28 CFR 42.609 - EEOC reasonable cause determination and conciliation efforts.

Code of Federal Regulations, 2012 CFR

2012-07-01

... informal methods of conference, conciliation and persuasion. If EEOC would like the referring agency to... efforts to resolve the complaint by informal methods of conference, conciliation and persuasion fail, EEOC...

28 CFR 42.609 - EEOC reasonable cause determination and conciliation efforts.

Code of Federal Regulations, 2013 CFR

2013-07-01

... informal methods of conference, conciliation and persuasion. If EEOC would like the referring agency to... efforts to resolve the complaint by informal methods of conference, conciliation and persuasion fail, EEOC...

Ideas that Work for Outdoor Teachers and Leaders. Papers, Activities, and Resources from the National Outdoor Education Conference (Potosi, Missouri, October 9-13, 1985).

ERIC Educational Resources Information Center

Riley, Cheryl L., Comp.

Emphasizing the ethics of conservation, this conference report compiles the following information submitted by conference presenters: (1) summaries of their presentations; (2) environmental ethics statements pertinent to their subjects; (3) activities; (4) favorite quotation; and (5) resources and references including books, journals,…

16th Space Photovoltaic Research and Technology Conference. Revised

NASA Technical Reports Server (NTRS)

Bailey, Sheila (Editor)

2005-01-01

The purpose of the SPRAT conference is to bring members of the space solar cell community together in a relatively informal conference setting to discuss the recent developments in solar cell technology and to discuss the future directions of the field. The conference is sponsored by the Photovoltaic and Space Environmental Effects Branch at the NASA Glenn Research Center.

7th international conference on case histories in geotechnical engineering.

DOT National Transportation Integrated Search

2013-08-01

Funding used to enhance objectives of conference and to present successful case histories of varied project, orally, in posters and in : proceedings. This will become a storehouse of knowledge for future reference.

A Recombinant Rabies Virus Encoding Two Copies of the Glycoprotein Gene Confers Protection in Dogs against a Virulent Challenge

PubMed Central

Sun, Zhaojin; Chen, Jing; Ai, Jun; Dun, Can; Fu, Zhen F.; Niu, Xuefeng; Guo, Xiaofeng

2014-01-01

The rabies virus (RABV) glycoprotein (G) is the principal antigen responsible for the induction of virus neutralizing antibodies (VNA) and is the major modality of protective immunity in animals. A recombinant RABV HEP-Flury strain was generated by reverse genetics to encode two copies of the G-gene (referred to as HEP-dG). The biological properties of HEP-dG were compared to those of the parental virus (HEP-Flury strain). The HEP-dG recombinant virus grew 100 times more efficiently in BHK-21 cell than the parental virus, yet the virulence of the dG recombinant virus in suckling mice was lower than the parental virus. The HEP-dG virus can improve the expression of G-gene mRNA and the G protein and produce more offspring viruses in cells. The amount of G protein revealed a positive relationship with immunogenicity in mice and dogs. The inactivated HEP-dG recombinant virus induced higher levels of VNA and conferred better protection against virulent RABV in mice and dogs than the inactivated parental virus and a commercial vaccine. The protective antibody persisted for at least 12 months. These data demonstrate that the HEP-dG is stable, induces a strong VNA response and confers protective immunity more effectively than the RABV HEP-Flury strain. HEP-dG could be a potential candidate in the development of novel inactivated rabies vaccines PMID:24498294

The International Society for the Social Studies Annual Conference Proceedings (Orlando, Florida, February 27-28, 2014). Volume 2014, Issue 1

ERIC Educational Resources Information Center

Russell, William Benedict, III, Ed.

2014-01-01

The "International Society for the Social Studies (ISSS) Annual Conference Proceedings" is a peer-reviewed professional publication published once a year following the annual conference. The following papers are included in the 2014 proceedings: (1) Legal Profession in the Technological Era with Special Reference to Women Lawyers in…

Current Realities and Future Possibilities: Language and Science Literacy--Empowering Research and Informing Instruction

ERIC Educational Resources Information Center

Yore, Larry D.; Treagust, David F.

2006-01-01

In this final article, we briefly review and synthesize the science and language research and practice that arose from the current literature and presentations at an international conference, referred to as the first "Island Conference". We add to the synthesis of the articles the conference deliberations and on-going discussions of the field and…

Ninth International Conference on Sarcoidosis.

DTIC Science & Technology

1981-10-15

conference on sarcoidosis the author discusses the current status of sarcoidosis research and the latest developments in clinical treatment a they were...related at the conference. He also refers to the differing opinions that were presented about diagnosis and treatment of the dibease, as well as...clinical indices listed by Lebacq were uveitis , erythema nodosum, polyarthropathy, dactylitis, granulomatous infiltration of a scar, myopathy

NACA Conference on Aircraft Loads, Structures, and Flutter

NASA Technical Reports Server (NTRS)

1957-01-01

This document contains reproductions of technical papers on some of the most recent research results on aircraft loads, flutter, and structures from the NACA laboratories. These papers were presented by members of the staff of the NACA laboratories at the Conference held at the Langley Aeronautical Laboratory March 5, 6, and 7, 1957. The primary purpose of this Conference was to convey to contractors of the military services and others concerned with the design of aircraft these recent research results and to provide those attending an opportunity to discuss the results. The papers in this document are in the same form in which they were presented at the Conference in order to facilitate their prompt distribution. The original presentation and this record are considered as complementary to, rather than as substitutes for, the Committee?s more complete and formal reports. Accordingly, if information from this document is utilized it is requested that this document not be listed as a reference. Individual reports dealing with most of the information presented at the Conference will subsequently be published by NACA and will therefore be suitable as reference material.

Adult Education Development and the NAEP. Report of the All India Adult Education Conference (32nd, Amritsar, India, October 7-9, 1979). Series No. 134.

ERIC Educational Resources Information Center

Indian Adult Education Association, New Delhi.

This publication contains the proceedings of a conference held to discuss adult education and the National Adult Education Programme (NAEP) in India. Four major addresses are included in the booklet, along with references to other speeches, group discussion reports, resolutions, and recommendations. Inaugurating the conference, Shri J.J. Kidwai…

International Conference on Indium Phosphide and Related Materials, Held in Cape Cod, Massachusetts, on 11 - 15 May 1997.

DTIC Science & Technology

1998-01-14

runaway cells are very uniform across the wafer. On-wafer active load- causing the so-called current collapse. Using a Au air- pull measurement was...Input Power [ dBm] support and encouragement. References Fig. 4: On-wafer load- pull measurement at 9 GHz. [1] P. M. Asbeck, M. C. F. Chang, J. A...Measured Load Pull Characteristics of the 0.15gm x 300gm GaInAs/InP HEMT at 7GHz. 160 exceeded 830 mS/mm for > 0.5V. The 140 small-signal output

29 CFR 6.52 - Appointment of Administrative Law Judge and notification of prehearing conference and hearing date.

Code of Federal Regulations, 2011 CFR

2011-07-01

... receipt from the Administrator of an Order of Reference, notice to the parties, attachments and... place of a prehearing conference and of the hearing which shall be held immediately upon the completion...

29 CFR 6.52 - Appointment of Administrative Law Judge and notification of prehearing conference and hearing date.

Code of Federal Regulations, 2010 CFR

2010-07-01

... receipt from the Administrator of an Order of Reference, notice to the parties, attachments and... place of a prehearing conference and of the hearing which shall be held immediately upon the completion...

10 CFR 851.27 - Reference sources.

Code of Federal Regulations, 2011 CFR

2011-01-01

....nfpa.org. (v) American Conference of Governmental Industrial Hygienist (ACGIH), 1330 Kemper Meadow...) American Society of Mechanical Engineers (ASME), P.O. Box 2300 Fairfield, NJ 07007. Telephone: 800-843-2763...) American Conference of Governmental Industrial Hygienists, “Threshold Limit Values for Chemical Substances...

Cesium-diode performances from the 1963-to-1971 Thermionic Conversion Specialist Conferences

NASA Technical Reports Server (NTRS)

Morris, J. F.

1972-01-01

Indexes and summaries of the conference papers containing cesium-diode results are presented. Lists of converter materials, geometries, conditions, outputs, and lifetimes accompany the references. Simple chemical designations for emitters, collectors, and additives direct the reader to appropriate selections.

18th Space Photovoltaic Research and Technology Conference

NASA Technical Reports Server (NTRS)

Morton, Thomas L. (Compiler)

2005-01-01

The 18th Space Photovoltaic Research and Technology (SPRAT XVIII) Conference was held September 16 to 18, 2003, at the Ohio Aerospace Institute (OAI) in Brook Park, Ohio. The SPRAT conference, hosted by the Photovoltaic and Space Environments Branch of the NASA Glenn Research Center, brought together representatives of the space photovoltaic community from around the world to share the latest advances in space solar cell technology. This year s conference continued to build on many of the trends shown in SPRAT XVII-the continued advances of thin-film and multijunction solar cell technologies and the new issues required to qualify those types of cells for space applications.

Proceedings of the 19th Space Photovoltaic Research and Technology Conference

NASA Technical Reports Server (NTRS)

Castro, Stephanie (Compiler); Morton, Thomas (Compiler)

2007-01-01

The 19th Space Photovoltaic Research and Technology Conference (SPRAT XIX) was held September 20 to 22, 2005, at the Ohio Aerospace Institute (OAI) in Brook Park, Ohio. The SPRAT Conference, hosted by the Photovoltaic and Space Environments Branch of the NASA Glenn Research Center, brought together representatives of the space photovoltaic community from around the world to share the latest advances in space solar cell technology. This year's conference continued to build on many of the trends shown in SPRAT XVIII-the continued advances of thin-film and multijunction solar cell technologies and the new issues required to qualify those types of cells for space applications.

An Examination of Perceptions of the Use of Virtual Conferences in Organizations: The Organizational Systems Research Association (OSRA) and the Association for Business Communication (ABC) Members Speak Out.

ERIC Educational Resources Information Center

Wilkinson, Kelly L.; Hemby, K. Virginia

2000-01-01

A survey of 183 members of the Association for Business Communication and 33 members of the Organizational Systems Research Association found that, although virtual conferences reduce costs, professional isolation and lack of human contact are disadvantages. They should supplement but not replace traditional conferences. (Contains 18 references.)…

The Religion/Science Controversy: The Use and Abuse of Science in the Defense of Religion. Proceedings of a Conference (Westville, Indiana, October 5, 1985).

ERIC Educational Resources Information Center

Kanagy, Sherman P., II, Ed.

Science and religion have been referred to as the two strongest general forces which influence humankind. This document contains the proceedings of a conference which was held to address some of the relationships and controversies surrounding these topics. Included are the texts of the major papers presented at the conference. These are: (1)…

An official American Thoracic Society workshop report: stem cells and cell therapies in lung biology and diseases.

PubMed

Weiss, Daniel J; Chambers, Daniel; Giangreco, Adam; Keating, Armand; Kotton, Darrell; Lelkes, Peter I; Wagner, Darcy E; Prockop, Darwin J

2015-04-01

The University of Vermont College of Medicine and the Vermont Lung Center, in collaboration with the NHLBI, Alpha-1 Foundation, American Thoracic Society, European Respiratory Society, International Society for Cell Therapy, and the Pulmonary Fibrosis Foundation, convened a workshop, "Stem Cells and Cell Therapies in Lung Biology and Lung Diseases," held July 29 to August 1, 2013 at the University of Vermont. The conference objectives were to review the current understanding of the role of stem and progenitor cells in lung repair after injury and to review the current status of cell therapy and ex vivo bioengineering approaches for lung diseases. These are all rapidly expanding areas of study that both provide further insight into and challenge traditional views of mechanisms of lung repair after injury and pathogenesis of several lung diseases. The goals of the conference were to summarize the current state of the field, discuss and debate current controversies, and identify future research directions and opportunities for both basic and translational research in cell-based therapies for lung diseases. This conference was a follow-up to four previous biennial conferences held at the University of Vermont in 2005, 2007, 2009, and 2011. Each of those conferences, also sponsored by the National Institutes of Health, American Thoracic Society, and Respiratory Disease Foundations, has been important in helping guide research and funding priorities. The major conference recommendations are summarized at the end of the report and highlight both the significant progress and major challenges in these rapidly progressing fields.

An Official American Thoracic Society Workshop Report: Stem Cells and Cell Therapies in Lung Biology and Diseases

PubMed Central

Chambers, Daniel; Giangreco, Adam; Keating, Armand; Kotton, Darrell; Lelkes, Peter I.; Wagner, Darcy E.; Prockop, Darwin J.

2015-01-01

The University of Vermont College of Medicine and the Vermont Lung Center, in collaboration with the NHLBI, Alpha-1 Foundation, American Thoracic Society, European Respiratory Society, International Society for Cell Therapy, and the Pulmonary Fibrosis Foundation, convened a workshop, “Stem Cells and Cell Therapies in Lung Biology and Lung Diseases,” held July 29 to August 1, 2013 at the University of Vermont. The conference objectives were to review the current understanding of the role of stem and progenitor cells in lung repair after injury and to review the current status of cell therapy and ex vivo bioengineering approaches for lung diseases. These are all rapidly expanding areas of study that both provide further insight into and challenge traditional views of mechanisms of lung repair after injury and pathogenesis of several lung diseases. The goals of the conference were to summarize the current state of the field, discuss and debate current controversies, and identify future research directions and opportunities for both basic and translational research in cell-based therapies for lung diseases. This conference was a follow-up to four previous biennial conferences held at the University of Vermont in 2005, 2007, 2009, and 2011. Each of those conferences, also sponsored by the National Institutes of Health, American Thoracic Society, and Respiratory Disease Foundations, has been important in helping guide research and funding priorities. The major conference recommendations are summarized at the end of the report and highlight both the significant progress and major challenges in these rapidly progressing fields. PMID:25897748

Interventions for treating painful sickle cell crisis during pregnancy.

PubMed

Martí-Carvajal, Arturo J; Peña-Martí, Guiomar E; Comunián-Carrasco, Gabriella; Martí-Peña, Arturo J

2009-01-21

Sickle cell disease is a group of genetic haemoglobin disorders. All over the world, about 300,000 children with these disorders are born each year. Acute sickle cell pain episodes are the most common cause of hospitalisation. Pregnancy in women with sickle cell disease is associated with an increased incidence of maternal and fetal morbidity and mortality. The painful crisis is a severe complication of this illness, and it requires several interventions: packed red cell transfusion, fluid replacement therapy, analgesic drugs, oxygen therapy and steroids; but the approach is not standardised. To assess the effectiveness and safety of different regimens of packed red cell transfusion, oxygen therapy, fluid replacement therapy, analgesic drugs, and steroids for the treatment of painful sickle cell crisis during pregnancy. We searched the Cochrane Pregnancy and Childbirth Group's Trials Register (December 2007), the Cochrane Cystic Fibrosis and Genetic Disorders Group's Trials Register (October 2007), LILACS database (1982 to December 2007) and the following web sites: ClinicalTrials.gov (http://www.clinicaltrials.gov) (December 5, 2007); Current Controlled Trials (http://controlled-trials.com/) (December 5, 2007), and Sistema de Información Esencial en Terapéutica y Salud (http://www.icf.uab.es/informacion/Papyrus/sietes.asp) (December 1, 2007). We also handsearched the European Haematology Association conference (June 2007), the American Society of Hematology conference (December 2007) and reference lists of all retrieved articles. We intended to include randomised clinical trials. We intended to summarise data by standard Cochrane Collaboration methodologies. We could not find any randomised clinical trials on interventions (packed red cell transfusion, oxygen therapy, fluid replacement therapy, analgesic drugs, and steroids) for the treatment of painful sickle cell crisis during pregnancy. This review found no randomised clinical trials on the safety and efficacy of interventions for treating painful sickle cell crisis during pregnancy. The effects of interventions need to be tested in randomised clinical trials.

Proceedings of the Fuel Cells `97 Review Meeting

DOE Office of Scientific and Technical Information (OSTI.GOV)

None

The Federal Energy Technology Center (FETC) sponsored the Fuel Cells '97 Review Meeting on August 26-28, 1997, in Morgantown, West Virginia. The purpose of the meeting was to provide an annual forum for the exchange of ideas and discussion of results and plans related to the research on fuel cell power systems. The total of almost 250 conference participants included engineers and scientists representing utilities, academia, and government from the U.S. and eleven other countries: Canada, China, India, Iran, Italy, Japan, Korea, Netherlands, Russia, Taiwan, and the United Kingdom. On first day, the conference covered the perspectives of sponsors andmore » end users, and the progress reports of fuel-cell developers. Papers covered phosphoric, carbonate, and solid oxide fuel cells for stationary power applications. On the second day, the conference covered advanced research in solid oxide and other fuel cell developments. On the third day, the conference sponsored a workshop on advanced research and technology development. A panel presentation was given on fuel cell opportunities. Breakout sessions with group discussions followed this with fuel cell developers, gas turbine vendors, and consultants.« less

Immunity to Cryptococcus neoformans and C. gattii during cryptococcosis

PubMed Central

Gibson, Josie F.; Johnston, Simon A.

2015-01-01

The vast majority of infection with cryptococcal species occurs with Cryptococcus neoformans in the severely immunocompromised. A significant exception to this is the infections of those with apparently normal immune systems by Cryptococcus gattii. Susceptibility to cryptococcosis can be broadly categorised as a defect in adaptive immune responses, especially in T cell immunity. However, innate immune cells such as macrophages play a key role and are likely the primary effector cell in the killing and ultimate clearance of cryptococcal infection. In this review we discuss the current state of our understanding of how the immune system responds to cryptococcal infection in health and disease, with reference to the work communicated at the 9th International Conference on Cryptococcus and Cryptococcosis (ICCC9). We have focussed on cell mediated responses, particularly early in infection, but with the aim of presenting a broad overview of our understanding of immunity to cryptococcal infection, highlighting some recent advances and offering some perspectives on future directions. PMID:25498576

Man and His Environment: Interaction and Interdependence. Proceedings of Conference I.

ERIC Educational Resources Information Center

Wang, J. Y., Ed.

This report of a 1969 Environmental Sciences Institute includes presentations from authorities on environmental problems, the discussion following some presentations, references, and the results of a panel discussion which involved all conference speakers. Papers presented were: "Is There an Ecological Crisis?""The Challenge of…

IFLA General Conference, 1985. Division on Regional Activities. Papers.

ERIC Educational Resources Information Center

International Federation of Library Associations, The Hague (Netherlands).

Papers on regional library activities which were presented at the 1985 International Federation of Library Associations (IFLA) conference include: (1) "Importance of Information Resources in National Development with Particular Reference to the Asian Scene" (Yogendra P. Dubey, India); (2) "Report of the Activities of the Regional…

SOURCES OF INDOOR AIR CONTAMINANTS: CHARACTERIZING EMISSIONS AND HEALTH EFFECTS

EPA Science Inventory

This document consists of the Preface, Chapter 1. Introduction, Chapter 6. Conclusion, and References relating to an October 1990 conference at the John B. Pierce Laboratory and Yale University, New Haven, CT.

The purpose of a May 1985 international conference on indoor s...

Ethical and Stylistic Implications in Delivering Conference Papers.

ERIC Educational Resources Information Center

Enos, Theresa

1986-01-01

Analyzes shortcomings of conference papers intended for the eye rather than the ear. Referring to classical oratory, speech act theory, and cognitive theory, recommends revising papers for oral presentation by using classical disposition; deductive rather than inductive argument; formulaic repetition of words and phrases; non-inverted clause…

36th International Conference on High Energy Physics

NASA Astrophysics Data System (ADS)

The Australian particle physics community was honoured to host the 36th ICHEP conference in 2012 in Melbourne. This conference has long been the reference event for our international community. The announcement of the discovery of the Higgs boson at the LHC was a major highlight, with huge international press coverage. ICHEP2012 was described by CERN Director-General, Professor Rolf Heuer, as a landmark conference for our field. In additional to the Higgs announcement, important results from neutrino physics, from flavour physics, and from physics beyond the standard model also provided great interest. There were also updates on key accelerator developments such as the new B-factories, plans for the LHC upgrade, neutrino facilities and associated detector developments. ICHEP2012 exceeded the promise expected of the key conference for our field, and really did provide a reference point for the future. Many thanks to the contribution reviewers: Andy Bakich, Csaba Balazs, Nicole Bell, Catherine Buchanan, Will Crump, Cameron Cuthbert, Ben Farmer, Sudhir Gupta, Elliot Hutchison, Paul Jackson, Geng-Yuan Jeng, Archil Kobakhidze, Doyoun Kim, Tong Li, Antonio Limosani (Head Editor), Kristian McDonald, Nikhul Patel, Aldo Saavedra, Mark Scarcella, Geoff Taylor, Ian Watson, Graham White, Tony Williams and Bruce Yabsley.

Maintaining success, reducing treatment burden, focusing on survivorship: highlights from the third European consensus conference on diagnosis and treatment of germ-cell cancer.

PubMed

Beyer, J; Albers, P; Altena, R; Aparicio, J; Bokemeyer, C; Busch, J; Cathomas, R; Cavallin-Stahl, E; Clarke, N W; Claßen, J; Cohn-Cedermark, G; Dahl, A A; Daugaard, G; De Giorgi, U; De Santis, M; De Wit, M; De Wit, R; Dieckmann, K P; Fenner, M; Fizazi, K; Flechon, A; Fossa, S D; Germá Lluch, J R; Gietema, J A; Gillessen, S; Giwercman, A; Hartmann, J T; Heidenreich, A; Hentrich, M; Honecker, F; Horwich, A; Huddart, R A; Kliesch, S; Kollmannsberger, C; Krege, S; Laguna, M P; Looijenga, L H J; Lorch, A; Lotz, J P; Mayer, F; Necchi, A; Nicolai, N; Nuver, J; Oechsle, K; Oldenburg, J; Oosterhuis, J W; Powles, T; Rajpert-De Meyts, E; Rick, O; Rosti, G; Salvioni, R; Schrader, M; Schweyer, S; Sedlmayer, F; Sohaib, A; Souchon, R; Tandstad, T; Winter, C; Wittekind, C

2013-04-01

In November 2011, the Third European Consensus Conference on Diagnosis and Treatment of Germ-Cell Cancer (GCC) was held in Berlin, Germany. This third conference followed similar meetings in 2003 (Essen, Germany) and 2006 (Amsterdam, The Netherlands) [Schmoll H-J, Souchon R, Krege S et al. European consensus on diagnosis and treatment of germ-cell cancer: a report of the European Germ-Cell Cancer Consensus Group (EGCCCG). Ann Oncol 2004; 15: 1377-1399; Krege S, Beyer J, Souchon R et al. European consensus conference on diagnosis and treatment of germ-cell cancer: a report of the second meeting of the European Germ-Cell Cancer Consensus group (EGCCCG): part I. Eur Urol 2008; 53: 478-496; Krege S, Beyer J, Souchon R et al. European consensus conference on diagnosis and treatment of germ-cell cancer: a report of the second meeting of the European Germ-Cell Cancer Consensus group (EGCCCG): part II. Eur Urol 2008; 53: 497-513]. A panel of 56 of 60 invited GCC experts from all across Europe discussed all aspects on diagnosis and treatment of GCC, with a particular focus on acute and late toxic effects as well as on survivorship issues. The panel consisted of oncologists, urologic surgeons, radiooncologists, pathologists and basic scientists, who are all actively involved in care of GCC patients. Panelists were chosen based on the publication activity in recent years. Before the meeting, panelists were asked to review the literature published since 2006 in 20 major areas concerning all aspects of diagnosis, treatment and follow-up of GCC patients, and to prepare an updated version of the previous recommendations to be discussed at the conference. In addition, ∼50 E-vote questions were drafted and presented at the conference to address the most controversial areas for a poll of expert opinions. Here, we present the main recommendations and controversies of this meeting. The votes of the panelists are added as online supplements.

Accurate live and dead bacterial cell enumeration using flow cytometry (Conference Presentation)

NASA Astrophysics Data System (ADS)

Ou, Fang; McGoverin, Cushla; Swift, Simon; Vanholsbeeck, Frédérique

2017-03-01

Flow cytometry (FCM) is based on the detection of scattered light and fluorescence to identify cells with particular characteristics of interest. However most FCM cannot precisely control the flow through its interrogation point and hence the volume and concentration of the sample cannot be immediately obtained. The easiest, most reliable and inexpensive way of obtaining absolute counts with FCM is by using reference beads. We investigated a method of using FCM with reference beads to measure live and dead bacterial concentration over the range of 106 to 108 cells/mL and ratio varying from 0 to 100%. We believe we are the first to use this method for such a large cell concentration range while also establishing the effect of varying the live/dead bacteria ratios. Escherichia coli solutions with differing ratios of live:dead cells were stained with fluorescent dyes SYTO 9 and propidium iodide (PI), which label live and dead cells, respectively. Samples were measured using a LSR II Flow Cytometer (BD Biosciences); using 488 nm excitation with 20 mW power. Both SYTO 9 and PI fluorescence were collected and threshold was set to side scatter. Traditional culture-based plate count was done in parallel to the FCM analysis. The concentration of live bacteria from FCM was compared to that obtained by plate counts. Preliminary results show that the concentration of live bacteria obtained by FCM and plate counts correlate well with each other and indicates this may be extended to a wider concentration range or for studying other cell characteristics.

An Official American Thoracic Society Workshop Report 2015. Stem Cells and Cell Therapies in Lung Biology and Diseases.

PubMed

Wagner, Darcy E; Cardoso, Wellington V; Gilpin, Sarah E; Majka, Susan; Ott, Harald; Randell, Scott H; Thébaud, Bernard; Waddell, Thomas; Weiss, Daniel J

2016-08-01

The University of Vermont College of Medicine, in collaboration with the NHLBI, Alpha-1 Foundation, American Thoracic Society, Cystic Fibrosis Foundation, European Respiratory Society, International Society for Cellular Therapy, and the Pulmonary Fibrosis Foundation, convened a workshop, "Stem Cells and Cell Therapies in Lung Biology and Lung Diseases," held July 27 to 30, 2015, at the University of Vermont. The conference objectives were to review the current understanding of the role of stem and progenitor cells in lung repair after injury and to review the current status of cell therapy and ex vivo bioengineering approaches for lung diseases. These are all rapidly expanding areas of study that both provide further insight into and challenge traditional views of mechanisms of lung repair after injury and pathogenesis of several lung diseases. The goals of the conference were to summarize the current state of the field, discuss and debate current controversies, and identify future research directions and opportunities for both basic and translational research in cell-based therapies for lung diseases. This 10th anniversary conference was a follow up to five previous biennial conferences held at the University of Vermont in 2005, 2007, 2009, 2011, and 2013. Each of those conferences, also sponsored by the National Institutes of Health, American Thoracic Society, and respiratory disease foundations, has been important in helping guide research and funding priorities. The major conference recommendations are summarized at the end of the report and highlight both the significant progress and major challenges in these rapidly progressing fields.

Stem Cells, Cell Therapies, and Bioengineering in Lung Biology and Diseases. Comprehensive Review of the Recent Literature 2010–2012

PubMed Central

2013-01-01

A conference, “Stem Cells and Cell Therapies in Lung Biology and Lung Diseases,” was held July 25 to 28, 2011 at the University of Vermont to review the current understanding of the role of stem and progenitor cells in lung repair after injury and to review the current status of cell therapy and ex vivo bioengineering approaches for lung diseases. These are rapidly expanding areas of study that provide further insight into and challenge traditional views of mechanisms of lung repair after injury and pathogenesis of several lung diseases. The goals of the conference were to summarize the current state of the field, to discuss and debate current controversies, and to identify future research directions and opportunities for basic and translational research in cell-based therapies for lung diseases. The goal of this article, which accompanies the formal conference report, is to provide a comprehensive review of the published literature in lung regenerative medicine from the last conference report through December 2012. PMID:23869446

2006 Bethesda International Consensus recommendations on the immunophenotypic analysis of hematolymphoid neoplasia by flow cytometry: optimal reagents and reporting for the flow cytometric diagnosis of hematopoietic neoplasia.

PubMed

Wood, Brent L; Arroz, Maria; Barnett, David; DiGiuseppe, Joseph; Greig, Bruce; Kussick, Steven J; Oldaker, Teri; Shenkin, Mark; Stone, Elizabeth; Wallace, Paul

2007-01-01

Immunophenotyping by flow cytometry has become standard practice in the evaluation and monitoring of patients with hematopoietic neoplasia. However, despite its widespread use, considerable variability continues to exist in the reagents used for evaluation and the format in which results are reported. As part of the 2006 Bethesda Consensus conference, a committee was formed to attempt to define a consensus set of reagents suitable for general use in the diagnosis and monitoring of hematopoietic neoplasms. The committee included laboratory professionals from private, public, and university hospitals as well as large reference laboratories that routinely operate clinical flow cytometry laboratories with an emphasis on lymphoma and leukemia immunophenotyping. A survey of participants successfully identified the cell lineage(s) to be evaluated for each of a variety of specific medical indications and defined a set of consensus reagents suitable for the initial evaluation of each cell lineage. Elements to be included in the reporting of clinical flow cytometric results for leukemia and lymphoma evaluation were also refined and are comprehensively listed. The 2006 Bethesda Consensus conference represents the first successful attempt to define a set of consensus reagents suitable for the initial evaluation of hematopoietic neoplasia. Copyright 2007 Clinical Cytometry Society.

IFLA General Conference, 1986. Management and Technology Division. Section: Statistics. Papers.

ERIC Educational Resources Information Center

International Federation of Library Associations and Institutions, The Hague (Netherlands).

Papers on statistics which were presented at the 1986 International Federation of Library Associations (IFLA) conference include: (1) "Library Data Collection in Brazil (Nice Menezes de Figueiredo, Brazil); (2) "Fact-Finding on Statistics and Reference Tools in Japan" (Yuriko Sugimoto, Chihomi Oka, Ikuko Mayumi, and Keiko Kurata,…

Early Identification of Skill Needs in Europe. CEDEFOP Reference Series.

ERIC Educational Resources Information Center

Schmidt, Susanne Liane, Ed.; Schomann, Klaus, Ed.; Tessaring, Manfred, Ed.

This document contains the following papers: "Early Recognition of Skill Needs in Europe: European Conference, Berlin, 30/31 May 2002" (Susanne Liane Schmidt, Klaus Schomann, Manfred Tessaring); "Welcome and Opening of the European Conference 'Early Recognition of Skill Needs in Europe,' 30 May 2002, Social Sciences Research Center…

Proceedings of the American Academy of Nursing Conference on Using Innovative Technology to Decrease Nursing Demand and Enhance Patient Care Delivery.

ERIC Educational Resources Information Center

Nursing Outlook, 2003

2003-01-01

Includes an introduction and 13 papers that address the following: nursing shortages; the role of technology in improving patient safety and care, simulating practice environments, and improving efficiency; and recommendations of conference participants. Many papers contain references. (JOW)

Designing Asynchronous, Text-Based Computer Conferences: Ten Research-Based Suggestions

ERIC Educational Resources Information Center

Choitz, Paul; Lee, Doris

2006-01-01

Asynchronous computer conferencing refers to the use of computer software and a network enabling participants to post messages that allow discourse to continue even though interactions may be extended over days and weeks. Asynchronous conferences are time-independent, adapting to multiple time zones and learner schedules. Such activities as…

Diffusion of knowledge in dentistry. The pit and fissure sealant conferences.

PubMed

Chapko, M K

1988-01-01

This paper presents data on the diffusion to dentists of information from the May 1981 American Dental Association conference and December 1983 National Institutes of Health (NIH) conference on pit and fissure sealants. A mail survey was sent to 521 (72.2% returned) randomly selected dentists in general practice and all 47 (76.6% returned) pedodontists in the State of Washington. Approximately 70% of the dentists were aware that the conferences had taken place and a little over 50% were aware of the conference recommendations. Awareness was related to: being a pedodontist, number of continuing education hours taken, number of referred journals read, and being an officer in a dental organization.

10.1142/9781911299660_fmatter years Laser Interaction and Related Plasma Phenomena (lirpp Vol. 13)

NASA Astrophysics Data System (ADS)

Hora, Heinrich

2016-10-01

When these proceedings of 13th international conference LASER INTERACTION AND RELATED PLASMA PHENOMENA (LIRPP) will be circulated in 1998, it is just 30 years that this conference series began. Professor Miley asked me to present some thoughts at this occasion since I am involved from the beginning to 1991 a director and then as emeritus director. The conferences were in the following years 1969, 1971, 1973, 1976, 1979, 1982, 1985, 1987, 1989, 1991, 1993, 1995 and 1997 and reference to each of the conferences is simply given by the year in brackets...

Postconditioning hormesis put in perspective: an overview of experimental and clinical studies.

PubMed

Wiegant, F A C; Prins, H A B; Van Wijk, R

2011-01-01

A beneficial effect of applying mild stress to cells or organisms, that were initially exposed to a high dose of stress, has been referred to as 'postconditioning hormesis'. The initial high dose of stress activates intrinsic self-recovery mechanisms. Modulation of these endogenous adaptation strategies by administration of a subsequent low dose of stress can confer effects that are beneficial to the biological system. Owing to its potentially therapeutic applications, postconditioning hormesis is subject to research in various scientific disciplines. This paper presents an overview of the dynamics of postconditioning hormesis and illustrates this phenomenon with a number of examples in experimental and clinical research.

Documents of the International Conferences on Education, 1979-1986: Cumulative Catalogue = Documents des conferences internationales de l'education, 1979-1986: catalogue cumulatif = Documentos de las Conferencias Internacionales de Educacion, 1979-1986: Catalogo Cumulativo.

ERIC Educational Resources Information Center

United Nations Educational, Scientific, and Cultural Organization, Paris (France).

Composed of two sections, this catalog lists 925 documents prepared for and produced by the 37th through the 40th sessions of the International Conference on Education (1979, 1981, 1984, and 1986). Included are reference and information papers contributed by the United Nations Educational, Scientific, and Cultural Organization (Unesco)…

NREL: SMARTS - SMARTS References

Science.gov Websites

Improve Concentrating Photovoltaic System Design & Performance Evaluation." Proceedings of the 29th Institute of Electrical and Electronics Engineers Photovoltaic Specialists Conference. New Orleans Irradiance Reference Standards for Photovoltaic Performance." Journal of Solar Energy Engineering (126

New Features in the ADS Abstract Service

NASA Astrophysics Data System (ADS)

Eichhorn, G.; Accomazzi, A.; Grant, C. S.; Kurtz, M. J.; ReyBacaicoa, V.; Murray, S. S.

2001-11-01

The ADS Abstract Service contains over 2.3 million references in four databases: Astronomy/Astrophysics/Planetary Sciences, Instrumentation, Physics/Geophysics, and Preprints. We provide abstracts and articles free to the astronomical community for all major and many smaller astronomy journals, PhD theses, conference proceedings, and technical reports. These four databases can be queried either separately of jointly. The ADS also has scanned 1.3 million pages in 180,000 articles in the ADS Article Service. This literature archive contains all major Astronomy journals and many smaller journals, as well as conference proceedings, including the abstract books from all the LPSCs back to volume 2. A new feature gives our users the ability to see list of articles that were also read by the readers of a given article. This is a powerful tool to find out what current articles are relevant in a particular field of study. We have recently expanded the citation and reference query capabilities. It allows our users to select papers for which they want to see references or citations and then retrieve these citations/references. Another new capability is the ability to sort a list of articles by their citation count. As usual, users should be reminded that the citations in ADS are incomplete because we do not obtain reference lists from all publishers. In addition, we cannot match all references (e.g. in press, private communications, author errors, some conference papers, etc.). Anyone using the citations for analysis of publishing records should keep this in mind. More work on expanding the citation and reference features is planned over the next year. ADS Home Page http://ads.harvard.edu/

Reminiscences and Reflections on the History of International Conferences on Spectral Line Shapes

NASA Astrophysics Data System (ADS)

Szudy, J.

2017-02-01

A brief account of the history of International Conferences on Spectral Line Shapes (ICSLS) is given. Although in common use the “Europhysics Study Conference on Spectral Line Broadening and Related Topics” held in Meudon in 1973 is referred to as the first in the current sequence of ICSLS meetings, it is noted that five conferences dealing with line shape topics were organized before 1973 both in the USA and in Europe. Some details are given about their format and program. In particular, “The First International Conference on Spectral Lines” held in 1972 at the University of Tennessee at Knoxville is remembered as a meeting fully devoted to line shape problems, and as such should be regarded, in addition to the Meudon conference, as one of the roots of the line-shape community. Some of the highlights of particular ICSLS conferences as well as characteristics of their proceedings are briefly reviewed.

Advances in Tissue Regeneration

DTIC Science & Technology

2010-01-01

Conference Hand Transplants Face transplants Skin Graft Stretching 33 www.afirm.mil Josh Maloney 1st AFIRM Hand Transplant 2010 MHS Conference...34www.afirm.mil Cell spraying in place of skin grafting for burn AFIRM: clinical trials scheduled for FY 10 2010 MHS Conference Before After patients...ReCell) Using Extracellular matrix to regrow lost muscle tissue. Weeks 6 & 7 Week 9 Week 8 Week 10 Week 11 Autologous engineered skin grafts Not

2009 Gordon Research Conference, Applied and Environmental Microbiology

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dubilier, Nicole

The topic of the 2009 Gordon Conference on Applied and Environmental Microbiology is: From Single Cells to the Environment. The Conference will present and discuss cutting-edge research on applied and environmental microbiology with a focus on understanding interactions between microorganisms and the environment at levels ranging from single cells to complex communities. The Conference will feature a wide range of topics such as single cell techniques (including genomics, imaging, and NanoSIMS), microbial diversity at scales ranging from clonal to global, environmental 'meta-omics', biodegradation and bioremediation, metal - microbe interactions, animal microbiomes and symbioses. The Conference will bring together investigators whomore » are at the forefront of their field, and will provide opportunities for junior scientists and graduate students to present their work in poster format and exchange ideas with leaders in the field. Some poster presenters will be selected for short talks. The collegial atmosphere of this Conference, with extensive discussion sessions as well as opportunities for informal gatherings in the afternoons and evenings, provides an ideal setting for scientists from different disciplines to exchange ideas, brainstorm and discuss cross-disciplinary collaborations.« less

14 CFR 221.152 - Method of withdrawing portion of authority conferred by power of attorney.

Code of Federal Regulations, 2013 CFR

2013-01-01

..., DEPARTMENT OF TRANSPORTATION (AVIATION PROCEEDINGS) ECONOMIC REGULATIONS TARIFFS Giving and Revoking Powers... attorney. If a carrier desires to issue a power of attorney conferring less authority than a previous power... the Office of International Aviation. Such revocation notice shall include reference to the new power...

14 CFR 221.152 - Method of withdrawing portion of authority conferred by power of attorney.

Code of Federal Regulations, 2012 CFR

2012-01-01

..., DEPARTMENT OF TRANSPORTATION (AVIATION PROCEEDINGS) ECONOMIC REGULATIONS TARIFFS Giving and Revoking Powers... attorney. If a carrier desires to issue a power of attorney conferring less authority than a previous power... the Office of International Aviation. Such revocation notice shall include reference to the new power...

14 CFR 221.152 - Method of withdrawing portion of authority conferred by power of attorney.

Code of Federal Regulations, 2014 CFR

2014-01-01

..., DEPARTMENT OF TRANSPORTATION (AVIATION PROCEEDINGS) ECONOMIC REGULATIONS TARIFFS Giving and Revoking Powers... attorney. If a carrier desires to issue a power of attorney conferring less authority than a previous power... the Office of International Aviation. Such revocation notice shall include reference to the new power...

14 CFR 221.152 - Method of withdrawing portion of authority conferred by power of attorney.

Code of Federal Regulations, 2011 CFR

2011-01-01

..., DEPARTMENT OF TRANSPORTATION (AVIATION PROCEEDINGS) ECONOMIC REGULATIONS TARIFFS Giving and Revoking Powers... attorney. If a carrier desires to issue a power of attorney conferring less authority than a previous power... the Office of International Aviation. Such revocation notice shall include reference to the new power...

14 CFR 221.152 - Method of withdrawing portion of authority conferred by power of attorney.

Code of Federal Regulations, 2010 CFR

2010-01-01

..., DEPARTMENT OF TRANSPORTATION (AVIATION PROCEEDINGS) ECONOMIC REGULATIONS TARIFFS Giving and Revoking Powers... attorney. If a carrier desires to issue a power of attorney conferring less authority than a previous power... the Office of International Aviation. Such revocation notice shall include reference to the new power...

Established and Evolving Spoken Research Process Genres: Plenary Lecture and Poster Session Discussions at Academic Conferences.

ERIC Educational Resources Information Center

Shalom, Celia

1993-01-01

Two types of main hall discussions at an ecology conference were studied: plenary lecture discussion as an accepted, established spoken research process genre with its own conventions; and poster session discussion as a fragile, embryonic research process genre struggling for definition. (14 references) (Author/LB)

Airborne Wind Shear Detection and Warning Systems: Third Combined Manufacturers' and Technologists' Conference, part 1

NASA Technical Reports Server (NTRS)

Vicroy, Dan D. (Compiler); Bowles, Roland L. (Compiler); Schlickenmaier, Herbert (Compiler)

1991-01-01

Papers presented at the conference on airborne wind shear detection and warning systems are compiled. The following subject areas are covered: terms of reference; case study; flight management; sensor fusion and flight evaluation; Terminal Doppler Weather Radar data link/display; heavy rain aerodynamics; and second generation reactive systems.

Proceedings of the 15th Space Photovoltaic Research and Technology Conference

NASA Technical Reports Server (NTRS)

Bailey, Sheila (Compiler)

2004-01-01

Reports from the 15th Space Photovoltaic Research and Technology Conference included topics on space solar cell research, space photovoltaics, multibandgap cells,thermophotovoltaics,flight experiments, environmental effects; calibration and characterization; and photovoltaics for planetary surfaces.

25.5 Betavoltaic Power Cells

DTIC Science & Technology

2006-01-01

Conference Paper POSTPRINT 3. DATES COVERED (From - To) 2004 - 2006 4. TITLE AND SUBTITLE 25.5 Betavoltaic Power Cells 5a. CONTRACT NUMBER FA9453-04...Sources Conference, 12-15 Jun 06, Philadelphia, PA Government Purpose Rights 14. ABSTRACT Betavoltaic power cells utilize beta-emitting...radioisotopes and semiconductor devices to produce long-lived power in a variety of small form factors. Qynergy is developing betavoltaic power cells based on

13th International Conference on Chlamydomonas

DOE Office of Scientific and Technical Information (OSTI.GOV)

Silflow, Carolyn D.

2014-03-11

The 13th International Conference on Chlamydomonas (EMBO Workshop on the Cell and Molecular Biology of Chlamydomonas) was held May 27 to June 1, 2008 in Hyeres, France. The conference was the biennial meeting for all researchers studying the green algal systems Chlamydomonas and Volvox. The conference brought together approximately 200 investigators from around the world (North America, Asia, Europe and Australia) representing different fields and disciplines (cell biology, genetics, biochemistry, biophysics, plant physiology, genomics). It provided an opportunity for investigators from different countries to share methodologies and to discuss recent results with a focus on the Chlamydomonas experimental system.

Diagnostic tool for red blood cell membrane disorders: Assessment of a new generation ektacytometer☆

PubMed Central

Da Costa, Lydie; Suner, Ludovic; Galimand, Julie; Bonnel, Amandine; Pascreau, Tiffany; Couque, Nathalie; Fenneteau, Odile; Mohandas, Narla

2016-01-01

Inherited red blood cell (RBC) membrane disorders, such as hereditary spherocytosis, elliptocytosis and hereditary ovalocytosis, result from mutations in genes encoding various RBC membrane and skeletal proteins. The RBC membrane, a composite structure composed of a lipid bilayer linked to a spectrin/actin-based membrane skeleton, confers upon the RBC unique features of deformability and mechanical stability. The disease severity is primarily dependent on the extent of membrane surface area loss. RBC membrane disorders can be readily diagnosed by various laboratory approaches that include RBC cytology, flow cytometry, ektacytometry, electrophoresis of RBC membrane proteins and genetics. The reference technique for diagnosis of RBC membrane disorders is the osmotic gradient ektacytometry. However, in spite of its recognition as the reference technique, this technique is rarely used as a routine diagnosis tool for RBC membrane disorders due to its limited availability. This may soon change as a new generation of ektacytometer has been recently engineered. In this review, we describe the workflow of the samples shipped to our Hematology laboratory for RBC membrane disorder analysis and the data obtained for a large cohort of French patients presenting with RBC membrane disorders using a newly available version of the ektacytomer. PMID:26603718

Navigating the Information Ocean: Charting the Course. Abstracts from the Academic Library Association of Ohio Annual Conference (Columbus, Ohio, November 4, 1994).

ERIC Educational Resources Information Center

Academic Library Association of Ohio.

Abstracts of 14 papers presented at the conference are provided here. Titles are: "Electronic Information Terraforming: Designing and Implementing a Front-end System Using World-Wide Web Technology" (Abbie Basile; And Others); "Characteristics of Generation X and Implications for Reference and Instructional Services" (Catherine…

Community Development, Problems and Prospects. Proceedings of a Commonwealth Conference, University Park, Pennsylvania, March 7-9, 1965.

ERIC Educational Resources Information Center

Buck, Roy C., Ed.; Rath, Robert A., Ed.

Conference papers on community development problems and prospects deal with needs, methods, objectives, resources, and the role of universities, with particular reference to urban areas. Concerns include deficiencies in knowledge, leadership, government, and the quality of urban life; land use and urban design; principles of economic development…

Cumulative reports and publications through 31 December 1983

NASA Technical Reports Server (NTRS)

1983-01-01

All reports for the calendar years 1975 through December 1983 are listed by author. Since ICASE reports are intended to be preprints of articles for journals and conference proceedings, the published reference is included when available. Thirteen older journal and conference proceedings references are included as well as five additional reports by ICASE personnel. Major categories of research covered include: (1) numerical methods, with particular emphasis on the development and analysis of basic algorithms; (2) computational problems in engineering and the physical sciences, particularly fluid dynamics, acoustics, structural analysis, and chemistry; and (3) computer systems and software, especially vector and parallel computers, microcomputers, and data management.

The natural defense system and the normative self model

PubMed Central

Kourilsky, Philippe

2016-01-01

Infectious agents are not the only agressors, and the immune system is not the sole defender of the organism. In an enlarged perspective, the ‘normative self model’ postulates that a ‘natural defense system’ protects man and other complex organisms against the environmental and internal hazards of life, including infections and cancers. It involves multiple error detection and correction mechanisms that confer robustness to the body at all levels of its organization. According to the model, the self relies on a set of physiological norms, and NONself (meaning : Non Obedient to the Norms of the self) is anything ‘off-norms’. The natural defense system comprises a set of ‘civil defenses’ (to which all cells in organs and tissues contribute), and a ‘professional army ‘, made of a smaller set of mobile cells. Mobile and non mobile cells differ in their tuning abilities. Tuning extends the recognition capabilities of NONself by the mobile cells, which increase their defensive function. To prevent them to drift, which would compromise self/NONself discrimination, the more plastic mobile cells need to periodically refer to the more stable non mobile cells to keep within physiological standards. PMID:27303629

Definitions, Criteria and Global Classification of Mast Cell Disorders with Special Reference to Mast Cell Activation Syndromes: A Consensus Proposal

PubMed Central

Valent, Peter; Akin, Cem; Arock, Michel; Brockow, Knut; Butterfield, Joseph H.; Carter, Melody C.; Castells, Mariana; Escribano, Luis; Hartmann, Karin; Lieberman, Philip; Nedoszytko, Boguslaw; Orfao, Alberto; Schwartz, Lawrence B.; Sotlar, Karl; Sperr, Wolfgang R.; Triggiani, Massimo; Valenta, Rudolf; Horny, Hans-Peter; Metcalfe, Dean D.

2012-01-01

Activation of tissue mast cells (MCs) and their abnormal growth and accumulation in various organs are typically found in primary MC disorders also referred to as mastocytosis. However, increasing numbers of patients are now being informed that their clinical findings are due to MC activation (MCA) that is neither associated with mastocytosis nor with a defined allergic or inflammatory reaction. In other patients with MCA, MCs appear to be clonal cells, but criteria for diagnosing mastocytosis are not met. A working conference was organized in 2010 with the aim to define criteria for diagnosing MCA and related disorders, and to propose a global unifying classification of all MC disorders and pathologic MC reactions. This classification includes three types of ‘MCA syndromes’ (MCASs), namely primary MCAS, secondary MCAS and idiopathic MCAS. MCA is now defined by robust and generally applicable criteria, including (1) typical clinical symptoms, (2) a substantial transient increase in serum total tryptase level or an increase in other MC-derived mediators, such as histamine or prostaglandin D2, or their urinary metabolites, and (3) a response of clinical symptoms to agents that attenuate the production or activities of MC mediators. These criteria should assist in the identification and diagnosis of patients with MCAS, and in avoiding misdiagnoses or overinterpretation of clinical symptoms in daily practice. Moreover, the MCAS concept should stimulate research in order to identify and exploit new molecular mechanisms and therapeutic targets. PMID:22041891

Mechanisms of Cancer Cell Dormancy--Another Hallmark of Cancer?

PubMed

Yeh, Albert C; Ramaswamy, Sridhar

2015-12-01

Disease relapse in cancer patients many years after clinical remission, often referred to as cancer dormancy, is well documented but remains an incompletely understood phenomenon on the biologic level. Recent reviews have summarized potential models that can explain this phenomenon, including angiogenic, immunologic, and cellular dormancy. We focus on mechanisms of cellular dormancy as newer biologic insights have enabled better understanding of this process. We provide a historical context, synthesize current advances in the field, and propose a mechanistic framework that treats cancer cell dormancy as a dynamic cell state conferring a fitness advantage to an evolving malignancy under stress. Cellular dormancy appears to be an active process that can be toggled through a variety of signaling mechanisms that ultimately downregulate the RAS/MAPK and PI(3)K/AKT pathways, an ability that is preserved even in cancers that constitutively depend on these pathways for their growth and survival. Just as unbridled proliferation is a key hallmark of cancer, the ability of cancer cells to become quiescent may be critical to evolving malignancies, with implications for understanding cancer initiation, progression, and treatment resistance. ©2015 American Association for Cancer Research.

Mechanisms of Cancer Cell Dormancy – Another Hallmark of Cancer?

PubMed Central

Yeh, Albert C.; Ramaswamy, Sridhar

2015-01-01

Disease relapse in cancer patients many years after clinical remission, often referred to as cancer dormancy, is well documented but remains an incompletely understood phenomenon on the biological level. Recent reviews have summarized potential models that can explain this phenomenon, including angiogenic, immunologic, and cellular dormancy. We focus on mechanisms of cellular dormancy as newer biological insights have enabled better understanding of this process. We provide a historical context, synthesize current advances in the field, and propose a mechanistic framework that treats cancer cell dormancy as a dynamic cell state conferring a fitness advantage to an evolving malignancy under stress. Cellular dormancy appears to be an active process that can be toggled through a variety of signaling mechanisms that ultimately down-regulate the Ras/MAPK and PI(3)K/AKT pathways, an ability that is preserved even in cancers that constitutively depend on these pathways for their growth and survival. Just as unbridled proliferation is a key hallmark of cancer, the ability of cancer cells to become quiescent may be critical to evolving malignancies, with implications for understanding cancer initiation, progression, and treatment resistance. PMID:26354021

50 years of Arabidopsis research: highlights and future directions.

PubMed

Provart, Nicholas J; Alonso, Jose; Assmann, Sarah M; Bergmann, Dominique; Brady, Siobhan M; Brkljacic, Jelena; Browse, John; Chapple, Clint; Colot, Vincent; Cutler, Sean; Dangl, Jeff; Ehrhardt, David; Friesner, Joanna D; Frommer, Wolf B; Grotewold, Erich; Meyerowitz, Elliot; Nemhauser, Jennifer; Nordborg, Magnus; Pikaard, Craig; Shanklin, John; Somerville, Chris; Stitt, Mark; Torii, Keiko U; Waese, Jamie; Wagner, Doris; McCourt, Peter

2016-02-01

922 I. 922 II. 922 III. 925 IV. 925 V. 926 VI. 927 VII. 928 VIII. 929 IX. 930 X. 931 XI. 932 XII. 933 XIII. Natural variation and genome-wide association studies 934 XIV. 934 XV. 935 XVI. 936 XVII. 937 937 References 937 SUMMARY: The year 2014 marked the 25(th) International Conference on Arabidopsis Research. In the 50 yr since the first International Conference on Arabidopsis Research, held in 1965 in Göttingen, Germany, > 54 000 papers that mention Arabidopsis thaliana in the title, abstract or keywords have been published. We present herein a citational network analysis of these papers, and touch on some of the important discoveries in plant biology that have been made in this powerful model system, and highlight how these discoveries have then had an impact in crop species. We also look to the future, highlighting some outstanding questions that can be readily addressed in Arabidopsis. Topics that are discussed include Arabidopsis reverse genetic resources, stock centers, databases and online tools, cell biology, development, hormones, plant immunity, signaling in response to abiotic stress, transporters, biosynthesis of cells walls and macromolecules such as starch and lipids, epigenetics and epigenomics, genome-wide association studies and natural variation, gene regulatory networks, modeling and systems biology, and synthetic biology. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

Summer Conference on International Inter-Library Cooperation Held at Clarkson College of Technology, Potsdam, New York, June 7-9, 1967.

ERIC Educational Resources Information Center

North Country Reference and Research Resources Council, Canton, NY.

The conference was held by the North Country Reference and Research Resources Council as a means of communicating and cooperating with Canadian libraries situated in close proximity to the Northern New York State libraries composing the Council. Topics covered by invited speakers and round table discussions included: (1) cooperative library…

Architectural Contributions to Effective Programming for the Mentally Retarded. Conference Report of the Architectural Institute (Denver, Colorado, May 15-16, 1967).

ERIC Educational Resources Information Center

American Association on Mental Deficiency, Washington, DC.

Conference participants consider the role of the architect and the programer in planning and constructing facilities for the mentally handicapped. David Rosen discusses the design problems of state institutions with particular reference to the Woodbridge State School in New Jersey; Gunnar Dybwad describes the need of the programer for the…

Cells in Space

NASA Technical Reports Server (NTRS)

Sibonga, Jean D. (Editor); Mains, Richard C. (Editor); Fast, Thomas N. (Editor); Callahan, Paul X. (Editor); Winget, Charles M. (Editor)

1989-01-01

Discussions and presentations addressed three aspects of cell research in space: the suitability of the cell as a subject in microgravity experiments, the requirements for generic flight hardware to support cell research, and the potential for collaboration between academia, industry, and government to develop these studies in space. Synopses are given for the presentations and follow-on discussions at the conference and papers are presented from which the presentations were based. An Executive Summary outlines the recommendations and conclusions generated at the conference.

FID Statutes, Rules of Procedures, Terms of Reference.

ERIC Educational Resources Information Center

International Federation for Documentation, The Hague (Netherlands).

Following a brief historical chronology of the International Federation for Documentation (FID), the organization's statutes are presented in the original French text and in English. The rules of procedures outline membership policy, conduct of technical bodies, FID conferences, publications, and regional commissions. Terms of reference are…

Adolescent Suicide. January 1986 through June 1988. Current Bibliographies in Medicine.

ERIC Educational Resources Information Center

Martyniuk, Joy S.

This bibliography contains selected references to worldwide publications dealing with suicide or attempted suicide in adolescents. It consists of references to journal articles, books, dissertations, conference papers, letters, and editorials. The citations were extracted through searches of the literature of various disciplines (medicine,…

28 CFR 42.609 - EEOC reasonable cause determination and conciliation efforts.

Code of Federal Regulations, 2011 CFR

2011-07-01

... informal methods of conference, conciliation and persuasion. If EEOC would like the referring agency to participate in conciliation negotiations, EEOC shall so notify the agency and the agency shall participate. EEOC shall provide advance notice of any conciliation negotiations to referring agencies that request...

28 CFR 42.609 - EEOC reasonable cause determination and conciliation efforts.

Code of Federal Regulations, 2010 CFR

2010-07-01

... informal methods of conference, conciliation and persuasion. If EEOC would like the referring agency to participate in conciliation negotiations, EEOC shall so notify the agency and the agency shall participate. EEOC shall provide advance notice of any conciliation negotiations to referring agencies that request...

Space Photovoltaic Research and Technology Conference

NASA Technical Reports Server (NTRS)

1991-01-01

The Eleventh Space Photovoltaic Research and Technology conference was held at NASA Lewis Research Center from May 7 to 9, 1991. The papers and workshop summaries presented here report remarkable progress on a wide variety of approaches in space photovoltaics, both near and far term applications. Papers were presented in a variety of technical areas, including multijunction cell technology, GaAs and InP cells, system studies, cell and array development, and photovoltaics for conversion of laser radiation. Three workshops were held to discuss thin film cell development, III-V cell development, and space environmental effects.

Identification of an "Exceptional Responder" Cell Line to MEK1 Inhibition: Clinical Implications for MEK-Targeted Therapy | Office of Cancer Genomics

Cancer.gov

The identification of somatic genetic alterations that confer sensitivity to pharmacologic inhibitors has led to new cancer therapies. To identify mutations that confer an exceptional dependency, shRNA-based loss-of-function data were analyzed from a dataset of numerous cell lines to reveal genes that are essential in a small subset of cancer cell lines. Once these cell lines were determined, detailed genomic characterization from these cell lines was utilized to ascertain the genomic aberrations that led to this extreme dependency.

Review of Federal Reference Method for Ozone: Nitric Oxide-Chemiluminescence:Supplemental Material for CASAC AMMS

EPA Science Inventory

ApproachPer suggestion made by CASAC AMMS members during the April 3, 2014 conference call on the Review of Federal Reference Method for Ozone: Nitric Oxide-Chemiluminescence, ORD has performed additional data analysis activities to explain and mitigate scatter observed in the co...

Stem Cells and Aging.

PubMed

Koliakos, George

2017-02-01

The article is a presentation at the 4th Conference of ESAAM, which took place on October 30-31, 2015, in Athens, Greece. Its purpose was not to cover all aspects of cellular aging but to share with the audience of the Conference, in a 15-minute presentation, current knowledge about the rejuvenating and repairing somatic stem cells that are distinct from other stem cell types (such as embryonic or induced pluripotent stem cells), emphasize that our body in old age cannot take advantage of these rejuvenating cells, and provide some examples of novel experimental stem cell applications in the field of rejuvenation and antiaging biomedical research.

Proceedings of the 14Th Space Photovoltaic Research and Technology Conference (SPRAT 14)

NASA Technical Reports Server (NTRS)

Landis, Geoffrey (Compiler)

1995-01-01

The Fourteenth Space Photovoltaic Research and Technology conference was held at the NASA Lewis Research Center from October 24-26, 1995. The abstracts presented in this volume report substantial progress in a variety of areas in space photovoltaics. Technical and review papers were presented in many areas, including high efficiency GaAs and InP solar cells, GaAs/Ge cells as commercial items, high efficiency multiple bandgap cells, solar cell and array technology, heteroepitaxial cells, thermophotovoltaic energy conversion, and space radiation effects. Space flight data on a variety of cells were also presented.

An initial examination of the potential role of T-cell immunity in protection against feline immunodeficiency virus (FIV) infection.

PubMed

Aranyos, Alek M; Roff, Shannon R; Pu, Ruiyu; Owen, Jennifer L; Coleman, James K; Yamamoto, Janet K

2016-03-14

The importance of vaccine-induced T-cell immunity in conferring protection with prototype and commercial FIV vaccines is still unclear. Current studies performed adoptive transfer of T cells from prototype FIV-vaccinated cats to partial-to-complete feline leukocyte antigen (FLA)-matched cats a day before either homologous FIVPet or heterologous-subtype pathogenic FIVFC1 challenge. Adoptive-transfer (A-T) conferred a protection rate of 87% (13 of 15, p < 0.001) against FIVPet using the FLA-matched T cells, whereas all 12 control cats were unprotected. Furthermore, A-T conferred protection rate of 50% (6 of 12, p<0.023) against FIVFC1 using FLA-matched T cells, whereas all 8 control cats were unprotected. Transfer of FLA-matched T and B cells demonstrated that T cells are needed to confer A-T protection. In addition, complete FLA-matching and addition of T-cell numbers > 13 × 10(6) cells were required for A-T protection against FIVFC1 strain, reported to be a highly pathogenic virus resistant to vaccine-induced neutralizing-antibodies. The addition of FLA-matched B cells alone was not protective. The poor quality of the anti-FIV T-cell immunity induced by the vaccine likely contributed to the lack of protection in an FLA-matched recipient against FIVFC1. The quality of the immune response was determined by the presence of high mRNA levels of cytolysin (perforin) and cytotoxins (granzymes A, B, and H) and T helper-1 cytokines (interferon-γ [IFNγ] and IL2). Increased cytokine, cytolysin and cytotoxin production was detected in the donors which conferred protection in A-T studies. In addition, the CD4(+) and CD8(+) T-cell proliferation and/or IFNγ responses to FIV p24 and reverse transcriptase increased with each year in cats receiving 1X-3X vaccine boosts over 4 years. These studies demonstrate that anti-FIV T-cell immunity induced by vaccination with a dual-subtype FIV vaccine is essential for prophylactic protection against AIDS lentiviruses such as FIV and potentially HIV-1. Copyright © 2016 Elsevier Ltd. All rights reserved.

An initial examination of the potential role of T-cell immunity in protection against feline immunodeficiency virus (FIV) infection

PubMed Central

Aranyos, Alek M.; Roff, Shannon R.; Pu, Riuyu; Owen, Jennifer L.; Coleman, James K.; Yamamoto, Janet K.

2016-01-01

The importance of vaccine-induced T-cell immunity in conferring protection with prototype and commercial FIV vaccines is still unclear. Current studies performed adoptive transfer of T cells from prototype FIV-vaccinated cats to partial-to-complete feline leukocyte antigen (FLA)-matched cats a day before either homologous FIVPet or heterologous-subtype pathogenic FIVFC1 challenge. Adoptive-transfer (A–T) conferred a protection rate of 87% (13 of 15, p<0.001) against FIVPet using FLA-matched T cells, whereas all 12 control cats were unprotected. Furthermore, A-T conferred protection rate of 50% (6 of 12, p<0.023) against FIVFC1 using FLA-matched T cells, whereas all 8 control cats were unprotected. Transfer of FLA-matched T and B cells demonstrated that T cells are needed to confer A-T protection. In addition, complete FLA-matching and addition of T-cell numbers >13×106 cells were required for A-T protection against FIVFC1 strain, reported to be a highly pathogenic virus resistant to vaccine-induced neutralizing-antibodies. The addition of FLA-matched B cells alone was not protective. The poor quality of the anti-FIV T-cell immunity induced by the vaccine likely contributed to the lack of protection in an FLA-matched recipient against FIVFC1. The quality of the immune response was determined by the presence of high mRNA levels of cytolysin (perforin) and cytotoxins (granzymes A, B, and H) and T helper-1 cytokines (interferon-γ [IFNγ] and IL2). Increased cytokine, cytolysin and cytotoxin production was detected in the donors which conferred protection in A-T studies. In addition, the CD4+ and CD8+ T-cell proliferation and/or IFNγ responses to FIV p24 and reverse transcriptase increased with each year in cats receiving 1X-3X vaccine boosts over 4 years. These studies demonstrate that anti-FIV T-cell immunity induced by vaccination with a dual-subtype FIV vaccine is essential for prophylactic protection against AIDS lentiviruses such as FIV and potentially HIV-1. PMID:26802606

The Seattle Conference: The Role of the State Department of Education in Teacher Education (April 27-29, 1966).

ERIC Educational Resources Information Center

Edelfelt, Roy A.; Allen, Wendell C.

This book includes the papers and speeches which were part of the Seattle Conference in which representatives of 49 states met to reevaluate beliefs and procedures regarding the future role of state departments of education particularly with reference to the identification and setting of goals. There are seven speeches and papers: "The Dynamic Duo…

Summary Proceedings of the Congress of International Physicians for the Prevention of Nuclear War (2nd, Cambridge, England, April, 1982).

ERIC Educational Resources Information Center

International Physicians for the Prevention of Nuclear War, Inc., Boston, MA.

This conference was held to alert physicians worldwide of the mortal peril of nuclear war to public health, with the hope that they will help educate their communities about the effects of nuclear war. Summary papers prepared during the conference include: medical consequences of nuclear war with special reference to Europe--immediate problems for…

Library Services and Construction Act Amendments of 1990. Conference Report (To Accompany H.R. 2742). House of Representatives, 101st Congress, 2nd Session.

ERIC Educational Resources Information Center

Congress of the U.S., Washington, DC.

This conference report on the Library Services and Construction Act Amendments of 1990 includes the text of a substitute amendment agreed to by a committee of House of Representatives and Senate members. Amendments are presented for the following sections of the act: (1) Short Title; References; (2) Definitions; (3) Authorization of…

MOTHER AND INFANT CARE, PRACTICAL NURSE TRAINING PROGRAM, LESSON PLANS, PREPARED BY PRACTICAL NURSING INSTRUCTORS DURING CONFERENCE (UNIVERSITY OF TENNESSEE, AUGUST 14-18, 1961).

ERIC Educational Resources Information Center

Tennessee State Board for Vocational Education, Murfreesboro. Vocational Curriculum Lab.

PRACTICAL NURSE INSTRUCTORS, IN CONFERENCE, COMPILED THIS INDIVIDUALLY PLANNED AND TESTED MATERIAL TO BE USED IN PRACTICAL NURSE EDUCATION. THIRTY-TWO LESSON PLANS ON THE SUBJECT OF MOTHER AND INFANT CARE COVER TOPICS RANGING FROM THE REPRODUCTIVE SYSTEM TO COMPLICATIONS INVOLVING THE NEWBORN. EACH PLAN INCLUDES AIM, REFERENCES, MATERIALS,…

A Bioinformatic Approach to Inter Functional Interactions within Protein Sequences

DTIC Science & Technology

2009-02-23

AFOSR/AOARD Reference Number: USAFAOGA07: FA4869-07-1-4050 AFOSR/AOARD Program Manager : Hiroshi Motoda, Ph.D. Period of...Conference on Knowledge Discovery and Data Mining.) In a separate study we have applied our approaches to the problem of whole genome alignment. We have...SIGKDD Conference on Knowledge Discovery and Data Mining Attached. Interactions: Please list: (a) Participation/presentations at meetings

The Conference Proceedings of the 2003 Air Transport Research Society (ATRS) World Conference, Volume 2

NASA Technical Reports Server (NTRS)

Bowen, Brent (Editor); Gudmundsson, Sveinn (Editor); Oum, Tae (Editor)

2003-01-01

The UNO Aviation Institute Monograph Series began in 1994 as a key component of the education outreach and information transfer missions of the Aviation Institute and the NASA Nebraska Space Grant & EPSCoR Programs. The series is an outlet for aviation materials to be indexed and disseminated through an efficient medium. Publications are welcome in all aspects of aviation. Publication formats may include, but are not limited to, conference proceedings, bibliographies, research reports, manuals, technical reports, and other documents that should be archived and indexed for future reference by the aviation and world wide communities.

Critical appraisal of apparently evidence-based written advertising in Pakistan.

PubMed

Rohra, Dileep Kumar; Bashir, Muhammad Umair; Khwaja, Ummey Aymen; Nazir, Muhammad Ressam

2008-06-01

The objective of the study was to critically assess references cited in support of claims in drug advertisements. Drug advertising brochures were collected from privately practicing General Practitioners from different parts of Karachi. Three blinded reviewers then categorized each reference in the brochure according to the sources viz: journals (both Medline indexed and non-indexed), medical reference books, web addresses, personal communications or testimonials, abstracts presented at symposia/conferences, WHO and National Health Guidelines, 'data on file' and 'others' (which included a diverse set of references). Each reviewer then assessed and analyzed the references further into 2 broad categories: traceable and non-traceable. Traceable references were appraised and, depending upon the claim with which the reference was attached, were classified into justifiable, inaccurate/false, exaggerated and ambiguous. We collected a total of 175 different brochures. Thirty-nine (22.3%) brochures did not cite any references and were not subjected to further analysis. The remaining 136 (77.7%) contained a total of 559 references. 305 (54.6%) of these references were from Medline-indexed journals; 67 (12.0%) were from non-indexed journals; 55 (9.8%) references quoted medical reference books; 27 (4.8%) references cited web addresses; 12 (2.1%) references were personal communications/testimonials; 11 (2.0%) references referred to abstracts presented at symposia/conferences; 12 (2.1%) references were from WHO and National Health Guidelines; 8 (1.4%) references were listed as 'data on file', while the remainder that could not be defined were classified as 'others' (13.1%). Out of a total of 559 references, 249 (44.5%) could not be traced. After critically analyzing the 310 traceable references, 197 (63.5%) were adjudged justifiable, 30 (9.7%) inaccurate/false, 79 (25.5%) exaggerated and 15 (4.8%) ambiguous. Results of this study show for the first time that the claims substantiated with references in the pharmaceutical advertisements in Pakistan are highly unreliable.

Back to our future? The Consensus Conference and Combined-Integrated model of doctoral training in professional psychology.

PubMed

Shealy, Craig N; Cobb, Harriet C; Crowley, Susan L; Nelson, Paul; Peterson, Gary

2004-09-01

Is it possible and advisable for the profession of psychology to articulate and endorse a common, generalist, and integrative framework for the education and training of its students? At the Consensus Conference on Combined and Integrated Doctoral Training in Psychology, held at James Madison University in Harrisonburg, VA (USA), May 2 to 4, 2003, participants from across the spectrum of education and training in professional psychology ultimately answered "yes." This article, the first in this special series on the Consensus Conference and Combined-Integrated (C-I) model of doctoral training in professional psychology, essentially provides an overview of the conference rationale, participants, goals, proceedings, and results. Because the other 12 articles in this series all reference the Consensus Conference and C-I model, this overview provides a good starting point for understanding what occurred at the conference, what it means to educate and train from a C-I perspective, and what the potential implications of such a model might be for the profession of psychology.

Diagnostic tool for red blood cell membrane disorders: Assessment of a new generation ektacytometer.

PubMed

Da Costa, Lydie; Suner, Ludovic; Galimand, Julie; Bonnel, Amandine; Pascreau, Tiffany; Couque, Nathalie; Fenneteau, Odile; Mohandas, Narla

2016-01-01

Inherited red blood cell (RBC) membrane disorders, such as hereditary spherocytosis, elliptocytosis and hereditary ovalocytosis, result from mutations in genes encoding various RBC membrane and skeletal proteins. The RBC membrane, a composite structure composed of a lipid bilayer linked to a spectrin/actin-based membrane skeleton, confers upon the RBC unique features of deformability and mechanical stability. The disease severity is primarily dependent on the extent of membrane surface area loss. RBC membrane disorders can be readily diagnosed by various laboratory approaches that include RBC cytology, flow cytometry, ektacytometry, electrophoresis of RBC membrane proteins and genetics. The reference technique for diagnosis of RBC membrane disorders is the osmotic gradient ektacytometry. However, in spite of its recognition as the reference technique, this technique is rarely used as a routine diagnosis tool for RBC membrane disorders due to its limited availability. This may soon change as a new generation of ektacytometer has been recently engineered. In this review, we describe the workflow of the samples shipped to our Hematology laboratory for RBC membrane disorder analysis and the data obtained for a large cohort of French patients presenting with RBC membrane disorders using a newly available version of the ektacytomer. Copyright © 2015 Elsevier Inc. All rights reserved.

Proceedings of the 12th Space Photovoltaic Research and Technology Conference (SPRAT 12)

NASA Technical Reports Server (NTRS)

1993-01-01

The Twelfth Space Photovoltaic Research and Technology conference was held at the NASA Lewis Research Center from 20 to 22 Oct. 1992. The papers and workshops presented in this volume report substantial progress in a variety of areas in space photovoltaics. Topics covered include: high efficiency GaAs and InP solar cells, GaAs/Ge cells as commercial items, flexible amorphous and thin film solar cells (in the early stages of pilot production), high efficiency multiple bandgap cells, laser power converters, solar cell and array technology, heteroepitaxial cells, betavoltaic energy conversion, and space radiation effects in InP cells. Space flight data on a variety of cells were also presented.

Summary of talks and papers at ISCB-Asia/SCCG 2012

PubMed Central

2013-01-01

The second ISCB-Asia conference of the International Society for Computational Biology took place December 17-19, 2012, in Shenzhen, China. The conference was co-hosted by BGI as the first Shenzhen Conference on Computational Genomics (SCCG). 45 talks were presented at ISCB-Asia/SCCG 2012. The topics covered included software tools, reproducible computing, next-generation sequencing data analysis, transcription and mRNA regulation, protein structure and function, cancer genomics and personalized medicine. Nine of the proceedings track talks are included as full papers in this supplement. In this report we first give a short overview of the conference by listing some statistics and visualizing the talk abstracts as word clouds. Then we group the talks by topic and briefly summarize each one, providing references to related publications whenever possible. Finally, we close with a few comments on the success of this conference.

Combination antibiotic therapy for the treatment of infective endocarditis due to enterococci.

PubMed

Leone, Sebastiano; Noviello, Silvana; Esposito, Silvano

2016-06-01

Enterococci are common causes of infective endocarditis (IE) in both health care and community-based setting. Enterococcal IE requires bactericidal therapy for an optimal outcome. For decades, cell-wall-active antimicrobial agents (penicillins or vancomycin) in combination with aminoglycosides were the cornerstone of the treatment; however, the emergence of antibiotic resistance has significantly reduced the efficacy of these regimens. Data for this review were identified by searches of MEDLINE and references from relevant articles on antibiotic combination regimens for the treatment of enterococcal IE. Abstracts presented in scientific conferences were not searched for. New effective and safe combination treatments, including double-β-lactam and daptomycin/β-lactam combination, are proving useful for the management of IE due to enterococci.

DNA replication stress and cancer chemotherapy.

PubMed

Kitao, Hiroyuki; Iimori, Makoto; Kataoka, Yuki; Wakasa, Takeshi; Tokunaga, Eriko; Saeki, Hiroshi; Oki, Eiji; Maehara, Yoshihiko

2018-02-01

DNA replication is one of the fundamental biological processes in which dysregulation can cause genome instability. This instability is one of the hallmarks of cancer and confers genetic diversity during tumorigenesis. Numerous experimental and clinical studies have indicated that most tumors have experienced and overcome the stresses caused by the perturbation of DNA replication, which is also referred to as DNA replication stress (DRS). When we consider therapeutic approaches for tumors, it is important to exploit the differences in DRS between tumor and normal cells. In this review, we introduce the current understanding of DRS in tumors and discuss the underlying mechanism of cancer therapy from the aspect of DRS. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

Evidence for a primary autoimmune type of diabetes mellitus.

PubMed

Bottazzo, G F; Cudworth, A G; Moul, D J; Doniach, D; Festenstein, H

1978-11-04

Sixty-eight patients with longstanding diabetes and persistent islet-cell antibody and 35 with coexistent diabetes and Graves's disease or primary myxoedema were studied with particular reference to the HLA system and autoantibody patterns. A higher incidence of HLA-B8 than normal was observed in the two groups. An additive relative risk exists when type I diabetes and autoimmune thyroid disease coexist, indicating that different HLA-linked genes may confer susceptibility to the pancreatic and thyroid disorders. Other characteristics, including female predominance, a later onset of diabetes, and a strong family history of autoimmune endocrinopathy, provide further evidence that this form of diabetes is aetiologically distinct from that generally seen in children. These results support the hypothesis of a primary autoimmune type of diabetes mellitus.

Unintegration, Disintegration and Deintegration

ERIC Educational Resources Information Center

Urban, Elizabeth

2006-01-01

This paper is a response to a review of the conference titled, "Unintegration, Disintegration and Integration", written by Cathy Urwin and Maria Rhode in the ACP Bulletin. The review mentioned Michael Fordham, noting that he referred to a "good" kind of unintegration. In this paper, I point out that this is a somewhat misleading reference to what…

The pepper Bs4C proteins are localized to the endoplasmic reticulum (ER) membrane and confer disease resistance to bacterial blight in transgenic rice.

PubMed

Wang, Jun; Zeng, Xuan; Tian, Dongsheng; Yang, Xiaobei; Wang, Lanlan; Yin, Zhongchao

2018-03-30

Transcription activator-like effector (TALE)-dependent dominant disease resistance (R) genes in plants, also referred to as executor R genes, are induced on infection by phytopathogenic bacteria of the genus Xanthomonas harbouring the corresponding TALE genes. Unlike the traditional R proteins, the executor R proteins do not determine the resistance specificity and may function broadly in different plant species. The executor R gene Bs4C-R in the resistant genotype PI 235047 of the pepper species Capsicum pubescens (CpBs4C-R) confers disease resistance to Xanthomonas campestris pv. vesicatoria (Xcv) harbouring the TALE genes avrBsP/avrBs4. In this study, the synthetic genes of CpBs4C-R and two other Bs4C-like genes, the susceptible allele in the genotype PI585270 of C. pubescens (CpBs4C-S) and the CaBs4C-R homologue gene in the cultivar 'CM334' of Capsicum annum (CaBs4C), were characterized in tobacco (Nicotiana benthamiana) and rice (Oryza sativa). The Bs4C genes induced cell death in N. benthamiana. The functional Bs4C-eCFP fusion proteins were localized to the endoplasmic reticulum (ER) membrane in the leaf epidermal cells of N. benthamiana. The Xa10 promoter-Bs4C fusion genes in transgenic rice conferred strain-specific disease resistance to Xanthomonas oryzae pv. oryzae (Xoo), the causal agent of bacterial blight in rice, and were specifically induced by the Xa10-incompatible Xoo strain PXO99 A (pHM1avrXa10). The results indicate that the Bs4C proteins from pepper species function broadly in rice and the Bs4C protein-mediated cell death from the ER is conserved between dicotyledonous and monocotyledonous plants, which can be utilized to engineer novel and enhanced disease resistance in heterologous plants. © 2018 TEMASEK LIFE SCIENCES LABORATORY. MOLECULAR PLANT PATHOLOGY © 2018 JOHN WILEY & SONS LTD.

Expression of vascular endothelial growth factor does not promote transformation but confers a growth advantage in vivo to Chinese hamster ovary cells.

PubMed Central

Ferrara, N; Winer, J; Burton, T; Rowland, A; Siegel, M; Phillips, H S; Terrell, T; Keller, G A; Levinson, A D

1993-01-01

Vascular endothelial growth factor (VEGF) is a mitogen with a specificity for endothelial cells in vitro and an angiogenic inducer in vivo. We tested the hypothesis that VEGF may confer on expressing cells a growth advantage in vivo. Dihydrofolatereductase--Chinese hamster ovary cells were transfected with expression vectors which direct the constitutive synthesis of VEGF. Neither the expression nor the exogenous administration of VEGF stimulated anchorage-dependent or anchorage-independent growth of Chinese hamster ovary cells in vitro. However, VEGF-expressing clones, unlike control cells, demonstrated an ability to proliferate in nude mice. Histologic examination revealed that the proliferative lesions were compact, well vascularized, and nonedematous. Ultrastructural analysis revealed that capillaries within the lesions were of the continuous type. These findings indicate that the expression of VEGF may confer on cells the ability to grow in vivo in the absence of transformation by purely paracrine mechanisms. Since VEGF is a widely distributed protein, this property may have relevance for a variety of physiological and pathological proliferative processes. Images PMID:8423215

Crizotinib-Resistant Mutants of EML4-ALK Identified Through an Accelerated Mutagenesis Screen

PubMed Central

Zhang, Sen; Wang, Frank; Keats, Jeffrey; Zhu, Xiaotian; Ning, Yaoyu; Wardwell, Scott D; Moran, Lauren; Mohemmad, Qurish K; Anjum, Rana; Wang, Yihan; Narasimhan, Narayana I; Dalgarno, David; Shakespeare, William C; Miret, Juan J; Clackson, Tim; Rivera, Victor M

2011-01-01

Activating gene rearrangements of anaplastic lymphoma kinase (ALK) have been identified as driver mutations in non-small-cell lung cancer, inflammatory myofibroblastic tumors, and other cancers. Crizotinib, a dual MET/ALK inhibitor, has demonstrated promising clinical activity in patients with non-small-cell lung cancer and inflammatory myofibroblastic tumors harboring ALK translocations. Inhibitors of driver kinases often elicit kinase domain mutations that confer resistance, and such mutations have been successfully predicted using in vitro mutagenesis screens. Here, this approach was used to discover an extensive set of ALK mutations that can confer resistance to crizotinib. Mutations at 16 residues were identified, structurally clustered into five regions around the kinase active site, which conferred varying degrees of resistance. The screen successfully predicted the L1196M, C1156Y, and F1174L mutations, recently identified in crizotinib-resistant patients. In separate studies, we demonstrated that crizotinib has relatively modest potency in ALK-positive non-small-cell lung cancer cell lines. A more potent ALK inhibitor, TAE684, maintained substantial activity against mutations that conferred resistance to crizotinib. Our study identifies multiple novel mutations in ALK that may confer clinical resistance to crizotinib, suggests that crizotinib's narrow selectivity window may underlie its susceptibility to such resistance and demonstrates that a more potent ALK inhibitor may be effective at overcoming resistance. PMID:22034911

A Perspective on Knowing about Global Warming and a Critical Comment about Schools and Curriculum in Relation to Socio-Scientific Issues

ERIC Educational Resources Information Center

Levinson, Ralph

2012-01-01

The focus of this response to Virginie Albe and Marie-Jose Gombert's (2011) article on a research study of students' school science conference on global warming is to develop some thoughts on covert assumptions which underpin any such conference. My comments refer to the politics behind the production of scientific knowledge of climate change and…

Predictive Computations of Properties of Wide-Gap and Nano-Semiconductors

DTIC Science & Technology

2007-01-01

for reducing this burden to Washington Headquarters Services , Directorate for Information Operations and Reports, 1215 Jefferson Davis Highway, Suite...and two (2) international conferences. The utter significance of our findings resides in the fact that they have confirmed our resolution of a long...technical presentations, three of which were at international conferences. To reduce redundancy, we refer the reader to the following full listing of the

Application of Droplet Digital PCR for Estimating Vector Copy Number States in Stem Cell Gene Therapy.

PubMed

Lin, Huan-Ting; Okumura, Takashi; Yatsuda, Yukinori; Ito, Satoru; Nakauchi, Hiromitsu; Otsu, Makoto

2016-10-01

Stable gene transfer into target cell populations via integrating viral vectors is widely used in stem cell gene therapy (SCGT). Accurate vector copy number (VCN) estimation has become increasingly important. However, existing methods of estimation such as real-time quantitative PCR are more restricted in practicality, especially during clinical trials, given the limited availability of sample materials from patients. This study demonstrates the application of an emerging technology called droplet digital PCR (ddPCR) in estimating VCN states in the context of SCGT. Induced pluripotent stem cells (iPSCs) derived from a patient with X-linked chronic granulomatous disease were used as clonable target cells for transduction with alpharetroviral vectors harboring codon-optimized CYBB cDNA. Precise primer-probe design followed by multiplex analysis conferred assay specificity. Accurate estimation of per-cell VCN values was possible without reliance on a reference standard curve. Sensitivity was high and the dynamic range of detection was wide. Assay reliability was validated by observation of consistent, reproducible, and distinct VCN clustering patterns for clones of transduced iPSCs with varying numbers of transgene copies. Taken together, use of ddPCR appears to offer a practical and robust approach to VCN estimation with a wide range of clinical and research applications.

Application of Droplet Digital PCR for Estimating Vector Copy Number States in Stem Cell Gene Therapy

PubMed Central

Lin, Huan-Ting; Okumura, Takashi; Yatsuda, Yukinori; Ito, Satoru; Nakauchi, Hiromitsu; Otsu, Makoto

2016-01-01

Stable gene transfer into target cell populations via integrating viral vectors is widely used in stem cell gene therapy (SCGT). Accurate vector copy number (VCN) estimation has become increasingly important. However, existing methods of estimation such as real-time quantitative PCR are more restricted in practicality, especially during clinical trials, given the limited availability of sample materials from patients. This study demonstrates the application of an emerging technology called droplet digital PCR (ddPCR) in estimating VCN states in the context of SCGT. Induced pluripotent stem cells (iPSCs) derived from a patient with X-linked chronic granulomatous disease were used as clonable target cells for transduction with alpharetroviral vectors harboring codon-optimized CYBB cDNA. Precise primer–probe design followed by multiplex analysis conferred assay specificity. Accurate estimation of per-cell VCN values was possible without reliance on a reference standard curve. Sensitivity was high and the dynamic range of detection was wide. Assay reliability was validated by observation of consistent, reproducible, and distinct VCN clustering patterns for clones of transduced iPSCs with varying numbers of transgene copies. Taken together, use of ddPCR appears to offer a practical and robust approach to VCN estimation with a wide range of clinical and research applications. PMID:27763786

PREFACE: 17th Pan-American Synchrotron Radiation Instrumentation Conference SRI2013

NASA Astrophysics Data System (ADS)

Williams, Gwyn P.; Revesz, Peter; Arp, Uwe

2014-03-01

These proceedings are a collection of the articles presented at the seventeenth Pan-American Synchrotron Radiation Instrumentation Conference SRI2013, held on the campus of the National Institute of Standards and Technology (NIST), located in Gaithersburg, Maryland, United States of America, 19-21 June, 2013. SRI2013 was jointly hosted by the Cornell University Cornell High Energy Synchrotron Source (CHESS), the Thomas Jefferson National Accelerator Facility (Jefferson Lab), and the Synchrotron Ultraviolet Radiation Facility (SURF III) at NIST. This meeting's focus was clearly on instrumentation, thus fulfilling the intent of this SRI meeting series, which was initiated at NIST, then the National Bureau of Standards (NBS), in 1979. SRI2013 hosted more than 150 delegates, despite the new US governmental travel restrictions. This proceedings series aims to be an essential reference work for practitioners in the field. It primarily documents the evolution and development of techniques, but also recent scientific advances, that were presented during the two and a half days of the conference. We are extremely thankful to all the authors who contributed to making these proceedings a volume of reference as well as to the reviewers for their careful reading and constructive recommendations for improving the articles. Great thanks go to Robert Dragoset at NIST, for creating and maintaining the conference website and generating the conference logo. We are also thankful for the excellent support we received from the Conference Program at NIST, especially Kathy Kilmer and Angela Ellis. And we would like to dedicate these proceedings to the memory of Kathy Kilmer, who passed away on 15 October, 2013. NIST will not be the same without her. The Co-Editors: Uwe Arp (SURF/NIST) Peter Reversz (CHESS) Gwyn P Williams (Jefferson Lab)

Naturally Occurring Mutations in the MPS1 Gene Predispose Cells to Kinase Inhibitor Drug Resistance.

PubMed

Gurden, Mark D; Westwood, Isaac M; Faisal, Amir; Naud, Sébastien; Cheung, Kwai-Ming J; McAndrew, Craig; Wood, Amy; Schmitt, Jessica; Boxall, Kathy; Mak, Grace; Workman, Paul; Burke, Rosemary; Hoelder, Swen; Blagg, Julian; Van Montfort, Rob L M; Linardopoulos, Spiros

2015-08-15

Acquired resistance to therapy is perhaps the greatest challenge to effective clinical management of cancer. With several inhibitors of the mitotic checkpoint kinase MPS1 in preclinical development, we sought to investigate how resistance against these inhibitors may arise so that mitigation or bypass strategies could be addressed as early as possible. Toward this end, we modeled acquired resistance to the MPS1 inhibitors AZ3146, NMS-P715, and CCT251455, identifying five point mutations in the kinase domain of MPS1 that confer resistance against multiple inhibitors. Structural studies showed how the MPS1 mutants conferred resistance by causing steric hindrance to inhibitor binding. Notably, we show that these mutations occur in nontreated cancer cell lines and primary tumor specimens, and that they also preexist in normal lymphoblast and breast tissues. In a parallel piece of work, we also show that the EGFR p.T790M mutation, the most common mutation conferring resistance to the EGFR inhibitor gefitinib, also preexists in cancer cells and normal tissue. Our results therefore suggest that mutations conferring resistance to targeted therapy occur naturally in normal and malignant cells and these mutations do not arise as a result of the increased mutagenic plasticity of cancer cells. ©2015 American Association for Cancer Research.

Bifunctional NaYF4:Er3+/Yb3+ submicron rods, implemented in quantum dot sensitized solar cell(Conference Presentation)

NASA Astrophysics Data System (ADS)

Guerrero, J. Pablo; Cerdán Pasarán, Andrea; López-Luke, Tzarara; Ramachari, D.; Esparza, Diego; De la Rosa Cruz, Elder; Romero Arellano, Victor Hugo

2016-09-01

In this work are presented the results obtained with solar cells sensitized with quantum dots of cadmium sulphide (CdS) incorporating luminescent materials (NaYF4:Yb/Er). The study revealed that through using a bifunctional layer of NaYF4:Yb/Er submicron rods, the infrared radiation is absorbed in 980nm to generate luminescence in the visible region to 530nm, under the UP-conversion process, in the same way simultaneously, NaYF4:Yb/Er layer causes scattering toward the quantum dots, the emission and scattering generated by this material is reabsorbed by the QD-CdS, and these in turn are absorbing in its range of solar radiation absorption, Thus generates an increase in the electron injection into the semiconductor of TiO2. The results of a cell incorporating NaYF4: Yb/Er at 0.07M shown photoconversion efficiencies of 3.39% improving efficiency with respect to the reference solar cell without using NaYF4: Yb/Er of 1.99%. The obtained values of current and voltage showed a strong dependence of the percentage of NaYF4 Yb/Er, and the mechanism of incorporation of this material.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Preston, R.J.

The traveler attended the 1st International Conference on Biological Dosimetry in Madrid, Spain. This conference was organized to provide information to a general audience of biologists, physicists, radiotherapists, industrial hygiene personnel and individuals from related fields on the current ability of cytogenetic analysis to provide estimates of radiation dose in cases of occupational or environmental exposure. There is a growing interest in Spain in biological dosimetry because of the increased use of radiation sources for medical and occupational uses, and with this the anticipated and actual increase in numbers of overexposure. The traveler delivered the introductory lecture on Biological Dosimetry:more » Mechanistic Concepts'' that was intended to provide a framework by which the more applied lectures could be interpreted in a mechanistic way. A second component of the trip was to provide advice with regard to several recent cases of overexposure that had been or were being assessed by the Radiopathology and Radiotherapy Department of the Hospital General Gregorio Maranon'' in Madrid. The traveler had provided information on several of these, and had analyzed cells from some exposed or purportedly exposed individuals. The members of the biological dosimetry group were referred to individuals at REACTS at Oak Ridge Associated Universities for advice on follow-up treatment.« less

Bcl-xL mediates therapeutic resistance of a mesenchymal breast cancer cell subpopulation

PubMed Central

Keitel, Ulrike; Scheel, Andreas; Thomale, Jürgen; Halpape, Rovena; Kaulfuß, Silke; Scheel, Christina; Dobbelstein, Matthias

2014-01-01

The transition from an epithelial to a mesenchymal phenotype (EMT) confers increased invasiveness and clonogenic potential to tumor cells. We used a breast epithelium-derived cell culture model to evaluate the impact of EMT on the cellular sensitivity towards chemotherapeutics and apoptotic stimuli. Cells that had passed through an EMT acquired resistance towards chemotherapeutics and death ligands. Mechanistically, we found that the levels of the apoptosis inhibitor Bcl-xL were strongly enhanced in mesenchymal versus epithelial cells, whereas the pro-apoptotic proteins Bim and Puma were diminished. Clinical samples from breast cancer showed enhanced Bcl-xL staining in cells that had dispersed into the desmoplastic stroma, as compared to cells that were part of large tumor cell aggregates, suggesting increased Bcl-xL expression when cells invade the stroma. Bcl-xL was necessary for apoptotic resistance in mesenchymal cells, and its expression was sufficient to confer such resistance to epithelial cells. To antagonize Bcl-xL, BH3-mimetics were used. They successfully interfered with the proliferation and survival of mesenchymal cells, and also inhibited the growth of xenograft tumors raised from the mesenchymal subpopulation. We conclude that enhanced Bcl-xL levels confer resistance to cells upon EMT, and that Bcl-xL represents a promising target for therapy directed against invasive cancer cells. PMID:25473892

Preliminary Reports, Memoranda and Technical Notes of the Materials Research Council Summer Conference, La Jolla, California

DTIC Science & Technology

1983-07-01

Multilayer Thin Film materials M. S. Wrighton ...................................... 26 •.. Line Defects in Langmuir - Blodgett Films J. P. Hirth...of Langmuir and Blodgett can be used to prepare monolayers and multilayers of organic materials on a o, variety of substrates. The films of organic...references therein. * 2. Cf. Thin Solid Films, 99, (1982) from the proceedings of the "* . International Conference on Langmuir - Blodgett Films held

Summary Impacts of Modeled Provisions of the 2003 Conference Energy Bill

EIA Publications

2004-01-01

This service report was undertaken at the February 2, 2004, request of Senator John Sununu to perform an assessment of the Conference Energy Bill of 2003. This report summarizes the CEB provisions that can be analyzed using the National Energy Modeling System (NEMS) and have the potential to affect energy consumption, supply, and prices. The impacts are estimated by comparing the projections with the CEB provisions to the AEO2004 Reference Case.

Towards understanding thysanoptera

Treesearch

Bruce L. Parker; Margaret Skinner; eds.

1991-01-01

Thirty-one papers and three posters on the systematics, biology, behavior and management of Thysanoptera, with particular reference to Taeniothrips inconsequens (Uzel), pear thrips, presented at an international conference in Burlington, Vermont.

FLT3-ITD induces expression of Pim kinases through STAT5 to confer resistance to the PI3K/Akt pathway inhibitors on leukemic cells by enhancing the mTORC1/Mcl-1 pathway.

PubMed

Okada, Keigo; Nogami, Ayako; Ishida, Shinya; Akiyama, Hiroki; Chen, Cheng; Umezawa, Yoshihiro; Miura, Osamu

2018-02-06

FLT3-ITD is the most frequent tyrosine kinase mutation in acute myeloid leukemia (AML) associated with poor prognosis. We previously reported that activation of STAT5 confers resistance to PI3K/Akt inhibitors on the FLT3-ITD-positive AML cell line MV4-11 and 32D cells driven by FLT3-ITD (32D/ITD) but not by FLT3 mutated in the tyrosine kinase domain (32D/TKD). Here, we report the involvement of Pim kinases expressed through STAT5 activation in acquisition of this resistance. The specific pan-Pim kinase inhibitor AZD1208 as well as PIM447 in combination with the PI3K inhibitor GDC-0941 or the Akt inhibitor MK-2206 cooperatively downregulated the mTORC1/4EBP1 pathway, formation of the eIF4E/eIF4G complex, and Mcl-1 expression leading to activation of Bak and Bax to induce caspase-dependent apoptosis synergistically in these cells. These cooperative effects were enhanced or inhibited by knock down of mTOR or expression of its activated mutant, respectively. Overexpression of Mcl-1 conferred the resistance on 32D/ITD cells to combined inhibition of the PI3K/Akt pathway and Pim kinases, while the Mcl-1-specific BH3 mimetic A-1210477 conquered the resistance of MV4-11 cells to GDC-0941. Furthermore, overexpression of Pim-1 in 32D/TKD enhanced the mTORC1/Mcl-1 pathway and partially protected it from the PI3K/Akt inhibitors or the FLT3 inhibitor gilteritinib to confer the resistance to PI3K/Akt inhibitors. Finally, AZD1208 and GDC-0941 cooperatively inhibited the mTORC1/Mcl-1 pathway and reduced viable cell numbers of primary AML cells from some FLT3-ITD positive cases. Thus, Pim kinases may protect the mTORC1/4EBP1/Mcl-1 pathway to confer the resistance to the PI3K/Akt inhibitors on FLT3-ITD cells and represent promising therapeutic targets.

75 FR 8999 - Agency Information Collection Activities: Comment Request

Federal Register 2010, 2011, 2012, 2013, 2014

2010-02-26

.... Methodological findings may be presented externally in technical papers at conferences, published in the... represent several methodological improvement projects. \\2\\ This number refers to the science, engineering...

Two members of the mouse mdr gene family confer multidrug resistance with overlapping but distinct drug specificities.

PubMed Central

Devault, A; Gros, P

1990-01-01

We report the cloning and functional analysis of a complete clone for the third member of the mouse mdr gene family, mdr3. Nucleotide and predicted amino acid sequence analyses showed that the three mouse mdr genes encode highly homologous membrane glycoproteins, which share the same length (1,276 residues), the same predicted functional domains, and overall structural arrangement. Regions of divergence among the three proteins are concentrated in discrete segments of the predicted polypeptides. Sequence comparison indicated that the three mouse mdr genes were created from a common ancestor by two independent gene duplication events, the most recent one producing mdr1 and mdr3. When transfected and overexpressed in otherwise drug-sensitive cells, the mdr3 gene, like mdr1 and unlike mdr2, conferred multidrug resistance to these cells. In independently derived transfected cell clones expressing similar amounts of either MDR1 or MDR3 protein, the drug resistance profile conferred by mdr3 was distinct from that conferred by mdr1. Cells transfected with and expressing MDR1 showed a marked 7- to 10-fold preferential resistance to colchicine and Adriamycin compared with cells expressing equivalent amounts of MDR3. Conversely, cells transfected with and expressing MDR3 showed a two- to threefold preferential resistance to actinomycin D over their cellular counterpart expressing MDR1. These results suggest that MDR1 and MDR3 are membrane-associated efflux pumps which, in multidrug-resistant cells and perhaps normal tissues, have overlapping but distinct substrate specificities. Images PMID:1969610

Fourth NASA Goddard Conference on Mass Storage Systems and Technologies

NASA Technical Reports Server (NTRS)

Kobler, Benjamin (Editor); Hariharan, P. C. (Editor)

1994-01-01

This report contains copies of all those technical papers received in time for publication just prior to the Fourth Goddard Conference on Mass Storage and Technologies, held March 28-30, 1995, at the University of Maryland, University College Conference Center, in College Park, Maryland. This series of conferences continues to serve as a unique medium for the exchange of information on topics relating to the ingestion and management of substantial amounts of data and the attendant problems involved. This year's discussion topics include new storage technology, stability of recorded media, performance studies, storage system solutions, the National Information infrastructure (Infobahn), the future for storage technology, and lessons learned from various projects. There also will be an update on the IEEE Mass Storage System Reference Model Version 5, on which the final vote was taken in July 1994.

NACA: University Conference on Aerodynamics. A Compilation of the Papers Presented

NASA Technical Reports Server (NTRS)

1948-01-01

This document contains reproductions of the technical papers presented at the NACA - University Conference on Aerodynamics held at the Langley Aeronautical Laboratory on June 21, 22, and 23, 1948. The conference was held in recognition of the difficulties, imposed by security restrictions, in keeping abreast of the rapid advances in aerodynamics. The papers were prepared to review the status of a number of fields of interest, to summarize the more important wartime advances that are no longer classified, and to orient reference material for further study. The papers in this document are in the same form in which they were presented at the conference so that distribution of them might be prompt. The original presentation and this record are considered as complementary to, rather than as substitutes for, the Committee?s system of complete and formal reports.

IEEE Photovoltaic Specialists Conference, 20th, Las Vegas, NV, Sept. 26-30, 1988, Conference Record. Volumes 1 & 2

NASA Astrophysics Data System (ADS)

Various papers on photovoltaics are presented. The general topics considered include: amorphous materials and cells; amorphous silicon-based solar cells and modules; amorphous silicon-based materials and processes; amorphous materials characterization; amorphous silicon; high-efficiency single crystal solar cells; multijunction and heterojunction cells; high-efficiency III-V cells; modeling and characterization of high-efficiency cells; LIPS flight experience; space mission requirements and technology; advanced space solar cell technology; space environmental effects and modeling; space solar cell and array technology; terrestrial systems and array technology; terrestrial utility and stand-alone applications and testing; terrestrial concentrator and storage technology; terrestrial stand-alone systems applications; terrestrial systems test and evaluation; terrestrial flatplate and concentrator technology; use of polycrystalline materials; polycrystalline II-VI compound solar cells; analysis of and fabrication procedures for compound solar cells.

Proceedings of the 12th Space Photovoltaic Research and Technology Conference (SPRAT 12)

DOE Office of Scientific and Technical Information (OSTI.GOV)

NONE

1993-05-01

The Twelfth Space Photovoltaic Research and Technology conference was held at the NASA Lewis Research Center from 20 to 22 Oct. 1992. The papers and workshops presented in this volume report substantial progress in a variety of areas in space photovoltaics. Topics covered include: high efficiency GaAs and InP solar cells, GaAs/Ge cells as commercial items, flexible amorphous and thin film solar cells (in the early stages of pilot production), high efficiency multiple bandgap cells, laser power converters, solar cell and array technology, heteroepitaxial cells, betavoltaic energy conversion, and space radiation effects in InP cells. Space flight data on amore » variety of cells were also presented. Separate abstracts have been prepared for articles from this report.« less

Walking a Tightrope: The Balancing Act of Learning Advising. Refereed Proceedings of the 2007 Annual International Conference of the Association of Tertiary Learning Advisors of Aotearoa New Zealand. Volume 3

ERIC Educational Resources Information Center

Manalo, Emmanuel, Ed.; Bartlett-Trafford, Julie, Ed.; Crozier, Susan, Ed.

2008-01-01

This volume comprises the refereed proceedings of the 2007 ATLAANZ (Association of Tertiary Learning Advisors of Aotearoa/New Zealand) conference. The first three chapters set the scene well for the breadth and depth of issues addressed by the authors. In Chapter 1, Andy Begg refers to his own educational journey in discussing the inseparability…

Diagnostics and Dynamics of the Solar Chromosphere

NASA Astrophysics Data System (ADS)

Kneer, F.; von Uexküll, M.

Research of the chromosphere of the Sun is exciting, as it has been over more than a century. The present contribution can only give glimpses into the wealth of chromospheric structures and dynamics. Likewise, in view of the limited space, it is not possible to present in due balance the published work on the solar chromosphere. The reader is referred to the monographs by Bray and Loughhead (1974, with a historical account and many references to early work) and by Athay (1976) for the state of knowledge two decades ago. Among the conferences dealing meanwhile with the chromosphere we mention the proceedings edited by Bonnet and Delache (1976) and by Ulmschneider et al. (1991). Withbroe and Noyes (1977) treated the mass and energy flow in the chromosphere and corona; a throughout account of the Ca II K2v cell grains is given by Rutten and Uitenbroek (1991); the review by Narain and Ulmschneider (1996) deals with chromospheric and coronal heating mechanisms. Last but not least, the book ``Le Soleil'' by Secchi (1877) is historically precious and full of still viable ideas.

Treatment Option Overview (Small Cell Lung Cancer)

MedlinePlus

... Events Scientific Meetings & Lectures Conferences Advisory Board Meetings Social Media Events Cancer Currents Blog All Press Releases 2018 ... Events Scientific Meetings & Lectures Conferences Advisory Board Meetings Social Media Cancer Currents Blog About NCI NCI Overview History ...

The shed ectodomain of Nr-CAM stimulates cell proliferation and motility, and confers cell transformation.

PubMed

Conacci-Sorrell, Maralice; Kaplan, Anna; Raveh, Shani; Gavert, Nancy; Sakurai, Takeshi; Ben-Ze'ev, Avri

2005-12-15

Nr-CAM, a cell-cell adhesion molecule of the immunoglobulin-like cell adhesion molecule family, known for its function in neuronal outgrowth and guidance, was recently identified as a target gene of beta-catenin signaling in human melanoma and colon carcinoma cells and tissue. Retrovirally mediated transduction of Nr-CAM into fibroblasts induces cell motility and tumorigenesis. We investigated the mechanisms by which Nr-CAM can confer properties related to tumor cell behavior and found that Nr-CAM expression in NIH3T3 cells protects cells from apoptosis in the absence of serum by constitutively activating the extracellular signal-regulated kinase and AKT signaling pathways. We detected a metalloprotease-mediated shedding of Nr-CAM into the culture medium of cells transfected with Nr-CAM, and of endogenous Nr-CAM in B16 melanoma cells. Conditioned medium and purified Nr-CAM-Fc fusion protein both enhanced cell motility, proliferation, and extracellular signal-regulated kinase and AKT activation. Moreover, Nr-CAM was found in complex with alpha4beta1 integrins in melanoma cells, indicating that it can mediate, in addition to homophilic cell-cell adhesion, heterophilic adhesion with extracellular matrix receptors. Suppression of Nr-CAM levels by small interfering RNA in B16 melanoma inhibited the adhesive and tumorigenic capacities of these cells. Stable expression of the Nr-CAM ectodomain in NIH3T3 cells conferred cell transformation and tumorigenesis in mice, suggesting that the metalloprotease-mediated shedding of Nr-CAM is a principal route for promoting oncogenesis by Nr-CAM.

FASEB summer research conference on signal transduction in plants. Final report, June 16, 1996--June 21, 1996

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lomax, T.L.; Quatrano, R.S.

1996-12-31

This is the program from the second FASEB conference on Signal Transduction in Plants. Topic areas included the following: environmental signaling; perception and transduction of light signals; signaling in plant microbe interactions; signaling in plant pathogen interactions; cell, cell communication; cytoskeleton, plasma membrane, and cellwall continuum; signaling molecules in plant growth and development I and II. A list of participants is included.

PREFACE: 20th International Conference on Computing in High Energy and Nuclear Physics (CHEP2013)

NASA Astrophysics Data System (ADS)

Groep, D. L.; Bonacorsi, D.

2014-06-01

In this age and time, capturing 'state of the art' of computing in a conference proceedings gets to be increasingly hard. It is quite common too for the submitted abstracts to refer to studies yet to be done - and the time span between abstract submission and the actual conference is often less than six months. By the time the proceedings appear in journal form, a similar period after its closing session, some of the work is over a year old, by which time new ideas will have been formed and the deployment of current ones progressed - at times beyond recognition. The preface is continued in the pdf.

2009 Epigenetics Gordon Research Conference (August 9 - 14, 2009)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jeanie Lee

Epigenetics refers to the study of heritable changes in genome function that occur without a change in primary DNA sequence. The 2009 Gordon Conference in Epigenetics will feature discussion of various epigenetic phenomena, emerging understanding of their underlying mechanisms, and the growing appreciation that human, animal, and plant health all depend on proper epigenetic control. Special emphasis will be placed on genome-environment interactions particularly as they relate to human disease. Towards improving knowledge of molecular mechanisms, the conference will feature international leaders studying the roles of higher order chromatin structure, noncoding RNA, repeat elements, nuclear organization, and morphogenic evolution. Traditionalmore » and new model organisms are selected from plants, fungi, and metazoans.« less

MTAP deletion confers enhanced dependency on the PRMT5 arginine methyltransferase in cancer cells | Office of Cancer Genomics

Cancer.gov

The discovery of cancer dependencies has the potential to inform therapeutic strategies and to identify putative drug targets. Integrating data from comprehensive genomic profiling of cancer cell lines and from functional characterization of cancer cell dependencies, we discovered that loss of the enzyme methylthioadenosine phosphorylase (MTAP) confers a selective dependence on protein arginine methyltransferase 5 (PRMT5) and its binding partner WDR77. MTAP is frequently lost due to its proximity to the commonly deleted tumor suppressor gene, CDKN2A.

Treatment of a Solid Tumor Using Engineered Drug-Resistant Immunocompetent Cells and Cytotoxic Chemotherapy

PubMed Central

Dasgupta, Anindya; Shields, Jordan E.

2012-01-01

Abstract Multimodal therapy approaches, such as combining chemotherapy agents with cellular immunotherapy, suffers from potential drug-mediated toxicity to immune effector cells. Overcoming such toxic effects of anticancer cellular products is a potential critical barrier to the development of combined therapeutic approaches. We are evaluating an anticancer strategy that focuses on overcoming such a barrier by genetically engineering drug-resistant variants of immunocompetent cells, thereby allowing for the coadministration of cellular therapy with cytotoxic chemotherapy, a method we refer to as drug-resistant immunotherapy (DRI). The strategy relies on the use of cDNA sequences that confer drug resistance and recombinant lentiviral vectors to transfer nucleic acid sequences into immunocompetent cells. In the present study, we evaluated a DRI-based strategy that incorporates the immunocompetent cell line NK-92, which has intrinsic antitumor properties, genetically engineered to be resistant to both temozolomide and trimetrexate. These immune effector cells efficiently lysed neuroblastoma cell lines, which we show are also sensitive to both chemotherapy agents. The antitumor efficacy of the DRI strategy was demonstrated in vivo, whereby neuroblastoma-bearing NOD/SCID/γ-chain knockout (NSG) mice treated with dual drug-resistant NK-92 cell therapy followed by dual cytotoxic chemotherapy showed tumor regression and significantly enhanced survival compared with animals receiving either nonengineered cell-based therapy and chemotherapy, immunotherapy alone, or chemotherapy alone. These data show there is a benefit to using drug-resistant cellular therapy when combined with cytotoxic chemotherapy approaches. PMID:22397715

Occludin confers adhesiveness when expressed in fibroblasts.

PubMed

Van Itallie, C M; Anderson, J M

1997-05-01

Occludin is an integral membrane protein specifically associated with tight junctions. Previous studies suggest it is likely to function in forming the intercellular seal. In the present study, we expressed occludin under an inducible promotor in occludin-null fibroblasts to determine whether this protein confers intercellular adhesion. When human occludin is stably expressed in NRK and Rat-1 fibroblasts, which lack endogenous occludin and tight junctions but do have well developed ZO-1-containing adherens-like junctions, occludin colocalizes with ZO-1 to points of cell-cell contact. In contrast, L-cell fibroblasts which lack cadherin-based adherens junctions, target neither ZO-1 nor occludin to sites of cell contact. Occludin-induced adhesion was next quantified using a suspended cell assay. In NRK and Rat-1 cells, occludin expression induces adhesion in the absence of calcium, thus independent of cadherin-cadherin contacts. In contrast, L-cells are nonadhesive in this assay and show no increase in adhesion after induction of occludin expression. Binding of an antibody to the first of the putative extracellular loops of occludin confirmed that this sequence was exposed on the cell surface, and synthetic peptides containing the amino acid sequence of this loop inhibit adhesion induced by occludin expression. These results suggest that the extracellular surface of occludin is directly involved in cell-cell adhesion and the ability to confer adhesiveness correlates with the ability to colocalize with its cytoplasmic binding protein, ZO-1.

Potential Mapping of an Indium-Tin-Oxide Glass Box in a GEC Reference Cell

NASA Astrophysics Data System (ADS)

Kaplan, Rebecca; Carmona-Reyes, Jorge; Hyde, Truell; Matthews, Lorin; Casper Program Team

The use of indium-tin-oxide (ITO) coated boxes, as well as boxes coated with other substances, placed on or floating above the lower electrode in studies using Gaseous Electronics Conference Radio Frequency Reference Cells have increased in interest, as have the use of plain glass boxes. This increase in interest is due to the greater ability to control the confinement forces and in effect create dust chain structures which aid in studies within other areas of physics such as; entropy, kinetic dust temperature, plasma balls and coulomb explosions. Further analysis of the data obtained using these boxes shows what appear to be at least two different regions of confinement inside the boxes as well as some unexpected phenomena related to anomalous values and behavior of the electric field. These areas affect the dust to dust and dust to plasma interactions independently in the separate regions and are therefore of great interest. In this study electric potential and electric field maps created in MatLab with data obtained using two probes mounted on CASPER's S-100 nano-manipulator will be presented, connecting the information obtained from these maps to the behavior of the dust observed for different experimental conditions. All of this has been made possible by the opportunity and funding from the CASPER program and the National Science Foundation Grant Number PHY-1262031.

Pancreatic adenocarcinoma upregulated factor (PAUF) confers resistance to pancreatic cancer cells against oncolytic parvovirus H-1 infection through IFNA receptor-mediated signaling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaowinn, Sirichat; Cho, Il-Rae; Moon, Jeong

2015-04-03

Pancreatic adenocarcinoma upregulated factor (PAUF), a novel oncogene, plays a crucial role in the development of pancreatic cancer, including its metastasis and proliferation. Therefore, PAUF-expressing pancreatic cancer cells could be important targets for oncolytic virus-mediated treatment. Panc-1 cells expressing PAUF (Panc-PAUF) showed relative resistance to parvovirus H-1 infection compared with Panc-1 cells expressing an empty vector (Panc-Vec). Of interest, expression of type I IFN-α receptor (IFNAR) was higher in Panc-PAUF cells than in Panc-Vec cells. Increased expression of IFNAR in turn increased the activation of Stat1 and Tyk2 in Panc-PAUF cells compared with that in Panc-Vec cells. Suppression of Tyk2more » and Stat1, which are important downstream molecules for IFN-α signaling, sensitized pancreatic cancer cells to parvovirus H-1-mediated apoptosis. Further, constitutive suppression of PAUF sensitized Bxpc3 pancreatic cancer cells to parvovirus H-1 infection. Taken together, these results suggested that PAUF conferred resistance to pancreatic cancer cells against oncolytic parvovirus H-1 infection through IFNAR-mediated signaling. - Highlights: • PAUF confers resistance against oncolytic parvovirus H-1 infection. • PAUF enhances the expression of IFNAR in Panc-1 cells. • Increased activation of Tyk2 or Stat1 by PAUF provides resistance to parvovirus H-1-mediated apoptosis. • Constitutive inhibition of PAUF enhances parvovirus H-1-mediated oncolysis of Bxpc3 pancreatic cancer cells.« less

Treatment Option Overview (Non-Small Cell Lung Cancer)

MedlinePlus

... Events Scientific Meetings & Lectures Conferences Advisory Board Meetings Social Media Events Cancer Currents Blog All Press Releases 2018 ... Events Scientific Meetings & Lectures Conferences Advisory Board Meetings Social Media Cancer Currents Blog About NCI NCI Overview History ...

White House Conference on Food and Nutrition

THOMAS, 111th Congress

Rep. McGovern, James P. [D-MA-3

2009-04-02

House - 04/28/2009 Referred to the Subcommittee on Department Operations, Oversight, Nutrition and Forestry. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

White House Conference on Food and Nutrition

THOMAS, 111th Congress

Rep. McGovern, James P. [D-MA-3

2009-05-07

House - 06/22/2010 Referred to the Subcommittee on Department Operations, Oversight, Nutrition and Forestry. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

Working Together: Planting the Seed. "Kia Pihi Ai Te Mahi Ngatahi." Proceedings of the 2012 Annual International Conference of the Association of Tertiary Learning Advisors of Aotearoa/New Zealand (ATLAANZ) (Hamilton, New Zealand, Nov 21-23, 2013). Volume 8

ERIC Educational Resources Information Center

Gera, Christina, Ed.

2013-01-01

The 7 articles in this 8th volume comprise the referred proceedings of the 2012 ATLAANZ (Association of Tertiary Learning Advisors Aotearoa/New Zealand) conference. The first three chapters present tools that can assist students with their academic development: In chapter 1, ("The DELNA Language Advisory Session: How do Students…

Dissection of enhanced cell expansion processes in leaves triggered by a defect in cell proliferation, with reference to roles of endoreduplication.

PubMed

Fujikura, Ushio; Horiguchi, Gorou; Tsukaya, Hirokazu

2007-02-01

Leaf development relies on cell proliferation, post-mitotic cell expansion and the coordination of these processes. In several Arabidopsis thaliana mutants impaired in cell proliferation, such as angustifolia3 (an3), leaf cells are larger than normal at their maturity. This phenomenon, which we call compensated cell enlargement, suggests the presence of such coordination in leaf development. To dissect genetically the cell expansion system(s) underlying this compensation seen in the an3 mutant, we isolated and utilized 10 extra-small sisters (xs) mutant lines that show decreased cell size but normal cell numbers in leaves. In the xs single mutants, the palisade cell sizes in mature leaves are about 20-50% smaller than those of wild-type cells. Phenotypes of the palisade cell sizes in all combinations of xs an3 double mutants fall into three classes. In the first class, the compensated cell enlargement was significantly suppressed. Conversely, in the second class, the defective cell expansion conferred by the xs mutations was significantly suppressed by the an3 mutation. The residual xs mutations had effects additive to those of the an3 mutation on cell expansion. The endopolyploidy levels in the first class of mutants were decreased, unaffected or increased, as compared with those in wild-type, suggesting that the abnormally enhanced cell expansion observed in an3 could be mediated, at least in part, by ploidy-independent mechanisms. Altogether, these results clearly showed that a defect in cell proliferation in leaf primordia enhances a part of the network that regulates cell expansion, which is required for normal leaf expansion.

Fifth NASA Goddard Conference on Mass Storage Systems and Technologies. Volume 2

NASA Technical Reports Server (NTRS)

Kobler, Benjamin (Editor); Hariharan, P. C. (Editor)

1996-01-01

This document contains copies of those technical papers received in time for publication prior to the Fifth Goddard Conference on Mass Storage Systems and Technologies held September 17 - 19, 1996, at the University of Maryland, University Conference Center in College Park, Maryland. As one of an ongoing series, this conference continues to serve as a unique medium for the exchange of information on topics relating to the ingestion and management of substantial amounts of data and the attendant problems involved. This year's discussion topics include storage architecture, database management, data distribution, file system performance and modeling, and optical recording technology. There will also be a paper on Application Programming Interfaces (API) for a Physical Volume Repository (PVR) defined in Version 5 of the Institute of Electrical and Electronics Engineers (IEEE) Reference Model (RM). In addition, there are papers on specific archives and storage products.

The targeted inhibition of mitochondrial Hsp90 overcomes the apoptosis resistance conferred by Bcl-2 in Hep3B cells via necroptosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yan, Chunlan; Department of Physiology, Zhejiang University School of Medicine, Hangzhou, Zhejiang 310058; Oh, Joon Seok

Previous studies have reported that a Gamitrinib variant containing triphenylphosphonium (G-TPP) binds to mitochondrial Hsp90 and rapidly inhibits its activity, thus inducing the apoptotic pathway in the cells. Accordingly, G-TPP shows a potential as a promising drug for the treatment of cancer. A cell can die from different types of cell death such as apoptosis, necrosis, necroptosis, and autophagic cell death. In this study, we further investigated the mechanisms and modes of cell death in the G-TPP-treated Hep3B and U937 cell lines. We discovered that G-TPP kills the U937 cells through the apoptotic pathway and the overexpression of Bcl-2 significantlymore » inhibits U937 cell death to G-TPP. We further discovered that G-TPP kills the Hep3B cells by activating necroptosis in combination with the partial activation of caspase-dependent apoptosis. Importantly, G-TPP overcomes the apoptosis resistance conferred by Bcl-2 in Hep3B cells via necroptosis. We also observed that G-TPP induces compensatory autophagy in the Hep3B cell line. We further found that whereas there is a Bcl-2-Beclin 1 interaction in response to G-TPP, silencing the beclin 1 gene failed to block LC3-II accumulation in the Hep3B cells, indicating that G-TPP triggers Beclin 1-independent protective autophagy in Hep3B cells. Taken together, these data reveal that G-TPP induces cell death through a combination of death pathways, including necroptosis and apoptosis, and overcomes the apoptosis resistance conferred by Bcl-2 in Hep3B cells via necroptosis. These findings are important for the therapeutic exploitation of necroptosis as an alternative cell death program to bypass the resistance to apoptosis. Highlights: ► G-TPP binds to mitochondrial Hsp90. ► G-TPP induces apoptosis in U937 human leukemia cancer cells. ► G-TPP induces combination of death pathways in Hep3B cell. ► G-TPP overcomes the resistance conferred by Bcl-2 in Hep3B cells via necroptosis. ► G-TPP triggers Beclin 1-independent protective autophagy in Hep3B cells.« less

A hydrophobic hole transporting system to improve moisture stability of perovskite solar cells (Conference Presentation)

NASA Astrophysics Data System (ADS)

Xiao, Lixin

2016-09-01

Non-ion additive hole-transporting material (HTM) of hydrophobic oligothiophene derivative named DR3TBDTT and triphenylamine derivative of N,N'-di(3-methylphenyl)-N,N-diphenyl-4,4-diaminobiphenyl (TPD) were used for the organic-inorganic hybrid perovskite solar cells. The power conversion efficiency (PCE) was comparable to the device using Li-TFSI doped spiro-MeOTAD. Moreover, the PCE decreases by only 10% after approximately 1000 h without encapsulation, which suggests an alternative method to improve the stability of perovskite solar cells[1-3 ]. Figure 1. Schematic illustration of the energy diagram of the device without lithium salts REFERENCES [1] Zheng, L.; Ma, Y.; Chu, S.; Wang, S.; Qu, B.; Xiao, L.; Chen, Z.;Gong, Q.; Wu, Z.; Hou, X. Nanoscale 6, 8171-8176 (2014). [2] Zheng Lingling, Chung Yao-Hsien, Ma Yingzhuang, Zhang Lipei, Xiao Lixin, Chen Zhijian, Wang Shufeng, Qu Bo and Gong Qihuang, Chem. Commun. 50, 11196-11199 (2014). [3] Ma Yingzhuang, Chung Yao-Hsien, Zheng Lingling, Zhang Danfei, Yu Xiao, Xiao Lixin, Chen Zhijian, Wang Shufeng, Qu Bo, Gong Qihuang, and Zou Dechun, ACS Appl. Mater. Interfaces 7 (12), 6406-6411 (2015)

4th International Plant Biomechanics Conference Proceedings (Abstracts)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Frank W. Telewski; Lothar H. Koehler; Frank W. Ewers

2003-07-20

The 4th International Plant Biomechanics Conference facilitated an interdisciplinary exchange between scientists, engineers, and educators addressing the major questions encountered in the field of Plant Biomechanics. Subjects covered by the conference include: Evolution; Ecology; Mechanoreception; Cell Walls; Genetic Modification; Applied Biomechanics of Whole Plants, Plant Products, Fibers & Composites; Fluid Dynamics; Wood & Trees; Fracture Mechanics; Xylem Pressure & Water Transport; Modeling; and Introducing Plant Biomechanics in Secondary School Education.

A scoping review about conference objectives and evaluative practices: how do we get more out of them?

PubMed

Neves, Justin; Lavis, John N; Ranson, M Kent

2012-08-02

Large multi-day conferences have often been criticized as ineffective ways to improve social outcomes and to influence policy or practice. Unfortunately, many conference evaluations have also been inadequate in determining the impact of a conference on its associated social sector, with little evidence gathered or analyzed to substantiate or refute these criticisms. The aim of this scoping review is to investigate and report stakeholders' objectives for planning or participating in large multi-day conferences and how these objectives are being evaluated. We conducted a scoping review supplemented by a small number of key informant interviews. Eight bibliographic databases were systematically searched to identify papers describing conference objectives and/or evaluations. We developed a conference evaluation framework based on theoretical models and empirical findings, which structured the descriptive synthesis of the data. We identified 3,073 potential papers for review, of which 44 were included in this study. Our evaluation framework connects five key elements in planning a conference and its evaluation (number in brackets refers to number of themes identified): conference objectives (8), purpose of evaluation (7), evaluation methods (5), indicators of success (9) and theories/models (8). Further analysis of indicators of success identified three categories of indicators with differing scopes (i.e. immediate, prospective or follow-up) as well as empirical links between the purpose of evaluations and these indicators. Conference objectives and evaluations were largely correlated with the type of conference (i.e. academic, political/governmental or business) but diverse overall. While much can be done to improve the quality and usefulness of conference evaluations, there are innovative assessments that are currently being utilized by some conferences and warrant further investigation. This review provides conference evaluators and organizers a simple resource to improve their own assessments by highlighting and categorizing potential objectives and evaluation strategies.

A scoping review about conference objectives and evaluative practices: how do we get more out of them?

PubMed Central

2012-01-01

Large multi-day conferences have often been criticized as ineffective ways to improve social outcomes and to influence policy or practice. Unfortunately, many conference evaluations have also been inadequate in determining the impact of a conference on its associated social sector, with little evidence gathered or analyzed to substantiate or refute these criticisms. The aim of this scoping review is to investigate and report stakeholders’ objectives for planning or participating in large multi-day conferences and how these objectives are being evaluated. We conducted a scoping review supplemented by a small number of key informant interviews. Eight bibliographic databases were systematically searched to identify papers describing conference objectives and/or evaluations. We developed a conference evaluation framework based on theoretical models and empirical findings, which structured the descriptive synthesis of the data. We identified 3,073 potential papers for review, of which 44 were included in this study. Our evaluation framework connects five key elements in planning a conference and its evaluation (number in brackets refers to number of themes identified): conference objectives (8), purpose of evaluation (7), evaluation methods (5), indicators of success (9) and theories/models (8). Further analysis of indicators of success identified three categories of indicators with differing scopes (i.e. immediate, prospective or follow-up) as well as empirical links between the purpose of evaluations and these indicators. Conference objectives and evaluations were largely correlated with the type of conference (i.e. academic, political/governmental or business) but diverse overall. While much can be done to improve the quality and usefulness of conference evaluations, there are innovative assessments that are currently being utilized by some conferences and warrant further investigation. This review provides conference evaluators and organizers a simple resource to improve their own assessments by highlighting and categorizing potential objectives and evaluation strategies. PMID:22857399

Cumulative reports and publications through December 31, 1985

NASA Technical Reports Server (NTRS)

1986-01-01

A complete list of ICASE Reports are contained. Since ICASE Reports are intended to be preprints of articles that will appear in journals or conference proceedings, the published reference is included when it is available.

EPA’s Hg Gas Traceability Approach for Source Emissions Measurement and Monitoring

EPA Science Inventory

Solicited presentation (special topic) at the International Conference on Mercury as a Global Pollutant on how EPA establishes the NIST traceability of reference materials used to support regulatory mercury emissions measurements.

Stop Wasteful Federal Bonuses and Conferences Act of 2012

THOMAS, 112th Congress

Sen. McCaskill, Claire [D-MO

2012-08-02

Senate - 08/02/2012 Read twice and referred to the Committee on Homeland Security and Governmental Affairs. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

Vaccination with human amniotic epithelial cells confer effective protection in a murine model of Colon adenocarcinoma.

PubMed

Tabatabaei, M; Mosaffa, N; Ghods, R; Nikoo, S; Kazemnejad, S; Khanmohammadi, M; Mirzadeghan, E; Mahmoudi, A R; Bolouri, M R; Falak, R; Keshavarzi, B; Ramezani, M; Zarnani, A H

2018-04-01

As a prophylactic cancer vaccine, human amniotic membrane epithelial cells (hAECs) conferred effective protection in a murine model of colon cancer. The immunized mice mounted strong cross-protective CTL and antibody responses. Tumor burden was significantly reduced in tumor-bearing mice after immunization with hAECs. Placental cancer immunotherapy could be a promising approach for primary prevention of cancer. In spite of being the star of therapeutic strategies for cancer treatment, the results of immunotherapeutic approaches are still far from expectations. In this regard, primary prevention of cancer using prophylactic cancer vaccines has gained considerable attention. The immunologic similarities between cancer development and placentation have helped researchers to unravel molecular mechanisms responsible for carcinogenesis and to take advantage of stem cells from reproductive organs to elicit robust anti-cancer immune responses. Here, we showed that vaccination of mice with human amniotic membrane epithelial cells (hAECs) conferred effective protection against colon cancer and led to expansion of systemic and splenic cytotoxic T cell population and induction of cross-protective cytotoxic responses against tumor cells. Vaccinated mice mounted tumor-specific Th1 responses and produced cross-reactive antibodies against cell surface markers of cancer cells. Tumor burden was also significantly reduced in tumor-bearing mice immunized with hAECs. Our findings pave the way for potential future application of hAECs as an effective prophylactic cancer vaccine. © 2017 UICC.

Bioavailable Concentrations of Delphinidin and Its Metabolite, Gallic Acid, Induce Antioxidant Protection Associated with Increased Intracellular Glutathione in Cultured Endothelial Cells

PubMed Central

Goszcz, Katarzyna; Deakin, Sherine J.; Duthie, Garry G.; Stewart, Derek

2017-01-01

Despite limited bioavailability and rapid degradation, dietary anthocyanins are antioxidants with cardiovascular benefits. This study tested the hypothesis that the antioxidant protection conferred by the anthocyanin, delphinidin, is mediated by modulation of endogenous antioxidant defences, driven by its degradation product, gallic acid. Delphinidin was found to degrade rapidly (t1/2 ~ 30 min), generating gallic acid as a major degradation product. Both delphinidin and gallic acid generated oxygen-centred radicals at high (100 μM) concentrations in vitro. In a cultured human umbilical vein endothelial cell model of oxidative stress, the antioxidant protective effects of both delphinidin and gallic acid displayed a hormesic profile; 100 μM concentrations of both were cytotoxic, but relatively low concentrations (100 nM–1 μM) protected the cells and were associated with increased intracellular glutathione. We conclude that delphinidin is intrinsically unstable and unlikely to confer any direct antioxidant activity in vivo yet it offered antioxidant protection to cells at low concentrations. This paradox might be explained by the ability of the degradation product, gallic acid, to confer benefit. The findings are important in understanding the mode of protection conferred by anthocyanins and reinforce the necessity to conduct in vitro experiments at biologically relevant concentrations. PMID:29081896

A value-based medicine analysis of ranibizumab for the treatment of subfoveal neovascular macular degeneration.

PubMed

Brown, Melissa M; Brown, Gary C; Brown, Heidi C; Peet, Jonathan

2008-06-01

To assess the conferred value and average cost-utility (cost-effectiveness) for intravitreal ranibizumab used to treat occult/minimally classic subfoveal choroidal neovascularization associated with age-related macular degeneration (AMD). Value-based medicine cost-utility analysis. MARINA (Minimally Classic/Occult Trial of the Anti-Vascular Endothelial Growth Factor Antibody Ranibizumab in the Treatment of Neovascular AMD) Study patients utilizing published primary data. Reference case, third-party insurer perspective, cost-utility analysis using 2006 United States dollars. Conferred value in the forms of (1) quality-adjusted life-years (QALYs) and (2) percent improvement in health-related quality of life. Cost-utility is expressed in terms of dollars expended per QALY gained. All outcomes are discounted at a 3% annual rate, as recommended by the Panel on Cost-effectiveness in Health and Medicine. Data are presented for the second-eye model, first-eye model, and combined model. Twenty-two intravitreal injections of 0.5 mg of ranibizumab administered over a 2-year period confer 1.039 QALYs, or a 15.8% improvement in quality of life for the 12-year period of the second-eye model reference case of occult/minimally classic age-related subfoveal choroidal neovascularization. The reference case treatment cost is $52652, and the cost-utility for the second-eye model is $50691/QALY. The quality-of-life gain from the first-eye model is 6.4% and the cost-utility is $123887, whereas the most clinically simulating combined model yields a quality-of-life gain of 10.4% and cost-utility of $74169. By conventional standards and the most commonly used second-eye and combined models, intravitreal ranibizumab administered for occult/minimally classic subfoveal choroidal neovascularization is a cost-effective therapy. Ranibizumab treatment confers considerably greater value than other neovascular macular degeneration pharmaceutical therapies that have been studied in randomized clinical trials.

Formalin-Inactivated Coxiella burnetii Phase I Vaccine-Induced Protection Depends on B Cells To Produce Protective IgM and IgG

PubMed Central

Peng, Ying; Schoenlaub, Laura; Elliott, Alexandra; Mitchell, William; Zhang, Yan

2013-01-01

To further understand the mechanisms of formalin-inactivated Coxiella burnetii phase I (PI) vaccine (PIV)-induced protection, we examined if B cell, T cell, CD4+ T cell, or CD8+ T cell deficiency in mice significantly affects the ability of PIV to confer protection against a C. burnetii infection. Interestingly, compared to wild-type (WT) mice, PIV conferred comparable levels of protection in CD4+ T cell- or CD8+ T cell-deficient mice and partial protection in T cell-deficient mice but did not provide measurable protection in B cell-deficient mice. These results suggest that PIV-induced protection depends on B cells. In addition, anti-PI-specific IgM was the major detectable antibody (Ab) in immune sera from PIV-vaccinated CD4+ T cell-deficient mice, and passive transfer of immune sera from PIV-vaccinated CD4+ T cell-deficient mice conferred significant protection. These results suggest that T cell-independent anti-PI-specific IgM may contribute to PIV-induced protection. Our results also suggested that PIV-induced protection may not depend on complement activation and Fc receptor-mediated effector functions. Furthermore, our results demonstrated that both IgM and IgG from PIV-vaccinated WT mouse sera were able to inhibit C. burnetii infection in vivo, but only IgM from PIV-vaccinated CD4+ T cell-deficient mouse sera inhibited C. burnetii infection. Collectively, these findings suggest that PIV-induced protection depends on B cells to produce protective IgM and IgG and that T cell-independent anti-PI-specific IgM may play a critical role in PIV-induced protection against C. burnetii infection. PMID:23545296

High resolution microendoscopy for early detection of esophageal cancer in low-resource settings (Conference Presentation)

NASA Astrophysics Data System (ADS)

Richards-Kortum, Rebecca

2016-03-01

Esophageal squamous cell neoplasia (ESCN) is the sixth leading cause of cancer death worldwide. Most deaths due to ESCN occur in developing countries, with highest risk areas in northern China. Lugol's chromoendoscopy (LCE) is the gold-standard for ESCN screening; while the sensitivity of LCE for ESCN is >95%, LCE suffers poor specificity (< 65%) due to false positive findings from inflammatory lesions. High resolution microendoscopy (HRME) uses a low-cost, fiber-optic fluorescence microscope to image morphology of the surface epithelium without need for biopsy. We developed a tablet-interfaced HRME with automated, real-time image analysis. In an in vivo study of 177 patients referred for endoscopy in China, use of the algorithm identified neoplasia with a sensitivity and specificity of 95% and 91% compared to the gold standard of histology.

Identification and classification of genes required for tolerance to freeze-thaw stress revealed by genome-wide screening of Saccharomyces cerevisiae deletion strains.

PubMed

Ando, Akira; Nakamura, Toshihide; Murata, Yoshinori; Takagi, Hiroshi; Shima, Jun

2007-03-01

Yeasts used in bread making are exposed to freeze-thaw stress during frozen-dough baking. To clarify the genes required for freeze-thaw tolerance, genome-wide screening was performed using the complete deletion strain collection of diploid Saccharomyces cerevisiae. The screening identified 58 gene deletions that conferred freeze-thaw sensitivity. These genes were then classified based on their cellular function and on the localization of their products. The results showed that the genes required for freeze-thaw tolerance were frequently involved in vacuole functions and cell wall biogenesis. The highest numbers of gene products were components of vacuolar H(+)-ATPase. Next, the cross-sensitivity of the freeze-thaw-sensitive mutants to oxidative stress and to cell wall stress was studied; both of these are environmental stresses closely related to freeze-thaw stress. The results showed that defects in the functions of vacuolar H(+)-ATPase conferred sensitivity to oxidative stress and to cell wall stress. In contrast, defects in gene products involved in cell wall assembly conferred sensitivity to cell wall stress but not to oxidative stress. Our results suggest the presence of at least two different mechanisms of freeze-thaw injury: oxidative stress generated during the freeze-thaw process, and defects in cell wall assembly.

Alkali-aggregate reactivity (AAR) workshops for engineers and practitioners reference manual.

DOT National Transportation Integrated Search

2013-01-01

Funding for the Federal Highway Administration (FHWA) Alkali-Silica Reactivity (ASR) Development and Deployment Program was provided under SAFETEA-LU. A related Conference Report provides additional guidance stating that project and programs related ...

Cumulative reports and publications through December 31, 1990

NASA Technical Reports Server (NTRS)

1991-01-01

This document contains a complete list of ICASE reports. Since ICASE reports are intended to be preprints of articles that will appear in journals or conference proceedings, the published reference is included when it is available.

Cumulative reports and publications through December 31, 1986

NASA Technical Reports Server (NTRS)

1987-01-01

This document contains a complete list of ICASE Reports. Since ICASE Reports are intended to be preprints of articles that will appear in journals or conference proceedings, the published reference is included when it is available.

Cumulative reports and publications through December 31, 1988

NASA Technical Reports Server (NTRS)

1989-01-01

This document contains a complete list of ICASE Reports. Since ICASE Reports are intended to be preprints of articles that will appear in journals or conference proceedings, the published reference is included when it is available.

Object Based Systems Engineering

DTIC Science & Technology

2011-10-17

practically impossible where the original SMEs are unavailable or lack perfect recall. 7. Capture the precious and transient logic behind this...complex system. References 1. FITCH, J. Exploiting Decision-to-Requirements Traceability, briefing to NDIA CMMI Conference, November, 2009 2

White House Conference on Children and Youth in 2010 Act

THOMAS, 111th Congress

Sen. Landrieu, Mary L. [D-LA

2009-04-30

Senate - 04/30/2009 Read twice and referred to the Committee on Health, Education, Labor, and Pensions. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

Cumulative reports and publications through December 31, 1993

NASA Technical Reports Server (NTRS)

1994-01-01

This document contains a complete list of ICASE reports. Since ICASE reports are intended to be preprints of articles that will appear in journals or conference proceedings, the published reference is included when it is available.

Remote Sensing.

ERIC Educational Resources Information Center

Williams, Richard S., Jr.; Southworth, C. Scott

1983-01-01

The Landsat Program became the major event of 1982 in geological remote sensing with the successful launch of Landsat 4. Other 1982 remote sensing accomplishments, research, publications, (including a set of Landsat worldwide reference system index maps), and conferences are highlighted. (JN)

Subcellular localization of the Hpa RxLR effector repertoire identifies a tonoplast-associated protein HaRxL17 that confers enhanced plant susceptibility.

PubMed

Caillaud, Marie-Cécile; Piquerez, Sophie J M; Fabro, Georgina; Steinbrenner, Jens; Ishaque, Naveed; Beynon, Jim; Jones, Jonathan D G

2012-01-01

Filamentous phytopathogens form sophisticated intracellular feeding structures called haustoria in plant cells. Pathogen effectors are likely to play a role in the establishment and maintenance of haustoria in addition to their better-characterized role in suppressing plant defence. However, the specific mechanisms by which these effectors promote virulence remain unclear. To address this question, we examined changes in subcellular architecture using live-cell imaging during the compatible interaction between the oomycete Hyaloperonospora arabidopsidis (Hpa) and its host Arabidopsis. We monitored host-cell restructuring of subcellular compartments within plant mesophyll cells during haustoria ontogenesis. Live-cell imaging highlighted rearrangements in plant cell membranes upon infection, in particular to the tonoplast, which was located close to the extra-haustorial membrane surrounding the haustorium. We also investigated the subcellular localization patterns of Hpa RxLR effector candidates (HaRxLs) in planta. We identified two major classes of HaRxL effector based on localization: nuclear-localized effectors and membrane-localized effectors. Further, we identified a single effector, HaRxL17, that associated with the tonoplast in uninfected cells and with membranes around haustoria, probably the extra-haustorial membrane, in infected cells. Functional analysis of selected effector candidates in planta revealed that HaRxL17 enhances plant susceptibility. The roles of subcellular changes and effector localization, with specific reference to the potential role of HaRxL17 in plant cell membrane trafficking, are discussed with respect to Hpa virulence. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

First Aviation System Technology Advanced Research (AvSTAR) Workshop

NASA Technical Reports Server (NTRS)

Denery, Dallas G. (Editor); Weathers, Del W. (Editor); Rosen, Robert (Technical Monitor); Edwards, Tom (Technical Monitor)

2001-01-01

This Conference Proceedings documents the results of a two-day NASA/FAA/Industry workshop that was held at the NASA Ames Research Center, located at Moffett Field, CA, on September 21-22, 2000. The purpose of the workshop was to bring together a representative cross section of leaders in air traffic management, from industry. FAA, and academia, to assist in defining the requirements for a new research effort, referred to as AvSTAR Aviation Systems Technology Advanced Research). The Conference Proceedings includes the individual presentation, and summarizes the workshop discussions and recommendations.

Goddard Conference on Mass Storage Systems and Technologies, volume 2

NASA Technical Reports Server (NTRS)

Kobler, Ben (Editor); Hariharan, P. C. (Editor)

1993-01-01

Papers and viewgraphs from the conference are presented. Discussion topics include the IEEE Mass Storage System Reference Model, data archiving standards, high-performance storage devices, magnetic and magneto-optic storage systems, magnetic and optical recording technologies, high-performance helical scan recording systems, and low end helical scan tape drives. Additional discussion topics addressed the evolution of the identifiable unit for processing (file, granule, data set, or some similar object) as data ingestion rates increase dramatically, and the present state of the art in mass storage technology.

Books and monographs on finite element technology

NASA Technical Reports Server (NTRS)

Noor, A. K.

1985-01-01

The present paper proviees a listing of all of the English books and some of the foreign books on finite element technology, taking into account also a list of the conference proceedings devoted solely to finite elements. The references are divided into categories. Attention is given to fundamentals, mathematical foundations, structural and solid mechanics applications, fluid mechanics applications, other applied science and engineering applications, computer implementation and software systems, computational and modeling aspects, special topics, boundary element methods, proceedings of symmposia and conferences on finite element technology, bibliographies, handbooks, and historical accounts.

2012 Gordon Research Conference on Cellular and Molecular Fungal Biology, Final Progress Report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berman, Judith

The Gordon Research Conference on Cellular and Molecular Fungal Biology was held at Holderness School, Holderness New Hampshire, June 17 - 22, 2012. The 2012 Gordon Conference on Cellular and Molecular Fungal Biology (CMFB) will present the latest, cutting-edge research on the exciting and growing field of molecular and cellular aspects of fungal biology. Topics will range from yeast to filamentous fungi, from model systems to economically important organisms, and from saprophytes and commensals to pathogens of plants and animals. The CMFB conference will feature a wide range of topics including systems biology, cell biology and morphogenesis, organismal interactions, genomemore » organisation and regulation, pathogenesis, energy metabolism, biomass production and population genomics. The Conference was well-attended with 136 participants. Gordon Research Conferences does not permit publication of meeting proceedings.« less

Emerging antibody-drug conjugates for treating lymphoid malignancies.

PubMed

Wolska-Washer, Anna; Robak, Pawel; Smolewski, Piotr; Robak, Tadeusz

2017-09-01

Antibody-drug conjugates (ADC) are monoclonal antibodies (Mabs) attached to biologically active drugs through specialized chemical linkers. They deliver and release cytotoxic agents at the tumor site, reducing the likelihood of systemic exposure and therefore toxicity. These agents should improve the potency of chemotherapy by increasing the accumulation of cytotoxic the drug within or near the neoplastic cells with reduced systemic effects. Areas covered: A literature review was conducted of the MEDLINE database PubMed for articles in English examining Mabs, B-cell receptor pathway inhibitors and immunomodulating drugs. Publications from 2000 through April 2017 were scrutinized. Conference proceedings from the previous five years of the American Society of Hematology, European Hematology Association, American Society of Clinical Oncology, and ACR/ARHP Annual Scientific Meetings were searched manually. Additional relevant publications were obtained by reviewing the references from the chosen articles. Expert opinion: Newer ADCs show promise as treatment for several hematologic malignancies, especially lymphoma, multiple myeloma, and leukemia. However, definitive data from ongoing and future clinical trials will aid in better defining the status of these agents in the treatment of these diseases.

Summaries of "You Do It" Activities Presented at the 1978 SASTA Conference in the Riverland.

ERIC Educational Resources Information Center

Walsh, Terry

1980-01-01

Summarizes "you do it" activities presented at the 1978 South Australian Science Teachers Association Conference. Topics include microscope use and maintenance, chemical slide cells, chemical models, sound waves, microwaves, astronomy, plant keys, reading geological maps, and natural dye processes. (DS)

Gene therapy for sickle cell disease.

PubMed

Olowoyeye, Abiola; Okwundu, Charles I

2016-11-14

Sickle cell disease encompasses a group of genetic disorders characterized by the presence of at least one hemoglobin S (Hb S) allele, and a second abnormal allele that could allow abnormal hemoglobin polymerisation leading to a symptomatic disorder.Autosomal recessive disorders (such as sickle cell disease) are good candidates for gene therapy because a normal phenotype can be restored in diseased cells with only a single normal copy of the mutant gene. This is an update of a previously published Cochrane Review. The objectives of this review are:to determine whether gene therapy can improve survival and prevent symptoms and complications associated with sickle cell disease;to examine the risks of gene therapy against the potential long-term gain for people with sickle cell disease. We searched the Cochrane Cystic Fibrosis and Genetic Disorders Group Haemoglobinopathies Trials Register, which comprises of references identified from comprehensive electronic database searches and searching relevant journals and abstract books of conference proceedings.Date of the most recent search of the Group's Haemoglobinopathies Trials Register: 15 August 2016. All randomised or quasi-randomised clinical trials (including any relevant phase 1, 2 or 3 trials) of gene therapy for all individuals with sickle cell disease, regardless of age or setting. No trials of gene therapy for sickle cell disease were found. No trials of gene therapy for sickle cell disease were reported. No randomised or quasi-randomised clinical trials of gene therapy for sickle cell disease were reported. Thus, no objective conclusions or recommendations in practice can be made on gene therapy for sickle cell disease. This systematic review has identified the need for well-designed, randomised controlled trials to assess the benefits and risks of gene therapy for sickle cell disease.

Gene therapy for sickle cell disease.

PubMed

Olowoyeye, Abiola; Okwundu, Charles I

2014-10-10

Sickle cell disease encompasses a group of genetic disorders characterized by the presence of at least one hemoglobin S (Hb S) allele, and a second abnormal allele that could allow abnormal hemoglobin polymerisation leading to a symptomatic disorder.Autosomal recessive disorders (such as sickle cell disease) are good candidates for gene therapy because a normal phenotype can be restored in diseased cells with only a single normal copy of the mutant gene. The objectives of this review are:- to determine whether gene therapy can improve survival and prevent symptoms and complications associated with sickle cell disease;- to examine the risks of gene therapy against the potential long-term gain for people with sickle cell disease. We searched the Cochrane Cystic Fibrosis and Genetic Disorders Group Haemoglobinopathies Trials Register, which comprises of references identified from comprehensive electronic database searches and searching relevant journals and abstract books of conference proceedings.Date of the most recent search of the Group's Haemoglobinopathies Trials Register: 21 July 2014. All randomised or quasi-randomised clinical trials (including any relevant phase 1, 2 or 3 trials) of gene therapy for all individuals with sickle cell disease, regardless of age or setting. No trials of gene therapy for sickle cell disease were found. No trials of gene therapy for sickle cell disease were reported. No randomised or quasi-randomised clinical trials of gene therapy for sickle cell disease were reported. Thus, no objective conclusions or recommendations in practice can be made on gene therapy for sickle cell disease. This systematic review has identified the need for well-designed, randomised controlled trials to assess the benefits and risks of gene therapy for sickle cell disease.

Anticancer drugs cause release of exosomes with heat shock proteins from human hepatocellular carcinoma cells that elicit effective natural killer cell antitumor responses in vitro.

PubMed

Lv, Li-Hong; Wan, Yun-Le; Lin, Yan; Zhang, Wei; Yang, Mei; Li, Guo-Lin; Lin, Hao-Ming; Shang, Chang-Zhen; Chen, Ya-Jin; Min, Jun

2012-05-04

Failure of immune surveillance related to inadequate host antitumor immune responses has been suggested as a possible cause of the high incidence of recurrence and poor overall survival outcome of hepatocellular carcinoma. The stress-induced heat shock proteins (HSPs) are known to act as endogenous "danger signals" that can improve tumor immunogenicity and induce natural killer (NK) cell responses. Exosome is a novel secretory pathway for HSPs. In our experiments, the immune regulatory effect of the HSP-bearing exosomes secreted by human hepatocellular carcinoma cells under stress conditions on NK cells was studied. ELISA results showed that the production of HSP60, HSP70, and HSP90 was up-regulated in both cell lines in a stress-specific manner. After exposure to hepatocellular carcinoma cell-resistant or sensitive anticancer drugs (hereafter referred to as "resistant" or "sensitive" anticancer drug), the membrane microvesicles were actively released by hepatocellular carcinoma cells, differing in their ability to present HSPs on the cell surface, which were characterized as exosomes. Acting as a decoy, the HSP-bearing exosomes efficiently stimulated NK cell cytotoxicity and granzyme B production, up-regulated the expression of inhibitory receptor CD94, and down-regulated the expression of activating receptors CD69, NKG2D, and NKp44. Notably, resistant anticancer drugs enhanced exosome release and generated more exosome-carried HSPs, which augmented the activation of the cytotoxic response. In summary, our findings demonstrated that exosomes derived from resistant anticancer drug-treated HepG2 cells conferred superior immunogenicity in inducing HSP-specific NK cell responses, which provided a clue for finding an efficient vaccine for hepatocellular carcinoma immunotherapy.

Cumulative reports and publications through December 31, 1987

NASA Technical Reports Server (NTRS)

1988-01-01

This document contains a complete list of Institute for Computer Applications in Science and Engineering (ICASE) Reports. Since ICASE Reports are preprints of articles to be published in journals or conference proceeding, the published reference is included when available.

Recognizing the 75th anniversary of the National Conference of State Liquor Administrators.

THOMAS, 111th Congress

Rep. McMahon, Michael E. [D-NY-13

2009-09-22

House - 10/19/2009 Referred to the Subcommittee on the Constitution, Civil Rights, and Civil Liberties. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

Analysis Reveals Impact of Road Grade on Vehicle Energy Use | News | NREL

Science.gov Websites

of modern automobiles is essential for designing increasingly efficient powertrains. In recent years more information, refer to the conference paper-Contribution of Road Grade to the Energy Use of Modern

Fifth NASA Goddard Conference on Mass Storage Systems and Technologies.. Volume 1

NASA Technical Reports Server (NTRS)

Kobler, Benjamin (Editor); Hariharan, P. C. (Editor)

1996-01-01

This document contains copies of those technical papers received in time for publication prior to the Fifth Goddard Conference on Mass Storage Systems and Technologies. As one of an ongoing series, this conference continues to serve as a unique medium for the exchange of information on topics relating to the ingestion and management of substantial amounts of data and the attendant problems involved. This year's discussion topics include storage architecture, database management, data distribution, file system performance and modeling, and optical recording technology. There will also be a paper on Application Programming Interfaces (API) for a Physical Volume Repository (PVR) defined in Version 5 of the Institute of Electrical and Electronics Engineers (IEEE) Reference Model (RM). In addition, there are papers on specific archives and storage products.

Conference on Aerospace Transparent Materials and Enclosures, 18-21 November 1975, Atlanta, Georgia

DTIC Science & Technology

1976-04-01

rapid by stress-assisted sorption . Whatever the mechanism of solvent penetration, the transmission of solvent to the craze tip is governed by fluid flow...420 e. Newer Fluoropolymers: Tefzel. Halar, PFA Because of the recent commercial introduction of these plasti ns, little weathering information is...film in Arizona (reference 33). PFA (perfluoroalkoxy resin) is said to have excellent weather- ability (reference 78). It seems likely that all these

Bacillus Calmette-Guérin strain differences have an impact on clinical outcome in bladder cancer immunotherapy.

PubMed

Rentsch, Cyrill A; Birkhäuser, Frédéric D; Biot, Claire; Gsponer, Joël R; Bisiaux, Aurélie; Wetterauer, Christian; Lagranderie, Micheline; Marchal, Gilles; Orgeur, Mickael; Bouchier, Christiane; Bachmann, Alexander; Ingersoll, Molly A; Brosch, Roland; Albert, Matthew L; Thalmann, George N

2014-10-01

Whether the commonly used bacillus Calmette-Guérin (BCG) strains Connaught and Tice confer different treatment responses in non-muscle-invasive bladder cancer (NMIBC) is unknown. To compare clinical efficacy, immunogenicity, and genetics of BCG Connaught and Tice. A prospective randomized single-institution trial with treatment of 142 high-risk NMIBC patients with BCG Connaught or Tice. Patients were randomized to receive six instillations of BCG Connaught or Tice. For experimental studies, BCG strains were compared in C57Bl/6 mice. Bladders and lymphoid tissues were analyzed by cytometry and the latter cultivated to detect live BCG. BCG genomic DNA was sequenced and compared with reference genomes. Recurrence-free survival was the primary end point of the clinical study. The Kaplan-Meier estimator was used for estimating survival and time-to-event end points. Nonparametric tests served for the analysis of the in vivo results. Treatment with BCG Connaught conferred significantly greater 5-yr recurrence-free survival compared with treatment with BCG Tice (p=0.0108). Comparable numbers of patients experienced BCG therapy-related side effects in each treatment group (p=0.09). In mice, BCG Connaught induced stronger T-helper cell 1-biased responses, greater priming of BCG-specific CD8(+) T cells, and more robust T-cell recruitment to the bladder than BCG Tice. Genome sequencing of the BCG strains revealed candidate genes potentially involved in the differential clinical responses. BCG strain may have an impact on treatment outcome in NMIBC immunotherapy. We compared the efficacy of two commonly used bacillus Calmette-Guérin (BCG) strains for the treatment of NMIBC and found that treatment with BCG Connaught prevented recurrences more efficiently than BCG Tice. Comparison of the immunogenicity of the two strains in mice indicated superior immunogenicity of BCG Connaught. We also identified genetic differences that may explain the differential efficacy of the Connaught and Tice BCG strains. NCT00003779. Copyright © 2014. Published by Elsevier B.V.

2017 The 7th International Conference on Computer Engineering and Networks

NASA Astrophysics Data System (ADS)

This conference proceeding is a collection of the papers accepted by the CENet 2017 - the 7th International Conference on Computer Engineering and Networks held on Shanghai from 22-23 July, 2017. This proceeding contains the five parts: Part I focuses on Machine learning (21 papers); Part II Wireless communication (21 papers); Part III Information theory (21 papers), Part IV Cloud science (14 papers) and Part V Data analysis (21 papers). Each part can be used as an excellent reference by industry practitioners, university faculty, and undergraduate as well as graduate students who need to build a knowledge base of the most current advances and state-of-practice in the topics covered by this conference proceedings. This will enable them to produce, maintain, and manage systems with high levels of trustworthiness and complexity Thanks go to the authors for their hard work and dedication as well as the reviewers for ensuring the selection of only the highest quality papers; their efforts made this proceedings possible.

Effects of vaccines in patients with sickle cell disease: a systematic review protocol.

PubMed

Wiyeh, Alison Beriliy; Abdullahi, Leila Hussein; Wonkam, Ambroise; Wiysonge, Charles Shey; Kaba, Mamadou

2018-03-25

Sickle cell disease (SCD) is an inherited haematological disorder caused by a single point mutation (Glub6Val) that promotes polymerisation of haemoglobin S and sickling of erythrocytes. Inflammation, haemolysis, microvascular obstruction and organ damage characterise the highly variable clinical expression of SCD. People with SCD are at increased risk of severe infections, hence the need for vaccination against common disease-causing organisms in this population. We aim to review the evidence on the efficacy and safety of vaccines in people with SCD. The present systematic review will examine the current data as indexed in PubMed, CENTRAL, EMBASE and EBSCOHost. We will consult Strategic Advisory Group of Experts practice statements, conference abstracts, reference lists of relevant articles, WHO ICTRP trial registry and experts in the field. Two authors will independently screen search outputs, select studies, extract data and assess risk of bias; resolving discrepancies by discussion and consensus between the two authors or arbitration by a third author when necessary. We will perform a meta-analysis for clinically homogenous studies. Evidence from clinically diverse studies will be aggregated using narrative synthesis of the findings. In either case, we will use the GRADE approach to assess the strength of the available evidence. The study draws on data that are readily available in the public domain, hence no formal ethical review and approval is required. The findings of this review will be disseminated through conference presentations and a publication in a peer-reviewed journal. CRD42018084051. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Occupational Burnout among Librarians.

ERIC Educational Resources Information Center

Haack, Mary; And Others

1984-01-01

Outlines stages of occupational burnout (enthusiasm, stagnation, frustration, apathy) and begins empirical assessment of burnout syndrome among librarians and other information professionals. Results of pilot survey conducted at one-day conference on reference service using two measures (Staff Burnout Scale for Health Professionals, projective…

FY 1980 scientific and technical reports, articles, papers, and presentations

NASA Technical Reports Server (NTRS)

White, O. L. (Compiler)

1980-01-01

Abstracts are presented for 60 technical memoranda and 5 technical papers published in technical journals or presented by MSFC personnel in FY 1980. Conference and reference publications are cited along with contractor reports and papers cleared for presentation.

Supporting the goals and objectives of the Prague Conference on Holocaust Era Assets.

THOMAS, 111th Congress

Rep. Wexler, Robert [D-FL-19

2009-03-30

Senate - 07/06/2009 Received in the Senate and referred to the Committee on Foreign Relations. (All Actions) Tracker: This bill has the status Agreed to in HouseHere are the steps for Status of Legislation:

Quality of radiologists' communication with other clinicians--As experienced by radiologists.

PubMed

Fatahi, Nabi; Krupic, Ferid; Hellström, Mikael

2015-06-01

The objective was to study radiologists' experiences of written and oral communication with referring clinicians, and its potential implications for decision making and patient care. Focus group discussions with 12 radiologists were carried out. Content analysis was used for interpretation of the data. Radiologists reported many problems with the request forms: improper choice of imaging examinations and procedures, insufficient patient history/information, unclear clinical questions, lack of specific terms and unclear abbreviations on the request form. Radiologists also mentioned other difficulties: insufficient attention among participating clinicians during conferences, difficulties in reaching the referring clinicians by telephone, and communication difficulties in making priorities between patients. To overcome these problems, radiologists suggested increased contacts between radiologists and clinicians, and educational activities. A number of difficulties in oral and written communication were highlighted. The use of medical imaging may be optimized by joint discussions on indications and methodology and educational activities, such as lectures, seminars and conferences, directed to the medical community at large. Improved communication between radiologists and referring clinicians should be encouraged to ensure diagnostic quality, correct patient prioritization and patient safety, and to avoid unnecessary delays and costs. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Morbidity and Mortality Conference in Obstetrics and Gynecology: A Tool for Addressing the 6 Core Competencies

PubMed Central

Bevis, Kerri S; Straughn, J. Michael; Kendrick, James E; Walsh-Covarrubias, Julie; Kilgore, Larry C

2011-01-01

Background Residency program directors are challenged to effectively teach and assess the Accreditation Council for Graduate Medical Education's (ACGME) 6 competencies. The purpose of this study was to characterize the morbidity and mortality (M&M) conference as a cost-effective and efficient approach for addressing the ACGME competencies through evaluation of resident participation and case diversity. Methods In our modified M&M conference, senior residents submit a weekly list of cases to the conference proctors. The resident presents the case, including a critique of management, using the medical literature. The resident submits a case summary evaluating patient care practices, integrating scientific evidence, and evaluating systemic barriers to care. Completed case summaries are distributed and archived for reference. Results During a 3-year period, 30 residents presented 196 cases. Of these, 37 (19%) directly related to systems-based practice, 20 (10%) involved problems with inadequate communication, and 11 (6%) included issues of professionalism or ethics. All cases involved practice-based learning and medical knowledge. Conclusions The M&M conference addresses the core competencies through resident participation as well as directed analysis of diverse cases. PMID:22379530

[Selected aspects of computer-assisted literature management].

PubMed

Reiss, M; Reiss, G

1998-01-01

We want to report about our own experiences with a database manager. Bibliography database managers are used to manage information resources: specifically, to maintain a database to references and create bibliographies and reference lists for written works. A database manager allows to enter summary information (record) for articles, book sections, books, dissertations, conference proceedings, and so on. Other features that may be included in a database manager include the ability to import references from different sources, such as MEDLINE. The word processing components allow to generate reference list and bibliographies in a variety of different styles, generates a reference list from a word processor manuscript. The function and the use of the software package EndNote 2 for Windows are described. Its advantages in fulfilling different requirements for the citation style and the sort order of reference lists are emphasized.

New Advances and Challenges of Targeting Cancer Stem Cells.

PubMed

Dashzeveg, Nurmaa K; Taftaf, Rokana; Ramos, Erika K; Torre-Healy, Luke; Chumakova, Anastasia; Silver, Daniel J; Alban, Tyler J; Sinyuk, Maksim; Thiagarajan, Praveena S; Jarrar, Awad M; Turaga, Soumya M; Saygin, Caner; Mulkearns-Hubert, Erin; Hitomi, Masahiro; Rich, Jeremy N; Gerson, Stanton L; Lathia, Justin D; Liu, Huiping

2017-10-01

The second International Cancer Stem Cell Conference in Cleveland, Ohio, on September 20-23, 2016, convened 330 attendees from academic, industrial, and clinical organizations. It featured a debate on the concepts and challenges of the cancer stem cells (CSC) as well as CSC-centered scientific sessions on clinical trials, genetics and epigenetics, tumor microenvironment, immune suppression, metastasis, therapeutic resistance, and emerging novel concepts. The conference hosted 35 renowned speakers, 100 posters, 20 short talks, and a preconference workshop. The reported advances of CSC research and therapies fostered new collaborations across national and international borders, and inspired the next generation's young scientists. Cancer Res; 77(19); 5222-7. ©2017 AACR . ©2017 American Association for Cancer Research.

Poster exhibitions at conferences: are we doing it properly?

PubMed

Beamish, Andrew J; Ansell, James; Foster, Jessica J; Foster, Kathryn A; Egan, Richard J

2015-01-01

Literature exploring the educational value and quality of conference poster presentation is scarce. The aim of this study was to identify and describe the variation in poster exhibitions across a spectrum of conferences attended by trainees. Prospective observational assessment of conference posters was carried out across 7 variables at 4 conferences attended by surgical trainees in 2012. Posters were compared by individual variables and according to overall poster score combining all 7 variables examined. The number of authors listed was also compared. Random samples of consecutively numbered posters were examined at the exhibitions of 4 conferences, which included a UK national medical education conference (Association for the Study of Medical Education), a UK international surgical conference (Association of Surgeons of Great Britain and Ireland), a European oncology conference (European Society of Surgical Oncology), and a North American joint medical and surgical conference (Digestive Diseases Week). Significant variation existed between conferences in posters and their presentation. The proportion of presenters failing to display their posters ranged from 3% to 26% (p < 0.0001). Adherence to size guidelines varied from 89% to 100% (p = 0.002). The inclusion of references ranged from 19% to 82% (p < 0.0001). The presence of a presenting author during the allocated session varied widely from 21% to 86% (p < 0.0001). No significant variation was observed in the proportion of posters that were formatted using aims, methods, results, and conclusion sections (81%-93%; p = 0.513) or in the proportion of posters that were identified as difficult to read (24%-28%; p = 0.919). Association for the Study of Medical Education outperformed each of the other exhibitions overall (p < 0.0001). Posters with greater than the median of 4 authors performed significantly better across all areas (p < 0.0001-0.042) except presenter attendance (p = 0.480). Poster exhibitions varied widely, with room for improvement at all 4 conferences. Lessons can be learned by all conferences from each other to improve presenter engagement with and the educational value of poster exhibitions. Copyright © 2014 Association of Program Directors in Surgery. Published by Elsevier Inc. All rights reserved.

Expedition 40 Press Conference

NASA Image and Video Library

2014-05-27

A man taking a picture with a cell phone is seen reflected in the glass separating the quarantined crew during a press conference on Tuesday, May 27, 2014, at the Cosmonaut Hotel in Baikonur, Kazakhstan. The mission to the International Space Station is set to launch May 29 from the Baikonur Cosmodrome. Photo Credit: (NASA/Joel Kowsky)

Report of the 2014 Cent Gardes HIV Vaccine Conference-Part 2: Cell-mediated immunity, mucosal protection, and clinical trials: Fondation Mérieux Conference Center, Veyrier du Lac, France, 5-7 October, 2014.

PubMed

Girard, Marc P; Picot, Valentina; Longuet, Christophe; Nabel, Gary J

2015-08-07

The 2014 Cent Gardes Conference took place on October 5-7, 2014, at the Fondation Mérieux Conference Center, on the shores of the Annecy Lake and aimed to review the progress and promise of HIV vaccines. The elicitation of broadly neutralizing antibodies (bNAbs), their use in passive immunization, as well as their genetic delivery (vector immunoprophylaxis) by a recombinant Adenovirus-associated virus (AAV) vector were reviewed in a preceding article [1]. Approaches to the elicitation of long-lasting T cell or mucosal immunity were also discussed and are now reviewed here. The possibility of eliciting mucosal IgAs was discussed, since it was demonstrated that transcytosis-blocking IgAs can protect monkeys against repeated vaginal challenge with a pathogenic chimeric simian and human immunodeficiency virus (SHIV). The possibility of purging the HIV reservoirs from HIV-infected persons and developing a cure of the disease was also discussed. Copyright © 2015. Published by Elsevier Ltd.. All rights reserved.

Logic, History, and the Chemistry Textbook: I. Does Chemistry Have a Logical Structure?

ERIC Educational Resources Information Center

Jensen, William B.

1998-01-01

Presents the first of three invited keynote lectures from the 1995 conference of the New England Association of Chemistry Teachers. Discusses the relevance of the history of chemistry to the teaching of chemistry. Contains 27 references. (DDR)

A bibliography on parallel and vector numerical algorithms

NASA Technical Reports Server (NTRS)

Ortega, James M.; Voigt, Robert G.; Romine, Charles H.

1988-01-01

This is a bibliography on numerical methods. It also includes a number of other references on machine architecture, programming language, and other topics of interest to scientific computing. Certain conference proceedings and anthologies which have been published in book form are also listed.

A bibliography on parallel and vector numerical algorithms

NASA Technical Reports Server (NTRS)

Ortega, J. M.; Voigt, R. G.

1987-01-01

This is a bibliography of numerical methods. It also includes a number of other references on machine architecture, programming language, and other topics of interest to scientific computing. Certain conference proceedings and anthologies which have been published in book form are listed also.

A bibliography on parallel and vector numerical algorithms

NASA Technical Reports Server (NTRS)

Ortega, James M.; Voigt, Robert G.; Romine, Charles H.

1990-01-01

This is a bibliography on numerical methods. It also includes a number of other references on machine architecture, programming language, and other topics of interest to scientific computing. Certain conference proceedings and anthologies which have been published in book form are also listed.

Physics at the FMQT’08 conference

NASA Astrophysics Data System (ADS)

Špička, V.; Nieuwenhuizen, Th. M.; Keefe, P. D.

2010-01-01

This paper summarizes the recent state of the art of the following topics presented at the FQMT’08 conference: Foundations of quantum physics, Quantum measurement; Quantum noise, decoherence and dephasing; Cold atoms and Bose-Einstein condensation; Physics of quantum computing and information; Nonequilibrium quantum statistical mechanics; Quantum, mesoscopic and partly classical thermodynamics; Mesoscopic, nano-electro-mechanical systems and optomechanical systems; Spins systems and their dynamics, Brownian motion and molecular motors; Physics of biological systems, and Relevant experiments from the nanoscale to the macroscale. To all these subjects an introduction is given and the recent literature is overviewed. The paper contains some 680 references in total.

Red blood cells, still vital after all these years: Commentary on Canadian Blood Services' International Symposium 2017.

PubMed

Qadri, Syed M; Donkor, David A; Yan, Matthew; Ning, Shuoyan; Branch, Donald R; Seghatchian, Jerard; Sheffield, William P

2018-04-01

Canadian Blood Services (CBS), Canada's national blood transfusion service, has for many years sponsored an annual conference, for the education and awareness of interested participants, showcasing the latest evidence-based understanding of both basic science and clinical issues in transfusion medicine and science. The 15th iteration of this symposium took place September 9, 2017 and focused on some of the vital aspects of red blood cells (RBC), in line with the" 3Rs" concept, namely the provision of the Right red blood cell (RBC) product to the Right patient at the Right time. Presentations touched upon: the evolution of blood banking in North America; the monocyte monolayer assay as a predictor of post-transfusion hemolysis; hemoglobin-based oxygen carriers; RBC alloimmunization; serological approaches to complex RBC antibody problems; randomized clinical trials related to the age of stored RBC; RBC genotyping; pathophysiology, prevention and treatment of hemolytic disease of the fetus and newborn (HDFN); and testing and timing in perinatal serology. This commentary provides summaries of all speakers' presentations annotated with relevant references. Special thanks are due to all contributors for their praiseworthy approaches in sharing their experiences and knowledge on this interesting scientific/clinical and management theme. Copyright © 2018 Elsevier Ltd. All rights reserved.

How I treat double-hit lymphoma.

PubMed

Friedberg, Jonathan W

2017-08-03

The 2016 revision of the World Health Organization (WHO) classification for lymphoma has included a new category of lymphoma, separate from diffuse large B-cell lymphoma, termed high-grade B-cell lymphoma with translocations involving myc and bcl-2 or bcl-6 . These lymphomas, which occur in <10% of cases of diffuse large B-cell lymphoma, have been referred to as double-hit lymphomas (or triple-hit lymphomas if all 3 rearrangements are present). It is important to differentiate these lymphomas from the larger group of double-expressor lymphomas, which have increased expression of MYC and BCL-2 and/or BCL-6 by immunohistochemistry, by using variable cutoff percentages to define positivity. Patients with double-hit lymphomas have a poor prognosis when treated with standard chemoimmunotherapy and have increased risk of central nervous system involvement and progression. Double-hit lymphomas may arise as a consequence of the transformation of the underlying indolent lymphoma. There are no published prospective trials in double-hit lymphoma, however retrospective studies strongly suggest that aggressive induction regimens may confer a superior outcome. In this article, I review my approach to the evaluation and treatment of double-hit lymphoma, with an eye toward future clinical trials incorporating rational targeted agents into the therapeutic armamentarium. © 2017 by The American Society of Hematology.

The Third NASA Goddard Conference on Mass Storage Systems and Technologies

NASA Technical Reports Server (NTRS)

Kobler, Benjamin (Editor); Hariharan, P. C. (Editor)

1993-01-01

This report contains copies of nearly all of the technical papers and viewgraphs presented at the Goddard Conference on Mass Storage Systems and Technologies held in October 1993. The conference served as an informational exchange forum for topics primarily relating to the ingestion and management of massive amounts of data and the attendant problems involved. Discussion topics include the necessary use of computers in the solution of today's infinitely complex problems, the need for greatly increased storage densities in both optical and magnetic recording media, currently popular storage media and magnetic media storage risk factors, data archiving standards including a talk on the current status of the IEEE Storage Systems Reference Model (RM). Additional topics addressed System performance, data storage system concepts, communications technologies, data distribution systems, data compression, and error detection and correction.

Goddard Conference on Mass Storage Systems and Technologies, Volume 1

NASA Technical Reports Server (NTRS)

Kobler, Ben (Editor); Hariharan, P. C. (Editor)

1993-01-01

Copies of nearly all of the technical papers and viewgraphs presented at the Goddard Conference on Mass Storage Systems and Technologies held in Sep. 1992 are included. The conference served as an informational exchange forum for topics primarily relating to the ingestion and management of massive amounts of data and the attendant problems (data ingestion rates now approach the order of terabytes per day). Discussion topics include the IEEE Mass Storage System Reference Model, data archiving standards, high-performance storage devices, magnetic and magneto-optic storage systems, magnetic and optical recording technologies, high-performance helical scan recording systems, and low end helical scan tape drives. Additional topics addressed the evolution of the identifiable unit for processing purposes as data ingestion rates increase dramatically, and the present state of the art in mass storage technology.

Disruptive environmental chemicals and cellular mechanisms that confer resistance to cell death

PubMed Central

Narayanan, Kannan Badri; Ali, Manaf; Barclay, Barry J.; Cheng, Qiang (Shawn); D’Abronzo, Leandro; Dornetshuber-Fleiss, Rita; Ghosh, Paramita M.; Gonzalez Guzman, Michael J.; Lee, Tae-Jin; Leung, Po Sing; Li, Lin; Luanpitpong, Suidjit; Ratovitski, Edward; Rojanasakul, Yon; Romano, Maria Fiammetta; Romano, Simona; Sinha, Ranjeet K.; Yedjou, Clement; Al-Mulla, Fahd; Al-Temaimi, Rabeah; Amedei, Amedeo; Brown, Dustin G.; Ryan, Elizabeth P.; Colacci, Anna Maria; Hamid, Roslida A.; Mondello, Chiara; Raju, Jayadev; Salem, Hosni K.; Woodrick, Jordan; Scovassi, A.Ivana; Singh, Neetu; Vaccari, Monica; Roy, Rabindra; Forte, Stefano; Memeo, Lorenzo; Kim, Seo Yun; Bisson, William H.; Lowe, Leroy; Park, Hyun Ho

2015-01-01

Cell death is a process of dying within biological cells that are ceasing to function. This process is essential in regulating organism development, tissue homeostasis, and to eliminate cells in the body that are irreparably damaged. In general, dysfunction in normal cellular death is tightly linked to cancer progression. Specifically, the up-regulation of pro-survival factors, including oncogenic factors and antiapoptotic signaling pathways, and the down-regulation of pro-apoptotic factors, including tumor suppressive factors, confers resistance to cell death in tumor cells, which supports the emergence of a fully immortalized cellular phenotype. This review considers the potential relevance of ubiquitous environmental chemical exposures that have been shown to disrupt key pathways and mechanisms associated with this sort of dysfunction. Specifically, bisphenol A, chlorothalonil, dibutyl phthalate, dichlorvos, lindane, linuron, methoxychlor and oxyfluorfen are discussed as prototypical chemical disruptors; as their effects relate to resistance to cell death, as constituents within environmental mixtures and as potential contributors to environmental carcinogenesis. PMID:26106145

HIV-2 infects resting CD4+ T cells but not monocyte-derived dendritic cells.

PubMed

Chauveau, Lise; Puigdomenech, Isabel; Ayinde, Diana; Roesch, Ferdinand; Porrot, Françoise; Bruni, Daniela; Visseaux, Benoit; Descamps, Diane; Schwartz, Olivier

2015-01-13

Human Immunodeficiency Virus-type 2 (HIV-2) encodes Vpx that degrades SAMHD1, a cellular restriction factor active in non-dividing cells. HIV-2 replicates in lymphocytes but the susceptibility of monocyte-derived dendritic cells (MDDCs) to in vitro infection remains partly characterized. Here, we investigated HIV-2 replication in primary CD4+ T lymphocytes, both activated and non-activated, as well as in MDDCs. We focused on the requirement of Vpx for productive HIV-2 infection, using the reference HIV-2 ROD strain, the proviral clone GL-AN, as well as two primary HIV-2 isolates. All HIV-2 strains tested replicated in activated CD4+ T cells. Unstimulated CD4+ T cells were not productively infected by HIV-2, but viral replication was triggered upon lymphocyte activation in a Vpx-dependent manner. In contrast, MDDCs were poorly infected when exposed to HIV-2. HIV-2 particles did not potently fuse with MDDCs and did not lead to efficient viral DNA synthesis, even in the presence of Vpx. Moreover, the HIV-2 strains tested were not efficiently sensed by MDDCs, as evidenced by a lack of MxA induction upon viral exposure. Virion pseudotyping with VSV-G rescued fusion, productive infection and HIV-2 sensing by MDDCs. Vpx allows the non-productive infection of resting CD4+ T cells, but does not confer HIV-2 with the ability to efficiently infect MDDCs. In these cells, an entry defect prevents viral fusion and reverse transcription independently of SAMHD1. We propose that HIV-2, like HIV-1, does not productively infect MDDCs, possibly to avoid triggering an immune response mediated by these cells.

17th Space Photovoltaic Research and Technology Conference

NASA Technical Reports Server (NTRS)

Jenkins, Phillip (Compiler)

2002-01-01

The 17th Space Photovoltaic Research and Technology (SPRAT XVII) Conference was held September 11-13, 2001, at the Ohio Aerospace Institute (OAI) in Cleveland, Ohio. The SPRAT conference, hosted by the Photovoltaic and Space Environments Branch of the NASA Glenn Research Center, brought together representatives of the space photovoltaic community from around the world to share the latest advances in space solar technology. This year's conference continued to build on many of the trends shown in SPRAT XVI; the use of new high-efficiency cells for commercial use and the development of novel array concepts such as Boeing's Solar Tile concept. In addition, new information was presented on space environmental interactions with solar arrays.

PAK4 confers the malignance of cervical cancers and contributes to the cisplatin-resistance in cervical cancer cells via PI3K/AKT pathway.

PubMed

Shu, Xiang-Rong; Wu, Jing; Sun, He; Chi, Li-Qun; Wang, Jin-Huan

2015-09-28

Multiple protein or microRNA markers have been recognized to contribute to the progression and recurrence of cervical cancers. Particular those, which are associated with the chemo- or radio-resistance of cervical cancers, have been proposed to be promising and to facilitate the definition for cervical cancer treatment options. This study was designed to explore the potential prognosis value of p21-activated kinase (PAK)-4 in cervical cancer, via the Kaplan-Meier analysis, log-rank test and Cox regression analysis, and then to investigate the regulatory role of PAK4 in the cisplatin resistance in cervical cancer cells, via the strategies of both PAK4 overexpression and PAK4 knockout. It was demonstrated that PAK4 was upregulated in cervical cancer tissues, in an association with the cancer's malignance variables such as FIGO stage, lymph node or distant metastasis and the poor histological grade. The high PAK4 expression was also independently associated with poor prognosis to cervical cancer patients. Moreover, PAK4 confers cisplatin resistance in cervical cancer Hela or Caski cells. In addition, the PI3K/Akt pathway has been implicated in the PAK4-confered cisplatin resistance. And the PI3K/Akt inhibitor, LY294002, markedly deteriorated the cisplatin-mediated viability reduction of Hela or Caski cells, indicating the involvement of PI3K/Akt pathway in the cisplatin resistance in cervical cancer cells. This study has confirmed the significant prognostic role of PAK4 level in cervical cancer patients and has recognized the regulatory role in cervical cancer progression. Moreover, our study has indicated that PAK4 also confers the chemoresistance of cervical cancer cells in a PI3K/Akt-dependent way. Thus, our study indicates PAK4 as a promising marker for cervical cancer treatment.

Comparison of chemotherapeutic drug resistance in cells transfected with canine ABCG2 or feline ABCG2.

PubMed

Lewis, R S; Fidel, J; Dassanayake, S; Court, M H; Burke, N S; Mealey, K L

2017-06-01

ABCG2 (ATP binding cassette subfamily G, member 2) mediates resistance to a variety of cytotoxic agents. Although human ABCG2 is well characterized, the function of canine ABCG2 has not been studied previously. Feline ABCG2 has an amino acid substitution in the adenosine triphosphate-binding domain that decreases its transport capacity relative to human ABCG2. Our goal was to compare canine ABCG2-mediated chemotherapeutic drug resistance to feline ABCG2-mediated chemotherapeutic drug resistance. HEK-293 cells stably transfected with plasmid containing canine ABCG2, feline ABCG2 or no ABCG2 were exposed to carboplatin, doxorubicin, mitoxantrone, toceranib or vincristine, and cell survival was subsequently determined. Canine ABCG2 conferred a greater degree of chemotherapy resistance than feline ABCG2 for mitoxantrone. Neither canine nor feline ABCG2 conferred resistance to doxorubicin, vincristine or toceranib. Canine, but not feline, ABCG2 conferred resistance to carboplatin, a drug that is not reported to be a substrate for ABCG2 in other species. © 2015 John Wiley & Sons Ltd.

Arginine insertion and loss of N-linked glycosylation site in HIV-1 envelope V3 region confer CXCR4-tropism

PubMed Central

Tsuchiya, Kiyoto; Ode, Hirotaka; Hayashida, Tsunefusa; Kakizawa, Junko; Sato, Hironori; Oka, Shinichi; Gatanaga, Hiroyuki

2013-01-01

The third variable region (V3) of HIV-1 envelope glycoprotein gp120 plays a key role in determination of viral coreceptor usage (tropism). However, which combinations of mutations in V3 confer a tropism shift is still unclear. A unique pattern of mutations in antiretroviral therapy-naive HIV-1 patient was observed associated with the HIV-1 tropism shift CCR5 to CXCR4. The insertion of arginine at position 11 and the loss of the N-linked glycosylation site were indispensable for acquiring pure CXCR4-tropism, which were confirmed by cell-cell fusion assay and phenotype analysis of recombinant HIV-1 variants. The same pattern of mutations in V3 and the associated tropism shift were identified in two of 53 other patients (3.8%) with CD4+ cell count <200/mm3. The combination of arginine insertion and loss of N-linked glycosylation site usually confers CXCR4-tropism. Awareness of this rule will help to confirm the tropism prediction from V3 sequences by conventional rules. PMID:23925152

Inability of spleen cells from chancre-immune rabbits to confer immunity to challenge with Treponema pallidum.

PubMed Central

Baughn, R E; Musher, D M; Simmons, C B

1977-01-01

Although several lines of evidence suggest that cellular immune mechanisms play a role in controlling infection due to Treponema pallidum, recent studies have shown that induction of acquired cellular resistance by antigenically unrelated organisms fails to protect rabbits against syphilitic infection, thereby casting doubt on this hypothesis. In the present paper we describe attempts to transfer immunity to syphilis by using spleen cells from chancre-immune rabbits. Intravenous infusion of 2 X 10(8) spleen lymphocytes was capable of transferring acquired cellular resistance to Listeria and delayed hypersensitivity to tuberculin. However, in eight separate experiments using outbred or inbred rabbits, 2 X 10(8) spleen cells from syphilis-immune animals failed to confer resistance to T. pallidum whether by intravenous or intradermal challenge. Mixing immune lymphocytes with treponemes immediately before intradermal inoculation also failed to confer resistance. Despite the fact that syphilitic infection stimulates cellular immune mechanisms and induces acquired cellular resistance to antigenically unrelated organisms, cellular immunity may not play an important role in immunity to syphilis. PMID:143456

IPPF Co-operative Information Service. February 1979.

ERIC Educational Resources Information Center

International Planned Parenthood Federation, London (England).

Bibliographic entries are classified into nine categories: (1) General Reference; (2) International Planned Parenthood Federation; (3) Family Planning; (4) Bio-Medical Research; (5) Social Sciences Related to Family Planning; (6) Education and Training; (7) Information and Communication; (8) International Organizations and Conferences; and (9)…

Cumulative reports and publications through December 31, 1994

NASA Technical Reports Server (NTRS)

1995-01-01

This document contains a complete list of Institute for Computer Applications in Science and Engineering (ICASE) reports. Since ICASE reports are intended to be preprints of articles that will appear in journals or conference proceedings, the published reference is included when it is available.

Commending the National Student Leadership Conference for organizing college campus experiences for high school students for more than 20 years.

THOMAS, 111th Congress

Rep. Watson, Diane E. [D-CA-33

2010-09-15

House - 11/18/2010 Referred to the Subcommittee on Early Childhood, Elementary, and Secondary Education. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

Mixed Media: A Roundup of New Microform and Electronic Products.

ERIC Educational Resources Information Center

Carter, Christina E.

1996-01-01

Introduces two microfilm collections, one on the Indian Wars of the 19th century and one on records of the Southern Christian Leadership Conference, and four CD-ROM references focusing on Amnesty International, multicultural America, Latin American studies, and North American Indians. (SLD)

BIBLIOGRAPHY ON LEARNING PROCESS. SUPPLEMENT II.

ERIC Educational Resources Information Center

Harvard Univ., Cambridge, MA. Graduate School of Education.

THIS SUPPLEMENTARY BIBLIOGRAPHY LISTS MATERIALS ON VARIOUS FACETS OF HUMAN LEARNING. APPROXIMATELY 60 UNANNOTATED REFERENCES ARE PROVIDED FOR DOCUMENTS DATING FROM 1954 TO 1966. JOURNAL ARTICLES, BOOKS, RESEARCH REPORTS, AND CONFERENCE PAPERS ARE LISTED. SOME SUBJECT AREAS INCLUDED ARE (1) LEARNING PARAMETERS AND ABILITY, (2) RETENTION AND…

Neutron Scattering Announcements

Science.gov Websites

will be added. We encourage everyone interested in neutron scattering to take full advantage of this neutron source ESS. After an initial layout phase using analytical considerations further assessment of Home Page | Facilities | Reference | Software | Conferences | Announcements | Mailing Lists Neutron

10 CFR 851.27 - Reference sources.

Code of Federal Regulations, 2010 CFR

2010-01-01

..., NY 10036. Telephone number: 212-642-4980, or go to: http://www.ansi.org. (iv) National Fire....nfpa.org. (v) American Conference of Governmental Industrial Hygienist (ACGIH), 1330 Kemper Meadow Drive, Cincinnati, OH 45240. Telephone number 513-742-2020, or go to: http://www.acgih.org. (vi...

To frame is to explain: a deductive frame-analysis of Dutch and French climate change coverage during the annual UN Conferences of the Parties.

PubMed

Dirikx, Astrid; Gelders, Dave

2010-11-01

This study examines the way Dutch and French newspapers frame climate change during the annual United Nations Conferences of the Parties. The methods used in previous studies on the framing of climate change do not allow for general cross-national comparisons. We conduct a quantitative deductive framing analysis on 257 quality Dutch and French newspaper articles between 2001 and 2007. Both countries' newspapers seem to frame climate change through mainly the same lens. The majority of the articles make reference to the consequences of the (non-)pursuit of a certain course of action and of possible losses and gains (consequences frame). Additionally, many articles mention the need for urgent actions, refer to possible solutions and suggest that governments are responsible for and/or capable of alleviating climate change problems (responsibility frame). Finally, the conflict frame was found to be used less often than the aforementioned frames, but more regularly than the human interest frame.

RAD18 mediates resistance to ionizing radiation in human glioma cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xie, Chen; Wang, Hongwei; Cheng, Hongbin

Highlights: • RAD18 is an important mediator of the IR-induced resistance in glioma cell lines. • RAD18 overexpression confers resistance to IR-mediated apoptosis. • The elevated expression of RAD18 is associated with recurrent GBM who underwent IR therapy. - Abstract: Radioresistance remains a major challenge in the treatment of glioblastoma multiforme (GBM). RAD18 a central regulator of translesion DNA synthesis (TLS), has been shown to play an important role in regulating genomic stability and DNA damage response. In the present study, we investigate the relationship between RAD18 and resistance to ionizing radiation (IR) and examined the expression levels of RAD18more » in primary and recurrent GBM specimens. Our results showed that RAD18 is an important mediator of the IR-induced resistance in GBM. The expression level of RAD18 in glioma cells correlates with their resistance to IR. Ectopic expression of RAD18 in RAD18-low A172 glioma cells confers significant resistance to IR treatment. Conversely, depletion of endogenous RAD18 in RAD18-high glioma cells sensitized these cells to IR treatment. Moreover, RAD18 overexpression confers resistance to IR-mediated apoptosis in RAD18-low A172 glioma cells, whereas cells deficient in RAD18 exhibit increased apoptosis induced by IR. Furthermore, knockdown of RAD18 in RAD18-high glioma cells disrupts HR-mediated repair, resulting in increased accumulation of DSB. In addition, clinical data indicated that RAD18 was significantly higher in recurrent GBM samples that were exposed to IR compared with the corresponding primary GBM samples. Collectively, our findings reveal that RAD18 may serve as a key mediator of the IR response and may function as a potential target for circumventing IR resistance in human GBM.« less

Bibliography of selected water-resources publications on Nevada by the U.S. Geological Survey, 1885 through 1995

USGS Publications Warehouse

Bunch, R.L.

1996-01-01

References to 898 water-resources publications are listed alphabetically by senior author and indexed by hydrographic-area name or other geographic features. Most of the publications were written between 1960 and 1995 by U.S. Geological Survey scientists and engineers of the Water Resources Division, Nevada District. Also included are references to publications by other Water Resources Division authors that deal with Nevada hydrology. References to publications written before 1960 are included to provide a historical perspective. The references include several types of Geological Survey book and map publications, as well as State-series reports, journal articles, conference and symposium papers, abstracts, and graduate- degree theses. Information on publication availability is provided also.

A value-based medicine comparison of interventions for subfoveal neovascular macular degeneration.

PubMed

Brown, Gary C; Brown, Melissa M; Brown, Heidi C; Kindermann, Sylvia; Sharma, Sanjay

2007-06-01

To perform a value-based medicine analysis of clinical trials that evaluate the interventions of laser photocoagulation, intravitreal pegaptanib therapy, and photodynamic therapy (PDT) with verteporfin for the treatment of classic subfoveal choroidal neovascularization. Reference case cost-utility analysis using value-based medicine principles, which use patient-based utility values and standardized, input variable criteria. Data from participants in the Macular Photocoagulation Study, Pegaptanib for Neovascular Age-Related Macular Degeneration Study, and the Treatment of Age-Related Macular Degeneration with Photodynamic Therapy Study. Visual data were converted to a value-based format using time tradeoff utility analysis values from patients with macular degeneration. Costs were obtained from 2005 Medicare data. Outcomes (quality-adjusted life-years [QALYs]) and costs were discounted at a 3% annual rate. Interventional QALYs gained, percent improvement in quality of life, and dollars spent per QALY gained. Laser photocoagulation confers a 4.4% (P = 0.03 versus pegaptanib therapy) improvement in quality of life for the reference case, whereas pegaptanib therapy confers a 5.9% improvement and PDT confers an 8.1% (P = 0.0002 versus pegaptanib therapy) improvement. The cost-utility associated with laser photocoagulation is $8179, that for pegaptanib therapy is $66978, and that for PDT is $31544. All sensitivity analyses remain within the conventional standards of cost-effectiveness. Photodynamic therapy confers greater patient value than intravitreal pegaptanib therapy and laser photocoagulation for the treatment of classic subfoveal choroidal neovascularization. Despite the fact that laser photocoagulation is the most cost-effective intervention, both PDT and pegaptanib therapy deliver greater value, and thus are both preferred over laser photocoagulation. Using an economic measure, photodynamic therapy is the preferred treatment among these 3 interventions.

Titan Cells Confer Protection from Phagocytosis in Cryptococcus neoformans Infections

PubMed Central

Okagaki, Laura H.

2012-01-01

The human fungal pathogen Cryptococcus neoformans produces an enlarged “titan” cell morphology when exposed to the host pulmonary environment. Titan cells exhibit traits that promote survival in the host. Previous studies showed that titan cells are not phagocytosed and that increased titan cell production in the lungs results in reduced phagocytosis of cryptococcal cells by host immune cells. Here, the effect of titan cell production on host-pathogen interactions during early stages of pulmonary cryptococcosis was explored. The relationship between titan cell production and phagocytosis was found to be nonlinear; moderate increases in titan cell production resulted in profound decreases in phagocytosis, with significant differences occurring within the first 24 h of the infection. Not only were titan cells themselves protected from phagocytosis, but titan cell formation also conferred protection from phagocytosis to normal-size cryptococcal cells. Large particles introduced into the lungs were not phagocytosed, suggesting the large size of titan cells protects against phagocytosis. The presence of large particles was unable to protect smaller particles from phagocytosis, revealing that titan cell size alone is not sufficient to provide the observed cross-protection of normal-size cryptococcal cells. These data suggest that titan cells play a critical role in establishment of the pulmonary infection by promoting the survival of the entire population of cryptococcal cells. PMID:22544904

Titan cells confer protection from phagocytosis in Cryptococcus neoformans infections.

PubMed

Okagaki, Laura H; Nielsen, Kirsten

2012-06-01

The human fungal pathogen Cryptococcus neoformans produces an enlarged "titan" cell morphology when exposed to the host pulmonary environment. Titan cells exhibit traits that promote survival in the host. Previous studies showed that titan cells are not phagocytosed and that increased titan cell production in the lungs results in reduced phagocytosis of cryptococcal cells by host immune cells. Here, the effect of titan cell production on host-pathogen interactions during early stages of pulmonary cryptococcosis was explored. The relationship between titan cell production and phagocytosis was found to be nonlinear; moderate increases in titan cell production resulted in profound decreases in phagocytosis, with significant differences occurring within the first 24 h of the infection. Not only were titan cells themselves protected from phagocytosis, but titan cell formation also conferred protection from phagocytosis to normal-size cryptococcal cells. Large particles introduced into the lungs were not phagocytosed, suggesting the large size of titan cells protects against phagocytosis. The presence of large particles was unable to protect smaller particles from phagocytosis, revealing that titan cell size alone is not sufficient to provide the observed cross-protection of normal-size cryptococcal cells. These data suggest that titan cells play a critical role in establishment of the pulmonary infection by promoting the survival of the entire population of cryptococcal cells.

Space Electrochemical Research and Technology Conference: Abstracts

NASA Technical Reports Server (NTRS)

1989-01-01

The objectives of the conference were to examine current technologies, research efforts, and advanced ideas, and to identify technical barriers which affect the advancement of electrochemical energy storage systems for space applications. Papers were presented and workshops were conducted in four technical areas: advanced concepts, hydrogen-oxygen fuel cells and electrolyzers, the nickel electrode, and advanced rechargeable batteries.

Geothermal resources: exploration and exploitation. A bibliography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

This comprehensive bibliography contains 5476 citations of foreign and domestic research reports, journal articles, patents, conference proceedings, and books concerned with the exploration and exploitation of geothermal resources. The coverage dates back as far as useful references could be obtained and extends through June 1976. References are arranged in broad subject categories and are made up of complete bibliographic citations. These are followed by a listing of subject descriptors used to describe the subject content of each reference. Four indexes are included: Corporate, Personal Author, Subject, and Report Number. Also included is a list of journals from which articles weremore » selected. (LBS)« less

The International Society of Urological Pathology (ISUP) Vancouver Classification of Renal Neoplasia.

PubMed

Srigley, John R; Delahunt, Brett; Eble, John N; Egevad, Lars; Epstein, Jonathan I; Grignon, David; Hes, Ondrej; Moch, Holger; Montironi, Rodolfo; Tickoo, Satish K; Zhou, Ming; Argani, Pedram

2013-10-01

The classification working group of the International Society of Urological Pathology consensus conference on renal neoplasia was in charge of making recommendations regarding additions and changes to the current World Health Organization Classification of Renal Tumors (2004). Members of the group performed an exhaustive literature review, assessed the results of the preconference survey and participated in the consensus conference discussion and polling activities. On the basis of the above inputs, there was consensus that 5 entities should be recognized as new distinct epithelial tumors within the classification system: tubulocystic renal cell carcinoma (RCC), acquired cystic disease-associated RCC, clear cell (tubulo) papillary RCC, the MiT family translocation RCCs (in particular t(6;11) RCC), and hereditary leiomyomatosis RCC syndrome-associated RCC. In addition, there are 3 rare carcinomas that were considered as emerging or provisional new entities: thyroid-like follicular RCC; succinate dehydrogenase B deficiency-associated RCC; and ALK translocation RCC. Further reports of these entities are required to better understand the nature and behavior of these highly unusual tumors. There were a number of new concepts and suggested modifications to the existing World Health Organization 2004 categories. Within the clear cell RCC group, it was agreed upon that multicystic clear cell RCC is best considered as a neoplasm of low malignant potential. There was agreement that subtyping of papillary RCC is of value and that the oncocytic variant of papillary RCC should not be considered as a distinct entity. The hybrid oncocytic chromophobe tumor, which is an indolent tumor that occurs in 3 settings, namely Birt-Hogg-Dubé Syndrome, renal oncocytosis, and as a sporadic neoplasm, was placed, for the time being, within the chromophobe RCC category. Recent advances related to collecting duct carcinoma, renal medullary carcinoma, and mucinous spindle cell and tubular RCC were elucidated. Outside of the epithelial category, advances in our understanding of angiomyolipoma, including the epithelioid and epithelial cystic variants, were considered. In addition, the apparent relationship between cystic nephroma and mixed epithelial and stromal tumor was discussed, with the consensus that these tumors form a spectrum of neoplasia. Finally, it was thought that the synovial sarcoma should be removed from the mixed epithelial and mesenchymal category and placed within the sarcoma group. The new classification is to be referred to as the International Society of Urological Pathology Vancouver Classification of Renal Neoplasia.

Rapid sequence evolution of street rabies glycoprotein is related to the highly heterogeneous nature of the viral population.

PubMed

Benmansour, A; Brahimi, M; Tuffereau, C; Coulon, P; Lafay, F; Flamand, A

1992-03-01

The sequence of the glycoprotein gene of a street rabies virus was determined directly using fragments of a rabid dog brain after PCR amplification. Compared with that of the prototype strain CVS, this sequence displayed 10% divergence in overall amino acid composition. However only 6% divergence was noted in the ectodomain suggesting that structural constraints are exerted on this portion of the glycoprotein. A human strain isolated on cell culture from the saliva of a patient with clinical rabies had only five amino acid differences with the canine isolate, an indication of their close relatedness. These differences could have originated during transmission from dog to dog, or from dog to man, or during isolation on cell culture; they are nonetheless indicative of a genetic evolution of street rabies virus. This evolution was further evidenced by the selection of cell-adapted variants which displayed new amino acid substitutions in the glycoprotein. One of them concerned antigenic site III where arginine at position 333 was replaced by glutamine. As expected this substitution conferred resistance to a site IIIa monoclonal antibody (MAb), but surprisingly did not abolish neurovirulence for adult mice. However, a decrease in the neurovirulence of the cell-adapted variant in the presence of a site IIIa specific MAb was noted, suggesting that neurovirulence was due to a subpopulation neutralizable by the MAb. Simultaneous presence of both the parental and variant sequences was indeed evidenced in the brain of a mouse inoculated with the cell-adapted variant; during multiplication in the mouse brain, the frequency of the parental sequence rose from less than 10% to nearly 50%, indicating the selective advantage conferred by arginine 333 in nervous tissue. Altogether these results were suggestive of an intrinsic heterogeneity of street rabies virus. This heterogeneity was further demonstrated by the sequencing of molecular clones of the glycoprotein gene, which revealed that only one-third of the viral genomes present in the brain of a rabid dog had the consensus sequence. Two-thirds of the clones analyzed displayed from one to three amino acid substitutions. Such heterogeneous populations have been referred to as quasispecies, a concept which implies heterogeneous populations kept together in a dynamic equilibrium. This equilibrium could be rapidly displaced, giving the virus the capacity to adapt easily to new environmental conditions.

[Bioaerosol concentrations and the identification of aerosolized bacteria by 16S rDNA analysis in work environments].

PubMed

Ishimatsu, Sumiyo; Abe, Hiroki; Fukuda, Kazumasa; Ishidao, Toru; Taniguchi, Hatsumi; Hori, Hajime

2007-03-01

Bioaerosols cause sick building syndrome (SBS) and allergy. Many kinds of bioaerosol impactors are used for measurement of airborne microorganism concentrations in Japan. However, because the impactors are set on agar plates, some microorganisms cannot make colonies on the plates because of their lower viability or demands of nutrition. On the other hand, by double staining using ethidium bromide (EtBr) and carboxyfluorescein diacetate (CFDA), both total cells and cells with esterase activities can be detected without incubation. In this study, we calculated total cell concentrations and percentages of cells with esterase activities by the combination of filter sampling and double staining (EtBr and CFDA) from air of a laboratory, a conference room and outdoors. Temperature and humidity in the laboratory were constantly kept by an air conditioner, but in the conference room, an air conditioner was only operated sometimes because of its low frequency of use. There were no significant differences between total cell concentrations and humidity in both rooms, but increase of the percentages of cells with esterase activities depended on rainfall before the samplings (n=15, p<0.05 by Mann-Whitney test). The increase of active microorganisms by rainfall should be considered when we evaluate the risk of bioaerosols in the workplace. There were few differences in classifications of aerosolized bacteria by 16S rDNA sequence-based homology between the laboratory and the conference room. In both rooms, few pathogenic bacteria were observed.

Rebuilding the Injured Lung

PubMed Central

2015-01-01

The 57th annual Thomas L. Petty Aspen Lung Conference, entitled “Rebuilding the Injured Lung,” was held from June 4 to 7, 2014 at the Gant Conference Center in Aspen, Colorado. Investigators from a wide range of disciplines and perspectives convened to discuss the biology of lung injury, how the lung repairs itself, how and why repair fails, and how the repair process can be enhanced. Among the challenges identified in the course of the conference was how to develop more predictive experimental models that capture the multidimensional complexity of lung injury and repair in a tractable manner. From such approaches that successfully fuse the biological and physical sciences, the group envisioned that new therapies for acute and chronic lung injury would emerge. The discussion of experimental therapeutics ranged from pharmaceuticals and cells that interdict fibrosis and enhance repair to a de novo lung derived from stem cells repopulating a decellularized matrix. PMID:25830839

35th International Conference of High Energy Physics

NASA Astrophysics Data System (ADS)

The French particle physics community is particularly proud to have been selected to host the 35th ICHEP conference in 2010 in Paris. This conference is the focal point of all our field since more than fifty years and is the reference event where all important results in particle physics cosmology and astroparticles are presented and discussed. This alone suffices to make this event very important. But in 2010, a coincidence of exceptional events will make this conference even more attractive! What is then so special about ICHEP 2010 conference? It will be the first ICHEP conference where physics results obtained at the LHC will be presented! New results about the elusive Higgs boson, or signals of physics beyond the standard model might therefore be announced at this conference! Major discoveries in other domains such as gravitational waves, neutrino telescopes, neutrino oscillations, dark matter or in the flavour sector are also possible, just to name a few. In addition , 2010 will be an important date to shape up the future of our field. Several major projects will present the status of their Conceptual or Engineering Design Reports during the conference. The International Linear Collider (ILC) Global Design Effort team will present the report corresponding to the end of their Technical Design Phase 1. The Compact Linear Collider (CLIC) will also report on its Conceptual Design Report. Other major projects such as Super B factories will also be presented. These reports together with LHC physics results will form the basis for key political decisions needed to be taken in the years to come. In summary, there can be no doubt that Paris is the place to be in summer 2010 for anyone interested in High Energy Physics and we will make every effort to make your stay as interesting and enjoyable as possible.

Castles and cuitlacoche: the first international Ustilago conference.

PubMed

Kronstad, J W

2003-04-01

The first international Ustilago conference was held in Marburg, Germany from August 22 to 25, 2002. The meeting focused on molecular genetic and cell biology research with Ustilago maydis, the causative agent of common smut of maize. This fungus has emerged as a useful experimental organism for studying the biology of basidiomycete fungi, with a particular emphasis on the interaction of the fungus with the host plant. Thus presentations at the meeting covered the range of current research topics including DNA recombination and repair, mating and sexual development, phytopathology, cell biology, the cell cycle, signaling, and genomics. The meeting also highlighted historical aspects of U. maydis research with presentations by pioneers in the field including Robin Holiday (recombination), Yigal Koltin (killer phenomenon) and Peter Day (plant pathology).

Sickle Cell Trait, Exercise, and Altitude.

ERIC Educational Resources Information Center

Eichner, Edward R.

1986-01-01

Sickle cell trait is generally benign and does not shorten life, but it may confer some small risk with extremes of exercise or altitude. Research concerning these risks is presented, and it is concluded sickle cell trait is no barrier to outstanding athletic performance. (Author/MT)

Neomorphic Mutations in PIK3R1 Confer Sensitivity to MAPK Inhibitors due to Activation of ERK and JNK Pathways | Office of Cancer Genomics

Cancer.gov

In a recent publication in Cancer Cell, CTD2 investigators discovered that a known cancer-associated gain-of-function alteration in phosphoinositide-3-kinase regulatory subunit 1 (PIK3R1) results in novel protein activity that confers sensitivity to mitogen-activated protein kinase (MAPK) inhibitors. The PIK3R1 gene encodes the p85α regulatory subunit of PIK3. Under normal conditions, p85α suppresses PIK3 mediated activation of downstream pathways that promote cell growth and survival.

Acute kidney injury in the ICU: from injury to recovery: reports from the 5th Paris International Conference.

PubMed

Bellomo, Rinaldo; Ronco, Claudio; Mehta, Ravindra L; Asfar, Pierre; Boisramé-Helms, Julie; Darmon, Michael; Diehl, Jean-Luc; Duranteau, Jacques; Hoste, Eric A J; Olivier, Joannes-Boyau; Legrand, Matthieu; Lerolle, Nicolas; Malbrain, Manu L N G; Mårtensson, Johan; Oudemans-van Straaten, Heleen M; Parienti, Jean-Jacques; Payen, Didier; Perinel, Sophie; Peters, Esther; Pickkers, Peter; Rondeau, Eric; Schetz, Miet; Vinsonneau, Christophe; Wendon, Julia; Zhang, Ling; Laterre, Pierre-François

2017-12-01

The French Intensive Care Society organized its yearly Paris International Conference in intensive care on June 18-19, 2015. The main purpose of this meeting is to gather the best experts in the field in order to provide the highest quality update on a chosen topic. In 2015, the selected theme was: "Acute Renal Failure in the ICU: from injury to recovery." The conference program covered multiple aspects of renal failure, including epidemiology, diagnosis, treatment and kidney support system, prognosis and recovery together with acute renal failure in specific settings. The present report provides a summary of every presentation including the key message and references and is structured in eight sections: (a) diagnosis and evaluation, (b) old and new diagnosis tools, (c) old and new treatments, (d) renal replacement therapy and management, (e) acute renal failure witness of other conditions, (f) prognosis and recovery, (g) extracorporeal epuration beyond the kidney, (h) the use of biomarkers in clinical practice http://www.srlf.org/5th-paris-international-conference-jeudi-18-et-vendredi-19-juin-2015/ .

Gold nanoparticle plasmonics enhanced ultrafast laser-induced optoporation and stimulation of targeted cells (Conference Presentation)

NASA Astrophysics Data System (ADS)

Meunier, Michel; Bergeron, Éric; Lavoie-Cardinal, Flavie; Boutopoulos, Christos; Salesse, Charleen; Winnik, Françoise M.; De Koninck, Paul

2016-03-01

Gold nanoparticles (AuNPs) have found numerous applications in nanomedicine in view of their robustness, ease of functionalization and low toxicity. Upon irradiation of AuNPs by a pulsed ultrafast laser, various highly localized phenomena can be obtained including a temperature rise, pressure wave, charge injection and production of nanobubbles close to the cellular membrane [1]. These phenomena can be used to manipulate, optoperforate, transfect and stimulate targeted cells [2-5]. Irradiating at 800 nm in the optically biological transparent window, we demonstrated local optoporation and transfection of cells as well as local stimulation of neurons. Two recent examples will be given: (i) Laser-induced selective optoporation of cells: The technique can be used on various types of cells and a proof of principle will be given on human cancer cells in a co-culture using functionalized AuNPs [6]. (ii) Laser-induced stimulation of neurons and monitoring of the localized Ca2+ signaling: This all optical method uses a standard confocal microscope to trigger a transient increase in free Ca2+ in neurons covered by functionalized AuNPs as well as to measure these local variations optically with the Ca2+ sensor GCaMP6s [7]. The proposed techniques provide a new complement to light-dependent methods in neuroscience. REFERENCES (by our group): (1) Boulais, J. Photochem. Photobiol. C Photochem. Rev. 17, 26 (2013); (2) Baumgart, Biomaterials 33, 2345 (2012); (3) Boulais, NanoLett. 12, 4763 (2012); (4) Boutopoulos, J. Biophotonics (2015); (5) Boutopoulos, Nanoscale 7, 11758 (2015); (6) Bergeron, Biomaterials, submitted (2015); (7) Lavoie-Cardinal, Nature Commun. submitted (2015).

Systemic mastocytosis--a systematic review.

PubMed

Andersen, Christen Lykkegaard; Kristensen, Thomas Kielsgaard; Severinsen, Marianne Tang; Møller, Michael Boe; Vestergaard, Hanne; Bergmann, Olav J; Hasselbalch, Hans Carl; Bjerrum, Ole Weis

2012-03-01

The mast cell lives a hidden life, but it is implicated in several physiological reactions. Its ability to react to different stimuli impacts a variety of conditions such as asthma, atopic dermatitis, urticaria and anaphylaxis. It is not until recent decades that the evolution of the cell has been described and its fascinating biology has only recently been depicted. We here give a review of systemic mastocytosis in regards to cell biology, diagnostic approaches and clinical practice. A search was made in PubMed in August 2011 entering the keywords: mastocytosis, (systemic, cutaneous, aggressive), mast cell leukaemia, mast cell sarcoma, chromosome, mutation, haematology and treatment. Mastocytosis is characterized by an abnormal proliferation of mast cells, which accumulate in one or several organ systems, primarily the skin and bone marrow. The disease is clinically heterogeneous and varies from a relatively benign condition with isolated cutaneous lesions to a very aggressive systemic condition with a grave prognosis. The condition affects men and women equally. Children are especially affected by the cutaneous form. In most children, the condition will improve or remit spontaneously before adulthood. Mastocytosis in adults, however, is more often systemic and tends to persist. Patients with mastocytosis represent a heterogeneous group in terms of clinical presentation, management and prognosis. Furthermore, a range of medical specialties serve as the primary entrance to health services, which can be a challenge in respect of achieving uniform management. In order to improve diagnostics and management of systemic mastocytosis, the European Competence Network on Mastocytosis has been established. Patients under suspicion of systemic mastocytosis should be conferred with or referred to a haematological and a dermatological/allergological department.

Organizing the Cellular and Molecular Heterogeneity in High-Grade Serous Ovarian Cancer by Mass Cytometry

DTIC Science & Technology

2014-10-01

Bendall SC, Sung P, Nolan GP, Arvin AM. Single-cell mass cytometry analysis of human tonsil T cell remodeling by varicella zoster virus. Cell Rep...Perspectives on Flow Cytometry 2013, September 20, 2013, Mass Cytometry and Cell Cycle, Mexico City, Mexico (by Web Conference) Nolan: Nuclear

Working together for the common good: cell-cell communication in bacteria.

PubMed

Stevens, Ann M; Schuster, Martin; Rumbaugh, Kendra P

2012-05-01

The 4th ASM Conference on Cell-Cell Communication in Bacteria was held in Miami, FL, from 6 to 9 November 2011. This review highlights three key themes that emerged from the many exciting talks and poster presentations in the area of quorum sensing: sociomicrobiology, signal transduction mechanisms, and interspecies communication.

Thymidine Kinase 1 Loss Confers Trifluridine Resistance without Affecting 5-Fluorouracil Metabolism and Cytotoxicity.

PubMed

Edahiro, Keitaro; Iimori, Makoto; Kobunai, Takashi; Morikawa-Ichinose, Tomomi; Miura, Daisuke; Kataoka, Yuki; Niimi, Shinichiro; Wakasa, Takeshi; Saeki, Hiroshi; Oki, Eiji; Kitao, Hiroyuki; Maehara, Yoshihiko

2018-06-04

Acquired resistance to therapeutic drugs is a serious problem for cancer patients receiving systemic treatment. Experimentally, drug resistance is established in cell lines in vitro by repeated, continuous exposure to escalating concentrations of the drug; however, the precise mechanism underlying the acquired resistance is not always known. Here, it is demonstrated that the human colorectal cancer cell line DLD1 with acquired resistance to trifluridine (FTD), a key component of the novel, orally administered nucleoside analog-type chemotherapeutic drug trifluridine/tipiracil, lacks functional thymidine kinase 1 (TK1) expression because of one nonsense mutation in the coding exon. Targeted disruption of the TK1 gene also conferred severe FTD resistance, indicating that the loss of TK1 protein expression is the primary cause of FTD resistance. Both FTD-resistant DLD1 cells and DLD1-TK1-/- cells exhibited similar 5-fluorouracil (5-FU) sensitivity to that of the parental DLD1 line. The quantity of cellular pyrimidine nucleotides in these cells and the kinetics of thymidylate synthase ternary complex formation in 5-FU-treated cells is similar to DLD1 cells, indicating that 5-FU metabolism and cytotoxicity were unaffected. The present data provide molecular-based evidence that acquired resistance to FTD does not confer 5-FU resistance, implying that 5-FU-based chemotherapy would be effective even in tumors that become refractory to FTD during trifluridine/tipiracil treatment. 5-fluorouracil-based chemotherapy would be effective even in tumors that become refractory to trifluridine during combined trifluridine/tipiracil treatment. Copyright ©2018, American Association for Cancer Research.

Update 76: Selected Recent Works in the Social Sciences.

ERIC Educational Resources Information Center

Pike, Mary L., Ed.; Lusignan, Louise, Ed.

This is a selected bibliography of current reference and acquisition tools in the social sciences. The tools include sourcebooks, dictionaries, indexes, conference proceedings, special bibliographies, directories, research reports, and journals. Most citations represent works published since 1970 and new editions of important earlier works.…

40 CFR 164.50 - Prehearing conference and primary discovery.

Code of Federal Regulations, 2012 CFR

2012-07-01

... possibility of obtaining stipulations of fact and documents which will avoid unnecessary delay; (4) Matters of... any party desires that questions of scientific fact be referred to a committee designated by the National Academy of Sciences. (2) Preparation of questions. On determining an affirmative intent, the...

40 CFR 164.50 - Prehearing conference and primary discovery.

Code of Federal Regulations, 2011 CFR

2011-07-01

... possibility of obtaining stipulations of fact and documents which will avoid unnecessary delay; (4) Matters of... any party desires that questions of scientific fact be referred to a committee designated by the National Academy of Sciences. (2) Preparation of questions. On determining an affirmative intent, the...

40 CFR 164.50 - Prehearing conference and primary discovery.

Code of Federal Regulations, 2010 CFR

2010-07-01

... possibility of obtaining stipulations of fact and documents which will avoid unnecessary delay; (4) Matters of... any party desires that questions of scientific fact be referred to a committee designated by the National Academy of Sciences. (2) Preparation of questions. On determining an affirmative intent, the...

40 CFR 164.50 - Prehearing conference and primary discovery.

Code of Federal Regulations, 2013 CFR

2013-07-01

... possibility of obtaining stipulations of fact and documents which will avoid unnecessary delay; (4) Matters of... any party desires that questions of scientific fact be referred to a committee designated by the National Academy of Sciences. (2) Preparation of questions. On determining an affirmative intent, the...

40 CFR 164.50 - Prehearing conference and primary discovery.

Code of Federal Regulations, 2014 CFR

2014-07-01

... possibility of obtaining stipulations of fact and documents which will avoid unnecessary delay; (4) Matters of... any party desires that questions of scientific fact be referred to a committee designated by the National Academy of Sciences. (2) Preparation of questions. On determining an affirmative intent, the...

Chemical Weapons Treaty Technologies Reference Collection - 1997 Supplement

DTIC Science & Technology

1999-11-01

INFRARED SPECTROSCOPY (FTIR). EDGEWOOD...102034 CB-102751 CB-102954 CB-103165 FIRST REVIEW CONFERENCE CB-103294 FLOW SCHEMATICS CB-103106 FOURIER TRANSFORM INFRARED SPECTROSCOPY CB... INFRARED SPECTROSCOPY CB-100365 CB-101343 CB-102248 CB-102715 CB-102759 CB-102768 CB-102805 CB-102880 INFRARED SPECTROSCOPY (Continued)

Development of the Next Generation of Adaptive Interfaces

DTIC Science & Technology

2015-03-01

References Drury JL, Riek L, Rackliffe N. A decomposition of UAV-related situation awareness. Proceedings of Human- Robot Interaction Conference, Salt Lake...317 FORT BELVOIR VA 22060-5828 1 ARMY RSCH LABORATORY – HRED (PDF) RDRL HRM AY M BARNES 2520 HEALY AVE STE 1172 BLDG 51005

ELECTRIC MOTORS FOR FARM USE.

ERIC Educational Resources Information Center

Illinois Univ., Urbana. Coll. of Agriculture.

BETWEEN 2 AND 8 HOURS ARE REQUIRED FOR USE OF THIS TEXTUAL OR REFERENCE MATERIAL ON ELECTRIC MOTORS. IT WAS DEVELOPED BY AN AGRICULTURAL EDUCATION-AGRICULTURAL ENGINEERING SPECIALIST ON THE BASIS OF CONFERENCES WITH SUBJECT MATTER SPECIALISTS, TEACHER EDUCATORS, SUPERVISORS, AND TEACHERS. THE OBJECTIVES AND SUBJECT MATTER CENTER AROUND THE…

29 CFR 1910.6 - Incorporation by reference.

Code of Federal Regulations, 2012 CFR

2012-07-01

... purchase from the American Conference of Governmental Industrial Hygienists (ACGIH), 1014 Broadway, Cincinnati OH 45202: (1) “Industrial Ventilation: A Manual of Recommended Practice” (22nd ed., 1995...: http://www.ansi.org. (1)-(2) [Reserved] (3) ANSI A11.1-65 (R 70) Practice for Industrial Lighting, IBR...

Lunar and Planetary Science XXXIII

NASA Technical Reports Server (NTRS)

2002-01-01

This CD-ROM publication contains the extended abstracts that were accepted for presentation at the 33rd Lunar and Planetary Science Conference held in Houston, TX, March 11-15, 2002. The papers are presented in PDF format and are indexed by author, keyword, meteorite, program and samples for quick reference.

Lunar and Planetary Science XXXII

NASA Technical Reports Server (NTRS)

2001-01-01

This CD-ROM publication contains the extended abstracts that were accepted for presentation at the 32nd Lunar and Planetary Science Conference held at Houston, TX, March 12-16, 2001. The papers are presented in PDF format and are indexed by author, keyword, meteorite, program and samples for quick reference.

Congratulating the six-time Defending Mid-American Conference Champion Bowling Green State University women's basketball team on another outstanding and record-setting season.

THOMAS, 111th Congress

Rep. Latta, Robert E. [R-OH-5

2010-03-25

House - 04/30/2010 Referred to the Subcommittee on Higher Education, Lifelong Learning, and Competitiveness. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

A 60 Meter Delay Stabilized Microwave Fiber Optic Link for 5.3 GHz Reference Signal Distribution on the Shuttle Radar Topography Mapper

NASA Technical Reports Server (NTRS)

Lutes, G.; Tu, M.; McWatters, D.

1999-01-01

The Photonic Systems for Antenna Applications Symposium (PSAA) is the primary conference devoted exclusively to the exchange of information on the technology and application of photonics in antenna, phased array, and sensor systems.

Mutations Enhancing Amino Acid Catabolism Confer a Growth Advantage in Stationary Phase

PubMed Central

Zinser, Erik R.; Kolter, Roberto

1999-01-01

Starved cultures of Escherichia coli undergo successive rounds of population takeovers by mutants of increasing fitness. These mutants express the growth advantage in stationary phase (GASP) phenotype. Previous work identified the rpoS819 allele as a GASP mutation allowing cells to take over stationary-phase cultures after growth in rich media (M. M. Zambrano, D. A. Siegele, M. A. Almirón, A. Tormo, and R. Kolter, Science 259:1757–1760, 1993). Here we have identified three new GASP loci from an aged rpoS819 strain: sgaA, sgaB, and sgaC. Each locus is capable of conferring GASP on the rpoS819 parent, and they can provide successively higher fitnesses for the bacteria in the starved cultures. All four GASP mutations isolated thus far allow for faster growth on both individual and mixtures of amino acids. Each mutation confers a growth advantage on a different subset of amino acids, and these mutations act in concert to increase the overall catabolic capacity of the cell. We present a model whereby this enhanced ability to catabolize amino acids is responsible for the fitness gain during carbon starvation, as it may allow GASP mutants to outcompete the parental cells when growing on the amino acids released by dying cells. PMID:10482523

The Second Pediatric Blood and Marrow Transplant Consortium International Consensus Conference on Late Effects after Pediatric Hematopoietic Cell Transplantation (HCT): Defining the Unique Late Effects of Children undergoing HCT for Immune Deficiencies, Inherited Marrow Failure Disorders, and Hemoglobinopathies

PubMed Central

Dietz, Andrew C.; Duncan, Christine N.; Alter, Blanche P.; Bresters, Dorine; Cowan, Morton J.; Notarangelo, Luigi; Rosenberg, Philip S.; Shenoy, Shalini; Skinner, Roderick; Walters, Mark C.; Wagner, John; Baker, K. Scott; Pulsipher, Michael A.

2016-01-01

An international consensus conference sponsored by the Pediatric Blood and Marrow Transplant consortium entitled, “Late Effects Screening and Recommendations Following Allogeneic Hematopoietic Cell Transplant for Immune Deficiency and Non-malignant Hematologic Disease was held in Minneapolis, Minnesota on May 10–11, 2016. The purpose of the conference was to address the unmet need for a greater understanding of and the screening for long-term complications in the growing population of survivors of transplantation for nonmalignant disorders. The conference focused on transplantation for hemoglobinopathy, immune deficiency, and inherited bone marrow syndromes. A multidisciplinary group of experts in the disease areas and transplant late effects presented the current state of understanding of how the underlying disease, pretransplant therapies, and transplant related factors uniquely interact to influence the development of late toxicities. Recommendations were put forth by the group for the late effects screening of survivors of transplantation for these non-malignant disorders. The findings and recommendations that came from this conference will be presented in a series of six additional manuscripts in the upcoming months. In this manuscript we explore the need for screening practices specific to the survivors of transplantation for non-malignant diseases and the metholodologic challenges associated with the study of these patients. PMID:27737772

Solitary BioY Proteins Mediate Biotin Transport into Recombinant Escherichia coli

PubMed Central

Finkenwirth, Friedrich; Kirsch, Franziska

2013-01-01

Energy-coupling factor (ECF) transporters form a large group of vitamin uptake systems in prokaryotes. They are composed of highly diverse, substrate-specific, transmembrane proteins (S units), a ubiquitous transmembrane protein (T unit), and homo- or hetero-oligomeric ABC ATPases. Biotin transporters represent a special case of ECF-type systems. The majority of the biotin-specific S units (BioY) is known or predicted to interact with T units and ABC ATPases. About one-third of BioY proteins, however, are encoded in organisms lacking any recognizable T unit. This finding raises the question of whether these BioYs function as transporters in a solitary state, a feature ascribed to certain BioYs in the past. To address this question in living cells, an Escherichia coli K-12 derivative deficient in biotin synthesis and devoid of its endogenous high-affinity biotin transporter was constructed as a reference strain. This organism is particularly suited for this purpose because components of ECF transporters do not naturally occur in E. coli K-12. The double mutant was viable in media containing either high levels of biotin or a precursor of the downstream biosynthetic path. Importantly, it was nonviable on trace levels of biotin. Eight solitary bioY genes of proteobacterial origin were individually expressed in the reference strain. Each of the BioYs conferred biotin uptake activity on the recombinants, which was inferred from uptake assays with [3H]biotin and growth of the cells on trace levels of biotin. The results underscore that solitary BioY transports biotin across the cytoplasmic membrane. PMID:23836870

Alloexposed blood donors and transfusion-related acute lung injury: a case-referent study.

PubMed

Middelburg, Rutger A; van Stein, Daniëlle; Atsma, Femke; Wiersum-Osselton, Johanna C; Porcelijn, Leendert; Beckers, Erik A M; Briët, Ernest; van der Bom, Johanna G

2011-10-01

Donor white blood cell (WBC) antibodies are thought to increase the risk of transfusion-related acute lung injury (TRALI). WBC antibodies can be present in blood products from donors who have been alloexposed. Alloexposed donors are increasingly excluded from donating plasma, but can still donate plasma-poor products. We aimed to quantify the contribution of alloexposed donors to the occurrence of TRALI for different blood product types. We performed a case-referent study including all reported TRALI patients and all Dutch blood donors. Data on alloexposure status of donors of all TRALI cases reported between January 2004 and October 2008, in the Netherlands, were compared to information on the total donor population. Alloexposure status of all 223 involved donors was compared to the expected status. The overall percentage of TRALI cases that could have been prevented by the deferral of all alloexposed donors (i.e., population-attributable risk [PAR]) was 51% (95% confidence interval [CI], 14%-88%). In 19 recipients of exclusively plasma-poor products (mostly red blood cells [RBCs]), alloexposure of the donors was not associated with TRALI, while in 28 recipients of both plasma-poor and plasma-rich products (>200 mL plasma), the PAR was 94% (95% CI, 34%-100%). Alloexposed donors conferred an increased risk of TRALI in recipients of plasma-rich products, but not in recipients of plasma-poor products. Although WBC antibodies are an important risk factor for TRALI, among RBC recipients another risk factor must be more important. © 2011 American Association of Blood Banks.

Confinement and Structural Changes in Vertically Aligned Dust Structures

NASA Astrophysics Data System (ADS)

Hyde, Truell

2013-10-01

In physics, confinement is known to influence collective system behavior. Examples include coulomb crystal variants such as those formed from ions or dust particles (classical), electrons in quantum dots (quantum) and the structural changes observed in vertically aligned dust particle systems formed within a glass box placed on the lower electrode of a Gaseous Electronics Conference (GEC) rf reference cell. Recent experimental studies have expanded the above to include the biological domain by showing that the stability and dynamics of proteins confined through encapsulation and enzyme molecules placed in inorganic cavities such as those found in biosensors are also directly influenced by their confinement. In this paper, the self-assembly and subsequent collective behavior of structures formed from n, charged dust particles interacting with one another and located within a glass box placed on the lower, powered electrode of a GEC rf reference cell is discussed. Self-organized formation of vertically aligned one-dimensional chains, two-dimensional zigzag structures, and three-dimensional helical structures of triangular, quadrangular, pentagonal, hexagonal, and heptagonal symmetries are shown to occur. System evolution is shown to progress from one-dimensional chain structures, through a zigzag transition to a two-dimensional, spindle like structures, and then to various three-dimensional, helical structures exhibiting various symmetries. Stable configurations are shown to be strongly dependent upon system confinement. The critical conditions for structural transitions as well as the basic symmetry exhibited by the one-, two-, and three-dimensional structures that subsequently develop will be shown to be in good agreement with molecular dynamics simulations.

PREFACE: 5th Baltic Conference on Silicate Materials

NASA Astrophysics Data System (ADS)

Mezinskis, G.; Bragina, L.; Colombo, P.; Frischat, G. H.; Grabis, J.; Greil, P.; Deja, J.; Kaminskas, R.; Kliava, J.; Medvids, A.; Nowak, I.; Siauciunas, R.; Valancius, Z.; Zalite, I.

2011-12-01

Logo This Volume of IOP Conference Series: Materials Science and Engineering presents a selection of the contributions to the 5th Baltic Conference on Silicate Materials (BaltSilica2011) held at Riga Technical University, Riga, Latvia from 23-25 May 2011. The conference was organized by Riga Technical University (Latvia) and Kaunas University of Technology (Lithuania). The series of Baltic conferences on silicate materials was started since 2004: the first conference was held in Riga, Latvia, 2004; the second conference was held in Kaunas, Lithuania 2005; the third was held again in Riga, Latvia, 2007, and the fourth was held in Kaunas, Lithuania 2009. BaltSilica 2011 was attended by around 50 participants from Latvia, Lithuania, Estonia, Germany, Poland, Italy, France, Ukraine and Russia. In comparison with previous silicate materials conferences, the broadening of participating countries is an indication of the interest of scientists, engineers and students to exchange research ideas, latest results, and to find new research topics for cooperation in the fields of silicate, high temperature materials, and inorganic nanomaterials. The scientific programme included 8 invited plenary lectures 23 oral presentations and 25 posters [1]. Scientific themes covered in the conference and in this special issue: Natural and Artificial Stone Materials; Traditional and New Ceramic and Glass-Like Materials; Nanoparticles and Nanomaterials. This volume consists of 23 selected proceeding papers. The Editor of this special issue is grateful to all the contributors to BaltSilica 2011. I am also very grateful to the scientific committee, the local organizing committee, the session chairs, the referees who refereed the submitted articles to this issue, and to students from the Department of Silicate, High Temperature and Inorganic Nanomaterials Technology of the Riga Technical University who ensured the smooth running of the conference. Particular thanks goes to eight plenary speakers who provided interesting findings and thoughtful overviews in the scientific themes of the conference. Special thanks go to Prof., Dr.rer.nat. Günther Heinz Frischat (Germany) who encouraged and supported the organization of these scientific meetings from the very first BaltSilica conferences. With warm regards and best wishes for the next BaltSilica conference. The Conference Chairman Gundars Mezinskis Reference [1] Baltic Conference on Silicate Materials. Book of abstracts of the 5th Baltic Conference on Silicate Materials BaltSilica 2011 : 23-25 May 2011, Riga, Latvia ed G Mezinskis, G Sedmale, J Setina, I Sperberga, L Krage, I Pavlovska, D Andersone (Riga: RTU Publishing House) p 94

500 Watt Solar AMTEC Power System for Small Spacecraft.

DTIC Science & Technology

1995-03-01

Thermal Modeling of High Efficiency AMTEC Cells ," Proceedings of the 24th National Heat Transfer Conference. Journal Article 12. SPACE...power flow calculation is the power required by the AMTEC cells which is the cell output power over the cell efficiency . The system model also...Converter ( AMTEC ) cell , called the multi-tube cell , integrated with an individual Thermal Energy Storage (TES) unit. The

Midbody Accumulation in Breast Cancer Stem Cells

DTIC Science & Technology

2011-08-01

transit amplifying or differentiating cells. These results suggest that MBds are in almost exclusively in stem cells and putative breast cancer stem...confer tumor-like properties to these cells. We were unable to establish GFP-MKLP1 breast cancer cell lines for this analysis for some reason that we...and nonpolarized cells (Fig. 1c, d). Immuno- electron microscopy confirmed this localization and revealed ultrastructural features characteristic of

Diagnosis and management of acquired aplastic anemia in childhood. Guidelines from the Marrow Failure Study Group of the Pediatric Haemato-Oncology Italian Association (AIEOP).

PubMed

Barone, Angelica; Lucarelli, Annunziata; Onofrillo, Daniela; Verzegnassi, Federico; Bonanomi, Sonia; Cesaro, Simone; Fioredda, Francesca; Iori, Anna Paola; Ladogana, Saverio; Locasciulli, Anna; Longoni, Daniela; Lanciotti, Marina; Macaluso, Alessandra; Mandaglio, Rosalba; Marra, Nicoletta; Martire, Baldo; Maruzzi, Matteo; Menna, Giuseppe; Notarangelo, Lucia Dora; Palazzi, Giovanni; Pillon, Marta; Ramenghi, Ugo; Russo, Giovanna; Svahn, Johanna; Timeus, Fabio; Tucci, Fabio; Cugno, Chiara; Zecca, Marco; Farruggia, Piero; Dufour, Carlo; Saracco, Paola

2015-06-01

Acquired aplastic anemia (AA) is a rare heterogeneous disease characterized by pancytopenia and hypoplastic bone marrow. The incidence is 2-3/million inhabitants/year, in Europe, but higher in East Asia. Survival in severe aplastic anemia (SAA) has markedly improved in the past 2 decades because of advances in hematopoietic stem cell transplantation, immunosuppressive and biologic drugs, and supportive care. In SAA hematopoietic stem cell transplant (HSCT) from a matched sibling donor (MSD) is the treatment of choice. If a MSD is not available, the options include immunosuppressive therapy (IST) or unrelated donor HSCT. The objective of this guideline is to provide healthcare professionals with clear guidance on the diagnosis and management of pediatric patients with AA. A preliminary, evidence-based document issued by a group of pediatric hematologists was discussed, modified and approved during a series of "Consensus Conferences" according to procedures previously validated by the AIEOP Board. The guidelines highlight the importance of referring pediatric patients with AA to pediatric centers with long experience in diagnosis, differential diagnosis, management, supportive care and follow-up of AA. Copyright © 2015. Published by Elsevier Inc.

2012 Gordon Research Conference, Electron donor-acceptor interactions, August 5-10 2012

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCusker, James

The upcoming incarnation of the Gordon Research Conference on Electron Donor Acceptor Interactions will feature sessions on classic topics including proton-coupled electron transfer, dye-sensitized solar cells, and biological electron transfer, as well as emerging areas such as quantum coherence effects in donor-acceptor interactions, spintronics, and the application of donor-acceptor interactions in chemical synthesis.

Public Libraries Section. Libraries Serving General Public Division. Papers.

ERIC Educational Resources Information Center

International Federation of Library Associations, The Hague (Netherlands).

Papers on public libraries, which were presented at the 1983 International Federation of Library Associations (IFLA) conference, include: (1) "The Role of Public Libraries in Developing Countries with Particular Reference to the Gambia" by Sally P. C. N'Jie (The Gambia); (2) "Public Libraries in the Federal Republic of Germany…

Teleconferencing; A Bibliography.

ERIC Educational Resources Information Center

Weber, Dianne, Comp.

A bibliography lists works on two-way electronic conferencing, as well as several general works on telecommunications. It is in three parts. The record identifications (RECID) index is a list of 168 references to books, parts of books, journal articles, conference papers, news items, and unpublished papers. The author index relists the entire…

Proceedings of the American Vocational Education Research Association (San Diego, California, December 7-10, 2000).

ERIC Educational Resources Information Center

2000

The following 14 papers, with abstracts and references, are compiled in this conference proceedings: "Exploring the Roles and Duties of Vocational Special Needs Educators" (Melanie Fagert); "Professional Competencies for Provisionally Licensed Career and Technical Education Teachers in Virginia" (Betty Heath-Camp, Daisy L.…

Identifying Subject-Specific Conferences as Professional Development Opportunities for the Academic Librarian

ERIC Educational Resources Information Center

Tomaszewski, Robert; MacDonald, Karen I.

2009-01-01

A major challenge facing academic libraries is the need for reference librarians to become knowledge experts in their assigned subject areas. The subject-specialist approach increases the effectiveness of collection development, classroom instruction, and faculty liaison interactions. Simultaneously, this approach creates the need for continuous…

Rubella Deaf-Blind Child: Implications of Psychological Assessment. Proceedings.

ERIC Educational Resources Information Center

Rouin, Carole

Presented are proceedings of a conference involving authorities in testing and evaluating the blind, deaf, and deaf-blind. In a paper titled "Psychological Implications of Assessing the Deaf", C. Goetzinger discusses references used in audiology, anatomy and physiology of the ear, degrees of hearing impairment, and implications of the various…

Tests and Testing for Bilingual Children: A Bibliography of Literature.

ERIC Educational Resources Information Center

Kirsch, Judith, Comp.

This annotated listing cites tests, guides, dissertations, journal articles, research reports, reference materials, and conference papers and proceedings regarding tests and testing for bilingual children. Items cited were published between 1964-81. The listing is one of a series of bibliographies from a computerized database, Bilingual Education…

The History of Delta Pi Epsilon, 1936-1986--A Golden Past: Foundation for the Future.

ERIC Educational Resources Information Center

Crank, Floyd L.

1986-01-01

The history of Delta Pi Epsilon (1936-1986) is presented, citing such highlights as research awards, new chapters, publications, annual conferences, organization of new committees, and conventions. Facts about Delta Pi Epsilon and a list of references are included also. (CT)

Nutrition issues in Codex: Health claims, nutrient reference values and WTO agreements: A conference report

USDA-ARS?s Scientific Manuscript database

A previous workshop had reviewed the development of the Codex Alimentarius (Codex) and its central role in protecting the health of consumers and ensuring fair practices in international food trade. This workshop further reviewed how Codex promotes harmonization and consensus by promoting the coordi...

49 CFR 260.27 - Additional information for loan guarantees.

Code of Federal Regulations, 2010 CFR

2010-10-01

... history on that obligation; and (b) With respect to each existing Lender, Holder, or prospective Lender, a statement as to: (1) Full and correct name and principal business address; (2) Reference to applicable provisions of law and the charter or other governing instruments conferring authority to do business on the...

New Developments in Information Services.

ERIC Educational Resources Information Center

McAllister, Lois, Ed.

The purpose of this conference was to: (1) improve reference and research library resources and services within its area by identifying, sharing and developing such resources and services and (2) further inter-library cooperation, communication and transportation of materials within the area of the Council. Aware that many information needs exist…

ESCOL '90: Proceedings of the Eastern States Conference on Linguistics (7th, Columbus, Ohio, September 21-23, 1990).

ERIC Educational Resources Information Center

No, Yongkyoon, Ed.; Libucha, Mark, Ed.

Papers include: "Length and Structure Effects in Syntactic Processing"; Nantong Tone Sandhi and Tonal Feature Geometry"; "Event Reference and Property Theory"; "Function-Argument Structure, Category Raising and Bracketing Paradoxes"; "At the Phonetics-Phonology Interface: (Re)Syllabification and English Stop…

Product Category Rules Alignment Workshop, October 4, 2011 in Chicago, IL, USA

EPA Science Inventory

A workshop on Product Category Rule (PCR) alignment was held as a special session in the LCA XI conference with approximately 120 participants. PCR alignment refers to the process of assuring that PCRs (rules for developing LCA-based claims like EPDs) developed by different parti...

Neutron Scattering Home Page (Low-Graphics)

Science.gov Websites

will be added. We encourage everyone interested in neutron scattering to take full advantage of this Home Page | Facilities | Reference | Software | Conferences | Announcements | Mailing Lists Neutron Scattering Banner Neutron Scattering Home Page A new portal for neutron scattering has just been established

Management PhD Candidates' Job Search: The Initial Interview.

ERIC Educational Resources Information Center

Hunt, Steven C.; Sawhney, Rajeev

2003-01-01

A survey of 200 doctoral students who interviewed with business schools at the Academy of Management conference received 74 responses. On average, they interviewed with 15.74 schools and did considerable preconference information gathering. Many complained of the physical conditions and lack of interviewer preparation. (Contains 20 references.)…

Commending Harry Belafonte for receiving the Hubert H. Humphrey Civil and Human Rights Award from the Leadership Conference on Civil and Human Rights.

THOMAS, 111th Congress

Rep. Richardson, Laura [D-CA-37

2010-06-24

House - 07/26/2010 Referred to the Subcommittee on the Constitution, Civil Rights, and Civil Liberties. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

Goddard Laboratory for Atmospheric Science, collected reprints 1978-1979, volume 1

NASA Technical Reports Server (NTRS)

Skillman, W. C. (Editor); Kreins, E. R. (Editor)

1981-01-01

A ready reference is presented to 61 papers by members of the Laboratory published between January 1, 1978 and December 31, 1979. To avoid unnecessary duplication, only abstracts or introductions of NASA reports and conference proceedings are included with reprints of articles from various journals.

25 Years of Teamwork for Adult Education in Iowa.

ERIC Educational Resources Information Center

Stacy, W. H.

This silver anniversary report reviews the history of the Iowa Adult Education Association (IAEA) since its founding on April 7, 1945. IAEA conferences, meetings, workshops, and publications are covered year by year, with particular reference to such activities and concerns as leadership training, professional continuing education, educational…

PREFACE: Sensors & their Applications XVI

NASA Astrophysics Data System (ADS)

Kyriacou, Panicos; O'Riordan, Alan

2011-08-01

This volume records the Proceedings of the sixteenth conference in the biennial Sensors and Their Applications series which took place at the Clarion Hotel, Cork, Ireland between 12-14 September 2011. The conference is organized by the Instrument Science and Technology Group of the Institute of Physics. On this occasion, the conference was hosted by Tyndall National Institute at University College Cork. This year the conference returns to Ireland, having last been held in Limerick in 2003. The conference proceedings record the continuing growth of the sensors community nationally and internationally. The conferences bring together contributions from scientists and engineers from academia, research institutes and industrial establishments, and therefore provide an excellent opportunity for these communities to present and discuss the latest results in the field of sensors, instrumentation and measurement. Amongst the more traditional themes, such as optical sensing, there is growth in new areas such as biomedical sensing and instrumentation, and nanosensing, which is reflected in this volume. Similarly the contribution of modelling and simulation techniques in sensor and instrumentation design and their applications is acknowledged by a session in this area. The sessions across the conference are supported by notable contributions from invited speakers. We would like to thank all of our colleagues in the sensor and instrumentation community who have supported this event by contributing manuscripts. Our thanks also go to Tyndall National Institute for hosting this conference and all the sponsors who, with their generous financial and in-kind contributions, enabled the better organization of this conference. We would also like to thank all the members of the Instrument Science and Technology Group for their support, and in particular for refereeing the submitted manuscripts. We are also pleased to express our thanks to the Conference Department of the Institute of Physics for their invaluable support in organising this event. We are especially grateful to Dawn Stewart for her responsive and efficient day-to-day handling of this event, as well as to Claire Garland for her planning and management of this event. We hope that the conference authors, participants and a wider audience will find these proceedings to be of interest and to serve as a useful reference text. Panicos KyriacouConference ChairmanAlan O'RiordanConference Local Chairman

Disruptive environmental chemicals and cellular mechanisms that confer resistance to cell death.

PubMed

Narayanan, Kannan Badri; Ali, Manaf; Barclay, Barry J; Cheng, Qiang Shawn; D'Abronzo, Leandro; Dornetshuber-Fleiss, Rita; Ghosh, Paramita M; Gonzalez Guzman, Michael J; Lee, Tae-Jin; Leung, Po Sing; Li, Lin; Luanpitpong, Suidjit; Ratovitski, Edward; Rojanasakul, Yon; Romano, Maria Fiammetta; Romano, Simona; Sinha, Ranjeet K; Yedjou, Clement; Al-Mulla, Fahd; Al-Temaimi, Rabeah; Amedei, Amedeo; Brown, Dustin G; Ryan, Elizabeth P; Colacci, Annamaria; Hamid, Roslida A; Mondello, Chiara; Raju, Jayadev; Salem, Hosni K; Woodrick, Jordan; Scovassi, A Ivana; Singh, Neetu; Vaccari, Monica; Roy, Rabindra; Forte, Stefano; Memeo, Lorenzo; Kim, Seo Yun; Bisson, William H; Lowe, Leroy; Park, Hyun Ho

2015-06-01

Cell death is a process of dying within biological cells that are ceasing to function. This process is essential in regulating organism development, tissue homeostasis, and to eliminate cells in the body that are irreparably damaged. In general, dysfunction in normal cellular death is tightly linked to cancer progression. Specifically, the up-regulation of pro-survival factors, including oncogenic factors and antiapoptotic signaling pathways, and the down-regulation of pro-apoptotic factors, including tumor suppressive factors, confers resistance to cell death in tumor cells, which supports the emergence of a fully immortalized cellular phenotype. This review considers the potential relevance of ubiquitous environmental chemical exposures that have been shown to disrupt key pathways and mechanisms associated with this sort of dysfunction. Specifically, bisphenol A, chlorothalonil, dibutyl phthalate, dichlorvos, lindane, linuron, methoxychlor and oxyfluorfen are discussed as prototypical chemical disruptors; as their effects relate to resistance to cell death, as constituents within environmental mixtures and as potential contributors to environmental carcinogenesis. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Latin America multidisciplinary research on heat shock proteins and cell stress: proceedings of the first conference of the Latin America Chapter of the Cell Stress Society International.

PubMed

Bausero, María A

2015-09-01

The First Conference of the Latin America Chapter of the Cell Stress Society International (CSSI) organized by CSSI was held in Montevideo, Uruguay, on March 11-14, 2014. The Latin America Chapter of the CSSI (LAC-CSSI) was established at the Workshop on the Molecular Biology of the Stress Response, Porto Alegre, Brazil, May 2012. The chapter's first meeting took place in the beautiful city of Montevideo and was chaired by the first (LAC-CSSI) elected president Professor María Bausero. Forty-two invited speakers presented their work to more than 100 scientists. The first day of the conference was dedicated to an introductory program for students, young investigators, and participants new to the field of molecular chaperones and the stress response. These seminars were held in the Pasteur Institute of Montevideo and the Faculty of Sciences of the University of the Republic. These institutions were carefully selected to give foreign participants a broad view of the diversity of students and institutions doing research in Uruguay, as well as an opportunity for direct interaction with our scientists and students. Invited speakers for the seminar series were Dr. Wolfgang Schumann, Dr. Cristina Bonorino, Dr. Antonio De Maio, Dr. Ian Brown, Dr. Rafael Radi, Dr. Daniel Ciocca, and Dr. Celia Quijano. The remaining days of the conference took place at the Sheraton Hotel in Montevideo, and the scientific sessions are discussed below.

Resistance to hypoxia-induced necroptosis is conferred by glycolytic pyruvate scavenging of mitochondrial superoxide in colorectal cancer cells.

PubMed

Huang, C-Y; Kuo, W-T; Huang, Y-C; Lee, T-C; Yu, L C H

2013-05-02

Cancer cells may survive under oxygen and nutrient deprivation by metabolic reprogramming for high levels of anaerobic glycolysis, which contributes to tumor growth and drug resistance. Abnormally expressed glucose transporters (GLUTs) are colocalized with hypoxia (Hx) inducible factor (HIF)1α in peri-necrotic regions in human colorectal carcinoma. However, the underlying mechanisms of anti-necrotic resistance conferred by glucose metabolism in hypoxic cancer cells remain poorly understood. Our aim was to investigate signaling pathways of Hx-induced necroptosis and explore the role of glucose pyruvate metabolite in mechanisms of death resistance. Human colorectal carcinoma cells were Hx exposed with or without glucose, and cell necroptosis was examined by receptor-interacting protein (RIP)1/3 kinase immunoprecipitation and (32)P kinase assays. Our results showed increased RIP1/3 complex formation and phosphorylation in hypoxic, but not normoxic cells in glucose-free media. Blocking RIP1 signaling, by necrostatin-1 or gene silencing, decreased lactodehydrogenase (LDH) leakage and plasma membrane disintegration. Generation of mitochondrial superoxide was noted after hypoxic challenge; its reduction by antioxidants inhibited RIP signaling and cell necrosis. Supplementation of glucose diminished the RIP-dependent LDH leakage and morphological damage in hypoxic cells, whereas non-metabolizable sugar analogs did not. Hypoxic cells given glucose showed nuclear translocation of HIF1α associated with upregulation of GLUT-1 and GLUT-4 expression, as well as increase of intracellular ATP, pyruvate and lactate levels. The glucose-mediated death resistance was ablated by iodoacetate (an inhibitor to glyceraldehyde-3-phosphate dehydrogenase), but not by UK5099 (an inhibitor to mitochondrial pyruvate carrier), suggesting that glycolytic pathway was involved in anti-necrotic mechanism. Lastly, replacing glucose with cell-permeable pyruvate derivative also led to decrease of Hx-induced necroptosis by suppression of mitochondrial superoxide in an energy-independent manner. In conclusion, glycolytic metabolism confers resistance to RIP-dependent necroptosis in hypoxic cancer cells partly through pyruvate scavenging of mitochondrial free radicals.

The wind god promotes lung cancer.

PubMed

Frisch, Steven M; Schaller, Michael D

2014-05-12

In this issue of Cancer Cell, Li and colleagues demonstrate that the hematopoietic transcription factor Aiolos (named after the Wind God of Greek mythology) confers anoikis resistance in lung tumor cells through repression of cell adhesion-related genes including the mechanosensor p66Shc. Copyright © 2014 Elsevier Inc. All rights reserved.

Who Defends the Stem Cell's Citadel?

PubMed

Strick-Marchand, Hélène; Durantel, David

2018-03-01

Recently in Cell, Wu et al. (2018) demonstrated that intrinsic expression of a subset of interferon stimulated genes confers resistance to viral infections in stem cells both in vitro and in vivo, while differentiated cells lose this intrinsic gatekeeper expression pattern in favor of inducible interferon responses. Copyright © 2018 Elsevier Inc. All rights reserved.

The granulocyte-macrophage colony-stimulating factor promoter cis-acting element CLE0 mediates induction signals in T cells and is recognized by factors related to AP1 and NFAT.

PubMed Central

Masuda, E S; Tokumitsu, H; Tsuboi, A; Shlomai, J; Hung, P; Arai, K; Arai, N

1993-01-01

Expression of the granulocyte-macrophage colony-stimulating factor (GM-CSF) gene in T cells is activated by the combination of phorbol ester (phorbol myristate acetate) and calcium ionophore (A23187), which mimic antigen stimulation through the T-cell receptor. We have previously shown that a fragment containing bp -95 to +27 of the mouse GM-CSF promoter can confer inducibility to reporter genes in the human Jurkat T-cell line. Here we use an in vitro transcription system to demonstrate that a cis-acting element (positions -54 to -40), referred to as CLE0, is a target for the induction signals. We observed induction with templates containing intact CLE0 but not with templates with deleted or mutated CLE0. We also observed that two distinct signals were required for the stimulation through CLE0, since only extracts from cells treated with both phorbol myristate acetate and A23187 supported optimal induction. Stimulation probably was mediated by CLE0-binding proteins because depletion of these proteins specifically reduced GM-CSF transcription. One of the binding factors possessed biochemical and immunological features identical to those of the transcription factor AP1. Another factor resembled the T-cell-specific factor NFAT. The characteristics of these two factors are consistent with their involvement in GM-CSF induction. The presence of CLE0-like elements in the promoters of interleukin-3 (IL-3), IL-4, IL-5, GM-CSF, and NFAT sites in the IL-2 promoter suggests that the factors we detected, or related factors that recognize these sites, may account for the coordinate induction of these genes during T-cell activation. Images PMID:8246960

Capillary reference half-cell

DOEpatents

Hall, Stephen H.

1996-01-01

The present invention is a reference half-cell electrode wherein intermingling of test fluid with reference fluid does not affect the performance of the reference half-cell over a long time. This intermingling reference half-cell may be used as a single or double junction submersible or surface reference electrode. The intermingling reference half-cell relies on a capillary tube having a first end open to reference fluid and a second end open to test fluid wherein the small diameter of the capillary tube limits free motion of fluid within the capillary to diffusion. The electrode is placed near the first end of the capillary in contact with the reference fluid. The method of operation of the present invention begins with filling the capillary tube with a reference solution. After closing the first end of the capillary, the capillary tube may be fully submerged or partially submerged with the second open end inserted into test fluid. Since the electrode is placed near the first end of the capillary, and since the test fluid may intermingle with the reference fluid through the second open end only by diffusion, this intermingling capillary reference half-cell provides a stable voltage potential for long time periods.

Capillary reference half-cell

DOEpatents

Hall, S.H.

1996-02-13

The present invention is a reference half-cell electrode wherein intermingling of test fluid with reference fluid does not affect the performance of the reference half-cell over a long time. This intermingling reference half-cell may be used as a single or double junction submersible or surface reference electrode. The intermingling reference half-cell relies on a capillary tube having a first end open to reference fluid and a second end open to test fluid wherein the small diameter of the capillary tube limits free motion of fluid within the capillary to diffusion. The electrode is placed near the first end of the capillary in contact with the reference fluid. The method of operation of the present invention begins with filling the capillary tube with a reference solution. After closing the first end of the capillary, the capillary tube may be fully submerged or partially submerged with the second open end inserted into test fluid. Since the electrode is placed near the first end of the capillary, and since the test fluid may intermingle with the reference fluid through the second open end only by diffusion, this intermingling capillary reference half-cell provides a stable voltage potential for long time periods. 11 figs.

mTOR Signaling Confers Resistance to Targeted Cancer Drugs.

PubMed

Guri, Yakir; Hall, Michael N

2016-11-01

Cancer is a complex disease and a leading cause of death worldwide. Extensive research over decades has led to the development of therapies that target cancer-specific signaling pathways. However, the clinical benefits of such drugs are at best transient due to tumors displaying intrinsic or adaptive resistance. The underlying compensatory pathways that allow cancer cells to circumvent a drug blockade are poorly understood. We review here recent studies suggesting that mammalian TOR (mTOR) signaling is a major compensatory pathway conferring resistance to many cancer drugs. mTOR-mediated resistance can be cell-autonomous or non-cell-autonomous. These findings suggest that mTOR signaling should be monitored routinely in tumors and that an mTOR inhibitor should be considered as a co-therapy. Copyright © 2016 Elsevier Inc. All rights reserved.

Allotopic expression of a mitochondrial alternative oxidase confers cyanide resistance to human cell respiration

PubMed Central

Hakkaart, Gerrit A J; Dassa, Emmanuel P; Jacobs, Howard T; Rustin, Pierre

2006-01-01

Human mitochondrial respiration is distinct from that of most plants, microorganisms and even some metazoans in that it reduces molecular oxygen only through the highly cyanide-sensitive enzyme cytochrome c oxidase. Here we show that expression of the cyanide-insensitive alternative oxidase (AOX), recently identified in the ascidian Ciona intestinalis, is well tolerated by cultured human cells and confers spectacular cyanide resistance to mitochondrial substrate oxidation. The expressed AOX seems to be confined to mitochondria. AOX involvement in electron flow is triggered by a highly reduced redox status of the respiratory chain (RC) and enhanced by pyruvate; otherwise, the enzyme remains essentially inactive. AOX expression promises to be a valuable tool to limit the deleterious consequences of RC deficiency in human cells and whole animals. PMID:16322757

Device for monitoring cell voltage

DOEpatents

Doepke, Matthias [Garbsen, DE; Eisermann, Henning [Edermissen, DE

2012-08-21

A device for monitoring a rechargeable battery having a number of electrically connected cells includes at least one current interruption switch for interrupting current flowing through at least one associated cell and a plurality of monitoring units for detecting cell voltage. Each monitoring unit is associated with a single cell and includes a reference voltage unit for producing a defined reference threshold voltage and a voltage comparison unit for comparing the reference threshold voltage with a partial cell voltage of the associated cell. The reference voltage unit is electrically supplied from the cell voltage of the associated cell. The voltage comparison unit is coupled to the at least one current interruption switch for interrupting the current of at least the current flowing through the associated cell, with a defined minimum difference between the reference threshold voltage and the partial cell voltage.

Redirection to the bone marrow improves T cell persistence and antitumor functions.

PubMed

Khan, Anjum B; Carpenter, Ben; Santos E Sousa, Pedro; Pospori, Constandina; Khorshed, Reema; Griffin, James; Velica, Pedro; Zech, Mathias; Ghorashian, Sara; Forrest, Calum; Thomas, Sharyn; Gonzalez Anton, Sara; Ahmadi, Maryam; Holler, Angelika; Flutter, Barry; Ramirez-Ortiz, Zaida; Means, Terry K; Bennett, Clare L; Stauss, Hans; Morris, Emma; Lo Celso, Cristina; Chakraverty, Ronjon

2018-05-01

A key predictor for the success of gene-modified T cell therapies for cancer is the persistence of transferred cells in the patient. The propensity of less differentiated memory T cells to expand and survive efficiently has therefore made them attractive candidates for clinical application. We hypothesized that redirecting T cells to specialized niches in the BM that support memory differentiation would confer increased therapeutic efficacy. We show that overexpression of chemokine receptor CXCR4 in CD8+ T cells (TCXCR4) enhanced their migration toward vascular-associated CXCL12+ cells in the BM and increased their local engraftment. Increased access of TCXCR4 to the BM microenvironment induced IL-15-dependent homeostatic expansion and promoted the differentiation of memory precursor-like cells with low expression of programmed death-1, resistance to apoptosis, and a heightened capacity to generate polyfunctional cytokine-producing effector cells. Following transfer to lymphoma-bearing mice, TCXCR4 showed a greater capacity for effector expansion and better tumor protection, the latter being independent of changes in trafficking to the tumor bed or local out-competition of regulatory T cells. Thus, redirected homing of T cells to the BM confers increased memory differentiation and antitumor immunity, suggesting an innovative solution to increase the persistence and functions of therapeutic T cells.

Conference Scene: Induced pluripotent cells: a new path for regenerative medicine. 7 October 2010, BioPark, Welwyn Garden City, Hertfordshire, UK.

PubMed

Crutzen, Hélène S G

2011-01-01

Embryonic stem cells and induced pluripotent stem (iPS) cells, which are embryonic stem-like cells derived from adult tissues, have the broadest differentiation potential. These cells are unique in their ability to self-renew, to be maintained in an undifferentiated state for long periods of culturing and to give rise to many different cell lineages including germ-line cells. They therefore represent an invaluable tool for facilitating research towards the realization of regenerative medicine. The recent developments in embryonic stem cell and iPS cell technology have allowed human cell models to be developed that will hopefully provide novel platforms for disease analysis not only at the basic science level, but also for drug discovery and screening, and other clinical applications. This 1-day conference, chaired by Professor Peter Andrews from the University of Sheffield, UK, and Dr Chris Denning from the University of Nottingham, UK, focused on generation of iPS cells, their differentiation into specific fates and applications to disease modeling. It consisted of 11 talks by UK-based and international researchers, and three posters; Ms Azra Fatima from Cologne University, Germany, won the competition for her poster on the derivation of iPS cells from a patient with arrhythmogenic right ventricular cardiomyopathy.

Mps1 Mediated Phosphorylation of Hsp90 Confers Renal Cell Carcinoma Sensitivity and Selectivity to Hsp90 Inhibitors.

PubMed

Woodford, Mark R; Truman, Andrew W; Dunn, Diana M; Jensen, Sandra M; Cotran, Richard; Bullard, Renee; Abouelleil, Mourad; Beebe, Kristin; Wolfgeher, Donald; Wierzbicki, Sara; Post, Dawn E; Caza, Tiffany; Tsutsumi, Shinji; Panaretou, Barry; Kron, Stephen J; Trepel, Jane B; Landas, Steve; Prodromou, Chrisostomos; Shapiro, Oleg; Stetler-Stevenson, William G; Bourboulia, Dimitra; Neckers, Len; Bratslavsky, Gennady; Mollapour, Mehdi

2016-02-02

The molecular chaperone Hsp90 protects deregulated signaling proteins that are vital for tumor growth and survival. Tumors generally display sensitivity and selectivity toward Hsp90 inhibitors; however, the molecular mechanism underlying this phenotype remains undefined. We report that the mitotic checkpoint kinase Mps1 phosphorylates a conserved threonine residue in the amino-domain of Hsp90. This, in turn, regulates chaperone function by reducing Hsp90 ATPase activity while fostering Hsp90 association with kinase clients, including Mps1. Phosphorylation of Hsp90 is also essential for the mitotic checkpoint because it confers Mps1 stability and activity. We identified Cdc14 as the phosphatase that dephosphorylates Hsp90 and disrupts its interaction with Mps1. This causes Mps1 degradation, thus providing a mechanism for its inactivation. Finally, Hsp90 phosphorylation sensitizes cells to its inhibitors, and elevated Mps1 levels confer renal cell carcinoma selectivity to Hsp90 drugs. Mps1 expression level can potentially serve as a predictive indicator of tumor response to Hsp90 inhibitors. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Surface Characterization, Corrosion Resistance and in Vitro Biocompatibility of a New Ti-Hf-Mo-Sn Alloy

PubMed Central

Ion, Raluca; Drob, Silviu Iulian; Ijaz, Muhammad Farzik; Vasilescu, Cora; Osiceanu, Petre; Gordin, Doina-Margareta; Cimpean, Anisoara; Gloriant, Thierry

2016-01-01

A new superelastic Ti-23Hf-3Mo-4Sn biomedical alloy displaying a particularly large recovery strain was synthesized and characterized in this study. Its native passive film is very thick (18 nm) and contains very protective TiO2, Ti2O3, HfO2, MoO2, and SnO2 oxides (XPS analysis). This alloy revealed nobler electrochemical behavior, more favorable values of the corrosion parameters and open circuit potentials in simulated body fluid in comparison with commercially pure titanium (CP-Ti) and Ti-6Al-4V alloy taken as reference biomaterials in this study. This is due to the favorable influence of the alloying elements Hf, Sn, Mo, which enhance the protective properties of the native passive film on alloy surface. Impedance spectra showed a passive film with two layers, an inner, capacitive, barrier, dense layer and an outer, less insulating, porous layer that confer both high corrosion resistance and bioactivity to the alloy. In vitro tests were carried out in order to evaluate the response of Human Umbilical Vein Endothelial Cells (HUVECs) to Ti-23Hf-3Mo-4Sn alloy in terms of cell viability, cell proliferation, phenotypic marker expression and nitric oxide release. The results indicate a similar level of cytocompatibility with HUVEC cells cultured on Ti-23Hf-3Mo-4Sn substrate and those cultured on the conventional CP-Ti and Ti-6Al-4V metallic materials. PMID:28773939

Electron Cloud Effects in Accelerators

DOE Office of Scientific and Technical Information (OSTI.GOV)

Furman, M.A.

Abstract We present a brief summary of various aspects of the electron-cloud effect (ECE) in accelerators. For further details, the reader is encouraged to refer to the proceedings of many prior workshops, either dedicated to EC or with significant EC contents, including the entire ?ECLOUD? series [1?22]. In addition, the proceedings of the various flavors of Particle Accelerator Conferences [23] contain a large number of EC-related publications. The ICFA Beam Dynamics Newsletter series [24] contains one dedicated issue, and several occasional articles, on EC. An extensive reference database is the LHC website on EC [25].

ASM Conference on Prokaryotic Development

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaplan, H. B.

2005-07-13

Support was provided by DOE for the 2nd ASM Conference on Prokaryotic Development. The final conference program and abstracts book is attached. The conference presentations are organized around topics that are central to the current research areas in prokaryotic development. The program starts with topics that involve relatively simple models systems and ends with systems that are more complex. The topics are: i) the cell cycle, ii) the cytoskeleton, iii) morphogenesis, iv) developmental transcription, v) signaling, vi) multicellularity, and vii) developmental diversity and symbiosis. The best-studied prokaryotic development model systems will be highlighted at the conference through research presentations bymore » leaders in the field. Many of these systems are also model systems of relevance to the DOE mission including carbon sequestration (Bradyrizobium, Synechococcus), energy production (Anabaena, Rhodobacter) and bioremediation (Caulobacter, Mesorhizobium). In addition, many of the highlighted organisms have important practical applications; the actinomycetes and myxobacteria produce antimicrobials that are of commercial interest. It is certain that the cutting-edge science presented at the conference will be applicable to the large group of bacteria relevant to the DOE mission.« less

Cell-specific Labeling Enzymes for Analysis of Cell–Cell Communication in Continuous Co-culture*

PubMed Central

Tape, Christopher J.; Norrie, Ida C.; Worboys, Jonathan D.; Lim, Lindsay; Lauffenburger, Douglas A.; Jørgensen, Claus

2014-01-01

We report the orthologous screening, engineering, and optimization of amino acid conversion enzymes for cell-specific proteomic labeling. Intracellular endoplasmic-reticulum-anchored Mycobacterium tuberculosis diaminopimelate decarboxylase (DDCM.tub-KDEL) confers cell-specific meso-2,6-diaminopimelate-dependent proliferation to multiple eukaryotic cell types. Optimized lysine racemase (LyrM37-KDEL) supports D-lysine specific proliferation and efficient cell-specific isotopic labeling. When ectopically expressed in discrete cell types, these enzymes confer 90% cell-specific isotopic labeling efficiency after 10 days of co-culture. Moreover, DDCM.tub-KDEL and LyrM37-KDEL facilitate equally high cell-specific labeling fidelity without daily media exchange. Consequently, the reported novel enzyme pairing can be used to study cell-specific signaling in uninterrupted, continuous co-cultures. Demonstrating the importance of increased labeling stability for addressing novel biological questions, we compare the cell-specific phosphoproteome of fibroblasts in direct co-culture with epithelial tumor cells in both interrupted (daily media exchange) and continuous (no media exchange) co-cultures. This analysis identified multiple cell-specific phosphorylation sites specifically regulated in the continuous co-culture. Given their applicability to multiple cell types, continuous co-culture labeling fidelity, and suitability for long-term cell–cell phospho-signaling experiments, we propose DDCM.tub-KDEL and LyrM37-KDEL as excellent enzymes for cell-specific labeling with amino acid precursors. PMID:24820872

Intestinal epithelial cell secretion of RELM-beta protects against gastrointestinal worm infection

USDA-ARS?s Scientific Manuscript database

IL-4 and IL-13 protect against parasitic helminths, but little is known about the mechanism of host protection. We show that IL-4/IL-13 confer immunity against worms by inducing intestinal epithelial cells (IEC) to differentiate into goblet cells that secrete resistin-like molecule beta (RELMB). R...

The flavoprotein Tah18-dependent NO synthesis confers high-temperature stress tolerance on yeast cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishimura, Akira; Kawahara, Nobuhiro; Takagi, Hiroshi, E-mail: hiro@bs.naist.jp

Highlights: Black-Right-Pointing-Pointer NO is produced from L-arginine in response to elevated temperature in yeast. Black-Right-Pointing-Pointer Tah18 was first identified as the yeast protein involved in NO synthesis. Black-Right-Pointing-Pointer Tah18-dependent NO synthesis confers tolerance to high-temperature on yeast cells. -- Abstract: Nitric oxide (NO) is a ubiquitous signaling molecule involved in the regulation of a large number of cellular functions. In the unicellular eukaryote yeast, NO may be involved in stress response pathways, but its role is poorly understood due to the lack of mammalian NO synthase (NOS) orthologues. Previously, we have proposed the oxidative stress-induced L-arginine synthesis and its physiologicalmore » role under stress conditions in yeast Saccharomyces cerevisiae. Here, our experimental results indicated that increased conversion of L-proline into L-arginine led to NO production in response to elevated temperature. We also showed that the flavoprotein Tah18, which was previously reported to transfer electrons to the Fe-S cluster protein Dre2, was involved in NO synthesis in yeast. Gene knockdown analysis demonstrated that Tah18-dependent NO synthesis confers high-temperature stress tolerance on yeast cells. As it appears that such a unique cell protection mechanism is specific to yeasts and fungi, it represents a promising target for antifungal activity.« less

TolC plays a crucial role in immune protection conferred by Edwardsiella tarda whole-cell vaccines.

PubMed

Wang, Chao; Peng, Bo; Li, Hui; Peng, Xuan-Xian

2016-07-12

Although vaccines developed from live organisms have better efficacy than those developed from dead organisms, the mechanisms underlying this differential efficacy remain unexplored. In this study, we combined sub-immunoproteomics with immune challenge to investigate the action of the outer membrane proteome in the immune protection conferred by four Edwardsiella tarda whole-cell vaccines prepared via different treatments and to identify protective immunogens that play a key role in this immune protection. Thirteen spots representing five outer membrane proteins and one cytoplasmic protein were identified, and it was found that their abundance was altered in relation with the immune protective abilities of the four vaccines. Among these proteins, TolC and OmpA were found to be the key immunogens conferring the first and second highest degrees of protection, respectively. TolC was detected in the two effective vaccines (live and inactivated-30-F). The total antiserum and anti-OmpA titers were higher for the two effective vaccines than for the two ineffective vaccines (inactivated-80-F and inactivated-100). Further evidence demonstrated that the live and inactivated-30-F vaccines demonstrated stronger abilities to induce CD8+ and CD4+ T cell differentiation than the other two evaluated vaccines. Our results indicate that the outer membrane proteome changes dramatically following different treatments, which contributes to the effectiveness of whole-cell vaccines.

2001 Gordon Research Conference on Applied and Environmental Microbiology. Final progress report [agenda and attendee list

DOE Office of Scientific and Technical Information (OSTI.GOV)

Drake, Harold

2001-07-26

The Gordon Research Conference on Applied and Environmental Microbiology was held at Connecticut College, New London, Connecticut, July 22-27, 2001. The conference was attended by 121 participants. The attendees represented the spectrum of endeavor in this field, coming from academia, industry, and government laboratories, and included US and foreign scientists, senior researchers, young investigators, and students. Emphasis was placed on current unpublished research and discussion of the future target areas in this field. There was a conscious effort to stimulate discussion about the key issues in the field today. Session topics included the following: Environmental and applied genomics, Cell-to-cell signalingmore » and multicellular behavior, Emerging technologies and methods, Novel metabolisms and ecosystems, Directed evolution of enzymes and pathways, Symbiotic and trophic relationships, Synthesis and application of novel biopolymers, and Microbes at the oxic-anoxic interface. There was also a special lecture titled ''Under the umbrella of the big tree: microbial biology into the 21st century.''« less

Human Neural Cell-Based Biosensor

DTIC Science & Technology

2013-05-28

ionotropic receptors in human embryonic stem cell derived neural progenitors. Neuroscience. 2011 Sep 29;192:793-805. Krishnamoorthy M, Gerwe BA, Scharer...coupled receptors . Pharmacol Ther. 2011 Mar;129(3):290-306. Workshop/conference abstracts, presentations, posters, and papers Powe, A, et al

The Alternative Road. The Rehabilitation of the Practical.

ERIC Educational Resources Information Center

Layton, David, Ed.

The "alternative road" refers to a practically oriented curriculum, one which is more concerned with being able to do, rather than remembering. The book consists of an edited series of papers which were presented at a conference in England on the rehabilitation of the practical, at which a broad range of interests (academic,…

Lifelong Learning Research Conference Proceedings (9th, College Park, Maryland, February 25-26, 1988).

ERIC Educational Resources Information Center

Rivera, William M., Comp.; Davis, Cynthia, Comp.

The following 26 papers, with abstracts and references, are included in these proceedings: "Panel: Continuing Professional Education in Cooperative Extension" (Robert L. Bruce, G. L. Carter, Jr., Ronald Jimmerson, Joan S. Thomson); "New Farm Families: Implications for Extension Educators" (Jane W. McGonigal, Robert L. Bruce); "The Experience of…

Numerical methods in heat transfer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lewis, R.W.

1985-01-01

This third volume in the series in Numerical Methods in Engineering presents expanded versions of selected papers given at the Conference on Numerical Methods in Thermal Problems held in Venice in July 1981. In this reference work, contributors offer the current state of knowledge on the numerical solution of convective heat transfer problems and conduction heat transfer problems.

An Aid to Comprehensive Planning for Migrant Programs.

ERIC Educational Resources Information Center

Smith, Mona, Comp.

Designed as a guide for all personnel involved in migrant projects, this pamphlet is a compilation of references derived from presentations made at the New York State Migrant Program Directors Conference held at Victor, New York, November 29-December 1, 1972. A short description of agency services and a list of sources for further information…

The Relationship between Research Method and Visual Display: A Study of Conference Proceedings in the Field of Knowledge Organization

ERIC Educational Resources Information Center

Friedman, Alon

2014-01-01

Introduction: "Research method" refers to how to conduct research, how to measure progress, and what constitutes success. Visualisation has become the platform for communicating research findings according to Friedman and Smiraglia. Knowledge organization aims to organize knowledge and many researchers employ visualisation in their…

Comparison of Human and Latent Semantic Analysis (LSA) Judgements of Pairwise Document Similarities for a News Corpus

DTIC Science & Technology

2004-09-01

University. Miro Kraetzl critically assessed the manuscript before it was sent for review. References Allan, J., Callan, J., Croft, W.B., Ballesteros, L...Conference (TREC 6). NIST Special Publication 500-240. Baayen,R.H. (2001). Word Frequency Distributions. Kluwer Academic Publishers, P.O. Box 322 , 3300

Dimensions of Personalisation in Technology-Enhanced Learning: A Framework and Implications for Design

ERIC Educational Resources Information Center

FitzGerald, Elizabeth; Kucirkova, Natalia; Jones, Ann; Cross, Simon; Ferguson, Rebecca; Herodotou, Christothea; Hillaire, Garron; Scanlon, Eileen

2018-01-01

Personalisation of learning is a recurring trend in our society, referred to in government speeches, popular media, conference and research papers and technological innovations. This latter aspect--of using personalisation in technology-enhanced learning (TEL)--has promised much but has not always lived up to the claims made. Personalisation is…

Day Care: Guide to Reading. (Garde De Jour: Guide Du Lecteur).

ERIC Educational Resources Information Center

Department of National Health and Welfare, Ottawa (Ontario).

This bibliography contains references to books, articles, project reports, pamphlets, and conference papers (a few written in French) chosen for their easy availability and divided into sections on various topics pertinent to day care services: (1) organization and administration, funding and costing, need for day care; (2) parent involvement,…

38 CFR Appendix A to Part 20 - Cross-References

Code of Federal Regulations, 2012 CFR

2012-07-01

..., and mailing address of the Board. 38 CFR 20.606 Rule 606. Legal interns, law students and paralegals... Rule 604. Representation by agents. 38 CFR 20.606 Rule 606. Legal interns, law students and paralegals... Section. 20.708 38 CFR 20.606(d) See re the prehearing conference required when a legal intern, law...

38 CFR Appendix A to Part 20 - Cross-References

Code of Federal Regulations, 2014 CFR

2014-07-01

..., and mailing address of the Board. 38 CFR 20.606 Rule 606. Legal interns, law students and paralegals... Rule 604. Representation by agents. 38 CFR 20.606 Rule 606. Legal interns, law students and paralegals... Section. 20.708 38 CFR 20.606(d) See re the prehearing conference required when a legal intern, law...

38 CFR Appendix A to Part 20 - Cross-References

Code of Federal Regulations, 2011 CFR

2011-07-01

..., and mailing address of the Board. 38 CFR 20.606 Rule 606. Legal interns, law students and paralegals... Rule 604. Representation by agents. 38 CFR 20.606 Rule 606. Legal interns, law students and paralegals... Section. 20.708 38 CFR 20.606(d) See re the prehearing conference required when a legal intern, law...

38 CFR Appendix A to Part 20 - Cross-References

Code of Federal Regulations, 2013 CFR

2013-07-01

..., and mailing address of the Board. 38 CFR 20.606 Rule 606. Legal interns, law students and paralegals... Rule 604. Representation by agents. 38 CFR 20.606 Rule 606. Legal interns, law students and paralegals... Section. 20.708 38 CFR 20.606(d) See re the prehearing conference required when a legal intern, law...

Reading and TV; Proceedings of the Spring 1972 Rutgers University Reading Conference.

ERIC Educational Resources Information Center

Shew, Phillip, Ed.; Muscara, Sandra, Ed.

The perspectives of this document, which explores the relationships between television and reading instruction, are both theoretical and practical. Articles in the first section establish a frame of reference for evaluating the use of television in reading instruction, focusing particularly on the relationships among media and their import for…

Training Directors' Conceptualizations of the Intersections of Diversity and Trainee Competence Problems: A Preliminary Analysis

ERIC Educational Resources Information Center

Miller, David S. Shen; Forrest, Linda; Elman, Nancy S.

2009-01-01

Counseling psychology has demonstrated leadership on multicultural issues through serious and committed attention to diversity in scholarship, conferences, and training and recruitment. Yet a survey of the literature on trainees with competence problems resulted in limited references to race/ethnicity and/or gender (REG). Using transcripts of…

Population Change, Resources, and the Environment. Population Trends and Public Policy No. 4.

ERIC Educational Resources Information Center

Jacobsen, Judith, Ed.

Intended for policymakers, this document focuses on environmental factors limiting the expansion of the world's food supply, the dilemma of fostering third world economic development, and prospects for energy development. The first of five parts gives an overview of a 1983 Population Reference Bureau conference which focused on current thinking…

A Reflective Journey in Teaching: Pre-Service Music Teachers' Action Research

ERIC Educational Resources Information Center

Mok, Annie O.

2016-01-01

The qualitative study referred to here investigated what a class of undergraduate pre-service music teachers could learn from conducting a piece of action research for primary 5 pupils in Hong Kong. Data were collected from lesson observations, post-lesson conferences with the pre-service teachers, their presentations and individual reflection…

An Objectivist Critique of Relativism in Mathematics Education

NASA Astrophysics Data System (ADS)

Rowlands, Stuart; Graham, Ted; Berry, John

Many constructivists tag as `absolutist' references to mathematics as an abstract body of knowledge, and stake-out the moral high-ground with the argument that mathematics is not only utilised oppressively but that mathematics is, in-itself, oppressive. With much reference to Ernest's (1991) Philosophy of Mathematics Education this tag has been justified on the grounds that if mathematics is a social-cultural creation that is mutable and fallible then it must be social acceptance that confers the objectivity of mathematics. This paper argues that mathematics, albeit a social-cultural creation that is mutable and fallible, is a body of knowledge the objectivity of which is independent of origin or social acceptance. Recently, Ernest (1998) has attempted to express social constructivism as a philosophy of mathematics and has included the category of logical necessity in his elaboration of the objectivity of mathematics. We argue that this inclusion of logical necessity not only represents a U-turn, but that the way in which Ernest has included this category is an attempt to maintain his earlier position that it is social acceptance that confers the objectivity of mathematics.

The GSK3B gene confers risk for both major depressive disorder and schizophrenia in the Han Chinese population.

PubMed

Chen, Jianhua; Wang, Meng; Waheed Khan, Raja Amjad; He, Kuanjun; Wang, Qingzhong; Li, Zhiqiang; Shen, Jiawei; Song, Zhijian; Li, Wenjin; Wen, Zujia; Jiang, Yiwen; Xu, Yifeng; Shi, Yongyong; Ji, Weidong

2015-10-01

Glycogen synthease kinase-3B is a key gene encoding a protein kinase which is abundant in brain, and is involved in signal transduction cascades of neuronal cell development and energy metabolism. Previous researches proposed GSK3B as a potential region for schizophrenia. To validate the susceptibility of GSK3B to major depressive disorder, and to investigate the overlapping risk conferred by GSK3B for mental disorders, we performed a large-scale case-control study, analyzed 6 tag single nucleotide polymorphisms using TaqMan® technology in 1,045 major depressive disorder patients, 1,235 schizophrenia patients and 1,235 normal controls of Han Chinese origin. We found rs334535 (Pallele=2.79E-03, Pgenotype=5.00E-03, OR=1.429) and rs2199503 (Pallele=0.020, Pgenotype= 0.040, OR=1.157) showed association with major depressive disorder before Bonferroni correction. rs6771023 (adjusted Pallele=1.64E-03, adjusted Pgenotype=6.00E-03, OR=0.701) and rs2199503 (adjusted Pallele=0.001, adjusted Pgenotype=0.002, OR=1.251) showed significant association with schizophrenia after Bonferroni correction. rs2199503 (adjusted Pallele=1.70E-03, adjusted Pgenotype=0.006, OR=1.208) remained to be significant in the combined cases of major depressive disorder and schizophrenia after Bonferroni correction. Further validations of our findings in samples with larger scale are suggested, and functional genomic study is needed to elucidate the role of GSK3B in signal pathway and psychiatric disorders. Our results provide evidence that the GSK3B gene could be a promising region which contains genetic risk for both major depressive disorder and schizophrenia in the Han Chinese population. The study on variants conferring overlapping risk for multiple psychiatric disorders could be tangible pathogenesis support and clinical or diagnostic references. Copyright © 2015. Published by Elsevier B.V.

Editorial

NASA Astrophysics Data System (ADS)

Boerma, Dirk O.; Climent-Font, Aurelio; Respaldiza, Miguel Ángel

2006-08-01

The IBA conference has taken place in different countries from all over the world. It started in the United States in 1973, and since then has been held biennially without interruption, becoming the reference meeting on ion beam analysis and related methods and techniques. In its 17th edition, two Spanish laboratories, one from the Universidad de Sevilla and one from the Universidad Autónoma de Madrid had the honour and responsibility of organizing the conference. These two laboratories are, so far, the only ones in the country equipped with accelerators dedicated to ion beam analysis; the Centro Nacional de Aceleradores (CNA) in Seville and the Centro de Micro-Análisis de Materiales (CMAM) in Madrid. We took up this task enthusiastically, conscious that Spain has only very recently been equipped with IBA techniques and that this event would highlight to the scientific community of our country the importance and involvement of IBA techniques in new scientific and technological developments. The conference was held at the Melia Sevilla Hotel in Seville, Spain from 26 June-1 July 2005. This special issue of Nuclear Instruments and Methods in Physics Research B contains the published proceedings of the conference.

The fourth International Conference on Information Science and Cloud Computing

NASA Astrophysics Data System (ADS)

This book comprises the papers accepted by the fourth International Conference on Information Science and Cloud Computing (ISCC), which was held from 18-19 December, 2015 in Guangzhou, China. It has 70 papers divided into four parts. The first part focuses on Information Theory with 20 papers; the second part emphasizes Machine Learning also containing 21 papers; in the third part, there are 21 papers as well in the area of Control Science; and the last part with 8 papers is dedicated to Cloud Science. Each part can be used as an excellent reference by engineers, researchers and students who need to build a knowledge base of the most current advances and state-of-practice in the topics covered by the ISCC conference. Special thanks go to Professor Deyu Qi, General Chair of ISCC 2015, for his leadership in supervising the organization of the entire conference; Professor Tinghuai Ma, Program Chair, and members of program committee for evaluating all the submissions and ensuring the selection of only the highest quality papers; and the authors for sharing their ideas, results and insights. We sincerely hope that you enjoy reading papers included in this book.

International Conference on Harmonisation; guidance on Q10 Pharmaceutical Quality System; availability. Notice.

PubMed

2009-04-08

The Food and Drug Administration (FDA) is announcing the availability of a guidance entitled "Q10 Pharmaceutical Quality System." The guidance was prepared under the auspices of the International Conference on Harmonisation of Technical Requirements for Registration of Pharmaceuticals for Human Use (ICH). The guidance describes a model for an effective quality management system for the pharmaceutical industry, referred to as the Pharmaceutical Quality System. The guidance is intended to provide a comprehensive approach to an effective pharmaceutical quality system that is based on International Organization for Standardization (ISO) concepts, includes applicable good manufacturing practice (GMP) regulations and complements ICH guidances on "Q8 Pharmaceutical Development" and "Q9 Quality Risk Management."

The Conference Proceedings of the 1999 Air Transport Research Group (ATRG) of the WCTR Society. Volume 1

NASA Technical Reports Server (NTRS)

Zhang, Anming (Editor); Bowen, Brent D. (Editor)

1999-01-01

The UNO (University of Nebraska at Omaha) Aviation Institute Monograph Series began in 1994 as a key component of the education outreach and information transfer missions of the Aviation Institute and the NASA Nebraska Space Grant & EPSCoR (Experimental Program to Stimulate Competitive Research) Programs. The series is an outlet for aviation materials to be indexed and disseminated through an efficient medium. Publications are welcome in all aspects of aviation. Publication formats may include, but are not limited to, conference proceedings, bibliographies, research reports, manuals, technical reports, and other documents that should be archived and indexed for future reference by the aviation and world wide communities.

Prior lactose glycation of caseinate via the Maillard reaction affects in vitro activities of the pepsin-trypsin digest toward intestinal epithelial cells.

PubMed

Wang, X P; Zhao, X H

2017-07-01

The well-known Maillard reaction in milk occurs between lactose and milk proteins during thermal treatment, and its effects on milk nutrition and safety have been well studied. A lactose-glycated caseinate was prepared via this reaction and digested using 2 digestive proteases, pepsin and trypsin. The glycated caseinate digest was assessed for its in vitro activities on rat intestinal epithelial cells in terms of growth proliferation, anti-apoptotic effect, and differentiation induction using caseinate digest as reference, to verify potential effects of the Maillard reaction on these activities of caseinate digest to the cells. Two digests had proliferative and anti-apoptotic effects, and reached the highest effects at 0.02 g/L of digest concentration with treatment time of 24 h. In comparison with caseinate digest, glycated caseinate digest always showed weaker proliferative (5.3-14.2%) and anti-apoptotic (5.9-39.0%) effects, and was more toxic to the cells at 0.5 g/L of digest concentration with treatment time of 48 h. However, glycated caseinate digest at 2 incubation times of 4 to 7 d showed differentiation induction higher than caseinate digest, as it could confer the cells with increased activities in lactase (16.3-26.6%), sucrase (22.4-31.2%), and alkaline phosphatase (17.4-24.8%). Transmission electron microscopy observation results also confirmed higher differentiation induction of glycated caseinate digest. Amino acid loss and lactose glycation partially contributed to these decreased and enhanced activities of glycated caseinate digest, respectively. The Maillard reaction of caseinate and lactose is thus shown in this study to have effects on the activities of caseinate digest to intestinal epithelial cells. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Space Electrochemical Research and Technology

NASA Technical Reports Server (NTRS)

1991-01-01

The proceedings of NASA's third Space Electrochemical Research and Technology (SERT) conference are presented. The objective of the conference was to assess the present status and general thrust of research and development in those areas of electrochemical technology required to enable NASA missions in the next century. The conference provided a forum for the exchange of ideas and opinions of those actively involved in the field, in order to define new opportunities for the application of electrochemical processes in future NASA missions. Papers were presented in three technical areas: the electrochemical interface, the next generation in aerospace batteries and fuel cells, and electrochemistry for nonenergy storage applications.

Update on hypoxia-inducible factors and hydroxylases in oxygen regulatory pathways: from physiology to therapeutics

PubMed Central

Ratcliffe, Peter; Koivunen, Peppi; Myllyharju, Johanna; Ragoussis, Jiannis; Bovée, Judith VMG; Batinic-Haberle, Ines; Vinatier, Claire; Trichet, Valérie; Robriquet, Florence; Oliver, Lisa; Gardie, Betty

2017-01-01

The “Hypoxia Nantes 2016” organized its second conference dedicated to the field of hypoxia research. This conference focused on “the role of hypoxia under physiological conditions as well as in cancer” and took place in Nantes, France, in October 6–7, 2016. The main objective of this conference was to bring together a large group of scientists from different spheres of hypoxia. Recent advances were presented and discussed around different topics: genomics, physiology, musculoskeletal, stem cells, microenvironment and cancer, and oxidative stress. This review summarizes the major highlights of the meeting. PMID:28352643

Elucidate the Mechanism of Telomere Maintenance in STAG2 Mutated Tumor Cells

DTIC Science & Technology

2017-12-01

recent analysis identified the cohesin subunit STAG2 as one of twelve genes mutated in four or more tumor types including melanoma, pancreatic...conferences, seminars, study groups , and individual study. Include participation in conferences, workshops, and seminars not listed under major...only 12 genes found to be significantly mutated in four or more cancer types (18). Approximately 85% of STAG2 mutations are truncating and often result

Space Photovoltaic Research and Technology 1983. High Efficiency, Radiation Damage, and Blanket Technology

NASA Technical Reports Server (NTRS)

1984-01-01

This three day conference, sixth in a series that began in 1974, was held at the NASA Lewis Research Center on October 18-20, 1983. The conference provided a forum for the discussion of space photovoltaic systems, their research status, and program goals. Papers were presented and workshops were held in a variety of technology areas, including basic cell research, advanced blanket technology, and radiation damage.

Progress in Applied Surface, Interface and Thin Film Science 2015. Solar Renewable Energy News IV, November 23-26, 2015, Florence, Italy (SURFINT-SREN IV)

NASA Astrophysics Data System (ADS)

2017-02-01

The main goal of the conference is to contribute to new knowledge in surface, interface, ultra-thin films and very-thin films science of inorganic and organic materials by the most rapid interactive manner - by direct communication among scientists of corresponding research fields. The list of topics indicates that conference interests cover the development of basic theoretical physical and chemical principles and performance of surfaces-, thin films-, and interface-related procedures, and corresponding experimental research on atomic scale. Topical results are applied at development of new inventive industrial equipments needed for investigation of electrical, optical, and structural properties, and other parameters of atomic-size research objects. The conference range spreads, from physical point of view, from fundamental research done on sub-atomic and quantum level to production of devices built on new physical principles. The conference topics include also presentation of principally new devices in following fields: solar cells, liquid crystal displays, high-temperature superconductivity, and sensors. During the event, special attention will be given to evaluation of scientific and technical quality of works prepared by PhD students, to deep ecological meaning of solar cell energy production, and to exhibitions of companies.

Absolute atomic hydrogen densities in a radio frequency discharge measured by two-photon laser induced fluorescence imaging

NASA Astrophysics Data System (ADS)

Chérigier, L.; Czarnetzki, U.; Luggenhölscher, D.; Schulz-von der Gathen, V.; Döbele, H. F.

1999-01-01

Absolute atomic hydrogen densities were measured in the gaseous electronics conference reference cell parallel plate reactor by Doppler-free two-photon absorption laser induced fluorescence spectroscopy (TALIF) at λ=205 nm. The capacitively coupled radio frequency discharge was operated at 13.56 MHz in pure hydrogen under various input power and pressure conditions. The Doppler-free excitation technique with an unfocused laser beam together with imaging the fluorescence radiation by an intensified charge coupled device camera allows instantaneous spatial resolution along the radial direction. Absolute density calibration is obtained with the aid of a flow tube reactor and titration with NO2. The influence of spatial intensity inhomogenities along the laser beam and subsequent fluorescence are corrected by TALIF in xenon. A full mapping of the absolute density distribution between the electrodes was obtained. The detection limit for atomic hydrogen amounts to about 2×1018 m-3. The dissociation degree is of the order of a few percent.

EDITORIAL: International MEMS Conference 2006

NASA Astrophysics Data System (ADS)

Tay, Francis E. H.; Jianmin, Miao; Iliescu, Ciprian

2006-04-01

The International MEMS conference (iMEMS2006) organized by the Institute of Bioengineering and Nanotechnology and Nanyang Technological University aims to provide a platform for academicians, professionals and industrialists in various related fields from all over the world to share and learn from each other. Of great interest is the incorporation of the theme of life sciences application using MEMS. It is the desire of this conference to initiate collaboration and form network of cooperation. This has continued to be the objective of iMEMS since its inception in 1997. The technological advance of MEMS over the past few decades has been truly exciting in terms of development and applications. In order to participate in this rapid development, a conference involving delegates from within the MEMS community and outside the community is very meaningful and timely. With the receipt of over 200 articles, delegates related to MEMS field from all over the world will share their perspectives on topics such as MEMS/MST Design, MEMS Teaching and Education, MEMS/MST Packaging, MEMS/MST Fabrication, Microsystems Applications, System Integration, Wearable Devices, MEMSWear and BioMEMS. Invited speakers and delegates from outside the field have also been involved to provide challenges, especially in the life sciences field, for the MEMS community to potentially address. The proceedings of the conference will be published as an issue in the online Journal of Physics: Conference Series and this can reach a wider audience and will facilitate the reference and citation of the work presented in the conference. We wish to express our deep gratitude to the International Scientific Committee members and the organizing committee members for contributing to the success of this conference. We would like to thank all the delegates, speakers and sponsors from all over the world for presenting and sharing their perspectives on topics related to MEMS and the challenges that MEMS can potentially address.

Audiovisual heritage preservation in Earth and Space Science Informatics: Videos from Free and Open Source Software for Geospatial (FOSS4G) conferences in the TIB|AV-Portal.

NASA Astrophysics Data System (ADS)

Löwe, Peter; Marín Arraiza, Paloma; Plank, Margret

2016-04-01

The influence of Free and Open Source Software (FOSS) projects on Earth and Space Science Informatics (ESSI) continues to grow, particularly in the emerging context of Data Science or Open Science. The scientific significance and heritage of FOSS projects is only to a limited amount covered by traditional scientific journal articles: Audiovisual conference recordings contain significant information for analysis, reference and citation. In the context of data driven research, this audiovisual content needs to be accessible by effective search capabilities, enabling the content to be searched in depth and retrieved. Thereby, it is ensured that the content producers receive credit for their efforts within the respective communities. For Geoinformatics and ESSI, one distinguished driver is the OSGeo Foundation (OSGeo), founded in 2006 to support and promote the interdisciplinary collaborative development of open geospatial technologies and data. The organisational structure is based on software projects that have successfully passed the OSGeo incubation process, proving their compliance with FOSS licence models. This quality assurance is crucial for the transparent and unhindered application in (Open) Science. The main communication channels within and between the OSGeo-hosted community projects for face to face meetings are conferences on national, regional and global scale. Video recordings have been complementing the scientific proceedings since 2006. During the last decade, the growing body of OSGeo videos has been negatively affected by content loss, obsolescence of video technology and dependence on commercial video portals. Even worse, the distributed storage and lack of metadata do not guarantee concise and efficient access of the content. This limits the retrospective analysis of video content from past conferences. But, it also indicates a need for reliable, standardized, comparable audiovisual repositories for the future, as the number of OSGeo projects continues to grow - and so does the number of topics to be addressed at conferences. Up to now, commercial Web 2.0 platforms like Youtube and Vimeo were used. However, these platforms lack capabilities for long-term archiving and scientific citation, such as persistent identifiers that permit the citation of specific intervals of the overall content. To address these issues, the scientific library community has started to implement improved multimedia archiving and retrieval services for scientific audiovisual content which fulfil these requirements. Using the reference case of the OSGeo conference video recordings, this paper gives an overview over the new and growing collection activities by the German National Library of Science and Technology for audiovisual content in Geoinformatics/ESSI in the TIB|AV Portal for audiovisual content. Following a successful start in 2014 and positive response from the OSGeo Community, the TIB acquisition strategy for OSGeo video material was extended to include German, European, North-American and global conference content. The collection grows steadily by new conference content and also by harvesting of past conference videos from commercial Web 2.0 platforms like Youtube and Vimeo. This positions the TIB|AV-Portal as a reliable and concise long-term resource for innovation mining, education and scholarly research within the ESSI context both within Academia and Industry.

1999 Gordon Research Conference on Mammalian DNA Repair. Final Progress Report

DOE Office of Scientific and Technical Information (OSTI.GOV)

NONE

1999-02-12

This Conference will examine DNA repair as the key component in genomic surveillance that is so crucial to the overall integrity and function of mammalian cells. Recent discoveries have catapulted the field of DNA repair into a pivotal position for fundamental investigations into oncology, aging, environmental health, and developmental biology. We hope to highlight the most promising and exciting avenues of research in robust discussions at this conference. This Mammalian DNA Repair Gordon Conference differs from the past conferences in this series, in which the programs were broader in scope, with respect to topics and biological systems covered. A conferencemore » sponsored by the Genetics Society in April 1998 emphasized recombinational mechanisms for double-strand break repair and the role of mismatch repair deficiency in colorectal cancer. These topics will therefore receive somewhat less emphasis in the upcoming Conference. In view of the recent mechanistic advances in mammalian DNA repair, an upcoming comprehensive DNA repair meeting next autumn at Hilton Head; and the limited enrollment for Gordon Conferences we have decided to focus session-by-session on particular areas of controversy and/or new developments specifically in mammalian systems. Thus, the principal presentations will draw upon results from other cellular systems only to the extent that they impact our understanding of mammalian DNA repair.« less

The RESTORE program of restorative justice for sex crimes: vision, process, and outcomes.

PubMed

Koss, Mary P

2014-06-01

The article reports empirical evaluation of RESTORE, a restorative justice (RJ) conferencing program adapted to prosecutor-referred adult misdemeanor and felony sexual assaults. RESTORE conferences included voluntary enrollment, preparation, and a face-to-face meeting where primary and secondary victims voice impacts, and responsible persons acknowledge their acts and together develop a re-dress plan that is supervised for 1 year. Process data included referral and consent rates, participant characteristics, observational ratings of conferences compared with program design, services delivered, and safety monitoring. Outcome evaluation used 22 cases to assess (a) pre-post reasons for choosing RESTORE, (b) preparation and conference experiences, (c) overall program and justice satisfaction, and (d) completion rates. This is the first peer-reviewed quantitative evaluation of RJ conferencing for adult sexual assault. Although the data have limitations, the results support cautious optimism regarding feasibility, safety, and satisfactory outcomes. They help envision how conferencing could expand and individualize justice options for sexual assault.

Programmed cell death

DOE Office of Scientific and Technical Information (OSTI.GOV)

NONE

The purpose of this conference to provide a multidisciplinary forum for exchange of state-of-the-art information on the role programmed cell death plays in normal development and homeostasis of many organisms. This volume contains abstracts of papers in the following areas: invertebrate development; immunology/neurology; bcl-2 family; biochemistry; programmed cell death in viruses; oncogenesis; vertebrate development; and diseases.

PREFACE: Electron Microscopy and Analysis Group Conference (EMAG2015)

NASA Astrophysics Data System (ADS)

MacLaren, Ian

2015-10-01

2015 marked a new venture for the EMAG group of the Institute of Physics in that the conference was held in conjunction with the MMC2015 conference at the wonderful Manchester Central conference centre. As anyone who was there would be able to confirm, this went exceptionally well and was a really vibrant and top quality conference. The oral sessions were filled with good talks, the poster sessions were very lively, and there was a good balance between oral sessions with a specifically "EMAG" identity, and the integration into a larger conference with the ability to switch between up to six parallel sessions covering physical sciences, techniques, and life sciences. The large conference also attracted a wide range of exhibitors, and this is essential for the ongoing success of all of our work, in a field that is very dependent on continued technical innovation and on collaborations between academic researchers and commercial developers of microscopes, holders, detectors, spectrometers, sample preparation equipment, and software, among other things. As has long been the case at EMAG, all oral and poster presenters were invited to submit papers for consideration for the proceedings. As ever, these papers were independently reviewed by other conference attendees, with the aim of continuing the long tradition of the EMAG proceedings being a top quality, peer-reviewed publication, worthy of reference in future years. Whilst I recognise that not all presenters were able to submit papers to the proceedings (for instance due to the need not to prejudice publication in some other journals, or due to avoiding duplicate publication of data), we are gratified that our presenters submitted as many papers as they did. The 41 papers included provide an interesting snapshot of many of the areas covered in the conference presentations, including functional materials, coatings, 3D microscopy, FIB and SEM, nanomaterials, magnetic and structural materials, advances in EM techniques, and EM of biological systems and biomaterials. The arrangement of the papers in the proceedings is not the same as the ordering of the conference sessions, but has been grouped by similar topics. I hope you enjoy reading these papers and that these serve as an interesting summary of what was an excellent conference. Best wishes Dr Ian MacLaren SUPA School of Physics and Astronomy University of Glasgow Glasgow G12 8QQ

Promotion of Tumor-Initiating Cells in Primary and Recurrent Breast Tumors

DTIC Science & Technology

2014-10-01

confer stemness . We hypothesize that inhibition of IKK/NF-κB will reduce or eliminate breast camcer TICs, blocking tumorigenesis. Furthermore, we...Korkaya H, Liu S, Wicha MS. Breast cancer stem cells, cytokine networks, and the tumor microenvironment. J Clin Invest. 2011 Oct;121(10):3804-9. Review...cells and sub- population of cells termed cancer stem cells or tumor-initiating cells (TICs).1 The primary characteristic of TICs is their ability to

Calcium-binding protein S100A4 confers mesenchymal progenitor cell fibrogenicity in idiopathic pulmonary fibrosis

PubMed Central

Xia, Hong; Gilbertsen, Adam; Herrera, Jeremy; Racila, Emilian; Peterson, Mark; Griffin, Timothy; Benyumov, Alexey; Yang, Libang; Bitterman, Peter B.; Henke, Craig A.

2017-01-01

Idiopathic pulmonary fibrosis (IPF) is a progressive disease with a prevalence of 1 million persons worldwide. The fibrosis spreads from affected alveoli into contiguous alveoli and leads to death by asphyxiation. We previously discovered that the IPF lung harbors fibrogenic mesenchymal progenitor cells (MPCs) that serve as a cell of origin for disease-mediating myofibroblasts. In a prior genomewide transcriptional analysis, we found that IPF MPCs displayed increased expression of S100 calcium-binding A4 (S100A4), a protein linked to cancer cell proliferation and invasiveness. Here, we have examined whether S100A4 mediates MPC fibrogenicity. Ex vivo analysis revealed that IPF MPCs had increased levels of nuclear S100A4, which interacts with L-isoaspartyl methyltransferase to promote p53 degradation and MPC self-renewal. In vivo, injection of human IPF MPCs converted a self-limited bleomycin-induced mouse model of lung fibrosis to a model of persistent fibrosis in an S100A4-dependent manner. S100A4 gain of function was sufficient to confer fibrotic properties to non-IPF MPCs. In IPF tissue, fibroblastic foci contained cells expressing Ki67 and the MPC markers SSEA4 and S100A4. The expression colocalized in an interface region between myofibroblasts in the focus core and normal alveolar structures, defining this region as an active fibrotic front. Our findings indicate that IPF MPCs are intrinsically fibrogenic and that S100A4 confers MPCs with fibrogenicity. PMID:28530639

Peter Rupnowski | NREL

Science.gov Websites

Nanoscience Center, develops novel, high-speed, high-resolution, inline-compatible, nondestructive techniques high-temperature fuel cells and Li-ion batteries. The techniques include hyper-spectral and thermal conference publications. Research Interests Low- and high-temperature fuel cells Li-ion batteries Development

Global Identification of Disease Associated Genes in Fragile X Cells

DTIC Science & Technology

2016-08-01

for this study listed as follows: 1) Validate the co-localized R-loop formation and chromosome fragility in Fragile X cells, particularly at the brain ...retardation protein February 2016, NGS Data Analysis & Informatics Conference, San Diego, California (Poster presentation) Title: Global detection

Rhizoctonia resistance conferred by a sugar beet polygalacturonase-inhibiting protein gene

USDA-ARS?s Scientific Manuscript database

Polygalacturonase-inhibiting proteins (PGIPs) are cell wall leucine-rich repeat (LRR) proteins recognized as having a role in plant defense. PGIPs inhibit fungal polygalacturonase (PG) enzymes that break down the polygalacturonate chain in plant cell walls to initiate disease development. The inte...

Exogenous Gene Transmission of Isocitrate Dehydrogenase 2 Mimics Ischemic Preconditioning Protection.

PubMed

Kolb, Alexander L; Corridon, Peter R; Zhang, Shijun; Xu, Weimin; Witzmann, Frank A; Collett, Jason A; Rhodes, George J; Winfree, Seth; Bready, Devin; Pfeffenberger, Zechariah J; Pomerantz, Jeremy M; Hato, Takashi; Nagami, Glenn T; Molitoris, Bruce A; Basile, David P; Atkinson, Simon J; Bacallao, Robert L

2018-04-01

Ischemic preconditioning confers organ-wide protection against subsequent ischemic stress. A substantial body of evidence underscores the importance of mitochondria adaptation as a critical component of cell protection from ischemia. To identify changes in mitochondria protein expression in response to ischemic preconditioning, we isolated mitochondria from ischemic preconditioned kidneys and sham-treated kidneys as a basis for comparison. The proteomic screen identified highly upregulated proteins, including NADP+-dependent isocitrate dehydrogenase 2 (IDH2), and we confirmed the ability of this protein to confer cellular protection from injury in murine S3 proximal tubule cells subjected to hypoxia. To further evaluate the role of IDH2 in cell protection, we performed detailed analysis of the effects of Idh2 gene delivery on kidney susceptibility to ischemia-reperfusion injury. Gene delivery of IDH2 before injury attenuated the injury-induced rise in serum creatinine ( P <0.05) observed in controls and increased the mitochondria membrane potential ( P <0.05), maximal respiratory capacity ( P <0.05), and intracellular ATP levels ( P <0.05) above those in controls. This communication shows that gene delivery of Idh2 can confer organ-wide protection against subsequent ischemia-reperfusion injury and mimics ischemic preconditioning. Copyright © 2018 by the American Society of Nephrology.

Electronic cigarettes: a review of safety and clinical issues.

PubMed

Weaver, Michael; Breland, Alison; Spindle, Tory; Eissenberg, Thomas

2014-01-01

This clinical case conference discusses 3 cases of patients using electronic cigarettes. Electronic cigarettes, also referred to as electronic nicotine delivery systems or "e-cigarettes," generally consist of a power source (usually a battery) and a heating element (commonly referred to as an atomizer) that vaporize a solution (e-liquid). The user inhales the resulting vapor. E-liquids contain humectants such as propylene glycol and/or vegetable glycerin, flavorings, and usually, but not always, nicotine. Each patient's information is an amalgamation of actual patients and is presented and then followed by a discussion of clinical issues.

A genome-wide screen identifies YAP/WBP2 interplay conferring growth advantage on human epidermal stem cells

PubMed Central

Walko, Gernot; Woodhouse, Samuel; Pisco, Angela Oliveira; Rognoni, Emanuel; Liakath-Ali, Kifayathullah; Lichtenberger, Beate M.; Mishra, Ajay; Telerman, Stephanie B.; Viswanathan, Priyalakshmi; Logtenberg, Meike; Renz, Lisa M.; Donati, Giacomo; Quist, Sven R.; Watt, Fiona M.

2017-01-01

Individual human epidermal cells differ in their self-renewal ability. To uncover the molecular basis for this heterogeneity, we performed genome-wide pooled RNA interference screens and identified genes conferring a clonal growth advantage on normal and neoplastic (cutaneous squamous cell carcinoma, cSCC) human epidermal cells. The Hippo effector YAP was amongst the top positive growth regulators in both screens. By integrating the Hippo network interactome with our data sets, we identify WW-binding protein 2 (WBP2) as an important co-factor of YAP that enhances YAP/TEAD-mediated gene transcription. YAP and WPB2 are upregulated in actively proliferating cells of mouse and human epidermis and cSCC, and downregulated during terminal differentiation. WBP2 deletion in mouse skin results in reduced proliferation in neonatal and wounded adult epidermis. In reconstituted epidermis YAP/WBP2 activity is controlled by intercellular adhesion rather than canonical Hippo signalling. We propose that defective intercellular adhesion contributes to uncontrolled cSCC growth by preventing inhibition of YAP/WBP2. PMID:28332498

Evaluation of a Crack-Growth Gage for Monitoring Possible Structural Fatigue-Crack Growth

DTIC Science & Technology

1978-02-01

the gages and structural components and tested the specimens. Appreciation is also extended to Dennis E. Macha for his effort in making the laser...SDM Conference AIAA/ASME, San Diego, California, March 21-23, 1977. 20 AFML-TR-77-233 REFERENCES (CONTINUED) 12. D. E. Macha , W. N. Sharpe, Jr., and A

The Tie that Binds: Building Discourse Communities and Group Cohesion through Computer-Based Conferences.

ERIC Educational Resources Information Center

Selfe, Cynthia L.; Eilola, J. Daniel

1988-01-01

Discussion of the use of electronic conferencing to form a discourse community focuses on a case study of student consultants working in a microcomputer lab supporting writing courses at Michigan Technological University. The formulation of a group identity, as well as group values, goals, and expectations are discussed. (16 references) (LRW)

A Measurement of Student Teachers' Parent-Teacher Communication Competences: The Design of a Video-Based Instrument

ERIC Educational Resources Information Center

De Coninck, Karen; Valcke, Martin; Vanderlinde, Ruben

2018-01-01

This study reports on the design of a video-based instrument to assess student teachers' parent-teacher communication competences (PTCC) in a reliable and valid way. PTCC refer to the competences needed to communicate successfully with parents during conversations such as parent-teacher conferences. Taking into account both conceptual and…

Cumulutive reports and publications through December 31, 1984

NASA Technical Reports Server (NTRS)

1985-01-01

A complete list of the Institute for Computer Applications in Science and Engineering (ICASE) Reports are given. Since ICASE Reports are intended to be preprints of articles that will appear in journals or conference proceedings, the published reference is included when it is available. Topics include numerical methods, parameter identification, fluid dynamics, acoustics, structural analysis, and computers.

An XCP User’s Guide and Reference Manual

DTIC Science & Technology

1993-08-01

Sanford, and J. R. Haustein , 1985: Observing hurricane-driven waves and currents, Proc. 17th Annual Offshore Technology Conference, OTC 4934, 331-339...of Washington, Seattle, IWA, 164 pp. I 3 TR 9309 A3 I I Sanford, T. B., P. G. Black, J. R. Haustein , J. W. Feeney, G. Z. Forristall, and J. F. Price

Effects of Alloy Chemistry Changes on Sacrificial Aluminum Anode Performance, Tri-Service Committee on Corrosion Proceedings

DTIC Science & Technology

1994-06-01

Notes 14. Abstract 15. Subject Terms Tri-Service Conference on Corrosion A • PON ... i 19. Limitation 20. # of 21. Responsible Person...review of the text. REFERENCES 1. Reding , J.’ J.J. Newport III and J.R. Minderhout; US Patent 3,321,306, "Galvanic Anode Alloy and Products Produced

Forest Resilience, Biodiversity, and Climate Change

Treesearch

I. Thompson; B. Mackey; S. McNulty; A. Mosseler

2009-01-01

This paper reviews the concepts of ecosystem resilience, resistance, and stability in forests and their relationship to biodiversity, with particular reference to climate change. The report is a direct response to a request by the ninth meeting of the Conference of the Parties to the CBD, in decision IX/51, to explore the links between biodiversity, forest ecosystem...

Combustion Science to Reduce PM Emissions for Military Platforms

DTIC Science & Technology

2012-01-01

355 7.0 References 356 Appendix: List of Archival Publications and Conference Papers 376 vi List...carbonaddition HITRAN Database of infra-red spectra HP High Pressure HW Harris and Weiner ICCD Intensified charge coupled device ID internal diameter IR ...archival publication based on this work received a distinguished outstanding paper award at the 32nd International Combustion Symposium

Aerospace technology transfer to the public sector; Proceedings of the Conference, Crystal City, Va., November 9-11, 1977

NASA Technical Reports Server (NTRS)

Grey, J. (Editor); Newman, M.

1978-01-01

The dynamics of aerospace technology transfer is discussed with reference to the agencies which facilitate the transfer to both the public and private sectors. Attention is given to NASA's Technology Utilization Program, and to specific applications of aerospace technology spinoff in the daily life of Americans.

12 CFR Appendix A to Subpart B of... - Commentary

Code of Federal Regulations, 2014 CFR

2014-01-01

...,” as defined in section 4A-501(b) of Article 4A, Funds Transfers, of the Uniform Commercial Code (UCC... refers to other provisions of the Uniform Commercial Code, e.g., definitions in article 1 of the UCC, these other provisions of the UCC, as approved by the National Conference of Commissioners on Uniform...

12 CFR Appendix A to Subpart B of... - Commentary

Code of Federal Regulations, 2010 CFR

2010-01-01

...,” as defined in section 4A-501(b) of Article 4A, Funds Transfers, of the Uniform Commercial Code (UCC... refers to other provisions of the Uniform Commercial Code, e.g., definitions in Article 1 of the UCC, these other provisions of the UCC, as approved by the National Conference of Commissioners on Uniform...

12 CFR Appendix A to Subpart B of... - Commentary

Code of Federal Regulations, 2011 CFR

2011-01-01

...,” as defined in section 4A-501(b) of Article 4A, Funds Transfers, of the Uniform Commercial Code (UCC... refers to other provisions of the Uniform Commercial Code, e.g., definitions in Article 1 of the UCC, these other provisions of the UCC, as approved by the National Conference of Commissioners on Uniform...

12 CFR Appendix A to Subpart B of... - Commentary

Code of Federal Regulations, 2013 CFR

2013-01-01

...,” as defined in section 4A-501(b) of Article 4A, Funds Transfers, of the Uniform Commercial Code (UCC... refers to other provisions of the Uniform Commercial Code, e.g., definitions in article 1 of the UCC, these other provisions of the UCC, as approved by the National Conference of Commissioners on Uniform...

12 CFR Appendix A to Subpart B of... - Commentary

Code of Federal Regulations, 2012 CFR

2012-01-01

...,” as defined in section 4A-501(b) of Article 4A, Funds Transfers, of the Uniform Commercial Code (UCC... refers to other provisions of the Uniform Commercial Code, e.g., definitions in Article 1 of the UCC, these other provisions of the UCC, as approved by the National Conference of Commissioners on Uniform...

To amend title 38, United States Code, to direct the Secretary of Veterans Affairs to notify Congress of conferences sponsored by the Department of Veterans Affairs, and for other purposes.

THOMAS, 112th Congress

Rep. Stutzman, Marlin A. [R-IN-3

2011-06-22

Senate - 10/12/2011 Received in the Senate and Read twice and referred to the Committee on Veterans' Affairs. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

Difference and Choice: Exploring Prenatal Testing and the Use of Genetic Information with People with Learning Difficulties.

ERIC Educational Resources Information Center

Ward, Linda; Howarth, Joyce; Rodgers, Jackie

2002-01-01

This article describes two workshops that explained the use of prenatal testing and genetic information to inform choices in pregnancy to people with learning difficulties, explored the issues with them, and describe the contribution subsequently made by these people to a British national conference on this subject. (Contains references.)…

Marketing & Libraries Do Mix: A Handbook for Libraries and Information Centers.

ERIC Educational Resources Information Center

Tenney, H. Baird; And Others

This handbook offers a practical set of ideas to help all types of libraries in the task of marketing their services in an increasingly competitive economy and provides a model program as urged by the White House Conference on Library and Information Services. It is aimed at adult information services in particular, with passing references to…

Perspectives on Terminology and Conceptual and Professional Issues in Health Education and Health Promotion Credentialing

ERIC Educational Resources Information Center

Taub, Alyson; Allegrante, John P.; Barry, Margaret M.; Sakagami, Keiko

2009-01-01

This article was prepared to inform the deliberations of the Galway Consensus Conference by providing a common and global reference point for the discussion of terminology and key conceptual and professional issues in the credentialing of health education and health promotion specialists. The article provides a review of the terminology that is…

DIALOG Users Workshope, August 8-9, 1974. Second Working Conference. Arlington, Virginia.

ERIC Educational Resources Information Center

Federation of Information Users, Pittsburgh, PA.

The workshop had its genesis in the belief that interactive bibliographic data base searching will become an essential function of reference service and that there is a need for indepth training and more communication with suppliers--the on-line system supplier and the data base supplier. The workshop included presentations by data base suppliers,…

Making an "Impact": Some Personal Reflections on the Humanities in the UK

ERIC Educational Resources Information Center

Looseley, David

2011-01-01

This article brings together reflections on the impact agenda from two separate sources: a conference at the University of Warwick in August 2009, and a speech given at the University of Leeds some weeks before. It develops these reflections with particular reference to Modern Languages, reviewing how the Humanities probe other value systems, deal…

76 FR 37808 - PJM Interconnection, L.L.C.; Notice of Discussion Topics for Staff Technical Conference

Federal Register 2010, 2011, 2012, 2013, 2014

2011-06-28

... performance measurement of demand response in PJM's capacity market, the Reliability Pricing Model (RPM). \\1...'s April 7, 2011 filing, which proposes to modify the reference point of capacity demand response... less than the customer's Peak Load Contribution (PLC).\\2\\ \\2\\ PJM describes the PLC as the average of...

Photovoltaic Science and Engineering Conference in Japan, 2nd, Tokyo, Japan, December 2-4, 1980, Proceedings

NASA Astrophysics Data System (ADS)

The state-of-the-art in amorphous solar cells is reviewed in terms of polycrystalline silicon solar cells, single crystal silicon solar cells, and methods of characterizing solar cells, including dielectric liquid immersion to increase cell efficiency. Compound semiconductor solar cells are explored, and new structures and advanced solar cell materials are discussed. Film deposition techniques for fabricating amorphous solar cells are presented, and the characterization, in addition to the physics and the performance, of amorphous solar cells are examined.

Distinct mechanisms act in concert to mediate cell cycle arrest.

PubMed

Toettcher, Jared E; Loewer, Alexander; Ostheimer, Gerard J; Yaffe, Michael B; Tidor, Bruce; Lahav, Galit

2009-01-20

In response to DNA damage, cells arrest at specific stages in the cell cycle. This arrest must fulfill at least 3 requirements: it must be activated promptly; it must be sustained as long as damage is present to prevent loss of genomic information; and after the arrest, cells must re-enter into the appropriate cell cycle phase to ensure proper ploidy. Multiple molecular mechanisms capable of arresting the cell cycle have been identified in mammalian cells; however, it is unknown whether each mechanism meets all 3 requirements or whether they act together to confer specific functions to the arrest. To address this question, we integrated mathematical models describing the cell cycle and the DNA damage signaling networks and tested the contributions of each mechanism to cell cycle arrest and re-entry. Predictions from this model were then tested with quantitative experiments to identify the combined action of arrest mechanisms in irradiated cells. We find that different arrest mechanisms serve indispensable roles in the proper cellular response to DNA damage over time: p53-independent cyclin inactivation confers immediate arrest, whereas p53-dependent cyclin downregulation allows this arrest to be sustained. Additionally, p21-mediated inhibition of cyclin-dependent kinase activity is indispensable for preventing improper cell cycle re-entry and endoreduplication. This work shows that in a complex signaling network, seemingly redundant mechanisms, acting in a concerted fashion, can achieve a specific cellular outcome.

SINGLE MOLECULE APPROACHES TO BIOLOGY, 2010 GORDON RESEARCH CONFERENCE, JUNE 27-JULY 2, 2010, ITALY

DOE Office of Scientific and Technical Information (OSTI.GOV)

Professor William Moerner

2010-07-09

The 2010 Gordon Conference on Single-Molecule Approaches to Biology focuses on cutting-edge research in single-molecule science. Tremendous technical developments have made it possible to detect, identify, track, and manipulate single biomolecules in an ambient environment or even in a live cell. Single-molecule approaches have changed the way many biological problems are addressed, and new knowledge derived from these approaches continues to emerge. The ability of single-molecule approaches to avoid ensemble averaging and to capture transient intermediates and heterogeneous behavior renders them particularly powerful in elucidating mechanisms of biomolecular machines: what they do, how they work individually, how they work together,more » and finally, how they work inside live cells. The burgeoning use of single-molecule methods to elucidate biological problems is a highly multidisciplinary pursuit, involving both force- and fluorescence-based methods, the most up-to-date advances in microscopy, innovative biological and chemical approaches, and nanotechnology tools. This conference seeks to bring together top experts in molecular and cell biology with innovators in the measurement and manipulation of single molecules, and will provide opportunities for junior scientists and graduate students to present their work in poster format and to exchange ideas with leaders in the field. A number of excellent poster presenters will be selected for short oral talks. Topics as diverse as single-molecule sequencing, DNA/RNA/protein interactions, folding machines, cellular biophysics, synthetic biology and bioengineering, force spectroscopy, new method developments, superresolution imaging in cells, and novel probes for single-molecule imaging will be on the program. Additionally, the collegial atmosphere of this Conference, with programmed discussion sessions as well as opportunities for informal gatherings in the afternoons and evenings in the beauty of the Il Ciocco site in Tuscany, provides an avenue for scientists from different disciplines to interact and brainstorm and promotes cross-disciplinary collaborations directed toward compelling biological problems.« less

Enhancing the Breadth of Efficacy of Therapeutic Vaccines for Breast Cancer

DTIC Science & Technology

2014-10-01

4b. Generate specific tumor antigen lysates from recombinant baculovirus- infected insect cells. *Currently expressing antigens in C1R cells since... Immunology Conference, Breckenridge CO (invited by Jim Hagman). Sept 20, 2014, Analysis of the T cell repertoire in breast cancer using emulsion...by Jonathan Bramson).   13 Nov 11, 2014 (anticipated), Elimination of the bottlenecks in T cell receptor antigen discovery, Immunology Forum

Stem cell gene therapy--second conference. Biology and technology. 31 May - 3 June 1998, Orcas Island, WA, USA.

PubMed

Barquinero, J

1998-07-01

This conference, which was organized by George Stamatoyanno-poulos (University of Washington, Seattle, WA, USA), comprised 44 oral and 55 poster presentations. It started immediately after the First Annual Meeting of the American Society of Gene Therapy in Seattle, and took place at the Rosario Resort, located in the beautiful and quiet Orcas Island, in the Pacific Northwest. Several issues including stem cell biology, viral vectors, gene transfer into hematopoietic stem cells (HSCs) and a variety of clinical trials were covered. There were about 150 attendees including students, postdoctoral fellows and prominent experts in different aspects of the field. Most of these were from academia including research institutes, universities and hospitals, with a very small proportion from industry. Some of the information had already been presented a few days before at the Seattle meeting.

Platelets regulate lymphatic vascular development through CLEC-2-SLP-76 signaling.

PubMed

Bertozzi, Cara C; Schmaier, Alec A; Mericko, Patricia; Hess, Paul R; Zou, Zhiying; Chen, Mei; Chen, Chiu-Yu; Xu, Bin; Lu, Min-min; Zhou, Diane; Sebzda, Eric; Santore, Matthew T; Merianos, Demetri J; Stadtfeld, Matthias; Flake, Alan W; Graf, Thomas; Skoda, Radek; Maltzman, Jonathan S; Koretzky, Gary A; Kahn, Mark L

2010-07-29

Although platelets appear by embryonic day 10.5 in the developing mouse, an embryonic role for these cells has not been identified. The SYK-SLP-76 signaling pathway is required in blood cells to regulate embryonic blood-lymphatic vascular separation, but the cell type and molecular mechanism underlying this regulatory pathway are not known. In the present study we demonstrate that platelets regulate lymphatic vascular development by directly interacting with lymphatic endothelial cells through C-type lectin-like receptor 2 (CLEC-2) receptors. PODOPLANIN (PDPN), a transmembrane protein expressed on the surface of lymphatic endothelial cells, is required in nonhematopoietic cells for blood-lymphatic separation. Genetic loss of the PDPN receptor CLEC-2 ablates PDPN binding by platelets and confers embryonic lymphatic vascular defects like those seen in animals lacking PDPN or SLP-76. Platelet factor 4-Cre-mediated deletion of Slp-76 is sufficient to confer lymphatic vascular defects, identifying platelets as the cell type in which SLP-76 signaling is required to regulate lymphatic vascular development. Consistent with these genetic findings, we observe SLP-76-dependent platelet aggregate formation on the surface of lymphatic endothelial cells in vivo and ex vivo. These studies identify a nonhemostatic pathway in which platelet CLEC-2 receptors bind lymphatic endothelial PDPN and activate SLP-76 signaling to regulate embryonic vascular development.

Deoxycytidine kinase is downregulated under hypoxic conditions and confers resistance against cytarabine in acute myeloid leukaemia.

PubMed

Degwert, Nicole; Latuske, Emily; Vohwinkel, Gabi; Stamm, Hauke; Klokow, Marianne; Bokemeyer, Carsten; Fiedler, Walter; Wellbrock, Jasmin

2016-09-01

Leukaemia initiating cells reside within specialised niches in the bone marrow where they undergo complex interactions with different stromal cell types. The bone marrow niche is characterised by a low oxygen content resulting in high expression of hypoxia-inducible factor 1 α in leukaemic cells conferring a negative prognosis to patients with acute myeloid leukaemia (AML). In the current study, we investigated the impact of hypoxic vs. normoxic conditions on the sensitivity of AML cell lines and primary AML blasts to cytarabine. AML cells cultured under 6% oxygen were significantly more resistant against cytarabine compared to cells cultured under normoxic conditions in proliferation and colony-formation assays. Interestingly upon cultivation under hypoxia, the expression of the cytarabine-activating enzyme deoxycytidine kinase was downregulated in all analysed AML cell lines and primary AML samples representing a possible mechanism for resistance to chemotherapy. Furthermore, the downregulation of deoxycytidine kinase could be associated with hypoxia-inducible factor 1 α as treatment with its inhibitor BAY87-2243 hampered the downregulation of deoxycytidine kinase expression under hypoxic conditions. In conclusion, our data reveal that hypoxia-induced downregulation of deoxycytidine kinase represents one stroma-cell-independent mechanism of drug resistance to cytarabine in acute myeloid leukaemia. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

NOTCH2 signaling confers immature morphology and aggressiveness in human hepatocellular carcinoma cells

PubMed Central

HAYASHI, YOSHIHIRO; OSANAI, MAKOTO; LEE, GANG-HONG

2015-01-01

The NOTCH family of membranous receptors plays key roles during development and carcinogenesis. Since NOTCH2, yet not NOTCH1 has been shown essential for murine hepatogenesis, NOTCH2 rather than NOTCH1 may be more relevant to human hepatocarcinogenesis; however, no previous studies have supported this hypothesis. We therefore assessed the role of NOTCH2 in human hepatocellular carcinoma (HCC) by immunohistochemistry and cell culture. Immunohistochemically, 19% of primary HCCs showed nuclear staining for NOTCH2, indicating activated NOTCH2 signaling. NOTCH2-positive HCCs were on average in more advanced clinical stages, and exhibited more immature cellular morphology, i.e. higher nuclear-cytoplasmic ratios and nuclear densities. Such features were not evident in NOTCH1-positive HCCs. In human HCC cell lines, abundant NOTCH2 expression was associated with anaplasia, represented by loss of E-cadherin. When NOTCH2 signaling was stably downregulated in HLF cells, an anaplastic HCC cell line, the cells were attenuated in potential for in vitro invasiveness and migration, as well as in vivo tumorigenicity accompanied by histological maturation. Generally, inverse results were obtained for a differentiated HCC cell line, Huh7, manipulated to overexpress activated NOTCH2. These findings suggested that the NOTCH2 signaling may confer aggressive behavior and immature morphology in human HCC cells. PMID:26252838

NOTCH2 signaling confers immature morphology and aggressiveness in human hepatocellular carcinoma cells.

PubMed

Hayashi, Yoshihiro; Osanai, Makoto; Lee, Gang-Hong

2015-10-01

The NOTCH family of membranous receptors plays key roles during development and carcinogenesis. Since NOTCH2, yet not NOTCH1 has been shown essential for murine hepatogenesis, NOTCH2 rather than NOTCH1 may be more relevant to human hepatocarcinogenesis; however, no previous studies have supported this hypothesis. We therefore assessed the role of NOTCH2 in human hepatocellular carcinoma (HCC) by immunohistochemistry and cell culture. Immunohistochemically, 19% of primary HCCs showed nuclear staining for NOTCH2, indicating activated NOTCH2 signaling. NOTCH2-positive HCCs were on average in more advanced clinical stages, and exhibited more immature cellular morphology, i.e. higher nuclear-cytoplasmic ratios and nuclear densities. Such features were not evident in NOTCH1‑positive HCCs. In human HCC cell lines, abundant NOTCH2 expression was associated with anaplasia, represented by loss of E-cadherin. When NOTCH2 signaling was stably downregulated in HLF cells, an anaplastic HCC cell line, the cells were attenuated in potential for in vitro invasiveness and migration, as well as in vivo tumorigenicity accompanied by histological maturation. Generally, inverse results were obtained for a differentiated HCC cell line, Huh7, manipulated to overexpress activated NOTCH2. These findings suggested that the NOTCH2 signaling may confer aggressive behavior and immature morphology in human HCC cells.

New insights into antimetastatic and antiangiogenic effects of cannabinoids.

PubMed

Ramer, Robert; Hinz, Burkhard

2015-01-01

Cannabinoids exert antitumorigenic effects via multiple mechanisms. Of these, antimetastatic and antiangiogenic actions have attracted considerable interest in the past years. Regarding the underlying antimetastatic mechanism, several studies revealed cannabinoids to alter the gene expression of cancer cells toward a less-aggressive phenotype and to modulate their secretomic profile. Cannabinoids likewise modulate the release of factors from tumor cells that subsequently suppress the chemoattraction of vessel cells thereby conferring antiangiogenesis. Among the diverse mediators of cannabinoids' antitumorigenic action, the tissue inhibitor of matrix metalloproteinases-1, which is released from cancer cells upon cannabinoid treatment, has been implicated as a pivotal factor conferring both anti-invasive properties of cancer cells as well as antiangiogenic capacities of endothelial cells. In addition, cannabinoids have been shown to inhibit angiogenic capacities of endothelial cells directly via suppressing their proliferation, tube formation, and migration. This chapter reviews the cell- and substance-specific antitumorigenic mechanisms of cannabinoids with particular consideration of their antimetastatic/anti-invasive and antiangiogenic actions. In addition, beneficial interactions of cannabinoids with currently used chemotherapeutics as well as the influence of cannabinoids on tumor-immune surveillance are addressed. Collectively, the currently available data suggest cannabinoids as a potential tool in modern cancer pharmacotherapy. Copyright © 2015 Elsevier Inc. All rights reserved.

Space Electrochemical Research and Technology

NASA Technical Reports Server (NTRS)

1993-01-01

This document contains the proceedings of NASA's fourth Space Electrochemical Research and Technology (SERT) Conference, held at the NASA Lewis Research Center on April 14-15, 1993. The objective of the conference was to assess the present status and general thrust of research and development in those areas of electrochemical technology required to enable NASA missions into the next century. The conference provided a forum for the exchange of ideas and opinions of those actively involved in the field, in order to define new opportunities for the application of electrochemical processes in future NASA missions. Papers were presented in three technical areas: advanced secondary batteries, fuel cells, and advanced concepts for space power. This document contains the papers presented.

12th International CHARGE syndrome conference proceedings.

PubMed

Martin, Donna M; Salem-Hartshorne, Nancy; Hartshorne, Timothy S; Scacheri, Peter C; Hefner, Margaret A

2016-04-01

The CHARGE Syndrome Foundation holds an International conference for families and professionals every other summer. In July, 2015, the 12th meeting was held in Schaumburg, Illinois, at the Renaissance Schaumburg Hotel. Day one of the 4-day conference was dedicated to professionals caring for and researching various aspects of CHARGE, including education, medical management, animal models, and stem cell-based approaches to understanding and treating individuals with CHARGE. Here, we summarize presentations from the meeting, including a synopsis of each of the three different breakout sessions (Medical/Clinical, Basic Science/CHD7, and Education), followed by a list of abstracts and authors for both platform and poster presentations. © 2016 Wiley Periodicals, Inc.

RasGRP1 confers the phorbol ester-sensitive phenotype to EL4 lymphoma cells.

PubMed

Han, Shujie; Knoepp, Stewart M; Hallman, Mark A; Meier, Kathryn E

2007-01-01

The murine EL4 lymphoma cell line exists in variants that are either sensitive or resistant to the tumor promoter phorbol 12-myristate 13-acetate (PMA). In sensitive EL4 cells, PMA causes robust Erk mitogen-activated protein kinase activation that results in growth arrest. In resistant cells, PMA induces minimal Erk activation, without growth arrest. PMA stimulates IL-2 production in sensitive, but not resistant, cells. The role of RasGRP1, a PMA-activated guanine nucleotide exchange factor for Ras, in EL4 phenotype was examined. Endogenous RasGRP1 protein is expressed at much higher levels in sensitive than in resistant cells. PMA-induced Ras activation is observed in sensitive cells but not in resistant cells lacking Ras-GRP1. PMA induces down-regulation of RasGRP1 protein in sensitive cells but increases RasGRP1 in resistant cells. Transfection of RasGRP1 into resistant cells enhances PMA-induced Erk activation. In the reverse experiment, introduction of small interfering RNA (siRNA) for RasGRP1 suppresses PMA-induced Ras and Erk activations in sensitive cells. Sensitive cells incubated with siRNA for RasGRP1 exhibit the PMA-resistant phenotype, in that they are able to proliferate in the presence of PMA and do not secrete IL-2 when stimulated with PMA. These studies indicate that the PMA-sensitive phenotype, as previously defined for the EL4 cell line, is conferred by endogenous expression of RasGRP1 protein.

Clinical and genetic aspects of testicular germ cell tumours.

PubMed

Lutke Holzik, Martijn F; Sijmons, Rolf H; Hoekstra-Weebers, Josette Ehm; Sleijfer, Dirk T; Hoekstra, Harald J

2008-02-15

In this paper we review clinical and genetic aspects of testicular germ cell tumours (TGCTs). TGCT is the most common type of malignant disorder in men aged 1540 years. Its incidence has increased sharply in recent years. Fortunately, survival of patients with TGCT has improved enormously, which can chiefly be attributed to the cisplatin-based polychemotherapy that was introduced in the nineteen eighties to treat patients with metastasized TGCT. In addition, new strategies have been developed in the surgical approach to metastasized/non-metastasized TGCT and alterations have been made to the radiotherapy technique and radiation dose for seminoma. Family history of TGCT is among the strongest risk factors for this tumour type. Although this fact and others suggest the existence of genetic predisposition to develop TGCT, no germline mutations conferring high risk of developing TGCT have been identified so far. A small deletion, referred to as gr/gr, identified on the Y chromosome is probably associated with only a modest increase in TGCT risk, and linkage of familial TGCT to the Xq27 region has not been confirmed yet. Whether highly penetrant TGCT-predisposing mutations truly exist or familial clustering of TGCT can be explained by combinations of weak predispositions, shared in utero or postnatal risks factors and coincidental somatic mutations is an intriguing puzzle, still waiting to be solved.

Experienced Junior-High-School Teachers' PCK in Light of a Curriculum Change: "The Cell Is to Be Studied Longitudinally"

ERIC Educational Resources Information Center

Cohen, Rachel; Yarden, Anat

2009-01-01

In the new science and technology junior-high-school curriculum in Israel, it is recommended that the cell topic be taught "longitudinally in conjunction with other study contents". This recommendation confers a change in teaching the cell topic and provides an opportunity to form meaningful relationships between biological phenomena at…

The expanding implications of polyploidy

PubMed Central

Schoenfelder, Kevin P.

2015-01-01

Polyploid cells, which contain more than two genome copies, occur throughout nature. Beyond well-established roles in increasing cell size/metabolic output, polyploidy can also promote nonuniform genome, transcriptome, and metabolome alterations. Polyploidy also frequently confers resistance to environmental stresses not tolerated by diploid cells. Recent progress has begun to unravel how this fascinating phenomenon contributes to normal physiology and disease. PMID:26008741

Natural sequence variants of yeast environmental sensors confer cell-to-cell expression variability

PubMed Central

Fehrmann, Steffen; Bottin-Duplus, Hélène; Leonidou, Andri; Mollereau, Esther; Barthelaix, Audrey; Wei, Wu; Steinmetz, Lars M; Yvert, Gaël

2013-01-01

Living systems may have evolved probabilistic bet hedging strategies that generate cell-to-cell phenotypic diversity in anticipation of environmental catastrophes, as opposed to adaptation via a deterministic response to environmental changes. Evolution of bet hedging assumes that genotypes segregating in natural populations modulate the level of intraclonal diversity, which so far has largely remained hypothetical. Using a fluorescent Pmet17-GFP reporter, we mapped four genetic loci conferring to a wild yeast strain an elevated cell-to-cell variability in the expression of MET17, a gene regulated by the methionine pathway. A frameshift mutation in the Erc1p transmembrane transporter, probably resulting from a release of laboratory strains from negative selection, reduced Pmet17-GFP expression variability. At a second locus, cis-regulatory polymorphisms increased mean expression of the Mup1p methionine permease, causing increased expression variability in trans. These results demonstrate that an expression quantitative trait locus (eQTL) can simultaneously have a deterministic effect in cis and a probabilistic effect in trans. Our observations indicate that the evolution of transmembrane transporter genes can tune intraclonal variation and may therefore be implicated in both reactive and anticipatory strategies of adaptation. PMID:24104478

ACY-1215 accelerates vemurafenib induced cell death of BRAF-mutant melanoma cells via induction of ER stress and inhibition of ERK activation.

PubMed

Peng, Ueihuei; Wang, Zhihao; Pei, Sa; Ou, Yunchao; Hu, Pengchao; Liu, Wanhong; Song, Jiquan

2017-02-01

BRAFV600E mutation is found in ~50% of melanoma patients and BRAFV600E kinase activity inhibitor, vemurafenib, has achieved a remarkable clinical response rate. However, most patients treated with vemurafenib eventually develop resistance. Overcoming primary and secondary resistance to selective BRAF inhibitors remains one of the most critically compelling challenges for these patients. HDAC6 has been shown to confer resistance to chemotherapy in several types of cancer. Few studies focused on the role of HDAC6 in vemurafenib resistance. Here we showed that overexpression of HDAC6 confers resistance to vemurafenib in BRAF-mutant A375 cells. ACY-1215, a selective HDAC6 inhibitor, inhibits the proliferation and induces the apoptosis of A375 cells. Moreover, ACY-1215 sensitizes A375 cells to vemurafenib induced cell proliferation inhibition and apoptosis induction, which occur partly through induction of endoplasmic reticulum (ER) stress and inactivation of extracellular signal-regulated kinase (ERK). Taken together, our results suggest that the inhibition of HDAC6 may be a promising strategy for the treatment of melanoma and overcoming resistance to vemurafenib.

Phosphorylation of AKT induced by phosphorylated Hsp27 confers the apoptosis-resistance in t-AUCB-treated glioblastoma cells in vitro.

PubMed

Li, Rujun; Li, Junyang; Sang, Dongping; Lan, Qing

2015-01-01

The aim of this study is to determine whether phosphorylation of AKT could be effected by t-AUCB-induced p-Hsp27 and whether p-AKT inhibition sensitizes glioblastoma cells to t-AUCB, and to evaluate the effects of simultaneous inhibition of p-Hsp27 and p-AKT on t-AUCB treated glioblastoma cells. Cell growth was detected using CCK-8 assay; Caspase-3 activity assay kits and flow cytometry were used in apoptosis analysis; Western blot analysis was used to detect p-Hsp27 and p-AKT levels; RNA interference using the siRNA oligos of Hsp27 was performed to knockdown gene expression of Hsp27. All data were analyzed by the Student-Newman-Keul's test. We demonstrated that t-AUCB treatment induces AKT phosphorylation by activating Hsp27 in U251 and LN443 cell lines. Inhibition of AKT phosphorylation by AKT inhibitor IV sensitizes glioblastoma cells to t-AUCB, strengthens t-AUCB suppressing cell growth and inducing cell apoptosis. We also found inhibiting both p-Hsp27 and p-AKT synergistically strengthen t-AUCB suppressing cell growth. Thus, p-AKT induced by p-Hsp27 confers the apoptosis-resistance in t-AUCB-treated glioblastoma cells. Targeting p-Hsp27 and/or p-AKT may be a potential effective strategy for the treatment of glioblastoma.

The Conference Proceedings of the 2003 Air Transport Research Society (ATRS) World Conference, Volume 5

NASA Technical Reports Server (NTRS)

Bowen, Brent (Editor); Gudmundsson, Sveinn (Editor); Oum, Tae (Editor)

2003-01-01

The UNO Aviation Institute Monograph Series began in 1994 as a key component of the education outreach and information transfer missions of the Aviation Institute and the NASA Nebraska Space Grant & EPSCoR Programs. The series is an outlet for aviation materials to be indexed and disseminated through an efficient medium. Publications are welcome in all aspects of aviation. Publication formats may include, but are not limited to, conference proceedings, bibliographies, research reports, manuals, technical reports, and other documents that should be archived and indexed for future reference by the aviation and world wide communities. The Conference proceedings of the 2003 Air Transport Research Society (ATRS) world conference, volume 5 is presented. The topics include: 1) The Temporal Configuration of Airline Networks in Europe; 2) Determination and Applications of Environmental Costs at Different Sized Airports-Aircraft Noise and Engine Emissions; 3) Cost Effective Measures to Reduce CO2 Emissions in the Air Freight Sector; 4) An Assessment of the Sustainability of Air Transport System: Quantification of Indicators; 5) Regulation, Competition and Network Evolution in Aviation; 6) Regulation in the Air: Price and Frequency Cap; 7) Industry Consolidation and Future Airline Network Structures in Europe; 8) Application of Core Theory to the U.S. Airline Industry; 9) Air Freight Transshipment Route Choice Analysis; 10) A Fuzzy Approach of the Competition on Air Transport Market; and 11) Developing Passenger Demand Models for International Aviation from/to Egypt: A Case Study of Cairo Airport and Egyptair.

Antibody induced CD4 down-modulation of T cells is site-specifically mediated by CD64+ cells

PubMed Central

Vogel, Stephanie; Grabski, Elena; Buschjäger, Daniela; Klawonn, Frank; Döring, Marius; Wang, Junxi; Fletcher, Erika; Bechmann, Ingo; Witte, Torsten; Durisin, Martin; Schraven, Burkhart; Mangsbo, Sara M.; Schönfeld, Kurt; Czeloth, Niklas; Kalinke, Ulrich

2015-01-01

Treatment of PBMC with the CD4-specific mAb BT-061 induces CD4 down-modulation of T cells. Here we report that addition of BT-061 to purified T cells did not confer this effect, whereas incubation of T cells in BT-061 coated wells restored CD4 down-modulation. These results implied that Fcγ receptor mediated cell-cell interactions played a role. In consistence with this hypothesis PBMC depleted of CD64+ monocytes did not confer CD4 down-modulation of BT-061 decorated T cells. Strikingly, CD4 down-modulation was observed in BT-061 treated synovial fluid punctuated from patients’ inflamed joints that comprised enhanced numbers of CD64+ cells. In contrast, in a circulating whole blood system injection of BT-061 did not induce CD4 down-modulation, due to CD64 saturation by serum IgG. Similarly, tonsil derived mononuclear cells devoid of CD64+ cells did not show CD4 down-modulation, whereas addition of blood derived monocytes restored the effect. Thus, the interaction of BT-061 decorated T cells with CD64+ cells is needed for CD4 down-modulation, implying that in patients BT-061 would primarily induce CD4 down-modulation at inflammatory sites. These results highlight the need not only to examine the interaction of a given mAb with single FcγR, but also the immunological environment that is appropriate to support such interactions. PMID:26670584

Csf3r mutations in mice confer a strong clonal HSC advantage via activation of Stat5

PubMed Central

Liu, Fulu; Kunter, Ghada; Krem, Maxwell M.; Eades, William C.; Cain, Jennifer A.; Tomasson, Michael H.; Hennighausen, Lothar; Link, Daniel C.

2008-01-01

A fundamental property of leukemic stem cells is clonal dominance of the bone marrow microenvironment. Truncation mutations of CSF3R, which encodes the G-CSF receptor (G-CSFR), are implicated in leukemic progression in patients with severe congenital neutropenia. Here we show that expression of a truncated mutant Csf3r in mice confers a strong clonal advantage at the HSC level that is dependent upon exogenous G-CSF. G-CSF–induced proliferation, phosphorylation of Stat5, and transcription of Stat5 target genes were increased in HSCs isolated from mice expressing the mutant Csf3r. Conversely, the proliferative advantage conferred by the mutant Csf3r was abrogated in myeloid progenitors lacking both Stat5A and Stat5B, and HSC function was reduced in mice expressing a truncated mutant Csf3r engineered to have impaired Stat5 activation. These data indicate that in mice, inappropriate Stat5 activation plays a key role in establishing clonal dominance by stem cells expressing mutant Csf3r. PMID:18292815

EDITORIAL: The 10th International Conference on New Developments and Applications in Optical Radiometry (NEWRAD 2008) The 10th International Conference on New Developments and Applications in Optical Radiometry (NEWRAD 2008)

NASA Astrophysics Data System (ADS)

Ikonen, Erkki

2009-08-01

This special issue of Metrologia contains selected papers from the NEWRAD 2008 Conference, held in Daejeon, Korea, on 12-16 October 2008. NEWRAD 2008 continues a series of conferences on radiometry entitled 'New Developments and Applications in Optical Radiometry', which have taken place as follows: Cambridge, MA, USA (1985) Teddington, UK (1988) Davos, Switzerland (1990) Baltimore, MD, USA (1992) Berlin, Germany (1994) Tucson, AZ, USA (1997) Madrid, Spain (1999) Gaithersburg, MD, USA (2002) Davos, Switzerland (2005) Daejeon, Korea (2008) As the first NEWRAD Conference arranged in Asia, NEWRAD 2008 opened a new era for this series of conferences. The conference was followed by a Workshop on High Temperature Fixed Points and meetings of the Working Groups of the Consultative Committee for Photometry and Radiometry (CCPR). The organizer of all these events was Dr In Won Lee of the Korea Research Institute of Standards and Science (KRISS). The NEWRAD Scientific Committee thanks him and his team for their tremendous efforts which maintained and developed the high standards of previous NEWRAD Conferences. The specific themes of NEWRAD 2008 included optical measurements related to displays, energy and terahertz applications. Furthermore, half a day of sessions was devoted to both remote sensing and to few-photon sources and detectors. A total of 140 papers were presented, including 11 invited and 30 contributed talks. The conference proceedings containing two-page extended abstracts were distributed to the participants as a paper volume and on a USB memory stick. The authors of selected contributions were invited to submit a full paper for this special issue. The submitted papers were handled by the normal reviewing procedures of Metrologia. On behalf of the Scientific Committee, I thank the reviewers and editorial staff of Metrologia for careful processing of the manuscripts. It is evident that this special issue, like its predecessors, will serve as an important reference for radiometry for years to come. The next conference in the series, NEWRAD 2011, will take place in Hawaii on 19-23 September 2011. The primary contact is Mark Yarbrough of the University of Hawaii Marine Center. Dr Yarbrough can be contacted via e-mail at yarbrough@mlml.calstate.edu.

Gravitational Lensing: Recent Progress & Future Goals

NASA Technical Reports Server (NTRS)

Brainerd, Tereasa

2001-01-01

This award was intended to provide financial support for an international astrophysics conference on gravitational lensing which was held at Boston University from July 25 to July 30, 1999. Because of the nature of the award, no specific research was proposed, nor was any carried out. The participants at the conference presented results of their on-going research efforts, and written summaries of their presentations have been published by the Astronomical Society of the Pacific as part of their conference series. The reference to the conference proceedings book is Gravitational Lensing: Recent Progress and Future Goals, ASP Conference Series volume 237, eds. T. G. Brainerd and C. S. Kochanek (2001). The ISBN number of this book is 1-58381-074-9. The goal of the conference was to bring together both senior and junior investigators who were actively involved in all aspects of gravitational lensing research. This was the first conference in four years to address gravitational lensing from such a broad perspective (the previous such conference being IAU Symposium 173 held in Melbourne, Australia in July 1995). The conference was attended by 190 participants, who represented of order 70 different institutions and of order 15 different countries. The Scientific Organizing Committee members were Matthias Bartelmann (co-chair), Tereasa Brainerd (co-chair), Ian Browne, Richard Ellis, Nick Kaiser, Yannick Mellier, Sjur Refsdal, HansWalter Rix, Joachim Wambsganss, and Rachel Webster. The Local Organizing Committee members were Tereasa Brainerd (chair), Emilio Falco, Jacqueline Hewitt, Christopher Kochanek, and Irwin Shapiro. The oral sessions were organized around specific applications of gravitational lensing and included invited reviews, invited 'targeted talks', and contributed talks. The review speakers were Roger Blandford, Tereasa Brainerd, Gus Evrard, Nick Kaiser, Guinevere Kaufmann, Chris Kochanek, Charley Lineweaver, Gerry Luppino, Shude Mao, Paul Schechter, Peter Snhneider, amd Ed Turner. The 'targeted talk' speakers were Andy Boden, Ian Browne, Emilio Falco, Harry Ferguson, Bhuvnesh Jain, Christine Jones, Arlie Petters, Hans-Walter Rix, Penny Sackett, Prasenjit Saha, Virginia Trimble, and Joachim Wambsganss. Due to limited time, only 25% of the abstracts which were submitted for consideration as contributed talks could actually be accepted for the final program; those which were not selected as talks were presented as posters, and a special poster viewing session was held to allow participants to present their work. A copy of the complete Final Program of the conference is included in the following pages.

Psychological therapies for sickle cell disease and pain.

PubMed

Anie, K A; Green, J

2002-01-01

Sickle cell disease comprises a group of genetic blood disorders, and occurs when the sickle haemoglobin gene is inherited from both parents. The effects of the condition are: varying degrees of anaemia which if severe reduce the capacity for mobility; predisposition to obstruction of small blood capillaries causing pain in muscle and bone known as "crises"; damage to major organs such as the spleen, liver, kidneys, and lungs; and increased vulnerability to severe infections. There are both medical and non-medical complications, and treatment is usually symptomatic and palliative in nature. Psychological intervention for individuals with sickle cell disease seems viable in complementing current medical treatment, and studies examining their efficacy appear to have also yielded encouraging results. To examine the evidence that in patients with sickle cell disease, psychological treatment improves the ability to cope with the condition. The Cochrane Cystic Fibrosis and Genetic Disorders Group specialist trials register which comprises references from comprehensive electronic database searches. Also, hand searching relevant journals, hand searching abstract books of conference proceedings, and searches on the Internet were performed. Date of the most recent search of the Group's specialised register: January 2001. All randomised or quasi-randomised controlled trials comparing the use of psychological intervention to no (psychological) intervention in patients with sickle cell disease. Both reviewers independently extracted data and assessed trial quality. Five studies were identified in the initial search, of which three studies, with a total of 158 patients were eligible for inclusion in the review. Published data reveal that family education and cognitive behavioural therapy can help patients cope with sickle cell disease. Patient education programmes improve knowledge and attitudes of patients with sickle cell disease. There is as yet however, insufficient evidence to demonstrate the role of other psychological therapies. This systematic review has clearly identified the need for well-designed, adequately powered, multicentre randomised controlled trials assessing the effectiveness of specific intervention in sickle cell disease.

Multi-color phase imaging and sickle cell anemia (Conference Presentation)

NASA Astrophysics Data System (ADS)

Hosseini, Poorya; Zhou, Renjie; Yaqoob, Zahid; So, Peter T. C.

2016-03-01

Quantitative phase measurements at multiple wavelengths has created an opportunity for exploring new avenues in phase microscopy such as enhancing imaging-depth (1), measuring hemoglobin concentrations in erythrocytes (2), and more recently in tomographic mapping of the refractive index of live cells (3). To this end, quantitative phase imaging has been demonstrated both at few selected spectral points as well as with high spectral resolution (4,5). However, most of these developed techniques compromise imaging speed, field of view, or the spectral resolution to perform interferometric measurements at multiple colors. In the specific application of quantitative phase in studying blood diseases and red blood cells, current techniques lack the required sensitivity to quantify biological properties of interest at individual cell level. Recently, we have set out to develop a stable quantitative interferometric microscope allowing for measurements of such properties for red cells without compromising field of view or speed of the measurements. The feasibility of the approach will be initially demonstrated in measuring dispersion curves of known solutions, followed by measuring biological properties of red cells in sickle cell anemia. References: 1. Mann CJ, Bingham PR, Paquit VC, Tobin KW. Quantitative phase imaging by three-wavelength digital holography. Opt Express. 2008;16(13):9753-64. 2. Park Y, Yamauchi T, Choi W, Dasari R, Feld MS. Spectroscopic phase microscopy for quantifying hemoglobin concentrations in intact red blood cells. Opt Lett. 2009;34(23):3668-70. 3. Hosseini P, Sung Y, Choi Y, Lue N, Yaqoob Z, So P. Scanning color optical tomography (SCOT). Opt Express. 2015;23(15):19752-62. 4. Jung J-H, Jang J, Park Y. Spectro-refractometry of individual microscopic objects using swept-source quantitative phase imaging. Anal Chem. 2013;85(21):10519-25. 5. Rinehart M, Zhu Y, Wax A. Quantitative phase spectroscopy. Biomed Opt Express. 2012;3(5):958-65.

Role of Receptor Sialylation in the Ovarian Tumor Cell Phenotype

DTIC Science & Technology

2014-08-01

Chemical Society meeting, Baton Rouge, LA, Nov 2012; (3) 19th World Congress on Advances in Oncology conference, Athens, Greece, scheduled for Oct, 2014...dehydrogenase 1 is a marker for normal and malignant human colonic stem cells (SC) and tracks SC overpopulation during colon tumorigenesis. Cancer Res 2009;69

Tutorial Conference on Neural Modeling

DTIC Science & Technology

1985-01-01

83 2’. ~ 4,~T~’E’~u. 1 -ivot oF mcpoqr & wiploo covE~to TUTORIAL CONFERENCE Oil NEURAL MODELING FINAL REPORT to 1 , PERFORMING OG..-AOT NUM..R I...necea wsy ang Identlif by block nw.berj nerve cell modeling ; stability-plasticity, diletma 20. ASTRACT lConrinue on tevot., side It necosasiY and...results of neural modelling , and to explore its implications for associated pyshcological disciplines. The format devoted the mornings to lectures by

Clinical Significance and Mechanistic Insights into Ovarian Cancer Mitochondrial Dysfunction

DTIC Science & Technology

2017-05-01

during the reporting period. If there is nothing to report under a particular item, state “Nothing to Report.” • Publications, conference papers , and...yes Books or other non-periodical, one-time publications. Nothing to Report Other publications, conference papers , and presentations...scites w ere obtained from stage III-IV ovarian cancer patients (S U N Y / P enn S tate H ershey IR B approved study). O varian cancer cells w ere

Final report for Conference Support Grant "From Computational Biophysics to Systems Biology - CBSB12"

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hansmann, Ulrich H.E.

2012-07-02

This report summarizes the outcome of the international workshop From Computational Biophysics to Systems Biology (CBSB12) which was held June 3-5, 2012, at the University of Tennessee Conference Center in Knoxville, TN, and supported by DOE through the Conference Support Grant 120174. The purpose of CBSB12 was to provide a forum for the interaction between a data-mining interested systems biology community and a simulation and first-principle oriented computational biophysics/biochemistry community. CBSB12 was the sixth in a series of workshops of the same name organized in recent years, and the second that has been held in the USA. As in previousmore » years, it gave researchers from physics, biology, and computer science an opportunity to acquaint each other with current trends in computational biophysics and systems biology, to explore venues of cooperation, and to establish together a detailed understanding of cells at a molecular level. The conference grant of $10,000 was used to cover registration fees and provide travel fellowships to selected students and postdoctoral scientists. By educating graduate students and providing a forum for young scientists to perform research into the working of cells at a molecular level, the workshop adds to DOE's mission of paving the way to exploit the abilities of living systems to capture, store and utilize energy.« less

Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

PubMed Central

Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

2001-01-01

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

Revised classification/nomenclature of vitiligo and related issues: the Vitiligo Global Issues Consensus Conference

PubMed Central

Ezzedine, K.; Lim, H. W.; Suzuki, T.; Katayama, I.; Hamzavi, I.; Lan, C. C. E.; Goh, B. K.; Anbar, T.; de Castro, C. Silva; Lee, A. Y.; Parsad, D.; van Geel, N.; Le Poole, I. C.; Oiso, N.; Benzekri, L.; Spritz, R.; Gauthier, Y.; Hann, S. K.; Picardo, M.; Taieb, A.

2012-01-01

Summary During the 2011 International Pigment Cell Conference (IPCC), the Vitiligo European Taskforce (VETF) convened a consensus conference on issues of global importance for vitiligo clinical research. As suggested by an international panel of experts, the conference focused on four topics: classification and nomenclature; definition of stable disease; definition of Koebner’s phenomenon (KP); and ‘autoimmune vitiligo’. These topics were discussed in seven working groups representing different geographical regions. A consensus emerged that segmental vitiligo be classified separately from all other forms of vitiligo and that the term ‘vitiligo’ be used as an umbrella term for all non-segmental forms of vitiligo, including ‘mixed vitiligo’ in which segmental and non-segmental vitiligo are combined and which is considered a subgroup of vitiligo. Further, the conference recommends that disease stability be best assessed based on the stability of individual lesions rather than the overall stability of the disease as the latter is difficult to define precisely and reliably. The conference also endorsed the classification of KP for vitiligo as proposed by the VETF (history based, clinical observation based, or experimentally induced). Lastly, the conference agreed that ‘autoimmune vitiligo’ should not be used as a separate classification as published evidence indicates that the pathophysiology of all forms of vitiligo likely involves autoimmune or inflammatory mechanisms. PMID:22417114

Revised classification/nomenclature of vitiligo and related issues: the Vitiligo Global Issues Consensus Conference.

PubMed

Ezzedine, K; Lim, H W; Suzuki, T; Katayama, I; Hamzavi, I; Lan, C C E; Goh, B K; Anbar, T; Silva de Castro, C; Lee, A Y; Parsad, D; van Geel, N; Le Poole, I C; Oiso, N; Benzekri, L; Spritz, R; Gauthier, Y; Hann, S K; Picardo, M; Taieb, A

2012-05-01

During the 2011 International Pigment Cell Conference (IPCC), the Vitiligo European Taskforce (VETF) convened a consensus conference on issues of global importance for vitiligo clinical research. As suggested by an international panel of experts, the conference focused on four topics: classification and nomenclature; definition of stable disease; definition of Koebner's phenomenon (KP); and 'autoimmune vitiligo'. These topics were discussed in seven working groups representing different geographical regions. A consensus emerged that segmental vitiligo be classified separately from all other forms of vitiligo and that the term 'vitiligo' be used as an umbrella term for all non-segmental forms of vitiligo, including 'mixed vitiligo' in which segmental and non-segmental vitiligo are combined and which is considered a subgroup of vitiligo. Further, the conference recommends that disease stability be best assessed based on the stability of individual lesions rather than the overall stability of the disease as the latter is difficult to define precisely and reliably. The conference also endorsed the classification of KP for vitiligo as proposed by the VETF (history based, clinical observation based, or experimentally induced). Lastly, the conference agreed that 'autoimmune vitiligo' should not be used as a separate classification as published evidence indicates that the pathophysiology of all forms of vitiligo likely involves autoimmune or inflammatory mechanisms. © 2012 John Wiley & Sons A/S.

Role of orientation reference selection in motion sickness

NASA Technical Reports Server (NTRS)

Peterka, Robert J.; Black, F. Owen

1990-01-01

Three areas related to human orientation control are investigated: (1) reflexes associated with the control of eye movements and posture; (2) the perception of body rotation and position with respect to gravity; and (3) the strategies used to resolve sensory conflict situations which arise when different sensory systems provide orientation cues which are not consistent with one another or with previous experience. Of particular interest is the possibility that a subject may be able to ignore an inaccurate sensory modality in favor of one or more other sensory modalities which do provide accurate orientation reference information. This process is referred as sensory selection. This proposal will attempt to quantify subject's sensory selection abilities and determine if this ability confers some immunity to the development of motion sickness symptoms.

BCL-W has a fundamental role in B cell survival and lymphomagenesis.

PubMed

Adams, Clare M; Kim, Annette S; Mitra, Ramkrishna; Choi, John K; Gong, Jerald Z; Eischen, Christine M

2017-02-01

Compromised apoptotic signaling is a prerequisite for tumorigenesis. The design of effective therapies for cancer treatment depends on a comprehensive understanding of the mechanisms that govern cell survival. The antiapoptotic proteins of the BCL-2 family are key regulators of cell survival and are frequently overexpressed in malignancies, leading to increased cancer cell survival. Unlike BCL-2 and BCL-XL, the closest antiapoptotic relative BCL-W is required for spermatogenesis, but was considered dispensable for all other cell types. Here, however, we have exposed a critical role for BCL-W in B cell survival and lymphomagenesis. Loss of Bcl-w conferred sensitivity to growth factor deprivation-induced B cell apoptosis. Moreover, Bcl-w loss profoundly delayed MYC-mediated B cell lymphoma development due to increased MYC-induced B cell apoptosis. We also determined that MYC regulates BCL-W expression through its transcriptional regulation of specific miR. BCL-W expression was highly selected for in patient samples of Burkitt lymphoma (BL), with 88.5% expressing BCL-W. BCL-W knockdown in BL cell lines induced apoptosis, and its overexpression conferred resistance to BCL-2 family-targeting BH3 mimetics. Additionally, BCL-W was overexpressed in diffuse large B cell lymphoma and correlated with decreased patient survival. Collectively, our results reveal that BCL-W profoundly contributes to B cell lymphoma, and its expression could serve as a biomarker for diagnosis and aid in the development of better targeted therapies.

BCL-W has a fundamental role in B cell survival and lymphomagenesis

PubMed Central

Adams, Clare M.; Kim, Annette S.; Mitra, Ramkrishna; Choi, John K.; Gong, Jerald Z.; Eischen, Christine M.

2017-01-01

Compromised apoptotic signaling is a prerequisite for tumorigenesis. The design of effective therapies for cancer treatment depends on a comprehensive understanding of the mechanisms that govern cell survival. The antiapoptotic proteins of the BCL-2 family are key regulators of cell survival and are frequently overexpressed in malignancies, leading to increased cancer cell survival. Unlike BCL-2 and BCL-XL, the closest antiapoptotic relative BCL-W is required for spermatogenesis, but was considered dispensable for all other cell types. Here, however, we have exposed a critical role for BCL-W in B cell survival and lymphomagenesis. Loss of Bcl-w conferred sensitivity to growth factor deprivation–induced B cell apoptosis. Moreover, Bcl-w loss profoundly delayed MYC-mediated B cell lymphoma development due to increased MYC-induced B cell apoptosis. We also determined that MYC regulates BCL-W expression through its transcriptional regulation of specific miR. BCL-W expression was highly selected for in patient samples of Burkitt lymphoma (BL), with 88.5% expressing BCL-W. BCL-W knockdown in BL cell lines induced apoptosis, and its overexpression conferred resistance to BCL-2 family–targeting BH3 mimetics. Additionally, BCL-W was overexpressed in diffuse large B cell lymphoma and correlated with decreased patient survival. Collectively, our results reveal that BCL-W profoundly contributes to B cell lymphoma, and its expression could serve as a biomarker for diagnosis and aid in the development of better targeted therapies. PMID:28094768

C-Phycocyanin Confers Protection against Oxalate-Mediated Oxidative Stress and Mitochondrial Dysfunctions in MDCK Cells

PubMed Central

Farooq, Shukkur M.; Boppana, Nithin B.; Asokan, Devarajan; Sekaran, Shamala D.; Shankar, Esaki M.; Li, Chunying; Gopal, Kaliappan; Bakar, Sazaly A.; Karthik, Harve S.; Ebrahim, Abdul S.

2014-01-01

Oxalate toxicity is mediated through generation of reactive oxygen species (ROS) via a process that is partly dependent on mitochondrial dysfunction. Here, we investigated whether C-phycocyanin (CP) could protect against oxidative stress-mediated intracellular damage triggered by oxalate in MDCK cells. DCFDA, a fluorescence-based probe and hexanoyl-lysine adduct (HEL), an oxidative stress marker were used to investigate the effect of CP on oxalate-induced ROS production and membrane lipid peroxidation (LPO). The role of CP against oxalate-induced oxidative stress was studied by the evaluation of mitochondrial membrane potential by JC1 fluorescein staining, quantification of ATP synthesis and stress-induced MAP kinases (JNK/SAPK and ERK1/2). Our results revealed that oxalate-induced cells show markedly increased ROS levels and HEL protein expression that were significantly decreased following pre-treatment with CP. Further, JC1 staining showed that CP pre-treatment conferred significant protection from mitochondrial membrane permeability and increased ATP production in CP-treated cells than oxalate-alone-treated cells. In addition, CP treated cells significantly decreased the expression of phosphorylated JNK/SAPK and ERK1/2 as compared to oxalate-alone-treated cells. We concluded that CP could be used as a potential free radical-scavenging therapeutic strategy against oxidative stress-associated diseases including urolithiasis. PMID:24691130

Knowledge-Intensive, Interactive and Efficient Relational Pattern Learning

DTIC Science & Technology

2006-09-01

insightful comments. References 1. E. Alphonse and C. Rouveirol. Lazy propositionalisation for relational learning. In H. W., editor, 14th European...their atom-and-bond structures. Some other work, especially on propositionalization of First Order Logic (FOL) ( Alphonse and Rouveirol 2000), has been...Applications of Artificial Intelligence Conference (IAAI-04), page To Appear, 2004. E. Alphonse and C. Rouveirol. Lazy propositionalisation for

Stochastic Online Learning in Dynamic Networks under Unknown Models

DTIC Science & Technology

2016-08-02

Repeated Game with Incomplete Information, IEEE International Conference on Acoustics, Speech, and Signal Processing. 20-MAR-16, Shanghai, China...in a game theoretic framework for the application of multi-seller dynamic pricing with unknown demand models. We formulated the problem as an...infinitely repeated game with incomplete information and developed a dynamic pricing strategy referred to as Competitive and Cooperative Demand Learning

Fire Problems in High-Rise Buildings. California Fire Service Training Program.

ERIC Educational Resources Information Center

California State Dept. of Education, Sacramento. Bureau of Industrial Education.

Resulting from a conference concerned with high-rise fire problems, this manual has been prepared as a fire department training manual and as a reference for students enrolled in fire service training courses. Information is provided for topics dealing with: (1) Typical Fire Problems in High-Rise Buildings, (2) Heat, (3) Smoke and Fire Gases, (4)…

Epigenetic modifications: basic mechanisms and role in cardiovascular disease (2013 Grover Conference series).

PubMed

Loscalzo, Joseph; Handy, Diane E

2014-06-01

Epigenetics refers to heritable traits that are not a consequence of DNA sequence. Three classes of epigenetic regulation exist: DNA methylation, histone modification, and noncoding RNA action. In the cardiovascular system, epigenetic regulation affects development, differentiation, and disease propensity or expression. Defining the determinants of epigenetic regulation offers opportunities for novel strategies for disease prevention and treatment.

Funding the Pan American Materials Conference

DTIC Science & Technology

2015-06-01

sufficient support and (b) senior invited speakers that lend prestige to the event. (a) Papers published in peer-reviewed journals ( N /A for none...including journal references, in the following categories: (b) Papers published in non-peer-reviewed journals ( N /A for none) (c) Presentations...interesting lecture on the extraction of keratin from poultry feathers . The development of alloys for biomedical applications magnesium was described

Navy Distributed Virtual Library Requirements Analysis.

DTIC Science & Technology

1995-12-01

Josie McCrary asajam01@asnmail.asc.edu Issues In Science and Technology Librarianship ♦ Provides short substantial articles on timely and important...topics in science and technology librarianship as well as conference and workshop reports and short correspondences. ♦ Send a message to acrlsts...electronic journal encompassing all aspects of aca- demic audiovisual librarianship . Focus includes cataloging, refer- ence, collection development

Improvements to the Sandia CTH Hydro-Code to Support Blast Analysis and Protective Design of Military Vehicles

DTIC Science & Technology

2014-04-15

used for advertising or product endorsement purposes. 6.0 REFERENCES [1] McGlaun, J., Thompson, S. and Elrick, M. “CTH: A Three-Dimensional Shock-Wave...Validation of a Loading Model for Simulating Blast Mine Effects on Armoured Vehicles,” 7 th International LS-DYNA Users Conference, Detroit, MI 2002. [14

Learning as Transformation: Critical Perspectives on a Theory in Progress. The Jossey-Bass Higher and Adult Education Series.

ERIC Educational Resources Information Center

Mezirow, Jack, Ed.

Stemming from a 1998 Columbia University conference on transformative learning, this 3-part book contains 12 articles that examine the concept of how adults learn to change ("transform") their frames of reference. The following are included in Part One: Developing Concepts of Transformative Learning: "Learning To Think Like an Adult: Core Concepts…

Cubans in the United States: A Bibliography for Research in the Social and Behavioral Sciences, 1960-1983. Bibliographies and Indexes in Sociology, Number 1.

ERIC Educational Resources Information Center

MacCorkle, Lyn, Comp.

This volume brings together a wide-ranging body of English-language sources pertaining to Cuban American society. Some 1,600 references cite journal and periodical articles, dissertations, government reports, conference papers, and unpublished works. Spanish-language bibliographies that contain English-language titles or related Spanish-language…

Fya/Fyb antigen polymorphism in human erythrocyte Duffy antigen affects susceptibility to Plasmodium vivax malaria

PubMed Central

King, Christopher L.; Adams, John H.; Xianli, Jia; Grimberg, Brian T.; McHenry, Amy M.; Greenberg, Lior J.; Siddiqui, Asim; Howes, Rosalind E.; da Silva-Nunes, Monica; Ferreira, Marcelo U.; Zimmerman, Peter A.

2011-01-01

Plasmodium vivax (Pv) is a major cause of human malaria and is increasing in public health importance compared with falciparum malaria. Pv is unique among human malarias in that invasion of erythrocytes is almost solely dependent on the red cell's surface receptor, known as the Duffy blood-group antigen (Fy). Fy is an important minor blood-group antigen that has two immunologically distinct alleles, referred to as Fya or Fyb, resulting from a single-point mutation. This mutation occurs within the binding domain of the parasite's red cell invasion ligand. Whether this polymorphism affects susceptibility to clinical vivax malaria is unknown. Here we show that Fya, compared with Fyb, significantly diminishes binding of Pv Duffy binding protein (PvDBP) at the erythrocyte surface, and is associated with a reduced risk of clinical Pv in humans. Erythrocytes expressing Fya had 41–50% lower binding compared with Fyb cells and showed an increased ability of naturally occurring or artificially induced antibodies to block binding of PvDBP to their surface. Individuals with the Fya+b− phenotype demonstrated a 30–80% reduced risk of clinical vivax, but not falciparum malaria in a prospective cohort study in the Brazilian Amazon. The Fya+b− phenotype, predominant in Southeast Asian and many American populations, would confer a selective advantage against vivax malaria. Our results also suggest that efficacy of a PvDBP-based vaccine may differ among populations with different Fy phenotypes. PMID:22123959

Fy(a)/Fy(b) antigen polymorphism in human erythrocyte Duffy antigen affects susceptibility to Plasmodium vivax malaria.

PubMed

King, Christopher L; Adams, John H; Xianli, Jia; Grimberg, Brian T; McHenry, Amy M; Greenberg, Lior J; Siddiqui, Asim; Howes, Rosalind E; da Silva-Nunes, Monica; Ferreira, Marcelo U; Zimmerman, Peter A

2011-12-13

Plasmodium vivax (Pv) is a major cause of human malaria and is increasing in public health importance compared with falciparum malaria. Pv is unique among human malarias in that invasion of erythrocytes is almost solely dependent on the red cell's surface receptor, known as the Duffy blood-group antigen (Fy). Fy is an important minor blood-group antigen that has two immunologically distinct alleles, referred to as Fy(a) or Fy(b), resulting from a single-point mutation. This mutation occurs within the binding domain of the parasite's red cell invasion ligand. Whether this polymorphism affects susceptibility to clinical vivax malaria is unknown. Here we show that Fy(a), compared with Fy(b), significantly diminishes binding of Pv Duffy binding protein (PvDBP) at the erythrocyte surface, and is associated with a reduced risk of clinical Pv in humans. Erythrocytes expressing Fy(a) had 41-50% lower binding compared with Fy(b) cells and showed an increased ability of naturally occurring or artificially induced antibodies to block binding of PvDBP to their surface. Individuals with the Fy(a+b-) phenotype demonstrated a 30-80% reduced risk of clinical vivax, but not falciparum malaria in a prospective cohort study in the Brazilian Amazon. The Fy(a+b-) phenotype, predominant in Southeast Asian and many American populations, would confer a selective advantage against vivax malaria. Our results also suggest that efficacy of a PvDBP-based vaccine may differ among populations with different Fy phenotypes.

The carboxyl terminus of FANCE recruits FANCD2 to the Fanconi Anemia (FA) E3 ligase complex to promote the FA DNA repair pathway.

PubMed

Polito, David; Cukras, Scott; Wang, Xiaozhe; Spence, Paige; Moreau, Lisa; D'Andrea, Alan D; Kee, Younghoon

2014-03-07

Fanconi anemia (FA) is a genome instability syndrome characterized by bone marrow failure and cellular hypersensitivity to DNA cross-linking agents. In response to DNA damage, the FA pathway is activated through the cooperation of 16 FA proteins. A central player in the pathway is a multisubunit E3 ubiquitin ligase complex or the FA core complex, which monoubiquitinates its substrates FANCD2 and FANCI. FANCE, a subunit of the FA core complex, plays an essential role by promoting the integrity of the complex and by directly recognizing FANCD2. To delineate its role in substrate ubiquitination from the core complex assembly, we analyzed a series of mutations within FANCE. We report that a phenylalanine located at the highly conserved extreme C terminus, referred to as Phe-522, is a critical residue for mediating the monoubiquitination of the FANCD2-FANCI complex. Using the FANCE mutant that specifically disrupts the FANCE-FANCD2 interaction as a tool, we found that the interaction-deficient mutant conferred cellular sensitivity in reconstituted FANCE-deficient cells to a similar degree as FANCE null cells, suggesting the significance of the FANCE-FANCD2 interaction in promoting cisplatin resistance. Intriguingly, ectopic expression of the FANCE C terminus fragment alone in FA normal cells disrupts DNA repair, consolidating the importance of the FANCE-FANCD2 interaction in the DNA cross-link repair.

The Carboxyl Terminus of FANCE Recruits FANCD2 to the Fanconi Anemia (FA) E3 Ligase Complex to Promote the FA DNA Repair Pathway*

PubMed Central

Polito, David; Cukras, Scott; Wang, Xiaozhe; Spence, Paige; Moreau, Lisa; D'Andrea, Alan D.; Kee, Younghoon

2014-01-01

Fanconi anemia (FA) is a genome instability syndrome characterized by bone marrow failure and cellular hypersensitivity to DNA cross-linking agents. In response to DNA damage, the FA pathway is activated through the cooperation of 16 FA proteins. A central player in the pathway is a multisubunit E3 ubiquitin ligase complex or the FA core complex, which monoubiquitinates its substrates FANCD2 and FANCI. FANCE, a subunit of the FA core complex, plays an essential role by promoting the integrity of the complex and by directly recognizing FANCD2. To delineate its role in substrate ubiquitination from the core complex assembly, we analyzed a series of mutations within FANCE. We report that a phenylalanine located at the highly conserved extreme C terminus, referred to as Phe-522, is a critical residue for mediating the monoubiquitination of the FANCD2-FANCI complex. Using the FANCE mutant that specifically disrupts the FANCE-FANCD2 interaction as a tool, we found that the interaction-deficient mutant conferred cellular sensitivity in reconstituted FANCE-deficient cells to a similar degree as FANCE null cells, suggesting the significance of the FANCE-FANCD2 interaction in promoting cisplatin resistance. Intriguingly, ectopic expression of the FANCE C terminus fragment alone in FA normal cells disrupts DNA repair, consolidating the importance of the FANCE-FANCD2 interaction in the DNA cross-link repair. PMID:24451376

Gordon Research Conference on Genetic Toxicology

DOE Office of Scientific and Technical Information (OSTI.GOV)

Project Director Penelope Jeggo

2003-02-15

Genetic toxicology represents a study of the genetic damage that a cell can incur, the agents that induce such damage, the damage response mechanisms available to cells and organisms, and the potential consequences of such damage. Genotoxic agents are abundant in the environment and are also induced endogenously. The consequences of such damage can include carcinogenesis and teratogenesis. An understanding of genetic toxicology is essential to carry out risk evaluations of the impact of genotoxic agents and to assess how individual genetic differences influence the response to genotoxic damage. In recent years, the importance of maintaining genomic stability has becomemore » increasingly recognized, in part by the realization that failure of the damage response mechanisms underlies many, if not all, cancer incidence. The importance of these mechanisms is also underscored by their remarkable conservation between species, allowing the study of simple organisms to provide significant input into our understanding of the underlying mechanisms. It has also become clear that the damage response mechanisms interface closely with other aspects of cellular metabolism including replication, transcription and cell cycle regulation. Moreover, defects in many of these mechanisms, as observed for example in ataxia telangiectasia patients, confer disorders with associated developmental abnormalities demonstrating their essential roles during growth and development. In short, while a decade ago, a study of the impact of DNA damage was seen as a compartmentalized area of cellular research, it is now appreciated to lie at the centre of an array of cellular responses of crucial importance to human health. Consequently, this has become a dynamic and rapidly advancing area of research. The Genetic Toxicology Gordon Research Conference is biannual with an evolving change in the emphasis of the meetings. From evaluating the nature of genotoxic chemicals, which lay at the centre of the early conferences, the emphasis has moved to understanding how cells and organisms respond to the different forms of genotoxic damage incurred. By understanding these mechanisms, the risk to humans can be more rationally assessed and evaluated. More recently, the format of the meetings have aimed to facilitate input from the range of disciplines that can now provide insight into the field. This evolution in emphasis has been continued in the format of the proposed 2003 meeting. In the last Genetic Toxicology Gordon Conference (2001), the aim was to integrate studies on genetic toxicology at the structural, molecular and cellular level with those involving mice and humans (2 micron to Man). In the 2003 conference, we aim to integrate the approaches from 2 micron to man together with approaches where our basic knowledge has been exploited in an applied context (2 micron to Man to manipulation).« less

Proceedings of the Midwinter Conference of Immunologists (28th) Held in Pacific Grove, California on 28-31 January 1989 (Lymphocyte Differentiation)

DTIC Science & Technology

1989-02-24

N. Witte Sf-ak-r’." OWEN N. WITTE University of California, Los Angeles, CA "Oncogene Interactions with Primitive Lymphoid Cells" DAVID BALTIMORE The...as Schwann cells, myotubes and astroglial cells. Neurons use different receptors to interact with different cell types. Different neu-ons also differ...controlled by a clock in the progenitor cell that is driven by platelet- derived growth factor (PDGF) secreted by type-i astrocytes. Type-2 astrocyte

The malignant niche: safe spaces for toxic stem cell marketing.

PubMed

Sipp, Douglas

2017-01-01

Many tumors are sustained by microenvironments, or niches, that support and protect malignant cells, thus conferring a competitive advantage against both healthy cells and therapeutic interventions (for a brief review, see Yao and Link (Stem Cells 35: 3-8, 2017)). The global industry engaged in the commercial promotion of unproven and scientifically implausible cell-based "regenerative" therapies has developed a number of self-protective strategies that support its survival and growth in ways that are broadly analogous to the functions of the malignant niche.

New Data in the ADS Abstract and Article Service

NASA Astrophysics Data System (ADS)

Eichhorn, G.; Accomazzi, A.; Grant, C. S.; Kurtz, M. J.; Murray, S. S.

1996-05-01

In the last few months the data holdings in the ADS have been considerably expanded. In the abstracts databases we have included over 50,000 abstracts from SPIE conference proceedings (provided by SPIE), a complete set of references for lunar and planetary sciences, and abstracts from recent Lunar and Planetary Institute sponsored conferences (both provided by the Lunar and Planetary Institute). We also extended our cooperation with the CDS in Strasbourg, France by providing a link to the list of objects that are in the SIMBAD database for each reference. The ADS article service now holds full-text articles for 20 years of the Astrophysical Journal Letters, the Astronomical Journal, and the Publications of the Astronomical Society of the Pacific, and 5 years of the Astrophysical Journal on-line. The following journals are being processed and some may be on-line for this AAS meeting: Astrophysical Journal (1975-1989), Astronomy and Astrophysics, Proceedings of the Astronomical Society of Australia, Publications of the Astronomical Society of Japan, Revista Mexicana, Bulletin of the Astronomical Society of India, Obs. Reports of Skalnate Pleso, and Baltic Astronomy. We are now working with two scanning companies to speed up the scanning process and hope that by the end of the year we have all of these journals completely on-line for at least the period 1975 - 1995. Usage statistics for Jan - March 1996: Users Queries References Full Abstracts retrieved retrieved ------------------------------------------- 13,823 365,812 7,953,930 309,866

Enhanced Recovery After Surgery (ERAS®) in Individuals with Diabetes: A Systematic Review.

PubMed

Albalawi, Zaina; Laffin, Michael; Gramlich, Leah; Senior, Peter; McAlister, Finlay A

2017-08-01

Prevalence of diabetes in surgical patients is 10-40%. It is well recognized that they have higher rates of complications, and longer stays in hospital compared to patients without diabetes. Enhanced recovery after surgery (ERAS) is an evidence-based multimodal surgical care pathway that improves postoperative complications and length of stay in patients without diabetes. This review evaluates the evidence on whether individuals with diabetes would benefit from ERAS implementation. MEDLINE, Cochrane Central Register of Controlled Trials (CENTRAL) and EMBASE searched with no language restrictions applied. Conference proceedings and bibliographies were reviewed. Experts in the field were contacted, and www.clinicaltrials.gov searched for ongoing trials. Randomized controlled trials (RCT) looking at individuals with diabetes undergoing surgery randomized to ERAS ® or conventional care. Non-randomized controlled trials, controlled before-after studies, interrupted time series, and cohort studies with concurrent controls were also considered. Two authors independently screened studies. The electronic search yielded 437 references. After removing duplicates, 376 were screened for eligibility. Conference proceedings and bibliographies identified additional references. Searching www.clinicaltrials.gov yielded 59 references. Contacting experts in the field identified no further studies. Fourteen full articles were assessed and subsequently excluded for the following reasons: used an intervention other than ERAS ® , did not include patients with diabetes, or used an uncontrolled observational design. To date, the effects of ERAS ® on patients with diabetes have not been rigorously evaluated. This review highlights the lack of evidence in this area and provides guidance on design for future studies.

An anti-tumor protein produced by Trichinella spiralis and identified by screening a T7 phage display library, induces apoptosis in human hepatoma H7402 cells

USDA-ARS?s Scientific Manuscript database

Trichinella spiralis infection confers effective resistance to tumor cell expansion. In this study, a T7 phage cDNA display library was constructed to express genes encoded by T. spiralis. Organic phase multi-cell screening was used to sort through candidate proteins in a transfected human chronic m...

How the Curriculum Guideline "The Cell Is to Be Studied Longitudinally" Is Expressed in Six Israeli Junior-High-School Textbooks

ERIC Educational Resources Information Center

Cohen, Rachel; Yarden, Anat

2010-01-01

The most recent science and technology curriculum for junior high school in Israel contains a new guideline stating that the cell topic is to be taught "longitudinally in conjunction with other study contents." This guideline confers a change in teaching the cell topic and provides an opportunity to form meaningful relationships between…

Recombineering reveals a diverse collection of ribosomal proteins L4 and L22 that confer resistance to macrolide antibiotics

PubMed Central

Diner, Elie J.; Hayes, Christopher S.

2009-01-01

Summary Mutations in ribosomal proteins L4 and L22 confer resistance to erythromycin and other macrolide antibiotics in a variety of bacteria. L4 and L22 have elongated loops whose tips converge in the peptide exit tunnel near the macrolide binding site, and resistance mutations typically affect residues within these loops. Here, we use bacteriophage λ Red-mediated recombination, or “recombineering”, to uncover new L4 and L22 alleles that confer macrolide resistance in Escherichia coli. We randomized residues at the tips of the L4 and L22 loops using recombineered oligonucleotide libraries, and selected the mutagenized cells for erythromycin-resistant mutants. These experiments led to the identification of 341 different resistance mutations encoding 278 unique L4 and L22 proteins – the overwhelming majority of which are novel. Many resistance mutations were complex, involving multiple missense mutations, in-frame deletions, and insertions. Transfer of L4 and L22 mutations into wild-type cells by phage P1-mediated transduction demonstrated that each allele was sufficient to confer macrolide resistance. Although L4 and L22 mutants are typically resistant to most macrolides, selections carried out on different antibiotics revealed macrolide-specific resistance mutations. L22 Lys90Trp is one such allele, which confers resistance to erythromycin, but not tylosin or spiramycin. Purified L22 Lys90Trp ribosomes show reduced erythromycin binding, but have the same affinity for tylosin as wild-type ribosomes. Moreover, DMS methylation protection assays demonstrated that L22 Lys90Trp ribosomes bind tylosin more readily than erythromycin in vivo. This work underscores the exceptional functional plasticity of the L4 and L22 proteins, and highlights the utility of Red-mediated recombination in targeted genetic selections. PMID:19150357

Could the Extended Phenotype Extend to the Cellular and Subcellular Levels in Insect-Induced Galls?

PubMed Central

Carneiro, Renê Gonçalves da Silva; Pacheco, Priscilla; Isaias, Rosy Mary dos Santos

2015-01-01

Neo-ontogenesis of plant galls involves redifferentiation of host plant tissues to express new phenotypes, when new cell properties are established via structural-functional remodeling. Herein, Psidium cattleianum leaves and Nothotrioza cattleiani galls are analyzed by developmental anatomy, cytometry and immunocytochemistry of cell walls. We address hypothesis-driven questions concerning the organogenesis of globoid galls in the association of P. cattleianum - N. cattleianum, and P. myrtoides - N. myrtoidis. These double co-generic systems represent good models for comparing final gall shapes and cell lineages functionalities under the perspective of convergent plant-dependent or divergent insect-induced characteristics. Gall induction, and growth and development are similar in both galls, but homologous cell lineages exhibit divergent degrees of cell hypertrophy and directions of elongation. Median cortical cells in P. cattleianum galls hypertrophy the most, while in P. myrtoides galls there is a centrifugal gradient of cell hypertrophy. Cortical cells in P. cattleianum galls tend to anisotropy, while P. myrtoidis galls have isotropically hypertrophied cells. Immunocytochemistry evidences the chemical identity and functional traits of cell lineages: epidermal cells walls have homogalacturonans (HGAs) and galactans, which confer rigidity to sites of enhanced cell division; oil gland cell walls have arabinogalactan proteins (AGPs) that help avoiding cell death; and parenchyma cell walls have HGAs, galactans and arabinans, which confer porosity. Variations in such chemical identities are related to specific sites of hypertrophy. Even though the double co-generic models have the same macroscopic phenotype, the globoid morphotype, current analyses indicate that the extended phenotype of N. cattleiani is substantiated by cellular and subcellular specificities. PMID:26053863

Cisplatin-resistant lung cancer cell-derived exosomes increase cisplatin resistance of recipient cells in exosomal miR-100-5p-dependent manner.

PubMed

Qin, Xiaobing; Yu, Shaorong; Zhou, Leilei; Shi, Meiqi; Hu, Yong; Xu, Xiaoyue; Shen, Bo; Liu, Siwen; Yan, Dali; Feng, Jifeng

2017-01-01

Exosomes derived from lung cancer cells confer cisplatin (DDP) resistance to other cancer cells. However, the underlying mechanism is still unknown. A549 resistance to DDP (A549/DDP) was established. Microarray was used to analyze microRNA (miRNA) expression profiles of A549 cells, A549/DDP cells, A549 exosomes, and A549/DDP exosomes. There was a strong correlation of miRNA profiles between exosomes and their maternal cells. A total of 11 miRNAs were significantly upregulated both in A549/DDP cells compared with A549 cells and in exosomes derived from A549/DDP cells in contrast to exosomes from A549 cells. A total of 31 downregulated miRNAs were also observed. miR-100-5p was the most prominent decreased miRNA in DDP-resistant exosomes compared with the corresponding sensitive ones. Downregulated miR-100-5p was proved to be involved in DDP resistance in A549 cells, and mammalian target of rapamycin (mTOR) expression was reverse regulated by miR-100-5p. Exosomes confer recipient cells' resistance to DDP in an exosomal miR-100-5p-dependent manner with mTOR as its potential target both in vitro and in vivo. Exosomes from DDP-resistant lung cancer cells A549 can alter other lung cancer cells' sensitivity to DDP in exosomal miR-100-5p-dependent manner. Our study provides new insights into the molecular mechanism of DDP resistance in lung cancer.

Innovations and challenges in renal cancer: summary statement from the Third Cambridge Conference.

PubMed

Atkins, Michael B; Bukowski, Ronald M; Escudier, Bernard J; Figlin, Robert A; Hudes, Gary H; Kaelin, William G; Linehan, W Marston; McDermott, David F; Mier, James W; Pedrosa, Ivan; Rini, Brian I; Signoretti, Sabina; Sosman, Jeffrey A; Teh, Bin Tean; Wood, Christopher G; Zurita, Amado J; King, Laura

2009-05-15

The Third Cambridge Conference on Innovations and Challenges in Renal Cancer, a symposium held in Cambridge, Massachusetts, June 27-28, 2008, and chaired by Michael B. Atkins, was convened to discuss the current state of knowledge in the field, critique new data, stimulate communication among those involved in basic and clinical research, and offer recommendations for further study. Four main topics were discussed: genetics and molecular biology of renal cell cancer, staging and prognosis, systemic therapy, and correlative science and biomarkers in stage IV disease. The conference format combined brief presentations with extended periods of discussion. The conclusions and recommendations are summarized in this paper and presented in more detail in the individual papers that follow. (c) 2009 American Cancer Society.

Innovations and Challenges in Renal Cancer: Summary Statement From the Third Cambridge Conference

PubMed Central

Atkins, Michael B.; Bukowski, Ronald M.; Escudier, Bernard J.; Figlin, Robert A.; Hudes, Gary H.; Kaelin, William G.; Linehan, W. Marston; McDermott, David F.; Mier, James W.; Pedrosa, Ivan; Rini, Brian I.; Signoretti, Sabina; Sosman, Jeffrey A.; Teh, Bin Tean; Wood, Christopher G.; Zurita, Amado J.; King, Laura

2009-01-01

The Third Cambridge Conference on Innovations and Challenges in Renal Cancer, a symposium held in Cambridge, Massachusetts, June 27–28, 2008, and chaired by Michael B. Atkins, was convened to discuss the current state of knowledge in the field, critique new data, stimulate communication among those involved in basic and clinical research, and offer recommendations for further study. Four main topics were discussed: genetics and molecular biology of renal cell cancer, staging and prognosis, systemic therapy, and correlative science and biomarkers in stage IV disease. The conference format combined brief presentations with extended periods of discussion. The conclusions and recommendations are summarized in this paper and presented in more detail in the individual papers that follow. PMID:19402064

Space Electrochemical Research and Technology (SERT), 1989

NASA Technical Reports Server (NTRS)

Baldwin, Richard S. (Editor)

1989-01-01

The proceedings of NASA's second Space Electrochemical Research and Technology Conference are presented. The objectives of the conference were to examine current technologies, research efforts, and advanced ideas, and to identify technical barriers which affect the advancement of electrochemical energy storage systems for space applications. The conference provided a forum for the exchange of ideas and opinions of those actively involved in the field, with the intention of coalescing views and findings into conclusions on progress in the field, prospects for future advances, areas overlooked, and the directions of future efforts. Related overviews were presented in the areas of NASA advanced mission models. Papers were presented and workshops conducted in four technical areas: advanced concepts, hydrogen-oxygen fuel cells and electrolyzers, the nickel electrode, and advanced rechargable batteries.

In vitro and in vivo antiproliferative activity of metformin on stem-like cells isolated from spontaneous canine mammary carcinomas: translational implications for human tumors.

PubMed

Barbieri, Federica; Thellung, Stefano; Ratto, Alessandra; Carra, Elisa; Marini, Valeria; Fucile, Carmen; Bajetto, Adriana; Pattarozzi, Alessandra; Würth, Roberto; Gatti, Monica; Campanella, Chiara; Vito, Guendalina; Mattioli, Francesca; Pagano, Aldo; Daga, Antonio; Ferrari, Angelo; Florio, Tullio

2015-04-07

Cancer stem cells (CSCs) are considered the cell subpopulation responsible for breast cancer (BC) initiation, growth, and relapse. CSCs are identified as self-renewing and tumor-initiating cells, conferring resistance to chemo- and radio-therapy to several neoplasias. Nowadays, th (about 10mM)e pharmacological targeting of CSCs is considered an ineludible therapeutic goal. The antidiabetic drug metformin was reported to suppress in vitro and in vivo CSC survival in different tumors and, in particular, in BC preclinical models. However, few studies are available on primary CSC cultures derived from human postsurgical BC samples, likely because of the limited amount of tissue available after surgery. In this context, comparative oncology is acquiring a relevant role in cancer research, allowing the analysis of larger samples from spontaneous pet tumors that represent optimal models for human cancer. Isolation of primary canine mammary carcinoma (CMC) cells and enrichment in stem-like cell was carried out from fresh tumor specimens by culturing cells in stem-permissive conditions. Phenotypic and functional characterization of CMC-derived stem cells was performed in vitro, by assessment of self-renewal, long-lasting proliferation, marker expression, and drug sensitivity, and in vivo, by tumorigenicity experiments. Corresponding cultures of differentiated CMC cells were used as internal reference. Metformin efficacy on CMC stem cell viability was analyzed both in vitro and in vivo. We identified a subpopulation of CMC cells showing human breast CSC features, including expression of specific markers (i.e. CD44, CXCR4), growth as mammospheres, and tumor-initiation in mice. These cells show resistance to doxorubicin but were highly sensitive to metformin in vitro. Finally, in vivo metformin administration significantly impaired CMC growth in NOD-SCID mice, associated with a significant depletion of CSCs. Similarly to the human counterpart, CMCs contain stem-like subpopulations representing, in a comparative oncology context, a valuable translational model for human BC, and, in particular, to predict the efficacy of antitumor drugs. Moreover, metformin represents a potential CSC-selective drug for BC, as effective (neo-)adjuvant therapy to eradicate CSC in mammary carcinomas of humans and animals.

The World Health Organisation 2016 classification of penile carcinomas: a review and update from the International Society of Urological Pathology expert-driven recommendations.

PubMed

Cubilla, Antonio L; Velazquez, Elsa F; Amin, Mahul B; Epstein, Jonathan; Berney, Daniel M; Corbishley, Cathy M

2018-05-01

The International Society of Urological Pathology (ISUP) held an expert-driven penile cancer conference in Boston in March 2015, which focused on the new World Health Organisation (WHO) classification of penile cancer: human papillomavirus (HPV)-related tumours and histological grading. The conference was preceded by an online survey of the ISUP members, and the results were used to initiate discussions. Because of the rarity of penile tumours, this was not a consensus but an expert-driven conference aimed at assisting pathologists who do not see these tumours on a regular basis. After a justification for the novel separation of penile squamous cell carcinomas into HPV-related and non-HPV-related-carcinomas, the histological classification of penile carcinoma was proposed; this system was also accepted subsequently by the WHO for subtyping of penile carcinomas (2016). A description of HPV-related neoplasms, which may be recognised by their histological features, was presented, and p16 was recommended as a surrogate indicator of HPV. A three-tier grading system was recommended for penile squamous carcinomas; this was also adopted by the WHO (2016). Many of the distinctive histological subtypes of squamous cell carcinoma of the penis are associated with distinct grades, based on the squamous cell carcinoma subtype histological features. © 2017 John Wiley & Sons Ltd.

Mechanisms of Resistance to Chemotherapies Targeting BRCA-Mutant Breast Cancer

DTIC Science & Technology

2015-12-01

limiting for mutagenic NHEJ but not for physiological CSR. An implication of our results is that deregulation of the RNF168/53BP1 pathway could alter the...resistance in BRCA-deficient tumors. We have also observed that deregulation of the RNF168/53BP1 pathway can alter the chemosensitivity of BRCA1 deficient...FASEB Summer Research Conference. Big Sky, Montana, 2015 g. Invited Speaker, Conference "Chromatin and Cell Fate", Essen, Germany , 2015 h. Invited

Defense AT and L Magazine. Vol. 42, no. 6, November-December 2013

DTIC Science & Technology

2013-11-01

Blackberries , e-mail, conference calls, flextime and flex place. The project manager no longer can always schedule face-to-face weekly team meetings...alive and well! In an age of cellphones, Blackberries , e-mail, conference calls, flextime and flex place, the PM no longer has the luxury of always... Blackberries (or other “smart” devices) Have you ever been in a crowded room when a cell phone chimes? It’s like being at the OK Corral where everyone in the

Space Photovoltaic Research and Technology 1995

NASA Technical Reports Server (NTRS)

Landis, Geoffrey (Compiler)

1995-01-01

The Fourteenth Space Photovoltaic Research and Technology conference was held at the NASA Lewis Research Center from October 24-26, 1995. The abstracts presented in this volume report substantial progress in a variety of areas in space photovoltaics. Technical and review papers were presented in many areas, including high efficiency GaAs and InP solar cells, GaAs/Ge cells as commercial items, high efficiency multiple bandgap cells, solar cell and array technology, heteroepitaxial cells, thermophotovoltaic energy conversion, and space radiation effects. Space flight data on a variety of cells were also presented.

Space Photovoltaic Research and Technology 1995

NASA Technical Reports Server (NTRS)

Landis, Geoffrey (Compiler)

1996-01-01

The Fourteenth Space Photovoltaic Research and Technology conference was held at the NASA Lewis Research Center from October 24-26, 1995. The abstracts presented in this volume report substantial progress in a variety of areas in space photovoltaics. Technical and review papers were presented in many areas, including high efficiency GaAs and InP solar cells, GaAs/Ge cells as commercial items, high efficiency multiple bandgap cells, solar cell and array technology, heteroepitaxial cells, thermophotovoltaic energy conversion, and space radiation effects. Space flight data on a variety of cells were also presented.

Serum- and Glucocorticoid-Inducible Kinase 1 Confers Protection in Cell-Based and in In Vivo Neurotoxin Models via the c-Jun N-Terminal Kinase Signaling Pathway

PubMed Central

Iqbal, Sarah; Howard, Shannon

2015-01-01

Serum glucocorticoid kinase 1 (SGK1) has been shown to be protective in models of Parkinson's disease, but the details by which it confers benefit is unknown. The current study was designed to investigate the details by which SGK1 confers neuroprotection. To do this we employed a cellular neurodegeneration model to investigate c-Jun N-terminal kinase (JNK) signaling and endoplasmic reticulum (ER) stress induced by 6-hydroxydopamine. SGK1-expressing adenovirus was created and used to overexpress SGK1 in SH-SY5Y cells, and dexamethasone was used to increase endogenous expression of SGK1. Oxidative stress, mitochondrial dysfunction, and cell death were monitored to test the protective effect of SGK1. To investigate the effect of SGK1 overexpression in vivo, SGK1-expressing adenovirus was injected into the striatum of mice treated with 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine, and protection of dopaminergic neurons was quantitatively assessed by tyrosine hydroxylase immunohistochemistry. SGK1 overexpression was found to decrease reactive oxygen species generation, alleviate mitochondrial dysfunction, and rescue cell death in vitro and in vivo by inactivating mitogen-activated protein kinase kinase 4 (MKK4), JNK, and glycogen synthase kinase 3β (GSK3β) and thereby decreasing ER and oxidative stress. These results suggest that therapeutic strategies for activation of SGK1 may have the potential to be neuroprotective by deactivating the JNK and GSK3β pathways. PMID:25825522

Progress in batteries and solar cells - Volume 6

NASA Astrophysics Data System (ADS)

Shimotake, Hiroshi; Voss, Ernst

The present conference encompasses topics in lithium cell development, manganese cell design, lead-acid batteries, fuel cells, nickel-cadmium and other rechargeable batteries, and battery chargers and related power systems. Attention is given to molten carbonate fuel cells, prospects for sodium/sulfur propulsion batteries, ultrathin lithium batteries, solid state batteries, a gelled electrolyte lead-acid battery for deep discharge applications, and phosphoric acid fuel cells. Also discussed are computer-based battery monitors, a novel nickel-iron battery for electric vehicle applications, conductive polymer electrode electrochemical cells, and catalyst- and electrode-related research for phosphoric acid fuel cells.

Comparison of In-Vitro and In-Vivo Toxic Effects of Microcystin-LR in Fasted Rats

DTIC Science & Technology

1989-02-15

form: FASEB J. 2, A584 (1988); Conference on Natural Toxins from Aquatic arid Marine Environments, Woods Hole, MA, August 1987, in press. The views of...intramitochondrial granules. J. Cell ijiol. 20, 95-109. REYNOLDS, E. S. (1965) Liver parenchymal cell injury. Ill. The nature of calcium-associated

Differential regulation of polysaccharide-specific antibody responses to isolated polysaccharides, conjugate vaccines, and intact Gram-positive versus Gram-negative extracellular bacteria.

PubMed

Snapper, Clifford M

2016-06-24

Bacterial capsular polysaccharides are major virulence factors and are key targets in a number of licensed anti-bacterial vaccines. Their major characteristics are their large molecular weight and expression of repeating antigenic epitopes that mediate multivalent B cell receptor cross-linking. In addition, since the majority of these antigens cannot associate with MHC-II they fail to recruit CD4+ T cell help and are referred to as T cell-independent antigens. In this review I will discuss a series of studies from my laboratory that have underscored the importance of understanding polysaccharide-specific antibody responses within the context in which the PS is expressed (i.e. in isolation, as a component of conjugate vaccines, and expressed naturally by intact bacteria). We have shown that multivalent B cell receptor crosslinking, as mediated by polysaccharides, uniquely determines the qualitative response of the B cell to subsequent stimuli, but by itself is insufficient to induce antibody secretion or class switching. For these latter events to occur, second signals must act in concert with primary signals derived from the B cell receptor. The co-expression of polysaccharide and protein within intact bacteria promotes recruitment of CD4+ T cell help for the associated PS-specific IgG response, in contrast to isolated polysaccharides. Further, the particulate nature of extracellular bacteria confers properties to the polysaccharide-specific IgG response that makes it distinct immunologically from soluble conjugate vaccines. Finally, the underlying biochemical and/or structural differences that distinguish Gram-positive and Gram-negative bacteria appear to play critical roles in differentially regulating the associated polysaccharide-specific IgG responses to these groups of pathogens. These studies have a number of implications for the understanding and future design of polysaccharide-based vaccines. Published by Elsevier Ltd.

Conducting polymer scaffolds for electrical control of cellular functions (Conference Presentation)

NASA Astrophysics Data System (ADS)

Inal, Sahika; Wan, Alwin M.; Williams, Tiffany V.; Giannelis, Emmanuel P.; Fischbach-Teschl, Claudia; Gourdon, Delphine; Owens, Róisín. M.; Malliaras, George G.

2016-09-01

Considering the limited physiological relevance of 2D cell culture experiments, significant effort was devoted to the development of materials that could more accurately recreate the in vivo cellular microenvironment, and support 3D cell cultures in vitro. (1) One such class of materials is conducting polymers, which are promising due to their compliant mechanical properties, compatibility with biological systems, mixed electrical and ionic conductivity, and ability to form porous structures. (2) In this work, we report the fabrication of a single component, macroporous scaffold made from poly(3,4-ethylenedioxythiophene):poly(styrenesulfonate) (PEDOT:PSS) via an ice-templating method. (3) PEDOT:PSS scaffolds offer tunable pore size, morphology and shape through facile changes in preparation conditions, and are capable of supporting 3D cell cultures due to their biocompatibility and tissue-like elasticity. Moreover, these materials are functional: they exhibit excellent electrochemical switching behavior and significantly lower impedance compared to films. Their electrochemical activity enables their use in the active channel of a state of the art diagnostic tool in the field of bioelectronics, i.e., the organic electrochemical transistor (OECT). The inclusion of cells within the porous architecture affects the impedance of the electrically-conducting polymer network and, thus, may be used as a method to quantify cell growth. The adhesion and pro-angiogenic secretions of mouse fibroblasts cultured within the scaffolds can be controlled by switching the electrochemical state of the polymer prior to cell-seeding. In summary, these smart materials hold promise not only as extracellular matrix-mimicking structures for cell culture, but also as high-performance bioelectronic tools for diagnostic and signaling applications. References [1] M. Holzwarth, P. X. Ma, Journal of Materials Chemistry, 21, 10243-10251 (2011). [2] L. H. Jimison, J. Rivnay, R. M. Owens, in Organic Electronics, Wiley-VCH Verlag GmbH and Co. KGaA, 27-6 (2013). [3] A. M.-D. Wan, S. Inal, T. Williams et al. Journal of Materials Chemistry B, DOI: 10.1039/C5TB00390C (2015).

Targeting Common but Complex Proteoglycans on Breast Cancer Cells and Stem Cells Using Evolutionary Refined Malaria Proteins

DTIC Science & Technology

2014-09-01

chondroitin sulfate A proteoglycans present on all tested breast cancer cells and the vast majority of tested tissue biopsies. Using pull down assays...Invited, Daugaard. C) 2014. Gordon research conference, July 6-11; Targeting of cancer-specific chondroitin sulfate on circulating tumor cells using...now successfully identified a number of proteoglycans that interact with the recombinant malaria protein VAR2CSA when sulfated on carbon 4 of the CS

Artemisinin conferred ERK mediated neuroprotection to PC12 cells and cortical neurons exposed to sodium nitroprusside-induced oxidative insult.

PubMed

Zheng, Wenhua; Chong, Cheong-Meng; Wang, Haitao; Zhou, Xuanhe; Zhang, Lang; Wang, Rikang; Meng, Qian; Lazarovici, Philip; Fang, Jiankang

2016-08-01

The production of nitric oxide (NO) is one of the primary mediators of ischemic damage, glutamate neurotoxicity and neurodegeneration and therefore inhibition of NO-induced neurotoxicity may be considered a therapeutic target for reducing neuronal cell death (neuroprotection). In this study, artemisinin, a well-known anti-malaria drug was found to suppress sodium nitroprusside (SNP, a nitric oxide donor)-induced cell death in the PC12 cells and brain primary cortical neuronal cultures. Pretreatment of PC12 cells with artemisinin significantly suppressed SNP-induced cell death by decreasing the extent of oxidation, preventing the decline of mitochondrial membrane potential, restoring abnormal changes in nuclear morphology and reducing lactate dehydrogenase release and inhibiting caspase 3/7 activities. Western blotting analysis revealed that artemisinin was able to activate extracellular regulated protein kinases (ERK) pathway. Furthermore, the ERK inhibitor PD98059 blocked the neuroprotective effect of artemisinin whereas the PI3K inhibitor LY294002 had no effect. Cumulatively these findings support the notion that artemisinin confers neuroprotection from SNP-induce neuronal cell death insult, a phenomenon coincidentally related to activation of ERK phosphorylation. This SNP-induced oxidative insult in PC12 cell culture model may be useful to investigate molecular mechanisms of NO-induced neurotoxicity and drug-induced neuroprotection, and to generate novel therapeutic concepts for ischemic disease treatment. Copyright © 2016 Elsevier Inc. All rights reserved.

Conclusions and recommendations from the symposium, Beyond Cholesterol: Prevention and Treatment of Coronary Heart Disease with n-3 Fatty Acids.

PubMed

Deckelbaum, Richard J; Leaf, Alexander; Mozaffarian, Dariush; Jacobson, Terry A; Harris, William S; Akabas, Sharon R

2008-06-01

After the symposium "Beyond Cholesterol: Prevention and Treatment of Coronary Heart Disease with n-3 Fatty Acids," faculty who presented at the conference submitted manuscripts relating to their conference topics, and these are presented in this supplement. The content of these manuscripts was reviewed, and 2 conference calls were convened. The objective was to summarize existing evidence, gaps in evidence, and future research needed to strengthen recommendations for specific intakes of n-3 fatty acids for different conditions relating to cardiovascular disease. The following 2 questions were the main items discussed. What are the roles of n-3 fatty acids in primary versus secondary prevention of coronary heart disease? What are the roles of n-3 fatty acids in hypertriglyceridemia, in the metabolic syndrome and type 2 diabetes, and in sudden cardiac death, cardiac arrhythmias, and vulnerable plaque? Each area was summarized by using 2 general categories: 1) current knowledge for which general consensus exists, and 2) recommendations for research and policy. Additional references for these conclusions can be found in the articles included in the supplement.

[Recent history: 12th International Conference on Cancer, Buenos Aires, Argentina, 1978].

PubMed

Spinelli, Hugo

2014-04-01

Using the approaches of history of the present, this article recovers the discussions surrounding the 12th International Conference on Cancer carried out in Buenos Aires in 1978, in reaction to which Georges Périès organized a "counter-conference" in Paris. In order to understand this discussion, the political situation of the time is described, as is the state of human rights at the time in Argentina, the role of the media - in particular the newspapers La Nación and Clarín and the magazine Gente - and the institutional position adopted by the National Academy of Medicine, as expressed in a letter sent to the presidents of the primary scientific societies of the world. The letter is reprinted in this text as a documentary source, taken from Memoria: Año 1978 (Presidencia de Dr. José E. Rivarola) [Acta: Year 1978 (Presidency of Dr. José E. Rivarola)]. The framework of the discussion makes reference to science's social policy versus science's supposed neutrality and the role of scientific societies.

Traceable calibration of photovoltaic reference cells using natural sunlight

NASA Astrophysics Data System (ADS)

Müllejans, H.; Zaaiman, W.; Pavanello, D.; Dunlop, E. D.

2018-02-01

At the European Solar Test Installation (ESTI) photovoltaic (PV) reference cells are calibrated traceably to SI units via the World Radiometric Reference (WRR) using natural sunlight. The Direct Sunlight Method (DSM) is described in detail and the latest measurement results and an updated uncertainty budget are reported. These PV reference cells then provide a practical means for measuring the irradiance of natural or simulated sunlight during the calibration of other PV devices.

Zfra activates memory Hyal-2+ CD3− CD19− spleen cells to block cancer growth, stemness, and metastasis in vivo

PubMed Central

Chang, Jean-Yun; Huang, Shenq-Shyang; Chou, Pei-Yi; Ye, Siou-Ru; Chen, Szu-Jung; He, Huan; Liu, Ting-Hsiu; Chou, Ying-Tsen; Lai, Feng-Jie; Chen, Shean-Jen; Lee, Hoong-Chien; Kakhniashvili, David; Goodman, Steven R.; Chang, Nan-Shan

2015-01-01

Zfra is a 31-amino-acid zinc finger-like protein, which participates in the tumor necrosis factor signaling. Here, we determined that when nude mice and BALB/c mice were pre-injected with nanogram levels of a synthetic Zfra1–31 or truncated Zfra4–10 peptide via tail veins, these mice became resistant to the growth, metastasis and stemness of melanoma cells, and many malignant cancer cells. The synthetic peptides underwent self-polymerization in phosphate-buffered saline. Alteration of the Ser8 phosphorylation site to Gly8 abolished Zfra aggregation and its-mediated cancer suppression in vivo. Injected Zfra peptide autofluoresced due to polymerization and was trapped mainly in the spleen. Transfer of Zfra-stimulated spleen cells to naïve mice conferred resistance to cancer growth. Zfra-binding cells, designated Hyal-2+ CD3− CD19− Z cells, are approximately 25–30% in the normal spleen, but are significantly downregulated (near 0–3%) in tumor-growing mice. Zfra prevented the loss of Z cells caused by tumors. In vitro stimulation or education of naïve spleen cells with Zfra allowed generation of activated Z cells to confer a memory anticancer response in naïve or cancer-growing mice. In particular, Z cells are abundant in nude and NOD-SCID mice, and can be readily activated by Zfra to mount against cancer growth. PMID:25686832

Deletion of Pten Expands Lung Epithelial Progenitor Pools and Confers Resistance to Airway Injury

PubMed Central

Tiozzo, Caterina; De Langhe, Stijn; Yu, Mingke; Londhe, Vedang A.; Carraro, Gianni; Li, Min; Li, Changgong; Xing, Yiming; Anderson, Stewart; Borok, Zea; Bellusci, Saverio; Minoo, Parviz

2009-01-01

Rationale: Pten is a tumor-suppressor gene involved in stem cell homeostasis and tumorigenesis. In mouse, Pten expression is ubiquitous and begins as early as 7 days of gestation. Pten−/− mouse embryos die early during gestation indicating a critical role for Pten in embryonic development. Objectives: To test the role of Pten in lung development and injury. Methods: We conditionally deleted Pten throughout the lung epithelium by crossing Ptenflox/flox with Nkx2.1-cre driver mice. The resulting PtenNkx2.1-cre mutants were analyzed for lung defects and response to injury. Measurements and Main Results: PtenNkx2.1-cre embryonic lungs showed airway epithelial hyperplasia with no branching abnormalities. In adult mice, PtenNkx2.1-cre lungs exhibit increased progenitor cell pools composed of basal cells in the trachea, CGRP/CC10 double-positive neuroendocrine cells in the bronchi, and CC10/SPC double-positive cells at the bronchioalveolar duct junctions. Pten deletion affected differentiation of various lung epithelial cell lineages, with a decreased number of terminally differentiated cells. Over time, PtenNxk2.1-cre epithelial cells residing in the bronchioalveolar duct junctions underwent proliferation and formed uniform masses, supporting the concept that the cells residing in this distal niche may also be the source of procarcinogenic stem cells. Finally, increased progenitor cells in all the lung compartments conferred an overall selective advantage to naphthalene injury compared with wild-type control mice. Conclusions: Pten has a pivotal role in lung stem cell homeostasis, cell differentiation, and consequently resistance to lung injury. PMID:19574443

Results of the 1995 JPL balloon flight solar cell calibration program

NASA Technical Reports Server (NTRS)

Anspaugh, B. E.; Weiss, R. S.

1995-01-01

The Jet Propulsion Laboratory (JPL) solar cell calibration program was conceived to produce reference standards for the purpose of accurately setting solar simulator intensities. The concept was to fly solar cells on a high-altitude balloon, to measure their output at altitudes near 120,000 ft (36.6 km), to recover the cells, and to use them as reference standards. The procedure is simple. The reference cell is placed in the simulator beam, and the beam intensity is adjusted until the reference cell reads the same as it read on the balloon. As long as the reference cell has the same spectral response as the cells or panels to be measured, this is a very accurate method of setting the intensity. But as solar cell technology changes, the spectral response of the solar cells changes also, and reference standards using the new technology must be built and calibrated. Until the summer of 1985, there had always been a question as to how much the atmosphere above the balloon modified the solar spectrum. If the modification was significant, the reference cells might not have the required accuracy. Solar cells made in recent years have increasingly higher blue responses, and if the atmosphere has any effect at all, it would be expected to modify the calibration of these newer blue cells much more so than for cells made in the past. JPL has been flying calibration standards on high-altitude balloons since 1963 and continues to organize a calibration balloon flight at least once a year. The 1995 flight was the 48th flight in this series. The 1995 flight incorporated 46 solar cell modules from 7 different participants. The payload included Si, amorphous Si, GaAs, GaAs/Ge, dual junction cells, top and bottom sections of dual junction cells, and a triple junction cell. A new data acquisition system was built for the balloon flights and flown for the first time on the 1995 flight. This system allows the measurement of current-voltage (I-V) curves for 20 modules in addition to measurement of modules with fixed loads as had been done in the past.

Reactivation of Mitogen-activated Protein Kinase (MAPK) Pathway by FGF Receptor 3 (FGFR3)/Ras Mediates Resistance to Vemurafenib in Human B-RAF V600E Mutant Melanoma*

PubMed Central

Yadav, Vipin; Zhang, Xiaoyi; Liu, Jiangang; Estrem, Shawn; Li, Shuyu; Gong, Xue-Qian; Buchanan, Sean; Henry, James R.; Starling, James J.; Peng, Sheng-Bin

2012-01-01

Oncogenic B-RAF V600E mutation is found in 50% of melanomas and drives MEK/ERK pathway and cancer progression. Recently, a selective B-RAF inhibitor, vemurafenib (PLX4032), received clinical approval for treatment of melanoma with B-RAF V600E mutation. However, patients on vemurafenib eventually develop resistance to the drug and demonstrate tumor progression within an average of 7 months. Recent reports indicated that multiple complex and context-dependent mechanisms may confer resistance to B-RAF inhibition. In the study described herein, we generated B-RAF V600E melanoma cell lines of acquired-resistance to vemurafenib, and investigated the underlying mechanism(s) of resistance. Biochemical analysis revealed that MEK/ERK reactivation through Ras is the key resistance mechanism in these cells. Further analysis of total gene expression by microarray confirmed a significant increase of Ras and RTK gene signatures in the vemurafenib-resistant cells. Mechanistically, we found that the enhanced activation of fibroblast growth factor receptor 3 (FGFR3) is linked to Ras and MAPK activation, therefore conferring vemurafenib resistance. Pharmacological or genetic inhibition of the FGFR3/Ras axis restored the sensitivity of vemurafenib-resistant cells to vemurafenib. Additionally, activation of FGFR3 sufficiently reactivated Ras/MAPK signaling and conferred resistance to vemurafenib in the parental B-RAF V600E melanoma cells. Finally, we demonstrated that vemurafenib-resistant cells maintain their addiction to the MAPK pathway, and inhibition of MEK or pan-RAF activities is an effective therapeutic strategy to overcome acquired-resistance to vemurafenib. Together, we describe a novel FGFR3/Ras mediated mechanism for acquired-resistance to B-RAF inhibition. Our results have implications for the development of new therapeutic strategies to improve the outcome of patients with B-RAF V600E melanoma. PMID:22730329

First Annual Fuel Cell End Users Forum

DTIC Science & Technology

2011-05-03

UNCLASSIFIED: Dist A. Approved for public release 1 Conference Report First Annual Fuel Cell End Users Forum ...Report First Annual Fuel Cell End Users Forum 5a. CONTRACT NUMBER w56hzv-09-D-0154 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S...End Users Forum was established to provide a user focused venue that enables a peer-to-peer support network to exchange information and gain knowledge

Chondracanthus tenellus (Harvey) hommersand extract protects the human keratinocyte cell line by blocking free radicals and UVB radiation-induced cell damage.

PubMed

Piao, Mei Jing; Hyun, Yu Jae; Oh, Tae-Heon; Kang, Hee Kyoung; Yoo, Eun Sook; Koh, Young Sang; Lee, Nam Ho; Suh, In Soo; Hyun, Jin Won

2012-12-01

The aim of this study was to investigate the protective effects of the ethanol extract of the red algae Chondracanthus tenellus (Harvey) Hommersand (CTE) on cultured human keratinocyte cell line. The cellular protection conferred by CTE was evidenced by the ability of the extract to absorb ultraviolet B (UVB; 280-320 nm) and to scavenge the radical 1,1-diphenyl-2-picrylhydrazyl, as well as intracellular reactive oxygen species (ROS), induced by either hydrogen peroxide (H(2)O(2)) or UVB radiation. In addition, both superoxide anion generated by the xanthine/xanthine oxidase system and hydroxyl radical generated by the Fenton reaction (FeSO(4) + H(2)O(2)) were scavenged by CTE, as confirmed using electron spin resonance spectrometry. In the human keratinocyte cell line, CTE decreased the degree of injury resulting from UVB-induced oxidative stress to lipids, proteins, and DNA. CTE-treated cells also showed a reduction in UVB-induced apoptosis, as exemplified by fewer apoptotic bodies and less DNA fragmentation. Taken together, these results suggest that CTE confers protection on the human keratinocyte cell line against UVB-induced oxidative stress by absorbing UVB ray and scavenging ROS, thereby reducing injury to cellular constituents.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Su Jin; New Drug Development Center, Osong Medical Innovation Foundation, Cheongwon, Chungbuk; Chang, Suhwan

Highlights: • PMAb83, a human monoclonal antibody against PAUF, impaired tumor progression in vivo. • PMAb83 attenuated aggressiveness of tumor cells and suppressed angiogenesis. • PMAb83 in combination with gemcitabine conferred improved survival of mouse model. - Abstract: Pancreatic adenocarcinoma up-regulated factor (PAUF) is expressed in pancreatic ductal adenocarcinoma (PDAC) and plays an important role in tumor progression and metastasis. Here we evaluate the anti-tumor efficacy of a human monoclonal antibody against PAUF, PMAb83, to provide a therapeutic intervention to treat the disease. PMAb83 reduced tumor growth and distant metastasis in orthotopically xenografted mice of human PDAC cells. PMAb83 treatmentmore » retarded proliferation along with weakened aggressiveness traits of the carcinoma cells. AKT/β-catenin signaling played a role in the carcinoma cell proliferation and the treated xenograft tumors exhibited reduced levels of β-catenin and cyclin D1. Moreover PMAb83 abrogated the PAUF-induced angiogenic responses of endothelial cells, reducing the density of CD31{sup +} vessels in the treated tumors. In combination with gemcitabine, PMAb83 conferred enhanced survival of xenografted mice by about twofold compared to gemcitabine alone. Taken together, our findings show that PMAb83 treatment decreases the aggressiveness of carcinoma cells and suppresses tumor vascularization, which culminates in mitigated tumor growth and metastasis with improved survival in PDAC mouse models.« less

Neutrophils confer T cell resistance to myeloid-derived suppressor cell-mediated suppression to promote chronic inflammation.

PubMed

Ryan, Sean O; Johnson, Jenny L; Cobb, Brian A

2013-05-15

Low-grade chronic inflammation can persist in aging humans unnoticed for years or even decades, inflicting continuous damage that can culminate later in life as organ dysfunction, physical frailty, and some of the most prominent debilitating and deadly age-associated diseases, including rheumatoid arthritis, diabetes, heart disease, and cancer. Despite the near universal acceptance of these associations, the mechanisms underlying unresolved inflammation remain poorly understood. In this study, we describe a novel inducible method to examine systemic chronic inflammation using susceptible animal models. Induced inflammation results in unresolved innate cellular responses and persistence of the same serum proinflammatory molecules used as diagnostic biomarkers and therapeutic targets for chronic inflammation in humans. Surprisingly, we found long-term persistence of an inflammation-associated neutrophil cell population constitutively producing the proinflammatory IFN-γ cytokine, which until now has only been detected transiently in acute inflammatory responses. Interestingly, these cells appear to confer T cell resistance to the otherwise potent anti-inflammatory function of myeloid-derived suppressor cells, revealing a novel mechanism for the maintenance of chronic inflammatory responses over time. This discovery represents an attractive target to resolve inflammation and prevent the inflammation-induced pathologies that are of critical concern for the well-being of the aging population.

Direct Correlation between Motile Behavior and Protein Abundance in Single Cells

PubMed Central

Gillet, Sébastien; Frankel, Nicholas W.; Weibel, Douglas B.

2016-01-01

Understanding how stochastic molecular fluctuations affect cell behavior requires the quantification of both behavior and protein numbers in the same cells. Here, we combine automated microscopy with in situ hydrogel polymerization to measure single-cell protein expression after tracking swimming behavior. We characterized the distribution of non-genetic phenotypic diversity in Escherichia coli motility, which affects single-cell exploration. By expressing fluorescently tagged chemotaxis proteins (CheR and CheB) at different levels, we quantitatively mapped motile phenotype (tumble bias) to protein numbers using thousands of single-cell measurements. Our results disagreed with established models until we incorporated the role of CheB in receptor deamidation and the slow fluctuations in receptor methylation. Beyond refining models, our central finding is that changes in numbers of CheR and CheB affect the population mean tumble bias and its variance independently. Therefore, it is possible to adjust the degree of phenotypic diversity of a population by adjusting the global level of expression of CheR and CheB while keeping their ratio constant, which, as shown in previous studies, confers functional robustness to the system. Since genetic control of protein expression is heritable, our results suggest that non-genetic diversity in motile behavior is selectable, supporting earlier hypotheses that such diversity confers a selective advantage. PMID:27599206

Epigenetic memory via concordant DNA methylation is inversely correlated to developmental potential of mammalian cells

PubMed Central

Goodson, Jamie; Al-Azzawi, Haneen; Allain, Shannon Q.; Simon, Noah; Palasek, Stan; Miller, Daniel G.; Johnson, Winslow C.; Laird, Charles D.

2017-01-01

In storing and transmitting epigenetic information, organisms must balance the need to maintain information about past conditions with the capacity to respond to information in their current and future environments. Some of this information is encoded by DNA methylation, which can be transmitted with variable fidelity from parent to daughter strand. High fidelity confers strong pattern matching between the strands of individual DNA molecules and thus pattern stability over rounds of DNA replication; lower fidelity confers reduced pattern matching, and thus greater flexibility. Here, we present a new conceptual framework, Ratio of Concordance Preference (RCP), that uses double-stranded methylation data to quantify the flexibility and stability of the system that gave rise to a given set of patterns. We find that differentiated mammalian cells operate with high DNA methylation stability, consistent with earlier reports. Stem cells in culture and in embryos, in contrast, operate with reduced, albeit significant, methylation stability. We conclude that preference for concordant DNA methylation is a consistent mode of information transfer, and thus provides epigenetic stability across cell divisions, even in stem cells and those undergoing developmental transitions. Broader application of our RCP framework will permit comparison of epigenetic-information systems across cells, developmental stages, and organisms whose methylation machineries differ substantially or are not yet well understood. PMID:29107996

Role of T-bet, the master regulator of Th1 cells, in the cytotoxicity of murine CD4+ T cells.

PubMed

Eshima, Koji; Misawa, Kana; Ohashi, Chihiro; Iwabuchi, Kazuya

2018-05-01

Although CD4 + T cells are generally regarded as helper T cells, some activated CD4 + T cells have cytotoxic properties. Given that CD4 + cytotoxic T lymphocytes (CTLs) often secrete IFN-γ, CTL activity among CD4 + T cells may be attributable to Th1 cells, where a T-box family molecule, T-bet serves as the "master regulator". However, although the essential contribution of T-bet to expression of IFN-γ has been well-documented, it remains unclear whether T-bet is involved in CD4 + T cell-mediated cytotoxicity. In this study, to investigate the ability of T-bet to confer cytolytic activity on CD4 + T cells, the T-bet gene (Tbx21) was introduced into non-cytocidal CD4 + T cell lines and their cytolytic function analyzed. Up-regulation of FasL (CD178), which provided the transfectant with cytotoxicity, was observed in Tbx21transfected CD4 + T cells but not in untransfected parental cells. In one cell line, T-bet transduction also induced perforin gene (Prf1) expression and Tbx21 transfectants efficiently killed Fas - target cells. Although T-bet was found to repress up-regulation of CD40L (CD154), which controls FasL-mediated cytolysis, the extent of CD40L up-regulation on in vitro-differentiated Th1 cells was similar to that on Th2 cells, suggesting the existence of a compensatory mechanism. These results collectively indicate that T-bet may be involved in the expression of genes, such as FasL and Prf1, which confer cytotoxicity on Th1 cells. © 2018 The Societies and John Wiley & Sons Australia, Ltd.

Incremental Parsing with Reference Interaction

DTIC Science & Technology

2004-07-01

ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) Department of...Computer Science,University of Rochester,Rochester,NY,14627 8. PERFORMING ORGANIZATION REPORT NUMBER 9. SPONSORING/MONITORING AGENCY NAME(S) AND...Evidence from eye movements in spoken language comprehen- sion. Conference Abstract. Architechtures and Mechanisms for Language Processing. R. M

Proceedings of International Conference on the Role of the Polar Regions in Global Change Held in Fairbanks Alaska on 11-15 June 1990. Volume 1

DTIC Science & Technology

1992-03-01

and occurring at was first noted by Findeisen [1940]. temperatures near -400C were found in the 27 years of data The homogeneous freezing of water at...the likelihood. and distinct pollutant-produced signatire on the nature of the consequences of such processes. REFERENCES Findeisen , W., The formation

Overview of Selection Process for Most Influential Paper of the 1970's

NASA Technical Reports Server (NTRS)

Hayes, Peggy S.; Moser, Kelsey M.

2011-01-01

Slides are for a presentation at the AIAA AFM conference invited session titled, 'AFM Most Influential Papers of the 1970's'. The slides describe the selection process used by the members of the technical committee to select the finalists and winning paper. The slides refer to technical papers published in the past, but have no technical data contained within them.

A joint resolution conferring honorary citizenship of the United States on Bernardo de Galvez y Madrid, Viscount of Galveston and Count of Galvez.

THOMAS, 113th Congress

Sen. Rubio, Marco [R-FL

2014-06-04

Senate - 06/04/2014 Read twice and referred to the Committee on the Judiciary. (All Actions) Notes: For further action, see H.J.RES.105, which became Public Law 113-229 on 12/16/2014. Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

2005 8th Annual Systems Engineering Conference. Volume 2, Wednesday Presentations

DTIC Science & Technology

2005-10-27

Acquisition Programs: An OSD Perspective, Col Warren Anderson, OUSD (AT&L) Defense Systems Implementation of Policy Requiring Systems Engineering Plans...Technical Excellence, Col Warren Anderson, OUSD (AT&L) Defense Systems Applying CMMI to System Safety, Mr. Tom Pfitzer, APT Research, Inc. System...to following pages for Tutorials Schedule) Buffett Lunch Tutorial Tracks (Please refer to following pages for Tutorials Schedule) Reception in

The Current State and Problems of Czechoslovak Medical Biometeorology

DTIC Science & Technology

1961-03-24

First Working Conference of the Bioclimatological Group of the Czechoslovak Meteorological Society of the Czechoslovak Academy of Sciences, held on 13...shows soms systematic work, V Struzka had already referred to the problems and tasks of biometeorology, bioclimatology , and spa meteorology at the First...International Society fo? Bioclimatology and Biometeorology in 1956j its ranks were joined by members of the individual laboratories in our country

Proceedings of International Conference on Oral Education of the Deaf. Volume II (Northampton, Massachusetts, June 17-21, 1967; New York, New York, June 22-24, 1967).

ERIC Educational Resources Information Center

Clarke School for the Deaf, Northampton, MA.

Papers from five plenary sessions and a number of sectional meetings consider oral education of the deaf. Elementary and secondary deaf education programs are discussed with reference to teaching the multiply handicapped, curriculum development, programed instruction, and teaching methods and materials. The following are also treated: the subject…

Guide to preparing SAND reports. Revised

DOE Office of Scientific and Technical Information (OSTI.GOV)

Locke, T.K.

1996-04-01

This guide contains basic information needed to produce a SAND report. Its guidelines reflect DOE regulation and Sandia policy. The guide includes basic writing instructions in an annotated sample report; guidance for organization, format, and layout of reports produced by line organizations; and information about conference papers, journal articles, and brochures. The appendixes contain sections on Sandia`s preferred usage, equations, references, copyrights and permissions, and publishing terms.

Peer Review of Submissions to the Annual American Evaluation Association Conference by the Graduate Student & New Evaluators Topical Interest Group

ERIC Educational Resources Information Center

Schroter, Daniela C.; Coryn, Chris L. S.; Montrosse, Bianca E.

2008-01-01

Peer review is an umbrella term that refers to a class of selection and oversight practices, including the familiar mechanisms of the review of proposals submitted for funding, of manuscripts for scholarly publications, and of personnel qualifications and portfolios for selection and promotion. Peer review has long been a cornerstone of modern…

Communication and Attitude Revision

DTIC Science & Technology

1992-01-01

Conference on Aritificial Intelligence , (1989) 1074- 1079 3. Clark, H., Marshal, C.: Definite reference and mutual knowledge. In Joshi, A., Sag, I.. and...21st Annual Meeting of the ACL (1983) 57-63 9. Konolige, K.: On the relation between default and autoepistemic logic. Artificial Intelligence 35(3...reasoning. Artificial Intelligence 13 (1980) 81-132 16. Richmond Thomason. Accommodation, meaning, and implicature. In Cohen, P., Morgan, J., and

Parallel Logic Programming and Parallel Systems Software and Hardware

DTIC Science & Technology

1989-07-29

Conference, Dallas TX. January 1985. (55) [Rous75] Roussel, P., "PROLOG: Manuel de Reference et d’Uilisation", Group d’ Intelligence Artificielle , Universite d...completed. Tools were provided for software development using artificial intelligence techniques. Al software for massively parallel architectures was...using artificial intelligence tech- niques. Al software for massively parallel architectures was started. 1. Introduction We describe research conducted

The Philippine Parliamentarians Conference on Human Survival, Population and Development. Summary.

PubMed

1988-12-01

Proceedings of the 1st Philippine Parliamentarians' Conference on Human Survival, Population and Development (PARLCON '88) are summarized in this report. Conference participants included the House and Senate, government officials, representatives of nongovernmental organizations, international organizations, the diplomatic corps and the media. A message from the President was read, referring the "silent emergency" of malnutrition and infant mortality of over 100,000 yearly. The events taking place were a statement of objectives, a Senate Resolution welcoming the convening of the conference, an opening ceremony, a posthumous award to R. M. Sales, executive director of the UNFPA, and a final a plan of action. Much of the content of the above events was duplicated in the final plan, which was formulated in 17 points. Some of these key points were: recognition of the need for quality of life, the detrimental effect of rapid population growth on development, the right of spouses to plan family size within their ethical beliefs, and the need for political will to address development concerns. The conference recommended that parliament and local governments strive for a consensus on national policy regarding population; ensure that economic gains are not decimated by population growth, protect the environment, develop social and industrial infrastructure in outlying areas, pursue national self-reliance, promote the human right of choosing desired family size, endorse the small family norm, empower women by educational and income generating opportunities, gather national data on population, strengthen the Population Commission, support nongovernmental agencies that provide family planning services, and promote education on family planning.

Estrogen receptor alpha regulates expression of the breast cancer 1 associated ring domain 1 (BARD1) gene through intronic DNA sequence.

PubMed

Creekmore, Amy L; Ziegler, Yvonne S; Bonéy, Jamie L; Nardulli, Ann M

2007-03-15

We have used a chromatin immunoprecipitation (ChIP)-based cloning strategy to isolate and identify genes associated with estrogen receptor alpha (ERalpha) in MCF-7 human breast cancer cells. One of the gene regions isolated was a 288bp fragment from the ninth intron of the breast cancer 1 associated ring domain (BARD1) gene. We demonstrated that ERalpha associated with this region of the endogenous BARD 1 gene in MCF-7 cells, that ERalpha bound to three of five ERE half sites located in the 288bp BARD1 region, and that this 288bp BARD1 region conferred estrogen responsiveness to a heterologous promoter. Importantly, treatment of MCF-7 cells with estrogen increased BARD1 mRNA and protein levels. These findings demonstrate that ChIP cloning strategies can be utilized to successfully isolate regulatory regions that are far removed from the transcription start site and assist in identifying cis elements involved in conferring estrogen responsiveness.

Identification of a transcription factor like protein at the TOR locus in Leishmania mexicana amazonensis.

PubMed

Detke, S

1997-12-15

The TOR gene (TOxic nucleoside Resistance gene) was mapped to a 2.3 kb fragment on the amplified DNA from tubercidin resistant Leishmania (TUB). This DNA fragment conferred upon wild type cells resistance to tubercidin, inosine dialdehyde, formycin A and B and allopurinol riboside and a reduced ability to accumulate purine nucleobases and nucleosides. These properties were characteristic of the parental TUB cells which carried the intact amplified DNA and have been hypothesized to be caused by a reduction in the activity of the multiple purine transporters within this organism. The TOR gene was found to be partially homologous to the rodent and human Oct-6/SCIP/Tst-1 gene. It lacked, however, the POU specific domain of this class of transcription factors and contained only the first two helices of the POU homeodomain. This truncated homeodomain was not required to confer resistance upon wild type cells to toxic nucleosides, suggesting that TOR was not a repressor with independent DNA binding capability.

Circular non-coding RNA ANRIL modulates ribosomal RNA maturation and atherosclerosis in humans

PubMed Central

Holdt, Lesca M.; Stahringer, Anika; Sass, Kristina; Pichler, Garwin; Kulak, Nils A.; Wilfert, Wolfgang; Kohlmaier, Alexander; Herbst, Andreas; Northoff, Bernd H.; Nicolaou, Alexandros; Gäbel, Gabor; Beutner, Frank; Scholz, Markus; Thiery, Joachim; Musunuru, Kiran; Krohn, Knut; Mann, Matthias; Teupser, Daniel

2016-01-01

Circular RNAs (circRNAs) are broadly expressed in eukaryotic cells, but their molecular mechanism in human disease remains obscure. Here we show that circular antisense non-coding RNA in the INK4 locus (circANRIL), which is transcribed at a locus of atherosclerotic cardiovascular disease on chromosome 9p21, confers atheroprotection by controlling ribosomal RNA (rRNA) maturation and modulating pathways of atherogenesis. CircANRIL binds to pescadillo homologue 1 (PES1), an essential 60S-preribosomal assembly factor, thereby impairing exonuclease-mediated pre-rRNA processing and ribosome biogenesis in vascular smooth muscle cells and macrophages. As a consequence, circANRIL induces nucleolar stress and p53 activation, resulting in the induction of apoptosis and inhibition of proliferation, which are key cell functions in atherosclerosis. Collectively, these findings identify circANRIL as a prototype of a circRNA regulating ribosome biogenesis and conferring atheroprotection, thereby showing that circularization of long non-coding RNAs may alter RNA function and protect from human disease. PMID:27539542

Practicing safe cell culture: applied process designs for minimizing virus contamination risk.

PubMed

Kiss, Robert D

2011-01-01

CONFERENCE PROCEEDING Proceedings of the PDA/FDA Adventitious Viruses in Biologics: Detection and Mitigation Strategies Workshop in Bethesda, MD, USA; December 1-3, 2010 Guest Editors: Arifa Khan (Bethesda, MD), Patricia Hughes (Bethesda, MD) and Michael Wiebe (San Francisco, CA) Genentech responded to a virus contamination in its biologics manufacturing facility by developing and implementing a series of barriers specifically designed to prevent recurrence of this significant and impactful event. The barriers included steps to inactivate or remove potential virus particles from the many raw materials used in cell culture processing. Additionally, analytical testing barriers provided protection of the downstream processing areas should a culture contamination occur, and robust virus clearance capability provided further assurance of virus safety should a low level contamination go undetected. This conference proceeding will review Genentech's approach, and lessons learned, in minimizing virus contamination risk in cell culture processes through multiple layers of targeted barriers designed to deliver biologics products with high success rates.

Role of mitogen-activated protein kinases and Mcl-1 in apoptosis induction by withaferin A in human breast cancer cells.

PubMed

Hahm, Eun-Ryeong; Lee, Joomin; Singh, Shivendra V

2014-11-01

Withaferin A (WA), a bioactive constituent of Ayurvedic medicine plant Withania somnifera, is a potent apoptosis inducer in cancer cells but the mechanism of cell death induction is not fully characterized. The present study was undertaken to determine the role of mitogen-activated protein kinases (MAPK), including c-jun NH2 -terminal kinase (JNK), extracellular signal-regulated kinase (ERK), and p38 MAPK, and anti-apoptotic protein myeloid cell leukemia-1 (Mcl-1) in regulation of WA-induced apoptosis using human breast cancer cells. Exposure of MCF-7 (estrogen responsive) and SUM159 (triple negative) human breast cancer cells to WA resulted in increased phosphorylation of ERK, JNK, and p38 MAPK, but these effects were relatively more pronounced in the former cell line than in SUM159. Overexpression of manganese-superoxide dismutase conferred partial protection against WA-mediated hyperphosphorylation of ERK, but not JNK or p38 MAPK. Cell death resulting from WA treatment in MCF-7 cells was significantly augmented by pharmacological inhibition of ERK and p38 MAPK. Interestingly, the WA-induced apoptosis in MCF-7 cells was partially but significantly blocked in the presence of a JNK-specific inhibitor. Pharmacological inhibition of ERK or JNK had no effect on WA-induced apoptosis in SUM159 cells. The WA-treated cells exhibited induction of long and short forms of Mcl-1. RNA interference of Mcl-1 alone triggered apoptosis. Furthermore, the WA-induced cell death in MCF-7 cells was modestly but significantly augmented by knockdown of the Mcl-1 protein. These observations indicate that: MAPK have cell line-specific role in cell death by WA, and Mcl-1 induction confers modest protection against WA-induced apoptosis. © 2013 Wiley Periodicals, Inc.

Hierarchy of stroma-derived factors in supporting growth of stroma-dependent hemopoietic cells: membrane-bound SCF is sufficient to confer stroma competence to epithelial cells.

PubMed

Friel, Jutta; Itoh, Katsuhiko; Bergholz, Ulla; Jücker, Manfred; Stocking, Carol; Harrison, Paul; Ostertag, Wolfram

2002-03-01

Hemopoiesis takes place in a microenvironment where hemopoietic cells are closely associated with stroma by various interactions. Stroma coregulates the proliferation and differentiation of hemopoietic cells. Stroma-hemopoietic-cell contact can be supported by locally produced membrane associated growth factors. The stroma derived growth factor, stem cell factor (SCF) is important in hemopoiesis. We examined the different biological interactions of membrane bound and soluble SCF with human hemopoietic cells expressing the SCF receptor, c-kit. To analyze the function of the SCF isoforms in inducing the proliferation of hemopoietic TF1 or Cord blood (CB) CD34+ cells we used stroma cell lines that differ in their presentation of no SCF, membrane SCF, or soluble SCF. We established a new coculture system using an epithelial cell line that excludes potential interfering effects with other known stroma encoded hemopoietic growth factors. We show that soluble SCF, in absence of membrane-bound SCF, inhibits long term clonal growth of primary or established CD34+ hemopoietic cells, whereas membrane-inserted SCF "dominantly" induces long term proliferation of these cells. We demonstrate a hierarchy of these SCF isoforms in the interaction of stroma with hemopoietic TF1 cells. Membrane-bound SCF is "dominant" over soluble SCF, whereas soluble SCF acts epistatically in interacting with hemopoietic cells compared with other stroma derived factors present in SCF deficient stroma. A hierarchy of stroma cell lines can be arranged according to their presentation of membrane SCF or soluble SCF. In our model system, membrane-bound SCF expression is sufficient to confer stroma properties to an epithelial cell line but soluble SCF does not.

Real-time garbage collection for list processing

NASA Technical Reports Server (NTRS)

Shuler, R. L., Jr. (Inventor)

1986-01-01

In a list processing system, small reference counters are maintained in conjunction with memory cells for the purpose of identifying memory cells that become available for re-use. The counters are updated as references to the cells are created and destroyed, and when a counter of a cell is decremented to logical zero the cell is immediately returned to a list of free cells. In those cases where a counter must be incremented beyond the maximum value that can be represented in a small counter, the cell is restructured so that the additional reference count can be represented. The restructuring involves allocating an additional cell, distributing counter, tag, and pointer information among the two cells, and linking both cells appropriately into the existing list structure.

Conference on Biological Actions and Medical Applications of Dimethyl Sulfoxide (DMSO), 15-17 September 1982.

DTIC Science & Technology

1983-06-01

Effects on Isolated Fat Cells. By PAUL B. WIESER ......... 135 Induction of Glohin Gene Expression During Erythroid Cell Differentiation. By RICHARD A...lipolysis and decreases insulin-stimulated glucose oxidation in free while fat cells of rat." It V also enhances heme synthesis in quail embryo yolk sac...metabolism of fat cells. Biochem. Pharma- col. 26: 775-778. 18. TERASAWA. T., Y. MIt RA & R. MASJDA. 1981. The mechanism of the action of DMSO on the

Anti-apoptotic ARC protein confers chemoresistance by controlling leukemia-microenvironment interactions through a NFκB/IL1β signaling network

PubMed Central

Carter, Bing Z.; Mak, Po Yee; Chen, Ye; Mak, Duncan H.; Mu, Hong; Jacamo, Rodrigo; Ruvolo, Vivian; Arold, Stefan T.; Ladbury, John E.; Burks, Jared K.; Kornblau, Steven; Andreeff, Michael

2016-01-01

To better understand how the apoptosis repressor with caspase recruitment domain (ARC) protein confers drug resistance in acute myeloid leukemia (AML), we investigated the role of ARC in regulating leukemia-mesenchymal stromal cell (MSC) interactions. In addition to the previously reported effect on AML apoptosis, we have demonstrated that ARC enhances migration and adhesion of leukemia cells to MSCs both in vitro and in a novel human extramedullary bone/bone marrow mouse model. Mechanistic studies revealed that ARC induces IL1β expression in AML cells and increases CCL2, CCL4, and CXCL12 expression in MSCs, both through ARC-mediated activation of NFκB. Expression of these chemokines in MSCs increased by AML cells in an ARC/IL1β-dependent manner; likewise, IL1β expression was elevated when leukemia cells were co-cultured with MSCs. Further, cells from AML patients expressed the receptors for and migrated toward CCL2, CCL4, and CXCL12. Inhibition of IL1β suppressed AML cell migration and sensitized the cells co-cultured with MSCs to chemotherapy. Our results suggest the existence of a complex ARC-regulated circuit that maintains intimate connection of AML with the tumor microenvironment through NFκB/IL1β-regulated chemokine receptor/ligand axes and reciprocal crosstalk resulting in cytoprotection. The data implicate ARC as a promising drug target to potentially sensitize AML cells to chemotherapy. PMID:26956049

Metabolic bone diseases in patients after allogeneic hematopoietic stem cell transplantation: report from the Consensus Conference on Clinical Practice in chronic graft-versus-host disease.

PubMed

Hautmann, Anke Heidewig; Elad, Sharon; Lawitschka, Anita; Greinix, Hildegard; Bertz, Hartmut; Halter, Joerg; Faraci, Maura; Hofbauer, Lorenz Christian; Lee, Stephanie; Wolff, Daniel; Holler, Ernst

2011-09-01

With improved outcome of allogeneic stem cell transplantation (allo-SCT) for hematologic malignancies, long-term complications gain greater importance. Skeletal complications such as osteoporosis or avascular necrosis (AVN) occur frequently in allogeneic recipients with a cumulative incidence of diminished bone mineral density of 24-50% between 2 and 12 months after allo-SCT and a cumulative incidence of AVN in as many as 19% of patients 3 years after allo-SCT. Here, we present a review as part of the German, Austrian, and Swiss Consensus Conference on clinical practice in chronic graft-versus-host disease, held 2009 in Regensburg. The Consensus Conference aimed to achieve a consensus on the current evidence of diagnosis, prevention, and therapeutic options of late complications after allo-SCT summarizing and discussing the literature on these topics. In this report, we provide recommendations for metabolic bone diseases agreed upon by the working party. This includes guidelines for diagnosis, prevention, and therapeutic options in patients with low bone mass or AVN. © 2011 The Authors. Transplant International © 2011 European Society for Organ Transplantation.

Rhizobial galactoglucan determines the predatory pattern of Myxococcus xanthus and protects Sinorhizobium meliloti from predation

PubMed Central

Pérez, Juana; Jiménez-Zurdo, José I.; Martínez-Abarca, Francisco; Millán, Vicenta; Shimkets, Lawrence J.; Muñoz-Dorado, José

2014-01-01

Summary Myxococcus xanthus is a social bacterium that preys on prokaryotic and eukaryotic microorganisms. Co-culture of M. xanthus with reference laboratory strains and field isolates of the legume symbiont Sinorhizobium meliloti revealed two different predatory patterns that resemble frontal and wolfpack attacks. Use of mutants impaired in the two types of M. xanthus surface motility (A or adventurous and S or social motility) and a csgA mutant, which is unable to form macroscopic travelling waves known as ripples, has demonstrated that both motility systems but not rippling are required for efficient predation. To avoid frontal attack and reduce killing rates, rhizobial cells require a functional expR gene. ExpR regulates expression of genes involved in a variety of functions. The use of S. meliloti mutants impaired in several of these functions revealed that the exopolysaccharide galactoglucan (EPS II) is the major determinant of the M. xanthus predatory pattern. The data also suggest that this biopolymer confers an ecological advantage to rhizobial survival in soil, which may have broad environmental implications. PMID:24707988

PREFACE: Sensors and Their Applications XVII

NASA Astrophysics Data System (ADS)

Bilas, V.; McConnell, G.; Kyriacou, P.

2013-06-01

This volume records the Proceedings of the seventeenth conference in the biennial Sensors and Their Applications series that took place at Rixos Libertas, Dubrovnik, Croatia from 16-18 September 2013. The conference is organised by the Instrument Science and Technology Group of the Institute of Physics. The conference was the first organised by the Institute of Physics to be held outside of the UK and Ireland, thus continuing the collaborative and adventurous nature of the meeting. The conference proceedings record the continuing health, diversity and activity of the sensors community worldwide, bringing together contributions from academics and industrial researchers to provide excellent networking opportunities. It is interesting to note some continuing themes such as Optical Sensors and Electromagnetic Sensors, as well as trends in Environmental Sensing and Glacial Monitoring that reflect our changing world, and Sensors in Biology and Medicine that have a growing importance with an ageing population. The conference also accounts for research specialisms and unique strengths from the local community in Croatia, including demining and metal detector sensing. We should like to thank all of our colleagues and friends in the sensor community who have supported this event by contributing manuscripts. Our thanks go also to members of the Technical Programme Committee for their support, and in particular for refereeing the submitted manuscripts. We are also pleased to express our thanks to the Conference Department of the Institute of Physics for their invaluable support in organising this event. We are especially grateful to Dawn Stewart for her responsive and day-to-day handling of this conference, as well as Claire Garland for help in planning and managing this international event. We hope that the conference authors, participants and a wider audience will find these proceedings to be of interest and to serve as a useful reference text. V Bilas, G McConnell and P Kyriacou Organising Committee Conference Organising Committee V Bilas, conference chair, University of Zagreb, Croatia G McConnell, conference chair, University of Strathclyde, UK P Kyriacou, conference chair, City University London, UK D Stewart, conference co-ordinator, Institute of Physics, UK Technical Programme Committee L Benini, University of Bologna, Italy M Butta, Czech Technical University in Prague, Czech Republic M Cifrek, University of Zagreb, Croatia G Collier, Kingston University London, UK J Deur, University of Zagreb, Croatia H Dzapo, University of Zagreb, Croatia M Gasulla, Universitat Politenica de Catalunya, BarcelonaTech, Spain S Hadjiloucas, University of Reading, UK P Kyriacou, City University of London, UK I Lackovic, University of Zagreb, Croatia R Magjarevic, University of Zagreb, Croatia G McConnell, University of Strathclyde, UK A O'Riordan, Tyndall National Institute, UK K Ozanyan, University of Manchester, UK A Peyton, University of Manchester, UK S Reilly, National Physical Laboratory, UK T Sun, City University London, UK A Tickle, Coventry University, UK D Vasic, University of Zagreb, Croatia S Welch, ESPKTN, UK Y Yan, University of Kent, UK H Zangl, Technical University of Graz, Austria

Elevated Cell Wall Chitin in Candida albicans Confers Echinocandin Resistance In Vivo

PubMed Central

Lee, Keunsook K.; MacCallum, Donna M.; Jacobsen, Mette D.; Walker, Louise A.; Odds, Frank C.

2012-01-01

Candida albicans cells with increased cell wall chitin have reduced echinocandin susceptibility in vitro. The aim of this study was to investigate whether C. albicans cells with elevated chitin levels have reduced echinocandin susceptibility in vivo. BALB/c mice were infected with C. albicans cells with normal chitin levels and compared to mice infected with high-chitin cells. Caspofungin therapy was initiated at 24 h postinfection. Mice infected with chitin-normal cells were successfully treated with caspofungin, as indicated by reduced kidney fungal burdens, reduced weight loss, and decreased C. albicans density in kidney lesions. In contrast, mice infected with high-chitin C. albicans cells were less susceptible to caspofungin, as they had higher kidney fungal burdens and greater weight loss during early infection. Cells recovered from mouse kidneys at 24 h postinfection with high-chitin cells had 1.6-fold higher chitin levels than cells from mice infected with chitin-normal cells and maintained a significantly reduced susceptibility to caspofungin when tested in vitro. At 48 h postinfection, caspofungin treatment induced a further increase in chitin content of C. albicans cells harvested from kidneys compared to saline treatment. Some of the recovered clones had acquired, at a low frequency, a point mutation in FKS1 resulting in a S645Y amino acid substitution, a mutation known to confer echinocandin resistance. This occurred even in cells that had not been exposed to caspofungin. Our results suggest that the efficacy of caspofungin against C. albicans was reduced in vivo due to either elevation of chitin levels in the cell wall or acquisition of FKS1 point mutations. PMID:21986821

Overexpression of CYP3A4 in a COLO 205 Colon Cancer Stem Cell Model in vitro

PubMed Central

Olszewski, Ulrike; Liedauer, Richard; Ausch, Christoph; Thalhammer, Theresia; Hamilton, Gerhard

2011-01-01

Cancer stem cells (CSCs) seem to constitute a subpopulation of tumor cells that escape from chemotherapy and cause recurrent disease. Low proliferation rates, protection in a stem cell niche and overexpression of drug resistance proteins are considered to confer chemoresistance. We established an in vitro colon CSC-like model using the COLO 205 cell line, which revealed transiently increased expression of CD133 when transferred to serum-free stem cell culture medium. Assessment of global gene expression of COLO 205 cells under these conditions identified a set of upregulated genes including cytochrome P450 3A4 (CYP3A4) and aldehyde dehydrogenase 1A1 (ALDH1A1), as confirmed by real-time qPCR. ALDH1A1 is a CSC marker for certain tumor entities and confers resistance to cyclophosphamide. CYP3A4 is expressed in liver and colon and its overexpression seems particularly relevant in colon cancer, since it inactivates irinotecan and other xenobiotics, such as taxols and vinca alkaloids. In conclusion, this COLO 205 model provides evidence for CD133 induction concomitant with overexpression of CYP3A4, which, together with ATP-binding cassette, subfamily G, member 2 (ABCG2) and others, may have a role in chemoresistant colon CSCs and a negative impact on disease-free survival in colon cancer patients. PMID:24212669

Space Electrochemical Research and Technology. Abstracts

NASA Technical Reports Server (NTRS)

1995-01-01

This document contains abstracts of the proceedings of NASA's fifth Space Electrochemical Research and Technology (SERT) Conference, held at the NASA Lewis Research Center on May 1-3, 1995. The objective of the conference was to assess the present status and general thrust of research and development in those areas of electrochemical technology required to enable NASA missions into the next century. The conference provided a forum for the exchange of ideas and opinions of those actively involved in the field, in order to define new opportunities for the application of electrochemical processes in future NASA missions. Papers were presented in three technical areas: (1) the electrochemical interface, (2) the next generation in aerospace batteries and fuel cells, and (3) electrochemistry for non-energy storage applications. This document contains the abstracts of the papers presented.

Activation of Antibiotic Production in Bacillus spp. by Cumulative Drug Resistance Mutations

PubMed Central

Tojo, Shigeo; Tanaka, Yukinori

2015-01-01

Bacillus subtilis strains produce a wide range of antibiotics, including ribosomal and nonribosomal peptide antibiotics, as well as bacilysocin and neotrehalosadiamine. Mutations in B. subtilis strain 168 that conferred resistance to drugs such as streptomycin and rifampin resulted in overproduction of the dipeptide antibiotic bacilysin. Cumulative drug resistance mutations, such as mutations in the mthA and rpsL genes, which confer low- and high-level resistance, respectively, to streptomycin, and mutations in rpoB, which confer resistance to rifampin, resulted in cells that overproduced bacilysin. Transcriptional analysis demonstrated that the enhanced transcription of biosynthesis genes was responsible for the overproduction of bacilysin. This approach was effective also in activating the cryptic genes of Bacillus amyloliquefaciens, leading to actual production of antibiotic(s). PMID:26369962

Proceedings of the First National Sickle Cell Educational Symposium (May 1976, St. Louis, Missouri).

ERIC Educational Resources Information Center

Public Health Service (DHEW), Arlington, VA.

This conference was organized around presentations about the cases of an adult and a pediatric sickle cell anemia patient. Following the presentations of the patients' case histories, and clinical and laboratory findings, the cases were discussed by specialists from various areas of expertise. Among the perspectives offered were those of internal…

Analysis of papillary renal adenocarcinoma.

PubMed

Mydlo, J H; Bard, R H

1987-12-01

A retrospective review was conducted comparing the angiographic findings, tumor volumes, staging, and survival of patients with papillary renal adenocarcinoma as compared with the more common clear and granular cell renal adenocarcinoma. The data suggest that the papillary histopathologic organization confers an improved prognosis, which concurs with previous findings. We speculate on why this tumor behaves differently from clear cell carcinoma.