Sample records for consecutive base pairs

  1. Crystal structure of metallo DNA duplex containing consecutive Watson-Crick-like T-Hg(II)-T base pairs.

    PubMed

    Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2014-02-24

    The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Bifacial Base-Pairing Behaviors of 5-Hydroxyuracil DNA Bases through Hydrogen Bonding and Metal Coordination.

    PubMed

    Takezawa, Yusuke; Nishiyama, Kotaro; Mashima, Tsukasa; Katahira, Masato; Shionoya, Mitsuhiko

    2015-10-12

    A novel bifacial ligand-bearing nucleobase, 5-hydroxyuracil (U(OH) ), which forms both a hydrogen-bonded base pair (U(OH) -A) and a metal-mediated base pair (U(OH) -M-U(OH) ) has been developed. The U(OH) -M-U(OH) base pairs were quantitatively formed in the presence of lanthanide ions such as Gd(III) when U(OH) -U(OH) pairs were consecutively incorporated into DNA duplexes. This result established metal-assisted duplex stabilization as well as DNA-templated assembly of lanthanide ions. Notably, a duplex possessing U(OH) -A base pairs was destabilized by addition of Gd(III) ions. This observation suggests that the hybridization behaviors of the U(OH) -containing DNA strands are altered by metal complexation. Thus, the U(OH) nucleobase with a bifacial base-pairing property holds great promise as a component for metal-responsive DNA materials. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Zn2+ selectively stabilizes FdU-substituted DNA through a unique major groove binding motif

    PubMed Central

    Ghosh, Supratim; Salsbury, Freddie R.; Horita, David A.; Gmeiner, William H.

    2011-01-01

    We report, based on semi-empirical calculations, that Zn2+ binds duplex DNA containing consecutive FdU–dA base pairs in the major groove with distorted trigonal bipyramidal geometry. In this previously uncharacterized binding motif, O4 and F5 on consecutive FdU are axial ligands while three water molecules complete the coordination sphere. NMR spectroscopy confirmed Zn2+ complexation occurred with maintenance of base pairing while a slight hypsochromic shift in circular dichroism (CD) spectra indicated moderate structural distortion relative to B-form DNA. Zn2+ complexation inhibited ethidium bromide (EtBr) intercalation and stabilized FdU-substituted duplex DNA (ΔTm > 15°C). Mg2+ neither inhibited EtBr complexation nor had as strong of a stabilizing effect. DNA sequences that did not contain consecutive FdU were not stabilized by Zn2+. A lipofectamine preparation of the Zn2+–DNA complex displayed enhanced cytotoxicity toward prostate cancer cells relative to the individual components prepared as lipofectamine complexes indicating the potential utility of Zn2+–DNA complexes for cancer treatment. PMID:21296761

  4. The repeating nucleotide sequence in the repetitive mitochondrial DNA from a "low-density" petite mutant of yeast.

    PubMed Central

    Van Kreijl, C F; Bos, J L

    1977-01-01

    The repeating nucleotide sequence of 68 base pairs in the mtDNA from an ethidium-induced cytoplasmic petite mutant of yeast has been determined. For sequence analysis specifically primed and terminated RNA copies, obtained by in vitro transcription of the separated strands, were use. The sequence consists of 66 consecutive AT base pairs flanked by two GC pairs and comprises nearly all of the mutant mitochondrial genome. The sequence, moreover, also represents the first part of wild-type mtDNA sequence so far. Images PMID:198740

  5. Routing and spectrum assignment based on ant colony optimization of minimum consecutiveness loss in elastic optical networks

    NASA Astrophysics Data System (ADS)

    Wang, Fu; Liu, Bo; Zhang, Lijia; Xin, Xiangjun; Tian, Qinghua; Zhang, Qi; Rao, Lan; Tian, Feng; Luo, Biao; Liu, Yingjun; Tang, Bao

    2016-10-01

    Elastic Optical Networks are considered to be a promising technology for future high-speed network. In this paper, we propose a RSA algorithm based on the ant colony optimization of minimum consecutiveness loss (ACO-MCL). Based on the effect of the spectrum consecutiveness loss on the pheromone in the ant colony optimization, the path and spectrum of the minimal impact on the network are selected for the service request. When an ant arrives at the destination node from the source node along a path, we assume that this path is selected for the request. We calculate the consecutiveness loss of candidate-neighbor link pairs along this path after the routing and spectrum assignment. Then, the networks update the pheromone according to the value of the consecutiveness loss. We save the path with the smallest value. After multiple iterations of the ant colony optimization, the final selection of the path is assigned for the request. The algorithms are simulated in different networks. The results show that ACO-MCL algorithm performs better in blocking probability and spectrum efficiency than other algorithms. Moreover, the ACO-MCL algorithm can effectively decrease spectrum fragmentation and enhance available spectrum consecutiveness. Compared with other algorithms, the ACO-MCL algorithm can reduce the blocking rate by at least 5.9% in heavy load.

  6. In-stem labelling allows visualization of DNA strand displacements by distinct fluorescent colour change.

    PubMed

    Barrois, Sebastian; Wagenknecht, Hans-Achim

    2013-05-21

    The combination of thiazole orange (TO) and thiazole red (TR) as an internal pair of fluorescent DNA base surrogates ("DNA traffic lights") allows us to follow at least two consecutive DNA strand displacements in real time through a distinct fluorescence colour change from green to red and vice versa.

  7. Contamination of Ambient Air with Acinetobacter baumannii on Consecutive Inpatient Days.

    PubMed

    Shimose, Luis A; Doi, Yohei; Bonomo, Robert A; De Pascale, Dennise; Viau, Roberto A; Cleary, Timothy; Namias, Nicholas; Kett, Daniel H; Munoz-Price, L Silvia

    2015-07-01

    Acinetobacter-positive patients had their ambient air tested for up to 10 consecutive days. The air was Acinetobacter positive for an average of 21% of the days; the rate of contamination was higher among patients colonized in the rectum than in the airways (relative risk [RR], 2.35; P = 0.006). Of the 6 air/clinical isolate pairs available, 4 pairs were closely related according to rep-PCR results. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  8. China Accreditation Test for Translators and Interpreters (CATTI): Test Review Based on the Language Pairing of English and Chinese

    ERIC Educational Resources Information Center

    Zhao, Hulin; Gu, Xiangdong

    2016-01-01

    Test Purpose: The CATTI aims to measure competence in translation and interpreting (including simultaneous and consecutive interpreting) between Chinese and seven foreign languages: English, Japanese, French, Arabic, Russian, German, or Spanish. The test is intended to cover a wide range of domains including business, government, academia, and…

  9. In search of functional association from time-series microarray data based on the change trend and level of gene expression

    PubMed Central

    He, Feng; Zeng, An-Ping

    2006-01-01

    Background The increasing availability of time-series expression data opens up new possibilities to study functional linkages of genes. Present methods used to infer functional linkages between genes from expression data are mainly based on a point-to-point comparison. Change trends between consecutive time points in time-series data have been so far not well explored. Results In this work we present a new method based on extracting main features of the change trend and level of gene expression between consecutive time points. The method, termed as trend correlation (TC), includes two major steps: 1, calculating a maximal local alignment of change trend score by dynamic programming and a change trend correlation coefficient between the maximal matched change levels of each gene pair; 2, inferring relationships of gene pairs based on two statistical extraction procedures. The new method considers time shifts and inverted relationships in a similar way as the local clustering (LC) method but the latter is merely based on a point-to-point comparison. The TC method is demonstrated with data from yeast cell cycle and compared with the LC method and the widely used Pearson correlation coefficient (PCC) based clustering method. The biological significance of the gene pairs is examined with several large-scale yeast databases. Although the TC method predicts an overall lower number of gene pairs than the other two methods at a same p-value threshold, the additional number of gene pairs inferred by the TC method is considerable: e.g. 20.5% compared with the LC method and 49.6% with the PCC method for a p-value threshold of 2.7E-3. Moreover, the percentage of the inferred gene pairs consistent with databases by our method is generally higher than the LC method and similar to the PCC method. A significant number of the gene pairs only inferred by the TC method are process-identity or function-similarity pairs or have well-documented biological interactions, including 443 known protein interactions and some known cell cycle related regulatory interactions. It should be emphasized that the overlapping of gene pairs detected by the three methods is normally not very high, indicating a necessity of combining the different methods in search of functional association of genes from time-series data. For a p-value threshold of 1E-5 the percentage of process-identity and function-similarity gene pairs among the shared part of the three methods reaches 60.2% and 55.6% respectively, building a good basis for further experimental and functional study. Furthermore, the combined use of methods is important to infer more complete regulatory circuits and network as exemplified in this study. Conclusion The TC method can significantly augment the current major methods to infer functional linkages and biological network and is well suitable for exploring temporal relationships of gene expression in time-series data. PMID:16478547

  10. Tracking quasi-stationary flow of weak fluorescent signals by adaptive multi-frame correlation.

    PubMed

    Ji, L; Danuser, G

    2005-12-01

    We have developed a novel cross-correlation technique to probe quasi-stationary flow of fluorescent signals in live cells at a spatial resolution that is close to single particle tracking. By correlating image blocks between pairs of consecutive frames and integrating their correlation scores over multiple frame pairs, uncertainty in identifying a globally significant maximum in the correlation score function has been greatly reduced as compared with conventional correlation-based tracking using the signal of only two consecutive frames. This approach proves robust and very effective in analysing images with a weak, noise-perturbed signal contrast where texture characteristics cannot be matched between only a pair of frames. It can also be applied to images that lack prominent features that could be utilized for particle tracking or feature-based template matching. Furthermore, owing to the integration of correlation scores over multiple frames, the method can handle signals with substantial frame-to-frame intensity variation where conventional correlation-based tracking fails. We tested the performance of the method by tracking polymer flow in actin and microtubule cytoskeleton structures labelled at various fluorophore densities providing imagery with a broad range of signal modulation and noise. In applications to fluorescent speckle microscopy (FSM), where the fluorophore density is sufficiently low to reveal patterns of discrete fluorescent marks referred to as speckles, we combined the multi-frame correlation approach proposed above with particle tracking. This hybrid approach allowed us to follow single speckles robustly in areas of high speckle density and fast flow, where previously published FSM analysis methods were unsuccessful. Thus, we can now probe cytoskeleton polymer dynamics in living cells at an entirely new level of complexity and with unprecedented detail.

  11. Novel techniques for data decomposition and load balancing for parallel processing of vision systems: Implementation and evaluation using a motion estimation system

    NASA Technical Reports Server (NTRS)

    Choudhary, Alok Nidhi; Leung, Mun K.; Huang, Thomas S.; Patel, Janak H.

    1989-01-01

    Computer vision systems employ a sequence of vision algorithms in which the output of an algorithm is the input of the next algorithm in the sequence. Algorithms that constitute such systems exhibit vastly different computational characteristics, and therefore, require different data decomposition techniques and efficient load balancing techniques for parallel implementation. However, since the input data for a task is produced as the output data of the previous task, this information can be exploited to perform knowledge based data decomposition and load balancing. Presented here are algorithms for a motion estimation system. The motion estimation is based on the point correspondence between the involved images which are a sequence of stereo image pairs. Researchers propose algorithms to obtain point correspondences by matching feature points among stereo image pairs at any two consecutive time instants. Furthermore, the proposed algorithms employ non-iterative procedures, which results in saving considerable amounts of computation time. The system consists of the following steps: (1) extraction of features; (2) stereo match of images in one time instant; (3) time match of images from consecutive time instants; (4) stereo match to compute final unambiguous points; and (5) computation of motion parameters.

  12. A curved RNA helix incorporating an internal loop with G·A and A·A non-Watson–Crick base pairing

    PubMed Central

    Baeyens, Katrien J.; De Bondt, Hendrik L.; Pardi, Arthur; Holbrook, Stephen R.

    1996-01-01

    The crystal structure of the RNA dodecamer 5′-GGCC(GAAA)GGCC-3′ has been determined from x-ray diffraction data to 2.3-Å resolution. In the crystal, these oligomers form double helices around twofold symmetry axes. Four consecutive non-Watson–Crick base pairs make up an internal loop in the middle of the duplex, including sheared G·A pairs and novel asymmetric A·A pairs. This internal loop sequence produces a significant curvature and narrowing of the double helix. The helix is curved by 34° from end to end and the diameter is narrowed by 24% in the internal loop. A Mn2+ ion is bound directly to the N7 of the first guanine in the Watson–Crick region following the internal loop and the phosphate of the preceding residue. This Mn2+ location corresponds to a metal binding site observed in the hammerhead catalytic RNA. PMID:8917508

  13. [Flicker comparison of optic disc photographs: sensitivity and specificity].

    PubMed

    Funk, Jens; Lagrèze, Wolf; Zeyen, Thierry

    2002-12-01

    Examination and documentation of the optic nerve head are essential in monitoring glaucoma patients. Even minor changes in optic nerve head morphology can be visualised using the so-called flicker test: Two optic nerve head photographs, taken at consecutive examinations, are superimposed by projection. When occluding the pictures in a rapid alternating fashion, changes in optic nerve head morphology appear as motion. In this study, we evaluated sensitivity and specificity of the flicker test. A set of 33 pairs of serial optic disc slides was used as gold standard. These 33 pairs had been classified earlier by 3 independent groups of experts. 23 had been classified as "no change over time", 10 had been classified as "change". All 33 pairs were now evaluated by flicker comparison in a masked fashion. Flicker comparison usually took 1 minute per pair of slides. Sensitivity was 90 %, specificity was 65 %. The sensitivity was reasonably high. The moderate specificity was due to some cases showing "change" with the flicker comparison which might have been overlooked by the expert groups. Flicker comparison is an easy, fast and reliable technique to evaluate pairs of consecutive optic disc photographs.

  14. The integrity of the G2421-C2395 base pair in the ribosomal E-site is crucial for protein synthesis

    PubMed Central

    Koch, Miriam; Clementi, Nina; Rusca, Nicola; Vögele, Paul; Erlacher, Matthias; Polacek, Norbert

    2015-01-01

    During the elongation cycle of protein biosynthesis, tRNAs traverse through the ribosome by consecutive binding to the 3 ribosomal binding sites (A-, P-, and E- sites). While the ribosomal A- and P-sites have been functionally well characterized in the past, the contribution of the E-site to protein biosynthesis is still poorly understood in molecular terms. Previous studies suggested an important functional interaction of the terminal residue A76 of E-tRNA with the nucleobase of the universally conserved 23S rRNA residue C2394. Using an atomic mutagenesis approach to introduce non-natural nucleoside analogs into the 23S rRNA, we could show that removal of the nucleobase or the ribose 2'-OH at C2394 had no effect on protein synthesis. On the other hand, our data disclose the importance of the highly conserved E-site base pair G2421-C2395 for effective translation. Ribosomes with a disrupted G2421-C2395 base pair are defective in tRNA binding to the E-site. This results in an impaired translation of genuine mRNAs, while homo-polymeric templates are not affected. Cumulatively our data emphasize the importance of E-site tRNA occupancy and in particular the intactness of the 23S rRNA base pair G2421-C2395 for productive protein biosynthesis. PMID:25826414

  15. Migrational homing by a pair of mallards

    USGS Publications Warehouse

    Dwyer, T.J.; Derrickson, S.R.; Gilmer, D.S.

    1973-01-01

    It is generally assumed that wild, North American female dabbling ducks (Anatinae: Anatini) select new mates each year and may return to the same nesting areas in consecutive years (McKinney 1964, Wildfowl 16: 93). Lincoln (1934, Bird-Banding 5: 151) first documented migrational homing in a female Mallard (Anas platyrhynchos), and Sowls (1955, Prairie ducks, Harrisburg, Pennsylvania, Stackpole Co., pp. 25-45), working with color-marked birds, established that female Pintails (A. acuta), Gadwalls (A. strepera), Shovelers (A. clypeata), and Blue-winged Teal (A. discors) also return to previously used nesting areas. Black-bellied Tree Ducks (Dendrocygna autumnalis), in the same subfamily as the true geese (Anserinae), not only home to previously used nesting sites, but also retain the same mates in consecutive years (Bolen 1971, J. Wildl. Mgmt. 35: 386). Instances are recorded of males in the subfamily Anatinae returning to the same locality in consecutive years (Sowls, ibid.; Lewis Cowardin, pers. comm.), but no information exists on the homing of pairs. During the course of a study on the social behavior and habitat use of various dabbling ducks in North Dakota, we documented the migrational homing of a pair of Mallards. On 6 May 1971 we captured a pair of Mallards in a cannon-net trap and affixed numbered nasal saddles and a miniature radio transmitter to both the hen and drake. The drake's transmitter failed in a few days, but the hen's transmitter allowed us to locate the pair several times until 2 June 1971. Our last record for the hen was on 15 June 1971. We never found a nest site, and feel that she did not raise a brood.

  16. Pair Negotiation When Developing English Speaking Tasks

    ERIC Educational Resources Information Center

    Bohórquez Suárez, Ingrid Liliana; Gómez Sará, Mary Mily; Medina Mosquera, Sindy Lorena

    2011-01-01

    This study analyzes what characterizes the negotiations of seventh graders at a public school in Bogotá when working in pairs to develop speaking tasks in EFL classes. The inquiry is a descriptive case study that follows the qualitative paradigm. As a result of analyzing the data, we obtained four consecutive steps that characterize students'…

  17. A convergence algorithm for correlation of breech face images based on the congruent matching cells (CMC) method.

    PubMed

    Chen, Zhe; Song, John; Chu, Wei; Soons, Johannes A; Zhao, Xuezeng

    2017-11-01

    The Congruent Matching Cells (CMC) method was invented at the National Institute of Standards and Technology (NIST) for accurate firearm evidence identification and error rate estimation. The CMC method is based on the principle of discretization. The toolmark image of the reference sample is divided into correlation cells. Each cell is registered to the cell-sized area of the compared image that has maximum surface topography similarity. For each resulting cell pair, one parameter quantifies the similarity of the cell surface topography and three parameters quantify the pattern congruency of the registration position and orientation. An identification (declared match) requires a significant number of CMCs, that is, cell pairs that meet both similarity and pattern congruency requirements. The use of cell correlations reduces the effects of "invalid regions" in the compared image pairs and increases the correlation accuracy. The identification accuracy of the CMC method can be further improved by considering a feature named "convergence," that is, the tendency of the x-y registration positions of the correlated cell pairs to converge at the correct registration angle when comparing same-source samples at different relative orientations. In this paper, the difference of the convergence feature between known matching (KM) and known non-matching (KNM) image pairs is characterized, based on which an improved algorithm is developed for breech face image correlations using the CMC method. Its advantage is demonstrated by comparison with three existing CMC algorithms using four datasets. The datasets address three different brands of consecutively manufactured pistol slides, with significant differences in the distribution overlap of cell pair topography similarity for KM and KNM image pairs. For the same CMC threshold values, the convergence algorithm demonstrates noticeably improved results by reducing the number of false-positive or false-negative CMCs in a comparison. Published by Elsevier B.V.

  18. Differences in binding and monitoring mechanisms contribute to lifespan age differences in false memory.

    PubMed

    Fandakova, Yana; Shing, Yee Lee; Lindenberger, Ulman

    2013-10-01

    Based on a 2-component framework of episodic memory development across the lifespan (Shing & Lindenberger, 2011), we examined the contribution of memory-related binding and monitoring processes to false memory susceptibility in childhood and old age. We administered a repeated continuous recognition task to children (N = 20, 10-12 years), younger adults (N = 20, 20-27 years), and older adults (N = 21, 68-76 years). Participants saw the same set of unrelated word pairs in 3 consecutive runs and their task was to identify pair reoccurrences within runs. Across runs, correct detection of repeated pairs decreased in children only, whereas false recognition of lure pairs showed a greater increase in older adults than in children or younger adults. False recognition of rearranged pairs decreased across runs for all participants. This decrease was most pronounced in children, in particular for high-confidence memory errors. We conclude that memory binding mechanisms are sufficiently developed in children to facilitate memory monitoring and reduce false memory for associative information. In contrast, older adults show senescent impairments in both binding and monitoring mechanisms that both contribute to elevated illusory recollections in old age. We conclude that binding and monitoring processes during memory performance follow different developmental trajectories from childhood to old age.

  19. Epidemiological and clinical analysis of a consecutive series of conjoined twins in Spain.

    PubMed

    Martínez-Frías, María Luisa; Bermejo, Eva; Mendioroz, Jacobo; Rodríguez-Pinilla, Elvira; Blanco, Manuel; Egüés, Javier; Félix, Valentín; García, Angel; Huertas, Héctor; Nieto, Carmen; López, José Antonio; López, Santiago; Paisán, Luis; Rosa, Alejandro; Vázquez, María Socorro

    2009-04-01

    The aim of the study was to analyze the frequency and certain epidemiological characteristics of a consecutive series of conjoined twins born in Spain. We used data from the Spanish Collaborative Study of Congenital Malformations for the period April 1976 to 2006. Because the Spanish law permitting voluntary termination of pregnancies (TOP) when the fetus presented malformations was effective by the end of 1985, we analyzed the data in 4 periods, 2 before 1986 and 2 after. During the first period (1976-1979) only live births were recorded, whereas both still and live births were included in the other three (1980-1985, 1986-1995, and 1996-2006). In the present study, the cases were classified as symmetrical (16 pairs) and asymmetrical (1 pair) conjoined twins. Each pair of conjoined twins was considered as only one case for calculations, regardless of the type of union. Among a total of 2,281,604 consecutive births between 1980 and 2006, there were a total of 15 cases of symmetrical conjoined twins giving a frequency of 0.70 per 100,000 (1/152,107), whereas there was only 1 stillborn asymmetrical conjoined twin pair (0.04/100,000). Among the 13,418 consecutive stillborns surveyed, 6 cases of conjoined twins were identified (either symmetrical or asymmetrical) giving a frequency of 44.72 per 100,000, and 11 pairs were identified among the 2,425,583 total live births surveyed during the first period 1976 to 1979, a frequency of 0.45 per 100,000. Thus, the frequency among stillborn infants is 99.34 times higher than that observed among live births. However, the frequency for the total births (3 last periods) showed a decreasing trend from 1.47 per 100,000 birth in the first period (1980-1985) when TOP was illegal, to a value of 0.09 per 100,000 in the last period, more than 16-fold lower, probably because of the TOP of affected fetuses. Therefore, we consider that the frequencies observed in the period 1980 to 1985 are the basal values in our population. The most frequent type observed was thoracopagus, with an overall prevalence at birth of 0.44 per 100,000 (1/228,160) from 1980 to 2006, representing 58.82% of the total population of symmetric conjoined twin pairs. Diprosopus pairs were the next most common group (11.76%). Most of the cases were females (4 males/11 females), and although this appeared to be mainly because of the thoracopagus pairs (males-females, 2:8), in such a small number of cases, it is not possible to determine the ratios for the other groups. Gestational age was significantly shorter than in control twins for each type studied. We conclude that it is incorrect to consider that all types of conjoined twins have the same epidemiological characteristics, such as the frequency at birth. The differences observed may be related with the distinct embryo-fetal mortality of each type of conjoined twins in different populations, and the sex ratio, among others.

  20. How the manner of presentation of data influences older patients in determining their treatment preferences.

    PubMed

    Mazur, D J; Merz, J F

    1993-03-01

    To assess how the manner of presentation of graphic data to older patients influences their treatment preferences. Cross-sectional structured interviews with patients. A university-based Department of Veterans Affairs Medical Center. One hundred sixty-six consecutive patients (mean age = 64.8 years, range of ages 29-82) seen in a Department of Veterans Affairs general medicine clinic. Five pairs of 5-year survival curves were presented to patients. Each pair was composed of two survival curves for alternative unidentified treatments for an unidentified medical condition. Curve A (LT = better long-term, worse short-term survival) was fixed throughout all curve pairs. Curve B (ST = better short-term, worse long-term survival) changed in each curve pair, showing incrementally better chances of short-term survival across the five curve pairs. Patients were randomly assigned to view the curve pairs in forward (increasing short-term survival) or backward (decreasing short-term survival) order. Order is a significant predictor of patients' initial preferences for the short-term survival curve (P = 0.0004) as well as their willingness to shift preferences during presentation of the five curve pairs. Patients > or = 65 were more likely to initially choose the ST curve in forward order presentation than patients < 65. More educated patients generally were less likely to prefer the ST curve under both elicitation orders. The data indicate that the method of eliciting patients' preferences strongly influenced their expressed preferences, and that these preferences may have predictable relationships with demographic characteristics such as age.

  1. A natural language processing pipeline for pairing measurements uniquely across free-text CT reports.

    PubMed

    Sevenster, Merlijn; Bozeman, Jeffrey; Cowhy, Andrea; Trost, William

    2015-02-01

    To standardize and objectivize treatment response assessment in oncology, guidelines have been proposed that are driven by radiological measurements, which are typically communicated in free-text reports defying automated processing. We study through inter-annotator agreement and natural language processing (NLP) algorithm development the task of pairing measurements that quantify the same finding across consecutive radiology reports, such that each measurement is paired with at most one other ("partial uniqueness"). Ground truth is created based on 283 abdomen and 311 chest CT reports of 50 patients each. A pre-processing engine segments reports and extracts measurements. Thirteen features are developed based on volumetric similarity between measurements, semantic similarity between their respective narrative contexts and structural properties of their report positions. A Random Forest classifier (RF) integrates all features. A "mutual best match" (MBM) post-processor ensures partial uniqueness. In an end-to-end evaluation, RF has precision 0.841, recall 0.807, F-measure 0.824 and AUC 0.971; with MBM, which performs above chance level (P<0.001), it has precision 0.899, recall 0.776, F-measure 0.833 and AUC 0.935. RF (RF+MBM) has error-free performance on 52.7% (57.4%) of report pairs. Inter-annotator agreement of three domain specialists with the ground truth (κ>0.960) indicates that the task is well defined. Domain properties and inter-section differences are discussed to explain superior performance in abdomen. Enforcing partial uniqueness has mixed but minor effects on performance. A combined machine learning-filtering approach is proposed for pairing measurements, which can support prospective (supporting treatment response assessment) and retrospective purposes (data mining). Copyright © 2014 Elsevier Inc. All rights reserved.

  2. CryoEM structure of the spliceosome immediately after branching

    PubMed Central

    Galej, Wojciech P.; Wilkinson, Max E.; Fica, Sebastian M.; Oubridge, Chris; Newman, Andrew J.; Nagai, Kiyoshi

    2016-01-01

    Pre-mRNA splicing proceeds by two consecutive trans-esterification reactions via a lariat-intron intermediate. We present the 3.8Å cryoEM structure of the spliceosome immediately after lariat formation. The 5’-splice site is cleaved but remains close to the catalytic Mg2+ site in the U2/U6 snRNA triplex, and the 5’-phosphate of the intron nucleotide G(+1) is linked to the branch adenosine 2’OH. The 5’-exon is held between the Prp8 N-terminal and Linker domains, and base-pairs with U5 snRNA loop 1. Non-Watson-Crick interactions between the branch helix and 5’-splice site dock the branch adenosine into the active site, while intron nucleotides +3 to +6 base-pair with the U6 snRNA ACAGAGA sequence. Isy1 and the step one factors Yju2 and Cwc25 stabilise docking of the branch helix. The intron downstream of the branch site emerges between the Prp8 RT and Linker domains and extends towards Prp16 helicase, suggesting a plausible mechanism of remodelling before exon ligation. PMID:27459055

  3. Apolipoprotein B-52 mutation associated with hypobetalipoproteinemia is compatible with a misaligned pairing deletion mechanism.

    PubMed

    Groenewegen, W A; Krul, E S; Schonfeld, G

    1993-06-01

    We have identified a new truncation of apoB in a large kindred with hypobetalipoproteinemia that arose by an ambiguous deletion of one of four different groups of base-pairs. Eleven affected members of the kindred had total cholesterols (C) of 114 +/- 28, LDL-Cs of 46 +/- 21, and apoBs of 47 +/- 25 (all in mg/dl, mean +/- SD). These levels were lower (P < 0.0001) than in 15 unaffected relatives. On Western blotting, apoB-100 and a second major band corresponding to apoB-52 were seen in the affected individuals. The majority of the plasma apoB-52 was associated with a smaller than normal low density lipoprotein (LDL) particle. The molecular basis for this apoB-52 truncation is a 5-bp deletion, converting the sequence between cDNA nucleotide 7276 and 7283 from 5'-AAGTTAAG-3' into the mutant sequence 5'-AAG-3'. This results in a frameshift starting at amino acid residue 2357 and a termination codon at amino acid residue 2362. Deletion of one of four different groups of five consecutive bases, i.e., AAGTT, AGTTA, GTTAA, and TTAAG, all result in the same mutant sequence. Thus, the precise deletion is ambiguous. We propose that a misaligned pairing mechanism involving repeat sequences is compatible with this deletion mutation. We have noted similar ambiguous deletions associated with apoB-37, apoB-40, and a number of single base deletions and some may also be explained by a misaligned pairing mechanism. Small ambiguous deletions appear to constitute a major proportion of the apoB gene mutation spectrum suggesting that it may be a suitable model for studying the mechanisms of such mutations.

  4. Visual Odometry Based on Structural Matching of Local Invariant Features Using Stereo Camera Sensor

    PubMed Central

    Núñez, Pedro; Vázquez-Martín, Ricardo; Bandera, Antonio

    2011-01-01

    This paper describes a novel sensor system to estimate the motion of a stereo camera. Local invariant image features are matched between pairs of frames and linked into image trajectories at video rate, providing the so-called visual odometry, i.e., motion estimates from visual input alone. Our proposal conducts two matching sessions: the first one between sets of features associated to the images of the stereo pairs and the second one between sets of features associated to consecutive frames. With respect to previously proposed approaches, the main novelty of this proposal is that both matching algorithms are conducted by means of a fast matching algorithm which combines absolute and relative feature constraints. Finding the largest-valued set of mutually consistent matches is equivalent to finding the maximum-weighted clique on a graph. The stereo matching allows to represent the scene view as a graph which emerge from the features of the accepted clique. On the other hand, the frame-to-frame matching defines a graph whose vertices are features in 3D space. The efficiency of the approach is increased by minimizing the geometric and algebraic errors to estimate the final displacement of the stereo camera between consecutive acquired frames. The proposed approach has been tested for mobile robotics navigation purposes in real environments and using different features. Experimental results demonstrate the performance of the proposal, which could be applied in both industrial and service robot fields. PMID:22164016

  5. Incremental Multi-view 3D Reconstruction Starting from Two Images Taken by a Stereo Pair of Cameras

    NASA Astrophysics Data System (ADS)

    El hazzat, Soulaiman; Saaidi, Abderrahim; Karam, Antoine; Satori, Khalid

    2015-03-01

    In this paper, we present a new method for multi-view 3D reconstruction based on the use of a binocular stereo vision system constituted of two unattached cameras to initialize the reconstruction process. Afterwards , the second camera of stereo vision system (characterized by varying parameters) moves to capture more images at different times which are used to obtain an almost complete 3D reconstruction. The first two projection matrices are estimated by using a 3D pattern with known properties. After that, 3D scene points are recovered by triangulation of the matched interest points between these two images. The proposed approach is incremental. At each insertion of a new image, the camera projection matrix is estimated using the 3D information already calculated and new 3D points are recovered by triangulation from the result of the matching of interest points between the inserted image and the previous image. For the refinement of the new projection matrix and the new 3D points, a local bundle adjustment is performed. At first, all projection matrices are estimated, the matches between consecutive images are detected and Euclidean sparse 3D reconstruction is obtained. So, to increase the number of matches and have a more dense reconstruction, the Match propagation algorithm, more suitable for interesting movement of the camera, was applied on the pairs of consecutive images. The experimental results show the power and robustness of the proposed approach.

  6. Dipping-interface mapping using mode-separated Rayleigh waves

    USGS Publications Warehouse

    Luo, Y.; Xia, J.; Xu, Y.; Zeng, C.; Miller, R.D.; Liu, Q.

    2009-01-01

    Multichannel analysis of surface waves (MASW) method is a non-invasive geophysical technique that uses the dispersive characteristic of Rayleigh waves to estimate a vertical shear (S)-wave velocity profile. A pseudo-2D S-wave velocity section is constructed by aligning 1D S-wave velocity profiles at the midpoint of each receiver spread that are contoured using a spatial interpolation scheme. The horizontal resolution of the section is therefore most influenced by the receiver spread length and the source interval. Based on the assumption that a dipping-layer model can be regarded as stepped flat layers, high-resolution linear Radon transform (LRT) has been proposed to image Rayleigh-wave dispersive energy and separate modes of Rayleigh waves from a multichannel record. With the mode-separation technique, therefore, a dispersion curve that possesses satisfactory accuracy can be calculated using a pair of consecutive traces within a mode-separated shot gather. In this study, using synthetic models containing a dipping layer with a slope of 5, 10, 15, 20, or 30 degrees and a real-world example, we assess the ability of using high-resolution LRT to image and separate fundamental-mode Rayleigh waves from raw surface-wave data and accuracy of dispersion curves generated by a pair of consecutive traces within a mode-separated shot gather. Results of synthetic and real-world examples demonstrate that a dipping interface with a slope smaller than 15 degrees can be successfully mapped by separated fundamental waves using high-resolution LRT. ?? Birkh??user Verlag, Basel 2009.

  7. Induction of Long-term Depression-like Plasticity by Pairings of Motor Imagination and Peripheral Electrical Stimulation

    PubMed Central

    Jochumsen, Mads; Signal, Nada; Nedergaard, Rasmus W.; Taylor, Denise; Haavik, Heidi; Niazi, Imran K.

    2015-01-01

    Long-term depression (LTD) and long-term potentiation (LTP)-like plasticity are models of synaptic plasticity which have been associated with memory and learning. The induction of LTD and LTP-like plasticity, using different stimulation protocols, has been proposed as a means of addressing abnormalities in cortical excitability associated with conditions such as focal hand dystonia and stroke. The aim of this study was to investigate whether the excitability of the cortical projections to the tibialis anterior (TA) muscle could be decreased when dorsiflexion of the ankle joint was imagined and paired with peripheral electrical stimulation (ES) of the nerve supplying the antagonist soleus muscle. The effect of stimulus timing was evaluated by comparing paired stimulation timed to reach the cortex before, at and after the onset of imagined movement. Fourteen healthy subjects participated in six experimental sessions held on non-consecutive days. The timing of stimulation delivery was determined offline based on the contingent negative variation (CNV) of electroencephalography brain data obtained during imagined dorsiflexion. Afferent stimulation was provided via a single pulse ES to the peripheral nerve paired, based on the CNV, with motor imagination of ankle dorsiflexion. A significant decrease (P = 0.001) in the excitability of the cortical projection of TA was observed when the afferent volley from the ES of the tibial nerve (TN) reached the cortex at the onset of motor imagination based on the CNV. When TN stimulation was delivered before (P = 0.62), or after (P = 0.23) imagined movement onset there was no significant effect. Nor was a significant effect found when ES of the TN was applied independent of imagined movement (P = 0.45). Therefore, the excitability of the cortical projection to a muscle can be inhibited when ES of the nerve supplying the antagonist muscle is precisely paired with the onset of imagined movement. PMID:26648859

  8. Induction of Long-term Depression-like Plasticity by Pairings of Motor Imagination and Peripheral Electrical Stimulation.

    PubMed

    Jochumsen, Mads; Signal, Nada; Nedergaard, Rasmus W; Taylor, Denise; Haavik, Heidi; Niazi, Imran K

    2015-01-01

    Long-term depression (LTD) and long-term potentiation (LTP)-like plasticity are models of synaptic plasticity which have been associated with memory and learning. The induction of LTD and LTP-like plasticity, using different stimulation protocols, has been proposed as a means of addressing abnormalities in cortical excitability associated with conditions such as focal hand dystonia and stroke. The aim of this study was to investigate whether the excitability of the cortical projections to the tibialis anterior (TA) muscle could be decreased when dorsiflexion of the ankle joint was imagined and paired with peripheral electrical stimulation (ES) of the nerve supplying the antagonist soleus muscle. The effect of stimulus timing was evaluated by comparing paired stimulation timed to reach the cortex before, at and after the onset of imagined movement. Fourteen healthy subjects participated in six experimental sessions held on non-consecutive days. The timing of stimulation delivery was determined offline based on the contingent negative variation (CNV) of electroencephalography brain data obtained during imagined dorsiflexion. Afferent stimulation was provided via a single pulse ES to the peripheral nerve paired, based on the CNV, with motor imagination of ankle dorsiflexion. A significant decrease (P = 0.001) in the excitability of the cortical projection of TA was observed when the afferent volley from the ES of the tibial nerve (TN) reached the cortex at the onset of motor imagination based on the CNV. When TN stimulation was delivered before (P = 0.62), or after (P = 0.23) imagined movement onset there was no significant effect. Nor was a significant effect found when ES of the TN was applied independent of imagined movement (P = 0.45). Therefore, the excitability of the cortical projection to a muscle can be inhibited when ES of the nerve supplying the antagonist muscle is precisely paired with the onset of imagined movement.

  9. Introducing improved structural properties and salt dependence into a coarse-grained model of DNA

    NASA Astrophysics Data System (ADS)

    Snodin, Benedict E. K.; Randisi, Ferdinando; Mosayebi, Majid; Šulc, Petr; Schreck, John S.; Romano, Flavio; Ouldridge, Thomas E.; Tsukanov, Roman; Nir, Eyal; Louis, Ard A.; Doye, Jonathan P. K.

    2015-06-01

    We introduce an extended version of oxDNA, a coarse-grained model of deoxyribonucleic acid (DNA) designed to capture the thermodynamic, structural, and mechanical properties of single- and double-stranded DNA. By including explicit major and minor grooves and by slightly modifying the coaxial stacking and backbone-backbone interactions, we improve the ability of the model to treat large (kilobase-pair) structures, such as DNA origami, which are sensitive to these geometric features. Further, we extend the model, which was previously parameterised to just one salt concentration ([Na+] = 0.5M), so that it can be used for a range of salt concentrations including those corresponding to physiological conditions. Finally, we use new experimental data to parameterise the oxDNA potential so that consecutive adenine bases stack with a different strength to consecutive thymine bases, a feature which allows a more accurate treatment of systems where the flexibility of single-stranded regions is important. We illustrate the new possibilities opened up by the updated model, oxDNA2, by presenting results from simulations of the structure of large DNA objects and by using the model to investigate some salt-dependent properties of DNA.

  10. Introducing improved structural properties and salt dependence into a coarse-grained model of DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Snodin, Benedict E. K., E-mail: benedict.snodin@chem.ox.ac.uk; Mosayebi, Majid; Schreck, John S.

    2015-06-21

    We introduce an extended version of oxDNA, a coarse-grained model of deoxyribonucleic acid (DNA) designed to capture the thermodynamic, structural, and mechanical properties of single- and double-stranded DNA. By including explicit major and minor grooves and by slightly modifying the coaxial stacking and backbone-backbone interactions, we improve the ability of the model to treat large (kilobase-pair) structures, such as DNA origami, which are sensitive to these geometric features. Further, we extend the model, which was previously parameterised to just one salt concentration ([Na{sup +}] = 0.5M), so that it can be used for a range of salt concentrations including thosemore » corresponding to physiological conditions. Finally, we use new experimental data to parameterise the oxDNA potential so that consecutive adenine bases stack with a different strength to consecutive thymine bases, a feature which allows a more accurate treatment of systems where the flexibility of single-stranded regions is important. We illustrate the new possibilities opened up by the updated model, oxDNA2, by presenting results from simulations of the structure of large DNA objects and by using the model to investigate some salt-dependent properties of DNA.« less

  11. Reciprocal uniparental disomy in yeast.

    PubMed

    Andersen, Sabrina L; Petes, Thomas D

    2012-06-19

    In the diploid cells of most organisms, including humans, each chromosome is usually distinguishable from its partner homolog by multiple single-nucleotide polymorphisms. One common type of genetic alteration observed in tumor cells is uniparental disomy (UPD), in which a pair of homologous chromosomes are derived from a single parent, resulting in loss of heterozygosity for all single-nucleotide polymorphisms while maintaining diploidy. Somatic UPD events are usually explained as reflecting two consecutive nondisjunction events. Here we report a previously undescribed mode of chromosome segregation in Saccharomyces cerevisiae in which one cell division produces daughter cells with reciprocal UPD for the same pair of chromosomes without an aneuploid intermediate. One pair of sister chromatids is segregated into one daughter cell and the other pair is segregated into the other daughter cell, mimicking a meiotic chromosome segregation pattern. We term this process "reciprocal uniparental disomy."

  12. A two-qubit photonic quantum processor and its application to solving systems of linear equations

    PubMed Central

    Barz, Stefanie; Kassal, Ivan; Ringbauer, Martin; Lipp, Yannick Ole; Dakić, Borivoje; Aspuru-Guzik, Alán; Walther, Philip

    2014-01-01

    Large-scale quantum computers will require the ability to apply long sequences of entangling gates to many qubits. In a photonic architecture, where single-qubit gates can be performed easily and precisely, the application of consecutive two-qubit entangling gates has been a significant obstacle. Here, we demonstrate a two-qubit photonic quantum processor that implements two consecutive CNOT gates on the same pair of polarisation-encoded qubits. To demonstrate the flexibility of our system, we implement various instances of the quantum algorithm for solving of systems of linear equations. PMID:25135432

  13. Absolute/convective secondary instabilities and the role of confinement in free shear layers

    NASA Astrophysics Data System (ADS)

    Arratia, Cristóbal; Mowlavi, Saviz; Gallaire, François

    2018-05-01

    We study the linear spatiotemporal stability of an infinite row of equal point vortices under symmetric confinement between parallel walls. These rows of vortices serve to model the secondary instability leading to the merging of consecutive (Kelvin-Helmholtz) vortices in free shear layers, allowing us to study how confinement limits the growth of shear layers through vortex pairings. Using a geometric construction akin to a Legendre transform on the dispersion relation, we compute the growth rate of the instability in different reference frames as a function of the frame velocity with respect to the vortices. This approach is verified and complemented with numerical computations of the linear impulse response, fully characterizing the absolute/convective nature of the instability. Similar to results by Healey on the primary instability of parallel tanh profiles [J. Fluid Mech. 623, 241 (2009), 10.1017/S0022112008005284], we observe a range of confinement in which absolute instability is promoted. For a parallel shear layer with prescribed confinement and mixing length, the threshold for absolute/convective instability of the secondary pairing instability depends on the separation distance between consecutive vortices, which is physically determined by the wavelength selected by the previous (primary or pairing) instability. In the presence of counterflow and moderate to weak confinement, small (large) wavelength of the vortex row leads to absolute (convective) instability. While absolute secondary instabilities in spatially developing flows have been previously related to an abrupt transition to a complex behavior, this secondary pairing instability regenerates the flow with an increased wavelength, eventually leading to a convectively unstable row of vortices. We argue that since the primary instability remains active for large wavelengths, a spatially developing shear layer can directly saturate on the wavelength of such a convectively unstable row, by-passing the smaller wavelengths of absolute secondary instability. This provides a wavelength selection mechanism, according to which the distance between consecutive vortices should be sufficiently large in comparison with the channel width in order for the row of vortices to persist. We argue that the proposed wavelength selection criteria can serve as a guideline for experimentally obtaining plane shear layers with counterflow, which has remained an experimental challenge.

  14. A big data geospatial analytics platform - Physical Analytics Integrated Repository and Services (PAIRS)

    NASA Astrophysics Data System (ADS)

    Hamann, H.; Jimenez Marianno, F.; Klein, L.; Albrecht, C.; Freitag, M.; Hinds, N.; Lu, S.

    2015-12-01

    A big data geospatial analytics platform:Physical Analytics Information Repository and Services (PAIRS)Fernando Marianno, Levente Klein, Siyuan Lu, Conrad Albrecht, Marcus Freitag, Nigel Hinds, Hendrik HamannIBM TJ Watson Research Center, Yorktown Heights, NY 10598A major challenge in leveraging big geospatial data sets is the ability to quickly integrate multiple data sources into physical and statistical models and be run these models in real time. A geospatial data platform called Physical Analytics Information and Services (PAIRS) is developed on top of open source hardware and software stack to manage Terabyte of data. A new data interpolation and re gridding is implemented where any geospatial data layers can be associated with a set of global grid where the grid resolutions is doubling for consecutive layers. Each pixel on the PAIRS grid have an index that is a combination of locations and time stamp. The indexing allow quick access to data sets that are part of a global data layers and allowing to retrieve only the data of interest. PAIRS takes advantages of parallel processing framework (Hadoop) in a cloud environment to digest, curate, and analyze the data sets while being very robust and stable. The data is stored on a distributed no-SQL database (Hbase) across multiple server, data upload and retrieval is parallelized where the original analytics task is broken up is smaller areas/volume, analyzed independently, and then reassembled for the original geographical area. The differentiating aspect of PAIRS is the ability to accelerate model development across large geographical regions and spatial resolution ranging from 0.1 m up to hundreds of kilometer. System performance is benchmarked on real time automated data ingestion and retrieval of Modis and Landsat data layers. The data layers are curated for sensor error, verified for correctness, and analyzed statistically to detect local anomalies. Multi-layer query enable PAIRS to filter different data layers based on specific conditions (e.g analyze flooding risk of a property based on topography, soil ability to hold water, and forecasted precipitation) or retrieve information about locations that share similar weather and vegetation patterns during extreme weather events like heat wave.

  15. Burrowing Owl (Speotyto cunicularia) monitoring and management activities in Manitoba, 1987-1996

    Treesearch

    Ken D. De Smet

    1997-01-01

    Monitoring of Burrowing Owl (Speotyto cunicularia) populations in Manitoba from 1987-1996 revealed a continuous population decline from 34 known nesting pairs to only one. Management activities are discussed including public awareness programs, reintroductions, habitat protection and provision of artificial nest burrows. Nest reuse in consecutive...

  16. Integrating evidence-based practice into RN-to-BSN clinical nursing education.

    PubMed

    Oh, Eui Geum; Kim, Sunah; Kim, So Sun; Kim, Sue; Cho, Eun Yong; Yoo, Ji-Soo; Kim, Hee Soon; Lee, Ju Hee; You, Mi Ae; Lee, Hyejung

    2010-07-01

    This study examines the effects of integrating evidence-based practice (EBP) into clinical practicum on EBP efficacy and barriers to research utilization among Korean RN-to-BSN students. A one-group pretest-posttest design was used. Eighty-one students were recruited from a school of nursing in Korea. Evidence-based practice clinical practicum was composed of two consecutive programs during one semester. Lectures, individual mentoring on EBP practicum, small group, and wrap-up conferences were provided. Outcomes of EBP efficacy and barriers to research utilization were analyzed using paired t tests for 74 final participants. Evidence-based practice efficacy scores increased significantly (p < 0.05), and the barriers to research utilization scores decreased significantly after the EBP clinical practicum. The results highlight the effectiveness of EBP education among RN-to-BSN students. These results may help health educators develop effective educational strategies to integrate EBP concepts into a clinical practicum. Copyright 2010, SLACK Incorporated.

  17. Effects of empty bins on image upscaling in capsule endoscopy

    NASA Astrophysics Data System (ADS)

    Rukundo, Olivier

    2017-07-01

    This paper presents a preliminary study of the effect of empty bins on image upscaling in capsule endoscopy. The presented study was conducted based on results of existing contrast enhancement and interpolation methods. A low contrast enhancement method based on pixels consecutiveness and modified bilinear weighting scheme has been developed to distinguish between necessary empty bins and unnecessary empty bins in the effort to minimize the number of empty bins in the input image, before further processing. Linear interpolation methods have been used for upscaling input images with stretched histograms. Upscaling error differences and similarity indices between pairs of interpolation methods have been quantified using the mean squared error and feature similarity index techniques. Simulation results demonstrated more promising effects using the developed method than other contrast enhancement methods mentioned.

  18. MRMer, an interactive open source and cross-platform system for data extraction and visualization of multiple reaction monitoring experiments.

    PubMed

    Martin, Daniel B; Holzman, Ted; May, Damon; Peterson, Amelia; Eastham, Ashley; Eng, Jimmy; McIntosh, Martin

    2008-11-01

    Multiple reaction monitoring (MRM) mass spectrometry identifies and quantifies specific peptides in a complex mixture with very high sensitivity and speed and thus has promise for the high throughput screening of clinical samples for candidate biomarkers. We have developed an interactive software platform, called MRMer, for managing highly complex MRM-MS experiments, including quantitative analyses using heavy/light isotopic peptide pairs. MRMer parses and extracts information from MS files encoded in the platform-independent mzXML data format. It extracts and infers precursor-product ion transition pairings, computes integrated ion intensities, and permits rapid visual curation for analyses exceeding 1000 precursor-product pairs. Results can be easily output for quantitative comparison of consecutive runs. Additionally MRMer incorporates features that permit the quantitative analysis experiments including heavy and light isotopic peptide pairs. MRMer is open source and provided under the Apache 2.0 license.

  19. The LPM effect in sequential bremsstrahlung 2: factorization

    DOE PAGES

    Arnold, Peter; Chang, Han-Chih; Iqbal, Shahin

    2016-09-13

    The splitting processes of bremsstrahlung and pair production in a medium are coherent over large distances in the very high energy limit, which leads to a suppression known as the Landau-Pomeranchuk-Migdal (LPM) effect. In this paper, we continue analysis of the case when the coherence lengths of two consecutive splitting processes overlap (which is important for understanding corrections to standard treatments of the LPM effect in QCD), avoiding soft-gluon approximations. In particular, this paper analyzes the subtle problem of how to precisely separate overlapping double splitting (e.g. overlapping double bremsstrahlung) from the case of consecutive, independent bremsstrahlung (which is themore » case that would be implemented in a Monte Carlo simulation based solely on single splitting rates). As an example of the method, we consider the rate of real double gluon bremsstrahlung from an initial gluon with various simplifying assumptions (thick media; q approximation; large N c; and neglect for the moment of processes involving 4-gluon ver-tices) and explicitly compute the correction Δ dΓ/dx dy due to overlapping formation times.« less

  20. Improving accuracy for identifying related PubMed queries by an integrated approach.

    PubMed

    Lu, Zhiyong; Wilbur, W John

    2009-10-01

    PubMed is the most widely used tool for searching biomedical literature online. As with many other online search tools, a user often types a series of multiple related queries before retrieving satisfactory results to fulfill a single information need. Meanwhile, it is also a common phenomenon to see a user type queries on unrelated topics in a single session. In order to study PubMed users' search strategies, it is necessary to be able to automatically separate unrelated queries and group together related queries. Here, we report a novel approach combining both lexical and contextual analyses for segmenting PubMed query sessions and identifying related queries and compare its performance with the previous approach based solely on concept mapping. We experimented with our integrated approach on sample data consisting of 1539 pairs of consecutive user queries in 351 user sessions. The prediction results of 1396 pairs agreed with the gold-standard annotations, achieving an overall accuracy of 90.7%. This demonstrates that our approach is significantly better than the previously published method. By applying this approach to a one day query log of PubMed, we found that a significant proportion of information needs involved more than one PubMed query, and that most of the consecutive queries for the same information need are lexically related. Finally, the proposed PubMed distance is shown to be an accurate and meaningful measure for determining the contextual similarity between biological terms. The integrated approach can play a critical role in handling real-world PubMed query log data as is demonstrated in our experiments.

  1. Improving accuracy for identifying related PubMed queries by an integrated approach

    PubMed Central

    Lu, Zhiyong; Wilbur, W. John

    2009-01-01

    PubMed is the most widely used tool for searching biomedical literature online. As with many other online search tools, a user often types a series of multiple related queries before retrieving satisfactory results to fulfill a single information need. Meanwhile, it is also a common phenomenon to see a user type queries on unrelated topics in a single session. In order to study PubMed users’ search strategies, it is necessary to be able to automatically separate unrelated queries and group together related queries. Here, we report a novel approach combining both lexical and contextual analyses for segmenting PubMed query sessions and identifying related queries and compare its performance with the previous approach based solely on concept mapping. We experimented with our integrated approach on sample data consisting of 1,539 pairs of consecutive user queries in 351 user sessions. The prediction results of 1,396 pairs agreed with the gold-standard annotations, achieving an overall accuracy of 90.7%. This demonstrates that our approach is significantly better than the previously published method. By applying this approach to a one day query log of PubMed, we found that a significant proportion of information needs involved more than one PubMed query, and that most of the consecutive queries for the same information need are lexically related. Finally, the proposed PubMed distance is shown to be an accurate and meaningful measure for determining the contextual similarity between biological terms. The integrated approach can play a critical role in handling real-world PubMed query log data as is demonstrated in our experiments. PMID:19162232

  2. Simulated sonic booms and sleep : effects of repeated booms of 1.0 psf.

    DOT National Transportation Integrated Search

    1972-12-01

    Eight male subjects in each of three age groups (21-26, 40-45, 60-72 years) slept in pairs in the CAMI sonic boom simulation facility for 21 consecutive nights. The first five nights were used to acclimate the subjects (nights 1 and 2) and to obtain ...

  3. Nonenzymatic template-directed synthesis on hairpin oligonucleotides. 3. Incorporation of adenosine and uridine residues

    NASA Technical Reports Server (NTRS)

    Wu, T.; Orgel, L. E.

    1992-01-01

    We have used [32P]-labeled hairpin oligonucleotides to study template-directed synthesis on templates containing one or more A or T residues within a run of C residues. When nucleoside-5'-phosphoro(2-methyl)imidazolides are used as substrates, isolated A and T residues function efficiently in facilitating the incorporation of U and A, respectively. The reactions are regiospecific, producing mainly 3'-5'-phosphodiester bonds. Pairs of consecutive non-C residues are copied much less efficiently. Limited synthesis of CA and AC sequences on templates containing TG and GT sequences was observed along with some synthesis of the AA sequences on templates containing TT sequences. The other dimer sequences investigated, AA, AG, GA, TA, and AT, could not be copied. If A is absent from the reaction mixture, misincorporation of G residues is a significant reaction on templates containing an isolated T residue or two consecutive T residues. However, if both A and G are present, A is incorporated to a much greater extent than G. We believe that wobble-pairing between T and G is responsible for misincorporation when only G is present.

  4. Effect of Foot Hyperpronation on Lumbar Lordosis and Thoracic Kyphosis in Standing Position Using 3-Dimensional Ultrasound-Based Motion Analysis System

    PubMed Central

    Farokhmanesh, Khatere; Shirzadian, Toraj; Mahboubi, Mohammad; Shahri, Mina Neyakan

    2014-01-01

    Based on clinical observations, foot hyperpronation is very common. Excessive pronation (hyperpronation) can cause malalignment of the lower extremities. This most often leads to functional and structural deficits. The aim of this study was to assess the effect of foot hyperpronation on lumbar lordosis and thoracic kyphosis. Thirty five healthy subjects (age range, 18030 years) were asked to stand on 4 positions including a flat surface (normal position) and on wedges angled at 10, 15, and 20 degrees. Sampling was done using simple random sampling. Measurements were made by a motion analysis system. For data analysis, the SPSS software (ver. 18) using paired t-test and repeated measures analysis of variance (ANOVA) was applied. The eversion created by the wedges caused a significant increase in lumbar lordosis and thoracic kyphosis. The most significant change occurred between two consecutive positions of flat surface and the first wedge. The t-test for repeated measures showed a high correlation between each two consecutive positions. The results showed that with increased bilateral foot pronation, lumbar lordosis and thoracic kyphosis increased as well. In fact, each of these results is a compensation phenomenon. Further studies are required to determine long-term results of excessive foot pronation and its probable effect on damage progression. PMID:25169004

  5. Effect of foot hyperpronation on lumbar lordosis and thoracic kyphosis in standing position using 3-dimensional ultrasound-based motion analysis system.

    PubMed

    Farokhmanesh, Khatere; Shirzadian, Toraj; Mahboubi, Mohammad; Shahri, Mina Neyakan

    2014-06-17

    Based on clinical observations, foot hyperpronation is very common. Excessive pronation (hyperpronation) can cause malalignment of the lower extremities. This most often leads to functional and structural deficits. The aim of this study was to assess the effect of foot hyperpronation on lumbar lordosis and thoracic kyphosis. Thirty five healthy subjects (age range, 18030 years) were asked to stand on 4 positions including a flat surface (normal position) and on wedges angled at 10, 15, and 20 degrees. Sampling was done using simple random sampling. Measurements were made by a motion analysis system. For data analysis, the SPSS software (ver. 18) using paired t-test and repeated measures analysis of variance (ANOVA) was applied. The eversion created by the wedges caused a significant increase in lumbar lordosis and thoracic kyphosis. The most significant change occurred between two consecutive positions of flat surface and the first wedge. The t-test for repeated measures showed a high correlation between each two consecutive positions. The results showed that with increased bilateral foot pronation, lumbar lordosis and thoracic kyphosis increased as well. In fact, each of these results is a compensation phenomenon. Further studies are required to determine long-term results of excessive foot pronation and its probable effect on damage progression.

  6. High Level Rule Modeling Language for Airline Crew Pairing

    NASA Astrophysics Data System (ADS)

    Mutlu, Erdal; Birbil, Ş. Ilker; Bülbül, Kerem; Yenigün, Hüsnü

    2011-09-01

    The crew pairing problem is an airline optimization problem where a set of least costly pairings (consecutive flights to be flown by a single crew) that covers every flight in a given flight network is sought. A pairing is defined by using a very complex set of feasibility rules imposed by international and national regulatory agencies, and also by the airline itself. The cost of a pairing is also defined by using complicated rules. When an optimization engine generates a sequence of flights from a given flight network, it has to check all these feasibility rules to ensure whether the sequence forms a valid pairing. Likewise, the engine needs to calculate the cost of the pairing by using certain rules. However, the rules used for checking the feasibility and calculating the costs are usually not static. Furthermore, the airline companies carry out what-if-type analyses through testing several alternate scenarios in each planning period. Therefore, embedding the implementation of feasibility checking and cost calculation rules into the source code of the optimization engine is not a practical approach. In this work, a high level language called ARUS is introduced for describing the feasibility and cost calculation rules. A compiler for ARUS is also implemented in this work to generate a dynamic link library to be used by crew pairing optimization engines.

  7. Concordance analysis of paired cancer antigen (CA) 15-3 and 27.29 testing.

    PubMed

    Lin, David C; Genzen, Jonathan R

    2018-01-01

    Cancer antigens (CA) 15-3 and 27.29 are used in the clinical management of many breast cancer patients. Given that immunoassays for CA 15-3 and CA 27.29 target epitopes on the same glycoprotein-Mucin 1 (MUC1)-the present analysis was conducted to evaluate the potential concordance of tumor marker results when both tests were ordered by providers on the same specimens. A retrospective limited dataset of paired CA 15-3 (Roche Diagnostics) and CA 27.29 (Siemens Diagnostics) test results was obtained from a national clinical reference laboratory. Concordance according to reference interval (RI) status and percent (%) change between consecutive test results was analyzed. 37,652 paired results from 12,470 distinct patients were obtained. The correlation between CA 15-3 and CA 27.29 results was high (correlation coefficient: Pearson, 0.967), although across the dataset a significant difference between CA 15-3 and CA 27.29 results was observed (P < 0.05). RI concordance between CA 15-3 and CA 27.29 results was observed in 93.7% of pairs (35,280 of 37,652). Correlation was also observed in the % change of CA 15-3 and CA 27.29 results between consecutive specimens for individual patients. Using doubling or halving thresholds (i.e., 100% increase or 50% decrease), concordance in % change was observed between CA 15-3 and CA 27.29 in approximately 90% of cases. Individual patient results trended similarly across both markers over time. While generally concordant, CA 15-3 and CA 27.29 results should not be used interchangeably. The present report provides no evidence for added value in performing both tests routinely for individual patients.

  8. Reproduction and monogamy in captive flock of greater flamingos (Phoenicopterus Roseus).

    PubMed

    Sandri, Camillo; Sammarini, Carolina; Regaiolli, Barbara; Spiezio, Caterina; Piccirillo, Alessandra

    2018-01-01

    Due to the great number of greater flamingos in captivity and their long life span, studying their behavior and welfare might be useful to improve the husbandry and breeding of this species in zoos. This study aimed to investigate factors affecting the breeding activity of captive greater flamingos (Phoenicopterus roseus) from 2012 to 2016. To estimate reproductive success, the number of pairs, eggs laid, and hatchlings were recorded. In addition, information on age, egg-laying history of the partners, and pair composition was collected. An increase in the number of pairs, eggs, and hatchlings was reported over the years. For each breeding season, there were pairs who laid more than once, especially in 2014 and 2015. Approximately 50% of pairs were monogamous between consecutive years; however, the percentage dropped gradually when comparing nonconsecutive years. Senescence and previous experience seemed to affect the reproductive success of the study flamingos. In conclusion, different factors can influence the reproduction of greater flamingos in zoos. All these factors are related to nonhuman animal welfare and need to be considered in developing and improving management practices.

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marekova, Elisaveta

    Series of relatively large earthquakes in different regions of the Earth are studied. The regions chooses are of a high seismic activity and has a good contemporary network for recording of the seismic events along them. The main purpose of this investigation is the attempt to describe analytically the seismic process in the space and time. We are considering the statistical distributions the distances and the times between consecutive earthquakes (so called pair analysis). Studies conducted on approximating the statistical distribution of the parameters of consecutive seismic events indicate the existence of characteristic functions that describe them best. Such amore » mathematical description allows the distributions of the examined parameters to be compared to other model distributions.« less

  10. Clinical outcome in neonates with twin anemia-polycythemia sequence.

    PubMed

    Lopriore, Enrico; Slaghekke, Femke; Oepkes, Dick; Middeldorp, Johanna M; Vandenbussche, Frank P; Walther, Frans J

    2010-07-01

    The purpose of this study was to evaluate neonatal outcome of monochorionic twin pregnancies complicated by twin anemia-polycythemia sequence (TAPS). A cohort of consecutive monochorionic twins with TAPS with double survivors was included in the study. Each twin pair with TAPS was compared with 2 monochorionic twin pairs who were unaffected by TAPS or twin-to-twin transfusion syndrome and who were matched for gestational age at birth. Neonatal death, severe morbidity, and cerebral injury were studied. We included 19 twin pairs in the TAPS group and 38 control twin pairs. The incidence of neonatal death and severe neonatal morbidity was similar in the TAPS group and control group (3% [1/38] vs 1% [1/76] and 24% [9/38] vs 28% [21/76], respectively). Severe cerebral injury was detected in 1 infant (5%) in the TAPS group and 1 infant (2%) in the control group. Neonatal mortality and morbidity rates in a select population of TAPS neonates are similar to control neonatal rates. Copyright (c) 2010 Mosby, Inc. All rights reserved.

  11. Measurement of hyperpolarized gas diffusion at very short time scales

    PubMed Central

    Carl, Michael; Wilson Miller, G.; Mugler, John P.; Rohrbaugh, Scott; Tobias, William A.; Cates, Gordon D.

    2007-01-01

    We present a new pulse sequence for measuring very-short-time-scale restricted diffusion of hyperpolarized noble gases. The pulse sequence is based on concatenating a large number of bipolar diffusion-sensitizing gradients to increase the diffusion attenuation of the MR signal while maintaining a fundamentally short diffusion time. However, it differs in several respects from existing methods that use oscillating diffusion gradients for this purpose. First, a wait time is inserted between neighboring pairs of gradient pulses; second, consecutive pulse pairs may be applied along orthogonal axes; and finally, the diffusion-attenuated signal is not simply read out at the end of the gradient train but is periodically sampled during the wait times between neighboring pulse pairs. The first two features minimize systematic differences between the measured (apparent) diffusion coefficient and the actual time-dependent diffusivity, while the third feature optimizes the use of the available MR signal to improve the precision of the diffusivity measurement in the face of noise. The benefits of this technique are demonstrated using theoretical calculations, Monte-Carlo simulations of gas diffusion in simple geometries, and experimental phantom measurements in a glass sphere containing hyperpolarized 3He gas. The advantages over the conventional single-bipolar approach were found to increase with decreasing diffusion time, and thus represent a significant step toward making accurate surface-to-volume measurements in the lung airspaces. PMID:17936048

  12. Multiplying and detecting propagating microwave photons using inelastic Cooper-pair tunneling

    NASA Astrophysics Data System (ADS)

    Leppäkangas, Juha; Marthaler, Michael; Hazra, Dibyendu; Jebari, Salha; Albert, Romain; Blanchet, Florian; Johansson, Göran; Hofheinz, Max

    2018-01-01

    The interaction between propagating microwave fields and Cooper-pair tunneling across a DC-voltage-biased Josephson junction can be highly nonlinear. We show theoretically that this nonlinearity can be used to convert an incoming single microwave photon into an outgoing n -photon Fock state in a different mode. In this process, the electrostatic energy released in a Cooper-pair tunneling event is transferred to the outgoing Fock state, providing energy gain. The created multiphoton Fock state is frequency entangled and highly bunched. The conversion can be made reflectionless (impedance matched) so that all incoming photons are converted to n -photon states. With realistic parameters, multiplication ratios n >2 can be reached. By two consecutive multiplications, the outgoing Fock-state number can get sufficiently large to accurately discriminate it from vacuum with linear postamplification and power measurement. Therefore, this amplification scheme can be used as a single-photon detector without dead time.

  13. Continuous-Time Monitoring of Landau-Zener Interference in a Cooper-Pair Box

    NASA Astrophysics Data System (ADS)

    Sillanpää, Mika; Lehtinen, Teijo; Paila, Antti; Makhlin, Yuriy; Hakonen, Pertti

    2006-05-01

    Landau-Zener (LZ) tunneling can occur with a certain probability when crossing energy levels of a quantum two-level system are swept across the minimum energy separation. Here we present experimental evidence of quantum interference effects in solid-state LZ tunneling. We used a Cooper-pair box qubit where the LZ tunneling occurs at the charge degeneracy. By employing a weak nondemolition monitoring, we observe interference between consecutive LZ-tunneling events; we find that the average level occupancies depend on the dynamical phase. The system’s unusually strong linear response is explained by interband relaxation. Our interferometer can be used as a high-resolution Mach-Zehnder type detector for phase and charge.

  14. Continuous-time monitoring of Landau-Zener interference in a cooper-pair box.

    PubMed

    Sillanpää, Mika; Lehtinen, Teijo; Paila, Antti; Makhlin, Yuriy; Hakonen, Pertti

    2006-05-12

    Landau-Zener (LZ) tunneling can occur with a certain probability when crossing energy levels of a quantum two-level system are swept across the minimum energy separation. Here we present experimental evidence of quantum interference effects in solid-state LZ tunneling. We used a Cooper-pair box qubit where the LZ tunneling occurs at the charge degeneracy. By employing a weak nondemolition monitoring, we observe interference between consecutive LZ-tunneling events; we find that the average level occupancies depend on the dynamical phase. The system's unusually strong linear response is explained by interband relaxation. Our interferometer can be used as a high-resolution Mach-Zehnder-type detector for phase and charge.

  15. Skeleton-based tracing of curved fibers from 3D X-ray microtomographic imaging

    NASA Astrophysics Data System (ADS)

    Huang, Xiang; Wen, Donghui; Zhao, Yanwei; Wang, Qinghui; Zhou, Wei; Deng, Daxiang

    A skeleton-based fiber tracing algorithm is described and applied on a specific fibrous material, porous metal fiber sintered sheet (PMFSS), featuring high porosity and curved fibers. The skeleton segments are firstly categorized according to the connectivity of the skeleton paths. Spurious segments like fiber bonds are detected making extensive use of the distance transform (DT) values. Single fibers are then traced and reconstructed by consecutively choosing the connecting skeleton segment pairs that show the most similar orientations and radius. Moreover, to reduce the misconnection due to the tracing orders, a multilevel tracing strategy is proposed. The fibrous network is finally reconstructed by dilating single fibers according to the DT values. Based on the traced single fibers, various morphology information regarding fiber length, radius, orientation, and tortuosity are quantitatively analyzed and compared with our previous results (Wang et al., 2013). Moreover, the number of bonds per fibers are firstly accessed. The methodology described in this paper can be expanded to other fibrous materials with adapted parameters.

  16. Childhood adversity, parental vulnerability and disorder: examining inter-generational transmission of risk.

    PubMed

    Bifulco, A; Moran, P M; Ball, C; Jacobs, C; Baines, R; Bunn, A; Cavagin, J

    2002-11-01

    An investigation of intergenerational factors associated with psychiatric disorder in late adolescence/early adulthood was undertaken to differentiate influences from maternal disorder, maternal poor psychosocial functioning and poor parenting, on offspring. The sample comprised an intensively studied series of 276 mother-offspring pairs in a relatively deprived inner-city London area with high rates of lone parenthood and socio-economic disadvantage. The paired sample was collected over two time periods: first a consecutively screened series of mothers and offspring in 1985-90 (n = 172 pairs) and second a 'vulnerable' series of mothers and offspring in 1995-99 (n = 104 pairs). The vulnerable mothers were selected for poor interpersonal functioning and/or low self-esteem and the consecutive series were used for comparison. Rates of childhood adversity and disorder in the offspring were examined in the two groups. Maternal characteristics including psychosocial vulnerability and depression were then examined in relation to risk transmission. Offspring of vulnerable mothers had a fourfold higher rate of yearly disorder than those in the comparison series (43% vs. 11%, p < .001). They were twice as likely as those in the comparison series to have experienced childhood adversity comprising either severe neglect, physical or sexual abuse before age 17. Physical abuse, in particular, perpetrated either by mother or father/surrogate father was significantly raised in the vulnerable group. Analysis of the combined series showed that maternal vulnerability and neglect/abuse of offspring provided the best model for offspring disorder. Maternal history of depression had no direct effect on offspring disorder; its effects were entirely mediated by offspring neglect/abuse. Maternal childhood adversity also had no direct effect. Results are discussed in relation to psychosocial models of risk transmission for disorder. Maternal poor psychosocial functioning needs to be identified as a factor requiring intervention in order to stem escalation of risk across generations.

  17. Inhaled concentrated ambient particles are associated with hematologic and bronchoalveolar lavage changes in canines.

    PubMed Central

    Clarke, R W; Coull, B; Reinisch, U; Catalano, P; Killingsworth, C R; Koutrakis, P; Kavouras, I; Murthy, G G; Lawrence, J; Lovett, E; Wolfson, J M; Verrier, R L; Godleski, J J

    2000-01-01

    Pulmonary inflammatory and hematologic responses of canines were studied after exposure to concentrated ambient particles (CAPs) using the Harvard ambient particle concentrator (HAPC). For pulmonary inflammatory studies, normal dogs were exposed in pairs to either CAPs or filtered air (paired studies) for 6 hr/day on 3 consecutive days. For hematologic studies, dogs were exposed for 6 hr/day for 3 consecutive days with one receiving CAPs while the other was simultaneously exposed to filtered air; crossover of exposure took place the following week (crossover studies). Physicochemical characterization of CAPs exposure samples included measurements of particle mass, size distribution, and composition. No statistical differences in biologic responses were found when all CAPs and all sham exposures were compared. However, the variability in biologic response was considerably higher with CAPs exposure. Subsequent exploratory graphical analyses and mixed linear regression analyses suggested associations between CAPs constituents and biologic responses. Factor analysis was applied to the compositional data from paired and crossover experiments to determine elements consistently associated with each other in CAPs samples. In paired experiments, four factors were identified; in crossover studies, a total of six factors were observed. Bronchoalveolar lavage (BAL) and hematologic data were regressed on the factor scores. Increased BAL neutrophil percentage, total peripheral white blood cell (WBC) counts, circulating neutrophils, and circulating lymphocytes were associated with increases in the aluminum/silicon factor. Increased circulating neutrophils and increased BAL macrophages were associated with the vanadium/nickel factor. Increased BAL neutrophils were associated with the bromine/lead factor when only the compositional data from the third day of CAPs exposure were used. Significant decreases in red blood cell counts and hemoglobin levels were correlated with the sulfur factor. BAL or hematologic parameters were not associated with increases in total CAPs mass concentration. These data suggest that CAPs inhalation is associated with subtle alterations in pulmonary and systemic cell profiles, and specific components of CAPs may be responsible for these biologic responses. PMID:11133399

  18. Detecting cm-scale hot spot over 24-km-long single-mode fiber by using differential pulse pair BOTDA based on double-peak spectrum.

    PubMed

    Diakaridia, Sanogo; Pan, Yue; Xu, Pengbai; Zhou, Dengwang; Wang, Benzhang; Teng, Lei; Lu, Zhiwei; Ba, Dexin; Dong, Yongkang

    2017-07-24

    In distributed Brillouin optical fiber sensor when the length of the perturbation to be detected is much smaller than the spatial resolution that is defined by the pulse width, the measured Brillouin gain spectrum (BGS) experiences two or multiple peaks. In this work, we propose and demonstrate a technique using differential pulse pair Brillouin optical time-domain analysis (DPP-BOTDA) based on double-peak BGS to enhance small-scale events detection capability, where two types of single mode fiber (main fiber and secondary fiber) with 116 MHz Brillouin frequency shift (BFS) difference have been used. We have realized detection of a 5-cm hot spot at the far end of 24-km single mode fiber by employing a 50-cm spatial resolution DPP-BOTDA with only 1GS/s sampling rate (corresponding to 10 cm/point). The BFS at the far end of 24-km sensing fiber has been measured with 0.54 MHz standard deviation which corresponds to a 0.5°C temperature accuracy. This technique is simple and cost effective because it is implemented using the similar experimental setup of the standard BOTDA, however, it should be noted that the consecutive small-scale events have to be separated by a minimum length corresponding to the spatial resolution defined by the pulse width difference.

  19. Deficits in process-specific prefrontal and hippocampal activations contribute to adult age differences in episodic memory interference.

    PubMed

    Fandakova, Yana; Lindenberger, Ulman; Shing, Yee Lee

    2014-07-01

    The ability to distinguish currently relevant from familiar but irrelevant memories is important in everyday life. We used functional magnetic resonance imaging to examine the neural correlates of age differences in the ability to withstand interference from similar past events. Younger and older adults worked on a continuous recognition task consisting of 3 consecutive runs. Each run was composed of the same set of word pairs, and participants were instructed to recognize word pair repetitions within runs. The monitoring demands associated with rejecting familiar, but currently irrelevant information were assumed to increase over consecutive runs. Over runs, older, but not younger adults showed decline in memory performance, whereas younger, but not older adults showed increasing engagement of anterior prefrontal cortex. Individual differences in cortical thickness and task-related activation of anterior prefrontal areas predicted performance differences within and across age groups. Compared with younger adults, older adults also showed a reduced hippocampal response to novel associations of familiar stimuli. We conclude that monitoring deficits due to impaired involvement of prefrontal regions and reduced hippocampal responses to associative novelty contribute to aging-related deficits in disambiguating the contextual information of familiar events. © The Author 2013. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  20. Rewritable ferroelectric vortex pairs in BiFeO3

    NASA Astrophysics Data System (ADS)

    Li, Yang; Jin, Yaming; Lu, Xiaomei; Yang, Jan-Chi; Chu, Ying-Hao; Huang, Fengzhen; Zhu, Jinsong; Cheong, Sang-Wook

    2017-08-01

    Ferroelectric vortex in multiferroic materials has been considered as a promising alternative to current memory cells for the merit of high storage density. However, the formation of regular natural ferroelectric vortex is difficult, restricting the achievement of vortex memory device. Here, we demonstrated the creation of ferroelectric vortex-antivortex pairs in BiFeO3 thin films by using local electric field. The evolution of the polar vortex structure is studied by piezoresponse force microscopy at nanoscale. The results reveal that the patterns and stability of vortex structures are sensitive to the poling position. Consecutive writing and erasing processes cause no influence on the original domain configuration. The Z4 proper coloring vortex-antivortex network is then analyzed by graph theory, which verifies the rationality of artificial vortex-antivortex pairs. This study paves a foundation for artificial regulation of vortex, which provides a possible pathway for the design and realization of non-volatile vortex memory devices and logical devices.

  1. Dual tree fractional quaternion wavelet transform for disparity estimation.

    PubMed

    Kumar, Sanoj; Kumar, Sanjeev; Sukavanam, Nagarajan; Raman, Balasubramanian

    2014-03-01

    This paper proposes a novel phase based approach for computing disparity as the optical flow from the given pair of consecutive images. A new dual tree fractional quaternion wavelet transform (FrQWT) is proposed by defining the 2D Fourier spectrum upto a single quadrant. In the proposed FrQWT, each quaternion wavelet consists of a real part (a real DWT wavelet) and three imaginary parts that are organized according to the quaternion algebra. First two FrQWT phases encode the shifts of image features in the absolute horizontal and vertical coordinate system, while the third phase has the texture information. The FrQWT allowed a multi-scale framework for calculating and adjusting local disparities and executing phase unwrapping from coarse to fine scales with linear computational efficiency. Copyright © 2013 ISA. Published by Elsevier Ltd. All rights reserved.

  2. New approach for the identification of implausible values and outliers in longitudinal childhood anthropometric data.

    PubMed

    Shi, Joy; Korsiak, Jill; Roth, Daniel E

    2018-03-01

    We aimed to demonstrate the use of jackknife residuals to take advantage of the longitudinal nature of available growth data in assessing potential biologically implausible values and outliers. Artificial errors were induced in 5% of length, weight, and head circumference measurements, measured on 1211 participants from the Maternal Vitamin D for Infant Growth (MDIG) trial from birth to 24 months of age. Each child's sex- and age-standardized z-score or raw measurements were regressed as a function of age in child-specific models. Each error responsible for a biologically implausible decrease between a consecutive pair of measurements was identified based on the higher of the two absolute values of jackknife residuals in each pair. In further analyses, outliers were identified as those values beyond fixed cutoffs of the jackknife residuals (e.g., greater than +5 or less than -5 in primary analyses). Kappa, sensitivity, and specificity were calculated over 1000 simulations to assess the ability of the jackknife residual method to detect induced errors and to compare these methods with the use of conditional growth percentiles and conventional cross-sectional methods. Among the induced errors that resulted in a biologically implausible decrease in measurement between two consecutive values, the jackknife residual method identified the correct value in 84.3%-91.5% of these instances when applied to the sex- and age-standardized z-scores, with kappa values ranging from 0.685 to 0.795. Sensitivity and specificity of the jackknife method were higher than those of the conditional growth percentile method, but specificity was lower than for conventional cross-sectional methods. Using jackknife residuals provides a simple method to identify biologically implausible values and outliers in longitudinal child growth data sets in which each child contributes at least 4 serial measurements. Crown Copyright © 2018. Published by Elsevier Inc. All rights reserved.

  3. Scapular thickness--implications for fracture fixation.

    PubMed

    Burke, Charity S; Roberts, Craig S; Nyland, John A; Radmacher, Paula G; Acland, Robert D; Voor, Michael J

    2006-01-01

    The purpose of this study was to measure and map scapula osseous thickness to identify the optimal areas for internal fixation. Eighteen (9 pairs) scapulae from 2 female and 7 male cadavers were used. After harvest and removal of all soft tissues, standardized measurement lines were made based on anatomic landmarks. For consistency among scapulae, measurements were taken at standard percentage intervals along each line approximating the distance between two consecutive reconstruction plate screw holes. Two-mm-diameter drill holes were made at each point, and a standard depth gauge was used to measure thickness. The glenoid fossa (25 mm) displayed the greatest mean osseous thickness, followed by the lateral scapular border (9.7 mm), the scapula spine (8.3 mm), and the central portion of the body of the scapula (3.0 mm). To optimize screw purchase and internal fixation strength, the lateral border, the lateral aspect of the base of the scapula spine, and the scapula spine itself should be used for anatomic sites of internal fixation of scapula fractures.

  4. Fully automatic and reference-marker-free image stitching method for full-spine and full-leg imaging with computed radiography

    NASA Astrophysics Data System (ADS)

    Wang, Xiaohui; Foos, David H.; Doran, James; Rogers, Michael K.

    2004-05-01

    Full-leg and full-spine imaging with standard computed radiography (CR) systems requires several cassettes/storage phosphor screens to be placed in a staggered arrangement and exposed simultaneously to achieve an increased imaging area. A method has been developed that can automatically and accurately stitch the acquired sub-images without relying on any external reference markers. It can detect and correct the order, orientation, and overlap arrangement of the subimages for stitching. The automatic determination of the order, orientation, and overlap arrangement of the sub-images consists of (1) constructing a hypothesis list that includes all cassette/screen arrangements, (2) refining hypotheses based on a set of rules derived from imaging physics, (3) correlating each consecutive sub-image pair in each hypothesis and establishing an overall figure-of-merit, (4) selecting the hypothesis of maximum figure-of-merit. The stitching process requires the CR reader to over scan each CR screen so that the screen edges are completely visible in the acquired sub-images. The rotational displacement and vertical displacement between two consecutive sub-images are calculated by matching the orientation and location of the screen edge in the front image and its corresponding shadow in the back image. The horizontal displacement is estimated by maximizing the correlation function between the two image sections in the overlap region. Accordingly, the two images are stitched together. This process is repeated for the newly stitched composite image and the next consecutive sub-image until a full-image composite is created. The method has been evaluated in both phantom experiments and clinical studies. The standard deviation of image misregistration is below one image pixel.

  5. Coordinated vigilance provides evidence for direct reciprocity in coral reef fishes.

    PubMed

    Brandl, Simon J; Bellwood, David R

    2015-09-25

    Reciprocity is frequently assumed to require complex cognitive abilities. Therefore, it has been argued that reciprocity may be restricted to animals that can meet these demands. Here, we provide evidence for the potential presence of direct reciprocity in teleost fishes. We demonstrate that in pairs of coral reef rabbitfishes (f. Siganidae), one fish frequently assumes an upright vigilance position in the water column, while the partner forages in small crevices in the reef substratum. Both behaviours are strongly coordinated and partners regularly alternate their positions, resulting in a balanced distribution of foraging activity. Compared to solitary individuals, fishes in pairs exhibit longer vigilance bouts, suggesting that the help provided to the partner is costly. In turn, fishes in pairs take more consecutive bites and penetrate deeper into crevices than solitary individuals, suggesting that the safety provided by a vigilant partner may outweigh initial costs by increasing foraging efficiency. Thus, the described system appears to meet all of the requirements for direct reciprocity. We argue that the nature of rabbitfish pairs provides favourable conditions for the establishment of direct reciprocity, as continuous interaction with the same partner, simultaneous needs, interdependence, and communication relax the cognitive demands of reciprocal cooperation.

  6. Heritability, assortative mating and gender differences in violent crime: results from a total population sample using twin, adoption, and sibling models.

    PubMed

    Frisell, Thomas; Pawitan, Yudi; Långström, Niklas; Lichtenstein, Paul

    2012-01-01

    Research addressing genetic and environmental determinants to antisocial behaviour suggests substantial variability across studies. Likewise, evidence for etiologic gender differences is mixed, and estimates might be biased due to assortative mating. We used longitudinal Swedish total population registers to estimate the heritability of objectively measured violent offending (convictions) in classic twin (N = 36,877 pairs), adoptee-parent (N = 5,068 pairs), adoptee-sibling (N = 10,610 pairs), and sibling designs (N = 1,521,066 pairs). Type and degree of assortative mating were calculated from comparisons between spouses of siblings and half-siblings, and across consecutive spouses. Heritability estimates for the liability of violent offending agreed with previously reported heritability for self-reported antisocial behaviour. While the sibling model yielded estimates similar to the twin model (A ≈ 55%, C ≈ 13%), adoptee-models appeared to underestimate familial effects (A ≈ 20-30%, C ≈ 0%). Assortative mating was moderate to strong (r (spouse) = 0.4), appeared to result from both phenotypic assortment and social homogamy, but had only minor effect on variance components. Finally, we found significant gender differences in the etiology of violent crime.

  7. Behavioral conditioning of immunosuppression is possible in humans.

    PubMed

    Goebel, Marion U; Trebst, Almuth E; Steiner, Jan; Xie, Yu F; Exton, Michael S; Frede, Stilla; Canbay, Ali E; Michel, Martin C; Heemann, Uwe; Schedlowski, Manfred

    2002-12-01

    Behavioral conditioned immunosuppression has been described in rodents as the most impressive demonstration of brain-to-immune system interaction. To analyze whether behavioral conditioned immunosuppression is possible in humans, healthy subjects in this double-blind, placebo-controlled study were conditioned in four sessions over 3 consecutive days, receiving the immunosuppressive drug cyclosporin A as an unconditioned stimulus paired with a distinctively flavored drink (conditioned stimulus) each 12 h. In the next week, re-exposure to the conditioned stimulus (drink), but now paired with placebo capsules, induced a suppression of immune functions as analyzed by the IL-2 and IFN-gamma mRNA expression, intracellular production, and in vitro release of IL-2 and IFN-gamma, as well as lymphocyte proliferation. These data demonstrate for the first time that immunosuppression can be behaviorally conditioned in humans.

  8. Evaluation of 3D Additively Manufactured Canine Brain Models for Teaching Veterinary Neuroanatomy.

    PubMed

    Schoenfeld-Tacher, Regina M; Horn, Timothy J; Scheviak, Tyler A; Royal, Kenneth D; Hudson, Lola C

    Physical specimens are essential to the teaching of veterinary anatomy. While fresh and fixed cadavers have long been the medium of choice, plastinated specimens have gained widespread acceptance as adjuncts to dissection materials. Even though the plastination process increases the durability of specimens, these are still derived from animal tissues and require periodic replacement if used by students on a regular basis. This study investigated the use of three-dimensional additively manufactured (3D AM) models (colloquially referred to as 3D-printed models) of the canine brain as a replacement for plastinated or formalin-fixed brains. The models investigated were built based on a micro-MRI of a single canine brain and have numerous practical advantages, such as durability, lower cost over time, and reduction of animal use. The effectiveness of the models was assessed by comparing performance among students who were instructed using either plastinated brains or 3D AM models. This study used propensity score matching to generate similar pairs of students. Pairings were based on gender and initial anatomy performance across two consecutive classes of first-year veterinary students. Students' performance on a practical neuroanatomy exam was compared, and no significant differences were found in scores based on the type of material (3D AM models or plastinated specimens) used for instruction. Students in both groups were equally able to identify neuroanatomical structures on cadaveric material, as well as respond to questions involving application of neuroanatomy knowledge. Therefore, we postulate that 3D AM canine brain models are an acceptable alternative to plastinated specimens in teaching veterinary neuroanatomy.

  9. A Novel Application for the Cavalieri Principle: A Stereological and Methodological Study

    PubMed Central

    Altunkaynak, Berrin Zuhal; Altunkaynak, Eyup; Unal, Deniz; Unal, Bunyamin

    2009-01-01

    Objective The Cavalieri principle was applied to consecutive pathology sections that were photographed at the same magnification and used to estimate tissue volumes via superimposing a point counting grid on these images. The goal of this study was to perform the Cavalieri method quickly and practically. Materials and Methods In this study, 10 adult female Sprague Dawley rats were used. Brain tissue was removed and sampled both systematically and randomly. Brain volumes were estimated using two different methods. First, all brain slices were scanned with an HP ScanJet 3400C scanner, and their images were shown on a PC monitor. Brain volume was then calculated based on these images. Second, all brain slices were photographed in 10× magnification with a microscope camera, and brain volumes were estimated based on these micrographs. Results There was no statistically significant difference between the volume measurements of the two techniques (P>0.05; Paired Samples t Test). Conclusion This study demonstrates that personal computer scanning of serial tissue sections allows for easy and reliable volume determination based on the Cavalieri method. PMID:25610077

  10. A novel application for the cavalieri principle: a stereological and methodological study.

    PubMed

    Altunkaynak, Berrin Zuhal; Altunkaynak, Eyup; Unal, Deniz; Unal, Bunyamin

    2009-08-01

    The Cavalieri principle was applied to consecutive pathology sections that were photographed at the same magnification and used to estimate tissue volumes via superimposing a point counting grid on these images. The goal of this study was to perform the Cavalieri method quickly and practically. In this study, 10 adult female Sprague Dawley rats were used. Brain tissue was removed and sampled both systematically and randomly. Brain volumes were estimated using two different methods. First, all brain slices were scanned with an HP ScanJet 3400C scanner, and their images were shown on a PC monitor. Brain volume was then calculated based on these images. Second, all brain slices were photographed in 10× magnification with a microscope camera, and brain volumes were estimated based on these micrographs. There was no statistically significant difference between the volume measurements of the two techniques (P>0.05; Paired Samples t Test). This study demonstrates that personal computer scanning of serial tissue sections allows for easy and reliable volume determination based on the Cavalieri method.

  11. Reproducibility for Heart Rate Variability Analysis during 6-Min Walk Test in Patients with Heart Failure and Agreement between Devices.

    PubMed

    Braga, Lays Magalhães; Prado, Gustavo Faibischew; Umeda, Iracema Ioco Kikuchi; Kawauchi, Tatiana Satie; Taboada, Adriana Marques Fróes; Azevedo, Raymundo Soares; Pereira Filho, Horacio Gomes; Grupi, César José; Souza, Hayala Cristina Cavenague; Moreira, Dalmo Antônio Ribeiro; Nakagawa, Naomi Kondo

    2016-01-01

    Heart rate variability (HRV) analysis is a useful method to assess abnormal functioning in the autonomic nervous system and to predict cardiac events in patients with heart failure (HF). HRV measurements with heart rate monitors have been validated with an electrocardiograph in healthy subjects but not in patients with HF. We explored the reproducibility of HRV in two consecutive six-minute walk tests (6MW), 60-minute apart, using a heart rate monitor (PolarS810i) and a portable electrocardiograph (called Holter) in 50 HF patients (mean age 59 years, NYHA II, left ventricular ejection fraction ~35%). The reproducibility for each device was analysed using a paired t-test or the Wilcoxon signed-rank test. Additionally, we assessed the agreement between the two devices based on the HRV indices at rest, during the 6MW and during recovery using concordance correlation coefficients (CCC), 95% confidence intervals and Bland-Altman plots. The test-retest for the HRV analyses was reproducible using Holter and PolarS810i at rest but not during recovery. In the second 6MW, patients showed significant increases in rMSSD and walking distance. The PolarS810i measurements had remarkably high concordance correlation [0.86

  12. A micromanipulation cell including a tool changer

    NASA Astrophysics Data System (ADS)

    Clévy, Cédric; Hubert, Arnaud; Agnus, Joël; Chaillet, Nicolas

    2005-10-01

    This paper deals with the design, fabrication and characterization of a tool changer for micromanipulation cells. This tool changer is part of a manipulation cell including a three linear axes robot and a piezoelectric microgripper. All these parts are designed to perform micromanipulation tasks in confined spaces such as a microfactory or in the chamber of a scanning electron microscope (SEM). The tool changer principle is to fix a pair of tools (i.e. the gripper tips) either on the tips of the microgripper actuator (piezoceramic bulk) or on a tool magazine. The temperature control of a thermal glue enables one to fix or release this pair of tools. Liquefaction and solidification are generated by surface mounted device (SMD) resistances fixed on the surface of the actuator or magazine. Based on this principle, the tool changer can be adapted to other kinds of micromanipulation cells. Hundreds of automatic tool exchanges were performed with a maximum positioning error between two consecutive tool exchanges of 3.2 µm, 2.3 µm and 2.8 µm on the X, Y and Z axes respectively (Z refers to the vertical axis). Finally, temperature measurements achieved under atmospheric pressure and in a vacuum environment and pressure measurements confirm the possibility of using this device in the air as well as in a SEM.

  13. Categorical learning between 'male' and 'female' photographic human faces in jungle crows (Corvus macrorhynchos).

    PubMed

    Bogale, Bezawork Afework; Aoyama, Masato; Sugita, Shoei

    2011-01-01

    We trained jungle crows to discriminate among photographs of human face according to their sex in a simultaneous two-alternative task to study their categorical learning ability. Once the crows reached a discrimination criterion (greater than or equal to 80% correct choices in two consecutive sessions; binomial probability test, p<.05), they next received generalization and transfer tests (i.e., greyscale, contour, and 'full' occlusion) in Experiment 1 followed by a 'partial' occlusion test in Experiment 2 and random stimuli pair test in Experiment 3. Jungle crows learned the discrimination task in a few trials and successfully generalized to novel stimuli sets. However, all crows failed the greyscale test and half of them the contour test. Neither occlusion of internal features of the face, nor randomly pairing of exemplars affected discrimination performance of most, if not all crows. We suggest that jungle crows categorize human face photographs based on perceptual similarities as other non-human animals do, and colour appears to be the most salient feature controlling discriminative behaviour. However, the variability in the use of facial contours among individuals suggests an exploitation of multiple features and individual differences in visual information processing among jungle crows. Copyright © 2010 Elsevier B.V. All rights reserved.

  14. Image phase shift invariance based cloud motion displacement vector calculation method for ultra-short-term solar PV power forecasting

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Fei; Zhen, Zhao; Liu, Chun

    Irradiance received on the earth's surface is the main factor that affects the output power of solar PV plants, and is chiefly determined by the cloud distribution seen in a ground-based sky image at the corresponding moment in time. It is the foundation for those linear extrapolation-based ultra-short-term solar PV power forecasting approaches to obtain the cloud distribution in future sky images from the accurate calculation of cloud motion displacement vectors (CMDVs) by using historical sky images. Theoretically, the CMDV can be obtained from the coordinate of the peak pulse calculated from a Fourier phase correlation theory (FPCT) method throughmore » the frequency domain information of sky images. The peak pulse is significant and unique only when the cloud deformation between two consecutive sky images is slight enough, which is likely possible for a very short time interval (such as 1?min or shorter) with common changes in the speed of cloud. Sometimes, there will be more than one pulse with similar values when the deformation of the clouds between two consecutive sky images is comparatively obvious under fast changing cloud speeds. This would probably lead to significant errors if the CMDVs were still only obtained from the single coordinate of the peak value pulse. However, the deformation estimation of clouds between two images and its influence on FPCT-based CMDV calculations are terrifically complex and difficult because the motion of clouds is complicated to describe and model. Therefore, to improve the accuracy and reliability under these circumstances in a simple manner, an image-phase-shift-invariance (IPSI) based CMDV calculation method using FPCT is proposed for minute time scale solar power forecasting. First, multiple different CMDVs are calculated from the corresponding consecutive images pairs obtained through different synchronous rotation angles compared to the original images by using the FPCT method. Second, the final CMDV is generated from all of the calculated CMDVs through a centroid iteration strategy based on its density and distance distribution. Third, the influence of different rotation angle resolution on the final CMDV is analyzed as a means of parameter estimation. Simulations under various scenarios including both thick and thin clouds conditions indicated that the proposed IPSI-based CMDV calculation method using FPCT is more accurate and reliable than the original FPCT method, optimal flow (OF) method, and particle image velocimetry (PIV) method.« less

  15. Image phase shift invariance based cloud motion displacement vector calculation method for ultra-short-term solar PV power forecasting

    DOE PAGES

    Wang, Fei; Zhen, Zhao; Liu, Chun; ...

    2017-12-18

    Irradiance received on the earth's surface is the main factor that affects the output power of solar PV plants, and is chiefly determined by the cloud distribution seen in a ground-based sky image at the corresponding moment in time. It is the foundation for those linear extrapolation-based ultra-short-term solar PV power forecasting approaches to obtain the cloud distribution in future sky images from the accurate calculation of cloud motion displacement vectors (CMDVs) by using historical sky images. Theoretically, the CMDV can be obtained from the coordinate of the peak pulse calculated from a Fourier phase correlation theory (FPCT) method throughmore » the frequency domain information of sky images. The peak pulse is significant and unique only when the cloud deformation between two consecutive sky images is slight enough, which is likely possible for a very short time interval (such as 1?min or shorter) with common changes in the speed of cloud. Sometimes, there will be more than one pulse with similar values when the deformation of the clouds between two consecutive sky images is comparatively obvious under fast changing cloud speeds. This would probably lead to significant errors if the CMDVs were still only obtained from the single coordinate of the peak value pulse. However, the deformation estimation of clouds between two images and its influence on FPCT-based CMDV calculations are terrifically complex and difficult because the motion of clouds is complicated to describe and model. Therefore, to improve the accuracy and reliability under these circumstances in a simple manner, an image-phase-shift-invariance (IPSI) based CMDV calculation method using FPCT is proposed for minute time scale solar power forecasting. First, multiple different CMDVs are calculated from the corresponding consecutive images pairs obtained through different synchronous rotation angles compared to the original images by using the FPCT method. Second, the final CMDV is generated from all of the calculated CMDVs through a centroid iteration strategy based on its density and distance distribution. Third, the influence of different rotation angle resolution on the final CMDV is analyzed as a means of parameter estimation. Simulations under various scenarios including both thick and thin clouds conditions indicated that the proposed IPSI-based CMDV calculation method using FPCT is more accurate and reliable than the original FPCT method, optimal flow (OF) method, and particle image velocimetry (PIV) method.« less

  16. Feasibility and Use of the Mobile Food Record for Capturing Eating Occasions among Children Ages 3-10 Years in Guam.

    PubMed

    Aflague, Tanisha F; Boushey, Carol J; Guerrero, Rachael T Leon; Ahmad, Ziad; Kerr, Deborah A; Delp, Edward J

    2015-06-02

    Children's readiness to use technology supports the idea of children using mobile applications for dietary assessment. Our goal was to determine if children 3-10 years could successfully use the mobile food record (mFR) to capture a usable image pair or pairs. Children in Sample 1 were tasked to use the mFR to capture an image pair of one eating occasion while attending summer camp. For Sample 2, children were tasked to record all eating occasions for two consecutive days at two time periods that were two to four weeks apart. Trained analysts evaluated images. In Sample 1, 90% (57/63) captured one usable image pair. All children (63/63) returned the mFR undamaged. Sixty-two children reported: The mFR was easy to use (89%); willingness to use the mFR again (87%); and the fiducial marker easy to manage (94%). Children in Sample 2 used the mFR at least one day at Time 1 (59/63, 94%); Time 2 (49/63, 78%); and at both times (47/63, 75%). This latter group captured 6.21 ± 4.65 and 5.65 ± 3.26 mean (± SD) image pairs for Time 1 and Time 2, respectively. Results support the potential for children to independently record dietary intakes using the mFR.

  17. A new technique to determine the correlation between the QT interval and heart-rate for control and SIDS babies

    NASA Technical Reports Server (NTRS)

    Sadeh, D.; Shannon, D. C.; Abboud, S.; Akselrod, S.; Cohen, R. J.

    1987-01-01

    The ability of the autonomic nervous system to alter the QT interval in response to heart rate changes is essential to cardiovascular control. An accurate way to determine the relation between QT intervals and their corresponding RR intervals is described. A computer algorithm measures the RR intervals using digital filtering and cross-correlating the QRS sections of consecutive waveforms. The QT intervals is calculated by choosing a section of, the ECG that includes the T wave and cross-correlating it with all the consecutive T waves. At least 4000 pairs of QT-RR intervals are computed for each subject and a best fit correlation function determines the relations between the QT and RR intervals. This technique enables to establish a precise correlation between RR and QT in order to distinguish between control and SIDS babies.

  18. Sorting permutations by prefix and suffix rearrangements.

    PubMed

    Lintzmayer, Carla Negri; Fertin, Guillaume; Dias, Zanoni

    2017-02-01

    Some interesting combinatorial problems have been motivated by genome rearrangements, which are mutations that affect large portions of a genome. When we represent genomes as permutations, the goal is to transform a given permutation into the identity permutation with the minimum number of rearrangements. When they affect segments from the beginning (respectively end) of the permutation, they are called prefix (respectively suffix) rearrangements. This paper presents results for rearrangement problems that involve prefix and suffix versions of reversals and transpositions considering unsigned and signed permutations. We give 2-approximation and ([Formula: see text])-approximation algorithms for these problems, where [Formula: see text] is a constant divided by the number of breakpoints (pairs of consecutive elements that should not be consecutive in the identity permutation) in the input permutation. We also give bounds for the diameters concerning these problems and provide ways of improving the practical results of our algorithms.

  19. A secure steganography for privacy protection in healthcare system.

    PubMed

    Liu, Jing; Tang, Guangming; Sun, Yifeng

    2013-04-01

    Private data in healthcare system require confidentiality protection while transmitting. Steganography is the art of concealing data into a cover media for conveying messages confidentially. In this paper, we propose a steganographic method which can provide private data in medical system with very secure protection. In our method, a cover image is first mapped into a 1D pixels sequence by Hilbert filling curve and then divided into non-overlapping embedding units with three consecutive pixels. We use adaptive pixel pair match (APPM) method to embed digits in the pixel value differences (PVD) of the three pixels and the base of embedded digits is dependent on the differences among the three pixels. By solving an optimization problem, minimal distortion of the pixel ternaries caused by data embedding can be obtained. The experimental results show our method is more suitable to privacy protection of healthcare system than prior steganographic works.

  20. Spawning behaviour of Allis shad Alosa alosa: new insights based on imaging sonar data.

    PubMed

    Langkau, M C; Clavé, D; Schmidt, M B; Borcherding, J

    2016-06-01

    Spawning behaviour of Alosa alosa was observed by high resolution imaging sonar. Detected clouds of sexual products and micro bubbles served as a potential indicator of spawning activity. Peak spawning time was between 0130 and 0200 hours at night. Increasing detections over three consecutive nights were consistent with sounds of mating events (bulls) assessed in hearing surveys in parallel to the hydro acoustic detection. In 70% of the analysed mating events there were no additional A. alosa joining the event whilst 70% of the mating events showed one or two A. alosa leaving the cloud. In 31% of the analysed mating events, however, three or more A. alosa were leaving the clouds, indicating that matings are not restricted to a pair. Imaging sonar is suitable for monitoring spawning activity and behaviour of anadromous clupeids in their spawning habitats. © 2016 The Fisheries Society of the British Isles.

  1. Short communication: Is hair cortisol a potential indicator for stress caused by chronic lameness in dairy cows?

    PubMed

    Fischer-Tenhagen, C; Ladwig-Wiegard, M; Heuwieser, W; Thöne-Reineke, C

    2018-06-01

    The objective of this study was to evaluate hair cortisol concentration as an indicator for stress caused by chronic lameness in dairy cows. Sixty-eight cows were scored for lameness for 4 consecutive weeks. The hair of the tail switch was clipped at the beginning of the study and regrown hair was clipped after 4 wk. Hair samples were analyzed for cortisol concentration. Animals with 2 consecutive locomotion scores ≥3 or with an overall mean score >1.5 were classified as lame. After pair matching lame and nonlame cows, considering days in milk, lactation number, and milk yield, and excluding cows with less than 20 mg hair sample for analysis, 21 lame and 21 nonlame cows were included in the analysis. The mean hair cortisol concentration in this study was 2.32 ± 0.35 pg/mg (mean ± standard deviation). Cortisol concentration from hair regrown in the study period was 2.38 ± 0.95 and 2.26 ± 1.35 pg/mg for lame and nonlame cows (n = 21), respectively; we found no difference in mean cortisol level of primiparous and multiparous cows. Based on these data, hair cortisol concentration was not a useful indicator to differentiate cows with chronic lameness and healthy cows. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  2. Development, Implementation, and Evaluation of an Interdisciplinary Women's Health and Laboratory Course.

    PubMed

    Guarner, Jeannette; Winkler, Ann M; Flowers, Lisa; Hill, Charles E; Ellis, Jane E; Workowski, Kimberly; Reid, Michelle D; Goedken, Jennifer

    2016-09-01

    To describe the creation, implementation, and evaluation of a case-based, interdisciplinary course that highlights laboratory principles for students who have selected a career in obstetrics and gynecology. We developed four case-based modules with questions that emphasize laboratory principles required to establish a diagnosis and treat and monitor each case-based scenario. The cases were offered as a 4-hour elective course during the medical school capstone. A clinician and a clinical pathologist pair facilitated the case discussions with groups of six to nine medical students during 2 consecutive years. Pre- and postknowledge quizzes were given to the students. In addition, a structured evaluation of the course was performed. Twenty-two students participated in the courses. Most found the format effective and the information useful. There was a significant increase in their related knowledge as established by pre- and posttesting. Case-based discussions gave learners a better understanding of the function and complexity of the clinical laboratories, and multidisciplinary facilitation highlighted the value of interacting with laboratory professionals to enhance clinical care. © American Society for Clinical Pathology, 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  3. Orthographic Stereo Correlator on the Terrain Model for Apollo Metric Images

    NASA Technical Reports Server (NTRS)

    Kim, Taemin; Husmann, Kyle; Moratto, Zachary; Nefian, Ara V.

    2011-01-01

    A stereo correlation method on the object domain is proposed to generate the accurate and dense Digital Elevation Models (DEMs) from lunar orbital imagery. The NASA Ames Intelligent Robotics Group (IRG) aims to produce high-quality terrain reconstructions of the Moon from Apollo Metric Camera (AMC) data. In particular, IRG makes use of a stereo vision process, the Ames Stereo Pipeline (ASP), to automatically generate DEMs from consecutive AMC image pairs. Given camera parameters of an image pair from bundle adjustment in ASP, a correlation window is defined on the terrain with the predefined surface normal of a post rather than image domain. The squared error of back-projected images on the local terrain is minimized with respect to the post elevation. This single dimensional optimization is solved efficiently and improves the accuracy of the elevation estimate.

  4. Interspecific Cross-Mating Between Aedes aegypti and Aedes albopictus Laboratory Strains: Implication of Population Density on Mating Behaviors.

    PubMed

    Marcela, P; Hassan, A Abu; Hamdan, A; Dieng, H; Kumara, T K

    2015-12-01

    Mating behavior between Aedes aegypti and Ae. albopictus, established colony strains were examined under laboratory conditions (30-cm(3) screened cages) for 5 consecutive days. The effect of selected male densities (30, 20, 10) and female density (20) on the number of swarming, mating pairs, eggs produced, and inseminated females were evaluated. Male densities significantly increased swarming behavior, mating pairs, and egg production of heterospecific females, but female insemination was reduced. Aedes aegypti males mate more readily with heterospecific females than do Ae. albopictus males. The current study suggests that Ae. aegypti males were not species-specific in mating, and if released into the field as practiced in genetically modified mosquito techniques, they may mate with both Ae. aegypti and Ae. albopictus females, hence reducing populations of both species by producing infertile eggs.

  5. Let's stay together? Intrinsic and extrinsic factors involved in pair bond dissolution in a recolonizing wolf population.

    PubMed

    Milleret, Cyril; Wabakken, Petter; Liberg, Olof; Åkesson, Mikael; Flagstad, Øystein; Andreassen, Harry Peter; Sand, Håkan

    2017-01-01

    For socially monogamous species, breeder bond dissolution has important consequences for population dynamics, but the extent to which extrinsic or intrinsic population factors causes pair dissolution remain poorly understood, especially among carnivores. Using an extensive life-history data set, a survival analysis and competing risks framework, we examined the fate of 153 different wolf (Canis lupus) pairs in the recolonizing Scandinavian wolf population, during 14 winters of snow tracking and DNA monitoring. Wolf pair dissolution was generally linked to a mortality event and was strongly affected by extrinsic (i.e. anthropogenic) causes. No divorce was observed, and among the pair dissolution where causes have been identified, death of one or both wolves was always involved. Median time from pair formation to pair dissolution was three consecutive winters (i.e. approximately 2 years). Pair dissolution was mostly human-related, primarily caused by legal control actions (36·7%), verified poaching (9·2%) and traffic-related causes (2·1%). Intrinsic factors, such as disease and age, accounted for only 7·7% of pair dissolutions. The remaining 44·3% of dissolution events were from unknown causes, but we argue that a large portion could be explained by an additional source of human-caused mortality, cryptic poaching. Extrinsic population factors, such as variables describing the geographical location of the pair, had a stronger effect on risk of pair dissolution compared to anthropogenic landscape characteristics. Population intrinsic factors, such as the inbreeding coefficient of the male pair member, had a negative effect on pair bond duration. The mechanism behind this result remains unknown, but might be explained by lower survival of inbred males or more complex inbreeding effects mediated by behaviour. Our study provides quantitative estimates of breeder bond duration in a social carnivore and highlights the effect of extrinsic (i.e. anthropogenic) and intrinsic factors (i.e. inbreeding) involved in wolf pair bond duration. Unlike the effects of intrinsic and extrinsic factors that are commonly reported on individual survival or population growth, here we provide quantitative estimates of their potential effect on the social unit of the population, the wolf pair. © 2016 The Authors. Journal of Animal Ecology published by John Wiley & Sons Ltd on behalf of British Ecological Society.

  6. Report on Pairing-based Cryptography.

    PubMed

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

  7. Report on Pairing-based Cryptography

    PubMed Central

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST’s position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed. PMID:26958435

  8. I Know My Neighbour: Individual Recognition in Octopus vulgaris

    PubMed Central

    Tricarico, Elena; Borrelli, Luciana; Gherardi, Francesca; Fiorito, Graziano

    2011-01-01

    Background Little is known about individual recognition (IR) in octopuses, although they have been abundantly studied for their sophisticated behaviour and learning capacities. Indeed, the ability of octopuses to recognise conspecifics is suggested by a number of clues emerging from both laboratory studies (where they appear to form and maintain dominance hierarchies) and field observations (octopuses of neighbouring dens display little agonism between each other). To fill this gap in knowledge, we investigated the behaviour of 24 size-matched pairs of Octopus vulgaris in laboratory conditions. Methodology/Principal Findings The experimental design was composed of 3 phases: Phase 1 (acclimatization): 12 “sight-allowed” (and 12 “isolated”) pairs were maintained for 3 days in contiguous tanks separated by a transparent (and opaque) partition to allow (and block) the vision of the conspecific; Phase 2 (cohabitation): members of each pair (both sight-allowed and isolated) were transferred into an experimental tank and were allowed to interact for 15 min every day for 3 consecutive days; Phase 3 (test): each pair (both sight-allowed and isolated) was subject to a switch of an octopus to form pairs composed of either familiar (“sham switches”) or unfamiliar conspecifics (“real switches”). Longer latencies (i.e. the time elapsed from the first interaction) and fewer physical contacts in the familiar pairs as opposed to the unfamiliar pairs were used as proxies for recognition. Conclusions Octopuses appear able to recognise conspecifics and to remember the individual previously met for at least one day. To the best of our knowledge, this is the first experimental study showing the occurrence of a form of IR in cephalopods. Future studies should clarify whether this is a “true” IR. PMID:21533257

  9. South Polar Skua breeding populations in the Ross Sea assessed from demonstrated relationship with Adélie Penguin numbers

    USGS Publications Warehouse

    Wilson, Deborah J.; Lyver, Phil O'B.; Greene, Terry C.; Whitehead, Amy L.; Dugger, Catherine; Karl, Brian J.; Barringer, James R. F.; McGarry, Roger; Pollard, Annie M.; Ainley, David G.

    2017-01-01

    In the Ross Sea region, most South Polar Skuas (Stercorarius maccormicki) nest near Adélie Penguin (Pygoscelis adeliae) colonies, preying and scavenging on fish, penguins, and other carrion. To derive a relationship to predict skua numbers from better-quantified penguin numbers, we used distance sampling to estimate breeding skua numbers within 1000 m of 5 penguin nesting locations (Cape Crozier, Cape Royds, and 3 Cape Bird locations) on Ross Island in 3 consecutive years. Estimated numbers of skua breeding pairs were highest at Cape Crozier (270,000 penguin pairs; 1099 and 1347 skua pairs in 2 respective years) and lowest at Cape Royds (3000 penguin pairs; 45 skua pairs). The log–log linear relationship (R2 = 0.98) between pairs of skuas and penguins was highly significant, and most historical estimates of skua and penguin numbers in the Ross Sea were within 95 % prediction intervals of the regression. Applying our regression model to current Adélie Penguin colony sizes at 23 western Ross Sea locations predicted that 4635 pairs of skuas now breed within 1000 m of penguin colonies in the Ross Island metapopulation (including Beaufort Island) and northern Victoria Land. We estimate, using published skua estimates for elsewhere in Antarctica, that the Ross Sea South Polar Skua population comprises ~50 % of the world total, although this may be an overestimate because of incomplete data elsewhere. To improve predictions and enable measurement of future skua population change, we recommend additional South Polar Skua surveys using consistent distance-sampling methods at penguin colonies of a range of sizes.

  10. Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

    PubMed Central

    Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

    2015-01-01

    Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

  11. A patient with phonologic alexia can learn to read "much" from "mud pies"

    PubMed Central

    Lott, Susan Nitzberg; Sample, Diane M.; Oliver, Robyn T.; Lacey, Elizabeth H.; Friedman, Rhonda B.

    2008-01-01

    People with phonologic alexia often have difficulty reading functors and verbs, in addition to pseudowords. Friedman et al (2002) reported a successful treatment for phonologic alexia that paired problematic functors and verbs with easily read relays that were homophonous nouns (e.g. "be" paired with "bee"). The current study evaluates the efficacy of pairing problematic grammatical words with relays that share initial phonemes, but vary in the relationship of their final phonemes. Results showed that reading of target grammatical words improved to criterion level (90% accuracy over two consecutive probes) in all experimental conditions with shared phonology, but remained far below criterion level in control conditions. There was a significant correlation between degree of phonologic relatedness and error rate. Maintenance of the treatment effect was poor as assessed by traditional measurement, however a dramatic savings during relearning was demonstrated during a subsequent treatment phase. The finding that reading can be re-organized by pairing target words not only with homophones, but with other phonologically related relays, suggests that this approach could be applied to a wide corpus of words and, therefore, potentially be of great use clinically. We suggest, within a connectionist account, that the treatment effect results from relays priming the initial phonologic units of the targets. PMID:18513760

  12. Familiality of gender identity disorder in non-twin siblings.

    PubMed

    Gómez-Gil, Esther; Esteva, Isabel; Almaraz, M Cruz; Pasaro, Eduardo; Segovia, Santiago; Guillamon, Antonio

    2010-04-01

    Familial studies and reports of co-occurrence of gender identity disorder (GID) within a family may help to clarify the question of whether transsexualism is a familial phenomenon. In a sample of 995 consecutive transsexual probands (677 male-to-female [MF] and 318 female-to-male [FM]), we report 12 pairs of transsexual non-twin siblings (nine pairs of MF siblings, two pairs of MF-FM siblings, and one pair of FM siblings). The present study doubles the number of case reports of co-occurrence of transsexualism in non-twin siblings available in the literature. According to our data, the probability that a sibling of a transsexual will also be transsexual was 4.48 times higher for siblings of MF than for siblings of FM transsexual probands, and 3.88 times higher for the brothers than for the sisters of transsexual probands. Moreover, the prevalence of transsexualism in siblings of transsexuals (1/211 siblings) was much higher than the range expected according to the prevalence data of transsexualism in Spain. The study suggests that siblings of transsexuals may have a higher risk of being transsexual than the general population, and that the risk is higher for brothers than sisters of transsexuals, and for siblings of MF than FM transsexuals. Nevertheless, the risk is low.

  13. Interplay of upper and lower motor neuron degeneration in amyotrophic lateral sclerosis.

    PubMed

    de Carvalho, Mamede; Poliakov, Artiom; Tavares, Cristiano; Swash, Michael

    2017-11-01

    We studied motor unit recruitment to test a new method to identify motor unit firing rate (FR) variability. We studied 68 ALS patients, with and without upper neuron signs (UMN) in lower limbs, 24 patients with primary lateral sclerosis (PLS), 13 patients with spinal cord lesion and 39 normal subjects. All recordings were made from tibialis anterior muscles of normal strength. Subjects performed a very slight contraction in order to activate 2 motor units in each recording. 5-7 motor unit pairs were recorded in each subject. Mean consecutive differences (MCD) were calculated for each pair of potentials. The mean MCD for each muscle was estimated as the mean from the total number of pairs recorded. Ap value<0.01 was accepted as significant. MCD of FR frequency was less in the subjects with spinal cord lesion and PLS. In addition, the FR frequency of the 1st motor unit in a pair of units was markedly reduced in PLS, and in subjects with spinal cord lesions. These results support a lower threshold and reduced FR fluctuation in spinal motor neurons of spastic patients. This method can be developed for detection of UMN lesions. Copyright © 2017 International Federation of Clinical Neurophysiology. Published by Elsevier B.V. All rights reserved.

  14. Nucleic acid duplexes incorporating a dissociable covalent base pair

    NASA Technical Reports Server (NTRS)

    Gao, K.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    1999-01-01

    We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure.

  15. Branchpoint selection in the splicing of U12-dependent introns in vitro.

    PubMed

    McConnell, Timothy S; Cho, Soo-Jin; Frilander, Mikko J; Steitz, Joan A

    2002-05-01

    In metazoans, splicing of introns from pre-mRNAs can occur by two pathways: the major U2-dependent or the minor U12-dependent pathways. Whereas the U2-dependent pathway has been well characterized, much about the U12-dependent pathway remains to be discovered. Most of the information regarding U12-type introns has come from in vitro studies of a very few known introns of this class. To expand our understanding of U12-type splicing, especially to test the hypothesis that the simple base-pairing mechanism between the intron and U12 snRNA defines the branchpoint of U12-dependent introns, additional in vitro splicing substrates were created from three putative U12-type introns: the third intron of the Xenopus RPL1 a gene (XRP), the sixth intron of the Xenopus TFIIS.oA gene (XTF), and the first intron of the human Sm E gene (SME). In vitro splicing in HeLa nuclear extract confirmed U12-dependent splicing of each of these introns. Surprisingly, branchpoint mapping of the XRP splicing intermediate shows use of the upstream rather than the downstream of two consecutive adenosines within the branchpoint sequence (BPS), contrary to the prediction based on alignment with the sixth intron of human P120, a U12-dependent intron whose branch site was previously determined. Also, in the SME intron, the position of the branchpoint A residue within the region base paired with U12 differs from that in P120 and XTF. Analysis of these three additional introns therefore rules out simple models for branchpoint selection by the U12-type spliceosome.

  16. Branchpoint selection in the splicing of U12-dependent introns in vitro.

    PubMed Central

    McConnell, Timothy S; Cho, Soo-Jin; Frilander, Mikko J; Steitz, Joan A

    2002-01-01

    In metazoans, splicing of introns from pre-mRNAs can occur by two pathways: the major U2-dependent or the minor U12-dependent pathways. Whereas the U2-dependent pathway has been well characterized, much about the U12-dependent pathway remains to be discovered. Most of the information regarding U12-type introns has come from in vitro studies of a very few known introns of this class. To expand our understanding of U12-type splicing, especially to test the hypothesis that the simple base-pairing mechanism between the intron and U12 snRNA defines the branchpoint of U12-dependent introns, additional in vitro splicing substrates were created from three putative U12-type introns: the third intron of the Xenopus RPL1 a gene (XRP), the sixth intron of the Xenopus TFIIS.oA gene (XTF), and the first intron of the human Sm E gene (SME). In vitro splicing in HeLa nuclear extract confirmed U12-dependent splicing of each of these introns. Surprisingly, branchpoint mapping of the XRP splicing intermediate shows use of the upstream rather than the downstream of two consecutive adenosines within the branchpoint sequence (BPS), contrary to the prediction based on alignment with the sixth intron of human P120, a U12-dependent intron whose branch site was previously determined. Also, in the SME intron, the position of the branchpoint A residue within the region base paired with U12 differs from that in P120 and XTF. Analysis of these three additional introns therefore rules out simple models for branchpoint selection by the U12-type spliceosome. PMID:12022225

  17. High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

    PubMed

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2015-11-02

    Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Fovea sparing internal limiting membrane peeling using multiple parafoveal curvilinear peels for myopic foveoschisis: technique and outcome.

    PubMed

    Jin, Haiying; Zhang, Qi; Zhao, Peiquan

    2016-10-18

    To introduce a modified surgical technique, the "parafoveal multiple curvelinear internal limiting membrane (ILM) peeling", to preserve epi-foveal ILM in myopic foveoschisis surgery. Consecutive patients with myopic foveoschisis were enrolled in the present prospective interventional case series. The surgeries were performed using transconjunctival 23-gauge system. The macular area was divided into quadrants. ILM was peeled off in a curvilinear manner centered around the site that was away from the central fovea in each quadrant. Shearing forces were used to control the direction to keep the peeling away from central fovea. ILM at central fovea of about 500 to 1000 μm was preserved by this technique. This technique was performed in 20 eyes of 20 consecutive patients. Epi-foveal ILM was successfully preserved in all cases using the technique. Patients were followed up for more than 12 months. The mean postoperative logMAR visual acuity improved from 1.67 ± 0.65 preoperatively to 1.15 ± 0.49 (P = 0.015; paired t-test). Postoperative OCT examinations showed that full-thickness macular holes (MHs) did not developed in any case. Central fovea thickness decreased from 910 ± 261 μm preoperatively to 125 ± 85 postoperatively (P = 0.001; paired t-test). Fovea sparing ILM peeling using multiple parafoveal curvilinear peels prevents the development of postoperative full-thickness MHs in eyes with myopic foveoschisis.

  19. Impaired clinical utility of sequential patient GEM blood gas measurements associated with calibration schedule.

    PubMed

    Cembrowski, George S; Xu, Qian; Cembrowski, Adam R; Mei, Junyi; Sadrzadeh, Hossein

    2017-11-01

    Within- and/or between-instrument variation may falsely indicate patient trends or obscure real trends. We employ a methodology that transforms sequential intra-patient results into estimates of biologic and analytic variation. We previously derived realistic biologic variation (s b ) of blood gas (BG) and hematology analytes. We extend this methodology to derive the imprecision of two GEM 4000 BG analyzers. A laboratory data repository provided arterial BG, electrolyte and metabolite results generated by two GEM 4000s on ICU patients in 2012-2013. We tabulated consecutive pairs of intra-patient results separated by increasing time interval between consecutive tests. The average between pair variations were regressed against time with the y-intercept representing the sum of the biologic variation and short term analytic variation: y o 2 =s b 2 +s a 2 . Using an equivalent equation for the Radiometer ABL, the imprecision of the two GEMs was calculated: s aGEM =(y oGEM 2 -y oABL 2 +s aABL 2 ) 1/2 . This analysis was performed for nearly all measurements, regardless of time as well for values obtained over two 12h mutually exclusive periods, starting either at 2am or 2pm. Regression graphs were derived from 1800 patients' blood gas results with least 10,000 data pairs grouped into 2h intervals. The calculated s aGEM exceed the directly measured s aABL with many GEM sigma ratios of biologic variation/analytic variation being close to unity. All of the afternoon s aGEM exceeded their morning counterparts with pH, pCO 2 , K and bicarbonate being statistically significant. For many analytes, the average analytical variation of tandem GEMs approximates the biologic variation, indicating impaired clinical usefulness of tandem sequential measurements. A significant component of this variation is due to increased variation of the GEMs between 2pm and 2am. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  20. The nearest neighbor and next nearest neighbor effects on the thermodynamic and kinetic properties of RNA base pair

    NASA Astrophysics Data System (ADS)

    Wang, Yujie; Wang, Zhen; Wang, Yanli; Liu, Taigang; Zhang, Wenbing

    2018-01-01

    The thermodynamic and kinetic parameters of an RNA base pair with different nearest and next nearest neighbors were obtained through long-time molecular dynamics simulation of the opening-closing switch process of the base pair near its melting temperature. The results indicate that thermodynamic parameters of GC base pair are dependent on the nearest neighbor base pair, and the next nearest neighbor base pair has little effect, which validated the nearest-neighbor model. The closing and opening rates of the GC base pair also showed nearest neighbor dependences. At certain temperature, the closing and opening rates of the GC pair with nearest neighbor AU is larger than that with the nearest neighbor GC, and the next nearest neighbor plays little role. The free energy landscape of the GC base pair with the nearest neighbor GC is rougher than that with nearest neighbor AU.

  1. [Structural and Dipole Structure Peculiarities of Hoogsteen Base Pairs Formed in Complementary Nucleobases according to ab initio Quantum Mechanics Studies].

    PubMed

    Petrenko, Y M

    2015-01-01

    Ab initio quantum mechanics studies for the detection of structure and dipole structure peculiarities of Hoogsteen base pairs relative to Watson-Crick base pairs, were performed during our work. These base pairs are formed as a result of complementary interactions. It was revealed, that adenine-thymine Hoogsteen base pair and adenine-thymine Watson-Crick base pairs can be formed depending on initial configuration. Cytosine-guanine Hoogsteen pairs are formed only when cytosine was originally protonated. Both types of Hoogsteen pairs have noticeable difference in the bond distances and angles. These differences appeared in purine as well as in pyrimidine parts of the pairs. Hoogsteen pairs have mostly shorter hydrogen bond lengths and significantly larger angles of hydrogen bonds and larger angles between the hydrogen bonds than Watson-Crick base pairs. Notable differences are also observed with respect to charge distribution and dipole moment. Quantitative data on these differences are shown in our work. It is also reported that the values of local parameters (according to Cambridge classification of the parameters which determine DNA properties) in Hoogsteen base pairs, are greatly different from Watson-Crick ones.

  2. Nucleic acid duplexes incorporating a dissociable covalent base pair

    PubMed Central

    Gao, Kui; Orgel, Leslie E.

    1999-01-01

    We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure. PMID:10611299

  3. In vitro extinction learning in Hermissenda: involvement of conditioned inhibition molecules

    PubMed Central

    Cavallo, Joel S.; Hamilton, Brittany N.; Farley, Joseph

    2014-01-01

    Extinction of a conditioned association is typically viewed as the establishment of new learning rather than the erasure of the original memory. However, recent research in the nudibranch, Hermissenda crassicornis (H.c.) demonstrated that extinction training (using repeated light-alone presentations) given 15 min, but not 23 h, after memory acquisition reversed both the cellular correlates of learning (enhanced Type B cell excitability) and the behavioral changes (reduced phototaxis) produced by associative conditioning (pairings of light, CS, and rotation, US). Here, we investigated the putative molecular signaling pathways that underlie this extinction in H.c. by using a novel in vitro protocol combined with pharmacological manipulations. After intact H.c. received either light-rotation pairings (Paired), random presentations of light and rotation (Random), or no stimulation (Untrained), B cells from isolated CNSs were recorded from during exposure to extinction training consisting of two series of 15 consecutive light-steps (LSs). When in vitro extinction was administered shortly (2 h, but not 24 h) after paired training, B cells from Paired animals showed progressive and robust declines in spike frequency by the 30th LS, while control cells (Random and Untrained) did not. We found that several molecules implicated in H.c. conditioned inhibitory (CI) learning, protein phosphatase 1 (PP1) and arachidonic acid (AA)/12-lipoxygenase (12-LOX) metabolites, also contributed to the spike frequency decreases produced by in vitro extinction. Protein phosphatase 2B (PP2B) also appeared to play a role. Calyculin A (PP1 inhibitor), cyclosporin A (PP2B inhibitor), and baicalein (a 12-LOX inhibitor) all blocked the spike frequency declines in Paired B cells produced by 30 LSs. Conversely, injection of catalytically-active PP1 (caPP1) or PP2B (caPP2B) into Untrained B cells partially mimicked the spike frequency declines observed in Paired cells, as did bath-applied AA, and occluded additional LS-produced reductions in spiking in Paired cells. PMID:25374517

  4. Discriminative echolocation in a porpoise, 12

    PubMed Central

    Turner, Ronald N.; Norris, Kenneth S.

    1966-01-01

    Operant conditioning techniques were used to establish a discriminative echolocation performance in a porpoise. Pairs of spheres of disparate diameters were presented in an under-water display, and the positions of the spheres were switched according to a scrambled sequence while the blindfolded porpoise responded on a pair of submerged response levers. Responses which identified the momentary state of the display were food-reinforced, while those which did not (errors) produced time out. Errors were then studied in relation to decreased disparity between the spheres. As disparity was decreased, errors which terminated runs of correct responses occurred more frequently and were followed by longer strings of consecutive errors. Increased errors and disruption of a stable pattern of collateral behavior were associated. Since some sources of error other than decreased disparity were present, the porpoise's final performance did not fully reflect the acuity of its echolocation channel. PMID:5964509

  5. Method for coding low entrophy data

    NASA Technical Reports Server (NTRS)

    Yeh, Pen-Shu (Inventor)

    1995-01-01

    A method of lossless data compression for efficient coding of an electronic signal of information sources of very low information rate is disclosed. In this method, S represents a non-negative source symbol set, (s(sub 0), s(sub 1), s(sub 2), ..., s(sub N-1)) of N symbols with s(sub i) = i. The difference between binary digital data is mapped into symbol set S. Consecutive symbols in symbol set S are then paired into a new symbol set Gamma which defines a non-negative symbol set containing the symbols (gamma(sub m)) obtained as the extension of the original symbol set S. These pairs are then mapped into a comma code which is defined as a coding scheme in which every codeword is terminated with the same comma pattern, such as a 1. This allows a direct coding and decoding of the n-bit positive integer digital data differences without the use of codebooks.

  6. Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides.

    PubMed

    Buchmueller, Karen L; Staples, Andrew M; Uthe, Peter B; Howard, Cameron M; Pacheco, Kimberly A O; Cox, Kari K; Henry, James A; Bailey, Suzanna L; Horick, Sarah M; Nguyen, Binh; Wilson, W David; Lee, Moses

    2005-01-01

    Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, -ImPy- and -PyPy-. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and DeltaT (M) experiments. The f/Py pairing, when placed next to the -ImPy- or -PyPy- central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With -ImPy- central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson-Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the -PyPy- central pairings.

  7. Unique Thermal Stability of Unnatural Hydrophobic Ds Bases in Double-Stranded DNAs.

    PubMed

    Kimoto, Michiko; Hirao, Ichiro

    2017-10-20

    Genetic alphabet expansion technology, the introduction of unnatural bases or base pairs into replicable DNA, has rapidly advanced as a new synthetic biology area. A hydrophobic unnatural base pair between 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds) and 2-nitro-4-propynylpyrrole (Px) exhibited high fidelity as a third base pair in PCR. SELEX methods using the Ds-Px pair enabled high-affinity DNA aptamer generation, and introducing a few Ds bases into DNA aptamers extremely augmented their affinities and selectivities to target proteins. Here, to further scrutinize the functions of this highly hydrophobic Ds base, the thermal stabilities of double-stranded DNAs (dsDNA) containing a noncognate Ds-Ds or G-Ds pair were examined. The thermal stability of the Ds-Ds self-pair was as high as that of the natural G-C pair, and apart from the generally higher stability of the G-C pair than that of the A-T pair, most of the 5'-pyrimidine-Ds-purine-3' sequences, such as CDsA and TDsA, exhibited higher stability than the 5'-purine-Ds-pyrimidine-3' sequences, such as GDsC and ADsC, in dsDNAs. This trait enabled the GC-content-independent control of the thermal stability of the designed dsDNA fragments. The melting temperatures of dsDNA fragments containing the Ds-Ds pair can be predicted from the nearest-neighbor parameters including the Ds base. In addition, the noncognate G-Ds pair can efficiently distinguish its neighboring cognate natural base pairs from noncognate pairs. We demonstrated that real-time PCR using primers containing Ds accurately detected a single-nucleotide mismatch in target DNAs. These unique properties of the Ds base that affect the stabilities of the neighboring base pairs could impart new functions to DNA molecules and technologies.

  8. Vortex dipolar structures in a rigid model of the larynx at flow onset

    NASA Astrophysics Data System (ADS)

    Chisari, N. E.; Artana, G.; Sciamarella, D.

    2011-02-01

    Starting jet airflow is investigated in a channel with a pair of consecutive slitted constrictions approximating the true and false vocal folds in the human larynx. The flow is visualized using the Schlieren optical technique and simulated by solving the Navier-Stokes equations for an incompressible two-dimensional viscous flow. Laboratory and numerical experiments show the spontaneous formation of three different classes of vortex dipolar structures in several regions of the laryngeal profile under conditions that may be assimilated to those of voice onset.

  9. An algorithm for surface smoothing with rational splines

    NASA Technical Reports Server (NTRS)

    Schiess, James R.

    1987-01-01

    Discussed is an algorithm for smoothing surfaces with spline functions containing tension parameters. The bivariate spline functions used are tensor products of univariate rational-spline functions. A distinct tension parameter corresponds to each rectangular strip defined by a pair of consecutive spline knots along either axis. Equations are derived for writing the bivariate rational spline in terms of functions and derivatives at the knots. Estimates of these values are obtained via weighted least squares subject to continuity constraints at the knots. The algorithm is illustrated on a set of terrain elevation data.

  10. Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides

    PubMed Central

    Buchmueller, Karen L.; Staples, Andrew M.; Uthe, Peter B.; Howard, Cameron M.; Pacheco, Kimberly A. O.; Cox, Kari K.; Henry, James A.; Bailey, Suzanna L.; Horick, Sarah M.; Nguyen, Binh; Wilson, W. David; Lee, Moses

    2005-01-01

    Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, –ImPy– and –PyPy–. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and ΔTM experiments. The f/Py pairing, when placed next to the –ImPy– or –PyPy– central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With –ImPy– central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson–Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the –PyPy– central pairings. PMID:15703305

  11. Base-Pairing Energies of Protonated Nucleoside Base Pairs of dCyd and m5dCyd: Implications for the Stability of DNA i-Motif Conformations

    NASA Astrophysics Data System (ADS)

    Yang, Bo; Rodgers, M. T.

    2015-08-01

    Hypermethylation of cytosine in expanded (CCG)n•(CGG)n trinucleotide repeats results in Fragile X syndrome, the most common cause of inherited mental retardation. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of protonated base pairs of cytosine. Here we investigate the effects of 5-methylation and the sugar moiety on the base-pairing energies (BPEs) of protonated cytosine base pairs by examining protonated nucleoside base pairs of 2'-deoxycytidine (dCyd) and 5-methyl-2'-deoxycytidine (m5dCyd) using threshold collision-induced dissociation techniques. 5-Methylation of a single or both cytosine residues leads to very small change in the BPE. However, the accumulated effect may be dramatic in diseased state trinucleotide repeats where many methylated base pairs may be present. The BPEs of the protonated nucleoside base pairs examined here significantly exceed those of Watson-Crick dGuo•dCyd and neutral dCyd•dCyd base pairs, such that these base-pairing interactions provide the major forces responsible for stabilization of DNA i-motif conformations. Compared with isolated protonated nucleobase pairs of cytosine and 1-methylcytosine, the 2'-deoxyribose sugar produces an effect similar to the 1-methyl substituent, and leads to a slight decrease in the BPE. These results suggest that the base-pairing interactions may be slightly weaker in nucleic acids, but that the extended backbone is likely to exert a relatively small effect on the total BPE. The proton affinity (PA) of m5dCyd is also determined by competitive analysis of the primary dissociation pathways that occur in parallel for the protonated (m5dCyd)H+(dCyd) nucleoside base pair and the absolute PA of dCyd previously reported.

  12. Acquisition of Motor and Cognitive Skills through Repetition in Typically Developing Children

    PubMed Central

    Magallón, Sara; Narbona, Juan; Crespo-Eguílaz, Nerea

    2016-01-01

    Background Procedural memory allows acquisition, consolidation and use of motor skills and cognitive routines. Automation of procedures is achieved through repeated practice. In children, improvement in procedural skills is a consequence of natural neurobiological development and experience. Methods The aim of the present research was to make a preliminary evaluation and description of repetition-based improvement of procedures in typically developing children (TDC). Ninety TDC children aged 6–12 years were asked to perform two procedural learning tasks. In an assembly learning task, which requires predominantly motor skills, we measured the number of assembled pieces in 60 seconds. In a mirror drawing learning task, which requires more cognitive functions, we measured time spent and efficiency. Participants were tested four times for each task: three trials were consecutive and the fourth trial was performed after a 10-minute nonverbal interference task. The influence of repeated practice on performance was evaluated by means of the analysis of variance with repeated measures and the paired-sample test. Correlation coefficients and simple linear regression test were used to examine the relationship between age and performance. Results TDC achieved higher scores in both tasks through repetition. Older children fitted more pieces than younger ones in assembling learning and they were faster and more efficient at the mirror drawing learning task. Conclusions These findings indicate that three consecutive trials at a procedural task increased speed and efficiency, and that age affected basal performance in motor-cognitive procedures. PMID:27384671

  13. Impaired limb position sense after stroke: a quantitative test for clinical use.

    PubMed

    Carey, L M; Oke, L E; Matyas, T A

    1996-12-01

    A quantitative measure of wrist position sense was developed to advance clinical measurement of proprioceptive limb sensibility after stroke. Test-retest reliability, normative standards, and ability to discriminate impaired and unimpaired performance were investigated. Retest reliability was assessed over three sessions, and a matched-pairs study compared stroke and unimpaired subjects. Both wrists were tested, in counterbalanced order. Patients were tested in hospital-based rehabilitation units. Reliability was investigated on a consecutive sample of 35 adult stroke patients with a range of proprioceptive discrimination abilities and no evidence of neglect. A consecutive sample of 50 stroke patients and convenience sample of 50 healthy volunteers, matched for age, sex, and hand dominance, were tested in the normative-discriminative study. Age and sex were representative of the adult stroke population. The test required matching of imposed wrist positions using a pointer aligned with the axis of movement and a protractor scale. The test was reliable (r = .88 and .92) and observed changes of 8 degrees can be interpreted, with 95% confidence, as genuine. Scores of healthy volunteers ranged from 3.1 degrees to 10.9 degrees average error. The criterion of impairment was conservatively defined as 11 degrees (+/-4.8 degrees) average error. Impaired and unimpaired performance were well differentiated. Clinicians can confidently and quantitatively sample one aspect of proprioceptive sensibility in stroke patients using the wrist position sense test. Development of tests on other joints using the present approach is supported by our findings.

  14. Acquisition of Motor and Cognitive Skills through Repetition in Typically Developing Children.

    PubMed

    Magallón, Sara; Narbona, Juan; Crespo-Eguílaz, Nerea

    2016-01-01

    Procedural memory allows acquisition, consolidation and use of motor skills and cognitive routines. Automation of procedures is achieved through repeated practice. In children, improvement in procedural skills is a consequence of natural neurobiological development and experience. The aim of the present research was to make a preliminary evaluation and description of repetition-based improvement of procedures in typically developing children (TDC). Ninety TDC children aged 6-12 years were asked to perform two procedural learning tasks. In an assembly learning task, which requires predominantly motor skills, we measured the number of assembled pieces in 60 seconds. In a mirror drawing learning task, which requires more cognitive functions, we measured time spent and efficiency. Participants were tested four times for each task: three trials were consecutive and the fourth trial was performed after a 10-minute nonverbal interference task. The influence of repeated practice on performance was evaluated by means of the analysis of variance with repeated measures and the paired-sample test. Correlation coefficients and simple linear regression test were used to examine the relationship between age and performance. TDC achieved higher scores in both tasks through repetition. Older children fitted more pieces than younger ones in assembling learning and they were faster and more efficient at the mirror drawing learning task. These findings indicate that three consecutive trials at a procedural task increased speed and efficiency, and that age affected basal performance in motor-cognitive procedures.

  15. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    PubMed

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional DNA molecules such as artificial DNAzymes and DNA machines. In addition, the metallo-base pairing system is a powerful tool for the construction of homogeneous and heterogeneous metal arrays, which can lead to DNA-based nanomaterials such as electronic wires and magnetic devices. Recently researchers have investigated these systems as enzyme replacements, which may offer an additional contribution to chemical biology and synthetic biology through the expansion of the genetic alphabet.

  16. Theoretical determination of one-electron redox potentials for DNA bases, base pairs, and stacks.

    PubMed

    Paukku, Y; Hill, G

    2011-05-12

    Electron affinities, ionization potentials, and redox potentials for DNA bases, base pairs, and N-methylated derivatives are computed at the DFT/M06-2X/6-31++G(d,p) level of theory. Redox properties of a guanine-guanine stack model are explored as well. Reduction and oxidation potentials are in good agreement with the experimental ones. Electron affinities of base pairs were found to be negative. Methylation of canonical bases affects the ionization potentials the most. Base pair formation and base stacking lower ionization potentials by 0.3 eV. Pairing of guanine with the 5-methylcytosine does not seem to influence the redox properties of this base pair much.

  17. Electronic health record systems in ophthalmology: impact on clinical documentation.

    PubMed

    Sanders, David S; Lattin, Daniel J; Read-Brown, Sarah; Tu, Daniel C; Wilson, David J; Hwang, Thomas S; Morrison, John C; Yackel, Thomas R; Chiang, Michael F

    2013-09-01

    To evaluate quantitative and qualitative differences in documentation of the ophthalmic examination between paper and electronic health record (EHR) systems. Comparative case series. One hundred fifty consecutive pairs of matched paper and EHR notes, documented by 3 attending ophthalmologist providers. An academic ophthalmology department implemented an EHR system in 2006. Database queries were performed to identify cases in which the same problems were documented by the same provider on different dates, using paper versus EHR methods. This was done for 50 consecutive pairs of examinations in 3 different diseases: age-related macular degeneration (AMD), glaucoma, and pigmented choroidal lesions (PCLs). Quantitative measures were used to compare completeness of documenting the complete ophthalmologic examination, as well as disease-specific critical findings using paper versus an EHR system. Qualitative differences in paper versus EHR documentation were illustrated by selecting representative paired examples. (1) Documentation score, defined as the number of examination elements recorded for the slit-lamp examination, fundus examination, and complete ophthalmologic examination and for critical clinical findings for each disease. (2) Paired comparison of qualitative differences in paper versus EHR documentation. For all 3 diseases (AMD, glaucoma, PCL), the number of complete examination findings recorded was significantly lower with paper than the EHR system (P ≤ 0.004). Among the 3 individual examination sections (general, slit lamp, fundus) for the 3 diseases, 5 of the 9 possible combinations had significantly lower mean documentation scores with paper than EHR notes. For 2 of the 3 diseases, the number of critical clinical findings recorded was significantly lower using paper versus EHR notes (P ≤ 0.022). All (150/150) paper notes relied on graphical representations using annotated hand-drawn sketches, whereas no (0/150) EHR notes contained drawings. Instead, the EHR systems documented clinical findings using textual descriptions and interpretations. There were quantitative and qualitative differences in the nature of paper versus EHR documentation of ophthalmic findings in this study. The EHR notes included more complete documentation of examination elements using structured textual descriptions and interpretations, whereas paper notes used graphical representations of findings. The author(s) have no proprietary or commercial interest in any materials discussed in this article. Copyright © 2013 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.

  18. Evolution of lightning in an isolated hailstorm of moderate size in the tropics

    NASA Astrophysics Data System (ADS)

    Kamra, A. K.; Pawar, S. D.

    2007-10-01

    Evolution of lightning activity in a tropical hailstorm of moderate size that developed in the premonsoon season at Pune (18°32'N, 73°51'E, 559 m above sea level) is studied from the measurements of surface electric field, the Maxwell current and thunder. Total flash rate is counted from the electric field record, and the cloud-to-ground (CG) flash rate is estimated from the visual observations. Precise timings of their occurrence were confirmed from the observations of overshoot in the Maxwell current records. The storm exhibited an almost constant rate of one CG flash every 1 to 2 min over the whole life time of the storm. The ratio of intracloud (IC) to CG flashes (IC/CG) increased with the increase in total flash rate. In the convective stage of the storm, field changes from consecutive flashes were generally found to alternate in polarity. Moreover, in this stage, field changes occur in pairs, the first field change of each pair being of negative polarity and the second one of positive polarity. The two field changes in a pair occur with an average time difference of 14.3 ± 8.4 s while two consecutive pairs appear after 29.3 ± 9.1 s. In between the convective and mature stages, our observations suggest the occurrence of the phenomenon of rain gush and the field excursion associated with falling precipitation. Development of the mature stage was marked with rapid transitions in the surface electric field and the Maxwell current polarities from negative to positive. Further, total flash rate and IC/CG ratio sharply increase, and the lightning-induced electric field changes become almost exclusively of negative polarity. Observations suggest possibly a lifting up of the charging region in mature stage of the storm. The dissipating stage of the storm witnessed hail and rain showers, sharp transition of electric field and the Maxwell current from positive to negative polarity and occurrence of a few positive CG discharges. Our observations are consistent with the general belief that that some lightning flashes, by neutralizing and depositing charge in the region of opposite polarity, change the charge distribution so as to trigger another discharge in the storm.

  19. Base pairing and base mis-pairing in nucleic acids

    NASA Technical Reports Server (NTRS)

    Wang, A. H. J.; Rich, A.

    1986-01-01

    In recent years we have learned that DNA is conformationally active. It can exist in a number of different stable conformations including both right-handed and left-handed forms. Using single crystal X-ray diffraction analysis we are able to discover not only additional conformations of the nucleic acids but also different types of hydrogen bonded base-base interactions. Although Watson-Crick base pairings are the predominant type of interaction in double helical DNA, they are not the only types. Recently, we have been able to examine mismatching of guanine-thymine base pairs in left-handed Z-DNA at atomic resolution (1A). A minimum amount of distortion of the sugar phosphate backbone is found in the G x T pairing in which the bases are held together by two hydrogen bonds in the wobble pairing interaction. Because of the high resolution of the analysis we can visualize water molecules which fill in to accommodate the other hydrogen bonding positions in the bases which are not used in the base-base interactions. Studies on other DNA oligomers have revealed that other types of non-Watson-Crick hydrogen bonding interactions can occur. In the structure of a DNA octamer with the sequence d(GCGTACGC) complexed to an antibiotic triostin A, it was found that the two central AT base pairs are held together by Hoogsteen rather than Watson-Crick base pairs. Similarly, the G x C base pairs at the ends are also Hoogsteen rather than Watson-Crick pairing. Hoogsteen base pairs make a modified helix which is distinct from the Watson-Crick double helix.

  20. Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex†

    PubMed Central

    Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.

    2011-01-01

    The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

  1. Structural landscape of base pairs containing post-transcriptional modifications in RNA

    PubMed Central

    Seelam, Preethi P.; Sharma, Purshotam

    2017-01-01

    Base pairs involving post-transcriptionally modified nucleobases are believed to play important roles in a wide variety of functional RNAs. Here we present our attempts toward understanding the structural and functional role of naturally occurring modified base pairs using a combination of X-ray crystal structure database analysis, sequence analysis, and advanced quantum chemical methods. Our bioinformatics analysis reveals that despite their presence in all major secondary structural elements, modified base pairs are most prevalent in tRNA crystal structures and most commonly involve guanine or uridine modifications. Further, analysis of tRNA sequences reveals additional examples of modified base pairs at structurally conserved tRNA regions and highlights the conservation patterns of these base pairs in three domains of life. Comparison of structures and binding energies of modified base pairs with their unmodified counterparts, using quantum chemical methods, allowed us to classify the base modifications in terms of the nature of their electronic structure effects on base-pairing. Analysis of specific structural contexts of modified base pairs in RNA crystal structures revealed several interesting scenarios, including those at the tRNA:rRNA interface, antibiotic-binding sites on the ribosome, and the three-way junctions within tRNA. These scenarios, when analyzed in the context of available experimental data, allowed us to correlate the occurrence and strength of modified base pairs with their specific functional roles. Overall, our study highlights the structural importance of modified base pairs in RNA and points toward the need for greater appreciation of the role of modified bases and their interactions, in the context of many biological processes involving RNA. PMID:28341704

  2. Development of transient head cavities during early organogenesis of the Nile Crocodile (Crocodylus niloticus).

    PubMed

    Kundrát, Martin; Janácek, Jirí; Martin, Samuel

    2009-09-01

    Three consecutive pairs of head cavities (premandibular, mandibular, and hyoid) found in elasmobranchs have been considered as remnants of preotic 'head' somites-serial homologues of the myotomic compartments of trunk somites that give rise to the extraoccular musculature. Here, we study a more derived vertebrate, and show that cavitation is more complex in the head of Crocodylus niloticus, than just the occurrence of three pairs of cavities. Apart from the premandibular cavities, paired satellite microcavities, and unpaired extrapremandibular microcavities are recognized in the prechordal region as well. We observed that several developmental phenomena occur at the same time as the formation of the head cavities (premandibular, satellite, extrapremandibular, mandibular, and hyoid) appear temporarily in the crocodile embryo. These are 1) rapid growth of the optic stalk and inflation of the optic vesicle; 2) release of the intimate topographical relationships between the neural tube, notochord and oral gut; 3) tendency of the prechordal mesenchyme to follow the curvature of the forebrain; and 4) proliferation of the prechordal mesenchyme. On the basis of volumetric characters, only the hyoid cavity and hyoid condensation is comparable to the trunk somitocoel and somite, respectively. Copyright 2009 Wiley-Liss, Inc.

  3. Physiological responses of preterm newborn infants submitted to classical music therapy.

    PubMed

    da Silva, Camila Mendes; Cação, Jessica Marcelle R; Silva, Karin Cristina dos S; Marques, Cassia Fernandes; Merey, Leila Simone F

    2013-01-01

    To evaluate the physiological effects of music therapy on hospitalized preterm newborns. A noncontrolled clinical trial including 12 newborn infants with gestational age <36 weeks, spontaneously breathing. The preterm infants were submitted to 15-minute sessions of classical music therapy twice a day (morning and afternoon) for three consecutive days. The variables: heart and respiratory rates, oxygen saturation, diastolic and systolic arterial pressures, and body temperature were analyzed before and immediately after each music therapy session. There was a decrease in the heart rate after the second session of music therapy (paired t-test; p=0.002), and an increase at the end of the third session (paired t-test; p=0.005). Respiratory rate decreased during the fourth and fifth sessions (paired t-test; p=0.01 and 0.03, respectively). Regarding oxygen saturation, there was an increase after the fifth session (p=0.008). Comparison of physiological parameters among sessions, for the six studied sessions, showed only that the gain in oxygen saturation during the fifth session was significantly higher than during the sixth one (Tukey's test after variance analysis; p=0.04). Music therapy may modify short-term physiological responses of hospitalized preterm newborn infants.

  4. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    PubMed

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson-Crick base pair in SECIS element plays an important role in the selenocysteine expression by UGA codon.

  5. Introducing a model of pairing based on base pair specific interactions between identical DNA sequences

    NASA Astrophysics Data System (ADS)

    (O' Lee, Dominic J.

    2018-02-01

    At present, there have been suggested two types of physical mechanism that may facilitate preferential pairing between DNA molecules, with identical or similar base pair texts, without separation of base pairs. One mechanism solely relies on base pair specific patterns of helix distortion being the same on the two molecules, discussed extensively in the past. The other mechanism proposes that there are preferential interactions between base pairs of the same composition. We introduce a model, built on this second mechanism, where both thermal stretching and twisting fluctuations are included, as well as the base pair specific helix distortions. Firstly, we consider an approximation for weak pairing interactions, or short molecules. This yields a dependence of the energy on the square root of the molecular length, which could explain recent experimental data. However, analysis suggests that this approximation is no longer valid at large DNA lengths. In a second approximation, for long molecules, we define two adaptation lengths for twisting and stretching, over which the pairing interaction can limit the accumulation of helix disorder. When the pairing interaction is sufficiently strong, both adaptation lengths are finite; however, as we reduce pairing strength, the stretching adaptation length remains finite but the torsional one becomes infinite. This second state persists to arbitrarily weak values of the pairing strength; suggesting that, if the molecules are long enough, the pairing energy scales as length. To probe differences between the two pairing mechanisms, we also construct a model of similar form. However, now, pairing between identical sequences solely relies on the intrinsic helix distortion patterns. Between the two models, we see interesting qualitative differences. We discuss our findings, and suggest new work to distinguish between the two mechanisms.

  6. pKa shifting in double-stranded RNA is highly dependent upon nearest neighbors and bulge positioning.

    PubMed

    Wilcox, Jennifer L; Bevilacqua, Philip C

    2013-10-22

    Shifting of pKa's in RNA is important for many biological processes; however, the driving forces responsible for shifting are not well understood. Herein, we determine how structural environments surrounding protonated bases affect pKa shifting in double-stranded RNA (dsRNA). Using (31)P NMR, we determined the pKa of the adenine in an A(+)·C base pair in various sequence and structural environments. We found a significant dependence of pKa on the base pairing strength of nearest neighbors and the location of a nearby bulge. Increasing nearest neighbor base pairing strength shifted the pKa of the adenine in an A(+)·C base pair higher by an additional 1.6 pKa units, from 6.5 to 8.1, which is well above neutrality. The addition of a bulge two base pairs away from a protonated A(+)·C base pair shifted the pKa by only ~0.5 units less than a perfectly base paired hairpin; however, positioning the bulge just one base pair away from the A(+)·C base pair prohibited formation of the protonated base pair as well as several flanking base pairs. Comparison of data collected at 25 °C and 100 mM KCl to biological temperature and Mg(2+) concentration revealed only slight pKa changes, suggesting that similar sequence contexts in biological systems have the potential to be protonated at biological pH. We present a general model to aid in the determination of the roles protonated bases may play in various dsRNA-mediated processes including ADAR editing, miRNA processing, programmed ribosomal frameshifting, and general acid-base catalysis in ribozymes.

  7. Database of non-canonical base pairs found in known RNA structures

    NASA Technical Reports Server (NTRS)

    Nagaswamy, U.; Voss, N.; Zhang, Z.; Fox, G. E.

    2000-01-01

    Atomic resolution RNA structures are being published at an increasing rate. It is common to find a modest number of non-canonical base pairs in these structures in addition to the usual Watson-Crick pairs. This database summarizes the occurrence of these rare base pairs in accordance with standard nomenclature. The database, http://prion.bchs.uh.edu/, contains information such as sequence context, sugar pucker conformation, anti / syn base conformations, chemical shift, p K (a)values, melting temperature and free energy. Of the 29 anticipated pairs with two or more hydrogen bonds, 20 have been encountered to date. In addition, four unexpected pairs with two hydrogen bonds have been reported bringing the total to 24. Single hydrogen bond versions of five of the expected geometries have been encountered among the single hydrogen bond interactions. In addition, 18 different types of base triplets have been encountered, each of which involves three to six hydrogen bonds. The vast majority of the rare base pairs are antiparallel with the bases in the anti configuration relative to the ribose. The most common are the GU wobble, the Sheared GA pair, the Reverse Hoogsteen pair and the GA imino pair.

  8. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs

    PubMed Central

    2017-01-01

    Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package. PMID:29107980

  9. Computation of fluid and particle motion from a time-sequenced image pair: a global outlier identification approach.

    PubMed

    Ray, Nilanjan

    2011-10-01

    Fluid motion estimation from time-sequenced images is a significant image analysis task. Its application is widespread in experimental fluidics research and many related areas like biomedical engineering and atmospheric sciences. In this paper, we present a novel flow computation framework to estimate the flow velocity vectors from two consecutive image frames. In an energy minimization-based flow computation, we propose a novel data fidelity term, which: 1) can accommodate various measures, such as cross-correlation or sum of absolute or squared differences of pixel intensities between image patches; 2) has a global mechanism to control the adverse effect of outliers arising out of motion discontinuities, proximity of image borders; and 3) can go hand-in-hand with various spatial smoothness terms. Further, the proposed data term and related regularization schemes are both applicable to dense and sparse flow vector estimations. We validate these claims by numerical experiments on benchmark flow data sets. © 2011 IEEE

  10. It can work: Open employment for people with experience of mental illness.

    PubMed

    Peterson, Debbie; Gordon, Sarah; Neale, Jenny

    2017-01-01

    Previous research has tended to focus on the barriers to employment for people with mental illness and the extra support they may need. This research contributes to the knowledge base pertaining to this population by looking at successful employment relationships in New Zealand. To describe factors enabling and/or sustaining the open employment of people with experience of mental illness. Fifteen pairs of employers and employees were interviewed individually but consecutively (using a semi-structured interview schedule) about their perceptions of the critical factors that enabled and sustained the employee's employment. Employee participants were recruited by advertisement, with employers approached through their employees. Transcripts were analysed using a thematic analysis. Themes raised in the interviews included the meaning of work, disclosure of mental illness, the benefits of working, special arrangements or accommodations, the work environment and key things employers and employees do to sustain successful employment. Four critical success factors were identified relating to disclosure, the employment relationship, freedom from discrimination and workplace flexibility.

  11. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    PubMed

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  12. Improving vehicle tracking rate and speed estimation in dusty and snowy weather conditions with a vibrating camera

    PubMed Central

    Yaghoobi Ershadi, Nastaran

    2017-01-01

    Traffic surveillance systems are interesting to many researchers to improve the traffic control and reduce the risk caused by accidents. In this area, many published works are only concerned about vehicle detection in normal conditions. The camera may vibrate due to wind or bridge movement. Detection and tracking of vehicles is a very difficult task when we have bad weather conditions in winter (snowy, rainy, windy, etc.), dusty weather in arid and semi-arid regions, at night, etc. Also, it is very important to consider speed of vehicles in the complicated weather condition. In this paper, we improved our method to track and count vehicles in dusty weather with vibrating camera. For this purpose, we used a background subtraction based strategy mixed with an extra processing to segment vehicles. In this paper, the extra processing included the analysis of the headlight size, location, and area. In our work, tracking was done between consecutive frames via a generalized particle filter to detect the vehicle and pair the headlights using the connected component analysis. So, vehicle counting was performed based on the pairing result, with Centroid of each blob we calculated distance between two frames by simple formula and hence dividing it by the time between two frames obtained from the video. Our proposed method was tested on several video surveillance records in different conditions such as dusty or foggy weather, vibrating camera, and in roads with medium-level traffic volumes. The results showed that the new proposed method performed better than our previously published method and other methods, including the Kalman filter or Gaussian model, in different traffic conditions. PMID:29261719

  13. Improving vehicle tracking rate and speed estimation in dusty and snowy weather conditions with a vibrating camera.

    PubMed

    Yaghoobi Ershadi, Nastaran

    2017-01-01

    Traffic surveillance systems are interesting to many researchers to improve the traffic control and reduce the risk caused by accidents. In this area, many published works are only concerned about vehicle detection in normal conditions. The camera may vibrate due to wind or bridge movement. Detection and tracking of vehicles is a very difficult task when we have bad weather conditions in winter (snowy, rainy, windy, etc.), dusty weather in arid and semi-arid regions, at night, etc. Also, it is very important to consider speed of vehicles in the complicated weather condition. In this paper, we improved our method to track and count vehicles in dusty weather with vibrating camera. For this purpose, we used a background subtraction based strategy mixed with an extra processing to segment vehicles. In this paper, the extra processing included the analysis of the headlight size, location, and area. In our work, tracking was done between consecutive frames via a generalized particle filter to detect the vehicle and pair the headlights using the connected component analysis. So, vehicle counting was performed based on the pairing result, with Centroid of each blob we calculated distance between two frames by simple formula and hence dividing it by the time between two frames obtained from the video. Our proposed method was tested on several video surveillance records in different conditions such as dusty or foggy weather, vibrating camera, and in roads with medium-level traffic volumes. The results showed that the new proposed method performed better than our previously published method and other methods, including the Kalman filter or Gaussian model, in different traffic conditions.

  14. Rotational-translational fourier imaging system

    NASA Technical Reports Server (NTRS)

    Campbell, Jonathan W. (Inventor)

    2004-01-01

    This invention has the ability to create Fourier-based images with only two grid pairs. The two grid pairs are manipulated in a manner that allows (1) a first grid pair to provide multiple real components of the Fourier-based image and (2) a second grid pair to provide multiple imaginary components of the Fourier-based image. The novelty of this invention resides in the use of only two grid pairs to provide the same imaging information that has been traditionally collected with multiple grid pairs.

  15. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    PubMed

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  16. Efficient Implementation of the Pairing on Mobilephones Using BREW

    NASA Astrophysics Data System (ADS)

    Yoshitomi, Motoi; Takagi, Tsuyoshi; Kiyomoto, Shinsaku; Tanaka, Toshiaki

    Pairing based cryptosystems can accomplish novel security applications such as ID-based cryptosystems, which have not been constructed efficiently without the pairing. The processing speed of the pairing based cryptosystems is relatively slow compared with the other conventional public key cryptosystems. However, several efficient algorithms for computing the pairing have been proposed, namely Duursma-Lee algorithm and its variant ηT pairing. In this paper, we present an efficient implementation of the pairing over some mobilephones. Moreover, we compare the processing speed of the pairing with that of the other standard public key cryptosystems, i. e. RSA cryptosystem and elliptic curve cryptosystem. Indeed the processing speed of our implementation in ARM9 processors on BREW achieves under 100 milliseconds using the supersingular curve over F397. In addition, the pairing is more efficient than the other public key cryptosystems, and the pairing can be achieved enough also on BREW mobilephones. It has become efficient enough to implement security applications, such as short signature, ID-based cryptosystems or broadcast encryption, using the pairing on BREW mobilephones.

  17. The Maximum Likelihood Estimation of Signature Transformation /MLEST/ algorithm. [for affine transformation of crop inventory data

    NASA Technical Reports Server (NTRS)

    Thadani, S. G.

    1977-01-01

    The Maximum Likelihood Estimation of Signature Transformation (MLEST) algorithm is used to obtain maximum likelihood estimates (MLE) of affine transformation. The algorithm has been evaluated for three sets of data: simulated (training and recognition segment pairs), consecutive-day (data gathered from Landsat images), and geographical-extension (large-area crop inventory experiment) data sets. For each set, MLEST signature extension runs were made to determine MLE values and the affine-transformed training segment signatures were used to classify the recognition segments. The classification results were used to estimate wheat proportions at 0 and 1% threshold values.

  18. An ensemble of SVM classifiers based on gene pairs.

    PubMed

    Tong, Muchenxuan; Liu, Kun-Hong; Xu, Chungui; Ju, Wenbin

    2013-07-01

    In this paper, a genetic algorithm (GA) based ensemble support vector machine (SVM) classifier built on gene pairs (GA-ESP) is proposed. The SVMs (base classifiers of the ensemble system) are trained on different informative gene pairs. These gene pairs are selected by the top scoring pair (TSP) criterion. Each of these pairs projects the original microarray expression onto a 2-D space. Extensive permutation of gene pairs may reveal more useful information and potentially lead to an ensemble classifier with satisfactory accuracy and interpretability. GA is further applied to select an optimized combination of base classifiers. The effectiveness of the GA-ESP classifier is evaluated on both binary-class and multi-class datasets. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. Envisaging quantum transport phenomenon in a muddled base pair of DNA

    NASA Astrophysics Data System (ADS)

    Vohra, Rajan; Sawhney, Ravinder Singh

    2018-05-01

    The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

  20. Higher order structural effects stabilizing the reverse Watson–Crick Guanine-Cytosine base pair in functional RNAs

    PubMed Central

    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

    2014-01-01

    The G:C reverse Watson–Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. PMID:24121683

  1. Molecular switching behavior in isosteric DNA base pairs.

    PubMed

    Jissy, A K; Konar, Sukanya; Datta, Ayan

    2013-04-15

    The structures and proton-coupled behavior of adenine-thymine (A-T) and a modified base pair containing a thymine isostere, adenine-difluorotoluene (A-F), are studied in different solvents by dispersion-corrected density functional theory. The stability of the canonical Watson-Crick base pair and the mismatched pair in various solvents with low and high dielectric constants is analyzed. It is demonstrated that A-F base pairing is favored in solvents with low dielectric constant. The stabilization and conformational changes induced by protonation are also analyzed for the natural as well as the mismatched base pair. DNA sequences capable of changing their sequence conformation on protonation are used in the construction of pH-based molecular switches. An acidic medium has a profound influence in stabilizing the isostere base pair. Such a large gain in stability on protonation leads to an interesting pH-controlled molecular switch, which can be incorporated in a natural DNA tract. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Solution structure of an ATP-binding RNA aptamer reveals a novel fold.

    PubMed Central

    Dieckmann, T; Suzuki, E; Nakamura, G K; Feigon, J

    1996-01-01

    In vitro selection has been used to isolate several RNA aptamers that bind specifically to biological cofactors. A well-characterized example in the ATP-binding RNA aptamer family, which contains a conserved 11-base loop opposite a bulged G and flanked by regions of double-stranded RNA. The nucleotides in the consensus sequence provide a binding pocket for ATP (or AMP), which binds with a Kd in the micromolar range. Here we present the three-dimensional solution structure of a 36-nucleotide ATP-binding RNA aptamer complexed with AMP, determined from NMR-derived distance and dihedral angle restraints. The conserved loop and bulged G form a novel compact, folded structure around the AMP. The backbone tracing of the loop nucleotides can be described by a Greek zeta (zeta). Consecutive loop nucleotides G, A, A form a U-turn at the bottom of the zeta, and interact with the AMP to form a structure similar to a GNRA tetraloop, with AMP standing in for the final A. Two asymmetric G. G base pairs close the stems flanking the internal loop. Mutated aptamers support the existence of the tertiary interactions within the consensus nucleotides and with the AMP found in the calculated structures. PMID:8756406

  3. Mule cognition: a case of hybrid vigour?

    PubMed

    Proops, Leanne; Burden, Faith; Osthaus, Britta

    2009-01-01

    This study compares the behaviour of the mule (Equus asinus x Equus caballus) with that of its parent species to assess the effects of hybridization on cognition. Six mules, six ponies (E. caballus) and six donkeys (E. asinus) were given a two choice visual discrimination learning task. Each session consisted of 12 trials and pass level was reached when subjects chose the correct stimulus for at least 9 out of the 12 trials in three consecutive sessions. A record was made of how many pairs each subject learnt over 25 sessions. The mules' performance was significantly better than that of either of the parent species (Kruskal-Wallis: H(x) = 8.11, P = 0.017). They were also the only group to learn enough pairs to be able to show a successive reduction in the number of sessions required to reach criterion level. This study provides the first empirical evidence that the improved characteristics of mules may be extended from physical attributes to cognitive function.

  4. Imaging of Chromosome Dynamics in Mouse Testis Tissue by Immuno-FISH.

    PubMed

    Scherthan, Harry

    2017-01-01

    The mouse (Mus musculus) represents the central mammalian genetic model system for biomedical and developmental research. Mutant mouse models have provided important insights into chromosome dynamics during the complex meiotic differentiation program that compensates for the genome doubling at fertilization. Homologous chromosomes (homologues) undergo dynamic pairing and recombine during first meiotic prophase before they become partitioned into four haploid sets by two consecutive meiotic divisions that lack an intervening S-phase. Fluorescence in situ hybridization (FISH) has been instrumental in the visualization and imaging of the dynamic reshaping of chromosome territories and mobility during prophase I, in which meiotic telomeres were found to act as pacemakers for the chromosome pairing dance. FISH combined with immunofluorescence (IF) co-staining of nuclear proteins has been instrumental for the visualization and imaging of mammalian meiotic chromosome behavior. This chapter describes FISH and IF methods for the analysis of chromosome dynamics in nuclei of paraffin-embedded mouse testes. The techniques have proven useful for fresh and archived paraffin testis material of several mammalian species.

  5. Automatic registration of multi-modal microscopy images for integrative analysis of prostate tissue sections.

    PubMed

    Lippolis, Giuseppe; Edsjö, Anders; Helczynski, Leszek; Bjartell, Anders; Overgaard, Niels Chr

    2013-09-05

    Prostate cancer is one of the leading causes of cancer related deaths. For diagnosis, predicting the outcome of the disease, and for assessing potential new biomarkers, pathologists and researchers routinely analyze histological samples. Morphological and molecular information may be integrated by aligning microscopic histological images in a multiplex fashion. This process is usually time-consuming and results in intra- and inter-user variability. The aim of this study is to investigate the feasibility of using modern image analysis methods for automated alignment of microscopic images from differently stained adjacent paraffin sections from prostatic tissue specimens. Tissue samples, obtained from biopsy or radical prostatectomy, were sectioned and stained with either hematoxylin & eosin (H&E), immunohistochemistry for p63 and AMACR or Time Resolved Fluorescence (TRF) for androgen receptor (AR). Image pairs were aligned allowing for translation, rotation and scaling. The registration was performed automatically by first detecting landmarks in both images, using the scale invariant image transform (SIFT), followed by the well-known RANSAC protocol for finding point correspondences and finally aligned by Procrustes fit. The Registration results were evaluated using both visual and quantitative criteria as defined in the text. Three experiments were carried out. First, images of consecutive tissue sections stained with H&E and p63/AMACR were successfully aligned in 85 of 88 cases (96.6%). The failures occurred in 3 out of 13 cores with highly aggressive cancer (Gleason score ≥ 8). Second, TRF and H&E image pairs were aligned correctly in 103 out of 106 cases (97%).The third experiment considered the alignment of image pairs with the same staining (H&E) coming from a stack of 4 sections. The success rate for alignment dropped from 93.8% in adjacent sections to 22% for sections furthest away. The proposed method is both reliable and fast and therefore well suited for automatic segmentation and analysis of specific areas of interest, combining morphological information with protein expression data from three consecutive tissue sections. Finally, the performance of the algorithm seems to be largely unaffected by the Gleason grade of the prostate tissue samples examined, at least up to Gleason score 7.

  6. 1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

    PubMed

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2012-11-21

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

  7. 1,8-Naphthyridine-2,7-diamine: A Potential Universal Reader of the Watson-Crick Base Pairs for DNA Sequencing by Electron Tunneling

    PubMed Central

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2013-01-01

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read the DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A:T and G:C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs. PMID:23038027

  8. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    PubMed

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. CT angiography versus conventional digital angiography in preoperative assessment for Chinese living kidney donors.

    PubMed

    Yap, Desmond Yat Hin; Chu, Ferdinand Siu Kay; Chu, Sai Man; Tam, Po Chor; Tam, Sidney; Chan, Tak Mao; Lai, Kar Neng; Tang, Sydney Chi Wai

    2010-01-01

    Computed tomography (CT) angiography is used for preoperative evaluation of living kidney donors, but its correlation with intraoperative findings during the transplant operation remains unknown. Between April 1997 and October 2008, 34 consecutive pairs of living kidney transplants were carried out. Conventional digital angiography was employed for the preoperative assessment in the first 19 pairs, and CT angiography in the subsequent 15 pairs. The radiological reports and operative findings during kidney harvest were carefully examined and compared. Among the 34 cases in our cohort, we found 9 early branching renal arteries (26.4%) and 6 double renal arteries (17%). Venous and ureteral anomalies were rare, with only 1 case (2.9%) of each. CT angiography offered excellent and equal accuracy (accuracy 100%) when compared with conventional digital angiography for renal arterial anatomy. CT angiography showed superior performance compared with conventional angiography in the domain of venous and collecting system anomalies (accuracy 100% vs. 94.7%, respectively). No contrast nephropathy or allergy was documented in our series. CT angiography showed excellent correlations with surgical findings in the Chinese population. It is associated with minimal risk of contrast nephropathy as well as lower cost and therefore should be adopted as the standard preoperative assessment of living kidney donors.

  10. Pre-exposure to wheel running disrupts taste aversion conditioning.

    PubMed

    Salvy, Sarah-Jeanne; Pierce, W David; Heth, Donald C; Russell, James C

    2002-05-01

    When rats are given access to a running wheel after drinking a flavored solution, they subsequently drink less of that flavor solution. It has been suggested that running produces a conditioned taste aversion (CTA). This study explored whether CTA is eliminated by prior exposure to wheel running [i.e., unconditioned stimulus (UCS) pre-exposure effect]. The rats in the experimental group (UW) were allowed to wheel run for 1 h daily for seven consecutive days of pre-exposure. Rats in the two other groups had either access to locked wheels (LW group) or were maintained in their home cages (HC group) during the pre-exposure days. All rats were then exposed to four paired and four unpaired trials using a "ABBAABBA" design. Conditioning trials were composed of one flavored liquid followed by 60-min access to wheel running. For the unpaired trials, rats received a different flavor not followed by the opportunity to run. All rats were then initially tested for water consumption followed by tests of the two flavors (paired or unpaired) in a counterbalanced design. Rats in the UW group show no CTA to the liquid paired with wheel running, whereas LW and HC groups developed CTA. These results indicate that pre-exposure to wheel running (i.e., the UCS), eliminates subsequent CTA.

  11. Comparison of clinical knowledge bases for summarization of electronic health records.

    PubMed

    McCoy, Allison B; Sittig, Dean F; Wright, Adam

    2013-01-01

    Automated summarization tools that create condition-specific displays may improve clinician efficiency. These tools require new kinds of knowledge that is difficult to obtain. We compared five problem-medication pair knowledge bases generated using four previously described knowledge base development approaches. The number of pairs in the resulting mapped knowledge bases varied widely due to differing mapping techniques from the source terminologies, ranging from 2,873 to 63,977,738 pairs. The number of overlapping pairs across knowledge bases was low, with one knowledge base having half of the pairs overlapping with another knowledge base, and most having less than a third overlapping. Further research is necessary to better evaluate the knowledge bases independently in additional settings, and to identify methods to integrate the knowledge bases.

  12. Increased Rate of Poor Laryngoscopic Views in Patients Scheduled for Cardiac Surgery Versus Patients Scheduled for General Surgery: A Propensity Score-Based Analysis of 21,561 Cases.

    PubMed

    Heinrich, Sebastian; Ackermann, Andreas; Prottengeier, Johannes; Castellanos, Ixchel; Schmidt, Joachim; Schüttler, Jürgen

    2015-12-01

    Former analyses reported an increased rate of poor direct laryngoscopy view in cardiac surgery patients; however, these findings frequently could be attributed to confounding patient characteristics. In most of the reported cardiac surgery cohorts, the rate of well-known risk factors for poor direct laryngoscopy view such as male sex, obesity, or older age, were increased compared with the control groups. Especially in the ongoing debate on anesthesia staff qualification for cardiac interventions outside the operating room a detailed and stratified risk analysis seems necessary. Retrospective, anonymous, propensity score-based, matched-pair analysis. Single-center study in a university hospital. No active participants. Retrospective, anonymous chart analysis. The anesthesia records of patients undergoing cardiac surgery in a period of 6 consecutive years were analyzed retrospectively. The results were compared with those of a control group of patients who underwent general surgery. Poor laryngoscopic view was defined as Cormack and Lehane classification grade 3 or 4. The records of 21,561 general anesthesia procedures were reviewed for the study. The incidence of poor direct laryngoscopic views in patients scheduled for cardiac surgery was significantly increased compared with those of the general surgery cohort (7% v 4.2%). Using propensity score-based matched-pair analysis, equal subgroups were generated of each surgical department, with 2,946 patients showing identical demographic characteristics. After stratifying for demographic characteristics, the rate of poor direct laryngoscopy view remained statistically significantly higher in the cardiac surgery group (7.5% v 5.7%). Even with stratification for demographic risk factors, cardiac surgery patients showed a significantly higher rate of poor direct laryngoscopic view compared with general surgery patients. These results should be taken into account for human resource management and distribution of difficult airway equipment, especially when cardiac interventional programs are implemented in remote hospital locations. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Plant-pollinator interactions in a biodiverse meadow are rather stable and tight for 3 consecutive years.

    PubMed

    Fang, Qiang; Huang, Shuangquan

    2016-05-01

    Plant-pollinator interactions can be highly variable across years in natural communities. Although variation in the species composition and its basic structure has been investigated to understand the dynamic nature of pollination networks, little is known about the temporal dynamic of interaction strength between the same plant and pollinator species in any natural community. Pollinator-mediated selection on the evolution of floral traits could be diminished if plant-pollinator interactions vary temporally. To quantify the temporal variation in plant-pollinator interactions and the interaction strength (observed visits), we compared weighted networks between plants and pollinators in a biodiverse alpine meadow in Shangri-La, southwest China for 3 consecutive years. Although plant-pollinator interactions were highly dynamic such that identical interactions only accounted for 10.7% of the total between pair years, the diversity of interactions was stable. These identical interactions contributed 41.2% of total visits and were similar in strength and weighted nestedness. For plant species, 72.6% of species were visited by identical pollinator species between pair years, accounting for over half of the total visits and three-quarters at the functional group level. More generalized pollinators contributed more connectiveness and were more central in networks across years. However, there was no similar or even opposite trend for plant species, which suggested that specialized plant species may also be central in pollinator networks. The variation in pollinator composition decreased as pollinator species numbers increased, suggesting that generalized plants experienced stable pollinator partition. The stable, tight interactions between generalized pollinators and specialized plants represent cornerstones of the studied community. © 2016 International Society of Zoological Sciences, Institute of Zoology/Chinese Academy of Sciences and John Wiley & Sons Australia, Ltd.

  14. Double-crested Cormorant studies at Little Galloo Island, Lake Ontario in 2013: Diet composition, fish consumption and the efficacy of management activities in reducing fish predation

    USGS Publications Warehouse

    Johnson, James H.; McCullough, Russ D.; Mazzocchi, Irene

    2014-01-01

    For almost two decades Little Galloo Island (LGI) has supported a large colony of Double-crested Cormorants (Phalacrocorax auritus) in the eastern basin of Lake Ontario. Cormorant nest counts on the island since the early 1990's have averaged 4,297 per year. However, less than 2,000 pairs have nested on the island in three of the past five years. The highest count was reached in 1996 with 8,410 nesting pairs on the island. Johnson et al. (2013) estimated that cormorants from LGI alone have consumed 504 million fish since 1992. The proliferation of cormorants in the eastern basin of Lake Ontario coincided with declines in two important recreational fish species, smallmouth bass (Micropterus dolemieu) and yellow perch (Perca falvescens). Lantry et al. (2002) and Burnett et al. (2002) provide convincing evidence linking cormorant population increases to declining eastern basin smallmouth bass and yellow perch stocks. Decline of these fish stocks was evident only in the eastern basin, suggesting a localized problem, which is consistent with the halo effect where large piscivorous waterbird colonies may deplete local fish stocks (Birt et al. 1987). The year 2013 marked the twenty second consecutive year of study of the food habits and fish consumption of LGI cormorants and the fifteenth consecutive year evaluating the efficacy of management activities to control the reproductive success of cormorants nesting at LGI. The program consists mainly of spraying cormorant eggs with food grade vegetable oil as well as the culling of adult and immature birds. This paper reports the findings of work carried out in 2013 at LGI.

  15. Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

    PubMed Central

    Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

    2012-01-01

    DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Okutsu, N.; Shimamura, K.; Shimizu, E.

    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-Cmore » base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.« less

  17. Recognition of Watson-Crick base pairs: constraints and limits due to geometric selection and tautomerism

    PubMed Central

    Yusupov, Marat; Yusupova, Gulnara

    2014-01-01

    The natural bases of nucleic acids have a strong preference for one tautomer form, guaranteeing fidelity in their hydrogen bonding potential. However, base pairs observed in recent crystal structures of polymerases and ribosomes are best explained by an alternative base tautomer, leading to the formation of base pairs with Watson-Crick-like geometries. These observations set limits to geometric selection in molecular recognition of complementary Watson-Crick pairs for fidelity in replication and translation processes. PMID:24765524

  18. Structator: fast index-based search for RNA sequence-structure patterns

    PubMed Central

    2011-01-01

    Background The secondary structure of RNA molecules is intimately related to their function and often more conserved than the sequence. Hence, the important task of searching databases for RNAs requires to match sequence-structure patterns. Unfortunately, current tools for this task have, in the best case, a running time that is only linear in the size of sequence databases. Furthermore, established index data structures for fast sequence matching, like suffix trees or arrays, cannot benefit from the complementarity constraints introduced by the secondary structure of RNAs. Results We present a novel method and readily applicable software for time efficient matching of RNA sequence-structure patterns in sequence databases. Our approach is based on affix arrays, a recently introduced index data structure, preprocessed from the target database. Affix arrays support bidirectional pattern search, which is required for efficiently handling the structural constraints of the pattern. Structural patterns like stem-loops can be matched inside out, such that the loop region is matched first and then the pairing bases on the boundaries are matched consecutively. This allows to exploit base pairing information for search space reduction and leads to an expected running time that is sublinear in the size of the sequence database. The incorporation of a new chaining approach in the search of RNA sequence-structure patterns enables the description of molecules folding into complex secondary structures with multiple ordered patterns. The chaining approach removes spurious matches from the set of intermediate results, in particular of patterns with little specificity. In benchmark experiments on the Rfam database, our method runs up to two orders of magnitude faster than previous methods. Conclusions The presented method's sublinear expected running time makes it well suited for RNA sequence-structure pattern matching in large sequence databases. RNA molecules containing several stem-loop substructures can be described by multiple sequence-structure patterns and their matches are efficiently handled by a novel chaining method. Beyond our algorithmic contributions, we provide with Structator a complete and robust open-source software solution for index-based search of RNA sequence-structure patterns. The Structator software is available at http://www.zbh.uni-hamburg.de/Structator. PMID:21619640

  19. The effect of the number of consecutive night shifts on diurnal rhythms in cortisol, melatonin and heart rate variability (HRV): a systematic review of field studies.

    PubMed

    Jensen, Marie Aarrebo; Garde, Anne Helene; Kristiansen, Jesper; Nabe-Nielsen, Kirsten; Hansen, Åse Marie

    2016-05-01

    The purpose of this review is to summarize the current knowledge from field studies on how many consecutive night shifts are required for adaptation of diurnal rhythms in cortisol, melatonin and heart rate variability (HRV) to night work. A systematic search of the databases PubMed and Web of Science resulted in 18 studies selected for review. Cortisol was measured in five studies, melatonin in 11 studies and HRV in four studies. Diurnal rhythms were assessed by use of several different measures based on three to eight samples per day for cortisol and melatonin and 24-h recordings for HRV. Most of the studies in the review were small studies with less than 30 participants, and most studies evaluated diurnal rhythms after only two consecutive night shifts whereas only six studies used seven or more consecutive night shifts. The majority of studies found that adaptation to night work had not occurred after two consecutive night shifts, whereas a small number found evidence for full adaptation after seven consecutive night shifts based on diurnal rhythms in cortisol and melatonin. There are methodological differences in the field studies analyzing diurnal rhythms and large diversity in the occupational fields studied. Nevertheless, we conclude that diurnal rhythms in cortisol, melatonin and HRV are not adapted to night work after 1-3 consecutive night shifts. Studies are needed to establish how many consecutive night shifts are needed for full adaptation of diurnal rhythms to night work.

  20. Structure based alignment and clustering of proteins (STRALCP)

    DOEpatents

    Zemla, Adam T.; Zhou, Carol E.; Smith, Jason R.; Lam, Marisa W.

    2013-06-18

    Disclosed are computational methods of clustering a set of protein structures based on local and pair-wise global similarity values. Pair-wise local and global similarity values are generated based on pair-wise structural alignments for each protein in the set of protein structures. Initially, the protein structures are clustered based on pair-wise local similarity values. The protein structures are then clustered based on pair-wise global similarity values. For each given cluster both a representative structure and spans of conserved residues are identified. The representative protein structure is used to assign newly-solved protein structures to a group. The spans are used to characterize conservation and assign a "structural footprint" to the cluster.

  1. Sequence dependency of canonical base pair opening in the DNA double helix

    PubMed Central

    Villa, Alessandra

    2017-01-01

    The flipping-out of a DNA base from the double helical structure is a key step of many cellular processes, such as DNA replication, modification and repair. Base pair opening is the first step of base flipping and the exact mechanism is still not well understood. We investigate sequence effects on base pair opening using extensive classical molecular dynamics simulations targeting the opening of 11 different canonical base pairs in two DNA sequences. Two popular biomolecular force fields are applied. To enhance sampling and calculate free energies, we bias the simulation along a simple distance coordinate using a newly developed adaptive sampling algorithm. The simulation is guided back and forth along the coordinate, allowing for multiple opening pathways. We compare the calculated free energies with those from an NMR study and check assumptions of the model used for interpreting the NMR data. Our results further show that the neighboring sequence is an important factor for the opening free energy, but also indicates that other sequence effects may play a role. All base pairs are observed to have a propensity for opening toward the major groove. The preferred opening base is cytosine for GC base pairs, while for AT there is sequence dependent competition between the two bases. For AT opening, we identify two non-canonical base pair interactions contributing to a local minimum in the free energy profile. For both AT and CG we observe long-lived interactions with water and with sodium ions at specific sites on the open base pair. PMID:28369121

  2. Theoretical study on the binding mechanism between N6-methyladenine and natural DNA bases.

    PubMed

    Song, Qi-Xia; Ding, Zhen-Dong; Liu, Jian-Hua; Li, Yan; Wang, Hai-Jun

    2013-03-01

    N6-methyladenine (m(6)A) is a rare base naturally occurring in DNA. It is different from the base adenine due to its N-CH(3). Therefore, the base not only pairs with thymine, but also with other DNA bases (cytosine, adenine and guanine). In this work, Møller-Plesset second-order (MP2) method has been used to investigate the binding mechanism between m(6)A and natural DNA bases in gas phase and in aqueous solution. The results show that N-CH(3) changed the way of N6-methyladenine binding to natural DNA bases. The binding style significantly influences the stability of base pairs. The trans-m(6)A:G and trans-m(6)A:C conformers are the most stable among all the base pairs. The existence of solvent can remarkably reduce the stability of the base pairs, and the DNA bases prefer pairing with trans-m(6)A to cis-m(6)A. Besides, the properties of these hydrogen bonds have been analyzed by atom in molecules (AIM) theory, natural bond orbital (NBO) analysis and Wiberg bond indexes (WBI). In addition, pairing with m(6)A decreases the binding energies compared to the normal Watson-Crick base pairs, it may explain the instability of the N6 site methylated DNA in theory.

  3. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs.

    PubMed

    McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F

    2015-01-01

    Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.

  4. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs

    PubMed Central

    Wright, A.; Krousel-Wood, M.; Thomas, E. J.; McCoy, J. A.; Sittig, D. F.

    2015-01-01

    Summary Background Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. Objective We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. Methods We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. Results The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. Conclusions We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes. PMID:26171079

  5. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    PubMed

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  6. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

    PubMed Central

    Kondo, Jiro; Westhof, Eric

    2011-01-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

  7. Closing loop base pairs in RNA loop-loop complexes: structural behavior, interaction energy and solvation analysis through molecular dynamics simulations.

    PubMed

    Golebiowski, Jérôme; Antonczak, Serge; Fernandez-Carmona, Juan; Condom, Roger; Cabrol-Bass, Daniel

    2004-12-01

    Nanosecond molecular dynamics using the Ewald summation method have been performed to elucidate the structural and energetic role of the closing base pair in loop-loop RNA duplexes neutralized by Mg2+ counterions in aqueous phases. Mismatches GA, CU and Watson-Crick GC base pairs have been considered for closing the loop of an RNA in complementary interaction with HIV-1 TAR. The simulations reveal that the mismatch GA base, mediated by a water molecule, leads to a complex that presents the best compromise between flexibility and energetic contributions. The mismatch CU base pair, in spite of the presence of an inserted water molecule, is too short to achieve a tight interaction at the closing-loop junction and seems to force TAR to reorganize upon binding. An energetic analysis has allowed us to quantify the strength of the interactions of the closing and the loop-loop pairs throughout the simulations. Although the water-mediated GA closing base pair presents an interaction energy similar to that found on fully geometry-optimized structure, the water-mediated CU closing base pair energy interaction reaches less than half the optimal value.

  8. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    PubMed

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Leszczynski, Jerzy; Sponer, Judit; Sponer, Jiri

    Recent experimental studies on the Watson Crick type base pairing of triazine and aminopyrimidine derivatives suggest that acid/base properties of the constituent bases might be related to the duplex stabilities measured in solution. Herein we use high-level quantum chemical calculations and molecular dynamics simulations to evaluate the base pairing and stacking interactions of seven selected base pairs, which are common in that they are stabilized by two NH O hydrogen bonds separated by one NH N hydrogen bond. We show that neither the base pairing nor the base stacking interaction energies correlate with the reported pKa data of the basesmore » and the melting points of the duplexes. This suggests that the experimentally observed correlation between the melting point data of the duplexes and the pKa values of the constituent bases is not rooted in the intrinsic base pairing and stacking properties. The physical chemistry origin of the observed experimental correlation thus remains unexplained and requires further investigations. In addition, since our calculations are carried out with extrapolation to the complete basis set of atomic orbitals and with inclusion of higher electron correlation effects, they provide reference data for stacking and base pairing energies of non-natural bases.« less

  10. Breeding of Djungarian hamsters (Phodopus sungorus): influence of parity and litter size on weaning success and offspring sex ratio.

    PubMed

    Lerchl, A

    1995-04-01

    The reproduction of 368 breeding pairs of Djungarian hamsters (Phodopus sungorus) has been recorded and evaluated during 5 consecutive years. Three-hundred-and-eight pairs (= 83.7%) were successful breeders giving birth to 2113 litters (up to 13 per dam) with a total of 12,591 offspring (mean: 6.0 +/- 2.2 [+/- SD] per litter). One-hundred-and-fifty dams delivered within 25 days after pairing, indicating a breeding success in the first oestrous cycle of 40.8% of all pairs (95% confidence interval: 35.7%-46.0%). The average number of offspring was higher in the 2nd than in the first litter, reaching a maximum in the 3rd (6.8 +/- 2.0), and decreasing thereafter. The loss of offspring (mean: 24.2%) was higher in older parents and influenced by the number of offspring per litter, indicating that experience and stress contribute to breeding success. A small, but significantly higher number of females was recorded only when no loss of offspring occurred until weaning (females: 2.36 +/- 1.75; males: 2.16 +/- 1.63, P < 0.001). There was no indication of a shift of the offspring sex ratio towards favouring females with increased litter numbers, in contrast to the predictions of the Trivers-Willard hypothesis, at least with respect to the species and the breeding conditions as described in this report. Since all breeders were kept under long-day type photoperiods (16L:8D), no signs of seasonality in breeding outcome were noted.

  11. Thermal transport in topological-insulator-based superconducting hybrid structures with mixed singlet and triplet pairing states.

    PubMed

    Li, Hai; Zhao, Yuan Yuan

    2017-11-22

    In the framework of the Bogoliubov-de Gennes equation, we investigate the thermal transport properties in topological-insulator-based superconducting hybrid structures with mixed spin-singlet and spin-triplet pairing states, and emphasize the different manifestations of the spin-singlet and spin-triplet pairing states in the thermal transport signatures. It is revealed that the temperature-dependent differential thermal conductance strongly depends on the components of the pairing state, and the negative differential thermal conductance only occurs in the spin-singlet pairing state dominated regime. It is also found that the thermal conductance is profoundly sensitive to the components of the pairing state. In the spin-singlet pairing state controlled regime, the thermal conductance obviously oscillates with the phase difference and junction length. With increasing the proportion of the spin-triplet pairing state, the oscillating characteristic of the thermal conductance fades out distinctly. These results suggest an alternative route for distinguishing the components of pairing states in topological-insulator-based superconducting hybrid structures.

  12. Genetic and DNA sequence analysis of the kanamycin resistance transposon Tn903.

    PubMed Central

    Grindley, N D; Joyce, C M

    1980-01-01

    The kanamycin resistance transposon Tn903 consists of a unique region of about 1000 base pairs bounded by a pair of 1050-base-pair inverted repeat sequences. Each repeat contains two Pvu II endonuclease cleavage sites separated by 520 base pairs. We have constructed derivatives of Tn903 in which this 520-base-pair fragment is deleted from one or both repeats. Those derivatives that lack both 520-base-pair fragments cannot transpose, whereas those that lack just one remain transposition proficient. One such transposable derivative, Tn903 delta I, has been selected for further study. We have determined the sequence of the intact inverted repeat. The 18 base pairs at each end are identical and inverted relative to one another, a structure characteristic of insertion sequences. Additional experiments indicate that a single inverted repeat from Tn903 can, in fact, transpose; we propose that this element be called IS903. To correlate the DNA sequence with genetic activities, we have created mutations by inserting a 10-base-pair DNA fragment at several sites within the intact repeat of Tn903 delta 1, and we have examined the effect of such insertions on transposability. The results suggest that IS903 encodes a 307-amino-acid polypeptide (a "transposase") that is absolutely required for transposition of IS903 or Tn903. Images PMID:6261245

  13. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    PubMed

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    PubMed

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  15. Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

    PubMed Central

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-01

    The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

  16. m1A and m1G Potently Disrupt A-RNA Structure Due to the Intrinsic Instability of Hoogsteen Base Pairs

    PubMed Central

    Zhou, Huiqing; Kimsey, Isaac J.; Nikolova, Evgenia N.; Sathyamoorthy, Bharathwaj; Grazioli, Gianmarc; McSally, James; Bai, Tianyu; Wunderlich, Christoph H.; Kreutz, Christoph; Andricioaei, Ioan; Al-Hashimi, Hashim M.

    2016-01-01

    The B-DNA double helix can dynamically accommodate G–C and A–T base pairs in either Watson-Crick or Hoogsteen configurations. Here, we show that G–C+ and A–U Hoogsteen base pairs are strongly disfavored in A-RNA. As a result, N1-methyl adenosine and N1-methyl guanosine, which occur in DNA as a form of alkylation damage, and in RNA as a posttranscriptional modification, have dramatically different consequences. They create G–C+ and A–U Hoogsteen base pairs in duplex DNA that maintain the structural integrity of the double helix, but block base pairing all together and induce local duplex melting in RNA, providing a mechanism for potently disrupting RNA structure through posttranscriptional modifications. The markedly different propensities to form Hoogsteen base pairs in B-DNA and A-RNA may help meet the opposing requirements of maintaining genome stability on one hand, and dynamically modulating the structure of the epitranscriptome on the other. PMID:27478929

  17. Two-subunit DNA escort mechanism and inactive subunit bypass in an ultra-fast ring ATPase

    DOE PAGES

    Liu, Ninning; Chistol, Gheorghe; Bustamante, Carlos

    2015-10-09

    SpoIIIE is a homo-hexameric dsDNA translocase responsible for completing chromosome segregation in Bacillus subtilis. Here in this study, we use a single-molecule approach to monitor SpoIIIE translocation when challenged with neutral-backbone DNA and non-hydrolyzable ATP analogs. We show that SpoIIIE makes multiple essential contacts with phosphates on the 5'→3' strand in the direction of translocation. Using DNA constructs with two neutral-backbone segments separated by a single charged base pair, we deduce that SpoIIIE’s step size is 2 bp. Finally, experiments with non-hydrolyzable ATP analogs suggest that SpoIIIE can operate with non-consecutive inactive subunits. We propose a two-subunit escort translocation mechanismmore » that is strict enough to enable SpoIIIE to track one DNA strand, yet sufficiently compliant to permit the motor to bypass inactive subunits without arrest. We speculate that such a flexible mechanism arose for motors that, like SpoIIIE, constitute functional bottlenecks where the inactivation of even a single motor can be lethal for the cell.« less

  18. Two-subunit DNA escort mechanism and inactive subunit bypass in an ultra-fast ring ATPase

    DOE PAGES

    Liu, Ninning; Chistol, Gheorghe; Bustamante, Carlos

    2015-10-09

    SpoIIIE is a homo-hexameric dsDNA translocase responsible for completing chromosome segregation in Bacillus subtilis . Here, we use a single-molecule approach to monitor SpoIIIE translocation when challenged with neutral-backbone DNA and non-hydrolyzable ATP analogs. We show that SpoIIIE makes multiple essential contacts with phosphates on the 5'→3' strand in the direction of translocation. Using DNA constructs with two neutral-backbone segments separated by a single charged base pair, we deduce that SpoIIIE’s step size is 2 bp. Finally, experiments with non-hydrolyzable ATP analogs suggest that SpoIIIE can operate with non-consecutive inactive subunits. We propose a two-subunit escort translocation mechanism that ismore » strict enough to enable SpoIIIE to track one DNA strand, yet sufficiently compliant to permit the motor to bypass inactive subunits without arrest. We speculate that such a flexible mechanism arose for motors that, like SpoIIIE, constitute functional bottlenecks where the inactivation of even a single motor can be lethal for the cell.« less

  19. Investigating the physical properties of outbursts on comet 67P/Churyumov-Gerasimenko

    NASA Astrophysics Data System (ADS)

    Lin, Z.-Y.; Knollenberg, J.; Vincent, J.-B.; A'Hearn, M. F.; Ip, W.-H.; Sierks, H.; &. The Osiris Team

    2017-09-01

    Our measurements of outbursts were based on the outburst sequences scheduled by single-filter observation (UV375 filter in WAC or orange filter in NAC) and pairs of consecutive images obtained in short time interval with NAC orange filter. The main results from the analysis of the images of outbursts from July 29 to September 30, 2015 can be summarized as follows: The calculated excess brightness from these outburst plume ranges from a few percent to ˜28%. In some major outbursts, the contributed brightness from the outburst plume can be one or two times larger than the typical coma jet activities. The strongest one is the perihelion outburst detected just a few hours before the comet reached perihelion. By studying the brightness slope of outburst plume, we interpret the detected transient events as the continuous streams of outflowing gas and dust which are triggered by some particular mechanisms and then remain active for some minutes to less than few hours. The mass ejection rate during a large outburst could reach a few percent of the steady state value of the dust coma.

  20. Do Wild Great Tits Avoid Exposure to Light at Night?

    PubMed Central

    de Jong, Maaike; Ouyang, Jenny Q.; van Grunsven, Roy H. A.; Visser, Marcel E.; Spoelstra, Kamiel

    2016-01-01

    Studies of wild populations have provided important insights into the effects of artificial light at night on organisms, populations and ecosystems. However, in most studies the exact amount of light at night individuals are exposed to remains unknown. Individuals can potentially control their nighttime light exposure by seeking dark spots within illuminated areas. This uncertainty makes it difficult to attribute effects to a direct effect of light at night, or to indirect effects, e.g., via an effect of light at night on food availability. In this study, we aim to quantify the nocturnal light exposure of wild birds in a previously dark forest-edge habitat, experimentally illuminated with three different colors of street lighting, in comparison to a dark control. During two consecutive breeding seasons, we deployed male great tits (Parus major) with a light logger measuring light intensity every five minutes over a 24h period. We found that three males from pairs breeding in brightly illuminated nest boxes close to green and red lamp posts, were not exposed to more artificial light at night than males from pairs breeding further away. This suggests, based on our limited sample size, that these males could have been avoiding light at night by choosing a roosting place with a reduced light intensity. Therefore, effects of light at night previously reported for this species in our experimental set-up might be indirect. In contrast to urban areas where light is omnipresent, bird species in non-urban areas may evade exposure to nocturnal artificial light, thereby avoiding direct consequences of light at night. PMID:27355354

  1. Behavioral and neural bases of extinction learning in Hermissenda

    PubMed Central

    Cavallo, Joel S.; Hamilton, Brittany N.; Farley, Joseph

    2014-01-01

    Extinction of classical conditioning is thought to produce new learning that masks or interferes with the original memory. However, research in the nudibranch Hermissenda crassicornis (H.c.) has challenged this view, and instead suggested that extinction erased the original associative memory. We have re-examined extinction in H.c. to test whether extinguished associative memories can be detected on the behavioral and cellular levels, and to characterize the temporal variables involved. Associative conditioning using pairings of light (CS) and rotation (US) produced characteristic suppression of H.c. phototactic behavior. A single session of extinction training (repeated light-alone presentations) reversed suppressed behavior back to pre-training levels when administered 15 min after associative conditioning. This effect was abolished if extinction was delayed by 23 h, and yet was recovered using extended extinction training (three consecutive daily extinction sessions). Extinguished phototactic suppression did not spontaneously recover at any retention interval (RI) tested (2-, 24-, 48-, 72-h), or after additional US presentations (no observed reinstatement). Extinction training (single session, 15 min interval) also reversed the pairing-produced increases in light-evoked spike frequencies of Type B photoreceptors, an identified site of associative memory storage that is causally related to phototactic suppression. These results suggest that the behavioral effects of extinction training are not due to temporary suppression of associative memories, but instead represent a reversal of the underlying cellular changes necessary for the expression of learning. In the companion article, we further elucidate mechanisms responsible for extinction-produced reversal of memory-related neural plasticity in Type B photoreceptors. PMID:25191236

  2. Effect of kangaroo mother care on vital physiological parameters of the low birth weight newborn.

    PubMed

    Bera, Alpanamayi; Ghosh, Jagabandhu; Singh, Arun Kumarendu; Hazra, Avijit; Som, Tapas; Munian, Dinesh

    2014-10-01

    Low birth weight (LBW; <2500 g), which is often associated with preterm birth, is a common problem in India. Both are recognized risk factors for neonatal mortality. Kangaroo mother care (KMC) is a non-conventional, low-cost method for newborn care based upon intimate skin-to-skin contact between mother and baby. Our objective was to assess physiological state of LBW babies before and after KMC in a teaching hospital setting. Study cohort comprised in-born LBW babies and their mothers - 300 mother-baby pairs were selected through purposive sampling. Initially, KMC was started for 1 hour duration (at a stretch) on first day and then increased by 1 hour each day for next 2 days. Axillary temperature, respiration rate (RR/ min), heart rate (HR/ min), and oxygen saturation (SpO2) were assessed for 3 consecutive days, immediately before and after KMC. Data from 265 mother-baby pairs were analyzed. Improvements occurred in all 4 recorded physiological parameters during the KMC sessions. Mean temperature rose by about 0.4°C, RR by 3 per minute, HR by 5 bpm, and SpO2 by 5% following KMC sessions. Although modest, these changes were statistically significant on all 3 days. Individual abnormalities (e.g. hypothermia, bradycardia, tachycardia, low SpO2) were often corrected during the KMC sessions. Babies receiving KMC showed modest but statistically significant improvement in vital physiological parameters on all 3 days. Thus, without using special equipment, the KMC strategy can offer improved care to LBW babies. These findings support wider implementation of this strategy.

  3. Effects of pure and hybrid iterative reconstruction algorithms on high-resolution computed tomography in the evaluation of interstitial lung disease.

    PubMed

    Katsura, Masaki; Sato, Jiro; Akahane, Masaaki; Mise, Yoko; Sumida, Kaoru; Abe, Osamu

    2017-08-01

    To compare image quality characteristics of high-resolution computed tomography (HRCT) in the evaluation of interstitial lung disease using three different reconstruction methods: model-based iterative reconstruction (MBIR), adaptive statistical iterative reconstruction (ASIR), and filtered back projection (FBP). Eighty-nine consecutive patients with interstitial lung disease underwent standard-of-care chest CT with 64-row multi-detector CT. HRCT images were reconstructed in 0.625-mm contiguous axial slices using FBP, ASIR, and MBIR. Two radiologists independently assessed the images in a blinded manner for subjective image noise, streak artifacts, and visualization of normal and pathologic structures. Objective image noise was measured in the lung parenchyma. Spatial resolution was assessed by measuring the modulation transfer function (MTF). MBIR offered significantly lower objective image noise (22.24±4.53, P<0.01 among all pairs, Student's t-test) compared with ASIR (39.76±7.41) and FBP (51.91±9.71). MTF (spatial resolution) was increased using MBIR compared with ASIR and FBP. MBIR showed improvements in visualization of normal and pathologic structures over ASIR and FBP, while ASIR was rated quite similarly to FBP. MBIR significantly improved subjective image noise (P<0.01 among all pairs, the sign test), and streak artifacts (P<0.01 each for MBIR vs. the other 2 image data sets). MBIR provides high-quality HRCT images for interstitial lung disease by reducing image noise and streak artifacts and improving spatial resolution compared with ASIR and FBP. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Dynamic routing and spectrum assignment based on multilayer virtual topology and ant colony optimization in elastic software-defined optical networks

    NASA Astrophysics Data System (ADS)

    Wang, Fu; Liu, Bo; Zhang, Lijia; Zhang, Qi; Tian, Qinghua; Tian, Feng; Rao, Lan; Xin, Xiangjun

    2017-07-01

    Elastic software-defined optical networks greatly improve the flexibility of the optical switching network while it has brought challenges to the routing and spectrum assignment (RSA). A multilayer virtual topology model is proposed to solve RSA problems. Two RSA algorithms based on the virtual topology are proposed, which are the ant colony optimization (ACO) algorithm of minimum consecutiveness loss and the ACO algorithm of maximum spectrum consecutiveness. Due to the computing power of the control layer in the software-defined network, the routing algorithm avoids the frequent link-state information between routers. Based on the effect of the spectrum consecutiveness loss on the pheromone in the ACO, the path and spectrum of the minimal impact on the network are selected for the service request. The proposed algorithms have been compared with other algorithms. The results show that the proposed algorithms can reduce the blocking rate by at least 5% and perform better in spectrum efficiency. Moreover, the proposed algorithms can effectively decrease spectrum fragmentation and enhance available spectrum consecutiveness.

  5. Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion

    PubMed Central

    Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.

    2014-01-01

    The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089

  6. Imidazopyridine/Pyrrole and hydroxybenzimidazole/pyrrole pairs for DNA minor groove recognition.

    PubMed

    Renneberg, Dorte; Dervan, Peter B

    2003-05-14

    The DNA binding properties of fused heterocycles imidazo[4,5-b]pyridine (Ip) and hydroxybenzimidazole (Hz) paired with pyrrole (Py) in eight-ring hairpin polyamides are reported. The recognition profile of Ip/Py and Hz/Py pairs were compared to the five-membered ring pairs Im/Py and Hp/Py on a DNA restriction fragment at four 6-base pair recognition sites which vary at a single position 5'-TGTNTA-3', where N = G, C, T, A. The Ip/Py pair distinguishes G.C from C.G, T.A, and A.T, and the Hz/Py pair distinguishes T.A from A.T, G.C, and C.G, affording a new set of heterocycle pairs to target the four Watson-Crick base pairs in the minor groove of DNA.

  7. AExaCTT - Aerobic Exercise and Consecutive Task-specific Training for the upper limb after stroke: Protocol for a randomised controlled pilot study.

    PubMed

    Valkenborghs, Sarah R; Visser, Milanka M; Dunn, Ashlee; Erickson, Kirk I; Nilsson, Michael; Callister, Robin; van Vliet, Paulette

    2017-09-01

    Motor function may be enhanced if aerobic exercise is paired with motor training. One potential mechanism is that aerobic exercise increases levels of brain-derived neurotrophic factor (BDNF), which is important in neuroplasticity and involved in motor learning and motor memory consolidation. This study will examine the feasibility of a parallel-group assessor-blinded randomised controlled trial investigating whether task-specific training preceded by aerobic exercise improves upper limb function more than task-specific training alone, and determine the effect size of changes in primary outcome measures. People with upper limb motor dysfunction after stroke will be allocated to either task-specific training or aerobic exercise and consecutive task-specific training. Both groups will perform 60 hours of task-specific training over 10 weeks, comprised of 3 × 1 hour sessions per week with a therapist and 3 × 1 hours of home-based self-practice per week. The combined intervention group will also perform 30 minutes of aerobic exercise (70-85%HR max ) immediately prior to the 1 hour of task-specific training with the therapist. Recruitment, adherence, retention, participant acceptability, and adverse events will be recorded. Clinical outcome measures will be performed pre-randomisation at baseline, at completion of the training program, and at 1 and 6 months follow-up. Primary clinical outcome measures will be the Action Research Arm Test (ARAT) and the Wolf Motor Function Test (WMFT). If aerobic exercise prior to task-specific training is acceptable, and a future phase 3 randomised controlled trial seems feasible, it should be pursued to determine the efficacy of this combined intervention for people after stroke.

  8. Guanosine 2-NH2 groups of Escherichia coli RNase P RNA involved in intramolecular tertiary contacts and direct interactions with tRNA.

    PubMed Central

    Heide, C; Pfeiffer, T; Nolan, J M; Hartmann, R K

    1999-01-01

    We have identified by nucleotide analog interference mapping (NAIM) exocyclic NH2 groups of guanosines in RNase P RNA from Escherichia coli that are important for tRNA binding. The majority of affected guanosines represent phylogenetically conserved nucleotides. Several sites of interference could be assigned to direct contacts with the tRNA moiety, whereas others were interpreted as reflecting indirect effects on tRNA binding due to the disruption of tertiary contacts within the catalytic RNA. Our results support the involvement of the 2-NH2 groups of G292/G293 in pairing with C74 and C75 of tRNA CCA-termini, as well as formation of two consecutive base triples involving C75 and A76 of CCA-ends interacting with G292/A258 and G291/G259, respectively. Moreover, we present first biochemical evidence for two tertiary contacts (L18/P8 and L8/P4) within the catalytic RNA, whose formation has been postulated previously on the basis of phylogenetic comparative analyses. The tRNA binding interference data obtained in this and our previous studies are consistent with the formation of a consecutive nucleotide triple and quadruple between the tetraloop L18 and helix P8. Formation of the nucleotide triple (G316 and A94:U104 in wild-type E. coli RNase P RNA) is also supported by mutational analysis. For the mutant RNase P RNA carrying a G94:C104 double mutation, an additional G316-to-A mutation resulted in a restoration of binding affinity for mature and precursor tRNA. PMID:9917070

  9. A novel method of continuous measurement of head of bed elevation in ventilated patients.

    PubMed

    Balonov, Konstantin; Miller, Andrew D; Lisbon, Alan; Kaynar, A Murat

    2007-06-01

    We developed a novel pressure transducer-based method of continuous measurement of head of bed elevation. Following validation of the method we hypothesized that head of bed angles would be at or above 30 degrees among mechanically ventilated patients throughout the day due to a hospital-wide initiative on ventilator-associated pneumonia prevention and standardized electronic order entry system to keep head of bed at an angle of 30 degrees or greater. Prospective observational study in university hospital intensive care units. Twenty-nine consecutive mechanically ventilated patients with no contraindications for semirecumbency. We acquired 113 pairs of measurements on unused beds for validation of the method at angles between 3 degrees and 70 degrees. Correlation between transducer and protractor was fitted into a linear regression model (R2 = 0.98) with minimal variation of data along the line of equality. Bland-Altman analysis showed a mean difference of 1.6 degrees +/- 1.6 degrees. Ninety-six percent of differences were within 2 SD from the mean. This method was then used among 29 intubated patients to collect head of bed data over a 24-h period for 3 consecutive days. Contrary to our hypothesis, all patients had head of bed angles less than 30 degrees. Our results suggest that this method could be used with high reliability and patients in our institution were not kept even at 30 degrees. The results are in accord with those of a recent study which found that continued maintenance of previously suggested head of bed angles was difficult to attain clinically. This may lead us to reevaluate methods studying the impact of head of bed elevation in VAP prevention.

  10. Stacking interactions and DNA intercalation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Dr. Shen; Cooper, Valentino R; Thonhauser, Prof. Timo

    2009-01-01

    The relationship between stacking interactions and the intercalation of proflavine and ellipticine within DNA is investigated using a nonempirical van der Waals density functional for the correlation energy. Our results, employing a binary stack model, highlight fundamental, qualitative differences between base-pair base-pair interactions and that of the stacked intercalator base pair system. Most notable result is the paucity of torque which so distinctively defines the Twist of DNA. Surprisingly, this model, when combined with a constraint on the twist of the surrounding base-pair steps to match the observed unwinding of the sugar-phosphate backbone, was sufficient for explaining the experimentally observedmore » proflavine intercalator configuration. Our extensive mapping of the potential energy surface of base-pair intercalator interactions can provide valuable information for future nonempirical studies of DNA intercalation dynamics.« less

  11. TH-A-BRF-02: BEST IN PHYSICS (JOINT IMAGING-THERAPY) - Modeling Tumor Evolution for Adaptive Radiation Therapy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Y; Lee, CG; Chan, TCY

    2014-06-15

    Purpose: To develop mathematical models of tumor geometry changes under radiotherapy that may support future adaptive paradigms. Methods: A total of 29 cervical patients were scanned using MRI, once for planning and weekly thereafter for treatment monitoring. Using the tumor volumes contoured by a radiologist, three mathematical models were investigated based on the assumption of a stochastic process of tumor evolution. The “weekly MRI” model predicts tumor geometry for the following week from the last two consecutive MRI scans, based on the voxel transition probability. The other two models use only the first pair of consecutive MRI scans, and themore » transition probabilities were estimated via tumor type classified from the entire data set. The classification is based on either measuring the tumor volume (the “weekly volume” model), or implementing an auxiliary “Markov chain” model. These models were compared to a constant volume approach that represents the current clinical practice, using various model parameters; e.g., the threshold probability β converts the probability map into a tumor shape (larger threshold implies smaller tumor). Model performance was measured using volume conformity index (VCI), i.e., the union of the actual target and modeled target volume squared divided by product of these two volumes. Results: The “weekly MRI” model outperforms the constant volume model by 26% on average, and by 103% for the worst 10% of cases in terms of VCI under a wide range of β. The “weekly volume” and “Markov chain” models outperform the constant volume model by 20% and 16% on average, respectively. They also perform better than the “weekly MRI” model when β is large. Conclusion: It has been demonstrated that mathematical models can be developed to predict tumor geometry changes for cervical cancer undergoing radiotherapy. The models can potentially support adaptive radiotherapy paradigm by reducing normal tissue dose. This research was supported in part by the Ontario Consortium for Adaptive Interventions in Radiation Oncology (OCAIRO) funded by the Ontario Research Fund (ORF) and the MITACS Accelerate Internship Program.« less

  12. Box Cello Middle School Science Clubs

    NASA Astrophysics Data System (ADS)

    Vandegrift, Guy

    1998-10-01

    The Box Cello is a middle school science club which is attempting to (1) understand the cello and (2) design a low-cost starter instrument. We can support and justify this research by adding a third goal: (3) to help supply local science classes with equipment. My policy of spending one entire day each week away from the university, out in a local school is essential to this project. This schedule also permits me to conduct lessons on optics and music in the schools. And, it permits circulation of tools and equipment. A simple calculation demonstrates the great economy achieved by combining science clubs with academic year school visits. Consider the cost of letting 10,000 students in 10 middle schools each learn about and play with a pair of "upside-down" glasses for one hour. A visit to each school for three consecutive weeks would easily permit such a circulation if only 30 pairs were constructed. Assume rhetorically, that the construction of 30 pairs of glasses were to consume the entire estimated annual budget of $100,000. The cost per student would be only ten dollars! The visits, guest lectures, and equipment loans permit informal networking (including lunch) with math, science and music teachers in 10 schools. For more information, visit the http://www.utep.edu/boxcello/

  13. Development and evaluation of a crowdsourcing methodology for knowledge base construction: identifying relationships between clinical problems and medications

    PubMed Central

    Wright, Adam; Laxmisan, Archana; Ottosen, Madelene J; McCoy, Jacob A; Butten, David; Sittig, Dean F

    2012-01-01

    Objective We describe a novel, crowdsourcing method for generating a knowledge base of problem–medication pairs that takes advantage of manually asserted links between medications and problems. Methods Through iterative review, we developed metrics to estimate the appropriateness of manually entered problem–medication links for inclusion in a knowledge base that can be used to infer previously unasserted links between problems and medications. Results Clinicians manually linked 231 223 medications (55.30% of prescribed medications) to problems within the electronic health record, generating 41 203 distinct problem–medication pairs, although not all were accurate. We developed methods to evaluate the accuracy of the pairs, and after limiting the pairs to those meeting an estimated 95% appropriateness threshold, 11 166 pairs remained. The pairs in the knowledge base accounted for 183 127 total links asserted (76.47% of all links). Retrospective application of the knowledge base linked 68 316 medications not previously linked by a clinician to an indicated problem (36.53% of unlinked medications). Expert review of the combined knowledge base, including inferred and manually linked problem–medication pairs, found a sensitivity of 65.8% and a specificity of 97.9%. Conclusion Crowdsourcing is an effective, inexpensive method for generating a knowledge base of problem–medication pairs that is automatically mapped to local terminologies, up-to-date, and reflective of local prescribing practices and trends. PMID:22582202

  14. Delivered volumes of enteral nutrition exceed prescribed volumes.

    PubMed

    Walker, Renee Nichole; Utech, Anne; Velez, Maria Eugenia; Schwartz, Katie

    2014-10-01

    Enteral nutrition (EN) provisions are typically calculated based on a 24-hour infusion period. However, feedings are often interrupted for daily activities, procedures, or gastrointestinal intolerance. The study's objective was to determine the delivered EN quantities provided to stable hospitalized patients, using cellular time and measured volumes to verify our EN calculation adjustment. A supply of consecutively numbered ready-to-hang (RTH) EN product was delivered to the bedside of 26 inpatients with established EN tolerance at goal rates on various types of nursing units. The dietitian weighed the volume remaining in the infusing product and recorded the measurement time. On the following days, the dietitian continued to weigh the infusing RTH product and the empty RTH bottles saved by nursing. The primary outcome was the difference between the prescribed and delivered EN provisions, which was calculated with a paired t test. Patients received significantly more calories in the delivered enteral feeding (mean [SD], 1678 [385] kcal) than prescribed calories in the EN order (1489 [246 kcal]; t = 3.736, P = .001), adjusting for observed time. No significant differences were found between nursing units, product, and rate. EN delivered may actually exceed ordered amounts by 5%–21% (mean, 12%) with feeding pump inaccuracy as the primary contributing factor. This differs from what others have found. Our findings support using a volume-based ordering system vs a rate-based ordering system for more accurate EN delivery.

  15. Acuity of a Cryptochrome and Vision-Based Magnetoreception System in Birds

    PubMed Central

    Solov'yov, Ilia A.; Mouritsen, Henrik; Schulten, Klaus

    2010-01-01

    Abstract The magnetic compass of birds is embedded in the visual system and it has been hypothesized that the primary sensory mechanism is based on a radical pair reaction. Previous models of magnetoreception have assumed that the radical pair-forming molecules are rigidly fixed in space, and this assumption has been a major objection to the suggested hypothesis. In this article, we investigate theoretically how much disorder is permitted for the radical pair-forming, protein-based magnetic compass in the eye to remain functional. Our study shows that only one rotational degree of freedom of the radical pair-forming protein needs to be partially constrained, while the other two rotational degrees of freedom do not impact the magnetoreceptive properties of the protein. The result implies that any membrane-associated protein is sufficiently restricted in its motion to function as a radical pair-based magnetoreceptor. We relate our theoretical findings to the cryptochromes, currently considered the likeliest candidate to furnish radical pair-based magnetoreception. PMID:20655831

  16. A structural determinant in the uracil DNA glycosylase superfamily for the removal of uracil from adenine/uracil base pairs

    PubMed Central

    Lee, Dong-Hoon; Liu, Yinling; Lee, Hyun-Wook; Xia, Bo; Brice, Allyn R.; Park, Sung-Hyun; Balduf, Hunter; Dominy, Brian N.; Cao, Weiguo

    2015-01-01

    The uracil DNA glycosylase superfamily consists of several distinct families. Family 2 mismatch-specific uracil DNA glycosylase (MUG) from Escherichia coli is known to exhibit glycosylase activity on three mismatched base pairs, T/U, G/U and C/U. Family 1 uracil N-glycosylase (UNG) from E. coli is an extremely efficient enzyme that can remove uracil from any uracil-containing base pairs including the A/U base pair. Here, we report the identification of an important structural determinant that underlies the functional difference between MUG and UNG. Substitution of a Lys residue at position 68 with Asn in MUG not only accelerates the removal of uracil from mismatched base pairs but also enables the enzyme to gain catalytic activity on A/U base pairs. Binding and kinetic analysis demonstrate that the MUG-K68N substitution results in enhanced ground state binding and transition state interactions. Molecular modeling reveals that MUG-K68N, UNG-N123 and family 5 Thermus thermophiles UDGb-A111N can form bidentate hydrogen bonds with the N3 and O4 moieties of the uracil base. Genetic analysis indicates the gain of function for A/U base pairs allows the MUG-K68N mutant to remove uracil incorporated into the genome during DNA replication. The implications of this study in the origin of life are discussed. PMID:25550433

  17. Structural features of the DNA hairpin d(ATCCTA-GTTA-TAGGAT): formation of a G-A base pair in the loop.

    PubMed Central

    van Dongen, M J; Mooren, M M; Willems, E F; van der Marel, G A; van Boom, J H; Wijmenga, S S; Hilbers, C W

    1997-01-01

    The three-dimensional structure of the hairpin formed by d(ATCCTA-GTTA-TAGGAT) has been determined by means of two-dimensional NMR studies, distance geometry and molecular dynamics calculations. The first and the last residues of the tetraloop of this hairpin form a sheared G-A base pair on top of the six Watson-Crick base pairs in the stem. The glycosidic torsion angles of the guanine and adenine residues in the G-A base pair reside in the anti and high- anti domain ( approximately -60 degrees ) respectively. Several dihedral angles in the loop adopt non-standard values to accommodate this base pair. The first and second residue in the loop are stacked in a more or less normal helical fashion; the fourth loop residue also stacks upon the stem, while the third residue is directed away from the loop region. The loop structure can be classified as a so-called type-I loop, in which the bases at the 5'-end of the loop stack in a continuous fashion. In this situation, loop stability is unlikely to depend heavily on the nature of the unpaired bases in the loop. Moreover, the present study indicates that the influence of the polarity of a closing A.T pair is much less significant than that of a closing C.G base pair. PMID:9092659

  18. Gist-Based Memory for Prices and ‘Better Buys’ in Younger and Older Adults

    PubMed Central

    Flores, Cynthia C.; Hargis, Mary B.; McGillivray, Shannon; Friedman, Michael C.; Castel, Alan D.

    2016-01-01

    Aging typically leads to various memory deficits which results in older adults’ tendency to remember more general information and rely on gist memory. The current study examined if younger and older adults could remember which of two comparable grocery items (e.g., two similar but different jams) was paired with a lower price (the “better buy”). Participants studied lists of grocery items and their prices, in which the two items in each category were presented consecutively (Experiment 1), or separated by intervening items (Experiment 2). At test, participants were asked to identify the “better buy” and recall the price of both items. There were negligible age-related differences for the “better buy” in Experiment 1, but age-related differences were present in Experiment 2 when there were greater memory demands involved in comparing the two items. Together, these findings suggest that when price information of two items can be evaluated and compared within a short period of time, older adults can form stable gist-based memory for prices, but that this is impaired with longer delays. We relate the findings to age-related changes in the use of gist and verbatim memory when remembering prices, as well as the associative deficit account of cognitive aging. PMID:27310613

  19. The VISPA Internet Platform for Students

    NASA Astrophysics Data System (ADS)

    Asseldonk, D. v.; Erdmann, M.; Fischer, R.; Glaser, C.; Müller, G.; Quast, T.; Rieger, M.; Urban, M.

    2016-04-01

    The VISPA internet platform enables users to remotely run Python scripts and view resulting plots or inspect their output data. With a standard web browser as the only user requirement on the client-side, the system becomes suitable for blended learning approaches for university physics students. VISPA was used in two consecutive years each by approx. 100 third year physics students at the RWTH Aachen University for their homework assignments. For example, in one exercise students gained a deeper understanding of Einsteins mass-energy relation by analyzing experimental data of electron-positron pairs revealing J / Ψ and Z particles. Because the students were free to choose their working hours, only few users accessed the platform simultaneously. The positive feedback from students and the stability of the platform lead to further development of the concept. This year, students accessed the platform in parallel while they analyzed the data recorded by demonstrated experiments live in the lecture hall. The platform is based on experience in the development of professional analysis tools. It combines core technologies from previous projects: an object-oriented C++ library, a modular data-driven analysis flow, and visual analysis steering. We present the platform and discuss its benefits in the context of teaching based on surveys that are conducted each semester.

  20. Gist-based memory for prices and "better buys" in younger and older adults.

    PubMed

    Flores, Cynthia C; Hargis, Mary B; McGillivray, Shannon; Friedman, Michael C; Castel, Alan D

    2017-04-01

    Ageing typically leads to various memory deficits which results in older adults' tendency to remember more general information and rely on gist memory. The current study examined if younger and older adults could remember which of two comparable grocery items (e.g., two similar but different jams) was paired with a lower price (the "better buy"). Participants studied lists of grocery items and their prices, in which the two items in each category were presented consecutively (Experiment 1), or separated by intervening items (Experiment 2). At test, participants were asked to identify the "better buy" and recall the price of both items. There were negligible age-related differences for the "better buy" in Experiment 1, but age-related differences were present in Experiment 2 when there were greater memory demands involved in comparing the two items. Together, these findings suggest that when price information of two items can be evaluated and compared within a short period of time, older adults can form stable gist-based memory for prices, but that this is impaired with longer delays. We relate the findings to age-related changes in the use of gist and verbatim memory when remembering prices, as well as the associative deficit account of cognitive ageing.

  1. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

    PubMed

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

    2009-03-18

    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

  2. Indirect genetic effect model using feeding behaviour traits to define the degree of interaction between mates: an implementation in pigs growth rate.

    PubMed

    Ragab, M; Piles, M; Quintanilla, R; Sánchez, J P

    2018-06-06

    An alternative implementation of the animal model including indirect genetic effect (IGE) is presented considering pair-mate-specific interaction degrees to improve the performance of the model. Data consisted of average daily gain (ADG) records from 663 pigs kept in groups of 10 to 14 mates during the fattening period. Three types of models were used to fit ADG data: (i) animal model (AM); (ii) AM with classical IGE (AM-IGE); and (iii) AM fitting IGE with a specific degree of interaction between each pair of mates (AM-IGEi). Several feeding behavior phenotypes were used to define the pair-mate-specific degree of interaction in AM-IGEi: feeding rate (g/min), feeding frequency (min/day), the time between consecutive visits to the feeder (min/day), occupation time (min/day) and an index considering all these variables. All models included systematic effects batch, initial age (covariate), final age (covariate), number of pigs per pen (covariate), plus the random effect of the pen. Estimated posterior mean (posterior SD) of heritability was 0.47 (0.15) using AM. Including social genetic effects in the model, total heritable variance expressed as a proportion of total phenotypic variance (T 2) was 0.54 (0.29) using AM-IGE, whereas it ranged from 0.51 to 0.55 (0.12 to 0.14) with AM-IGEi, depending on the behavior trait used to define social interactions. These results confirm the contribution of IGEs to the total heritable variation of ADG. Moreover, important differences between models were observed in EBV rankings. The percentage of coincidence of top 10% animals between AM and AM-IGEi ranged from 0.44 to 0.89 and from 0.41to 0.68 between AM-IGE and AM-IGEi. Based on the goodness of fit and predictive ability, social models are preferred for the genetic evaluation of ADG. Among models including IGEs, when the pair-specific degree of interaction was defined using feeding behavior phenotypes we obtained an increase in the accuracy of genetic parameters estimates, the better goodness of fit and higher predictive ability. We conclude that feeding behavior variables can be used to measure the interaction between pen mates and to improve the performance of models including IGEs.

  3. Theory of nodal s ±-wave pairing symmetry in the Pu-based 115 superconductor family

    DOE PAGES

    Das, Tanmoy; Zhu, Jian -Xin; Graf, Matthias J.

    2015-02-27

    The spin-fluctuation mechanism of superconductivity usually results in the presence of gapless or nodal quasiparticle states in the excitation spectrum. Nodal quasiparticle states are well established in copper-oxide, and heavy-fermion superconductors, but not in iron-based superconductors. Here, we study the pairing symmetry and mechanism of a new class of plutonium-based high-T c superconductors and predict the presence of a nodal s⁺⁻ wave pairing symmetry in this family. Starting from a density-functional theory (DFT) based electronic structure calculation we predict several three-dimensional (3D) Fermi surfaces in this 115 superconductor family. We identify the dominant Fermi surface “hot-spots” in the inter-band scatteringmore » channel, which are aligned along the wavevector Q = (π, π, π), where degeneracy could induce sign-reversal of the pairing symmetry. Our calculation demonstrates that the s⁺⁻ wave pairing strength is stronger than the previously thought d-wave pairing; and more importantly, this pairing state allows for the existence of nodal quasiparticles. Finally, we predict the shape of the momentum- and energy-dependent magnetic resonance spectrum for the identification of this pairing symmetry.« less

  4. Growth properties associated with A-U replacement of specific G-C base pairs in 16S rRNA from Escherichia coli.

    PubMed Central

    Triman, K L

    1995-01-01

    Mutations that disrupt each of seven specific G-C base pairs in 16S rRNA from Escherichia coli confer loss of expression of a plasmid-encoded 16S rRNA selectable marker (spectinomycin resistance). However, A-U replacement of G-C base pairs at nucleotides 359/52 or 1292/1245 in 16S rRNA permits normal expression of the marker. By contrast, A-U replacements at 146/176, 153/168, 350/339, or 1293/1244 are associated with loss of expression of the marker. These genetic studies are designed to determine the importance of specific base pairs by assessment of the structural and functional impairments of 16S rRNA molecules resulting from expression of base pair substitutions at these positions. PMID:7543481

  5. Experimental demonstration of wavelength domain rogue-free ONU based on wavelength-pairing for TDM/WDM optical access networks.

    PubMed

    Lee, Jie Hyun; Park, Heuk; Kang, Sae-Kyoung; Lee, Joon Ki; Chung, Hwan Seok

    2015-11-30

    In this study, we propose and experimentally demonstrate a wavelength domain rogue-free ONU based on wavelength-pairing of downstream and upstream signals for time/wavelength division-multiplexed optical access networks. The wavelength-pairing tunable filter is aligned to the upstream wavelength channel by aligning it to one of the downstream wavelength channels. Wavelength-pairing is implemented with a compact and cyclic Si-AWG integrated with a Ge-PD. The pairing filter covered four 100 GHz-spaced wavelength channels. The feasibility of the wavelength domain rogue-free operation is investigated by emulating malfunction of the misaligned laser. The wavelength-pairing tunable filter based on the Si-AWG blocks the upstream signal in the non-assigned wavelength channel before data collision with other ONUs.

  6. Orbital selective pairing and gap structures of iron-based superconductors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kreisel, Andreas; Andersen, Brian M.; Sprau, P. O.

    We discuss the in uence on spin-fluctuation pairing theory of orbital selective strong correlation effects in Fe-based superconductors, particularly Fe chalcogenide systems. We propose that a key ingredient for an improved itinerant pairing theory is orbital selectivity, i.e., incorporating the reduced coherence of quasiparticles occupying specific orbital states. This modifies the usual spin-fluctuation via suppression of pair scattering processes involving those less coherent states and results in orbital selective Cooper pairing of electrons in the remaining states. We show that this paradigm yields remarkably good agreement with the experimentally observed anisotropic gap structures in both bulk and monolayer FeSe, asmore » well as LiFeAs, indicating that orbital selective Cooper pairing plays a key role in the more strongly correlated iron-based superconductors.« less

  7. Orbital selective pairing and gap structures of iron-based superconductors

    DOE PAGES

    Kreisel, Andreas; Andersen, Brian M.; Sprau, P. O.; ...

    2017-05-08

    We discuss the in uence on spin-fluctuation pairing theory of orbital selective strong correlation effects in Fe-based superconductors, particularly Fe chalcogenide systems. We propose that a key ingredient for an improved itinerant pairing theory is orbital selectivity, i.e., incorporating the reduced coherence of quasiparticles occupying specific orbital states. This modifies the usual spin-fluctuation via suppression of pair scattering processes involving those less coherent states and results in orbital selective Cooper pairing of electrons in the remaining states. We show that this paradigm yields remarkably good agreement with the experimentally observed anisotropic gap structures in both bulk and monolayer FeSe, asmore » well as LiFeAs, indicating that orbital selective Cooper pairing plays a key role in the more strongly correlated iron-based superconductors.« less

  8. Acid-induced exchange of the imino proton in G.C pairs.

    PubMed Central

    Nonin, S; Leroy, J L; Gueron, M

    1996-01-01

    Acid-induced catalysis of imino proton exchange in G.C pairs of DNA duplexes is surprisingly fast, being nearly as fast as for the isolated nucleoside, despite base-pair dissociation constants in the range of 10(-5) at neutral or basic pH. It is also observed in terminal G.C pairs of duplexes and in base pairs of drug-DNA complexes. We have measured imino proton exchange in deoxyguanosine and in the duplex (ATATAGATCTATAT) as a function of pH. We show that acid-induced exchange can be assigned to proton transfer from N7-protonated guanosine to cytidine in the open state of the pair. This is faster than transfer from neutral guanosine (the process of intrinsic catalysis previously characterized at neutral ph) due to the lower imino proton pK of the protonated form, 7.2 instead of 9.4. Other interpretations are excluded by a study of exchange catalysis by formiate and cytidine as exchange catalysts. The cross-over pH between the regimes of pH-independent and acid-induced exchange rates is more basic in the case of base pairs than in the mononucleoside, suggestive of an increase by one to two decades in the dissociation constant of the base pair upon N7 protonation of G. Acid-induced catalysis is much weaker in A.T base pairs, as expected in view of the low pK for protonation of thymidine. PMID:8604298

  9. Acid-induced exchange of the imino proton in G.C pairs.

    PubMed

    Nonin, S; Leroy, J L; Gueron, M

    1996-02-15

    Acid-induced catalysis of imino proton exchange in G.C pairs of DNA duplexes is surprisingly fast, being nearly as fast as for the isolated nucleoside, despite base-pair dissociation constants in the range of 10(-5) at neutral or basic pH. It is also observed in terminal G.C pairs of duplexes and in base pairs of drug-DNA complexes. We have measured imino proton exchange in deoxyguanosine and in the duplex (ATATAGATCTATAT) as a function of pH. We show that acid-induced exchange can be assigned to proton transfer from N7-protonated guanosine to cytidine in the open state of the pair. This is faster than transfer from neutral guanosine (the process of intrinsic catalysis previously characterized at neutral ph) due to the lower imino proton pK of the protonated form, 7.2 instead of 9.4. Other interpretations are excluded by a study of exchange catalysis by formiate and cytidine as exchange catalysts. The cross-over pH between the regimes of pH-independent and acid-induced exchange rates is more basic in the case of base pairs than in the mononucleoside, suggestive of an increase by one to two decades in the dissociation constant of the base pair upon N7 protonation of G. Acid-induced catalysis is much weaker in A.T base pairs, as expected in view of the low pK for protonation of thymidine.

  10. Characterization of consecutive Streptococcus pyogenes isolates from patients with pharyngitis and bacteriological treatment failure: special reference to prtF1 and sic / drs.

    PubMed

    Brandt, C M; Allerberger, F; Spellerberg, B; Holland, R; Lütticken, R; Haase, G

    2001-02-15

    To analyze bacteriological treatment failure in streptococcal pharyngitis, 40 consecutive Streptococcus pyogenes isolates from 18 patients were characterized. For 17 patients, isolates were indistinguishable with respect to emm type, random amplified polymorphic DNA pattern, and presence of prtF1 encoding the fibronectin-binding protein F1. prtF1 was detected only in the 11 isolates (4 patients) with emm12 and in the single isolate with emm6. Further analysis by vir(mga) regulon typing, sequencing of sic encoding the streptococcal inhibitor of complement from 19 isolates with emm1 (9 patients), and sequencing of drs (distantly related sic) from 11 isolates with emm12 revealed distinct sic alleles with insertions and/or deletions in sic that corresponded to differences in restriction patterns of the vir(mga) regulon only for paired isolates of 2 patients. Among isolates with emm12, 2 novel drs alleles were found. Analysis of these data suggests that neither the presence of prtF1 nor the diversification of sic / drs is required for the persistence of S. pyogenes in pharyngitis.

  11. Developing Topological Insulator Fiber Based Photon Pairs Source for Ultrafast Optoelectronic Applications

    DTIC Science & Technology

    2016-04-01

    DEVELOPING TOPOLOGICAL INSULATOR FIBER BASED PHOTON PAIRS SOURCE FOR ULTRAFAST OPTOELECTRONIC APPLICATIONS NORTHWESTERN UNIVERSITY...REPORT TYPE FINAL TECHNICAL REPORT 3. DATES COVERED (From - To) APRIL 2015 – DEC 2015 4. TITLE AND SUBTITLE DEVELOPING TOPOLOGICAL INSULATOR FIBER BASED...in developing a new source for the production of correlated/entangled photon pairs based on the unique nanolayer properties of topological insulator

  12. Base pairing among three cis-acting sequences contributes to template switching during hepadnavirus reverse transcription.

    PubMed

    Liu, Ning; Tian, Ru; Loeb, Daniel D

    2003-02-18

    Synthesis of the relaxed-circular (RC) DNA genome of hepadnaviruses requires two template switches during plus-strand DNA synthesis: primer translocation and circularization. Although primer translocation and circularization use different donor and acceptor sequences, and are distinct temporally, they share the common theme of switching from one end of the minus-strand template to the other end. Studies of duck hepatitis B virus have indicated that, in addition to the donor and acceptor sequences, three other cis-acting sequences, named 3E, M, and 5E, are required for the synthesis of RC DNA by contributing to primer translocation and circularization. The mechanism by which 3E, M, and 5E act was not known. We present evidence that these sequences function by base pairing with each other within the minus-strand template. 3E base-pairs with one portion of M (M3) and 5E base-pairs with an adjacent portion of M (M5). We found that disrupting base pairing between 3E and M3 and between 5E and M5 inhibited primer translocation and circularization. More importantly, restoring base pairing with mutant sequences restored the production of RC DNA. These results are consistent with the model that, within duck hepatitis B virus capsids, the ends of the minus-strand template are juxtaposed via base pairing to facilitate the two template switches during plus-strand DNA synthesis.

  13. Loss of G-A base pairs is insufficient for achieving a large opening of U4 snRNA K-turn motif.

    PubMed

    Cojocaru, Vlad; Klement, Reinhard; Jovin, Thomas M

    2005-01-01

    Upon binding to the 15.5K protein, two tandem-sheared G-A base pairs are formed in the internal loop of the kink-turn motif of U4 snRNA (Kt-U4). We have reported that the folding of Kt-U4 is assisted by protein binding. Unstable interactions that contribute to a large opening of the free RNA ('k-e motion') were identified using locally enhanced sampling molecular dynamics simulations, results that agree with experiments. A detailed analysis of the simulations reveals that the k-e motion in Kt-U4 is triggered both by loss of G-A base pairs in the internal loop and backbone flexibility in the stems. Essential dynamics show that the loss of G-A base pairs is correlated along the first mode but anti-correlated along the third mode with the k-e motion. Moreover, when enhanced sampling was confined to the internal loop, the RNA adopted an alternative conformation characterized by a sharper kink, opening of G-A base pairs and modified stacking interactions. Thus, loss of G-A base pairs is insufficient for achieving a large opening of the free RNA. These findings, supported by previously published RNA structure probing experiments, suggest that G-A base pair formation occurs upon protein binding, thereby stabilizing a selective orientation of the stems.

  14. Individual Characteristics vs. Experience: An Experimental Study on Cooperation in Prisoner's Dilemma

    PubMed Central

    Barreda-Tarrazona, Iván; Jaramillo-Gutiérrez, Ainhoa; Pavan, Marina; Sabater-Grande, Gerardo

    2017-01-01

    Cooperative behavior is often assumed to depend on individuals' characteristics, such as altruism and reasoning ability. Evidence is mixed about what the precise impact of these characteristics is, as the subjects of study are generally randomly paired, generating a heterogeneous mix of the two characteristics. In this study we ex-ante create four different groups of subjects by factoring their higher or lower than the median scores in both altruism and reasoning ability. Then we use these groups in order to analyze the joint effect of the two characteristics on the individual choice of cooperating and on successful paired cooperation. Subjects belonging to each group play first 10 one-shot prisoner's dilemma (PD) games with ten random partners and then three consecutive 10-round repeated PD games with three random partners. In all games, we elicit players' beliefs regarding cooperation using an incentive compatible method. Individuals with high altruism are more optimistic about the cooperative behavior of the other player in the one-shot game. They also show higher individual cooperation and paired cooperation rates in the first repetitions of this game. Contrary to the one-shot PD games where high reasoning ability reduces the probability of playing cooperatively, the sign of the relationship is inverted in the first repeated PD game, showing that high reasoning ability individuals better adjust their behavior to the characteristics of the game they are playing. In this sense, the joint effect of reasoning ability and altruism is not linear, with reasoning ability counteracting the cooperative effect of altruism in the one-shot game and reinforcing it in the first repeated game. However, experience playing the repeated PD games takes over the two individual characteristics in explaining individual and paired cooperation. Thus, in a (PD) setting, altruism and reasoning ability significantly affect behavior in single encounters, while in repeated interactions individual and paired cooperation reach similarly high levels independently of these individual characteristics. PMID:28473787

  15. A multiobserver study of the effects of including point-of-care patient photographs with portable radiography: a means to detect wrong-patient errors.

    PubMed

    Tridandapani, Srini; Ramamurthy, Senthil; Provenzale, James; Obuchowski, Nancy A; Evanoff, Michael G; Bhatti, Pamela

    2014-08-01

    To evaluate whether the presence of facial photographs obtained at the point-of-care of portable radiography leads to increased detection of wrong-patient errors. In this institutional review board-approved study, 166 radiograph-photograph combinations were obtained from 30 patients. Consecutive radiographs from the same patients resulted in 83 unique pairs (ie, a new radiograph and prior, comparison radiograph) for interpretation. To simulate wrong-patient errors, mismatched pairs were generated by pairing radiographs from different patients chosen randomly from the sample. Ninety radiologists each interpreted a unique randomly chosen set of 10 radiographic pairs, containing up to 10% mismatches (ie, error pairs). Radiologists were randomly assigned to interpret radiographs with or without photographs. The number of mismatches was identified, and interpretation times were recorded. Ninety radiologists with 21 ± 10 (mean ± standard deviation) years of experience were recruited to participate in this observer study. With the introduction of photographs, the proportion of errors detected increased from 31% (9 of 29) to 77% (23 of 30; P = .006). The odds ratio for detection of error with photographs to detection without photographs was 7.3 (95% confidence interval: 2.29-23.18). Observer qualifications, training, or practice in cardiothoracic radiology did not influence sensitivity for error detection. There is no significant difference in interpretation time for studies without photographs and those with photographs (60 ± 22 vs. 61 ± 25 seconds; P = .77). In this observer study, facial photographs obtained simultaneously with portable chest radiographs increased the identification of any wrong-patient errors, without substantial increase in interpretation time. This technique offers a potential means to increase patient safety through correct patient identification. Copyright © 2014 AUR. Published by Elsevier Inc. All rights reserved.

  16. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

    PubMed Central

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

    2003-01-01

    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  17. [Mass spectrometric and quantum chemical study of dimeric associates of nucleosides].

    PubMed

    Sukhodub, L F; Aksenov, S A; Boldeskul, A I

    1995-01-01

    Deoxyribonucleosides H-bonded pairs were investigated using fast atom bombardment mass spectrometry and MNDO/H quantum chemistry method. It was shown that "rare" (enol or imin) forms of the nitrogen bases could form pairs with energy comparable with "canonical" base pair energy. It was shown that pair stability rows, which are measured using different experimental techniques, were in conformity each with other.

  18. Reverse transcription polymerase chain reaction protocols for cloning small circular RNAs.

    PubMed

    Navarro, B; Daròs, J A; Flores, R

    1998-07-01

    A protocol is described for general application for cloning small circular RNAs which requires only minimal amounts of template (approximately 50 ng) of unknown sequence. Both cDNA strands are synthesized with a 26-mer primer whose six 3'-terminal positions are totally degenerate in two consecutive reactions catalyzed by reverse transcriptase and DNA polymerase, respectively. The cDNAs are then PCR-amplified, using a 20-mer primer with the non-degenerate sequence of the previous primer, cloned and sequenced. This information permits the synthesis of one or more pairs of specific and adjacent primers for obtaining full-length cDNA clones by a protocol which is also described.

  19. Does a mother singing to her premature baby affect feeding in the neonatal intensive care unit?

    PubMed

    Blumenfeld, Hugh; Eisenfeld, Leonard

    2006-01-01

    Recent studies suggest that premature neonates exposed to music have reduced symptoms of stress, faster weight gain, and shorter neonatal intensive care unit (NICU) stays. This pilot study attempted to measure contingent effects of mothers' singing during feedings. Mothers sang to their babies during 2 of 4 feedings on 2 consecutive days, logging songs they sang, and subjectively evaluating each feeding. Infants' heart and respiration rates were recorded as well as duration of feeding and volume of fluid taken orally; feeding velocity and percent of feeding goal were calculated. In paired t tests, no significant benefits or deterrents assignable to the singing were observed.

  20. Twin hydroxymethyluracil-A base pair steps define the binding site for the DNA-binding protein TF1.

    PubMed

    Grove, A; Figueiredo, M L; Galeone, A; Mayol, L; Geiduschek, E P

    1997-05-16

    The DNA-bending protein TF1 is the Bacillus subtilis bacteriophage SPO1-encoded homolog of the bacterial HU proteins and the Escherichia coli integration host factor. We recently proposed that TF1, which binds with high affinity (Kd was approximately 3 nM) to preferred sites within the hydroxymethyluracil (hmU)-containing phage genome, identifies its binding sites based on sequence-dependent DNA flexibility. Here, we show that two hmU-A base pair steps coinciding with two previously proposed sites of DNA distortion are critical for complex formation. The affinity of TF1 is reduced 10-fold when both of these hmU-A base pair steps are replaced with A-hmU, G-C, or C-G steps; only modest changes in affinity result when substitutions are made at other base pairs of the TF1 binding site. Replacement of all hmU residues with thymine decreases the affinity of TF1 greatly; remarkably, the high affinity is restored when the two hmU-A base pair steps corresponding to previously suggested sites of distortion are reintroduced into otherwise T-containing DNA. T-DNA constructs with 3-base bulges spaced apart by 9 base pairs of duplex also generate nM affinity of TF1. We suggest that twin hmU-A base pair steps located at the proposed sites of distortion are key to target site selection by TF1 and that recognition is based largely, if not entirely, on sequence-dependent DNA flexibility.

  1. Use of the Blom Tracheotomy Tube with Suction Inner Cannula to Decontaminate Microorganisms from the Subglottic Space. A Proof of Concept.

    PubMed

    Rabach, Lesley; Siegel, Mark D; Puchalski, Jonathan T; Towle, Dana; Follert, Michelle; Johnson, Kelsey M; Rademaker, Alfred W; Leder, Steven B

    2015-06-01

    Preventing pulmonary complications during mechanical ventilation via tracheotomy is a high priority. To investigate if the Blom tracheotomy tube with suction-above-the-cuff inner cannula reduced the quantity of normal flora and pathogens in supra- versus subglottic spaces. We enrolled 20 consecutive medical ICU adults requiring tracheostomy for mechanical ventilation in this proof-of-concept, prospective, single-center study. All participants received a Blom tracheotomy tube with suction-above-the-cuff inner cannula to decontaminate microorganisms from the supra- and subglottic spaces. Supra- and subglottic sputum samples were obtained for microbiologic analysis while an endotracheal tube was in place before tracheotomy and once per week for up to 4 weeks of mechanical ventilation after tracheotomy. Demographics, duration of endotracheal tube intubation, and duration of mechanical ventilation post-tracheotomy were recorded. There was a significant reduction for supraglottic (2.86 ± 1.11 [mean ± SD]) versus subglottic suction samples (2.48 ± 1.07) (paired t test, P = 0.048; Wilcoxon test, P = 0.045) when all data pairs for normal flora and pathogens were combined across times. There was a significant reduction of normal flora pooled across times in 19 data pairs for supraglottic (3.00 ± 1.05) versus subglottic suction samples (2.00 ± 0.94) (paired t test, P = 0.0004; Wilcoxon test, P = 0.0007). There was no significant reduction of pathogens pooled across times in 25 data pairs for supraglottic (2.76 ± 1.16) versus subglottic suction samples (2.84 ± 1.03) (paired t test, P = 0.75; Wilcoxon test, P = 0.83). Proof-of-concept was confirmed. The Blom tracheotomy tube with disposable suction-above-the-cuff inner cannula decontaminated microorganisms from the subglottic space when normal flora and pathogens were combined. Future research should investigate if decreased quantity of normal flora and pathogens in the subglottic space reduces the incidence of ventilator-associated pulmonary complications in critically ill patients requiring ongoing mechanical ventilation via tracheotomy.

  2. A comparison of doctors', parents' and children's reports of health states and health-related quality of life in children with chronic conditions.

    PubMed

    Morrow, A M; Hayen, A; Quine, S; Scheinberg, A; Craig, J C

    2012-03-01

    Health-related quality of life is an important outcome. Self-report is the gold standard, but in the paediatric setting we often rely on proxy reporting. Our understanding of the differences between self- and proxy reports and the factors that influence them is limited. These differences can impact on treatment choices and the patient-doctor relationship. To evaluate differences between children's, parents' and doctors' perceptions of health states and health-related quality of life in children with chronic illness and explore factors which explain these differences. Consecutive families attending eligible clinics at a tertiary paediatric centre were invited to complete the Health Utilities Index (HUI) 23 questionnaire. Percentage agreement and kappas were calculated as a measure of the agreement between pairs. Chi-squared tests or Fisher's exact test, if appropriate, were performed to determine if there was an association between level of agreement and participant variables. Data were collected for 130 parent-doctor pairs, 59 child-parent pairs and 59 child-doctor pairs. Overall health-related quality of life scores did not differ between responders, but there was poorer agreement for subjective domains. Doctor-child agreement was lower than parent-child agreement. Children with a diagnosis of cerebral palsy or chronic neurological condition were more likely to have lower inter-rater agreement for both subjective and objective domains. On the HUI2, agreement was lower for parent-child pairs when the father was the respondent. For child-doctor pairs, an increased frequency of patient-doctor visits and doctors' seniority were predictors of poorer agreement on the HUI3 and HUI2 respectively. We identified factors associated with level of agreement for self- and proxy reporting on the HUI23. Parent-child agreement was higher than doctor-child agreement. Patients with significant pain or emotional distress and patients with a diagnosis of severe cerebral palsy or chronic neurological conditions were more susceptible to under-reporting of subjective aspects of well-being by doctors and parents and may benefit from formal assessment of health-related quality of life in the clinical setting. © 2011 Blackwell Publishing Ltd.

  3. Chemotherapy-induced anorexia is accompanied by activation of brain pathways signaling dehydration.

    PubMed

    Sinno, Maria Hamze; Coquerel, Quentin; Boukhettala, Nabile; Coëffier, Moïse; Gallas, Syrine; Terashi, Mutsumi; Ibrahim, Ayman; Breuillé, Denis; Déchelotte, Pierre; Fetissov, Sergueï O

    2010-12-02

    Cancer chemotherapy is accompanied by anorexia and mucositis. To clarify the mechanisms of chemotherapy-induced anorexia, we studied the expression of c-fos and appetite-regulating neuropeptidergic and inflammatory mediators in the hypothalamus of rats treated with methotrexate (MTX). Sprague-Dawley rats received MTX (2.5mg/kg, subcutaneously) on three consecutive days and were compared with ad libitum- and pair-fed control rats five days after the first injection. MTX administration inhibited food and water intake and induced lean and fat mass losses. MTX also induced mucositis and diarrhea without changes in plasma osmolality. Pair-fed rats lost a similar amount of body weight but had no mucositis or diarrhea. Increased number of c-fos positive hypothalamic vasopressin neurosecretory neurons as well as numerous c-fos positive cells in the subfornical organ and in the organum vasculosum of the lamina terminalis were found in MTX-treated as compared to control or pair-fed rats. In both MTX and pair-fed rats, a decrease of hypothalamic proopiomelanocortin mRNA expression and low plasma levels of interleukin-1β (IL-1β) were found reflecting probably the energy deficit. No significant changes of IL-1β mRNA expression and intensity of microglial staining in the hypothalamus were found in MTX-treated rats. The pattern of c-fos expression in the hypothalamus during MTX treatment is similar to that seen with systemic dehydration, which is known to cause anorexia. No evidence of inflammatory origin of anorexia was found, suggesting that chemotherapy accompanied by mucositis and diarrhea may cause anorexia associated with systemic dehydration. Copyright © 2010 Elsevier Inc. All rights reserved.

  4. Context-dependent effects of rimonabant on ethanol-induced conditioned place preference in female mice.

    PubMed

    Silva, Aline A F; Barbosa-Souza, Evelyn; Confessor-Carvalho, Cassio; Silva, Raiany R R; De Brito, Ana Carolina L; Cata-Preta, Elisangela G; Silva Oliveira, Thaynara; Berro, Lais F; Oliveira-Lima, Alexandre J; Marinho, Eduardo A V

    2017-10-01

    The CB1 receptor antagonist rimonabant has been previously found to prevent behavioral effects of drugs of abuse in a context-dependent manner, suggesting an important role of endocannabinoid signaling in drug-induced environmental conditioning. The aim of the present study was to evaluate the effects of rimonabant on ethanol-induced conditioned place preference (CPP) in female mice. Animals were conditioned with saline or ethanol (1.8g/kg) during 8 sessions, and subsequently treated with either saline or rimonabant (1 or 10mg/kg) in the CPP environment previously associated with saline (unpaired) or ethanol (paired) for 6 consecutive days. Animals were then challenged with ethanol (1.8g/kg) in the ethanol-paired environment and ethanol-induced CPP was quantified on the following day. While treatment with 1mg/kg rimonabant in the saline-associated environment had no effects on the subsequent expression of ethanol-induced CPP, it blocked the expression of CPP to ethanol when paired to the ethanol-associated environment. When given in the ethanol-paired environment, 10mg/kg rimonabant induced aversion to the ethanol-associated environment. The same aversion effect was observed for 10mg/kg rimonabant when given in the saline-associated environment, thereby potentiating the expression of ethanol-induced CPP. Importantly, rimonabant did not induce CPP or conditioned place aversion on its own. Controlling for the estrous cycle phase showed no influences of hormonal cycle on the development and expression of ethanol-induced CPP. Our data suggest that rimonabant reduces the rewarding properties of ethanol by abolishing drug-environment conditioning in the CPP paradigm in a context-dependent manner. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Diagnostic significance of intrathecally produced herpes simplex and varizella-zoster virus-specific antibodies in central nervous system infections.

    PubMed

    Schultze, Detlev; Weder, Bruno; Cassinotti, Pascal; Vitek, Lucie; Krausse, Konrad; Fierz, Walter

    2004-11-27

    The optimal strategy for the diagnosis of herpes simplex virus (HSV) and varizella-zoster virus (VZV) disease of the central nervous system is the detection of viral DNA by polymerase chain reaction assay (PCR) in cerebrospinal fluid (CSF) and the examination of intrathecal production of specific antibodies. However, in acute neurological disease caused by either HSV or VZV, dual intrathecal synthesis of HSV-1, 2- as well as VZV-specific antibodies may be detectable and thus can hamper accurate aetiological diagnosis. This paper illustrates such equivocal findings in two case reports, investigates their frequency and discusses the possible reasons. Consecutive CSF/serum pairs of two patients with central nervous system (CNS) disease were tested by HSV-1-, HSV-2-, and VZV-specific PCR and by different serological assays for detection of neurotropic viruses and bacteria. Additionally, the results of microbiological investigations of 1'155 CSF/serum samples were retrospectively analyzed for coincident intrathecal antibody synthesis against HSV-1, 2 and VZV. Although only HSV-1 and VZV-specific DNA was detectable in the CSF of two patients with encephalitis and chronic meningitis, respectively, increasing intrathecal antibody production against both virus species could be demonstrated. Retrospective analysis of 1155 CSF/serum pairs revealed 55 (4.8%) pairs with evidence for intrathecally produced antibodies against either HSV-1, 2 (30/55) or VZV (14/55). Eleven of these 55 (20%) pairs showed intrathecal antibody-production against both virus species. Patients with CNS infection with HSV and VZV can be diagnosed by detecting intrathecally produced virus-specific antibodies, in addition to virus-specific PCR. However, in an appreciable proportion of patients a correct diagnosis is hampered by coincidentally detected antibodies in CSF against both virus species. Possible reasons for these equivocal findings are given.

  6. Agreement between invasive blood pressures measured in three peripheral arteries in anaesthetized horses under clinical conditions.

    PubMed

    Wilson, Keely A T; Raisis, Anthea L; Drynan, Eleanor A; Lester, Guy D; Hosgood, Giselle L

    2018-05-01

    To determine agreement between invasive blood pressures measured in three peripheral arteries in anaesthetized horses undergoing elective surgery. Prospective balanced incomplete block design. A total of 18 client-owned horses. Invasive blood pressure (IBP) was measured simultaneously in one of the following three combinations: 1) transverse facial and facial artery; 2) transverse facial and metatarsal artery; and 3) facial and metatarsal artery. The agreement in blood pressure measured for each combination was performed in six horses. At each sample time, systolic (SAP), mean (MAP) and diastolic (DAP) arterial pressures were measured concurrently in each artery, and the mean of three consecutive measurements was recorded. The position of horse, heart rate and use of dobutamine were also recorded. Bland-Altman analysis was used to assess agreement between sites. A total of 54 paired measurements were obtained, with 18 paired measurements from each combination. All paired measurements showed poor and haphazard (nonsystematic) agreement. The widest limit of agreement was 51 mmHg for SAP measured in the facial artery and metatarsal artery, with a bias of -11 mmHg. The smallest limit of agreement was 16 mmHg for MAP measured in the transverse facial and metatarsal artery, with a bias of 1 mmHg. There was poor and haphazard agreement for SAP, MAP and DAP measured in each pair of peripheral arteries in this study. These results show that blood pressure measured in different peripheral arteries cannot be used interchangeably. This has implications for studies that use IBP as an outcome variable and studies determining agreement between noninvasive blood pressure and IBP measurements in horses under general anaesthesia. Copyright © 2018 Association of Veterinary Anaesthetists and American College of Veterinary Anesthesia and Analgesia. Published by Elsevier Ltd. All rights reserved.

  7. Understanding the kinetic mechanism of RNA single base pair formation

    PubMed Central

    Xu, Xiaojun; Yu, Tao; Chen, Shi-Jie

    2016-01-01

    RNA functions are intrinsically tied to folding kinetics. The most elementary step in RNA folding is the closing and opening of a base pair. Understanding this elementary rate process is the basis for RNA folding kinetics studies. Previous studies mostly focused on the unfolding of base pairs. Here, based on a hybrid approach, we investigate the folding process at level of single base pairing/stacking. The study, which integrates molecular dynamics simulation, kinetic Monte Carlo simulation, and master equation methods, uncovers two alternative dominant pathways: Starting from the unfolded state, the nucleotide backbone first folds to the native conformation, followed by subsequent adjustment of the base conformation. During the base conformational rearrangement, the backbone either retains the native conformation or switches to nonnative conformations in order to lower the kinetic barrier for base rearrangement. The method enables quantification of kinetic partitioning among the different pathways. Moreover, the simulation reveals several intriguing ion binding/dissociation signatures for the conformational changes. Our approach may be useful for developing a base pair opening/closing rate model. PMID:26699466

  8. Retroperitoneal versus transperitoneal robotic-assisted laparoscopic partial nephrectomy: a matched-pair, bicenter analysis with cost comparison using time-driven activity-based costing.

    PubMed

    Laviana, Aaron A; Tan, Hung-Jui; Hu, Jim C; Weizer, Alon Z; Chang, Sam S; Barocas, Daniel A

    2018-03-01

    To perform a bicenter, retrospective study of perioperative outcomes of retroperitoneal versus transperitoneal robotic-assisted laparoscopic partial nephrectomy (RALPN) and assess costs using time-driven activity-based costing (TDABC). We identified 355 consecutive patients who underwent RALPN at University of California Los Angeles and the University of Michigan during 2009-2016. We matched according to RENAL nephrometry score, date, and institution for 78 retroperitoneal versus 78 transperitoneal RALPN. Unadjusted analyses were performed using McNemar's Chi-squared or paired t test, and adjusted analyses were performed using multivariable repeated measures regression analysis. From multivariable models, predicted probabilities were derived according to approach. Cost analysis was performed using TDABC. Patients treated with retroperitoneal versus transperitoneal RALPN were similar in age (P = 0.490), sex (P = 0.715), BMI (P = 0.273), and comorbidity (P = 0.393). Most tumors were posterior or lateral in both the retroperitoneal (92.3%) and transperitoneal (85.9%) groups. Retroperitoneal RALPN was associated with shorter operative times (167.0 versus 191.1 min, P = 0.001) and length of stay (LOS) (1.8 versus 2.7 days, P < 0.001). There were no differences in renal function preservation or cancer control. In adjusted analyses, retroperitoneal RALPN was 17.6-min shorter (P < 0.001) and had a 76% lower probability of LOS at least 2 days (P < 0.001). Utilizing TDABC, transperitoneal RALPN added $2337 in cost when factoring in disposable equipment, operative time, LOS, and personnel. In two high-volume, tertiary centers, retroperitoneal RALPN is associated with reduced operative times and shortened LOS in posterior and lateral tumors, whereas sharing similar clinicopathologic outcomes, which may translate into lower healthcare costs. Further investigation into anterior tumors is needed.

  9. Clinical and Radiographic Results of Attune and PFC Sigma Knee Designs at 2-Year Follow-Up: A Prospective Matched-Pair Analysis.

    PubMed

    Ranawat, Chitranjan S; White, Peter B; West, Sarah; Ranawat, Amar S

    2017-02-01

    Anterior knee pain (AKP) and/or crepitation are important causes of dissatisfaction after total knee arthroplasty (TKA). Aim of this prospective, matched-pair study was to compare 2 different designs of patellofemoral (ie, trochlear groove) TKA. The Attune knee has an anatomic trochlear groove with a medialized dome patellar component vs the PFC Sigma with a single radius trochlear groove with a domed shaped patella. Between January 2010 and December 2014, 100 consecutive Attune TKAs were matched to 100 PFC Sigma TKAs based on age, gender, side, and body mass index. All surgeries were performed via medial parapatellar approach and used cemented, posterior-stabilized implants with patellar resurfacing. Clinical evaluations were assessed using Knee Society Scores (KSS) and a patient-administered questionnaire at 2-year follow-up (range, 1.5-3 years). Based on the KSS clinical rating system, excellent clinical results were achieved in 89.4% and 90.7% of Attune and PFC Sigma TKAs, respectively. There were no significant differences in the KS pain or function scores. The overall incidence of AKP was significantly lower with the Attune knee compared to that of the PFC Sigma (12.5% vs 25.8%; P = .02). The incidence of hearing or feeling noise was also less with the Attune knee (17.7% vs 30.9%; P = .02). The incidence of painful crepitation was low in both groups (1.0% vs 4.1%) with no significant difference between groups (P = .37). Both groups had similar high satisfaction scores of 8.6 and 8.4 for the Attune and PFC groups, respectively (P = .09). At 2-year follow-up, there were no differences between the PFC Sigma and Attune knees in KSS or satisfaction. However, the Attune group had a lesser incidence of AKP and crepitation. Further studies should focus on AKP and noise in cruciate-retaining knees. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. A loop 2 cytidine-stem 1 minor groove interaction as a positive determinant for pseudoknot-stimulated -1 ribosomal frameshifting.

    PubMed

    Cornish, Peter V; Hennig, Mirko; Giedroc, David P

    2005-09-06

    The molecular determinants of stimulation of -1 programmed ribosomal frameshifting (-1 PRF) by RNA pseudoknots are poorly understood. Sugarcane yellow leaf virus (ScYLV) encodes a 28-nt mRNA pseudoknot that promotes -1 PRF between the P1 (protease) and P2 (polymerase) genes in plant luteoviruses. The solution structure of the ScYLV pseudoknot reveals a well ordered loop 2 (L2) that exhibits continuous stacking of A20 through C27 in the minor groove of the upper stem 1 (S1), with C25 flipped out of the triple-stranded stack. Five consecutive triple base pairs flank the helical junction where the 3' nucleotide of L2, C27, adopts a cytidine 27 N3-cytidine 14 2'-OH hydrogen bonding interaction with the C14-G7 base pair. This interaction is isosteric with the adenosine N1-2'-OH interaction in the related mRNA from beet western yellows virus (BWYV); however, the ScYLV and BWYV mRNA structures differ in their detailed L2-S1 hydrogen bonding and L2 stacking interactions. Functional analyses of ScYLV/BWYV chimeric pseudoknots reveal that the ScYLV RNA stimulates a higher level of -1 PRF (15 +/- 2%) relative to the BWYV pseudoknot (6 +/- 1%), a difference traced largely to the identity of the 3' nucleotide of L2 (C27 vs. A25 in BWYV). Strikingly, C27A ScYLV RNA is a poor frameshift stimulator (2.0%) and is destabilized by approximately 1.5 kcal x mol(-1) (pH 7.0, 37 degrees C) with respect to the wild-type pseudoknot. These studies establish that the precise network of weak interactions nearest the helical junction in structurally similar pseudoknots make an important contribution to setting the frameshift efficiency in mRNAs.

  11. A loop 2 cytidine-stem 1 minor groove interaction as a positive determinant for pseudoknot-stimulated –1 ribosomal frameshifting

    PubMed Central

    Cornish, Peter V.; Hennig, Mirko; Giedroc, David P.

    2005-01-01

    The molecular determinants of stimulation of –1 programmed ribosomal frameshifting (–1 PRF) by RNA pseudoknots are poorly understood. Sugarcane yellow leaf virus (ScYLV) encodes a 28-nt mRNA pseudoknot that promotes –1 PRF between the P1 (protease) and P2 (polymerase) genes in plant luteoviruses. The solution structure of the ScYLV pseudoknot reveals a well ordered loop 2 (L2) that exhibits continuous stacking of A20 through C27 in the minor groove of the upper stem 1 (S1), with C25 flipped out of the triple-stranded stack. Five consecutive triple base pairs flank the helical junction where the 3′ nucleotide of L2, C27, adopts a cytidine 27 N3-cytidine 14 2′-OH hydrogen bonding interaction with the C14-G7 base pair. This interaction is isosteric with the adenosine N1–2′-OH interaction in the related mRNA from beet western yellows virus (BWYV); however, the ScYLV and BWYV mRNA structures differ in their detailed L2–S1 hydrogen bonding and L2 stacking interactions. Functional analyses of ScYLV/BWYV chimeric pseudoknots reveal that the ScYLV RNA stimulates a higher level of –1 PRF (15 ± 2%) relative to the BWYV pseudoknot (6 ± 1%), a difference traced largely to the identity of the 3′ nucleotide of L2 (C27 vs. A25 in BWYV). Strikingly, C27A ScYLV RNA is a poor frameshift stimulator (2.0%) and is destabilized by ≈1.5 kcal·mol–1 (pH 7.0, 37°C) with respect to the wild-type pseudoknot. These studies establish that the precise network of weak interactions nearest the helical junction in structurally similar pseudoknots make an important contribution to setting the frameshift efficiency in mRNAs. PMID:16123125

  12. Imino proton exchange and base-pair kinetics in the AMP-RNA aptamer complex.

    PubMed

    Nonin, S; Jiang, F; Patel, D J

    1997-05-02

    We report on the dynamics of base-pair opening in the ATP-binding asymmetric internal loop and flanking base-pairs of the AMP-RNA aptamer complex by monitoring the exchange characteristics of the extremely well resolved imino protons in the NMR spectrum of the complex. The kinetics of imino proton exchange as a function of basic pH or added ammonia catalyst are used to measure the apparent base-pair dissociation constants and lifetimes of Watson-Crick and mismatched base-pairs, as well as the solvent accessibility of the unpaired imino protons in the complex. The exchange characteristics of the imino protons identify the existence of four additional hydrogen bonds stabilizing the conformation of the asymmetric ATP-binding internal loop that were not detected by NOEs and coupling constants alone, but are readily accommodated in the previously reported solution structure of the AMP-RNA aptamer complex published from our laboratory. The hydrogen exchange kinetics of the non-Watson-Crick pairs in the asymmetric internal loop of the AMP-RNA aptamer complex have been characterized and yield apparent dissociation constants (alphaKd) that range from 10(-2) to 10(-7). Surprisingly, three of these alphaKd values are amongst the lowest measured for all base-pairs in the AMP-RNA aptamer complex. Comparative studies of hydrogen exchange of the imino protons in the free RNA aptamer and the AMP-RNA aptamer complex establish that complexation stabilizes not only the bases within the ATP-binding asymmetric internal loop, but also the flanking stem base-pairs (two pairs on either side) of the binding site. We also outline some preliminary results related to the exchange properties of a sugar 2'-hydroxyl proton of a guanosine residue involved in a novel hydrogen bond that has been shown to contribute to the immobilization of the bound AMP by the RNA aptamer, and whose resonance is narrow and downfield shifted in the spectrum.

  13. The 5S rRNA loop E: chemical probing and phylogenetic data versus crystal structure.

    PubMed

    Leontis, N B; Westhof, E

    1998-09-01

    A significant fraction of the bases in a folded, structured RNA molecule participate in noncanonical base pairing interactions, often in the context of internal loops or multi-helix junction loops. The appearance of each new high-resolution RNA structure provides welcome data to guide efforts to understand and predict RNA 3D structure, especially when the RNA in question is a functionally conserved molecule. The recent publication of the crystal structure of the "Loop E" region of bacterial 5S ribosomal RNA is such an event [Correll CC, Freeborn B, Moore PB, Steitz TA, 1997, Cell 91:705-712]. In addition to providing more examples of already established noncanonical base pairs, such as purine-purine sheared pairings, trans-Hoogsteen UA, and GU wobble pairs, the structure provides the first high-resolution views of two new purine-purine pairings and a new GU pairing. The goal of the present analysis is to expand the capabilities of both chemical probing and phylogenetic analysis to predict with greater accuracy the structures of RNA molecules. First, in light of existing chemical probing data, we investigate what lessons could be learned regarding the interpretation of this widely used method of RNA structure probing. Then we analyze the 3D structure with reference to molecular phylogeny data (assuming conservation of function) to discover what alternative base pairings are geometrically compatible with the structure. The comparisons between previous modeling efforts and crystal structures show that the intricate involvements of ions and water molecules in the maintenance of non-Watson-Crick pairs render the process of correctly identifying the interacting sites in such pairs treacherous, except in cases of trans-Hoogsteen A/U or sheared A/G pairs for the adenine N1 site. The phylogenetic analysis identifies A/A, A/C, A/U and C/A, C/C, and C/U pairings isosteric with sheared A/G, as well as A/A and A/C pairings isosteric with both G/U and G/G bifurcated pairings. Thus, each non-Watson-Crick pair could be characterized by a phylogenetic signature of variations between isosteric-like pairings. In addition to the conservative changes, which form a dictionary of pairings isosterically compatible with those observed in the crystal structure, concerted changes involving several base pairs also occur. The latter covariations may indicate transitions between related but distinctive motifs within the loop E of 5S ribosomal RNA.

  14. The electrostatic characteristics of G·U wobble base pairs

    PubMed Central

    Xu, Darui; Landon, Theresa; Greenbaum, Nancy L.; Fenley, Marcia O.

    2007-01-01

    G·U wobble base pairs are the most common and highly conserved non-Watson–Crick base pairs in RNA. Previous surface maps imply uniformly negative electrostatic potential at the major groove of G·U wobble base pairs embedded in RNA helices, suitable for entrapment of cationic ligands. In this work, we have used a Poisson–Boltzmann approach to gain a more detailed and accurate characterization of the electrostatic profile. We found that the major groove edge of an isolated G·U wobble displays distinctly enhanced negativity compared with standard GC or AU base pairs; however, in the context of different helical motifs, the electrostatic pattern varies. G·U wobbles with distinct widening have similar major groove electrostatic potentials to their canonical counterparts, whereas those with minimal widening exhibit significantly enhanced electronegativity, ranging from 0.8 to 2.5 kT/e, depending upon structural features. We propose that the negativity at the major groove of G·U wobble base pairs is determined by the combined effect of the base atoms and the sugar-phosphate backbone, which is impacted by stacking pattern and groove width as a result of base sequence. These findings are significant in that they provide predictive power with respect to which G·U sites in RNA are most likely to bind cationic ligands. PMID:17526525

  15. Automatic identification of bullet signatures based on consecutive matching striae (CMS) criteria.

    PubMed

    Chu, Wei; Thompson, Robert M; Song, John; Vorburger, Theodore V

    2013-09-10

    The consecutive matching striae (CMS) numeric criteria for firearm and toolmark identifications have been widely accepted by forensic examiners, although there have been questions concerning its observer subjectivity and limited statistical support. In this paper, based on signal processing and extraction, a model for the automatic and objective counting of CMS is proposed. The position and shape information of the striae on the bullet land is represented by a feature profile, which is used for determining the CMS number automatically. Rapid counting of CMS number provides a basis for ballistics correlations with large databases and further statistical and probability analysis. Experimental results in this report using bullets fired from ten consecutively manufactured barrels support this developed model. Published by Elsevier Ireland Ltd.

  16. Reactivity of cytosine and thymine in single-base-pair mismatches with hydroxylamine and osmium tetroxide and its application to the study of mutations.

    PubMed Central

    Cotton, R G; Rodrigues, N R; Campbell, R D

    1988-01-01

    The chemical reactivity of thymine (T), when mismatched with the bases cytosine, guanine, and thymine, and of cytosine (C), when mismatched with thymine, adenine, and cytosine, has been examined. Heteroduplex DNAs containing such mismatched base pairs were first incubated with osmium tetroxide (for T and C mismatches) or hydroxylamine (for C mismatches) and then incubated with piperidine to cleave the DNA at the modified mismatched base. This cleavage was studied with an internally labeled strand containing the mismatched T or C, such that DNA cleavage and thus reactivity could be detected by gel electrophoresis. Cleavage at a total of 13 T and 21 C mismatches isolated (by at least three properly paired bases on both sides) single-base-pair mismatches was identified. All T or C mismatches studied were cleaved. By using end-labeled DNA probes containing T or C single-base-pair mismatches and conditions for limited cleavage, we were able to show that cleavage was at the base predicted by sequence analysis and that mismatches in a length of DNA could be readily detected by such an approach. This procedure may enable detection of all single-base-pair mismatches by use of sense and antisense probes and thus may be used to identify the mutated base and its position in a heteroduplex. Images PMID:3260032

  17. Electrostatics Explains the Position-Dependent Effect of G⋅U Wobble Base Pairs on the Affinity of RNA Kissing Complexes.

    PubMed

    Abi-Ghanem, Josephine; Rabin, Clémence; Porrini, Massimiliano; Dausse, Eric; Toulmé, Jean-Jacques; Gabelica, Valérie

    2017-10-06

    In the RNA realm, non-Watson-Crick base pairs are abundant and can affect both the RNA 3D structure and its function. Here, we investigated the formation of RNA kissing complexes in which the loop-loop interaction is modulated by non-Watson-Crick pairs. Mass spectrometry, surface plasmon resonance, and UV-melting experiments show that the G⋅U wobble base pair favors kissing complex formation only when placed at specific positions. We tried to rationalize this effect by molecular modeling, including molecular mechanics Poisson-Boltzmann surface area (MMPBSA) thermodynamics calculations and PBSA calculations of the electrostatic potential surfaces. Modeling reveals that the G⋅U stabilization is due to a specific electrostatic environment defined by the base pairs of the entire loop-loop region. The loop is not symmetric, and therefore the identity and position of each base pair matters. Predicting and visualizing the electrostatic environment created by a given sequence can help to design specific kissing complexes with high affinity, for potential therapeutic, nanotechnology or analytical applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. An Automated Energy Detection Algorithm Based on Consecutive Mean Excision

    DTIC Science & Technology

    2018-01-01

    present in the RF spectrum. 15. SUBJECT TERMS RF spectrum, detection threshold algorithm, consecutive mean excision, rank order filter , statistical...Median 4 3.1.9 Rank Order Filter (ROF) 4 3.1.10 Crest Factor (CF) 5 3.2 Statistical Summary 6 4. Algorithm 7 5. Conclusion 8 6. References 9...energy detection algorithm based on morphological filter processing with a semi- disk structure. Adelphi (MD): Army Research Laboratory (US); 2018 Jan

  19. The Impact of a Peer-Learning Agent Based on Pair Programming in a Programming Course

    ERIC Educational Resources Information Center

    Han, Keun-Woo; Lee, EunKyoung; Lee, YoungJun

    2010-01-01

    This paper analyzes the educational effects of a peer-learning agent based on pair programming in programming courses. A peer-learning agent system was developed to facilitate the learning of a programming language through the use of pair programming strategies. This system is based on the role of a peer-learning agent from pedagogical and…

  20. Weak nanoscale chaos and anomalous relaxation in DNA

    NASA Astrophysics Data System (ADS)

    Mazur, Alexey K.

    2017-06-01

    Anomalous nonexponential relaxation in hydrated biomolecules is commonly attributed to the complexity of the free-energy landscapes, similarly to polymers and glasses. It was found recently that the hydrogen-bond breathing of terminal DNA base pairs exhibits a slow power-law relaxation attributable to weak Hamiltonian chaos, with parameters similar to experimental data. Here, the relationship is studied between this motion and spectroscopic signals measured in DNA with a small molecular photoprobe inserted into the base-pair stack. To this end, the earlier computational approach in combination with an analytical theory is applied to the experimental DNA fragment. It is found that the intensity of breathing dynamics is strongly increased in the internal base pairs that flank the photoprobe, with anomalous relaxation quantitatively close to that in terminal base pairs. A physical mechanism is proposed to explain the coupling between the relaxation of base-pair breathing and the experimental response signal. It is concluded that the algebraic relaxation observed experimentally is very likely a manifestation of weakly chaotic dynamics of hydrogen-bond breathing in the base pairs stacked to the photoprobe and that the weak nanoscale chaos can represent an ubiquitous hidden source of nonexponential relaxation in ultrafast spectroscopy.

  1. Distribution of Base Pair Alternations in a Periodic DNA Chain: Application of Pólya Counting to a Physical System

    NASA Astrophysics Data System (ADS)

    Hillebrand, Malcolm; Paterson-Jones, Guy; Kalosakas, George; Skokos, Charalampos

    2018-03-01

    In modeling DNA chains, the number of alternations between Adenine-Thymine (AT) and Guanine-Cytosine (GC) base pairs can be considered as a measure of the heterogeneity of the chain, which in turn could affect its dynamics. A probability distribution function of the number of these alternations is derived for circular or periodic DNA. Since there are several symmetries to account for in the periodic chain, necklace counting methods are used. In particular, Polya's Enumeration Theorem is extended for the case of a group action that preserves partitioned necklaces. This, along with the treatment of generating functions as formal power series, allows for the direct calculation of the number of possible necklaces with a given number of AT base pairs, GC base pairs and alternations. The theoretically obtained probability distribution functions of the number of alternations are accurately reproduced by Monte Carlo simulations and fitted by Gaussians. The effect of the number of base pairs on the characteristics of these distributions is also discussed, as well as the effect of the ratios of the numbers of AT and GC base pairs.

  2. Weak nanoscale chaos and anomalous relaxation in DNA.

    PubMed

    Mazur, Alexey K

    2017-06-01

    Anomalous nonexponential relaxation in hydrated biomolecules is commonly attributed to the complexity of the free-energy landscapes, similarly to polymers and glasses. It was found recently that the hydrogen-bond breathing of terminal DNA base pairs exhibits a slow power-law relaxation attributable to weak Hamiltonian chaos, with parameters similar to experimental data. Here, the relationship is studied between this motion and spectroscopic signals measured in DNA with a small molecular photoprobe inserted into the base-pair stack. To this end, the earlier computational approach in combination with an analytical theory is applied to the experimental DNA fragment. It is found that the intensity of breathing dynamics is strongly increased in the internal base pairs that flank the photoprobe, with anomalous relaxation quantitatively close to that in terminal base pairs. A physical mechanism is proposed to explain the coupling between the relaxation of base-pair breathing and the experimental response signal. It is concluded that the algebraic relaxation observed experimentally is very likely a manifestation of weakly chaotic dynamics of hydrogen-bond breathing in the base pairs stacked to the photoprobe and that the weak nanoscale chaos can represent an ubiquitous hidden source of nonexponential relaxation in ultrafast spectroscopy.

  3. Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

    PubMed

    Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

    2015-02-10

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

  4. Differential stabilities and sequence-dependent base pair opening dynamics of Watson–Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine

    DOE PAGES

    Szulik, Marta W.; Pallan, Pradeep S.; Nocek, Boguslaw; ...

    2015-01-29

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T 8X 9G 10-3' sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC didmore » not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A 5:T 8, whereas 5caC did not. At the oxidized base pair G 4:X 9, 5fC exhibited an increase in the imino proton exchange rate and the calculated k op. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C 3:G 10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G 4:X 9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N 4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. Furthermore, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.« less

  5. Differential Stabilities and Sequence-Dependent Base Pair Opening Dynamics of Watson–Crick Base Pairs with 5-Hydroxymethylcytosine, 5-Formylcytosine, or 5-Carboxylcytosine

    PubMed Central

    2016-01-01

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825

  6. Layer-Based Approach for Image Pair Fusion.

    PubMed

    Son, Chang-Hwan; Zhang, Xiao-Ping

    2016-04-20

    Recently, image pairs, such as noisy and blurred images or infrared and noisy images, have been considered as a solution to provide high-quality photographs under low lighting conditions. In this paper, a new method for decomposing the image pairs into two layers, i.e., the base layer and the detail layer, is proposed for image pair fusion. In the case of infrared and noisy images, simple naive fusion leads to unsatisfactory results due to the discrepancies in brightness and image structures between the image pair. To address this problem, a local contrast-preserving conversion method is first proposed to create a new base layer of the infrared image, which can have visual appearance similar to another base layer such as the denoised noisy image. Then, a new way of designing three types of detail layers from the given noisy and infrared images is presented. To estimate the noise-free and unknown detail layer from the three designed detail layers, the optimization framework is modeled with residual-based sparsity and patch redundancy priors. To better suppress the noise, an iterative approach that updates the detail layer of the noisy image is adopted via a feedback loop. This proposed layer-based method can also be applied to fuse another noisy and blurred image pair. The experimental results show that the proposed method is effective for solving the image pair fusion problem.

  7. Measuring the accelerating effect of the planetary-scale waves on Venus observed with UVI/AKATSUKI and ground-based telescopes

    NASA Astrophysics Data System (ADS)

    Imai, M.; Kouyama, T.; Takahashi, Y.; Watanabe, S.; Yamazaki, A.; Yamada, M.; Nakamura, M.; Satoh, T.; Imamura, T.; Nakaoka, T.; Kawabata, M.; Yamanaka, M.; Kawabata, K. S.

    2017-12-01

    Venus has a global cloud layer, and the atmosphere rotates with the speed over 100 m/s. The scattering of solar radiance and absorber in clouds cause the strong dark and bright contrast in 365 nm unknown absorption bands. The Japanese Venus orbiter AKATSUKI and the onboard instrument UVI capture 100 km mesoscale cloud features over the entire visible dayside area. In contrast, planetary-scale features are observed when the orbiter is at the moderate distance from Venus and when the Sun-Venus-orbiter phase angle is smaller than 45 deg. Cloud top wind velocity was measured with the mesoscale cloud tracking technique, however, observations of the propagation velocity and its variation of the planetary-scale feature are not well conducted because of the limitation of the observable area. The purpose of the study is measuring the effect of wind acceleration by planetary-scale waves. Each cloud motion can be represented as the wind and phase velocity of the planetary-scale waves, respectively. We conducted simultaneous observations of the zonal motion of both mesoscale and planetary-scale feature using UVI/AKATSUKI and ground-based Pirka and Kanata telescopes in Japan. Our previous ground-based observation revealed the periodicity change of planetary-scale waves with a time scale of a couple of months. For the initial analysis of UVI images, we used the time-consecutive images taken in the orbit #32. During this orbit (from Nov. 13 to 20, 2016), 7 images were obtained with 2 hr time-interval in a day whose spatial resolution ranged from 10-35 km. To investigate the typical mesoscale cloud motion, the Gaussian-filters with sigma = 3 deg. were used to smooth geometrically mapped images with 0.25 deg. resolution. Then the amount of zonal shift for each 5 deg. latitudinal bands between the pairs of two time-consecutive images were estimated by searching the 2D cross-correlation maximum. The final wind velocity (or rotation period) for mesoscale features were determined with a small error about +/- 0.1-day period in equatorial region (Figure 2). The same method will be applied for planetary-scale features captured by UVI, and ground-based observations compensate the discontinuity in UVI data. At the presentation, the variability in winds and wave propagation velocity with the time scale of a couple of months will be shown.

  8. Base pairing among three cis-acting sequences contributes to template switching during hepadnavirus reverse transcription

    PubMed Central

    Liu, Ning; Tian, Ru; Loeb, Daniel D.

    2003-01-01

    Synthesis of the relaxed-circular (RC) DNA genome of hepadnaviruses requires two template switches during plus-strand DNA synthesis: primer translocation and circularization. Although primer translocation and circularization use different donor and acceptor sequences, and are distinct temporally, they share the common theme of switching from one end of the minus-strand template to the other end. Studies of duck hepatitis B virus have indicated that, in addition to the donor and acceptor sequences, three other cis-acting sequences, named 3E, M, and 5E, are required for the synthesis of RC DNA by contributing to primer translocation and circularization. The mechanism by which 3E, M, and 5E act was not known. We present evidence that these sequences function by base pairing with each other within the minus-strand template. 3E base-pairs with one portion of M (M3) and 5E base-pairs with an adjacent portion of M (M5). We found that disrupting base pairing between 3E and M3 and between 5E and M5 inhibited primer translocation and circularization. More importantly, restoring base pairing with mutant sequences restored the production of RC DNA. These results are consistent with the model that, within duck hepatitis B virus capsids, the ends of the minus-strand template are juxtaposed via base pairing to facilitate the two template switches during plus-strand DNA synthesis. PMID:12578983

  9. DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

    PubMed Central

    Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

    2008-01-01

    We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

  10. 76 FR 15233 - Proposed Modification to Regulation Concerning the Revocation of Antidumping and Countervailing...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-21

    ... an antidumping or countervailing duty order with respect to individual exporters or producers based on those individual exporters or producers having received antidumping margins of zero for three consecutive years, or countervailing duty rates of zero for five consecutive years. DATES: To be assured of...

  11. Base drive circuit

    DOEpatents

    Lange, A.C.

    1995-04-04

    An improved base drive circuit having a level shifter for providing bistable input signals to a pair of non-linear delays. The non-linear delays provide gate control to a corresponding pair of field effect transistors through a corresponding pair of buffer components. The non-linear delays provide delayed turn-on for each of the field effect transistors while an associated pair of transistors shunt the non-linear delays during turn-off of the associated field effect transistor. 2 figures.

  12. An Intelligent Model for Pairs Trading Using Genetic Algorithms.

    PubMed

    Huang, Chien-Feng; Hsu, Chi-Jen; Chen, Chi-Chung; Chang, Bao Rong; Li, Chen-An

    2015-01-01

    Pairs trading is an important and challenging research area in computational finance, in which pairs of stocks are bought and sold in pair combinations for arbitrage opportunities. Traditional methods that solve this set of problems mostly rely on statistical methods such as regression. In contrast to the statistical approaches, recent advances in computational intelligence (CI) are leading to promising opportunities for solving problems in the financial applications more effectively. In this paper, we present a novel methodology for pairs trading using genetic algorithms (GA). Our results showed that the GA-based models are able to significantly outperform the benchmark and our proposed method is capable of generating robust models to tackle the dynamic characteristics in the financial application studied. Based upon the promising results obtained, we expect this GA-based method to advance the research in computational intelligence for finance and provide an effective solution to pairs trading for investment in practice.

  13. An Intelligent Model for Pairs Trading Using Genetic Algorithms

    PubMed Central

    Hsu, Chi-Jen; Chen, Chi-Chung; Li, Chen-An

    2015-01-01

    Pairs trading is an important and challenging research area in computational finance, in which pairs of stocks are bought and sold in pair combinations for arbitrage opportunities. Traditional methods that solve this set of problems mostly rely on statistical methods such as regression. In contrast to the statistical approaches, recent advances in computational intelligence (CI) are leading to promising opportunities for solving problems in the financial applications more effectively. In this paper, we present a novel methodology for pairs trading using genetic algorithms (GA). Our results showed that the GA-based models are able to significantly outperform the benchmark and our proposed method is capable of generating robust models to tackle the dynamic characteristics in the financial application studied. Based upon the promising results obtained, we expect this GA-based method to advance the research in computational intelligence for finance and provide an effective solution to pairs trading for investment in practice. PMID:26339236

  14. Dual Switching Monopolar Radiofrequency Ablation Using a Separable Clustered Electrode: Comparison with Consecutive and Switching Monopolar Modes in Ex Vivo Bovine Livers

    PubMed Central

    Yoon, Jeong-Hee; Han, Joon Koo; Choi, Byung Ihn

    2013-01-01

    Objective To compare the in-vitro efficiency of dual-switching monopolar (DSM) radiofrequency ablation (RFA) using a separable clustered electrode (Octopus® electrodes) with consecutive monopolar (CM) and switching monopolar (SM) RFA techniques to create an ablative zone in the explanted bovine liver. Materials and Methods For DSM-RFA, we used a prototype, three-channel, dual generator RFA Unit and Octopus® electrodes with three, 17 gauge internally cooled electrodes. The RFA Unit allowed simultaneous radiofrequency (RF) energy delivery to two electrodes of the Octopus® electrodes as well as automatic switching among the three electrode pairs according to the impedance changes. RF energy was sequentially applied to one of the three electrodes for 24 minutes (group A; CM mode, n = 10) or alternatively applied for 12 minutes (group B; SM mode, n = 10) or concurrently applied to a pair of electrodes for 12 minutes (group C; DSM mode, n = 10) in explanted bovine livers. Changes in the impedance and current during RFA as well as the dimensions of the thermal ablative zones were compared among the three groups. Results The mean, delivered RF energy amounts in groups A, B, and C were 63.15 ± 8.6 kJ, 72.13 ± 5.4 kJ, and 106.08 ± 13.4 kJ, respectively (p < 0.001). The DSM mode created a significantly larger ablation volume than did the other modes, i.e., 68.1 ± 10.2 cm3 (group A), 92.0 ± 19.9 cm3 (group B), and 115.1 ± 14.0 cm3 (group C) (p < 0.001). The circularity in groups A, B, and C were 0.84 ± 0.06, 0.87 ± 0.04 and 0.90 ± 0.03, respectively (p = 0.03). Conclusion DSM-RFA using Octopus® electrodes can help create large ablative zones within a relatively short time. PMID:23690705

  15. Termination of seizure clusters is related to the duration of focal seizures.

    PubMed

    Ferastraoaru, Victor; Schulze-Bonhage, Andreas; Lipton, Richard B; Dümpelmann, Matthias; Legatt, Alan D; Blumberg, Julie; Haut, Sheryl R

    2016-06-01

    Clustered seizures are characterized by shorter than usual interseizure intervals and pose increased morbidity risk. This study examines the characteristics of seizures that cluster, with special attention to the final seizure in a cluster. This is a retrospective analysis of long-term inpatient monitoring data from the EPILEPSIAE project. Patients underwent presurgical evaluation from 2002 to 2009. Seizure clusters were defined by the occurrence of at least two consecutive seizures with interseizure intervals of <4 h. Other definitions of seizure clustering were examined in a sensitivity analysis. Seizures were classified into three contextually defined groups: isolated seizures (not meeting clustering criteria), terminal seizure (last seizure in a cluster), and intracluster seizures (any other seizures within a cluster). Seizure characteristics were compared among the three groups in terms of duration, type (focal seizures remaining restricted to one hemisphere vs. evolving bilaterally), seizure origin, and localization concordance among pairs of consecutive seizures. Among 92 subjects, 77 (83%) had at least one seizure cluster. The intracluster seizures were significantly shorter than the last seizure in a cluster (p = 0.011), whereas the last seizure in a cluster resembled the isolated seizures in terms of duration. Although focal only (unilateral), seizures were shorter than seizures that evolved bilaterally and there was no correlation between the seizure type and the seizure position in relation to a cluster (p = 0.762). Frontal and temporal lobe seizures were more likely to cluster compared with other localizations (p = 0.009). Seizure pairs that are part of a cluster were more likely to have a concordant origin than were isolated seizures. Results were similar for the 2 h definition of clustering, but not for the 8 h definition of clustering. We demonstrated that intracluster seizures are short relative to isolated seizures and terminal seizures. Frontal and temporal lobe seizures are more likely to cluster. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  16. The fidelity of replication of the three-base-pair set adenine/thymine, hypoxanthine/cytosine and 6-thiopurine/5-methyl-2-pyrimidinone with T7 DNA polymerase

    PubMed Central

    2004-01-01

    With the goal of constructing a genetic alphabet consisting of a set of three base pairs, the fidelity of replication of the three base pairs TH (5-methyl-2-pyrimidinone)/HS (6-thiopurine; thiohypoxanthine), C/H (hypoxanthine) and T/A was evaluated using T7 DNA polymerase, a polymerase with a strong 3′→5′ exonuclease activity. An evaluation of the suitability of a new base pair for replication should include both the contribution of the fidelity of a polymerase activity and the contribution of proofreading by a 3′→5′ exonuclease activity. Using a steady-state kinetics method that included the contribution of the 3′→5′ exonuclease activity, the fidelity of replication was determined. The method determined the ratio of the apparent rate constant for the addition of a deoxynucleotide to the primer across from a template base by the polymerase activity and the rate constant for removal of the added deoxynucleotide from the primer by the 3′→5′ exonuclease activity. This ratio was designated the eni (efficiency of net incorporation). The eni of the base pair C/H was equal to or greater than the eni of T/A. The eni of the base pair TH/HS was 0.1 times that of A/T for TH in the template and 0.01 times that of A/T for HS in the template. The ratio of the eni of a mismatched deoxynucleotide to the eni of a matched deoxynucleotide was a measure of the error frequency. The error frequencies were as follows: thymine or TH opposite a template hypoxanthine, 2×10−6; HS opposite a template cytosine, <3×10−4. The remaining 24 mismatched combinations of bases gave no detectable net incorporation. Two mismatches, hypoxanthine opposite a template thymine or a template TH, showed trace incorporation in the presence of a standard dNTP complementary to the next template base. T7 DNA polymerase extended the primer beyond each of the matched base pairs of the set. The level of fidelity of replication of the three base pairs with T7 DNA polymerase suggests that they are adequate for a three-base-pair alphabet for DNA replication. PMID:15078225

  17. Visually directed vs. software-based targeted biopsy compared to transperineal template mapping biopsy in the detection of clinically significant prostate cancer.

    PubMed

    Valerio, Massimo; McCartan, Neil; Freeman, Alex; Punwani, Shonit; Emberton, Mark; Ahmed, Hashim U

    2015-10-01

    Targeted biopsy based on cognitive or software magnetic resonance imaging (MRI) to transrectal ultrasound registration seems to increase the detection rate of clinically significant prostate cancer as compared with standard biopsy. However, these strategies have not been directly compared against an accurate test yet. The aim of this study was to obtain pilot data on the diagnostic ability of visually directed targeted biopsy vs. software-based targeted biopsy, considering transperineal template mapping (TPM) biopsy as the reference test. Prospective paired cohort study included 50 consecutive men undergoing TPM with one or more visible targets detected on preoperative multiparametric MRI. Targets were contoured on the Biojet software. Patients initially underwent software-based targeted biopsies, then visually directed targeted biopsies, and finally systematic TPM. The detection rate of clinically significant disease (Gleason score ≥3+4 and/or maximum cancer core length ≥4mm) of one strategy against another was compared by 3×3 contingency tables. Secondary analyses were performed using a less stringent threshold of significance (Gleason score ≥4+3 and/or maximum cancer core length ≥6mm). Median age was 68 (interquartile range: 63-73); median prostate-specific antigen level was 7.9ng/mL (6.4-10.2). A total of 79 targets were detected with a mean of 1.6 targets per patient. Of these, 27 (34%), 28 (35%), and 24 (31%) were scored 3, 4, and 5, respectively. At a patient level, the detection rate was 32 (64%), 34 (68%), and 38 (76%) for visually directed targeted, software-based biopsy, and TPM, respectively. Combining the 2 targeted strategies would have led to detection rate of 39 (78%). At a patient level and at a target level, software-based targeted biopsy found more clinically significant diseases than did visually directed targeted biopsy, although this was not statistically significant (22% vs. 14%, P = 0.48; 51.9% vs. 44.3%, P = 0.24). Secondary analysis showed similar results. Based on these findings, a paired cohort study enrolling at least 257 men would verify whether this difference is statistically significant. The diagnostic ability of software-based targeted biopsy and visually directed targeted biopsy seems almost comparable, although utility and efficiency both seem to be slightly in favor of the software-based strategy. Ongoing trials are sufficiently powered to prove or disprove these findings. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Pairing States of Spin-3/2 Fermions: Symmetry-Enforced Topological Gap Functions

    NASA Astrophysics Data System (ADS)

    Venderbos, Jörn W. F.; Savary, Lucile; Ruhman, Jonathan; Lee, Patrick A.; Fu, Liang

    2018-01-01

    We study the topological properties of superconductors with paired j =3/2 quasiparticles. Higher spin Fermi surfaces can arise, for instance, in strongly spin-orbit coupled band-inverted semimetals. Examples include the Bi-based half-Heusler materials, which have recently been established as low-temperature and low-carrier density superconductors. Motivated by this experimental observation, we obtain a comprehensive symmetry-based classification of topological pairing states in systems with higher angular momentum Cooper pairing. Our study consists of two main parts. First, we develop the phenomenological theory of multicomponent (i.e., higher angular momentum) pairing by classifying the stationary points of the free energy within a Ginzburg-Landau framework. Based on the symmetry classification of stationary pairing states, we then derive the symmetry-imposed constraints on their gap structures. We find that, depending on the symmetry quantum numbers of the Cooper pairs, different types of topological pairing states can occur: fully gapped topological superconductors in class DIII, Dirac superconductors, and superconductors hosting Majorana fermions. Notably, we find a series of nematic fully gapped topological superconductors, as well as double- and triple-Dirac superconductors, with quadratic and cubic dispersion, respectively. Our approach, applied here to the case of j =3/2 Cooper pairing, is rooted in the symmetry properties of pairing states, and can therefore also be applied to other systems with higher angular momentum and high-spin pairing. We conclude by relating our results to experimentally accessible signatures in thermodynamic and dynamic probes.

  19. The dispersion and detection patterns of mtDNA-assigned red fox Vulpes vulpes scats in Tasmania are anomalous.

    PubMed

    Marks, Clive A; Obendorf, David; Pereira, Filipe; Edwards, Ivo; Hall, Graham P

    2014-08-01

    Models used for resource allocation in eradication programmes must be based on replicated data of known quality and have proven predictive accuracy, or they may provide a false indication of species presence and/or distribution. In the absence of data corroborating the presence of extant foxes Vulpes vulpes in Tasmania, a habitat-specific model based upon mtDNA data (Sarre et al . 2012. Journal Applied Ecology , 50, 459-468) implied that foxes were widespread. Overall, 61 of 9940 (0·6%) surveyed scats were assigned as mtDNA fox positive by the fox eradication programme (FEP). We investigated the spatiotemporal distribution of the 61 mtDNA-assigned fox scats and modelled the probability of replicating scat detection in independent surveys using detection dogs based upon empirically derived probabilities of scat detection success obtained by the FEP using imported fox scats. In a prior mainland study, fox genotypes were recurrently detected in a consecutive four-day pool of scats. In Tasmania, only three contemporaneously collected scat pairs of unknown genotype were detected by the FEP within an area corresponding to a conservatively large mainland fox home range (639 ha) in a decade. Nearest neighbour pairs were widely spaced (mean = 7·0 km; circular area = 153 km 2 ) and generated after a mean of 281 days. The majority of assigned mtDNA positive scats were found in urban and peri-urban environments corresponding to small mainland fox home ranges (30-45 ha) that imply higher scat density and more certain replication. Using the lowest empirically determined scat detection success for dogs, the failure to replicate fox scat detection on 34 of 36 occasions in a large (639 ha) home range is highly improbable ( P  = 0·00001) and suggestive of Type I error. Synthesis and applications . Type I error, which may have various sources, should be considered when scat mtDNA data are few, accumulated over many years, uncorroborated by observations of extant specimens, inadequately replicated in independent surveys within an expected spatiotemporal scale and reported in geographically isolated environments unlikely to have been colonized.

  20. Effects of vagus nerve stimulation on extinction of conditioned fear and post-traumatic stress disorder symptoms in rats.

    PubMed

    Noble, L J; Gonzalez, I J; Meruva, V B; Callahan, K A; Belfort, B D; Ramanathan, K R; Meyers, E; Kilgard, M P; Rennaker, R L; McIntyre, C K

    2017-08-22

    Exposure-based therapies help patients with post-traumatic stress disorder (PTSD) to extinguish conditioned fear of trauma reminders. However, controlled laboratory studies indicate that PTSD patients do not extinguish conditioned fear as well as healthy controls, and exposure therapy has high failure and dropout rates. The present study examined whether vagus nerve stimulation (VNS) augments extinction of conditioned fear and attenuates PTSD-like symptoms in an animal model of PTSD. To model PTSD, rats were subjected to a single prolonged stress (SPS) protocol, which consisted of restraint, forced swim, loss of consciousness, and 1 week of social isolation. Like PTSD patients, rats subjected to SPS show impaired extinction of conditioned fear. The SPS procedure was followed, 1 week later, by auditory fear conditioning (AFC) and extinction. VNS or sham stimulation was administered during half of the extinction days, and was paired with presentations of the conditioned stimulus. One week after completion of extinction training, rats were given a battery of behavioral tests to assess anxiety, arousal and avoidance. Results indicated that rats given SPS 1 week prior to AFC (PTSD model) failed to extinguish the freezing response after eleven consecutive days of extinction. Administration of VNS reversed the extinction impairment and attenuated reinstatement of the conditioned fear response. Delivery of VNS during extinction also eliminated the PTSD-like symptoms, such as anxiety, hyperarousal and social avoidance for more than 1 week after VNS treatment. These results provide evidence that extinction paired with VNS treatment can lead to remission of fear and improvements in PTSD-like symptoms. Taken together, these findings suggest that VNS may be an effective adjunct to exposure therapy for the treatment of PTSD.

  1. Sythesis of MCMC and Belief Propagation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ahn, Sungsoo; Chertkov, Michael; Shin, Jinwoo

    Markov Chain Monte Carlo (MCMC) and Belief Propagation (BP) are the most popular algorithms for computational inference in Graphical Models (GM). In principle, MCMC is an exact probabilistic method which, however, often suffers from exponentially slow mixing. In contrast, BP is a deterministic method, which is typically fast, empirically very successful, however in general lacking control of accuracy over loopy graphs. In this paper, we introduce MCMC algorithms correcting the approximation error of BP, i.e., we provide a way to compensate for BP errors via a consecutive BP-aware MCMC. Our framework is based on the Loop Calculus (LC) approach whichmore » allows to express the BP error as a sum of weighted generalized loops. Although the full series is computationally intractable, it is known that a truncated series, summing up all 2-regular loops, is computable in polynomial-time for planar pair-wise binary GMs and it also provides a highly accurate approximation empirically. Motivated by this, we first propose a polynomial-time approximation MCMC scheme for the truncated series of general (non-planar) pair-wise binary models. Our main idea here is to use the Worm algorithm, known to provide fast mixing in other (related) problems, and then design an appropriate rejection scheme to sample 2-regular loops. Furthermore, we also design an efficient rejection-free MCMC scheme for approximating the full series. The main novelty underlying our design is in utilizing the concept of cycle basis, which provides an efficient decomposition of the generalized loops. In essence, the proposed MCMC schemes run on transformed GM built upon the non-trivial BP solution, and our experiments show that this synthesis of BP and MCMC outperforms both direct MCMC and bare BP schemes.« less

  2. Effect of Kangaroo Mother Care on Vital Physiological Parameters of The Low Birth Weight Newborn

    PubMed Central

    Bera, Alpanamayi; Ghosh, Jagabandhu; Singh, Arun Kumarendu; Hazra, Avijit; Som, Tapas; Munian, Dinesh

    2014-01-01

    Objectives: Low birth weight (LBW; <2500 g), which is often associated with preterm birth, is a common problem in India. Both are recognized risk factors for neonatal mortality. Kangaroo mother care (KMC) is a non-conventional, low-cost method for newborn care based upon intimate skin-to-skin contact between mother and baby. Our objective was to assess physiological state of LBW babies before and after KMC in a teaching hospital setting. Materials and Methods: Study cohort comprised in-born LBW babies and their mothers - 300 mother-baby pairs were selected through purposive sampling. Initially, KMC was started for 1 hour duration (at a stretch) on first day and then increased by 1 hour each day for next 2 days. Axillary temperature, respiration rate (RR/ min), heart rate (HR/ min), and oxygen saturation (SpO2) were assessed for 3 consecutive days, immediately before and after KMC. Results: Data from 265 mother-baby pairs were analyzed. Improvements occurred in all 4 recorded physiological parameters during the KMC sessions. Mean temperature rose by about 0.4°C, RR by 3 per minute, HR by 5 bpm, and SpO2 by 5% following KMC sessions. Although modest, these changes were statistically significant on all 3 days. Individual abnormalities (e.g. hypothermia, bradycardia, tachycardia, low SpO2) were often corrected during the KMC sessions. Conclusions: Babies receiving KMC showed modest but statistically significant improvement in vital physiological parameters on all 3 days. Thus, without using special equipment, the KMC strategy can offer improved care to LBW babies. These findings support wider implementation of this strategy. PMID:25364150

  3. Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

    NASA Technical Reports Server (NTRS)

    Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

    2011-01-01

    We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

  4. N-H Stretching Excitations in Adenosine-Thymidine Base Pairs in Solution: Base Pair Geometries, Infrared Line Shapes and Ultrafast Vibrational Dynamics

    PubMed Central

    Greve, Christian; Preketes, Nicholas K.; Fidder, Henk; Costard, Rene; Koeppe, Benjamin; Heisler, Ismael A.; Mukamel, Shaul; Temps, Friedrich; Nibbering, Erik T. J.; Elsaesser, Thomas

    2013-01-01

    We explore the N-H stretching vibrations of adenosine-thymidine base pairs in chloroform solution with linear and nonlinear infrared spectroscopy. Based on estimates from NMR measurements and ab initio calculations, we conclude that adenosine and thymidine form hydrogen bonded base pairs in Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen configurations with similar probability. Steady-state concentration- and temperature dependent linear FT-IR studies, including H/D exchange experiments, reveal that these hydrogen-bonded base pairs have complex N-H/N-D stretching spectra with a multitude of spectral components. Nonlinear 2D-IR spectroscopic results, together with IR-pump-IR-probe measurements, as also corroborated by ab initio calculations, reveal that the number of N-H stretching transitions is larger than the total number of N-H stretching modes. This is explained by couplings to other modes, such as an underdamped low-frequency hydrogen-bond mode, and a Fermi resonance with NH2 bending overtone levels of the adenosine amino-group. Our results demonstrate that modeling based on local N-H stretching vibrations only is not sufficient and call for further refinement of the description of the N-H stretching manifolds of nucleic acid base pairs of adenosine and thymidine, incorporating a multitude of couplings with fingerprint and low-frequency modes. PMID:23234439

  5. Structural Basis for the Lesion-scanning Mechanism of the MutY DNA Glycosylase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Lan; Chakravarthy, Srinivas; Verdine, Gregory L.

    The highly mutagenic A:8-oxoguanine (oxoG) base pair is generated mainly by misreplication of the C:oxoG base pair, the oxidation product of the C:G base pair. The A:oxoG base pair is particularly insidious because neither base in it carries faithful information to direct the repair of the other. The bacterial MutY (MUTYH in humans) adenine DNA glycosylase is able to initiate the repair of A:oxoG by selectively cleaving the A base from the A:oxoG base pair. The difference between faithful repair and wreaking mutagenic havoc on the genome lies in the accurate discrimination between two structurally similar base pairs: A:oxoG andmore » A:T. Here we present two crystal structures of the MutY N-terminal domain in complex with either undamaged DNA or DNA containing an intrahelical lesion. These structures have captured for the first time a DNA glycosylase scanning the genome for a damaged base in the very first stage of lesion recognition and the base extrusion pathway. The mode of interaction observed here has suggested a common lesion-scanning mechanism across the entire helix-hairpin-helix superfamily to which MutY belongs. In addition, small angle X-ray scattering studies together with accompanying biochemical assays have suggested a possible role played by the C-terminal oxoG-recognition domain of MutY in lesion scanning.« less

  6. KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.

    PubMed

    Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas

    2012-07-01

    Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Egli, Martin; Pallan, Pradeep S.; Pattanayek, Rekha

    An experimental rationalization of the structure type encountered in DNA and RNA by systematically investigating the chemical and physical properties of alternative nucleic acids has identified systems with a variety of sugar-phosphate backbones that are capable of Watson-Crick base pairing and in some cases cross-pairing with the natural nucleic acids. The earliest among the model systems tested to date, (4{prime} {yields} 6{prime})-linked oligo(2{prime},3{prime}-dideoxy-{beta}-d-glucopyranosyl)nucleotides or homo-DNA, shows stable self-pairing, but the pairing rules for the four natural bases are not the same as those in DNA. However, a complete interpretation and understanding of the properties of the hexapyranosyl (4{prime} {yields} 6{prime})more » family of nucleic acids has been impeded until now by the lack of detailed 3D-structural data. We have determined the crystal structure of a homo-DNA octamer. It reveals a weakly twisted right-handed duplex with a strong inclination between the hexose-phosphate backbones and base-pair axes, and highly irregular values for helical rise and twist at individual base steps. The structure allows a rationalization of the inability of allo-, altro-, and glucopyranosyl-based oligonucleotides to form stable pairing systems.« less

  8. Sequence-dependent base pair stepping dynamics in XPD helicase unwinding

    PubMed Central

    Qi, Zhi; Pugh, Robert A; Spies, Maria; Chemla, Yann R

    2013-01-01

    Helicases couple the chemical energy of ATP hydrolysis to directional translocation along nucleic acids and transient duplex separation. Understanding helicase mechanism requires that the basic physicochemical process of base pair separation be understood. This necessitates monitoring helicase activity directly, at high spatio-temporal resolution. Using optical tweezers with single base pair (bp) resolution, we analyzed DNA unwinding by XPD helicase, a Superfamily 2 (SF2) DNA helicase involved in DNA repair and transcription initiation. We show that monomeric XPD unwinds duplex DNA in 1-bp steps, yet exhibits frequent backsteps and undergoes conformational transitions manifested in 5-bp backward and forward steps. Quantifying the sequence dependence of XPD stepping dynamics with near base pair resolution, we provide the strongest and most direct evidence thus far that forward, single-base pair stepping of a helicase utilizes the spontaneous opening of the duplex. The proposed unwinding mechanism may be a universal feature of DNA helicases that move along DNA phosphodiester backbones. DOI: http://dx.doi.org/10.7554/eLife.00334.001 PMID:23741615

  9. Efficient Acceleration of the Pair-HMMs Forward Algorithm for GATK HaplotypeCaller on Graphics Processing Units.

    PubMed

    Ren, Shanshan; Bertels, Koen; Al-Ars, Zaid

    2018-01-01

    GATK HaplotypeCaller (HC) is a popular variant caller, which is widely used to identify variants in complex genomes. However, due to its high variants detection accuracy, it suffers from long execution time. In GATK HC, the pair-HMMs forward algorithm accounts for a large percentage of the total execution time. This article proposes to accelerate the pair-HMMs forward algorithm on graphics processing units (GPUs) to improve the performance of GATK HC. This article presents several GPU-based implementations of the pair-HMMs forward algorithm. It also analyzes the performance bottlenecks of the implementations on an NVIDIA Tesla K40 card with various data sets. Based on these results and the characteristics of GATK HC, we are able to identify the GPU-based implementations with the highest performance for the various analyzed data sets. Experimental results show that the GPU-based implementations of the pair-HMMs forward algorithm achieve a speedup of up to 5.47× over existing GPU-based implementations.

  10. DNA bases ring-expanded with a cyclopentadiene free radical: a theoretical investigation of building blocks with diradical character.

    PubMed

    Zhao, Peiwen; Bu, Yuxiang

    2016-01-14

    In this work, we computationally design radical nucleobases which possess improved electronic properties, especially diradical properties through introducing a cyclopentadiene radical. We predict that the detailed electromagnetic features of base assemblies are based on the orientation of the extra five-membered cyclopentadiene ring. Broken symmetry DFT calculations take into account the relevant structures and properties. Our results reveal that both the radicalized DNA bases and the base pairs formed when they combine with their counterparts remain stable and display larger spin delocalization. The mode of embedding the cyclopentadiene free radical in the structures has some influence on the degree of π-conjugation, which results in various diradical characteristics. Single-layered radical base pairs all have an open-shell singlet ground state, but the energy difference between singlet and triplet is not significant. For two-layered radical base pairs, the situation is more complex. All of them have an open-shell state as their ground state, including an open-shell singlet state and an open-shell triplet state. That is, the majority of radical base pairs possess anti-ferromagnetic or ferromagnetic characteristics. We present here a more in-depth discussion and analyses to study the magnetic characteristics of radical bases and base pairs. As an important factor, two-layered radical base pairs also have been carefully analyzed. We hope that all the measurements and results presented here will stimulate further detailed insights into the related mechanisms in modified DNA bases and the design of better ring-expanded DNA magnetic materials.

  11. Identification of residue pairing in interacting β-strands from a predicted residue contact map.

    PubMed

    Mao, Wenzhi; Wang, Tong; Zhang, Wenxuan; Gong, Haipeng

    2018-04-19

    Despite the rapid progress of protein residue contact prediction, predicted residue contact maps frequently contain many errors. However, information of residue pairing in β strands could be extracted from a noisy contact map, due to the presence of characteristic contact patterns in β-β interactions. This information may benefit the tertiary structure prediction of mainly β proteins. In this work, we propose a novel ridge-detection-based β-β contact predictor to identify residue pairing in β strands from any predicted residue contact map. Our algorithm RDb 2 C adopts ridge detection, a well-developed technique in computer image processing, to capture consecutive residue contacts, and then utilizes a novel multi-stage random forest framework to integrate the ridge information and additional features for prediction. Starting from the predicted contact map of CCMpred, RDb 2 C remarkably outperforms all state-of-the-art methods on two conventional test sets of β proteins (BetaSheet916 and BetaSheet1452), and achieves F1-scores of ~ 62% and ~ 76% at the residue level and strand level, respectively. Taking the prediction of the more advanced RaptorX-Contact as input, RDb 2 C achieves impressively higher performance, with F1-scores reaching ~ 76% and ~ 86% at the residue level and strand level, respectively. In a test of structural modeling using the top 1 L predicted contacts as constraints, for 61 mainly β proteins, the average TM-score achieves 0.442 when using the raw RaptorX-Contact prediction, but increases to 0.506 when using the improved prediction by RDb 2 C. Our method can significantly improve the prediction of β-β contacts from any predicted residue contact maps. Prediction results of our algorithm could be directly applied to effectively facilitate the practical structure prediction of mainly β proteins. All source data and codes are available at http://166.111.152.91/Downloads.html or the GitHub address of https://github.com/wzmao/RDb2C .

  12. Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands

    NASA Astrophysics Data System (ADS)

    Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree

    2018-05-01

    In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.

  13. 2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

    PubMed

    Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

    2017-11-02

    The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Radical-pair based avian magnetoreception

    NASA Astrophysics Data System (ADS)

    Procopio, Maria; Ritz, Thorsten

    2014-03-01

    Behavioural experiments suggest that migratory birds possess a magnetic compass sensor able to detect the direction of the geomagnetic. One hypothesis for the basis of this remarkable sensory ability is that the coherent quantum spin dynamics of photoinduced radical pair reactions transduces directional magnetic information from the geomagnetic field into changes of reaction yields, possibly involving the photoreceptor cryptochrome in the birds retina. The suggested radical-pair based avian magnetoreception has attracted attention in the field of quantum biology as an example of a biological sensor which might exploit quantum coherences for its biological function. Investigations on such a spin-based sensor have focussed on uncovering the design features for the design of a biomimetic magnetic field sensor. We study the effects of slow fluctuations in the nuclear spin environment on the directional signal. We quantitatively evaluate the robustness of signals under fluctuations on a timescale longer than the lifetime of a radical pair, utilizing two models of radical pairs. Our results suggest design principles for building a radical-pair based compass sensor that is both robust and highly directional sensitive.

  15. A novel method to enhance informed consent: a prospective and randomised trial of form-based versus electronic assisted informed consent in paediatric endoscopy.

    PubMed

    Friedlander, Joel A; Loeben, Greg S; Finnegan, Patricia K; Puma, Anita E; Zhang, Xuemei; de Zoeten, Edwin F; Piccoli, David A; Mamula, Petar

    2011-04-01

    To evaluate the adequacy of paediatric informed consent and its augmentation by a supplemental computer-based module in paediatric endoscopy. The Consent-20 instrument was developed and piloted on 47 subjects. Subsequently, parents of 101 children undergoing first-time, diagnostic upper endoscopy performed under moderate IV sedation were prospectively and consecutively, blinded, randomised and enrolled into two groups that received either standard form-based informed consent or standard form-based informed consent plus a commercial (Emmi Solutions, Inc, Chicago, Il), sixth grade level, interactive learning module (electronic assisted consent). Anonymously and electronically, the subjects' anxiety (State Trait Anxiety Inventory), satisfaction (Modified Group Health Association of America), number of questions asked, and attainment of informed consent were assessed (Consent-20). Statistics were calculated using t test, paired t test, and Mann Whitney tests. The ability to achieve informed consent, as measured by the new instrument, was 10% in the control form-based consent group and 33% in the electronic assisted consent group (p<0.0001). Electronically assisting form-based informed consent did not alter secondary outcome measures of subject satisfaction, anxiety or number of questions asked in a paediatric endoscopy unit. This study demonstrates the limitations of form-based informed consent methods for paediatric endoscopy. It also shows that even when necessary information was repeated electronically in a comprehensive and standardised video, informed consent as measured by our instrument was incompletely achieved. The supplemental information did, however, significantly improve understanding in a manner that did not negatively impact workflow, subject anxiety or subject satisfaction. Additional study of informed consent is required.

  16. Comparison of the conformation of an oligonucleotide containing a central G-T base pair with the non-mismatch sequence by proton NMR.

    PubMed Central

    Quignard, E; Fazakerley, G V; van der Marel, G; van Boom, J H; Guschlbauer, W

    1987-01-01

    We have recorded NOESY spectra of two non-selfcomplementary undecanucleotide duplexes. From the observed NOEs we do not detect any significant distortion of the helix when a G-C pair is replaced by a G-T pair and the normal interresidue connectivities can be followed through the mismatch site. We conclude that the 2D spectra of the non-exchangeable protons do not allow differentiation between a wobble or rare tautomer form for the mismatch. NOE measurements in H2O, however, clearly show that the mismatch adopts a wobble structure and give information on the hydration in the minor groove for the G-T base pair which is embedded between two A-T base pairs in the sequence. PMID:3033602

  17. Stringent Nucleotide Recognition by the Ribosome at the Middle Codon Position.

    PubMed

    Liu, Wei; Shin, Dongwon; Ng, Martin; Sanbonmatsu, Karissa Y; Tor, Yitzhak; Cooperman, Barry S

    2017-08-29

    Accurate translation of the genetic code depends on mRNA:tRNA codon:anticodon base pairing. Here we exploit an emissive, isosteric adenosine surrogate that allows direct measurement of the kinetics of codon:anticodon University of California base formation during protein synthesis. Our results suggest that codon:anticodon base pairing is subject to tighter constraints at the middle position than at the 5'- and 3'-positions, and further suggest a sequential mechanism of formation of the three base pairs in the codon:anticodon helix.

  18. Characterization of the Trans Watson-Crick GU Base Pair Located in the Catalytic Core of the Antigenomic HDV Ribozyme

    PubMed Central

    Lévesque, Dominique; Reymond, Cédric; Perreault, Jean-Pierre

    2012-01-01

    The HDV ribozyme’s folding pathway is, by far, the most complex folding pathway elucidated to date for a small ribozyme. It includes 6 different steps that have been shown to occur before the chemical cleavage. It is likely that other steps remain to be discovered. One of the most critical of these unknown steps is the formation of the trans Watson-Crick GU base pair within loop III. The U23 and G28 nucleotides that form this base pair are perfectly conserved in all natural variants of the HDV ribozyme, and therefore are considered as being part of the signature of HDV-like ribozymes. Both the formation and the transformation of this base pair have been studied mainly by crystal structure and by molecular dynamic simulations. In order to obtain physical support for the formation of this base pair in solution, a set of experiments, including direct mutagenesis, the site-specific substitution of chemical groups, kinetic studies, chemical probing and magnesium-induced cleavage, were performed with the specific goal of characterizing this trans Watson-Crick GU base pair in an antigenomic HDV ribozyme. Both U23 and G28 can be substituted for nucleotides that likely preserve some of the H-bond interactions present before and after the cleavage step. The formation of the more stable trans Watson-Crick base pair is shown to be a post-cleavage event, while a possibly weaker trans Watson-Crick/Hoogsteen interaction seems to form before the cleavage step. The formation of this unusually stable post-cleavage base pair may act as a driving force on the chemical cleavage by favouring the formation of a more stable ground state of the product-ribozyme complex. To our knowledge, this represents the first demonstration of a potential stabilising role of a post-cleavage conformational switch event in a ribozyme-catalyzed reaction. PMID:22768274

  19. Building a knowledge base of severe adverse drug events based on AERS reporting data using semantic web technologies.

    PubMed

    Jiang, Guoqian; Wang, Liwei; Liu, Hongfang; Solbrig, Harold R; Chute, Christopher G

    2013-01-01

    A semantically coded knowledge base of adverse drug events (ADEs) with severity information is critical for clinical decision support systems and translational research applications. However it remains challenging to measure and identify the severity information of ADEs. The objective of the study is to develop and evaluate a semantic web based approach for building a knowledge base of severe ADEs based on the FDA Adverse Event Reporting System (AERS) reporting data. We utilized a normalized AERS reporting dataset and extracted putative drug-ADE pairs and their associated outcome codes in the domain of cardiac disorders. We validated the drug-ADE associations using ADE datasets from SIDe Effect Resource (SIDER) and the UMLS. We leveraged the Common Terminology Criteria for Adverse Event (CTCAE) grading system and classified the ADEs into the CTCAE in the Web Ontology Language (OWL). We identified and validated 2,444 unique Drug-ADE pairs in the domain of cardiac disorders, of which 760 pairs are in Grade 5, 775 pairs in Grade 4 and 2,196 pairs in Grade 3.

  20. Object Detection in Natural Backgrounds Predicted by Discrimination Performance and Models

    NASA Technical Reports Server (NTRS)

    Ahumada, A. J., Jr.; Watson, A. B.; Rohaly, A. M.; Null, Cynthia H. (Technical Monitor)

    1995-01-01

    In object detection, an observer looks for an object class member in a set of backgrounds. In discrimination, an observer tries to distinguish two images. Discrimination models predict the probability that an observer detects a difference between two images. We compare object detection and image discrimination with the same stimuli by: (1) making stimulus pairs of the same background with and without the target object and (2) either giving many consecutive trials with the same background (discrimination) or intermixing the stimuli (object detection). Six images of a vehicle in a natural setting were altered to remove the vehicle and mixed with the original image in various proportions. Detection observers rated the images for vehicle presence. Discrimination observers rated the images for any difference from the background image. Estimated detectabilities of the vehicles were found by maximizing the likelihood of a Thurstone category scaling model. The pattern of estimated detectabilities is similar for discrimination and object detection, and is accurately predicted by a Cortex Transform discrimination model. Predictions of a Contrast- Sensitivity- Function filter model and a Root-Mean-Square difference metric based on the digital image values are less accurate. The discrimination detectabilities averaged about twice those of object detection.

  1. A hybrid prognostic model for multistep ahead prediction of machine condition

    NASA Astrophysics Data System (ADS)

    Roulias, D.; Loutas, T. H.; Kostopoulos, V.

    2012-05-01

    Prognostics are the future trend in condition based maintenance. In the current framework a data driven prognostic model is developed. The typical procedure of developing such a model comprises a) the selection of features which correlate well with the gradual degradation of the machine and b) the training of a mathematical tool. In this work the data are taken from a laboratory scale single stage gearbox under multi-sensor monitoring. Tests monitoring the condition of the gear pair from healthy state until total brake down following several days of continuous operation were conducted. After basic pre-processing of the derived data, an indicator that correlated well with the gearbox condition was obtained. Consecutively the time series is split in few distinguishable time regions via an intelligent data clustering scheme. Each operating region is modelled with a feed-forward artificial neural network (FFANN) scheme. The performance of the proposed model is tested by applying the system to predict the machine degradation level on unseen data. The results show the plausibility and effectiveness of the model in following the trend of the timeseries even in the case that a sudden change occurs. Moreover the model shows ability to generalise for application in similar mechanical assets.

  2. Effects of a specially pulsed electric field on an animal model of wound healing.

    PubMed

    Cinar, Kenan; Comlekci, Selcuk; Senol, Nurgul

    2009-09-01

    The possible beneficial effects of a specially pulsed electric field (PEF) on wound healing were investigated in this study. We made a pair of triangular, full-thickness, dorsal incisions in the skin of 32 healthy male mice (one control group and three exposure groups). The treatment groups were kept between parallel plates in a partially insulated exposed environment. Group I was exposed to an electric field intensity of 10 kV/m, group II was exposed to 1.9 kV/m, and group III was exposed to 0.9 kV/m. PEFs were applied to the subjects for 20-22 h and 8 consecutive days. We determined the differences in wound recovery between the groups based on the following parameters: collagen fiber density, inflammatory infiltration density, capillary proliferation, and existence of exudates. We found that a 0.9 kV/m-1.9 kV/m chopped direct current (DC) electric field with a 30 micros repetition time favorably affected collagen synthesis and wound recovery. Despite the intensity of 0.9-1.9 kV/m, PEF accelerated healing, but 10 kV/m decelerated this recovery process.

  3. Terminal base pairs of oligodeoxynucleotides: imino proton exchange and fraying.

    PubMed

    Nonin, S; Leroy, J L; Guéron, M

    1995-08-22

    We have estimated the dissociation constant of the terminal base pairs of the B-DNA duplexes formed by 5'-d(CGCGATCGCG) and 5'-d(TAGCGCTA) by two methods, one based on the change in imino proton chemical shift with temperature and the other on the apparent pK shift of the imino proton, as monitored by the change in chemical shift of aromatic protons. These methods do not rely on imino proton exchange, whose rate was also measured. (1) The effect of ammonia on the imino proton exchange rate of the terminal pair of the 5'-d(CGCGATCGCG) duplex is 67 times less than on the isolated nucleoside. This provides an upper limit on the exchange rate from the closed pair. In fact, the effect is just as predicted from the dissociation constant, assuming that there is no exchange at all from the closed pair and that, as has been argued previously, external catalysts act on the open state as they do on the isolated nucleoside. The inhibition of catalyzed proton exchange in the closed pair, despite exposure of one face of the pair to solvent, is a new feature of the exchange process. It will allow determination of the dissociation constant of terminal pairs from the exchange rate. (2) Intrinsic catalysis of proton exchange is less efficient for the terminal pair than for an internal one. A possible explanation is that proton transfer across the water bridge responsible for intrinsic catalysis is slower, as expected if the open-state separation of the bases is larger in a terminal pair. This observation may lead to a direct method for the study of fraying. (3) At 0 degrees C, the dissociation constant of the second pair of the 5'-d(CGCGATCGCG) duplex is close to the square of the constant for the terminal pair, as predicted from a simple model of fraying. The enthalpy and entropy of opening of the terminal pairs may be compared with those of nearest neighbor interactions derived from calorimetry [Breslauer, K. J., et al. (1986) Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750].

  4. Hybrid-denovo: a de novo OTU-picking pipeline integrating single-end and paired-end 16S sequence tags.

    PubMed

    Chen, Xianfeng; Johnson, Stephen; Jeraldo, Patricio; Wang, Junwen; Chia, Nicholas; Kocher, Jean-Pierre A; Chen, Jun

    2018-03-01

    Illumina paired-end sequencing has been increasingly popular for 16S rRNA gene-based microbiota profiling. It provides higher phylogenetic resolution than single-end reads due to a longer read length. However, the reverse read (R2) often has significant low base quality, and a large proportion of R2s will be discarded after quality control, resulting in a mixture of paired-end and single-end reads. A typical 16S analysis pipeline usually processes either paired-end or single-end reads but not a mixture. Thus, the quantification accuracy and statistical power will be reduced due to the loss of a large amount of reads. As a result, rare taxa may not be detectable with the paired-end approach, or low taxonomic resolution will result in a single-end approach. To have both the higher phylogenetic resolution provided by paired-end reads and the higher sequence coverage by single-end reads, we propose a novel OTU-picking pipeline, hybrid-denovo, that can process a hybrid of single-end and paired-end reads. Using high-quality paired-end reads as a gold standard, we show that hybrid-denovo achieved the highest correlation with the gold standard and performed better than the approaches based on paired-end or single-end reads in terms of quantifying the microbial diversity and taxonomic abundances. By applying our method to a rheumatoid arthritis (RA) data set, we demonstrated that hybrid-denovo captured more microbial diversity and identified more RA-associated taxa than a paired-end or single-end approach. Hybrid-denovo utilizes both paired-end and single-end 16S sequencing reads and is recommended for 16S rRNA gene targeted paired-end sequencing data.

  5. Utilizing formative evaluation to enhance the understanding of chemistry and the methods and procedures of science

    NASA Astrophysics Data System (ADS)

    Pizzini, Edward L.; Treagust, David F.; Cody, John

    The purpose of this study was to determine whether or not formative evaluation could facilitate goal attainment in a biochemistry course and produce desired learning outcomes consistently by altering course materials and/or instruction. Formative evaluation procedures included the administration of the Inorganic-Organic-Biological Chemistry Test Form 1974 and the Methods and Procedures of Science test to course participants over three consecutive years. A one group pretest-post-test design was used. The statistical analysis involved the use of the Wilcoxon matched-pairs signed-ranks test. The study involved 64 participants. The findings indicate that the use of formative evaluation can be effective in producing desired learning outcomes to facilitate goal attainment.

  6. A field evaluation of a piezo-optical dosimeter for environmental monitoring of nitrogen dioxide.

    PubMed

    Wright, John D; Schillinger, Eric F J; Cazier, Fabrice; Nouali, Habiba; Mercier, Agnes; Beaugard, Charles

    2004-06-01

    Measurements of 8-hour time-weighted average NO(2) concentrations are reported at 7 different locations in the region of Dunkirk over 5 consecutive days using PiezOptic monitoring badges previously calibrated for the range 0-70 ppb together with data from chemiluminescent analysers in 5 sites (4 fixed and one mobile). The latter facilities also provided data on ozone and NO concentrations and meteorological conditions. Daily averages from the two pairs of badges in different types of sampling cover in each site have been compared with data from the chemiluminescent analysers, and found largely to agree within error margins of +/-30%. Although NO(2) and ozone concentrations were low, rendering detailed discussion impossible, the general features followed expected patterns.

  7. [Analysis of health self-management for diabetes self-efficacy].

    PubMed

    Liu, Yalan; Ding, Xianbin; Jiang, Yi; Zhang, Chunhua; Mao, Deqiang; Shen, Zhuozhi; Qi, Li; Lü, Xiaoyan; Lu, Junjia; Wang, Tingting

    2015-08-01

    To evaluate the effect of health self-management on self-efficiency of diabetes patients.
 A total of 184 eligible and voluntary diabetes patients were recruited for 6 consecutive weeks of knowledge and skills intervention, and interviewed with questionnaire by diabetes self-efficacy scale (DSES) before and after the intervention. The changes in self-efficiency were compared with two paired sample McNemar test.
 After the intervention, the total scores of self-efficiency on diet, medication, blood sugar monitoring, foot care and complications management were all increased significantly compared with those before the intervention (P<0.05).
 The intervention model of health self-management for self-efficiency in diabetes patients is effective, and the quality of patients' life can be improved.

  8. Asymptotic formulae for the zeros of orthogonal polynomials

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Badkov, V M

    2012-09-30

    Let p{sub n}(t) be an algebraic polynomial that is orthonormal with weight p(t) on the interval [-1, 1]. When p(t) is a perturbation (in certain limits) of the Chebyshev weight of the first kind, the zeros of the polynomial p{sub n}( cos {tau}) and the differences between pairs of (not necessarily consecutive) zeros are shown to satisfy asymptotic formulae as n{yields}{infinity}, which hold uniformly with respect to the indices of the zeros. Similar results are also obtained for perturbations of the Chebyshev weight of the second kind. First, some preliminary results on the asymptotic behaviour of the difference between twomore » zeros of an orthogonal trigonometric polynomial, which are needed, are established. Bibliography: 15 titles.« less

  9. Blackcurrant Leaf Chlorosis Associated Virus: Evidence of the Presence of Circular RNA during Infections.

    PubMed

    James, Delano; Phelan, James; Sanderson, Daniel

    2018-05-15

    Blackcurrant leaf chlorosis associated virus (BCLCaV) was detected recently by next-generation sequencing (NGS) and a new and distinct species in the genus Idaeovirus was proposed. Analysis of NGS-derived paired-end reads revealed the existence of bridge reads encompassing the 3'-terminus and 5'-terminus of RNA-2 or RNA-3 of BCLCaV. The full RNA-2 or RNA-3 could be amplified using outward facing or abutting primers; also, RNA-2/RNA-3 could be detected even after three consecutive RNase R enzyme treatments, with denaturation at 95 °C preceding each digestion. Evidence was obtained indicating that there are circular forms of BCLCaV RNA-2 and RNA-3.

  10. Diurnal vocal activity of gray whales in Laguna San Ignacio, BCS, Mexico

    NASA Astrophysics Data System (ADS)

    Guerra, Melania; Thode, Aaron; Wisdom, Sheyna; Gonzalez, Sergio; Urban, Jorge; Sumich, James

    2005-09-01

    Three sets of portable horizontal acoustic arrays were deployed during a week in February 2005 to gather acoustic recordings of gray whales (Eschrichtius robustus) in Laguna San Ignacio, one of the three major breeding/calving lagoons in Baja California, Mexico. These arrays, which were constructed by attaching a pair of autonomous flash-memory acoustic sensors to a rope, were deployed for 36 consecutive hours on two occasions, spatially covering the narrowest point of the lagoon near Punta Piedra, the area of the highest concentration of whales. Additionally a single hydrophone was deployed off a small boat to record during friendly encounters with single whales and cow/calf pairs. Each recorder's time series was analyzed for Type 1 gray whale sounds (called pops), which are pulsive, broadband, and have substantial acoustic energy between 100 and 600 Hz. The number of automated acoustic detections per hour can be compared with population sizes estimated by two visual surveys conducted by scientists of the Autonomous University of Baja California Sur, La Paz. The results of several automated analyses of both the bottom-mounted and boat-deployed recordings will be presented, with a focus on potential diurnal patterns in the vocal activity.

  11. Self-reported and employer-recorded sickness absence in doctors.

    PubMed

    Murphy, I J

    2014-09-01

    Doctors' sickness absence reduces the quality and continuity of patient care and is financially costly. Doctors have lower rates of sickness absence than other healthcare workers. To compare self-reported with recorded sickness absence in doctors in a UK National Health Service hospital trust. A retrospective questionnaire study. The main outcome measures were self-reported and trust-recorded sickness absence episodes of 4 days or more in two consecutive 6-month periods. The response rate was 82% (607/736). Self-reported sickness absence rates were 1.2% compared with a rate of 0.6% from trust-recorded data. There were 38 matched pairs of self-reported (mean duration: 18 days, standard deviation: 22 days) and trust-recorded (mean duration: 10 days, standard deviation: 17 days) sickness absence episodes of 4 days or more in the 12 months studied. A matched pairs t-test determined that the difference between the two means was significant (t = 2.57, P < 0.05). Doctors' sickness absence was significantly under-recorded in this study population. © The Author 2014. Published by Oxford University Press on behalf of the Society of Occupational Medicine. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  12. Volumetric blood flow via time-domain correlation: experimental verification.

    PubMed

    Embree, P M; O'Brien, W R

    1990-01-01

    A novel ultrasonic volumetric flow measurement method using time-domain correlation of consecutive pairs of echoes has been developed. An ultrasonic data acquisition system determined the time shift between a pair of range gated echoes by searching for the time shift with the maximum correlation between the RF sampled waveforms. Experiments with a 5-MHz transducer indicate that the standard deviation of the estimate of steady fluid velocity through 6-mm-diameter tubes is less than 10% of the mean. Experimentally, Sephadex (G-50; 20-80 mum dia.) particles in water and fresh porcine blood have been used as ultrasound scattering fluids. Two-dimensional (2-D) flow velocity can be estimated by slowly sweeping the ultrasonic beam across the blood vessel phantom. Volumetric flow through the vessel is estimated by integrating the 2-D flow velocity field and then is compared to hydrodynamic flow measurements to assess the overall experimental accuracy of the time-domain method. Flow rates from 50-500 ml/min have been estimated with an accuracy better than 10% under the idealized characteristics used in this study, which include straight circular thin-walled tubes, laminar axially-symmetric steady flow, and no intervening tissues.

  13. Relativistic coupled cluster theory based on the no-pair Dirac-Coulomb-Breit Hamiltonian: Relativistic pair correlation energies of the Xe atom

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Eliav, E.; Kaldor, U.; Ishikawa, Y.

    1994-12-31

    Relativistic pair correlation energies of Xe were computed by employing a recently developed relativistic coupled cluster theory based on the no-pair Dirac-Coulomb-Breit Hamiltonian. The matrix Dirac-Fock-Breit SCF and relativistic coupled cluster calculations were performed by means of expansion in basis sets of well-tempered Gaussian spinors. A detailed study of the pair correlation energies in Xe is performed, in order to investigate the effects of the low-frequency Breit interaction on the correlation energies of Xe. Nonadditivity of correlation and relativistic (particularly Breit) effects is discussed.

  14. On twelve types of covering-based rough sets.

    PubMed

    Safari, Samira; Hooshmandasl, Mohammad Reza

    2016-01-01

    Covering approximation spaces are a generalization of equivalence-based rough set theories. In this paper, we will consider twelve types of covering based approximation operators by combining four types of covering lower approximation operators and three types of covering upper approximation operators. Then, we will study the properties of these new pairs and show they have most of the common properties among existing covering approximation pairs. Finally, the relation between these new pairs is studied.

  15. Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

    PubMed

    Hwang, Hanshin; Taylor, John-Stephen

    2005-03-29

    We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the Klenow fragment, and the lesser role of shape selection in insertion by pol eta due to its more open and less constrained active site.

  16. Energy barriers and rates of tautomeric transitions in DNA bases: ab initio quantum chemical study.

    PubMed

    Basu, Soumalee; Majumdar, Rabi; Das, Gourab K; Bhattacharyya, Dhananjay

    2005-12-01

    Tautomeric transitions of DNA bases are proton transfer reactions, which are important in biology. These reactions are involved in spontaneous point mutations of the genetic material. In the present study, intrinsic reaction coordinates (IRC) analyses through ab initio quantum chemical calculations have been carried out for the individual DNA bases A, T, G, C and also A:T and G:C base pairs to estimate the kinetic and thermodynamic barriers using MP2/6-31G** method for tautomeric transitions. Relatively higher values of kinetic barriers (about 50-60 kcal/mol) have been observed for the single bases, indicating that tautomeric alterations of isolated single bases are quite unlikely. On the other hand, relatively lower values of the kinetic barriers (about 20-25 kcal/mol) for the DNA base pairs A:T and G:C clearly suggest that the tautomeric shifts are much more favorable in DNA base pairs than in isolated single bases. The unusual base pairing A':C, T':G, C':A or G':T in the daughter DNA molecule, resulting from a parent DNA molecule with tautomeric shifts, is found to be stable enough to result in a mutation. The transition rate constants for the single DNA bases in addition to the base pairs are also calculated by computing the free energy differences between the transition states and the reactants.

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Yujie; Gong, Sha; Wang, Zhen

    The thermodynamic and kinetic parameters of an RNA base pair were obtained through a long-time molecular dynamics simulation of the opening-closing switch process of the base pair near its melting temperature. The thermodynamic parameters were in good agreement with the nearest-neighbor model. The opening rates showed strong temperature dependence, however, the closing rates showed only weak temperature dependence. The transition path time was weakly temperature dependent and was insensitive to the energy barrier. The diffusion constant exhibited super-Arrhenius behavior. The free energy barrier of breaking a single base stack results from the enthalpy increase, ΔH, caused by the disruption ofmore » hydrogen bonding and base-stacking interactions. The free energy barrier of base pair closing comes from the unfavorable entropy loss, ΔS, caused by the restriction of torsional angles. These results suggest that a one-dimensional free energy surface is sufficient to accurately describe the dynamics of base pair opening and closing, and the dynamics are Brownian.« less

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gao, X.; Patel, D.J.

    The authors report on two-dimensional proton NMR studies of echinomycin complexes with the self-complementary d(A1-C2-G3-Tr) and d(T1-C2-G3-A4) duplexes in aqueous solution. The exchangeable and nonexchangeable antibiotic and nucleic acid protons in the 1 echinomycin per tetranucleotide duplex complexes have been assigned from analyses of scalar coupling and distance connectivities in two-dimensional data sets records in H/sub 2/O and D/sub 2/O solution. An analysis of the intermolecular NOE patterns for both complexes combined with large upfield imino proton and large downfield phosphorus complexation chemical shift changes demonstrates that the two quinoxaline chromophores of echinomycin bisintercalate into the minor groove surrounding themore » dC-dG step of each tetranucleotide duplex. Further, the quinoxaline rings selectively stack between A1 and C2 bases in the d(ACGT) complex and between T1 and C2 bases in the d(TCGA) complex. The intermolecular NOE patterns and the base and sugar proton chemical shifts for residues C2 and G3 are virtually identical for the d(ACGT) and d(TCGA) complexes. A large set of intermolecular contacts established from nuclear Overhauser effects (NOEs) between antibiotic and nucleic acid protons in the echinomycin-tetranucleotide complexes in solution are consistent with corresponding contacts reported for echinomycin-oligonucleotide complexes in the crystalline state. The authors demonstrate that the G x G base pairs adopt Watson-Crick pairing in both d(ACGT) and d(TCGA) complexes in solution. By contrast, the A1 x T4 base pairs adopt Hoogsteen pairing for the echinomycin-d(A1-C2-G3-Tr) complex while the T1 x A4 base pairs adopt Watson-Crick pairing for the echinomycin-d(T1-C2-G3-A4) complex in aqueous solution. These results emphasize the role of sequence in discriminating between Watson-Crick and Hoogsteen pairs at base pairs flanking the echinomycin bisintercalation site in solution.« less

  19. Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

    PubMed

    Brovarets, Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H-bonds in the А·Т base pair are cooperative, reinforcing each other, whereas the C2H⋯O2 H-bond in the А(∗)·Т(∗) base pair behaves anticooperatively, in other words it gets weakened while two others get strengthened. From a quantum-mechanical point of view, the A(∗)·T(∗) Löwdin's base pair appeared to be dynamically unstable because the electronic energy of the back-reaction barrier of the A·T → A(∗)·T(∗) tautomerization does not exceed zero-point vibrational energy associated with the mode for which vibrational frequency becomes imaginary in the TS of tautomerization. Additionally, it was demonstrated using the conductor-like polarizable continuum model that the effects of biomolecular environment (ϵ = 4) cannot ensure dynamic stabilization of the A(∗)·T(∗) Löwdin's base pair. These findings, together with data available from the literature, indicate that the tautomerization of the A·T Watson-Crick base pair to the A(∗)·T(∗) Löwdin's base pair through the DPT cannot be a source of spontaneous point errors that occur during DNA replication.

  20. Effects of forefoot bending stiffness of badminton shoes on agility, comfort perception and lower leg kinematics during typical badminton movements.

    PubMed

    Park, Sang-Kyoon; Lam, Wing-Kai; Yoon, Sukhoon; Lee, Ki-Kwang; Ryu, Jiseon

    2017-09-01

    This study investigated whether an increase in the forefoot bending stiffness of a badminton shoe would positively affect agility, comfort and biomechanical variables during badminton-specific movements. Three shoe conditions with identical shoe upper and sole designs with different bending stiffness (Flexible, Regular and Stiff) were used. Elite male badminton players completed an agility test on a standard badminton court involving consecutive lunges in six directions, a comfort test performed by a pair of participants conducting a game-like practice trial and a biomechanics test involving a random assignment of consecutive right forward lunges. No significant differences were found in agility time and biomechanical variables among the three shoes. The players wearing the shoe with a flexible forefoot outsole demonstrated a decreased perception of comfort in the forefoot cushion compared to regular and stiffer conditions during the comfort test (p < 0.05). The results suggested that the modification of forefoot bending stiffness would influence individual perception of comfort but would not influence performance and lower extremity kinematics during the tested badminton-specific tasks. It was concluded that an optimisation of forefoot structure and materials in badminton shoes should consider the individual's perception to maximise footwear comfort in performance.

  1. Feasibility of simultaneous computed tomographic colonography and fully automated bone mineral densitometry in a single examination.

    PubMed

    Summers, Ronald M; Baecher, Nicolai; Yao, Jianhua; Liu, Jiamin; Pickhardt, Perry J; Choi, J Richard; Hill, Suvimol

    2011-01-01

    To show the feasibility of calculating the bone mineral density (BMD) from computed tomographic colonography (CTC) scans using fully automated software. Automated BMD measurement software was developed that measures the BMD of the first and second lumbar vertebrae on computed tomography and calculates the mean of the 2 values to provide a per patient BMD estimate. The software was validated in a reference population of 17 consecutive women who underwent quantitative computed tomography and in a population of 475 women from a consecutive series of asymptomatic patients enrolled in a CTC screening trial conducted at 3 medical centers. The mean (SD) BMD was 133.6 (34.6) mg/mL (95% confidence interval, 130.5-136.7; n = 475). In women aged 42 to 60 years (n = 316) and 61 to 79 years (n = 159), the mean (SD) BMDs were 143.1 (33.5) and 114.7 (28.3) mg/mL, respectively (P < 0.0001). Fully automated BMD measurements were reproducible for a given patient with 95% limits of agreement of -9.79 to 8.46 mg/mL for the mean difference between paired assessments on supine and prone CTC. Osteoporosis screening can be performed simultaneously with screening for colorectal polyps.

  2. Tracking cells in Life Cell Imaging videos using topological alignments.

    PubMed

    Mosig, Axel; Jäger, Stefan; Wang, Chaofeng; Nath, Sumit; Ersoy, Ilker; Palaniappan, Kannap-pan; Chen, Su-Shing

    2009-07-16

    With the increasing availability of live cell imaging technology, tracking cells and other moving objects in live cell videos has become a major challenge for bioimage informatics. An inherent problem for most cell tracking algorithms is over- or under-segmentation of cells - many algorithms tend to recognize one cell as several cells or vice versa. We propose to approach this problem through so-called topological alignments, which we apply to address the problem of linking segmentations of two consecutive frames in the video sequence. Starting from the output of a conventional segmentation procedure, we align pairs of consecutive frames through assigning sets of segments in one frame to sets of segments in the next frame. We achieve this through finding maximum weighted solutions to a generalized "bipartite matching" between two hierarchies of segments, where we derive weights from relative overlap scores of convex hulls of sets of segments. For solving the matching task, we rely on an integer linear program. Practical experiments demonstrate that the matching task can be solved efficiently in practice, and that our method is both effective and useful for tracking cells in data sets derived from a so-called Large Scale Digital Cell Analysis System (LSDCAS). The source code of the implementation is available for download from http://www.picb.ac.cn/patterns/Software/topaln.

  3. Effect of genome sequence on the force-induced unzipping of a DNA molecule.

    PubMed

    Singh, N; Singh, Y

    2006-02-01

    We considered a dsDNA polymer in which distribution of bases are random at the base pair level but ordered at a length of 18 base pairs and calculated its force elongation behaviour in the constant extension ensemble. The unzipping force F(y) vs. extension y is found to have a series of maxima and minima. By changing base pairs at selected places in the molecule we calculated the change in F(y) curve and found that the change in the value of force is of the order of few pN and the range of the effect depending on the temperature, can spread over several base pairs. We have also discussed briefly how to calculate in the constant force ensemble a pause or a jump in the extension-time curve from the knowledge of F(y).

  4. Quantum entanglement and quantum information in biological systems (DNA)

    NASA Astrophysics Data System (ADS)

    Hubač, Ivan; Švec, Miloslav; Wilson, Stephen

    2017-12-01

    Recent studies of DNA show that the hydrogen bonds between given base pairs can be treated as diabatic systems with spin-orbit coupling. For solid state systems strong diabaticity and spin-orbit coupling the possibility of forming Majorana fermions has been discussed. We analyze the hydrogen bonds in the base pairs in DNA from this perspective. Our analysis is based on a quasiparticle supersymmetric transformation which couples electronic and vibrational motion and includes normal coordinates and the corresponding momenta. We define qubits formed by Majorana fermions in the hydrogen bonds and also discuss the entangled states in base pairs. Quantum information and quantum entropy are introduced. In addition to the well-known classical information connected with the DNA base pairs, we also consider quantum information and show that the classical and quantum information are closely connected.

  5. Paired peer review of university classroom teaching in a school of nursing and midwifery.

    PubMed

    Bennett, Paul N; Parker, Steve; Smigiel, Heather

    2012-08-01

    Peer review of university classroom teaching can increase the quality of teaching but is not universally practiced in Australian universities. To report an evaluation of paired peer-review process using both paper and web based teaching evaluation tools. Twenty university teachers in one metropolitan Australian School of Nursing and Midwifery were randomly paired and then randomly assigned to a paper based or web-based peer review tool. Each teacher reviewed each other's classroom teaching as part of a peer review program. The participants then completed an 18 question survey evaluating the peer review tool and paired evaluation process. Responses were analyzed using frequencies and percentages. Regardless of the tool used, participants found this process of peer review positive (75%), collegial (78%), supportive (61%) and non-threatening (71%). Participants reported that the peer review will improve their own classroom delivery (61%), teaching evaluation (61%) and planning (53%). The web-based tool was found to be easier to use and allowed more space than the paper-based tool. Implementation of a web-based paired peer review system can be a positive method of peer review of university classroom teaching. Pairing of teachers to review each other's classroom teaching is a promising strategy and has the potential to improve teaching in teaching universities. Copyright © 2011 Elsevier Ltd. All rights reserved.

  6. RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

    PubMed

    Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

    2017-02-01

    Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

  7. Structural energetics of the adenine tract from an intrinsic transcription terminator.

    PubMed

    Huang, Yuegao; Weng, Xiaoli; Russu, Irina M

    2010-04-02

    Intrinsic transcription termination sites generally contain a tract of adenines in the DNA template that yields a tract of uracils at the 3' end of the nascent RNA. To understand how this base sequence contributes to termination of transcription, we have investigated two nucleic acid structures. The first is the RNA-DNA hybrid that contains the uracil tract 5'-rUUUUUAU-3' from the tR2 intrinsic terminator of bacteriophage lambda. The second is the homologous DNA-DNA duplex that contains the adenine tract 5'-dATAAAAA-3'. This duplex is present at the tR2 site when the DNA is not transcribed. The opening and the stability of each rU-dA/dT-dA base pair in the two structures are characterized by imino proton exchange and nuclear magnetic resonance spectroscopy. The results reveal concerted opening of the central rU-dA base pairs in the RNA-DNA hybrid. Furthermore, the stability profile of the adenine tract in the RNA-DNA hybrid is very different from that of the tract in the template DNA-DNA duplex. In the RNA-DNA hybrid, the stabilities of rU-dA base pairs range from 4.3 to 6.5 kcal/mol (at 10 degrees C). The sites of lowest stability are identified at the central positions of the tract. In the template DNA-DNA duplex, the dT-dA base pairs are more stable than the corresponding rU-dA base pairs in the hybrid by 0.9 to 4.6 kcal/mol and, in contrast to the RNA-DNA hybrid, the central base pairs have the highest stability. These results suggest that the central rU-dA/dT-dA base pairs in the adenine tract make the largest energetic contributions to transcription termination by promoting both the dissociation of the RNA transcript and the closing of the transcription bubble. The results also suggest that the high stability of dT-dA base pairs in the DNA provides a signal for the pausing of RNA polymerase at the termination site. Copyright 2010 Elsevier Ltd. All rights reserved.

  8. Stringent Nucleotide Recognition by the Ribosome at the Middle Codon Position

    PubMed Central

    Liu, Wei; Shin, Dongwon; Ng, Martin; Sanbonmatsu, Karissa Y.; Tor, Yitzhak; Cooperman, Barry S.

    2017-01-01

    Accurate translation of the genetic code depends on mRNA:tRNA codon:anticodon base pairing. Here we exploit an emissive, isosteric adenosine surrogate that allows direct measurement of the kinetics of codon:anticodon base formation during protein synthesis. Our results suggest that codon:anticodon base pairing is subject to tighter constraints at the middle position than at the 5′- and 3′-positions, and further suggest a sequential mechanism of formation of the three base pairs in the codon:anticodon helix. PMID:28850078

  9. The Effects of Reinforcer Pairing and Fading on Preschoolers' Snack Selections

    ERIC Educational Resources Information Center

    Solberg, Katherine M.; Hanley, Gregory P.; Layer, Stacy A.; Ingvarsson, Einar T.

    2007-01-01

    The effects of reinforcement pairing and fading on preschoolers' snack selections were evaluated in a multiple baseline design. Baseline preferences for snack options were assessed via repeated paired-item preference assessments. Edible, social, and activity-based reinforcers were then exclusively paired with a less preferred snack option. Once…

  10. A systematic molecular dynamics study of nearest-neighbor effects on base pair and base pair step conformations and fluctuations in B-DNA

    PubMed Central

    Lavery, Richard; Zakrzewska, Krystyna; Beveridge, David; Bishop, Thomas C.; Case, David A.; Cheatham, Thomas; Dixit, Surjit; Jayaram, B.; Lankas, Filip; Laughton, Charles; Maddocks, John H.; Michon, Alexis; Osman, Roman; Orozco, Modesto; Perez, Alberto; Singh, Tanya; Spackova, Nada; Sponer, Jiri

    2010-01-01

    It is well recognized that base sequence exerts a significant influence on the properties of DNA and plays a significant role in protein–DNA interactions vital for cellular processes. Understanding and predicting base sequence effects requires an extensive structural and dynamic dataset which is currently unavailable from experiment. A consortium of laboratories was consequently formed to obtain this information using molecular simulations. This article describes results providing information not only on all 10 unique base pair steps, but also on all possible nearest-neighbor effects on these steps. These results are derived from simulations of 50–100 ns on 39 different DNA oligomers in explicit solvent and using a physiological salt concentration. We demonstrate that the simulations are converged in terms of helical and backbone parameters. The results show that nearest-neighbor effects on base pair steps are very significant, implying that dinucleotide models are insufficient for predicting sequence-dependent behavior. Flanking base sequences can notably lead to base pair step parameters in dynamic equilibrium between two conformational sub-states. Although this study only provides limited data on next-nearest-neighbor effects, we suggest that such effects should be analyzed before attempting to predict the sequence-dependent behavior of DNA. PMID:19850719

  11. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

    PubMed Central

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-01

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

  12. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

    PubMed

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-13

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

  13. Base drive circuit

    DOEpatents

    Lange, Arnold C.

    1995-01-01

    An improved base drive circuit (10) having a level shifter (24) for providing bistable input signals to a pair of non-linear delays (30, 32). The non-linear delays (30, 32) provide gate control to a corresponding pair of field effect transistors (100, 106) through a corresponding pair of buffer components (88, 94). The non-linear delays (30, 32) provide delayed turn-on for each of the field effect transistors (100, 106) while an associated pair of transistors (72, 80) shunt the non-linear delays (30, 32) during turn-off of the associated field effect transistor (100, 106).

  14. Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore

    NASA Technical Reports Server (NTRS)

    Vercoutere, Wenonah; DeGuzman, Veronica

    2003-01-01

    The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.

  15. [The Visual Association Test to study episodic memory in clinical geriatric psychology].

    PubMed

    Diesfeldt, Han; Prins, Marleen; Lauret, Gijs

    2018-04-01

    The Visual Association Test (VAT) is a brief learning task that consists of six line drawings of pairs of interacting objects (association cards). Subjects are asked to name or identify each object and later are presented with one object from the pair (the cue) and asked to name the other (the target). The VAT was administered in a consecutive sample of 174 psychogeriatric day care participants with mild to major neurocognitive disorder. Comparison of test performance with normative data from non-demented subjects revealed that 69% scored within the range of a major deficit (0-8 over two recall trials), 14% a minor, and 17% no deficit (9-10, and ≥10 respectively).VAT-scores correlated with another test of memory function, the Cognitive Screening Test (CST), based on the Short Portable Mental Status Questionnaire (r = 0.53). Tests of executive functioning (Expanded Mental Control Test, Category Fluency, Clock Drawing) did not add significantly to the explanation of variance in VAT-scores.Fifty-five participants (31.6%) were faced with initial problems in naming or identifying one or more objects on the cue cards or association cards. If necessary, naming was aided by the investigator. Initial difficulties in identifying cue objects were associated with lower VAT-scores, but this did not hold for difficulties in identifying target objects.A hierarchical multiple regression analysis was used to examine whether linear or quadratic trends best fitted VAT performance across the range of CST scores. The regression model revealed a linear but not a quadratic trend. The best fitting linear model implied that VAT scores differentiated between CST scores in the lower, as well as in the upper range, indicating the absence of floor and ceiling effects, respectively. Moreover, the VAT compares favourably to word list-learning tasks being more attractive in its presentation of interacting visual objects and cued recall based on incidental learning of the association between cues and targets.For practical purposes and based on documented sensitivity and specificity, Bayesian probability tables give predictive power of age-specific VAT cutoff scores for the presence or absence of a major neurocognitive disorder across a range of a priori probabilities or base rates.

  16. Validity of the Japanese Orthopaedic Association scoring system based on patient-reported improvement after posterior lumbar interbody fusion.

    PubMed

    Fujimori, Takahito; Okuda, Shinya; Iwasaki, Motoki; Yamasaki, Ryoji; Maeno, Takafumi; Yamashita, Tomoya; Matsumoto, Tomiya; Wada, Eiji; Oda, Takenori

    2016-06-01

    The Japanese Orthopaedic Association (JOA) scoring system is a physician-based outcome that has been used to evaluate treatment effectiveness after lumbar surgery. However, patient-centered evaluation becomes increasingly important. There is no study that has examined the relationship between the JOA scoring system and patients' self-reported improvement. The purpose of the present study was to validate the JOA scoring system for assessment of patient-reported improvement after lumbar surgery. This is a retrospective review of prospectively collected data. The patient sample included 273 mail-in responders of the 466 consecutive patients who underwent posterior lumbar interbody fusion for spondylolisthesis between 1996 and 2008 in a single hospital. The outcome measures were the JOA scoring system and patients' self-reported improvement. Two hundred seventy three patients were divided into five anchoring groups based on self-reported improvement from "Much better" to "Much worse." Outcomes (ie, recovery rate, amount of change from preoperative condition, and postoperative score) based on the JOA scoring system were compared among groups. Using the patient's self-reported improvement scale as an anchor, the association among each of the outcomes was examined. The cutoff point and the area under the curve (AUC) that differentiated "Improved" from "Neither improved nor worse" was calculated using receiver operating characteristic (ROC) curve analysis. The recovery rate and postoperative score were significantly different in 9 of 10 pairs of anchoring groups. The amount of change was significantly different in six pairs. Spearman correlation coefficient for the 5-point scale anchors of patients' self-reported improvement was 0.20 (p=.001) for the baseline score, 0.31 (p<.001) for the amount of change, 0.55 (p<.001) for the recovery rate, and 0.56 (p<.001) for the postoperative score. According to ROC analysis, the best cutoff points and AUCs were 13 points and 0.69, respectively, for the amount of change, 67% and 0.73, respectively, for recovery rate, and 23 points and 0.72, respectively, for postoperative score. The JOA scoring system is a valid method for assessment of patients' self-reported improvement. Patients' self-reported improvement is more likely to be associated with the final condition, such as postoperative score or recovery rate, rather than the change from the preoperative condition. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Triple helical DNA in a duplex context and base pair opening

    PubMed Central

    Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra

    2014-01-01

    It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

  18. Multi-hop teleportation based on W state and EPR pairs

    NASA Astrophysics Data System (ADS)

    Hai-Tao, Zhan; Xu-Tao, Yu; Pei-Ying, Xiong; Zai-Chen, Zhang

    2016-05-01

    Multi-hop teleportation has significant value due to long-distance delivery of quantum information. Many studies about multi-hop teleportation are based on Bell pairs, partially entangled pairs or W state. The possibility of multi-hop teleportation constituted by partially entangled pairs relates to the number of nodes. The possibility of multi-hop teleportation constituted by double W states is after n-hop teleportation. In this paper, a multi-hop teleportation scheme based on W state and EPR pairs is presented and proved. The successful possibility of quantum information transmitted hop by hop through intermediate nodes is deduced. The possibility of successful transmission is after n-hop teleportation. Project supported by the National Natural Science Foundation of China (Grant No. 61571105), the Prospective Future Network Project of Jiangsu Province, China (Grant No. BY2013095-1-18), and the Independent Project of State Key Laboratory of Millimeter Waves, China (Grant No. Z201504).

  19. Retinal biometrics based on Iterative Closest Point algorithm.

    PubMed

    Hatanaka, Yuji; Tajima, Mikiya; Kawasaki, Ryo; Saito, Koko; Ogohara, Kazunori; Muramatsu, Chisako; Sunayama, Wataru; Fujita, Hiroshi

    2017-07-01

    The pattern of blood vessels in the eye is unique to each person because it rarely changes over time. Therefore, it is well known that retinal blood vessels are useful for biometrics. This paper describes a biometrics method using the Jaccard similarity coefficient (JSC) based on blood vessel regions in retinal image pairs. The retinal image pairs were rough matched by the center of their optic discs. Moreover, the image pairs were aligned using the Iterative Closest Point algorithm based on detailed blood vessel skeletons. For registration, perspective transform was applied to the retinal images. Finally, the pairs were classified as either correct or incorrect using the JSC of the blood vessel region in the image pairs. The proposed method was applied to temporal retinal images, which were obtained in 2009 (695 images) and 2013 (87 images). The 87 images acquired in 2013 were all from persons already examined in 2009. The accuracy of the proposed method reached 100%.

  20. How Mg2+ ion and water network affect the stability and structure of non-Watson-Crick base pairs in E. coli loop E of 5S rRNA: a molecular dynamics and reference interaction site model (RISM) study.

    PubMed

    Shanker, Sudhanshu; Bandyopadhyay, Pradipta

    2017-08-01

    The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg 2+ ions through water-mediated interaction. It is important to know the synergic role of Mg 2+ and the water network surrounding Mg 2+ in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg 2+ is pulled from RNA, which causes disturbance of the water network. It was found that Mg 2+ remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg 2+ interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg 2+ and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg 2+ is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Weina; Hellinga, Homme W.; Beese, Lorena S.

    Even though high-fidelity polymerases copy DNA with remarkable accuracy, some base-pair mismatches are incorporated at low frequency, leading to spontaneous mutagenesis. Using high-resolution X-ray crystallographic analysis of a DNA polymerase that catalyzes replication in crystals, we observe that a C {center_dot} A mismatch can mimic the shape of cognate base pairs at the site of incorporation. This shape mimicry enables the mismatch to evade the error detection mechanisms of the polymerase, which would normally either prevent mismatch incorporation or promote its nucleolytic excision. Movement of a single proton on one of the mismatched bases alters the hydrogen-bonding pattern such thatmore » a base pair forms with an overall shape that is virtually indistinguishable from a canonical, Watson-Crick base pair in double-stranded DNA. These observations provide structural evidence for the rare tautomer hypothesis of spontaneous mutagenesis, a long-standing concept that has been difficult to demonstrate directly.« less

  2. Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

    PubMed

    Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

    2016-05-17

    The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Nearest-neighbor thermodynamics of deoxyinosine pairs in DNA duplexes

    PubMed Central

    Watkins, Norman E.; SantaLucia, John

    2005-01-01

    Nearest-neighbor thermodynamic parameters of the ‘universal pairing base’ deoxyinosine were determined for the pairs I·C, I·A, I·T, I·G and I·I adjacent to G·C and A·T pairs. Ultraviolet absorbance melting curves were measured and non-linear regression performed on 84 oligonucleotide duplexes with 9 or 12 bp lengths. These data were combined with data for 13 inosine containing duplexes from the literature. Multiple linear regression was used to solve for the 32 nearest-neighbor unknowns. The parameters predict the Tm for all sequences within 1.2°C on average. The general trend in decreasing stability is I·C > I·A > I·T ≈ I· G > I·I. The stability trend for the base pair 5′ of the I·X pair is G·C > C·G > A·T > T·A. The stability trend for the base pair 3′ of I·X is the same. These trends indicate a complex interplay between H-bonding, nearest-neighbor stacking, and mismatch geometry. A survey of 14 tandem inosine pairs and 8 tandem self-complementary inosine pairs is also provided. These results may be used in the design of degenerate PCR primers and for degenerate microarray probes. PMID:16264087

  4. Using Pair Programming to Teach CAD Based Engineering Graphics

    ERIC Educational Resources Information Center

    Leland, Robert P.

    2010-01-01

    Pair programming was introduced into a course in engineering graphics that emphasizes solid modeling using SolidWorks. In pair programming, two students work at a single computer, and periodically trade off roles as driver (hands on the keyboard and mouse) and navigator (discuss strategy and design issues). Pair programming was used in a design…

  5. Magnetic field homogeneity of a conical coaxial coil pair.

    PubMed

    Salazar, F J; Nieves, F J; Bayón, A; Gascón, F

    2017-09-01

    An analytical study of the magnetic field created by a double-conical conducting sheet is presented. The analysis is based on the expansion of the magnetic field in terms of Legendre polynomials. It is demonstrated analytically that the angle of the conical surface that produces a nearly homogeneous magnetic field coincides with that of a pair of loops that fulfills the Helmholtz condition. From the results obtained, we propose an electric circuit formed by pairs of isolated conducting loops tightly wound around a pair of conical surfaces, calculating numerically the magnetic field produced by this system and its heterogeneity. An experimental setup of the proposed circuit was constructed and its magnetic field was measured. The results were compared with those obtained by numerical calculation, finding a good agreement. The numerical results demonstrate a significant improvement in homogeneity in the field of the proposed pair of conical coils compared with that achieved with a simple pair of Helmholtz loops or with a double solenoid. Moreover, a new design of a double pair of conical coils based on Braunbek's four loops is also proposed to achieve greater homogeneity. Regarding homogeneity, the rating of the analyzed configurations from best to worst is as follows: (1) double pair of conical coils, (2) pair of conical coils, (3) Braunbek's four loops, (4) Helmholtz pair, and (5) solenoid pair.

  6. Magnetic field homogeneity of a conical coaxial coil pair

    NASA Astrophysics Data System (ADS)

    Salazar, F. J.; Nieves, F. J.; Bayón, A.; Gascón, F.

    2017-09-01

    An analytical study of the magnetic field created by a double-conical conducting sheet is presented. The analysis is based on the expansion of the magnetic field in terms of Legendre polynomials. It is demonstrated analytically that the angle of the conical surface that produces a nearly homogeneous magnetic field coincides with that of a pair of loops that fulfills the Helmholtz condition. From the results obtained, we propose an electric circuit formed by pairs of isolated conducting loops tightly wound around a pair of conical surfaces, calculating numerically the magnetic field produced by this system and its heterogeneity. An experimental setup of the proposed circuit was constructed and its magnetic field was measured. The results were compared with those obtained by numerical calculation, finding a good agreement. The numerical results demonstrate a significant improvement in homogeneity in the field of the proposed pair of conical coils compared with that achieved with a simple pair of Helmholtz loops or with a double solenoid. Moreover, a new design of a double pair of conical coils based on Braunbek's four loops is also proposed to achieve greater homogeneity. Regarding homogeneity, the rating of the analyzed configurations from best to worst is as follows: (1) double pair of conical coils, (2) pair of conical coils, (3) Braunbek's four loops, (4) Helmholtz pair, and (5) solenoid pair.

  7. Timbre-induced pitch shift from the perspective of Signal Detection Theory: the impact of musical expertise, silence interval, and pitch region

    PubMed Central

    Vurma, Allan

    2014-01-01

    The paradigm of Signal Detection Theory (SDT) was used to analyze the ability of professional pianists (N = 16) and string players (N = 15) to discriminate small F0 differences between consecutive musical tones, presented in pairs, with identical and with different (bright and dull) timbres. The sensitivity (d′) and response bias (c) were heavily dependent on the timbral arrangement of the pairs of tones (the “comparable tones”), which can be interpreted as the influence of timbre-induced pitch shift on F0 discrimination. The participants were somewhat biased to “miss” signals when comparable tones had identical timbres and to make “false alarms” when the tones had different timbres. The d′ was lowest when the tones with a lower F0 in those stimulus-pairs containing tones with different timbres had a brighter timber, and highest when both tones had bright timbre. On average, the string players had a somewhat higher d′ and their perception was slightly less influenced by timbre-induced pitch shift when compared to the pianists. Nevertheless, the dependence of d′ and c on the timbral arrangement of the tones was registered in the case of all the participants at all the investigated pitch regions around D#3, D4, and C#5. Furthermore, the presence of a silence of 3.5 s—a silence interval—between the tones to be compared had an impact on both d′- and c-values as well as on the degree of vulnerability to timbre-induced pitch shift. PMID:24550867

  8. Discrimination of timbre in early auditory responses of the human brain.

    PubMed

    Seol, Jaeho; Oh, MiAe; Kim, June Sic; Jin, Seung-Hyun; Kim, Sun Il; Chung, Chun Kee

    2011-01-01

    The issue of how differences in timbre are represented in the neural response still has not been well addressed, particularly with regard to the relevant brain mechanisms. Here we employ phasing and clipping of tones to produce auditory stimuli differing to describe the multidimensional nature of timbre. We investigated the auditory response and sensory gating as well, using by magnetoencephalography (MEG). Thirty-five healthy subjects without hearing deficit participated in the experiments. Two different or same tones in timbre were presented through conditioning (S1)-testing (S2) paradigm as a pair with an interval of 500 ms. As a result, the magnitudes of auditory M50 and M100 responses were different with timbre in both hemispheres. This result might support that timbre, at least by phasing and clipping, is discriminated in the auditory early processing. The second response in a pair affected by S1 in the consecutive stimuli occurred in M100 of the left hemisphere, whereas both M50 and M100 responses to S2 only in the right hemisphere reflected whether two stimuli in a pair were the same or not. Both M50 and M100 magnitudes were different with the presenting order (S1 vs. S2) for both same and different conditions in the both hemispheres. Our results demonstrate that the auditory response depends on timbre characteristics. Moreover, it was revealed that the auditory sensory gating is determined not by the stimulus that directly evokes the response, but rather by whether or not the two stimuli are identical in timbre.

  9. Evaluating the accuracy of sampling to estimate central line-days: simplification of the National Healthcare Safety Network surveillance methods.

    PubMed

    Thompson, Nicola D; Edwards, Jonathan R; Bamberg, Wendy; Beldavs, Zintars G; Dumyati, Ghinwa; Godine, Deborah; Maloney, Meghan; Kainer, Marion; Ray, Susan; Thompson, Deborah; Wilson, Lucy; Magill, Shelley S

    2013-03-01

    To evaluate the accuracy of weekly sampling of central line-associated bloodstream infection (CLABSI) denominator data to estimate central line-days (CLDs). Obtained CLABSI denominator logs showing daily counts of patient-days and CLD for 6-12 consecutive months from participants and CLABSI numerators and facility and location characteristics from the National Healthcare Safety Network (NHSN). Convenience sample of 119 inpatient locations in 63 acute care facilities within 9 states participating in the Emerging Infections Program. Actual CLD and estimated CLD obtained from sampling denominator data on all single-day and 2-day (day-pair) samples were compared by assessing the distributions of the CLD percentage error. Facility and location characteristics associated with increased precision of estimated CLD were assessed. The impact of using estimated CLD to calculate CLABSI rates was evaluated by measuring the change in CLABSI decile ranking. The distribution of CLD percentage error varied by the day and number of days sampled. On average, day-pair samples provided more accurate estimates than did single-day samples. For several day-pair samples, approximately 90% of locations had CLD percentage error of less than or equal to ±5%. A lower number of CLD per month was most significantly associated with poor precision in estimated CLD. Most locations experienced no change in CLABSI decile ranking, and no location's CLABSI ranking changed by more than 2 deciles. Sampling to obtain estimated CLD is a valid alternative to daily data collection for a large proportion of locations. Development of a sampling guideline for NHSN users is underway.

  10. Estimating error rates for firearm evidence identifications in forensic science

    PubMed Central

    Song, John; Vorburger, Theodore V.; Chu, Wei; Yen, James; Soons, Johannes A.; Ott, Daniel B.; Zhang, Nien Fan

    2018-01-01

    Estimating error rates for firearm evidence identification is a fundamental challenge in forensic science. This paper describes the recently developed congruent matching cells (CMC) method for image comparisons, its application to firearm evidence identification, and its usage and initial tests for error rate estimation. The CMC method divides compared topography images into correlation cells. Four identification parameters are defined for quantifying both the topography similarity of the correlated cell pairs and the pattern congruency of the registered cell locations. A declared match requires a significant number of CMCs, i.e., cell pairs that meet all similarity and congruency requirements. Initial testing on breech face impressions of a set of 40 cartridge cases fired with consecutively manufactured pistol slides showed wide separation between the distributions of CMC numbers observed for known matching and known non-matching image pairs. Another test on 95 cartridge cases from a different set of slides manufactured by the same process also yielded widely separated distributions. The test results were used to develop two statistical models for the probability mass function of CMC correlation scores. The models were applied to develop a framework for estimating cumulative false positive and false negative error rates and individual error rates of declared matches and non-matches for this population of breech face impressions. The prospect for applying the models to large populations and realistic case work is also discussed. The CMC method can provide a statistical foundation for estimating error rates in firearm evidence identifications, thus emulating methods used for forensic identification of DNA evidence. PMID:29331680

  11. Estimating error rates for firearm evidence identifications in forensic science.

    PubMed

    Song, John; Vorburger, Theodore V; Chu, Wei; Yen, James; Soons, Johannes A; Ott, Daniel B; Zhang, Nien Fan

    2018-03-01

    Estimating error rates for firearm evidence identification is a fundamental challenge in forensic science. This paper describes the recently developed congruent matching cells (CMC) method for image comparisons, its application to firearm evidence identification, and its usage and initial tests for error rate estimation. The CMC method divides compared topography images into correlation cells. Four identification parameters are defined for quantifying both the topography similarity of the correlated cell pairs and the pattern congruency of the registered cell locations. A declared match requires a significant number of CMCs, i.e., cell pairs that meet all similarity and congruency requirements. Initial testing on breech face impressions of a set of 40 cartridge cases fired with consecutively manufactured pistol slides showed wide separation between the distributions of CMC numbers observed for known matching and known non-matching image pairs. Another test on 95 cartridge cases from a different set of slides manufactured by the same process also yielded widely separated distributions. The test results were used to develop two statistical models for the probability mass function of CMC correlation scores. The models were applied to develop a framework for estimating cumulative false positive and false negative error rates and individual error rates of declared matches and non-matches for this population of breech face impressions. The prospect for applying the models to large populations and realistic case work is also discussed. The CMC method can provide a statistical foundation for estimating error rates in firearm evidence identifications, thus emulating methods used for forensic identification of DNA evidence. Published by Elsevier B.V.

  12. The AO Pediatric Comprehensive Classification of Long Bone Fractures (PCCF).

    PubMed

    Audigé, Laurent; Slongo, Theddy; Lutz, Nicolas; Blumenthal, Andrea; Joeris, Alexander

    2017-04-01

    Background and purpose - The AO Pediatric Comprehensive Classification of Long Bone Fractures (PCCF) describes the localization and morphology of fractures, and considers severity in 2 categories: (1) simple, and (2) multifragmentary. We evaluated simple and multifragmentary fractures in a large consecutive cohort of children diagnosed with long bone fractures in Switzerland. Patients and methods - Children and adolescents treated for fractures between 2009 and 2011 at 2 tertiary pediatric surgery hospitals were retrospectively included. Fractures were classified according to the AO PCCF. Severity classes were described according to fracture location, patient age and sex, BMI, and cause of trauma. Results - Of all trauma events, 3% (84 of 2,730) were diagnosed with a multifragmentary fracture. This proportion was age-related: 2% of multifragmentary fractures occurred in school-children and 7% occurred in adolescents. In patients diagnosed with a single fracture only, the highest percentage of multifragmentation occurred in the femur (12%, 15 of 123). In fractured paired radius/ulna bones, multifragmentation occurred in 2% (11 of 687); in fractured paired tibia/fibula bones, it occurred in 21% (24 of 115), particularly in schoolchildren (5 of 18) and adolescents (16 of 40). In a multivariable regression model, age, cause of injury, and bone were found to be relevant prognostic factors of multifragmentation (odds ratio (OR) > 2). Interpretation - Overall, multifragmentation in long bone fractures in children was rare and was mostly observed in adolescents. The femur was mostly affected in single fractures and the lower leg was mostly affected in paired-bone fractures. The clinical relevance of multifragmentation regarding growth and long-term functional recovery remains to be determined.

  13. Geometrical correlations in the nucleosomal DNA conformation and the role of the covalent bonds rigidity

    PubMed Central

    Ghorbani, Maryam; Mohammad-Rafiee, Farshid

    2011-01-01

    We develop a simple elastic model to study the conformation of DNA in the nucleosome core particle. In this model, the changes in the energy of the covalent bonds that connect the base pairs of each strand of the DNA double helix, as well as the lateral displacements and the rotation of adjacent base pairs are considered. We show that because of the rigidity of the covalent bonds in the sugar-phosphate backbones, the base pair parameters are highly correlated, especially, strong twist-roll-slide correlation in the conformation of the nucleosomal DNA is vividly observed in the calculated results. This simple model succeeds to account for the detailed features of the structure of the nucleosomal DNA, particularly, its more important base pair parameters, roll and slide, in good agreement with the experimental results. PMID:20972223

  14. Intermolecular ‘cross-torque’: the N4-cytosine propargyl residue is rotated to the ‘CH’-edge as a result of Watson–Crick interaction

    PubMed Central

    Domingo, Olwen; Hellmuth, Isabell; Jäschke, Andres; Kreutz, Christoph; Helm, Mark

    2015-01-01

    Propargyl groups are attractive functional groups for labeling purposes, as they allow CuAAC-mediated bioconjugation. Their size minimally exceeds that of a methyl group, the latter being frequent in natural nucleotide modifications. To understand under which circumstances propargyl-containing oligodeoxynucleotides preserve base pairing, we focused on the exocyclic amine of cytidine. Residues attached to the exocyclic N4 may orient away from or toward the Watson–Crick face, ensuing dramatic alteration of base pairing properties. ROESY-NMR experiments suggest a uniform orientation toward the Watson–Crick face of N4-propargyl residues in derivatives of both deoxycytidine and 5-methyl-deoxycytidine. In oligodeoxynucleotides, however, UV-melting indicated that N4-propargyl-deoxycytidine undergoes standard base pairing. This implies a rotation of the propargyl moiety toward the ‘CH’-edge as a result of base pairing on the Watson–Crick face. In oligonucleotides containing the corresponding 5-methyl-deoxycytidine derivative, dramatically reduced melting temperatures indicate impaired Watson–Crick base pairing. This was attributed to a steric clash of the propargyl moiety with the 5-methyl group, which prevents back rotation to the ‘CH’-edge, consequently preventing Watson–Crick geometry. Our results emphasize the tendency of an opposing nucleic acid strand to mechanically rotate single N4-substituents to make way for Watson–Crick base pairing, providing no steric hindrance is present on the ‘CH’-edge. PMID:25934805

  15. The tolerance to exchanges of the Watson–Crick base pair in the hammerhead ribozyme core is determined by surrounding elements

    PubMed Central

    Przybilski, Rita; Hammann, Christian

    2007-01-01

    Tertiary interacting elements are important features of functional RNA molecules, for example, in all small nucleolytic ribozymes. The recent crystal structure of a tertiary stabilized type I hammerhead ribozyme revealed a conventional Watson–Crick base pair in the catalytic core, formed between nucleotides C3 and G8. We show that any Watson–Crick base pair between these positions retains cleavage competence in two type III ribozymes. In the Arabidopsis thaliana sequence, only moderate differences in cleavage rates are observed for the different base pairs, while the peach latent mosaic viroid (PLMVd) ribozyme exhibits a preference for a pyrimidine at position 3 and a purine at position 8. To understand these differences, we created a series of chimeric ribozymes in which we swapped sequence elements that surround the catalytic core. The kinetic characterization of the resulting ribozymes revealed that the tertiary interacting loop sequences of the PLMVd ribozyme are sufficient to induce the preference for Y3–R8 base pairs in the A. thaliana hammerhead ribozyme. In contrast to this, only when the entire stem–loops I and II of the A. thaliana sequences are grafted on the PLMVd ribozyme is any Watson–Crick base pair similarly tolerated. The data provide evidence for a complex interplay of secondary and tertiary structure elements that lead, mediated by long-range effects, to an individual modulation of the local structure in the catalytic core of different hammerhead ribozymes. PMID:17666711

  16. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    PubMed Central

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-01-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

  17. Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

    PubMed

    Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

    2015-05-14

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  18. Nanoenergetics and High Hydrogen Content Materials for Space Propulsion

    DTIC Science & Technology

    2014-01-28

    follows [141]: ( ) ( )2 2 , 2 ln 2 ln /Al Al p ox oxAl Al R r R a a r λ λ λ λ λ λ λ = ⎡ ⎤− − − +⎣ ⎦ (29) where ( ) ;Al Al b R a b R r...predictions of the transformation from acid -base pairs (e.g., nitric acid and ammonia) to ion pairs (e.g., NH4+ and NO3-), that is, proton transfer, in...calculations were performed to study the transformation from the stable acid -base pair for isolated formula units to stable ion pairs, as described in the

  19. Influence of Hydration on Proton Transfer in the Guanine-Cytosine Radical Cation (G•+-C) Base Pair: A Density Functional Theory Study

    PubMed Central

    Kumar, Anil; Sevilla, Michael D.

    2009-01-01

    On one-electron oxidation all molecules including DNA bases become more acidic in nature. For the GC base pair experiments suggest that a facile proton transfer takes place in the G•+-C base pair from N1 of G•+ to N3 of cytosine. This intra-base pair proton transfer reaction has been extensively considered using theoretical methods for the gas phase and it is predicted that the proton transfer is slightly unfavorable in disagreement with experiment. In the present study, we consider the effect of the first hydration layer on the proton transfer reaction in G•+-C by the use of density functional theory (DFT), B3LYP/6-31+G** calculations of the G•+-C base pair in the presence of 6 and 11 water molecules. Under the influence of hydration of 11 waters, a facile proton transfer from N1 of G•+ to N3 of C is predicted. The zero point energy (ZPE) corrected forward and backward energy barriers, for the proton transfer from N1 of G•+ to N3 of C, was found to be 1.4 and 2.6 kcal/mol, respectively. The proton transferred G•-(H+)C + 11H2O was found to be 1.2 kcal/mol more stable than G•+-C + 11H2O in agreement with experiment. The present calculation demonstrates that the inclusion of the first hydration shell around G•+-C base pair has an important effect on the internal proton transfer energetics. PMID:19485319

  20. Quantum correlation of fiber-based telecom-band photon pairs through standard loss and random media.

    PubMed

    Sua, Yong Meng; Malowicki, John; Lee, Kim Fook

    2014-08-15

    We study quantum correlation and interference of fiber-based telecom-band photon pairs with one photon of the pair experiencing multiple scattering in a random medium. We measure joint probability of two-photon detection for signal photon in a normal channel and idler photon in a channel, which is subjected to two independent conditions: standard loss (neutral density filter) and random media. We observe that both conditions degrade the correlation of signal and idler photons, and depolarization of the idler photon in random medium can enhance two-photon interference at certain relative polarization angles. Our theoretical calculation on two-photon polarization correlation and interference as a function of mean free path is in agreement with our experiment data. We conclude that quantum correlation of a polarization-entangled photon pair is better preserved than a polarization-correlated photon pair as one photon of the pair scatters through a random medium.

  1. Array based Discovery of Aptamer Pairs (Open Access Publisher’s Version)

    DTIC Science & Technology

    2014-12-11

    Array-based Discovery of Aptamer Pairs Minseon Cho,†,‡ Seung Soo Oh,‡ Jeff Nie,§ Ron Stewart,§ Monte J. Radeke,⊥ Michael Eisenstein,†,‡ Peter J...bidentate” target recognition, with affinities greatly exceeding either monovalent component. DNA aptamers are especially well-suited for such...constructs, because they can be linked via standard synthesis techniques without requiring chemical conjugation. Unfortunately, aptamer pairs are difficult

  2. Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

    PubMed

    Yang, Haozhe; Mei, Hui; Seela, Frank

    2015-07-06

    Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Mechanism Underlying the Nucleobase-Distinguishing Ability of Benzopyridopyrimidine (BPP).

    PubMed

    Kochman, Michał A; Bil, Andrzej; Miller, R J Dwayne

    2017-11-02

    Benzopyridopyrimidine (BPP) is a fluorescent nucleobase analogue capable of forming base pairs with adenine (A) and guanine (G) at different sites. When incorporated into oligodeoxynucleotides, it is capable of differentiating between the two purine nucleobases by virtue of the fact that its fluorescence is largely quenched when it is base-paired to guanine, whereas base-pairing to adenine causes only a slight reduction of the fluorescence quantum yield. In the present article, the photophysics of BPP is investigated through computer simulations. BPP is found to be a good charge acceptor, as demonstrated by its positive and appreciably large electron affinity. The selective quenching process is attributed to charge transfer (CT) from the purine nucleobase, which is predicted to be efficient in the BPP-G base pair, but essentially inoperative in the BPP-A base pair. The CT process owes its high selectivity to a combination of two factors: the ionization potential of guanine is lower than that of adenine, and less obviously, the site occupied by guanine enables a greater stabilization of the CT state through electrostatic interactions than the one occupied by adenine. The case of BPP illustrates that molecular recognition via hydrogen bonding can enhance the selectivity of photoinduced CT processes.

  4. Matched-Pair Comparison of Radioembolization Plus Best Supportive Care Versus Best Supportive Care Alone for Chemotherapy Refractory Liver-Dominant Colorectal Metastases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Seidensticker, Ricarda, E-mail: ricarda.seidensticker@med.ovgu.de; Denecke, Timm; Kraus, Patrick

    2012-10-15

    Purpose: This study was designed to evaluate overall survival after radioembolization or best supportive care (BSC) in patients with chemotherapy-refractory liver-dominant metastatic colorectal cancer (mCRC). Methods: This was a matched-pair comparison of patients who received radioembolization plus BSC or BSC alone for extensive liver disease. Twenty-nine patients who received radioembolization were retrospectively matched with a contemporary cohort of >500 patients who received BSC from 3 centers in Germany. Using clinical databases, patients were initially matched for prior treatments and tumor burden and then 29 patients were consecutively identified with two or more of four matching criteria: synchronous/metachronous metastases, tumor burden,more » increased ALP, and/or CEA >200 U/ml. Survival was calculated from date of progression before radioembolization or BSC by using Kaplan-Meier analysis. Results: Of 29 patients in each study arm, 16 pairs (55.2%) matched for all four criteria, and 11 pairs (37.9%) matched three criteria. Patients in both groups had a similar performance status (Karnofsky index, median 80% [range, 60-100%]). Compared with BSC alone, radioembolization prolonged survival (median, 8.3 vs. 3.5 months; P < 0.001) with a hazard ratio of 0.3 (95% confidence interval, 0.16-0.55; P < 0.001) in a multivariate Cox proportional hazard model. Treatment-related adverse events following radioembolization included: grade 1-2 fatigue (n = 20, 69%), grade 1 abdominal pain/nausea (n = 14, 48.3%), and grade 2 gastrointestinal ulceration (n = 3, 10.3%). Three cases of grade 3 radiation-induced liver disease were symptomatically managed. Conclusions: Radioembolization offers a promising addition to BSC in treatment-refractory patients for whom there are limited options. Survival was prolonged and adverse events were generally mild-to-moderate in nature and manageable.« less

  5. Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

    PubMed

    Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

    2015-12-01

    Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Duration comparison: relative stimulus differences stimulus age, and stimulus predictiveness.

    PubMed Central

    Stubbs, D A; Dreyfus, L R; Fetterman, J G; Boynton, D M; Locklin, N; Smith, L D

    1994-01-01

    Under a psychophysical trials procedure, pigeons were presented with a red light of one duration followed by a green light of a second duration. Eight geometrically spaced base durations were paired with one of four shorter and four longer durations as the alternate member of a duration pair, with different pairs randomly intermixed. One choice was reinforced if red had lasted longer than green, and a second choice was reinforced if green had lasted longer. Performance was compared when all the base durations and their pair members were included (entire-range condition) or when only the four longest base durations and their comparison durations (restricted-range condition) were used. Discrimination sensitivity decreased for longer duration pairs under both conditions, supporting a memory-based account. Sensitivity was lower under the restricted-range condition. Under both conditions, a bias to report "green as longer" increased as the second green duration increased. Bias changed as a matching function of the green-duration predictiveness of the correct choice. The results are related to a quantitative model of timing and remembering proposed by Staddon. PMID:8064211

  7. Temperature-Responsive Luminescent Solar Concentrators: Tuning Energy Transfer in a Liquid Crystalline Matrix.

    PubMed

    Sol, Jeroen A H P; Dehm, Volker; Hecht, Reinhard; Würthner, Frank; Schenning, Albertus P H J; Debije, Michael G

    2018-01-22

    Temperature-responsive luminescent solar concentrators (LSCs) have been fabricated in which the Förster resonance energy transfer (FRET) between a donor-acceptor pair in a liquid crystalline solvent can be tuned. At room temperatures, the perylene bisimide (PBI) acceptor is aggregated and FRET is inactive; while after heating to a temperature above the isotropic phase of the liquid crystal solvent, the acceptor PBI completely dissolves and FRET is activated. This unusual temperature control over FRET was used to design a color-tunable LSC. The device has been shown to be highly stable towards consecutive heating and cooling cycles, making it an appealing device for harvesting otherwise unused solar energy. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  8. Treatment of Neurogenic Cough with Tramadol: A Pilot Study.

    PubMed

    Dion, Gregory R; Teng, Stephanie E; Achlatis, Efstratios; Fang, Yixin; Amin, Milan R

    2017-07-01

    This study employs validated cough assessment tools to prospectively determine the impact of tramadol on cough severity and quality of life in subjects with neurogenic cough. The study was a prospective case series with planned data collection at a tertiary care academic medical center laryngology practice. Sixteen consecutive collected subjects with neurogenic cough prospectively completed pre- and posttreatment validated cough assessment tools, the cough severity index (CSI) and Leicester Cough Questionnaire (LCQ). All subjects in the study reported at least some improvement in their cough symptoms. In a Wilcoxon signed rank test that compared paired results, CSI scores improved from 23 to 14 and LCQ scores improved from 74 to 103 ( P = .003 and P = .005, respectively). This small preliminary assessment suggests that tramadol warrants additional evaluation as a treatment for neurogenic cough.

  9. DincRNA: a comprehensive web-based bioinformatics toolkit for exploring disease associations and ncRNA function.

    PubMed

    Cheng, Liang; Hu, Yang; Sun, Jie; Zhou, Meng; Jiang, Qinghua

    2018-06-01

    DincRNA aims to provide a comprehensive web-based bioinformatics toolkit to elucidate the entangled relationships among diseases and non-coding RNAs (ncRNAs) from the perspective of disease similarity. The quantitative way to illustrate relationships of pair-wise diseases always depends on their molecular mechanisms, and structures of the directed acyclic graph of Disease Ontology (DO). Corresponding methods for calculating similarity of pair-wise diseases involve Resnik's, Lin's, Wang's, PSB and SemFunSim methods. Recently, disease similarity was validated suitable for calculating functional similarities of ncRNAs and prioritizing ncRNA-disease pairs, and it has been widely applied for predicting the ncRNA function due to the limited biological knowledge from wet lab experiments of these RNAs. For this purpose, a large number of algorithms and priori knowledge need to be integrated. e.g. 'pair-wise best, pairs-average' (PBPA) and 'pair-wise all, pairs-maximum' (PAPM) methods for calculating functional similarities of ncRNAs, and random walk with restart (RWR) method for prioritizing ncRNA-disease pairs. To facilitate the exploration of disease associations and ncRNA function, DincRNA implemented all of the above eight algorithms based on DO and disease-related genes. Currently, it provides the function to query disease similarity scores, miRNA and lncRNA functional similarity scores, and the prioritization scores of lncRNA-disease and miRNA-disease pairs. http://bio-annotation.cn:18080/DincRNAClient/. biofomeng@hotmail.com or qhjiang@hit.edu.cn. Supplementary data are available at Bioinformatics online.

  10. Localization and anharmonicity of the vibrational modes for GC Watson-Crick and Hoogsteen base pairs.

    PubMed

    Bende, Attila; Bogdan, Diana; Muntean, Cristina M; Morari, Cristian

    2011-12-01

    We present an ab initio study of the vibrational properties of cytosine and guanine in the Watson-Crick and Hoogsteen base pair configurations. The results are obtained by using two different implementations of the DFT method. We assign the vibrational frequencies to cytosine or to guanine using the vibrational density of states. Next, we investigate the importance of anharmonic corrections for the vibrational modes. In particular, the unusual anharmonic effect of the H(+) vibration in the case of the Hoogsteen base pair configuration is discussed.

  11. Self-association and base pairing of guanosine, cytidine, adenosine, and uridine in dimethyl sulfoxide solution measured by 15N nuclear magnetic resonance spectroscopy.

    PubMed Central

    Dyllick-Brenzinger, C; Sullivan, G R; Pang, P P; Roberts, J D

    1980-01-01

    The self-association of guanosine, cytidine, and adenosine and base pairing between guanosine, cytidine, adenosine, and uridine in dimethyl sulfoxide have been investigated by the variation of their 15N NMR chemical shifts with concentration and temperature. Guanosine, cytidine, and adenosine all showed evidence of self-association by hydrogen bonding. In guanosine/cytidine mixtures, a hydrogen-bonded dimer is formed; however, no base pairing could be detected with adenosine/cytidine or adenosine/uridine mixtures. PMID:6932658

  12. Sequence of retrovirus provirus resembles that of bacterial transposable elements

    NASA Astrophysics Data System (ADS)

    Shimotohno, Kunitada; Mizutani, Satoshi; Temin, Howard M.

    1980-06-01

    The nucleotide sequences of the terminal regions of an infectious integrated retrovirus cloned in the modified λ phage cloning vector Charon 4A have been elucidated. There is a 569-base pair direct repeat at both ends of the viral DNA. The cell-virus junctions at each end consist of a 5-base pair direct repeat of cell DNA next to a 3-base pair inverted repeat of viral DNA. This structure resembles that of a transposable element and is consistent with the protovirus hypothesis that retroviruses evolved from the cell genome.

  13. Extending the language of DNA molecular recognition by polyamides: unexpected influence of imidazole and pyrrole arrangement on binding affinity and specificity.

    PubMed

    Buchmueller, Karen L; Staples, Andrew M; Howard, Cameron M; Horick, Sarah M; Uthe, Peter B; Le, N Minh; Cox, Kari K; Nguyen, Binh; Pacheco, Kimberly A O; Wilson, W David; Lee, Moses

    2005-01-19

    Pyrrole (Py) and imidazole (Im) polyamides can be designed to target specific DNA sequences. The effect that the pyrrole and imidazole arrangement, plus DNA sequence, have on sequence specificity and binding affinity has been investigated using DNA melting (DeltaT(M)), circular dichroism (CD), and surface plasmon resonance (SPR) studies. SPR results obtained from a complete set of triheterocyclic polyamides show a dramatic difference in the affinity of f-ImPyIm for its cognate DNA (K(eq) = 1.9 x 10(8) M(-1)) and f-PyPyIm for its cognate DNA (K(eq) = 5.9 x 10(5) M(-1)), which could not have been anticipated prior to characterization of these compounds. Moreover, f-ImPyIm has a 10-fold greater affinity for CGCG than distamycin A has for its cognate, AATT. To understand this difference, the triamide dimers are divided into two structural groupings: central and terminal pairings. The four possible central pairings show decreasing selectivity and affinity for their respective cognate sequences: -ImPy > -PyPy- > -PyIm- approximately -ImIm-. These results extend the language of current design motifs for polyamide sequence recognition to include the use of "words" for recognizing two adjacent base pairs, rather than "letters" for binding to single base pairs. Thus, polyamides designed to target Watson-Crick base pairs should utilize the strength of -ImPy- and -PyPy- central pairings. The f/Im and f/Py terminal groups yielded no advantage for their respective C/G or T/A base pairs. The exception is with the -ImPy- central pairing, for which f/Im has a 10-fold greater affinity for C/G than f/Py has for T/A.

  14. Intermolecular interactions of trifluorohalomethanes with Lewis bases in the gas phase: an ab initio study.

    PubMed

    Wang, Yi-Siang; Yin, Chih-Chien; Chao, Sheng D

    2014-10-07

    We perform an ab initio computational study of molecular complexes with the general formula CF3X-B that involve one trifluorohalomethane CF3X (X = Cl or Br) and one of a series of Lewis bases B in the gas phase. The Lewis bases are so chosen that they provide a range of electron-donating abilities for comparison. Based on the characteristics of their electron pairs, we consider the Lewis bases with a single n-pair (NH3 and PH3), two n-pairs (H2O and H2S), two n-pairs with an unsaturated bond (H2CO and H2CS), and a single π-pair (C2H4) and two π-pairs (C2H2). The aim is to systematically investigate the influence of the electron pair characteristics and the central atom substitution effects on the geometries and energetics of the formed complexes. The counterpoise-corrected supermolecule MP2 and coupled-cluster single double with perturbative triple [CCSD(T)] levels of theory have been employed, together with a series of basis sets up to aug-cc-pVTZ. The angular and radial configurations, the binding energies, and the electrostatic potentials of the stable complexes have been compared and discussed as the Lewis base varies. For those complexes where halogen bonding plays a significant role, the calculated geometries and energetics are consistent with the σ-hole model. Upon formation of stable complexes, the C-X bond lengths shorten, while the C-X vibrational frequencies increase, thus rendering blueshifting halogen bonds. The central atom substitution usually enlarges the intermolecular bond distances while it reduces the net charge transfers, thus weakening the bond strengths. The analysis based on the σ-hole model is grossly reliable but requires suitable modifications incorporating the central atom substitution effects, in particular, when interaction components other than electrostatic contributions are involved.

  15. On the use of magnets to disrupt the physiological compass of birds.

    PubMed

    Wang, K; Mattern, E; Ritz, T

    2006-10-04

    Behavioral researchers have attached magnets to birds during orientation experiments, assuming that such magnets will disrupt their ability to obtain magnetic information. Here, we investigate the effect of an attached magnet on the ability to derive directional information from a radical-pair based compass mechanism. We outline in some detail the geometrical symmetries that would allow a bird to identify magnetic directions in a radical-pair based compass. We show that the artificial field through an attached magnet will quickly disrupt the birds' ability to distinguish pole-ward from equator-ward headings, but that much stronger fields are necessary to disrupt their ability to detect the magnetic axis. Together with estimates of the functional limits of a radical-pair based compass, our calculations suggest that artificial fields of comparable size to the geomagnetic field are not generally sufficient to render a radical-pair based compass non-functional.

  16. Orbital-selective pairing and superconductivity in iron selenides

    NASA Astrophysics Data System (ADS)

    Nica, Emilian M.; Yu, Rong; Si, Qimiao

    2017-12-01

    An important challenge in condensed matter physics is understanding iron-based superconductors. Among these systems, the iron selenides hold the record for highest superconducting transition temperature and pose especially striking puzzles regarding the nature of superconductivity. The pairing state of the alkaline iron selenides appears to be of d-wave type based on the observation of a resonance mode in neutron scattering, while it seems to be of s-wave type from the nodeless gaps observed everywhere on the Fermi surface. Here we propose an orbital-selective pairing state, dubbed sτ3, as a natural explanation of these disparate properties. The pairing function, containing a matrix τ3 in the basis of 3d-electron orbitals, does not commute with the kinetic part of the Hamiltonian. This dictates the existence of both intraband and interband pairing terms in the band basis. A spin resonance arises from a d-wave-type sign change in the intraband pairing component, whereas the quasiparticle excitation is fully gapped on the FS due to an s-wave-like form factor associated with the addition in quadrature of the intraband and interband pairing terms. We demonstrate that this pairing state is energetically favored when the electron correlation effects are orbitally selective. More generally, our results illustrate how the multiband nature of correlated electrons affords unusual types of superconducting states, thereby shedding new light not only on the iron-based materials but also on a broad range of other unconventional superconductors such as heavy fermion and organic systems.

  17. Anomeric 2'-Deoxycytidines and Silver Ions: Hybrid Base Pairs with Greatly Enhanced Stability and Efficient DNA Mismatch Detection with α-dC.

    PubMed

    Guo, Xiurong; Seela, Frank

    2017-09-04

    α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Two-photon production of dilepton pairs in peripheral heavy ion collisions

    NASA Astrophysics Data System (ADS)

    Klein, Spencer R.

    2018-05-01

    The STAR collaboration has observed an excess production of e+e- pairs in relativistic heavy ion collisions, over the expectations from hadronic production models. The excess pairs have transverse momenta pT<150 MeV /c and are most prominent in peripheral gold-gold and uranium-uranium collisions. The pairs exhibit a peak at the J /ψ mass, but include a wide continuum, with pair invariant masses from 400 MeV/c 2 up to 2.6 GeV/c 2 . The ALICE Collaboration observes a similar excess in peripheral lead-lead collisions, but only at the J /ψ mass, without a corresponding continuum. This paper presents a calculation of the cross section and kinematic for two-photon production of e+e- pairs, and find general agreement with the STAR data. The calculation is based on the starlight simulation code, which is based on the Weizsäcker-Williams virtual photon approach. The STAR continuum observations are compatible with two-photon production of e+e- pairs. The ALICE analysis required individual muon pT be greater than 1 GeV/c; this eliminated almost all of the pairs from two-photon interactions, while leaving most of the J /ψ decays.

  19. Recent advances in mechanism-based chemotherapy drug-siRNA pairs in co-delivery systems for cancer: A review.

    PubMed

    Wang, Mingfang; Wang, Jinyu; Li, Bingcheng; Meng, Lingxin; Tian, Zhaoxing

    2017-09-01

    Co-delivery of chemotherapy drugs and siRNA for cancer therapy has achieved remarkable results according to synergistic/combined antitumor effects, and is recognized as a promising therapeutic modality. However, little attention has been paid to the extremely complex mechanisms of chemotherapy drug-siRNA pairs during co-delivery process. Proper selection of chemotherapy drug-siRNA pairs is beneficial for achieving desirable cancer therapeutic effects. Exploring the inherent principles during chemotherapy drug-siRNA pair selection for co-delivery would greatly enhanced therapeutic efficiency. To achieve ideal results, this article will systematically review current different mechanism-based chemotherapy drug-siRNA pairs for co-delivery in cancer treatment. Large-scale library screening of recent different chemotherapy drug-siRNA pairs for co-delivery would help to establish the chemotherapy drug-siRNA pair selection principle, which could pave the way for co-delivery of chemotherapy drugs and siRNA for cancer treatment in clinic. Following the inherent principle of chemotherapy drug-siRNA pair, more effective co-delivery vectors can be designed in the future. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Light-dependent magnetoreception in birds: the crucial step occurs in the dark.

    PubMed

    Wiltschko, Roswitha; Ahmad, Margaret; Nießner, Christine; Gehring, Dennis; Wiltschko, Wolfgang

    2016-05-01

    The Radical Pair Model proposes that the avian magnetic compass is based on spin-chemical processes: since the ratio between the two spin states singlet and triplet of radical pairs depends on their alignment in the magnetic field, it can provide information on magnetic directions. Cryptochromes, blue light-absorbing flavoproteins, with flavin adenine dinucleotide as chromophore, are suggested as molecules forming the radical pairs underlying magnetoreception. When activated by light, cryptochromes undergo a redox cycle, in the course of which radical pairs are generated during photo-reduction as well as during light-independent re-oxidation. This raised the question as to which radical pair is crucial for mediating magnetic directions. Here, we present the results from behavioural experiments with intermittent light and magnetic field pulses that clearly show that magnetoreception is possible in the dark interval, pointing to the radical pair formed during flavin re-oxidation. This differs from the mechanism considered for cryptochrome signalling the presence of light and rules out most current models of an avian magnetic compass based on the radical pair generated during photo-reduction. Using the radical pair formed during re-oxidation may represent a specific adaptation of the avian magnetic compass. © 2016 The Authors.

  1. Definition of the persistence length in the coarse-grained models of DNA elasticity.

    PubMed

    Fathizadeh, A; Eslami-Mossallam, B; Ejtehadi, M R

    2012-11-01

    By considering the detailed structure of DNA in the base pair level, two possible definitions of the persistence length are compared. One definition is related to the orientation of the terminal base pairs, and the other is based on the vectors which connect two adjacent base pairs at each end of the molecule. It is shown that although these definitions approach each other for long DNA molecules, they are dramatically different on short length scales. We show analytically that the difference mostly comes from the shear flexibility of the molecule and can be used to measure the shear modulus of DNA.

  2. Pair correlations in low-lying T =0 states of odd-odd nuclei with six nucleons

    NASA Astrophysics Data System (ADS)

    Fu, G. J.; Zhao, Y. M.; Arima, A.

    2018-02-01

    In this paper, we study pair correlations in low-lying T =0 states for two typical cases of odd-odd N =Z nuclei. The first case is six nucleons in a single j =9 /2 shell, for which we study the S -broken-pair approximation, the isoscalar spin-1 pair condensation, and the isoscalar spin-aligned pair condensation, with schematic interactions. In the second case, we study pair approximations and correlation energies for 22Na, 34Cl, 46V, 62Ga, and 94Ag in multi-j shells with effective interactions. A few T =0 states are found to be well represented by isoscalar nucleon pairs. The isoscalar spin-aligned pairs play an important role for the yrast T =0 states with I ˜2 j and I ˜Imax in 22Na, 46V, and 94Ag. The overlap between the isoscalar J =1 pair wave function and the shell-model wave function is around 0.5 for the I =1 ,3 states of 34Cl and the I =1 state of 94Ag. The I =9 state of 62Ga is very well described by the isoscalar J =3 pair condensation. The broken-pair approximation (which is similar to the 2-quasiparticle excitation of the isovector pair condensation) is appropriate for quite few states, such as the I =1 -3 states of 34Cl and the I =5 state of 62Ga. The correlation energies are presented in this paper. It is noted that the picture based on nucleon-pair wave functions is not always in agreement with the picture based on correlation energies.

  3. PAIRS, The GIS-Based Incident Response System for Pennsylvania, and NASA

    NASA Technical Reports Server (NTRS)

    Conrad, Eric; Arbegast, Daniel; Maynard, Nancy; Vicente, Gilberto

    2003-01-01

    Over the past several years the Pennsylvania Departments of Environmental Protection (DEP), Health (DOH), and Agriculture (PDA) built the GIs-based Pennsylvania West Nile Surveillance System. That system has become a model for collecting data that has a field component, laboratory component, reporting and mapping component, and a public information component. Given the success of the West Nile Virus System and the events of September 11, 2001, DEP then embarked on the development of the Pennsylvania Incident Response System, or PAIRS. PAIRS is an effective GIs-based approach to providing a system for response to incidents of any kind, including terrorism because it is building upon the existing experience, infrastructure and databases that were successfully developed to respond to the West Nile Virus by DEP, DOH, and PDA. The proposed system can be described as one that supports data acquisition, laboratory forensics, decision making/response, and communications. Decision makers will have tools to view and analyze data from various sources and, at the same time, to communicate with the large numbers of people responding to the same incident. Recent collaborations with NASA partners are creating mechanisms for the PAIRS system to incorporate space-based and other remote sensing geophysical parameters relevant to public health assessment and management, such as surface temperatures, precipitation, land cover/land use change, and humidity. This presentation will describe the PAIRS system and outline the Pennsylvania-NASA collaboration for integration of space-based data into the PAIRS system.

  4. Messages for men: the efficacy of EPPM-based messages targeting men's physical activity.

    PubMed

    Hatchell, Alexandra C; Bassett-Gunter, Rebecca L; Clarke, Marie; Kimura, Stacey; Latimer-Cheung, Amy E

    2013-01-01

    The majority of men are insufficiently active. Men's tendencies to participate in risky behaviors and their inactivity likely contribute to their increased risk of morbidity and mortality. Physical activity decreases the risk of developing many chronic diseases and may be an optimal behavior to target in men's health interventions. However, educational resources promoting physical activity for men are lacking. To address this gap, we tested the efficacy of messages based upon the Extended Parallel Process Model (EPPM; Witte, 1992) to increase men's physical activity intentions and behaviors. Men who were not meeting physical activity guidelines (n = 611) were randomly assigned to read high or low efficacy physical activity messages paired with high or no health risk information. Participants read four brief messages on four consecutive days. Intentions were assessed at baseline and the first follow-up (Day 5). Manipulation check measures were assessed at Day 5. Behavior was assessed at baseline and the second follow-up (Day 14). Overall, the messages had small sized effects. A completer analysis revealed that although men's intentions to be active increased over the course of the study regardless of the messages they received, only men who received risk information significantly increased their physical activity. Men who received low efficacy and risk information were less likely to meet the physical activity guidelines at Day 14 than men who only received low efficacy information. From these results, we suggest preliminary recommendations for the development of physical activity messages for men and areas for future EPPM-based research. PsycINFO Database Record (c) 2013 APA, all rights reserved.

  5. Identification in a pseudoknot of a U.G motif essential for the regulation of the expression of ribosomal protein S15.

    PubMed

    Bénard, L; Mathy, N; Grunberg-Manago, M; Ehresmann, B; Ehresmann, C; Portier, C

    1998-03-03

    The ribosomal protein S15 from Escherichia coli binds to a pseudoknot in its own messenger. This interaction is an essential step in the mechanism of S15 translational autoregulation. In a previous study, a recognition determinant for S15 autoregulation, involving a U.G wobble pair, was located in the center of stem I of the pseudoknot. In this study, an extensive mutagenesis analysis has been conducted in and around this U.G pair by comparing the effects of these mutations on the expression level of S15. The results show that the U.G wobble pair cannot be substituted by A.G, C.A, A.C, G.U, or C.G without loss of the autocontrol. In addition, the base pair C.G, adjacent to the 5' side of U, cannot be flipped or changed to another complementary base pair without also inducing derepression of translation. A unique motif, made of only two adjacent base pairs, U.G/C.G, is essential for S15 autoregulation and is presumably involved in direct recognition by the S15 protein.

  6. Identification in a pseudoknot of a U⋅G motif essential for the regulation of the expression of ribosomal protein S15

    PubMed Central

    Bénard, Lionel; Mathy, Nathalie; Grunberg-Manago, Marianne; Ehresmann, Bernard; Ehresmann, Chantal; Portier, Claude

    1998-01-01

    The ribosomal protein S15 from Escherichia coli binds to a pseudoknot in its own messenger. This interaction is an essential step in the mechanism of S15 translational autoregulation. In a previous study, a recognition determinant for S15 autoregulation, involving a U⋅G wobble pair, was located in the center of stem I of the pseudoknot. In this study, an extensive mutagenesis analysis has been conducted in and around this U⋅G pair by comparing the effects of these mutations on the expression level of S15. The results show that the U⋅G wobble pair cannot be substituted by A⋅G, C⋅A, A⋅C, G⋅U, or C⋅G without loss of the autocontrol. In addition, the base pair C⋅G, adjacent to the 5′ side of U, cannot be flipped or changed to another complementary base pair without also inducing derepression of translation. A unique motif, made of only two adjacent base pairs, U⋅G/C⋅G, is essential for S15 autoregulation and is presumably involved in direct recognition by the S15 protein. PMID:9482926

  7. Proximal pulmonary vein stenosis detection in pediatric patients: value of multiplanar and 3-D VR imaging evaluation.

    PubMed

    Lee, Edward Y; Jenkins, Kathy J; Muneeb, Muhammad; Marshall, Audrey C; Tracy, Donald A; Zurakowski, David; Boiselle, Phillip M

    2013-08-01

    One of the important benefits of using multidetector computed tomography (MDCT) is its capability to generate high-quality two-dimensional (2-D) multiplanar (MPR) and three-dimensional (3-D) images from volumetric and isotropic axial CT data. However, to the best of our knowledge, no results have been published on the potential diagnostic role of multiplanar and 3-D volume-rendered (VR) images in detecting pulmonary vein stenosis, a condition in which MDCT has recently assumed a role as the initial noninvasive imaging modality of choice. The purpose of this study was to compare diagnostic accuracy and interpretation time of axial, multiplanar and 3-D VR images for detection of proximal pulmonary vein stenosis in children, and to assess the potential added diagnostic value of multiplanar and 3-D VR images. We used our hospital information system to identify all consecutive children (< 18 years of age) with proximal pulmonary vein stenosis who had both a thoracic MDCT angiography study and a catheter-based conventional angiography within 2 months from June 2005 to February 2012. Two experienced pediatric radiologists independently reviewed each MDCT study for the presence of proximal pulmonary vein stenosis defined as ≥ 50% of luminal narrowing on axial, multiplanar and 3-D VR images. Final diagnosis was confirmed by angiographic findings. Diagnostic accuracy was compared using the z-test. Confidence level of diagnosis (scale 1-5, 5 = highest), perceived added diagnostic value (scale 1-5, 5 = highest), and interpretation time of multiplanar or 3-D VR images were compared using paired t-tests. Interobserver agreement was measured using the chance-corrected kappa coefficient. The final study population consisted of 28 children (15 boys and 13 girls; mean age: 5.2 months). Diagnostic accuracy based on 116 individual pulmonary veins for detection of proximal pulmonary vein stenosis was 72.4% (84 of 116) for axial MDCT images, 77.5% (90 of 116 cases) for multiplanar MDCT images, and 93% (108 of 116 cases) for 3-D VR images with significantly higher accuracy with 3-D VR compared to axial (z = 4.17, P < 0.001) and multiplanar (z = 3.34, P < 0.001) images. Confidence levels for detection of proximal pulmonary vein stenosis were significantly higher with 3-D VR images (mean level: 4.6) compared to axial MDCT images (mean level: 1.7) and multiplanar MDCT images (mean level: 2.0) (paired t-tests, P < 0.001). Thus, 3-D VR images (mean added diagnostic value: 4.7) were found to provide added diagnostic value for detecting proximal pulmonary vein stenosis (paired t-test, P < 0.001); however, multiplanar MDCT images did not provide added value (paired t-test, P = 0.89). Interpretation time was significantly longer and interobserver agreement was higher when using 3-D VR images than using axial MDCT images or MPR MDCT images for diagnosing proximal pulmonary vein stenosis (paired t-tests, P < 0.001). Use of 3-D VR images in the diagnosis of proximal pulmonary vein stenosis in children significantly increases accuracy, confidence level, added diagnostic value and interobserver agreement. Thus, the routine use of this technique should be encouraged despite its increased interpretation time.

  8. MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

    PubMed

    Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

    2016-01-01

    Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic strands to increase the success rate. It is a standalone web-based pipeline, which is fully configured within a virtual machine and thus can be readily used without any configuration. We have experimentally validated primer pairs designed by our pipeline and shown a very high success rate of primer pairs: out of 66 BSP primer pairs, 63 were successfully validated without any further optimization step and using the same qPCR conditions. The MSP-HTPrimer pipeline is freely available from http://sourceforge.net/p/msp-htprimer.

  9. Optimal Decisions for Organ Exchanges in a Kidney Paired Donation Program.

    PubMed

    Li, Yijiang; Song, Peter X-K; Zhou, Yan; Leichtman, Alan B; Rees, Michael A; Kalbfleisch, John D

    2014-05-01

    The traditional concept of barter exchange in economics has been extended in the modern era to the area of living-donor kidney transplantation, where one incompatible donor-candidate pair is matched to another pair with a complementary incompatibility, such that the donor from one pair gives an organ to a compatible candidate in the other pair and vice versa. Kidney paired donation (KPD) programs provide a unique and important platform for living incompatible donor-candidate pairs to exchange organs in order to achieve mutual benefit. In this paper, we propose novel organ allocation strategies to arrange kidney exchanges under uncertainties with advantages, including (i) allowance for a general utility-based evaluation of potential kidney transplants and an explicit consideration of stochastic features inherent in a KPD program; and (ii) exploitation of possible alternative exchanges when the originally planned allocation cannot be fully executed. This allocation strategy is implemented using an integer programming (IP) formulation, and its implication is assessed via a data-based simulation system by tracking an evolving KPD program over a series of match runs. Extensive simulation studies are provided to illustrate our proposed approach.

  10. Consecutive three-component synthesis of (hetero)arylated propargyl amides by chemoenzymatic aminolysis-Sonogashira coupling sequence.

    PubMed

    Hassan, Sidra; Ullrich, Anja; Müller, Thomas J J

    2015-02-07

    A novel chemoenzymatic three-component synthesis of (hetero)arylated propargyl amides in good yields based upon Novozyme® 435 (Candida antarctica lipase B (CAL-B)) catalyzed aminolysis of methyl carboxylates followed by Sonogashira coupling with (hetero)aryliodides in a consecutive one-pot fashion has been presented. This efficient methodology can be readily concatenated with a CuAAC (Cu catalyzed alkyne azide cycloaddition) as a third consecutive step to furnish 1,4-disubstituted 1,2,3-triazole ligated arylated propargyl amides. This one-pot process can be regarded as a transition metal catalyzed sequence that takes advantage of the copper source still present from the cross-coupling step.

  11. Adaptation to flood risk: Results of international paired flood event studies

    NASA Astrophysics Data System (ADS)

    Kreibich, Heidi; Di Baldassarre, Giuliano; Vorogushyn, Sergiy; Aerts, Jeroen C. J. H.; Apel, Heiko; Aronica, Giuseppe T.; Arnbjerg-Nielsen, Karsten; Bouwer, Laurens M.; Bubeck, Philip; Caloiero, Tommaso; Chinh, Do T.; Cortès, Maria; Gain, Animesh K.; Giampá, Vincenzo; Kuhlicke, Christian; Kundzewicz, Zbigniew W.; Llasat, Maria Carmen; Mârd, Johanna; Matczak, Piotr; Mazzoleni, Maurizio; Molinari, Daniela; Dung, Nguyen V.; Petrucci, Olga; Schröter, Kai; Slager, Kymo; Thieken, Annegret H.; Ward, Philip J.; Merz, Bruno

    2017-10-01

    As flood impacts are increasing in large parts of the world, understanding the primary drivers of changes in risk is essential for effective adaptation. To gain more knowledge on the basis of empirical case studies, we analyze eight paired floods, that is, consecutive flood events that occurred in the same region, with the second flood causing significantly lower damage. These success stories of risk reduction were selected across different socioeconomic and hydro-climatic contexts. The potential of societies to adapt is uncovered by describing triggered societal changes, as well as formal measures and spontaneous processes that reduced flood risk. This novel approach has the potential to build the basis for an international data collection and analysis effort to better understand and attribute changes in risk due to hydrological extremes in the framework of the IAHSs Panta Rhei initiative. Across all case studies, we find that lower damage caused by the second event was mainly due to significant reductions in vulnerability, for example, via raised risk awareness, preparedness, and improvements of organizational emergency management. Thus, vulnerability reduction plays an essential role for successful adaptation. Our work shows that there is a high potential to adapt, but there remains the challenge to stimulate measures that reduce vulnerability and risk in periods in which extreme events do not occur.

  12. Detection of endogenous cortisol in equine tears and blood at rest and after simulated stress.

    PubMed

    Monk, Caroline S; Hart, Kelsey A; Berghaus, Roy D; Norton, Natalie A; Moore, Phillip A; Myrna, Kathern E

    2014-07-01

    To determine whether cortisol is present in equine tears at rest and during simulated stress and compare tear cortisol to serum free and total cortisol. Fourteen healthy adult horses were included. Paired tear total cortisol and serum total and free cortisol concentrations were measured with ELISA, chemiluminescent immunoassay, and ultrafiltration methodology, respectively, in 10 horses at rest once daily for five consecutive days. In an additional four horses, paired tear and serum samples were collected for cortisol measurement before and after adrenocorticotropic hormone (ACTH) stimulation (cosyntropin, 1 μg/kg IV). Cortisol was detectable in equine tears at rest. Following ACTH stimulation, tear cortisol increased significantly from baseline at 60-120 min (P ≤ 0.001). Serum total and free cortisol also increased significantly at 30-180 min after ACTH stimulation (P ≤ 0.001). Both serum and tear cortisol returned to baseline concentrations by 360 min. Changes in tear cortisol were similarly associated with changes in serum total and free cortisol, although high tear cortisol concentrations suggest a portion of tear cortisol may be protein-bound. Cortisol is present in equine tears and increases in concert with serum cortisol following ACTH stimulation. Further study is needed to determine whether endogenous cortisol in tears contributes to ocular pathology. © 2013 American College of Veterinary Ophthalmologists.

  13. Development of rabbit embryos during a 96-h period of in vitro culture after superovulatory treatment under conditions of elevated ambient temperature.

    PubMed

    Cheng, H; Dooley, M P; Hopkins, S M; Anderson, L L; Yibchok-anun, S; Hsu, W H

    1999-08-16

    The effects of elevated ambient temperature on the response to exogenous gonadotropins were evaluated in female New Zealand White rabbits exposed to 33+/-1 degrees C (mean +/- SE) and 10-30% relative humidity (8 h/day) during a 5-day period. Does were treated with pFSH (0.3 mg/0.3 ml Standard Armour) twice daily during three consecutive days with a minimum interval of 8 h between injections. Six hours after the last FSH injection all does were removed from the experimental chamber, given hCG (25 IU/kg) and paired overnight. Nineteen hours after pairing, embryos were flushed from the reproductive tracts, evaluated, and subjected to in vitro culture during a 96-h period. The ovulatory responses to exogenous gonadotropins and fertilization rates did not differ significantly under conditions of elevated ambient temperature, whereas fewer blastocysts and increased number of degenerate embryos were observed after culture. We conclude that although hyperthermia was induced during exposure to elevated ambient temperature, it did not alter the ovulatory responses to gonadotropin treatment and plasma concentrations of FSH and LH compared with does in a thermoneutral environment. Exposure of donor rabbits to elevated ambient temperature before mating, however, increased embryonic degeneration.

  14. Optimal self-cleavage activity of the hepatitis delta virus RNA is dependent on a homopurine base pair in the ribozyme core.

    PubMed Central

    Been, M D; Perrotta, A T

    1995-01-01

    A non-Watson-Crick G.G interaction within the core region of the hepatitis delta virus (HDV) antigenomic ribozyme is required for optimal rates of self-cleavage activity. Base substitutions for either one or both G's revealed that full activity was obtained only when both G's were replaced with A's. At those positions, substitutions that generate potential Watson-Crick, G.U, heteropurine, or homopyrimidine combinations resulted in dramatically lower cleavage activity. A homopurine symmetric base pair, of the same type identified in the high-affinity binding site of the HIV RRE, is most consistent with this data. Additional features shared between the antigenomic ribozyme and the Rev binding site in the vicinity of the homopurine pairs suggest some structural similarity for this region of the two RNAs and a possible motif associated with this homopurine interaction. Evidence for a homopurine pair at the equivalent position in a modified form of the HDV genomic ribozyme was also found. With the postulated symmetric pairing scheme, large distortions in the nucleotide conformation, the sugar-phosphate backbone, or both would be necessary to accommodate this interaction at the end of a helix; we hypothesize that this distortion is critical to the structure of the active site of the ribozyme and it is stabilized by the homopurine base pair. PMID:8595561

  15. Concealed d -wave pairs in the s ± condensate of iron-based superconductors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ong, Tzen; Coleman, Piers; Schmalian, Jörg

    A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave (s ±) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. In this paper, we propose a new class of s ± statemore » containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave (L=2) motion of the pairs with the internal angular momenta I =2 of the iron orbitals to make a singlet (J =L+I =0), an s ± superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba 1$-$xK XFe 2As 2 as a reconfiguration of the orbital and internal angular momentum into a high spin (J =L+I =4) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. Finally, the formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.« less

  16. Concealed d -wave pairs in the s ± condensate of iron-based superconductors

    DOE PAGES

    Ong, Tzen; Coleman, Piers; Schmalian, Jörg

    2016-05-02

    A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave (s ±) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. In this paper, we propose a new class of s ± statemore » containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave (L=2) motion of the pairs with the internal angular momenta I =2 of the iron orbitals to make a singlet (J =L+I =0), an s ± superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba 1$-$xK XFe 2As 2 as a reconfiguration of the orbital and internal angular momentum into a high spin (J =L+I =4) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. Finally, the formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.« less

  17. Concealed d-wave pairs in the s± condensate of iron-based superconductors.

    PubMed

    Ong, Tzen; Coleman, Piers; Schmalian, Jörg

    2016-05-17

    A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave ([Formula: see text]) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. Here, we propose a new class of [Formula: see text] state containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave ([Formula: see text]) motion of the pairs with the internal angular momenta [Formula: see text] of the iron orbitals to make a singlet ([Formula: see text]), an [Formula: see text] superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba1-x KXFe2As2 as a reconfiguration of the orbital and internal angular momentum into a high spin ([Formula: see text]) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. The formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.

  18. Organic ion association in aqueous phase and ab initio-based force fields: The case of carboxylate/ammonium salts

    NASA Astrophysics Data System (ADS)

    Houriez, Céline; Vallet, Valérie; Réal, Florent; Meot-Ner Mautner, Michael; Masella, Michel

    2017-10-01

    We performed molecular dynamics simulations of carboxylate/methylated ammonium ion pairs solvated in bulk water and of carboxylate/methylated ammonium salt solutions at ambient conditions using an ab initio-based polarizable force field whose parameters are assigned to reproduce only high end quantum computations, at the Møller-Plesset second-order perturbation theory/complete basis set limit level, regarding single ions and ion pairs as isolated and micro-hydrated in gas phase. Our results agree with the available experimental results regarding carboxylate/ammonium salt solutions. For instance, our force field approach predicts the percentage of acetate associated with ammonium ions in CH3 COO-/CH3 NH3+ solutions at the 0.2-0.8M concentration scale to range from 14% to 35%, in line with the estimates computed from the experimental ion association constant in liquid water. Moreover our simulations predict the number of water molecules released from the ion first hydration shell to the bulk upon ion association to be about 2.0 ± 0.6 molecules for acetate/protonated amine ion pairs, 3.1 ± 1.5 molecules for the HCOO-/NH4+ pair and 3.3 ± 1.2 molecules for the CH3COO-/(CH3)4N+ pair. For protonated amine-based ion pairs, these values are in line with experiment for alkali/halide pairs solvated in bulk water. All these results demonstrate the promising feature of ab initio-based force fields, i.e., their capacity in accurately modeling chemical systems that cannot be readily investigated using available experimental techniques.

  19. New Common Proper-Motion Pairs with R.A. Between 00h and 01h

    NASA Astrophysics Data System (ADS)

    Caballero, Rafael

    2015-07-01

    This paper presents 37 new common proper-motion pairs. The new pairs have been obtained employing a semi-automatic procedure based on the inspection of images using the tool Aladin, completed with information obtained from the catalogs available at VizieR. All the pairs fulfill the Halbwachs criteria, employed to increase the probability of a physical bond between the two components.

  20. Experimental Study of Inertial Particle-Pair Relative Velocity in Isotropic Turbulence

    NASA Astrophysics Data System (ADS)

    Dou, Zhongwang

    The investigation of turbulence-enhanced inertial particle collision in isotropic turbulence could improve our understanding and modeling of many particle-laden turbulent flows in engineering and nature. In this study, we investigate one of the most critical factors of particle collision - particle-pair relative velocity (RV) in three major steps. First, to generate a reliable homogeneous and isotropic turbulence (HIT) field, we have designed and implemented a high Reynolds number (R lambda), enclosed, fan-driven HIT chamber in the shape of 'soccer ball', conducive for studying inertial particle dynamics using whole-field imaging techniques. The characterization of turbulence in this near-zero-mean flow chamber was performed using a new two-scale particle imaging velocimetry (PIV) approach. The measurement results showed that turbulence in the apparatus achieved high homogeneity and isotropy in a large central region (48mm diameter) of the chamber with minimized gravity effect. A maximum Rlambda of 384 was achieved. Second, to measure particle-pair RV accurately, we have employed numerical experiments to systemically analyze the measurement error in the previous particle-pair RV measurement by holographic PIV. We found that accurate RV measurement requires high accuracy of both particle positioning and particle pairing. To meet these requirements, we have devised a novel planar 4-frame particle tracking velocimetry technique (4F-PTV) combining two PIV systems. It tracks particles in four consecutive frames in high speed to increase particle pairing accuracy. Furthermore, the particles are tracked only in a thin laser light sheet, thus negating the intrinsic position uncertainty in the depth direction in holographic PIV. In addition, we have studied the laser thickness effect on the RV measurement and attempted to use Monte Carlo analysis to correct this effect. Third, and most importantly, to better understand turbulence-enhanced inertial particle collision, we have systematically investigated the effects of Reynolds number and Stokes number (St) on particle-pair RV using the planar 4F-PTV technique in the HIT chamber. Two experiments were performed: varying Rlambda between 246 and 357 at six fixed St values, and varying St between 0.02 and 4.63 at five fixed Rlambda values. Measured mean inward particle-pair RV as a function of separation distance r were compared against DNS under closely matched conditions. At all experimental conditions, an excellent agreement was achieved except when particle separation distance r<˜10eta (eta : Kolmogorov length scale), where experimental was consistently higher, possibly due to particle polydispersity and finite laser thickness in experiment. Through these three steps, we found that, at any fixed St, the mean inward particle-pair RV, was essentially independent of Rlambda, echoing DNS findings by Ireland et al. (2016a). At any fixed R lambda, increased with St at small r, showing dominance of the path-history effect in the dissipation range when St ≥ O(1), but decreased with St at large r, indicating dominance of the inertial filtering effect. What I provided here are the first experimental observation of the independence of mean inward particle-pair RV on Reynolds number, and the first experimental observation of these two mechanisms on the mean inward particle-pair RV over a large range of particle separation distances.

  1. Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA

    PubMed Central

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-01-01

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116

  2. Weaning mechanical ventilation after off-pump coronary artery bypass graft procedures directed by noninvasive gas measurements.

    PubMed

    Chakravarthy, Murali; Narayan, Sandeep; Govindarajan, Raghav; Jawali, Vivek; Rajeev, Subramanyam

    2010-06-01

    Partial pressure of carbon dioxide and oxygen were transcutaneously measured in adults after off-pump coronary artery bypass (OPCAB) surgery. The clinical use of such measurements and interchangeability with arterial blood gas measurements for weaning patients from postoperative mechanical ventilation were assessed. This was a prospective observational study. Tertiary referral heart hospital. Postoperative OPCAB surgical patients. Transcutaneous oxygen and carbon dioxide measurements. In this prospective observational study, 32 consecutive adult patients in a tertiary care medical center underwent OPCAB surgery. Noninvasive measurement of respiratory gases was performed during the postoperative period and compared with arterial blood gases. The investigator was blinded to the reports of arterial blood gas studies and weaned patients using a "weaning protocol" based on transcutaneous gas measurement. The number of patients successfully weaned based on transcutaneous measurements and the number of times the weaning process was held up were noted. A total of 212 samples (pairs of arterial and transcutaneous values of oxygen and carbon dioxide) were obtained from 32 patients. Bland-Altman plots and mountain plots were used to analyze the interchangeability of the data. Twenty-five (79%) of the patients were weaned from the ventilator based on transcutaneous gas measurements alone. Transcutaneous carbon dioxide measurements were found to be interchangeable with arterial carbon dioxide during 96% of measurements, versus 79% for oxygen measurements. More than three fourths of the patients were weaned from mechanical ventilation and extubated based on transcutaneous gas values alone after OPCAB surgery. The noninvasive transcutaneous carbon dioxide measurement can be used as a surrogate for arterial carbon dioxide measurement to manage postoperative OPCAB patients. Copyright 2010 Elsevier Inc. All rights reserved.

  3. Base-Pairing Systems Related to TNA: alpha-Threofuranosyl Oligonucleotides Containing Phosphoramidate Linkages

    NASA Technical Reports Server (NTRS)

    Meyer, Michael (Technical Monitor); Wu, Xiaolin; Guntha, Sreenivasulu; Ferenclc, Mathias; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2002-01-01

    (3'NH)- and (2'NH)-TNA, two isomeric phosphoramidate analogues of TNA (alpha-threofuranosyl-(3'-2') oligonucleotides), are shown to be efficient Watson-Crick base-pairing systems and to undergo intersystem crosspairing with TNA, RNA, and DNA.

  4. Control of box C/D snoRNP assembly by N6-methylation of adenine.

    PubMed

    Huang, Lin; Ashraf, Saira; Wang, Jia; Lilley, David Mj

    2017-09-01

    N 6 -methyladenine is the most widespread mRNA modification. A subset of human box C/D snoRNA species have target GAC sequences that lead to formation of N 6 -methyladenine at a key trans Hoogsteen-sugar A·G base pair, of which half are methylated in vivo The GAC target is conserved only in those that are methylated. Methylation prevents binding of the 15.5-kDa protein and the induced folding of the RNA Thus, the assembly of the box C/D snoRNP could in principle be regulated by RNA methylation at its critical first stage. Crystallography reveals that N 6 -methylation of adenine prevents the formation of trans Hoogsteen-sugar A·G base pairs, explaining why the box C/D RNA cannot adopt its kinked conformation. More generally, our data indicate that sheared A·G base pairs (but not Watson-Crick base pairs) are more susceptible to disruption by N 6 mA methylation and are therefore possible regulatory sites. The human signal recognition particle RNA and many related Alu retrotransposon RNA species are also methylated at N6 of an adenine that forms a sheared base pair with guanine and mediates a key tertiary interaction. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

  5. Guide-substrate base-pairing requirement for box H/ACA RNA-guided RNA pseudouridylation.

    PubMed

    De Zoysa, Meemanage D; Wu, Guowei; Katz, Raviv; Yu, Yi-Tao

    2018-06-05

    Box H/ACA RNAs are a group of small RNAs found in abundance in eukaryotes (as well as in archaea). Although their sequences differ, eukaryotic box H/ACA RNAs all share the same unique hairpin-hinge-hairpin-tail structure. Almost all of them function as guides that primarily direct pseudouridylation of rRNAs and spliceosomal snRNAs at specific sites. Although box H/ACA RNA-guided pseudouridylation has been extensively studied, the detailed rules governing this reaction, especially those concerning the guide RNA-substrate RNA base-pairing interactions that determine the specificity and efficiency of pseudouridylation, are still not exactly clear. This is particularly relevant given that the lengths of the guide sequences involved in base-pairing vary from one box H/ACA RNA to another. Here, we carry out a detailed investigation into guide-substrate base-pairing interactions, and identify the minimum number of base-pairs (8), required for RNA-guided pseudouridylation. In addition, we find that the pseudouridylation pocket, present in each hairpin of box H/ACA RNA, exhibits flexibility in fitting slightly different substrate sequences. Our results are consistent across three independent pseudouridylation pockets tested, suggesting that our findings are generally applicable to box H/ACA RNA-guided RNA pseudouridylation. Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  6. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Szulik, Marta W.; Pallan, Pradeep S.; Nocek, Boguslaw

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T 8X 9G 10-3' sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC didmore » not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A 5:T 8, whereas 5caC did not. At the oxidized base pair G 4:X 9, 5fC exhibited an increase in the imino proton exchange rate and the calculated k op. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C 3:G 10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G 4:X 9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N 4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. Furthermore, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.« less

  7. The physico-chemical "anatomy" of the tautomerization through the DPT of the biologically important pairs of hypoxanthine with DNA bases: QM and QTAIM perspectives.

    PubMed

    Brovarets', Ol'ha O; Zhurakivsky, Roman O; Hovorun, Dmytro M

    2013-10-01

    The biologically important tautomerization of the Hyp·Cyt, Hyp·Thy and Hyp·Hyp base pairs to the Hyp·Cyt, Hyp·Thy and Hyp·Hyp base pairs, respectively, by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ε = 4) corresponding to hydrophobic interfaces of protein-nucleic acid interactions by combining theoretical investigations at the B3LYP/6-311++G(d,p) level of QM theory with QTAIM topological analysis. Based on the sweeps of the energetic, electron-topological, geometric and polar parameters, which describe the course of the tautomerization along the intrinsic reaction coordinate (IRC), it was proved that the tautomerization through the DPT is concerted and asynchronous process for the Hyp·Cyt and Hyp·Thy base pairs, while concerted and synchronous for the Hyp·Hyp homodimer. The continuum with ε = 4 does not affect qualitatively the course of the tautomerization reaction for all studied complexes. The nine key points along the IRC of the Hyp·Cyt↔Hyp·Cyt and Hyp·Thy↔Hyp·Thy tautomerizations and the six key points of the Hyp·Hyp↔Hyp·Hyp tautomerization have been identified and fully characterized. These key points could be considered as electron-topological "fingerprints" of concerted asynchronous (for Hyp·Cyt and Hyp·Thy) or synchronous (for Hyp·Hyp) tautomerization process via the DPT. It was found, that in the Hyp·Cyt, Hyp·Thy, Hyp·Hyp and Hyp·Hyp base pairs all H-bonds are significantly cooperative and mutually reinforce each other, while the C2H…O2 H-bond in the Hyp·Cyt base pair and the O6H…O4 H-bond in the Hyp·Thy base pair behave anti-cooperatively, i.e., they become weakened, while two others become strengthened.

  8. Mild cognitive impairment: applicability of research criteria in a memory clinic and characterization of cognitive profile.

    PubMed

    Alladi, Suvarna; Arnold, Robert; Mitchell, Joanna; Nestor, Peter J; Hodges, John R

    2006-04-01

    We explored the applicability of recently proposed research criteria for mild cognitive impairment (MCI) in a memory clinic and changes in case definition related to which memory tests are used and the status of general cognitive function in MCI. A total of 166 consecutive GP referrals to the Cambridge Memory Clinic underwent comprehensive neuropsychological and psychiatric evaluation. Of 166 cases, 42 were excluded (significant depression 8, established dementia 29 and other disorders 5). Of 124 non-demented, non-depressed patients, 72 fulfilled Petersen's criteria for amnestic MCI based upon verbal memory performance [the Rey Auditory Verbal Learning Test (RAVLT)] and 90 met criteria if performance on verbal and/or non-verbal memory tests [the Rey figure recall or the Paired Associates Learning test (PAL)] was considered. Of the 90 broadly defined MCI cases, only 25 had pure amnesia: other subtle semantic and/or attention deficits were typically present. A further 12 were classed as non-amnestic MCI and 22 as 'worried well'. Definition of MCI varies considerably dependent upon the tests used for case definition. The majority have other cognitive deficits despite normal performance on the Mini-mental State Examination (MMSE) and intact activities of daily living (ADL) and fit within multi-domain MCI. Pure amnesic MCI is rare.

  9. The efficacy of surgical drainage in cervicofacial rhytidectomy: a prospective, randomized, controlled trial.

    PubMed

    Jones, Barry M; Grover, Rajiv; Hamilton, Stephen

    2007-07-01

    Postoperative drainage is often used instinctively in face lifting on the assumption that it may reduce the likelihood of complications. This potential benefit should be balanced against cost, discomfort, and the possibility of provoking bleeding and hematoma on removal. Evidence-based decisions on drainage are problematic, since no prospective studies have examined its role. This study was designed to address this issue directly. Fifty consecutive patients undergoing face lift over a 3-month period were randomized to drainage of one side of the face only, with the contralateral side serving as a paired control. Bruising, swelling, and hematoma or seroma were assessed objectively, independently of the operating surgeon and subjectively by the patients. Postoperative hematoma and edema were not influenced by the use of drains (p > 0.5). Patients reported no difference between the two sides with respect to swelling (p = 0.6) or discomfort (p = 0.5). However, drains produced a statistically significant reduction in postoperative bruising both on clinical assessment (p = 0.005) and patient assessment (p = 0.002). This article represents the first prospective, randomized, controlled trial assessing the use of postoperative drainage in facial rejuvenation surgery. Surgical drains do not influence postoperative complications, but they do significantly reduce bruising and so may facilitate the patient's return to normal activity.

  10. Computerized classification of proximal occlusion in the left anterior descending coronary artery.

    PubMed

    Gregg, Richard E; Nikus, Kjell C; Zhou, Sophia H; Startt Selvester, Ronald H; Barbara, Victoria

    2010-01-01

    Proximal occlusion within the left anterior descending (LAD) coronary artery in patients with acute myocardial infarction leads to higher mortality than does nonproximal occlusion. We evaluated an automated program to detect proximal LAD occlusion. All patients with suspected acute coronary syndrome (n = 7,710) presenting consecutively to the emergency department of a local hospital with a coronary angiogram–confirmed flow-limiting lesion and notation of occlusion site were included in the study (n = 711). Electrocardiograms (ECGs) that met ST-segment elevation myocardial infarction (STEMI) criteria were included in the training set (n = 183). Paired angiographic location of proximal LAD and ECGs with ST elevation in the anterolateral region were used for the computer program development (n = 36). The test set was based on ECG criteria for anterolateral STEMI only without angiographic reports (n = 162). Tested against 2 expert cardiologists' agreed reading of proximal LAD occlusion, the algorithm has a sensitivity of 95% and a specificity of 82%. The algorithm is designed to have high sensitivity rather than high specificity for the purpose of not missing any proximal LAD in the STEMI population. Our preliminary evaluation suggests that the algorithm can detect proximal LAD occlusion as an additional interpretation to STEMI detection with similar accuracy as cardiologist readers.

  11. Effectiveness of Self-Care Education on the Enhancement of the Self-Esteem of Patients Undergoing Hemodialysis.

    PubMed

    Poorgholami, Farzad; Javadpour, Shohreh; Saadatmand, Vahid; Jahromi, Marzieh Kargar

    2015-06-12

    The assessment of self-esteem in hemodialysis people is becoming increasingly important and necessary. Low self-esteem as a problem in patients undergoing hemodialysis decreases adherence to treatment. The researcher intends to carry out a study in order to investigate the effect of self-care education on enhancement of the self-esteem of patients undergoing hemodialysis in Iran. This is a quasi-experimental study. The subjects of the study who were selected based on purposive sampling method consisted of 50 patients with advanced chronic renal disease treated with hemodialysis. Before the intervention, two questionnaires were completed by patients. There was no intervention in the control group and the patients received only routine care in the hospital. In the experimental group, the hemodialysis patients received 5 consecutive one-hour training sessions by the researcher. Then the Rosenberg scale was filled out by the patients 2 month later. According to the results, Paired t-test showed a significant difference between the mean self-esteem score in both groups before and after intervention. Increasing the knowledge and awareness of hemodialysis patients must constitute a cornerstone of therapy and an integral part of nursing responsibilities. Nurses should educate the patients about self-care behaviors and remind them of the dangerous complications of abandoning these.

  12. Generalized Riemann hypothesis and stochastic time series

    NASA Astrophysics Data System (ADS)

    Mussardo, Giuseppe; LeClair, André

    2018-06-01

    Using the Dirichlet theorem on the equidistribution of residue classes modulo q and the Lemke Oliver–Soundararajan conjecture on the distribution of pairs of residues on consecutive primes, we show that the domain of convergence of the infinite product of Dirichlet L-functions of non-principal characters can be extended from down to , without encountering any zeros before reaching this critical line. The possibility of doing so can be traced back to a universal diffusive random walk behavior of a series C N over the primes which underlies the convergence of the infinite product of the Dirichlet functions. The series C N presents several aspects in common with stochastic time series and its control requires to address a problem similar to the single Brownian trajectory problem in statistical mechanics. In the case of the Dirichlet functions of non principal characters, we show that this problem can be solved in terms of a self-averaging procedure based on an ensemble of block variables computed on extended intervals of primes. Those intervals, called inertial intervals, ensure the ergodicity and stationarity of the time series underlying the quantity C N . The infinity of primes also ensures the absence of rare events which would have been responsible for a different scaling behavior than the universal law of the random walks.

  13. Impact of maternal nutritional status before and during pregnancy on neonatal body composition: A cross-sectional study.

    PubMed

    Pacce, Sol; Saure, Carola; Mazza, Carmen S; Garcia, Silvia; Tomzig, Rita G; Lopez, Ana P; Ribarola, Lucio; Krochick, Gabriela A

    2016-01-01

    The existence of early factors which, acting during critical periods of intrauterine or immediate postnatal development, determine long-term health has become increasingly recognized. Both high and low birth weight have been associated with cardiovascular risk factors in adulthood. Therefore, body composition at birth rather than birth weight may be a marker to predict future diseases. Maternal weight previous to and gained during pregnancy is associated with intrauterine fetal growth. To evaluate the correlation between maternal nutritional status before and during pregnancy and neonatal body composition. We studied consecutive mother-child pairs at delivery at an Argentinean public hospital during 5 months period, evaluating maternal and neonatal anthropometry before 24h of life as well as the history of the mother before and during pregnancy. Neonatal body composition was calculated according to a mathematical formula based on skinfold thickness measurement validated in newborns. Mothers of newborns with high body fat mass were more frequently obese (72.7% versus 35.1%, p 0.005), and more frequently showed weight gain above 18kg during pregnancy (76.4% versus 31%, p 0.03). Our findings confirm the hypothesis that maternal obesity before pregnancy is highly correlated with neonatal fat mass in the first hours of life. Copyright © 2016. Published by Elsevier Ltd.

  14. Velocity gap mode of capillary electrophoresis developed for high-resolution chiral separations.

    PubMed

    Li, Xue; Li, Youxin; Zhao, Lumeng; Shen, Jianguo; Zhang, Yong; Bao, James J

    2014-10-01

    A new CE method based on velocity gap (VG) theory has been developed for high-resolution chiral separations. In VG, two consecutive electric fields are adopted to drive analytes passing through two capillaries, which are linked together through a joint. The joint is immersed inside another buffer vial which has conductivity communication with the buffer inside the capillary. By adjusting the field strengths onto the two capillaries, it is possible to observe different velocities of an analyte when it passes through those two capillaries and there would be a net velocity change (NVC) for the same analyte. Different analytes may have different NVC which may be specifically meaningful for enantioseparations because enantiomers are usually hard to resolve. By taking advantage of this NVC, it is possible to enhance the resolution of a chiral separation if a proper voltage program is applied. The feasibility of using NVC to enhance chiral separation was demonstrated in the separations of three pairs of enantiomers: terbutaline, chlorpheniramine, and promethazine. All separations started with partial separation in a conventional CE and were significantly improved under the same experimental conditions. The results indicated that VG has the potential to be used to improve the resolving power of CE in chiral separations. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Structures of ω repressors bound to direct and inverted DNA repeats explain modulation of transcription

    PubMed Central

    Weihofen, Wilhelm Andreas; Cicek, Aslan; Pratto, Florencia; Alonso, Juan Carlos; Saenger, Wolfram

    2006-01-01

    Repressor ω regulates transcription of genes required for copy number control, accurate segregation and stable maintenance of inc18 plasmids hosted by Gram-positive bacteria. ω belongs to homodimeric ribbon-helix-helix (RHH2) repressors typified by a central, antiparallel β-sheet for DNA major groove binding. Homodimeric ω2 binds cooperatively to promotors with 7 to 10 consecutive non-palindromic DNA heptad repeats (5′-A/TATCACA/T-3′, symbolized by →) in palindromic inverted, converging (→←) or diverging (←→) orientation and also, unique to ω2 and contrasting other RHH2 repressors, to non-palindromic direct (→→) repeats. Here we investigate with crystal structures how ω2 binds specifically to heptads in minimal operators with (→→) and (→←) repeats. Since the pseudo-2-fold axis relating the monomers in ω2 passes the central C–G base pair of each heptad with ∼0.3 Å downstream offset, the separation between the pseudo-2-fold axes is exactly 7 bp in (→→), ∼0.6 Å shorter in (→←) but would be ∼0.6 Å longer in (←→). These variations grade interactions between adjacent ω2 and explain modulations in cooperative binding affinity of ω2 to operators with different heptad orientations. PMID:16528102

  16. Objectively assessed physical activity and sedentary behaviour does not differ between children and adolescents with and without a congenital heart defect: a pilot examination.

    PubMed

    Ewalt, Lauren A; Danduran, Michael J; Strath, Scott J; Moerchen, Victoria; Swartz, Ann M

    2012-02-01

    To objectively evaluate and describe physical activity levels in children with a stable congenital heart defect and compare those levels with children who do not have a congenital heart defect. We matched 21 pairs of children for gender and grade in school and gave them an accelerometer-based motion sensor to wear for 7 consecutive days. Physical activity levels did not differ between children with and without a congenital heart defect. During the 7 days of monitoring, children in this study spent most of their time in sedentary behaviours, that is, 6.7 hours of the 13 monitored hours, 54 minutes in moderate-intensity physical activity, and 12 minutes in vigorous-intensity physical activity. Less than one-fifth of all participants, with or without a congenital heart defect, accumulated sufficient physical activity to meet current physical activity recommendations for children and adolescents. Children with a stable congenital heart defect have activity behaviours that are similar to children without a congenital heart defect. Habitual physical activity in children with a congenital heart defect should be encouraged early on in life to develop strong physical activity habits that will hopefully follow them across their lifespan.

  17. Effect of proton transfer on the electronic coupling in DNA

    NASA Astrophysics Data System (ADS)

    Rak, Janusz; Makowska, Joanna; Voityuk, Alexander A.

    2006-06-01

    The effects of single and double proton transfer within Watson-Crick base pairs on donor-acceptor electronic couplings, Vda, in DNA are studied on the bases of quantum chemical calculations. Four dimers [AT,AT], [GC,GC], [GC,AT] and [GC,TA)] are considered. Three techniques - the generalized Mulliken-Hush scheme, the fragment charge method and the diabatic states method - are employed to estimate Vda for hole transfer between base pairs. We show that both single- and double proton transfer (PT) reactions may substantially affect the electronic coupling in DNA. The electronic coupling in [AT,AT] is predicted to be most sensitive to PT. Single PT within the first base pair in the dimer leads to increase in the hole transfer efficiency by a factor of 4, while proton transfer within the second pair should substantially, by 2.7 times, decrease the rate of charge transfer. Thus, directional asymmetry of the PT effects on the electronic coupling is predicted. The changes in the Vda matrix elements correlate with the topological properties of orbitals of donor and acceptor and can be qualitatively rationalized in terms of resonance structures of donor and acceptor. Atomic pair contributions to the Vda matrix elements are also analyzed.

  18. Functional network connectivity analysis based on partial correlation in Alzheimer's disease

    NASA Astrophysics Data System (ADS)

    Zhang, Nan; Guan, Xiaoting; Zhang, Yumei; Li, Jingjing; Chen, Hongyan; Chen, Kewei; Fleisher, Adam; Yao, Li; Wu, Xia

    2009-02-01

    Functional network connectivity (FNC) measures the temporal dependency among the time courses of functional networks. However, the marginal correlation between two networks used in the classic FNC analysis approach doesn't separate the FNC from the direct/indirect effects of other networks. In this study, we proposed an alternative approach based on partial correlation to evaluate the FNC, since partial correlation based FNC can reveal the direct interaction between a pair of networks, removing dependencies or influences from others. Previous studies have demonstrated less task-specific activation and less rest-state activity in Alzheimer's disease (AD). We applied present approach to contrast FNC differences of resting state network (RSN) between AD and normal controls (NC). The fMRI data under resting condition were collected from 15 AD and 16 NC. FNC was calculated for each pair of six RSNs identified using Group ICA, thus resulting in 15 (2 out of 6) pairs for each subject. Partial correlation based FNC analysis indicated 6 pairs significant differences between groups, while marginal correlation only revealed 2 pairs (involved in the partial correlation results). Additionally, patients showed lower correlation than controls among most of the FNC differences. Our results provide new evidences for the disconnection hypothesis in AD.

  19. Auto- and cross-power spectral analysis of dual trap optical tweezer experiments using Bayesian inference.

    PubMed

    von Hansen, Yann; Mehlich, Alexander; Pelz, Benjamin; Rief, Matthias; Netz, Roland R

    2012-09-01

    The thermal fluctuations of micron-sized beads in dual trap optical tweezer experiments contain complete dynamic information about the viscoelastic properties of the embedding medium and-if present-macromolecular constructs connecting the two beads. To quantitatively interpret the spectral properties of the measured signals, a detailed understanding of the instrumental characteristics is required. To this end, we present a theoretical description of the signal processing in a typical dual trap optical tweezer experiment accounting for polarization crosstalk and instrumental noise and discuss the effect of finite statistics. To infer the unknown parameters from experimental data, a maximum likelihood method based on the statistical properties of the stochastic signals is derived. In a first step, the method can be used for calibration purposes: We propose a scheme involving three consecutive measurements (both traps empty, first one occupied and second empty, and vice versa), by which all instrumental and physical parameters of the setup are determined. We test our approach for a simple model system, namely a pair of unconnected, but hydrodynamically interacting spheres. The comparison to theoretical predictions based on instantaneous as well as retarded hydrodynamics emphasizes the importance of hydrodynamic retardation effects due to vorticity diffusion in the fluid. For more complex experimental scenarios, where macromolecular constructs are tethered between the two beads, the same maximum likelihood method in conjunction with dynamic deconvolution theory will in a second step allow one to determine the viscoelastic properties of the tethered element connecting the two beads.

  20. Near patient cholesterol testing in patients with peripheral arterial disease.

    PubMed

    Hobbs, S D; Jones, A; Wilmink, A B; Bradbury, A W

    2003-09-01

    To assess the bias, precision and utility of the Bioscanner 2000 for near patient testing of total cholesterol (NPTC) in patients with peripheral arterial disease (PAD). One hundred consecutive patients attending a hospital-based clinic with symptomatic PAD underwent non-fasting NPTC using finger prick blood sample and a laboratory total cholesterol (TC) using blood drawn from an antecubital fossa vein. The Bioscanner 2000 showed good precision with a coefficient of variation of 1.8-3.8%. NPTC was significantly lower than laboratory TC (mean (S.D.) 4.67 (1.1) vs. 5.12 (1.2) mmol/l), p < or = 0.01, paired Student's t-test. Comparing the two methods using Deming regression revealed a 15% negative bias for the Bioscanner 2000 compared to laboratory testing, which was demonstrated to be a systematic bias using a Bland-Altman plot. Almost half (46%) of the readings differed by > 0.5 mmol/l, 16% by > 1.0 mmol/l and 3% by > 2 mmol/l. This means that if the cut-off for statin treatment were taken as a TC of 5.0 or 3.5 mmol/l then, based on NPTC, alone 18 and 6% of patients, respectively, would not have received a statin. In the present study, NPTC significantly under-estimated TC when compared to laboratory testing. However, in the majority of cases, this would not have affected the decision to prescribe a statin and NPTC testing allows the immediate institution or titration of statin treatment.

  1. Comparative reactivity of mismatched and unpaired bases in relation to their type and surroundings. Chemical cleavage of DNA mismatches in mutation detection analysis.

    PubMed

    Yakubovskaya, Marianna G; Belyakova, Anna A; Gasanova, Viktoria K; Belitsky, Gennady A; Dolinnaya, Nina G

    2010-07-01

    Systematic study of chemical reactivity of non-Watson-Crick base pairs depending on their type and microenvironment was performed on a model system that represents two sets of synthetic DNA duplexes with all types of mismatched and unmatched bases flanked by T.A or G.C pairs. Using comparative cleavage pattern analysis, we identified the main and additional target bases and performed quantitative study of the time course and efficacy of DNA modification caused by potassium permanganate or hydroxylamine. Potassium permanganate in combination with tetraethylammonium chloride was shown to induce DNA cleavage at all mismatched or bulged T residues, as well as at thymines of neighboring canonical pairs. Other mispaired (bulged) bases and thymine residues located on the second position from the mismatch site were not the targets for KMnO(4) attack. In contrast, hydroxylamine cleaved only heteroduplexes containing mismatched or unmatched C residues, and did not modify adjacent cytosines. However when G.C pairs flank bulged C residue, neighboring cytosines are also attacked by hydroxylamine due to defect migration. Chemical reactivity of target bases was shown to correlate strongly with the local disturbance of DNA double helix at mismatch or bulge site. With our model system, we were able to prove the absence of false-negative and false-positive results. Portion of heteroduplex reliably revealed in a mixture with corresponding homoduplex consists of 5% for bulge bases and "open" non-canonical pairs, and 10% for wobble base pairs giving minimal violations in DNA structure. This study provides a complete understanding of the principles of mutation detection methodology based on chemical cleavage of mismatches and clarifies the advantages and limitations of this approach in various biological and conformational studies of DNA. Copyright 2010 Elsevier Masson SAS. All rights reserved.

  2. A Heterogeneous Metal-Free Catalyst for Hydrogenation: Lewis Acid-Base Pairs Integrated into a Carbon Lattice.

    PubMed

    Ding, Yuxiao; Huang, Xing; Yi, Xianfeng; Qiao, Yunxiang; Sun, Xiaoyan; Zheng, Anmin; Su, Dang Sheng

    2018-06-04

    Designing heterogeneous metal-free catalysts for hydrogenation is a long-standing challenge in catalysis. Nanodiamond-based carbon materials were prepared that are surface-doped with electron-rich nitrogen and electron-deficient boron. The two heteroatoms are directly bonded to each other to form unquenched Lewis pairs with infinite π-electron donation from the surrounding graphitic structure. Remarkably, these Lewis pairs can split H 2 to form H + /H - pairs, which subsequently serve as the active species for hydrogenation of different substrates. This unprecedented finding sheds light on the uptake of H 2 across carbon-based materials and suggests that dual Lewis acidity-basicity on the carbon surface may be used to heterogeneously activate a variety of small molecules. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Action-outcome learning and prediction shape the window of simultaneity of audiovisual outcomes.

    PubMed

    Desantis, Andrea; Haggard, Patrick

    2016-08-01

    To form a coherent representation of the objects around us, the brain must group the different sensory features composing these objects. Here, we investigated whether actions contribute in this grouping process. In particular, we assessed whether action-outcome learning and prediction contribute to audiovisual temporal binding. Participants were presented with two audiovisual pairs: one pair was triggered by a left action, and the other by a right action. In a later test phase, the audio and visual components of these pairs were presented at different onset times. Participants judged whether they were simultaneous or not. To assess the role of action-outcome prediction on audiovisual simultaneity, each action triggered either the same audiovisual pair as in the learning phase ('predicted' pair), or the pair that had previously been associated with the other action ('unpredicted' pair). We found the time window within which auditory and visual events appeared simultaneous increased for predicted compared to unpredicted pairs. However, no change in audiovisual simultaneity was observed when audiovisual pairs followed visual cues, rather than voluntary actions. This suggests that only action-outcome learning promotes temporal grouping of audio and visual effects. In a second experiment we observed that changes in audiovisual simultaneity do not only depend on our ability to predict what outcomes our actions generate, but also on learning the delay between the action and the multisensory outcome. When participants learned that the delay between action and audiovisual pair was variable, the window of audiovisual simultaneity for predicted pairs increased, relative to a fixed action-outcome pair delay. This suggests that participants learn action-based predictions of audiovisual outcome, and adapt their temporal perception of outcome events based on such predictions. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  4. Consecutive learning of opposing unimanual motor tasks using the right arm followed by the left arm causes intermanual interference

    PubMed Central

    Thürer, Benjamin; Stein, Thorsten

    2017-01-01

    Intermanual transfer (motor memory generalization across arms) and motor memory interference (impairment of retest performance in consecutive motor learning) are well-investigated motor learning phenomena. However, the interplay of these phenomena remains elusive, i.e., whether intermanual interference occurs when two unimanual tasks are consecutively learned using different arms. Here, we examine intermanual interference when subjects consecutively adapt their right and left arm movements to novel dynamics. We considered two force field tasks A and B which were of the same structure but mirrored orientation (B = -A). The first test group (ABA-group) consecutively learned task A using their right arm and task B using their left arm before being retested for task A with their right arm. Another test group (AAA-group) learned only task A in the same right-left-right arm schedule. Control subjects learned task A using their right arm without intermediate left arm learning. All groups were able to adapt their right arm movements to force field A and both test groups showed significant intermanual transfer of this initial learning to the contralateral left arm of 21.9% (ABA-group) and 27.6% (AAA-group). Consecutively, both test groups adapted their left arm movements to force field B (ABA-group) or force field A (AAA-group). For the ABA-group, left arm learning caused significant intermanual interference of the initially learned right arm task (68.3% performance decrease). The performance decrease of the AAA-group (10.2%) did not differ from controls (15.5%). These findings suggest that motor control and learning of right and left arm movements involve partly similar neural networks or underlie a vital interhemispheric connectivity. Moreover, our results suggest a preferred internal task representation in extrinsic Cartesian-based coordinates rather than in intrinsic joint-based coordinates because interference was absent when learning was performed in extrinsically equivalent fashion (AAA-group) but interference occurred when learning was performed in intrinsically equivalent fashion (ABA-group). PMID:28459833

  5. Consecutive learning of opposing unimanual motor tasks using the right arm followed by the left arm causes intermanual interference.

    PubMed

    Stockinger, Christian; Thürer, Benjamin; Stein, Thorsten

    2017-01-01

    Intermanual transfer (motor memory generalization across arms) and motor memory interference (impairment of retest performance in consecutive motor learning) are well-investigated motor learning phenomena. However, the interplay of these phenomena remains elusive, i.e., whether intermanual interference occurs when two unimanual tasks are consecutively learned using different arms. Here, we examine intermanual interference when subjects consecutively adapt their right and left arm movements to novel dynamics. We considered two force field tasks A and B which were of the same structure but mirrored orientation (B = -A). The first test group (ABA-group) consecutively learned task A using their right arm and task B using their left arm before being retested for task A with their right arm. Another test group (AAA-group) learned only task A in the same right-left-right arm schedule. Control subjects learned task A using their right arm without intermediate left arm learning. All groups were able to adapt their right arm movements to force field A and both test groups showed significant intermanual transfer of this initial learning to the contralateral left arm of 21.9% (ABA-group) and 27.6% (AAA-group). Consecutively, both test groups adapted their left arm movements to force field B (ABA-group) or force field A (AAA-group). For the ABA-group, left arm learning caused significant intermanual interference of the initially learned right arm task (68.3% performance decrease). The performance decrease of the AAA-group (10.2%) did not differ from controls (15.5%). These findings suggest that motor control and learning of right and left arm movements involve partly similar neural networks or underlie a vital interhemispheric connectivity. Moreover, our results suggest a preferred internal task representation in extrinsic Cartesian-based coordinates rather than in intrinsic joint-based coordinates because interference was absent when learning was performed in extrinsically equivalent fashion (AAA-group) but interference occurred when learning was performed in intrinsically equivalent fashion (ABA-group).

  6. Cloud field classification based on textural features

    NASA Technical Reports Server (NTRS)

    Sengupta, Sailes Kumar

    1989-01-01

    An essential component in global climate research is accurate cloud cover and type determination. Of the two approaches to texture-based classification (statistical and textural), only the former is effective in the classification of natural scenes such as land, ocean, and atmosphere. In the statistical approach that was adopted, parameters characterizing the stochastic properties of the spatial distribution of grey levels in an image are estimated and then used as features for cloud classification. Two types of textural measures were used. One is based on the distribution of the grey level difference vector (GLDV), and the other on a set of textural features derived from the MaxMin cooccurrence matrix (MMCM). The GLDV method looks at the difference D of grey levels at pixels separated by a horizontal distance d and computes several statistics based on this distribution. These are then used as features in subsequent classification. The MaxMin tectural features on the other hand are based on the MMCM, a matrix whose (I,J)th entry give the relative frequency of occurrences of the grey level pair (I,J) that are consecutive and thresholded local extremes separated by a given pixel distance d. Textural measures are then computed based on this matrix in much the same manner as is done in texture computation using the grey level cooccurrence matrix. The database consists of 37 cloud field scenes from LANDSAT imagery using a near IR visible channel. The classification algorithm used is the well known Stepwise Discriminant Analysis. The overall accuracy was estimated by the percentage or correct classifications in each case. It turns out that both types of classifiers, at their best combination of features, and at any given spatial resolution give approximately the same classification accuracy. A neural network based classifier with a feed forward architecture and a back propagation training algorithm is used to increase the classification accuracy, using these two classes of features. Preliminary results based on the GLDV textural features alone look promising.

  7. Age-related Associative Memory Deficits in Value-based Remembering: The Contribution of Agenda-based Regulation and Strategy Use

    PubMed Central

    Ariel, Robert; Price, Jodi; Hertzog, Christopher

    2015-01-01

    Value-based remembering in free recall tasks may be spared from the typical age-related cognitive decline observed for episodic memory. However, it is unclear whether value-based remembering for associative information is also spared from age-related cognitive decline. The current experiments evaluated the contribution of agenda-based based regulation and strategy use during study to age differences and similarities in value-based remembering of associative information. Participants studied word pairs (Experiments 1-2) or single words (Experiment 2) slated with different point values by moving a mouse controlled cursor to different spatial locations to reveal either items for study or the point value associated with remembering each item. Some participants also provided strategy reports for each item. Younger and older adults allocated greater time to studying high than low valued information, reported using normatively effective encoding strategies to learn high-valued pairs, and avoided study of low-valued pairs. As a consequence, both age groups selectively remembered more high than low-valued items. Despite nearly identical regulatory behavior, an associative memory deficit for older adults was present for high valued pairs. Age differences in value-based remembering did not occur when the materials were word lists. Fluid intelligence also moderated the effectiveness of older adults’ strategy use for high valued pairs (Experiment 2). These results suggest that age differences in associative value-based remembering may be due to some older adults’ gleaning less benefit from using normatively effective encoding strategies rather than age differences in metacognitive self-regulation per se. PMID:26523692

  8. Using a respiratory navigator significantly reduces variability when quantifying left ventricular torsion with cardiovascular magnetic resonance.

    PubMed

    Hamlet, Sean M; Haggerty, Christopher M; Suever, Jonathan D; Wehner, Gregory J; Andres, Kristin N; Powell, David K; Charnigo, Richard J; Fornwalt, Brandon K

    2017-03-01

    Left ventricular (LV) torsion is an important indicator of cardiac function that is limited by high inter-test variability (50% of the mean value). We hypothesized that this high inter-test variability is partly due to inconsistent breath-hold positions during serial image acquisitions, which could be significantly improved by using a respiratory navigator for cardiovascular magnetic resonance (CMR) based quantification of LV torsion. We assessed respiratory-related variability in measured LV torsion with two distinct experimental protocols. First, 17 volunteers were recruited for CMR with cine displacement encoding with stimulated echoes (DENSE) in which a respiratory navigator was used to measure and then enforce variability in end-expiratory position between all LV basal and apical acquisitions. From these data, we quantified the inter-test variability of torsion in the absence and presence of enforced end-expiratory position variability, which established an upper bound for the expected torsion variability. For the second experiment (in 20 new, healthy volunteers), 10 pairs of cine DENSE basal and apical images were each acquired from consecutive breath-holds and consecutive navigator-gated scans (with a single acceptance position). Inter-test variability of torsion was compared between the breath-hold and navigator-gated scans to quantify the variability due to natural breath-hold variation. To demonstrate the importance of these variability reductions, we quantified the reduction in sample size required to detect a clinically meaningful change in LV torsion with the use of a respiratory navigator. The mean torsion was 3.4 ± 0.2°/cm. From the first experiment, enforced variability in end-expiratory position translated to considerable variability in measured torsion (0.56 ± 0.34°/cm), whereas inter-test variability with consistent end-expiratory position was 57% lower (0.24 ± 0.16°/cm, p < 0.001). From the second experiment, natural respiratory variability from consecutive breath-holds translated to a variability in torsion of 0.24 ± 0.10°/cm, which was significantly higher than the variability from navigator-gated scans (0.18 ± 0.06°/cm, p = 0.02). By using a respiratory navigator with DENSE, theoretical sample sizes were reduced from 66 to 16 and 26 to 15 as calculated from the two experiments. A substantial portion (22-57%) of the inter-test variability of LV torsion can be reduced by using a respiratory navigator to ensure a consistent breath-hold position between image acquisitions.

  9. Why the tautomerization of the G·C Watson-Crick base pair via the DPT does not cause point mutations during DNA replication? QM and QTAIM comprehensive analysis.

    PubMed

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    The ground-state tautomerization of the G·C Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4), corresponding to a hydrophobic interface of protein-nucleic acid interactions, using DFT and MP2 levels of quantum-mechanical (QM) theory and quantum theory "Atoms in molecules" (QTAIM). Based on the sweeps of the electron-topological, geometric, polar, and energetic parameters, which describe the course of the G·C ↔ G*·C* tautomerization (mutagenic tautomers of the G and C bases are marked with an asterisk) through the DPT along the intrinsic reaction coordinate (IRC), it was proved that it is, strictly speaking, a concerted asynchronous process both at the DFT and MP2 levels of theory, in which protons move with a small time gap in vacuum, while this time delay noticeably increases in the continuum with ϵ = 4. It was demonstrated using the conductor-like polarizable continuum model (CPCM) that the continuum with ϵ = 4 does not qualitatively affect the course of the tautomerization reaction. The DPT in the G·C Watson-Crick base pair occurs without any intermediates both in vacuum and in the continuum with ϵ = 4 at the DFT/MP2 levels of theory. The nine key points along the IRC of the G·C base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These key points have been used to define the reactant, transition state, and product regions of the DPT reaction in the G·C base pair. Analysis of the energetic characteristics of the H-bonds allows us to arrive at a definite conclusion that the middle N1H⋯N3/N3H⋯N1 and the lower N2H⋯O2/N2H⋯O2 parallel H-bonds in the G·C/G*·C* base pairs, respectively, are anticooperative, that is, the strengthening of the middle H-bond is accompanied by the weakening of the lower H-bond. At that point, the upper N4H⋯O6 and O6H⋯N4 H-bonds in the G·C and G*·C* base pairs, respectively, remain constant at the changes of the middle and the lower H-bonds at the beginning and at the ending of the G·C ↔ G*·C* tautomerization. Aiming to answer the question posed in the title of the article, we established that the G*·C* Löwdin's base pair satisfies all the requirements necessary to cause point mutations in DNA except its lifetime, which is much less than the period of time required for the replication machinery to forcibly dissociate a base pair into the monomers (several ns) during DNA replication. So, from the physicochemical point of view, the G*·C* Löwdin's base pair cannot be considered as a source of point mutations arising during DNA replication.

  10. Error-correcting pairs for a public-key cryptosystem

    NASA Astrophysics Data System (ADS)

    Pellikaan, Ruud; Márquez-Corbella, Irene

    2017-06-01

    Code-based Cryptography (CBC) is a powerful and promising alternative for quantum resistant cryptography. Indeed, together with lattice-based cryptography, multivariate cryptography and hash-based cryptography are the principal available techniques for post-quantum cryptography. CBC was first introduced by McEliece where he designed one of the most efficient Public-Key encryption schemes with exceptionally strong security guarantees and other desirable properties that still resist to attacks based on Quantum Fourier Transform and Amplitude Amplification. The original proposal, which remains unbroken, was based on binary Goppa codes. Later, several families of codes have been proposed in order to reduce the key size. Some of these alternatives have already been broken. One of the main requirements of a code-based cryptosystem is having high performance t-bounded decoding algorithms which is achieved in the case the code has a t-error-correcting pair (ECP). Indeed, those McEliece schemes that use GRS codes, BCH, Goppa and algebraic geometry codes are in fact using an error-correcting pair as a secret key. That is, the security of these Public-Key Cryptosystems is not only based on the inherent intractability of bounded distance decoding but also on the assumption that it is difficult to retrieve efficiently an error-correcting pair. In this paper, the class of codes with a t-ECP is proposed for the McEliece cryptosystem. Moreover, we study the hardness of distinguishing arbitrary codes from those having a t-error correcting pair.

  11. Exploring the Limits of DNA Size: Naphtho-homologated DNA Bases and Pairs

    PubMed Central

    Lee, Alex H. F.; Kool, Eric T.

    2008-01-01

    A new design for DNA bases and base pairs is described in which the pyrimidine bases are widened by naphtho-homologation. Two naphtho-homologated deoxyribosides, dyyT (1) and dyyC (2) were synthesized and could be incorporated into oligonucleotides as suitably protected phosphoramidite derivatives. The deoxyribosides were found to be fluorescent, with emission maxima at 446 and 433 nm, respectively. Studies with single substitutions of 1 and 2 in the natural DNA context revealed exceptionally strong base stacking propensity for both. Sequences containing multiple substitutions of 1 and 2 paired opposite adenine and guanine were subsequently mixed and studied by several analytical methods. Data from UV mixing experiments, FRET measurements, fluorescence quenching experiments, and hybridizations on beads suggest that complementary “doublewide DNA” (yyDNA) strands may self-assemble into helical complexes with 1:1 stoichiometry. Data from thermal denaturation plots and CD spectra were less conclusive. Control experiments in one sequence context gave evidence that yyDNA helices, if formed, are preferentially antiparallel and are sequence selective. Hypothesized base pairing schemes are analogous to Watson-Crick pairing, but with glycosidic C1′-C1′ distances widened by over 45%, to ca. 15.2 Å. The possible self-assembly of the double-wide DNA helix establishes a new limit for the size of information-encoding, DNA-like molecules, and the fluorescence of yyDNA bases suggests uses as reporters in monomeric and oligomeric forms. PMID:16834396

  12. Demonstration of spectral correlation control in a source of polarization-entangled photon pairs at telecom wavelength.

    PubMed

    Lutz, Thomas; Kolenderski, Piotr; Jennewein, Thomas

    2014-03-15

    Spectrally correlated photon pairs can be used to improve the performance of long-range fiber-based quantum communication protocols. We present a source based on spontaneous parametric downconversion, which allows one to control spectral correlations within the entangled photon pair without spectral filtering by changing the pump-pulse duration or the characteristics of the coupled spatial modes. The spectral correlations and polarization entanglement are characterized. We find that the generated photon pairs can feature both positive spectral correlations, decorrelation, or negative correlations at the same time as polarization entanglement with a high fidelity of 0.97 (no background subtraction) with the expected Bell state.

  13. The crystal structure of an oligo(U):pre-mRNA duplex from a trypanosome RNA editing substrate

    PubMed Central

    Mooers, Blaine H.M.; Singh, Amritanshu

    2011-01-01

    Guide RNAs bind antiparallel to their target pre-mRNAs to form editing substrates in reaction cycles that insert or delete uridylates (Us) in most mitochondrial transcripts of trypanosomes. The 5′ end of each guide RNA has an anchor sequence that binds to the pre-mRNA by base-pair complementarity. The template sequence in the middle of the guide RNA directs the editing reactions. The 3′ ends of most guide RNAs have ∼15 contiguous Us that bind to the purine-rich unedited pre-mRNA upstream of the editing site. The resulting U-helix is rich in G·U wobble base pairs. To gain insights into the structure of the U-helix, we crystallized 8 bp of the U-helix in one editing substrate for the A6 mRNA of Trypanosoma brucei. The fragment provides three samples of the 5′-AGA-3′/5′-UUU-3′ base-pair triple. The fusion of two identical U-helices head-to-head promoted crystallization. We obtained X-ray diffraction data with a resolution limit of 1.37 Å. The U-helix had low and high twist angles before and after each G·U wobble base pair; this variation was partly due to shearing of the wobble base pairs as revealed in comparisons with a crystal structure of a 16-nt RNA with all Watson–Crick base pairs. Both crystal structures had wider major grooves at the junction between the poly(U) and polypurine tracts. This junction mimics the junction between the template helix and the U-helix in RNA-editing substrates and may be a site of major groove invasion by RNA editing proteins. PMID:21878548

  14. Superordinate Level Processing Has Priority Over Basic-Level Processing in Scene Gist Recognition

    PubMed Central

    Sun, Qi; Zheng, Yang; Sun, Mingxia; Zheng, Yuanjie

    2016-01-01

    By combining a perceptual discrimination task and a visuospatial working memory task, the present study examined the effects of visuospatial working memory load on the hierarchical processing of scene gist. In the perceptual discrimination task, two scene images from the same (manmade–manmade pairing or natural–natural pairing) or different superordinate level categories (manmade–natural pairing) were presented simultaneously, and participants were asked to judge whether these two images belonged to the same basic-level category (e.g., street–street pairing) or not (e.g., street–highway pairing). In the concurrent working memory task, spatial load (position-based load in Experiment 1) and object load (figure-based load in Experiment 2) were manipulated. The results were as follows: (a) spatial load and object load have stronger effects on discrimination of same basic-level scene pairing than same superordinate level scene pairing; (b) spatial load has a larger impact on the discrimination of scene pairings at early stages than at later stages; on the contrary, object information has a larger influence on at later stages than at early stages. It followed that superordinate level processing has priority over basic-level processing in scene gist recognition and spatial information contributes to the earlier and object information to the later stages in scene gist recognition. PMID:28382195

  15. Hot carrier-enhanced interlayer electron-hole pair multiplication in 2D semiconductor heterostructure photocells

    NASA Astrophysics Data System (ADS)

    Barati, Fatemeh; Grossnickle, Max; Su, Shanshan; Lake, Roger K.; Aji, Vivek; Gabor, Nathaniel M.

    2017-12-01

    Strong electronic interactions can result in novel particle-antiparticle (electron-hole, e-h) pair generation effects, which may be exploited to enhance the photoresponse of nanoscale optoelectronic devices. Highly efficient e-h pair multiplication has been demonstrated in several important nanoscale systems, including nanocrystal quantum dots, carbon nanotubes and graphene. The small Fermi velocity and nonlocal nature of the effective dielectric screening in ultrathin layers of transition-metal dichalcogenides (TMDs) indicates that e-h interactions are very strong, so high-efficiency generation of e-h pairs from hot electrons is expected. However, such e-h pair multiplication has not been observed in 2D TMD devices. Here, we report the highly efficient multiplication of interlayer e-h pairs in 2D semiconductor heterostructure photocells. Electronic transport measurements of the interlayer I-VSD characteristics indicate that layer-indirect e-h pairs are generated by hot-electron impact excitation at temperatures near T = 300 K. By exploiting this highly efficient interlayer e-h pair multiplication process, we demonstrate near-infrared optoelectronic devices that exhibit 350% enhancement of the optoelectronic responsivity at microwatt power levels. Our findings, which demonstrate efficient carrier multiplication in TMD-based optoelectronic devices, make 2D semiconductor heterostructures viable for a new class of ultra-efficient photodetectors based on layer-indirect e-h excitations.

  16. Using a CBL Unit, a Temperature Sensor, and a Graphing Calculator to Model the Kinetics of Consecutive First-Order Reactions as Safe In-Class Demonstrations

    ERIC Educational Resources Information Center

    Moore-Russo, Deborah A.; Cortes-Figueroa, Jose E.; Schuman, Michael J.

    2006-01-01

    The use of Calculator-Based Laboratory (CBL) technology, the graphing calculator, and the cooling and heating of water to model the behavior of consecutive first-order reactions is presented, where B is the reactant, I is the intermediate, and P is the product for an in-class demonstration. The activity demonstrates the spontaneous and consecutive…

  17. Utilizing Molecular Dynamics ' Multipotent Methodologies to Measure Microscopic Motions of DNA Molecules: A Magniloquent Manuscript On DNA's Means and Mannerisms

    NASA Astrophysics Data System (ADS)

    Kingsland, Addie

    DNA is an amazing molecule which is the basic template for all genetics. It is the primary molecule for storing biological information, and has many applications in nanotechnology. Double-stranded DNA may contain mismatched base pairs beyond the Watson-Crick pairs guanine-cytosine and adenine-thymine. To date, no one has found a physical property of base pair mismatches which describes the behavior of naturally occurring mismatch repair enzymes. Many materials properties of DNA are also unknown, for instance, when pulling DNA in different configurations, different energy differences are observed with no obvious reason why. DNA mismatches also affect their local environment, for instance changing the quantum yield of nearby azobenzene moieties. We utilize molecular dynamics computer simulations to study the structure and dynamics for both matched and mismatched base pairs, within both biological and materials contexts, and in both equilibrium and biased dynamics. We show that mismatched pairs shift further in the plane normal to the DNA strand and are more likely to exhibit non-canonical structures, including the e-motif. Base pair mismatches alter their local environment, affecting the trans- to cis- photoisomerization quantum yield of azobenzene, as well as increasing the likelihood of observing the e-motif. We also show that by using simulated data, we can give new insights on theoretical models to calculate the energetics of pulling DNA strands apart. These results, all relatively inexpensive on modern computer hardware, can help guide the design of DNA-based nanotechnologies, as well as give new insights into the functioning of mismatch repair systems in cancer prevention.

  18. Stability of the guinea pigs personality - cognition - linkage over time.

    PubMed

    Brust, Vera; Guenther, Anja

    2017-01-01

    In human psychological research, personality traits as well as cognitive traits are usually validated for both, their stability over time and contexts. While stability over time gives an estimate on how genetically fixated a trait can be, correlations across traits have the power to reveal linkages or trade - offs. In animals, these validations have widely been done for personality but not for cognitive traits. We tested guinea pigs in four consecutive discrimination tasks using four unique pairs of objects with two objects of the same form but different size in each pair. The same animals were tested twice each for three personality traits, i.e. boldness, aggression and sociopositive behaviour. The animals did not learn to "always choose the larger item" in the cognitive task but learned to discriminate the two objects of each stimulus pair anew, so that we did test for learning speed in four slightly different task setups. Performance over the four tasks was significantly repeatable as well as all tested personality traits. A stable linkage over time was found between sociopositive behaviour and learning performance, probably indicating an ecological relevance for a correlation between these two traits. Still, not all traits seem to be connected amongst each other, as in our case boldness and aggression are both not linked to individual learning performance. Future studies will hopefully further investigate the repeatability of various cognitive traits in several species and thus lead to a better understanding of the interdependence of personality and cognition. This will help to unravel which suites of traits facilitate individual life histories and hence improve our understanding of the emergence and maintenance of individual differences. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Sickness-induced changes in physiology do not affect fecundity or same-sex behavior.

    PubMed

    Sylvia, Kristyn E; Báez Ramos, Patricia; Demas, Gregory E

    2018-02-01

    Previous work in our lab has shown that early-life infection affects female reproductive physiology and function (i.e., smaller ovaries, abnormal estrous cycles) and alters investigation and aggression towards male conspecifics in a reproductive context. Although many studies have investigated the effects of postnatal immune challenge on physiological and behavioral development, fewer studies have examined whether these changes have ultimate effects on reproduction. In the current study, we paired Siberian hamsters (Phodopus sungorus) and simulated a bacterial infection in early life by administering lipopolysaccharide (LPS) to male and female pups on pnd3 and pnd5. In adulthood, hamsters were paired with novel individuals of the same sex, and we scored an array of social behaviors (e.g., investigation, aggression). We then paired animals with individuals of the opposite sex for 5 consecutive nights, providing them with the opportunity to mate. We found that females exhibited impaired reproductive physiology and function in adulthood (i.e., smaller ovaries and abnormal estrous cycles), similar to our previous work. However, both LPS-treated males and females exhibited similar same-sex social behavior when compared with saline-treated controls, they successfully mated, and there were no significant changes in fecundity. These data suggest that the physiological changes in response to neonatal immune challenge may not have long-term effects on reproductive success in a controlled environment. Collectively, the results of this study are particularly important when investigating the relationships between physiology and behavior within an ultimate context. Animals exposed to early-life stress may in fact be capable of compensating for changes in physiology in order to survive and reproduce in some contexts. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Development of a Highly Sensitive Nested-PCR Procedure Using a Single Closed Tube for Detection of Erwinia amylovora in Asymptomatic Plant Material

    PubMed Central

    Llop, Pablo; Bonaterra, Anna; Peñalver, Javier; López, María M.

    2000-01-01

    A novel method, which involves a nested PCR in a single closed tube, was developed for the sensitive detection of Erwinia amylovora in plant material. The external and internal primer pairs used had different annealing temperatures and directed the amplification of a specific DNA fragment from plasmid pEA29. The procedure involved two consecutive PCRs, the first of which was performed at a higher annealing temperature that allowed amplification only by the external primer pair. Using pure cultures of E. amylovora, the sensitivity of the nested PCR in one tube was similar to that of a standard nested PCR in two tubes. The specificity and sensitivity were greater than those of standard PCR procedures that used a single primer pair. The presence of inhibitors in plant material, very common in E. amylovora hosts, is overcome with this system in combination with a simple DNA extraction protocol because it eliminates many of the inhibitory compounds. In addition, it needs a very small sample volume (1 μl of DNA extracted). With 83 samples of naturally infected material, this method achieved better results than any other PCR technique: standard PCR detected 55% of positive samples, two-tube nested PCR detected 71% of positive samples, and nested PCR in a single closed tube detected 78% of positive samples. When analyzing asymptomatic plant material, the number of positive samples detected by the developed nested PCR was also the highest, compared with the PCR protocols indicated previously (17, 20, and 25% of 251 samples analyzed, respectively). This method is proposed for the detection of endophytic and epiphytic populations of E. amylovora in epidemiological studies and for routine use in quarantine surveys, due to its high sensitivity, specificity, speed, and simplicity. PMID:10788384

  1. The AO Pediatric Comprehensive Classification of Long Bone Fractures (PCCF)

    PubMed Central

    Audigé, Laurent; Slongo, Theddy; Lutz, Nicolas; Blumenthal, Andrea; Joeris, Alexander

    2017-01-01

    Background and purpose The AO Pediatric Comprehensive Classification of Long Bone Fractures (PCCF) describes the localization and morphology of fractures, and considers severity in 2 categories: (1) simple, and (2) multifragmentary. We evaluated simple and multifragmentary fractures in a large consecutive cohort of children diagnosed with long bone fractures in Switzerland. Patients and methods Children and adolescents treated for fractures between 2009 and 2011 at 2 tertiary pediatric surgery hospitals were retrospectively included. Fractures were classified according to the AO PCCF. Severity classes were described according to fracture location, patient age and sex, BMI, and cause of trauma. Results Of all trauma events, 3% (84 of 2,730) were diagnosed with a multifragmentary fracture. This proportion was age-related: 2% of multifragmentary fractures occurred in school­children and 7% occurred in adolescents. In patients diagnosed with a single fracture only, the highest percentage of multifragmentation occurred in the femur (12%, 15 of 123). In fractured paired radius/ulna bones, multifragmentation occurred in 2% (11 of 687); in fractured paired tibia/fibula bones, it occurred in 21% (24 of 115), particularly in schoolchildren (5 of 18) and adolescents (16 of 40). In a multivariable regression model, age, cause of injury, and bone were found to be relevant prognostic factors of multifragmentation (odds ratio (OR) > 2). Interpretation Overall, multifragmentation in long bone fractures in children was rare and was mostly observed in adolescents. The femur was mostly affected in single fractures and the lower leg was mostly affected in paired-bone fractures. The clinical relevance of multifragmentation regarding growth and long-term functional recovery remains to be determined. PMID:27882814

  2. A new method for computing the reliability of consecutive k-out-of-n:F systems

    NASA Astrophysics Data System (ADS)

    Gökdere, Gökhan; Gürcan, Mehmet; Kılıç, Muhammet Burak

    2016-01-01

    In many physical systems, reliability evaluation, such as ones encountered in telecommunications, the design of integrated circuits, microwave relay stations, oil pipeline systems, vacuum systems in accelerators, computer ring networks, and spacecraft relay stations, have had applied consecutive k-out-of-n system models. These systems are characterized as logical connections among the components of the systems placed in lines or circles. In literature, a great deal of attention has been paid to the study of the reliability evaluation of consecutive k-out-of-n systems. In this paper, we propose a new method to compute the reliability of consecutive k-out-of-n:F systems, with n linearly and circularly arranged components. The proposed method provides a simple way for determining the system failure probability. Also, we write R-Project codes based on our proposed method to compute the reliability of the linear and circular systems which have a great number of components.

  3. Four base recognition by triplex-forming oligonucleotides at physiological pH

    PubMed Central

    Rusling, David A.; Powers, Vicki E. C.; Ranasinghe, Rohan T.; Wang, Yang; Osborne, Sadie D.; Brown, Tom; Fox, Keith R.

    2005-01-01

    We have achieved recognition of all 4 bp by triple helix formation at physiological pH, using triplex-forming oligonucleotides that contain four different synthetic nucleotides. BAU [2′-aminoethoxy-5-(3-aminoprop-1-ynyl)uridine] recognizes AT base pairs with high affinity, MeP (3-methyl-2 aminopyridine) binds to GC at higher pHs than cytosine, while APP (6-(3-aminopropyl)-7-methyl-3H-pyrrolo[2,3-d]pyrimidin-2(7H)-one) and S [N-(4-(3-acetamidophenyl)thiazol-2-yl-acetamide)] bind to CG and TA base pairs, respectively. Fluorescence melting and DNase I footprinting demonstrate successful triplex formation at a 19mer oligopurine sequence that contains two CG and two TA interruptions. The complexes are pH dependent, but are still stable at pH 7.0. BAU, MeP and APP retain considerable selectivity, and single base pair changes opposite these residues cause a large reduction in affinity. In contrast, S is less selective and tolerates CG pairs as well as TA. PMID:15911633

  4. Structure of p73 DNA-binding domain tetramer modulates p73 transactivation

    PubMed Central

    Ethayathulla, Abdul S.; Tse, Pui-Wah; Monti, Paola; Nguyen, Sonha; Inga, Alberto; Fronza, Gilberto; Viadiu, Hector

    2012-01-01

    The transcription factor p73 triggers developmental pathways and overlaps stress-induced p53 transcriptional pathways. How p53-family response elements determine and regulate transcriptional specificity remains an unsolved problem. In this work, we have determined the first crystal structures of p73 DNA-binding domain tetramer bound to response elements with spacers of different length. The structure and function of the adaptable tetramer are determined by the distance between two half-sites. The structures with zero and one base-pair spacers show compact p73 DNA-binding domain tetramers with large tetramerization interfaces; a two base-pair spacer results in DNA unwinding and a smaller tetramerization interface, whereas a four base-pair spacer hinders tetramerization. Functionally, p73 is more sensitive to spacer length than p53, with one base-pair spacer reducing 90% of transactivation activity and longer spacers reducing transactivation to basal levels. Our results establish the quaternary structure of the p73 DNA-binding domain required as a scaffold to promote transactivation. PMID:22474346

  5. Covariant Evolutionary Event Analysis for Base Interaction Prediction Using a Relational Database Management System for RNA.

    PubMed

    Xu, Weijia; Ozer, Stuart; Gutell, Robin R

    2009-01-01

    With an increasingly large amount of sequences properly aligned, comparative sequence analysis can accurately identify not only common structures formed by standard base pairing but also new types of structural elements and constraints. However, traditional methods are too computationally expensive to perform well on large scale alignment and less effective with the sequences from diversified phylogenetic classifications. We propose a new approach that utilizes coevolutional rates among pairs of nucleotide positions using phylogenetic and evolutionary relationships of the organisms of aligned sequences. With a novel data schema to manage relevant information within a relational database, our method, implemented with a Microsoft SQL Server 2005, showed 90% sensitivity in identifying base pair interactions among 16S ribosomal RNA sequences from Bacteria, at a scale 40 times bigger and 50% better sensitivity than a previous study. The results also indicated covariation signals for a few sets of cross-strand base stacking pairs in secondary structure helices, and other subtle constraints in the RNA structure.

  6. Covariant Evolutionary Event Analysis for Base Interaction Prediction Using a Relational Database Management System for RNA

    PubMed Central

    Xu, Weijia; Ozer, Stuart; Gutell, Robin R.

    2010-01-01

    With an increasingly large amount of sequences properly aligned, comparative sequence analysis can accurately identify not only common structures formed by standard base pairing but also new types of structural elements and constraints. However, traditional methods are too computationally expensive to perform well on large scale alignment and less effective with the sequences from diversified phylogenetic classifications. We propose a new approach that utilizes coevolutional rates among pairs of nucleotide positions using phylogenetic and evolutionary relationships of the organisms of aligned sequences. With a novel data schema to manage relevant information within a relational database, our method, implemented with a Microsoft SQL Server 2005, showed 90% sensitivity in identifying base pair interactions among 16S ribosomal RNA sequences from Bacteria, at a scale 40 times bigger and 50% better sensitivity than a previous study. The results also indicated covariation signals for a few sets of cross-strand base stacking pairs in secondary structure helices, and other subtle constraints in the RNA structure. PMID:20502534

  7. Multi-user distribution of polarization entangled photon pairs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Trapateau, J.; Orieux, A.; Diamanti, E.

    We experimentally demonstrate multi-user distribution of polarization entanglement using commercial telecom wavelength division demultiplexers. The entangled photon pairs are generated from a broadband source based on spontaneous parametric down conversion in a periodically poled lithium niobate crystal using a double path setup employing a Michelson interferometer and active phase stabilisation. We test and compare demultiplexers based on various technologies and analyze the effect of their characteristics, such as losses and polarization dependence, on the quality of the distributed entanglement for three channel pairs of each demultiplexer. In all cases, we obtain a Bell inequality violation, whose value depends on themore » demultiplexer features. This demonstrates that entanglement can be distributed to at least three user pairs of a network from a single source. Additionally, we verify for the best demultiplexer that the violation is maintained when the pairs are distributed over a total channel attenuation corresponding to 20 km of optical fiber. These techniques are therefore suitable for resource-efficient practical implementations of entanglement-based quantum key distribution and other quantum communication network applications.« less

  8. Contact ion pair formation between hard acids and soft bases in aqueous solutions observed with 2DIR spectroscopy.

    PubMed

    Sun, Zheng; Zhang, Wenkai; Ji, Minbiao; Hartsock, Robert; Gaffney, Kelly J

    2013-12-12

    The interaction of charged species in aqueous solution has important implications for chemical, biological, and environmental processes. We have used 2DIR spectroscopy to study the equilibrium dynamics of thiocyanate chemical exchange between free ion (NCS(-)) and contact ion pair configurations (MNCS(+)), where M(2+) = Mg(2+) or Ca(2+). Detailed studies of the influence of anion concentration and anion speciation show that the chemical exchange observed with the 2DIR measurements results from NCS(-) exchanging with other anion species in the first solvation shell surrounding Mg(2+) or Ca(2+). The presence of chemical exchange in the 2DIR spectra provides an indirect, but robust, determinant of contact ion pair formation. We observe preferential contact ion pair formation between soft Lewis base anions and hard Lewis acid cations. This observation cannot be easily reconciled with Pearson's acid-base concept or Collins' Law of Matching Water Affinities. The anions that form contact ion pairs also correspond to the ions with an affinity for water and protein surfaces, so similar physical and chemical properties may control these distinct phenomena.

  9. A Metacognitive Approach to Pair Programming: Influence on Metacognitive Awareness

    ERIC Educational Resources Information Center

    Breed, Betty; Mentz, Elsa; van der Westhuizen, Gert

    2014-01-01

    Introduction: The research focused on metacognition in a collaborative learning setting. Based on a comprehensive literature study the researchers designed a metacognitive teaching-learning strategy for pair programmers. Our purpose was to investigate the influence of this metacognitive teaching-learning strategy during pair programming in an…

  10. Multichordal charge exchange recombination spectroscopy on Doublet III (abstract)

    NASA Astrophysics Data System (ADS)

    Seraydarian, R. P.; Burrell, K. H.; Kahn, C.

    1985-05-01

    Single shot, multipoint ion temperature and plasma rotation profiles have been routinely obtained on the Doublet III tokamak for 32 consecutive time slices with 20-ms resolution. A six-chord tangentially viewing spectroscopic diagnostic has been built to look at radiation emitted by fully stripped low-Z impurity ions (He, C, O) that have undergone charge exchange recombination with hydrogen atoms from a 3-MW heating beam. The main components of the instrument are a single monochromator for wavelength dispersion, a single image intensifier tube for photon gain, and a pair of 1024-element linear photodiode arrays for detection. A special arrangement of fiber optics allows simultaneous data acquisition from all chords without the use of scanning mirrors or other moving parts. Ion temperature profiles taken under a variety of plasma conditions will be presented.

  11. Robust Mosaicking of Stereo Digital Elevation Models from the Ames Stereo Pipeline

    NASA Technical Reports Server (NTRS)

    Kim, Tae Min; Moratto, Zachary M.; Nefian, Ara Victor

    2010-01-01

    Robust estimation method is proposed to combine multiple observations and create consistent, accurate, dense Digital Elevation Models (DEMs) from lunar orbital imagery. The NASA Ames Intelligent Robotics Group (IRG) aims to produce higher-quality terrain reconstructions of the Moon from Apollo Metric Camera (AMC) data than is currently possible. In particular, IRG makes use of a stereo vision process, the Ames Stereo Pipeline (ASP), to automatically generate DEMs from consecutive AMC image pairs. However, the DEMs currently produced by the ASP often contain errors and inconsistencies due to image noise, shadows, etc. The proposed method addresses this problem by making use of multiple observations and by considering their goodness of fit to improve both the accuracy and robustness of the estimate. The stepwise regression method is applied to estimate the relaxed weight of each observation.

  12. Constructing Pairing-Friendly Elliptic Curves under Embedding Degree 1 for Securing Critical Infrastructures.

    PubMed

    Wang, Maocai; Dai, Guangming; Choo, Kim-Kwang Raymond; Jayaraman, Prem Prakash; Ranjan, Rajiv

    2016-01-01

    Information confidentiality is an essential requirement for cyber security in critical infrastructure. Identity-based cryptography, an increasingly popular branch of cryptography, is widely used to protect the information confidentiality in the critical infrastructure sector due to the ability to directly compute the user's public key based on the user's identity. However, computational requirements complicate the practical application of Identity-based cryptography. In order to improve the efficiency of identity-based cryptography, this paper presents an effective method to construct pairing-friendly elliptic curves with low hamming weight 4 under embedding degree 1. Based on the analysis of the Complex Multiplication(CM) method, the soundness of our method to calculate the characteristic of the finite field is proved. And then, three relative algorithms to construct pairing-friendly elliptic curve are put forward. 10 elliptic curves with low hamming weight 4 under 160 bits are presented to demonstrate the utility of our approach. Finally, the evaluation also indicates that it is more efficient to compute Tate pairing with our curves, than that of Bertoni et al.

  13. Genome Editing Tools in Plants

    PubMed Central

    Mohanta, Tapan Kumar; Bashir, Tufail; Hashem, Abeer; Bae, Hanhong

    2017-01-01

    Genome editing tools have the potential to change the genomic architecture of a genome at precise locations, with desired accuracy. These tools have been efficiently used for trait discovery and for the generation of plants with high crop yields and resistance to biotic and abiotic stresses. Due to complex genomic architecture, it is challenging to edit all of the genes/genomes using a particular genome editing tool. Therefore, to overcome this challenging task, several genome editing tools have been developed to facilitate efficient genome editing. Some of the major genome editing tools used to edit plant genomes are: Homologous recombination (HR), zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), pentatricopeptide repeat proteins (PPRs), the CRISPR/Cas9 system, RNA interference (RNAi), cisgenesis, and intragenesis. In addition, site-directed sequence editing and oligonucleotide-directed mutagenesis have the potential to edit the genome at the single-nucleotide level. Recently, adenine base editors (ABEs) have been developed to mutate A-T base pairs to G-C base pairs. ABEs use deoxyadeninedeaminase (TadA) with catalytically impaired Cas9 nickase to mutate A-T base pairs to G-C base pairs. PMID:29257124

  14. Constructing Pairing-Friendly Elliptic Curves under Embedding Degree 1 for Securing Critical Infrastructures

    PubMed Central

    Dai, Guangming

    2016-01-01

    Information confidentiality is an essential requirement for cyber security in critical infrastructure. Identity-based cryptography, an increasingly popular branch of cryptography, is widely used to protect the information confidentiality in the critical infrastructure sector due to the ability to directly compute the user’s public key based on the user’s identity. However, computational requirements complicate the practical application of Identity-based cryptography. In order to improve the efficiency of identity-based cryptography, this paper presents an effective method to construct pairing-friendly elliptic curves with low hamming weight 4 under embedding degree 1. Based on the analysis of the Complex Multiplication(CM) method, the soundness of our method to calculate the characteristic of the finite field is proved. And then, three relative algorithms to construct pairing-friendly elliptic curve are put forward. 10 elliptic curves with low hamming weight 4 under 160 bits are presented to demonstrate the utility of our approach. Finally, the evaluation also indicates that it is more efficient to compute Tate pairing with our curves, than that of Bertoni et al. PMID:27564373

  15. Micrometer-Scale Ballistic Transport of Electron Pairs in LaAlO_{3}/SrTiO_{3} Nanowires.

    PubMed

    Tomczyk, Michelle; Cheng, Guanglei; Lee, Hyungwoo; Lu, Shicheng; Annadi, Anil; Veazey, Joshua P; Huang, Mengchen; Irvin, Patrick; Ryu, Sangwoo; Eom, Chang-Beom; Levy, Jeremy

    2016-08-26

    High-mobility complex-oxide heterostructures and nanostructures offer new opportunities for extending the paradigm of quantum transport beyond the realm of traditional III-V or carbon-based materials. Recent quantum transport investigations with LaAlO_{3}/SrTiO_{3}-based quantum dots reveal the existence of a strongly correlated phase in which electrons form spin-singlet pairs without becoming superconducting. Here, we report evidence for the micrometer-scale ballistic transport of electron pairs in quasi-1D LaAlO_{3}/SrTiO_{3} nanowire cavities. In the paired phase, Fabry-Perot-like quantum interference is observed, in sync with conductance oscillations observed in the superconducting regime (at a zero magnetic field). Above a critical magnetic field B_{p}, the electron pairs unbind and the conductance oscillations shift with the magnetic field. These experimental observations extend the regime of ballistic electronic transport to strongly correlated phases.

  16. Pentopyranosyl Oligonucleotide Systems. Part 11: Systems with Shortened Backbones: D)-beta-Ribopyranosyl-(4 yields 3 )- and (L)-alpha - Lyxopyranosyl-(4 yields 3 )-oligonucleotides

    NASA Technical Reports Server (NTRS)

    Wippo, Harald; Reck, Folkert; Kudick, Rene; Ramaseshan, Mahesh; Ceulemans, Griet; Bolli, Martin; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2001-01-01

    The (L)-a-lyxopyranosyl-(4'yields 3')-oligonucleotide system-a member of a pentopyranosyl oligonucleotide family containing a shortened backbone-is capable of cooperative base-pairing and of cross-pairing with DNA and RNA. In contrast, corresponding (D)-beta-ribopyransoyl-(4' yields 3')-oligonucleotides do not show base-pairing under similar conditions. We conclude that oligonucleotide systems can violate the six-bonds-per-backbone-unit rule by having five bonds instead, if their vicinally bound phosphodiester bridges can assume an antiperiplanar conformation. An additional structural feature that seems relevant to the cross-pairing capability of the (L)-a-lyxopyranosyl-(4' yields 3')-oligonucleotide system is its (small) backbone/basepair axes inclination. An inclination which is similar to that in B-DNA seems to be a prerequisite for an oligonucleotide system s capability to cross-pair with DNA.

  17. Recognition tunneling measurement of the conductance of DNA bases embedded in self-assembled monolayers.

    PubMed

    Huang, Shuo; Chang, Shuai; He, Jin; Zhang, Peiming; Liang, Feng; Tuchband, Michael; Li, Shengqing; Lindsay, Stuart

    2010-12-09

    The DNA bases interact strongly with gold electrodes, complicating efforts to measure the tunneling conductance through hydrogen-bonded Watson Crick base pairs. When bases are embedded in a self-assembled alkane-thiol monolayer to minimize these interactions, new features appear in the tunneling data. These new features track the predictions of density-functional calculations quite well, suggesting that they reflect tunnel conductance through hydrogen-bonded base pairs.

  18. Recognition tunneling measurement of the conductance of DNA bases embedded in self-assembled monolayers

    PubMed Central

    Huang, Shuo; Chang, Shuai; He, Jin; Zhang, Peiming; Liang, Feng; Tuchband, Michael; Li, Shengqing; Lindsay, Stuart

    2010-01-01

    The DNA bases interact strongly with gold electrodes, complicating efforts to measure the tunneling conductance through hydrogen-bonded Watson Crick base pairs. When bases are embedded in a self-assembled alkane-thiol monolayer to minimize these interactions, new features appear in the tunneling data. These new features track the predictions of density-functional calculations quite well, suggesting that they reflect tunnel conductance through hydrogen-bonded base pairs. PMID:21197382

  19. Interobserver Agreement in Clinical Grading of Vitreous Haze Using Alternative Grading Scales

    PubMed Central

    Hornbeak, Dana M; Payal, Abhishek; Pistilli, Maxwell; Biswas, Jyotirmay; Ganesh, Sudha K; Gupta, Vishali; Rathinam, Sivakumar R; Davis, Janet L; Kempen, John H

    2014-01-01

    Purpose To evaluate the reliability of clinical grading of vitreous haze using a new 9-step ordinal scale vs. the existing 6-step ordinal scale. Design Evaluation of Diagnostic Test (interobserver agreement study). Participants 119 consecutive patients (204 uveitic eyes) presenting for uveitis subspecialty care on the study day at one of three large uveitis centers. Methods Five pairs of uveitis specialists clinically graded vitreous haze in the same eyes, one after the other using the same equipment, using the 6- and 9-step scales. Main Outcome Measures Agreement in vitreous haze grade between each pair of specialists was evaluated by the κ statistic (exact agreement and agreement within one or two grades). Results The scales correlated well (Spearman’s ρ=0.84). Exact agreement was modest using both the 6-step and 9-step scales: average κ=0.46 (range 0.28–0.81) and κ=0.40 (range 0.15–0.63), respectively. Within-1-grade agreement was slightly more favorable for the scale with fewer steps, but values were excellent for both scales: κ=0.75 (range 0.66–0.96) and κ=0.62 (range 0.38–0.87), respectively. Within-2-grade agreement for the 9-step scale also was excellent [κ=0.85 (range 0.79–0.92)]. Two-fold more cases were potentially clinical trial eligible based on the 9- than the 6-step scale (p<0.001). Conclusions Both scales are sufficiently reproducible using clinical grading for clinical and research use with the appropriate threshold (a ≥2 and ≥3 step differences for the 6-step and 9-step scales respectively). The results suggest that more eyes are likely to meet eligibility criteria for trials using the 9-step scale. The 9-step scale appears to have higher reproducibility with Reading Center grading than clinical grading, suggesting Reading Center grading may be preferable for clinical trials. PMID:24697913

  20. Estimation of Disability Weights in the General Population of South Korea Using a Paired Comparison

    PubMed Central

    Ock, Minsu; Ahn, Jeonghoon; Yoon, Seok-Jun; Jo, Min-Woo

    2016-01-01

    We estimated the disability weights in the South Korean population by using a paired comparison-only model wherein ‘full health’ and ‘being dead’ were included as anchor points, without resorting to a cardinal method, such as person trade-off. The study was conducted via 2 types of survey: a household survey involving computer-assisted face-to-face interviews and a web-based survey (similar to that of the GBD 2010 disability weight study). With regard to the valuation methods, paired comparison, visual analogue scale (VAS), and standard gamble (SG) were used in the household survey, whereas paired comparison and population health equivalence (PHE) were used in the web-based survey. Accordingly, we described a total of 258 health states, with ‘full health’ and ‘being dead’ designated as anchor points. In the analysis, 4 models were considered: a paired comparison-only model; hybrid model between paired comparison and PHE; VAS model; and SG model. A total of 2,728 and 3,188 individuals participated in the household and web-based survey, respectively. The Pearson correlation coefficients of the disability weights of health states between the GBD 2010 study and the current models were 0.802 for Model 2, 0.796 for Model 1, 0.681 for Model 3, and 0.574 for Model 4 (all P-values<0.001). The discrimination of values according to health state severity was most suitable in Model 1. Based on these results, the paired comparison-only model was selected as the best model for estimating disability weights in South Korea, and for maintaining simplicity in the analysis. Thus, disability weights can be more easily estimated by using paired comparison alone, with ‘full health’ and ‘being dead’ as one of the health states. As noted in our study, we believe that additional evidence regarding the universality of disability weight can be observed by using a simplified methodology of estimating disability weights. PMID:27606626

  1. Easy design of colorimetric logic gates based on nonnatural base pairing and controlled assembly of gold nanoparticles.

    PubMed

    Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding

    2013-07-16

    Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.

  2. Synthesis and Properties of Size-expanded DNAs: Toward Designed, Functional Genetic Systems

    PubMed Central

    Krueger, Andrew T.; Lu, Haige; Lee, Alex H. F.; Kool, Eric T.

    2008-01-01

    We describe the design, synthesis, and properties of DNA-like molecules in which the base pairs are expanded by benzo homologation. The resulting size-expanded genetic helices are called xDNA (“expanded DNA”) and yDNA (“wide DNA”). The large component bases are fluorescent, and they display high stacking affinity. When singly substituted into natural DNA, they are destabilizing because the benzo-expanded base pair size is too large for the natural helix. However, when all base pairs are expanded, xDNA and yDNA form highly stable, sequence-selective double helices. The size-expanded DNAs are candidates for components of new, functioning genetic systems. In addition, the fluorescence of expanded DNA bases makes them potentially useful in probing nucleic acids. PMID:17309194

  3. The Effects of Reinforcer Pairing and Fading on Preschoolers' Snack Selections

    PubMed Central

    Solberg, Katherine M; Hanley, Gregory P; Layer, Stacy A; Ingvarsson, Einar T

    2007-01-01

    The effects of reinforcement pairing and fading on preschoolers' snack selections were evaluated in a multiple baseline design. Baseline preferences for snack options were assessed via repeated paired-item preference assessments. Edible, social, and activity-based reinforcers were then exclusively paired with a less preferred snack option. Once the snack paired with reinforcement was selected most frequently, the three types of reinforcement were systematically faded. Frequent selections of the previously less preferred snack option were produced with paired reinforcement, but were disrupted for all children as the paired reinforcement was reduced to low levels. These data showed that paired reinforcement was initially effective in increasing preference for the originally less preferred snack options, but more permanent changes in the value of the snack options were not achieved. Conditions for producing persistent changes in children's snack choices are discussed. PMID:18189095

  4. A process-based approach to characterizing the effect of acute alprazolam challenge on visual paired associate learning and memory in healthy older adults.

    PubMed

    Pietrzak, Robert H; Scott, James Cobb; Harel, Brian T; Lim, Yen Ying; Snyder, Peter J; Maruff, Paul

    2012-11-01

    Alprazolam is a benzodiazepine that, when administered acutely, results in impairments in several aspects of cognition, including attention, learning, and memory. However, the profile (i.e., component processes) that underlie alprazolam-related decrements in visual paired associate learning has not been fully explored. In this double-blind, placebo-controlled, randomized cross-over study of healthy older adults, we used a novel, "process-based" computerized measure of visual paired associate learning to examine the effect of a single, acute 1-mg dose of alprazolam on component processes of visual paired associate learning and memory. Acute alprazolam challenge was associated with a large magnitude reduction in visual paired associate learning and memory performance (d = 1.05). Process-based analyses revealed significant increases in distractor, exploratory, between-search, and within-search error types. Analyses of percentages of each error type suggested that, relative to placebo, alprazolam challenge resulted in a decrease in the percentage of exploratory errors and an increase in the percentage of distractor errors, both of which reflect memory processes. Results of this study suggest that acute alprazolam challenge decreases visual paired associate learning and memory performance by reducing the strength of the association between pattern and location, which may reflect a general breakdown in memory consolidation, with less evidence of reductions in executive processes (e.g., working memory) that facilitate visual paired associate learning and memory. Copyright © 2012 John Wiley & Sons, Ltd.

  5. Optimizing photon-pair generation electronically using a p-i-n diode incorporated in a silicon microring resonator

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Savanier, Marc, E-mail: msavanier@eng.ucsd.edu; Kumar, Ranjeet; Mookherjea, Shayan, E-mail: smookherjea@eng.ucsd.edu

    Silicon photonic microchips may be useful for compact, inexpensive, room-temperature optically pumped photon-pair sources, which unlike conventional photon-pair generators based on crystals or optical fibers, can be manufactured using CMOS-compatible processes on silicon wafers. It has been shown that photon pairs can be created in simple structures such as microring resonators at a rate of a few hundred kilohertz using less than a milliwatt of optical pump power, based on the process of spontaneous four-wave mixing. To create a practical photon-pair source, however, also requires some way of monitoring the device and aligning the pump wavelength when the temperature varies,more » since silicon resonators are highly sensitive to temperature. In fact, monitoring photodiodes are standard components in classical laser diodes, but the incorporation of germanium or InGaAs photodiodes would raise the cost and fabrication complexity. Here, we present a simple and effective all-electronic technique for finding the optimum operating point for the microring used to generate photon pairs, based on measuring the reverse-biased current in a silicon p-i-n junction diode fabricated across the waveguide that constitutes the silicon microring. We show that by monitoring the current, and using it to tune the pump laser wavelength, the photon-pair generation properties of the microring can be preserved over a temperature range of more than 30 °C.« less

  6. Complexes of oligo(poly)nucleotides with structural anomalies

    NASA Astrophysics Data System (ADS)

    Dolinnaya, N. G.; Gryaznova, O. I.

    1989-08-01

    The results of studies on the structure and properties of DNA-RNA hybrids and complexes of oligo(poly)nucleotides containing non-canonical base pairs or unpaired bases both within and at the ends of the double helix are surveyed. The methods used in the study of such systems are briefly characterised: X-ray diffraction analysis, NMR and UV spectroscopy, circular dichroism, scanning microcalorimetry, etc. A comparative analysis of the influence of the non-canonical pairs on the structure and the energetic and kinetic parameters of the formation and dissociation of the oligonucleotide complexes has been carried out. The question of the stability of the non-canonical pairs as a function of their nature and position in the double helix is considered. The mechanisms of the formation of the hydrogen bonds between the bases of non-complementary pairs are discussed. The bibliography includes 171 references.

  7. Apparatus And Method For Reducing Drag Of A Bluff Body In Ground Effect Using Counter-Rotating Vortex Pairs

    DOEpatents

    Ortega, Jason M.; Sabari, Kambiz

    2005-12-27

    An aerodynamic base drag reduction apparatus and method for bluff bodies, such as tractor-trailer trucks, utilizing a pair of lift surfaces extending to lift surface tips and located alongside the bluff body such as on opposing left and right side surfaces. In a flowstream substantially parallel to the longitudinal centerline of the bluff body, the pair of lift surfaces generate a pair of counter-rotating trailing vortices which confluence together in the wake of the bluff body in a direction orthogonal to the flowstream. The confluence draws or otherwise turns the flowstream, such as the flowstream passing over a top surface of the bluff body, in and around behind a trailing end of the bluff body to raise the pressure on a base surface at the trailing end and thereby reduce the aerodynamic base drag.

  8. Apparatus And Method For Reducing Drag Of A Bluff Body In Ground Effect Using Counter-Rotating Vortex Pairs

    DOEpatents

    Ortega, Jason M.; Salari, Kambiz

    2005-08-09

    An aerodynamic base drag reduction apparatus and method for bluff bodies, such as tractor-trailer trucks, utilizing a pair of lift surfaces extending to lift surface tips and located alongside the bluff body such as on opposing left and right side surfaces. In a flowstream substantially parallel to the longitudinal centerline of the bluff body, the pair of lift surfaces generate a pair of counter-rotating trailing vortices which confluence together in the wake of the bluff body in a direction orthogonal to the flowstream. The confluence draws or otherwise turns the flowstream, such as the flowstream passing over a top surface of the bluff body, in and around behind a trailing end of the bluff body to raise the pressure on a base surface at the trailing end and thereby reduce the aerodynamic base drag.

  9. Compositions of orthogonal lysyl-tRNA and aminoacyl-tRNA synthetase pairs and uses thereof

    DOEpatents

    Anderson, J Christopher [San Francisco, CA; Wu, Ning [Brookline, MA; Santoro, Stephen [Cambridge, MA; Schultz, Peter G [La Jolla, CA

    2009-12-29

    Compositions and methods of producing components of protein biosynthetic machinery that include orthogonal lysyl-tRNAs, orthogonal lysyl-aminoacyl-tRNA synthetases, and orthogonal pairs of lysyl-tRNAs/synthetases, which incorporate homoglutamines into proteins are provided in response to a four base codon. Methods for identifying these orthogonal pairs are also provided along with methods of producing proteins with homoglutamines using these orthogonal pairs.

  10. Compositions of orthogonal lysyl-tRNA and aminoacyl-tRNA synthetase pairs and uses thereof

    DOEpatents

    Anderson, J Christopher [San Francisco, CA; Wu, Ning [Brookline, MA; Santoro, Stephen [Cambridge, MA; Schultz, Peter G [La Jolla, CA

    2011-10-04

    Compositions and methods of producing components of protein biosynthetic machinery that include orthogonal lysyl-tRNAs, orthogonal lysyl-aminoacyl-tRNA synthetases, and orthogonal pairs of lysyl-tRNAs/synthetases, which incorporate homoglutamines into proteins are provided in response to a four base codon. Methods for identifying these orthogonal pairs are also provided along with methods of producing proteins with homoglutamines using these orthogonal pairs.

  11. Compositions of orthogonal lysyl-tRNA and aminoacyl-tRNA synthetase pairs and uses thereof

    DOEpatents

    Anderson, J Christopher [San Francisco, CA; Wu, Ning [Brookline, MA; Santoro, Stephen [Cambridge, MA; Schultz, Peter G [La Jolla, CA

    2009-08-18

    Compositions and methods of producing components of protein biosynthetic machinery that include orthogonal lysyl-tRNAs, orthogonal lysyl-aminoacyl-tRNA synthetases, and orthogonal pairs of lysyl-tRNAs/synthetases, which incorporate homoglutamines into proteins are provided in response to a four base codon. Methods for identifying these orthogonal pairs are also provided along with methods of producing proteins with homoglutamines using these orthogonal pairs.

  12. All gene-sized DNA molecules in four species of hypotrichs have the same terminal sequence and an unusual 3' terminus.

    PubMed Central

    Klobutcher, L A; Swanton, M T; Donini, P; Prescott, D M

    1981-01-01

    In hypotrichous ciliates, all of the macronuclear DNA is in the form of low molecular weight molecules with an average size of approximately 2200 base pairs. Total macronuclear DNA from four hypotrichs has been shown to have inverted terminal repeats by direct sequence analysis. In Oxytricha nova, Oxytricha sp., and Stylonychia pustulata, this terminal sequence may be written as 5'-C4A4C4A4C4 ... 3'-G4T4G4T4G4T4G4T4G4 ... In Euplotes aediculatus, the sequences is similar but differs in the lengths of the duplex region (28 base pairs) and of the putative 3' extension (14 base pairs). Also in Euplotes, a second common sequence of 5 base pairs (A-A-C-T-T-T-T-G-A-A) occurs internal to the terminal repeat and a 17-base-pair heterogeneous region: 5'-C4A4C4A4C4A4C4(X)17T-T-G-A-A ... 3'-G2T4G4T4G4T4G4T4G4T4G4(X)17A-A-C-T-T ... The length of the terminal repeat sequence for O. nova was confirmed in cloned macronuclear DNA molecules. Images PMID:6265931

  13. Stacked-unstacked equilibrium at the nick site of DNA.

    PubMed

    Protozanova, Ekaterina; Yakovchuk, Peter; Frank-Kamenetskii, Maxim D

    2004-09-17

    Stability of duplex DNA with respect to separation of complementary strands is crucial for DNA executing its major functions in the cell and it also plays a central role in major biotechnology applications of DNA: DNA sequencing, polymerase chain reaction, and DNA microarrays. Two types of interaction are well known to contribute to DNA stability: stacking between adjacent base-pairs and pairing between complementary bases. However, their contribution into the duplex stability is yet to be determined. Now we fill this fundamental gap in our knowledge of the DNA double helix. We have prepared a series of 32, 300 bp-long DNA fragments with solitary nicks in the same position differing only in base-pairs flanking the nick. Electrophoretic mobility of these fragments in the gel has been studied. Assuming the equilibrium between stacked and unstacked conformations at the nick site, all 32 stacking free energy parameters have been obtained. Only ten of them are essential and they govern the stacking interactions between adjacent base-pairs in intact DNA double helix. A full set of DNA stacking parameters has been determined for the first time. From these data and from a well-known dependence of DNA melting temperature on G.C content, the contribution of base-pairing into duplex stability has been estimated. The obtained energy parameters of the DNA double helix are of paramount importance for understanding sequence-dependent DNA flexibility and for numerous biotechnology applications.

  14. Roles of the active site residues and metal cofactors in noncanonical base-pairing during catalysis by human DNA polymerase iota.

    PubMed

    Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey

    2014-10-01

    Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Quantum chemical investigations of AlN-doped C60 for use as a nano-biosensor in detection of mispairing between DNA bases.

    PubMed

    Siddiqui, Shamoon Ahmad; Bouarissa, Nadir; Rasheed, Tabish; Al-Hajry, A

    2014-12-01

    Quantum chemical calculations were carried out to study the electronic structure and stability of adenine-thymine and the rare tautomer of adenine-thymine base pairs along with their Cu 2+ complexes and their interactions with AlN-modified fullerene (C58AlN) using Density Functional Theory (B3LYP method). Since, these two forms of base pairs and their Cu 2+ complexes have almost similar electronic structures, their chemical differentiation is an extremely difficult task. In this investigation, we have observed that AlN-doped C 60 could be used as a potentially viable nanoscale sensor to detect these two base pairs as well as their Cu2+ complexes.

  16. Associations between number of consecutive night shifts and impairment of neurobehavioral performance during a subsequent simulated night shift.

    PubMed

    Magee, Michelle; Sletten, Tracey L; Ferguson, Sally A; Grunstein, Ronald R; Anderson, Clare; Kennaway, David J; Lockley, Steven W; Rajaratnam, Shantha Mw

    2016-05-01

    This study aimed to investigate sleep and circadian phase in the relationships between neurobehavioral performance and the number of consecutive shifts worked. Thirty-four shift workers [20 men, mean age 31.8 (SD 10.9) years] worked 2-7 consecutive night shifts immediately prior to a laboratory-based, simulated night shift. For 7 days prior, participants worked their usual shift sequence, and sleep was assessed with logs and actigraphy. Participants completed a 10-minute auditory psychomotor vigilance task (PVT) at the start (~21:00 hours) and end (~07:00 hours) of the simulated night shift. Mean reaction times (RT), number of lapses and RT distribution was compared between those who worked 2-3 consecutive night shifts versus those who worked 4-7 shifts. Following 4-7 shifts, night shift workers had significantly longer mean RT at the start and end of shift, compared to those who worked 2-3 shifts. The slowest and fastest 10% RT were significantly slower at the start, but not end, of shift among participants who worked 4-7 nights. Those working 4-7 nights also demonstrated a broader RT distribution at the start and end of shift and had significantly slower RT based on cumulative distribution analysis (5 (th), 25 (th), 50 (th), 75 (th)percentiles at the start of shift; 75th percentile at the end of shift). No group differences in sleep parameters were found for 7 days and 24 hours prior to the simulated night shift. A greater number of consecutive night shifts has a negative impact on neurobehavioral performance, likely due to cognitive slowing.

  17. On the binding of indeno[1,2-c]isoquinolines in the DNA-topoisomerase I cleavage complex.

    PubMed

    Xiao, Xiangshu; Antony, Smitha; Pommier, Yves; Cushman, Mark

    2005-05-05

    An ab initio quantum mechanics calculation is reported which predicts the orientation of indenoisoquinoline 4 in the ternary cleavage complex formed from DNA and topoisomerase I (top1). The results of this calculation are consistent with the hypothetical structures previously proposed for the indenoisoquinoline-DNA-top1 ternary complexes based on molecular modeling, the crystal structure of a recently reported ternary complex, and the biological results obtained with a pair of diaminoalkyl-substituted indenoisoquinoline enantiomers. The results of these studies indicate that the pi-pi stacking interactions between the indenoisoquinolines and the neighboring DNA base pairs play a major role in determining binding orientation. The calculation of the electrostatic potential surface maps of the indenoisoquinolines and the adjacent DNA base pairs shows electrostatic complementarity in the observed binding orientation, leading to the conclusion that electrostatic attraction between the intercalators and the base pairs in the cleavage complex plays a major stabilizing role. On the other hand, the calculation of LUMO and HOMO energies of indenoisoquinoline 13b and neighboring DNA base pairs in conjunction with NBO analysis indicates that charge transfer complex formation plays a relatively minor role in stabilizing the ternary complexes derived from indenoisoquinolines, DNA, and top1. The results of these studies are important in understanding the existing structure-activity relationships for the indenoisoquinolines as top1 inhibitors and as anticancer agents, and they will be important in the future design of indenoisoquinoline-based top1 inhibitors.

  18. Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

    PubMed

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-09-18

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Platinum(II)-Oligonucleotide Coordination Based Aptasensor for Simple and Selective Detection of Platinum Compounds.

    PubMed

    Cai, Sheng; Tian, Xueke; Sun, Lianli; Hu, Haihong; Zheng, Shirui; Jiang, Huidi; Yu, Lushan; Zeng, Su

    2015-10-20

    Wide use of platinum-based chemotherapeutic regimens for the treatment for carcinoma calls for a simple and selective detection of platinum compound in biological samples. On the basis of the platinum(II)-base pair coordination, a novel type of aptameric platform for platinum detection has been introduced. This chemiluminescence (CL) aptasensor consists of a designed streptavidin (SA) aptamer sequence in which several base pairs were replaced by G-G mismatches. Only in the presence of platinum, coordination occurs between the platinum and G-G base pairs as opposed to the hydrogen-bonded G-C base pairs, which leads to SA aptamer sequence activation, resulting in their binding to SA coated magnetic beads. These Pt-DNA coordination events were monitored by a simple and direct luminol-peroxide CL reaction through horseradish peroxidase (HRP) catalysis with a strong chemiluminescence emission. The validated ranges of quantification were 0.12-240 μM with a limit of detection of 60 nM and selectivity over other metal ions. This assay was also successfully used in urine sample determination. It will be a promising candidate for the detection of platinum in biomedical and environmental samples.

  20. Theoretical Probing of Weak Anion-Cation Interactions in Certain Pyridinium-Based Ionic Liquid Ion Pairs and the Application of Molecular Electrostatic Potential in Their Ionic Crystal Density Determination: A Comparative Study Using Density Functional Approach.

    PubMed

    Joseph, Aswathy; Thomas, Vibin Ipe; Żyła, Gaweł; Padmanabhan, A S; Mathew, Suresh

    2018-01-11

    A comprehensive study on the structure, nature of interaction, and properties of six ionic pairs of 1-butylpyridinium and 1-butyl-4-methylpyridinium cations in combination with tetrafluoroborate (BF 4 - ), chloride (Cl - ), and bromide (Br - ) anions have been carried out using density functional theory (DFT). The anion-cation interaction energy (ΔE int ), thermochemistry values, theoretical band gap, molecular orbital energy order, DFT-based chemical activity descriptors [chemical potential (μ), chemical hardness (η), and electrophilicity index (ω)], and distribution of density of states (DOS) of these ion pairs were investigated. The ascendancy of the -CH 3 substituent at the fourth position of the 1-butylpyridinium cation ring on the values of ΔE int , theoretical band gap and chemical activity descriptors was evaluated. The ΔE int values were negative for all six ion pairs and were highest for Cl - containing ion pairs. The theoretical band gap value after -CH 3 substitution increased from 3.78 to 3.96 eV (for Cl - ) and from 2.74 to 2.88 eV (for Br - ) and decreased from 4.9 to 4.89 eV (for BF 4 - ). Ion pairs of BF 4 - were more susceptible to charge transfer processes as inferred from their significantly high η values and comparatively small difference in ω value after -CH 3 substitution. The change in η and μ values due to the -CH 3 substituent is negligibly small in all cases except for the ion pairs of Cl - . Critical-point (CP) analyses were carried out to investigate the AIM topological parameters at the interionic bond critical points (BCPs). The RDG isosurface analysis indicated that the anion-cation interaction was dominated by strong H cat ···X ani and C cat ···X ani interactions in ion pairs of Cl - and Br - whereas a weak van der Waal's effect dominated in ion pairs of BF 4 - . The molecular electrostatic potential (MESP)-based parameter ΔΔV min measuring the anion-cation interaction strength showed a good linear correlation with ΔE int for all 1-butylpyridinium ion pairs (R 2 = 0.9918). The ionic crystal density values calculated by using DFT-based MESP showed only slight variations from experimentally reported values.

  1. Experimental extraction of an entangled photon pair from two identically decohered pairs.

    PubMed

    Yamamoto, Takashi; Koashi, Masato; Ozdemir, Sahin Kaya; Imoto, Nobuyuki

    2003-01-23

    Entanglement is considered to be one of the most important resources in quantum information processing schemes, including teleportation, dense coding and entanglement-based quantum key distribution. Because entanglement cannot be generated by classical communication between distant parties, distribution of entangled particles between them is necessary. During the distribution process, entanglement between the particles is degraded by the decoherence and dissipation processes that result from unavoidable coupling with the environment. Entanglement distillation and concentration schemes are therefore needed to extract pairs with a higher degree of entanglement from these less-entangled pairs; this is accomplished using local operations and classical communication. Here we report an experimental demonstration of extraction of a polarization-entangled photon pair from two decohered photon pairs. Two polarization-entangled photon pairs are generated by spontaneous parametric down-conversion and then distributed through a channel that induces identical phase fluctuations to both pairs; this ensures that no entanglement is available as long as each pair is manipulated individually. Then, through collective local operations and classical communication we extract from the two decohered pairs a photon pair that is observed to be polarization-entangled.

  2. Comparison of single and consecutive dual frequency induction surface hardening of gear wheels

    NASA Astrophysics Data System (ADS)

    Barglik, J.; Ducki, K.; Kukla, D.; Mizera, J.; Mrówka-Nowotnik, G.; Sieniawski, J.; Smalcerz, A.

    2018-05-01

    Mathematical modelling of single and consecutive dual - frequency induction surface hardening systems are presented and compared. The both models are solved by the 3D FEM-based professional software supported by a number of own numerical procedures. The methodology is illustrated with some examples of surface induction hardening of a gear wheel made of steel 41Cr4. The computations are in a good accordance with experiments provided on the laboratory stand.

  3. Milestone Report:3.2.2.26 Appliances, HVAC & Water Heating R&D-Select Sorption Technology

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ally, Moonis Raza

    The purpose of this report is to select a sorption technology based on recent work completed on characterizing working pairs for both absorption and adsorption technologies based on Global Warming Potential (GWP) of less than 100 (relative to carbon dioxide, 100-year atmospheric life span) and zero Ozone Depletion Potential (ODP). From a total of eighty-three potential working pairs (absorption technology), there were only two candidate working pairs for the absorption technology, and 8 potential working pairs for adsorption technology. After screening these ten potential candidates on the basis of sizes of the desorber, absorber/adsorber, evaporator, condenser, and rectifier (where applicable),more » the ORNL-Georgia Tech study concluded that best working pairs are NH3-H2O for the most compact system in terms of heat transfer equipment surface area, and NH3-LiNO3 and MeOH-[mmin][DMP] where efficiency is most important. Based on a single-stage absorption and adsorption modeling using the Engineering Equation Solver (EES), the performance of both sorption systems was evaluated from known heat transfer correlations, and thermos-physical properties. Based on these results, the technology chosen is absorption technology. The selected technology is absorption for the reasons cited in Section 4.« less

  4. The role of the AT pairs in the acid denaturation of DNA.

    PubMed Central

    Hermann, P; Fredericq, E

    1977-01-01

    It has been determined previously that the protonation of the GC pairs induces a DNA conformation change which leads to a "metastable" structure. The role of the AT pairs, however, is no well known because the protonation does not modify their spectral properties. By means of an indirect method based on the binding of proflavine, it has been determined that the AT pairs are protonated before the acid-induced denaturation and that they seem to be unable to assume a conformation change when protonated. These results would indicate that the protonated AT pairs may be responsible for the induction of the acid denaturation and not the GC pairs as it was thought previously. PMID:20604

  5. Using NMR and molecular dynamics to link structure and dynamics effects of the universal base 8-aza, 7-deaza, N8 linked adenosine analog

    PubMed Central

    Spring-Connell, Alexander M.; Evich, Marina G.; Debelak, Harald; Seela, Frank; Germann, Markus W.

    2016-01-01

    A truly universal nucleobase enables a host of novel applications such as simplified templates for PCR primers, randomized sequencing and DNA based devices. A universal base must pair indiscriminately to each of the canonical bases with little or preferably no destabilization of the overall duplex. In reality, many candidates either destabilize the duplex or do not base pair indiscriminatingly. The novel base 8-aza-7-deazaadenine (pyrazolo[3,4-d]pyrimidin- 4-amine) N8-(2′deoxyribonucleoside), a deoxyadenosine analog (UB), pairs with each of the natural DNA bases with little sequence preference. We have utilized NMR complemented with molecular dynamic calculations to characterize the structure and dynamics of a UB incorporated into a DNA duplex. The UB participates in base stacking with little to no perturbation of the local structure yet forms an unusual base pair that samples multiple conformations. These local dynamics result in the complete disappearance of a single UB proton resonance under native conditions. Accommodation of the UB is additionally stabilized via heightened backbone conformational sampling. NMR combined with various computational techniques has allowed for a comprehensive characterization of both structural and dynamic effects of the UB in a DNA duplex and underlines that the UB as a strong candidate for universal base applications. PMID:27566150

  6. Intermolecular interactions of trifluorohalomethanes with Lewis bases in the gas phase: An ab initio study

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Yi-Siang; Yin, Chih-Chien; Chao, Sheng D., E-mail: sdchao@spring.iam.ntu.edu.tw

    2014-10-07

    We perform an ab initio computational study of molecular complexes with the general formula CF{sub 3}X—B that involve one trifluorohalomethane CF{sub 3}X (X = Cl or Br) and one of a series of Lewis bases B in the gas phase. The Lewis bases are so chosen that they provide a range of electron-donating abilities for comparison. Based on the characteristics of their electron pairs, we consider the Lewis bases with a single n-pair (NH{sub 3} and PH{sub 3}), two n-pairs (H{sub 2}O and H{sub 2}S), two n-pairs with an unsaturated bond (H{sub 2}CO and H{sub 2}CS), and a single π-pairmore » (C{sub 2}H{sub 4}) and two π-pairs (C{sub 2}H{sub 2}). The aim is to systematically investigate the influence of the electron pair characteristics and the central atom substitution effects on the geometries and energetics of the formed complexes. The counterpoise-corrected supermolecule MP2 and coupled-cluster single double with perturbative triple [CCSD(T)] levels of theory have been employed, together with a series of basis sets up to aug-cc-pVTZ. The angular and radial configurations, the binding energies, and the electrostatic potentials of the stable complexes have been compared and discussed as the Lewis base varies. For those complexes where halogen bonding plays a significant role, the calculated geometries and energetics are consistent with the σ-hole model. Upon formation of stable complexes, the C–X bond lengths shorten, while the C–X vibrational frequencies increase, thus rendering blueshifting halogen bonds. The central atom substitution usually enlarges the intermolecular bond distances while it reduces the net charge transfers, thus weakening the bond strengths. The analysis based on the σ-hole model is grossly reliable but requires suitable modifications incorporating the central atom substitution effects, in particular, when interaction components other than electrostatic contributions are involved.« less

  7. Sample size considerations for paired experimental design with incomplete observations of continuous outcomes.

    PubMed

    Zhu, Hong; Xu, Xiaohan; Ahn, Chul

    2017-01-01

    Paired experimental design is widely used in clinical and health behavioral studies, where each study unit contributes a pair of observations. Investigators often encounter incomplete observations of paired outcomes in the data collected. Some study units contribute complete pairs of observations, while the others contribute either pre- or post-intervention observations. Statistical inference for paired experimental design with incomplete observations of continuous outcomes has been extensively studied in literature. However, sample size method for such study design is sparsely available. We derive a closed-form sample size formula based on the generalized estimating equation approach by treating the incomplete observations as missing data in a linear model. The proposed method properly accounts for the impact of mixed structure of observed data: a combination of paired and unpaired outcomes. The sample size formula is flexible to accommodate different missing patterns, magnitude of missingness, and correlation parameter values. We demonstrate that under complete observations, the proposed generalized estimating equation sample size estimate is the same as that based on the paired t-test. In the presence of missing data, the proposed method would lead to a more accurate sample size estimate comparing with the crude adjustment. Simulation studies are conducted to evaluate the finite-sample performance of the generalized estimating equation sample size formula. A real application example is presented for illustration.

  8. A comparative review of methods for comparing means using partially paired data.

    PubMed

    Guo, Beibei; Yuan, Ying

    2017-06-01

    In medical experiments with the objective of testing the equality of two means, data are often partially paired by design or because of missing data. The partially paired data represent a combination of paired and unpaired observations. In this article, we review and compare nine methods for analyzing partially paired data, including the two-sample t-test, paired t-test, corrected z-test, weighted t-test, pooled t-test, optimal pooled t-test, multiple imputation method, mixed model approach, and the test based on a modified maximum likelihood estimate. We compare the performance of these methods through extensive simulation studies that cover a wide range of scenarios with different effect sizes, sample sizes, and correlations between the paired variables, as well as true underlying distributions. The simulation results suggest that when the sample size is moderate, the test based on the modified maximum likelihood estimator is generally superior to the other approaches when the data is normally distributed and the optimal pooled t-test performs the best when the data is not normally distributed, with well-controlled type I error rates and high statistical power; when the sample size is small, the optimal pooled t-test is to be recommended when both variables have missing data and the paired t-test is to be recommended when only one variable has missing data.

  9. Reference set for performance testing of pediatric vaccine safety signal detection methods and systems.

    PubMed

    Brauchli Pernus, Yolanda; Nan, Cassandra; Verstraeten, Thomas; Pedenko, Mariia; Osokogu, Osemeke U; Weibel, Daniel; Sturkenboom, Miriam; Bonhoeffer, Jan

    2016-12-12

    Safety signal detection in spontaneous reporting system databases and electronic healthcare records is key to detection of previously unknown adverse events following immunization. Various statistical methods for signal detection in these different datasources have been developed, however none are geared to the pediatric population and none specifically to vaccines. A reference set comprising pediatric vaccine-adverse event pairs is required for reliable performance testing of statistical methods within and across data sources. The study was conducted within the context of the Global Research in Paediatrics (GRiP) project, as part of the seventh framework programme (FP7) of the European Commission. Criteria for the selection of vaccines considered in the reference set were routine and global use in the pediatric population. Adverse events were primarily selected based on importance. Outcome based systematic literature searches were performed for all identified vaccine-adverse event pairs and complemented by expert committee reports, evidence based decision support systems (e.g. Micromedex), and summaries of product characteristics. Classification into positive (PC) and negative control (NC) pairs was performed by two independent reviewers according to a pre-defined algorithm and discussed for consensus in case of disagreement. We selected 13 vaccines and 14 adverse events to be included in the reference set. From a total of 182 vaccine-adverse event pairs, we classified 18 as PC, 113 as NC and 51 as unclassifiable. Most classifications (91) were based on literature review, 45 were based on expert committee reports, and for 46 vaccine-adverse event pairs, an underlying pathomechanism was not plausible classifying the association as NC. A reference set of vaccine-adverse event pairs was developed. We propose its use for comparing signal detection methods and systems in the pediatric population. Published by Elsevier Ltd.

  10. Recognition of T·G mismatched base pairs in DNA by stacked imidazole-containing polyamides: surface plasmon resonance and circular dichroism studies

    PubMed Central

    Lacy, Eilyn R.; Cox, Kari K.; Wilson, W. David; Lee, Moses

    2002-01-01

    An imidazole-containing polyamide trimer, f-ImImIm, where f is a formamido group, was recently found using NMR methods to recognize T·G mismatched base pairs. In order to characterize in detail the T·G recognition affinity and specificity of imidazole-containing polyamides, f-ImIm, f-ImImIm and f-PyImIm were synthesized. The kinetics and thermodynamics for the polyamides binding to Watson–Crick and mismatched (containing one or two T·G, A·G or G·G mismatched base pairs) hairpin oligonucleotides were determined by surface plasmon resonance and circular dichroism (CD) methods. f-ImImIm binds significantly more strongly to the T·G mismatch-containing oligonucleotides than to the sequences with other mismatched or with Watson–Crick base pairs. Compared with the Watson–Crick CCGG sequence, f-ImImIm associates more slowly with DNAs containing T·G mismatches in place of one or two C·G base pairs and, more importantly, the dissociation rate from the T·G oligonucleotides is very slow (small kd). These results clearly demonstrate the binding selectivity and enhanced affinity of side-by-side imidazole/imidazole pairings for T·G mismatches and show that the affinity and specificity increase arise from much lower kd values with the T·G mismatched duplexes. CD titration studies of f-ImImIm complexes with T·G mismatched sequences produce strong induced bands at ∼330 nm with clear isodichroic points, in support of a single minor groove complex. CD DNA bands suggest that the complexes remain in the B conformation. PMID:11937638

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ogle, James M.; Brodersen, Ditlev E.; Clemons, William M.

    Crystal structures of the 30S ribosomal subunit in complex with messenger RNA and cognate transfer RNA in the A site, both in the presence and absence of the antibiotic paromomycin, have been solved at between 3.1 and 3.3 angstroms resolution. Cognate transfer RNA (tRNA) binding induces global domain movements of the 30S subunit and changes in the conformation of the universally conserved and essential bases A1492, A1493, and G530 of 16S RNA. These bases interact intimately with the minor groove of the first two base pairs between the codon and anticodon, thus sensing Watson-Crick base-pairing geometry and discriminating against near-cognatemore » tRNA. The third, or 'wobble,' position of the codon is free to accommodate certain noncanonical base pairs. By partially inducing these structural changes, paromomycin facilitates binding of near-cognate tRNAs.« less

  12. Energy hyperspace for stacking interaction in AU/AU dinucleotide step: Dispersion-corrected density functional theory study.

    PubMed

    Mukherjee, Sanchita; Kailasam, Senthilkumar; Bansal, Manju; Bhattacharyya, Dhananjay

    2014-01-01

    Double helical structures of DNA and RNA are mostly determined by base pair stacking interactions, which give them the base sequence-directed features, such as small roll values for the purine-pyrimidine steps. Earlier attempts to characterize stacking interactions were mostly restricted to calculations on fiber diffraction geometries or optimized structure using ab initio calculations lacking variation in geometry to comment on rather unusual large roll values observed in AU/AU base pair step in crystal structures of RNA double helices. We have generated stacking energy hyperspace by modeling geometries with variations along the important degrees of freedom, roll, and slide, which were chosen via statistical analysis as maximally sequence dependent. Corresponding energy contours were constructed by several quantum chemical methods including dispersion corrections. This analysis established the most suitable methods for stacked base pair systems despite the limitation imparted by number of atom in a base pair step to employ very high level of theory. All the methods predict negative roll value and near-zero slide to be most favorable for the purine-pyrimidine steps, in agreement with Calladine's steric clash based rule. Successive base pairs in RNA are always linked by sugar-phosphate backbone with C3'-endo sugars and this demands C1'-C1' distance of about 5.4 Å along the chains. Consideration of an energy penalty term for deviation of C1'-C1' distance from the mean value, to the recent DFT-D functionals, specifically ωB97X-D appears to predict reliable energy contour for AU/AU step. Such distance-based penalty improves energy contours for the other purine-pyrimidine sequences also. © 2013 Wiley Periodicals, Inc. Biopolymers 101: 107-120, 2014. Copyright © 2013 Wiley Periodicals, Inc.

  13. Retention of nucleic acids in ion-pair reversed-phase high-performance liquid chromatography depends not only on base composition but also on base sequence.

    PubMed

    Qiao, Jun-Qin; Liang, Chao; Wei, Lan-Chun; Cao, Zhao-Ming; Lian, Hong-Zhen

    2016-12-01

    The study on nucleic acid retention in ion-pair reversed-phase high-performance liquid chromatography mainly focuses on size-dependence, however, other factors influencing retention behaviors have not been comprehensively clarified up to date. In this present work, the retention behaviors of oligonucleotides and double-stranded DNAs were investigated on silica-based C 18 stationary phase by ion-pair reversed-phase high-performance liquid chromatography. It is found that the retention of oligonucleotides was influenced by base composition and base sequence as well as size, and oligonucleotides prone to self-dimerization have weaker retention than those not prone to self-dimerization but with the same base composition. However, homo-oligonucleotides are suitable for the size-dependent separation as a special case of oligonucleotides. For double-stranded DNAs, the retention is also influenced by base composition and base sequence, as well as size. This may be attributed to the interaction of exposed bases in major or minor grooves with the hydrophobic alky chains of stationary phase. In addition, no specific influence of guanine and cytosine content was confirmed on retention of double-stranded DNAs. Notably, the space effect resulted from the stereostructure of nucleic acids also influences the retention behavior in ion-pair reversed-phase high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Measuring Three-Dimensional Thorax Motion Via Biplane Radiographic Imaging: Technique and Preliminary Results.

    PubMed

    Baumer, Timothy G; Giles, Joshua W; Drake, Anne; Zauel, Roger; Bey, Michael J

    2016-01-01

    Measures of scapulothoracic motion are dependent on accurate imaging of the scapula and thorax. Advanced radiographic techniques can provide accurate measures of scapular motion, but the limited 3D imaging volume of these techniques often precludes measurement of thorax motion. To overcome this, a thorax coordinate system was defined based on the position of rib pairs and then compared to a conventional sternum/spine-based thorax coordinate system. Alignment of the rib-based coordinate system was dependent on the rib pairs used, with the rib3:rib4 pairing aligned to within 4.4 ± 2.1 deg of the conventional thorax coordinate system.

  15. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    NASA Astrophysics Data System (ADS)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  16. Pair distribution function study and mechanical behavior of as-cast and structurally relaxed Zr-based bulk metallic glasses

    NASA Astrophysics Data System (ADS)

    Fan, Cang; Liaw, P. K.; Wilson, T. W.; Choo, H.; Gao, Y. F.; Liu, C. T.; Proffen, Th.; Richardson, J. W.

    2006-12-01

    Contrary to reported results on structural relaxation inducing brittleness in amorphous alloys, the authors found that structural relaxation actually caused an increase in the strength of Zr55Cu35Al10 bulk metallic glass (BMG) without changing the plasticity. Three dimensional models were rebuilt for the as-cast and structurally relaxed BMGs by reverse Monte Carlo (RMC) simulations based on the pair distribution function (PDF) measured by neutron scattering. Only a small portion of the atom pairs was found to change to more dense packing. The concept of free volume was defined based on the PDF and RMC studies, and the mechanism of mechanical behavior was discussed.

  17. ClaRNA: a classifier of contacts in RNA 3D structures based on a comparative analysis of various classification schemes

    PubMed Central

    Waleń, Tomasz; Chojnowski, Grzegorz; Gierski, Przemysław; Bujnicki, Janusz M.

    2014-01-01

    The understanding of folding and function of RNA molecules depends on the identification and classification of interactions between ribonucleotide residues. We developed a new method named ClaRNA for computational classification of contacts in RNA 3D structures. Unique features of the program are the ability to identify imperfect contacts and to process coarse-grained models. Each doublet of spatially close ribonucleotide residues in a query structure is compared to clusters of reference doublets obtained by analysis of a large number of experimentally determined RNA structures, and assigned a score that describes its similarity to one or more known types of contacts, including pairing, stacking, base–phosphate and base–ribose interactions. The accuracy of ClaRNA is 0.997 for canonical base pairs, 0.983 for non-canonical pairs and 0.961 for stacking interactions. The generalized squared correlation coefficient (GC2) for ClaRNA is 0.969 for canonical base pairs, 0.638 for non-canonical pairs and 0.824 for stacking interactions. The classifier can be easily extended to include new types of spatial relationships between pairs or larger assemblies of nucleotide residues. ClaRNA is freely available via a web server that includes an extensive set of tools for processing and visualizing structural information about RNA molecules. PMID:25159614

  18. Homologous Chromosome Pairing in Drosophila melanogaster Proceeds through Multiple Independent Initiations

    PubMed Central

    Fung, Jennifer C.; Marshall, Wallace F.; Dernburg, Abby; Agard, David A.; Sedat, John W.

    1998-01-01

    The dynamics by which homologous chromosomes pair is currently unknown. Here, we use fluorescence in situ hybridization in combination with three-dimensional optical microscopy to show that homologous pairing of the somatic chromosome arm 2L in Drosophila occurs by independent initiation of pairing at discrete loci rather than by a processive zippering of sites along the length of chromosome. By evaluating the pairing frequencies of 11 loci on chromosome arm 2L over several timepoints during Drosophila embryonic development, we show that all 11 loci are paired very early in Drosophila development, within 13 h after egg deposition. To elucidate whether such pairing occurs by directed or undirected motion, we analyzed the pairing kinetics of histone loci during nuclear cycle 14. By measuring changes of nuclear length and correlating these changes with progression of time during cycle 14, we were able to express the pairing frequency and distance between homologous loci as a function of time. Comparing the experimentally determined dynamics of pairing to simulations based on previously proposed models of pairing motion, we show that the observed pairing kinetics are most consistent with a constrained random walk model and not consistent with a directed motion model. Thus, we conclude that simple random contacts through diffusion could suffice to allow pairing of homologous sites. PMID:9531544

  19. Homologous chromosome pairing in Drosophila melanogaster proceeds through multiple independent initiations.

    PubMed

    Fung, J C; Marshall, W F; Dernburg, A; Agard, D A; Sedat, J W

    1998-04-06

    The dynamics by which homologous chromosomes pair is currently unknown. Here, we use fluorescence in situ hybridization in combination with three-dimensional optical microscopy to show that homologous pairing of the somatic chromosome arm 2L in Drosophila occurs by independent initiation of pairing at discrete loci rather than by a processive zippering of sites along the length of chromosome. By evaluating the pairing frequencies of 11 loci on chromosome arm 2L over several timepoints during Drosophila embryonic development, we show that all 11 loci are paired very early in Drosophila development, within 13 h after egg deposition. To elucidate whether such pairing occurs by directed or undirected motion, we analyzed the pairing kinetics of histone loci during nuclear cycle 14. By measuring changes of nuclear length and correlating these changes with progression of time during cycle 14, we were able to express the pairing frequency and distance between homologous loci as a function of time. Comparing the experimentally determined dynamics of pairing to simulations based on previously proposed models of pairing motion, we show that the observed pairing kinetics are most consistent with a constrained random walk model and not consistent with a directed motion model. Thus, we conclude that simple random contacts through diffusion could suffice to allow pairing of homologous sites.

  20. Ag(I)-mediated homo and hetero pairs of guanosine and cytidine: monitoring by circular dichroism spectroscopy.

    PubMed

    Goncharova, Iryna

    2014-01-24

    Ag(I)-containing compounds are attractive as antibacterial and antifungal agents. The renewed interest in the application of silver(I) compounds has led to the need for detailed knowledge of the mechanism of their action. One of the possible ways is the coordination of Ag(I) to G-C pairs of DNA, where Ag(+) ions form Ag(I)-mediated base pairs and inhibit the transcription. Herein, a systematic chiroptical study on silver(I)-mediated homo and mixed pairs of the C-G complementary-base derivatives cytidine(C) and 5'-guanosine monophosphate(G) in water is presented. Ag(I)-mediated homo and hetero pairs of G and C and their self-assembled species were studied under two pH levels (7.0 and 10.0) by vibrational (VCD) and electronic circular dichroism(ECD). VCD was used for the first time in this field and showed itself to be a powerful method for obtaining specific structural information in solution. Based on results of the VCD experiments, the different geometries of the homo pairs were proposed under pH 7.0 and 10.0. ECD was used as a diagnostic tool to characterize the studied systems and as a contact point between the previously defined structures of the metal or proton mediated pairs of nucleobases and the systems studied here. On the basis of the obtained data, the formation of the self-assembled species of cytidine with a structure similar to the i-motif structure in DNA was proposed at pH 10.0. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Ag(I)-mediated homo and hetero pairs of guanosine and cytidine: Monitoring by circular dichroism spectroscopy

    NASA Astrophysics Data System (ADS)

    Goncharova, Iryna

    2014-01-01

    Ag(I)-containing compounds are attractive as antibacterial and antifungal agents. The renewed interest in the application of silver(I) compounds has led to the need for detailed knowledge of the mechanism of their action. One of the possible ways is the coordination of Ag(I) to G-C pairs of DNA, where Ag+ ions form Ag(I)-mediated base pairs and inhibit the transcription. Herein, a systematic chiroptical study on silver(I)-mediated homo and mixed pairs of the C-G complementary-base derivatives cytidine(C) and 5‧-guanosine monophosphate(G) in water is presented. Ag(I)-mediated homo and hetero pairs of G and C and their self-assembled species were studied under two pH levels (7.0 and 10.0) by vibrational (VCD) and electronic circular dichroism(ECD). VCD was used for the first time in this field and showed itself to be a powerful method for obtaining specific structural information in solution. Based on results of the VCD experiments, the different geometries of the homo pairs were proposed under pH 7.0 and 10.0. ECD was used as a diagnostic tool to characterize the studied systems and as a contact point between the previously defined structures of the metal or proton mediated pairs of nucleobases and the systems studied here. On the basis of the obtained data, the formation of the self-assembled species of cytidine with a structure similar to the i-motif structure in DNA was proposed at pH 10.0.

  2. Socialization in Pigtailed Macaques (Macaca nemestrina)

    PubMed Central

    WORLEIN, JULIE M.; KROEKER, ROSE; LEE, GRACE H.; THOM, JINHEE P.; BELLANCA, RITA U.; CROCKETT, CAROLYN M.

    2018-01-01

    In response to new emphasis by regulatory agencies regarding socialization, behavioral management programs are allocating greater resources to maximize socialization opportunities for laboratory primates. Information regarding predictors of compatibility and risk of injury for all laboratory-housed species of macaques are needed to make social introductions and pairings as efficient and safe as possible. This study presents data on 674 pairs of pigtailed macaques (Macaca nemestrina) at the Washington National Primate Research Center over a 7-year period. During pair introduction, behavior was monitored while the degree of tactile contact was gradually increased. Based on observed behavior, pairs were assigned a behavioral introduction score (BIS), rating the quality of their interactions for each day of introduction. Animals deemed compatible, based on the BIS and technologist judgment, were allowed to progress to continuous contact with no staff present. A small proportion of animals deemed compatible at introduction was later separated for subsequent incompatibility or aggression; these proportions were higher in full contact compared to protected contact pairings. Of 674 pairs, 75% were deemed compatible at introduction in protected contact; 86 of these pairs were later transitioned to full contact with 98% compatibility. Predictors of decreased compatibility assessed during protected contact introductions included age (adult pairs were less compatible), the BIS on the last day of introduction, and aggression or injury during the introductory period. Predictors of injuries during the protected contact introduction process included: aggression on the first day of introduction, a negative BIS on the first or last day of introduction, and, surprisingly, the presence of grooming on the first day of introduction. Injuries during both introduction and subsequent pairing in protected contact were rare; however, injury rates increased significantly during full-contact pairing. These findings underscore the necessity of species-specific data to guide decision-making during the social introduction process. PMID:27109591

  3. Base pairing between the 3' exon and an internal guide sequence increases 3' splice site specificity in the Tetrahymena self-splicing rRNA intron.

    PubMed Central

    Suh, E R; Waring, R B

    1990-01-01

    It has been proposed that recognition of the 3' splice site in many group I introns involves base pairing between the start of the 3' exon and a region of the intron known as the internal guide sequence (R. W. Davies, R. B. Waring, J. Ray, T. A. Brown, and C. Scazzocchio, Nature [London] 300:719-724, 1982). We have examined this hypothesis, using the self-splicing rRNA intron from Tetrahymena thermophila. Mutations in the 3' exon that weaken this proposed pairing increased use of a downstream cryptic 3' splice site. Compensatory mutations in the guide sequence that restore this pairing resulted in even stronger selection of the normal 3' splice site. These changes in 3' splice site usage were more pronounced in the background of a mutation (414A) which resulted in an adenine instead of a guanine being the last base of the intron. These results show that the proposed pairing (P10) plays an important role in ensuring that cryptic 3' splice sites are selected against. Surprisingly, the 414A mutation alone did not result in activation of the cryptic 3' splice site. Images PMID:2342465

  4. Mediated Activity in the Primary Classroom: Girls, Boys and Computers.

    ERIC Educational Resources Information Center

    Fitzpatrick, Helen; Hardman, Margaret

    2000-01-01

    Studied the social interaction of 7- and 9-year-olds working in the same or mixed gender pairs on language-based computer and noncomputer tasks. At both ages, mixed gender pairs showed more assertive and less transactive (collaborative) interaction than same gender pairs on both tasks. Discusses the mediational role of the computer and the social…

  5. Memory for Object Locations: Priority Effect and Sex Differences in Associative Spatial Learning

    ERIC Educational Resources Information Center

    Cinan, Sevtap; Atalay, Deniz; Sisman, Simge; Basbug, Gokce; Dervent-Ozbek, Sevinc; Teoman, Dalga D.; Karagoz, Ayca; Karadeniz, A. Yezdan; Beykurt, Sinem; Suleyman, Hediye; Memis, H. Ozge; Yurtsever, Ozgur D.

    2007-01-01

    This paper reports two experiments conducted to examine priority effects and sex differences in object location memory. A new task of paired position-learning was designed, based on the A-B A-C paradigm, which was used in paired word learning. There were three different paired position-learning conditions: (1) positions of several different…

  6. A Macroscopic Analogue of the Nuclear Pairing Potential

    ERIC Educational Resources Information Center

    Dunlap, Richard A.

    2013-01-01

    A macroscopic system involving permanent magnets is used as an analogue to nucleons in a nucleus to illustrate the significance of the pairing interaction. This illustrates that the view of the total nuclear energy based only on the nucleon occupancy of the energy levels can yield erroneous results and it is only when the pairing interaction is…

  7. Coexistence of Multiple Attractors in an Active Diode Pair Based Chua’s Circuit

    NASA Astrophysics Data System (ADS)

    Bao, Bocheng; Wu, Huagan; Xu, Li; Chen, Mo; Hu, Wen

    This paper focuses on the coexistence of multiple attractors in an active diode pair based Chua’s circuit with smooth nonlinearity. With dimensionless equations, dynamical properties, including boundness of system orbits and stability distributions of two nonzero equilibrium points, are investigated, and complex coexisting behaviors of multiple kinds of disconnected attractors of stable point attractors, limit cycles and chaotic attractors are numerically revealed. The results show that unlike the classical Chua’s circuit, the proposed circuit has two stable nonzero node-foci for the specified circuit parameters, thereby resulting in the emergence of multistability phenomenon. Based on two general impedance converters, the active diode pair based Chua’s circuit with an adjustable inductor and an adjustable capacitor is made in hardware, from which coexisting multiple attractors are conveniently captured.

  8. Analyzing Population Genetics Using the Mitochondrial Control Region and Bioinformatics

    ERIC Educational Resources Information Center

    Sato, Takumi; Phillips, Bonnie; Latourelle, Sandra M.; Elwess, Nancy L.

    2010-01-01

    The 14-base pair hypervariable region in mitochondrial DNA (mtDNA) of Asian populations, specifically Japanese and Chinese students at Plattsburgh State University, was examined. Previous research on this 14-base pair region showed it to be susceptible to mutations and as a result indicated direct correlation with specific ethnic populations.…

  9. Patients' experiences of cold exposure during ambulance care.

    PubMed

    Aléx, Jonas; Karlsson, Stig; Saveman, Britt-Inger

    2013-06-06

    Exposure to cold temperatures is often a neglected problem in prehospital care. Cold exposure increase thermal discomfort and, if untreated causes disturbances of vital body functions until ultimately reaching hypothermia. It may also impair cognitive function, increase pain and contribute to fear and an overall sense of dissatisfaction. The aim of this study was to investigate injured and ill patients' experiences of cold exposure and to identify related factors. During January to March 2011, 62 consecutively selected patients were observed when they were cared for by ambulance nursing staff in prehospital care in the north of Sweden. The field study was based on observations, questions about thermal discomfort and temperature measurements (mattress air and patients' finger temperature). Based on the observation protocol the participants were divided into two groups, one group that stated it was cold in the patient compartment in the ambulance and another group that did not. Continuous variables were analyzed with independent sample t-test, paired sample t-test and dichotomous variables with cross tabulation. In the ambulance 85% of the patients had a finger temperature below comfort zone and 44% experienced the ambient temperature in the patient compartment in the ambulance to be cold. There was a significant decrease in finger temperature from the first measurement indoor compared to measurement in the ambulance. The mattress temperature at the ambulance ranged from -22.3°C to 8.4°C. Cold exposure in winter time is common in prehospital care. Sick and injured patients immediately react to cold exposure with decreasing finger temperature and experience of discomfort from cold. Keeping the patient in the comfort zone is of great importance. Further studies are needed to increase knowledge which can be a base for implications in prehospital care for patients who probably already suffer for other reasons.

  10. Validated MicroRNA Target Databases: An Evaluation.

    PubMed

    Lee, Yun Ji Diana; Kim, Veronica; Muth, Dillon C; Witwer, Kenneth W

    2015-11-01

    Preclinical Research Positive findings from preclinical and clinical studies involving depletion or supplementation of microRNA (miRNA) engender optimism about miRNA-based therapeutics. However, off-target effects must be considered. Predicting these effects is complicated. Each miRNA may target many gene transcripts, and the rules governing imperfectly complementary miRNA: target interactions are incompletely understood. Several databases provide lists of the relatively small number of experimentally confirmed miRNA: target pairs. Although incomplete, this information might allow assessment of at least some of the off-target effects. We evaluated the performance of four databases of experimentally validated miRNA: target interactions (miRWalk 2.0, miRTarBase, miRecords, and TarBase 7.0) using a list of 50 alphabetically consecutive genes. We examined the provided citations to determine the degree to which each interaction was experimentally supported. To assess stability, we tested at the beginning and end of a five-month period. Results varied widely by database. Two of the databases changed significantly over the course of 5 months. Most reported evidence for miRNA: target interactions were indirect or otherwise weak, and relatively few interactions were supported by more than one publication. Some returned results appear to arise from simplistic text searches that offer no insight into the relationship of the search terms, may not even include the reported gene or miRNA, and may thus, be invalid. We conclude that validation databases provide important information, but not all information in all extant databases is up-to-date or accurate. Nevertheless, the more comprehensive validation databases may provide useful starting points for investigation of off-target effects of proposed small RNA therapies. © 2015 Wiley Periodicals, Inc.

  11. Binding of DNA hairpins to an assembler-strand as part of a primordial translation device

    NASA Astrophysics Data System (ADS)

    Baumann, Ulrich

    1987-09-01

    A crucial event in the process leading to the origin of life is the emergence of a simple translation device. To approach experimental realization of this device the binding ability of short DNA hairpins to complementary oligonucleotides fixed on a solid support was investigated. The binding is achieved by base pairing between the loop nucleotides of the hairpins containing different numbers of adenosine residues and oligothymidylates covalently linked to cellulose. The loop has to consist of at least five nucleotides to achieve binding. The exact number of established base pairs was determined in two ways. First, the elution temperatures of hairpins and those of oligoadenylates which had the length of the loop were compared. Secondly, the architecture of the loop was analyzed by means of the single-strand-specific nuclease from mung bean acting as structural probe. Onlyn-2 of n loop nucleotides of a hairpin are able to form base pairs. Therefore, a strong evidence for the formation of a triplet of base pairs between primeval tRNA and mRNA sufficient to stabilize the complex enzyme-free is given.

  12. Solvent effect on the intermolecular proton transfer of the Watson and Crick guanine-cytosine and adenine-thymine base pairs: a polarizable continuum model study.

    PubMed

    Romero, Eduardo E; Hernandez, Florencio E

    2018-01-03

    Herein we present our results on the study of the double proton transfer (DPT) mechanism in the adenine-thymine (AT) and guanine-cytosine (GC) base pairs, both in gas phase and in solution. The latter was modeled using the polarizable continuum method (PCM) in different solvents. According to our DFT calculations, the DPT may occur for both complexes in a stepwise mechanism in condensate phase. In gas phase only the GC base pair exhibits a concerted DPT mechanism. Using the Wigner's tunneling corrections to the transition state theory we demonstrate that such corrections are important for the prediction of the rate constants of both systems in gas and in condensate phase. We also show that (i) as the polarity of the medium decreases the equilibrium constant of the DPT reaction increases in both complexes, and (ii) that the equilibrium constant in the GC complex is four orders of magnitude larger than in AT. This observation suggests that the spontaneous mutations in DNA base pairs are more probable in GC than in AT.

  13. [Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

    PubMed

    Brovarets', O O; Hovorun, D M

    2010-01-01

    A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*<---->Gua.Cyt<---->Gua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

  14. DFT investigation of the vibrational properties of GC Watson-Crick and Hoogsteen base pairs in the presence of Mg²⁺, Ca²⁺, and Cu²⁺ ions.

    PubMed

    Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian

    2014-04-01

    The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.

  15. Large-Scale, Exhaustive Lattice-Based Structural Auditing of SNOMED CT

    NASA Astrophysics Data System (ADS)

    Zhang, Guo-Qiang

    One criterion for the well-formedness of ontologies is that their hierarchical structure form a lattice. Formal Concept Analysis (FCA) has been used as a technique for assessing the quality of ontologies, but is not scalable to large ontologies such as SNOMED CT. We developed a methodology called Lattice-based Structural Auditing (LaSA), for auditing biomedical ontologies, implemented through automated SPARQL queries, in order to exhaustively identify all non-lattice pairs in SNOMED CT. The percentage of non-lattice pairs ranges from 0 to 1.66 among the 19 SNOMED CT hierarchies. Preliminary manual inspection of a limited portion of the 518K non-lattice pairs, among over 34 million candidate pairs, revealed inconsistent use of precoordination in SNOMED CT, but also a number of false positives. Our results are consistent with those based on FCA, with the advantage that the LaSA computational pipeline is scalable and applicable to ontological systems consisting mostly of taxonomic links. This work is based on collaboration with Olivier Bodenreider from the National Library of Medicine, Bethesda, USA.

  16. An inversion of 25 base pairs causes feline GM2 gangliosidosis variant.

    PubMed

    Martin, Douglas R; Krum, Barbara K; Varadarajan, G S; Hathcock, Terri L; Smith, Bruce F; Baker, Henry J

    2004-05-01

    In G(M2) gangliosidosis variant 0, a defect in the beta-subunit of lysosomal beta-N-acetylhexosaminidase (EC 3.2.1.52) causes abnormal accumulation of G(M2) ganglioside and severe neurodegeneration. Distinct feline models of G(M2) gangliosidosis variant 0 have been described in both domestic shorthair and Korat cats. In this study, we determined that the causative mutation of G(M2) gangliosidosis in the domestic shorthair cat is a 25-base-pair inversion at the extreme 3' end of the beta-subunit (HEXB) coding sequence, which introduces three amino acid substitutions at the carboxyl terminus of the protein and a translational stop that is eight amino acids premature. Cats homozygous for the 25-base-pair inversion express levels of beta-subunit mRNA approximately 190% of normal and protein levels only 10-20% of normal. Because the 25-base-pair inversion is similar to mutations in the terminal exon of human HEXB, the domestic shorthair cat should serve as an appropriate model to study the molecular pathogenesis of human G(M2) gangliosidosis variant 0 (Sandhoff disease).

  17. Combined effects of metal complexation and size expansion in the electronic structure of DNA base pairs

    NASA Astrophysics Data System (ADS)

    Brancolini, Giorgia; Di Felice, Rosa

    2011-05-01

    Novel DNA derivatives have been recently investigated in the pursuit of modified DNA duplexes to tune the electronic structure of DNA-based assemblies for nanotechnology applications. Size-expanded DNAs (e.g., xDNA) and metalated DNAs (M-DNA) may enhance stacking interactions and induce metallic conductivity, respectively. Here we explore possible ways of tailoring the DNA electronic structure by combining the aromatic size expansion with the metal-doping. We select the salient structures from our recent study on natural DNA pairs complexed with transition metal ions and consider the equivalent model configurations for xDNA pairs. We present the results of density functional theory electronic structure calculations of the metalated expanded base-pairs with various localized basis sets and exchange-correlation functionals. Implicit solvent and coordination water molecules are also included. Our results indicate that the effect of base expansion is largest in Ag-xGC complexes, while Cu-xGC complexes are the most promising candidates for nanowires with enhanced electron transfer and also for on-purpose modification of the DNA double-helix for signal detection.

  18. Are herb-pairs of traditional Chinese medicine distinguishable from others? Pattern analysis and artificial intelligence classification study of traditionally defined herbal properties.

    PubMed

    Ung, Choong Yong; Li, Hu; Cao, Zhi Wei; Li, Yi Xue; Chen, Yu Zong

    2007-05-04

    Multi-herb prescriptions of traditional Chinese medicine (TCM) often include special herb-pairs for mutual enhancement, assistance, and restraint. These TCM herb-pairs have been assembled and interpreted based on traditionally defined herbal properties (TCM-HPs) without knowledge of mechanism of their assumed synergy. While these mechanisms are yet to be determined, properties of TCM herb-pairs can be investigated to determine if they exhibit features consistent with their claimed unique synergistic combinations. We analyzed distribution patterns of TCM-HPs of TCM herb-pairs to detect signs indicative of possible synergy and used artificial intelligence (AI) methods to examine whether combination of their TCM-HPs are distinguishable from those of non-TCM herb-pairs assembled by random combinations and by modification of known TCM herb-pairs. Patterns of the majority of 394 known TCM herb-pairs were found to exhibit signs of herb-pair correlation. Three AI systems, trained and tested by using 394 TCM herb-pairs and 2470 non-TCM herb-pairs, correctly classified 72.1-87.9% of TCM herb-pairs and 91.6-97.6% of the non-TCM herb-pairs. The best AI system predicted 96.3% of the 27 known non-TCM herb-pairs and 99.7% of the other 1,065,100 possible herb-pairs as non-TCM herb-pairs. Our studies suggest that TCM-HPs of known TCM herb-pairs contain features distinguishable from those of non-TCM herb-pairs consistent with their claimed synergistic or modulating combinations.

  19. Altered minor-groove hydrogen bonds in DNA block transcription elongation by T7 RNA polymerase.

    PubMed

    Tanasova, Marina; Goeldi, Silvan; Meyer, Fabian; Hanawalt, Philip C; Spivak, Graciela; Sturla, Shana J

    2015-05-26

    DNA transcription depends upon the highly efficient and selective function of RNA polymerases (RNAPs). Modifications in the template DNA can impact the progression of RNA synthesis, and a number of DNA adducts, as well as abasic sites, arrest or stall transcription. Nonetheless, data are needed to understand why certain modifications to the structure of DNA bases stall RNA polymerases while others are efficiently bypassed. In this study, we evaluate the impact that alterations in dNTP/rNTP base-pair geometry have on transcription. T7 RNA polymerase was used to study transcription over modified purines and pyrimidines with altered H-bonding capacities. The results suggest that introducing wobble base-pairs into the DNA:RNA heteroduplex interferes with transcriptional elongation and stalls RNA polymerase. However, transcriptional stalling is not observed if mismatched base-pairs do not H-bond. Together, these studies show that RNAP is able to discriminate mismatches resulting in wobble base-pairs, and suggest that, in cases of modifications with minor steric impact, DNA:RNA heteroduplex geometry could serve as a controlling factor for initiating transcription-coupled DNA repair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Unsuspected Dengue as a Cause of Acute Febrile Illness in Children and Adults in Western Nicaragua.

    PubMed

    Reller, Megan E; de Silva, Aravinda M; Miles, Jeremy J; Jadi, Ramesh S; Broadwater, Anne; Walker, Katie; Woods, Christopher; Mayorga, Orlando; Matute, Armando

    2016-10-01

    Dengue is an emerging infectious disease of global significance. Suspected dengue, especially in children in Nicaragua's heavily-urbanized capital of Managua, has been well documented, but unsuspected dengue among children and adults with undifferentitated fever has not. To prospectively study dengue in semi-urban and rural western Nicaragua, we obtained epidemiologic and clinical data as well as acute and convalescent sera (2 to 4 weeks after onset of illness) from a convenience sample (enrollment Monday to Saturday daytime to early evening) of consecutively enrolled patients (n = 740) aged ≥ 1 years presenting with acute febrile illness. We tested paired sera for dengue IgG and IgM and serotyped dengue virus using reverse transcriptase-PCR. Among 740 febrile patients enrolled, 90% had paired sera. We found 470 (63.5%) were seropositive for dengue at enrollment. The dengue seroprevalance increased with age and reached >90% in people over the age of 20 years. We identified acute dengue (serotypes 1 and 2) in 38 (5.1%) patients. Only 8.1% (3/37) of confirmed cases were suspected clinically. Dengue is an important and largely unrecognized cause of fever in rural western Nicaragua. Since Zika virus is transmitted by the same vector and has been associated with severe congenital infections, the population we studied is at particular risk for being devastated by the Zika epidemic that has now reached Central America.

Top