4+ T cell-deficient mice conferred significant protection. These results suggest that T cell-independent anti-PI-specific IgM may contribute to PIV-induced protection. Our results also suggested that PIV-induced protection may not depend on complement activation and Fc receptor-mediated effector functions. Furthermore, our results demonstrated that both IgM and IgG from PIV-vaccinated WT mouse sera were able to inhibit C. burnetii infection in vivo, but only IgM from PIV-vaccinated CD4+ T cell-deficient mouse sera inhibited C. burnetii infection. Collectively, these findings suggest that PIV-induced protection depends on B cells to produce protective IgM and IgG and that T cell-independent anti-PI-specific IgM may play a critical role in PIV-induced protection against C. burnetii infection. PMID:23545296

  20. Notification: EPA Conferences - Maximizing Cost Efficiencies

    EPA Pesticide Factsheets

    Project #OA-FY15-0381, September 19, 2014. The U.S. Environmental Protection Agency (EPA) Office of Inspector General (OIG) plans to begin preliminary research in October 2014 for an audit of conference spending.

  1. S1 of distinct IBV population expressed from recombinant adenovirus confers protection against challenge.

    PubMed

    Toro, H; Zhang, J F; Gallardo, R A; van Santen, V L; van Ginkel, F W; Joiner, K S; Breedlove, C

    2014-06-01

    Protective properties of three distinct infectious bronchitis virus (IBV) Ark Delmarva poultry industry (ArkDPI) S1 proteins encoded from replication-defective recombinant adenovirus vectors were investigated. Using a suboptimal dose of each recombinant virus, we demonstrated that IBV S1 amino acid sequences showing > or = 95.8% amino acid identity to the S1 of the challenge strain differed in their ability at conferring protection. Indeed, the S1 sequence of the IBV population previously designated C4 (AdIBVS1.C4), which protected the most poorly, differs from the S1 sequence of population C2 (AdIBVS1.C2), which provided the highest protection, only at amino acid position 56. The fact that a change in one amino acid in this region significantly altered the induction of a protective immune response against this protein provides evidence that the first portion of S1 displays relevant immunoprotective epitopes. Use of an optimal dose of AdIBVS1.C2 effectively protected chickens from clinical signs and significantly reduced viral load after IBV Ark virulent challenge. Moreover, increased numbers of both IgA and IgG IBV-specific antibody secreting lymphocytes were detected in the spleen after challenge. The increased response detected for both IgA and IgG lymphocytes after challenge might be explained by vaccine-induced B memory cells. The fact that a single vaccination with Ad/IBVS1.C2 provides protection against IBV challenge is promising, because Ad-vectored vaccines can be mass delivered by in ovo inoculation using automated in ovo injectors.

  2. Education--Due Process for Washington Public School Students--Wash. Ad. Code ch. 180-40 (1972)

    ERIC Educational Resources Information Center

    Talmadge, Philip

    1975-01-01

    In Washington, legislative and administrative rules of the State Board of Education have conferred protections of constitutional due process on public school students. The author examines the regulatory framework and effects concluding that the Washington due process rules should serve as a model for other states. (JT)

  3. Legal Limitations on Public Pension Plan Reform. Conference Paper 2009-08

    ERIC Educational Resources Information Center

    Monahan, Amy B.

    2009-01-01

    There is significant interest in reforming retirement plans for public school employees, particularly in light of current market conditions. This paper presents an overview of the various types of state regulation of public pension plans that affect possibilities for reform. Several states have legal protections that effectively prevent a state…

  4. Engineered newcastle disease virus expressing the F and G protein of AMPV-C confers protection against challenges in turkeys.

    USDA-ARS?s Scientific Manuscript database

    Avian metapneumovirus (aMPV) infects the respiratory and reproductive tracts of domestic poultry, which may develop into secondary infections that can result in substantial economic losses for producers. Live attenuated vaccines appear to be the most effective in countries where the disease is prev...

  5. 76 FR 22091 - California Independent System, Operator Corporation; Supplemental Notice of Agenda and Discussion...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-04-20

    ... purposes only. All parties are invited to file written comments following the technical conference. A free... technical support for the free webcasts. It also offers access to this event via television in the DC area... questions during the conference via e-mail at [email protected] . FERC conferences are accessible under...

  6. Health Occupations Education. Biennial National Health Occupations Research Conference Proceedings. (5th, Nashville, Tennessee, December 1, 1993).

    ERIC Educational Resources Information Center

    Rzonca, Chet, Ed.

    These proceedings include the agenda of the conference, a list of its cosponsors, and the texts of the following six papers presented at the conference: "Hepatitis Vaccine: Are Health Occupations Education Students Protected?" (Cynthia Chappelka); "Integrated Academics: An HOE Model" (Karen E. Gable, Beverly Ransdell); "The Ability of Work Related…

  7. The protective effect of Mucuna pruriens seeds against snake venom poisoning.

    PubMed

    Tan, Nget Hong; Fung, Shin Yee; Sim, Si Mui; Marinello, Enrico; Guerranti, Roberto; Aguiyi, John C

    2009-06-22

    The seed, leaf and root of Mucuna pruriens have been used in traditional medicine for treatments of various diseases. In Nigeria, the seed is used as oral prophylactics for snakebite. To study the protective effects of Mucuna pruriens seed extract against the lethalities of various snake venoms. Rats were pre-treated with Mucuna pruriens seed extract and challenged with various snake venoms. The effectiveness of anti-Mucuna pruriens (anti-MPE) antibody to neutralize the lethalities of snake venoms was investigated by in vitro neutralization. In rats, MPE pre-treatment conferred effective protection against lethality of Naja sputatrix venom and moderate protection against Calloselasma rhodostoma venom. Indirect ELISA and immunoblotting studies showed that there were extensive cross-reactions between anti-MPE IgG and venoms from many different genera of poisonous snakes, suggesting the involvement of immunological neutralization in the protective effect of MPE pre-treatment against snake venom poisoning. In vitro neutralization experiments showed that the anti-MPE antibodies effectively neutralized the lethalities of Asiatic cobra (Naja) venoms, but were not very effective against other venoms tested. The anti-MPE antibodies could be used in the antiserum therapy of Asiatic cobra (Naja) bites.

  8. εPKC confers acute tolerance to cerebral ischemic reperfusion injury

    PubMed Central

    Bright, Rachel; Sun, Guo-Hua; Yenari, Midori A.; Steinberg, Gary K.; Mochly-Rosen, Daria

    2008-01-01

    In response to mild ischemic stress, the brain elicits endogenous survival mechanisms to protect cells against a subsequent lethal ischemic stress, referred to as ischemic tolerance. The molecular signals that mediate this protection are thought to involve the expression and activation of multiple kinases, including protein kinase C (PKC). Here we demonstrate that εPKC mediates cerebral ischemic tolerance in vivo. Systemic delivery of ψεRACK, an εPKC-selective peptide activator, confers neuroprotection against a subsequent cerebral ischemic event when delivered immediately prior to stroke. In addition, activation of εPKC by ψεRACK treatment decreases vascular tone in vivo, as demonstrated by a reduction in microvascular cerebral blood flow. Here we demonstrate the role of acute and transient εPKC in early cerebral tolerance in vivo and suggest that extra-parenchymal mechanisms, such as vasoconstriction, may contribute to the conferred protection. PMID:18586397

  9. Rate of biological invasions is lower in coastal marine protected areas.

    PubMed

    Ardura, A; Juanes, F; Planes, S; Garcia-Vazquez, E

    2016-09-09

    Marine biological invasions threaten biodiversity worldwide. Here we explore how Marine Protected areas, by reducing human use of the coast, confer resilience against the introduction of non-indigenous species (NIS), using two very different Pacific islands as case studies for developing and testing mathematical models. We quantified NIS vectors and promoters on Vancouver (Canada) and Moorea (French Polynesia) islands, sampled and barcoded NIS, and tested models at different spatial scales with different types of interaction among vectors and between marine protection and NIS frequency. In our results NIS were negatively correlated with the dimension of the protected areas and the intensity of the protection. Small to medium geographical scale protection seemed to be efficient against NIS introductions. The likely benefit of MPAs was by exclusion of aquaculture, principally in Canada. These results emphasize the importance of marine protected areas for biodiversity conservation, and suggest that small or medium protected zones would confer efficient protection against NIS introduction.

  10. Sixteenth Space Simulation Conference Confirming Spaceworthiness Into the Next Millennium

    NASA Technical Reports Server (NTRS)

    Stecher, Joseph L., III (Editor)

    1990-01-01

    The conference provided participants with a forum to acquire and exchange information on the state of the art in space simulation, test technology, thermal simulation and protection, contamination, and techniques of test measurements.

  11. Protection against Experimental Cryptococcosis following Vaccination with Glucan Particles Containing Cryptococcus Alkaline Extracts

    PubMed Central

    Lee, Chrono K.; Huang, Haibin; Shen, Zu T.; Lodge, Jennifer K.; Leszyk, John; Ostroff, Gary R.

    2015-01-01

    ABSTRACT A vaccine capable of protecting at-risk persons against infections due to Cryptococcus neoformans and Cryptococcus gattii could reduce the substantial global burden of human cryptococcosis. Vaccine development has been hampered though, by lack of knowledge as to which antigens are immunoprotective and the need for an effective vaccine delivery system. We made alkaline extracts from mutant cryptococcal strains that lacked capsule or chitosan. The extracts were then packaged into glucan particles (GPs), which are purified Saccharomyces cerevisiae cell walls composed primarily of β-1,3-glucans. Subcutaneous vaccination with the GP-based vaccines provided significant protection against subsequent pulmonary infection with highly virulent strains of C. neoformans and C. gattii. The alkaline extract derived from the acapsular strain was analyzed by liquid chromatography tandem mass spectrometry (LC-MS/MS), and the most abundant proteins were identified. Separation of the alkaline extract by size exclusion chromatography revealed fractions that conferred protection when loaded in GP-based vaccines. Robust Th1- and Th17-biased CD4+ T cell recall responses were observed in the lungs of vaccinated and infected mice. Thus, our preclinical studies have indicated promising cryptococcal vaccine candidates in alkaline extracts delivered in GPs. Ongoing studies are directed at identifying the individual components of the extracts that confer protection and thus would be promising candidates for a human vaccine. PMID:26695631

  12. Chondracanthus tenellus (Harvey) hommersand extract protects the human keratinocyte cell line by blocking free radicals and UVB radiation-induced cell damage.

    PubMed

    Piao, Mei Jing; Hyun, Yu Jae; Oh, Tae-Heon; Kang, Hee Kyoung; Yoo, Eun Sook; Koh, Young Sang; Lee, Nam Ho; Suh, In Soo; Hyun, Jin Won

    2012-12-01

    The aim of this study was to investigate the protective effects of the ethanol extract of the red algae Chondracanthus tenellus (Harvey) Hommersand (CTE) on cultured human keratinocyte cell line. The cellular protection conferred by CTE was evidenced by the ability of the extract to absorb ultraviolet B (UVB; 280-320 nm) and to scavenge the radical 1,1-diphenyl-2-picrylhydrazyl, as well as intracellular reactive oxygen species (ROS), induced by either hydrogen peroxide (H(2)O(2)) or UVB radiation. In addition, both superoxide anion generated by the xanthine/xanthine oxidase system and hydroxyl radical generated by the Fenton reaction (FeSO(4) + H(2)O(2)) were scavenged by CTE, as confirmed using electron spin resonance spectrometry. In the human keratinocyte cell line, CTE decreased the degree of injury resulting from UVB-induced oxidative stress to lipids, proteins, and DNA. CTE-treated cells also showed a reduction in UVB-induced apoptosis, as exemplified by fewer apoptotic bodies and less DNA fragmentation. Taken together, these results suggest that CTE confers protection on the human keratinocyte cell line against UVB-induced oxidative stress by absorbing UVB ray and scavenging ROS, thereby reducing injury to cellular constituents.

  13. Protection of rhesus macaques against inhalational anthrax with a Bacillus anthracis capsule conjugate vaccine.

    PubMed

    Chabot, Donald J; Ribot, Wilson J; Joyce, Joseph; Cook, James; Hepler, Robert; Nahas, Debbie; Chua, Jennifer; Friedlander, Arthur M

    2016-07-25

    The efficacy of currently licensed anthrax vaccines is largely attributable to a single Bacillus anthracis immunogen, protective antigen. To broaden protection against possible strains resistant to protective antigen-based vaccines, we previously developed a vaccine in which the anthrax polyglutamic acid capsule was covalently conjugated to the outer membrane protein complex of Neisseria meningitidis serotype B and demonstrated that two doses of 2.5μg of this vaccine conferred partial protection of rhesus macaques against inhalational anthrax . Here, we demonstrate complete protection of rhesus macaques against inhalational anthrax with a higher 50μg dose of the same capsule conjugate vaccine. These results indicate that B. anthracis capsule is a highly effective vaccine component that should be considered for incorporation in future generation anthrax vaccines. Published by Elsevier Ltd.

  14. Aerospace Environmental Technology Conference: Exectutive summary

    NASA Technical Reports Server (NTRS)

    Whitaker, A. F. (Editor)

    1995-01-01

    The mandated elimination of CFC's, Halons, TCA, and other ozone depleting chemicals and specific hazardous materials has required changes and new developments in aerospace materials and processes. The aerospace industry has been involved for several years in providing product substitutions, redesigning entire production processes, and developing new materials that minimize or eliminate damage to the environment. These activities emphasize replacement cleaning solvents and their application verifications, compliant coatings including corrosion protection systems, and removal techniques, chemical propulsion effects on the environment, and the initiation of modifications to relevant processing and manufacturing specifications and standards. The papers from this conference are being published in a separate volume as NASA CP-3298.

  15. Comparison of potential protection conferred by three immunization strategies (protein/protein, DNA/DNA, and DNA/protein) against Brucella infection using Omp2b in BALB/c Mice.

    PubMed

    Golshani, Maryam; Rafati, Sima; Nejati-Moheimani, Mehdi; Ghasemian, Melina; Bouzari, Saeid

    2016-12-25

    In the present study, immunogenicity and protective efficacy of the Brucella outer membrane protein 2b (Omp2b) was evaluated in BALB/c mice using Protein/Protein, DNA/DNA and DNA/Protein vaccine strategies. Immunization of mice with three vaccine regimens elicited a strong specific IgG response (higher IgG2a titers over IgG1 titers) and provided Th1-oriented immune response. Vaccination of BALB/c mice with the DNA/Pro regimen induced higher levels of IFN-γ/IL-2 and conferred more protection levels against B. melitenisis and B. abortus challenge than did the protein or DNA alone. In conclusion, Omp2b is able to stimulate specific immune responses and to confer cross protection against B. melitensis and B. abortus infection. Therefore, it could be introduced as a new potential candidate for the development of a subunit vaccine against Brucella infection. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. 33 CFR 154.814 - Facility requirements for vessel vapor overpressure and vacuum protection.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... maximum transfer rate determined at the pre-transfer conference required by § 156.120(w) of this chapter... section or a lower pressure agreed upon at the pre-transfer conference required by § 156.120(w) of this... paragraph (b) of this section or a higher pressure agreed upon at the pre-transfer conference required by...

  17. 33 CFR 154.814 - Facility requirements for vessel vapor overpressure and vacuum protection.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... maximum transfer rate determined at the pre-transfer conference required by § 156.120(w) of this chapter... section or a lower pressure agreed upon at the pre-transfer conference required by § 156.120(w) of this... paragraph (b) of this section or a higher pressure agreed upon at the pre-transfer conference required by...

  18. 33 CFR 154.814 - Facility requirements for vessel vapor overpressure and vacuum protection.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... maximum transfer rate determined at the pre-transfer conference required by § 156.120(w) of this chapter... section or a lower pressure agreed upon at the pre-transfer conference required by § 156.120(w) of this... paragraph (b) of this section or a higher pressure agreed upon at the pre-transfer conference required by...

  19. Protective effects of a Modified Vaccinia Ankara-based vaccine candidate against Crimean-Congo Haemorrhagic Fever virus require both cellular and humoral responses.

    PubMed

    Dowall, Stuart D; Graham, Victoria A; Rayner, Emma; Hunter, Laura; Watson, Robert; Taylor, Irene; Rule, Antony; Carroll, Miles W; Hewson, Roger

    2016-01-01

    Crimean-Congo Haemorrhagic Fever (CCHF) is a severe tick-borne disease, endemic in many countries in Africa, the Middle East, Eastern Europe and Asia. There is no approved vaccine currently available against CCHF. The most promising candidate, which has previously been shown to confer protection in the small animal model, is a modified Vaccinia Ankara virus vector expressing the CCHF viral glycoprotein (MVA-GP). It has been shown that MVA-GP induces both humoral and cellular immunogenicity. In the present study, sera and T-lymphocytes were passively and adoptively transferred into recipient mice prior to challenge with CCHF virus. Results demonstrated that mediators from both arms of the immune system were required to demonstrate protective effects against lethal challenge.

  20. Protective effects of a Modified Vaccinia Ankara-based vaccine candidate against Crimean-Congo Haemorrhagic Fever virus require both cellular and humoral responses

    PubMed Central

    Dowall, Stuart D.; Graham, Victoria A.; Rayner, Emma; Hunter, Laura; Watson, Robert; Taylor, Irene; Rule, Antony; Carroll, Miles W.; Hewson, Roger

    2016-01-01

    Crimean-Congo Haemorrhagic Fever (CCHF) is a severe tick-borne disease, endemic in many countries in Africa, the Middle East, Eastern Europe and Asia. There is no approved vaccine currently available against CCHF. The most promising candidate, which has previously been shown to confer protection in the small animal model, is a modified Vaccinia Ankara virus vector expressing the CCHF viral glycoprotein (MVA-GP). It has been shown that MVA-GP induces both humoral and cellular immunogenicity. In the present study, sera and T-lymphocytes were passively and adoptively transferred into recipient mice prior to challenge with CCHF virus. Results demonstrated that mediators from both arms of the immune system were required to demonstrate protective effects against lethal challenge. PMID:27272940

  1. Research on the relationship between humans and wilderness in Alaska

    Treesearch

    Alan E. Watson

    2005-01-01

    At the 2005 Biennial George Wright Society Conference on Parks, Protected Areas, and Cultural Sites in Philadelphia, March 14 to 18, there were many sessions relevant to wilderness. One session provided focus on a priority research area of the Leopold Institute: understanding the effects of management actions on relationships between people and wilderness. A great...

  2. Training for Effective National Weather Service (NWS) Communication in Chat and Conference Calls

    ERIC Educational Resources Information Center

    Pearce, Vanessa

    2012-01-01

    Staff of the National Weather Service Offices should be able to understand interpersonal communication and public relations in order to better serve their mission to "protect lives and property" as well as work with their internal and external partners (NWS Internet Services Team). Two technologies have been developed to assist the integration of…

  3. 77 FR 38306 - GFIRST Conference Stakeholder Evaluation

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-06-27

    ...), National Cyber Security Division (NCSD), United States Computer Emergency Readiness Team (US-CERT) will...- CERT, [email protected] . SUPPLEMENTARY INFORMATION: GFIRST is DHS's premier cyber conference and continually seeks to enhance collaborative efforts among cyber constituencies, partners, and stakeholders. The...

  4. RAGE deficiency attenuates the protective effect of Lidocaine against sepsis-induced acute lung injury.

    PubMed

    Zhang, Zhuo; Zhou, Jie; Liao, Changli; Li, Xiaobing; Liu, Minghua; Song, Daqiang; Jiang, Xian

    2017-04-01

    Lidocaine (Lido) is reported to suppress inflammatory responses and exhibit a therapeutic effect in models of cecal ligation and puncture (CLP)-induced acute lung injury (ALI). The receptor for advanced glycation end product (RAGE) exerts pro-inflammatory effects by enhancing pro-inflammatory cytokine production. However, the precise mechanism by which Lido confers protection against ALI is not clear. ALI was induced in RAGE WT and RAGE knockout (KO) rats using cecal ligation and puncture (CLP) operations for 24 h. The results showed that Lido significantly inhibited CLP-induced lung inflammation and histopathological lung injury. Furthermore, Lido significantly reduced CLP-induced upregulation of HMGB1 and RAGE expression and activation of the NF-κB and MAPK signaling pathways. With the use of RAGE KO rats, we demonstrate here that RAGE deficiency attenuates the protective effect of Lido against CLP-induced lung inflammatory cell infiltration and histopathological lung injury. These results suggest that RAGE deficiency attenuates the protective effect of Lido against CLP-induced ALI by attenuating the pro-inflammatory cytokines production.

  5. The Negatively Charged Regions of Lactoferrin Binding Protein B, an Adaptation against Anti-Microbial Peptides

    PubMed Central

    Morgenthau, Ari; Beddek, Amanda; Schryvers, Anthony B.

    2014-01-01

    Lactoferrin binding protein B (LbpB) is a bi-lobed membrane bound lipoprotein that is part of the lactoferrin receptor complex in a variety of Gram-negative pathogens. Despite high sequence diversity among LbpBs from various strains and species, a cluster of negatively charged amino acids is invariably present in the protein’s C-terminal lobe in all species except Moraxella bovis. The function of LbpB in iron acquisition has yet to be experimentally demonstrated, whereas in vitro studies have shown that LbpB confers protection against lactoferricin, a short cationic antimicrobial peptide released from the N- terminus of lactoferrin. In this study we demonstrate that the negatively charged regions can be removed from the Neisseria meningitidis LbpB without compromising stability, and this results in the inability of LbpB to protect against the bactericidal effects of lactoferricin. The release of LbpB from the cell surface by the autotransporter NalP reduces the protection against lactoferricin in the in vitro killing assay, attributed to removal of LbpB during washing steps, but is unlikely to have a similar impact in vivo. The protective effect of the negatively charged polysaccharide capsule in the killing assay was less than the protection conferred by LbpB, suggesting that LbpB plays a major role in protection against cationic antimicrobial peptides in vivo. The selective release of LbpB by NalP has been proposed to be a mechanism for evading the adaptive immune response, by reducing the antibody binding to the cell surface, but may also provide insights into the primary function of LbpB in vivo. Although TbpB and LbpB have been shown to be major targets of the human immune response, the selective release of LbpB suggests that unlike TbpB, LbpB may not be essential for iron acquisition, but important for protection against cationic antimicrobial peptides. PMID:24465982

  6. A single phosphorodiamidate morpholino oligomer targeting VP24 protects rhesus monkeys against lethal Ebola virus infection.

    PubMed

    Warren, Travis K; Whitehouse, Chris A; Wells, Jay; Welch, Lisa; Heald, Alison E; Charleston, Jay S; Sazani, Pete; Reid, St Patrick; Iversen, Patrick L; Bavari, Sina

    2015-02-10

    Ebola viruses (EBOV) cause severe disease in humans and nonhuman primates with high mortality rates and continue to emerge in new geographic locations, including several countries in West Africa, the site of a large ongoing outbreak. Phosphorodiamidate morpholino oligomers (PMOs) are synthetic antisense molecules that are able to target mRNAs in a sequence-specific fashion and suppress translation through steric hindrance. We previously showed that the use of PMOs targeting a combination of VP35 and VP24 protected rhesus monkeys from lethal EBOV infection. Surprisingly, the present study revealed that a PMOplus compound targeting VP24 alone was sufficient to confer protection from lethal EBOV infection but that a PMOplus targeting VP35 alone resulted in no protection. This study further substantiates recent data demonstrating that VP24 may be a key virulence factor encoded by EBOV and suggests that VP24 is a promising target for the development of effective anti-EBOV countermeasures. Several West African countries are currently being ravaged by an outbreak of Ebola virus (EBOV) that has become a major epidemic affecting not only these African countries but also Europe and the United States. A better understanding of the mechanism of virulence of EBOV is important for the development of effective treatments, as no licensed treatments or vaccines for EBOV disease are currently available. This study of phosphorodiamidate morpholino oligomers (PMOs) targeting the mRNAs of two different EBOV proteins, alone and in combination, demonstrated that targeting a single protein was effective at conferring a significant survival benefit in an EBOV lethal primate model. Future development of PMOs with efficacy against EBOV will be simplified if only one PMO is required instead of a combination, particularly in terms of regulatory approval. Copyright © 2015 Warren et al.

  7. Progressive exercise preconditioning protects against circulatory shock during experimental heatstroke.

    PubMed

    Hung, Ching-Hsia; Chang, Nen-Chung; Cheng, Bor-Chih; Lin, Mao-Tsun

    2005-05-01

    Heat shock protein (HSP) 72 expression protects against arterial hypotension in rat heatstroke. HSP72 can also be induced in multiple organs, including hearts from rats with endurance exercise. We validated the hypothesis that progressive exercise preconditioning may confer cardiovascular protection during heatstroke by inducing the overexpression of HSP72 in multiple organs. To deal with the matter, we assessed the effects of heatstroke on mean arterial pressure, heart rate, cardiac output, stroke volume, total peripheral vascular resistance, colonic temperature, blood gases, and serum or tissue levels of tumor necrosis factor-alpha (TNF-alpha) in urethane-anesthetized rats pretreated without or with progressive exercise training for 1, 2, or 3 weeks. In addition, HSP72 expression in multiple organs was determined in different groups of animals. Heatstroke was induced by exposing the rats to a high blanket temperature (43 degrees C); the moment at which mean arterial pressure decreased from the peak value was taken as the time of heatstroke onset. Previous exercise training for 3 weeks, but not 1 or 2 weeks, conferred significant protection against hyperthermia, arterial hypotension, decreased cardiac output, decreased stroke volume, decreased peripheral vascular resistance, and increased levels of serum or tissue TNF-alpha during heatstroke and correlated with overexpression of HSP72 in multiple organs, including heart, liver, and adrenal gland. However, 10 days after 3 weeks of progressive exercise training, when HSP72 expression in multiple organs returned to basal values, the beneficial effects exerted by 3 weeks of exercise training were no longer observed. These results strongly suggest that HSP72 preconditioning with progressive exercise training protects against hyperthermia, circulatory shock, and TNF-alpha overproduction during heatstroke.

  8. Light deficiency confers breast cancer risk by endocrine disorders.

    PubMed

    Suba, Zsuzsanna

    2012-09-01

    North-America and northern European countries exhibit the highest incidence rate of breast cancer, whereas women in southern regions are relatively protected. Immigrants from low cancer incidence regions to high-incidence areas might exhibit similarly higher or excessive cancer risk as compared with the inhabitants of their adoptive country. Additional cancer risk may be conferred by incongruence between their biological characteristics and foreign environment. Many studies established the racial/ethnic disparities in the risk and nature of female breast cancer in United States between African-American and Caucasian women. Mammary tumors in black women are diagnosed at earlier age, and are associated with higher rate of mortality as compared with cancers of white cases. Results of studies on these ethnic/racial differences in breast cancer incidence suggest that excessive pigmentation of dark skinned women results in a relative light-deficiency. Poor light exposure may explain the deleterious metabolic and hormonal alterations; such as insulin resistance, deficiencies of estrogen, thyroxin and vitamin-D conferring excessive cancer risk. The more northern the location of an adoptive country the higher the cancer risk for dark skinned immigrants. Recognition of the deleterious systemic effects of darkness and excessive melatonin synthesis enables cancer protection treatment for people living in light-deficient environment. Recent patents provide new methods for the prevention of hormonal and metabolic abnormities.

  9. Geometric models, antenna gains, and protection ratios as developed for BC SAT-R2 conference software

    NASA Technical Reports Server (NTRS)

    Miller, E. F.

    1982-01-01

    Mathematical models used in the software package developed for use at the 1983 Regional Administrative Radio Conference on broadcasting satellites. The models described are those used in the Spectrum Orbit Utilization Program (SOUP) analysis. The geometric relationships necessary to model broadcasting satellite systems are discussed. Antenna models represent copolarized and cross polarized performance as functions of the off axis angle. The protection ratio is modelled as a co-channel value and a template representing systems with frequency offsets.

  10. Attenuated Actinobacillus pleuropneumoniae double-deletion mutant S-8∆clpP/apxIIC confers protection against homologous or heterologous strain challenge.

    PubMed

    Xie, Fang; Li, Gang; Zhou, Long; Zhang, Yanhe; Cui, Ning; Liu, Siguo; Wang, Chunlai

    2017-01-06

    Actinobacillus pleuropneumoniae is the etiological agent of porcine pleuropneumonia, which leads to large economic losses to the swine industry worldwide. In this study, S-8△clpP△apxIIC, a double-deletion mutant of A. pleuropneumoniae was constructed, and its safety and protective efficacy were evaluated in pigs. The S-8△clpP△apxIIC mutant exhibited attenuated virulence in a murine (BALB/c) model, and caused no detrimental effects on pigs even at a dose of up to 1.0 × 10 9  CFU. Furthermore, the S-8△clpP△apxIIC mutant was able to induce a strong immune response in pigs, which included high levels of IgG1 and IgG2, stimulated gamma interferon (IFN-γ), interleukin 12 (IL-12), and interleukin 4 (IL-4) production, and conferred effective protection against the lethal challenge with A. pleuropneumoniae serovars 7 or 5a. The pigs in the S-8△clpP△apxIIC immunized groups have no lesions and reduced bacterial loads in the lung tissue after challenge. The data obtained in this study suggest that the S-8△clpP△apxIIC mutant can serve as a highly immunogenic and potential live attenuated vaccine candidate against A. pleuropneumoniae infection.

  11. Dynamic modeling of cost-effectiveness of rotavirus vaccination, Kazakhstan.

    PubMed

    Freiesleben de Blasio, Birgitte; Flem, Elmira; Latipov, Renat; Kuatbaeva, Ajnagul; Kristiansen, Ivar Sønbø

    2014-01-01

    The government of Kazakhstan, a middle-income country in Central Asia, is considering the introduction of rotavirus vaccination into its national immunization program. We performed a cost-effectiveness analysis of rotavirus vaccination spanning 20 years by using a synthesis of dynamic transmission models accounting for herd protection. We found that a vaccination program with 90% coverage would prevent ≈880 rotavirus deaths and save an average of 54,784 life-years for children <5 years of age. Indirect protection accounted for 40% and 60% reduction in severe and mild rotavirus gastroenteritis, respectively. Cost per life year gained was US $18,044 from a societal perspective and US $23,892 from a health care perspective. Comparing the 2 key parameters of cost-effectiveness, mortality rates and vaccine cost at

  12. Protection conferred by a recombinant Marek’s disease virus that expresses the spike protein from infectious bronchitis virus in specific pathogen-free chicken

    PubMed Central

    2012-01-01

    Background In many countries, the predominant field isolates of infectious bronchitis virus (IBV) have been classified as QX-like strains since 1996. However, no commercial vaccines that are specific for this type of IBV are currently available. Therefore, there is an urgent need to develop novel vaccines that prevent QX-like IBV infection. Results A recombinant Marek’s disease virus (MDV), rMDV-S1, that expresses the S1 subunit of the spike (S) protein from the QX-like infectious bronchitis virus (IBV) was constructed by inserting the IBV S1 gene into the genome of the CVI988/Rispens strain of MDV. Specific pathogen-free (SPF) chickens that were vaccinated with rMDV-S1 were protected when challenged with the QX-like IBV. They were observed to have mild clinical signs of disease, a short virus-shedding period and low mortality. Additionally, the rMDV-S1 conferred full protection to chickens against virulent MDV, as did the CVI988/Rispens strain. Conclusions Our results demonstrate that rMDV-S1 is an effective and promising recombinant vaccine for the prevention of QX-like IBV infection. PMID:22559869

  13. Report on Tick-Borne Disease and Integrated Pest Management Conference

    EPA Pesticide Factsheets

    The US Environmental Protection Agency (EPA) and the Centers for Disease Control and Prevention (CDC) co-hosted a conference on Tick-Borne Disease Integrated Pest Management on March 5-6, 2013, in Arlington, VA. This document summarizes this meeting.

  14. 77 FR 19661 - City of Broken Bow, OK; Notice of Technical Conference

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-02

    ... for the Broken Bow Re-Regulation Dam Hydroelectric Project No. 12470. This conference will be held on... Liberty at (202) 502-6862 or [email protected]gov by April 5, 2012, to RSVP. Nathaniel J. Davis, Sr...

  15. Cisplatin Analogs Confer Protection against Cyanide Poisoning.

    PubMed

    Nath, Anjali K; Shi, Xu; Harrison, Devin L; Morningstar, Jordan E; Mahon, Sari; Chan, Adriano; Sips, Patrick; Lee, Jangwoen; MacRae, Calum A; Boss, Gerry R; Brenner, Matthew; Gerszten, Robert E; Peterson, Randall T

    2017-05-18

    Cisplatin holds an illustrious position in the history of chemistry most notably for its role in the virtual cure of testicular cancer. Here we describe a role for this small molecule in cyanide detoxification in vivo. Cyanide kills organisms as diverse as insects, fish, and humans within seconds to hours. Current antidotes exhibit limited efficacy and are not amenable to mass distribution requiring the development of new classes of antidotes. The binding affinity of the cyanide anion for the positively charged metal platinum is known to create an extremely stable complex in vitro. We therefore screened a panel of diverse cisplatin analogs and identified compounds that conferred protection from cyanide poisoning in zebrafish, mice, and rabbits. Cumulatively, this discovery pipeline begins to establish the characteristics of platinum ligands that influence their solubility, toxicity, and efficacy, and provides proof of concept that platinum-based complexes are effective antidotes for cyanide poisoning. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Transgenic strategies to confer resistance against viruses in rice plants

    PubMed Central

    Sasaya, Takahide; Nakazono-Nagaoka, Eiko; Saika, Hiroaki; Aoki, Hideyuki; Hiraguri, Akihiro; Netsu, Osamu; Uehara-Ichiki, Tamaki; Onuki, Masatoshi; Toki, Seichi; Saito, Koji; Yatou, Osamu

    2014-01-01

    Rice (Oryza sativa L.) is cultivated in more than 100 countries and supports nearly half of the world’s population. Developing efficient methods to control rice viruses is thus an urgent necessity because viruses cause serious losses in rice yield. Most rice viruses are transmitted by insect vectors, notably planthoppers and leafhoppers. Viruliferous insect vectors can disperse their viruses over relatively long distances, and eradication of the viruses is very difficult once they become widespread. Exploitation of natural genetic sources of resistance is one of the most effective approaches to protect crops from virus infection; however, only a few naturally occurring rice genes confer resistance against rice viruses. Many investigators are using genetic engineering of rice plants as a potential strategy to control viral diseases. Using viral genes to confer pathogen-derived resistance against crops is a well-established procedure, and the expression of various viral gene products has proved to be effective in preventing or reducing infection by various plant viruses since the 1990s. RNA interference (RNAi), also known as RNA silencing, is one of the most efficient methods to confer resistance against plant viruses on their respective crops. In this article, we review the recent progress, mainly conducted by our research group, in transgenic strategies to confer resistance against tenuiviruses and reoviruses in rice plants. Our findings also illustrate that not all RNAi constructs against viral RNAs are equally effective in preventing virus infection and that it is important to identify the viral “Achilles’ heel” gene to target for RNAi attack when engineering plants. PMID:24454308

  17. Membrane receptor-dependent Notch1/Hes1 activation by melatonin protects against myocardial ischemia-reperfusion injury: in vivo and in vitro studies.

    PubMed

    Yu, Liming; Liang, Hongliang; Lu, Zhihong; Zhao, Guolong; Zhai, Mengen; Yang, Yang; Yang, Jian; Yi, Dinghua; Chen, Wensheng; Wang, Xiaowu; Duan, Weixun; Jin, Zhenxiao; Yu, Shiqiang

    2015-11-01

    Melatonin confers profound protective effect against myocardial ischemia-reperfusion injury (MI/RI). Activation of Notch1/Hairy and enhancer of split 1 (Hes1) signaling also ameliorates MI/RI. We hypothesize that melatonin attenuates MI/RI-induced oxidative damage by activating Notch1/Hes1 signaling pathway with phosphatase and tensin homolog deleted on chromosome 10 (Pten)/Akt acting as the downstream signaling pathway in a melatonin membrane receptor-dependent manner. Male Sprague Dawley rats were treated with melatonin (10 mg/kg/day) for 4 wk and then subjected to MI/R surgery. Melatonin significantly improved cardiac function and decreased myocardial apoptosis and oxidative damage. Furthermore, in cultured H9C2 cardiomyocytes, melatonin (100 μmol/L) attenuated simulated ischemia-reperfusion (SIR)-induced myocardial apoptosis and oxidative damage. Both in vivo and in vitro study demonstrated that melatonin treatment increased Notch1, Notch1 intracellular domain (NICD), Hes1, Bcl-2 expressions, and p-Akt/Akt ratio and decreased Pten, Bax, and caspase-3 expressions. However, these protective effects conferred by melatonin were blocked by DAPT (the specific inhibitor of Notch1 signaling), luzindole (the antagonist of melatonin membrane receptors), Notch1 siRNA, or Hes1 siRNA administration. In summary, our study demonstrates that melatonin treatment protects against MI/RI by modulating Notch1/Hes1 signaling in a receptor-dependent manner and Pten/Akt signaling pathways are key downstream mediators. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. Proceedings, 10th Central Hardwood Forest Conference

    Treesearch

    Kurt W. Gottschalk; Sandra L.C., eds. Fosbroke

    1995-01-01

    Two invited papers, 57 volunteer papers, and 22 volunteer poster summaries presented at the 10th Central Hardwood Forest Conference. Presentation topics included economics, forest amenities, harvesting, logging safety, utilization, physiology, genetics, ecology, regeneration, silviculture, protection, management, hydrology, soils, nutrient cycling, and hardwood markets...

  19. Proceedings of the 7th central hardwood conference; 1989 March 5-8; Carbondale, IL.

    Treesearch

    George Rink; Carl A. Budelsky

    1989-01-01

    Proceedings of the seventh central hardwood forest conference, March 5-8, 1989 at Carbondale, Illinois. Includes 48 manuscripts dealing with silviculture, biology, management, protection, regeneration, utilization, structure, hydrology, and research policy in the central hardwood forest.

  20. Strategies, Research Priorities, and Partnerships for Community IPM to Prevent Tick-Borne Diseases--2011 Conference

    EPA Pesticide Factsheets

    The U.S. Environmental Protection Agency (EPA) held the Promoting Community Integrated Pest Management to Prevent Tick-Borne Diseases Conference on March 30th and 31st, 2011 in Arlington, Virginia. Read the meeting summary.

  1. Innate defense regulator peptide 1018 protects against perinatal brain injury.

    PubMed

    Bolouri, Hayde; Sävman, Karin; Wang, Wei; Thomas, Anitha; Maurer, Norbert; Dullaghan, Edie; Fjell, Christopher D; Ek, C Joakim; Hagberg, Henrik; Hancock, Robert E W; Brown, Kelly L; Mallard, Carina

    2014-03-01

    There is currently no pharmacological treatment that provides protection against brain injury in neonates. It is known that activation of an innate immune response is a key, contributing factor in perinatal brain injury; therefore, the neuroprotective therapeutic potential of innate defense regulator peptides (IDRs) was investigated. The anti-inflammatory effects of 3 IDRs was measured in lipopolysaccharide (LPS)-activated murine microglia. IDRs were then assessed for their ability to confer neuroprotection in vivo when given 3 hours after neonatal brain injury in a clinically relevant model that combines an inflammatory challenge (LPS) with hypoxia-ischemia (HI). To gain insight into peptide-mediated effects on LPS-induced inflammation and neuroprotective mechanisms, global cerebral gene expression patterns were analyzed in pups that were treated with IDR-1018 either 4 hours before LPS or 3 hours after LPS+HI. IDR-1018 reduced inflammatory mediators produced by LPS-stimulated microglia cells in vitro and modulated LPS-induced neuroinflammation in vivo. When administered 3 hours after LPS+HI, IDR-1018 exerted effects on regulatory molecules of apoptotic (for, eg, Fadd and Tnfsf9) and inflammatory (for, eg, interleukin 1, tumor necrosis factor α, chemokines, and cell adhesion molecules) pathways and showed marked protection of both white and gray brain matter. IDR-1018 suppresses proinflammatory mediators and cell injurious mechanisms in the developing brain, and postinsult treatment is efficacious in reducing LPS-induced hypoxic-ischemic brain damage. IDR-1018 is effective in the brain when given systemically, confers neuroprotection of both gray and white matter, and lacks significant effects on the brain under normal conditions. Thus, this peptide provides the features of a promising neuroprotective agent in newborns with brain injury. © 2014 Child Neurology Society/American Neurological Association.

  2. The Gut Microbiota Mediates the Anti-Seizure Effects of the Ketogenic Diet.

    PubMed

    Olson, Christine A; Vuong, Helen E; Yano, Jessica M; Liang, Qingxing Y; Nusbaum, David J; Hsiao, Elaine Y

    2018-06-14

    The ketogenic diet (KD) is used to treat refractory epilepsy, but the mechanisms underlying its neuroprotective effects remain unclear. Here, we show that the gut microbiota is altered by the KD and required for protection against acute electrically induced seizures and spontaneous tonic-clonic seizures in two mouse models. Mice treated with antibiotics or reared germ free are resistant to KD-mediated seizure protection. Enrichment of, and gnotobiotic co-colonization with, KD-associated Akkermansia and Parabacteroides restores seizure protection. Moreover, transplantation of the KD gut microbiota and treatment with Akkermansia and Parabacteroides each confer seizure protection to mice fed a control diet. Alterations in colonic lumenal, serum, and hippocampal metabolomic profiles correlate with seizure protection, including reductions in systemic gamma-glutamylated amino acids and elevated hippocampal GABA/glutamate levels. Bacterial cross-feeding decreases gamma-glutamyltranspeptidase activity, and inhibiting gamma-glutamylation promotes seizure protection in vivo. Overall, this study reveals that the gut microbiota modulates host metabolism and seizure susceptibility in mice. Copyright © 2018 Elsevier Inc. All rights reserved.

  3. Protection against Chlamydia psittaci in mice conferred by Lyt-2+ T cells.

    PubMed Central

    Buzoni-Gatel, D; Guilloteau, L; Bernard, F; Bernard, S; Chardès, T; Rocca, A

    1992-01-01

    A murine model was used to study the respective roles of L3T4+ and Lyt-2+ T cells in protection against Chlamydia psittaci. Donor mice were intravenously (i.v.) infected with 1 x 10(5) plaque-forming units (PFU) per mice of live C. psittaci. One month after inoculation, splenic cells from donors were transferred into syngenic recipients (5 x 10(7) cells/mouse). As measured by splenic colonization on Day 6 after i.v. challenge (1 x 10(5) PFU/mouse), transfer with primed (untreated) cells conferred a 3 log protection in this model. In vitro treatment, before transfer, of splenic cells with anti-Lyt-2 monoclonal antibody (mAb) and complement, markedly impaired the protection in comparison with control mice transferred with primed untreated cells, whereas treatment with anti-L3T4 mAb did not reduce the transferred protection. Resistance to a reinfection with C. psittaci was also studied after selective in vivo depletion of L3T4+ and Lyt-2+ T cells. One month after primary infection, mice were treated with anti-L3T4 or anti-Lyt-2 mAb and challenged thereafter (i.v., 1 x 10(5) PFU). The splenic colonization on Day 6 after challenge demonstrated that treatment with anti-Lyt-2 mAb impaired resistance against a subsequent infection with C. psittaci. Treatment with anti-L3T4 mAb in vivo had no effect on protection, as previously described in vitro. The mechanisms by which Lyt-2+ T cells could participate in the elimination of bacteria were discussed. PMID:1427980

  4. Report on the 2015 US Environmental Protection Agency ...

    EPA Pesticide Factsheets

    Report The 2015 U.S. Environmental Protection Agency (EPA) International Decontamination Research and Development Conference brought together scientists, practitioners, and policymakers related to chemical, biological, and radiological (CBR) remediation.

  5. The Importance of Pace. Proceedings of the National Conference on Outdoor Leadership (Estes Park, Colorado, February 7-10, 2007)

    ERIC Educational Resources Information Center

    Phipps, Maurice, Ed.; Hayashi, Aya, Ed.

    2007-01-01

    The Wilderness Education Association (WEA) helps people enjoy and protect our nation's most precious resource: Our wilderness areas. The WEA has been training and certifying outdoor leaders around the world for nearly 30 years, teaching students safely and effectively to lead groups in the outdoors without harming the environment. In addition,…

  6. Education for Effective Resource Protection and Use. [Proceedings of the] National Conservation Education Association Conference (22nd, University of Florida, Gainesville, Florida, August 17-20, 1975)

    ERIC Educational Resources Information Center

    1975

    These proceedings present transcripts of the speeches relating environmental education to the forest products industry, health education, urban forestry, and natural history museums. Other speeches include the Florida model of environmental education, designing visual presentations, stress in natural and man-made environments, energetics, and…

  7. Improvements to the Sandia CTH Hydro-Code to Support Blast Analysis and Protective Design of Military Vehicles

    DTIC Science & Technology

    2014-04-15

    used for advertising or product endorsement purposes. 6.0 REFERENCES [1] McGlaun, J., Thompson, S. and Elrick, M. “CTH: A Three-Dimensional Shock-Wave...Validation of a Loading Model for Simulating Blast Mine Effects on Armoured Vehicles,” 7 th International LS-DYNA Users Conference, Detroit, MI 2002. [14

  8. Safe Environment Training: Effects on Catholic Schoolteachers' and Administrators' School Security and Satisfaction

    ERIC Educational Resources Information Center

    Teague, James Brian

    2013-01-01

    In 2002, in light of the sexual abuse crisis in the Catholic church, The United States Conference of Catholic Bishops established "The charter for the Protection of Children and Young People" that mandated safe environment training for clergy personnel, and volunteers working in the Catholic church. In this study, under the auspices of a…

  9. Dexamethasone protection from TNF-alpha-induced cell death in MCF-7 cells requires NF-kappaB and is independent from AKT.

    PubMed

    Machuca, Catalina; Mendoza-Milla, Criselda; Córdova, Emilio; Mejía, Salvador; Covarrubias, Luis; Ventura, José; Zentella, Alejandro

    2006-02-21

    The biochemical bases for hormone dependence in breast cancer have been recognized as an important element in tumor resistance, proliferation and metastasis. On this respect, dexamethasone (Dex) dependent protection against TNF-alpha-mediated cell death in the MCF-7 cell line has been demonstrated to be a useful model for the study of this type of cancer. Recently, cytoplasmic signaling induced by steroid receptors has been described, such as the activation of the PI3K/Akt and NF-kappaB pathways. We evaluated their possible participation in the Dex-dependent protection against TNF-alpha-mediated cell death. Cellular cultures of the MCF-7 cell line were exposed to either, TNF-alpha or TNF-alpha and Dex, and cell viability was evaluated. Next, negative dominants of PI3K and IkappaB-alpha, designed to block the PI3K/Akt and NF-kappaB pathways, respectively, were transfected and selection and evaluation of several clones overexpressing the mutants were examined. Also, correlation with inhibitor of apoptosis proteins (IAPs) expression was examined. Independent inhibition of these two pathways allowed us to test their participation in Dex-dependent protection against TNF-alpha-cytotoxicity in MCF-7 cells. Expression of the PI3K dominant negative mutant did not alter the protection conferred by Dex against TNF-alpha mediated cell death. Contrariwise, clones expressing the IkappaB-alpha dominant negative mutant lost the Dex-conferred protection against TNF-alpha. In these clones degradation of c-IAP was accelerated, while that of XIAP was remained unaffected. NF-kappaB, but not PI3K/Akt activation, is required for the Dex protective effect against TNF-alpha-mediated cell death, and correlates with lack of degradation of the anti-apoptotic protein c-IAP1.

  10. Proceedings, 8th Central Hardwood Forest Conference

    Treesearch

    Larry H. McCormick; Kurt W., eds. Gottschalk

    1991-01-01

    Two invited papers, forty-five volunteer papers, and twenty volunteer poster summaries presented at the 8th Central Hardwood Forest Conference. Presentations were on economics, forest amenities, harvesting, utilization, physiology, genetics, ecology, regeneration, silviculture, protection, management, hydrology, soils, nutrient cycling, and hardwood markets of central...

  11. Electronic Warfare / Electronic Protection (EW/EP) S&T Priority Steering Council

    DTIC Science & Technology

    2011-11-08

    Office Office of the Assistant Secretary of Defense (Research and Engineering) NDIA 8th Annual Disruptive Technologies Conference 8 November 2011...the NDIA Disruptive Technologies Conference, November 8, 2011 Washington, DC 14. ABSTRACT 15. SUBJECT TERMS 16. SECURITY CLASSIFICATION OF: 17

  12. 76 FR 11473 - Notice of Agreements Filed

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-02

    ...)-523-5793 or [email protected] . Agreement No.: 011346-022. Title: Israel Carrier Association... Shipping Services, Ltd. Filing Party: Howard A. Levy, Esq.; Chairman; Israel Trade Conference; 80 Wall... Agreement from a conference to a service contract with Israel's Ministry of Defense, changes the Agreement's...

  13. Managing protected areas under climate change: challenges and priorities.

    PubMed

    Rannow, Sven; Macgregor, Nicholas A; Albrecht, Juliane; Crick, Humphrey Q P; Förster, Michael; Heiland, Stefan; Janauer, Georg; Morecroft, Mike D; Neubert, Marco; Sarbu, Anca; Sienkiewicz, Jadwiga

    2014-10-01

    The implementation of adaptation actions in local conservation management is a new and complex task with multiple facets, influenced by factors differing from site to site. A transdisciplinary perspective is therefore required to identify and implement effective solutions. To address this, the International Conference on Managing Protected Areas under Climate Change brought together international scientists, conservation managers, and decision-makers to discuss current experiences with local adaptation of conservation management. This paper summarizes the main issues for implementing adaptation that emerged from the conference. These include a series of conclusions and recommendations on monitoring, sensitivity assessment, current and future management practices, and legal and policy aspects. A range of spatial and temporal scales must be considered in the implementation of climate-adapted management. The adaptation process must be area-specific and consider the ecosystem and the social and economic conditions within and beyond protected area boundaries. However, a strategic overview is also needed: management at each site should be informed by conservation priorities and likely impacts of climate change at regional or even wider scales. Acting across these levels will be a long and continuous process, requiring coordination with actors outside the "traditional" conservation sector. To achieve this, a range of research, communication, and policy/legal actions is required. We identify a series of important actions that need to be taken at different scales to enable managers of protected sites to adapt successfully to a changing climate.

  14. A Promising Listeria-Vectored Vaccine Induces Th1-Type Immune Responses and Confers Protection Against Tuberculosis.

    PubMed

    Yin, Yuelan; Lian, Kai; Zhao, Dan; Tao, Chengwu; Chen, Xiang; Tan, Weijun; Wang, Xiaobo; Xu, Zhengzhong; Hu, Maozhi; Rao, Yan; Zhou, Xiaohui; Pan, Zhiming; Zhang, Xiaoming; Jiao, Xin'an

    2017-01-01

    Deaths associated with tuberculosis (TB) is rising and accounted for 1.4 million deaths in 2015 many of which were due to drug-resistant bacteria. Vaccines represent an important medical intervention, but the current Bacilli Calmette-Guerin (BCG) vaccine is not ideal for the protection of teenagers and adults. Therefore, a safe and effective vaccine is urgently needed. In this study, we designed a novel vaccine using an attenuated Listeria monocytogenes strain carrying fusion antigen FbpB-ESAT-6 (rLM) and characterized its safety and protective efficacy against Mycobacterium tuberculosis ( M.tb ) infection in mice. Compared to the wild type strain yzuLM4 and parental strain LMΔ actA/plcB (LM1-2), the virulence of rLM was significantly reduced as judged by its infectious kinetics and LD 50 dose. Further characterization of intravenous immunization showed that prime-boost vaccination significantly increased the levels of Th1 cytokines (IFN-γ, IL-17, and IL-6), and enhanced cytotoxic T lymphocyte (CTL) CTLs activity, suggesting that rLM could elicit potent Th1/Th17 responses. More importantly, rLM significantly conferred the protection against M.tb H37Rv challenge. Collectively, our findings indicated that rLM is a novel and useful tool to prevent M.tb infection, and can be potentially be used to boost BCG-primed immunity.

  15. Threats, protests greet conference.

    PubMed

    Struck, D

    1994-09-04

    In preparation for the 1994 International Conference on Population and Development, Egypt has deployed 14,000 police to protect participants from threatened violence. The Vatican has joined forces with Muslim fundamentalists to condemn the conference as a vehicle for imposing Western ideals, particularly abortion, on Third world countries. In addition, the opposition is raising the specter of a descent of homosexuals onto Cairo and Muslim fundamentalists have threatened to murder Western representatives. A suit filed by Islamic lawyers, aimed at stopping the conference, failed. Sudan and Saudi Arabia plan to boycott the conference, and it remains uncertain whether Libya will be represented. Conference organizers have not been deterred by the threats and note that the controversy has drawn public attention to the central issues under debate.

  16. Influenza Virus-Like Particles Containing M2 Induce Broadly Cross Protective Immunity

    PubMed Central

    Song, Jae-Min; Wang, Bao-Zhong; Park, Kyoung-Mi; Van Rooijen, Nico; Quan, Fu-Shi; Kim, Min-Chul; Jin, Hyun-Tak; Pekosz, Andrew; Compans, Richard W.; Kang, Sang-Moo

    2011-01-01

    Background Current influenza vaccines based on the hemagglutinin protein are strain specific and do not provide good protection against drifted viruses or emergence of new pandemic strains. An influenza vaccine that can confer cross-protection against antigenically different influenza A strains is highly desirable for improving public health. Methodology/Principal Findings To develop a cross protective vaccine, we generated influenza virus-like particles containing the highly conserved M2 protein in a membrane-anchored form (M2 VLPs), and investigated their immunogenicity and breadth of cross protection. Immunization of mice with M2 VLPs induced anti-M2 antibodies binding to virions of various strains, M2 specific T cell responses, and conferred long-lasting cross protection against heterologous and heterosubtypic influenza viruses. M2 immune sera were found to play an important role in providing cross protection against heterosubtypic virus and an antigenically distinct 2009 pandemic H1N1 virus, and depletion of dendritic and macrophage cells abolished this cross protection, providing new insight into cross-protective immune mechanisms. Conclusions/Significance These results suggest that presenting M2 on VLPs in a membrane-anchored form is a promising approach for developing broadly cross protective influenza vaccines. PMID:21267073

  17. Pertussis Maternal Immunization: Narrowing the Knowledge Gaps on the Duration of Transferred Protective Immunity and on Vaccination Frequency

    PubMed Central

    Gaillard, María Emilia; Bottero, Daniela; Zurita, María Eugenia; Carriquiriborde, Francisco; Martin Aispuro, Pablo; Bartel, Erika; Sabater-Martínez, David; Bravo, María Sol; Castuma, Celina; Hozbor, Daniela Flavia

    2017-01-01

    Maternal safety through pertussis vaccination and subsequent maternal–fetal-antibody transfer are well documented, but information on infant protection from pertussis by such antibodies and by subsequent vaccinations is scarce. Since mice are used extensively for maternal-vaccination studies, we adopted that model to narrow those gaps in our understanding of maternal pertussis immunization. Accordingly, we vaccinated female mice with commercial acellular pertussis (aP) vaccine and measured offspring protection against Bordetella pertussis challenge and specific-antibody levels with or without revaccination. Maternal immunization protected the offspring against pertussis, with that immune protection transferred to the offspring lasting for several weeks, as evidenced by a reduction (4–5 logs, p < 0.001) in the colony-forming-units recovered from the lungs of 16-week-old offspring. Moreover, maternal-vaccination-acquired immunity from the first pregnancy still conferred protection to offspring up to the fourth pregnancy. Under the conditions of our experimental protocol, protection to offspring from the aP-induced immunity is transferred both transplacentally and through breastfeeding. Adoptive-transfer experiments demonstrated that transferred antibodies were more responsible for the protection detected in offspring than transferred whole spleen cells. In contrast to reported findings, the protection transferred was not lost after the vaccination of infant mice with the same or other vaccine preparations, and conversely, the immunity transferred from mothers did not interfere with the protection conferred by infant vaccination with the same or different vaccines. These results indicated that aP-vaccine immunization of pregnant female mice conferred protective immunity that is transferred both transplacentally and via offspring breastfeeding without compromising the protection boostered by subsequent infant vaccination. These results—though admittedly not necessarily immediately extrapolatable to humans—nevertheless enabled us to test hypotheses under controlled conditions through detailed sampling and data collection. These findings will hopefully refine hypotheses that can then be validated in subsequent human studies. PMID:28932228

  18. Mycobacterium tuberculosis multistage antigens confer comprehensive protection against pre- and post-exposure infections by driving Th1-type T cell immunity

    PubMed Central

    Fan, Xionglin; Yu, Qi; Jing, Yukai; Wang, Weihua; Li, Li; Zhou, Zijie

    2016-01-01

    There is an urgent need for a vaccine against tuberculosis (TB) that is more effective than the current sole licensed option. However, target antigens of Mycobacterium tuberculosis with the vaccine potential remain elusive. Five immunodominant antigens with characteristic expressions at the stages of primary infection (Ag85A), the regulation of nutrition and metabolism when transferring from rapid growth to latency (PhoY2 and Rv3407), latency (Rv2626c), and reactivation (RpfB) were selected to construct the fusion polyprotein WH121, which has better immunogenicity and protection than each multistage antigen. DMT adjuvanted WH121 vaccinated C57BL/6 mice could confer persistent and significant protection against the respiratory challenge with 80 CFU of virulent M. tuberculosis H37Rv at 9 and 18 weeks after immunization, as the BCG vaccine did. Moreover, WH121/DMT could boost the BCG primed mice against post-exposure infection, and more significantly inhibit the growth of M. tuberculosis in the spleen than BCG repeat vaccination. The protection elicited by WH121/DMT is attributed to the WH121-specific Th1-type biased immune responses, characterized by increased antigen-specific IgG2a/IgG1 ratio and high levels of IFN-γ secreted by the splenocytes of vaccinated mice. In particular, high levels of IFN-γ+ TEM cells in the spleen are an effective biomarker for the vaccine-induced early protection, and the persistent protection mainly depends on the increasing IL-2+IFN-γ+CD4+ and CD8+ T cells, especially IL-2+ TCM cells. These findings demonstrate that multistage-specific antigens might be promising targets for the next generation TB vaccine, and a combination of these antigens such as WH121/DMT is required for further preclinical evaluation. PMID:27566581

  19. Changes in Rates of Shore Retreat, Lake Michigan, 1967-1976.

    DTIC Science & Technology

    1979-12-01

    D.C., Apr. 1946. BERG, D.W., "Factors Affecting Beach Nourishment at Presque Isle Peninsula, Erie , Pennsylvania ," Proceedings of the Ninth Conference on...concern the behavior of beach fill at Presque Isle Peninsula on Lake Erie . Guidelines for moni- toring the effect of shore protection works in the Great...NTIS AD 631 520). BERG, D.W., and DUANE, D.B., "Effects of Particle Size and Distribution on Stability of Artificially Filled Beach, Presque Isle

  20. Biological mechanisms underlying the role of physical fitness in health and resilience

    PubMed Central

    Silverman, Marni N.; Deuster, Patricia A.

    2014-01-01

    Physical fitness, achieved through regular exercise and/or spontaneous physical activity, confers resilience by inducing positive psychological and physiological benefits, blunting stress reactivity, protecting against potentially adverse behavioural and metabolic consequences of stressful events and preventing many chronic diseases. In this review, we discuss the biological mechanisms underlying the beneficial effects of physical fitness on mental and physical health. Physical fitness appears to buffer against stress-related disease owing to its blunting/optimizing effects on hormonal stress responsive systems, such as the hypothalamic–pituitary–adrenal axis and the sympathetic nervous system. This blunting appears to contribute to reduced emotional, physiological and metabolic reactivity as well as increased positive mood and well-being. Another mechanism whereby regular exercise and/or physical fitness may confer resilience is through minimizing excessive inflammation. Chronic psychological stress, physical inactivity and abdominal adiposity have been associated with persistent, systemic, low-grade inflammation and exert adverse effects on mental and physical health. The anti-inflammatory effects of regular exercise/activity can promote behavioural and metabolic resilience, and protect against various chronic diseases associated with systemic inflammation. Moreover, exercise may benefit the brain by enhancing growth factor expression and neural plasticity, thereby contributing to improved mood and cognition. In summary, the mechanisms whereby physical fitness promotes increased resilience and well-being and positive psychological and physical health are diverse and complex. PMID:25285199

  1. Biological mechanisms underlying the role of physical fitness in health and resilience.

    PubMed

    Silverman, Marni N; Deuster, Patricia A

    2014-10-06

    Physical fitness, achieved through regular exercise and/or spontaneous physical activity, confers resilience by inducing positive psychological and physiological benefits, blunting stress reactivity, protecting against potentially adverse behavioural and metabolic consequences of stressful events and preventing many chronic diseases. In this review, we discuss the biological mechanisms underlying the beneficial effects of physical fitness on mental and physical health. Physical fitness appears to buffer against stress-related disease owing to its blunting/optimizing effects on hormonal stress responsive systems, such as the hypothalamic-pituitary-adrenal axis and the sympathetic nervous system. This blunting appears to contribute to reduced emotional, physiological and metabolic reactivity as well as increased positive mood and well-being. Another mechanism whereby regular exercise and/or physical fitness may confer resilience is through minimizing excessive inflammation. Chronic psychological stress, physical inactivity and abdominal adiposity have been associated with persistent, systemic, low-grade inflammation and exert adverse effects on mental and physical health. The anti-inflammatory effects of regular exercise/activity can promote behavioural and metabolic resilience, and protect against various chronic diseases associated with systemic inflammation. Moreover, exercise may benefit the brain by enhancing growth factor expression and neural plasticity, thereby contributing to improved mood and cognition. In summary, the mechanisms whereby physical fitness promotes increased resilience and well-being and positive psychological and physical health are diverse and complex.

  2. Neutralizing activity and protective immunity to ricin toxin conferred by B subunit (RTB)-specific Fab fragments.

    PubMed

    Yermakova, Anastasiya; Mantis, Nicholas J

    2013-09-01

    SylH3 and 24B11 are murine monoclonal antibodies directed against different epitopes on ricin toxin's binding (RTB) subunit that have been shown to passively protect mice against ricin challenge. Here we report that Fab fragments of SylH3 and 24B11 neutralize ricin in a cell based assay, and in a mouse challenge model as effectively as their respective full length parental IgGs. These data demonstrate that immunity to ricin can occur independent of Fc-mediated clearance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. Consumer Problems of Older Americans. New Directions for Government and Business. Background Papers and Recommendations from a Mini-Conference for the White House Conference on Aging (Washington, DC, January 29-30, 1980).

    ERIC Educational Resources Information Center

    National Retired Teachers Association, Washington, DC.

    These background papers and recommendations from a mini-conference on the consumer problems of older Americans and new directions that government and business should take to protect the consumer rights of the elderly address the following areas: credit, food, insurance, investments, prescription drugs and medical appliances, and primary health…

  4. Proceedings, 9th Central hardwood forest conference; 1993 March 8-10; West Lafayette, IN.

    Treesearch

    Andrew R. Gillespie; George R. Parker; Phillip E. Pope; George Rink

    1993-01-01

    Proceedings of the Ninth Central Hardwood Forest Conference includes one invited paper, 39 volunteer papers, and 13 volunteer poster abstracts. Presentations encompassed forest biology, protection, silviculture, ecology, inventory, yield, economics, marketing, wildlife management, soils, and nutrition of the central hardwood forests.

  5. 75 FR 12252 - Conference Call Meeting of the Manufactured Housing Consensus Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-15

    ... DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT [Docket No. FR-5406-N-01] Conference Call Meeting of...'s Consensus Committee Administering Organization, the National Fire Protection Association (NFPA... Housing Consensus Committee and the Administering Organization. The link can be found at: http://www.nfpa...

  6. 76 FR 2109 - Next Generation Risk Assessment Public Dialogue Conference

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-01-12

    ... ENVIRONMENTAL PROTECTION AGENCY [FRL-9246-7] Next Generation Risk Assessment Public Dialogue Conference Correction In notice document 2010-32977 appearing on page 82387 in the issue of Thursday, December 30, 2010, make the following correction: In the second column, below the signature date, the...

  7. IEEE 1990 International Symposium on Electromagnetic Compatibility, Washington, DC, Aug. 21-23, 1990, Record

    NASA Astrophysics Data System (ADS)

    The present conference discusses topics in EM shielding effectiveness, system-level EMC, EMP effects, circuit-level EMI testing, EMI control, analysis techniques for system-level EMC, EMP protective measures, EMI test methods, electrostatic-discharge testing, printed circuit-board design for EMC, and EM environment effects. Also discussed are EMI measurement procedures, EM spectrum-management issues for the 21st century, antenna and propagation effects on EMI testing, EMI control in cables, socioeconomic aspects of EMC, systemwide EMI controls, and EM radiation and coupling.

  8. MONTHLY HIGHLIGHTS (SUBSURFACE PROTECTION AND REMEDIATION DIVISION)

    EPA Science Inventory

    The Subsurface Protection and Remediation Division (SPRD) produces monthly highlights describing research accomplishments, involvement in current technical assistance activities, and staff participation in scientific meetings and conferences. Announcements of the release and avai...

  9. The host defense peptide beta-defensin 1 confers protection against Bordetella pertussis in newborn piglets.

    PubMed

    Elahi, Shokrollah; Buchanan, Rachelle M; Attah-Poku, Sam; Townsend, Hugh G G; Babiuk, Lorne A; Gerdts, Volker

    2006-04-01

    Innate immunity plays an important role in protection against respiratory infections in humans and animals. Host defense peptides such as beta-defensins represent major components of innate immunity. We recently developed a novel porcine model of pertussis, an important respiratory disease of young children and infants worldwide. Here, we investigated the role of porcine beta-defensin 1 (pBD-1), a porcine defensin homologue of human beta-defensin 2, in conferring protection against respiratory infection with Bordetella pertussis. In this model, newborn piglets were fully susceptible to infection and developed severe bronchopneumonia. In contrast, piglets older than 4 weeks of age were protected against infection with B. pertussis. Protection was associated with the expression of pBD-1 in the upper respiratory tract. In fact, pBD-1 expression was developmentally regulated, and the absence of pBD-1 was thought to contribute to the increased susceptibility of newborn piglets to infection with B. pertussis. Bronchoalveolar lavage specimens collected from older animals as well as chemically synthesized pBD-1 displayed strong antimicrobial activity against B. pertussis in vitro. Furthermore, in vivo treatment of newborn piglets with only 500 mug pBD-1 at the time of challenge conferred protection against infection with B. pertussis. Interestingly, pBD-1 displayed no bactericidal activity in vitro against Bordetella bronchiseptica, a closely related natural pathogen of pigs. Our results demonstrate that host defense peptides play an important role in protection against pertussis and are essential in modulating innate immune responses against respiratory infections.

  10. Cell-wall preparation containing poly-γ-D-glutamate covalently linked to peptidoglycan, a straightforward extractable molecule, protects mice against experimental anthrax infection.

    PubMed

    Candela, Thomas; Dumetz, Fabien; Tosi-Couture, Evelyne; Mock, Michèle; Goossens, Pierre L; Fouet, Agnès

    2012-12-17

    Bacillus anthracis is the causative agent of anthrax that is characterized by septicemia and toxemia. Many vaccine strategies were described to counteract anthrax infection. In contrast with veterinary live vaccines, currently human vaccines are acellular with the protective antigen, a toxin component, as the main constituent. However, in animal models this vaccine is less efficient than the live vaccine. In this study, we analyzed the protection afforded by a single extractable surface element. The poly-γ-D-glutamate capsule is covalently linked to the peptidoglycan. A preparation of peptidoglycan-linked poly-γ-D-glutamate (GluPG) was tested for its immunogenicity and its protective effect. GluPG injection, in mice, elicited the production of specific antibodies directed against poly-glutamate and partially protected the animals against lethal challenges with a non-toxinogenic strain. When combined to protective antigen, GluPG immunization conferred full protection against cutaneous anthrax induced with a fully virulent strain. Copyright © 2012 Elsevier Ltd. All rights reserved.

  11. Neutrophils Are Central to Antibody-Mediated Protection against Genital Chlamydia.

    PubMed

    Naglak, Elizabeth K; Morrison, Sandra G; Morrison, Richard P

    2017-10-01

    Determining the effector populations involved in humoral protection against genital chlamydia infection is crucial to development of an effective chlamydial vaccine. Antibody has been implicated in protection studies in multiple animal models, and we previously showed that the passive transfer of immune serum alone does not confer immunity in the mouse. Using the Chlamydia muridarum model of genital infection, we demonstrate a protective role for both Chlamydia -specific immunoglobulin G (IgG) and polymorphonuclear neutrophils and show the importance of an antibody/effector cell interaction in mediating humoral immunity. While neutrophils were found to contribute significantly to antibody-mediated protection in vivo , natural killer (NK) cells were dispensable for protective immunity. Furthermore, gamma interferon (IFN-γ)-stimulated primary peritoneal neutrophils (PPNs) killed chlamydiae in vitro in an antibody-dependent manner. The results from this study support the view that an IFN-γ-activated effector cell population cooperates with antibody to protect against genital chlamydia and establish neutrophils as a key effector cell in this response. Copyright © 2017 Naglak et al.

  12. The green vaccine: A global strategy to combat infectious and autoimmune diseases

    PubMed Central

    Davoodi-Semiromi, Abdoreza; Samson, Nalapalli; Daniell, Henry

    2009-01-01

    Plant derived oral green vaccines eliminate expenses associated with fermenters, purification, cold storage/transportation and sterile delivery. Green vaccines are expressed via the plant nuclear or chloroplast genomes. Chloroplast expression has advantages of hyper-expression of therapeutic proteins (10,000 copies of trans-gene per cell), efficient oral delivery and transgene containment via maternal inheritance. To date, 23 vaccine antigens against 16 different bacterial, viral or protozoan pathogens have been expressed in chloroplasts. Mice subcutaneously immunized with the chloroplast derived anthrax protective antigen conferred 100% protection against lethal doses of the anthrax toxin. Oral immunization (ORV) of F1-V antigens without adjuvant conferred greater protection (88%) against 50-fold lethal dose of aerosolized plague (Yersinia pestis) than subcutaneous (SQV) immunization (33%). Oral immunization of malarial vaccine antigens fused to the cholera antigen (CTB-AMA1/CTB-Msp1) conferred prolonged immunity (50% life span), 100% protection against cholera toxin challenge and inhibited proliferation of the malarial parasite. Protection was correlated with antigen-specific titers of intestinal, serum IgA & IgG1 in ORV and only IgG1 in SQV mice, but no other immunoglobulin. High level expression in edible plant chloroplasts ideal for oral delivery and long-term immunity observed should facilitate development of low cost human vaccines for large populations, at times of outbreak. PMID:19430198

  13. Passive Immunization with a Polyclonal Antiserum to the Hemoglobin Receptor of Haemophilus ducreyi Confers Protection against a Homologous Challenge in the Experimental Swine Model of Chancroid▿

    PubMed Central

    Leduc, Isabelle; Fusco, William G.; Choudhary, Neelima; Routh, Patty A.; Cholon, Deborah M.; Hobbs, Marcia M.; Almond, Glen W.; Orndorff, Paul E.; Elkins, Christopher

    2011-01-01

    Haemophilus ducreyi, the etiologic agent of chancroid, has an obligate requirement for heme. Heme is acquired by H. ducreyi from its human host via TonB-dependent transporters expressed at its bacterial surface. Of 3 TonB-dependent transporters encoded in the genome of H. ducreyi, only the hemoglobin receptor, HgbA, is required to establish infection during the early stages of the experimental human model of chancroid. Active immunization with a native preparation of HgbA (nHgbA) confers complete protection in the experimental swine model of chancroid, using either Freund's or monophosphoryl lipid A as adjuvants. To determine if transfer of anti-nHgbA serum is sufficient to confer protection, a passive immunization experiment using pooled nHgbA antiserum was conducted in the experimental swine model of chancroid. Pigs receiving this pooled nHgbA antiserum were protected from a homologous, but not a heterologous, challenge. Passively transferred polyclonal antibodies elicited to nHgbA bound the surface of H. ducreyi and partially blocked hemoglobin binding by nHgbA, but were not bactericidal. Taken together, these data suggest that the humoral immune response to the HgbA vaccine is protective against an H. ducreyi infection, possibly by preventing acquisition of the essential nutrient heme. PMID:21646451

  14. Passive immunization with a polyclonal antiserum to the hemoglobin receptor of Haemophilus ducreyi confers protection against a homologous challenge in the experimental swine model of chancroid.

    PubMed

    Leduc, Isabelle; Fusco, William G; Choudhary, Neelima; Routh, Patty A; Cholon, Deborah M; Hobbs, Marcia M; Almond, Glen W; Orndorff, Paul E; Elkins, Christopher

    2011-08-01

    Haemophilus ducreyi, the etiologic agent of chancroid, has an obligate requirement for heme. Heme is acquired by H. ducreyi from its human host via TonB-dependent transporters expressed at its bacterial surface. Of 3 TonB-dependent transporters encoded in the genome of H. ducreyi, only the hemoglobin receptor, HgbA, is required to establish infection during the early stages of the experimental human model of chancroid. Active immunization with a native preparation of HgbA (nHgbA) confers complete protection in the experimental swine model of chancroid, using either Freund's or monophosphoryl lipid A as adjuvants. To determine if transfer of anti-nHgbA serum is sufficient to confer protection, a passive immunization experiment using pooled nHgbA antiserum was conducted in the experimental swine model of chancroid. Pigs receiving this pooled nHgbA antiserum were protected from a homologous, but not a heterologous, challenge. Passively transferred polyclonal antibodies elicited to nHgbA bound the surface of H. ducreyi and partially blocked hemoglobin binding by nHgbA, but were not bactericidal. Taken together, these data suggest that the humoral immune response to the HgbA vaccine is protective against an H. ducreyi infection, possibly by preventing acquisition of the essential nutrient heme.

  15. Immunological Effects of Probiotics and their Significance to Human Health

    NASA Astrophysics Data System (ADS)

    Gill, Harsharn S.; Grover, Sunita; Batish, Virender K.; Gill, Preet

    Probiotics are defined as live microorganisms which when administered in adequate amounts confer a health benefit upon the host (FAO/WHO, 2001). Lactic acid bacteria, particularly Lactobacillus and Bifidobacterium species are commonly used as probiotics. Other less commonly used probiotics include the yeast Sacchromyces cerevisiae and some non-pathogenic Escherichia coli and Bacillus species. Studies over the past 20 years have demonstrated that probiotic intake is able to confer a range of health benefits including modulation of the immune system, protection against gastrointestinal and respiratory tract infections, lowering of blood cholesterol levels, attenuation of overt immuno-inflammatory disorders (such as inflammatory bowel disease, allergies) and anti-cancer effects. However, the strongest clinical evidence for probiotics relates to their effectiveness in improving gut health and modulating (via stimulation or regulation) the host immune system. This chapter provides an overview of the current status of our knowledge regarding the immunostimulatory and immunoregulatory effects of probiotics on the immune system and their significance to human health.

  16. Fifteenth Space Simulation Conference: Support the Highway to Space Through Testing

    NASA Technical Reports Server (NTRS)

    Stecher, Joseph (Editor)

    1988-01-01

    The Institute of Environmental Sciences Fifteenth Space Simulation Conference, Support the Highway to Space Through Testing, provided participants a forum to acquire and exchange information on the state-of-the-art in space simulation, test technology, thermal simulation and protection, contamination, and techniques of test measurements.

  17. 78 FR 29318 - Notice of Public Meeting of the Assembly of the Administrative Conference of the United States

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-05-20

    ...: articulation of questions to be informed by science information; attribution for agency personnel who... FURTHER INFORMATION CONTACT: Shawne McGibbon, General Counsel (Designated Federal Officer), Administrative...-480-2088; email [email protected] . SUPPLEMENTARY INFORMATION: The Administrative Conference of the...

  18. Fourteenth Space Simulation Conference: Testing for a Permanent Presence in Space

    NASA Technical Reports Server (NTRS)

    Stecher, Joseph L., III (Editor)

    1986-01-01

    The Institute of Environmental Sciences Fourteenth Space Simulation Conference, Testing for a Permanent Presence in Space, provided participants a forum to acquire and exchange information on the state-of-the-art in space simulation, test technology, thermal simulation, and protection, contamination, and techniques of test measurements.

  19. Proceedings: North American forest insect work conference.

    Treesearch

    D.C. Allen; L.P. Abrahamson

    1992-01-01

    A proceedings of a conference held to stimulate interaction among people working in areas of forest protection and silviculture and on issues of national and international concern relative to forest insect and disease management, education, and research. National issues addressed were forest productivity, stewardship, biological diversity, and new perspectives and how...

  20. 76 FR 38409 - Conference Call Meeting of the Manufactured Housing Consensus Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-06-30

    ... DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT [Docket No. FR-5496-N-03] Conference Call Meeting of... Committee Administering Organization, the National Fire Protection Association (NFPA). Interested parties... Committee and the Administering Organization. The link can be found at: http://www.nfpa.org/categoryList.asp...

  1. The 68th Session of the International Labour Conference, June 1982.

    ERIC Educational Resources Information Center

    International Labour Review, 1982

    1982-01-01

    This year's session adopted new standards such as maintenance of migrant workers' social security rights, protection of workers against unjustified dismissal, and vocational rehabilitation. This article describes the conference's examination of these technical agenda items, and its annual review of the application of Conventions and…

  2. 78 FR 34035 - Forest Resource Coordinating Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-06-06

    ... morning of each conference call. Written comments may be submited by mail to Attn: Maya Solomon, 1400... Maya Solomon via phone at 202-205-1376 or via email at [email protected] prior to the conference call to facilitate distribution of support materials. FOR FURTHER INFORMATION CONTACT: Maya Solomon...

  3. 2008 Tactical Wheeled Vehicles Conference (TWV) Volume 1

    DTIC Science & Technology

    2008-02-05

    additional LSAC cabs FMTV Gunners Restraint (2,022 LSAC; 1,855 RACK) Counterweight bumper for M1078 Cargo with LSAC Cab and GPK 3 Jan 08NDIA TWV Conference...Objective Gunner Protection Kits to support Up-Armored HMMWV’s GPK Upgrade Program. Partnerships: Ensured partnerships with commercial manufacturers

  4. FORUM ON INNOVATIVE HAZARDOUS WASTE TREATMENT TECHNOLOGIES: DOMESTIC AND INTERNATIONAL. Third, Dallas, Texas, June 11-13, 1991 - TECHNICAL PAPERS

    EPA Science Inventory

    On June 11 -13,1991, the U.S. Environmental Protection Agency's Technology Innovation Office and Risk Reduction Engineering Laboratory hosted an international conference in Dallas, TX, to exchange solutions to hazardous waste treatment problems. This conference, the Third Forum...

  5. Turning Purpose into Action. Wilderness Education Association Proceedings of the National Conference on Outdoor Leadership (Martinsville, Indiana, February 15-19, 2006)

    ERIC Educational Resources Information Center

    Phipps, Maurice, Ed.; Hayashi, Aya, Ed.

    2006-01-01

    The Wilderness Education Association (WEA) helps people enjoy and protect our nation's most precious resource: Our wilderness areas. They have been training and certifying outdoor leaders around the world for nearly 30 years, teaching students safely and effectively to lead groups in the outdoors without harming the environment. In addition,…

  6. China’s International Behavior. Activism, Opportunism, and Diversification

    DTIC Science & Technology

    2009-01-01

    military, science and technology, culture, education, and tourism . In the words of reports from the high- level 2006 Central Conference on Foreign...services took effect in July 2007 and covers construction, environmental protection, tourism , transportation, and education. Talks on investment and...legitimacy and gover - nance practices are not a priority for China in its bilateral relations.163 Such issues become relevant to Chinese leaders and

  7. Theory-Based Analysis of Interest in an HIV Vaccine for Reasons Indicative of Risk Compensation among African American Women

    ERIC Educational Resources Information Center

    Painter, Julia E.; Temple, Brandie S.; Woods, Laura A.; Cwiak, Carrie; Haddad, Lisa B.; Mulligan, Mark J.; DiClemente, Ralph J.

    2018-01-01

    Licensure of an HIV vaccine could reduce or eliminate HIV among vulnerable populations. However, vaccine effectiveness could be undermined by risk compensation (RC), defined by an increase in risky behavior due to a belief that the vaccine will confer protection. Interest in an HIV vaccine for reasons indicative of RC may serve as an indicator of…

  8. Consumer Protection in Postsecondary Education: A National Invitational Conference. Program Handbook.

    ERIC Educational Resources Information Center

    Albanese, Frank N.; And Others

    Twelve preconference papers and background articles that identify issues in consumer protection in postsecondary education are presented. The papers and articles include "Recruitment Practices of Postsecondary Schools" (Frank N. Albanese); "The Role of a State Agency in Consumer Protection" (Philip F. Ashler); "The Three R's of Postsecondary…

  9. Protective Predictors of Alcohol Use Trajectories among Canadian Aboriginal Youth

    ERIC Educational Resources Information Center

    Rawana, Jennine S.; Ames, Megan E.

    2012-01-01

    Some Aboriginal youth are at disproportionate risk of using substances and developing abuse and dependence disorders. However, not all Aboriginal youth misuse substances and limited research has examined the protective factors conferring against substance use among these youth. The present study aimed to identify protective factors related to the…

  10. Development of a broadly protective modified-live virus vaccine candidate against porcine reproductive and respiratory syndrome virus

    USDA-ARS?s Scientific Manuscript database

    Modified-live virus (MLV) vaccines are widely used to protect pigs against porcine reproductive and respiratory syndrome virus (PRRSV). However, current MLV vaccines do not confer adequate levels of heterologous protection, presumably due to the substantial genetic diversity of PRRSV isolates circul...

  11. 40 CFR 304.24 - Intervention and withdrawal.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 27 2010-07-01 2010-07-01 false Intervention and withdrawal. 304.24 Section 304.24 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SUPERFUND, EMERGENCY... Intervention and withdrawal. (a)(1) No later than thirty days prior to the pre-hearing conference (see § 304.31...

  12. 40 CFR 304.24 - Intervention and withdrawal.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 28 2014-07-01 2014-07-01 false Intervention and withdrawal. 304.24 Section 304.24 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SUPERFUND, EMERGENCY... Intervention and withdrawal. (a)(1) No later than thirty days prior to the pre-hearing conference (see § 304.31...

  13. 40 CFR 304.24 - Intervention and withdrawal.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 29 2012-07-01 2012-07-01 false Intervention and withdrawal. 304.24 Section 304.24 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SUPERFUND, EMERGENCY... Intervention and withdrawal. (a)(1) No later than thirty days prior to the pre-hearing conference (see § 304.31...

  14. 40 CFR 304.24 - Intervention and withdrawal.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 28 2011-07-01 2011-07-01 false Intervention and withdrawal. 304.24 Section 304.24 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SUPERFUND, EMERGENCY... Intervention and withdrawal. (a)(1) No later than thirty days prior to the pre-hearing conference (see § 304.31...

  15. 40 CFR 304.24 - Intervention and withdrawal.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 29 2013-07-01 2013-07-01 false Intervention and withdrawal. 304.24 Section 304.24 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SUPERFUND, EMERGENCY... Intervention and withdrawal. (a)(1) No later than thirty days prior to the pre-hearing conference (see § 304.31...

  16. Endothelial mineralocorticoid receptor ablation does not alter blood pressure, kidney function or renal vessel contractility

    PubMed Central

    Laursen, Sidsel B.; Finsen, Stine; Marcussen, Niels; Quaggin, Susan E.

    2018-01-01

    Aldosterone blockade confers substantial cardiovascular and renal protection. The effects of aldosterone on mineralocorticoid receptors (MR) expressed in endothelial cells (EC) within the renal vasculature have not been delineated. We hypothesized that lack of MR in EC may be protective in renal vasculature and examined this by ablating the Nr3c2 gene in endothelial cells (EC-MR) in mice. Blood pressure, heart rate and PAH clearance were measured using indwelling catheters in conscious mice. The role of the MR in EC on contraction and relaxation was investigated in the renal artery and in perfused afferent arterioles. Urinary sodium excretion was determined by use of metabolic cages. EC-MR transgenics had markedly decreased MR expression in isolated aortic endothelial cells as compared to littermates (WT). Blood pressure and effective renal plasma flow at baseline and following AngII infusion was similar between groups. No differences in contraction and relaxation were observed between WT and EC-MR KO in isolated renal arteries during baseline or following 2 or 4 weeks of AngII infusion. The constriction or dilatations of afferent arterioles between genotypes were not different. No changes were found between the groups with respect to urinary excretion of sodium after 4 weeks of AngII infusion, or in urinary albumin excretion and kidney morphology. In conclusion, deletion of the EC-MR does not confer protection towards the development of hypertension, endothelial dysfunction of renal arteries or renal function following prolonged AngII-infusion. PMID:29466427

  17. Induction of complex immune responses and strong protection against retrovirus challenge by adenovirus-based immunization depends on the order of vaccine delivery.

    PubMed

    Kaulfuß, Meike; Wensing, Ina; Windmann, Sonja; Hrycak, Camilla Patrizia; Bayer, Wibke

    2017-02-06

    In the Friend retrovirus mouse model we developed potent adenovirus-based vaccines that were designed to induce either strong Friend virus GagL 85-93 -specific CD8 + T cell or antibody responses, respectively. To optimize the immunization outcome we evaluated vaccination strategies using combinations of these vaccines. While the vaccines on their own confer strong protection from a subsequent Friend virus challenge, the simple combination of the vaccines for the establishment of an optimized immunization protocol did not result in a further improvement of vaccine effectivity. We demonstrate that the co-immunization with GagL 85-93 /leader-gag encoding vectors together with envelope-encoding vectors abrogates the induction of GagL 85-93 -specific CD8 + T cells, and in successive immunization protocols the immunization with the GagL 85-93 /leader-gag encoding vector had to precede the immunization with an envelope encoding vector for the efficient induction of GagL 85-93 -specific CD8 + T cells. Importantly, the antibody response to envelope was in fact enhanced when the mice were adenovirus-experienced from a prior immunization, highlighting the expedience of this approach. To circumvent the immunosuppressive effect of envelope on immune responses to simultaneously or subsequently administered immunogens, we developed a two immunizations-based vaccination protocol that induces strong immune responses and confers robust protection of highly Friend virus-susceptible mice from a lethal Friend virus challenge.

  18. Protecting newborns against pertussis: the value of vaccinating during pregnancy.

    PubMed

    Vilajeliu, Alba; García-Basteiro, Alberto L; Bayas, José M

    2015-01-01

    Resurgence of pertussis has recently been reported in several countries with long-standing pertussis immunization and high vaccination coverage. This situation requires consideration of alternative immunization strategies to protect newborns. In the absence of a vaccine that confers long-lasting immunity, maternal vaccination for pertussis during pregnancy seems to be a safe, immunogenic, effective and accepted strategy to protect infants during the first weeks of life. The existing scientific evidence provides the grounds for pregnant women and healthcare workers to make informed decisions regarding this measure as well as for countries with high pertussis-related infant morbidity and mortality that should consider implementation. Furthermore, this could be a promising strategy to address other vaccine-preventable diseases of pregnancy and the neonatal period.

  19. Effect of wall material on the antioxidant activity and physicochemical properties of Rubus fruticosus juice microcapsules.

    PubMed

    Díaz, Dafne I; Beristain, Cesar I; Azuara, Ebner; Luna, Guadalupe; Jimenez, Maribel

    2015-01-01

    Blackberry (Rubus fruticosus) juice possesses compounds with antioxidant activity, which can be protected by different biopolymers used in the microencapsulation. Therefore, the effects of cell wall material including maltodextrin (MD), Arabic gum (GA) and whey protein concentrate (WPC) were evaluated on the physicochemical and antioxidant properties of encapsulated blackberries using a spray-drying technique. Anthocyanin concentration, polymeric colour, total polyphenols, radical scavenging activity of the 1,1-diphenyl-2-picrilhydrazil radical, reducing power and the stability at different storage conditions were evaluated. GA and MD conferred a similar protection to the antioxidant compounds when the microcapsules were stored at low water activities (aw < 0.515) in contrast to at a high moisture content (aw > 0.902), whereas WPC presented a high protection. Therefore, the selection of the best wall material for blackberry juice encapsulation depends of the conditions of storage of the powder.

  20. C-Phycocyanin Confers Protection against Oxalate-Mediated Oxidative Stress and Mitochondrial Dysfunctions in MDCK Cells

    PubMed Central

    Farooq, Shukkur M.; Boppana, Nithin B.; Asokan, Devarajan; Sekaran, Shamala D.; Shankar, Esaki M.; Li, Chunying; Gopal, Kaliappan; Bakar, Sazaly A.; Karthik, Harve S.; Ebrahim, Abdul S.

    2014-01-01

    Oxalate toxicity is mediated through generation of reactive oxygen species (ROS) via a process that is partly dependent on mitochondrial dysfunction. Here, we investigated whether C-phycocyanin (CP) could protect against oxidative stress-mediated intracellular damage triggered by oxalate in MDCK cells. DCFDA, a fluorescence-based probe and hexanoyl-lysine adduct (HEL), an oxidative stress marker were used to investigate the effect of CP on oxalate-induced ROS production and membrane lipid peroxidation (LPO). The role of CP against oxalate-induced oxidative stress was studied by the evaluation of mitochondrial membrane potential by JC1 fluorescein staining, quantification of ATP synthesis and stress-induced MAP kinases (JNK/SAPK and ERK1/2). Our results revealed that oxalate-induced cells show markedly increased ROS levels and HEL protein expression that were significantly decreased following pre-treatment with CP. Further, JC1 staining showed that CP pre-treatment conferred significant protection from mitochondrial membrane permeability and increased ATP production in CP-treated cells than oxalate-alone-treated cells. In addition, CP treated cells significantly decreased the expression of phosphorylated JNK/SAPK and ERK1/2 as compared to oxalate-alone-treated cells. We concluded that CP could be used as a potential free radical-scavenging therapeutic strategy against oxidative stress-associated diseases including urolithiasis. PMID:24691130

  1. Increased Antibody Affinity Confers Broad In Vitro Protection against Escape Mutants of Severe Acute Respiratory Syndrome Coronavirus

    PubMed Central

    Rani, Mridula; Bolles, Meagan; Donaldson, Eric F.; Van Blarcom, Thomas; Baric, Ralph; Iverson, Brent

    2012-01-01

    Even though the effect of antibody affinity on neutralization potency is well documented, surprisingly, its impact on neutralization breadth and escape has not been systematically determined. Here, random mutagenesis and DNA shuffling of the single-chain variable fragment of the neutralizing antibody 80R followed by bacterial display screening using anchored periplasmic expression (APEx) were used to generate a number of higher-affinity variants of the severe acute respiratory syndrome coronavirus (SARS-CoV)-neutralizing antibody 80R with equilibrium dissociation constants (KD) as low as 37 pM, a >270-fold improvement relative to that of the parental 80R single-chain variable fragment (scFv). As expected, antigen affinity was shown to correlate directly with neutralization potency toward the icUrbani strain of SARS-CoV. Additionally, the highest-affinity antibody fragment displayed 10-fold-increased broad neutralization in vitro and completely protected against several SARS-CoV strains containing substitutions associated with antibody escape. Importantly, higher affinity also led to the suppression of viral escape mutants in vitro. Escape from the highest-affinity variant required reduced selective pressure and multiple substitutions in the binding epitope. Collectively, these results support the hypothesis that engineered antibodies with picomolar dissociation constants for a neutralizing epitope can confer escape-resistant protection. PMID:22696652

  2. Whole-Killed Blood-Stage Vaccine-Induced Immunity Suppresses the Development of Malaria Parasites in Mosquitoes.

    PubMed

    Zhu, Feng; Liu, Taiping; Zhao, Chenhao; Lu, Xiao; Zhang, Jian; Xu, Wenyue

    2017-01-01

    As a malaria transmission-blocking vaccine alone does not confer a direct benefit to the recipient, it is necessary to develop a vaccine that not only blocks malaria transmission but also protects vaccinated individuals. In this study we observed that a whole-killed blood-stage vaccine (WKV) not only conferred protection against the blood-stage challenge but also markedly inhibited the transmission of different strains of the malaria parasite. Although the parasitemia is much lower in WKV-immunized mice challenged with malaria parasites, the gametocytemia is comparable between control and immunized mice during the early stages of infection. The depletion of CD4 + T cells prior to the adoptive transfer of parasites into WKV-immunized mice has no effect on the development of the malaria parasite in the mosquito, but the adoptive transfer of the serum from the immunized mice into the parasite-inoculated mice remarkably suppresses the development of malaria parasites in mosquitoes. Furthermore, immunized mice challenged with the malaria parasite generate higher levels of parasite-specific Abs and the inflammatory cytokines MCP-1 and IFN-γ. However, the adoptive transfer of parasite-specific IgG or the depletion of MCP-1, but not IFN-γ, to some extent is closely associated with the suppression of malaria parasite development in mosquitoes. These data strongly suggest that WKV-induced immune responses confer protection against the mosquito stage, which is largely dependent on malaria parasite-specific Abs and MCP-1. This finding sheds new light on blocking malaria transmission through the immunization of individuals with the WKV. Copyright © 2016 by The American Association of Immunologists, Inc.

  3. Yersinia pestis YopE contains a dominant CD8 T cell epitope that confers protection in a mouse model of pneumonic plague.

    PubMed

    Lin, Jr-Shiuan; Szaba, Frank M; Kummer, Lawrence W; Chromy, Brett A; Smiley, Stephen T

    2011-07-15

    Septic bacterial pneumonias are a major cause of death worldwide. Several of the highest priority bioterror concerns, including anthrax, tularemia, and plague, are caused by bacteria that acutely infect the lung. Bacterial resistance to multiple antibiotics is increasingly common. Although vaccines may be our best defense against antibiotic-resistant bacteria, there has been little progress in the development of safe and effective vaccines for pulmonary bacterial pathogens. The Gram-negative bacterium Yersinia pestis causes pneumonic plague, an acutely lethal septic pneumonia. Historic pandemics of plague caused millions of deaths, and the plague bacilli's potential for weaponization sustains an ongoing quest for effective countermeasures. Subunit vaccines have failed, to date, to fully protect nonhuman primates. In mice, they induce the production of Abs that act in concert with type 1 cytokines to deliver high-level protection; however, the Y. pestis Ags recognized by cytokine-producing T cells have yet to be defined. In this study, we report that Y. pestis YopE is a dominant Ag recognized by CD8 T cells in C57BL/6 mice. After vaccinating with live attenuated Y. pestis and challenging intranasally with virulent plague, nearly 20% of pulmonary CD8 T cells recognize this single, highly conserved Ag. Moreover, immunizing mice with a single peptide, YopE(69-77), suffices to confer significant protection from lethal pulmonary challenge. These findings suggest YopE could be a valuable addition to subunit plague vaccines and provide a new animal model in which sensitive, pathogen-specific assays can be used to study CD8 T cell-mediated defense against acutely lethal bacterial infections of the lung.

  4. The GnRH analogue triptorelin confers ovarian radio-protection to adult female rats.

    PubMed

    Camats, N; García, F; Parrilla, J J; Calaf, J; Martín-Mateo, M; Caldés, M Garcia

    2009-10-02

    There is a controversy regarding the effects of the analogues of the gonadotrophin-releasing hormone (GnRH) in radiotherapy. This has led us to study the possible radio-protection of the ovarian function of a GnRH agonist analogue (GnRHa), triptorelin, in adult, female rats (Rattus norvegicus sp.). The effects of the X-irradiation on the oocytes of ovarian primordial follicles, with and without GnRHa treatment, were compared, directly in the female rats (F(0)) with reproductive parameters, and in the somatic cells of the resulting foetuses (F(1)) with cytogenetical parameters. In order to do this, the ovaries and uteri from 82 females were extracted for the reproductive analysis and 236 foetuses were obtained for cytogenetical analysis. The cytogenetical study was based on the data from 22,151 metaphases analysed. The cytogenetical parameters analysed to assess the existence of chromosomal instability were the number of aberrant metaphases (2234) and the number (2854) and type of structural chromosomal aberrations, including gaps and breaks. Concerning the reproductive analysis of the ovaries and the uteri, the parameters analysed were the number of corpora lutea, implantations, implantation losses and foetuses. Triptorelin confers radio-protection of the ovaries in front of chromosomal instability, which is different, with respect to the single and fractioned dose. The cytogenetical analysis shows a general decrease in most of the parameters of the triptorelin-treated groups, with respect to their controls, and some of these differences were considered to be statistically significant. The reproductive analysis indicates that there is also radio-protection by the agonist, although minor to the cytogenetical one. Only some of the analysed parameters show a statistically significant decrease in the triptorelin-treated groups.

  5. 17β-estradiol confers protection after traumatic brain injury in the rat and involves activation of G protein-coupled estrogen receptor 1.

    PubMed

    Day, Nicole L; Floyd, Candace L; D'Alessandro, Tracy L; Hubbard, William J; Chaudry, Irshad H

    2013-09-01

    Abstract Traumatic brain injury (TBI) is a significant public health problem in the United States. Despite preclinical success of various drugs, to date all clinical trials investigating potential therapeutics have failed. Recently, sex steroid hormones have sparked interest as possible neuroprotective agents after traumatic injury. One of these is 17β-estradiol (E2), the most abundant and potent endogenous vertebrate estrogen. The goal of our study was to investigate the acute potential protective effects of E2 or the specific G protein-coupled estrogen receptor 1 (GPER) agonist G-1 when administered in an intravenous bolus dose 1 hour post-injury in the lateral fluid percussion (LFP) rodent model of TBI. The results of this study show that, when assessed at 24 hours post-injury, E2 or G-1 confers protection in adult male rats subjected to LFP brain injury. Specifically, we found that an acute bolus dose of E2 or G-1 administered intravenously 1 hour post-TBI significantly increases neuronal survival in the ipsilateral CA 2/3 region of the hippocampus and decreases neuronal degeneration and apoptotic cell death in both the ipsilateral cortex and CA 2/3 region of the hippocampus. We also report a significant reduction in astrogliosis in the ipsilateral cortex, hilus, and CA 2/3 region of the hippocampus. Finally, these effects were observed to be chiefly dose-dependent for E2, with the 5 mg/kg dose generating a more robust level of protection. Our findings further elucidate estrogenic compounds as a clinically relevant pharmacotherapeutic strategy for treatment of secondary injury following TBI, and intriguingly, reveal a novel potential therapeutic target in GPER.

  6. The Emerging Role of IGF-1 Deficiency in Cardiovascular Aging: Recent Advances

    PubMed Central

    Csiszar, Anna

    2012-01-01

    This review focuses on cardiovascular protective effects of insulin-like growth factor (IGF)-1, provides a landscape of molecular mechanisms involved in cardiovascular alterations in patients and animal models with congenital and adult-onset IGF-1 deficiency, and explores the link between age-related IGF-1 deficiency and the molecular, cellular, and functional changes that occur in the cardiovascular system during aging. Microvascular protection conferred by endocrine and paracrine IGF-1 signaling, its implications for the pathophysiology of cardiac failure and vascular cognitive impairment, and the role of impaired cellular stress resistance in cardiovascular aging considered here are based on emerging knowledge of the effects of IGF-1 on Nrf2-driven antioxidant response. PMID:22451468

  7. 11th National Conference on Science, Policy, and the Environment: Our Changing Oceans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Peter Saundry

    2012-04-17

    On January 19-21, 2011, The National Council for Science and the Environment (NCSE) successfully convened its 11th National Conference on Science, Policy and the Environment: Our Changing Oceans in Washington, DC at the Ronald Reagan Building and International Trade Center. Over 1,247 participants attended the conference, representing federal, state and local governments, university and colleges across the US, civil society organizations, the business community, and international entities. In addition, the conference was webcast to an audience across several states. The conference provided a forum to examine the profound changes our ocean will undergo over the next 25-50 years and sharemore » various perspectives on the new research, tools, and policy initiatives to protect and sustain our ocean. Conference highlights and recommendations are available to the public on NCSE's conference website, www.OurChangingOceans.org.« less

  8. Topical Resiquimod Protects against Visceral Infection with Leishmania infantum chagasi in Mice

    PubMed Central

    Craft, Noah; Birnbaum, Ron; Quanquin, Natalie; Erfe, Marie Crisel B.; Quant, Cara; Haskell, Jacquelyn

    2014-01-01

    New prevention and treatment strategies are needed for visceral leishmaniasis, particularly ones that can be deployed simply and inexpensively in areas where leishmaniasis is endemic. Synthetic molecules that activate Toll-like receptor 7 and 8 (TLR7/8) pathways have previously been demonstrated to enhance protection against cutaneous leishmaniasis. We initially sought to determine whether the TLR7/8-activating molecule resiquimod might serve as an effective vaccine adjuvant targeting visceral leishmaniasis caused by infection with Leishmania infantum chagasi. Resiquimod was topically applied to the skin of mice either prior to or after systemic infection with L. infantum chagasi, and parasite burdens were assessed. Surprisingly, topical resiquimod application alone, in the absence of vaccination, conferred robust resistance to mice against future intravenous challenge with virulent L. infantum chagasi. This protection against L. infantum chagasi infection persisted as long as 8 weeks after the final topical resiquimod treatment. In addition, in mice with existing infections, therapeutic treatment with topical resiquimod led to significantly lower visceral parasite loads. Resiquimod increased trafficking of leukocytes, including B cells, CD4+ and CD8+ T cells, dendritic cells, macrophages, and granulocytes, in livers and spleens, which are the key target organs of visceralizing infection. We conclude that topical resiquimod leads to systemic immune modulation and confers durable protection against visceralizing L. infantum chagasi infection, in both prophylactic and therapeutic settings. These studies support continued studies of TLR-modulating agents to determine mechanisms of protection and also provide a rationale for translational development of a critically needed, novel class of topical, preventative, and therapeutic agents for these lethal infections. PMID:25030052

  9. Familial and temperamental predictors of resilience in children at risk for conduct disorder and depression

    PubMed Central

    Shannon, Katherine E.; Beauchaine, Theodore P.; Brenner, Sharon L.; Neuhaus, Emily; Gatzke-Kopp, Lisa

    2009-01-01

    In this study, we evaluated predictors of resilience among 8- to 12-year-old children recruited from primarily low socioeconomic status neighborhoods, 117 of whom suffered from clinical levels of conduct problems and/or depression, and 63 of whom suffered from no significant symptoms. Tests of interactions were conducted between (a) paternal antisocial behavior and maternal depression and (b) several physiological indices of child temperament and emotionality in predicting (c) children’s conduct problems and depression. Both internalizing and externalizing outcomes among children were associated specifically with maternal melancholic depression, and not with nonmelancholic depression. In addition, low levels of respiratory sinus arrhythmia (RSA) among children conferred significant risk for depression, regardless of maternal melancholia, whereas high RSA offered partial protection. Furthermore, high levels of maternal melancholia conferred significant risk for child depression, regardless of paternal antisocial behavior, whereas low levels of maternal melancholia offered partial protection. Finally, low levels of electrodermal responding (EDR) conferred significant risk for conduct problems, regardless of paternal antisocial behavior, whereas high EDR offered partial protection. None of the identified protective factors offered complete immunity from psychopathology. These findings underscore the complexity of resilience and resilience-related processes, and suggest several potential avenues for future longitudinal research. PMID:17705899

  10. Japanese encephalitis virus replicon-based vaccine expressing enterovirus-71 epitope confers dual protection from lethal challenges.

    PubMed

    Huang, Yi-Ting; Liao, Jia-Teh; Yen, Li-Chen; Chang, Yung-Kun; Lin, Yi-Ling; Liao, Ching-Len

    2015-09-11

    To construct safer recombinant flavivirus vaccine, we exploited Japanese encephalitis virus (JEV) replicon-based platform to generate single-round infectious particles (SRIPs) that expressed heterologous neutralizing epitope SP70 derived from enterovirus-71 (EV71). Such pseudo-infectious virus particles, named SRIP-SP70, although are not genuine viable viruses, closely mimic live virus infection to elicit immune responses within one round of viral life cycle. We found that, besides gaining of full protection to thwart JEV lethal challenge, female outbred ICR mice, when were immunized with SRIP-SP70 by prime-boost protocol, could not only induce SP70-specific and IgG2a predominant antibodies but also provide their newborns certain degree of protection against EV71 lethal challenge. Our results therefore exemplify that this vaccination strategy could indeed confer an immunized host a dual protective immunity against subsequent lethal challenge from JEV or EV71.

  11. Effectiveness of pentavalent rotavirus vaccine in a large urban population in the United States.

    PubMed

    Boom, Julie A; Tate, Jacqueline E; Sahni, Leila C; Rench, Marcia A; Hull, Jennifer J; Gentsch, Jon R; Patel, Manish M; Baker, Carol J; Parashar, Umesh D

    2010-02-01

    The goal was to assess the effectiveness of complete (3-dose) or partial (1- or 2-dose) immunization with pentavalent rotavirus vaccine (RV5) against rotavirus acute gastroenteritis (AGE) in US clinical practice. A case-control evaluation was conducted in February through June 2008 at an emergency department in Houston, Texas. Case patients with rotavirus AGE (N = 90) were identified through testing for rotavirus in fecal specimens obtained from 205 children 15 days through 23 months of age presenting with AGE. Control groups included rotavirus-negative AGE patients (N = 115), concurrently enrolled patients with acute respiratory infection (ARI) (N = 228), and up to 10 age- and zip code-matched children sampled from the Houston-Harris County Immunization Registry (HHCIR) for each case patient >8 months of age. Immunization data were obtained from parent records, health care providers, and/or the HHCIR. Vaccine effectiveness was calculated as 1 minus odds of RV5 vaccination for case patients versus control patients, after adjustment for age at presentation and birth date. The vaccine effectiveness of a complete RV5 series was 89% (95% confidence interval [CI]: 70%-96%) and 85% (95% CI: 55%-95%) with rotavirus-negative AGE and ARI control patients, respectively. Immunization data were available for 44% of case patients (n = 40) from the HHCIR; the estimated 3-dose vaccine effectiveness with these HHCIR control patients was 82% (95% CI: 19%-96%). A complete RV5 series conferred 100% protection (95% CI: 71%-100%) against severe rotavirus disease requiring hospitalization and 96% protection (95% CI: 72%-99%) against disease requiring intravenous hydration. Vaccine effectiveness of 1 and 2 doses against hospitalization and emergency department visits was 69% (95% CI: 13%-89%) and 81% (95% CI: 13%-96%), respectively, using rotavirus-negative AGE and ARI control groups combined. In this setting, a complete series of RV5 was highly effective against severe rotavirus AGE. Partial immunization also conferred substantial protection.

  12. Creatinine metabolite, HMH (5-hydroxy-1-methylhydantoin; NZ-419), modulates bradykinin-induced changes in vascular smooth muscle cells.

    PubMed

    Ienaga, Kazuharu; Sohn, Mimi; Naiki, Mitsuru; Jaffa, Ayad A

    2014-06-01

    A creatinine metabolite, 5-hydroxy-1-methylhydantoin (HMH: NZ-419), a hydroxyl radical scavenger, has previously been shown to confer renoprotection by inhibiting the progression of chronic kidney disease in rats. In the current study, we demonstrate that HMH modulates the effects of glucose and bradykinin (BK) in vascular smooth muscle cell (VSMC). HMH a novel anti-oxidant drug completely suppressed the expression of B2-kinin receptors (B2KR) in response to high glucose (25 mM) stimulation in VSMC and was also shown to attenuate the effects of BK on VSMC remodeling. HMH inhibited the BK-induced increase in MAPK phosphorylation and attenuated the increase in connective tissue growth factor (CTGF) protein levels in VSMC. These findings suggest that HMH may confer vascular protection against high glucose concentrations and BK-stimulation to ameliorate vascular injury and remodeling through its anti-oxidant properties.

  13. Fake news. Fake journals. Fake conferences. What we can do.

    PubMed

    Darbyshire, Philip

    2017-12-05

    It is time to take the gloves off in the fight against predatory publishers, predatory journals and the ever-increasing number of predatory conferences. There was a time when I believed that education and awareness, coupled with some basic policy 'signals' would be enough to bring most Universities and Schools of Nursing & Midwifery to the table (Darbyshire, McKenna, Lee, & East, 2016). It is quite touching that I could still be this naive at my age. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  14. The Drosophila carbonyl reductase sniffer prevents oxidative stress-induced neurodegeneration.

    PubMed

    Botella, Jose A; Ulschmid, Julia K; Gruenewald, Christoph; Moehle, Christoph; Kretzschmar, Doris; Becker, Katja; Schneuwly, Stephan

    2004-05-04

    A growing body of evidence suggests that oxidative stress is a common underlying mechanism in the pathogenesis of neurodegenerative disorders such as Alzheimer's, Huntington's, Creutzfeld-Jakob and Parkinson's diseases. Despite the increasing number of reports finding a causal relation between oxidative stress and neurodegeneration, little is known about the genetic elements that confer protection against the deleterious effects of oxidation in neurons. We have isolated and characterized the Drosophila melanogaster gene sniffer, whose function is essential for preventing age-related neurodegeneration. In addition, we demonstrate that oxidative stress is a direct cause of neurodegeneration in the Drosophila central nervous system and that reduction of sniffer activity leads to neuronal cell death. The overexpression of the gene confers neuronal protection against oxygen-induced apoptosis, increases resistance of flies to experimental normobaric hyperoxia, and improves general locomotor fitness. Sniffer belongs to the family of short-chain dehydrogenase/reductase (SDR) enzymes and exhibits carbonyl reductase activity. This is the first in vivo evidence of the direct and important implication of this enzyme as a neuroprotective agent in the cellular defense mechanisms against oxidative stress.

  15. Proceedings, 16th central hardwood forest conference

    Treesearch

    Douglass F. Jacobs; Charles H., eds. Michler

    2008-01-01

    Proceedings of the 16th Central Hardwood Forest Conference held April 8-9, 2008, in West Lafayette, IN. Includes 64 papers pertaining to forest regeneration and propagation, forest products, ecology and forest dynamics, human dimensions and economics, forest biometrics and modeling, silviculture and genetics, forest health and protection, and soil and mineral nutrition...

  16. PHYTOREMEDIATION: STATE OF THE SCIENCE CONFERENCE AND OTHER DEVELOPMENTS. EDITORIAL INTRODUCTION AND SPECIAL COMMENTARY

    EPA Science Inventory

    It is a pleasure to present six papers in this issue, selected from presentations at the U.S. Environmental Protection Agency (EPA) Conference, Phytoremediation: State of the Science held May 1-2, 2000 in Boston, MA, USA. These papers highlight some of the many advances reported...

  17. Proceedings, 15th central hardwood forest conference

    Treesearch

    David S. Buckley; Wayne K. Clatterbuck; [Editors

    2007-01-01

    Proceedings of the 15th central hardwood forest conference held February 27–March 1, 2006, in Knoxville, TN. Includes 86 papers and 30 posters pertaining to forest health and protection, ecology and forest dynamics, natural and artificial regeneration, forest products, wildlife, site classification, management and forest resources, mensuration and models, soil and...

  18. 75 FR 34734 - Improving Market and Planning Efficiency Through Improved Software; Notice of Agenda and...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-18

    ... Market and Planning Efficiency Through Improved Software; Notice of Agenda and Procedures for Staff Technical Conference June 10, 2010. This notice establishes the agenda and procedures for the staff[email protected] . Kimberly D. Bose, Secretary. Agenda for AD10-12 Staff Technical Conference on Enhanced Power...

  19. Report of the 2014 Cent Gardes HIV Vaccine Conference-Part 2: Cell-mediated immunity, mucosal protection, and clinical trials: Fondation Mérieux Conference Center, Veyrier du Lac, France, 5-7 October, 2014.

    PubMed

    Girard, Marc P; Picot, Valentina; Longuet, Christophe; Nabel, Gary J

    2015-08-07

    The 2014 Cent Gardes Conference took place on October 5-7, 2014, at the Fondation Mérieux Conference Center, on the shores of the Annecy Lake and aimed to review the progress and promise of HIV vaccines. The elicitation of broadly neutralizing antibodies (bNAbs), their use in passive immunization, as well as their genetic delivery (vector immunoprophylaxis) by a recombinant Adenovirus-associated virus (AAV) vector were reviewed in a preceding article [1]. Approaches to the elicitation of long-lasting T cell or mucosal immunity were also discussed and are now reviewed here. The possibility of eliciting mucosal IgAs was discussed, since it was demonstrated that transcytosis-blocking IgAs can protect monkeys against repeated vaginal challenge with a pathogenic chimeric simian and human immunodeficiency virus (SHIV). The possibility of purging the HIV reservoirs from HIV-infected persons and developing a cure of the disease was also discussed. Copyright © 2015. Published by Elsevier Ltd.. All rights reserved.

  20. Intestinal epithelial cell secretion of RELM-beta protects against gastrointestinal worm infection

    USDA-ARS?s Scientific Manuscript database

    IL-4 and IL-13 protect against parasitic helminths, but little is known about the mechanism of host protection. We show that IL-4/IL-13 confer immunity against worms by inducing intestinal epithelial cells (IEC) to differentiate into goblet cells that secrete resistin-like molecule beta (RELMB). R...

  1. Novel Catanionic Surfactant Vesicle Vaccines Protect against Francisella tularensis LVS and Confer Significant Partial Protection against F. tularensis Schu S4 Strain

    PubMed Central

    Richard, Katharina; Mann, Barbara J.; Stocker, Lenea; Barry, Eileen M.; Qin, Aiping; Cole, Leah E.; Hurley, Matthew T.; Ernst, Robert K.; Michalek, Suzanne M.; Stein, Daniel C.; DeShong, Philip

    2014-01-01

    Francisella tularensis is a Gram-negative immune-evasive coccobacillus that causes tularemia in humans and animals. A safe and efficacious vaccine that is protective against multiple F. tularensis strains has yet to be developed. In this study, we tested a novel vaccine approach using artificial pathogens, synthetic nanoparticles made from catanionic surfactant vesicles that are functionalized by the incorporation of either F. tularensis type B live vaccine strain (F. tularensis LVS [LVS-V]) or F. tularensis type A Schu S4 strain (F. tularensis Schu S4 [Schu S4-V]) components. The immunization of C57BL/6 mice with “bare” vesicles, which did not express F. tularensis components, partially protected against F. tularensis LVS, presumably through activation of the innate immune response, and yet it failed to protect against the F. tularensis Schu S4 strain. In contrast, immunization with LVS-V fully protected mice against intraperitoneal (i.p.) F. tularensis LVS challenge, while immunization of mice with either LVS-V or Schu S4-V partially protected C57BL/6 mice against an intranasal (i.n.) F. tularensis Schu S4 challenge and significantly increased the mean time to death for nonsurvivors, particularly following the i.n. and heterologous (i.e., i.p./i.n.) routes of immunization. LVS-V immunization, but not immunization with empty vesicles, elicited high levels of IgG against nonlipopolysaccharide (non-LPS) epitopes that were increased after F. tularensis LVS challenge and significantly increased early cytokine production. Antisera from LVS-V-immunized mice conferred passive protection against challenge with F. tularensis LVS. Together, these data indicate that functionalized catanionic surfactant vesicles represent an important and novel tool for the development of a safe and effective F. tularensis subunit vaccine and may be applicable for use with other pathogens. PMID:24351755

  2. Comparison of the protective efficacy between single and combination of recombinant adenoviruses expressing complete and truncated glycoprotein, and nucleoprotein of the pathogenic street rabies virus in mice.

    PubMed

    Kim, Ha-Hyun; Yang, Dong-Kun; Nah, Jin-Ju; Song, Jae-Young; Cho, In-Soo

    2017-06-24

    Rabies is an important viral zoonosis that causes acute encephalitis and death in mammals. To date, several recombinant vaccines have been developed based on G protein, which is considered to be the main antigen, and these vaccines are used for rabies control in many countries. Most recombinant viruses expressing RABV G protein retain the G gene from attenuated RABV. Not enough is currently known about the protective effect against RABV of a combination of recombinant adenoviruses expressing the G and N proteins of pathogenic street RABV. We constructed a recombinant adenovirus (Ad-0910Gsped) expressing the signal peptide and ectodomain (sped) of G protein of the Korean street strain, and evaluated the immunological protection conferred by a single and combination of three kinds of recombinant adenoviruses (Ad-0910Gsped and Ad-0910G with or without Ad-0910 N) in mice. A combination of Ad-0910G and Ad-0910 N conferred improved immunity against intracranial challenge compared to single administration of Ad-0910G. The Ad-0910G virus, expressing the complete G protein, was more immunogenic than Ad-0910Gsped, which expressed a truncated G protein with the transmembrane and cytoplasmic domains removed. Additionally, oral vaccination using a combination of viruses led to complete protection. Our results suggest that this combination of viruses is a viable new intramuscular and oral vaccine candidate.

  3. Long-Term Mental Health among Low-Income, Minority Women Following Exposure to Multiple Natural Disasters in Early and Late Adolescence Compared to Adulthood

    ERIC Educational Resources Information Center

    Jacobs, Marni B.; Harville, Emily W.

    2015-01-01

    Background: High impact experiences following a natural disaster have been shown to influence later psychopathology. Individual-level factors such as age may also contribute to a disaster's impact on mental health, though it is unclear whether young age confers a protective effect or represents a period of increased risk as compared to adulthood.…

  4. Sm2, a paralog of the Trichoderma cerato-platanin elicitor Sm1, is also highly important for plant protection conferred by the fungal-root interaction of Trichoderma with maize.

    PubMed

    Gaderer, Romana; Lamdan, Netta L; Frischmann, Alexa; Sulyok, Michael; Krska, Rudolf; Horwitz, Benjamin A; Seidl-Seiboth, Verena

    2015-01-16

    The proteins Sm1 and Sm2 from the biocontrol fungus Trichoderma virens belong to the cerato-platanin protein family. Members of this family are small, secreted proteins that are abundantly produced by filamentous fungi with all types of life-styles. Some species of the fungal genus Trichoderma are considered as biocontrol fungi because they are mycoparasites and are also able to directly interact with plants, thereby stimulating plant defense responses. It was previously shown that the cerato-platanin protein Sm1 from T. virens - and to a lesser extent its homologue Epl1 from Trichoderma atroviride - induce plant defense responses. The plant protection potential of other members of the cerato-platanin protein family in Trichoderma, however, has not yet been investigated. In order to analyze the function of the cerato-platanin protein Sm2, sm1 and sm2 knockout strains were generated and characterized. The effect of the lack of Sm1 and Sm2 in T. virens on inducing systemic resistance in maize seedlings, challenged with the plant pathogen Cochliobolus heterostrophus, was tested. These plant experiments were also performed with T. atroviride epl1 and epl2 knockout strains. In our plant-pathogen system T. virens was a more effective plant protectant than T. atroviride and the results with both Trichoderma species showed concordantly that the level of plant protection was more strongly reduced in plants treated with the sm2/epl2 knockout strains than with sm1/epl1 knockout strains. Although the cerato-platanin genes sm1/epl1 are more abundantly expressed than sm2/epl2 during fungal growth, Sm2/Epl2 are, interestingly, more important than Sm1/Epl1 for the promotion of plant protection conferred by Trichoderma in the maize-C. heterostrophus pathosystem.

  5. Vaccine potential of antigen cocktails composed of recombinant Toxoplasma gondii TgPI-1, ROP2 and GRA4 proteins against chronic toxoplasmosis in C3H mice.

    PubMed

    Picchio, Mariano S; Sánchez, Vanesa R; Arcon, Nadia; Soto, Ariadna S; Perrone Sibilia, Matías; Aldirico, María de Los Angeles; Urrutia, Mariela; Moretta, Rosalía; Fenoy, Ignacio M; Goldman, Alejandra; Martin, Valentina

    2018-02-01

    The development of an effective and safe vaccine to prevent Toxoplasma gondii infection is an important aim due to the great clinical and economic impact of this parasitosis. We have previously demonstrated that immunization with the serine protease inhibitor-1 (TgPI-1) confers partial protection to C3H/HeN and C57BL/6 mice. In order to improve the level of protection, in this work, we combined this novel antigen with ROP2 and/or GRA4 recombinant proteins (rTgPI-1+rROP2, rTgPI-1+rGRA4, rTgPI-1+rROP2+rGRA4) to explore the best combination against chronic toxoplasmosis in C3H/HeN mice. All tested vaccine formulations, administered following a homologous prime-boost protocol that combines intradermal and intranasal routes, conferred partial protection as measured by the reduction of brain cyst burden following oral challenge with tissue cysts of Me49 T. gondii strain. The highest level of protection was achieved by the mixture of rTgPI-1 and rROP2 proteins with an average parasite burden reduction of 50% compared to the unvaccinated control group. The vaccine-induced protective effect was related to the elicitation of systemic cellular and humoral immune responses that included antigen-specific spleen cell proliferation, the release of Th1/Th2 cytokines, and the generation of antigen-specific antibodies in serum. Additionally, mucosal immune responses were also induced, characterized by secretion of antigen-specific IgA antibodies in intestinal lavages and specific mesenteric lymph node cell proliferation. Our results demonstrate that rTgPI-1+rROP2 antigens seem a promising mixture to be combined with other immunogenic proteins in a multiantigenic vaccine formulation against toxoplasmosis. Copyright © 2018 Elsevier Inc. All rights reserved.

  6. Conference Proceedings on High Altitude and High Acceleration Protection for Military Aircrew Held in Pensacola Florida on 29-30 April 1991 (Les Equipements de Protection pour le Vol Haute Altitude et Grande Acceleration a Bord des Avions Militaires)

    DTIC Science & Technology

    1991-10-01

    may not be sensitive tu the fatigue changes brought about 58: 761-767. 1987. by this nonuniform exercise. Likewise, the central bio- chemical assay may...of the nonuniform dist- This effect is of sufficient interest in ribution of both vascular density and itself to justify undertaking in the...INTERTECHNIQUE W LAIR LIQUIDE BPlI BP 15 78374 - Plaisir C~dex 38360 - Sassenage C6dex (France) (France) RESUME :Les avions do combat actuels sont caract~ris~s

  7. Trade-offs in the effects of the apolipoprotein E polymorphism on risks of diseases of the heart, cancer, and neurodegenerative disorders: insights on mechanisms from the Long Life Family Study.

    PubMed

    Kulminski, Alexander M; Arbeev, Konstantin G; Culminskaya, Irina; Ukraintseva, Svetlana V; Stallard, Eric; Province, Michael A; Yashin, Anatoli I

    2015-04-01

    The lack of evolutionary established mechanisms linking genes to age-related traits makes the problem of genetic susceptibility to health span inherently complex. One complicating factor is genetic trade-off. Here we focused on long-living participants of the Long Life Family Study (LLFS), their offspring, and spouses to: (1) Elucidate whether trade-offs in the effect of the apolipoprotein E e4 allele documented in the Framingham Heart Study (FHS) are a more general phenomenon, and (2) explore potential mechanisms generating age- and gender-specific trade-offs in the effect of the e4 allele on cancer, diseases of the heart, and neurodegenerative disorders assessed retrospectively in the LLFS populations. The e4 allele can diminish risks of cancer and diseases of the heart and confer risks of diseases of the heart in a sex-, age-, and LLFS-population-specific manner. A protective effect against cancer is seen in older long-living men and, potentially, their sons (>75 years, relative risk [RR]>75=0.48, p=0.086), which resembles our findings in the FHS. The protective effect against diseases of the heart is limited to long-living older men (RR>76=0.50, p=0.016), as well. A detrimental effect against diseases of the heart is characteristic for a normal LLFS population of male spouses and is specific for myocardial infarction (RR=3.07, p=2.1×10(-3)). These trade-offs are likely associated with two inherently different mechanisms, including disease-specific (detrimental; characteristic for a normal male population) and systemic, aging-related (protective; characteristic for older long-living men) mechanisms. The e4 allele confers risks of neurological disorders in men and women (RR=1.98, p=0.046). The results highlight the complex role of the e4 allele in genetic susceptibility to health span.

  8. 19-Hydroxyeicosatetraenoic acid and isoniazid protect against angiotensin II-induced cardiac hypertrophy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Elkhatali, Samya; El-Sherbeni, Ahmed A.; Elshenawy, Osama H.

    We have recently demonstrated that 19-hydroxyeicosatetraenoic acid (19-HETE) is the major subterminal-HETE formed in the heart tissue, and its formation was decreased during cardiac hypertrophy. In the current study, we examined whether 19-HETE confers cardioprotection against angiotensin II (Ang II)-induced cardiac hypertrophy. The effect of Ang II, with and without 19-HETE (20 μM), on the development of cellular hypertrophy in cardiomyocyte RL-14 cells was assessed by real-time PCR. Also, cardiac hypertrophy was induced in Sprague–Dawley rats by Ang II, and the effect of increasing 19-HETE by isoniazid (INH; 200 mg/kg/day) was assessed by heart weight and echocardiography. Also, alterations inmore » cardiac cytochrome P450 (CYP) and their associated arachidonic acid (AA) metabolites were determined by real-time PCR, Western blotting and liquid-chromatography–mass-spectrometry. Our results demonstrated that 19-HETE conferred a cardioprotective effect against Ang II-induced cellular hypertrophy in vitro, as indicated by the significant reduction in β/α-myosin heavy chain ratio. In vivo, INH improved heart dimensions, and reversed the increase in heart weight to tibia length ratio caused by Ang II. We found a significant increase in cardiac 19-HETE, as well as a significant reduction in AA and its metabolite, 20-HETE. In conclusion, 19-HETE, incubated with cardiomyocytes in vitro or induced in the heart by INH in vivo, provides cardioprotection against Ang II-induced hypertrophy. This further confirms the role of CYP, and their associated AA metabolites in the development of cardiac hypertrophy. - Highlights: • We found 19-hydroxy arachidonic acid to protect cardiomyocytes from hypertrophy. • We validated the use of isoniazid as a cardiac 19-hydroxy arachidonic acid inducer. • We found isoniazid to increase protective and inhibit toxic eicosanoides. • We found isoniazid to protect against angiotensin-induced cardiac hypertrophy. • This will help to repurposing isoniazid as a treatment of heart diseases.« less

  9. Extended therapeutic window for post-exposure treatment of ricin intoxication conferred by the use of high-affinity antibodies.

    PubMed

    Noy-Porat, Tal; Alcalay, Ron; Epstein, Eyal; Sabo, Tamar; Kronman, Chanoch; Mazor, Ohad

    2017-03-01

    The plant toxin ricin is considered a potential bioterror agent against which there is no available antidote. To date, neutralizing antibodies are the most promising post-exposure treatment for ricin intoxication, yet so far they were shown to be effective only when given within several hours post exposure. As part of an ongoing effort to develop efficient ricin-countermeasures, we tested whether high-affinity antibodies that were previously isolated from immunized non-human primates, may confer effective post-exposure therapy for ricin-intoxicated mice treated at late time-points after exposure. While each antibody is capable of providing high protection rate by itself, a formulation consisting of three neutralizing antibodies that target different epitopes was tested to provide therapeutic coverage against different variants of the malicious pathogen. Indeed, the tri-antibody based cocktail was highly effective, its administration resulting in very high survival rates (>70%) when animals were treated as late as 48 h post exposure and significant protection (>30%) even at 72 h. This study establishes for the first time that anti-ricin antibodies can serve as a highly effective antidote at such late time-points after exposure. From the clinical point of view, the extended therapeutic window documented here is of high importance allowing adequate time to accurately identify the causative agent and may permit initiation of life-saving treatment with these antibodies even after the onset of clinical signs. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Associations between ghrelin and ghrelin receptor polymorphisms and cancer in Caucasian populations: a meta-analysis.

    PubMed

    Pabalan, Noel A; Seim, Inge; Jarjanazi, Hamdi; Chopin, Lisa K

    2014-11-07

    There is growing evidence that the ghrelin axis, including ghrelin (GHRL) and its receptor, the growth hormone secretagogue receptor (GHSR), play a role in cancer progression. Ghrelin gene and ghrelin receptor gene polymorphisms have been reported to have a range of effects in cancer, from increased risk, to protection from cancer, or having no association. In this study we aimed to clarify the role of ghrelin and ghrelin receptor polymorphisms in cancer by performing a meta-analysis of published case-control studies. In the overall analysis, homozygous and recessive associations indicated that the minor alleles of rs696217 and rs2075356 GHRL polymorphisms conferred reduced cancer risk (odds ratio [OR] 0.61-0.78). The risk was unchanged for breast cancer patients when analysed separately (OR 0.73-0.83). In contrast, the rs4684677 GHRL and the rs572169 GHSR polymorphisms conferred increased breast cancer risk (OR 1.97-1.98, p = 0.08 and OR 1.42-1.43, p = 0.08, respectively). All dominant and co-dominant effects showed null effects (OR 0.96-1.05), except for the rs572169 co-dominant effect, with borderline increased risk (OR 1.08, p = 0.05). This study suggests that the rs696217 and rs2075356 ghrelin gene (GHRL) polymorphisms may protect carriers against breast cancer, and the rs4684677 GHRL and rs572169 GHSR polymorphisms may increase the risk among carriers. In addition, larger studies are required to confirm these findings.

  11. Unrelated facultative endosymbionts protect aphids against a fungal pathogen.

    PubMed

    Łukasik, Piotr; van Asch, Margriet; Guo, Huifang; Ferrari, Julia; Godfray, H Charles J

    2013-02-01

    The importance of microbial facultative endosymbionts to insects is increasingly being recognized, but our understanding of how the fitness effects of infection are distributed across symbiont taxa is limited. In the pea aphid, some of the seven known species of facultative symbionts influence their host's resistance to natural enemies, including parasitoid wasps and a pathogenic fungus. Here we show that protection against this entomopathogen, Pandora neoaphidis, can be conferred by strains of four distantly related symbionts (in the genera Regiella, Rickettsia, Rickettsiella and Spiroplasma). They reduce mortality and also decrease fungal sporulation on dead aphids which may help protect nearby genetically identical insects. Pea aphids thus obtain protection from natural enemies through association with a wider range of microbial associates than has previously been thought. Providing resistance against natural enemies appears to be a particularly common way for facultative endosymbionts to increase in frequency within host populations. © 2012 Blackwell Publishing Ltd/CNRS.

  12. Erosion protection conferred by whole human saliva, dialysed saliva, and artificial saliva

    NASA Astrophysics Data System (ADS)

    Baumann, T.; Kozik, J.; Lussi, A.; Carvalho, T. S.

    2016-10-01

    During dental erosion, tooth minerals are dissolved, leading to a softening of the surface and consequently to irreversible surface loss. Components from human saliva form a pellicle on the tooth surface, providing some protection against erosion. To assess the effect of different components and compositions of saliva on the protective potential of the pellicle against enamel erosion, we prepared four different kinds of saliva: human whole stimulated saliva (HS), artificial saliva containing only ions (AS), human saliva dialysed against artificial saliva, containing salivary proteins and ions (HS/AS), and human saliva dialysed against deionised water, containing only salivary proteins but no ions (HS/DW). Enamel specimens underwent four cycles of immersion in either HS, AS, HS/AS, HS/DW, or a humid chamber (Ctrl), followed by erosion with citric acid. During the cycling process, the surface hardness and the calcium released from the surface of the specimens were measured. The different kinds of saliva provided different levels of protection, HS/DW exhibiting significantly better protection than all the other groups (p < 0.0001). Different components of saliva, therefore, have different effects on the protective properties of the pellicle and the right proportions of these components in saliva are critical for the ability to form a protective pellicle.

  13. STABILIZATION OF PROTOPLASTS AND SPHEROPLASTS BY SPERMINE AND OTHER POLYAMINES

    PubMed Central

    Tabor, Celia W.

    1962-01-01

    Tabor, Celia W. (National Institute of Arthritis and Metabolic Diseases, Bethesda, Md.). Stabilization of protoplasts and spheroplasts by spermine and other polyamines. J. Bacteriol. 83:1101–1111. 1962.—Spermine (10−3m) or spermidine prevents lysis of lysozyme-produced protoplasts of Escherichia coli W, E. coli B, and Micrococcus lysodeikticus in hypotonic media. Spheroplasts prepared by the action of penicillin are also stabilized by these concentrations of spermine and spermidine, but the protection is not as complete. Streptomycin, polylysine, and Ca++ are also effective or partially effective stabilizers, but 1,4-diaminobutane, 1,5-diaminopentane, ornithine, Mg++, and monovalent cations have no protective action at 10−3m concentration, and only a slight effect at higher concentrations. The osmotic stability conferred on protoplasts by spermine is irreversible. However, the protective effect of polyamines against lysis is not accompanied by restoration of viability to lysozyme protoplasts. There is a marked reduction in the loss of ultra-violet-absorbing material from the protoplasts to the medium when 10−3m spermine is present. PMID:16561942

  14. National Conference on Campus Safety (15th, University of Vermont, Burlington, June 21-26, 1968).

    ERIC Educational Resources Information Center

    Green, Jack N., Ed.

    Presentations made at the fifteenth National Conference on Campus Safety. The following topics are dealt with--(1) Occupational Health on Campus, (2) Teacher Liability in School Accidents, (3) Indoctrinating Students in Fire Safety, (4) Computer Installations Safety and Fire Protection, (5) The Design of Laboratory Buildings, (6) A Uniform System…

  15. Water Conservation with Water Saving Devices, Proceedings of a Conference. Extension Bulletin 421.

    ERIC Educational Resources Information Center

    Shelton, Theodore B., Ed.

    Presented are six papers on water conservation which were presented at a conference in New Jersey. The first two papers present recommendations of the New Jersey Department of Environmental Protection on water conservation and a master plan for New Jersey's water supply needs. The following four papers discuss water conservation with water-saving…

  16. Approaches to Privacy and Security in Computer Systems. Publication No. 404.

    ERIC Educational Resources Information Center

    Renninger, Clark R., Ed.

    A conference was held at the National Bureau of Standards on March 4-5, 1974 to continue the dialogue in search of ways to protect confidential information in computer systems. Proposals were presented for meeting governmental needs in safeguarding individual privacy and data confidentiality that were identified at a conference held in November…

  17. Case of Computer Conference at California College Pits Free Speech against Civil-Rights Protection.

    ERIC Educational Resources Information Center

    DeLoughry, Thomas J.; Wilson, David L.

    1994-01-01

    Santa Rosa Junior College (California) is in dispute with the Department of Education's Office of Civil Rights over comments about women students, termed sexual harassment, made in a men-only computer conference. The college is negotiating with the federal agency over what it must do to respond to student complaints. (MSE)

  18. Report on the Desirability of Adopting an International Instrument for the Protection of Translators.

    ERIC Educational Resources Information Center

    United Nations Educational, Scientific, and Cultural Organization, Paris (France).

    This report contains the formal documents leading to the inclusion on the provisional agenda of UNESCO's 1972 General Conference of a discussion considering the desirability of adopting an instrument for the protection of translators. Included in the document is the "Preliminary Study of the Technical and Legal Aspects of Copyright Protection for…

  19. Luteolin: A Flavonoid that Has Multiple Cardio-Protective Effects and Its Molecular Mechanisms

    PubMed Central

    Luo, Yuanyuan; Shang, Pingping; Li, Dongye

    2017-01-01

    Cardiovascular disease (CVD) has become the leading cause of morbidity and mortality worldwide. A well-monitored diet with a sufficient intake of fruits and vegetables has been confirmed as a primary prevention of CVD. Plant constituents such as flavonoids have been shown to confer healthy benefits. Luteolin (Lut), a kind of flavonoid, possesses anti-oxidative, anti-tumor, and anti-inflammatory properties. Recent scientific literature has reported the cardiac protective effects of Lut in vitro and in vivo. Therefore, the aim of this review is to provide an update and detailed overview with cardio-protective molecular mechanisms of Lut with a focus on multiple intrinsic and extrinsic effectors. We further explore how these mechanisms participate in ischemia/reperfusion (I/R) injury, heart failure (HF) and atherosclerosis (AS). A proper understanding of the cardiovascular protective effects and the relative mechanisms of Lut may provide the possibility of new drug design and development for CVD. With the previous studies mainly focused on basic research, we need to advance the prospects of its further clinical utilization against CVD, large prospective clinical trials of Lut are needed to observe its therapeutic effects on patients with I/R injury, HF and AS, especially on the effective therapeutic dosage, and safety of long-term administration. PMID:29056912

  20. Effect of Spirulina maxima and its protein extract on micronuclei induction by hydroxyurea in pregnant mice and their fetuses.

    PubMed

    Álvarez-González, Isela; Vázquez-Sánchez, Jorge; Chamorro-Cevallos, Germán; Madrigal-Bujaidar, Eduardo

    2013-11-01

    The purpose of the present report was to determine the inhibitory effect of Spirulina maxima (Sm) and its protein extract (PE), mainly consisting of C-phycocyanin, on the increase in micronuclei and bone marrow cytotoxicity induced by hydroxyurea (HU) in pregnant mice and their fetuses. The two tested antimutagenic agents were administered daily from day 10 to day 18 of pregnancy, and HU (300 mg/kg) was administered once on day 16 of the assay. The experimental design also included mice that were administered only Sm or PE (1000 and 400 mg/kg, respectively), two control groups that were administered with vehicles (water and 0.5% Tween 80), and one additional group that was treated solely with HU. Blood samples from the pregnant mice and their fetuses were examined at day 19 of pregnancy. Significant increases in the number of micronucleated polychromatic erythrocytes and in the total number of micronucleated erythrocytes were observed in all HU-treated animals. In contrast, similarly low numbers of micronuclei were observed in the two control groups and in the groups treated with Sm and PE alone. The administration of Sm (100, 500, and 1000 mg/kg) and PE (100, 200, and 400 mg/kg) to HU-treated animals conferred moderate genotoxic protection (∼30%) and some protection against the cytotoxicity induced by HU in mice. The obtained results provide new information regarding the capacity of the tested agents to confer protection to adult mice and transplacentally, as well as on a specific subclass of micronuclei.

  1. Renal ischemia-reperfusion injury and adenosine 2A receptor-mediated tissue protection: the role of CD4+ T cells and IFN-gamma.

    PubMed

    Day, Yuan-Ji; Huang, Liping; Ye, Hong; Li, Li; Linden, Joel; Okusa, Mark D

    2006-03-01

    A(2A) adenosine receptor (A(2A)R)-expressing bone marrow (BM)-derived cells contribute to the renal protective effect of A(2A) agonists in renal ischemia-reperfusion injury (IRI). We performed IRI in mice lacking T and B cells to determine whether A(2A)R expressed in CD4+ cells mediate protection from IRI. Rag-1 knockout (KO) mice were protected in comparison to wild-type (WT) mice when subjected to IRI. ATL146e, a selective A(2A) agonist, did not confer additional protection. IFN-gamma is an important early signal in IRI and is thought to contribute to reperfusion injury. Because IFN-gamma is produced by kidney cells and T cells we performed IRI in BM chimeras in which the BM of WT mice was reconstituted with BM from IFN-gamma KO mice (IFN-gamma KO-->WT chimera). We observed marked reduction in IRI in comparison to WT-->WT chimeras providing additional indirect support for the role of T cells. To confirm the role of CD4+ A(2A)R in mediating protection from IRI, Rag-1 KO mice were subjected to ischemia-reperfusion. The protection observed in Rag-1 KO mice was reversed in Rag-1 KO mice that were adoptively transferred WT CD4+ cells (WT CD4+-->Rag-1 KO) or A(2A) KO CD4+ cells (A(2A) KO CD4+-->Rag-1 KO). ATL146e reduced injury in WT CD4+-->Rag-1 KO mice but not in A(2A) KO CD4+-->Rag-1 KO mice. Rag-1 KO mice reconstituted with CD4+ cells derived from IFN-gamma KO mice (IFN-gamma CD4+-->Rag-1 KO) were protected from IRI; ATL146e conferred no additional protection. These studies demonstrate that CD4+ IFN-gamma contributes to IRI and that A(2A) agonists mediate protection from IRI through action on CD4+ cells.

  2. African Swine Fever Virus Georgia Isolate Harboring Deletions of MGF360 and MGF505 Genes Is Attenuated in Swine and Confers Protection against Challenge with Virulent Parental Virus

    PubMed Central

    O'Donnell, Vivian; Holinka, Lauren G.; Gladue, Douglas P.; Sanford, Brenton; Krug, Peter W.; Lu, Xiqiang; Arzt, Jonathan; Reese, Bo; Carrillo, Consuelo; Risatti, Guillermo R.

    2015-01-01

    ABSTRACT African swine fever virus (ASFV) is the etiological agent of a contagious and often lethal disease of domestic pigs that has significant economic consequences for the swine industry. The control of African swine fever (ASF) has been hampered by the unavailability of vaccines. Experimental vaccines have been developed using genetically modified live attenuated ASFVs where viral genes involved in virus virulence were removed from the genome. Multigene family 360 (MGF360) and MGF505 represent a group of genes sharing partial sequence and structural identities that have been connected with ASFV host range specificity, blocking of the host innate response, and virus virulence. Here we report the construction of a recombinant virus (ASFV-G-ΔMGF) derived from the highly virulent ASFV Georgia 2007 isolate (ASFV-G) by specifically deleting six genes belonging to MGF360 or MGF505: MGF505-1R, MGF360-12L, MGF360-13L, MGF360-14L, MGF505-2R, and MGF505-3R. ASFV-G-ΔMGF replicates as efficiently in primary swine macrophage cell cultures as the parental virus. In vivo, ASFV-G-ΔMGF is completely attenuated in swine, since pigs inoculated intramuscularly (i.m.) with either 102 or 104 50% hemadsorbing doses (HAD50) remained healthy, without signs of the disease. Importantly, when these animals were subsequently exposed to highly virulent parental ASFV-G, no signs of the disease were observed, although a proportion of these animals harbored the challenge virus. This is the first report demonstrating the role of MGF genes acting as independent determinants of ASFV virulence. Additionally, ASFV-G-ΔMGF is the first experimental vaccine reported to induce protection in pigs challenged with highly virulent and epidemiologically relevant ASFV-G. IMPORTANCE The main problem for controlling ASF is the lack of vaccines. Studies focusing on understanding ASFV virulence led to the production of genetically modified recombinant viruses that, while attenuated, are able to confer protection in pigs challenged with homologous viruses. Here we have produced an attenuated recombinant ASFV derived from highly virulent ASFV strain Georgia (ASFV-G) lacking only six of the multigene family 360 (MGF360) and MGF505 genes (ASFV-G-ΔMGF). It is demonstrated, by first time, that deleting specific MGF genes alone can completely attenuate a highly virulent field ASFV isolate. Recombinant virus ASFV-G-ΔMGF effectively confers protection in pigs against challenge with ASFV-G when delivered once via the intramuscular (i.m.) route. The protection against ASFV-G is highly effective by 28 days postvaccination. This is the first report of an experimental vaccine that induces solid protection against virulent ASFV-G. PMID:25810553

  3. Report on the 2013 US Environmental Protection Agency ...

    EPA Pesticide Factsheets

    Report This report summarizes presentations and discussions from the “2013 U.S Environmental Protection Agency (EPA) International Decontamination Research and Development Conference,” held November 5–7, 2013 at the U.S. EPA facilities in Research Triangle Park, North Carolina.

  4. Tetanus vaccination with a dissolving microneedle patch confers protective immune responses in pregnancy.

    PubMed

    Esser, E Stein; Romanyuk, AndreyA; Vassilieva, Elena V; Jacob, Joshy; Prausnitz, Mark R; Compans, Richard W; Skountzou, Ioanna

    2016-08-28

    Maternal and neonatal tetanus claim tens of thousands lives every year in developing countries, but could be prevented by hygienic practices and improved immunization of pregnant women. This study tested the hypothesis that skin vaccination can overcome the immunologically transformed state of pregnancy and enhance protective immunity to tetanus in mothers and their newborns. To achieve this goal, we developed microneedle patches (MNPs) that efficiently delivered unadjuvanted tetanus toxoid to skin of pregnant mice and demonstrated that this route induced superior immune responses in female mice conferring 100% survival to tetanus toxin challenge when compared to intramuscular vaccination. Mice born to MNP-vaccinated mothers showed detectable tetanus-specific IgG antibodies up to 12weeks of age and complete protection to tetanus toxin challenge up at 6weeks of age. In contrast, none of the 6-week old mice born to intramuscularly vaccinated mothers survived challenge. Although pregnant mice vaccinated with unadjuvanted tetanus toxoid had 30% lower IgG and IgG1 titers than mice vaccinated intramuscularly with Alum®-adjuvanted tetanus toxoid vaccine, IgG2a titers and antibody affinity maturation were similar between these groups. We conclude that skin immunization with MNPs containing unadjuvanted tetanus toxoid can confer potent protective efficacy to mothers and their offspring using a delivery method well suited for expanding vaccination coverage in developing countries. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Proceedings of the 2008 & 2009 National Conference on Outdoor Leadership: Connecting with Nature (San Diego, California, February, 12-16, 2008) [and] Necessary Journeys (Bloomington, Indiana, February 4-7, 2009)

    ERIC Educational Resources Information Center

    Phipps, Maurice, Ed.; Hayashi, Aya, Ed.

    2009-01-01

    The Wilderness Education Association (WEA) helps people enjoy and protect the nation's most precious resource: the wilderness areas. The WEA has been training and certifying outdoor leaders around the world for nearly 30 years, teaching students safely and effectively to lead groups in the outdoors without harming the environment. This document…

  6. Topical resiquimod protects against visceral infection with Leishmania infantum chagasi in mice.

    PubMed

    Craft, Noah; Birnbaum, Ron; Quanquin, Natalie; Erfe, Marie Crisel B; Quant, Cara; Haskell, Jacquelyn; Bruhn, Kevin W

    2014-09-01

    New prevention and treatment strategies are needed for visceral leishmaniasis, particularly ones that can be deployed simply and inexpensively in areas where leishmaniasis is endemic. Synthetic molecules that activate Toll-like receptor 7 and 8 (TLR7/8) pathways have previously been demonstrated to enhance protection against cutaneous leishmaniasis. We initially sought to determine whether the TLR7/8-activating molecule resiquimod might serve as an effective vaccine adjuvant targeting visceral leishmaniasis caused by infection with Leishmania infantum chagasi. Resiquimod was topically applied to the skin of mice either prior to or after systemic infection with L. infantum chagasi, and parasite burdens were assessed. Surprisingly, topical resiquimod application alone, in the absence of vaccination, conferred robust resistance to mice against future intravenous challenge with virulent L. infantum chagasi. This protection against L. infantum chagasi infection persisted as long as 8 weeks after the final topical resiquimod treatment. In addition, in mice with existing infections, therapeutic treatment with topical resiquimod led to significantly lower visceral parasite loads. Resiquimod increased trafficking of leukocytes, including B cells, CD4(+) and CD8(+) T cells, dendritic cells, macrophages, and granulocytes, in livers and spleens, which are the key target organs of visceralizing infection. We conclude that topical resiquimod leads to systemic immune modulation and confers durable protection against visceralizing L. infantum chagasi infection, in both prophylactic and therapeutic settings. These studies support continued studies of TLR-modulating agents to determine mechanisms of protection and also provide a rationale for translational development of a critically needed, novel class of topical, preventative, and therapeutic agents for these lethal infections. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  7. Interleukin-17 protects against the Francisella tularensis live vaccine strain but not against a virulent F. tularensis type A strain.

    PubMed

    Skyberg, Jerod A; Rollins, Maryclare F; Samuel, Joshua W; Sutherland, Marjorie D; Belisle, John T; Pascual, David W

    2013-09-01

    Francisella tularensis is a highly infectious intracellular bacterium that causes the zoonotic infection tularemia. While much literature exists on the host response to F. tularensis infection, the vast majority of work has been conducted using attenuated strains of Francisella that do not cause disease in humans. However, emerging data indicate that the protective immune response against attenuated F. tularensis versus F. tularensis type A differs. Several groups have recently reported that interleukin-17 (IL-17) confers protection against the live vaccine strain (LVS) of Francisella. While we too have found that IL-17Rα(-/-) mice are more susceptible to F. tularensis LVS infection, our studies, using a virulent type A strain of F. tularensis (SchuS4), indicate that IL-17Rα(-/-) mice display organ burdens and pulmonary gamma interferon (IFN-γ) responses similar to those of wild-type mice following infection. In addition, oral LVS vaccination conferred equivalent protection against pulmonary challenge with SchuS4 in both IL-17Rα(-/-) and wild-type mice. While IFN-γ was found to be critically important for survival in a convalescent model of SchuS4 infection, IL-17 neutralization from either wild-type or IFN-γ(-/-) mice had no effect on morbidity or mortality in this model. IL-17 protein levels were also higher in the lungs of mice infected with the LVS rather than F. tularensis type A, while IL-23p19 mRNA expression was found to be caspase-1 dependent in macrophages infected with LVS but not SchuS4. Collectively, these results demonstrate that IL-17 is dispensable for host immunity to type A F. tularensis infection, and that induced and protective immunity differs between attenuated and virulent strains of F. tularensis.

  8. Becoming an Environmental Professional 1990. Articles from Leading Environmental Professionals on Employment and Career Trends in the 1990s--Plus Proceedings from the CEIP Fund's Annual Environmental Careers Conference, "What on Earth Can You Do?" (6th, Boston, Massachusetts, October 22, 1989).

    ERIC Educational Resources Information Center

    CEIP Fund, Inc., Cleveland, OH.

    Presented in this collection are proceedings from a conference focused on how to go about preserving and protecting the environment and attended by over 120 colleges and universities and some 60 environmental organizations, as well as 10 additional articles on careers in areas related to the environment. Included in the conference proceedings are:…

  9. 11th International Conference on Atmospheric Electricity

    NASA Technical Reports Server (NTRS)

    Christian, H. J. (Compiler)

    1999-01-01

    This document contains the proceedings from the 11th International Conference on Atmospheric Electricity (ICAE 99), held June 7-11, 1999. This conference was attended by scientists and researchers from around the world. The subjects covered included natural and artificially initiated lightning, lightning in the middle and upper atmosphere (sprites and jets), lightning protection and safety, lightning detection techniques (ground, airborne, and space-based), storm physics, electric fields near and within thunderstorms, storm electrification, atmospheric ions and chemistry, shumann resonances, satellite observations of lightning, global electrical processes, fair weather electricity, and instrumentation.

  10. Vesicular Stomatitis Virus Pseudotyped with Ebola Virus Glycoprotein Serves as a Protective, Noninfectious Vaccine against Ebola Virus Challenge in Mice

    PubMed Central

    Lennemann, Nicholas J.; Herbert, Andrew S.; Brouillette, Rachel; Rhein, Bethany; Bakken, Russell A.; Perschbacher, Katherine J.; Cooney, Ashley L.; Miller-Hunt, Catherine L.; Ten Eyck, Patrick; Biggins, Julia; Olinger, Gene; Dye, John M.

    2017-01-01

    ABSTRACT The recent Ebola virus (EBOV) epidemic in West Africa demonstrates the potential for a significant public health burden caused by filoviral infections. No vaccine or antiviral is currently FDA approved. To expand the vaccine options potentially available, we assessed protection conferred by an EBOV vaccine composed of vesicular stomatitis virus pseudovirions that lack native G glycoprotein (VSVΔG) and bear EBOV glycoprotein (GP). These pseudovirions mediate a single round of infection. Both single-dose and prime/boost vaccination regimens protected mice against lethal challenge with mouse-adapted Ebola virus (ma-EBOV) in a dose-dependent manner. The prime/boost regimen provided significantly better protection than a single dose. As N-linked glycans are thought to shield conserved regions of the EBOV GP receptor-binding domain (RBD), thereby blocking epitopes within the RBD, we also tested whether VSVΔG bearing EBOV GPs that lack GP1 N-linked glycans provided effective immunity against challenge with ma-EBOV or a more distantly related virus, Sudan virus. Using a prime/boost strategy, high doses of GP/VSVΔG partially or fully denuded of N-linked glycans on GP1 protected mice against ma-EBOV challenge, but these mutants were no more effective than wild-type (WT) GP/VSVΔG and did not provide cross protection against Sudan virus. As reported for other EBOV vaccine platforms, the protection conferred correlated with the quantity of EBOV GP-specific Ig produced but not with the production of neutralizing antibodies. Our results show that EBOV GP/VSVΔG pseudovirions serve as a successful vaccination platform in a rodent model of Ebola virus disease and that GP1 N-glycan loss does not influence immunogenicity or vaccination success. IMPORTANCE The West African Ebola virus epidemic was the largest to date, with more than 28,000 people infected. No FDA-approved vaccines are yet available, but in a trial vaccination strategy in West Africa, recombinant, infectious VSV encoding the Ebola virus glycoprotein effectively prevented virus-associated disease. VSVΔG pseudovirion vaccines may prove as efficacious and have better safety, but they have not been tested to date. Thus, we tested the efficacy of VSVΔG pseudovirions bearing Ebola virus glycoprotein as a vaccine platform. We found that wild-type Ebola virus glycoprotein, in the context of this platform, provides robust protection of EBOV-challenged mice. Further, we found that removal of the heavy glycan shield surrounding conserved regions of the glycoprotein does not enhance vaccine efficacy. PMID:28615211

  11. Antimicrobial Activity of Lactic Acid Bacteria in Dairy Products and Gut: Effect on Pathogens

    PubMed Central

    Rodríguez, Eva; Landete, José María

    2015-01-01

    The food industry seeks alternatives to satisfy consumer demands of safe foods with a long shelf-life able to maintain the nutritional and organoleptic quality. The application of antimicrobial compounds-producing protective cultures may provide an additional parameter of processing in order to improve the safety and ensure food quality, keeping or enhancing its sensorial characteristics. In addition, strong evidences suggest that certain probiotic strains can confer resistance against infection with enteric pathogens. Several mechanisms have been proposed to support this phenomenon, including antimicrobial compounds secreted by the probiotics, competitive exclusion, or stimulation of the immune system. Recent research has increasingly demonstrated the role of antimicrobial compounds as protective mechanism against intestinal pathogens and therefore certain strains could have an effect on both the food and the gut. In this aspect, the effects of the combination of different strains keep unknown. The development of multistrain probiotic dairy products with good technological properties and with improved characteristics to those shown by the individual strains, able to act not only as protective cultures in foods, but also as probiotics able to exert a protective action against infections, has gained increased interest. PMID:25861634

  12. Single shot of 17D vaccine may not confer life-long protection against yellow fever.

    PubMed

    Vasconcelos, Pedro Fc

    2018-02-01

    The yellow fever (YF) vaccine has been used since the 1930s to prevent YF, which is a severe infectious disease caused by the yellow fever virus (YFV), and mainly transmitted by Culicidae mosquitoes from the genera Aedes and Haemagogus . Until 2013, the World Health Organization (WHO) recommended the administration of a vaccine dose every ten years. A new recommendation of a single vaccine dose to confer life-long protection against YFV infection has since been established. Recent evidence published elsewhere suggests that at least a second dose is needed to fully protect against YF disease. Here, we discuss the feasibility of administering multiple doses, the necessity for a new and modern vaccine, and recommend that the WHO conveys a meeting to discuss YFV vaccination strategies for people living in or travelling to endemic areas.

  13. Induction of protective immunity against toxoplasmosis in mice by immunization with Toxoplasma gondii RNA.

    PubMed

    Dimier-Poisson, Isabelle; Aline, Fleur; Bout, Daniel; Mévélec, Marie-Noëlle

    2006-03-06

    Toxoplasma gondii enters the mucosal surfaces of the host, and so immunity at these sites is of major interest. Due to the compartmentalization of the immune response, systemic immunization does not induce high levels of immunity at mucosal surfaces. Intranasal immunization has been shown to be very effective in inducing both systemic and mucosal immune responses. Immunization with mRNA can induce both humoral and cell-mediated immune responses, both of which are important in conferring immunity to T. gondii. The efficacy of RNA vaccination by the nasal route with T. gondii RNA was evaluated. We assessed the percentage of cumulative survival after an oral challenge with a lethal dose of T. gondii cysts (40 cysts), and the number of brain cysts following a challenge with a sublethal dose of T. gondii 76 K cysts (15 cysts). Vaccinated mice were found to be significantly better protected than non-immunized mice after a challenge with a lethal dose of cysts; and a challenge with a sublethal dose also resulted in fewer brain cysts than in non-immunized mice. Sera and intestinal secretions of immunized mice recognized T. gondii antigens, suggesting that a specific humoral immune response may occur. Moreover, a specific lymphoproliferative response observed in cervical lymph nodes may confer protection. These preliminary findings suggest that RNA vaccination by a mucosal route could be feasible.

  14. Nuclear aggregates of polyamines in a radiation-induced DNA damage model.

    PubMed

    Iacomino, Giuseppe; Picariello, Gianluca; Stillitano, Ilaria; D'Agostino, Luciano

    2014-02-01

    Polyamines (PA) are believed to protect DNA minimizing the effect of radiation damage either by inducing DNA compaction and aggregation or acting as scavengers of free radicals. Using an in vitro pDNA double strand breakage assay based on gel electrophoretic mobility, we compared the protective capability of PA against γ-radiation with that of compounds generated by the supramolecular self-assembly of nuclear polyamines and phosphates, named Nuclear Aggregates of Polyamines (NAPs). Both unassembled PA and in vitro produced NAPs (ivNAPs) were ineffective in conferring pDNA protection at the sub-mM concentration. Single PA showed an appreciable protective effect only at high (mM) concentrations. However, concentrations of spermine (4+) within a critical range (0.481 mM) induced pDNA precipitation, an event that was not observed with NAPs-pDNA interaction. We conclude that the interaction of individual PA is ineffective to assure DNA protection, simultaneously preserving the flexibility and charge density of the double strand. Furthermore, data obtained by testing polyamine and ivNAPS with the current radiation-induced DNA damage model support the concept that PA-phosphate aggregates are the only forms through which PA interact with DNA. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Mechanism of Aloe Vera extract protection against UVA: shelter of lysosomal membrane avoids photodamage.

    PubMed

    Rodrigues, Daniela; Viotto, Ana Cláudia; Checchia, Robert; Gomide, Andreza; Severino, Divinomar; Itri, Rosangela; Baptista, Maurício S; Martins, Waleska Kerllen

    2016-03-01

    The premature aging (photoaging) of skin characterized by wrinkles, a leathery texture and mottled pigmentation is a well-documented consequence of exposure to sunlight. UVA is an important risk factor for human cancer also associated with induction of inflammation, immunosuppression, photoaging and melanogenesis. Although herbal compounds are commonly used as photoprotectants against the harmful effects of UVA, the mechanisms involved in the photodamage are not precisely known. In this study, we investigated the effects of Aloe Vera (Aloe barbadensis mil) on the protection against UVA-modulated cell killing of HaCaT keratinocytes. Aloe Vera exhibited the remarkable ability of reducing both in vitro and in vivo photodamage, even though it does not have anti-radical properties. Interestingly, the protection conferred by Aloe Vera was associated with the maintenance of membrane integrity in both mimetic membranes and intracellular organelles. The increased lysosomal stability led to a decrease in lipofuscinogenesis and cell death. This study explains why Aloe Vera extracts offer protection against photodamage at a cellular level in both the UV and visible spectra, leading to its beneficial use as a supplement in protective dermatological formulations.

  16. DESIGNING A COMPREHENSIVE, INTEGRATED WATER RESOURCES MONITORING PROGRAM FOR FLORIDA

    EPA Science Inventory

    Proceedings of the National Water Quality Monitoring Conference "Monitoring Critical Foundations to Protect Our Waters," 7-9 July 1998, Reno, NV.

    In late 1996, Florida Department of Environmental Protection (FDEP) initiated an effort to design a multi-tiered monitoring and...

  17. The Five E's: Ethnicity, Education, Economy, Equity, and Environment. Proceedings [of the] Annual Conference of the Global Awareness Society International (Chicago, Illinois, June 1994).

    ERIC Educational Resources Information Center

    Huber, James H., Ed.; And Others

    The 23 conference papers in this proceedings include: (1) "Global Awareness Society International: Retrospectives and Prospectives" (Chang Shub Roh); (2) "Technology Transfer in Developing Countries: The Case of Turkey (1989-1994)" (Huseyin Ates; Asim Sen); (3) "Indigenous People, Environmental Protection and Globalization" (Edward D. Barker); (4)…

  18. Wood-destroying organisms in the new millennium : where have we gone since Bend 1989?

    Treesearch

    Michael Haverty; Jessie Micales-Glaeser

    2004-01-01

    At the joint meeting of the Western International Forest Disease Work Conference and the Western Forest Insect Work Conference, held in Bend, OR, on September 13, 1989, a symposium was convened entitled "Current Research on Wood-destroying Organisms and Future Prospects for Protecting Wood in Use. "Presentations were made by three pathologists and nine...

  19. Making Connections, Building Communities. Proceedings of the Annual Rural & Small Schools Conference (19th, Manhattan, Kansas, October 26-27, 1997).

    ERIC Educational Resources Information Center

    Kansas State Univ., Manhattan. Center for Rural Education and Small Schools.

    This proceedings contains 26 summaries of conference presentations and discussions. Titles and authors are: "Is a Sexual Harassment Policy Enough To Protect Against Liability?" (Camille Barnett); "Recreating the Communities of Our Youth" (Marlyn Benson); "Creating a Language of Ethics in Rural Schooling" (Terry R. Berkeley, Linda P. Thurston);…

  20. Comparing the effects of mitochondrial targeted and localized antioxidants with cellular antioxidants in human skin cells exposed to UVA and hydrogen peroxide.

    PubMed

    Oyewole, Anne O; Wilmot, Marie-Claire; Fowler, Mark; Birch-Machin, Mark A

    2014-01-01

    Skin cancer and aging are linked to increased cellular reactive oxygen species (ROS), particularly following exposure to ultraviolet A (UVA) in sunlight. As mitochondria are the main source of cellular ROS, this study compared the protective effects of mitochondria-targeted and -localized antioxidants (MitoQ and tiron, respectively) with cellular antioxidants against oxidative stress-induced [UVA and hydrogen peroxide (H2O2)] mitochondrial DNA (mtDNA) damage in human dermal fibroblasts. With the use of a long quantitative PCR assay, tiron (EC50 10 mM) was found to confer complete (100%) protection (P<0.001) against both UVA- and H2O2-induced mtDNA damage, whereas MitoQ (EC50 750 nM) provided less protection (17 and 32%, respectively; P<0.05). This particular protective effect of tiron was greater than a range of cellular antioxidants investigated. The nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathway provides cellular protection against oxidative stress. An ELISA assay for the Nrf2 target gene heme oxygenase-1 (HO-1) and studies using Nrf2 small interfering RNA both indicated that tiron's mode of action was Nrf2 independent. The comet assay showed that tiron's protective effect against H2O2-induced nuclear DNA damage was greater than the cellular antioxidants and MitoQ (P<0.001). This study provides a platform to investigate molecules with similar structure to tiron as potent and clinically relevant antioxidants.

  1. Report and policy brief from the 4th Africa Conference on Social Aspects of HIV/AIDS Research: innovations in access to prevention, treatment and care in HIV/AIDS, Kisumu, Kenya, 29 April - 3 May 2007.

    PubMed

    Setswe, G; Peltzer, K; Banyini, M; Skinner, D; Seager, J; Maile, S; Sedumedi, S; Gomis, D; van der Linde, I

    2007-08-01

    About 520 delegates from all over Africa and 21 countries attended the conference. This report and policy brief summarises the key findings and suggested policy options that emerged from rapporteur reports of conference proceedings including the following themes: (1) Orphans and vulnerable children, (2) Treatment, (3) Prevention, (4) Gender and male involvement, (5) Male circumcision, (6) People living with HIV/AIDS, (7) Food and nutrition, (8) Socioeconomics, and (9) Politics/policy. Two (11.8%) of the 17 OVC projects from the three countries were classified as best practice interventions. Of the 83 abstracts that were accepted at the conference, only 7 (8.4%) were dealing with antiretroviral therapy (ART). There has been tremendous effort by various organisations to provide information about prevention of HIV/AIDS. Information received by adolescents has been effective in increasing their knowledge, but without positive sexual behaviour change. The conference noted the contribution of gender discrimination and violence to the HIV epidemic and the different risks that men and women face in relation to the epidemic. Social scientists need to study the deep cultural meanings attached to male circumcision among different ethnic groups to be able to guide the debate on the latest biomedical findings on the protective effect of circumcision against HIV. Palliative care and support is crucial for coping among people living with HIV/AIDS (PLWHA) in order to deal with medical and psychological issues. Results from several countries have helped researchers to explore alternative ways of examining poverty in the context of HIV and AIDS. Policy frameworks which are likely to succeed in combating HIV/AIDS need to be updated to cover issues of access, testing, disclosure and stigma. In general, the conference was successful in identifying innovations in access to prevention, treatment and care in HIV/AIDS.

  2. The Anxiolytic and Antidepressant-like Effects of Testosterone and Estrogen in Gonadectomized Male Rats

    PubMed Central

    Carrier, Nicole; Saland, Samantha K.; Duclot, Florian; He, Huan; Mercer, Roger; Kabbaj, Mohamed

    2015-01-01

    Background While the influence of testosterone levels on vulnerability to affective disorders is not straightforward, research suggests this hormone may confer some degree of resiliency in men. We recently demonstrated a role for the dentate gyrus in mediating testosterone’s protective effects on depressive-like behavior in gonadectomized male rats. Here, testosterone may exert its effects through androgen receptor-mediated mechanisms or via local aromatization to estradiol. Methods Gonadectomized male rats were implanted with a placebo, testosterone, or estradiol pellet, and subsequent protective anxiolytic- and antidepressant-like effects of testosterone and its aromatized metabolite, estradiol, were then investigated in the open field and sucrose preference tests, respectively. Moreover, their influence on gene expression in the hippocampus was analyzed by genome-wide cDNA microarray analysis. Finally, the contribution of testosterone’s aromatization within the dentate gyrus was assessed by local infusion of the aromatase inhibitor, fadrozole, whose efficacy was confirmed by LC-MS/MS. Results Both hormones had antidepressant-like effects associated with a substantial overlap in transcriptional regulation, particularly in synaptic plasticity- and mitogen-activated protein kinase pathway-related genes. Further, chronic aromatase inhibition within the dentate gyrus blocked the protective effects of testosterone. Conclusions Both testosterone and estradiol exhibit anxiolytic- and antidepressant-like effects in gonadectomized male rats, while similarly regulating critical mediators of these behaviors, suggesting common underlying mechanisms. Accordingly, we demonstrated that testosterone’s protective effects are mediated, in part, by its aromatization in the dentate gyrus. These findings thus provide further insight into a role for estradiol in mediating the protective anxiolytic- and antidepressant-like effects of testosterone. PMID:25683735

  3. Expulsion of Nippostrongylus brasiliensis from rats protected with serum. I. The efficacy of sera from singly and multiply infected donors related to time of administration and volume of serum injected.

    PubMed Central

    Miller, H R

    1980-01-01

    Several of the parameters related to the efficacy of passive protection against Nippostrongylus brasiliensis were studied in female hybrid (PVG/c x DA)F1 and outbred Wistar rats. The time after infection at which immune serum was given did, to some extent, alter the degree of protection conferred. There was substantial protection 8 days after challenge in rats given hyperimmune serum (HIS) either as daily injections 4-7 days post-infection or as a single dose on day 4. Eight separate experiments in which HIS was injected 4 days after challenge with 1000 l3 resulted in expulsion of 96 +/- 2% of the worm burdens by day 8. In a further six experiments, following infection with 2000 l3 and using the same protocol, 85 +/- 3% of the worm burden was expelled by day 8. A lag of 2 days between serum transfer and commencement of worm expulsion was consistently observed and, within the space of a further 2-4 days, more than 95% of the parasites were expelled. Transplanted 'normal' and 'damaged' adult worms were also susceptible to the passive transfer of HIS. Sera recovered from rats immunized with two or three challenges (hyperimmune sera) were more protective than sera from rats given one challenge. Serum from rats challenged for the first time 6 days previously conferred significant protection against a 1000 l3 infection and sera recovered 8 and 10-12 days post-infection with 4000 l3 protected recipients with increasing effectiveness. Thoracic duct lymph collected on the tenth day of infection with 4000 l3 was also protective. The response to both primary infection and hyperimmune serum was dose-dependent. The consistently good protection achieved in the present study when compared with the variable success of previous experiments (reviewed by Ogilvie & Jones, 1971) may be a function of the strain and sex of the rats used, together with modifications of the immunization protocols. The relevance of these findings to mucosal defences against N. brasiliensis is discussed. PMID:7429533

  4. Chamomile confers protection against hydrogen peroxide-induced toxicity through activation of Nrf2-mediated defense response.

    PubMed

    Bhaskaran, Natarajan; Srivastava, Janmejai K; Shukla, Sanjeev; Gupta, Sanjay

    2013-01-01

    Oxidative stress plays an important role in the development of various human diseases. Aqueous chamomile extract is used as herbal medicine, in the form of tea, demonstrated to possess antiinflammatory and antioxidant properties. We demonstrate the cytoprotective effects of chamomile on hydrogen peroxide (H₂O₂)-induced cellular damage in macrophage RAW 264.7 cells. Pretreatment of cells with chamomile markedly attenuated H₂O₂-induced cell viability loss in a dose-dependent manner. The mechanisms by which chamomile-protected macrophages from oxidative stress was through the induction of several antioxidant enzymes including NAD(P)H:quinone oxidoreductase, superoxide dismutase, and catalase and increase nuclear accumulation of the transcription factor Nrf2 and its binding to antioxidant response elements. Furthermore, chamomile dose-dependently reduced H₂O₂-mediated increase in the intracellular levels of reactive oxygen species. Our results, for the first time, demonstrate that chamomile has protective effects against oxidative stress and might be beneficial to provide defense against cellular damage. Copyright © 2012 John Wiley & Sons, Ltd.

  5. Chamomile Confers Protection against Hydrogen Peroxide-Induced Toxicity through Activation of Nrf2-Mediated Defense Response

    PubMed Central

    Bhaskaran, Natarajan; Srivastava, Janmejai K.; Shukla, Sanjeev; Gupta, Sanjay

    2014-01-01

    Oxidative stress plays an important role in the development of various human diseases. Aqueous chamomile extract is used as herbal medicine, in the form of tea, demonstrated to possess antiinflammatory and antioxidant properties. We demonstrate the cytoprotective effects of chamomile on hydrogen peroxide (H2O2)-induced cellular damage in macrophage RAW 264.7 cells. Pretreatment of cells with chamomile markedly attenuated H2O2-induced cell viability loss in a dose-dependent manner. The mechanisms by which chamomile-protected macrophages from oxidative stress was through the induction of several antioxidant enzymes including NAD (P)H:quinone oxidoreductase, superoxide dismutase, and catalase and increase nuclear accumulation of the transcription factor Nrf2 and its binding to antioxidant response elements. Furthermore, chamomile dose-dependently reduced H2O2-mediated increase in the intracellular levels of reactive oxygen species. Our results, for the first time, demonstrate that chamomile has protective effects against oxidative stress and might be beneficial to provide defense against cellular damage. PMID:22511316

  6. Protein quality control in protection against systolic overload cardiomyopathy: the long term role of small heat shock proteins

    PubMed Central

    Kumarapeli, Asangi R K; Horak, Kathleen; Wang, Xuejun

    2010-01-01

    Molecular chaperones represent the first line of defense of intracellular protein quality control. As a major constituent of molecular chaperones, heat shock proteins (HSP) are known to confer cardiomyocyte short-term protection against various insults and injuries. Previously, we reported that the small HSP αB-crystallin (CryAB) attenuates cardiac hypertrophic response in mice subjected to 2 weeks of severe pressure overload. However, the long-term role of small HSPs in cardiac hypertrophy and failure has rarely been studied. The present study investigates the cardiac responses to chronic severe pressure overload in CryAB/HSPB2 germ line ablated (KO) and cardiac-specific CryAB overexpressingtransgenic (TG) mice. Pressure overload was induced by transverse aortic constriction in KO, TG, and non-transgenic wild type (NTG) control mice and 10 weeks later molecular, cellular, and whole organ level hypertrophic responses were analyzed. As we previously described, CryAB/HSPB2 KO mice showed abnormal baseline cardiac physiology that worsened into a restrictive cardiomyopathic phenotype with aging. Severe pressure overload in these mice led to rapid deterioration of heart function and development of congestive cardiac failure. Contrary to their short term protective phenotype, CryAB TG mice showed no significant effects on cardiac hypertrophic responses and very modest improvement of hemodynamics during chronic systolic overload. These findings indicate that small HSPs CryAB and/or HSPB2 are essential to maintain cardiac structure and function but overex-pression of CryAB is not sufficient to confer a sustained protection against chronic systolic overload. PMID:20733949

  7. Protein quality control in protection against systolic overload cardiomyopathy: the long term role of small heat shock proteins.

    PubMed

    Kumarapeli, Asangi R K; Horak, Kathleen; Wang, Xuejun

    2010-07-21

    Molecular chaperones represent the first line of defense of intracellular protein quality control. As a major constituent of molecular chaperones, heat shock proteins (HSP) are known to confer cardiomyocyte short-term protection against various insults and injuries. Previously, we reported that the small HSP alphaB-crystallin (CryAB) attenuates cardiac hypertrophic response in mice subjected to 2 weeks of severe pressure overload. However, the long-term role of small HSPs in cardiac hypertrophy and failure has rarely been studied. The present study investigates the cardiac responses to chronic severe pressure overload in CryAB/HSPB2 germ line ablated (KO) and cardiac-specific CryAB overexpressingtransgenic (TG) mice. Pressure overload was induced by transverse aortic constriction in KO, TG, and non-transgenic wild type (NTG) control mice and 10 weeks later molecular, cellular, and whole organ level hypertrophic responses were analyzed. As we previously described, CryAB/HSPB2 KO mice showed abnormal baseline cardiac physiology that worsened into a restrictive cardiomyopathic phenotype with aging. Severe pressure overload in these mice led to rapid deterioration of heart function and development of congestive cardiac failure. Contrary to their short term protective phenotype, CryAB TG mice showed no significant effects on cardiac hypertrophic responses and very modest improvement of hemodynamics during chronic systolic overload. These findings indicate that small HSPs CryAB and/or HSPB2 are essential to maintain cardiac structure and function but overex-pression of CryAB is not sufficient to confer a sustained protection against chronic systolic overload.

  8. Two outer membrane lipoproteins from Histophilus somni are immunogenic in rabbits and sheep and induce protection against bacterial challenge in mice.

    PubMed

    Guzmán-Brambila, Carolina; Rojas-Mayorquín, Argelia E; Flores-Samaniego, Beatriz; Ortuño-Sahagún, Daniel

    2012-11-01

    Histophilus somni is an economically important pathogen of cattle and other ruminants and is considered one of the key components of the bovine respiratory disease (BRD) complex, the leading cause of economic loss in the livestock industry. BRD is a multifactorial syndrome, in which a triad of agents, including bacteria, viruses, and predisposing factors or "stressors," combines to induce disease. Although vaccines against H. somni have been used for many decades, traditional bacterins have failed to demonstrate effective protection in vaccinated animals. Hence, the BRD complex continues to produce strong adverse effects on the health and well-being of stock and feeder cattle. The generation of recombinant proteins may facilitate the development of more effective vaccines against H. somni, which could confer better protection against BRD. In the present study, primers were designed to amplify, clone, express, and purify two recombinant lipoproteins from H. somni, p31 (Plp4) and p40 (LppB), which are structural proteins of the outer bacterial membrane. The results presented here demonstrate, to our knowledge for the first time, that when formulated, an experimental vaccine enriched with these two recombinant lipoproteins generates high antibody titers in rabbits and sheep and exerts a protective effect in mice against septicemia induced by H. somni bacterial challenge.

  9. Biochemical analysis of plant protection afforded by a nonpathogenic endophytic mutant of Colletotrichum magna

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Redman, R.S.; Rodriguez, R.J.; Clifton, D.R.

    1999-02-01

    A nonpathogenic mutant of Colletotrichum magna (path-1) was previously shown to protect watermelon (Citrullus lanatus) and cucumber (Cucumis sativus) seedlings from anthracnose disease elicited by wild-type C. magna. Disease protection was observed in stems of path-1-colonized cucurbits but not in cotyledons, indicating that path-1 conferred tissue-specific and/or localized protection. Plant biochemical indicators of a localized and systemic (peroxidase, phenylalanine ammonia-lyase, lignin, and salicylic acid) plant-defense response were investigated in anthracnose-resistant and-susceptible cultivars of cucurbit seedlings exposed to four treatments: (1) water (control), (2) path-1 conidia, (3) wild-type conidia, and (4) challenge conditions (inoculation into path-1 conidia for 48 h andmore » then exposure to wild-type conidia). Collectively, these analyses indicated that disease protection in path-1-colonized plants was correlated with the ability of these plants to mount a defense response more rapidly and to equal or greater levels than plants exposed to wild-type C. magna alone. Watermelon plants colonized with path-1 were also protected against disease caused by Colletotrichum orbiculare and Fusarium oxysporum. A model based on the kinetics of plant-defense activation is presented to explain the mechanism of path-1-conferred disease protection.« less

  10. Biochemical analysis of plant protection afforded by a nonpathogenic endophytic mutant of Colletotrichum magna

    USGS Publications Warehouse

    Redman, R.S.; Freeman, S.; Clifton, D.R.; Morrel, J.; Brown, G.; Rodriguez, R.J.

    1999-01-01

    A nonpathogenic mutant of Colletotrichum magna (path-1) was previously shown to protect watermelon (Citrullus lanatus) and cucumber (Cucumis sativus) seedlings from anthracnose disease elicited by wild-type C. magna. Disease protection was observed in stems of path-1-colonized cucurbits but not in cotyledons, indicating that path-1 conferred tissue-specific and/or localized protection. Plant biochemical indicators of a localized and systemic (peroxidase, phenylalanine ammonia-lyase, lignin, and salicylic acid) 'plant-defense' response were investigated in anthracnose-resistant and -susceptible cultivars of cucurbit seedlings exposed to four treatments: (1) water (control), (2) path-1 conidia, (3) wild-type conidia, and (4) challenge conditions (inoculation into path-1 conidia for 48 h and then exposure to wild-type conidia). Collectively, these analyses indicated that disease protection in path-1 colonized plants was correlated with the ability of these plants to mount a defense response more rapidly and to equal or greater levels than plants exposed to wild-type C. magna alone. Watermelon plants colonized with path-1 were also protected against disease caused by Colletotrichum orbiculare and Fusarium oxysporum. A model based on the kinetics of plant-defense activation is presented to explain the mechanism of path-1-conferred disease protection.

  11. Metformin treatment after the hypoxia-ischemia attenuates brain injury in newborn rats

    PubMed Central

    Fang, Mingchu; Jiang, Huai; Ye, Lixia; Cai, Chenchen; Hu, Yingying; Pan, Shulin; Li, Peijun; Xiao, Jian; Lin, Zhenlang

    2017-01-01

    Neonatal hypoxic-ischemic (HI) brain injury is a devastating disease that often leads to death and detrimental neurological deficits. The present study was designed to evaluate the ability of metformin to provide neuroprotection in a model of neonatal hypoxic-ischemic brain injury and to study the associated molecular mechanisms behind these protective effects. Here, we found that metformin treatment remarkably attenuated brain infarct volumes and brain edema at 24 h after HI injury, and the neuroprotection of metformin was associated with inhibition of neuronal apoptosis, suppression of the neuroinflammation and amelioration of the blood brain barrier breakdown. Additionally, metformin treatment conferred long-term protective against brain damage at 7 d after HI injury. Our study indicates that metformin treatment protects against neonatal hypoxic-ischemic brain injury and thus has potential as a therapy for this disease. PMID:29088867

  12. TYLOXAPOL CONFERS DURABLE PROTECTION AGAINST HYPEROXIC LUNG INJURY IN THE RAT

    EPA Science Inventory

    We tested the hypothesis that the non-lipid components of ExosurfR, tyloxapol (TY) and cetyl alcohol (CA), protect against hyperoxic lung injury by either 1) direct radical scavenging activity or 2) induction of the animals? endogenous anti-oxidant defenses. Adult rats were in...

  13. Identification of immune signatures predictive of clinical protection from malaria.

    PubMed

    Valletta, John Joseph; Recker, Mario

    2017-10-01

    Antibodies are thought to play an essential role in naturally acquired immunity to malaria. Prospective cohort studies have frequently shown how continuous exposure to the malaria parasite Plasmodium falciparum cause an accumulation of specific responses against various antigens that correlate with a decreased risk of clinical malaria episodes. However, small effect sizes and the often polymorphic nature of immunogenic parasite proteins make the robust identification of the true targets of protective immunity ambiguous. Furthermore, the degree of individual-level protection conferred by elevated responses to these antigens has not yet been explored. Here we applied a machine learning approach to identify immune signatures predictive of individual-level protection against clinical disease. We find that commonly assumed immune correlates are poor predictors of clinical protection in children. On the other hand, antibody profiles predictive of an individual's malaria protective status can be found in data comprising responses to a large set of diverse parasite proteins. We show that this pattern emerges only after years of continuous exposure to the malaria parasite, whereas susceptibility to clinical episodes in young hosts (< 10 years) cannot be ascertained by measured antibody responses alone.

  14. Duration of protective immunity conferred by maternal tetanus toxoid immunization: further evidence from Matlab, Bangladesh.

    PubMed Central

    Koenig, M A; Roy, N C; McElrath, T; Shahidullah, M; Wojtyniak, B

    1998-01-01

    OBJECTIVES: Although maternal tetanus immunization has been shown to be highly effective in the prevention of neonatal tetanus, unresolved questions remain concerning the required minimum number of doses and the resulting duration of effective immunity. This study examined the duration of effective immunity against neonatal tetanus provided by maternal tetanus immunization. METHODS: A randomized, double-blind cholera vaccine trial of 41,571 children and nonpregnant adult women carried out in 1974 in the Matlab comparison area of rural Bangladesh provided a unique opportunity to address dose and immunity issues. RESULTS: Children of women who received either 1 or 2 injections of tetanus toxoid experienced 4- to 14-day mortality levels consistently lower than those of children of unimmunized mothers. Analysis of neonatal-tetanus-related mortality showed that 2 injections of tetanus toxoid provided significant protection for subsequent durations of up to 12 or 13 years. CONCLUSIONS: The data demonstrate that a limited-dose regimen of maternal tetanus toxoid provides significant and extended protection against the risk of neonatal tetanus death. PMID:9618617

  15. The Janus face of iron on anoxic worlds: iron oxides are both protective and destructive to life on the early Earth and present-day Mars.

    PubMed

    Wadsworth, Jennifer; Cockell, Charles S

    2017-05-01

    The surface of the early Earth was probably subjected to a higher flux of ultraviolet (UV) radiation than today. UV radiation is known to severely damage DNA and other key molecules of life. Using a liquid culture and a rock analogue system, we investigated the interplay of protective and deleterious effects of iron oxides under UV radiation on the viability of the model organism, Bacillus subtilis. In the presence of hydrogen peroxide, there exists a fine balance between iron oxide's protective effects against this radiation and its deleterious effects caused by Photo-Fenton reactions. The maximum damage was caused by a concentration of hematite of ∼1 mg/mL. Concentrations above this confer increasing protection by physical blockage of the UV radiation, concentrations below this cause less effective UV radiation blockage, but also a correspondingly less effective Photo-Fenton reaction, providing an overall advantage. These results show that on anoxic worlds, surface habitability under a high UV flux leaves life precariously poised between the beneficial and deleterious effects of iron oxides. These results have relevance to the Archean Earth, but also the habitability of the Martian surface, where high levels of UV radiation in combination with iron oxides and hydrogen peroxide can be found. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  16. Proceedings of the conference on coastal erosion and wetland modification in Louisiana: causes, consequences, and options

    USGS Publications Warehouse

    Boesch, Donald F.

    1982-01-01

    This volume contains 16 papers and panel discussions from a conference held in Baton Rouge, La., 5-6 October 1981. The presentations consider the causes and consequences of coastal erosion and wetland modification in Louisiana and the mitigative options available to slow or reverse the rapid rate of coastal land loss. Detailed habitat mapping studies have allowed accurate estimates of coastal habitat change and land loss through 1978. Projections from these rates of change indicate an annual rate of land loss in coastal Louisiana in the early 1980's of approximately 130 km2/yr (50 m2/yr).The projected effects of wetland modification on the bountiful living resources of coastal Louisiana (fisheries, fur and hide bearers and waterfowl) are major because of the close dependence of these resources on estuarine wetlands. These changes and others related to flood protection, transportation and ownership of mineral resources are projected to have extensive social and economic consequences.Options proposed to slow coastal land loss include major and minor diversion of the Mississippi River, barrier island and shoreline restoration protection, hydrological management of wetlands and more restrictive permitting of dredging activities.

  17. Deletion of ssnA Attenuates the Pathogenicity of Streptococcus suis and Confers Protection against Serovar 2 Strain Challenge.

    PubMed

    Li, Miao; Cai, Ru-Jian; Li, Chun-Ling; Song, Shuai; Li, Yan; Jiang, Zhi-Yong; Yang, Dong-Xia

    2017-01-01

    Streptococcus suis serotype 2 (SS2) is a major porcine and human pathogen which causes arthritis, meningitis, and septicemia. Streptococcus suis nuclease A (SsnA) is a recently discovered deoxyribonuclease (DNase), which has been demonstrated to contribute to escape killing in neutrophil extracellular traps (NETs). To further determine the effects of ssnA on virulence, the ssnA deletion mutant (ΔssnA) and its complemented strain (C-ΔssnA) were constructed. The ability of ΔssnA mutant to interact with human laryngeal epithelial cell (Hep-2) was evaluated and it exhibited dramatically decreased ability to adhere to and invade Hep-2 cells. This mutation was found to exhibit significant attenuation of virulence when evaluated in CD1 mice, suggesting ssnA plays a critical role in the pathogenesis of SS2. Finally, we found that immunization with the ΔssnA mutant triggered both antibody responses and cell-mediated immunity, and conferred 80% protection against virulent SS2 challenge in mice. Taken together, our results suggest that ΔssnA represents an attractive candidate for designing an attenuated live vaccine against SS2.

  18. [Sponsoring of medical conferences, workshops and symposia by pharmaceutical companies. Physicians must be wary of this!].

    PubMed

    Warntjen, M

    2009-12-01

    The longstanding conventional forms of cooperation between medical organizations and physicians on the one hand and the pharmaceutical industry and manufacturers of medical products on the other hand nowadays hold the risk of coming into conflict with the public prosecutor. Typical circumstances which are taken up by the investigating authorities are financial supports of medical conferences, workshops and symposia. To understand the problem under criminal law it is important to become acquainted with the protective aim of the statutory offences of the acceptance of benefits according to section sign 331 of the Penal Code (Strafgesetzbuch, StGB) and of corruption according to section sign 332 of the Penal Code. The "trust of the general public in the objectivity of governmental decisions" must be protected and the "evil appearance of the corruptibility of official acts" must be counteracted. A basic differentiation is made between physicians with and without office-bearing functions. By paying attention to the recommendations and basic principles of cooperation between the medical profession and the healthcare industry presented in this article (transparency principle, equivalence principle, documentation principle and separation principle) the emergence of any suspicious factors can be effectively avoided.

  19. FLT3-ITD induces expression of Pim kinases through STAT5 to confer resistance to the PI3K/Akt pathway inhibitors on leukemic cells by enhancing the mTORC1/Mcl-1 pathway.

    PubMed

    Okada, Keigo; Nogami, Ayako; Ishida, Shinya; Akiyama, Hiroki; Chen, Cheng; Umezawa, Yoshihiro; Miura, Osamu

    2018-02-06

    FLT3-ITD is the most frequent tyrosine kinase mutation in acute myeloid leukemia (AML) associated with poor prognosis. We previously reported that activation of STAT5 confers resistance to PI3K/Akt inhibitors on the FLT3-ITD-positive AML cell line MV4-11 and 32D cells driven by FLT3-ITD (32D/ITD) but not by FLT3 mutated in the tyrosine kinase domain (32D/TKD). Here, we report the involvement of Pim kinases expressed through STAT5 activation in acquisition of this resistance. The specific pan-Pim kinase inhibitor AZD1208 as well as PIM447 in combination with the PI3K inhibitor GDC-0941 or the Akt inhibitor MK-2206 cooperatively downregulated the mTORC1/4EBP1 pathway, formation of the eIF4E/eIF4G complex, and Mcl-1 expression leading to activation of Bak and Bax to induce caspase-dependent apoptosis synergistically in these cells. These cooperative effects were enhanced or inhibited by knock down of mTOR or expression of its activated mutant, respectively. Overexpression of Mcl-1 conferred the resistance on 32D/ITD cells to combined inhibition of the PI3K/Akt pathway and Pim kinases, while the Mcl-1-specific BH3 mimetic A-1210477 conquered the resistance of MV4-11 cells to GDC-0941. Furthermore, overexpression of Pim-1 in 32D/TKD enhanced the mTORC1/Mcl-1 pathway and partially protected it from the PI3K/Akt inhibitors or the FLT3 inhibitor gilteritinib to confer the resistance to PI3K/Akt inhibitors. Finally, AZD1208 and GDC-0941 cooperatively inhibited the mTORC1/Mcl-1 pathway and reduced viable cell numbers of primary AML cells from some FLT3-ITD positive cases. Thus, Pim kinases may protect the mTORC1/4EBP1/Mcl-1 pathway to confer the resistance to the PI3K/Akt inhibitors on FLT3-ITD cells and represent promising therapeutic targets.

  20. Pellagra-like condition is xeroderma pigmentosum/Cockayne syndrome complex and niacin confers clinical benefit.

    PubMed

    Hijazi, H; Salih, M A; Hamad, M H A; Hassan, H H; Salih, S B M; Mohamed, K A; Mukhtar, M M; Karrar, Z A; Ansari, S; Ibrahim, N; Alkuraya, F S

    2015-01-01

    An extremely rare pellagra-like condition has been described, which was partially responsive to niacin and associated with a multisystem involvement. The condition was proposed to represent a novel autosomal recessive entity but the underlying mutation remained unknown for almost three decades. The objective of this study was to identify the causal mutation in the pellagra-like condition and investigate the mechanism by which niacin confers clinical benefit. Autozygosity mapping and exome sequencing were used to identify the causal mutation, and comet assay on patient fibroblasts before and after niacin treatment to assess its effect on DNA damage. We identified a single disease locus that harbors a novel mutation in ERCC5, thus confirming that the condition is in fact xeroderma pigmentosum/Cockayne syndrome (XP/CS) complex. Importantly, we also show that the previously described dermatological response to niacin is consistent with a dramatic protective effect against ultraviolet-induced DNA damage in patient fibroblasts conferred by niacin treatment. Our findings show the power of exome sequencing in reassigning previously described novel clinical entities, and suggest a mechanism for the dermatological response to niacin in patients with XP/CS complex. This raises interesting possibilities about the potential therapeutic use of niacin in XP. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Cost-Effective Optimization of Rubble-Mound Breakwater Cross Sections.

    DTIC Science & Technology

    1986-02-01

    of a Conference Held in London, London, England, p 20. Iribarren, Cavanilles R. 1938. "Una formula para el calculo de los diques de escollera," M...NAME AND ADDRESS 10. PROGRAM ELEMENT PROJECT, TASK" AREA & WORK UNIT NUMBERS US Army Engineer Waterways Experiment Station Civil Works Research...purpose as a wave barrier. A breakwater protecting a harbor entrance and mooring area from wave attack might serve q 6 to divert currents and longshore

  2. Current Methods for Evaluation of Physical Security System Effectiveness.

    DTIC Science & Technology

    1981-05-01

    It also helps the user modify a data set before further processing. (c) Safeguards Engineering and Analysis Data Base (SEAD)--To complete SAFE’s...graphic display software in addition to a Fortran compiler, and up to about (3 35,000 words of storage. For a fairly complex problem, a single run through...operational software . 94 BIBLIOGRAPHY Lenz, J.E., "The PROSE (Protection System Evaluator) Model," Proc. 1979 Winter Simulation Conference, IEEE, 1979

  3. Scientific and ethical issues related to deep brain stimulation for disorders of mood, behavior, and thought.

    PubMed

    Rabins, Peter; Appleby, Brian S; Brandt, Jason; DeLong, Mahlon R; Dunn, Laura B; Gabriëls, Loes; Greenberg, Benjamin D; Haber, Suzanne N; Holtzheimer, Paul E; Mari, Zoltan; Mayberg, Helen S; McCann, Evelyn; Mink, Sallie P; Rasmussen, Steven; Schlaepfer, Thomas E; Vawter, Dorothy E; Vitek, Jerrold L; Walkup, John; Mathews, Debra J H

    2009-09-01

    A 2-day consensus conference was held to examine scientific and ethical issues in the application of deep brain stimulation for treating mood and behavioral disorders, such as major depression, obsessive-compulsive disorder, and Tourette syndrome. The primary objectives of the conference were to (1) establish consensus among participants about the design of future clinical trials of deep brain stimulation for disorders of mood, behavior, and thought and (2) develop standards for the protection of human subjects participating in such studies. Conference participants identified 16 key points for guiding research in this growing field. The adoption of the described guidelines would help to protect the safety and rights of research subjects who participate in clinical trials of deep brain stimulation for disorders of mood, behavior, and thought and have further potential to benefit other stakeholders in the research process, including clinical researchers and device manufactures. That said, the adoption of the guidelines will require broad and substantial commitment from many of these same stakeholders.

  4. Legally Brown: Using Ethnographic Methods to Understand Sun Protection Attitudes and Behaviours among Young Australians "I Didn't Mean to Get Burnt--It Just Happened!"

    ERIC Educational Resources Information Center

    Potente, Sofia; Coppa, Kay; Williams, Ainslie; Engels, Rob

    2011-01-01

    Sun protection is not commonly perceived as an important issue by adolescents yet this behaviour would, if adopted, confer significant lifelong protection against skin cancer. Despite the world's highest skin cancer rates, Australia remains a culture which values sun seeking, tanning and outdoor activities. This qualitative study used ethnographic…

  5. Protecting intellectual property in space; Proceedings of the Aerospace Computer Security Conference, McLean, VA, March 20, 1985

    NASA Technical Reports Server (NTRS)

    1985-01-01

    The primary purpose of the Aerospace Computer Security Conference was to bring together people and organizations which have a common interest in protecting intellectual property generated in space. Operational concerns are discussed, taking into account security implications of the space station information system, Space Shuttle security policies and programs, potential uses of probabilistic risk assessment techniques for space station development, key considerations in contingency planning for secure space flight ground control centers, a systematic method for evaluating security requirements compliance, and security engineering of secure ground stations. Subjects related to security technologies are also explored, giving attention to processing requirements of secure C3/I and battle management systems and the development of the Gemini trusted multiple microcomputer base, the Restricted Access Processor system as a security guard designed to protect classified information, and observations on local area network security.

  6. Relative importance of complement-mediated bactericidal and opsonic activity for protection against meningococcal disease.

    PubMed

    Granoff, Dan M

    2009-06-24

    Killing of Neisseria meningitidis can result from complement-mediated serum bactericidal activity (SBA) or opsonophagocytosis (OPA), or a combination of the two mechanisms. While SBA titers > or =1:4 confer protection, recent evidence suggests that this threshold titer may not be required. For example, the incidence of meningococcal disease declines between ages 1 and 4 years without evidence of acquisition of SBA titers > or =1:4. Meningococcal polysaccharide vaccination also elicited OPA and lowered the risk of disease in patients with late complement component deficiencies whose sera did not support SBA. Sera from healthy adults immunized with an outer membrane vesicle vaccine showed OPA killing of N. meningitidis with C6-depleted complement, and whole blood from complement-sufficient non-immunized adults with SBA titers <1:4 also frequently had killing activity. Collectively the data indicate that SBA titers <1:4 and/or vaccine-induced OPA can confer protection against meningococcal disease.

  7. Relative importance of complement-mediated bactericidal and opsonic activity for protection against meningococcal disease

    PubMed Central

    Granoff, Dan M.

    2009-01-01

    Killing of Neisseria meningitidis can result from complement-mediated bactericidal activity (SBA) or opsonophagocytosis (OPA), or a combination of the two mechanisms. While SBA titers ≥1:4 confer protection, recent evidence suggests that this threshold titer may not be required. For example, the incidence of meningococcal disease declines between ages 1 and 4 years without evidence of acquisition of SBA titers ≥1:4. Meningococcal polysaccharide vaccination also elicited OPA and lowered the risk of disease in patients with late complement component deficiencies whose sera did not support SBA. Sera from healthy adults immunized with an outer membrane vesicle vaccine showed OPA killing of N. meningitidis with C6-depleted complement, and whole blood from complement-sufficient non-immunized adults with SBA titers <1:4 also frequently had killing activity. Collectively the data indicate that SBA titers <1:4 and/or vaccine-induced OPA can confer protection against meningococcal disease. PMID:19477054

  8. Protective Bars? Report on the EPEA International Conference on Prison Education (6th, Budapest, Hungary, November 1-5, 1997).

    ERIC Educational Resources Information Center

    Boros, Janos, Ed.

    This document contains 16 papers on practices in correctional education in Central and Eastern Europe, presented at a conference in Hungary in 1997. The papers center around these four topics: (1) Prison System and Humanization; (2) New Challenges in Prison Life and Prison Education; (3) Nothing Works? Something Works; and (4) Beyond 2000. The…

  9. Proceedings of the American power conference: Volume 59-1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McBride, A.E.

    1997-07-01

    This is Volume 59-1 of the proceedings of the American Power Conference, 1997. The contents include environmental protection; regulatory compliance and permitting; convergence of electric and gas industries; renewable/wind energy; improving operations and maintenance; globalization of renewable, generation, and distribution technologies; diagnostics; battery reliability; access to power transmission facilities; software for competitive decision making and operation; transmission and distribution; and nuclear operations and options.

  10. Southern Extension Water Training Workshop: Actions for Working Together. Proceedings of a Regional Conference (Birmingham, Alabama, November 13-15, 1989).

    ERIC Educational Resources Information Center

    Southern Rural Development Center, Mississippi State, MS.

    A training workshop for Southern Extension faculty and staff addressed aspects of water quality and related issues. Conference papers discussed: (1) basic information on hydrology--the science of water transport through the natural environment; (2) sources and impacts of water pollution; (3) the role of public policy in water quality protection;…

  11. Metabolic Fingerprint of PS3-Induced Resistance of Grapevine Leaves against Plasmopara viticola Revealed Differences in Elicitor-Triggered Defenses

    PubMed Central

    Adrian, Marielle; Lucio, Marianna; Roullier-Gall, Chloé; Héloir, Marie-Claire; Trouvelot, Sophie; Daire, Xavier; Kanawati, Basem; Lemaître-Guillier, Christelle; Poinssot, Benoît; Gougeon, Régis; Schmitt-Kopplin, Philippe

    2017-01-01

    Induction of plant resistance against pathogens by defense elicitors constitutes an attractive strategy to reduce the use of fungicides in crop protection. However, all elicitors do not systematically confer protection against pathogens. Elicitor-induced resistance (IR) thus merits to be further characterized in order to understand what makes an elicitor efficient. In this study, the oligosaccharidic defense elicitors H13 and PS3, respectively, ineffective and effective to trigger resistance of grapevine leaves against downy mildew, were used to compare their effect on the global leaf metabolism. Ultra high resolution mass spectrometry (FT-ICR-MS) analysis allowed us to obtain and compare the specific metabolic fingerprint induced by each elicitor and to characterize the associated metabolic pathways. Moreover, erythritol phosphate was identified as a putative marker of elicitor-IR. PMID:28261225

  12. S2 expressed from recombinant virus confers broad protection against infectious bronchitis virus

    USDA-ARS?s Scientific Manuscript database

    We previously demonstrated that overexposing the IBV (infectious bronchitis virus) S2 to the chicken immune system by means of a vectored vaccine, followed by boost with whole virus, protects chickens against IBV showing dissimilar S1. We developed recombinant Newcastle disease virus (NDV) LaSota (...

  13. Newcastle disease virus vectored infectious laryngotracheitis vaccines protect commercial broiler chickens in the presence of maternally derived antibodies

    USDA-ARS?s Scientific Manuscript database

    Newcastle disease virus (NDV) recombinants expressing the infectious laryngotracheitis virus (ILTV) glycoproteins B and D have previously been demonstrated to confer complete clinical protection against virulent ILTV and NDV challenges in naive chickens. We extended this study to assess whether mate...

  14. 78 FR 19460 - Marine Protected Areas Federal Advisory Committee; Public Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-04-01

    ... Areas Federal Advisory Committee; Public Meeting AGENCY: Office of National Marine Sanctuaries (ONMS... meeting via web conference call of the Marine Protected Areas Federal Advisory Committee (Committee). The... presentations as they are being given. Members of the public wishing to listen in should contact Lauren Wenzel...

  15. PROTECTING CHILDREN FROM ENVIRONMENTAL THREATS - A CONTINUING EDUCATION PROGRAM FOR NURSES OF THE AMERICAN NURSES FOUNDATION/ASSOCIATION

    EPA Science Inventory

    The American Nurses Association/Foundation will develop online, in print and pre conference continuing education (CE) children's environmental health protection programs to meet the objective of the program. The first CE program is on school environments, the second on home and ...

  16. Mycobacterium indicus pranii as a booster vaccine enhances BCG induced immunity and confers higher protection in animal models of tuberculosis.

    PubMed

    Saqib, Mohd; Khatri, Rahul; Singh, Bindu; Gupta, Ananya; Kumar, Arvind; Bhaskar, Sangeeta

    2016-12-01

    BCG, the only approved vaccine protects against severe form of childhood tuberculosis but its protective efficacy wanes in adolescence. BCG has reduced the incidence of infant TB considerably in endemic areas; therefore prime-boost strategy is the most realistic measure for control of tuberculosis in near future. Mycobacterium indicus pranii (MIP) shares significant antigenic repertoire with Mtb and BCG and has been shown to impart significant protection in animal models of tuberculosis. In this study, MIP was given as a booster to BCG vaccine which enhanced the BCG mediated immune response, resulting in higher protection. MIP booster via aerosol route was found to be more effective in protection than subcutaneous route of booster immunization. Pro-inflammatory cytokines like IFN-γ, IL-12 and IL-17 were induced at higher level in infected lungs of 'BCG-MIP' group both at mRNA expression level and in secretory form when compared with 'only BCG' group. BCG-MIP groups had increased frequency of multifunctional T cells with high MFI for IFN-γ and TNF-α in Mtb infected mice. Our data demonstrate for the first time, potential application of MIP as a booster to BCG vaccine for efficient protection against tuberculosis. This could be very cost effective strategy for efficient control of tuberculosis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. The challenge for Beijing.

    PubMed

    Farrow, C

    1995-01-01

    It is time for women's environmental needs to be placed firmly on the agenda of the world's conferences. While connections were made at the 1994 International Conference on Population and Development between women's rights, economics, sustainable development, and environmental issues, the document being prepared for the Beijing Women's Conference reduces the strength of the links. Internationally, the connections between women as environmental managers, farmers, consumers, food producers, laborers, wives, and mother are still not being made. Women are being excluded from the planning process in ways that increase environmental degradation and women's workload and remove the resource base upon which women depend. While women produce more than half of the world's food supply, they have title to only 1% of the world's land. Misunderstanding the role of women during the project design stage can result in the exclusion of women from project benefits. When the project is the designation of a protected area, it must be recognized that the only way to protect an area is to protect those whose livelihoods depend upon maintaining the biodiversity of the protected area. Environmental degradation has also forced women to provide for their families alone as their husbands migrate to find work. Eventually, the women must also migrate and cope with inadequate living conditions. The most urgent environmental problems faced by rural women are caused by deforestation and desertification which lead to a lack of fuelwood, water, and a less diverse diet of wild foods. The involvement of women in the planning and delivery of integrated conservation and development schemes is essential.

  18. JV Task 94 - Air Quality V: Mercury, Trace Elements, SO3, and Particulate Matter Conference

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Thomas A. Erickson

    2007-01-31

    This final report summarizes the planning, preparation, facilitation and production, and summary of the conference entitled 'Air Quality V: Mercury, Trace Elements, SO{sub 3}, and Particulate Matter,' held September 18-21, 2005, in Arlington, Virginia. The goal of the conference was to build on the discussions of the first four Air Quality Conferences, providing further opportunity for leading representatives of industry, government, research institutions, academia, and environmental organizations to discuss the key interrelationships between policy and science shaping near-term regulations and controls and to assist in moving forward on emerging issues that will lead to acceptable programs and policies to protectmore » human health, the environment, and economic growth. The conference was extremely timely, as it was the last large conference prior to publication of the U.S. Environmental Protection Agency's final regulations for mercury control from coal-fired utilities, and provided a forum to realistically assess the status of mercury controls in relation to the new regulations.« less

  19. Suppression of transforming growth factor-beta-induced apoptosis through a phosphatidylinositol 3-kinase/Akt-dependent pathway.

    PubMed

    Chen, R H; Su, Y H; Chuang, R L; Chang, T Y

    1998-10-15

    Insulin and insulin receptor substrate 1 (IRS-1) are capable of protecting liver cells from apoptosis induced by transforming growth factor-beta1 (TGF-beta). The Ras/mitogen-activated protein kinase (MAP kinase) and the phosphatidylinositol 3-kinase (PI 3-kinase)/Akt pathways are both activated upon insulin stimulation and can protect against apoptosis under certain circumstances. We investigated which of these pathways is responsible for the protective effect of insulin on TGF-beta-induced apoptosis. An activated Ras, although elicited a strong mitogenic effect, could not protect Hep3B cells from TGF-beta-induced apoptosis. Furthermore, PD98059, a selective inhibitor of MEK, did not suppress the antiapoptotic effect of insulin. In contrast, the PI 3-kinase inhibitor, LY294002, efficiently blocked the effect of insulin. Protection against TGF-beta-induced apoptosis conferred by PI 3-kinase was further verified by stable transfection of an activated PI 3-kinase. Downstream targets of PI 3-kinase involved in this protection was further investigated. An activated Akt mimicked the antiapoptotic effect of insulin, whereas a dominant-negative Akt inhibited such effect. However, rapamycin, the p70S6 kinase inhibitor, had no effect on the protectivity of insulin against TGF-beta-induced apoptosis, suggesting that the antiapoptotic target of PI 3-kinase/Akt pathway is independent or lies upstream of the p70S6 kinase. The mechanism by which PI 3-kinase/Akt pathway interferes with the apoptotic signaling of TGF-beta was explored. Activation of PI 3-kinase did not lead to a suppression of Smad hetero-oligomerization or nuclear translocation but blocked TGF-beta-induced caspase-3-like activity. In summary, the PI 3-kinase/Akt pathway, but not the Ras/MAP kinase pathway, protects against TGF-beta-induced apoptosis by inhibiting a step downstream of Smad but upstream of caspase-3.

  20. Repeated ischaemic preconditioning: a novel therapeutic intervention and potential underlying mechanisms.

    PubMed

    Thijssen, Dick H J; Maxwell, Joseph; Green, Daniel J; Cable, N Timothy; Jones, Helen

    2016-06-01

    What is the topic of this review? This review discusses the effects of repeated exposure of tissue to ischaemic preconditioning on cardiovascular function, the attendant adaptations and their potential clinical relevance. What advances does it highlight? We discuss the effects of episodic exposure to ischaemic preconditioning to prevent and/or attenuate ischaemic injury and summarize evidence pertaining to improvements in cardiovascular function and structure. Discussion is provided regarding the potential mechanisms that contribute to both local and systemic adaptation. Findings suggest that clinical benefits result from both the prevention of ischaemic events and the attenuation of their consequences. Ischaemic preconditioning (IPC) refers to the phenomenon whereby short periods of cyclical tissue ischaemia confer subsequent protection against ischaemia-induced injury. As a consequence, IPC can ameliorate the myocardial damage following infarction and can reduce infarct size. The ability of IPC to confer remote protection makes IPC a potentially feasible cardioprotective strategy. In this review, we discuss the concept that repeated exposure of tissue to IPC may increase the 'dose' of protection and subsequently lead to enhanced protection against ischaemia-induced myocardial injury. This may be relevant for clinical populations, who demonstrate attenuated efficacy of IPC to prevent or attenuate ischaemic injury (and therefore myocardial infarct size). Furthermore, episodic IPC facilitates repeated exposure to local (e.g. shear stress) and systemic stimuli (e.g. hormones, cytokines, blood-borne substances), which may induce improvement in vascular function and health. Such adaptation may contribute to prevention of cardio- and cerebrovascular events. The clinical benefits of repeated IPC may, therefore, result from both the prevention of ischaemic events and the attenuation of their consequences. We provide an overview of the literature pertaining to the impact of repeated IPC on cardiovascular function, related to both local and remote adaptation, as well as potential clinical implications. © 2016 The Authors. Experimental Physiology © 2016 The Physiological Society.

  1. Reactive oxygen species generated by a heat shock protein (Hsp) inducing product contributes to Hsp70 production and Hsp70-mediated protective immunity in Artemia franciscana against pathogenic vibrios.

    PubMed

    Baruah, Kartik; Norouzitallab, Parisa; Linayati, Linayati; Sorgeloos, Patrick; Bossier, Peter

    2014-10-01

    The cytoprotective role of heat shock protein (Hsp70) described in a variety of animal disease models, including vibriosis in farmed aquatic animals, suggests that new protective strategies relying upon the use of compounds that selectively turn on Hsp genes could be developed. The product Tex-OE® (hereafter referred to as Hspi), an extract from the skin of the prickly pear fruit, Opuntia ficus indica, was previously shown to trigger Hsp70 synthesis in a non-stressful situation in a variety of animals, including in a gnotobiotically (germ-free) cultured brine shrimp Artemia franciscana model system. This model system offers great potential for carrying out high-throughput, live-animal screens of compounds that have health benefit effects. By using this model system, we aimed to disclose the underlying cause behind the induction of Hsp70 by Hspi in the shrimp host, and to determine whether the product affects the shrimp in inducing resistance towards pathogenic vibrios. We provide unequivocal evidences indicating that during the pretreatment period with Hspi, there is an initial release of reactive oxygen species (hydrogen peroxide and/or superoxide anion), generated by the added product, in the rearing water and associated with the host. The reactive molecules generated are the triggering factors responsible for causing Hsp70 induction within Artemia. We have also shown that Hspi acts prophylactically at an optimum dose regimen to confer protection against pathogenic vibrios. This salutary effect was associated with upregulation of two important immune genes, prophenoloxidase and transglutaminase of the innate immune system. These findings suggest that inducers of stress protein (e.g. Hsp70) are potentially important modulator of immune responses and might be exploited to confer protection to cultured shrimp against Vibrio infection. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Neonatal Infection with G10P[11] Rotavirus Did Not Confer Protection against Subsequent Rotavirus Infection in a Community Cohort in Vellore, South India

    PubMed Central

    Banerjee, Indrani; Gladstone, Beryl Primrose; Le Fevre, Andrea M.; Ramani, Sasirekha; Iturriza-Gomara, Miren; Gray, James J.; Brown, David W.; Estes, Mary K.; Muliyil, Jaya Prakash; Jaffar, Shabbar; Kang, Gagandeep

    2008-01-01

    Background Various observational studies have suggested that neonatal rotavirus infection confers protection against diarrhea due to subsequent rotavirus infection. We examined the incidence of rotavirus infection and diarrhea during the first 2 years of life among children infected with the G10P[11] rotavirus strain during the neonatal period and those not infected with rotavirus. Methods Children were recruited at birth and were followed up at least twice weekly. Stool samples, collected every 2 weeks for surveillance and at each episode of diarrhea, were screened by enzyme-linked immunosorbent assay and were genotyped by polymerase chain reaction. Results Among 33 children infected neonatally with G10P[11] and 300 children not infected with rotavirus, there was no significant difference in the rates of rotavirus-positive diarrhea (rate ratio [RR], 1.05 [95% confidence interval {CI}, 0.61–1.79]), moderate or severe rotavirus-positive diarrhea (RR, 1.42 [95% CI, 0.73–2.78]), or asymptomatic rotavirus shedding (RR, 1.25 [95% CI, 0.85–1.83]). Conclusion Neonatal G10P[11] infection with a strain resembling a vaccine candidate did not confer protection against subsequent rotavirus infection or diarrhea of any severity in this setting. PMID:17262703

  3. Glycine triggers a non-ionotropic activity of GluN2A-containing NMDA receptors to confer neuroprotection.

    PubMed

    Hu, Rong; Chen, Juan; Lujan, Brendan; Lei, Ruixue; Zhang, Mi; Wang, Zefen; Liao, Mingxia; Li, Zhiqiang; Wan, Yu; Liu, Fang; Feng, Hua; Wan, Qi

    2016-10-03

    Ionotropic activation of NMDA receptors (NMDARs) requires agonist glutamate and co-agonist glycine. Here we show that glycine enhances the activation of cell survival-promoting kinase Akt in cultured cortical neurons in which both the channel activity of NMDARs and the glycine receptors are pre-inhibited. The effect of glycine is reduced by shRNA-mediated knockdown of GluN2A subunit-containing NMDARs (GluN2ARs), suggesting that a non-ionotropic activity of GluN2ARs mediates glycine-induced Akt activation. In support of this finding, glycine enhances Akt activation in HEK293 cells over-expressing GluN2ARs. The effect of glycine on Akt activation is sensitive to the antagonist of glycine-GluN1 binding site. As a functional consequence, glycine protects against excitotoxicity-induced neuronal death through the non-ionotropic activity of GluN2ARs and the neuroprotective effect is attenuated by Akt inhibition. Thus, this study reveals an unexpected role of glycine in eliciting a non-ionotropic activity of GluN2ARs to confer neuroprotection via Akt activation.

  4. Glycine triggers a non-ionotropic activity of GluN2A-containing NMDA receptors to confer neuroprotection

    PubMed Central

    Hu, Rong; Chen, Juan; Lujan, Brendan; Lei, Ruixue; Zhang, Mi; Wang, Zefen; Liao, Mingxia; Li, Zhiqiang; Wan, Yu; Liu, Fang; Feng, Hua; Wan, Qi

    2016-01-01

    Ionotropic activation of NMDA receptors (NMDARs) requires agonist glutamate and co-agonist glycine. Here we show that glycine enhances the activation of cell survival-promoting kinase Akt in cultured cortical neurons in which both the channel activity of NMDARs and the glycine receptors are pre-inhibited. The effect of glycine is reduced by shRNA-mediated knockdown of GluN2A subunit-containing NMDARs (GluN2ARs), suggesting that a non-ionotropic activity of GluN2ARs mediates glycine-induced Akt activation. In support of this finding, glycine enhances Akt activation in HEK293 cells over-expressing GluN2ARs. The effect of glycine on Akt activation is sensitive to the antagonist of glycine-GluN1 binding site. As a functional consequence, glycine protects against excitotoxicity-induced neuronal death through the non-ionotropic activity of GluN2ARs and the neuroprotective effect is attenuated by Akt inhibition. Thus, this study reveals an unexpected role of glycine in eliciting a non-ionotropic activity of GluN2ARs to confer neuroprotection via Akt activation. PMID:27694970

  5. Radiofrequency use and management. Impacts from the World Administrative Radio Conference of 1979

    NASA Astrophysics Data System (ADS)

    1982-01-01

    The impacts on the United States of key decisions taken at the general World Administrative Radio Conference (WARC-79) and options for preparation and participation in future international telecommunication conferences were evaluated. Congressional concern for the adequacy of existing machinery and procedures for U.S. policymaking and preparation for such conferences were reflected. WARC-79 and related international conferences demonstrate that contention for access to the radio spectrum and its important collateral element, the geostationary orbit for communication satellites, presents new and urgent challenges to vital U.S. national interests. Given the complexities of spectrum management in a changing world environment and the increased importance of telecommunications to both developed and developing nations, it is unlikely that traditional U.S. approaches to these issues are sufficient to protect vital U.S. interests in the future. Problems require strategies not yet developed or tested.

  6. An examination of the prospective association between religious service attendance and suicide: Explanatory factors and period effects.

    PubMed

    Kleiman, Evan M; Liu, Richard T

    2018-01-01

    We addressed two unanswered questions from prior research, demonstrating a prospective association between frequent religious service attendance and decreased risk for suicide. First, we assessed whether religious service attendance conferred protection from suicide even after accounting for strength of religious affiliation. Second, we evaluated whether the relationship between religious service attendance and suicide was subject to period effects. Data were drawn from the 1978-2010 General Social Survey, a nationally representative study of 30,650 non-institutionalized, English-speaking American residents age 18 or older. Data were linked with the National Death Index through the end of 2014. We analyzed these data using moderated Cox proportional hazard analyses. Religious affiliation had no relationship with suicide. Religious service attendance only had a protective effect against suicide death among those in later (2000-2010) rather than earlier (1998 and earlier) data collection periods. Secondary analysis of data limited the types of variables that were available. The protective nature of religion is due more to participating in religious activities, such as attending religious services, than to having a strong religious affiliation, and this effect exists primarily in more recent data collection periods. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. A Safe Vaccine (DV-STM-07) against Salmonella Infection Prevents Abortion and Confers Protective Immunity to the Pregnant and New Born Mice

    PubMed Central

    Negi, Vidya Devi; Nagarajan, Arvindhan G.; Chakravortty, Dipshikha

    2010-01-01

    Pregnancy is a transient immuno-compromised condition which has evolved to avoid the immune rejection of the fetus by the maternal immune system. The altered immune response of the pregnant female leads to increased susceptibility to invading pathogens, resulting in abortion and congenital defects of the fetus and a subnormal response to vaccination. Active vaccination during pregnancy may lead to abortion induced by heightened cell mediated immune response. In this study, we have administered the highly attenuated vaccine strain ΔpmrG-HM-D (DV-STM-07) in female mice before the onset of pregnancy and followed the immune reaction against challenge with virulent S. Typhimurium in pregnant mice. Here we demonstrate that DV-STM-07 vaccine gives protection against Salmonella in pregnant mice and also prevents Salmonella induced abortion. This protection is conferred by directing the immune response towards Th2 activation and Th1 suppression. The low Th1 response prevents abortion. The use of live attenuated vaccine just before pregnancy carries the risk of transmission to the fetus. We have shown that this vaccine is safe as the vaccine strain is quickly eliminated from the mother and is not transmitted to the fetus. This vaccine also confers immunity to the new born mice of vaccinated mothers. Since there is no evidence of the vaccine candidate reaching the new born mice, we hypothesize that it may be due to trans-colostral transfer of protective anti-Salmonella antibodies. These results suggest that our vaccine DV-STM-07 can be very useful in preventing abortion in the pregnant individuals and confer immunity to the new born. Since there are no such vaccine candidates which can be given to the new born and to the pregnant women, this vaccine holds a very bright future to combat Salmonella induced pregnancy loss. PMID:20161765

  8. VP2 (PTA motif) encoding DNA vaccine confers protection against lethal challenge with infectious pancreatic necrosis virus (IPNV) in trout.

    PubMed

    Ahmadivand, Sohrab; Soltani, Mehdi; Behdani, Mahdi; Evensen, Øystein; Alirahimi, Ehsan; Soltani, Elahe; Hassanzadeh, Reza; Ashrafi-Helan, Javad

    2018-02-01

    IPNV in Atlantic salmon is represented by various strains with different virulence and immunogenicity linked to various motifs of the VP2 capsid. IPNV variant with P 217 , T 221 , A 247 (PTA) motif is found to be avirulent in Atlantic salmon, but virulent in rainbow trout, and other salmonid species. This study describes a DNA vaccine delivered intramuscularly encoding the VP2 protein of infectious pancreatic necrosis virus (IPNV) with PTA motif that confers high protection in rainbow trout (Oncorhynchus mykiss). Intramuscular injection of 2, 5 and 10 μg of DNA (pcDNA3.1-VP2) in rainbow trout fry (4-5 g), confers relative protection of 75-83% in the different vaccine groups at 30 days post vaccination (450° days). The VP2 gene is expressed in spleen, kidney, muscle and liver at day 30 post-vaccination (RT-PCR), and IFN-1 and Mx-1 mRNA are upregulated at early time post vaccination, and so also for IgM, IgT, CD4 and CD8 in the head kidney of vaccinated fish compared to controls, 15 and 30 days post vaccination. Significant increase of serum anti-IPNV antibodies was found 30-90 days post-vaccination that was correlated with protection levels. Mortality corresponded with viral VP4 gene expression were significantly decreased in vaccinated and challenged fish. This shows for the first time that a VP2-encoding DNA vaccine delivered intramuscularly elicits a high level of protection alongside with high levels of circulating antibodies in rainbow trout and a lowered viral replication. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Partial protection of SIV-infected rhesus monkeys against superinfection with a heterologous SIV isolate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Korber, Bette

    2009-01-01

    Although there is increasing evidence that individuals already infected with human immunodeficiency virus type 1 (HIV-1) can be infected with a heterologous strain of the virus, the extent of protection against superinfection conferred by the first infection and the biologic consequences of superinfection are not well understood. We explored these questions in the simian immunodeficiency virus (SIV)/rhesus monkey model of HIV-1/AIDS. We infected cohorts of rhesus monkeys with either SIVmac251 or SIVsmE660 and then exposed animals to the reciprocal virus through intrarectal inoculations. Employing a quantitative real-time PCR assay, we determined the replication kinetics of the two strains of virusmore » for 20 weeks. We found that primary infection with a replication-competent virus did not protect against acquisition of infection by a heterologous virus but did confer relative control of the superinfecting virus. In animals that became superinfected, there was a reduction in peak replication and rapid control of the second virus. The relative susceptibility to superinfection was not correlated with CD4(+) T-cell count, CD4(+) memory T-cell subsets, cytokine production by virus-specific CD8(+) or CD4(+) cells, or neutralizing antibodies at the time of exposure to the second virus. Although there were transient increases in viral loads of the primary virus and a modest decline in CD4(+) T-cell counts after superinfection, there was no evidence of disease acceleration. These findings indicate that an immunodeficiency virus infection confers partial protection against a second immunodeficiency virus infection, but this protection may be mediated by mechanisms other than classical adaptive immune responses.« less

  10. Impacts of regional transport on black carbon in Huairou, Beijing, China.

    PubMed

    Wang, Yuqin; de Foy, Benjamin; Schauer, James J; Olson, Michael R; Zhang, Yang; Li, Zhengqiang; Zhang, Yuanxun

    2017-02-01

    The 22 nd Asia-Pacific Economic Cooperation (APEC) Conference was held near Yanqi Lake, Huairou, in Beijing, China during November 10-11, 2014. To guarantee haze-free days during the APEC Conference, the Beijing government and the governments of the surrounding provinces implemented a series of controls. Three months of Aethalometer 880 nm black carbon (BC) measurements were examined to understand the hourly fluctuations in BC concentrations that resulted from emission controls and meteorology changes. Measurements were collected at the University of Chinese Academy of Sciences near the APEC Conference site and in Central Beijing at the Institute of Remote Sensing and Digital Earth of the Chinese Academy of Sciences. Synoptic conditions are successfully represented through analysis of backward trajectories in six cluster groups. The clusters are identified based on air mass transport from various areas such as Inner Mongolia, Russia, three northeastern provinces, and Hebei industrial areas, to the measurement sites. Air pollution control measures during the APEC Conference significantly reduced BC at the conference site (Huairou) and in Central Beijing, with greater reductions in BC concentrations at the conference site than in Central Beijing. The highest BC concentrations in Huairou were associated with air masses originating from Central Beijing rather than from the Hebei industrial region. The success of the control measures implemented in Beijing and the surrounding regions demonstrates that BC concentrations can be effectively reduced to protect human health and mitigate regional climate forcing. This study also demonstrates the need for regional strategies to reduce BC concentrations, since urban areas like Beijing are sources as well as downwind receptors of emissions. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Gut Microbiota Elicits a Protective Immune Response against Malaria Transmission

    PubMed Central

    Yilmaz, Bahtiyar; Portugal, Silvia; Tran, Tuan M.; Gozzelino, Raffaella; Ramos, Susana; Gomes, Joana; Regalado, Ana; Cowan, Peter J.; d’Apice, Anthony J.F.; Chong, Anita S.; Doumbo, Ogobara K.; Traore, Boubacar; Crompton, Peter D.; Silveira, Henrique; Soares, Miguel P.

    2014-01-01

    Summary Glycosylation processes are under high natural selection pressure, presumably because these can modulate resistance to infection. Here, we asked whether inactivation of the UDP-galactose:β-galactoside-α1-3-galactosyltransferase (α1,3GT) gene, which ablated the expression of the Galα1-3Galβ1-4GlcNAc-R (α-gal) glycan and allowed for the production of anti-α-gal antibodies (Abs) in humans, confers protection against Plasmodium spp. infection, the causative agent of malaria and a major driving force in human evolution. We demonstrate that both Plasmodium spp. and the human gut pathobiont E. coli O86:B7 express α-gal and that anti-α-gal Abs are associated with protection against malaria transmission in humans as well as in α1,3GT-deficient mice, which produce protective anti-α-gal Abs when colonized by E. coli O86:B7. Anti-α-gal Abs target Plasmodium sporozoites for complement-mediated cytotoxicity in the skin, immediately after inoculation by Anopheles mosquitoes. Vaccination against α-gal confers sterile protection against malaria in mice, suggesting that a similar approach may reduce malaria transmission in humans. PaperFlick PMID:25480293

  12. D-METHIONINE REDUCES TOBRAMYCIN-INDUCED OTOTOXICITY WITHOUT ANTIMICROBIAL INTERFERENCE IN ANIMAL MODELS

    PubMed Central

    Fox, Daniel J.; Cooper, Morris D.; Speil, Cristian A.; Roberts, Melissa H.; Yanik, Susan C.; Meech, Robert P.; Hargrove, Tim L.; Verhulst, Steven J.; Rybak, Leonard P.; Campbell, Kathleen C. M.

    2015-01-01

    Background Tobramycin is a critical cystic fibrosis treatment however it causes ototoxicity. This study tested D-methionine protection from tobramycin-induced ototoxicity and potential antimicrobial interference. Methods Auditory brainstem responses (ABR) and outer hair cell (OHC) quantifications measured protection in guinea pigs treated with tobramycin and a range of D-methionine doses. In vitro antimicrobial interference studies tested inhibition and post antibiotic effect assays. In vivo antimicrobial interference studies tested normal and neutropenic E. coli murine survival and intraperitoneal lavage bacterial counts. Results D-methionine conferred significant ABR threshold shift reductions. OHC protection was less robust but significant at 20 kHz in the 420 mg/kg/day group. In vitro studies did not detect D-methionine-induced antimicrobial interference. In vivo studies did not detect D-methionine-induced interference in normal or neutropenic mice. Conclusions D-methionine protects from tobramycin-induced ototoxicity without antimicrobial interference. The study results suggest D-met as a potential otoprotectant from clinical tobramycin use in cystic fibrosis patients. PMID:26166286

  13. d-Methionine reduces tobramycin-induced ototoxicity without antimicrobial interference in animal models.

    PubMed

    Fox, Daniel J; Cooper, Morris D; Speil, Cristian A; Roberts, Melissa H; Yanik, Susan C; Meech, Robert P; Hargrove, Tim L; Verhulst, Steven J; Rybak, Leonard P; Campbell, Kathleen C M

    2016-07-01

    Tobramycin is a critical cystic fibrosis treatment however it causes ototoxicity. This study tested d-methionine protection from tobramycin-induced ototoxicity and potential antimicrobial interference. Auditory brainstem responses (ABRs) and outer hair cell (OHC) quantifications measured protection in guinea pigs treated with tobramycin and a range of d-methionine doses. In vitro antimicrobial interference studies tested inhibition and post antibiotic effect assays. In vivo antimicrobial interference studies tested normal and neutropenic Escherichia coli murine survival and intraperitoneal lavage bacterial counts. d-Methionine conferred significant ABR threshold shift reductions. OHC protection was less robust but significant at 20kHz in the 420mg/kg/day group. In vitro studies did not detect d-methionine-induced antimicrobial interference. In vivo studies did not detect d-methionine-induced interference in normal or neutropenic mice. d-Methionine protects from tobramycin-induced ototoxicity without antimicrobial interference. The study results suggest d-met as a potential otoprotectant from clinical tobramycin use in cystic fibrosis patients. Published by Elsevier B.V.

  14. A New Adjuvant Combined with Inactivated Influenza Enhances Specific CD8 T Cell Response in Mice and Decreases Symptoms in Swine Upon Challenge.

    PubMed

    Bouguyon, Edwige; Goncalves, Elodie; Shevtsov, Alexander; Maisonnasse, Pauline; Remyga, Stepan; Goryushev, Oleg; Deville, Sebastien; Bertho, Nicolas; Ben Arous, Juliette

    2015-11-01

    Vaccination is the most effective way to control swine influenza virus (SIV) in the field. Classical vaccines are based on inactivated antigens formulated with an oil emulsion or a polymeric adjuvant. Standard adjuvants enhance the humoral response and orient the immune response toward a Th2 response. An important issue is that current vaccines do not protect against new strains. One approach to improve cross-protection is to enhance Th1 and cytotoxic responses. The development of adjuvants orienting the immune response of inactivated vaccines toward Th1/Cytotoxic responses would be highly beneficial. This study shows that the water in oil in water emulsion adjuvant Montanide™ ISA 201 VG allows the induction of anti-influenza CD8 T cell in mice and induces homologous protection against an H1N1 challenge in swine. Such adjuvants that induce both humoral and cell-mediated immunity could improve the protection conferred by SIV vaccines in the field.

  15. Aflatoxicosis chemoprevention by probiotic Lactobacillius and lack of effect on the major histocompatibility complex.

    PubMed

    Rawal, Sumit; Bauer, Miranda M; Mendoza, Kristelle M; El-Nezami, Hani; Hall, Jeffery R; Kim, Ji Eun; Stevens, John R; Reed, Kent M; Coulombe, Roger A

    2014-10-01

    Turkeys are extremely sensitive to aflatoxin B1 (AFB1) which causes decreased growth, immunosuppression and liver necrosis. The purpose of this study was to determine whether probiotic Lactobacillus, shown to be protective in animal and clinical studies, would likewise confer protection in turkeys, which were treated for 11 days with either AFB1 (AFB; 1 ppm in diet), probiotic (PB; 1 × 10(11) CFU/ml; oral, daily), probiotic + AFB1 (PBAFB), or PBS control (CNTL). The AFB1 induced drop in body and liver weights were restored to normal in CNTL and PBAFB groups. Hepatotoxicity markers were not significantly reduced by probiotic treatment. Major histocompatibility complex (MHC) genes BG1 and BG4, which are differentially expressed in liver and spleens, were not significantly affected by treatments. These data indicate modest protection, but the relatively high dietary AFB1 treatment, and the extreme sensitivity of this species may reveal limits of probiotic-based protection strategies. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Discovering naturally processed antigenic determinants that confer protective T cell immunity

    PubMed Central

    Gilchuk, Pavlo; Spencer, Charles T.; Conant, Stephanie B.; Hill, Timothy; Gray, Jennifer J.; Niu, Xinnan; Zheng, Mu; Erickson, John J.; Boyd, Kelli L.; McAfee, K. Jill; Oseroff, Carla; Hadrup, Sine R.; Bennink, Jack R.; Hildebrand, William; Edwards, Kathryn M.; Crowe, James E.; Williams, John V.; Buus, Søren; Sette, Alessandro; Schumacher, Ton N.M.; Link, Andrew J.; Joyce, Sebastian

    2013-01-01

    CD8+ T cells (TCD8) confer protective immunity against many infectious diseases, suggesting that microbial TCD8 determinants are promising vaccine targets. Nevertheless, current T cell antigen identification approaches do not discern which epitopes drive protective immunity during active infection — information that is critical for the rational design of TCD8-targeted vaccines. We employed a proteomics-based approach for large-scale discovery of naturally processed determinants derived from a complex pathogen, vaccinia virus (VACV), that are presented by the most frequent representatives of four major HLA class I supertypes. Immunologic characterization revealed that many previously unidentified VACV determinants were recognized by smallpox-vaccinated human peripheral blood cells in a variegated manner. Many such determinants were recognized by HLA class I–transgenic mouse immune TCD8 too and elicited protective TCD8 immunity against lethal intranasal VACV infection. Notably, efficient processing and stable presentation of immune determinants as well as the availability of naive TCD8 precursors were sufficient to drive a multifunctional, protective TCD8 response. Our approach uses fundamental insights into T cell epitope processing and presentation to define targets of protective TCD8 immunity within human pathogens that have complex proteomes, suggesting that this approach has general applicability in vaccine sciences. PMID:23543059

  17. Discovering naturally processed antigenic determinants that confer protective T cell immunity.

    PubMed

    Gilchuk, Pavlo; Spencer, Charles T; Conant, Stephanie B; Hill, Timothy; Gray, Jennifer J; Niu, Xinnan; Zheng, Mu; Erickson, John J; Boyd, Kelli L; McAfee, K Jill; Oseroff, Carla; Hadrup, Sine R; Bennink, Jack R; Hildebrand, William; Edwards, Kathryn M; Crowe, James E; Williams, John V; Buus, Søren; Sette, Alessandro; Schumacher, Ton N M; Link, Andrew J; Joyce, Sebastian

    2013-05-01

    CD8+ T cells (TCD8) confer protective immunity against many infectious diseases, suggesting that microbial TCD8 determinants are promising vaccine targets. Nevertheless, current T cell antigen identification approaches do not discern which epitopes drive protective immunity during active infection - information that is critical for the rational design of TCD8-targeted vaccines. We employed a proteomics-based approach for large-scale discovery of naturally processed determinants derived from a complex pathogen, vaccinia virus (VACV), that are presented by the most frequent representatives of four major HLA class I supertypes. Immunologic characterization revealed that many previously unidentified VACV determinants were recognized by smallpox-vaccinated human peripheral blood cells in a variegated manner. Many such determinants were recognized by HLA class I-transgenic mouse immune TCD8 too and elicited protective TCD8 immunity against lethal intranasal VACV infection. Notably, efficient processing and stable presentation of immune determinants as well as the availability of naive TCD8 precursors were sufficient to drive a multifunctional, protective TCD8 response. Our approach uses fundamental insights into T cell epitope processing and presentation to define targets of protective TCD8 immunity within human pathogens that have complex proteomes, suggesting that this approach has general applicability in vaccine sciences.

  18. Effectiveness analyses may underestimate protection of infants after group C meningococcal immunization.

    PubMed

    Vu, David M; Kelly, Dominic; Heath, Paul T; McCarthy, Noel D; Pollard, Andrew J; Granoff, Dan M

    2006-07-15

    Group C meningococcal conjugate-vaccine effectiveness in the United Kingdom declines from ~90% in the first year to 0% between 1 and 4 years after immunization in infants immunized at 2, 3, and 4 months of age and to 61% in toddlers given a single dose. Confidence intervals are wide, and the extent of protection is uncertain. Serum samples were obtained from children 3-5 years of age who were participants in a preschool booster-vaccine trial. Serum bactericidal activity was measured with human complement. Group C anticapsular antibody concentrations were measured by a radioantigen binding assay. Passive protection was analyzed in an infant rat bacteremia model. Serum samples from UK children who had been immunized 2-3 years earlier as infants or toddlers had higher levels of radioantigen binding, bactericidal activity, and passive protection than did historical control serum samples from unimmunized children (P<.05). A higher proportion of children immunized as infants had serum bactericidal activity titers > or =1 : 4 (considered to be protective) than those immunized as toddlers (61% vs. 24%; P<.01), but there were no significant differences in the proportion of serum samples conferring passive protection (50% and 41%, respectively; P=.4). We found no evidence of lower immunity in children immunized as infants than as toddlers. On the basis of serum bactericidal activity and/or passive protection, 40%-50% of both age groups are protected at 2-3 years after immunization, which was significantly greater than in unimmunized historical controls (<5%).

  19. Vaccination with poly(D,L-lactide-co-glycolide) nanoparticles loaded with soluble Leishmania antigens and modified with a TNFα-mimicking peptide or monophosphoryl lipid A confers protection against experimental visceral leishmaniasis.

    PubMed

    Margaroni, Maritsa; Agallou, Maria; Athanasiou, Evita; Kammona, Olga; Kiparissides, Costas; Gaitanaki, Catherine; Karagouni, Evdokia

    2017-01-01

    Visceral leishmaniasis (VL) persists as a major public health problem, and since the existing chemotherapy is far from satisfactory, development of an effective vaccine emerges as the most appropriate strategy for confronting VL. The development of an effective vaccine relies on the selection of the appropriate antigen and also the right adjuvant and/or delivery vehicle. In the present study, the protective efficacy of poly(D,L-lactide-co-glycolide) (PLGA) nanoparticles (NPs), which were surface-modified with a TNFα-mimicking eight-amino-acid peptide (p8) and further functionalized by encapsulating soluble Leishmania infantum antigens (sLiAg) and monophosphoryl lipid A (MPLA), a TLR4 ligand, was evaluated against challenge with L. infantum parasites in BALB/c mice. Vaccination with these multifunctionalized PLGA nanoformulations conferred significant protection against parasite infection in vaccinated mice. In particular, vaccination with PLGA-sLiAg-MPLA or p8-PLGA-sLiAg NPs resulted in almost complete elimination of the parasite in the spleen for up to 4 months post-challenge. Parasite burden reduction was accompanied by antigen-specific humoral and cellular immune responses. Specifically, injection with PLGA-sLiAg-MPLA raised exclusively anti-sLiAg IgG1 antibodies post-vaccination, while in p8-PLGA-sLiAg-vaccinated mice, no antibody production was detected. However, 4 months post-challenge, in mice vaccinated with all the multifunctionalized NPs, antibody class switching towards IgG2a subtype was observed. The study of cellular immune responses revealed the increased proliferation capacity of spleen cells against sLiAg, consisting of IFNγ-producing CD4 + and CD8 + T cells. Importantly, the activation of CD8 + T cells was exclusively attributed to vaccination with PLGA NPs surface-modified with the p8 peptide. Moreover, characterization of cytokine production in vaccinated-infected mice revealed that protection was accompanied by significant increase of IFNγ and lower levels of IL-4 and IL-10 in protected mice when compared to control infected group. Conclusively, the above nanoformulations hold promise for future vaccination strategies against VL.

  20. Orbital Debris: A Chronology

    NASA Technical Reports Server (NTRS)

    Portree, Davis S. F. (Editor); Loftus, Joseph P., Jr. (Editor)

    1999-01-01

    This chronology covers the 37-year history of orbital debris concerns. It tracks orbital debris hazard creation, research, observation, experimentation, management, mitigation, protection, and policy. Included are debris-producing, events; U.N. orbital debris treaties, Space Shuttle and space station orbital debris issues; ASAT tests; milestones in theory and modeling; uncontrolled reentries; detection system development; shielding development; geosynchronous debris issues, including reboost policies: returned surfaces studies, seminar papers reports, conferences, and studies; the increasing effect of space activities on astronomy; and growing international awareness of the near-Earth environment.

  1. Effect of Prior Immunization on Induction of Cervical Cancer in Mice by Herpes Simplex Virus Type 2

    NASA Astrophysics Data System (ADS)

    Budd Wentz, W.; Heggie, Alfred D.; Anthony, Donald D.; Reagan, James W.

    1983-12-01

    Previous studies at this laboratory showed that repeated application of inactivated herpes simplex virus type 2 to the mouse cervix produces premalignant and malignant lesions. In the present study mice were inoculated with inactivated herpes simplex virus type 2 or control solution and Freund's adjuvant by intraperitoneal and subcutaneous routes before exposure of the cervix to inactivated virus. It appears that immunization with inactivated virus conferred a protection against the induction of cervical carcinoma.

  2. Heme Catabolism by Heme Oxygenase-1 Confers Host Resistance to Mycobacterium Infection

    PubMed Central

    Silva-Gomes, Sandro; Appelberg, Rui; Larsen, Rasmus; Soares, Miguel Parreira

    2013-01-01

    Heme oxygenases (HO) catalyze the rate-limiting step of heme degradation. The cytoprotective action of the inducible HO-1 isoform, encoded by the Hmox1 gene, is required for host protection against systemic infections. Here we report that upregulation of HO-1 expression in macrophages (Mϕ) is strictly required for protection against mycobacterial infection in mice. HO-1-deficient (Hmox1−/−) mice are more susceptible to intravenous Mycobacterium avium infection, failing to mount a protective granulomatous response and developing higher pathogen loads, than infected wild-type (Hmox1+/+) controls. Furthermore, Hmox1−/− mice also develop higher pathogen loads and ultimately succumb when challenged with a low-dose aerosol infection with Mycobacterium tuberculosis. The protective effect of HO-1 acts independently of adaptive immunity, as revealed in M. avium-infected Hmox1−/− versus Hmox1+/+ SCID mice lacking mature B and T cells. In the absence of HO-1, heme accumulation acts as a cytotoxic pro-oxidant in infected Mϕ, an effect mimicked by exogenous heme administration to M. avium-infected wild-type Mϕ in vitro or to mice in vivo. In conclusion, HO-1 prevents the cytotoxic effect of heme in Mϕ, contributing critically to host resistance to Mycobacterium infection. PMID:23630967

  3. African Swine Fever Virus Georgia Isolate Harboring Deletions of MGF360 and MGF505 Genes Is Attenuated in Swine and Confers Protection against Challenge with Virulent Parental Virus.

    PubMed

    O'Donnell, Vivian; Holinka, Lauren G; Gladue, Douglas P; Sanford, Brenton; Krug, Peter W; Lu, Xiqiang; Arzt, Jonathan; Reese, Bo; Carrillo, Consuelo; Risatti, Guillermo R; Borca, Manuel V

    2015-06-01

    African swine fever virus (ASFV) is the etiological agent of a contagious and often lethal disease of domestic pigs that has significant economic consequences for the swine industry. The control of African swine fever (ASF) has been hampered by the unavailability of vaccines. Experimental vaccines have been developed using genetically modified live attenuated ASFVs where viral genes involved in virus virulence were removed from the genome. Multigene family 360 (MGF360) and MGF505 represent a group of genes sharing partial sequence and structural identities that have been connected with ASFV host range specificity, blocking of the host innate response, and virus virulence. Here we report the construction of a recombinant virus (ASFV-G-ΔMGF) derived from the highly virulent ASFV Georgia 2007 isolate (ASFV-G) by specifically deleting six genes belonging to MGF360 or MGF505: MGF505-1R, MGF360-12L, MGF360-13L, MGF360-14L, MGF505-2R, and MGF505-3R. ASFV-G-ΔMGF replicates as efficiently in primary swine macrophage cell cultures as the parental virus. In vivo, ASFV-G-ΔMGF is completely attenuated in swine, since pigs inoculated intramuscularly (i.m.) with either 10(2) or 10(4) 50% hemadsorbing doses (HAD50) remained healthy, without signs of the disease. Importantly, when these animals were subsequently exposed to highly virulent parental ASFV-G, no signs of the disease were observed, although a proportion of these animals harbored the challenge virus. This is the first report demonstrating the role of MGF genes acting as independent determinants of ASFV virulence. Additionally, ASFV-G-ΔMGF is the first experimental vaccine reported to induce protection in pigs challenged with highly virulent and epidemiologically relevant ASFV-G. The main problem for controlling ASF is the lack of vaccines. Studies focusing on understanding ASFV virulence led to the production of genetically modified recombinant viruses that, while attenuated, are able to confer protection in pigs challenged with homologous viruses. Here we have produced an attenuated recombinant ASFV derived from highly virulent ASFV strain Georgia (ASFV-G) lacking only six of the multigene family 360 (MGF360) and MGF505 genes (ASFV-G-ΔMGF). It is demonstrated, by first time, that deleting specific MGF genes alone can completely attenuate a highly virulent field ASFV isolate. Recombinant virus ASFV-G-ΔMGF effectively confers protection in pigs against challenge with ASFV-G when delivered once via the intramuscular (i.m.) route. The protection against ASFV-G is highly effective by 28 days postvaccination. This is the first report of an experimental vaccine that induces solid protection against virulent ASFV-G. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  4. Transcutaneous immunization via rapidly dissolvable microneedles protects against hand-foot-and-mouth disease caused by enterovirus 71.

    PubMed

    Zhu, Zhuangzhi; Ye, Xiaohua; Ku, Zhiqiang; Liu, Qingwei; Shen, Chaoyun; Luo, Huafei; Luan, Hansen; Zhang, Chenghao; Tian, Shaoqiong; Lim, CheeYen; Huang, Zhong; Wang, Hao

    2016-12-10

    Recent large outbreaks of hand-foot-and-mouth disease (HFMD) have seriously affected the health of young children. Enterovirus 71 (EV71) is the main causative agent of HFMD. Herein, for the first time, rapidly dissolvable microneedles (MNs) loaded with EV71 virus-like particles (VLPs) were evaluated whether they could induce robust immune responses that confer protection against EV71 infection. The characteristics of prepared MNs including hygroscopy, mechanical strength, insertion capacity, dissolution profile, skin irritation and storage stability were comprehensively assessed. EV71 VLPs remained morphologically stable during fabrication. The MNs made of sodium hyaluronate maintained their insertion ability for at least 3h even at a high relative humidity of 75%. With the aid of spring-operated applicator, EV71 MNs (approximately 500μm length) could be readily penetrated into the mouse skin in vivo, and then rapidly dissolved to release encapsulated antigen within 2min. Additionally, MNs induced slight erythema that disappeared within a few hours. More importantly, mouse immunization and virus challenge studies demonstrated that MNs immunization induced high level of antibody responses conferring full protection against lethal EV71 virus challenge that were comparable to conventional intramuscular injection, but with only 1/10th of the delivered antigen (dose sparing). Consequently, our rapidly dissolving MNs may present as an effective and promising transcutaneous immunization device for HFMD prophylaxis among children. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Combination of Pneumococcal Surface Protein A (PspA) with Whole Cell Pertussis Vaccine Increases Protection Against Pneumococcal Challenge in Mice

    PubMed Central

    Ferreira, Daniela M.; Moreno, Adriana T.; Ferreira, Patricia C. D.; Lima, Fernanda A.; Santos, Fernanda L.; Sakauchi, Maria Aparecida; Takata, Célia S.; Higashi, Hisako G.; Raw, Isaías; Kubrusly, Flavia S.; Ho, Paulo L.

    2010-01-01

    Streptococcus pneumoniae is the leading cause of respiratory acute infections around the world. In Latin America, approximately 20,000 children under 5 years of age die of pneumococcal diseases annually. Pneumococcal surface protein A (PspA) is among the best-characterized pneumococcal antigens that confer protection in animal models of pneumococcal infections and, as such, is a good alternative for the currently available conjugated vaccines. Efficient immune responses directed to PspA in animal models have already been described. Nevertheless, few low cost adjuvants for a subunit pneumococcal vaccine have been proposed to date. Here, we have tested the adjuvant properties of the whole cell Bordetella pertussis vaccine (wP) that is currently part of the DTP (diphtheria-tetanus-pertussis) vaccine administrated to children in several countries, as an adjuvant to PspA. Nasal immunization of BALB/c mice with a combination of PspA5 and wP or wPlow – a new generation vaccine that contains low levels of B. pertussis LPS – conferred protection against a respiratory lethal challenge with S. pneumoniae. Both PspA5-wP and PspA5-wPlow vaccines induced high levels of systemic and mucosal antibodies against PspA5, with similar profile, indicating no essential requirement for B. pertussis LPS in the adjuvant properties of wP. Accordingly, nasal immunization of C3H/HeJ mice with PspA5-wP conferred protection against the pneumococcal challenge, thus ruling out a role for TLR4 responses in the adjuvant activity and the protection mechanisms triggered by the vaccines. The high levels of anti-PspA5 antibodies correlated with increased cross-reactivity against PspAs from different clades and also reflected in cross-protection. In addition, passive immunization experiments indicated that antibodies played an important role in protection in this model. Finally, subcutaneous immunization with a combination of PspA5 with DTPlow protected mice against challenge with two different pneumococcal strains, opening the possibility for the development of a combined infant vaccine composed of DTP and PspA. PMID:20523738

  6. The impact of phenotypic and genotypic G6PD deficiency on risk of plasmodium vivax infection: a case-control study amongst Afghan refugees in Pakistan.

    PubMed

    Leslie, Toby; Briceño, Marnie; Mayan, Ismail; Mohammed, Nasir; Klinkenberg, Eveline; Sibley, Carol Hopkins; Whitty, Christopher J M; Rowland, Mark

    2010-05-25

    The most common form of malaria outside Africa, Plasmodium vivax, is more difficult to control than P. falciparum because of the latent liver hypnozoite stage, which causes multiple relapses and provides an infectious reservoir. The African (A-) G6PD (glucose-6-phosphate dehydrogenase) deficiency confers partial protection against severe P. falciparum. Recent evidence suggests that the deficiency also confers protection against P. vivax, which could explain its wide geographical distribution in human populations. The deficiency has a potentially serious interaction with antirelapse therapies (8-aminoquinolines such as primaquine). If the level of protection was sufficient, antirelapse therapy could become more widely available. We therefore tested the hypothesis that G6PD deficiency is protective against vivax malaria infection. A case-control study design was used amongst Afghan refugees in Pakistan. The frequency of phenotypic and genotypic G6PD deficiency in individuals with vivax malaria was compared against controls who had not had malaria in the previous two years. Phenotypic G6PD deficiency was less common amongst cases than controls (cases: 4/372 [1.1%] versus controls 42/743 [5.7%]; adjusted odds ratio [AOR] 0.18 [95% confidence interval (CI) 0.06-0.52], p = 0.001). Genetic analysis demonstrated that the G6PD deficiency allele identified (Mediterranean type) was associated with protection in hemizygous deficient males (AOR = 0.12 [95% CI 0.02-0.92], p = 0.041). The deficiency was also protective in females carrying the deficiency gene as heterozygotes or homozygotes (pooled AOR = 0.37 [95% CI 0.15-0.94], p = 0.037). G6PD deficiency (Mediterranean type) conferred significant protection against vivax malaria infection in this population whether measured by phenotype or genotype, indicating a possible evolutionary role for vivax malaria in the selective retention of the G6PD deficiency trait in human populations. Further work is required on the genotypic protection associated with other types of G6PD deficiency and on developing simple point-of-care technologies to detect it before administering antirelapse therapy.

  7. Pleural innate response activator B cells protect against pneumonia via a GM-CSF-IgM axis

    PubMed Central

    Chousterman, Benjamin G.; Hilgendorf, Ingo; Robbins, Clinton S.; Theurl, Igor; Gerhardt, Louisa M.S.; Iwamoto, Yoshiko; Quach, Tam D.; Ali, Muhammad; Chen, John W.; Rothstein, Thomas L.; Nahrendorf, Matthias; Weissleder, Ralph

    2014-01-01

    Pneumonia is a major cause of mortality worldwide and a serious problem in critical care medicine, but the immunophysiological processes that confer either protection or morbidity are not completely understood. We show that in response to lung infection, B1a B cells migrate from the pleural space to the lung parenchyma to secrete polyreactive emergency immunoglobulin M (IgM). The process requires innate response activator (IRA) B cells, a transitional B1a-derived inflammatory subset which controls IgM production via autocrine granulocyte/macrophage colony-stimulating factor (GM-CSF) signaling. The strategic location of these cells, coupled with the capacity to produce GM-CSF–dependent IgM, ensures effective early frontline defense against bacteria invading the lungs. The study describes a previously unrecognized GM-CSF-IgM axis and positions IRA B cells as orchestrators of protective IgM immunity. PMID:24821911

  8. Designing malaria vaccines to circumvent antigen variability✩

    PubMed Central

    Ouattara, Amed; Barry, Alyssa E.; Dutta, Sheetij; Remarque, Edmond J.; Beeson, James G.; Plowe, Christopher V.

    2016-01-01

    Prospects for malaria eradication will be greatly enhanced by an effective vaccine, but parasite genetic diversity poses a major impediment to malaria vaccine efficacy. In recent pre-clinical and field trials, vaccines based on polymorphic Plasmodium falciparum antigens have shown efficacy only against homologous strains, raising the specter of allele-specific immunity such as that which plagues vaccines against influenza and HIV. The most advanced malaria vaccine, RTS,S, targets relatively conserved epitopes on the P. falciparum circumsporozoite protein. After more than 40 years of development and testing, RTS,S, has shown significant but modest efficacy against clinical malaria in phase 2 and 3 trials. Ongoing phase 2 studies of an irradiated sporozoite vaccine will ascertain whether the full protection against homologous experimental malaria challenge conferred by high doses of a whole organism vaccine can provide protection against diverse strains in the field. Here we review and evaluate approaches being taken to design broadly cross-protective malaria vaccines. PMID:26475447

  9. Multifaceted Defense against Listeria monocytogenes in the Gastro-Intestinal Lumen

    PubMed Central

    Becattini, Simone; Pamer, Eric G.

    2017-01-01

    Listeria monocytogenes is a foodborne pathogen that can cause febrile gastroenteritis in healthy subjects and systemic infections in immunocompromised individuals. Despite the high prevalence of L. monocytogenes in the environment and frequent contamination of uncooked meat and poultry products, infections with this pathogen are relatively uncommon, suggesting that protective defenses in the general population are effective. In the mammalian gastrointestinal tract, a variety of defense mechanisms prevent L. monocytogenes growth, epithelial penetration and systemic dissemination. Among these defenses, colonization resistance mediated by the gut microbiota is crucial in protection against a range of intestinal pathogens, including L. monocytogenes. Here we review defined mechanisms of defense against L. monocytogenes in the lumen of the gastro-intestinal tract, with particular emphasis on protection conferred by the autochthonous microbiota. We suggest that selected probiotic species derived from the microbiota may be developed for eventual clinical use to enhance resistance against L. monocytogenes infections. PMID:29271903

  10. Novel vaccine strategies against emerging viruses

    PubMed Central

    García-Sastre, Adolfo; Mena, Ignacio

    2013-01-01

    One of the main public health concerns of emerging viruses is their potential introduction into and sustained circulation among populations of immunologically naïve, susceptible hosts. The induction of protective immunity through vaccination can be a powerful tool to prevent this concern by conferring protection to the population at risk. Conventional approaches to develop vaccines against emerging pathogens have significant limitations: lack of experimental tools for several emerging viruses of concern, poor immunogenicity, safety issues, or lack of cross-protection against antigenic variants. The unpredictability of the emergence of future virus threats demands the capability to rapidly develop safe, effective vaccines. We describe some recent advances in new vaccine strategies that are being explored as alternatives to classical attenuated and inactivated vaccines, and provide examples of potential novel vaccines for emerging viruses. These approaches might be applied to the control of many other emerging pathogens. PMID:23477832

  11. An Overview: Consumer Protection in Higher Education. Why? For Whom? How?

    ERIC Educational Resources Information Center

    Willett, Sandra L.

    The protection of the student and prospective student at the postsecondary level is examined. Twenty-five possible educational abuses and concerns, such as discriminatory refund policies and misrepresentation, identified by the Federal Interagency on Education are listed. Ten issues selected as the thrust of the first National Conference on…

  12. From Punishment to Education: The International Debate on Juvenile Penal Reform before World War I

    ERIC Educational Resources Information Center

    Fuchs, Eckhardt

    2015-01-01

    The article addresses international efforts at child protection, emphasizing the criminal law on juveniles before 1914, and focuses on key international organizations and their various conferences and congresses. Although there was an institutional divide between welfare in general, child protection and youth crime, the organizations covered…

  13. Proceedings of papers presented at the 2nd international symposium on applications of biotechnology to tree culture, protection, and utilization.

    Treesearch

    Charles H. Michler; Michael R. Becwar; Daniel Cullen; Warren L. Nance; Ronald R. Sederoff; James M. Silvicek

    1994-01-01

    Contains 38 oral presentation abstracts, 34 poster abstracts, and 18 manuscripts on applications of biotechnology to tree research in the areas of stress resistance, protection, and wood utilization presented at an international conference in Bloomington, Minnesota, October 2-6, 1994.

  14. African swine fever virus serotype-specific proteins are significant protective antigens for African swine fever

    USDA-ARS?s Scientific Manuscript database

    African swine fever (ASF) is an emerging disease threat for the swine industry worldwide. No ASF vaccine is available and progress is hindered by lack of knowledge concerning the extent of African swine fever virus (ASFV) strain diversity and the viral antigens conferring type specific protective im...

  15. Maternally derived antibodies in commercial broiler chickens did not significantly interfere with protection of Newcastle disease virus vectored infectious laryngotracheitis vaccines

    USDA-ARS?s Scientific Manuscript database

    Newcastle disease virus (NDV) recombinants expressing the infectious laryngotracheitis virus (ILTV) glycoproteins B and D have previously been demonstrated to confer complete clinical protection against virulent ILTV and NDV challenges in naive chickens. However, there was a general concern that the...

  16. Microneedle delivery of an M2e-TLR5 ligand fusion protein to skin confers broadly cross-protective influenza immunity.

    PubMed

    Wang, Bao-Zhong; Gill, Harvinder S; He, Cheng; Ou, Changbo; Wang, Li; Wang, Ying-Chun; Feng, Hao; Zhang, Han; Prausnitz, Mark R; Compans, Richard W

    2014-03-28

    Influenza vaccines with broad cross-protection are urgently needed to prevent an emerging influenza pandemic. A fusion protein of the Toll-like receptor (TLR) 5-agonist domains from flagellin and multiple repeats of the conserved extracellular domain of the influenza matrix protein 2 (M2e) was constructed, purified and evaluated as such a vaccine. A painless vaccination method suitable for possible self-administration using coated microneedle arrays was investigated for skin-targeted delivery of the fusion protein in a mouse model. The results demonstrate that microneedle immunization induced strong humoral as well as mucosal antibody responses and conferred complete protection against homo- and heterosubtypic lethal virus challenges. Protective efficacy with microneedles was found to be significantly better than that seen with conventional intramuscular injection, and comparable to that observed with intranasal immunization. Because of its advantages for administration, safety and storage, microneedle delivery of M2e-flagellin fusion protein is a promising approach for an easy-to-administer universal influenza vaccine. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Efficacy of Recombinant Canine Distemper Virus Expressing Leishmania Antigen against Leishmania Challenge in Dogs

    PubMed Central

    Yoneda, Misako; Takenaka, Akiko; Doki, Miho; Goto, Yasuyuki; Sanjoba, Chizu; Endo, Yasuyuki; Fujiyuki, Tomoko; Sugai, Akihiro; Tsukiyama-Kohara, Kyoko; Matsumoto, Yoshitsugu; Sato, Hiroki; Kai, Chieko

    2015-01-01

    Canine distemper virus (CDV) vaccination confers long-term protection against CDV reinfection. To investigate the utility of CDV as a polyvalent vaccine vector for Leishmania, we generated recombinant CDVs, based on an avirulent Yanaka strain, that expressed Leishmania antigens: LACK, TSA, or LmSTI1 (rCDV–LACK, rCDV–TSA, and rCDV–LmSTI1, respectively). Dogs immunized with rCDV-LACK were protected against challenge with lethal doses of virulent CDV, in the same way as the parental Yanaka strain. To evaluate the protective effects of the recombinant CDVs against cutaneous leishmaniasis in dogs, dogs were immunized with one recombinant CDV or a cocktail of three recombinant CDVs, before intradermal challenge (in the ears) with infective-stage promastigotes of Leishmania major. Unvaccinated dogs showed increased nodules with ulcer formation after 3 weeks, whereas dogs immunized with rCDV–LACK showed markedly smaller nodules without ulceration. Although the rCDV–TSA- and rCDV–LmSTI1-immunized dogs showed little protection against L. major, the cocktail of three recombinant CDVs more effectively suppressed the progression of nodule formation than immunization with rCDV–LACK alone. These results indicate that recombinant CDV is suitable for use as a polyvalent live attenuated vaccine for protection against both CDV and L. major infections in dogs. PMID:26162094

  18. Efficacy of Recombinant Canine Distemper Virus Expressing Leishmania Antigen against Leishmania Challenge in Dogs.

    PubMed

    Miura, Ryuichi; Kooriyama, Takanori; Yoneda, Misako; Takenaka, Akiko; Doki, Miho; Goto, Yasuyuki; Sanjoba, Chizu; Endo, Yasuyuki; Fujiyuki, Tomoko; Sugai, Akihiro; Tsukiyama-Kohara, Kyoko; Matsumoto, Yoshitsugu; Sato, Hiroki; Kai, Chieko

    2015-01-01

    Canine distemper virus (CDV) vaccination confers long-term protection against CDV reinfection. To investigate the utility of CDV as a polyvalent vaccine vector for Leishmania, we generated recombinant CDVs, based on an avirulent Yanaka strain, that expressed Leishmania antigens: LACK, TSA, or LmSTI1 (rCDV-LACK, rCDV-TSA, and rCDV-LmSTI1, respectively). Dogs immunized with rCDV-LACK were protected against challenge with lethal doses of virulent CDV, in the same way as the parental Yanaka strain. To evaluate the protective effects of the recombinant CDVs against cutaneous leishmaniasis in dogs, dogs were immunized with one recombinant CDV or a cocktail of three recombinant CDVs, before intradermal challenge (in the ears) with infective-stage promastigotes of Leishmania major. Unvaccinated dogs showed increased nodules with ulcer formation after 3 weeks, whereas dogs immunized with rCDV-LACK showed markedly smaller nodules without ulceration. Although the rCDV-TSA- and rCDV-LmSTI1-immunized dogs showed little protection against L. major, the cocktail of three recombinant CDVs more effectively suppressed the progression of nodule formation than immunization with rCDV-LACK alone. These results indicate that recombinant CDV is suitable for use as a polyvalent live attenuated vaccine for protection against both CDV and L. major infections in dogs.

  19. Immune protection of chickens conferred by a vaccine consisting of attenuated strains of Salmonella Enteritidis, Typhimurium and Infantis.

    PubMed

    Varmuzova, Karolina; Faldynova, Marcela; Elsheimer-Matulova, Marta; Sebkova, Alena; Polansky, Ondrej; Havlickova, Hana; Sisak, Frantisek; Rychlik, Ivan

    2016-10-15

    The colonization of poultry with different Salmonella enterica serovars poses an issue throughout the world. In this study we therefore tested the efficacy of a vaccine consisting of attenuated strains of Salmonella enterica serovars Enteritidis, Typhimurium and Infantis against challenge with the same serovars and with S. Agona, Dublin and Hadar. We tested oral and aerosol administration of the vaccine, with or without co-administration of cecal microbiota from adult hens. The protective effect was determined by bacterial counts of the challenge strains up to week 18 of life and by characterizing the immune response using real-time PCR specific for 16 different genes. We have shown that a vaccine consisting of attenuated S. Enteritidis, S. Typhimurium and S. Infantis protected chickens against challenge with the wild type strains of the same serovars and partially protected chickens also against challenge with isolates belonging to serovars Dublin or Hadar. Aerosol vaccination was more effective at inducing systemic immunity whilst oral vaccination stimulated a local immune response in the gut. Co-administration of cecal microbiota increased the protectiveness in the intestinal tract but slightly decreased the systemic immune response. Adjusting the vaccine composition and changing the administration route therefore affects vaccine efficacy.

  20. Aging and the Vulnerability of Speech to Dual Task Demands

    PubMed Central

    Kemper, Susan; Schmalzried, RaLynn; Hoffman, Lesa; Herman, Ruth

    2010-01-01

    Tracking a digital pursuit rotor task was used to measure dual task costs of language production by young and older adults. Tracking performance by both groups was affected by dual task demands: time on target declined and tracking error increased as dual task demands increased from the baseline condition to a moderately demanding dual task condition to a more demanding dual task condition. When dual task demands were moderate, older adults’ speech rate declined but their fluency, grammatical complexity, and content were unaffected. When the dual task was more demanding, older adults’ speech, like young adults’ speech, became highly fragmented, ungrammatical, and incoherent. Vocabulary, working memory, processing speed, and inhibition affected vulnerability to dual task costs: vocabulary provided some protection for sentence length and grammaticality, working memory conferred some protection for grammatical complexity, and processing speed provided some protection for speech rate, propositional density, coherence, and lexical diversity. Further, vocabulary and working memory capacity provided more protection for older adults than for young adults although the protective effect of processing speed was somewhat reduced for older adults as compared to the young adults. PMID:21186917

  1. An investigation of the protective effect of alpha+-thalassaemia against severe Plasmodium falciparum amongst children in Kumasi, Ghana.

    PubMed

    Opoku-Okrah, C; Gordge, M; Kweku Nakua, E; Abgenyega, T; Parry, M; Robertson, C; Smith, C L

    2014-02-01

    Several factors influence the severity of Plasmodium falciparum; here, we investigate the impact of alpha+-thalassaemia genotype on P. falciparum parasitemia and prevalence of severe anaemia amongst microcytic children from Kumasi, Ghana. Seven hundred and thirty-two children (≤10 years) with P. falciparum were categorised into normocytic and microcytic (mean cell volume ≤76 fL). Microcytic individuals were genotyped for the -α(3.7) deletional thalassaemia mutation and parasite densities determined. Amongst microcytic patients both parasite densities and prevalence of severe malaria parasitemia (≥100 000/μL) were significantly lower (P < 0.001) in the presence of an alpha+-thalassaemia genotype compared with non-alpha+-thalassaemia genotype. There was no evidence that alpha+-thalassaemia protected against severe anaemia. The protection conferred by alpha-thalassaemia genotype against severe P. falciparum parasitemia did not change with increasing age. The severity of P. falciparum parasitemia was significantly lower in both the homozygous and heterozygous alpha+-thalassaemia groups compared with microcytic individuals with non-alpha+-thalassaemia genotype. The protective effect, from severe malaria, of the alpha+-thalassaemia allele does not alter with age. © 2013 John Wiley & Sons Ltd.

  2. Advancing rights for women: the role of litigation.

    PubMed

    Cabal, Luisa

    2006-12-01

    Litigation is becoming an increasingly attractive advocacy tool for human rights movements around the world. It has served as an effective strategy not only for reforming or enforcing laws that deny or protect basic human rights, but also for raising awareness of and mobilizing support for human rights issues. In this article, which is based on a presentation at a symposium session at the conference, Luisa Cabal focuses on a specific area within the realm of women's health and rights--the rights of HIV-positive women and girls, and in particular, violations they experience vis-à-vis access to health care--and discusses the potential for litigation to help raise awareness and advance efforts to protect and promote human rights in this area.

  3. Recreational mountain biking injuries.

    PubMed

    Aitken, S A; Biant, L C; Court-Brown, Charles M

    2011-04-01

    Mountain biking is increasing in popularity worldwide. The injury patterns associated with elite level and competitive mountain biking are known. This study analysed the incidence, spectrum and risk factors for injuries sustained during recreational mountain biking. The injury rate was 1.54 injuries per 1000 biker exposures. Men were more commonly injured than women, with those aged 30-39 years at highest risk. The commonest types of injury were wounding, skeletal fracture and musculoskeletal soft tissue injury. Joint dislocations occurred more commonly in older mountain bikers. The limbs were more commonly injured than the axial skeleton. The highest hospital admission rates were observed with head, neck and torso injuries. Protective body armour, clip-in pedals and the use of a full-suspension bicycle may confer a protective effect.

  4. BacMam virus-based surface display of the infectious bronchitis virus (IBV) S1 glycoprotein confers strong protection against virulent IBV challenge in chickens.

    PubMed

    Zhang, Jie; Chen, Xiao-Wei; Tong, Tie-Zhu; Ye, Yu; Liao, Ming; Fan, Hui-Ying

    2014-02-03

    Avian infectious bronchitis virus (IBV) is associated with production inefficiencies in domestic fowl, and causes massive economic losses to the poultry industry worldwide. Progress has been made in designing novel and efficient candidate vaccines to control IBV infection. BacMam virus, a modified baculovirus mediating transgene expression under the control of a mammalian promoter, has emerged as a versatile and safe vector during vaccine development. In previous work, we generated the BacMam virus Ac-CMV-S1, which expressed the S1 glycoprotein of IBV-M41. We showed that Ac-CMV-S1 induced excellent cellular immunity, but did not confer adequate protection in chickens compared with the conventional inactivated vaccine. In the current study, we generated an improved BacMam virus, BV-Dual-S1. This virus displayed the S1 glycoprotein on the baculovirus envelope, and was capable of expressing it in mammalian cells. BV-Dual-S1 elicited stronger humoral and cell-mediated immune responses, and showed greater capacity for induction of cytotoxic T lymphocyte responses, compared with Ac-CMV-S1 in specific pathogen-free chickens. A significant difference was not observed for protection rates between chickens immunized with BV-Dual-S1 (83%) or inactivated vaccine (89%) following challenge with virulent IBV-M41. Our findings show that the protective efficacy of BV-Dual-S1 could be significantly enhanced by baculovirus display technology. BacMam virus-based surface display strategies could serve as effective tools in designing vaccines against IB and other infectious diseases. Copyright © 2013. Published by Elsevier Ltd.

  5. Thrombomodulin Contributes to Gamma Tocotrienol-Mediated Lethality Protection and Hematopoietic Cell Recovery in Irradiated Mice

    PubMed Central

    Pathak, Rupak; Shao, Lijian; Ghosh, Sanchita P.; Zhou, Daohong; Boerma, Marjan; Weiler, Hartmut; Hauer-Jensen, Martin

    2015-01-01

    Systemic administration of recombinant thrombomodulin (TM) confers radiation protection partly by accelerating hematopoietic recovery. The uniquely potent radioprotector gamma tocotrienol (GT3), in addition to being a strong antioxidant, inhibits the enzyme hydroxy-methyl-glutaryl-coenzyme A reductase (HMGCR) and thereby likely modulates the expression of TM. We hypothesized that the mechanism underlying the exceptional radioprotective properties of GT3 partly depends on the presence of endothelial TM. In vitro studies confirmed that ionizing radiation suppresses endothelial TM (about 40% at 4 hr after 5 Gy γ-irradiation) and that GT3 induces TM expression (about 2 fold at the mRNA level after 5 μM GT3 treatment for 4 hr). In vivo survival studies showed that GT3 was significantly more effective as a radioprotector in TM wild type (TM+/+) mice than in mice with low TM function (TMPro/-). After exposure to 9 Gy TBI, GT3 pre-treatment conferred 85% survival in TM+/+ mice compared to only 50% in TMPro/-. Thus, GT3-mediated radiation lethality protection is partly dependent on endothelial TM. Significant post-TBI recovery of hematopoietic cells, particularly leukocytes, was observed in TM+/+ mice (p = 0.003), but not in TMPro/- mice, despite the fact that GT3 induced higher levels of granulocyte colony stimulating factor (G-CSF) in TMPro/- mice (p = 0.0001). These data demonstrate a critical, G-CSF-independent, role for endothelial TM in GT3-mediated lethality protection and hematopoietic recovery after exposure to TBI and may point to new strategies to enhance the efficacy of current medical countermeasures in radiological/nuclear emergencies. PMID:25860286

  6. CD4 T cell-mediated protection from lethal influenza: perforin and antibody-mediated mechanisms give a one-two punch.

    PubMed

    Brown, Deborah M; Dilzer, Allison M; Meents, Dana L; Swain, Susan L

    2006-09-01

    The mechanisms whereby CD4 T cells contribute to the protective response against lethal influenza infection remain poorly characterized. To define the role of CD4 cells in protection against a highly pathogenic strain of influenza, virus-specific TCR transgenic CD4 effectors were generated in vitro and transferred into mice given lethal influenza infection. Primed CD4 effectors conferred protection against lethal infection over a broad range of viral dose. The protection mediated by CD4 effectors did not require IFN-gamma or host T cells, but did result in increased anti-influenza Ab titers compared with untreated controls. Further studies indicated that CD4-mediated protection at high doses of influenza required B cells, and that passive transfer of anti-influenza immune serum was therapeutic in B cell-deficient mice, but only when CD4 effectors were present. Primed CD4 cells also acquired perforin (Pfn)-mediated cytolytic activity during effector generation, suggesting a second mechanism used by CD4 cells to confer protection. Pfn-deficient CD4 effectors were less able to promote survival in intact BALB/c mice and were unable to provide protection in B cell-deficient mice, indicating that Ab-independent protection by CD4 effectors requires Pfn. Therefore, CD4 effectors mediate protection to lethal influenza through at least two mechanisms: Pfn-mediated cytotoxicity early in the response promoted survival independently of Ab production, whereas CD4-driven B cell responses resulted in high titer Abs that neutralized remaining virus.

  7. Evaluation and monitoring of UVR in Shield Metal ARC Welding processing.

    PubMed

    Peng, Chiung-yu; Liu, Hung-hsin; Chang, Cheng-ping; Shieh, Jeng-yueh; Lan, Cheng-hang

    2007-08-01

    This study established a comprehensive approach to monitoring UVR magnitude from Shield Metal Arc Welding (SMAW) processing and quantified the effective exposure based on measured data. The irradiances from welding UVR were calculated with biological effective parameter (Slambda) for human exposure assessment. The spectral weighting function for UVR measurement and evaluation followed the American Conference of Governmental Industrial Hygienists (ACGIH) guidelines. Arc welding processing scatters bright light with UVR emission over the full UV spectrum (UVA, UVB, and UVC). The worst case of effective irradiance from a 50 cm distance arc spot with a 200 A electric current and an electrode E6011 (4 mm) is 311.0 microW cm(-2) and has the maximum allowance time (Tmax) of 9.6 s. Distance is an important factor affecting the irradiance intensity. The worst case of the effective irradiance values from arc welding at 100, 200, and 300 cm distances are 76.2, 16.6, and 12.1 microW cm(-2) with Tmax of 39.4, 180.7, and 247.9 s, respectively. Protective materials (glove and mask) were demonstrated to protect workers from hazardous UVR exposure. From this study, the methodology of UVR monitoring in SMAW processing was developed and established. It is recommended that welders should be fitted with appropriate protective materials for protection from UVR emission hazards.

  8. Prion Protein Does Not Confer Resistance to Hippocampus-Derived Zpl Cells against the Toxic Effects of Cu2+, Mn2+, Zn2+ and Co2+ Not Supporting a General Protective Role for PrP in Transition Metal Induced Toxicity

    PubMed Central

    Cingaram, Pradeep Kumar Reddy; Nyeste, Antal; Dondapati, Divya Teja; Fodor, Elfrieda; Welker, Ervin

    2015-01-01

    The interactions of transition metals with the prion protein (PrP) are well-documented and characterized, however, there is no consensus on their role in either the physiology of PrP or PrP-related neurodegenerative disorders. PrP has been reported to protect cells from the toxic stimuli of metals. By employing a cell viability assay, we examined the effects of various concentrations of Cu2+, Zn2+, Mn2+, and Co2+ on Zpl (Prnp -/-) and ZW (Prnp +/+) hippocampus-derived mouse neuronal cells. Prnp -/- Zpl cells were more sensitive to all four metals than PrP-expressing Zw cells. However, when we introduced PrP or only the empty vector into Zpl cells, we could not discern any protective effect associated with the presence of PrP. This observation was further corroborated when assessing the toxic effect of metals by propidium-iodide staining and fluorescence activated cell sorting analysis. Thus, our results on this mouse cell culture model do not seem to support a strong protective role for PrP against transition metal toxicity and also emphasize the necessity of extreme care when comparing cells derived from PrP knock-out and wild type mice. PMID:26426582

  9. Two Outer Membrane Lipoproteins from Histophilus somni Are Immunogenic in Rabbits and Sheep and Induce Protection against Bacterial Challenge in Mice

    PubMed Central

    Guzmán-Brambila, Carolina; Rojas-Mayorquín, Argelia E.; Flores-Samaniego, Beatriz

    2012-01-01

    Histophilus somni is an economically important pathogen of cattle and other ruminants and is considered one of the key components of the bovine respiratory disease (BRD) complex, the leading cause of economic loss in the livestock industry. BRD is a multifactorial syndrome, in which a triad of agents, including bacteria, viruses, and predisposing factors or “stressors,” combines to induce disease. Although vaccines against H. somni have been used for many decades, traditional bacterins have failed to demonstrate effective protection in vaccinated animals. Hence, the BRD complex continues to produce strong adverse effects on the health and well-being of stock and feeder cattle. The generation of recombinant proteins may facilitate the development of more effective vaccines against H. somni, which could confer better protection against BRD. In the present study, primers were designed to amplify, clone, express, and purify two recombinant lipoproteins from H. somni, p31 (Plp4) and p40 (LppB), which are structural proteins of the outer bacterial membrane. The results presented here demonstrate, to our knowledge for the first time, that when formulated, an experimental vaccine enriched with these two recombinant lipoproteins generates high antibody titers in rabbits and sheep and exerts a protective effect in mice against septicemia induced by H. somni bacterial challenge. PMID:22971783

  10. The P9 peptide sidechain specificity of I-Ad.

    PubMed

    Bartnes, K; Li, X; Briand, J P; Travers, P J; Hannestad, K

    1999-12-01

    The murine MHC class II variant I-Ad confers susceptibility to herpes simplex virus (HSV)-induced keratitis and relative protection against type 1 diabetes mellitus. The association to these autoimmune diseases appears to be largely determined by the peptide sidechain specificity of the P9 pocket, which we therefore have analyzed in detail. Assessment of T-cell responses and I-Ad binding capacity of position 446-substituted analogs of an IgG2a allotype b (IgG2a(b)) heavy chain peptide demonstrates that engagement of the P9 pocket is crucial for effective peptide presentation. Sidechain size rather than charge decides the capacity to engage the P9 pocket. Thus, small, uncharged sidechains are accepted, whereas acidic and aromatic amino acids as well as lysine and arginine are disfavored. The specificity of the P9 pocket of I-Ad (serine beta57) is distinct from that of the diabetes-associated I-Ag7 (aspartic acid beta57), supporting the contention that the polymorphism at residue beta57 influences diabetes susceptibility via P9-specific effects on the repertoires of self peptides presented to T cells. Furthermore, the data rationalize the susceptibility to HSV-induced keratitis conferred by the a and the protection conferred by the b allotypes of the IgG2a heavy chain. Keratitogenic T cells, which cross-react with the viral UL6 protein and a corneal antigen, are silenced in IgG2a(b) mice because of antigenic mimicry with gamma2a(b) 435-451. Our finding that the lysine P9 residue of the corresponding gamma2a(a) allopeptide precludes high-affinity binding to I-Ad indicates that the susceptibility of IgG2a(a) mice reflects inefficient thymic presentation of autologous IgG2a and thus failure to purge the T-cell repertoire of the pathogenic clones.

  11. miR-21 Contributes to Xenon-conferred Amelioration of Renal Ischemia–Reperfusion Injury in Mice

    PubMed Central

    Jia, Ping; Teng, Jie; Zou, Jianzhou; Fang, Yi; Zhang, Xiaoyan; Bosnjak, Zeljko J.; Liang, Mingyu; Ding, Xiaoqiang

    2015-01-01

    Background MicroRNAs participate in the regulation of numerous physiological and disease processes. The in vivo role of microRNAs in anesthetics-conferred organoprotection is unknown. Methods Mice were exposed for 2 h to either 70% xenon, or 70% nitrogen, 24 h before the induction of renal ischemia-reperfusion injury. The role of microRNA, miR-21, in renal protection conferred by the delayed xenon preconditioning was examined using in vivo knockdown of miR-21 and analysis of miR-21 target pathways. Results Xenon preconditioning provided morphologic and functional protection against renal ischemia-reperfusion injury (n = 6), characterized by attenuation of renal tubular damage, apoptosis, and oxidative stress. Xenon preconditioning significantly increased the expression of miR-21 in the mouse kidney. A locked nucleic acid-modified anti–miR-21, given before xenon preconditioning, knocked down miR-21 effectively, and exacerbated subsequent renal ischemia-reperfusion injury. Mice treated with anti–miR-21 and ischemia-reperfusion injury showed significantly higher serum creatinine than antiscrambled oligonucleotides-treated mice, 24 h after ischemia-reperfusion (1.37 ± 0.28 vs. 0.81 ± 0.14 mg/dl; n = 5; P < 0.05). Knockdown of miR-21 induced significant up-regulation of programmed cell death protein 4 and phosphatase and tensin homolog deleted on chromosome 10, two proapoptotic target effectors of miR-21, and resulted in significant down-regulation of phosphorylated protein kinase B and increased tubular cell apoptosis. In addition, xenon preconditioning up-regulated hypoxia-inducible factor-1α and its downstream effector vascular endothelial growth factor in a time-dependent manner. Knockdown of miR-21 resulted in a significant decrease of hypoxia-inducible factor-1α. Conclusions These results indicate that miR-21 contributes to the renoprotective effect of xenon preconditioning. PMID:23681145

  12. miR-21 contributes to xenon-conferred amelioration of renal ischemia-reperfusion injury in mice.

    PubMed

    Jia, Ping; Teng, Jie; Zou, Jianzhou; Fang, Yi; Zhang, Xiaoyan; Bosnjak, Zeljko J; Liang, Mingyu; Ding, Xiaoqiang

    2013-09-01

    MicroRNAs participate in the regulation of numerous physiological and disease processes. The in vivo role of microRNAs in anesthetics-conferred organoprotection is unknown. Mice were exposed for 2 h to either 70% xenon, or 70% nitrogen, 24 h before the induction of renal ischemia-reperfusion injury. The role of microRNA, miR-21, in renal protection conferred by the delayed xenon preconditioning was examined using in vivo knockdown of miR-21 and analysis of miR-21 target pathways. Xenon preconditioning provided morphologic and functional protection against renal ischemia-reperfusion injury (n = 6), characterized by attenuation of renal tubular damage, apoptosis, and oxidative stress. Xenon preconditioning significantly increased the expression of miR-21 in the mouse kidney. A locked nucleic acid-modified anti-miR-21, given before xenon preconditioning, knocked down miR-21 effectively, and exacerbated subsequent renal ischemia-reperfusion injury. Mice treated with anti-miR-21 and ischemia-reperfusion injury showed significantly higher serum creatinine than antiscrambled oligonucleotides-treated mice, 24 h after ischemia-reperfusion (1.37 ± 0.28 vs. 0.81 ± 0.14 mg/dl; n = 5; P < 0.05). Knockdown of miR-21 induced significant up-regulation of programmed cell death protein 4 and phosphatase and tensin homolog deleted on chromosome 10, two proapoptotic target effectors of miR-21, and resulted in significant down-regulation of phosphorylated protein kinase B and increased tubular cell apoptosis. In addition, xenon preconditioning up-regulated hypoxia-inducible factor-1α and its downstream effector vascular endothelial growth factor in a time-dependent manner. Knockdown of miR-21 resulted in a significant decrease of hypoxia-inducible factor-1α. These results indicate that miR-21 contributes to the renoprotective effect of xenon preconditioning.

  13. DNA Vaccines - A Modern Gimmick or a Boon to Vaccinology?

    PubMed

    Manickan, Elanchezhiyan; Karem, Kevin L; Rouse, Barry T

    2017-01-01

    The reports in 1993 that naked DNA encoding viral genes conferred protective immunity came as a surprise to most vaccinologists. This review analyses the expanding number of examples where plasmid DNA induces immune responses. Issues such as the type of immunity induced, mechanisms of immune protection, and how DNA vaccines compare with other approaches are emphasized. Additional issues discussed include the likely means by which DNA vaccines induce CTL, how the potency and type of immunity induced can be modified, and whether DNA vaccines represent a practical means of manipulating unwanted immune response occurring during immunoinflammatory diseases. It seems doubtful if DNA vaccines will replace currently effective vaccines, but they may prove useful for prophylactic use against some agents that at present lack an effective vaccine. DNA vaccines promise to be valuable to manipulate the immune response in situations where responses to agents are inappropriate or ineffective.

  14. Extended abstracts for an international conference on the development of the North and problems of recultivation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Everett, K.R.

    1994-12-31

    Ecological problems in many regions on Earth are the result of increasing technological pressure on the environment. These problems concern many of us and cause mankind to unite in order to search for means to protect the environment. Scientists, especially are responsible for the protection of the biosphere. The objective of this conference was to discuss the results of studies on the present condition of the environment in the Far North where the industrial pressure is increasing. The participants of this conference also offered and suggested various necessary measures for the protection of the region and restoration of its disturbedmore » sites. The specific structural characteristics of the environment of the Far North, tundra and northern taiga, cause its fragility and vulnerability to anthropogenic impact. The destruction of the thin, weak layer of soil and vegetation cover changes the thermal balance and thus causes the development of erosion process, which in their turn increase the zone of the direct technogenous destruction. Self restoration processes in this harsh climate usually are slow. The preservation of the ecological integrity in the Far North is essential for the stability of the biosphere of the planet. The specifics of the natural conditions must be taken into account so that man will be able to develop the means of intensive agro-technology that can speed up the process of restoration of the biocenosis in the damaged areas. The extended abstracts of the conference reports that constitute this volume contain both theoretical discussions of problems of recultivation as well as accounts of experimental studies and applied explorations.« less

  15. Computer-aided diagnosis workstation and teleradiology network system for chest diagnosis using the web medical image conference system with a new information security solution

    NASA Astrophysics Data System (ADS)

    Satoh, Hitoshi; Niki, Noboru; Eguchi, Kenji; Ohmatsu, Hironobu; Kaneko, Masahiro; Kakinuma, Ryutaro; Moriyama, Noriyuki

    2010-03-01

    Diagnostic MDCT imaging requires a considerable number of images to be read. Moreover, the doctor who diagnoses a medical image is insufficient in Japan. Because of such a background, we have provided diagnostic assistance methods to medical screening specialists by developing a lung cancer screening algorithm that automatically detects suspected lung cancers in helical CT images, a coronary artery calcification screening algorithm that automatically detects suspected coronary artery calcification and a vertebra body analysis algorithm for quantitative evaluation of osteoporosis. We also have developed the teleradiology network system by using web medical image conference system. In the teleradiology network system, the security of information network is very important subjects. Our teleradiology network system can perform Web medical image conference in the medical institutions of a remote place using the web medical image conference system. We completed the basic proof experiment of the web medical image conference system with information security solution. We can share the screen of web medical image conference system from two or more web conference terminals at the same time. An opinion can be exchanged mutually by using a camera and a microphone that are connected with the workstation that builds in some diagnostic assistance methods. Biometric face authentication used on site of teleradiology makes "Encryption of file" and "Success in login" effective. Our Privacy and information security technology of information security solution ensures compliance with Japanese regulations. As a result, patients' private information is protected. Based on these diagnostic assistance methods, we have developed a new computer-aided workstation and a new teleradiology network that can display suspected lesions three-dimensionally in a short time. The results of this study indicate that our radiological information system without film by using computer-aided diagnosis workstation and our teleradiology network system can increase diagnostic speed, diagnostic accuracy and security improvement of medical information.

  16. Photo-nano immunotherapy for metastatic cancers (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Zhou, Feifan

    2016-03-01

    We constructed a multifunction nano system SWNT-GC and investigated the synergize photothermal and immunological effects. Here, we improve the SWNT-GC nano system and design a new synergistic nano-particle, both have the photothermal effects and immunological effects. We investigate the therapeutic effects and detect the immune response with metastatic mouse tumor models. We also study the therapeutic mechanism after treatment in vitro and in vivo. With the enhancement of nano-materials on photothermal effects, laser treatment could destroy primary tumor and protect normal tissue with low dose laser irradiation. With the immunological effects of nano-materials, the treatment could trigger specific antitumor immune response, to eliminate the metastasis tumor. It is providing a promising treatment modality for the metastatic cancers.

  17. Advocating for efforts to protect African children, families, and communities from the threat of infectious diseases: report of the First International African Vaccinology Conference.

    PubMed

    Wiysonge, Charles Shey; Waggie, Zainab; Hawkridge, Anthony; Schoub, Barry; Madhi, Shabir Ahmed; Rees, Helen; Hussey, Gregory

    2016-01-01

    One means of improving healthcare workers' knowledge of and attitudes to vaccines is through running vaccine conferences which are accessible, affordable, and relevant to their everyday work. Various vaccinology conferences are held each year worldwide. These meetings focus heavily on basic science with much discussion about new developments in vaccines, and relatively little coverage of policy, advocacy, and communication issues. A negligible proportion of delegates at these conferences come from Africa, home to almost 40% of the global burden of vaccine-preventable diseases. To the best of our knowledge, no major vaccinology conference has ever been held on the African continent apart from World Health Organization (WHO) meetings. The content of the first International African Vaccinology Conference was planned to be different; to focus on the science, with a major part of discussions being on clinical, programmatic, policy, and advocacy issues. The conference was held in Cape Town, South Africa, from 8 to 11 November 2012. The theme of the conference was "Advocating for efforts to protect African children, families, and communities from the threat of infectious diseases". There were more than 550 registered participants from 55 countries (including 37 African countries). There were nine pre-conference workshops, ten plenary sessions, and 150 oral and poster presentations. The conference discussed the challenges to universal immunisation in Africa as well as the promotion of dialogue and communication on immunisation among all stakeholders. There was general acknowledgment that giant strides have been made in Africa since the global launch of the Expanded Programme on Immunisation in 1974. For example, there has been significant progress in introducing new and under-utilised vaccines; including hepatitis B, Haemophilus influenza type b, pneumococcal conjugate, rotavirus, meningococcal A conjugate, and human papillomavirus vaccines. In May 2012, African countries endorsed the Global Vaccine Action Plan at the World Health Assembly. However, more than six million children remain incompletely vaccinated in Africa leading to more than one million vaccine-preventable deaths annually. In addition, there are persistent problems with leadership and planning, vaccine stock management, supply chain capacity and quality, provider-parent communication, and financial sustainability. The conference delegates agreed to move from talking to taking concrete actions around children's health, and to ensure that African governments commit to saving children's lives. They would advocate for lower costs of immunisation programmes in Africa, perhaps through bulk buying and improved administration of vaccine rollout through the New Partnership for Africa's Development.

  18. Advocating for efforts to protect African children, families, and communities from the threat of infectious diseases: report of the First International African Vaccinology Conference

    PubMed Central

    Wiysonge, Charles Shey; Waggie, Zainab; Hawkridge, Anthony; Schoub, Barry; Madhi, Shabir Ahmed; Rees, Helen; Hussey, Gregory

    2016-01-01

    One means of improving healthcare workers’ knowledge of and attitudes to vaccines is through running vaccine conferences which are accessible, affordable, and relevant to their everyday work. Various vaccinology conferences are held each year worldwide. These meetings focus heavily on basic science with much discussion about new developments in vaccines, and relatively little coverage of policy, advocacy, and communication issues. A negligible proportion of delegates at these conferences come from Africa, home to almost 40% of the global burden of vaccine-preventable diseases. To the best of our knowledge, no major vaccinology conference has ever been held on the African continent apart from World Health Organization (WHO) meetings. The content of the first International African Vaccinology Conference was planned to be different; to focus on the science, with a major part of discussions being on clinical, programmatic, policy, and advocacy issues. The conference was held in Cape Town, South Africa, from 8 to 11 November 2012. The theme of the conference was “Advocating for efforts to protect African children, families, and communities from the threat of infectious diseases”. There were more than 550 registered participants from 55 countries (including 37 African countries). There were nine pre-conference workshops, ten plenary sessions, and 150 oral and poster presentations. The conference discussed the challenges to universal immunisation in Africa as well as the promotion of dialogue and communication on immunisation among all stakeholders. There was general acknowledgment that giant strides have been made in Africa since the global launch of the Expanded Programme on Immunisation in 1974. For example, there has been significant progress in introducing new and under-utilised vaccines; including hepatitis B, Haemophilus influenza type b, pneumococcal conjugate, rotavirus, meningococcal A conjugate, and human papillomavirus vaccines. In May 2012, African countries endorsed the Global Vaccine Action Plan at the World Health Assembly. However, more than six million children remain incompletely vaccinated in Africa leading to more than one million vaccine-preventable deaths annually. In addition, there are persistent problems with leadership and planning, vaccine stock management, supply chain capacity and quality, provider-parent communication, and financial sustainability. The conference delegates agreed to move from talking to taking concrete actions around children's health, and to ensure that African governments commit to saving children's lives. They would advocate for lower costs of immunisation programmes in Africa, perhaps through bulk buying and improved administration of vaccine rollout through the New Partnership for Africa's Development. PMID:27217879

  19. Protection against Experimental Cryptococcosis following Vaccination with Glucan Particles Containing Cryptococcus Alkaline Extracts.

    PubMed

    Specht, Charles A; Lee, Chrono K; Huang, Haibin; Tipper, Donald J; Shen, Zu T; Lodge, Jennifer K; Leszyk, John; Ostroff, Gary R; Levitz, Stuart M

    2015-12-22

    A vaccine capable of protecting at-risk persons against infections due to Cryptococcus neoformans and Cryptococcus gattii could reduce the substantial global burden of human cryptococcosis. Vaccine development has been hampered though, by lack of knowledge as to which antigens are immunoprotective and the need for an effective vaccine delivery system. We made alkaline extracts from mutant cryptococcal strains that lacked capsule or chitosan. The extracts were then packaged into glucan particles (GPs), which are purified Saccharomyces cerevisiae cell walls composed primarily of β-1,3-glucans. Subcutaneous vaccination with the GP-based vaccines provided significant protection against subsequent pulmonary infection with highly virulent strains of C. neoformans and C. gattii. The alkaline extract derived from the acapsular strain was analyzed by liquid chromatography tandem mass spectrometry (LC-MS/MS), and the most abundant proteins were identified. Separation of the alkaline extract by size exclusion chromatography revealed fractions that conferred protection when loaded in GP-based vaccines. Robust Th1- and Th17-biased CD4(+) T cell recall responses were observed in the lungs of vaccinated and infected mice. Thus, our preclinical studies have indicated promising cryptococcal vaccine candidates in alkaline extracts delivered in GPs. Ongoing studies are directed at identifying the individual components of the extracts that confer protection and thus would be promising candidates for a human vaccine. The encapsulated yeast Cryptococcus neoformans and its closely related sister species, Cryptococcus gattii, are major causes of morbidity and mortality, particularly in immunocompromised persons. This study reports on the preclinical development of vaccines to protect at-risk populations from cryptococcosis. Antigens were extracted from Cryptococcus by treatment with an alkaline solution. The extracted antigens were then packaged into glucan particles, which are hollow yeast cell walls composed mainly of β-glucans. The glucan particle-based vaccines elicited robust T cell immune responses and protected mice from otherwise-lethal challenge with virulent strains of C. neoformans and C. gattii. The technology used for antigen extraction and subsequent loading into the glucan particle delivery system is relatively simple and can be applied to vaccine development against other pathogens. Copyright © 2015 Specht et al.

  20. Contrasting protective effects of cannabinoids against oxidative stress and amyloid-β evoked neurotoxicity in vitro.

    PubMed

    Harvey, Benjamin S; Ohlsson, Katharina S; Mååg, Jesper L V; Musgrave, Ian F; Smid, Scott D

    2012-01-01

    Cannabinoids have been widely reported to have neuroprotective properties in vitro and in vivo. In this study we compared the effects of CB1 and CB2 receptor-selective ligands, the endocannabinoid anandamide and the phytocannabinoid cannabidiol, against oxidative stress and the toxic hallmark Alzheimer's protein, β-amyloid (Aβ) in neuronal cell lines. PC12 or SH-SY5Y cells were selectively exposed to either hydrogen peroxide, tert-butyl hydroperoxide or Aβ, alone or in the presence of the CB1 specific agonist arachidonyl-2'-chloroethylamide (ACEA), CB2 specific agonist JWH-015, anandamide or cannabidiol. Cannabidiol improved cell viability in response to tert-butyl hydroperoxide in PC12 and SH-SY5Y cells, while hydrogen peroxide-mediated toxicity was unaffected by cannabidiol pretreatment. Aβ exposure evoked a loss of cell viability in PC12 cells. Of the cannabinoids tested, only anandamide was able to inhibit Aβ-evoked neurotoxicity. ACEA had no effect on Aβ-evoked neurotoxicity, suggesting a CB1 receptor-independent effect of anandamide. JWH-015 pretreatment was also without protective influence on PC12 cells from either pro-oxidant or Aβ exposure. None of the cannabinoids directly inhibited or disrupted preformed Aβ fibrils and aggregates. In conclusion, the endocannabinoid anandamide protects neuronal cells from Aβ exposure via a pathway unrelated to CB1 or CB2 receptor activation. The protective effect of cannabidiol against oxidative stress does not confer protection against Aβ exposure, suggesting divergent pathways for neuroprotection of these two cannabinoids. Copyright © 2011 Elsevier Inc. All rights reserved.

  1. Electromagnetic Devices and Processes in Environment Protection: Post-Conference Materials.

    DTIC Science & Technology

    1994-09-09

    the Response of Power Transmission and Distribution Lines to a Nuclear Detonation at a High Altitude" 5. R. Goleman, M. Pahczyk, M. Pawlot...processes are unfortunately endothermal ones. However, if necessary energy is produced via a C02-free way(e.g. using solar, hydro, wind, nuclear or...POST-CONFERENCE MATERIALS 31 DETERMINING THE RESPONSE OF POWER TRANSMISSION AND DISTRIBUTION LINES TO A NUCLEAR DETONATION AT A HIGH ALTITUDE

  2. Proceedings of the symposium on current research on wood-destroying organisms and future prospects for protecting wood in use; September 13, 1989; Bend, OR.

    Treesearch

    Michael I. Haverty; W. Wayne Wilcox

    1991-01-01

    In 1989 the Western International Forest Disease Work Conference and the Western Forest Insect Work Conference met jointly in Bend, Oregon, during the week of September 11-15, 1989. One of the 90-minute, concurrent workshops scheduled during this period was a discussion of the biology and present and future control strategies of wood-destroying organisms. This subject...

  3. Security Games Applied to Real-World: Research Contributions and Challenges

    DTIC Science & Technology

    2012-01-01

    Marecki, J.: GUARDS and PROTECT: Next Generation Applications of Security Games . SIGECOM 10 (March 2011) 31–34 4. Shieh, E ., An, B., Yang, R., Tambe...Steigerwald, E .: GUARDS - Game Theoretic Security Allocation on a National Scale. In: Proc. of The 10th International Conference on Autonomous Agents...Shieh, E ., Kiekintveld, C.: Refinement of Strong Stackelberg Equilibria in Security Games . In: Proc. of the 25th Conference on Artificial Intelligence

  4. Program director and chief resident perspectives on the educational environment of US radiation oncology programs.

    PubMed

    Berriochoa, Camille; Weller, Michael; Berry, Danielle; Reddy, Chandana A; Koyfman, Shlomo; Tendulkar, Rahul

    Our goals were toexamine the educational approachesused at radiation oncology residency programs nationwide andto evaluate program director(PD) and chief resident (CR) perceptions of their educational environment. We distributed a survey regarding curricular structure via email toall identified US radiation oncology residency PDs and CRs. Pearson χ 2 test was used toevaluate whether differences existed between answers provided by the 2 study populations. The survey was disseminated to 200 individuals in 85 US residency programs: 49/85PDs(58%)and 74/115 (64%)CRs responded. More than one-half of PDs and CRs report that attending physicians discussed management, reviewed contours, and conducted mock oral board examinations with the residents. At nearly 50% of programs, the majority of teaching conferences use a lecture-based approach, whereas only 20% reported predominant utilization of the Socratic method. However, both PDs (63%) and CRs (49%) reported that Socratic teaching is more effective than didactic lectures (16% and 20%, respectively), with the remainder responding that they are equally effective. Teaching sessions were reported to be resident-led ≥75% of the time by 50% of CRs versus 18% of PDs (P = .002). Significantly more CRs than PDs felt that faculty-led teaching conferences were more effective than resident-led conferences (62% vs 26%, respectively; P < .001). There was a difference in perception regarding the protection of educational time, with 85% of PDs versus 59% of CRs reporting this time as being "never" or "infrequently" compromised by clinical duties (P = .005). There is considerable variability between PDs and CRs in the perceived structure and effectiveness of resident education in US radiation oncology residency programs. These data suggest opportunity for improvement in radiation oncology residency training, such as encouraging more faculty-led, Socratic-based teaching conferences. Increased communication between PDs and CRs can better align perceptions with educational goals. Copyright © 2016 American Society for Radiation Oncology. Published by Elsevier Inc. All rights reserved.

  5. The Philippine Parliamentarians Conference on Human Survival, Population and Development. Summary.

    PubMed

    1988-12-01

    Proceedings of the 1st Philippine Parliamentarians' Conference on Human Survival, Population and Development (PARLCON '88) are summarized in this report. Conference participants included the House and Senate, government officials, representatives of nongovernmental organizations, international organizations, the diplomatic corps and the media. A message from the President was read, referring the "silent emergency" of malnutrition and infant mortality of over 100,000 yearly. The events taking place were a statement of objectives, a Senate Resolution welcoming the convening of the conference, an opening ceremony, a posthumous award to R. M. Sales, executive director of the UNFPA, and a final a plan of action. Much of the content of the above events was duplicated in the final plan, which was formulated in 17 points. Some of these key points were: recognition of the need for quality of life, the detrimental effect of rapid population growth on development, the right of spouses to plan family size within their ethical beliefs, and the need for political will to address development concerns. The conference recommended that parliament and local governments strive for a consensus on national policy regarding population; ensure that economic gains are not decimated by population growth, protect the environment, develop social and industrial infrastructure in outlying areas, pursue national self-reliance, promote the human right of choosing desired family size, endorse the small family norm, empower women by educational and income generating opportunities, gather national data on population, strengthen the Population Commission, support nongovernmental agencies that provide family planning services, and promote education on family planning.

  6. The protective effect of dexmedetomidine in a rat ex vivo lung model of ischemia-reperfusion injury.

    PubMed

    Zhou, Yan; Zhou, Xinqiao; Zhou, Wenjuan; Pang, Qingfeng; Wang, Zhiping

    2018-01-01

    To investigate the effect of dexmedetomidine (Dex) in a rat ex vivo lung model of ischemia-reperfusion injury. An IL-2 ex vivo lung perfusion system was used to establish a rat ex vivo lung model of ischemia-reperfusion injury. Drugs were added to the perfusion solution for reperfusion. Lung injury was assessed by histopathological changes, airway pressure (Res), lung compliance (Compl), perfusion flow (Flow), pulmonary venous oxygen partial pressure (PaO2), and lung wet/dry (W/D) weight ratio. The levels of superoxide dismutase (SOD), malondialdehyde (MDA), 78 kDa glucose-regulated protein (GRP78) and CCAAT/enhancer-binding protein homologous protein (CHOP) were measured, respectively. The introduction of Dex attenuated the post-ischemia-reperfusion lung damage and MDA level, improved lung histology, W/D ratio, lung injury scores and SOD activity. Decreased mRNA and protein levels of GRP78 and CHOP compared with the IR group were observed after Dex treatment. The effect of Dex was dosage-dependence and a high dose of Dex (10 nM) was shown to confer the strongest protective effect against lung damage (P<0.05). Yohimbine, an α2 receptor antagonist, significantly reversed the protective effect of Dex in lung tissues (P<0.05). Dex reduced ischemia-reperfusion injury in rat ex vivo lungs.

  7. Identification of immune signatures predictive of clinical protection from malaria

    PubMed Central

    2017-01-01

    Antibodies are thought to play an essential role in naturally acquired immunity to malaria. Prospective cohort studies have frequently shown how continuous exposure to the malaria parasite Plasmodium falciparum cause an accumulation of specific responses against various antigens that correlate with a decreased risk of clinical malaria episodes. However, small effect sizes and the often polymorphic nature of immunogenic parasite proteins make the robust identification of the true targets of protective immunity ambiguous. Furthermore, the degree of individual-level protection conferred by elevated responses to these antigens has not yet been explored. Here we applied a machine learning approach to identify immune signatures predictive of individual-level protection against clinical disease. We find that commonly assumed immune correlates are poor predictors of clinical protection in children. On the other hand, antibody profiles predictive of an individual’s malaria protective status can be found in data comprising responses to a large set of diverse parasite proteins. We show that this pattern emerges only after years of continuous exposure to the malaria parasite, whereas susceptibility to clinical episodes in young hosts (< 10 years) cannot be ascertained by measured antibody responses alone. PMID:29065113

  8. Intelligence and neuroticism in relation to depression and psychological distress: Evidence from two large population cohorts.

    PubMed

    Navrady, L B; Ritchie, S J; Chan, S W Y; Kerr, D M; Adams, M J; Hawkins, E H; Porteous, D; Deary, I J; Gale, C R; Batty, G D; McIntosh, A M

    2017-06-01

    Neuroticism is a risk factor for selected mental and physical illnesses and is inversely associated with intelligence. Intelligence appears to interact with neuroticism and mitigate its detrimental effects on physical health and mortality. However, the inter-relationships of neuroticism and intelligence for major depressive disorder (MDD) and psychological distress has not been well examined. Associations and interactions between neuroticism and general intelligence (g) on MDD, self-reported depression, and psychological distress were examined in two population-based cohorts: Generation Scotland: Scottish Family Health Study (GS:SFHS, n=19,200) and UK Biobank (n=90,529). The Eysenck Personality Scale Short Form-Revised measured neuroticism and g was extracted from multiple cognitive ability tests in each cohort. Family structure was adjusted for in GS:SFHS. Neuroticism was strongly associated with increased risk for depression and higher psychological distress in both samples. Although intelligence conferred no consistent independent effects on depression, it did increase the risk for depression across samples once neuroticism was adjusted for. Results suggest that higher intelligence may ameliorate the association between neuroticism and self-reported depression although no significant interaction was found for clinical MDD. Intelligence was inversely associated with psychological distress across cohorts. A small interaction was found across samples such that lower psychological distress associates with higher intelligence and lower neuroticism, although effect sizes were small. From two large cohort studies, our findings suggest intelligence acts a protective factor in mitigating the effects of neuroticism on psychological distress. Intelligence does not confer protection against diagnosis of depression in those high in neuroticism. Copyright © 2017 The Authors. Published by Elsevier Masson SAS.. All rights reserved.

  9. Effect of a prior bout of preconditioning exercise on muscle damage from downhill walking.

    PubMed

    Maeo, Sumiaki; Ochi, Yusuke; Yamamoto, Masayoshi; Kanehisa, Hiroaki; Nosaka, Kazunori

    2015-03-01

    This study investigated whether reduced-duration downhill walking (DW) would confer a protective effect against muscle damage induced by a subsequent bout of longer duration DW performed 1 week or 4 weeks later. Healthy young adults were allocated to a control or one of the preconditioning exercise (PRE-1wk or PRE-4wk) groups (10 men and 4 women per group). PRE-1wk and PRE-4wk groups performed 20-min DW (-28% slope, 5 km/h, 10% body mass added to a backpack) 1 week and 4 weeks before 40-min DW, respectively, and the control group performed 40-min DW only. Maximal voluntary contraction (MVC) knee extension torque, plasma creatine kinase (CK) activity, and muscle soreness (100-mm visual analog scale) were measured before, immediately after, and 24, 48, and 72 h after DW, and the changes in these variables were compared among groups. The control group showed symptoms of muscle damage (e.g., prolonged decrease in MVC: -14% ± 10% at 48 h post-DW) after 40-min DW. Changes in all variables after 40-min DW of PRE-1wk and PRE-4wk groups were 54%-61% smaller (P < 0.05) than the control group, without significant differences between PRE-1wk and PRE-4wk groups for MVC and plasma CK activity. Importantly, changes after the preconditioning exercise (20-min DW) were 67%-69% smaller (P < 0.05) than those after the 40-min DW of the control group. These findings suggest that 20-min DW resulting in minor muscle damage conferred a protective effect against subsequent 40-min DW, and its effect could last for more than 4 weeks.

  10. Intramuscular delivery of adenovirus serotype 5 vector expressing humanized protective antigen induces rapid protection against anthrax that may bypass intranasally originated preexisting adenovirus immunity.

    PubMed

    Wu, Shipo; Zhang, Zhe; Yu, Rui; Zhang, Jun; Liu, Ying; Song, Xiaohong; Yi, Shaoqiong; Liu, Ju; Chen, Jianqin; Yin, Ying; Xu, Junjie; Hou, Lihua; Chen, Wei

    2014-02-01

    Developing an effective anthrax vaccine that can induce a rapid and sustained immune response is a priority for the prevention of bioterrorism-associated anthrax infection. Here, we developed a recombinant replication-deficient adenovirus serotype 5-based vaccine expressing the humanized protective antigen (Ad5-PAopt). A single intramuscular injection of Ad5-PAopt resulted in rapid and robust humoral and cellular immune responses in Fisher 344 rats. Animals intramuscularly inoculated with a single dose of 10⁸ infectious units of Ad5-PAopt achieved 100% protection from challenge with 10 times the 50% lethal dose (LD₅₀) of anthrax lethal toxin 7 days after vaccination. Although preexisting intranasally induced immunity to Ad5 slightly weakened the humoral and cellular immune responses to Ad5-PAopt via intramuscular inoculation, 100% protection was achieved 15 days after vaccination in Fisher 344 rats. The protective efficacy conferred by intramuscular vaccination in the presence of preexisting intranasally induced immunity was significantly better than that of intranasal delivery of Ad5-PAopt and intramuscular injection with recombinant PA and aluminum adjuvant without preexisting immunity. As natural Ad5 infection often occurs via the mucosal route, the work here largely illuminates that intramuscular inoculation with Ad5-PAopt can overcome the negative effects of immunity induced by prior adenovirus infection and represents an efficient approach for protecting against emerging anthrax.

  11. Intramuscular Delivery of Adenovirus Serotype 5 Vector Expressing Humanized Protective Antigen Induces Rapid Protection against Anthrax That May Bypass Intranasally Originated Preexisting Adenovirus Immunity

    PubMed Central

    Wu, Shipo; Zhang, Zhe; Yu, Rui; Zhang, Jun; Liu, Ying; Song, Xiaohong; Yi, Shaoqiong; Liu, Ju; Chen, Jianqin; Yin, Ying; Xu, Junjie

    2014-01-01

    Developing an effective anthrax vaccine that can induce a rapid and sustained immune response is a priority for the prevention of bioterrorism-associated anthrax infection. Here, we developed a recombinant replication-deficient adenovirus serotype 5-based vaccine expressing the humanized protective antigen (Ad5-PAopt). A single intramuscular injection of Ad5-PAopt resulted in rapid and robust humoral and cellular immune responses in Fisher 344 rats. Animals intramuscularly inoculated with a single dose of 108 infectious units of Ad5-PAopt achieved 100% protection from challenge with 10 times the 50% lethal dose (LD50) of anthrax lethal toxin 7 days after vaccination. Although preexisting intranasally induced immunity to Ad5 slightly weakened the humoral and cellular immune responses to Ad5-PAopt via intramuscular inoculation, 100% protection was achieved 15 days after vaccination in Fisher 344 rats. The protective efficacy conferred by intramuscular vaccination in the presence of preexisting intranasally induced immunity was significantly better than that of intranasal delivery of Ad5-PAopt and intramuscular injection with recombinant PA and aluminum adjuvant without preexisting immunity. As natural Ad5 infection often occurs via the mucosal route, the work here largely illuminates that intramuscular inoculation with Ad5-PAopt can overcome the negative effects of immunity induced by prior adenovirus infection and represents an efficient approach for protecting against emerging anthrax. PMID:24307239

  12. Challenges and Achievements in Prevention and Treatment of Smallpox

    PubMed Central

    Melamed, Sharon; Israely, Tomer; Paran, Nir

    2018-01-01

    Declaration of smallpox eradication by the WHO in 1980 led to discontinuation of the worldwide vaccination campaign. The increasing percentage of unvaccinated individuals, the existence of its causative infectious agent variola virus (VARV), and the recent synthetic achievements increase the threat of intentional or accidental release and reemergence of smallpox. Control of smallpox would require an emergency vaccination campaign, as no other protective measure has been approved to achieve eradication and ensure worldwide protection. Experimental data in surrogate animal models support the assumption, based on anecdotal, uncontrolled historical data, that vaccination up to 4 days postexposure confers effective protection. The long incubation period, and the uncertainty of the exposure status in the surrounding population, call for the development and evaluation of safe and effective methods enabling extension of the therapeutic window, and to reduce the disease manifestations and vaccine adverse reactions. To achieve these goals, we need to evaluate the efficacy of novel and already licensed vaccines as a sole treatment, or in conjunction with immune modulators and antiviral drugs. In this review, we address the available data, recent achievements, and open questions. PMID:29382130

  13. 77 FR 41984 - Meeting Notice for the President's Advisory Council on Faith-based and Neighborhood Partnerships

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-07-17

    ... to Ben O'Dell at [email protected] . There will also be a conference call line available for those... contact Ben O'Dell for any additional information about the President's Advisory Council meeting at... sent in advance to [email protected] . Dated: July 12, 2012. Ben O'Dell, Designated Federal Officer...

  14. Charter for the Protection of Children and Young People.

    ERIC Educational Resources Information Center

    Momentum, 2002

    2002-01-01

    Provides the text for United States Conference of Catholic Bishops Charter for the Protection of Children and Young People. This document is part of a special collection of resources in the journal that address sexual abuse and the growing number of both confirmed and alleged cases of pedophilia and sexual abuse within the Catholic Church. (RC)

  15. A Twin Protection Effect? Explaining Twin Survival Advantages with a Two-Process Mortality Model

    PubMed Central

    2016-01-01

    Twin studies that focus on the correlation in age-at-death between twin pairs have yielded important insights into the heritability and role of genetic factors in determining lifespan, but less attention is paid to the biological and social role of zygosity itself in determining survival across the entire life course. Using data from the Danish Twin Registry and the Human Mortality Database, we show that monozygotic twins have greater cumulative survival proportions at nearly every age compared to dizygotic twins and the Danish general population. We examine this survival advantage by fitting these data with a two-process mortality model that partitions survivorship patterns into extrinsic and intrinsic mortality processes roughly corresponding to acute, environmental and chronic, biological origins. We find intrinsic processes confer a survival advantage at older ages for males, while at younger ages, all monozygotic twins show a health protection effect against extrinsic death akin to a marriage protection effect. While existing research suggests an increasingly important role for genetic factors at very advanced ages, we conclude that the social closeness of monozygotic twins is a plausible driver of the survival advantage at ages <65. PMID:27192433

  16. Ameliorative Effect of Cactus (Opuntia ficus indica) Extract on Lithium-Induced Nephrocardiotoxicity: A Biochemical and Histopathological Study.

    PubMed

    Saad, Anouar Ben; Rjeibi, Ilhem; Ncib, Sana; Zouari, Nacim; Zourgui, Lazhar

    2017-01-01

    Opuntia ficus indica (family Cactaceae) is used in the treatment of a variety of conditions including metal-induced toxicity. The study reports the protective effects of Opuntia ficus indica (CCE) against lithium carbonate-induced toxicity in rats. Nephrocardiotoxicity was induced in male Wistar rats by single dose of lithium carbonate (25 mg/kg b.w twice daily for 30 days). Aqueous extract of Opuntia ficus indica was administered at the dose of 100 mg/kg of b.w by gavage for 60 days. Obtained results revealed that administration of lithium carbonate caused a significant increase in serum creatinine, uric acid, and urea levels. Additionally, a significant decrease in the level of renal and cardiac SOD, CAT, and GPx activities was associated with a significant increase of MDA levels in lithium carbonate group more than those of the control. However, the treatment of experimental rats with CCE prevented these alterations and maintained the antioxidant status. The histopathological observations supported the biochemical evidences of nephrocardioprotection. CCE supplementation could protect against lithium carbonate-induced renal and cardiac injuries in rats, plausibly by the upregulation of antioxidant enzymes and inhibition of MDA to confer the protective effect.

  17. Ameliorative Effect of Cactus (Opuntia ficus indica) Extract on Lithium-Induced Nephrocardiotoxicity: A Biochemical and Histopathological Study

    PubMed Central

    Ncib, Sana

    2017-01-01

    Opuntia ficus indica (family Cactaceae) is used in the treatment of a variety of conditions including metal-induced toxicity. The study reports the protective effects of Opuntia ficus indica (CCE) against lithium carbonate-induced toxicity in rats. Nephrocardiotoxicity was induced in male Wistar rats by single dose of lithium carbonate (25 mg/kg b.w twice daily for 30 days). Aqueous extract of Opuntia ficus indica was administered at the dose of 100 mg/kg of b.w by gavage for 60 days. Obtained results revealed that administration of lithium carbonate caused a significant increase in serum creatinine, uric acid, and urea levels. Additionally, a significant decrease in the level of renal and cardiac SOD, CAT, and GPx activities was associated with a significant increase of MDA levels in lithium carbonate group more than those of the control. However, the treatment of experimental rats with CCE prevented these alterations and maintained the antioxidant status. The histopathological observations supported the biochemical evidences of nephrocardioprotection. CCE supplementation could protect against lithium carbonate-induced renal and cardiac injuries in rats, plausibly by the upregulation of antioxidant enzymes and inhibition of MDA to confer the protective effect. PMID:29376078

  18. Ischemic Preconditioning Increases the Tolerance of Fatty Liver to Hepatic Ischemia-Reperfusion Injury in the Rat

    PubMed Central

    Serafín, Anna; Roselló-Catafau, Joan; Prats, Neus; Xaus, Carme; Gelpí, Emilio; Peralta, Carmen

    2002-01-01

    Hepatic steatosis is a major risk factor in ischemia-reperfusion. The present study evaluates whether preconditioning, demonstrated to be effective in normal livers, could also confer protection in the presence of steatosis and investigates the potential underlying protective mechanisms. Fatty rats had increased hepatic injury and decreased survival after 60 minutes of ischemia compared with lean rats. Fatty livers showed a degree of neutrophil accumulation and microcirculatory alterations similar to that of normal livers. However, in presence of steatosis, an increased lipid peroxidation that could be reduced with glutathione-ester pretreatment was observed after hepatic reperfusion. Ischemic preconditioning reduced hepatic injury and increased animal survival. Both in normal and fatty livers, this endogenous protective mechanism was found to control lipid peroxidation, hepatic microcirculation failure, and neutrophil accumulation, reducing the subsequent hepatic injury. These beneficial effects could be mediated by nitric oxide, because the inhibition of nitric oxide synthesis and nitric oxide donor pretreatment abolished and simulated, respectively, the benefits of preconditioning. Thus, ischemic preconditioning could be an effective surgical strategy to reduce the hepatic ischemia-reperfusion injury in normal and fatty livers under normothermic conditions, including hepatic resections, and liver transplantation. PMID:12163383

  19. Emerging Infections of CNS: Avian Influenza A Virus, Rift Valley Fever Virus and Human Parechovirus.

    PubMed

    Wiley, Clayton A; Bhardwaj, Nitin; Ross, Ted M; Bissel, Stephanie J

    2015-09-01

    History is replete with emergent pandemic infections that have decimated the human population. Given the shear mass of humans that now crowd the earth, there is every reason to suspect history will repeat itself. We describe three RNA viruses that have recently emerged in the human population to mediate severe neurological disease. These new diseases are results of new mutations in the infectious agents or new exposure pathways to the agents or both. To appreciate their pathogenesis, we summarize the essential virology and immune response to each agent. Infection is described in the context of known host defenses. Once the viruses evade immune defenses and enter central nervous system (CNS) cells, they rapidly co-opt host RNA processing to a cataclysmic extent. It is not clear why the brain is particularly susceptible to RNA viruses; but perhaps because of its tremendous dependence on RNA processing for physiological functioning, classical mechanisms of host defense (eg, interferon disruption of viral replication) are diminished or not available. Effectiveness of immunity, immunization and pharmacological therapies is reviewed to contextualize the scope of the public health challenge. Unfortunately, vaccines that confer protection from systemic disease do not necessarily confer protection for the brain after exposure through unconventional routes. © 2015 International Society of Neuropathology.

  20. Breast-feeding and infant illness: a dose-response relationship?

    PubMed Central

    Raisler, J; Alexander, C; O'Campo, P

    1999-01-01

    OBJECTIVES: The purpose of this study was to determine whether breast-feeding has a dose-related protective effect against illness and whether it confers special health benefits to poor infants. METHODS: The association between breast-feeding dose and illnesses in the first 6 months of life was analyzed with generalized estimating equations regression for 7092 infants from the National Maternal and Infant Health Survey. Breast-feeding dose (ratio of breast-feedings to other feedings) was categorized as full, most, equal, less, or no breast-feeding. RESULTS: Compared with no breast-feeding, full breast-feeding infants had lower odds ratios of diarrhea, cough or wheeze, and vomiting and lower mean ratios of illness months and sick baby medical visits. Most breast-feeding infants had lower odds ratios of diarrhea and cough or wheeze, and equal breast-feeding infants had lower odds ratios of cough or wheeze. Full, most, and equal breast-feeding infants without siblings had lower odds ratios of ear infections and certain other illnesses, but those with siblings did not. Less breast-feeding infants had no reduced odds ratios of illness. Findings did not vary by income. CONCLUSIONS: Full breast-feeding was associated with the lowest illness rates. Minimal (less) breast-feeding was not protective. Breast-feeding conferred similar health benefits in all economic groups. PMID:9987460

  1. Chemoprevention of rat prostate carcinogenesis by soy isoflavones and by Bowman-Birk inhibitor.

    PubMed

    McCormick, David L; Johnson, William D; Bosland, Maarten C; Lubet, Ronald A; Steele, Vernon E

    2007-01-01

    Epidemiology studies suggest that soy consumption confers protection against human prostate cancer. To identify the soy component(s) that may be responsible for this chemopreventive activity, studies were conducted to determine the influence of a soy isoflavone mixture (PTI G-2535; 45% genistein, 22% daidzein, 2% glycitein) and a soy-derived protease inhibitor (Bowman-Birk Inhibitor Concentrate; BBIC) on prostate carcinogenesis in rats. Prostate cancers were induced in male Wistar-Unilever rats by a sequential regimen of cyproterone acetate and testosterone propionate, followed by a single intravenous injection of N-methyl-N-nitrosourea (MNU) and chronic androgen stimulation. In separate studies, PTI G-2535 and BBIC were administered continuously at 0 (control), 200, or 2000 mg/kg diet, beginning 1 wk post-MNU. PTI G-2535 and BBIC both conferred modest, but statistically significant and dose-related protection against carcinogenesis in the dorsolateral+anterior prostate. These data demonstrate that both the isoflavone and protein (protease inhibitor) components of soy can inhibit prostate carcinogenesis in the rat. However, the modest individual activities of soy isoflavones and BBIC suggest that while both components may contribute to the chemopreventive activity of soy, combination administration (or exposure to whole soy) may be more effective in prostate cancer prevention than is administration of either component alone.

  2. Eating chocolate can significantly protect the skin from UV light.

    PubMed

    Williams, Stefanie; Tamburic, Slobodanka; Lally, Carmel

    2009-09-01

    Cocoa beans fresh from the tree are exceptionally rich in flavanols. Unfortunately, during conventional chocolate making, this high antioxidant capacity is greatly reduced due to manufacturing processes. To evaluate the photoprotective potential of chocolate consumption, comparing a conventional dark chocolate to a specially produced chocolate with preserved high flavanol (HF) levels. A double-blind in vivo study in 30 healthy subjects was conducted. Fifteen subjects each were randomly assigned to either a HF or low flavanol (LF) chocolate group and consumed a 20 g portion of their allocated chocolate daily. The minimal erythema dose (MED) was assessed at baseline and after 12 weeks under standardized conditions. In the HF chocolate group the mean MED more than doubled after 12 weeks of chocolate consumption, while in the LF chocolate group, the MED remained without significant change. Our study demonstrated that regular consumption of a chocolate rich in flavanols confers significant photoprotection and can thus be effective at protecting human skin from harmful UV effects. Conventional chocolate has no such effect.

  3. Preparation for emergence of an Eastern European porcine reproductive and respiratory syndrome virus (PRRSV) strain in Western Europe: Immunization with modified live virus vaccines or a field strain confers partial protection.

    PubMed

    Renson, P; Fablet, C; Le Dimna, M; Mahé, S; Touzain, F; Blanchard, Y; Paboeuf, F; Rose, N; Bourry, O

    2017-05-01

    The porcine reproductive and respiratory syndrome virus (PRRSV) causes huge economic losses for the swine industry worldwide. In the past several years, highly pathogenic strains that lead to even greater losses have emerged. For the Western European swine industry, one threat is the possible introduction of Eastern European PRRSV strains (example Lena genotype 1.3) which were shown to be more virulent than common Western resident strains under experimental conditions. To prepare for the possible emergence of this strain in Western Europe, we immunized piglets with a Western European PRRSV field strain (Finistere: Fini, genotype 1.1), a new genotype 1 commercial modified live virus (MLV) vaccine (MLV1) or a genotype 2 commercial MLV vaccine (MLV2) to evaluate and compare the level of protection that these strains conferred upon challenge with the Lena strain 4 weeks later. Results show that immunization with Fini, MLV1 or MLV2 strains shortened the Lena-induced hyperthermia. In the Fini group, a positive effect was also demonstrated in growth performance. The level of Lena viremia was reduced for all immunized groups (significantly so for Fini and MLV2). This reduction in Lena viremia was correlated with the level of Lena-specific IFNγ-secreting cells. In conclusion, we showed that a commercial MLV vaccine of genotype 1 or 2, as well as a field strain of genotype 1.1 may provide partial clinical and virological protection upon challenge with the Lena strain. The cross-protection induced by these immunizing strains was not related with the level of genetic similarity to the Lena strain. The slightly higher level of protection established with the field strain is attributed to a better cell-mediated immune response. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Cerium oxide nanoparticles protect rodent lungs from hypobaric hypoxia-induced oxidative stress and inflammation.

    PubMed

    Arya, Aditya; Sethy, Niroj Kumar; Singh, Sushil Kumar; Das, Mainak; Bhargava, Kalpana

    2013-01-01

    Cerium oxide nanoparticles (nanoceria) are effective at quenching reactive oxygen species (ROS) in cell culture and animal models. Although nanoceria reportedly deposit in lungs, their efficacy in conferring lung protection during oxidative stress remains unexplored. Thus, the study evaluated the protective efficacy of nanoceria in rat lung tissue during hypobaric hypoxia. A total of 48 animals were randomly divided into four equal groups (control [C], nanoceria treated [T], hypoxia [H], and nanoceria treated plus hypoxia [T+H]). Animals were injected intraperitoneally with either a dose of 0.5 μg/kg body weight/week of nanoceria (T and T+H groups) or vehicle (C and H groups) for 5 weeks. After the final dose, H and T+H animals were challenged with hypobaric hypoxia, while C and T animals were maintained at normoxia. Lungs were isolated and homogenate was obtained for analysis of ROS, lipid peroxidation, glutathione, protein carbonylation, and 4-hydroxynonenal-adduct formation. Plasma was used for estimating major inflammatory cytokines using enzyme-linked immunosorbent assay. Intact lung tissues were fixed and both transmission electron microscopy and histopathological examinations were carried out separately for detecting internalization of nanoparticles as well as altered lung morphology. Spherical nanoceria of 7-10 nm diameter were synthesized using a microemulsion method, and the lung protective efficacy of the nanoceria evaluated during hypobaric hypoxia. With repeated intraperitoneal injections of low micromole concentration, we successfully localized the nanoceria in rodent lung without any inflammatory response. The lung-deposited nanoceria limited ROS formation, lipid peroxidation, and glutathione oxidation, and prevented oxidative protein modifications like nitration and carbonyl formation during hypobaric hypoxia. We also observed reduced lung inflammation in the nanoceria-injected lungs, supporting the anti-inflammatory properties of nanoceria. Cumulatively, these results suggest nanoceria deposit in lungs, confer protection by quenching noxious free radicals during hypobaric hypoxia, and do not evoke any inflammatory response.

  5. Gut Microbiota-Induced Immunoglobulin G Controls Systemic Infection by Symbiotic Bacteria and Pathogens

    PubMed Central

    Zeng, Melody Y.; Cisalpino, Daniel; Varadarajan, Saranyaraajan; Hellman, Judith; Warren, H. Shaw; Cascalho, Marilia; Inohara, Naohiro; Núñez, Gabriel

    2016-01-01

    The gut microbiota is compartmentalized in the intestinal lumen and induces local immune responses, but it remains unknown whether the gut microbiota can induce systemic response and contribute to systemic immunity. We report that selective gut symbiotic gram-negative bacteria were able to disseminate systemically to induce immunoglobulin G (IgG) response, which primarily targeted gram-negative bacterial antigens and conferred protection against systemic infections by E. coli and Salmonella by directly coating bacteria to promote killing by phagocytes. T cells and Toll-like receptor 4 on B cells were important in the generation of microbiota-specific IgG. We identified murein lipoprotein (MLP), a highly conserved gram-negative outer membrane protein, as a major antigen that induced systemic IgG homeostatically in both mice and humans. Administration of anti-MLP IgG conferred crucial protection against systemic Salmonella infection. Thus, our findings reveal an important function for the gut microbiota in combating systemic infection through the induction of protective IgG. PMID:26944199

  6. Nuclear instrumentation and measurement: a review based on the ANIMMA conferences

    NASA Astrophysics Data System (ADS)

    Giot, Michel; Vermeeren, Ludo; Lyoussi, Abdallah; Reynard-Carette, Christelle; Lhuillier, Christian; Mégret, Patrice; Deconinck, Frank; Gonçalves, Bruno Soares

    2017-12-01

    The ANIMMA conferences offer a unique opportunity to discover research carried out in all fields of nuclear measurements and instrumentation with applications extending from fundamental physics to fission and fusion reactors, medical imaging, environmental protection and homeland security. After four successful editions of the Conference, it was decided to prepare a review based to a large extent but not exclusively on the papers presented during the first four editions of the conference. This review is organized according to the measurement methodologies: neutronic, photonic, thermal, acoustic and optical measurements, as well as medical imaging and specific challenges linked to data acquisition and electronic hardening. The paper describes the main challenges justifying research in these different areas, and summarizes the recent progress reported. It offers researchers and engineers a way to quickly and efficiently access knowledge in highly specialized areas.

  7. The protective effects of magnolol on acute trinitrobenzene sulfonic acid‑induced colitis in rats.

    PubMed

    Zhang, Yong; Fu, Li-Tang; Tang, Fang

    2018-03-01

    The present study aimed to investigate the protective effects of magnolol on acute 2,4,6-trinitrobenzene sulfonic acid (TNBS)‑induced colitis, and its underlying mechanisms. Experimental colitis was induced by intracolonic administration of TNBS/ethanol into rats. The model rats were randomly assigned into groups: TNBS, magnolol (high, medium and low doses), and salazosulfapyridine (positive control). All intervention regimens were administered by oral gavage, once a day for 7 consecutive days, 24 h after colitis induction. Histological and biochemical changes in colonic inflammation were evaluated by hematoxylin and eosin and immunohistochemistry, respectively. Rats treated with all doses of magnolol exhibited decreased colonic myeloperoxidase activity (P<0.05 vs. TNBS), reduced serum levels of proinflammatory cytokines [including interleukin (IL)‑6 and IL‑17], and downregulated Toll‑like receptor-4 (TLR‑4) mRNA expression. Histological analysis revealed that medium and high doses of magnolol conferred an anti‑inflammatory effect, which was indicated by a decrease in disease activity index, an increase in thymus index, and downregulation of nuclear factor (NF)‑κB p65 mRNA and TLR‑4 protein expression. However, only high‑dose magnolol significantly ameliorated the elevated colon weight/length ratio. The results of the present study indicate that magnolol exerts protective effects against acute TNBS‑induced colitis in rats, and the TLR‑4/NF‑κB signaling pathway‑mediated inhibitory effect on inflammatory cascades may contribute to the protective activity of magnolol.

  8. Mumps Parotitis and Ovarian Cancer: Modern Significance of an Historic Association

    DTIC Science & Technology

    2009-10-01

    ligation or a breast mastitis , found to protect against ovarian cancer, might do so by causing overexpression of the hypoglycosylated form of MUC1...negative plates were incubated overnight and washed three times with PBS before addition of 100 μl of 2.5% bovine serum albumin in PBS. Serially...a breast mastitis which have been shown to protect against ovarian cancer(10), might confer protection because of injury to the tissue causing

  9. Recent progress in the development of anthrax vaccines.

    PubMed

    Kaur, Manpreet; Bhatnagar, Rakesh

    2011-12-01

    Bacillus anthracis is the etiological agent of anthrax. Although anthrax is primarily an epizootic disease; humans are at risk for contracting anthrax. The potential use of B. anthracis spores as biowarfare agent has led to immense attention. Prolonged vaccination schedule of current anthrax vaccine and variable protection conferred; often leading to failure of therapy. This highlights the need for alternative anthrax countermeasures. A number of approaches are being investigated to substitute or supplement the existing anthrax vaccines. These relied on expression of Protective antigen (PA), the key protective immunogen; in bacterial or plant systems; or utilization of attenuated strains of B. anthracis for immunization. Few studies have established potential of domain IV of PA for immunization. Other targets including the spore, capsule, S-layer and anthrax toxin components have been investigated for imparting protective immunity. It has been shown that co-immunization of PA with domain I of lethal factor that binds PA resulted in higher antibody responses. Of the epitope based vaccines, the loop neutralizing determinant, in particular; elicited robust neutralizing antibody response and conferred 97% protection upon challenge. DNA vaccination resulted in varying degree of protection and seems a promising approach. Additionally, the applicability of monoclonal and therapeutic antibodies in the treatment of anthrax has also been demonstrated. The recent progress in the direction of anthrax prophylaxis has been evaluated in this review.

  10. Olives and Bone: A Green Osteoporosis Prevention Option

    PubMed Central

    Chin, Kok-Yong; Ima-Nirwana, Soelaiman

    2016-01-01

    Skeletal degeneration due to aging, also known as osteoporosis, is a major health problem worldwide. Certain dietary components confer protection to our skeletal system against osteoporosis. Consumption of olives, olive oil and olive polyphenols has been shown to improve bone health. This review aims to summarize the current evidence from cellular, animal and human studies on the skeletal protective effects of olives, olive oil and olive polyphenols. Animal studies showed that supplementation of olives, olive oil or olive polyphenols could improve skeletal health assessed via bone mineral density, bone biomechanical strength and bone turnover markers in ovariectomized rats, especially those with inflammation. The beneficial effects of olive oil and olive polyphenols could be attributed to their ability to reduce oxidative stress and inflammation. However, variations in the bone protective, antioxidant and anti-inflammatory effects between studies were noted. Cellular studies demonstrated that olive polyphenols enhanced proliferation of pre-osteoblasts, differentiation of osteoblasts and decreased the formation of osteoclast-like cells. However, the exact molecular pathways for its bone health promoting effects are yet to be clearly elucidated. Human studies revealed that daily consumption of olive oil could prevent the decline in bone mineral density and improve bone turnover markers. As a conclusion, olives, olive oil and its polyphenols are potential dietary interventions to prevent osteoporosis among the elderly. PMID:27472350

  11. Eliciting Epitope-Specific CD8+ T Cell Response by Immunization with Microbial Protein Antigens Formulated with α-Galactosylceramide: Theory, Practice, and Protocols.

    PubMed

    Gilchuk, Pavlo; Knight, Frances C; Wilson, John T; Joyce, Sebastian

    2017-01-01

    CD8+ cytotoxic T lymphocytes confer protection against infectious diseases caused by viruses, bacteria, and parasites. Hence, significant efforts have been invested into devising ways to generate CD8+ T cell-targeted vaccines. Generation of microbe-free protein subunit vaccines requires a thorough knowledge of protective target antigens. Such antigens are proteolytically processed peptides presented by MHC class I molecules. To induce a robust antigen-specific CD8+ T cell response through vaccination, it is essential to formulate the antigen with an effective adjuvant. Here, we describe a versatile method for generating high-frequency antigen-specific CD8+ T cells through immunization of mice using the invariant natural killer T cell agonist α-galactosylceramide as the adjuvant.

  12. Vaccination of chickens with recombinant salmonella expressing the M2e and CD154 increase protection and decrease viral shedding following low pathogenic avian influenza challenge

    USDA-ARS?s Scientific Manuscript database

    Avian influenza (AI) is a significant public health concern and serious economic threat to the commercial poultry industry worldwide. Previous research demonstrates that antibodies against M2e confer protection against influenza challenge. Using the Red recombinase system in combination with overl...

  13. The Value of Family Welfare Conferencing within the Child Protection and Welfare System

    ERIC Educational Resources Information Center

    Devaney, Carmel; Byrne, Paul

    2015-01-01

    The Family Welfare Conference (FWC) is a model used within the child protection and welfare services to address concerns about the needs of children and their family's ability to respond to these needs. The FWC model operates in partnership with family members, who participate in identifying both the issues of concern and potential responses to…

  14. 76 FR 26333 - U.S. Department of State Advisory Committee on Private International Law (ACPIL); Notice of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-06

    ... contact Tricia Smeltzer or Niesha Toms of the Department of State Legal Adviser's Office at [email protected] or Toms[email protected] and provide your name, affiliation, e-mail address, and mailing address... teleconferencing, please contact Tricia Smeltzer or Niesha Toms at 202-776-8420 to receive the conference call- in...

  15. 76 FR 19826 - U.S. Department of State Advisory Committee on Private International Law (ACPIL): Notice of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-04-08

    ... is controlled; persons wishing to attend should contact Tricia Smeltzer or Niesha Toms of the Department of State Legal Adviser's Office at [email protected] or Toms[email protected] and provide your name... Niesha Toms at 202-776-8420 to receive the conference call-in number and the relevant information. Dated...

  16. Incorporation of a recombinant Eimeria maxima IMP1 antigen into nanoparticles confers protective immunity against E. maxima challenge infection

    USDA-ARS?s Scientific Manuscript database

    The purpose of this study was to determine if incorporating a recombinant Eimeria maxima protein, namely rEmaxIMP1, into gold nanoparticles (NP) could improve the level of protective immunity against E. maxima challenge infection. Recombinant EmaxIMP1 was expressed in Escherchia coli as a poly-His f...

  17. Full protection against African horsesickness (AHS) in horses induced by baculovirus-derived AHS virus serotype 4 VP2, VP5 and VP7.

    PubMed

    Martínez-Torrecuadrada, J L; Díaz-Laviada, M; Roy, P; Sánchez, C; Vela, C; Sánchez-Vizcaíno, J M; Casal, J I

    1996-06-01

    African horsesickness virus serotype 4 (AHSV-4) outer capsid protein VP2, or VP2 and VP5 plus inner capsid protein VP7, derived from single or dual recombinant baculovirus expression vectors were used in different combinations to immunize horses. When the proteins were purified by affinity chromatography, the combination of all three proteins induced low levels of neutralizing antibodies and conferred protection against virulent virus challenge. However, purified VP2 or VP2 and VP5 in the absence of VP7 failed to induce neutralizing antibodies and protection. Immunization with non-purified proteins enhanced the titres of neutralizing antibodies. Again, the combination of the three proteins was able to confer total protection to immunized horses, which showed absence of viraemia. The antigenicity of recombinant VP2 was analysed with a collection of 30 MAbs. Both purified and unpurified recombinant VP2 proteins showed different antigenic patterns in comparison to that of VP2 on virions. An immunization experiment with four more horses confirmed these results. The vaccine described here would not only prevent the disease, but would drastically reduce the propagation of the virus by vectors.

  18. From Immunologically Archaic to Neoteric Glycovaccines

    PubMed Central

    Cavallari, Marco; De Libero, Gennaro

    2017-01-01

    Polysaccharides (PS) are present in the outermost surface of bacteria and readily come in contact with immune cells. They interact with specific antibodies, which in turn confer protection from infections. Vaccines with PS from pneumococci, meningococci, Haemophilus influenzae type b, and Salmonella typhi may be protective, although with the important constraint of failing to generate permanent immunological memory. This limitation has in part been circumvented by conjugating glycovaccines to proteins that stimulate T helper cells and facilitate the establishment of immunological memory. Currently, protection evoked by conjugated PS vaccines lasts for a few years. The same approach failed with PS from staphylococci, Streptococcus agalactiae, and Klebsiella. All those germs cause severe infections in humans and often develop resistance to antibiotic therapy. Thereby, prevention is of increasing importance to better control outbreaks. As only 23 of more than 90 pneumococcal serotypes and 4 of 13 clinically relevant Neisseria meningitidis serogroups are covered by available vaccines there is still tremendous clinical need for PS vaccines. This review focuses on glycovaccines and the immunological mechanisms for their success or failure. We discuss recent advances that may facilitate generation of high affinity anti-PS antibodies and confer specific immunity and long-lasting protection. PMID:28134792

  19. Protection from Staphylococcus aureus mastitis associated with poly-N-acetyl β-1,6 glucosamine specific antibody production using biofilm-embedded bacteria

    PubMed Central

    Pérez, M. M.; Prenafeta, A.; Valle, J.; Penadés, J.; Rota, C.; Solano, C.; Marco, J.; Grilló, M.J.; Lasa, I.; Irache, J.M.; Maira-Litran, T.; Jiménez-Barbero, J.; Costa, L.; Pier, G.B.; de Andrés, D.; Amorena, B.

    2010-01-01

    Staphylococcus aureus vaccines based on bacterins surrounded by slime, surface polysaccharides coupled to protein carriers and polysaccharides embedded in liposomes administered together with non-biofilm bacterins confer protection against mastitis. However, it remains unknown whether protective antibodies are directed to slime-associated known exopolysaccharides and could be produced in the absence of bacterin immunizations. Here, a sheep mastitis vaccination study was carried out using bacterins, crude bacterial extracts or a purified exopolysaccharide from biofilm bacteria delivered in different vehicles. This polysaccharide reacted specifically with antibodies to poly-N-acetyl-β-1,6-glucosamine (PNAG) and not with antibodies to other capsular antigens or bacterial components. Following intra-mammary challenge with biofilm-producing bacteria, antibody production against the polysaccharide, milk bacterial counts and mastitis lesions were determined. Bacterins from strong biofilm-producing bacteria triggered the highest production of antibodies to PNAG and conferred the highest protection against infection and mastitis, compared with weak biofilm-producing bacteria and non-cellular inocula. Thus, bacterins from strong biofilm bacteria, rather than purified polysaccharide, are proposed as a cost-efficient vaccination against S. aureus ruminant mastitis. PMID:19428854

  20. Biocontrol of tomato wilt disease by Bacillus subtilis isolates from natural environments depends on conserved genes mediating biofilm formation

    PubMed Central

    Liu, Hongxia; Kolter, Roberto; Losick, Richard; Guo, Jian-hua

    2014-01-01

    Summary Bacillus subtilis and other Bacilli have long been used as biological control agents against plant bacterial diseases but the mechanisms by which the bacteria confer protection are not well understood. Our goal in this study was to isolate strains of B. subtilis that exhibit high levels of biocontrol efficacy from natural environments and to investigate the mechanisms by which these strains confer plant protection. We screened a total of sixty isolates collected from various locations across China and obtained six strains that exhibited above 50% biocontrol efficacy on tomato plants against the plant pathogen Ralstonia solanacearum under greenhouse conditions. These wild strains were able to form robust biofilms both in defined medium and on tomato plant roots and exhibited strong antagonistic activities against various plant pathogens in plate assays. We show that plant protection by those strains depended on widely conserved genes required for biofilm formation, including regulatory genes and genes for matrix production. We provide evidence suggesting that matrix production is critical for bacterial colonization on plant root surfaces. Finally, we have established a model system for studies of B. subtilis-tomato plant interactions in protection against a plant pathogen. PMID:22934631

  1. The actin filament cross-linker L-plastin confers resistance to TNF-α in MCF-7 breast cancer cells in a phosphorylation-dependent manner

    PubMed Central

    Janji, Bassam; Vallar, Laurent; Tanoury, Ziad Al; Bernardin, François; Vetter, Guillaume; Schaffner-Reckinger, Elisabeth; Berchem, Guy; Friederich, Evelyne; Chouaib, Salem

    2010-01-01

    Abstract We used a tumour necrosis factor (TNF)-α resistant breast adenocarcinoma MCF-7 cell line to investigate the involvement of the actin cytoskeleton in the mechanism of cell resistance to this cytokine. We found that TNF resistance correlates with the loss of cell epithelial properties and the gain of a mesenchymal phenotype, reminiscent of an epithelial-to-mesenchymal transition (EMT). Morphological changes were associated with a profound reorganization of the actin cytoskeleton and with a change in the repertoire of expressed actin cytoskeleton genes and EMT markers, as revealed by DNA microarray-based expression profiling. L-plastin, an F-actin cross-linking and stabilizing protein, was identified as one of the most significantly up-regulated genes in TNF-resistant cells. Knockdown of L-plastin in these cells revealed its crucial role in conferring TNF resistance. Importantly, overexpression of wild-type L-plastin in TNF-sensitive MCF-7 cells was sufficient to protect them against TNF-mediated cell death. Furthermore, we found that this effect is dependent on serine-5 phosphorylation of L-plastin and that non-conventional protein kinase C isoforms and the ceramide pathway may regulate its phosphorylation state. The protective role of L-plastin was not restricted to TNF-α resistant MCF-7 cells because a correlation between the expression of L-plastin and the resistance to TNF-α was observed in other breast cancer cell lines. Together, our study discloses a novel unexpected role of the actin bundling protein L-plastin as a cell protective protein against TNF-cytotoxicity. PMID:19799649

  2. Deletion of the znuA virulence factor attenuates Actinobacillus pleuropneumoniae and confers protection against homologous or heterologous strain challenge.

    PubMed

    Yuan, Fangyan; Liao, Yonghong; You, Wujin; Liu, Zewen; Tan, Yongqiang; Zheng, Chengkun; BinWang; Zhou, Danna; Tian, Yongxiang; Bei, Weicheng

    2014-12-05

    The znuA gene is known to be important for growth and survival in Escherichia coli, Haemophilus spp., Neisseria gonorrhoeae, and Pasteurella multocida under low Zn(2+) conditions. This gene is also present in Actinobacillus pleuropneumoniae serotype 1; therefore, the aim of this study was to investigate the existence of a similar role for the znuA gene in the growth and virulence of this organism. A precisely defined ΔznuA deletion mutant of A. pleuropneumoniae was constructed based on the sequence of the wild-type SLW01 using transconjugation and counterselection. This mutation was found to be lethal in low-Zn(2+) medium. Furthermore, the ΔznuA mutant strain exhibited attenuated virulence (≥22-fold) as well as reduced mortality and morbidity in a murine (Balb/C) model of infection. The majority of the bacteria were cleared from the lungs within 2 weeks. The ΔznuA mutant strain caused no adverse effects in pigs at doses of up to 1.0×10(9) CFU/mL. The ΔznuA mutant strain induced a significant immune response and conferred 80% and 100% protection on immunised pigs against challenge with A. pleuropneumoniae strains belonging to homologous or heterologous serovars, respectively, compared to the blank controls. The data obtained in this study indicate the potential of the mutant ΔznuA strain for development as a live vaccine capable of inducing reliable cross-serovar protection following intratracheal immunisation. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Autovaccination confers protection against Devriesea agamarum associated septicemia but not dermatitis in bearded dragons (Pogona vitticeps).

    PubMed

    Hellebuyck, Tom; Van Steendam, Katleen; Deforce, Dieter; Blooi, Mark; Van Nieuwerburgh, Filip; Bullaert, Evelien; Ducatelle, Richard; Haesebrouck, Freddy; Pasmans, Frank; Martel, An

    2014-01-01

    Devrieseasis caused by Devriesea agamarum is a highly prevalent disease in captive desert lizards, resulting in severe dermatitis and in some cases mass mortality. In this study, we assessed the contribution of autovaccination to devrieseasis control by evaluating the capacity of 5 different formalin-inactivated D. agamarum vaccines to induce a humoral immune response in bearded dragons (Pogona vitticeps). Each vaccine contained one of the following adjuvants: CpG, incomplete Freund's, Ribi, aluminium hydroxide, or curdlan. Lizards were administrated one of the vaccines through subcutaneous injection and booster vaccination was given 3 weeks after primo-vaccination. An indirect ELISA was developed and used to monitor lizard serological responses. Localized adverse effects following subcutaneous immunization were observed in all but the Ribi adjuvanted vaccine group. Following homologous experimental challenge, the incomplete Freund's as well as the Ribi vaccine were observed to confer protection in bearded dragons against the development of D. agamarum associated septicemia but not against dermatitis. Subsequently, two-dimensional gelelectrophoresis followed by immunoblotting and mass spectrometry was conducted with serum obtained from 3 lizards that showed seroconversion after immunisation with the Ribi vaccine. Fructose-bisphosphate aldolase and aldo-keto reductase of D. agamarum reacted with serum from the latter lizards. Based on the demonstrated seroconversion and partial protection against D. agamarum associated disease following the use of formalin-inactivated vaccines as well as the identification of target antigens in Ribi vaccinated bearded dragons, this study provides promising information towards the development of a vaccination strategy to control devrieseasis in captive lizard collections.

  4. Autovaccination Confers Protection against Devriesea agamarum Associated Septicemia but Not Dermatitis in Bearded Dragons (Pogona vitticeps)

    PubMed Central

    Deforce, Dieter; Blooi, Mark; Van Nieuwerburgh, Filip; Bullaert, Evelien; Ducatelle, Richard; Haesebrouck, Freddy

    2014-01-01

    Devrieseasis caused by Devriesea agamarum is a highly prevalent disease in captive desert lizards, resulting in severe dermatitis and in some cases mass mortality. In this study, we assessed the contribution of autovaccination to devrieseasis control by evaluating the capacity of 5 different formalin-inactivated D. agamarum vaccines to induce a humoral immune response in bearded dragons (Pogona vitticeps). Each vaccine contained one of the following adjuvants: CpG, incomplete Freund's, Ribi, aluminium hydroxide, or curdlan. Lizards were administrated one of the vaccines through subcutaneous injection and booster vaccination was given 3 weeks after primo-vaccination. An indirect ELISA was developed and used to monitor lizard serological responses. Localized adverse effects following subcutaneous immunization were observed in all but the Ribi adjuvanted vaccine group. Following homologous experimental challenge, the incomplete Freund's as well as the Ribi vaccine were observed to confer protection in bearded dragons against the development of D. agamarum associated septicemia but not against dermatitis. Subsequently, two-dimensional gelelectrophoresis followed by immunoblotting and mass spectrometry was conducted with serum obtained from 3 lizards that showed seroconversion after immunisation with the Ribi vaccine. Fructose-bisphosphate aldolase and aldo-keto reductase of D. agamarum reacted with serum from the latter lizards. Based on the demonstrated seroconversion and partial protection against D. agamarum associated disease following the use of formalin-inactivated vaccines as well as the identification of target antigens in Ribi vaccinated bearded dragons, this study provides promising information towards the development of a vaccination strategy to control devrieseasis in captive lizard collections. PMID:25479609

  5. SUMOylation target sites at the C terminus protect Axin from ubiquitination and confer protein stability

    PubMed Central

    Kim, Min Jung; Chia, Ian V.; Costantini, Frank

    2008-01-01

    Axin is a scaffold protein for the β-catenin destruction complex, and a negative regulator of canonical Wnt signaling. Previous studies implicated the six C-terminal amino acids (C6 motif) in the ability of Axin to activate c-Jun N-terminal kinase, and identified them as a SUMOylation target. Deletion of the C6 motif of mouse Axin in vivo reduced the steady-state protein level, which caused embryonic lethality. Here, we report that this deletion (Axin-ΔC6) causes a reduced half-life in mouse embryonic fibroblasts and an increased susceptibility to ubiquitination in HEK 293T cells. We confirmed the C6 motif as a SUMOylation target in vitro, and found that mutating the C-terminal SUMOylation target residues increased the susceptibility of Axin to polyubiquitination and reduced its steady-state level. Heterologous SUMOylation target sites could replace C6 in providing this protective effect. These findings suggest that SUMOylation of the C6 motif may prevent polyubiquitination, thus increasing the stability of Axin. Although C6 deletion also caused increased association of Axin with Dvl-1, this interaction was not altered by mutating the lysine residues in C6, nor could heterologous SUMOylation motifs replace the C6 motif in this assay. Therefore, some other specific property of the C6 motif seems to reduce the interaction of Axin with Dvl-1.—Kim, M. J., Chia, I. V., Costantini, F. SUMOylation target sites at the C terminus protect Axin from ubiquitination and confer protein stability. PMID:18632848

  6. The Protective Effect of Apigenin on Myocardial Injury in Diabetic Rats mediating Activation of the PPAR-γ Pathway.

    PubMed

    Mahajan, Umesh B; Chandrayan, Govind; Patil, Chandragouda R; Arya, Dharamvir Singh; Suchal, Kapil; Agrawal, Yogeeta O; Ojha, Shreesh; Goyal, Sameer N

    2017-04-04

    We substantiated the role of peroxisome proliferator-activated receptor-γ (PPAR-γ) activation in the protective effect of apigenin against the myocardial infarction (MI) in diabetic rats. Diabetes was induced by intraperitoneal administration of a single dose of streptozotocin (55 mg/kg). The study groups included diabetic rats receiving vehicle, apigenin (75 mg/kg/day, orally), GW9662 (1 mg/kg/day, intraperitoneally), and a combination of apigenin and GW9662 for 14 days. The MI was induced in all the study groups except the diabetic control group by subcutaneous injection of 100 mg/kg/day of isoproterenol on the two terminal days. The diabetes and isoproterenol-induced MI was evident as a reduction in the maximal positive and negative rate of developed left ventricular pressure and an increase in the left ventricular end-diastolic pressure. The activities of creatine kinase on myocardial bundle (CK-MB) and lactate dehydrogenase (LDH) were also reduced. Apigenin treatment prevented the hemodynamic perturbations, restored the left ventricular function and reinstated a balanced redox status. It protected rats against an MI by attenuating myonecrosis, edema, cell death, and oxidative stress. GW9662, a PPAR-γ antagonist reversed the myocardial protection conferred by apigenin. Further, an increase in the PPAR-γ expression in the myocardium of the rats receiving apigenin reinforces the role of PPAR-γ pathway activation in the cardioprotective effects of apigenin.

  7. Protective Effect of Selenium on Aflatoxin B1-Induced Testicular Toxicity in Mice.

    PubMed

    Cao, Zheng; Shao, Bing; Xu, Feibo; Liu, Yunfeng; Li, Yanfei; Zhu, Yanzhu

    2017-12-01

    Aflatoxins have been considered as one of the major risk factors of male infertility, and aflatoxin B1 (AFB1) is the most highly toxic and prevalent member of the aflatoxins family. Selenium (Se), an essential nutritional trace mineral for normal testicular development and male fertility, has received extensive intensive on protective effects of male reproductive system due to its potential antioxidant and activating testosterone synthesis. To investigate the protective effect of Se on AFB1-induced testicular toxicity, the mice were orally administered with AFB1 (0.75 mg/kg) and Se (0.2 mg/kg or 0.4 mg/kg) for 45 days. We found that that Se elevated testes index, sperm functional parameters (concentration, malformation, and motility), and the level of serum testosterone in AFB1-exposed mice. Moreover, our results showed that Se attenuated the AFB1-induced oxidative stress and the reduction of testicular testosterone synthesis enzyme protein expression such as steroidogenic acute regulatory protein (StAR), P450 side-chain cleavage (P450scc), and 17β-hydroxysteroid dehydrogenase (17β-HSD) in AFB1-exposed mice. These results demonstrated that Se conferred protection against AFB1-induced testicular toxicity and can be attributed to its antioxidant and increased testosterone level by stimulating protein expression of StAR and testosterone synthetic enzymes.

  8. Second Aerospace Environmental Technology Conference

    NASA Technical Reports Server (NTRS)

    Whitaker, A. F. (Editor); Clark-Ingram, M. (Editor)

    1997-01-01

    The mandated elimination of CFC'S, Halons, TCA, and other ozone depleting chemicals and specific hazardous materials has required changes and new developments in aerospace materials and processes. The aerospace industry has been involved for several years in providing product substitutions, redesigning entire production processes, and developing new materials that minimize or eliminate damage to the environment. These activities emphasize replacement cleaning solvents and their application, verification, compliant coatings including corrosion protection system and removal techniques, chemical propulsion effects on the environment, and the initiation of modifications to relevant processing and manufacturing specifications and standards.

  9. Second Aerospace Environmental Technology Conference

    NASA Technical Reports Server (NTRS)

    Whitaker, A. F.; Clark-Ingram, M.; Hessler, S. L.

    1997-01-01

    The mandated elimination of CFC's, Halons, TCA, and other ozone depleting chemicals and specific hazardous materials has required changes and new developments in aerospace materials and processes. The aerospace industry has been involved for several years in providing product substitutions, redesigning entire production processes, and developing new materials that minimize or eliminate damage to the environment. These activities emphasize replacement cleaning solvents and their application verifications, compliant coatings including corrosion protection systems, and removal techniques, chemical propulsion effects on the environment, and the initiation of modifications to relevant processing and manufacturing specifications and standards.

  10. Molecular pharmacodynamics of emixustat in protection against retinal degeneration

    PubMed Central

    Zhang, Jianye; Kiser, Philip D.; Badiee, Mohsen; Palczewska, Grazyna; Dong, Zhiqian; Golczak, Marcin; Tochtrop, Gregory P.; Palczewski, Krzysztof

    2015-01-01

    Emixustat is a visual cycle modulator that has entered clinical trials as a treatment for age-related macular degeneration (AMD). This molecule has been proposed to inhibit the visual cycle isomerase RPE65, thereby slowing regeneration of 11-cis-retinal and reducing production of retinaldehyde condensation byproducts that may be involved in AMD pathology. Previously, we reported that all-trans-retinal (atRAL) is directly cytotoxic and that certain primary amine compounds that transiently sequester atRAL via Schiff base formation ameliorate retinal degeneration. Here, we have shown that emixustat stereoselectively inhibits RPE65 by direct active site binding. However, we detected the presence of emixustat-atRAL Schiff base conjugates, indicating that emixustat also acts as a retinal scavenger, which may contribute to its therapeutic effects. Using agents that lack either RPE65 inhibitory activity or the capacity to sequester atRAL, we assessed the relative importance of these 2 modes of action in protection against retinal phototoxicity in mice. The atRAL sequestrant QEA-B-001-NH2 conferred protection against phototoxicity without inhibiting RPE65, whereas an emixustat derivative incapable of atRAL sequestration was minimally protective, despite direct inhibition of RPE65. These data indicate that atRAL sequestration is an essential mechanism underlying the protective effects of emixustat and related compounds against retinal phototoxicity. Moreover, atRAL sequestration should be considered in the design of next-generation visual cycle modulators. PMID:26075817

  11. The Impact of Phenotypic and Genotypic G6PD Deficiency on Risk of Plasmodium vivax Infection: A Case-Control Study amongst Afghan Refugees in Pakistan

    PubMed Central

    Leslie, Toby; Briceño, Marnie; Mayan, Ismail; Mohammed, Nasir; Klinkenberg, Eveline; Sibley, Carol Hopkins; Whitty, Christopher J. M.; Rowland, Mark

    2010-01-01

    Background The most common form of malaria outside Africa, Plasmodium vivax, is more difficult to control than P. falciparum because of the latent liver hypnozoite stage, which causes multiple relapses and provides an infectious reservoir. The African (A−) G6PD (glucose-6-phosphate dehydrogenase) deficiency confers partial protection against severe P. falciparum. Recent evidence suggests that the deficiency also confers protection against P. vivax, which could explain its wide geographical distribution in human populations. The deficiency has a potentially serious interaction with antirelapse therapies (8-aminoquinolines such as primaquine). If the level of protection was sufficient, antirelapse therapy could become more widely available. We therefore tested the hypothesis that G6PD deficiency is protective against vivax malaria infection. Methods and Findings A case-control study design was used amongst Afghan refugees in Pakistan. The frequency of phenotypic and genotypic G6PD deficiency in individuals with vivax malaria was compared against controls who had not had malaria in the previous two years. Phenotypic G6PD deficiency was less common amongst cases than controls (cases: 4/372 [1.1%] versus controls 42/743 [5.7%]; adjusted odds ratio [AOR] 0.18 [95% confidence interval (CI) 0.06–0.52], p = 0.001). Genetic analysis demonstrated that the G6PD deficiency allele identified (Mediterranean type) was associated with protection in hemizygous deficient males (AOR = 0.12 [95% CI 0.02–0.92], p = 0.041). The deficiency was also protective in females carrying the deficiency gene as heterozygotes or homozygotes (pooled AOR = 0.37 [95% CI 0.15–0.94], p = 0.037). Conclusions G6PD deficiency (Mediterranean type) conferred significant protection against vivax malaria infection in this population whether measured by phenotype or genotype, indicating a possible evolutionary role for vivax malaria in the selective retention of the G6PD deficiency trait in human populations. Further work is required on the genotypic protection associated with other types of G6PD deficiency and on developing simple point-of-care technologies to detect it before administering antirelapse therapy. Please see later in the article for the Editors' Summary PMID:20520804

  12. Rearrangement of Influenza Virus Spliced Segments for the Development of Live-Attenuated Vaccines

    PubMed Central

    Nogales, Aitor; DeDiego, Marta L.; Topham, David J.

    2016-01-01

    ABSTRACT Influenza viral infections represent a serious public health problem, with influenza virus causing a contagious respiratory disease which is most effectively prevented through vaccination. Segments 7 (M) and 8 (NS) of the influenza virus genome encode mRNA transcripts that are alternatively spliced to express two different viral proteins. This study describes the generation, using reverse genetics, of three different recombinant influenza A/Puerto Rico/8/1934 (PR8) H1N1 viruses containing M or NS viral segments individually or modified M or NS viral segments combined in which the overlapping open reading frames of matrix 1 (M1)/M2 for the modified M segment and the open reading frames of nonstructural protein 1 (NS1)/nuclear export protein (NEP) for the modified NS segment were split by using the porcine teschovirus 1 (PTV-1) 2A autoproteolytic cleavage site. Viruses with an M split segment were impaired in replication at nonpermissive high temperatures, whereas high viral titers could be obtained at permissive low temperatures (33°C). Furthermore, viruses containing the M split segment were highly attenuated in vivo, while they retained their immunogenicity and provided protection against a lethal challenge with wild-type PR8. These results indicate that influenza viruses can be effectively attenuated by the rearrangement of spliced segments and that such attenuated viruses represent an excellent option as safe, immunogenic, and protective live-attenuated vaccines. Moreover, this is the first time in which an influenza virus containing a restructured M segment has been described. Reorganization of the M segment to encode M1 and M2 from two separate, nonoverlapping, independent open reading frames represents a useful tool to independently study mutations in the M1 and M2 viral proteins without affecting the other viral M product. IMPORTANCE Vaccination represents our best therapeutic option against influenza viral infections. However, the efficacy of current influenza vaccines is suboptimal, and novel approaches are necessary for the prevention of disease caused by this important human respiratory pathogen. In this work, we describe a novel approach to generate safer and more efficient live-attenuated influenza virus vaccines (LAIVs) based on recombinant viruses whose genomes encode nonoverlapping and independent M1/M2 (split M segment [Ms]) or both M1/M2 and NS1/NEP (Ms and split NS segment [NSs]) open reading frames. Viruses containing a modified M segment were highly attenuated in mice but were able to confer, upon a single intranasal immunization, complete protection against a lethal homologous challenge with wild-type virus. Notably, the protection efficacy conferred by our viruses with split M segments was better than that conferred by the current temperature-sensitive LAIV. Altogether, these results open a new avenue for the development of safer and more protective LAIVs on the basis of the reorganization of spliced viral RNA segments in the genome. PMID:27122587

  13. An Inactivated Rabies Virus–Based Ebola Vaccine, FILORAB1, Adjuvanted With Glucopyranosyl Lipid A in Stable Emulsion Confers Complete Protection in Nonhuman Primate Challenge Models

    PubMed Central

    Johnson, Reed F.; Kurup, Drishya; Hagen, Katie R.; Fisher, Christine; Keshwara, Rohan; Papaneri, Amy; Perry, Donna L.; Cooper, Kurt; Jahrling, Peter B.; Wang, Jonathan T.; ter Meulen, Jan; Wirblich, Christoph; Schnell, Matthias J.

    2016-01-01

    The 2013–2016 West African Ebola virus (EBOV) disease outbreak was the largest filovirus outbreak to date. Over 28 000 suspected, probable, or confirmed cases have been reported, with a 53% case-fatality rate. The magnitude and international impact of this EBOV outbreak has highlighted the urgent need for a safe and efficient EBOV vaccine. To this end, we demonstrate the immunogenicity and protective efficacy of FILORAB1, a recombinant, bivalent, inactivated rabies virus–based EBOV vaccine, in rhesus and cynomolgus monkeys. Our results demonstrate that the use of the synthetic Toll-like receptor 4 agonist glucopyranosyl lipid A in stable emulsion (GLA-SE) as an adjuvant increased the efficacy of FILORAB1 to 100% protection against lethal EBOV challenge, with no to mild clinical signs of disease. Furthermore, all vaccinated subjects developed protective anti–rabies virus antibody titers. Taken together, these results support further development of FILORAB1/GLA-SE as an effective preexposure EBOV vaccine. PMID:27456709

  14. G6PD A- deficiency and severe malaria in The Gambia: heterozygote advantage and possible homozygote disadvantage.

    PubMed

    Sirugo, Giorgio; Predazzi, Irene M; Bartlett, Jacquelaine; Tacconelli, Alessandra; Walther, Michael; Williams, Scott M

    2014-05-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is frequent in Africa, because it confers resistance to Plasmodium falciparum malaria; however, the nature of the protection and the genotypes associated with it have been controversial. In 1972, Bienzle and others described protection from malaria in West African females heterozygous for G6PD A-. They determined that G6PD A- heterozygotes had lower parasite counts than A- homozygotes, hemizygous males, and normal individuals. However, other studies have reached different conclusions about the protective genotypes. DNA samples from 135 children with severe malaria and 146 children with mild malaria from The Gambia were genotyped for the G6PD A- mutation that is most frequent among Gambians (G6PD 968 T->C); there was a marked deficiency of heterozygotes and an excess of homozygotes with severe malaria, producing a strong deviation from Hardy-Weinberg equilibrium. Our results support the protective effect in G6PD A- heterozygous females and suggest that homozygotes might be more susceptible to severe malaria attacks.

  15. Thermal Aggregation of Calcium-Fortified Skim Milk Enhances Probiotic Protection during Convective Droplet Drying.

    PubMed

    Wang, Juan; Huang, Song; Fu, Nan; Jeantet, Romain; Chen, Xiao Dong

    2016-08-03

    Probiotic bacteria have been reported to confer benefits on hosts when delivered in an adequate dose. Spray-drying is expected to produce dried and microencapsulated probiotic products due to its low production cost and high energy efficiency. The bottleneck in probiotic application addresses the thermal and dehydration-related inactivation of bacteria during process. A protective drying matrix was designed by modifying skim milk with the principle of calcium-induced protein thermal aggregation. The well-defined single-droplet drying technique was used to monitor the droplet-particle conversion and the protective effect of this modified Ca-aggregated milk on Lactobacillus rhamnosus GG. The Ca-aggregated milk exhibited a higher drying efficiency and superior protection on L. rhamnosus GG during thermal convective drying. The mechanism was explained by the aggregation in milk, causing the lower binding of water in the serum phase and, conversely, local concentrated milk aggregates involved in bacteria entrapment in the course of drying. This work may open new avenues for the development of probiotic products with high bacterial viability and calcium enrichment.

  16. Application of Remote Sensing to the Chesapeake Bay Region. Volume 1: Executive summary

    NASA Technical Reports Server (NTRS)

    Chen, W. T.; Freas, G. W., Jr.; Hickman, G. D.; Pemberton, D. A.; Wilkerson, T. D.; Adler, I.; Laurie, V. J.

    1978-01-01

    The proceedings are presented of a conference, jointly sponsored by the National Aeronautics and Space Administration, the U.S. Environmental Protection Agency, and the University of Maryland. The purpose of the Conference was to assemble representatives of federal and state government agencies engaged in research on the condition and evolution of the Chesapeake Bay to compose a status report, to present current activities and future plans, and to recommend a long-range future course of policies and programs.

  17. DoD High Performance Computing Modernization Program Users Group Conference (HPCMP UGC 2011) Held in Portland, Oregon on June 20-23, 2011

    DTIC Science & Technology

    2011-06-01

    4. Conclusion The Web -based AGeS system described in this paper is a computationally-efficient and scalable system for high- throughput genome...method for protecting web services involves making them more resilient to attack using autonomic computing techniques. This paper presents our initial...20–23, 2011 2011 DoD High Performance Computing Modernzation Program Users Group Conference HPCMP UGC 2011 The papers in this book comprise the

  18. The Impact of Environmental Protection on the Operational Commander’s Warfighting Decisions

    DTIC Science & Technology

    1993-05-17

    as well as the testing of any type of weapons."’ The 1982 United Nations Convention on the Law of the Sea places restrictions on the discharge of oil ...Janeiro, Brazil . The conference, which was sponsored by the United Nations, was a global environmental conference which was attended by a number of...were of mangrove areas along the Saigon River and that a single spraying of defoliants was sufficient to kill the mangrove trees. They estimated that

  19. Ninth Conference on Space Simulation

    NASA Technical Reports Server (NTRS)

    1977-01-01

    The papers presented in this conference provided an international dialogue and a meaningful exchange in the simulation of space environments as well as the evolution of these technological advances into other fields. The papers represent a significant contribution to the understanding of space simulation problems and the utilization of this knowledge. The topics of the papers include; spacecraft testing; facilities and test equipment; system and subsystem test; life sciences, medicine and space; physical environmental factors; chemical environmental factors; contamination; space physics; and thermal protection.

  20. The Role of Parental Engagement in the Intergenerational Transmission of Smoking Behavior and Identity.

    PubMed

    Gottfredson, Nisha C; Hussong, Andrea M; Ennett, Susan T; Rothenberg, W Andrew

    2017-05-01

    Prior research has found that the protective effect of parental engagement on adolescent smoking behaviors may be weaker if parents smoke. We examine parental influence on adolescent smoking using a social learning theory framework. We hypothesize that adolescents are more likely to mimic parental smoking behavior if they perceive parents as being more engaged and if the parent is the same gender of the adolescent. Hypotheses were tested using a diverse sample of 6,998 adolescents who were followed for seven waves (grades 6-12). Adolescent gender, time-stable and time-varying effects of parental engagement, adolescent perceptions of parental smoking, and interactions among the effects of these variables are tested using multilevel mediation models. We use a traditional measure of past 3-month adolescent smoking and a novel measure of smoking identity. Parental smoking was associated with a developmental increase in adolescent smoking and time-stable and time-varying parental engagement protected against adolescent smoking, whereas maternal engagement and smoking exerted independent and opposite effects with no moderation and time-stable paternal engagement moderated the effects of perceived paternal smoking on adolescent smoking outcomes. Parental smoking was more strongly associated with adolescent smoking outcomes when adolescent gender was congruent with parent gender. Even when parents smoke, parental engagement confers protection. Protective effects of engagement may be enhanced among parents who smoke through increased antismoking communication, particularly as adolescents reach the legal smoking age. Copyright © 2016 Society for Adolescent Health and Medicine. Published by Elsevier Inc. All rights reserved.

  1. Acylated and unacylated ghrelin confer neuroprotection to mesencephalic neurons.

    PubMed

    Wagner, Johanna; Vulinović, Franca; Grünewald, Anne; Unger, Marcus M; Möller, Jens C; Klein, Christine; Michel, Patrick P; Ries, Vincent; Oertel, Wolfgang H; Alvarez-Fischer, Daniel

    2017-12-04

    The polypeptide ghrelin is an endogenous ligand at the growth hormone secretagogue receptor 1a. To ghrelin multiple functions have been ascribed including promotion of gastrointestinal motility. Postprandial ghrelin levels have been reported to be reduced in patients suffering from Parkinson disease (PD). Experimental studies revealed neuroprotective effects of ghrelin in different PD models. The purpose of the present study was (i) to further elucidate the mechanism underlying the neuroprotective action of ghrelin and (ii) to determine whether these effects occur with both the acylated and the unacylated form. The study was conducted in primary mesencephalic cultures treated with mitochondrial complex I and complex II inhibitors. We show that protective effects of ghrelin against complex I inhibition with MPP + were independent of the acylation status of ghrelin, although acylated ghrelin appeared to be more potent. Protection by both forms was also observed when neurons were exposed to the complex II inhibitor 3-NP. Both forms led to higher oxygen consumption rates upon electron transport chain uncoupling, indicating that the two peptides may exert uncoupling effects themselves. We demonstrate that the rescue provided by ghrelin required calcium influx through L-type voltage-gated calcium channels. Whereas the protective effects of acylated ghrelin required receptor binding, effects of the unacylated form remained unaffected by treatment with a ghrelin receptor antagonist. Importantly, inhibition of ghrelin O-acyltransferase failed to reduce the activity of unacylated ghrelin. Overall, our data suggest that both acylated and unacylated ghrelin afford protection to dopamine neurons but through mechanisms that only partially overlap. Copyright © 2017 IBRO. Published by Elsevier Ltd. All rights reserved.

  2. Managing the effect of TRIPS on availability of priority vaccines.

    PubMed Central

    Milstien, Julie; Kaddar, Miloud

    2006-01-01

    The stated purpose of intellectual property protection is to stimulate innovation. The Agreement on Trade-Related Aspects of Intellectual Property Rights (TRIPS) requires all Members of the World Trade Organization (WTO) to enact national laws conferring minimum standards of intellectual property protection by certain deadlines. Critics of the Agreement fear that such action is inconsistent with ensuring access to medicines in the developing world. A WHO convened meeting on intellectual property rights and vaccines in developing countries, on which this paper is based, found no evidence that TRIPS has stimulated innovation in developing market vaccine development (where markets are weak) or that protection of intellectual property rights has had a negative effect on access to vaccines. However, access to future vaccines in the developing world could be threatened by compliance with TRIPS. The management of such threats requires adherence of all countries to the Doha Declaration on TRIPS, and the protections guaranteed by the Agreement itself, vigilance on TRIPS-plus elements of free trade agreements, developing frameworks for licensing and technology transfer, and promoting innovative vaccine development in developing countries. The role of international organizations in defining best practices, dissemination of information, and monitoring TRIPS impact will be crucial to ensuring optimal access to priority new vaccines for the developing world. PMID:16710544

  3. Adjuvant-enhanced CD4 T Cell Responses are Critical to Durable Vaccine Immunity.

    PubMed

    Martins, Karen A O; Cooper, Christopher L; Stronsky, Sabrina M; Norris, Sarah L W; Kwilas, Steven A; Steffens, Jesse T; Benko, Jacqueline G; van Tongeren, Sean A; Bavari, Sina

    2016-01-01

    Protein-based vaccines offer a safer alternative to live-attenuated or inactivated vaccines but have limited immunogenicity. The identification of adjuvants that augment immunogenicity, specifically in a manner that is durable and antigen-specific, is therefore critical for advanced development. In this study, we use the filovirus virus-like particle (VLP) as a model protein-based vaccine in order to evaluate the impact of four candidate vaccine adjuvants on enhancing long term protection from Ebola virus challenge. Adjuvants tested include poly-ICLC (Hiltonol), MPLA, CpG 2395, and alhydrogel. We compared and contrasted antibody responses, neutralizing antibody responses, effector T cell responses, and T follicular helper (Tfh) cell frequencies with each adjuvant's impact on durable protection. We demonstrate that in this system, the most effective adjuvant elicits a Th1-skewed antibody response and strong CD4 T cell responses, including an increase in Tfh frequency. Using immune-deficient animals and adoptive transfer of serum and cells from vaccinated animals into naïve animals, we further demonstrate that serum and CD4 T cells play a critical role in conferring protection within effective vaccination regimens. These studies inform on the requirements of long term immune protection, which can potentially be used to guide screening of clinical-grade adjuvants for vaccine clinical development.

  4. Mitochondria-Division Inhibitor 1 Protects Against Amyloid-β induced Mitochondrial Fragmentation and Synaptic Damage in Alzheimer's Disease.

    PubMed

    Reddy, P Hemachandra; Manczak, Maria; Yin, XiangLing

    2017-01-01

    The purpose our study was to determine the protective effects of mitochondria division inhibitor 1 (Mdivi1) in Alzheimer's disease (AD). Mdivi1 is hypothesized to reduce excessive fragmentation of mitochondria and mitochondrial dysfunction in AD neurons. Very little is known about whether Mdivi1 can confer protective effects in AD. In the present study, we sought to determine the protective effects of Mdivi1 against amyloid-β (Aβ)- and mitochondrial fission protein, dynamin-related protein 1 (Drp1)-induced excessive fragmentation of mitochondria in AD progression. We also studied preventive (Mdivi1+Aβ42) and intervention (Aβ42+Mdivi1) effects against Aβ42 in N2a cells. Using real-time RT-PCR and immunoblotting analysis, we measured mRNA and protein levels of mitochondrial dynamics, mitochondrial biogenesis, and synaptic genes. We also assessed mitochondrial function by measuring H2O2, lipid peroxidation, cytochrome oxidase activity, and mitochondrial ATP. MTT assays were used to assess the cell viability. Aβ42 was found to impair mitochondrial dynamics, lower mitochondrial biogenesis, lower synaptic activity, and lower mitochondrial function. On the contrary, Mdivi1 enhanced mitochondrial fusion activity, lowered fission machinery, and increased biogenesis and synaptic proteins. Mitochondrial function and cell viability were elevated in Mdivi1-treated cells. Interestingly, Mdivi1 pre- and post-treated cells treated with Aβ showed reduced mitochondrial dysfunction, and maintained cell viability, mitochondrial dynamics, mitochondrial biogenesis, and synaptic activity. The protective effects of Mdivi1 were stronger in N2a+Aβ42 pre-treated with Mdivi1, than in N2a+Aβ42 cells than Mdivi1 post-treated cells, indicating that Mdivi1 works better in prevention than treatment in AD like neurons.

  5. Extension of Drosophila lifespan by cinnamon through a sex-specific dependence on the insulin receptor substrate chico

    PubMed Central

    Schriner, Samuel E.; Kuramada, Steven; Lopez, Terry E.; Truong, Stephanie; Pham, Andrew; Jafari, Mahtab

    2015-01-01

    Cinnamon is a spice commonly used worldwide to flavor desserts, fruits, cereals, breads, and meats. Numerous health benefits have been attributed to its consumption, including the recent suggestion that it may decrease blood glucose levels in people with diabetes. Insulin signaling is an integral pathway regulating the lifespan of laboratory organisms, such as worms, flies, and mice. We posited that if cinnamon truly improved the clinical signs of diabetes in people that it would also act on insulin signaling in laboratory organisms and increase lifespan. We found that cinnamon did extend lifespan in the fruit fly, Drosophila melanogaster. However, it had no effect on the expression levels of the 3 aging-related Drosophila insulin-like peptides nor did it alter sugar, fat, or soluble protein levels, as would be predicted. In addition, cinnamon exhibited no protective effects in males against oxidative challenges. However, in females it did confer a protective effect against paraquat, but sensitized them to iron. Cinnamon provided no protective effect against desiccation and starvation in females, but sensitized males to both. Interestingly, cinnamon protected both sexes against cold, sensitized both to heat, and elevated HSP70 expression levels. We also found that cinnamon required the insulin receptor substrate to extend lifespan in males, but not females. We conclude that cinnamon does not extend lifespan by improving stress tolerance in general, though it does act, at least in part, through insulin signaling. PMID:25456850

  6. Endothelial nitric oxide synthase protects neurons against ischemic injury through regulation of brain-derived neurotrophic factor expression.

    PubMed

    Li, Shi-Ting; Pan, Jing; Hua, Xu-Ming; Liu, Hong; Shen, Sa; Liu, Jia-Fu; Li, Bin; Tao, Bang-Bao; Ge, Xiao-Li; Wang, Xu-Hui; Shi, Juan-Hong; Wang, Xiao-Qiang

    2014-02-01

    Several lines of evidence demonstrated that endothelial nitric oxide synthase (eNOS) confers protective effects during cerebral ischemia. In this study, we explored the underlying cellular and molecular mechanisms of neuroprotection by eNOS. A series of in vivo and in vitro ischemic models were employed to study the role of eNOS in maintaining neuronal survival and to identify the downstream factors. The current data showed that pretreatment with a specific eNOS inhibitor, L-N5-(1-iminoethyl) ornithine (L-NIO), aggravated the neuronal loss in the rat cerebral ischemic model, accompanied by reduction in brain-derived neurotrophic factor (BDNF) level, which was consistent with the findings in an oxygen-glucose deprivation model (OGD) with two neuronal cells: primary rat cortical neurons and human neuroblastoma SH-SY5Y cells. Furthermore, the extensive neuronal loss induced by L-NIO was totally abolished by exogenous BDNF in both in vitro and in vivo models. On the other hand, eNOS overexpression through an adenoviral vector exerted a prominent protective effect on the neuronal cells subject to OGD, and the protective effect was totally abrogated by a neutralizing anti-BDNF antibody. Collectively, our results indicate that the neuroprotection of neuron-derived eNOS against the cerebral ischemia was mediated through the regulation of BDNF secretion. In conclusion, our discovery provides a novel explanation for the neuroprotective effect of eNOS under pathological ischemic conditions such as stroke. © 2014 John Wiley & Sons Ltd.

  7. Extension of Drosophila lifespan by cinnamon through a sex-specific dependence on the insulin receptor substrate chico.

    PubMed

    Schriner, Samuel E; Kuramada, Steven; Lopez, Terry E; Truong, Stephanie; Pham, Andrew; Jafari, Mahtab

    2014-12-01

    Cinnamon is a spice commonly used worldwide to flavor desserts, fruits, cereals, breads, and meats. Numerous health benefits have been attributed to its consumption, including the recent suggestion that it may decrease blood glucose levels in people with diabetes. Insulin signaling is an integral pathway regulating the lifespan of laboratory organisms, such as worms, flies, and mice. We posited that if cinnamon truly improved the clinical signs of diabetes in people that it would also act on insulin signaling in laboratory organisms and increase lifespan. We found that cinnamon did extend lifespan in the fruit fly, Drosophila melanogaster. However, it had no effect on the expression levels of the 3 aging-related Drosophila insulin-like peptides nor did it alter sugar, fat, or soluble protein levels, as would be predicted. In addition, cinnamon exhibited no protective effects in males against oxidative challenges. However, in females it did confer a protective effect against paraquat, but sensitized them to iron. Cinnamon provided no protective effect against desiccation and starvation in females, but sensitized males to both. Interestingly, cinnamon protected both sexes against cold, sensitized both to heat, and elevated HSP70 expression levels. We also found that cinnamon required the insulin receptor substrate to extend lifespan in males, but not females. We conclude that cinnamon does not extend lifespan by improving stress tolerance in general, though it does act, at least in part, through insulin signaling. Published by Elsevier Inc.

  8. IL-4Rα-Associated Antigen Processing by B Cells Promotes Immunity in Nippostrongylus brasiliensis Infection

    PubMed Central

    Hoving, Jennifer C.; Nieuwenhuizen, Natalie; McSorley, Henry J.; Ndlovu, Hlumani; Bobat, Saeeda; Kimberg, Matti; Kirstein, Frank; Cutler, Anthony J.; DeWals, Benjamin; Cunningham, Adam F.; Brombacher, Frank

    2013-01-01

    In this study, B cell function in protective TH2 immunity against N. brasiliensis infection was investigated. Protection against secondary infection depended on IL-4Rα and IL-13; but not IL-4. Protection did not associate with parasite specific antibody responses. Re-infection of B cell-specific IL-4Rα−/− mice resulted in increased worm burdens compared to control mice, despite their equivalent capacity to control primary infection. Impaired protection correlated with reduced lymphocyte IL-13 production and B cell MHC class II and CD86 surface expression. Adoptive transfer of in vivo N. brasiliensis primed IL-4Rα expressing B cells into naïve BALB/c mice, but not IL-4Rα or IL-13 deficient B cells, conferred protection against primary N. brasiliensis infection. This protection required MHC class II compatibility on B cells suggesting cognate interactions by B cells with CD4+ T cells were important to co-ordinate immunity. Furthermore, the rapid nature of these protective effects by B cells suggested non-BCR mediated mechanisms, such as via Toll Like Receptors, was involved, and this was supported by transfer experiments using antigen pulsed Myd88−/− B cells. These data suggest TLR dependent antigen processing by IL-4Rα-responsive B cells producing IL-13 contribute significantly to CD4+ T cell-mediated protective immunity against N. brasiliensis infection. PMID:24204255

  9. 78 FR 49749 - Trailblazer Pipeline Company LLC; Notice of Technical Conference

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-15

    ... technical, engineering, and operational support for its proposed gas quality specifications. Consistent with... Rehabilitation Act of 1973. For accessibility accommodations please send an email to [email protected] or...

  10. 75 FR 2140 - Columbia Gulf Transmission Company; Notice of Technical Conference

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-01-14

    ... in the protests, and if necessary, to provide additional technical, engineering and operational... Rehabilitation Act of 1973. For accessibility accommodations please send an e-mail to [email protected] or...

  11. Cardioprotective Effects of Tualang Honey: Amelioration of Cholesterol and Cardiac Enzymes Levels.

    PubMed

    Khalil, Md Ibrahim; Tanvir, E M; Afroz, Rizwana; Sulaiman, Siti Amrah; Gan, Siew Hua

    2015-01-01

    The present study was designed to investigate the cardioprotective effects of Malaysian Tualang honey against isoproterenol- (ISO-) induced myocardial infarction (MI) in rats by investigating changes in the levels of cardiac marker enzymes, cardiac troponin I (cTnI), triglycerides (TG), total cholesterol (TC), lipid peroxidation (LPO) products, and antioxidant defense system combined with histopathological examination. Male albino Wistar rats (n = 40) were pretreated orally with Tualang honey (3 g/kg/day) for 45 days. Subcutaneous injection of ISO (85 mg/kg in saline) for two consecutive days caused a significant increase in serum cardiac marker enzymes (creatine kinase-MB (CK-MB), lactate dehydrogenase (LDH), and aspartate transaminase (AST)), cTnI, serum TC, and TG levels. In addition, ISO-induced myocardial injury was confirmed by a significant increase in heart lipid peroxidation (LPO) products (TBARS) and a significant decrease in antioxidant enzymes (SOD, GPx, GRx, and GST). Pretreatment of ischemic rats with Tualang honey conferred significant protective effects on all of the investigated biochemical parameters. The biochemical findings were further confirmed by histopathological examination in both Tualang-honey-pretreated and ISO-treated hearts. The present study demonstrates that Tualang honey confers cardioprotective effects on ISO-induced oxidative stress by contributing to endogenous antioxidant enzyme activity via inhibition of lipid peroxidation.

  12. Testing Antifungal Vaccines in an Animal Model of Invasive Candidiasis and in Human Mucosal Candidiasis.

    PubMed

    Segal, Esther

    2017-01-01

    The following article will concentrate on the NDV-3 anti-Candida and Staphylococcus vaccine. The vaccine is composed of the N-terminal portion of the Candida albicans agglutinin-like sequence 3 protein (Als3p) and aluminum hydroxide as adjuvant. The vaccine conferred protection to mice against experimental vaginal, oral, and intravenous challenge with C. albicans. Due to the sequence and structural homology of the Als3p with Staphylococcus aureus surface proteins, the vaccine also protected against experimental skin and IV infection with S. aureus. The vaccine has reached the stage of human trials: phase 1 clinical studies have shown that the vaccine is safe and immunogenic. The latest brief conference abstract reports of vaccination in women suffering from recurrent vaginal candidiasis, indicating that the recurrence rates were lower in the women receiving the vaccine.

  13. Protection by Flavanol-Rich Foods Against Vascular Dysfunction and Oxidative Damage: 27th Hohenheim Consensus Conference1

    PubMed Central

    Sies, Helmut; Hollman, Peter C.H.; Grune, Tilman; Stahl, Wilhelm; Biesalski, Hans K.; Williamson, Gary

    2012-01-01

    Criteria for assessing the purported protection by flavanol-rich foods against vascular dysfunction and oxidative damage to biomolecules was the subject of the 27th Hohenheim Consensus Conference held on July 11, 2011. State-of-the-art evidence was put into perspective, focusing on several questions that were followed by a consensus answer. Among the topics addressed were the major sources of flavanols in the human diet, the bioavailability of flavanols, biomarkers for “health benefit,” and the biological function of flavanols. Consensus was reached on these topics. No conclusion was reached on the design of randomized, controlled trials for substantiation of health claims for flavanol-rich foods as to the necessity of a study arm with an isolated pharmacologically active compound, e.g., (−)-epicatechin. PMID:22516731

  14. Genetic Mapping Identifies Novel Highly Protective Antigens for an Apicomplexan Parasite

    PubMed Central

    Blake, Damer P.; Billington, Karen J.; Copestake, Susan L.; Oakes, Richard D.; Quail, Michael A.; Wan, Kiew-Lian; Shirley, Martin W.; Smith, Adrian L.

    2011-01-01

    Apicomplexan parasites are responsible for a myriad of diseases in humans and livestock; yet despite intensive effort, development of effective sub-unit vaccines remains a long-term goal. Antigenic complexity and our inability to identify protective antigens from the pool that induce response are serious challenges in the development of new vaccines. Using a combination of parasite genetics and selective barriers with population-based genetic fingerprinting, we have identified that immunity against the most important apicomplexan parasite of livestock (Eimeria spp.) was targeted against a few discrete regions of the genome. Herein we report the identification of six genomic regions and, within two of those loci, the identification of true protective antigens that confer immunity as sub-unit vaccines. The first of these is an Eimeria maxima homologue of apical membrane antigen-1 (AMA-1) and the second is a previously uncharacterised gene that we have termed ‘immune mapped protein-1’ (IMP-1). Significantly, homologues of the AMA-1 antigen are protective with a range of apicomplexan parasites including Plasmodium spp., which suggest that there may be some characteristic(s) of protective antigens shared across this diverse group of parasites. Interestingly, homologues of the IMP-1 antigen, which is protective against E. maxima infection, can be identified in Toxoplasma gondii and Neospora caninum. Overall, this study documents the discovery of novel protective antigens using a population-based genetic mapping approach allied with a protection-based screen of candidate genes. The identification of AMA-1 and IMP-1 represents a substantial step towards development of an effective anti-eimerian sub-unit vaccine and raises the possibility of identification of novel antigens for other apicomplexan parasites. Moreover, validation of the parasite genetics approach to identify effective antigens supports its adoption in other parasite systems where legitimate protective antigen identification is difficult. PMID:21347348

  15. Development of a chimeric Zika vaccine using a licensed live-attenuated flavivirus vaccine as backbone.

    PubMed

    Li, Xiao-Feng; Dong, Hao-Long; Wang, Hong-Jiang; Huang, Xing-Yao; Qiu, Ye-Feng; Ji, Xue; Ye, Qing; Li, Chunfeng; Liu, Yang; Deng, Yong-Qiang; Jiang, Tao; Cheng, Gong; Zhang, Fu-Chun; Davidson, Andrew D; Song, Ya-Jun; Shi, Pei-Yong; Qin, Cheng-Feng

    2018-02-14

    The global spread of Zika virus (ZIKV) and its unexpected association with congenital defects necessitates the rapid development of a safe and effective vaccine. Here we report the development and characterization of a recombinant chimeric ZIKV vaccine candidate (termed ChinZIKV) that expresses the prM-E proteins of ZIKV using the licensed Japanese encephalitis live-attenuated vaccine SA14-14-2 as the genetic backbone. ChinZIKV retains its replication activity and genetic stability in vitro, while exhibiting an attenuation phenotype in multiple animal models. Remarkably, immunization of mice and rhesus macaques with a single dose of ChinZIKV elicits robust and long-lasting immune responses, and confers complete protection against ZIKV challenge. Significantly, female mice immunized with ChinZIKV are protected against placental and fetal damage upon ZIKV challenge during pregnancy. Overall, our study provides an alternative vaccine platform in response to the ZIKV emergency, and the safety, immunogenicity, and protection profiles of ChinZIKV warrant further clinical development.

  16. Genetic polymorphisms associated with breast cancer in malaysian cohort.

    PubMed

    Chahil, Jagdish Kaur; Munretnam, Khamsigan; Samsudin, Nurulhafizah; Lye, Say Hean; Hashim, Nikman Adli Nor; Ramzi, Nurul Hanis; Velapasamy, Sharmila; Wee, Ler Lian; Alex, Livy

    2015-04-01

    Genome-wide association studies have discovered multiple single nucleotide polymorphisms (SNPs) associated with the risk of common diseases. The objective of this study was to demonstrate the replication of previously published SNPs that showed statistical significance for breast cancer in the Malaysian population. In this case-control study, 80 subjects for each group were recruited from various hospitals in Malaysia. A total of 768 SNPs were genotyped and analyzed to distinguish risk and protective alleles. A total of three SNPs were found to be associated with increased risk of breast cancer while six SNPs showed protective effect. All nine were statistically significant SNPs (p ≤ 0.01), five SNPs from previous studies were successfully replicated in our study. Significant modifiable (diet) and non-modifiable (family history of breast cancer in first degree relative) risk factors were also observed. We identified nine SNPs from this study to be either conferring susceptibility or protection to breast cancer which may serve as potential markers in risk prediction.

  17. Immunogenicity and protective efficacy of a recombinant yellow fever vaccine against the murine malarial parasite Plasmodium yoelii.

    PubMed

    Stoyanov, Cristina T; Boscardin, Silvia B; Deroubaix, Stephanie; Barba-Spaeth, Giovanna; Franco, David; Nussenzweig, Ruth S; Nussenzweig, Michel; Rice, Charles M

    2010-06-23

    The live-attenuated yellow fever vaccine (YF17D) is one of the safest and most effective vaccines available today. Here, YF17D was genetically altered to express the circumsporozoite protein (CSP) from the murine malarial parasite Plasmodium yoelii. Reconstituted recombinant virus was viable and exhibited robust CSP expression. Immunization of naïve mice resulted in extensive proliferation of adoptively transferred CSP-specific transgenic CD8(+) T-cells. A single immunization of naïve mice with recombinant YF17D resulted in robust production of IFN-gamma by CD8(+) T-cells and IFN-gamma and IL-2 by CD4(+) T-cells. A prime-boost regimen consisting of recombinant virus followed by a low-dose of irradiated sporozoites conferred protection against challenge with P. yoelii. Taken together, these results show that recombinant YF17D can efficiently express CSP in culture, and prime a protective immune response in vivo. (c) 2010 Elsevier Ltd. All rights reserved.

  18. Designing malaria vaccines to circumvent antigen variability.

    PubMed

    Ouattara, Amed; Barry, Alyssa E; Dutta, Sheetij; Remarque, Edmond J; Beeson, James G; Plowe, Christopher V

    2015-12-22

    Prospects for malaria eradication will be greatly enhanced by an effective vaccine, but parasite genetic diversity poses a major impediment to malaria vaccine efficacy. In recent pre-clinical and field trials, vaccines based on polymorphic Plasmodium falciparum antigens have shown efficacy only against homologous strains, raising the specter of allele-specific immunity such as that which plagues vaccines against influenza and HIV. The most advanced malaria vaccine, RTS,S, targets relatively conserved epitopes on the P. falciparum circumsporozoite protein. After more than 40 years of development and testing, RTS,S, has shown significant but modest efficacy against clinical malaria in phase 2 and 3 trials. Ongoing phase 2 studies of an irradiated sporozoite vaccine will ascertain whether the full protection against homologous experimental malaria challenge conferred by high doses of a whole organism vaccine can provide protection against diverse strains in the field. Here we review and evaluate approaches being taken to design broadly cross-protective malaria vaccines. Copyright © 2015. Published by Elsevier Ltd.

  19. Cross-Reactive and Potent Neutralizing Antibody Responses in Human Survivors of Natural Ebolavirus Infection.

    PubMed

    Flyak, Andrew I; Shen, Xiaoli; Murin, Charles D; Turner, Hannah L; David, Joshua A; Fusco, Marnie L; Lampley, Rebecca; Kose, Nurgun; Ilinykh, Philipp A; Kuzmina, Natalia; Branchizio, Andre; King, Hannah; Brown, Leland; Bryan, Christopher; Davidson, Edgar; Doranz, Benjamin J; Slaughter, James C; Sapparapu, Gopal; Klages, Curtis; Ksiazek, Thomas G; Saphire, Erica Ollmann; Ward, Andrew B; Bukreyev, Alexander; Crowe, James E

    2016-01-28

    Recent studies have suggested that antibody-mediated protection against the Ebolaviruses may be achievable, but little is known about whether or not antibodies can confer cross-reactive protection against viruses belonging to diverse Ebolavirus species, such as Ebola virus (EBOV), Sudan virus (SUDV), and Bundibugyo virus (BDBV). We isolated a large panel of human monoclonal antibodies (mAbs) against BDBV glycoprotein (GP) using peripheral blood B cells from survivors of the 2007 BDBV outbreak in Uganda. We determined that a large proportion of mAbs with potent neutralizing activity against BDBV bind to the glycan cap and recognize diverse epitopes within this major antigenic site. We identified several glycan cap-specific mAbs that neutralized multiple ebolaviruses, including SUDV, and a cross-reactive mAb that completely protected guinea pigs from the lethal challenge with heterologous EBOV. Our results provide a roadmap to develop a single antibody-based treatment effective against multiple Ebolavirus infections. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. CROSS-REACTIVE AND POTENT NEUTRALIZING ANTIBODY RESPONSES IN HUMAN SURVIVORS OF NATURAL EBOLAVIRUS INFECTION

    PubMed Central

    Flyak, Andrew I.; Shen, Xiaoli; Murin, Charles D.; Turner, Hannah L.; David, Joshua A.; Fusco, Marnie L.; Lampley, Rebecca; Kose, Nurgun; Ilinykh, Philipp A.; Kuzmina, Natalia; Branchizio, Andre; King, Hannah; Brown, Leland; Bryan, Christopher; Davidson, Edgar; Doranz, Benjamin J.; Slaughter, James C.; Sapparapu, Gopal; Klages, Curtis; Ksiazek, Thomas G.; Saphire, Erica Ollmann; Ward, Andrew B.; Bukreyev, Alexander; Crowe, James E.

    2015-01-01

    Summary Recent studies have suggested that antibody-mediated protection against the Ebolaviruses may be achievable, but little is known about whether or not antibodies can confer cross-reactive protection against viruses belonging to diverse Ebolavirus species, such as Ebola virus (EBOV), Sudan virus (SUDV) and Bundibugyo virus (BDBV). We isolated a large panel of human monoclonal antibodies (mAbs) against BDBV glycoprotein (GP) using peripheral blood B cells from survivors of the 2007 BDBV outbreak in Uganda. We determined that a large proportion of mAbs with potent neutralizing activity against BDBV bind to the glycan cap and recognize diverse epitopes within this major antigenic site. We identified several glycan cap-specific mAbs that neutralized multiple ebolaviruses including SUDV, and a cross-reactive mAb that completely protected guinea pigs from the lethal challenge with heterologous EBOV. Our results provide a roadmap to develop a single antibody-based treatment effective against multiple Ebolavirus infections. PMID:26806128

  1. Intradermal Vaccination With Adjuvanted Ebola Virus Soluble Glycoprotein Subunit Vaccine by Microneedle Patches Protects Mice Against Lethal Ebola Virus Challenge.

    PubMed

    Liu, Ying; Ye, Ling; Lin, Fang; Gomaa, Yasmine; Flyer, David; Carrion, Ricardo; Patterson, Jean L; Prausnitz, Mark R; Smith, Gale; Glenn, Gregory; Wu, Hua; Compans, Richard W; Yang, Chinglai

    2018-06-08

    In this study, we investigated immune responses induced by purified Ebola virus (EBOV) soluble glycoprotein (sGP) subunit vaccines via intradermal immunization with microneedle (MN) patches in comparison with intramuscular (IM) injection in mice. Our results showed that MN delivery of EBOV sGP was superior to IM injection in eliciting higher levels and longer lasting antibody responses against EBOV sGP and GP antigens. Moreover, sGP-specific immune responses induced by MN or IM immunizations were effectively augmented by formulating sGP with a saponin-based adjuvant, and they were shown to confer complete protection of mice against lethal mouse-adapted EBOV (MA-EBOV) challenge. In comparison, mice that received sGP without adjuvant by MN or IM immunizations succumbed to lethal MA-EBOV challenge. These results show that immunization with EBOV sGP subunit vaccines with adjuvant by MN patches, which have been shown to provide improved safety and thermal stability, is a promising approach to protect against EBOV infection.

  2. Protecting civil aircraft from the MANPAD threat: is this a practical scenario?

    NASA Astrophysics Data System (ADS)

    Taylor, William

    2005-11-01

    This paper has been written as a key note address and backdrop to the 2005 SPIE Technologies for Optical Countermeasures II Conference. The paper uses as a topic the problem of protecting civil aircraft from the Man Portable Air Defence missile Systems (MANPADS). The paper examines the economic background of the airline industry and the effects such a successful attack could have. It then addresses the various motives, means, and opportunities that the terrorists have to use MANPADS to progress attacks against civil aircraft. In reviewing the various mitigation options available to defeat or deny MANPAD engagements, the paper identifies key technology areas available for exploitation. It then focuses on the optical countermeasure technologies used in providing aircraft platform self protection. Finally, the paper summarises and concludes that whilst a lot has and can be done to militate against the MANPAD threat there is not yet an exportable, affordable and robust countermeasures technology for large scale commercial systems and operations.

  3. Palonosetron as an anti-emetic and anti-nausea agent in oncology.

    PubMed

    Aapro, Matti S

    2007-12-01

    Palonosetron (Aloxi(®), Onicit(®), Paloxi(®)) is a second-generation 5-HT(3) receptor antagonist (RA) with an extended half-life of ~40 hours and high binding affinity for the 5-HT₃ receptor that is markedly different from other 5-HT(3) RAs. Phase III trials demonstrate that a single dose of palonosetron compared with traditional 5-HT₃ RAs is more effective in preventing chemotherapy-induced nausea and vomiting (CINV) during the first 24 hours following chemotherapy (acute CINV), and also exhibits prolonged efficacy to provide significantly better protection from CINV in the delayed and overall phases. This superior and extended protection from CINV conferred by palonosetron following a single intravenous dose before chemotherapy simplifies dosing schedules. Recent research has focused on optimization of palonosetron-based antiemetic regimens, particularly in combination with steroids and neurokinin-1 RAs. The available clinical data indicate high control rates for palonosetron, suggesting a synergistic potential for protection in patients scheduled to receive emetogenic drug regimens.

  4. Protection from glutamate-induced excitotoxicity by memantine

    PubMed Central

    Kutzing, Melinda K.; Luo, Vincent; Firestein, Bonnie L.

    2014-01-01

    This study investigates whether the uncompetitive NMDA receptor antagonist, memantine, is able to protect dissociated cortical neurons from glutamate-induced excitotoxicity (GIE). Treatment with glutamate resulted in a significant loss of synchronization of neuronal activity as well as a significant increase in the duration of synchronized bursting events (SBEs). By administering memantine at the same time as glutamate, we were able to completely prevent these changes to the neuronal activity. Pretreatment with memantine was somewhat effective in preventing changes to the culture synchronization but was unable to fully protect the synchronization of electrical activity between neurons that showed high levels of synchronization prior to injury. Additionally, memantine pretreatment was unable to prevent the increase in the duration of SBEs caused by GIE. Thus, the timing of memantine treatment is important for conferring neuroprotection against glutamate-induced neurotoxicity. Finally, we found that GIE leads to a significant increase in the burst duration. Our data suggest that this may be due to an alteration in the inhibitory function of the neurons. PMID:22203191

  5. Interfamily Transfer of Dual NB-LRR Genes Confers Resistance to Multiple Pathogens

    PubMed Central

    Narusaka, Mari; Kubo, Yasuyuki; Hatakeyama, Katsunori; Imamura, Jun; Ezura, Hiroshi; Nanasato, Yoshihiko; Tabei, Yutaka; Takano, Yoshitaka; Shirasu, Ken; Narusaka, Yoshihiro

    2013-01-01

    A major class of disease resistance (R) genes which encode nucleotide binding and leucine rich repeat (NB-LRR) proteins have been used in traditional breeding programs for crop protection. However, it has been difficult to functionally transfer NB-LRR-type R genes in taxonomically distinct families. Here we demonstrate that a pair of Arabidopsis (Brassicaceae) NB-LRR-type R genes, RPS4 and RRS1, properly function in two other Brassicaceae, Brassica rapa and Brassica napus, but also in two Solanaceae, Nicotiana benthamiana and tomato (Solanum lycopersicum). The solanaceous plants transformed with RPS4/RRS1 confer bacterial effector-specific immunity responses. Furthermore, RPS4 and RRS1, which confer resistance to a fungal pathogen Colletotrichum higginsianum in Brassicaceae, also protect against Colletotrichum orbiculare in cucumber (Cucurbitaceae). Importantly, RPS4/RRS1 transgenic plants show no autoimmune phenotypes, indicating that the NB-LRR proteins are tightly regulated. The successful transfer of two R genes at the family level implies that the downstream components of R genes are highly conserved. The functional interfamily transfer of R genes can be a powerful strategy for providing resistance to a broad range of pathogens. PMID:23437080

  6. 10th Annual Systems Engineering Conference: Volume 2 Wednesday

    DTIC Science & Technology

    2007-10-25

    intelligently optimize resource performance. Self - Healing Detect hardware/software failures and reconfigure to permit continued operations. Self ...Types Wake Ice WEAPON/PLATFORM ACOUSTICS Self -Noise Radiated Noise Beam Forming Pulse Types Submarines, surface ships, and platform sensors P r o p P r o...Computing Self -Protecting Detect internal/external attacks and protect it’s resources from exploitation. Self -Optimizing Detect sub-optimal behaviors and

  7. Vaccination with poly(D,L-lactide-co-glycolide) nanoparticles loaded with soluble Leishmania antigens and modified with a TNFα-mimicking peptide or monophosphoryl lipid A confers protection against experimental visceral leishmaniasis

    PubMed Central

    Margaroni, Maritsa; Agallou, Maria; Athanasiou, Evita; Kammona, Olga; Kiparissides, Costas; Gaitanaki, Catherine; Karagouni, Evdokia

    2017-01-01

    Visceral leishmaniasis (VL) persists as a major public health problem, and since the existing chemotherapy is far from satisfactory, development of an effective vaccine emerges as the most appropriate strategy for confronting VL. The development of an effective vaccine relies on the selection of the appropriate antigen and also the right adjuvant and/or delivery vehicle. In the present study, the protective efficacy of poly(D,L-lactide-co-glycolide) (PLGA) nanoparticles (NPs), which were surface-modified with a TNFα-mimicking eight-amino-acid peptide (p8) and further functionalized by encapsulating soluble Leishmania infantum antigens (sLiAg) and monophosphoryl lipid A (MPLA), a TLR4 ligand, was evaluated against challenge with L. infantum parasites in BALB/c mice. Vaccination with these multifunctionalized PLGA nanoformulations conferred significant protection against parasite infection in vaccinated mice. In particular, vaccination with PLGA-sLiAg-MPLA or p8-PLGA-sLiAg NPs resulted in almost complete elimination of the parasite in the spleen for up to 4 months post-challenge. Parasite burden reduction was accompanied by antigen-specific humoral and cellular immune responses. Specifically, injection with PLGA-sLiAg-MPLA raised exclusively anti-sLiAg IgG1 antibodies post-vaccination, while in p8-PLGA-sLiAg-vaccinated mice, no antibody production was detected. However, 4 months post-challenge, in mice vaccinated with all the multifunctionalized NPs, antibody class switching towards IgG2a subtype was observed. The study of cellular immune responses revealed the increased proliferation capacity of spleen cells against sLiAg, consisting of IFNγ-producing CD4+ and CD8+ T cells. Importantly, the activation of CD8+ T cells was exclusively attributed to vaccination with PLGA NPs surface-modified with the p8 peptide. Moreover, characterization of cytokine production in vaccinated–infected mice revealed that protection was accompanied by significant increase of IFNγ and lower levels of IL-4 and IL-10 in protected mice when compared to control infected group. Conclusively, the above nanoformulations hold promise for future vaccination strategies against VL. PMID:28883727

  8. Making evolutionary history count: biodiversity planning for coral reef fishes and the conservation of evolutionary processes

    NASA Astrophysics Data System (ADS)

    von der Heyden, Sophie

    2017-03-01

    Anthropogenic activities are having devastating impacts on marine systems with numerous knock-on effects on trophic functioning, species interactions and an accelerated loss of biodiversity. Establishing conservation areas can not only protect biodiversity, but also confer resilience against changes to coral reefs and their inhabitants. Planning for protection and conservation in marine systems is complex, but usually focuses on maintaining levels of biodiversity and protecting special and unique landscape features while avoiding negative impacts to socio-economic benefits. Conversely, the integration of evolutionary processes that have shaped extant species assemblages is rarely taken into account. However, it is as important to protect processes as it is to protect patterns for maintaining the evolutionary trajectories of populations and species. This review focuses on different approaches for integrating genetic analyses, such as phylogenetic diversity, phylogeography and the delineation of management units, temporal and spatial monitoring of genetic diversity and quantification of adaptive variation for protecting evolutionary resilience, into marine spatial planning, specifically for coral reef fishes. Many of these concepts are not yet readily applied to coral reef fish studies, but this synthesis highlights their potential and the importance of including historical processes into systematic biodiversity planning for conserving not only extant, but also future, biodiversity and its evolutionary potential.

  9. Preference-based comparative effectiveness and cost–effectiveness: a review and relevance of value-based medicine for vitreoretinal interventions.

    PubMed

    Brown, Melissa M; Brown, Gary C; Lieske, Heidi B; Lieske, P Alexander

    2012-05-01

    This analysis discusses the comparative effectiveness and cost-effectiveness of vitreoretinal interventions, measured in quality-adjusted life years (QALYs) and percentage patient value (PPV gain, or improvement in quality of life and/or length of life). The material is relevant since the Patient Protection and Affordable Care Act enacted by Congress with the support of the President has emphasized the critical importance of patient-based preferences. The majority of preference-based, comparative effectiveness and cost-effectiveness vitreoretinal interventions assessed in the US healthcare literature are Value-Based Medicine analyses, thus comparable. These interventions confer a mean patient (human) value gain (improvement in quality of life) of 8.3% [SD 6.3%, 95% confidence interval (CI) + 2.6%]. The average cost-utility of these vitreoretinal interventions is US$23 026/QALY (SD US$24 508, 95% CI + US$8770). Most vitreoretinal interventions are very cost effective using a conventional US standard of US$50 000/QALY as the upper anchor for a very cost-effective intervention, and the World Health Organization of approximately US$142 200/QALY as the upper anchor for a cost-effective intervention. Most vitreoretinal interventions confer considerable patient value and are very cost effective. Further standardization across healthcare is needed in the preference-based, comparative and cost-utility (cost-effectiveness) arena. The metrics of PPV (percentage patient value) gain and US$/PPV (dollars expended per percentage patient value gain) or financial value gain may be more user-friendly than the QALY.

  10. Single multivalent vaccination boosted by trickle larval infection confers protection against experimental lymphatic filariasis

    PubMed Central

    Joseph, SK; Ramaswamy, K

    2013-01-01

    The multivalent vaccine BmHAT, consisting of the Brugia malayi infective larval (L3) antigens heat shock protein12.6 (HSP12.6), abundant larval transcript-2 (ALT-2) and tetraspanin large extra cellular loop (TSP-LEL), was shown to be protective in rodent models from our laboratory. We hypothesize that since these antigens were identified using protective antibodies from immune endemic normal individuals, the multivalent vaccine can be augmented by natural L3 infections providing protection to the vaccinated host. This hypothesis was tested using single dose of DNA and Protein or Protein alone of the BmHAT vaccination in gerbils followed by live trickle L3 infection as booster dose. Vaccine-induced protection in gerbils was determined by worm establishment, micropore chamber assay and by antibody dependant cell cytotoxicity (ADCC) assay. Results were compared with the traditional prime-boost vaccination regimen. Gerbils vaccinated with BmHAT and boosted with L3 trickle infection were protected 51% (BmHAT DNA-Protein) and 48% (BmHAT Protein) respectively. BmHAT vaccination plus L3 trickle booster generated significant titer of antigen-specific IgG antibodies comparable to the traditional prime boost vaccination approach. BmHAT vaccination plus L3 trickle booster also generated antigen-specific cells in the spleen of vaccinated animals and these cells secreted predominantly IFN-γ and IL-4 in response to the vaccine antigens. These studies thus show that single dose of BmHAT multivalent vaccination followed by L3 trickle booster infection can confer significant protection against lymphatic filariasis. PMID:23735679

  11. Cross-protection among lethal H5N2 influenza viruses induced by DNA vaccine to the hemagglutinin.

    PubMed Central

    Kodihalli, S; Haynes, J R; Robinson, H L; Webster, R G

    1997-01-01

    Inoculation of mice with hemagglutinin (HA)-expressing DNA affords reliable protection against lethal influenza virus infection, while in chickens the same strategy has yielded variable results. Here we show that gene gun delivery of DNA encoding an H5 HA protein confers complete immune protection to chickens challenged with lethal H5 viruses. In tests of the influence of promoter selection on vaccine efficacy, close correlations were obtained between immune responses and the dose of DNA administered, whether a cytomegalovirus (CMV) immediate-early promoter or a chicken beta-actin promoter was used. Perhaps most important, the HA-DNA vaccine conferred 95% cross-protection against challenge with lethal antigenic variants that differed from the primary antigen by 11 to 13% (HA1 amino acid sequence homology). Overall, the high levels of protection seen with gene gun delivery of HA-DNA were as good as, if not better than, those achieved with a conventional whole-virus vaccine, with fewer instances of morbidity and death. The absence of detectable antibody titers after primary immunization, together with the rapid appearance of high titers immediately after challenge, implicates efficient B-cell priming as the principal mechanism of DNA-mediated immune protection. Our results suggest that the efficacy of HA-DNA influenza virus vaccine in mice extends to chickens and probably to other avian species as well. Indeed, the H5 preparation we describe offers an attractive means to protect the domestic poultry industry in the United States from lethal H5N2 viruses, which continue to circulate in Mexico. PMID:9094608

  12. Opportunities for nutritional amelioration of radiation-induced cellular damage

    NASA Technical Reports Server (NTRS)

    Turner, Nancy D.; Braby, Leslie A.; Ford, John; Lupton, Joanne R.

    2002-01-01

    The closed environment and limited evasive capabilities inherent in space flight cause astronauts to be exposed to many potential harmful agents (chemical contaminants in the environment and cosmic radiation exposure). Current power systems used to achieve space flight are prohibitively expensive for supporting the weight requirements to fully shield astronauts from cosmic radiation. Therefore, radiation poses a major, currently unresolvable risk for astronauts, especially for long-duration space flights. The major detrimental radiation effects that are of primary concern for long-duration space flights are damage to the lens of the eye, damage to the immune system, damage to the central nervous system, and cancer. In addition to the direct damage to biological molecules in cells, radiation exposure induces oxidative damage. Many natural antioxidants, whether consumed before or after radiation exposure, are able to confer some level of radioprotection. In addition to achieving beneficial effects from long-known antioxidants such as vitamins E and C and folic acid, some protection is conferred by several recently discovered antioxidant molecules, such as flavonoids, epigallocatechin, and other polyphenols. Somewhat counterintuitive is the protection provided by diets containing elevated levels of omega-3 polyunsaturated fatty acids, considering they are thought to be prone to peroxidation. Even with the information we have at our disposal, it will be difficult to predict the types of dietary modifications that can best reduce the risk of radiation exposure to astronauts, those living on Earth, or those enduring diagnostic or therapeutic radiation exposure. Much more work must be done in humans, whether on Earth or, preferably, in space, before we are able to make concrete recommendations.

  13. Two functional serotonin polymorphisms moderate the effect of food reinforcement on BMI

    PubMed Central

    Carr, Katelyn A.; Lin, Henry; Fletcher, Kelly D.; Sucheston, Lara; Singh, Prashant K.; Salis, Robbert; Erbe, Richard; Faith, Myles; Allison, David; Stice, Eric; Epstein, Leonard H.

    2014-01-01

    Food reinforcement, or the motivation to eat, has been associated with increased energy intake, greater body weight and prospective weight gain. Much of the previous research on the reinforcing value of food has focused on the role of dopamine, but it may be worthwhile to examine genetic polymorphisms in the serotonin and opioid systems as these neurotransmitters have been shown to be related to reinforcement processes and to influence energy intake. We examined the relationship among 44 candidate genetic polymorphisms in the dopamine, serotonin and opioid systems, and food reinforcement and body mass index (BMI) in a sample of 245 individuals. Polymorphisms in the Monoamine oxidase A (MAOA-LPR) and serotonin receptor 2A genes (rs6314) moderated the effect of food reinforcement on BMI, accounting for an additional 5-10% variance and revealed a potential role of the single nucleotide polymorphism, rs6314 in the serotonin 2A receptor as a differential susceptibility factor for obesity. Differential susceptibility describes a factor that can confer either risk or protection depending on a second variable, such that rs6314 is predictive of both high and low BMI based on the level of food reinforcement, while the diathesis stress or dual-gain model influences only one end of the outcome measure. The interaction with MAOA-LPR better fit the dual-risk or diathesis stress model, with the 3.5R/4R allele conferring protection for individuals low in food reinforcement. These results provide new insight into genes theoretically involved in obesity and support the hypothesis that genetics moderate the association between food reinforcement on BMI. PMID:23544600

  14. Pomegranate Supplementation Improves Affective and Motor Behavior in Mice after Radiation Exposure

    PubMed Central

    Dulcich, Melissa S.; Hartman, Richard E.

    2013-01-01

    Currently, NASA has plans for extended space travel, and previous research indicates that space radiation can have negative effects on cognitive skills as well as physical and mental health. With long-term space travel, astronauts will be exposed to greater radiation levels. Research shows that an antioxidant-enriched diet may offer some protection against the cellular effects of radiation and may provide significant neuroprotection from the effects of radiation-induced cognitive and behavioral skill deficits. Ninety-six C57BL/6 mice (48 pomegranate fed and 48 control) were irradiated with proton radiation (2 Gy), and two-month postradiation behaviors were assessed using a battery of behavioral tests to measure cognitive and motor functions. Proton irradiation was associated with depression-like behaviors in the tail suspension test, but this effect was ameliorated by the pomegranate diet. Males, in general, displayed worse coordination and balance than females on the rotarod task, and the pomegranate diet ameliorated this effect. Overall, it appears that proton irradiation, which may be encountered in space, may induce a different pattern of behavioral deficits in males than females and that a pomegranate diet may confer protection against some of those effects. PMID:23662154

  15. A novel vaccination strategy mediating the induction of lung-resident memory CD8 T cells confers heterosubtypic immunity against future pandemic influenza virus

    PubMed Central

    Lee, Yu-Na; Lee, Young-Tae; Kim, Min-Chul; Gewirtz, Andrew T.; Kang, Sang-Moo

    2016-01-01

    The currently used vaccine strategy to combat influenza A virus (IAV) aims to provide highly specific immunity to circulating seasonal IAV strains. However, the outbreak of 2009 influenza pandemic highlights the danger in this strategy. Here, we tested the hypothesis that universal vaccination that offers broader but weaker protection would result in cross protective T-cell responses after primary IAV infection, which would subsequently provide protective immunity against future pandemic strains. Specifically, we used tandem repeat M2e epitopes on virus-like particles (M2e5x VLP) that induced heterosubtypic immunity by eliciting antibodies to a conserved M2e epitope. M2e5x VLP was found to be superior to strain-specific current split vaccine in conferring heterosubtypic cross protection and in equipping the host with cross-protective lung-resident nucleoprotein-specific memory CD8+ T cell responses to a subsequent secondary infection with a new pandemic potential strain. Immune correlates for subsequent heterosubtypic immunity by M2e5x VLP vaccination were found to be virus-specific CD8+ T cells secreting IFN-γ and expressing lung-resident memory phenotypic markers CD69+ and CD103+ as well as M2e antibodies. Hence, vaccination with M2e5x VLP may be developable as a new strategy to combat future pandemic outbreaks. PMID:26864033

  16. Food safety evaluation for R-proteins introduced by biotechnology: A case study of VNT1 in late blight protected potatoes.

    PubMed

    Habig, Jeffrey W; Rowland, Aaron; Pence, Matthew G; Zhong, Cathy X

    2018-06-01

    Resistance genes (R-genes) from wild potato species confer protection against disease and can be introduced into cultivated potato varieties using breeding or biotechnology. The R-gene, Rpi-vnt1, which encodes the VNT1 protein, protects against late blight, caused by Phytophthora infestans. Heterologous expression and purification of active VNT1 in quantities sufficient for regulatory biosafety studies was problematic, making it impractical to generate hazard characterization data. As a case study for R-proteins, a weight-of-evidence, tiered approach was used to evaluate the safety of VNT1. The hazard potential of VNT1 was identified from relevant safety information including history of safe use, bioinformatics, mode of action, expression levels, and dietary intake. From the assessment it was concluded that Tier II hazard characterization was not needed. R-proteins homologous to VNT1 and identified in edible crops, have a history of safe consumption. VNT1 does not share sequence identity with known allergens. Expression levels of R-proteins are generally low, and VNT1 was not detected in potato varieties expressing the Rpi-vnt1 gene. With minimal hazard and negligible exposure, the risks associated with consumption of R-proteins in late blight protected potatoes are exceedingly low. R-proteins introduced into potatoes to confer late blight protection are safe for consumption. Copyright © 2018 Elsevier Inc. All rights reserved.

  17. Summary of the Italian inter-society recommendations for radiation protection optimization in interventional radiology.

    PubMed

    Compagnone, Gaetano; Padovani, Renato; D'Avanzo, Maria Antonietta; Grande, Sveva; Campanella, Francesco; Rosi, Antonella

    2018-05-01

    A Working Group coordinated by the Italian National Institute of Health (Istituto Superiore di Sanità) and the National Workers Compensation Authority (Istituto Nazionale per l'Assicurazione contro gli Infortuni sul Lavoro, INAIL) and consisting of 11 Italian scientific/professional societies involved in the fluoroscopically guided interventional practices has been established to define recommendations for the optimization of patients and staff radiation protection in interventional radiology. A summary of these recommendations is here reported. A multidisciplinary approach was used to establish the Working Group by involving radiologists, interventional radiologists, neuroradiologists, interventional cardiologists, occupational health specialists, medical physicists, radiation protection experts, radiographers and nurses. The Group operated as a "Consensus Conference". Three main topics have been addressed: patient radiation protection (summarized in ten "golden rules"); staff radiation protection (summarized in ten "golden rules"); and education/training of interventional radiology professionals. In the "golden rules", practical and operational recommendations were provided to help the professionals in optimizing dose delivered to patients and reducing their own exposure. Operative indications dealt also with continuing education and training, and recommendations on professional accreditation and certification. The "Consensus Conference" was the methodology adopted for the development of these recommendations. Involvement of all professionals is a winning approach to improve practical implementation of the recommendations, thus getting a real impact on the optimization of the interventional radiology practices.

  18. The protective effect of curcumin in Olfactory Ensheathing Cells exposed to hypoxia.

    PubMed

    Bonfanti, Roberta; Musumeci, Teresa; Russo, Cristina; Pellitteri, Rosalia

    2017-02-05

    Curcumin, a phytochemical component derived from the rhizomes of Curcuma longa, has shown a great variety of pharmacological activities, such as anti-inflammatory, anti-tumor, anti-depression and anti-oxidant activity. Therefore, in the last years it has been used as a therapeutic agent since it confers protection in different neurodegenerative diseases, cerebral ischemia and excitotoxicity. Olfactory Ensheathing Cells (OECs) are glial cells of the olfactory system. They are able to secrete several neurotrophic growth factors, promote axonal growth and support the remyelination of damaged axons. OEC transplantation has emerged as a possible experimental therapy to induce repair of spinal cord injury, even if the functional recovery is still limited. Since hypoxia is a secondary effect in spinal cord injury, this in vitro study investigates the protective effect of curcumin in OECs exposed to hypoxia. Primary OECs were obtained from neonatal rat olfactory bulbs and placed both in normal and hypoxic conditions. Furthermore, some cells were grown with basic Fibroblast Growth Factor (bFGF) and/or curcumin at different concentration and times. The results obtained through immunocytochemical procedures and MTT test show that curcumin stimulates cell viability in OECs grown in normal and hypoxic conditions. Furthermore, the synergistic effect of curcumin and bFGF is the most effective exerting protection on OECs. Since spinal cord injury is often accompanied by secondary insults, such as ischemia or hypoxia, our results suggest that curcumin in combination with bFGF might be considered a possible approach for restoration in injuries. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. 78 FR 11660 - Eunice Kennedy Shriver National Institute of Child Health & Human Development; Notice of Closed...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-19

    ... Boulevard, Rockville, MD 20852 (Telephone Conference Call). Contact Person: Peter Zelazowski, Ph.D..., peter[email protected] . (Catalogue of Federal Domestic Assistance Program Nos. 93.864, Population...

  20. Nasal Acai polysaccharides potentiate innate immunity to protect against pulmonary Francisella tularensis and Burkholderia pseudomallei Infections.

    PubMed

    Skyberg, Jerod A; Rollins, MaryClare F; Holderness, Jeff S; Marlenee, Nicole L; Schepetkin, Igor A; Goodyear, Andrew; Dow, Steven W; Jutila, Mark A; Pascual, David W

    2012-01-01

    Pulmonary Francisella tularensis and Burkholderia pseudomallei infections are highly lethal in untreated patients, and current antibiotic regimens are not always effective. Activating the innate immune system provides an alternative means of treating infection and can also complement antibiotic therapies. Several natural agonists were screened for their ability to enhance host resistance to infection, and polysaccharides derived from the Acai berry (Acai PS) were found to have potent abilities as an immunotherapeutic to treat F. tularensis and B. pseudomallei infections. In vitro, Acai PS impaired replication of Francisella in primary human macrophages co-cultured with autologous NK cells via augmentation of NK cell IFN-γ. Furthermore, Acai PS administered nasally before or after infection protected mice against type A F. tularensis aerosol challenge with survival rates up to 80%, and protection was still observed, albeit reduced, when mice were treated two days post-infection. Nasal Acai PS administration augmented intracellular expression of IFN-γ by NK cells in the lungs of F. tularensis-infected mice, and neutralization of IFN-γ ablated the protective effect of Acai PS. Likewise, nasal Acai PS treatment conferred protection against pulmonary infection with B. pseudomallei strain 1026b. Acai PS dramatically reduced the replication of B. pseudomallei in the lung and blocked bacterial dissemination to the spleen and liver. Nasal administration of Acai PS enhanced IFN-γ responses by NK and γδ T cells in the lungs, while neutralization of IFN-γ totally abrogated the protective effect of Acai PS against pulmonary B. pseudomallei infection. Collectively, these results demonstrate Acai PS is a potent innate immune agonist that can resolve F. tularensis and B. pseudomallei infections, suggesting this innate immune agonist has broad-spectrum activity against virulent intracellular pathogens.

  1. Effectiveness of the live attenuated rotavirus vaccine produced by a domestic manufacturer in China studied using a population-based case-control design.

    PubMed

    Zhen, Shan-Shan; Li, Yue; Wang, Song-Mei; Zhang, Xin-Jiang; Hao, Zhi-Yong; Chen, Ying; Wang, Dan; Zhang, Yan-Hong; Zhang, Zhi-Yong; Ma, Jing-Chen; Zhou, Peng; Zhang, Zhen; Jiang, Zhi-Wei; Zhao, Yu-Liang; Wang, Xuan-Yi

    2015-10-01

    A universal rotavirus (RV) immunization program is a potentially cost-effective measure for preventing RV infection in China. However, the efficacy of the only licensed RV vaccine (Lanzhou lamb rotavirus vaccine, LLR), which is made by a domestic manufacturer, has not been proven by a properly designed clinical trial. In October 2011 to March 2012, to measure the potential protection provided by LLR, a case-control study nested in a population-based active diarrhea surveillance study of children <5 years of age was conducted in rural Zhengding county. During the study period, 308 episodes of diarrhea were identified as being caused by RV infection, resulting in an incidence rate of 48.0/1000 people/year. The predominant RV serotype was G3 (61.5%), followed by G1 (15.2%), and G9 (6.5%). Overall, a protection of 35.0% (95% confidence interval (CI), 13.0%-52.0%) was identified, and higher protection was found among moderate RV gastroenteritis cases caused by the serotype G3 (52.0% 95% CI: 2.0%-76.1%). A concurrently conducted case-control study comparing non-RV viral diarrheal cases with non-diarrheal controls in the same population found that the RV vaccine offered no protection against non-RV diarrhea. Even under a less ideal immunization schedule, the oral LLR conferred a certain level of protection against RV gastroenteritis. However, further studies are needed to understand the full characteristics of the LLR, including its efficacy when administered following the optimal regimen, the potential risk of inducing intussusception, and the direct and indirect protective effects of LLR.

  2. Vaccination with liposomal leishmanial antigens adjuvanted with monophosphoryl lipid-trehalose dicorynomycolate (MPL-TDM) confers long-term protection against visceral leishmaniasis through a human administrable route.

    PubMed

    Ravindran, Rajesh; Maji, Mithun; Ali, Nahid

    2012-01-01

    The development of a long-term protective subunit vaccine against visceral leishmaniasis depends on antigens and adjuvants that can induce an appropriate immune response. The immunization of leishmanial antigens alone shows limited efficacy in the absence of an appropriate adjuvant. Earlier we demonstrated sustained protection against Leishmania donovani with leishmanial antigens entrapped in cationic liposomes through an intraperitoneal route. However, this route is not applicable for human administration. Herein, we therefore evaluated the immune response and protection induced by liposomal soluble leishmanial antigen (SLA) formulated with monophosphoryl lipid-trehalose dicorynomycolate (MPL-TDM) through a subcutaneous route. Subcutaneous immunization of BALB/c mice with SLA entrapped in liposomes or with MPL-TDM elicited partial protection against experimental visceral leishmaniasis. In contrast, liposomal SLA adjuvanted with MPL-TDM induced significantly higher levels of protection in liver and spleen in BALB/c mice challenged 10 days post-vaccination. Protection conferred by this formulation was sustained up to 12 weeks of immunization, and infection was controlled for at least 4 months of the challenge, similar to liposomal SLA immunization administered intraperitoneally. An analysis of cellular immune responses of liposomal SLA + MPL-TDM immunized mice demonstrated the induction of IFN-γ and IgG2a antibody production not only 10 days or 12 weeks post-vaccination but also 4 months after the challenge infection and a down regulation of IL-4 production after infection. Moreover, long-term immunity elicited by this formulation was associated with IFN-γ production also by CD8⁺ T cells. Taken together, our results suggest that liposomal SLA + MPL-TDM represent a good vaccine formulation for the induction of durable protection against L. donovani through a human administrable route.

  3. Inter-Clade Protection Offered by Mw-Adjuvanted Recombinant HA, NP Proteins, and M2e Peptide Combination Vaccine in Mice Correlates with Cellular Immune Response.

    PubMed

    Ingle, Nilesh B; Virkar, Rashmi G; Arankalle, Vidya A

    2016-01-01

    We documented earlier that Mw (heat-killed suspension of Mycobacterium indicus pranii ) adjuvant when used with conserved antigens, nucleoprotein (NP), and ectodomain of matrix (M2) protein (M2e) provided complete protection against homologous (clade 2.2) virus challenge in mice. The present study extends these observations to inter-clade challenge (clade 2.3.2.1) H5N1 virus and attempts to understand preliminary immunologic basis for the observed protection. Female BALB/c mice immunized with a single or two doses of vaccine formulations (clade 2.2 antigens) were challenged with 100LD50 homologous or heterologous (clade 2.3.2.1) virus. To understand the preliminary immunologic mechanism, we studied proportions of selected immune cell types, immune response gene expression, and Th1/Th2 cytokines induced by antigen-stimulated splenocytes from immunized mice, at different time points. Complete protection was conferred by Mw-HA, Mw-HA + NP, and Mw-HA + NP + M2e against homologous challenge. The protection correlated with IgG2a antibody titers indicating important role of Th1 response. Despite high inter-cladal antigenic differences, complete protection against the heterologous strain was achieved with Mw-HA + NP + M2e. Of note, a single dose with higher antigen concentrations (50 µg HA + 50 μg NP + 50 μg M2e) led to 80% protection against clade 2.3.2.1 strain. The protection conferred by Mw-HNM correlated with induction of IFN-γ, CD8 + T cytotoxic cells, and CD4 + T helper cells. Mw-adjuvanted HA + NP + M2e combination represents a promising vaccine candidate deserving further evaluation.

  4. Understanding reduced rotavirus vaccine efficacy in low socio-economic settings.

    PubMed

    Lopman, Benjamin A; Pitzer, Virginia E; Sarkar, Rajiv; Gladstone, Beryl; Patel, Manish; Glasser, John; Gambhir, Manoj; Atchison, Christina; Grenfell, Bryan T; Edmunds, W John; Kang, Gagandeep; Parashar, Umesh D

    2012-01-01

    Rotavirus vaccine efficacy ranges from >90% in high socio-economic settings (SES) to 50% in low SES. With the imminent introduction of rotavirus vaccine in low SES countries, understanding reasons for reduced efficacy in these settings could identify strategies to improve vaccine performance. We developed a mathematical model to predict rotavirus vaccine efficacy in high, middle and low SES based on data specific for each setting on incidence, protection conferred by natural infection and immune response to vaccination. We then examined factors affecting efficacy. Vaccination was predicted to prevent 93%, 86% and 51% of severe rotavirus gastroenteritis in high, middle and low SES, respectively. Also predicted was that vaccines are most effective against severe disease and efficacy declines with age in low but not high SES. Reduced immunogenicity of vaccination and reduced protection conferred by natural infection are the main factors that compromise efficacy in low SES. The continued risk of severe disease in non-primary natural infections in low SES is a key factor underpinning reduced efficacy of rotavirus vaccines. Predicted efficacy was remarkably consistent with observed clinical trial results from different SES, validating the model. The phenomenon of reduced vaccine efficacy can be predicted by intrinsic immunological and epidemiological factors of low SES populations. Modifying aspects of the vaccine (e.g. improving immunogenicity in low SES) and vaccination program (e.g. additional doses) may bring improvements.

  5. The use of ebselen for radioprotection in cultured cells and mice.

    PubMed

    Tak, Jean Kyoung; Park, Jeen-Woo

    2009-04-15

    Ionizing radiation induces the production of reactive oxygen species (ROS), which play an important causative role in cell death. Therefore, compounds that control the level of ROS may confer radioprotective effects. Ebselen, a seleno-organic compound, has been shown to protect against cell injury caused by ROS. The objective of this study was to examine the effects of ebselen on radiation-dependent toxicity. We investigated the protective role of ebselen against ionizing radiation in U937 cells and mice. Upon exposure to 20 Gy of gamma-irradiation, there was a distinct difference between untreated cells and the cells pretreated with 5 microM ebselen for 2 h with respect to viability, cellular redox status, and oxidative damage to cells. When cells were exposed to 2 Gy of gamma-irradiation, there was a distinct difference between the untreated cells and the cells pretreated with ebselen with respect to apoptotic features and mitochondrial function. Ebselen administration for 14 days at a daily dosage of 10 mg/kg provided substantial protection against killing and oxidative damage to mice exposed to whole-body irradiation. These data indicate that ebselen may have great potential as a new class of in vivo, non-sulfur-containing radiation protector.

  6. Psidium guajava Linn confers gastro protective effects on rats.

    PubMed

    Livingston Raja, N R; Sundar, K

    2012-02-01

    The best alternatives to synthetic medicines, available, for the treatment of gastric ulcer disorders, are the natural products found in plants. They are known to exhibit a variety of activities. The present study is aimed at the screening of Psidium (P.) guajava Linn for its gastro protective effect. The methanol extracts of the leaves of P. guajava were tested in three different ulcer models viz. aspirin (ASP), pyloric ligation (PL) and ethanol (EtoH) induced ulcer models in rats. The treatment of P. guajava at varying doses (100 mg/kg and 200 mg/kg) significantly (p < 0.001) inhibited the gastric lesions induced by ASP (70.5%), PL (65.07%) and EtoH (70.4%) respectively and the potency was found to be equivalent as compared to the standard drug, omeprazole. Reduction in the gastric secretory volume, acid secretion and increased gastric pH were the factors observed in treated rats. The presence of volatile oil, flavonoids and saponins present in the extracts of P. guajava may be responsible for the anti-ulcer property exhibited. The results further suggest that P. guajava possess gastro protective as well as ulcer healing properties which might also be due to its anti-secretory properties.

  7. Topical CpG Adjuvantation of a Protein-Based Vaccine Induces Protective Immunity to Listeria monocytogenes

    PubMed Central

    Cheng, Wing Ki; Wee, Kathleen; Kollmann, Tobias R.

    2014-01-01

    Robust CD8+ T cell responses are essential for immune protection against intracellular pathogens. Using parenteral administration of ovalbumin (OVA) protein as a model antigen, the effect of the Toll-like receptor 9 (TLR9) agonist, CpG oligodeoxynucleotide (ODN) 1826, as an adjuvant delivered either topically, subcutaneously, or intramuscularly on antigen-specific CD8+ T cell responses in a mouse model was evaluated. Topical CpG adjuvant increased the frequency of OVA-specific CD8+ T cells in the peripheral blood and in the spleen. The more effective strategy to administer topical CpG adjuvant to enhance CD8+ T cell responses was single-dose administration at the time of antigen injection with a prime-boost regimen. Topical CpG adjuvant conferred both rapid and long-lasting protection against systemic challenge with recombinant Listeria monocytogenes expressing the cytotoxic T lymphocyte (CTL) epitope of OVA257–264 (strain Lm-OVA) in a TLR9-dependent manner. Topical CpG adjuvant induced a higher proportion of CD8+ effector memory T cells than parenteral administration of the adjuvant. Although traditional vaccination strategies involve coformulation of antigen and adjuvant, split administration using topical adjuvant is effective and has advantages of safety and flexibility. Split administration of topical CpG ODN 1826 with parenteral protein antigen is superior to other administration strategies in enhancing both acute and memory protective CD8+ T cell immune responses to subcutaneous protein vaccines. This vaccination strategy induces rapid and persistent protective immune responses against the intracellular organism L. monocytogenes. PMID:24391136

  8. Intermittent Fasting Confers Protection in CNS Autoimmunity by Altering the Gut Microbiota.

    PubMed

    Cignarella, Francesca; Cantoni, Claudia; Ghezzi, Laura; Salter, Amber; Dorsett, Yair; Chen, Lei; Phillips, Daniel; Weinstock, George M; Fontana, Luigi; Cross, Anne H; Zhou, Yanjiao; Piccio, Laura

    2018-06-05

    Multiple sclerosis (MS) is more common in western countries with diet being a potential contributing factor. Here we show that intermittent fasting (IF) ameliorated clinical course and pathology of the MS model, experimental autoimmune encephalomyelitis (EAE). IF led to increased gut bacteria richness, enrichment of the Lactobacillaceae, Bacteroidaceae, and Prevotellaceae families and enhanced antioxidative microbial metabolic pathways. IF altered T cells in the gut with a reduction of IL-17 producing T cells and an increase in regulatory T cells. Fecal microbiome transplantation from mice on IF ameliorated EAE in immunized recipient mice on a normal diet, suggesting that IF effects are at least partially mediated by the gut flora. In a pilot clinical trial in MS patients, intermittent energy restriction altered blood adipokines and the gut flora resembling protective changes observed in mice. In conclusion, IF has potent immunomodulatory effects that are at least partially mediated by the gut microbiome. Copyright © 2018 Elsevier Inc. All rights reserved.

  9. Olive polyphenol effects in a mouse model of chronic ethanol addiction.

    PubMed

    Carito, Valentina; Ceccanti, Mauro; Cestari, Vincenzo; Natella, Fausta; Bello, Cristiano; Coccurello, Roberto; Mancinelli, Rosanna; Fiore, Marco

    2017-01-01

    Alcohol addiction elicits oxidative imbalance and it is well known that polyphenols possess antioxidant properties. We investigated whether or not polyphenols could confer a protective potential against alcohol-induced oxidative stress. We administered (per os) for two months 20 mg/kg of olive polyphenols containing mostly hydroxytyrosol in alcoholic adult male mice. Hydroxytyrosol metabolites as hydroxytyrosol sulfate 1 and hydroxytyrosol sulfate 2 were found in the serum of mice administered with polyphenols with the highest amount in animals treated with both polyphenols and alcohol. Oxidative stress was evaluated by FORT (free oxygen radical test) and FORD (free oxygen radical defense) tests. Alcoholic mice showed a worse oxidative status than nonalcoholic mice (higher FORT and lower FORD) but polyphenol supplementation partially counteracted the alcohol pro-oxidant effects, as evidenced by FORT. A better understanding of the antioxidant protection provided by polyphenols might be of primary interest for drug discovery and dietary-based prevention of the damage associated with chronic alcohol abuse. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Tang-Tong-Fang Confers Protection against Experimental Diabetic Peripheral Neuropathy by Reducing Inflammation

    PubMed Central

    Li, Mingdi; Huang, Da; Liu, Xiaoxing; Lin, Lan

    2015-01-01

    Tang-tong-fang (TTF) is a Chinese herbal formula that has been shown to be beneficial in diabetic peripheral neuropathy (DPN), a common complication secondary to diabetic microvascular injury. However, the underlying mechanism of protection in nerve ischemia provided by TTF is still unclear. We hypothesized that TTF alleviates DPN via inhibition of ICAM-1 expression. Therefore, we tested the effect of TTF in a previously established DPN model, in which nerve injury was induced by ischemia/reperfusion in streptozotocin-induced diabetic rats. We found that the conduction velocity and amplitude of action potentials of sciatic nerve conduction were reduced in the DPN model group but were rescued by TTF treatment. In addition, TTF treatment also attenuated the effect of DPN on other parameters including histology and ultrastructural changes, expression of ICAM-1, MPO, and TNF-α in rat sciatic nerves, and plasma sICAM-1 and MPO levels. Together, our data suggest that TTF treatment may alleviate DPN via ICAM-1 inhibition. PMID:26539228

  11. Influenza Virus Hemagglutinin Stalk-Specific Antibodies in Human Serum are a Surrogate Marker for In Vivo Protection in a Serum Transfer Mouse Challenge Model.

    PubMed

    Jacobsen, Henning; Rajendran, Madhusudan; Choi, Angela; Sjursen, Haakon; Brokstad, Karl A; Cox, Rebecca J; Palese, Peter; Krammer, Florian; Nachbagauer, Raffael

    2017-09-19

    The immunogenicity of current influenza virus vaccines is assessed by measuring an increase of influenza virus-specific antibodies in a hemagglutination inhibition assay. This method exclusively measures antibodies against the hemagglutinin head domain. While this domain is immunodominant, it has been shown that hemagglutination inhibition titers do not always accurately predict protection from disease. In addition, several novel influenza virus vaccines that are currently under development do not target the hemagglutinin head domain, but rather more conserved sites, including the hemagglutinin stalk. Importantly, antibodies against the hemagglutinin stalk do not show activity in hemagglutination inhibition assays and will require different methods for quantification. In this study, we tested human serum samples from a seasonal influenza virus vaccination trial and an avian H5N1 virus vaccination trial for antibody activities in multiple types of assays, including binding assays and also functional assays. We then performed serum transfer experiments in mice which then received an H1N1 virus challenge to assess the in vivo protective effects of the antibodies. We found that hemagglutinin-specific antibody levels measured in an enzyme-linked immunosorbent assay (ELISA) correlated well with protection from weight loss in mice. In addition, we found that weight loss was also inversely correlated with the level of serum antibody-dependent cellular cytotoxicity (ADCC) as measured in a reporter assay. These findings indicate that protection is in part conferred by Fc-dependent mechanisms. In conclusion, ELISAs can be used to measure hemagglutinin-specific antibody levels that could serve as a surrogate marker of protection for universal influenza virus vaccines. IMPORTANCE Influenza viruses are a serious concern for public health and cause a large number of deaths worldwide every year. Current influenza virus vaccines can confer protection from disease, but they often show low efficacy due to the ever-changing nature of the viruses. Novel vaccination approaches target conserved epitopes of the virus, including the hemagglutinin stalk domain, to elicit universally protective antibodies that also bind to mutated viruses or new subtypes of viruses. Importantly, the hemagglutination inhibition assay-the only assay that has been accepted as a correlate of protection by regulatory authorities-cannot measure antibodies against the hemagglutinin stalk domain. Therefore, novel correlates of protection and assays to measure vaccine immunogenicity need to be developed. In this study, we correlated the results from multiple assays with protection in mice after transfer of human serum and a lethal virus challenge to investigate potential novel serological surrogate markers for protection. Copyright © 2017 Jacobsen et al.

  12. Social Involvement Modulates the Response to Novel and Adverse Life Events in Mice.

    PubMed

    Colnaghi, Luca; Clemenza, Kelly; Groleau, Sarah E; Weiss, Shira; Snyder, Anna M; Lopez-Rosas, Mariana; Levine, Amir A

    2016-01-01

    Epidemiological findings suggest that social involvement plays a major role in establishing resilience to adversity, however, the neurobiology by which social involvement confers protection is not well understood. Hypothesizing that social involvement confers resilience by changing the way adverse life events are encoded, we designed a series of behavioral tests in mice that utilize the presence or absence of conspecific cage mates in measuring response to novel and adverse events. We found that the presence of cage mates increased movement after exposure to a novel environment, increased time spent in the open arms of the elevated plus maze, and decreased freezing time after a foot shock as well as expedited fear extinction, therefore significantly changing the response to adversity. This is a first description of a mouse model for the effects of social involvement on adverse life events. Understanding how social involvement provides resilience to adversity may contribute to the future treatment and prevention of mental and physical illness.

  13. Examining Application Components to Reveal Android Malware

    DTIC Science & Technology

    2013-03-01

    RGBDroid: a novel response-based approach to android privilege escalation attacks ”. Proceedings of the 5th USENIX conference on Large-Scale Exploits and...Wetherall. “These aren’t the droids you’re looking for: retrofitting android to protect data from imperious applications”. Proceedings of the 18th ACM...copyright protection in the United States. AFIT-ENG-13-M-19 EXAMINING APPLICATION COMPONENTS TO REVEAL ANDROID MALWARE THESIS Presented to the Faculty

  14. A recombinant iron transport protein from Bordetella pertussis confers protection against Bordetella parapertussis.

    PubMed

    Alvarez Hayes, Jimena; Oviedo, Juan Marcos; Valdez, Hugo; Laborde, Juan Martín; Maschi, Fabricio; Ayala, Miguel; Shah, Rohan; Fernandez Lahore, Marcelo; Rodriguez, Maria Eugenia

    2017-10-01

    Whooping cough, which is caused by Bordetella pertussis and B. parapertussis, is a reemerging disease. New protective antigens are needed to improve the efficacy of current vaccines against both species. Using proteomic tools, it was here found that B. parapertussis expresses a homolog of AfuA, a previously reported new vaccine candidate against B. pertussis. It was found that this homolog, named AfuA Bpp , is expressed during B. parapertussis infection, exposed on the surface of the bacteria and recognized by specific antibodies induced by the recombinant AfuA cloned from B. pertussis (rAfuA). Importantly, the presence of the O-antigen, a molecule that has been found to shield surface antigens on B. parapertussis, showed no influence on antibody recognition of AfuA Bpp on the bacterial surface. The present study further showed that antibodies induced by immunization with the recombinant protein were able to opsonize B. parapertussis and promote bacterial uptake by neutrophils. Finally, it was shown that this antigen confers protection against B. parapertussis infection in a mouse model. Altogether, these results indicate that AfuA is a good vaccine candidate for acellular vaccines protective against both causative agents of whooping cough. © 2017 The Societies and John Wiley & Sons Australia, Ltd.

  15. Differential Trafficking of TLR1 I602S Underlies Host Protection Against Pathogenic Mycobacteria§

    PubMed Central

    Hart, Bryan E.; Tapping, Richard I.

    2012-01-01

    We have recently identified I602S as a frequent single nucleotide polymorphism of human TLR1 which greatly inhibits cell surface trafficking, confers hyporesponsiveness to TLR1 agonists, and protects against the mycobacterial diseases leprosy and tuberculosis. Since mycobacteria are known to manipulate the TLR system to their advantage, we hypothesize that the hyporesponsive 602S variant may confer protection by enabling the host to overcome this immune subversion. We report that primary human monocytes and macrophages from homozygous TLR1 602S individuals are resistant to mycobacterial-induced downregulation of macrophage MHCII, CD64, and IFNγ responses compared to individuals who harbor the TLR1 602I variant. Additionally, when challenged with mycobacterial agonists, macrophages from TLR1 602S/S individuals resist induction of host arginase-1; an enzyme that depletes cellular arginine stores required for production of antimicrobial reactive nitrogen intermediates. The differences in cell activation mediated by TLR1 602S and TLR1 602I are observed upon stimulation with soluble mycobacterial-derived agonists but not with whole mycobacterial cells. Taken together, these results suggest that the TLR1 602S variant protects against mycobacterial disease by preventing soluble mycobacterial products, perhaps released from granulomas, from disarming myeloid cells prior to their encounter with whole mycobacteria. PMID:23105135

  16. 6-HYDROXYDOPAMINE INDUCES MITOCHONDRIAL ERK ACTIVATION

    PubMed Central

    Kulich, Scott M.; Horbinski, Craig; Patel, Manisha; Chu, Charleen T.

    2007-01-01

    Reactive oxygen species (ROS) are implicated in 6-hydroxydopamine (6-OHDA) injury to catecholaminergic neurons; however, the mechanism(s) are unclear. In addition to ROS generated during autoxidation, 6-OHDA may initiate secondary cellular sources of ROS that contribute to toxicity. Using a neuronal cell line, we found that catalytic metalloporphyrin antioxidants conferred protection if added 1 hour after exposure to 6-OHDA, whereas the hydrogen peroxide scavenger catalase failed to protect if added more than 15 min after 6-OHDA. There was a temporal correspondence between loss of protection and loss of the ability of the antioxidant to inhibit 6-OHDA-induced ERK phosphorylation. Time course studies of aconitase inactivation, as an indicator of intracellular superoxide, and MitoSOX red, a mitochondria targeted ROS indicator, demonstrate early intracellular ROS followed by a delayed phase of mitochondrial ROS production, associated with phosphorylation of a mitochondrial pool of ERK. Furthermore, upon initiation of mitochondrial ROS and ERK activation, 6-OHDA-injured cells became refractory to rescue by metalloporphyrin antioxidants. Together with previous studies showing that inhibition of the ERK pathway confers protection from 6-OHDA toxicity, and that phosphorylated ERK accumulates in mitochondria of degenerating human Parkinson’s disease neurons, these studies implicate mitochondrial ERK activation in Parkinsonian oxidative neuronal injury. PMID:17602953

  17. The Saccharomyces boulardii CNCM I-745 strain shows protective effects against the B. anthracis LT toxin.

    PubMed

    Pontier-Bres, Rodolphe; Rampal, Patrick; Peyron, Jean-François; Munro, Patrick; Lemichez, Emmanuel; Czerucka, Dorota

    2015-10-30

    The probiotic yeast Saccharomyces boulardii (S. boulardii) has been prescribed for the prophylaxis and treatment of several infectious diarrheal diseases. Gastrointestinal anthrax causes fatal systemic disease. In the present study, we investigated the protective effects conferred by Saccharomyces boulardii CNCM I-745 strain on polarized T84 columnar epithelial cells intoxicated by the lethal toxin (LT) of Bacillus anthracis. Exposure of polarized T84 cells to LT affected cell monolayer integrity, modified the morphology of tight junctions and induced the formation of actin stress fibers. Overnight treatment of cells with S. boulardii before incubation with LT maintained the integrity of the monolayers, prevented morphological modification of tight junctions, restricted the effects of LT on actin remodeling and delayed LT-induced MEK-2 cleavage. Mechanistically, we demonstrated that in the presence of S. boulardii, the medium is depleted of both LF and PA sub-units of LT and the appearance of a cleaved form of PA. Our study highlights the potential of the S. boulardii CNCM I-745 strain as a prophylactic agent against the gastrointestinal form of anthrax.

  18. The Saccharomyces boulardii CNCM I-745 Strain Shows Protective Effects against the B. anthracis LT Toxin

    PubMed Central

    Pontier-Bres, Rodolphe; Rampal, Patrick; Peyron, Jean-François; Munro, Patrick; Lemichez, Emmanuel; Czerucka, Dorota

    2015-01-01

    The probiotic yeast Saccharomyces boulardii (S. boulardii) has been prescribed for the prophylaxis and treatment of several infectious diarrheal diseases. Gastrointestinal anthrax causes fatal systemic disease. In the present study, we investigated the protective effects conferred by Saccharomyces boulardii CNCM I-745 strain on polarized T84 columnar epithelial cells intoxicated by the lethal toxin (LT) of Bacillus anthracis. Exposure of polarized T84 cells to LT affected cell monolayer integrity, modified the morphology of tight junctions and induced the formation of actin stress fibers. Overnight treatment of cells with S. boulardii before incubation with LT maintained the integrity of the monolayers, prevented morphological modification of tight junctions, restricted the effects of LT on actin remodeling and delayed LT-induced MEK-2 cleavage. Mechanistically, we demonstrated that in the presence of S. boulardii, the medium is depleted of both LF and PA sub-units of LT and the appearance of a cleaved form of PA. Our study highlights the potential of the S. boulardii CNCM I-745 strain as a prophylactic agent against the gastrointestinal form of anthrax. PMID:26529015

  19. Beyond Meatless, the Health Effects of Vegan Diets: Findings from the Adventist Cohorts

    PubMed Central

    Le, Lap Tai; Sabaté, Joan

    2014-01-01

    Vegetarians, those who avoid meat, and vegans, additionally avoiding dairy and eggs, represent 5% and 2%, respectively, of the US population. The aim of this review is to assess the effects of vegetarian diets, particularly strict vegetarian diets (i.e., vegans) on health and disease outcomes. We summarized available evidence from three prospective cohorts of Adventists in North America: Adventist Mortality Study, Adventist Health Study, and Adventist Health Study-2. Non-vegetarian diets were compared to vegetarian dietary patterns (i.e., vegan and lacto-ovo-vegetarian) on selected health outcomes. Vegetarian diets confer protection against cardiovascular diseases, cardiometabolic risk factors, some cancers and total mortality. Compared to lacto-ovo-vegetarian diets, vegan diets seem to offer additional protection for obesity, hypertension, type-2 diabetes, and cardiovascular mortality. Males experience greater health benefits than females. Limited prospective data is available on vegetarian diets and body weight change. Large randomized intervention trials on the effects of vegetarian diet patterns on neurological and cognitive functions, obesity, diabetes, and other cardiovascular outcomes are warranted to make meaningful recommendations. PMID:24871675

  20. Beyond meatless, the health effects of vegan diets: findings from the Adventist cohorts.

    PubMed

    Le, Lap Tai; Sabaté, Joan

    2014-05-27

    Vegetarians, those who avoid meat, and vegans, additionally avoiding dairy and eggs, represent 5% and 2%, respectively, of the US population. The aim of this review is to assess the effects of vegetarian diets, particularly strict vegetarian diets (i.e., vegans) on health and disease outcomes. We summarized available evidence from three prospective cohorts of Adventists in North America: Adventist Mortality Study, Adventist Health Study, and Adventist Health Study-2. Non-vegetarian diets were compared to vegetarian dietary patterns (i.e., vegan and lacto-ovo-vegetarian) on selected health outcomes. Vegetarian diets confer protection against cardiovascular diseases, cardiometabolic risk factors, some cancers and total mortality. Compared to lacto-ovo-vegetarian diets, vegan diets seem to offer additional protection for obesity, hypertension, type-2 diabetes, and cardiovascular mortality. Males experience greater health benefits than females. Limited prospective data is available on vegetarian diets and body weight change. Large randomized intervention trials on the effects of vegetarian diet patterns on neurological and cognitive functions, obesity, diabetes, and other cardiovascular outcomes are warranted to make meaningful recommendations.

Top