Trans splicing in Leishmania enriettii and identification of ribonucleoprotein complexes containing the spliced leader and U2 equivalent RNAs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miller, S.I.; Wirth, D.F.

1988-06-01

The 5' ends of Leishmania mRNAs contain an identical 35-nucleotide sequence termed the spliced leader (SL) or 5' mini-exon. The SL sequence is at the 5' end of an 85-nucleotide primary transcript that contains a consensus eucaryotic 5' intron-exon splice junction immediately 3' to the SL. The SL is added to protein-coding genes immediately 3' to a consensus eucaryotic 3' intron-exon splice junction. The authors' previous work demonstrated possible intermediates in discontinuous mRNA processing that contain the 50 nucleotides of the SL primary transcript 3' to the SL, the SL intron sequence (SLIS). These RNAs have a 5' terminus atmore » the splice junction of the SL and the SLIS. The authors examined a Leishmania nuclear extract for these RNAs in ribonucleoprotein (RNP) particles. Density centrifugation analysis showed that the SL RNA is predominately in RNP complexes at 60S, while the SLIS-containing RNAs are in complexes at 40S. They also demonstrated that the SLIS can be released from polyadenylated RNA by incubation with a HeLa cell extract containing debranching enzymatic activity. These data suggested that Leishmania enriettii mRNAs are assembled by bimolecular or trans splicing as has been recently demonstrated for Trypanosoma brucei. Furthermore, they determined the partial sequence of the Leishmania U2 equivalent RNA and demonstrated that it cosediments with the SL RNA at 60S in a nuclear extract. These RNP particles may be analogous to so-called spliceosomes that have been demonstrated in other systems.« less

Dimeric PROP1 binding to diverse palindromic TAAT sequences promotes its transcriptional activity.

PubMed

Nakayama, Michie; Kato, Takako; Susa, Takao; Sano, Akiko; Kitahara, Kousuke; Kato, Yukio

2009-08-13

Mutations in the Prop1 gene are responsible for murine Ames dwarfism and human combined pituitary hormone deficiency with hypogonadism. Recently, we reported that PROP1 is a possible transcription factor for gonadotropin subunit genes through plural cis-acting sites composed of AT-rich sequences containing a TAAT motif which differs from its consensus binding sequence known as PRDQ9 (TAATTGAATTA). This study aimed to verify the binding specificity and sequence of PROP1 by applying the method of SELEX (Systematic Evolution of Ligands by EXponential enrichment), EMSA (electrophoretic mobility shift assay) and transient transfection assay. SELEX, after 5, 7 and 9 generations of selection using a random sequence library, showed that nucleotides containing one or two TAAT motifs were accumulated and accounted for 98.5% at the 9th generation. Aligned sequences and EMSA demonstrated that PROP1 binds preferentially to 11 nucleotides composed of an inverted TAAT motif separated by 3 nucleotides with variation in the half site of palindromic TAAT motifs and with preferential requirement of T at the nucleotide number 5 immediately 3' to a TAAT motif. Transient transfection assay demonstrated first that dimeric binding of PROP1 to an inverted TAAT motif and its cognates resulted in transcriptional activation, whereas monomeric binding of PROP1 to a single TAAT motif and an inverted ATTA motif did not mediate activation. Thus, this study demonstrated that dimeric binding of PROP1 is able to recognize diverse palindromic TAAT sequences separated by 3 nucleotides and to exhibit its transcriptional activity.

Transcriptome characterization and polymorphism detection between subspecies of big sagebrush (Artemisia tridentata)

PubMed Central

2011-01-01

Background Big sagebrush (Artemisia tridentata) is one of the most widely distributed and ecologically important shrub species in western North America. This species serves as a critical habitat and food resource for many animals and invertebrates. Habitat loss due to a combination of disturbances followed by establishment of invasive plant species is a serious threat to big sagebrush ecosystem sustainability. Lack of genomic data has limited our understanding of the evolutionary history and ecological adaptation in this species. Here, we report on the sequencing of expressed sequence tags (ESTs) and detection of single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers in subspecies of big sagebrush. Results cDNA of A. tridentata sspp. tridentata and vaseyana were normalized and sequenced using the 454 GS FLX Titanium pyrosequencing technology. Assembly of the reads resulted in 20,357 contig consensus sequences in ssp. tridentata and 20,250 contigs in ssp. vaseyana. A BLASTx search against the non-redundant (NR) protein database using 29,541 consensus sequences obtained from a combined assembly resulted in 21,436 sequences with significant blast alignments (≤ 1e-15). A total of 20,952 SNPs and 119 polymorphic SSRs were detected between the two subspecies. SNPs were validated through various methods including sequence capture. Validation of SNPs in different individuals uncovered a high level of nucleotide variation in EST sequences. EST sequences of a third, tetraploid subspecies (ssp. wyomingensis) obtained by Illumina sequencing were mapped to the consensus sequences of the combined 454 EST assembly. Approximately one-third of the SNPs between sspp. tridentata and vaseyana identified in the combined assembly were also polymorphic within the two geographically distant ssp. wyomingensis samples. Conclusion We have produced a large EST dataset for Artemisia tridentata, which contains a large sample of the big sagebrush leaf transcriptome. SNP mapping among the three subspecies suggest the origin of ssp. wyomingensis via mixed ancestry. A large number of SNP and SSR markers provide the foundation for future research to address questions in big sagebrush evolution, ecological genetics, and conservation using genomic approaches. PMID:21767398

Nucleotide sequencing analysis of a LEU gene of Candida maltosa which complements leuB mutation of Escherichia coli and leu2 mutation of Saccharomyces cerevisiae.

PubMed

Takagi, M; Kobayashi, N; Sugimoto, M; Fujii, T; Watari, J; Yano, K

1987-01-01

The expression of a LEU gene from Candida maltosa (designated as C-LEU2) isolated previously (Kawamura et al. 1983) was shown to be regulated, when transferred into Saccharomyces cerevisiae, by leucine and threonine in the medium, as in the case of LEU2 gene of S. cerevisiae. The coding region together with the regulatory region was subcloned and the nucleotide sequence was determined. When the sequence of the coding region was compared with that of LEU2, the homology was 72% for base pairs and 76% for deduced amino acids. Comparison of the regulatory region of C-LEU2 with those of LEU1 and LEU2 suggested a few short consensus sequences which are involved in regulation of gene expression by leucine and threonine in the medium.

The human myelin oligodendrocyte glycoprotein (MOG) gene: Complete nucleotide sequence and structural characterization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paule Roth, M.; Malfroy, L.; Offer, C.

1995-07-20

Human myelin oligodendrocyte glycoprotein (MOG), a myelin component of the central nervous system, is a candidate target antigen for autoimmune-mediated demyelination. We have isolated and sequenced part of a cosmid clone that contains the entire human MOG gene. The primary nuclear transcript, extending from the putative start of transcription to the site of poly(A) addition, is 15,561 nucleotides in length. The human MOG gene contains 8 exons, separated by 7 introns; canonical intron/exon boundary sites are observed at each junction. The introns vary in size from 242 to 6484 bp and contain numerous repetitive DNA elements, including 14 Alu sequencesmore » within 3 introns. Another Alu element is located in the 3{prime}-untranslated region of the gene. Alu sequences were classified with respect to subfamily assignment. Seven hundred sixty-three nucleotides 5{prime} of the transcription start and 1214 nucleotides 3{prime} of the poly(A) addition sites were also sequenced. The 5{prime}-flanking region revealed the presence of several consensus sequences that could be relevant in the transcription of the MOG gene, in particular binding sites in common with other myelin gene promoters. Two polymorphic intragenic dinucleotide (CA){sub n} and tetranucleotide (TAAA){sub n} repeats were identified and may provide genetic marker tools for association and linkage studies. 50 refs., 3 figs., 3 tabs.« less

Nucleotide sequence of the gene encoding the nitrogenase iron protein of Thiobacillus ferrooxidans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pretorius, I.M.; Rawlings, D.E.; O'Neill, E.G.

1987-01-01

The DNA sequence was determined for the cloned Thiobacillus ferrooxidans nifH and part of the nifD genes. The DNA chains were radiolabeled with (..cap alpha..-/sup 32/P)dCTP (3000 Ci/mmol) or (..cap alpha..-/sup 35/S)dCTP (400 Ci/mmol). A putative T. ferrooxidans nifH promoter was identified whose sequences showed perfect consensus with those of the Klebsiella pneumoniae nif promoter. Two putative consensus upstream activator sequences were also identified. The amino acid sequence was deduced from the DNA sequence. In a comparison of nifH DNA sequences from T. ferrooxidans and eight other nitrogen-fixing microbes, a Rhizobium sp. isolated from Parasponia andersonii showed the greatest homologymore » (74%) and Clostridium pasteurianum (nifH1) showed the least homology (54%). In the comparison of the amino acid sequences of the Fe proteins, the Rhizobium sp. and Rhizobium japonicum showed the greatest homology (both 86%) and C. pasteurianum (nifH1 gene product) demonstrated the least homology (56%) to the T. ferrooxidans Fe protein.« less

Structure and Temporal Dynamics of Populations within Wheat Streak Mosaic Virus Isolates

PubMed Central

Hall, Jeffrey S.; French, Roy; Morris, T. Jack; Stenger, Drake C.

2001-01-01

Variation within the Type and Sidney 81 strains of wheat streak mosaic virus was assessed by single-strand conformation polymorphism (SSCP) analysis and confirmed by nucleotide sequencing. Limiting-dilution subisolates (LDSIs) of each strain were evaluated for polymorphism in the P1, P3, NIa, and CP cistrons. Different SSCP patterns among LDSIs of a strain were associated with single-nucleotide substitutions. Sidney 81 LDSI-S10 was used as founding inoculum to establish three lineages each in wheat, corn, and barley. The P1, HC-Pro, P3, CI, NIa, NIb, and CP cistrons of LDSI-S10 and each lineage at passages 1, 3, 6, and 9 were evaluated for polymorphism. By passage 9, each lineage differed in consensus sequence from LDSI-S10. The majority of substitutions occurred within NIa and CP, although at least one change occurred in each cistron except HC-Pro and P3. Most consensus sequence changes among lineages were independent, with substitutions accumulating over time. However, LDSI-S10 bore a variant nucleotide (G6016) in NIa that was restored to A6016 in eight of nine lineages by passage 6. This near-global reversion is most easily explained by selection. Examination of nonconsensus variation revealed a pool of unique substitutions (singletons) that remained constant in frequency during passage, regardless of the host species examined. These results suggest that mutations arising by viral polymerase error are generated at a constant rate but that most newly generated mutants are sequestered in virions and do not serve as replication templates. Thus, a substantial fraction of variation generated is static and has yet to be tested for relative fitness. In contrast, nonsingleton variation increased upon passage, suggesting that some mutants do serve as replication templates and may become established in a population. Replicated mutants may or may not rise to prominence to become the consensus sequence in a lineage, with the fate of any particular mutant subject to selection and stochastic processes such as genetic drift and population growth factors. PMID:11581391

Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR.

PubMed Central

D'Souza, T M; Boominathan, K; Reddy, C A

1996-01-01

Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. PMID:8837429

DNA sequence requirements for the accurate transcription of a protein-coding plastid gene in a plastid in vitro system from mustard (Sinapis alba L.)

PubMed Central

Link, Gerhard

1984-01-01

A nuclease-treated plastid extract from mustard (Sinapis alba L.) allows efficient transcription of cloned plastid DNA templates. In this in vitro system, the major runoff transcript of the truncated gene for the 32 000 mol. wt. photosystem II protein was accurately initiated from a site close to or identical with the in vivo start site. By using plasmids with deletions in the 5'-flanking region of this gene as templates, a DNA region required for efficient and selective initiation was detected ˜28-35 nucleotides upstream of the transcription start site. This region contains the sequence element TTGACA, which matches the consensus sequence for prokaryotic `−35' promoter elements. In the absence of this region, a region ˜13-27 nucleotides upstream of the start site still enables a basic level of specific transcription. This second region contains the sequence element TATATAA, which matches the consensus sequence for the `TATA' box of genes transcribed by RNA polymerase II (or B). The region between the `TATA'-like element and the transcription start site is not sufficient but may be required for specific transcription of the plastid gene. This latter region contains the sequence element TATACT, which resembles the prokaryotic `−10' (Pribnow) box. Based on the structural and transcriptional features of the 5' upstream region, a `promoter switch' mechanism is proposed, which may account for the developmentally regulated expression of this plastid gene. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Figure 5. PMID:16453540

An extended sequence specificity for UV-induced DNA damage.

PubMed

Chung, Long H; Murray, Vincent

2018-01-01

The sequence specificity of UV-induced DNA damage was determined with a higher precision and accuracy than previously reported. UV light induces two major damage adducts: cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). Employing capillary electrophoresis with laser-induced fluorescence and taking advantages of the distinct properties of the CPDs and 6-4PPs, we studied the sequence specificity of UV-induced DNA damage in a purified DNA sequence using two approaches: end-labelling and a polymerase stop/linear amplification assay. A mitochondrial DNA sequence that contained a random nucleotide composition was employed as the target DNA sequence. With previous methodology, the UV sequence specificity was determined at a dinucleotide or trinucleotide level; however, in this paper, we have extended the UV sequence specificity to a hexanucleotide level. With the end-labelling technique (for 6-4PPs), the consensus sequence was found to be 5'-GCTC*AC (where C* is the breakage site); while with the linear amplification procedure, it was 5'-TCTT*AC. With end-labelling, the dinucleotide frequency of occurrence was highest for 5'-TC*, 5'-TT* and 5'-CC*; whereas it was 5'-TT* for linear amplification. The influence of neighbouring nucleotides on the degree of UV-induced DNA damage was also examined. The core sequences consisted of pyrimidine nucleotides 5'-CTC* and 5'-CTT* while an A at position "1" and C at position "2" enhanced UV-induced DNA damage. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

A Simple Sequence Repeat- and Single-Nucleotide Polymorphism-Based Genetic Linkage Map of the Brown Planthopper, Nilaparvata lugens

PubMed Central

Jairin, Jirapong; Kobayashi, Tetsuya; Yamagata, Yoshiyuki; Sanada-Morimura, Sachiyo; Mori, Kazuki; Tashiro, Kosuke; Kuhara, Satoru; Kuwazaki, Seigo; Urio, Masahiro; Suetsugu, Yoshitaka; Yamamoto, Kimiko; Matsumura, Masaya; Yasui, Hideshi

2013-01-01

In this study, we developed the first genetic linkage map for the major rice insect pest, the brown planthopper (BPH, Nilaparvata lugens). The linkage map was constructed by integrating linkage data from two backcross populations derived from three inbred BPH strains. The consensus map consists of 474 simple sequence repeats, 43 single-nucleotide polymorphisms, and 1 sequence-tagged site, for a total of 518 markers at 472 unique positions in 17 linkage groups. The linkage groups cover 1093.9 cM, with an average distance of 2.3 cM between loci. The average number of marker loci per linkage group was 27.8. The sex-linkage group was identified by exploiting X-linked and Y-specific markers. Our linkage map and the newly developed markers used to create it constitute an essential resource and a useful framework for future genetic analyses in BPH. PMID:23204257

CapZyme-Seq Comprehensively Defines Promoter-Sequence Determinants for RNA 5' Capping with NAD.

PubMed

Vvedenskaya, Irina O; Bird, Jeremy G; Zhang, Yuanchao; Zhang, Yu; Jiao, Xinfu; Barvík, Ivan; Krásný, Libor; Kiledjian, Megerditch; Taylor, Deanne M; Ebright, Richard H; Nickels, Bryce E

2018-05-03

Nucleoside-containing metabolites such as NAD + can be incorporated as 5' caps on RNA by serving as non-canonical initiating nucleotides (NCINs) for transcription initiation by RNA polymerase (RNAP). Here, we report CapZyme-seq, a high-throughput-sequencing method that employs NCIN-decapping enzymes NudC and Rai1 to detect and quantify NCIN-capped RNA. By combining CapZyme-seq with multiplexed transcriptomics, we determine efficiencies of NAD + capping by Escherichia coli RNAP for ∼16,000 promoter sequences. The results define preferred transcription start site (TSS) positions for NAD + capping and define a consensus promoter sequence for NAD + capping: HRRASWW (TSS underlined). By applying CapZyme-seq to E. coli total cellular RNA, we establish that sequence determinants for NCIN capping in vivo match the NAD + -capping consensus defined in vitro, and we identify and quantify NCIN-capped small RNAs (sRNAs). Our findings define the promoter-sequence determinants for NCIN capping with NAD + and provide a general method for analysis of NCIN capping in vitro and in vivo. Copyright © 2018 Elsevier Inc. All rights reserved.

Weak Negative and Positive Selection and the Drift Load at Splice Sites

PubMed Central

Denisov, Stepan V.; Bazykin, Georgii A.; Sutormin, Roman; Favorov, Alexander V.; Mironov, Andrey A.; Gelfand, Mikhail S.; Kondrashov, Alexey S.

2014-01-01

Splice sites (SSs) are short sequences that are crucial for proper mRNA splicing in eukaryotic cells, and therefore can be expected to be shaped by strong selection. Nevertheless, in mammals and in other intron-rich organisms, many of the SSs often involve nonconsensus (Nc), rather than consensus (Cn), nucleotides, and beyond the two critical nucleotides, the SSs are not perfectly conserved between species. Here, we compare the SS sequences between primates, and between Drosophila fruit flies, to reveal the pattern of selection acting at SSs. Cn-to-Nc substitutions are less frequent, and Nc-to-Cn substitutions are more frequent, than neutrally expected, indicating, respectively, negative and positive selection. This selection is relatively weak (1 < |4Nes| < 4), and has a similar efficiency in primates and in Drosophila. Within some nucleotide positions, the positive selection in favor of Nc-to-Cn substitutions is weaker than the negative selection maintaining already established Cn nucleotides; this difference is due to site-specific negative selection favoring current Nc nucleotides. In general, however, the strength of negative selection protecting the Cn alleles is similar in magnitude to the strength of positive selection favoring replacement of Nc alleles, as expected under the simple nearly neutral turnover. In summary, although a fraction of the Nc nucleotides within SSs is maintained by selection, the abundance of deleterious nucleotides in this class suggests a substantial genome-wide drift load. PMID:24966225

Insights Into Upland Cotton (Gossypium hirsutum L.) Genetic Recombination Based on 3 High-Density Single-Nucleotide Polymorphism and a Consensus Map Developed Independently With Common Parents. Genomics Insights

USDA-ARS?s Scientific Manuscript database

High-density linkage maps are vital to supporting the correct placement of scaffolds and gene sequences on chromosomes and fundamental to contemporary organismal research and scientific approaches to genetic improvement; high-density linkage maps are especially important in paleopolyploids with exce...

Molecular cloning and nucleotide sequence of the alpha and beta subunits of allophycocyanin from the cyanelle genome of Cyanophora paradoxa.

PubMed Central

Bryant, D A; de Lorimier, R; Lambert, D H; Dubbs, J M; Stirewalt, V L; Stevens, S E; Porter, R D; Tam, J; Jay, E

1985-01-01

The genes for the alpha- and beta-subunit apoproteins of allophycocyanin (AP) were isolated from the cyanelle genome of Cyanophora paradoxa and subjected to nucleotide sequence analysis. The AP beta-subunit apoprotein gene was localized to a 7.8-kilobase-pair Pst I restriction fragment from cyanelle DNA by hybridization with a tetradecameric oligonucleotide probe. Sequence analysis using that oligonucleotide and its complement as primers for the dideoxy chain-termination sequencing method confirmed the presence of both AP alpha- and beta-subunit genes on this restriction fragment. Additional oligonucleotide primers were synthesized as sequencing progressed and were used to determine rapidly the nucleotide sequence of a 1336-base-pair region of this cloned fragment. This strategy allowed the sequencing to be completed without a detailed restriction map and without extensive and time-consuming subcloning. The sequenced region contains two open reading frames whose deduced amino acid sequences are 81-85% homologous to cyanobacterial and red algal AP subunits whose amino acid sequences have been determined. The two open reading frames are in the same orientation and are separated by 39 base pairs. AP alpha is 5' to AP beta and both coding sequences are preceded by a polypurine, Shine-Dalgarno-type sequence. Sequences upstream from AP alpha closely resemble the Escherichia coli consensus promoter sequences and also show considerable homology to promoter sequences for several chloroplast-encoded psbA genes. A 56-base-pair palindromic sequence downstream from the AP beta gene could play a role in the termination of transcription or translation. The allophycocyanin apoprotein subunit genes are located on the large single-copy region of the cyanelle genome. PMID:2987916

De novo assembly of mitochondrial genomes provides insights into genetic diversity and molecular evolution in wild boars and domestic pigs.

PubMed

Ni, Pan; Bhuiyan, Ali Akbar; Chen, Jian-Hai; Li, Jingjin; Zhang, Cheng; Zhao, Shuhong; Du, Xiaoyong; Li, Hua; Yu, Hui; Liu, Xiangdong; Li, Kui

2018-06-01

Up to date, the scarcity of publicly available complete mitochondrial sequences for European wild pigs hampers deeper understanding about the genetic changes following domestication. Here, we have assembled 26 de novo mtDNA sequences of European wild boars from next generation sequencing (NGS) data and downloaded 174 complete mtDNA sequences to assess the genetic relationship, nucleotide diversity, and selection. The Bayesian consensus tree reveals the clear divergence between the European and Asian clade and a very small portion (10 out of 200 samples) of maternal introgression. The overall nucleotides diversities of the mtDNA sequences have been reduced following domestication. Interestingly, the selection efficiencies in both European and Asian domestic pigs are reduced, probably caused by changes in both selection constraints and maternal population size following domestication. This study suggests that de novo assembled mitogenomes can be a great boon to uncover the genetic turnover following domestication. Further investigation is warranted to include more samples from the ever-increasing amounts of NGS data to help us to better understand the process of domestication.

cWINNOWER algorithm for finding fuzzy dna motifs

NASA Technical Reports Server (NTRS)

Liang, S.; Samanta, M. P.; Biegel, B. A.

2004-01-01

The cWINNOWER algorithm detects fuzzy motifs in DNA sequences rich in protein-binding signals. A signal is defined as any short nucleotide pattern having up to d mutations differing from a motif of length l. The algorithm finds such motifs if a clique consisting of a sufficiently large number of mutated copies of the motif (i.e., the signals) is present in the DNA sequence. The cWINNOWER algorithm substantially improves the sensitivity of the winnower method of Pevzner and Sze by imposing a consensus constraint, enabling it to detect much weaker signals. We studied the minimum detectable clique size qc as a function of sequence length N for random sequences. We found that qc increases linearly with N for a fast version of the algorithm based on counting three-member sub-cliques. Imposing consensus constraints reduces qc by a factor of three in this case, which makes the algorithm dramatically more sensitive. Our most sensitive algorithm, which counts four-member sub-cliques, needs a minimum of only 13 signals to detect motifs in a sequence of length N = 12,000 for (l, d) = (15, 4). Copyright Imperial College Press.

cWINNOWER Algorithm for Finding Fuzzy DNA Motifs

NASA Technical Reports Server (NTRS)

Liang, Shoudan

2003-01-01

The cWINNOWER algorithm detects fuzzy motifs in DNA sequences rich in protein-binding signals. A signal is defined as any short nucleotide pattern having up to d mutations differing from a motif of length l. The algorithm finds such motifs if multiple mutated copies of the motif (i.e., the signals) are present in the DNA sequence in sufficient abundance. The cWINNOWER algorithm substantially improves the sensitivity of the winnower method of Pevzner and Sze by imposing a consensus constraint, enabling it to detect much weaker signals. We studied the minimum number of detectable motifs qc as a function of sequence length N for random sequences. We found that qc increases linearly with N for a fast version of the algorithm based on counting three-member sub-cliques. Imposing consensus constraints reduces qc, by a factor of three in this case, which makes the algorithm dramatically more sensitive. Our most sensitive algorithm, which counts four-member sub-cliques, needs a minimum of only 13 signals to detect motifs in a sequence of length N = 12000 for (l,d) = (15,4).

Sequence diversity of wheat mosaic virus isolates.

PubMed

Stewart, Lucy R

2016-02-02

Wheat mosaic virus (WMoV), transmitted by eriophyid wheat curl mites (Aceria tosichella) is the causal agent of High Plains disease in wheat and maize. WMoV and other members of the genus Emaravirus evaded thorough molecular characterization for many years due to the experimental challenges of mite transmission and manipulating multisegmented negative sense RNA genomes. Recently, the complete genome sequence of a Nebraska isolate of WMoV revealed eight segments, plus a variant sequence of the nucleocapsid protein-encoding segment. Here, near-complete and partial consensus sequences of five more WMoV isolates are reported and compared to the Nebraska isolate: an Ohio maize isolate (GG1), a Kansas barley isolate (KS7), and three Ohio wheat isolates (H1, K1, W1). Results show two distinct groups of WMoV isolates: Ohio wheat isolate RNA segments had 84% or lower nucleotide sequence identity to the NE isolate, whereas GG1 and KS7 had 98% or higher nucleotide sequence identity to the NE isolate. Knowledge of the sequence variability of WMoV isolates is a step toward understanding virus biology, and potentially explaining observed biological variation. Published by Elsevier B.V.

Nucleotide sequence of the gag gene and gag-pol junction of feline leukemia virus.

PubMed Central

Laprevotte, I; Hampe, A; Sherr, C J; Galibert, F

1984-01-01

The nucleotide sequence of the gag gene of feline leukemia virus and its flanking sequences were determined and compared with the corresponding sequences of two strains of feline sarcoma virus and with that of the Moloney strain of murine leukemia virus. A high degree of nucleotide sequence homology between the feline leukemia virus and murine leukemia virus gag genes was observed, suggesting that retroviruses of domestic cats and laboratory mice have a common, proximal evolutionary progenitor. The predicted structure of the complete feline leukemia virus gag gene precursor suggests that the translation of nonglycosylated and glycosylated gag gene polypeptides is initiated at two different AUG codons. These initiator codons fall in the same reading frame and are separated by a 222-base-pair segment which encodes an amino terminal signal peptide. The nucleotide sequence predicts the order of amino acids in each of the individual gag-coded proteins (p15, p12, p30, p10), all of which derive from the gag gene precursor. Stable stem-and-loop secondary structures are proposed for two regions of viral RNA. The first falls within sequences at the 5' end of the viral genome, together with adjacent palindromic sequences which may play a role in dimer linkage of RNA subunits. The second includes coding sequences at the gag-pol junction and is proposed to be involved in translation of the pol gene product. Sequence analysis of the latter region shows that the gag and pol genes are translated in different reading frames. Classical consensus splice donor and acceptor sequences could not be localized to regions which would permit synthesis of the expected gag-pol precursor protein. Alternatively, we suggest that the pol gene product (RNA-dependent DNA polymerase) could be translated by a frameshift suppressing mechanism which could involve cleavage modification of stems and loops in a manner similar to that observed in tRNA processing. PMID:6328019

The complete sequence and promoter activity of the human A-raf-1 gene (ARAF1)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, J.E.; Beck, T.W.; Brennscheidt, U.

1994-03-01

The raf proto-oncogenes encode cytoplasmic protein serine/threonine kinases, which play a critical role in cell growth and development. One of these, A-raf-1 (human gene symbol, ARAF1), which is predominantly expressed in mouse urogenital tissues, has been mapped to an evolutionarily conserved linkage group composed of ARAF1, SYN1, TIMP, and properdin located at human chromosome Xp11.2. The authors have isolated human genomic DNA clones containing the expressed gene (ARAF1) on the X chromosome and a pseudogene (ARAF2) on chromosome 7p12-q11.21. Analysis of the nucleotide sequence from the ARAF1 genomic clones demonstrated that it consists of 16 exons encoded by minimally 10,776more » nucleotides. The major transcriptional start site (+1) was determined by RNase protection and primer extension assays. Promoter activity was confirmed by functional assays using DNA fragments fused to a CAT reporter gene. The ARAF1 minimal promoter, located between nucleotides -59 and +93, has a low G + C content and lacks consensus TATA and Inr sequences but shows sequence similarity at position -1 to the E box that is known to interact with USF and TFII-I transcription factors. 65 refs., 7 figs., 1 tab.« less

Human renin 5'-flanking DNA to nucleotide-2750.

PubMed

Smith, D L; Jeyapalan, S; Lang, J A; Guo, X H; Sigmund, C D; Morris, B J

1995-01-01

Renin is one of the most important factors in blood pressure and electrolyte regulation in mammals and the renin locus has been implicated in hypertension. To assist studies of promoter control we therefore determined the 5'-flanking sequence of the human gene (REN) to residue -2750 relative to the transcription start site (+1). Sites of homology to consensus sequences for binding of trans-acting factors involved in transcriptional control of other genes were identified, and functionality for two of these (a CRE and Pit-1 site) have so far been demonstrated.

Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR

DOE Office of Scientific and Technical Information (OSTI.GOV)

D`Souza, T.M.; Boominathan, K.; Reddy, C.A.

1996-10-01

Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum,more » Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.« less

Sequence specificity of the human mRNA N6-adenosine methylase in vitro.

PubMed Central

Harper, J E; Miceli, S M; Roberts, R J; Manley, J L

1990-01-01

N6-adenosine methylation is a frequent modification of mRNAs and their precursors, but little is known about the mechanism of the reaction or the function of the modification. To explore these questions, we developed conditions to examine N6-adenosine methylase activity in HeLa cell nuclear extracts. Transfer of the methyl group from S-[3H methyl]-adenosylmethionine to unlabeled random copolymer RNA substrates of varying ribonucleotide composition revealed a substrate specificity consistent with a previously deduced consensus sequence, Pu[G greater than A]AC[A/C/U]. 32-P labeled RNA substrates of defined sequence were used to examine the minimum sequence requirements for methylation. Each RNA was 20 nucleotides long, and contained either the core consensus sequence GGACU, or some variation of this sequence. RNAs containing GGACU, either in single or multiple copies, were good substrates for methylation, whereas RNAs containing single base substitutions within the GGACU sequence gave dramatically reduced methylation. These results demonstrate that the N6-adenosine methylase has a strict sequence specificity, and that there is no requirement for extended sequences or secondary structures for methylation. Recognition of this sequence does not require an RNA component, as micrococcal nuclease pretreatment of nuclear extracts actually increased methylation efficiency. Images PMID:2216767

Transcriptome Analysis and Comparison of Marmota monax and Marmota himalayana.

PubMed

Liu, Yanan; Wang, Baoju; Wang, Lu; Vikash, Vikash; Wang, Qin; Roggendorf, Michael; Lu, Mengji; Yang, Dongliang; Liu, Jia

2016-01-01

The Eastern woodchuck (Marmota monax) is a classical animal model for studying hepatitis B virus (HBV) infection and hepatocellular carcinoma (HCC) in humans. Recently, we found that Marmota himalayana, an Asian animal species closely related to Marmota monax, is susceptible to woodchuck hepatitis virus (WHV) infection and can be used as a new mammalian model for HBV infection. However, the lack of genomic sequence information of both Marmota models strongly limited their application breadth and depth. To address this major obstacle of the Marmota models, we utilized Illumina RNA-Seq technology to sequence the cDNA libraries of liver and spleen samples of two Marmota monax and four Marmota himalayana. In total, over 13 billion nucleotide bases were sequenced and approximately 1.5 billion clean reads were obtained. Following assembly, 106,496 consensus sequences of Marmota monax and 78,483 consensus sequences of Marmota himalayana were detected. For functional annotation, in total 73,603 Unigenes of Marmota monax and 78,483 Unigenes of Marmota himalayana were identified using different databases (NR, NT, Swiss-Prot, KEGG, COG, GO). The Unigenes were aligned by blastx to protein databases to decide the coding DNA sequences (CDS) and in total 41,247 CDS of Marmota monax and 34,033 CDS of Marmota himalayana were predicted. The single nucleotide polymorphisms (SNPs) and the simple sequence repeats (SSRs) were also analyzed for all Unigenes obtained. Moreover, a large-scale transcriptome comparison was performed and revealed a high similarity in transcriptome sequences between the two marmota species. Our study provides an extensive amount of novel sequence information for Marmota monax and Marmota himalayana. This information may serve as a valuable genomics resource for further molecular, developmental and comparative evolutionary studies, as well as for the identification and characterization of functional genes that are involved in WHV infection and HCC development in the woodchuck model.

Transcriptome Analysis and Comparison of Marmota monax and Marmota himalayana

PubMed Central

Wang, Lu; Vikash, Vikash; Wang, Qin; Roggendorf, Michael; Lu, Mengji; Yang, Dongliang; Liu, Jia

2016-01-01

The Eastern woodchuck (Marmota monax) is a classical animal model for studying hepatitis B virus (HBV) infection and hepatocellular carcinoma (HCC) in humans. Recently, we found that Marmota himalayana, an Asian animal species closely related to Marmota monax, is susceptible to woodchuck hepatitis virus (WHV) infection and can be used as a new mammalian model for HBV infection. However, the lack of genomic sequence information of both Marmota models strongly limited their application breadth and depth. To address this major obstacle of the Marmota models, we utilized Illumina RNA-Seq technology to sequence the cDNA libraries of liver and spleen samples of two Marmota monax and four Marmota himalayana. In total, over 13 billion nucleotide bases were sequenced and approximately 1.5 billion clean reads were obtained. Following assembly, 106,496 consensus sequences of Marmota monax and 78,483 consensus sequences of Marmota himalayana were detected. For functional annotation, in total 73,603 Unigenes of Marmota monax and 78,483 Unigenes of Marmota himalayana were identified using different databases (NR, NT, Swiss-Prot, KEGG, COG, GO). The Unigenes were aligned by blastx to protein databases to decide the coding DNA sequences (CDS) and in total 41,247 CDS of Marmota monax and 34,033 CDS of Marmota himalayana were predicted. The single nucleotide polymorphisms (SNPs) and the simple sequence repeats (SSRs) were also analyzed for all Unigenes obtained. Moreover, a large-scale transcriptome comparison was performed and revealed a high similarity in transcriptome sequences between the two marmota species. Our study provides an extensive amount of novel sequence information for Marmota monax and Marmota himalayana. This information may serve as a valuable genomics resource for further molecular, developmental and comparative evolutionary studies, as well as for the identification and characterization of functional genes that are involved in WHV infection and HCC development in the woodchuck model. PMID:27806133

Cloning and sequence analysis of the invertase gene INV 1 from the yeast Pichia anomala.

PubMed

Pérez, J A; Rodríguez, J; Rodríguez, L; Ruiz, T

1996-02-01

A genomic library from the yeast Pichia anomala has been constructed and employed to clone the gene encoding the sucrose-hydrolysing enzyme invertase by complementation of a sucrose non-fermenting mutant of Saccharomyces cerevisiae. The cloned gene, INV1, was sequenced and found to encode a polypeptide of 550 amino acids which contained a 22 amino-acid signal sequence and ten potential glycosylation sites. The amino-acid sequence shows significant identity with other yeast invertases and also with Kluyveromyces marxianus inulinase, a yeast beta-fructofuranosidase which has a different substrate specificity. The nucleotide sequences of the 5' and 3' non-coding regions were found to contain several consensus motifs probably involved in the initiation and termination of gene transcription.

Identification of IBV QX vaccine markers : Should vaccine acceptance by authorities require similar identifications for all live IBV vaccines?

PubMed

Listorti, Valeria; Laconi, Andrea; Catelli, Elena; Cecchinato, Mattia; Lupini, Caterina; Naylor, Clive J

2017-10-09

IBV genotype QX causes sufficient disease in Europe for several commercial companies to have started developing live attenuated vaccines. Here, one of those vaccines (L1148) was fully consensus sequenced alongside its progenitor field strain (1148-A) to determine vaccine markers, thereby enabling detection on farms. Twenty-eight single nucleotide substitutions were associated with the 1148-A attenuation, of which any combination can identify vaccine L1148 in the field. Sixteen substitutions resulted in amino acid coding changes of which half were in spike. One change in the 1b gene altered the normally highly conserved final 5 nucleotides of the transcription regulatory sequence of the S gene, common to all IBV QX genes. No mutations can currently be associated with the attenuation process. Field vaccination strategies would greatly benefit by such comparative sequence data being mandatorily submitted to regulators prior to vaccine release following a successful registration process. Copyright © 2017. Published by Elsevier Ltd.

Identification of a new genotype H wild-type mumps virus strain and its molecular relatedness to other virulent and attenuated strains.

PubMed

Amexis, Georgios; Rubin, Steven; Chatterjee, Nando; Carbone, Kathryn; Chumakov, Kostantin

2003-06-01

A single clinical isolate of mumps virus designated 88-1961 was obtained from a patient hospitalized with a clinical history of upper respiratory tract infection, parotitis, severe headache, fever and lymphadenopathy. We have sequenced the full-length genome of 88-1961 and compared it against all available full-length sequences of mumps virus. Based upon its nucleotide sequence of the SH gene 88-1961 was identified as a genotype H mumps strain. The overall extent of nucleotide and amino acid differences between each individual gene and protein of 88-1961 and the full-length mumps samples showed that the missense to silent ratios were unevenly distributed. Upon evaluation of the consensus sequence of 88-1961, four positions were found to be clearly heterogeneous at the nucleotide level (NP 315C/T, NP 318C/T, F 271A/C, and HN 855C/T). Sequence analysis revealed that the amino acid sequences for the NP, M, and the L protein were the most conserved, whereas the SH protein exhibited the highest variability among the compared mumps genotypes A, B, and G. No identifying molecular patterns in the non-coding (intergenic) or coding regions of 88-1961 were found when we compared it against relatively virulent (Urabe AM9 B, Glouc1/UK96, 87-1004 and 87-1005) and non-virulent mumps strains (Jeryl Lynn and all Urabe Am9 A substrains). Copyright 2003 Wiley-Liss, Inc.

Discovery and mapping of a new expressed sequence tag-single nucleotide polymorphism and simple sequence repeat panel for large-scale genetic studies and breeding of Theobroma cacao L.

PubMed Central

Allegre, Mathilde; Argout, Xavier; Boccara, Michel; Fouet, Olivier; Roguet, Yolande; Bérard, Aurélie; Thévenin, Jean Marc; Chauveau, Aurélie; Rivallan, Ronan; Clement, Didier; Courtois, Brigitte; Gramacho, Karina; Boland-Augé, Anne; Tahi, Mathias; Umaharan, Pathmanathan; Brunel, Dominique; Lanaud, Claire

2012-01-01

Theobroma cacao is an economically important tree of several tropical countries. Its genetic improvement is essential to provide protection against major diseases and improve chocolate quality. We discovered and mapped new expressed sequence tag-single nucleotide polymorphism (EST-SNP) and simple sequence repeat (SSR) markers and constructed a high-density genetic map. By screening 149 650 ESTs, 5246 SNPs were detected in silico, of which 1536 corresponded to genes with a putative function, while 851 had a clear polymorphic pattern across a collection of genetic resources. In addition, 409 new SSR markers were detected on the Criollo genome. Lastly, 681 new EST-SNPs and 163 new SSRs were added to the pre-existing 418 co-dominant markers to construct a large consensus genetic map. This high-density map and the set of new genetic markers identified in this study are a milestone in cocoa genomics and for marker-assisted breeding. The data are available at http://tropgenedb.cirad.fr. PMID:22210604

A cell-free stock of simian-human immunodeficiency virus that causes AIDS in pig-tailed macaques has a limited number of amino acid substitutions in both SIVmac and HIV-1 regions of the genome and has offered cytotropism.

PubMed

Stephens, E B; Mukherjee, S; Sahni, M; Zhuge, W; Raghavan, R; Singh, D K; Leung, K; Atkinson, B; Li, Z; Joag, S V; Liu, Z Q; Narayan, O

1997-05-12

We have examined both the sequence changes in the LTR, gag, vif, vpr, vpx, tat, rev, vpu, env, and nef genes and the cell tropism of a cell-free stock of chimeric simian-human immunodeficiency virus (SHIV) isolated from the cerebrospinal fluid of a pig-tailed macaque (PNb) that developed AIDS. This virus (SHIVKU-1) is highly pathogenic when inoculated into other macaques. DNA sequence analysis of PCR-amplified products revealed a total of 5 nucleotide changes in the LTR while vif had 2 consensus amino acid changes. The gag, vif, and vpx had no consensus amino acid substitutions, whereas vpr had 1 consensus substitution. The tat and rev genes of the HXB2 region of SHIVKU-1 had 2 and 1 consensus amino acid changes, respectively. The vpu gene of the HXB2 region of SHIV, which originally had an ACG at the beginning of the gene, reverted to an initiation ATG codon and in addition contained a consensus amino acid substitution at position 69 of this protein. As expected, the majority of the nucleotide substitutions were found in the env and nef genes. Thirteen and 5 amino acid changes were predicted for the corresponding Env and Nef proteins, respectively. In addition, one-third of the env gene clones isolated from the SHIVKU-1 stock had a 5-amino-acid deletion in the V4 region. Using three independent assays, we determined that the changes in the SHIVKU-1 were associated with an increase in the efficiency of replication in macrophages. The strikingly few consensus changes in the virus suggest that conversion of this virus to one capable of causing AIDS in pig-tailed macaques was associated with relatively few changes in the viral envelope and/or accessory genes. These results will provide the basis for the development of a pathogenic, molecular clone of SHIV capable of causing AIDS in pig-tailed macaques.

Structure and expression of the attacin genes in Hyalophora cecropia.

PubMed

Sun, S C; Lindström, I; Lee, J Y; Faye, I

1991-02-26

To study the regulation of the immune genes in insects, we have cloned and sequenced the attacin gene locus of the giant silk moth Hyalophora cecropia. The locus contains one acidic and one basic attacin gene as well as two pseudogenes, which are remnants of basic attacin genes. A small insertion element was found within the locus. The two functional attacin genes are transcribed in opposite directions and have two introns inserted at homologous positions. A common sequence, GGGGATTCCT, is found at nucleotide position -48 in the acidic gene and at nucleotide position -58 in the basic gene. Interestingly, this decanucleotide is similar to the consensus of the NF-k B-binding site. Expression studies revealed that both attacins are strongly induced by phorbol 12-myristate 13-acetate, lipopolysaccharide and bacteria. However, only the acidic attacin gene showed a clear response to injury.

Structural organization of the porcine and human genes coding for a leydig cell-specific insulin-like peptide (LEY I-L) and chromosomal localization of the human gene (INSL3)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Burkhardt E.; Adham, I.M.; Brosig, B.

1994-03-01

Leydig insulin-like protein (LEY I-L) is a member of the insulin-like hormone superfamily. The LEY I-L gene (designated INSL3) is expressed exclusively in prenatal and postnatal Leydig cells. The authors report here the cloning and nucleotide sequence of porcine and human LEY I-L genes including the 5[prime] regions. Both genes consist of two exons and one intron. The organization of the LEY I-L gene is similar to that of insulin and relaxin. The transcription start site in the porcine and human LEY I-L gene is localized 13 and 14 bp upstream of the translation start site, respectively. Alignment of themore » 5[prime] flanking regions of both genes reveals that the first 107 nucleotides upstream of the transcription start site exhibit an overall sequence similarity of 80%. This conserved region contains a consensus TATAA box, a CAAT-like element (GAAT), and a consensus SP1 sequence (GGGCGG) at equivalent positions in both genes and therefore may play a role in regulation of expression of the LEY I-L gene. The porcine and human genome contains a single copy of the LEY I-L gene. By in situ hybridization, the human gene was assigned to bands p13.2-p12 of the short arm of chromosome 19. 25 refs., 6 figs.« less

Characterization of sams genes of Amoeba proteus and the endosymbiotic X-bacteria.

PubMed

Jeon, Taeck J; Jeon, Kwang W

2003-01-01

As a result of harboring obligatory bacterial endosymbionts, the xD strain of Amoeba proteus no longer produces its own S-adenosylmethionine synthetase (SAMS). When symbiont-free D amoebae are infected with symbionts (X-bacteria), the amount of amoeba SAMS decreases to a negligible level within four weeks, but about 47% of the SAMS activity, which apparently comes from another source, is still detected. Complete nucleotide sequences of sams genes of D and xD amoebae are presented and show that there are no differences between the two. Long-established xD amoebae contain an intact sams gene and thus the loss of xD amoeba's SAMS is not due to the loss of the gene itself. The open reading frame of the amoeba's sams gene has 1,281 nucleotides, encoding SAMS of 426 amino acids with a mass of 48 kDa and pI of 6.5. The amino acid sequence of amoeba SAMS is longer than the SAMS of other organisms by having an extra internal stretch of 28 amino acids. The 5'-flanking region of amoeba sams contains consensus-binding sites for several transcription factors that are related to the regulation of sams genes in E. coli and yeast. The complete nucleotide sequence of the symbiont's sams gene is also presented. The open reading frame of X-bacteria sams is 1,146 nucleotides long, encoding SAMS of 381 amino acids with a mass of 41 kDa and pI of 6.0. The X-bacteria SAMS has 45% sequence identity with that of A. proteus.

Identification and cloning of a gamma 3 subunit splice variant of the human GABA(A) receptor.

PubMed

Poulsen, C F; Christjansen, K N; Hastrup, S; Hartvig, L

2000-05-31

cDNA sequences encoding two forms of the GABA(A) gamma 3 receptor subunit were cloned from human hippocampus. The nucleotide sequences differ by the absence (gamma 3S) or presence (gamma 3L) of 18 bp located in the presumed intracellular loop between transmembrane region (TM) III and IV. The extra 18 bp in the gamma 3L subunit generates a consensus site for phosphorylation by protein kinase C (PKC). Analysis of human genomic DNA encoding the gamma 3 subunit reveals that the 18 bp insert is contiguous with the upstream proximal exon.

Insights Into Upland Cotton (Gossypium hirsutum L.) Genetic Recombination Based on 3 High-Density Single-Nucleotide Polymorphism and a Consensus Map Developed Independently With Common Parents.

PubMed

Ulloa, Mauricio; Hulse-Kemp, Amanda M; De Santiago, Luis M; Stelly, David M; Burke, John J

2017-01-01

High-density linkage maps are vital to supporting the correct placement of scaffolds and gene sequences on chromosomes and fundamental to contemporary organismal research and scientific approaches to genetic improvement, especially in paleopolyploids with exceptionally complex genomes, eg, upland cotton ( Gossypium hirsutum L., "2n = 52"). Three independently developed intraspecific upland mapping populations were analyzed to generate 3 high-density genetic linkage single-nucleotide polymorphism (SNP) maps and a consensus map using the CottonSNP63K array. The populations consisted of a previously reported F 2 , a recombinant inbred line (RIL), and reciprocal RIL population, from "Phytogen 72" and "Stoneville 474" cultivars. The cluster file provided 7417 genotyped SNP markers, resulting in 26 linkage groups corresponding to the 26 chromosomes (c) of the allotetraploid upland cotton (AD) 1 arisen from the merging of 2 genomes ("A" Old World and "D" New World). Patterns of chromosome-specific recombination were largely consistent across mapping populations. The high-density genetic consensus map included 7244 SNP markers that spanned 3538 cM and comprised 3824 SNP bins, of which 1783 and 2041 were in the A t and D t subgenomes with 1825 and 1713 cM map lengths, respectively. Subgenome average distances were nearly identical, indicating that subgenomic differences in bin number arose due to the high numbers of SNPs on the D t subgenome. Examination of expected recombination frequency or crossovers (COs) on the chromosomes within each population of the 2 subgenomes revealed that COs were also not affected by the SNPs or SNP bin number in these subgenomes. Comparative alignment analyses identified historical ancestral A t -subgenomic translocations of c02 and c03, as well as of c04 and c05. The consensus map SNP sequences aligned with high congruency to the NBI assembly of Gossypium hirsutum . However, the genomic comparisons revealed evidence of additional unconfirmed possible duplications, inversions and translocations, and unbalance SNP sequence homology or SNP sequence/loci genomic dominance, or homeolog loci bias of the upland tetraploid A t and D t subgenomes. The alignments indicated that 364 SNP-associated previously unintegrated scaffolds can be placed in pseudochromosomes of the NBI G hirsutum assembly. This is the first intraspecific SNP genetic linkage consensus map assembled in G hirsutum with a core of reproducible mendelian SNP markers assayed on different populations and it provides further knowledge of chromosome arrangement of genic and nongenic SNPs. Together, the consensus map and RIL populations provide a synergistically useful platform for localizing and identifying agronomically important loci for improvement of the cotton crop.

srRNA evolution and phylogenetic relationships of the genus Naegleria (Protista: Rhizopoda).

PubMed

Baverstock, P R; Illana, S; Christy, P E; Robinson, B S; Johnson, A M

1989-05-01

A rapid RNA sequencing technique was used to partially sequence the small-subunit ribosomal RNA (srRNA) of four species of the amoeboid genus Naegleria. The extent of nucleotide sequence divergence between the two most divergent species was roughly similar to that found between mammals and frogs. However, the pattern of variation among the Naegleria species was quite different from that found for those species of tetrapods characterized to date. A phylogenetic analysis of the consensus Naegleria sequence showed that Naegleria was not monophyletic with either Acanthamoeba castellanii or Dictyostelium discoideum, two other amoebas for which sequences were available. It was shown that the semiconserved regions of the srRNA molecule evolve in a clocklike fashion and that the clock is time dependent rather than generation dependent.

Sequence analysis and expression of the M1 and M2 matrix protein genes of hirame rhabdovirus (HIRRV)

USGS Publications Warehouse

Nishizawa, T.; Kurath, G.; Winton, J.R.

1997-01-01

We have cloned and sequenced a 2318 nucleotide region of the genomic RNA of hirame rhabdovirus (HIRRV), an important viral pathogen of Japanese flounder Paralichthys olivaceus. This region comprises approximately two-thirds of the 3' end of the nucleocapsid protein (N) gene and the complete matrix protein (M1 and M2) genes with the associated intergenic regions. The partial N gene sequence was 812 nucleotides in length with an open reading frame (ORF) that encoded the carboxyl-terminal 250 amino acids of the N protein. The M1 and M2 genes were 771 and 700 nucleotides in length, respectively, with ORFs encoding proteins of 227 and 193 amino acids. The M1 gene sequence contained an additional small ORF that could encode a highly basic, arginine-rich protein of 25 amino acids. Comparisons of the N, M1, and M2 gene sequences of HIRRV with the corresponding sequences of the fish rhabdoviruses, infectious hematopoietic necrosis virus (IHNV) or viral hemorrhagic septicemia virus (VHSV) indicated that HIRRV was more closely related to IHNV than to VHSV, but was clearly distinct from either. The putative consensus gene termination sequence for IHNV and VHSV, AGAYAG(A)(7), was present in the N-M1, M1-M2, and M2-G intergenic regions of HIRRV as were the putative transcription initiation sequences YGGCAC and AACA. An Escherichia coli expression system was used to produce recombinant proteins from the M1 and M2 genes of HIRRV. These were the same size as the authentic M1 and M2 proteins and reacted with anti-HIRRV rabbit serum in western blots. These reagents can be used for further study of the fish immune response and to test novel control methods.

Regulation of the alpha-glucuronidase-encoding gene ( aguA) from Aspergillus niger.

PubMed

de Vries, R P; van de Vondervoort, P J I; Hendriks, L; van de Belt, M; Visser, J

2002-09-01

The alpha-glucuronidase gene aguA from Aspergillus niger was cloned and characterised. Analysis of the promoter region of aguA revealed the presence of four putative binding sites for the major carbon catabolite repressor protein CREA and one putative binding site for the transcriptional activator XLNR. In addition, a sequence motif was detected which differed only in the last nucleotide from the XLNR consensus site. A construct in which part of the aguA coding region was deleted still resulted in production of a stable mRNA upon transformation of A. niger. The putative XLNR binding sites and two of the putative CREA binding sites were mutated individually in this construct and the effects on expression were examined in A. niger transformants. Northern analysis of the transformants revealed that the consensus XLNR site is not actually functional in the aguA promoter, whereas the sequence that diverges from the consensus at a single position is functional. This indicates that XLNR is also able to bind to the sequence GGCTAG, and the XLNR binding site consensus should therefore be changed to GGCTAR. Both CREA sites are functional, indicating that CREA has a strong influence on aguA expression. A detailed expression analysis of aguA in four genetic backgrounds revealed a second regulatory system involved in activation of aguA gene expression. This system responds to the presence of glucuronic and galacturonic acids, and is not dependent on XLNR.

Randomization and In Vivo Selection Reveal a GGRG Motif Essential for Packaging Human Immunodeficiency Virus Type 2 RNA ▿ †

PubMed Central

Baig, Tayyba T.; Lanchy, Jean-Marc; Lodmell, J. Stephen

2009-01-01

The packaging signal (ψ) of human immunodeficiency virus type 2 (HIV-2) is present in the 5′ noncoding region of RNA and contains a 10-nucleotide palindrome (pal; 5′-392-GGAGUGCUCC) located upstream of the dimerization signal stem-loop 1 (SL1). pal has been shown to be functionally important in vitro and in vivo. We previously showed that the 3′ side of pal (GCUCC-3′) is involved in base-pairing interactions with a sequence downstream of SL1 to make an extended SL1, which is important for replication in vivo and the regulation of dimerization in vitro. However, the role of the 5′ side of pal (5′-GGAGU) was less clear. Here, we characterized this role using an in vivo SELEX approach. We produced a population of HIV-2 DNA genomes with random sequences within the 5′ side of pal and transfected these into COS-7 cells. Viruses from COS-7 cells were used to infect C8166 permissive cells. After several weeks of serial passage in C8166 cells, surviving viruses were sequenced. On the 5′ side of pal there was a striking convergence toward a GGRGN consensus sequence. Individual clones with consensus and nonconsensus sequences were tested in infectivity and packaging assays. Analysis of individuals that diverged from the consensus sequence showed normal viral RNA and protein synthesis but had replication defects and impaired RNA packaging. These findings clearly indicate that the GGRG motif is essential for viral replication and genomic RNA packaging. PMID:18971263

Complete genome sequences of two strains of Treponema pallidum subsp. pertenue from Ghana, Africa: Identical genome sequences in samples isolated more than 7 years apart.

PubMed

Strouhal, Michal; Mikalová, Lenka; Havlíčková, Pavla; Tenti, Paolo; Čejková, Darina; Rychlík, Ivan; Bruisten, Sylvia; Šmajs, David

2017-09-01

Treponema pallidum subsp. pertenue (TPE) is the causative agent of yaws, a multi-stage disease, endemic in tropical regions of Africa, Asia, Oceania, and South America. To date, four TPE strains have been completely sequenced including three TPE strains of human origin (Samoa D, CDC-2, and Gauthier) and one TPE strain (Fribourg-Blanc) isolated from a baboon. All TPE strains are highly similar to T. pallidum subsp. pallidum (TPA) strains. The mutation rate in syphilis and related treponemes has not been experimentally determined yet. Complete genomes of two TPE strains, CDC 2575 and Ghana-051, that infected patients in Ghana and were isolated in 1980 and 1988, respectively, were sequenced and analyzed. Both strains had identical consensus genome nucleotide sequences raising the question whether TPE CDC 2575 and Ghana-051 represent two different strains. Several lines of evidence support the fact that both strains represent independent samples including regions showing intrastrain heterogeneity (13 and 5 intrastrain heterogeneous sites in TPE Ghana-051 and TPE CDC 2575, respectively). Four of these heterogeneous sites were found in both genomes but the frequency of alternative alleles differed. The identical consensus genome sequences were used to estimate the upper limit of the yaws treponeme evolution rate, which was 4.1 x 10-10 nucleotide changes per site per generation. The estimated upper limit for the mutation rate of TPE was slightly lower than the mutation rate of E. coli, which was determined during a long-term experiment. Given the known diversity between TPA and TPE genomes and the assumption that both TPA and TPE have a similar mutation rate, the most recent common ancestor of syphilis and yaws treponemes appears to be more than ten thousand years old and likely even older.

CircularLogo: A lightweight web application to visualize intra-motif dependencies.

PubMed

Ye, Zhenqing; Ma, Tao; Kalmbach, Michael T; Dasari, Surendra; Kocher, Jean-Pierre A; Wang, Liguo

2017-05-22

The sequence logo has been widely used to represent DNA or RNA motifs for more than three decades. Despite its intelligibility and intuitiveness, the traditional sequence logo is unable to display the intra-motif dependencies and therefore is insufficient to fully characterize nucleotide motifs. Many methods have been developed to quantify the intra-motif dependencies, but fewer tools are available for visualization. We developed CircularLogo, a web-based interactive application, which is able to not only visualize the position-specific nucleotide consensus and diversity but also display the intra-motif dependencies. Applying CircularLogo to HNF6 binding sites and tRNA sequences demonstrated its ability to show intra-motif dependencies and intuitively reveal biomolecular structure. CircularLogo is implemented in JavaScript and Python based on the Django web framework. The program's source code and user's manual are freely available at http://circularlogo.sourceforge.net . CircularLogo web server can be accessed from http://bioinformaticstools.mayo.edu/circularlogo/index.html . CircularLogo is an innovative web application that is specifically designed to visualize and interactively explore intra-motif dependencies.

A single alteration 20 nt 5′ to an editing target inhibits chloroplast RNA editing in vivo

PubMed Central

Reed, Martha L.; Peeters, Nemo M.; Hanson, Maureen R.

2001-01-01

Transcripts of typical dicot plant plastid genes undergo C→U RNA editing at approximately 30 locations, but there is no consensus sequence surrounding the C targets of editing. The cis-acting elements required for editing of the C located at tobacco rpoB editing site II were investigated by introducing translatable chimeric minigenes containing sequence –20 to +6 surrounding the C target of editing. When the –20 to +6 sequence specified by the homologous region present in the black pine chloroplast genome was incorporated, virtually no editing of the transcripts occurred in transgenic tobacco plastids. Nucleotides that differ between the black pine and tobacco sequence were tested for their role in C→U editing by designing chimeric genes containing one or more of these divergent nucleotides. Surprisingly, the divergent nucleotide that had the strongest negative effect on editing of the minigene transcript was located –20 nt 5′ to the C target of editing. Expression of transgene transcripts carrying the 27 nt sequence did not affect the editing extent of the endogenous rpoB transcripts, even though the chimeric transcripts were much more abundant than those of the endogenous gene. In plants carrying a 93 nt rpoB editing site sequence, transgene transcripts accumulated to a level three times greater than transgene transcripts in the plants carrying the 27 nt rpoB editing sites and resulted in editing of the endogenous transcripts from 100 to 50%. Both a lower affinity of the 27 nt site for a trans-acting factor and lower abundance of the transcript could explain why expression of minigene transcripts containing the 27 nt sequence did not affect endogenous editing. PMID:11266552

Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

PubMed

Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

1991-02-15

The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

Differentiated evolutionary conservatism and lack of polymorphism of crucial sex determination genes (SRY and SOX9) in four species of the family Canidae.

PubMed

Nowacka-Woszuk, Joanna; Switonski, Marek

2009-01-01

The sex determination process is under the control of several genes of which two (SRY and SOX9), encoding transcription factors, play a crucial role. It is well-known that mutations at these genes may cause the development of an intersexual phenotype. The aim of this study was to conduct a comparative analysis of the coding sequence and 5'-flanking regions of both genes in four species of the family Canidae (the dog, red fox, arctic fox and Chinese raccoon dog). Similarity of the coding sequence of the SOX9 gene among the studied species was higher (99.7-99.9%) than in the case of the SRY gene (96.7-97.3%). Only single nucleotide changes were found in the compared coding sequences, whereas in the 5'-flanking region of both genes nucleotide substitutions, as well as insertions and deletions were observed. None of the changes detected in the 5'-flanking region occurred within the potential consensus sequences for transcription factors. No polymorphism was found for either of these genes in any of the analyzed species.

Cloning and expression of UDP-glucose: flavonoid 7-O-glucosyltransferase from hairy root cultures of Scutellaria baicalensis.

PubMed

Hirotani, M; Kuroda, R; Suzuki, H; Yoshikawa, T

2000-05-01

A cDNA encoding UDP-glucose: baicalein 7-O-glucosyltransferase (UBGT) was isolated from a cDNA library from hairy root cultures of Scutellaria baicalensis Georgi probed with a partial-length cDNA clone of a UDP-glucose: flavonoid 3-O-glucosyltransferase (UFGT) from grape (Vitis vinifera L.). The heterologous probe contained a glucosyltransferase consensus amino acid sequence which was also present in the Scutellaria cDNA clones. The complete nucleotide sequence of the 1688-bp cDNA insert was determined and the deduced amino acid sequences are presented. The nucleotide sequence analysis of UBGT revealed an open reading frame encoding a polypeptide of 476 amino acids with a calculated molecular mass of 53,094 Da. The reaction product for baicalein and UDP-glucose catalyzed by recombinant UBGT in Escherichia coli was identified as authentic baicalein 7-O-glucoside using high-performance liquid chromatography and proton nuclear magnetic resonance spectroscopy. The enzyme activities of recombinant UBGT expressed in E. coli were also detected towards flavonoids such as baicalein, wogonin, apigenin, scutellarein, 7,4'-dihydroxyflavone and kaempferol, and phenolic compounds. The accumulation of UBGT mRNA in hairy roots was in response to wounding or salicylic acid treatments.

Process of labeling specific chromosomes using recombinant repetitive DNA

DOEpatents

Moyzis, R.K.; Meyne, J.

1988-02-12

Chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family members and consensus sequences of the repetitive DNA families for the chromosome preferential sequences. The selected low homology regions are then hybridized with chromosomes to determine those low homology regions hybridized with a specific chromosome under normal stringency conditions.

Structure of the coding region and mRNA variants of the apyrase gene from pea (Pisum sativum)

NASA Technical Reports Server (NTRS)

Shibata, K.; Abe, S.; Davies, E.

2001-01-01

Partial amino acid sequences of a 49 kDa apyrase (ATP diphosphohydrolase, EC 3.6.1.5) from the cytoskeletal fraction of etiolated pea stems were used to derive oligonucleotide DNA primers to generate a cDNA fragment of pea apyrase mRNA by RT-PCR and these primers were used to screen a pea stem cDNA library. Two almost identical cDNAs differing in just 6 nucleotides within the coding regions were found, and these cDNA sequences were used to clone genomic fragments by PCR. Two nearly identical gene fragments containing 8 exons and 7 introns were obtained. One of them (H-type) encoded the mRNA sequence described by Hsieh et al. (1996) (DDBJ/EMBL/GenBank Z32743), while the other (S-type) differed by the same 6 nucleotides as the mRNAs, suggesting that these genes may be alleles. The six nucleotide differences between these two alleles were found solely in the first exon, and these mutation sites had two types of consensus sequences. These mRNAs were found with varying lengths of 3' untranslated regions (3'-UTR). There are some similarities between the 3'-UTR of these mRNAs and those of actin and actin binding proteins in plants. The putative roles of the 3'-UTR and alternative polyadenylation sites are discussed in relation to their possible role in targeting the mRNAs to different subcellular compartments.

Molecular cloning of actin genes in Trichomonas vaginalis and phylogeny inferred from actin sequences.

PubMed

Bricheux, G; Brugerolle, G

1997-08-01

The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.

Human Splice-Site Prediction with Deep Neural Networks.

PubMed

Naito, Tatsuhiko

2018-04-18

Accurate splice-site prediction is essential to delineate gene structures from sequence data. Several computational techniques have been applied to create a system to predict canonical splice sites. For classification tasks, deep neural networks (DNNs) have achieved record-breaking results and often outperformed other supervised learning techniques. In this study, a new method of splice-site prediction using DNNs was proposed. The proposed system receives an input sequence data and returns an answer as to whether it is splice site. The length of input is 140 nucleotides, with the consensus sequence (i.e., "GT" and "AG" for the donor and acceptor sites, respectively) in the middle. Each input sequence model is applied to the pretrained DNN model that determines the probability that an input is a splice site. The model consists of convolutional layers and bidirectional long short-term memory network layers. The pretraining and validation were conducted using the data set tested in previously reported methods. The performance evaluation results showed that the proposed method can outperform the previous methods. In addition, the pattern learned by the DNNs was visualized as position frequency matrices (PFMs). Some of PFMs were very similar to the consensus sequence. The trained DNN model and the brief source code for the prediction system are uploaded. Further improvement will be achieved following the further development of DNNs.

Population-genomic variation within RNA viruses of the Western honey bee, Apis mellifera, inferred from deep sequencing

PubMed Central

2013-01-01

Background Deep sequencing of viruses isolated from infected hosts is an efficient way to measure population-genetic variation and can reveal patterns of dispersal and natural selection. In this study, we mined existing Illumina sequence reads to investigate single-nucleotide polymorphisms (SNPs) within two RNA viruses of the Western honey bee (Apis mellifera), deformed wing virus (DWV) and Israel acute paralysis virus (IAPV). All viral RNA was extracted from North American samples of honey bees or, in one case, the ectoparasitic mite Varroa destructor. Results Coverage depth was generally lower for IAPV than DWV, and marked gaps in coverage occurred in several narrow regions (< 50 bp) of IAPV. These coverage gaps occurred across sequencing runs and were virtually unchanged when reads were re-mapped with greater permissiveness (up to 8% divergence), suggesting a recurrent sequencing artifact rather than strain divergence. Consensus sequences of DWV for each sample showed little phylogenetic divergence, low nucleotide diversity, and strongly negative values of Fu and Li’s D statistic, suggesting a recent population bottleneck and/or purifying selection. The Kakugo strain of DWV fell outside of all other DWV sequences at 100% bootstrap support. IAPV consensus sequences supported the existence of multiple clades as had been previously reported, and Fu and Li’s D was closer to neutral expectation overall, although a sliding-window analysis identified a significantly positive D within the protease region, suggesting selection maintains diversity in that region. Within-sample mean diversity was comparable between the two viruses on average, although for both viruses there was substantial variation among samples in mean diversity at third codon positions and in the number of high-diversity sites. FST values were bimodal for DWV, likely reflecting neutral divergence in two low-diversity populations, whereas IAPV had several sites that were strong outliers with very low FST. Conclusions This initial survey of genetic variation within honey bee RNA viruses suggests future directions for studies examining the underlying causes of population-genetic structure in these economically important pathogens. PMID:23497218

Population-genomic variation within RNA viruses of the Western honey bee, Apis mellifera, inferred from deep sequencing.

PubMed

Cornman, Robert Scott; Boncristiani, Humberto; Dainat, Benjamin; Chen, Yanping; vanEngelsdorp, Dennis; Weaver, Daniel; Evans, Jay D

2013-03-07

Deep sequencing of viruses isolated from infected hosts is an efficient way to measure population-genetic variation and can reveal patterns of dispersal and natural selection. In this study, we mined existing Illumina sequence reads to investigate single-nucleotide polymorphisms (SNPs) within two RNA viruses of the Western honey bee (Apis mellifera), deformed wing virus (DWV) and Israel acute paralysis virus (IAPV). All viral RNA was extracted from North American samples of honey bees or, in one case, the ectoparasitic mite Varroa destructor. Coverage depth was generally lower for IAPV than DWV, and marked gaps in coverage occurred in several narrow regions (< 50 bp) of IAPV. These coverage gaps occurred across sequencing runs and were virtually unchanged when reads were re-mapped with greater permissiveness (up to 8% divergence), suggesting a recurrent sequencing artifact rather than strain divergence. Consensus sequences of DWV for each sample showed little phylogenetic divergence, low nucleotide diversity, and strongly negative values of Fu and Li's D statistic, suggesting a recent population bottleneck and/or purifying selection. The Kakugo strain of DWV fell outside of all other DWV sequences at 100% bootstrap support. IAPV consensus sequences supported the existence of multiple clades as had been previously reported, and Fu and Li's D was closer to neutral expectation overall, although a sliding-window analysis identified a significantly positive D within the protease region, suggesting selection maintains diversity in that region. Within-sample mean diversity was comparable between the two viruses on average, although for both viruses there was substantial variation among samples in mean diversity at third codon positions and in the number of high-diversity sites. FST values were bimodal for DWV, likely reflecting neutral divergence in two low-diversity populations, whereas IAPV had several sites that were strong outliers with very low FST. This initial survey of genetic variation within honey bee RNA viruses suggests future directions for studies examining the underlying causes of population-genetic structure in these economically important pathogens.

The diploid genome sequence of an Asian individual

PubMed Central

Wang, Jun; Wang, Wei; Li, Ruiqiang; Li, Yingrui; Tian, Geng; Goodman, Laurie; Fan, Wei; Zhang, Junqing; Li, Jun; Zhang, Juanbin; Guo, Yiran; Feng, Binxiao; Li, Heng; Lu, Yao; Fang, Xiaodong; Liang, Huiqing; Du, Zhenglin; Li, Dong; Zhao, Yiqing; Hu, Yujie; Yang, Zhenzhen; Zheng, Hancheng; Hellmann, Ines; Inouye, Michael; Pool, John; Yi, Xin; Zhao, Jing; Duan, Jinjie; Zhou, Yan; Qin, Junjie; Ma, Lijia; Li, Guoqing; Yang, Zhentao; Zhang, Guojie; Yang, Bin; Yu, Chang; Liang, Fang; Li, Wenjie; Li, Shaochuan; Li, Dawei; Ni, Peixiang; Ruan, Jue; Li, Qibin; Zhu, Hongmei; Liu, Dongyuan; Lu, Zhike; Li, Ning; Guo, Guangwu; Zhang, Jianguo; Ye, Jia; Fang, Lin; Hao, Qin; Chen, Quan; Liang, Yu; Su, Yeyang; san, A.; Ping, Cuo; Yang, Shuang; Chen, Fang; Li, Li; Zhou, Ke; Zheng, Hongkun; Ren, Yuanyuan; Yang, Ling; Gao, Yang; Yang, Guohua; Li, Zhuo; Feng, Xiaoli; Kristiansen, Karsten; Wong, Gane Ka-Shu; Nielsen, Rasmus; Durbin, Richard; Bolund, Lars; Zhang, Xiuqing; Li, Songgang; Yang, Huanming; Wang, Jian

2009-01-01

Here we present the first diploid genome sequence of an Asian individual. The genome was sequenced to 36-fold average coverage using massively parallel sequencing technology. We aligned the short reads onto the NCBI human reference genome to 99.97% coverage, and guided by the reference genome, we used uniquely mapped reads to assemble a high-quality consensus sequence for 92% of the Asian individual's genome. We identified approximately 3 million single-nucleotide polymorphisms (SNPs) inside this region, of which 13.6% were not in the dbSNP database. Genotyping analysis showed that SNP identification had high accuracy and consistency, indicating the high sequence quality of this assembly. We also carried out heterozygote phasing and haplotype prediction against HapMap CHB and JPT haplotypes (Chinese and Japanese, respectively), sequence comparison with the two available individual genomes (J. D. Watson and J. C. Venter), and structural variation identification. These variations were considered for their potential biological impact. Our sequence data and analyses demonstrate the potential usefulness of next-generation sequencing technologies for personal genomics. PMID:18987735

Characterization of kinetoplast DNA from Phytomonas serpens.

PubMed

Sá-Carvalho, D; Perez-Morga, D; Traub-Cseko, Y M

1993-01-01

The restriction enzyme digestion of kinetoplast DNA from four Phytomonas serpens isolates shows an overall similar band pattern. One minicircle from isolate 30T was cloned and sequenced, showing low levels of homology but the same general features and organization as described for minicircles of other trypanosomatids. Extensive regions of the minicircle are composed by G and T on the H strand. These regions are very repetitive and similar to regions in a minicircle of Crithidia oncopelti and to telomeric sequences of Saccharomyces cerevisiae. Conserved Sequence Block 3, present in all trypanosomatids, is one nucleotide different from the consensus in P. serpens and provides a basis to differentiate P. serpens from other trypanosomatids. Electron microscopy of kinetoplast DNA evidenced a network with organization similar to other trypanosomatids and the measurement of minicircles confirmed the size of about 1.45 kb of the sequenced minicircle.

Development of an oligonucleotide probe for Aureobasidium pullulans based on the small-subunit rRNA gene.

PubMed Central

Li, S; Cullen, D; Hjort, M; Spear, R; Andrews, J H

1996-01-01

Aureobasidium pullulans, a cosmopolitan yeast-like fungus, colonizes leaf surfaces and has potential as a biocontrol agent of pathogens. To assess the feasibility of rRNA as a target for A. pullulans-specific oligonucleotide probes, we compared the nucleotide sequences of the small-subunit rRNA (18S) genes of 12 geographically diverse A. pullulans strains. Extreme sequence conservation was observed. The consensus A. pullulans sequence was compared with other fungal sequences to identify potential probes. A 21-mer probe which hybridized to the 12 A. pullulans strains but not to 98 other fungi, including 82 isolates from the phylloplane, was identified. A 17-mer highly specific for Cladosporium herbarum was also identified. These probes have potential in monitoring and quantifying fungi in leaf surface and other microbial communities. PMID:8633850

Sequence of a second gene encoding bovine submaxillary mucin: implication for mucin heterogeneity and cloning.

PubMed

Jiang, W; Woitach, J T; Gupta, D; Bhavanandan, V P

1998-10-20

Secreted epithelial mucins are extremely large and heterogeneous glycoproteins. We report the 5 kilobase DNA sequence of a second gene, BSM2, which encodes bovine submaxillary mucin. The determined nucleotide and deduced amino acid sequences of BSM2 are 95.2% and 92. 2% identical, respectively, to those of the previously described BSM1 gene isolated from the same cow. Further, the five predicted protein domains of the two genes are 100%, 94%, 93%, 77%, and 88% identical. Based on the above results, we propose that expression of multiple homologous core proteins from a single animal is a factor in generating diversity of saccharides in mucins and in providing resistance of the molecules to proteolysis. In addition, this work raises several important issues in mucin cloning such as assembling sequences from seemingly overlapping clones and deducing consensus sequences for nearly identical tandem repeats. Copyright 1998 Academic Press.

Location analysis for the estrogen receptor-α reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements

PubMed Central

Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.

2010-01-01

Location analysis for estrogen receptor-α (ERα)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERα-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10–20% nucleotide deviation from the canonical ERE sequence. We demonstrate that ∼50% of all ERα-bound loci do not have a discernable ERE and show that most ERα-bound EREs are not perfect consensus EREs. Approximately one-third of all ERα-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERα-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERα binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers. PMID:20047966

Location analysis for the estrogen receptor-alpha reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements.

PubMed

Mason, Christopher E; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M; Kallen, Roland G; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B

2010-04-01

Location analysis for estrogen receptor-alpha (ERalpha)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERalpha-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10-20% nucleotide deviation from the canonical ERE sequence. We demonstrate that approximately 50% of all ERalpha-bound loci do not have a discernable ERE and show that most ERalpha-bound EREs are not perfect consensus EREs. Approximately one-third of all ERalpha-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERalpha-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERalpha binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers.

PigGIS: Pig Genomic Informatics System

PubMed Central

Ruan, Jue; Guo, Yiran; Li, Heng; Hu, Yafeng; Song, Fei; Huang, Xin; Kristiensen, Karsten; Bolund, Lars; Wang, Jun

2007-01-01

Pig Genomic Information System (PigGIS) is a web-based depository of pig (Sus scrofa) genomic learning mainly engineered for biomedical research to locate pig genes from their human homologs and position single nucleotide polymorphisms (SNPs) in different pig populations. It utilizes a variety of sequence data, including whole genome shotgun (WGS) reads and expressed sequence tags (ESTs), and achieves a successful mapping solution to the low-coverage genome problem. With the data presently available, we have identified a total of 15 700 pig consensus sequences covering 18.5 Mb of the homologous human exons. We have also recovered 18 700 SNPs and 20 800 unique 60mer oligonucleotide probes for future pig genome analyses. PigGIS can be freely accessed via the web at and . PMID:17090590

Sequences within the 5' untranslated region regulate the levels of a kinetoplast DNA topoisomerase mRNA during the cell cycle.

PubMed Central

Pasion, S G; Hines, J C; Ou, X; Mahmood, R; Ray, D S

1996-01-01

Gene expression in trypanosomatids appears to be regulated largely at the posttranscriptional level and involves maturation of mRNA precursors by trans splicing of a 39-nucleotide miniexon sequence to the 5' end of the mRNA and cleavage and polyadenylation at the 3' end of the mRNA. To initiate the identification of sequences involved in the periodic expression of DNA replication genes in trypanosomatids, we have mapped splice acceptor sites in the 5' flanking region of the TOP2 gene, which encodes the kinetoplast DNA topoisomerase, and have carried out deletion analysis of this region on a plasmid-encoded TOP2 gene. Block deletions within the 5' untranslated region (UTR) identified two regions (-608 to -388 and -387 to -186) responsible for periodic accumulation of the mRNA. Deletion of one or the other of these sequences had no effect on periodic expression of the mRNA, while deletion of both regions resulted in constitutive expression of the mRNA throughout the cell cycle. Subcloning of these sequences into the 5' UTR of a construct lacking both regions of the TOP2 5' UTR has shown that an octamer consensus sequence present in the 5' UTR of the TOP2, RPA1, and DHFR-TS mRNAs is required for normal cycling of the TOP2 mRNA. Mutation of the consensus octamer sequence in the TOP2 5' UTR in a plasmid construct containing only a single consensus octamer and that shows normal cycling of the plasmid-encoded TOP2 mRNA resulted in substantial reduction of the cycling of the mRNA level. These results imply a negative regulation of TOP2 mRNA during the cell cycle by a mechanism involving redundant elements containing one or more copies of a conserved octamer sequence within the 5' UTR of TOP2 mRNA. PMID:8943327

Sequences within the 5' untranslated region regulate the levels of a kinetoplast DNA topoisomerase mRNA during the cell cycle.

PubMed

Pasion, S G; Hines, J C; Ou, X; Mahmood, R; Ray, D S

1996-12-01

Gene expression in trypanosomatids appears to be regulated largely at the posttranscriptional level and involves maturation of mRNA precursors by trans splicing of a 39-nucleotide miniexon sequence to the 5' end of the mRNA and cleavage and polyadenylation at the 3' end of the mRNA. To initiate the identification of sequences involved in the periodic expression of DNA replication genes in trypanosomatids, we have mapped splice acceptor sites in the 5' flanking region of the TOP2 gene, which encodes the kinetoplast DNA topoisomerase, and have carried out deletion analysis of this region on a plasmid-encoded TOP2 gene. Block deletions within the 5' untranslated region (UTR) identified two regions (-608 to -388 and -387 to -186) responsible for periodic accumulation of the mRNA. Deletion of one or the other of these sequences had no effect on periodic expression of the mRNA, while deletion of both regions resulted in constitutive expression of the mRNA throughout the cell cycle. Subcloning of these sequences into the 5' UTR of a construct lacking both regions of the TOP2 5' UTR has shown that an octamer consensus sequence present in the 5' UTR of the TOP2, RPA1, and DHFR-TS mRNAs is required for normal cycling of the TOP2 mRNA. Mutation of the consensus octamer sequence in the TOP2 5' UTR in a plasmid construct containing only a single consensus octamer and that shows normal cycling of the plasmid-encoded TOP2 mRNA resulted in substantial reduction of the cycling of the mRNA level. These results imply a negative regulation of TOP2 mRNA during the cell cycle by a mechanism involving redundant elements containing one or more copies of a conserved octamer sequence within the 5' UTR of TOP2 mRNA.

Developmentally programmed DNA splicing in Paramecium reveals short-distance crosstalk between DNA cleavage sites

PubMed Central

Gratias, Ariane; Lepère, Gersende; Garnier, Olivier; Rosa, Sarah; Duharcourt, Sandra; Malinsky, Sophie; Meyer, Eric; Bétermier, Mireille

2008-01-01

Somatic genome assembly in the ciliate Paramecium involves the precise excision of thousands of short internal eliminated sequences (IESs) that are scattered throughout the germline genome and often interrupt open reading frames. Excision is initiated by double-strand breaks centered on the TA dinucleotides that are conserved at each IES boundary, but the factors that drive cleavage site recognition remain unknown. A degenerate consensus was identified previously at IES ends and genetic analyses confirmed the participation of their nucleotide sequence in efficient excision. Even for wild-type IESs, however, variant excision patterns (excised or nonexcised) may be inherited maternally through sexual events, in a homology-dependent manner. We show here that this maternal epigenetic control interferes with the targeting of DNA breaks at IES ends. Furthermore, we demonstrate that a mutation in the TA at one end of an IES impairs DNA cleavage not only at the mutant end but also at the wild-type end. We conclude that crosstalk between both ends takes place prior to their cleavage and propose that the ability of an IES to adopt an excision-prone conformation depends on the combination of its nucleotide sequence and of additional determinants. PMID:18420657

Survey of bat populations from Mexico and Paraguay for rabies.

PubMed

Sheeler-Gordon, L L; Smith, J S

2001-07-01

A mammalian survey was conducted in Mexico (October 1994-January 1996) and in Paraguay (August 1996-March 1997); a complete specimen was collected for each bat in the survey, including primary voucher specimen, ectoparasites, karyotype, and various frozen tissues. The surveys combined provided 937 brain samples (65 bat species) for rabies diagnosis. One male Lasiurus ega, collected in Paraguay, tested positive for the rabies virus (overall prevalence rate of 0.1%). Nucleotide sequence from a 300 bp region of the rabies nucleoprotein gene was compared with sequence obtained from representative rabies virus samples in the repository at the Centers for Disease Control and Prevention (Atlanta, Georgia, USA). Rabies virus extracted from the brain material of L. ega differed by only one nucleotide from a 300 bp consensus sequence (>99% homology) derived from samples for the variant of rabies virus transmitted by Lasiurus cinereus. Lasiurus ego differed by approximately 15% for the variant transmitted by Desmodus rotundus. Phylogenetic analysis found no evidence to suggest L. ego is a reservoir for rabies antigenic variant 6. The most likely explanation for rabies in L. ega was infection following contact with a rabid L. cinereus.

A large outbreak of acute gastroenteritis in Shippensburg, Pennsylvania, 1972 revisited: evidence for common source exposure to a recombinant GII.Pg/GII.3 norovirus.

PubMed

Johnson, J A; Parra, G I; Levenson, E A; Green, K Y

2017-06-01

Historical outbreaks can be an important source of information in the understanding of norovirus evolution and epidemiology. Here, we revisit an outbreak of undiagnosed gastroenteritis that occurred in Shippensburg, Pennsylvania in 1972. Nearly 5000 people fell ill over the course of 10 days. Symptoms included diarrhea, vomiting, stomach cramps, and fever, lasting for a median of 24 h. Using current techniques, including next-generation sequencing of full-length viral genomic amplicons, we identified an unusual norovirus recombinant (GII.Pg/GII.3) in nine of 15 available stool samples from the outbreak. This particular recombinant virus has not been reported in recent decades, although GII.3 and GII.Pg genotypes have been detected individually in current epidemic strains. The consensus nucleotide sequences were nearly identical among the four viral genomes analysed, although each strain had three to seven positions in the genome with heterogenous non-synonymous nucleotide subpopulations. Two of these resulting amino acid polymorphisms were conserved in frequency among all four cases, consistent with common source exposure and successful transmission of a mixed viral population. Continued investigation of variant nucleotide populations and recombination events among ancestral norovirus strains such as the Shippensburg virus may provide unique insight into the origin of contemporary strains.

Cloning the promoter for transforming growth factor-beta type III receptor. Basal and conditional expression in fetal rat osteoblasts

NASA Technical Reports Server (NTRS)

Ji, C.; Chen, Y.; McCarthy, T. L.; Centrella, M.

1999-01-01

Transforming growth factor-beta binds to three high affinity cell surface molecules that directly or indirectly regulate its biological effects. The type III receptor (TRIII) is a proteoglycan that lacks significant intracellular signaling or enzymatic motifs but may facilitate transforming growth factor-beta binding to other receptors, stabilize multimeric receptor complexes, or segregate growth factor from activating receptors. Because various agents or events that regulate osteoblast function rapidly modulate TRIII expression, we cloned the 5' region of the rat TRIII gene to assess possible control elements. DNA fragments from this region directed high reporter gene expression in osteoblasts. Sequencing showed no consensus TATA or CCAAT boxes, whereas several nuclear factors binding sequences within the 3' region of the promoter co-mapped with multiple transcription initiation sites, DNase I footprints, gel mobility shift analysis, or loss of activity by deletion or mutation. An upstream enhancer was evident 5' proximal to nucleotide -979, and a silencer region occurred between nucleotides -2014 and -2194. Glucocorticoid sensitivity mapped between nucleotides -687 and -253, whereas bone morphogenetic protein 2 sensitivity co-mapped within the silencer region. Thus, the TRIII promoter contains cooperative basal elements and dispersed growth factor- and hormone-sensitive regulatory regions that can control TRIII expression by osteoblasts.

DNA barcoding of Clarias gariepinus, Coptodon zillii and Sarotherodon melanotheron from Southwestern Nigeria

PubMed Central

Falade, Mofolusho O.; Opene, Anthony J.; Benson, Otarigho

2016-01-01

DNA barcoding has been adopted as a gold standard rapid, precise and unifying identification system for animal species and provides a database of genetic sequences that can be used as a tool for universal species identification. In this study, we employed mitochondrial genes 16S rRNA (16S) and cytochrome oxidase subunit I (COI) for the identification of some Nigerian freshwater catfish and Tilapia species. Approximately 655 bp were amplified from the 5′ region of the mitochondrial cytochrome C oxidase subunit I (COI) gene whereas 570 bp were amplified for the 16S rRNA gene. Nucleotide divergences among sequences were estimated based on Kimura 2-parameter distances and the genetic relationships were assessed by constructing phylogenetic trees using the neighbour-joining (NJ) and maximum likelihood (ML) methods. Analyses of consensus barcode sequences for each species, and alignment of individual sequences from within a given species revealed highly consistent barcodes (99% similarity on average), which could be compared with deposited sequences in public databases. The nucleotide distance between species belonging to different genera based on COI ranged from 0.17% between Sarotherodon melanotheron and Coptodon zillii to 0.49% between Clarias gariepinus and C. zillii, indicating that S. melanotheron and C. zillii are closely related. Based on the data obtained, the utility of COI gene was confirmed in accurate identification of three fish species from Southwest Nigeria. PMID:27990256

Molecular identification and characterization of clustered regularly interspaced short palindromic repeats (CRISPRs) in a urease-positive thermophilic Campylobacter sp. (UPTC).

PubMed

Tasaki, E; Hirayama, J; Tazumi, A; Hayashi, K; Hara, Y; Ueno, H; Moore, J E; Millar, B C; Matsuda, M

2012-02-01

Novel clustered regularly-interspaced short palindromic repeats (CRISPRs) locus [7,500 base pairs (bp) in length] occurred in the urease-positive thermophilic Campylobacter (UPTC) Japanese isolate, CF89-12. The 7,500 bp gene loci consisted of the 5'-methylaminomethyl-2-thiouridylate methyltransferase gene, putative (P) CRISPR associated (p-Cas), putative open reading frames, Cas1 and Cas2, leader sequence region (146 bp), 12 CRISPRs consensus sequence repeats (each 36 bp) separated by a non-repetitive unique spacer region of similar length (26-31 bp) and the phosphatidyl glycerophosphatase A gene. When the CRISPRs loci in the UPTC CF89-12 and five C. jejuni isolates were compared with one another, these six isolates contained p-Cas, Cas1 and Cas2 within the loci. Four to 12 CRISPRs consensus sequence repeats separated by a non-repetitive unique spacer region occurred in six isolates and the nucleotide sequences of those repeats gave approximately 92-100% similarity with each other. However, no sequence similarity occurred in the unique spacer regions among these isolates. The putative σ(70) transcriptional promoter and the hypothetical ρ-independent terminator structures for the CRISPRs and Cas were detected. No in vivo transcription of p-Cas, Cas1 and Cas2 was confirmed in the UPTC cells.

Mutations That Improve the pRE Promoter of Coliphage Lambda

PubMed Central

Mahoney, Michael E.; Wulff, Daniel L.

1987-01-01

The dya5 mutation, a C→T change at position -43 of the λ pRE promoter, results in a twofold increase in pRE activity in vivo. Smaller increases in pRE activity are found for the dya2 mutation, a T→C change at position -1 of pRE, and the dya3 mutation, an A→G change at +5 of pRE. The mutant p RE promoters retain complete dependence on cII protein for activity. These observations argue, at least for pRE-like promoters, that promoter activities are influenced by nucleotide sequences at least eight nucleotides to the 5'-side of the conventional -35 region consensus sequence, and by nucleotide sequences near the start-site of transcription. Although Hawley and McClure (1983) found A·T pairs more frequently than G·TC pairs in the region of -40 to -45 of prokaryotic promoters, other mutations that change a G·TC pair to an A·T pair at positions -41, -44 and -45 of pRE do not result in increased promoter activity. We also found that a T→C change at position -42 results in a mild decrease in promoter activity. These observations argue that Ts at positions -42 and -43 of pRE are required for maximum promoter activity, but do not support the hypothesis that As and Ts in the -40 to -45 region generally lead to higher promoter activities. PMID:2953648

Molecular cloning of crustins from the hemocytes of Brazilian penaeid shrimps.

PubMed

Rosa, Rafael Diego; Bandeira, Paula Terra; Barracco, Margherita Anna

2007-09-01

Crustins are antimicrobial peptides initially identified in the hemocytes of the crab Carcinus maenas (11.5-kDa peptide or carcinin) and recently also recognized in penaeid shrimps and other crustacean species. The aim of this study was to identify sequences encoding for crustins from the hemocytes of four Brazilian penaeid species: Farfantepenaeus paulensis, Farfantepenaeus subtilis, Farfantepenaeus brasiliensis and Litopenaeus schmitti. Using primers based on consensus nucleotide alignment of crustins from different crustaceans, cDNA sequences coding for crustins in all indigenous penaeid species were amplified. The obtained four crustin sequences encoded for peptides containing a hydrophobic N-terminal region rich in glycine repeats and a C-terminal part with 12 cysteine residues and a conserved whey acidic protein domain. All obtained crustin sequences showed high amino acidic similarity among each other and with crustins from litopenaeid shrimps (76-98%). This is the first report of crustins in native Brazilian penaeid shrimps.

The s29x gene of symbiotic bacteria in Amoeba proteus with a novel promoter.

PubMed

Pak, J W; Jeon, K W

1996-05-24

Gram-symbiotic bacteria (called X-bacteria), present in the xD strain of Amoeba proteus as required cell components, synthesize and export a large amount of a 29-kDa protein, S29x. S29x is exported into the host's cytoplasm across the bacterial membranes and the symbiosome membrane. The complete nucleotide (nt) sequence of the s29x gene of X-bacteria has been determined, and the promoter sequence and tsp have also been identified. The gene has a nonconventional promoter with putative nt sequences different from the known consensus sequences. When Escherichia coli cells are transformed with s29x, the gene is expressed and the product is secreted into the culture medium. Functions of S29x are not fully known, but it is suspected that S29x plays an important role in the symbiotic relationship between amoebae and X-bacteria.

Changes in mumps virus neurovirulence phenotype associated with quasispecies heterogeneity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sauder, Christian J.; Vandenburgh, Kari M.; Iskow, Rebecca C.

2006-06-20

Mumps virus is a highly neurotropic virus with evidence of central nervous system invasion (CNS) in approximately half of all cases of infection. In countries where live attenuated mumps virus vaccines were introduced, the number of mumps cases declined dramatically; however, recently, the safety of some vaccine strains has been questioned. For example, one of the most widely used vaccines, the Urabe AM9 strain, was causally associated with meningitis, leading to the withdrawal of this product from the market in several countries. This highlights the need for a better understanding of the attenuation process and the identification of markers ofmore » attenuation. To this end, we further attenuated the Urabe AM9 strain by serial passage in cell culture and compared the complete nucleotide sequences of the parental and passaged viruses. Interestingly, despite a dramatic decrease in virus virulence (as assayed in rats), the only genomic changes were in the form of changes in the level of genetic heterogeneity at specific genome sites, i.e., either selection of one nucleotide variant at positions where the starting material exhibited nucleotide heterogeneity or the evolution of an additional nucleotide to create a heterogenic site. This finding suggests that changes in the level of genetic heterogeneity at specific genome sites can have profound neurovirulence phenotypic consequences and, therefore, caution should be exercised when evaluating genetic markers of virulence or attenuation based only on a consensus sequence.« less

Primary and secondary structural analyses of glutathione S-transferase pi from human placenta.

PubMed

Ahmad, H; Wilson, D E; Fritz, R R; Singh, S V; Medh, R D; Nagle, G T; Awasthi, Y C; Kurosky, A

1990-05-01

The primary structure of glutathione S-transferase (GST) pi from a single human placenta was determined. The structure was established by chemical characterization of tryptic and cyanogen bromide peptides as well as automated sequence analysis of the intact enzyme. The structural analysis indicated that the protein is comprised of 209 amino acid residues and gave no evidence of post-translational modifications. The amino acid sequence differed from that of the deduced amino acid sequence determined by nucleotide sequence analysis of a cDNA clone (Kano, T., Sakai, M., and Muramatsu, M., 1987, Cancer Res. 47, 5626-5630) at position 104 which contained both valine and isoleucine whereas the deduced sequence from nucleotide sequence analysis identified only isoleucine at this position. These results demonstrated that in the one individual placenta studied at least two GST pi genes are coexpressed, probably as a result of allelomorphism. Computer assisted consensus sequence evaluation identified a hydrophobic region in GST pi (residues 155-181) that was predicted to be either a buried transmembrane helical region or a signal sequence region. The significance of this hydrophobic region was interpreted in relation to the mode of action of the enzyme especially in regard to the potential involvement of a histidine in the active site mechanism. A comparison of the chemical similarity of five known human GST complete enzyme structures, one of pi, one of mu, two of alpha, and one microsomal, gave evidence that all five enzymes have evolved by a divergent evolutionary process after gene duplication, with the microsomal enzyme representing the most divergent form.

SC*994C>T causes the Sc(null) phenotype in Pacific Islanders and successful transfusion of Sc3+ blood to a patient with anti-Sc3.

PubMed

Reid, Marion E; Hue-Roye, Kim; Velliquette, Randall W; Larimore, Kathleen; Moscarelli, Sue; Ohswaldt, Nicolas; Lomas-Francis, Christine

2013-01-01

Antigens in the SC blood group system are expressed by the human erythrocyte membrane-associated protein (ERMAP).Two molecular bases have been reported for the Sc,un phenotype:SC*307del2 and SC*994C>T. We report our investigation of the molecular background of five Sc,n1 individuals from the Pacific Islands and describe the successful transfusion of Sc3+ blood to a patient with anti-Sc3 in her plasma. SC (ERMAP) exons 2,3, and 12 and their flanking intronic regions were analyzed. TheSC*994C>T change introduces a restriction enzyme cleavage site for Tsp45I, and polymerase chain reaction (PCR) products from exon 12 were subjected to this PCR-restriction fragment length polymorphism (RFLP) assay. The five samples had the variant SC*994T/T. One sample, from a first cousin of one Marshallese proband, was heterozygous for SC*1514C/T (in the 3' untranslated region); the other four samples were SC*1514C/C(consensus sequence). Samples from white donors (n = 100) and African American donors (n = 99) were tested using the Tsp45IPCR-RFLP assay; all gave a banding pattern that was consistent with the SC*994C/C consensus sequence. In all five samples,our analyses showed homozygosity for the nonsense nucleotide change SC*994C>Tin an allele carrying the nucleotide associated with SLd. Further investigation determined that one of the probands reported previously with the SC*994C>T change was from the Marshall Islands (which form part of the Micronesian Pacific Islands) and the other was from an unspecified location within the large collection of Pacific Islands. Taken together, the five known probands with the SC*994C>T silencing nucleotide change were from the Pacific Islands.

ApiEST-DB: analyzing clustered EST data of the apicomplexan parasites.

PubMed

Li, Li; Crabtree, Jonathan; Fischer, Steve; Pinney, Deborah; Stoeckert, Christian J; Sibley, L David; Roos, David S

2004-01-01

ApiEST-DB (http://www.cbil.upenn.edu/paradbs-servlet/) provides integrated access to publicly available EST data from protozoan parasites in the phylum Apicomplexa. The database currently incorporates a total of nearly 100,000 ESTs from several parasite species of clinical and/or veterinary interest, including Eimeria tenella, Neospora caninum, Plasmodium falciparum, Sarcocystis neurona and Toxoplasma gondii. To facilitate analysis of these data, EST sequences were clustered and assembled to form consensus sequences for each organism, and these assemblies were then subjected to automated annotation via similarity searches against protein and domain databases. The underlying relational database infrastructure, Genomics Unified Schema (GUS), enables complex biologically based queries, facilitating validation of gene models, identification of alternative splicing, detection of single nucleotide polymorphisms, identification of stage-specific genes and recognition of phylogenetically conserved and phylogenetically restricted sequences.

Analysis of the regulatory region of the protease III (ptr) gene of Escherichia coli K-12.

PubMed

Claverie-Martin, F; Diaz-Torres, M R; Kushner, S R

1987-01-01

The ptr gene of Escherichia coli encodes protease III (Mr 110,000) and a 50-kDa polypeptide, both of which are found in the periplasmic space. The gene is physically located between the recC and recB loci on the E. coli chromosome. The nucleotide sequence of a 1167-bp EcoRV-ClaI fragment of chromosomal DNA containing the promoter region and 885 bp of the ptr coding sequence has been determined. S1 nuclease mapping analysis showed that the major 5' end of the ptr mRNA was localized 127 bp upstream from the ATG start codon. The open reading frame (ORF), preceded by a Shine-Dalgarno sequence, extends to the end of the sequenced DNA. Downstream from the -35 and -10 regions is a sequence that strongly fits the consensus sequence of known nitrogen-regulated promoters. A signal peptide of 23 amino acids residues is present at the N terminus of the derived amino acid sequence. The cleavage site as well as the ORF were confirmed by sequencing the N terminus of mature protease III.

A 1,681-locus consensus genetic map of cultivated cucumber including 67 NB-LRR resistance gene homolog and ten gene loci

PubMed Central

2013-01-01

Background Cucumber is an important vegetable crop that is susceptible to many pathogens, but no disease resistance (R) genes have been cloned. The availability of whole genome sequences provides an excellent opportunity for systematic identification and characterization of the nucleotide binding and leucine-rich repeat (NB-LRR) type R gene homolog (RGH) sequences in the genome. Cucumber has a very narrow genetic base making it difficult to construct high-density genetic maps. Development of a consensus map by synthesizing information from multiple segregating populations is a method of choice to increase marker density. As such, the objectives of the present study were to identify and characterize NB-LRR type RGHs, and to develop a high-density, integrated cucumber genetic-physical map anchored with RGH loci. Results From the Gy14 draft genome, 70 NB-containing RGHs were identified and characterized. Most RGHs were in clusters with uneven distribution across seven chromosomes. In silico analysis indicated that all 70 RGHs had EST support for gene expression. Phylogenetic analysis classified 58 RGHs into two clades: CNL and TNL. Comparative analysis revealed high-degree sequence homology and synteny in chromosomal locations of these RGH members between the cucumber and melon genomes. Fifty-four molecular markers were developed to delimit 67 of the 70 RGHs, which were integrated into a genetic map through linkage analysis. A 1,681-locus cucumber consensus map including 10 gene loci and spanning 730.0 cM in seven linkage groups was developed by integrating three component maps with a bin-mapping strategy. Physically, 308 scaffolds with 193.2 Mbp total DNA sequences were anchored onto this consensus map that covered 52.6% of the 367 Mbp cucumber genome. Conclusions Cucumber contains relatively few NB-LRR RGHs that are clustered and unevenly distributed in the genome. All RGHs seem to be transcribed and shared significant sequence homology and synteny with the melon genome suggesting conservation of these RGHs in the Cucumis lineage. The 1,681-locus consensus genetic-physical map developed and the RGHs identified and characterized herein are valuable genomics resources that may have many applications such as quantitative trait loci identification, map-based gene cloning, association mapping, marker-assisted selection, as well as assembly of a more complete cucumber genome. PMID:23531125

Identification of New Single Nucleotide Polymorphism-Based Markers for Inter- and Intraspecies Discrimination of Obligate Bacterial Parasites (Pasteuria spp.) of Invertebrates ▿ †

PubMed Central

Mauchline, Tim H.; Knox, Rachel; Mohan, Sharad; Powers, Stephen J.; Kerry, Brian R.; Davies, Keith G.; Hirsch, Penny R.

2011-01-01

Protein-encoding and 16S rRNA genes of Pasteuria penetrans populations from a wide range of geographic locations were examined. Most interpopulation single nucleotide polymorphisms (SNPs) were detected in the 16S rRNA gene. However, in order to fully resolve all populations, these were supplemented with SNPs from protein-encoding genes in a multilocus SNP typing approach. Examination of individual 16S rRNA gene sequences revealed the occurrence of “cryptic” SNPs which were not present in the consensus sequences of any P. penetrans population. Additionally, hierarchical cluster analysis separated P. penetrans 16S rRNA gene clones into four groups, and one of which contained sequences from the most highly passaged population, demonstrating that it is possible to manipulate the population structure of this fastidious bacterium. The other groups were made from representatives of the other populations in various proportions. Comparison of sequences among three Pasteuria species, namely, P. penetrans, P. hartismeri, and P. ramosa, showed that the protein-encoding genes provided greater discrimination than the 16S rRNA gene. From these findings, we have developed a toolbox for the discrimination of Pasteuria at both the inter- and intraspecies levels. We also provide a model to monitor genetic variation in other obligate hyperparasites and difficult-to-culture microorganisms. PMID:21803895

Identification of new single nucleotide polymorphism-based markers for inter- and intraspecies discrimination of obligate bacterial parasites (Pasteuria spp.) of invertebrates.

PubMed

Mauchline, Tim H; Knox, Rachel; Mohan, Sharad; Powers, Stephen J; Kerry, Brian R; Davies, Keith G; Hirsch, Penny R

2011-09-01

Protein-encoding and 16S rRNA genes of Pasteuria penetrans populations from a wide range of geographic locations were examined. Most interpopulation single nucleotide polymorphisms (SNPs) were detected in the 16S rRNA gene. However, in order to fully resolve all populations, these were supplemented with SNPs from protein-encoding genes in a multilocus SNP typing approach. Examination of individual 16S rRNA gene sequences revealed the occurrence of "cryptic" SNPs which were not present in the consensus sequences of any P. penetrans population. Additionally, hierarchical cluster analysis separated P. penetrans 16S rRNA gene clones into four groups, and one of which contained sequences from the most highly passaged population, demonstrating that it is possible to manipulate the population structure of this fastidious bacterium. The other groups were made from representatives of the other populations in various proportions. Comparison of sequences among three Pasteuria species, namely, P. penetrans, P. hartismeri, and P. ramosa, showed that the protein-encoding genes provided greater discrimination than the 16S rRNA gene. From these findings, we have developed a toolbox for the discrimination of Pasteuria at both the inter- and intraspecies levels. We also provide a model to monitor genetic variation in other obligate hyperparasites and difficult-to-culture microorganisms.

Regulation of iron assimilation: nucleotide sequence analysis of an iron-regulated promoter from a fluorescent pseudomonad.

PubMed

O'Sullivan, D J; O'Gara, F

1991-08-01

An iron-regulated promoter was cloned on a 2.1 kb Bg/II fragment from Pseudomonas sp. strain M114 and fused to the lacZ reporter gene. Iron-regulated lacZ expression from the resulting construct (pSP1) in strain M114 was mediated via the Fur-like repressor which also regulates siderophore production in this strain. A 390 bp StuI-PstI internal fragment contained the necessary information for iron-regulated promoter expression. This fragment was sequenced and the initiation point for transcription was determined by primer extension analysis. The region directly upstream of the transcription start point contained no significant homology to known promoter consensus sequences. However the -16 to -25 bp region contained homology to four other iron-regulated pseudomonad promoters. Deletion of bases downstream from the transcriptional start did not affect the iron-regulated expression of the promoter. The -37 and -43 bp regions exhibited some homology to the 19 bp Escherichia coli Fur-binding consensus sequence. When expressed in E. coli (via a cloned transacting factor from strain M114) lacZ expression from pSP1 was found to be regulated by iron. A region of greater than 77 bases but less than 131 upstream from the transcriptional start was found to be necessary for promoter activity, further suggesting that a transcriptional activator may be required for expression.

Automated sequence analysis and editing software for HIV drug resistance testing.

PubMed

Struck, Daniel; Wallis, Carole L; Denisov, Gennady; Lambert, Christine; Servais, Jean-Yves; Viana, Raquel V; Letsoalo, Esrom; Bronze, Michelle; Aitken, Sue C; Schuurman, Rob; Stevens, Wendy; Schmit, Jean Claude; Rinke de Wit, Tobias; Perez Bercoff, Danielle

2012-05-01

Access to antiretroviral treatment in resource-limited-settings is inevitably paralleled by the emergence of HIV drug resistance. Monitoring treatment efficacy and HIV drugs resistance testing are therefore of increasing importance in resource-limited settings. Yet low-cost technologies and procedures suited to the particular context and constraints of such settings are still lacking. The ART-A (Affordable Resistance Testing for Africa) consortium brought together public and private partners to address this issue. To develop an automated sequence analysis and editing software to support high throughput automated sequencing. The ART-A Software was designed to automatically process and edit ABI chromatograms or FASTA files from HIV-1 isolates. The ART-A Software performs the basecalling, assigns quality values, aligns query sequences against a set reference, infers a consensus sequence, identifies the HIV type and subtype, translates the nucleotide sequence to amino acids and reports insertions/deletions, premature stop codons, ambiguities and mixed calls. The results can be automatically exported to Excel to identify mutations. Automated analysis was compared to manual analysis using a panel of 1624 PR-RT sequences generated in 3 different laboratories. Discrepancies between manual and automated sequence analysis were 0.69% at the nucleotide level and 0.57% at the amino acid level (668,047 AA analyzed), and discordances at major resistance mutations were recorded in 62 cases (4.83% of differences, 0.04% of all AA) for PR and 171 (6.18% of differences, 0.03% of all AA) cases for RT. The ART-A Software is a time-sparing tool for pre-analyzing HIV and viral quasispecies sequences in high throughput laboratories and highlighting positions requiring attention. Copyright © 2012 Elsevier B.V. All rights reserved.

Isolation and characterization of the gene coding for Escherichia coli arginyl-tRNA synthetase.

PubMed Central

Eriani, G; Dirheimer, G; Gangloff, J

1989-01-01

The gene coding for Escherichia coli arginyl-tRNA synthetase (argS) was isolated as a fragment of 2.4 kb after analysis and subcloning of recombinant plasmids from the Clarke and Carbon library. The clone bearing the gene overproduces arginyl-tRNA synthetase by a factor 100. This means that the enzyme represents more than 20% of the cellular total protein content. Sequencing revealed that the fragment contains a unique open reading frame of 1734 bp flanked at its 5' and 3' ends respectively by 247 bp and 397 bp. The length of the corresponding protein (577 aa) is well consistent with earlier Mr determination (about 70 kd). Primer extension analysis of the ArgRS mRNA by reverse transcriptase, located its 5' end respectively at 8 and 30 nucleotides downstream of a TATA and a TTGAC like element (CTGAC) and 60 nucleotides upstream of the unusual translation initiation codon GUG; nuclease S1 analysis located the 3'-end at 48 bp downstream of the translation termination codon. argS has a codon usage pattern typical for highly expressed E. coli genes. With the exception of the presence of a HVGH sequence similar to the HIGH consensus element, ArgRS has no relevant sequence homologies with other aminoacyl-tRNA synthetases. Images PMID:2668891

Combined hairpin-antisense compositions and methods for modulating expression

DOEpatents

Shanklin, John; Nguyen, Tam

2014-08-05

A nucleotide construct comprising a nucleotide sequence that forms a stem and a loop, wherein the loop comprises a nucleotide sequence that modulates expression of a target, wherein the stem comprises a nucleotide sequence that modulates expression of a target, and wherein the target modulated by the nucleotide sequence in the loop and the target modulated by the nucleotide sequence in the stem may be the same or different. Vectors, methods of regulating target expression, methods of providing a cell, and methods of treating conditions comprising the nucleotide sequence are also disclosed.

Combined hairpin-antisense compositions and methods for modulating expression

DOEpatents

Shanklin, John; Nguyen, Tam Huu

2015-11-24

A nucleotide construct comprising a nucleotide sequence that forms a stem and a loop, wherein the loop comprises a nucleotide sequence that modulates expression of a target, wherein the stem comprises a nucleotide sequence that modulates expression of a target, and wherein the target modulated by the nucleotide sequence in the loop and the target modulated by the nucleotide sequence in the stem may be the same or different. Vectors, methods of regulating target expression, methods of providing a cell, and methods of treating conditions comprising the nucleotide sequence are also disclosed.

Context based computational analysis and characterization of ARS consensus sequences (ACS) of Saccharomyces cerevisiae genome.

PubMed

Singh, Vinod Kumar; Krishnamachari, Annangarachari

2016-09-01

Genome-wide experimental studies in Saccharomyces cerevisiae reveal that autonomous replicating sequence (ARS) requires an essential consensus sequence (ACS) for replication activity. Computational studies identified thousands of ACS like patterns in the genome. However, only a few hundreds of these sites act as replicating sites and the rest are considered as dormant or evolving sites. In a bid to understand the sequence makeup of replication sites, a content and context-based analysis was performed on a set of replicating ACS sequences that binds to origin-recognition complex (ORC) denoted as ORC-ACS and non-replicating ACS sequences (nrACS), that are not bound by ORC. In this study, DNA properties such as base composition, correlation, sequence dependent thermodynamic and DNA structural profiles, and their positions have been considered for characterizing ORC-ACS and nrACS. Analysis reveals that ORC-ACS depict marked differences in nucleotide composition and context features in its vicinity compared to nrACS. Interestingly, an A-rich motif was also discovered in ORC-ACS sequences within its nucleosome-free region. Profound changes in the conformational features, such as DNA helical twist, inclination angle and stacking energy between ORC-ACS and nrACS were observed. Distribution of ACS motifs in the non-coding segments points to the locations of ORC-ACS which are found far away from the adjacent gene start position compared to nrACS thereby enabling an accessible environment for ORC-proteins. Our attempt is novel in considering the contextual view of ACS and its flanking region along with nucleosome positioning in the S. cerevisiae genome and may be useful for any computational prediction scheme.

Whole-genome analyses of DS-1-like human G2P[4] and G8P[4] rotavirus strains from Eastern, Western and Southern Africa

PubMed Central

Nyaga, Martin M.; Stucker, Karla M.; Esona, Mathew D.; Jere, Khuzwayo C.; Mwinyi, Bakari; Shonhai, Annie; Tsolenyanu, Enyonam; Mulindwa, Augustine; Chibumbya, Julia N.; Adolfine, Hokororo; Halpin, Rebecca A.; Roy, Sunando; Stockwell, Timothy B.; Berejena, Chipo; Seheri, Mapaseka L.; Mwenda, Jason M.; Steele, A. Duncan; Wentworth, David E.

2018-01-01

Group A rotaviruses (RVAs) with distinct G and P genotype combinations have been reported globally. We report the genome composition and possible origin of seven G8P[4] and five G2P[4] human RVA strains based on the genetic evolution of all 11 genome segments at the nucleotide level. Twelve RVA ELISA positive stool samples collected in the representative countries of Eastern, Southern and West Africa during the 2007–2012 surveillance seasons were subjected to sequencing using the Ion Torrent PGM and Illumina MiSeq platforms. A reference-based assembly was performed using CLC Bio’s clc_ref_assemble_long program, and full-genome consensus sequences were obtained. With the exception of the neutralising antigen, VP7, all study strains exhibited the DS-1-like genome constellation (P[4]-I2-R2-C2-M2-A2-N2-T2-E2-H2) and clustered phylogenetically with reference strains having a DS-1-like genetic backbone. Comparison of the nucleotide and amino acid sequences with selected global cognate genome segments revealed nucleotide and amino acid sequence identities of 81.7–100 % and 90.6–100 %, respectively, with NSP4 gene segment showing the most diversity among the strains. Bayesian analyses of all gene sequences to estimate the time of divergence of the lineage indicated that divergence times ranged from 16 to 44 years, except for the NSP4 gene where the lineage seemed to arise in the more distant past at an estimated 203 years ago. However, the long-term effects of changes found within the NSP4 genome segment should be further explored, and thus we recommend continued whole-genome analyses from larger sample sets to determine the evolutionary mechanisms of the DS-1-like strains collected in Africa. PMID:24952422

A comparative analysis of exome capture.

PubMed

Parla, Jennifer S; Iossifov, Ivan; Grabill, Ian; Spector, Mona S; Kramer, Melissa; McCombie, W Richard

2011-09-29

Human exome resequencing using commercial target capture kits has been and is being used for sequencing large numbers of individuals to search for variants associated with various human diseases. We rigorously evaluated the capabilities of two solution exome capture kits. These analyses help clarify the strengths and limitations of those data as well as systematically identify variables that should be considered in the use of those data. Each exome kit performed well at capturing the targets they were designed to capture, which mainly corresponds to the consensus coding sequences (CCDS) annotations of the human genome. In addition, based on their respective targets, each capture kit coupled with high coverage Illumina sequencing produced highly accurate nucleotide calls. However, other databases, such as the Reference Sequence collection (RefSeq), define the exome more broadly, and so not surprisingly, the exome kits did not capture these additional regions. Commercial exome capture kits provide a very efficient way to sequence select areas of the genome at very high accuracy. Here we provide the data to help guide critical analyses of sequencing data derived from these products.

Eukaryotic tRNAs fingerprint invertebrates vis-à-vis vertebrates.

PubMed

Mitra, Sanga; Das, Pijush; Samadder, Arpa; Das, Smarajit; Betai, Rupal; Chakrabarti, Jayprokas

2015-01-01

During translation, aminoacyl-tRNA synthetases recognize the identities of the tRNAs to charge them with their respective amino acids. The conserved identities of 58,244 eukaryotic tRNAs of 24 invertebrates and 45 vertebrates in genomic tRNA database were analyzed and their novel features extracted. The internal promoter sequences, namely, A-Box and B-Box, were investigated and evidence gathered that the intervention of optional nucleotides at 17a and 17b correlated with the optimal length of the A-Box. The presence of canonical transcription terminator sequences at the immediate vicinity of tRNA genes was ventured. Even though non-canonical introns had been reported in red alga, green alga, and nucleomorph so far, fairly motivating evidence of their existence emerged in tRNA genes of other eukaryotes. Non-canonical introns were seen to interfere with the internal promoters in two cases, questioning their transcription fidelity. In a first of its kind, phylogenetic constructs based on tRNA molecules delineated and built the trees of the vast and diverse invertebrates and vertebrates. Finally, two tRNA models representing the invertebrates and the vertebrates were drawn, by isolating the dominant consensus in the positional fluctuations of nucleotide compositions.

Characterization of Hepatitis C Virus (HCV) Envelope Diversification from Acute to Chronic Infection within a Sexually Transmitted HCV Cluster by Using Single-Molecule, Real-Time Sequencing

PubMed Central

Ho, Cynthia K. Y.; Raghwani, Jayna; Koekkoek, Sylvie; Liang, Richard H.; Van der Meer, Jan T. M.; Van Der Valk, Marc; De Jong, Menno; Pybus, Oliver G.

2016-01-01

ABSTRACT In contrast to other available next-generation sequencing platforms, PacBio single-molecule, real-time (SMRT) sequencing has the advantage of generating long reads albeit with a relatively higher error rate in unprocessed data. Using this platform, we longitudinally sampled and sequenced the hepatitis C virus (HCV) envelope genome region (1,680 nucleotides [nt]) from individuals belonging to a cluster of sexually transmitted cases. All five subjects were coinfected with HIV-1 and a closely related strain of HCV genotype 4d. In total, 50 samples were analyzed by using SMRT sequencing. By using 7 passes of circular consensus sequencing, the error rate was reduced to 0.37%, and the median number of sequences was 612 per sample. A further reduction of insertions was achieved by alignment against a sample-specific reference sequence. However, in vitro recombination during PCR amplification could not be excluded. Phylogenetic analysis supported close relationships among HCV sequences from the four male subjects and subsequent transmission from one subject to his female partner. Transmission was characterized by a strong genetic bottleneck. Viral genetic diversity was low during acute infection and increased upon progression to chronicity but subsequently fluctuated during chronic infection, caused by the alternate detection of distinct coexisting lineages. SMRT sequencing combines long reads with sufficient depth for many phylogenetic analyses and can therefore provide insights into within-host HCV evolutionary dynamics without the need for haplotype reconstruction using statistical algorithms. IMPORTANCE Next-generation sequencing has revolutionized the study of genetically variable RNA virus populations, but for phylogenetic and evolutionary analyses, longer sequences than those generated by most available platforms, while minimizing the intrinsic error rate, are desired. Here, we demonstrate for the first time that PacBio SMRT sequencing technology can be used to generate full-length HCV envelope sequences at the single-molecule level, providing a data set with large sequencing depth for the characterization of intrahost viral dynamics. The selection of consensus reads derived from at least 7 full circular consensus sequencing rounds significantly reduced the intrinsic high error rate of this method. We used this method to genetically characterize a unique transmission cluster of sexually transmitted HCV infections, providing insight into the distinct evolutionary pathways in each patient over time and identifying the transmission-associated genetic bottleneck as well as fluctuations in viral genetic diversity over time, accompanied by dynamic shifts in viral subpopulations. PMID:28077634

SSMART: Sequence-structure motif identification for RNA-binding proteins.

PubMed

Munteanu, Alina; Mukherjee, Neelanjan; Ohler, Uwe

2018-06-11

RNA-binding proteins (RBPs) regulate every aspect of RNA metabolism and function. There are hundreds of RBPs encoded in the eukaryotic genomes, and each recognize its RNA targets through a specific mixture of RNA sequence and structure properties. For most RBPs, however, only a primary sequence motif has been determined, while the structure of the binding sites is uncharacterized. We developed SSMART, an RNA motif finder that simultaneously models the primary sequence and the structural properties of the RNA targets sites. The sequence-structure motifs are represented as consensus strings over a degenerate alphabet, extending the IUPAC codes for nucleotides to account for secondary structure preferences. Evaluation on synthetic data showed that SSMART is able to recover both sequence and structure motifs implanted into 3'UTR-like sequences, for various degrees of structured/unstructured binding sites. In addition, we successfully used SSMART on high-throughput in vivo and in vitro data, showing that we not only recover the known sequence motif, but also gain insight into the structural preferences of the RBP. Availability: SSMART is freely available at https://ohlerlab.mdc-berlin.de/software/SSMART_137/. Supplementary data are available at Bioinformatics online.

Isolation of a gene (pbsC) required for siderophore biosynthesis in fluorescent Pseudomonas sp. strain M114.

PubMed

Adams, C; Dowling, D N; O'Sullivan, D J; O'Gara, F

1994-06-03

An iron-regulated gene, pbsC, required for siderophore production in fluorescent Pseudomonas sp. strain M114 has been identified. A kanamycin-resistance cassette was inserted at specific restriction sites within a 7 kb genomic fragment of M114 DNA and by marker exchange two siderophore-negative mutants, designated M1 and M2, were isolated. The nucleotide sequence of approximately 4 kb of the region flanking the insertion sites was determined and a large open reading frame (ORF) extending for 2409 bp was identified. This gene was designated pbsC (pseudobactin synthesis C) and its putative protein product termed PbsC. PbsC was found to be homologous to a family of enzymes involved in the biosynthesis of secondary metabolites, including EntF of Escherichia coli. These enzymes are believed to act via ATP-dependent binding of AMP to their substrate. Several areas of high sequence homology between these proteins and PbsC were observed, including a conserved AMP-binding domain. The expression of pbsC is iron-regulated as revealed when a DNA fragment containing the upstream region was cloned in a promoter probe vector and conjugated into the wild-type strain, M114. The nucleotide sequence upstream of the putative translational start site contains a region homologous to previously defined -16 to -25 sequences of iron-regulated genes but did not contain an iron-box consensus sequence. It was noted that inactivation of the pbsC gene also affected other iron-regulated phenotypes of Pseudomonas M114.

Describing sequencing results of structural chromosome rearrangements with a suggested next-generation cytogenetic nomenclature.

PubMed

Ordulu, Zehra; Wong, Kristen E; Currall, Benjamin B; Ivanov, Andrew R; Pereira, Shahrin; Althari, Sara; Gusella, James F; Talkowski, Michael E; Morton, Cynthia C

2014-05-01

With recent rapid advances in genomic technologies, precise delineation of structural chromosome rearrangements at the nucleotide level is becoming increasingly feasible. In this era of "next-generation cytogenetics" (i.e., an integration of traditional cytogenetic techniques and next-generation sequencing), a consensus nomenclature is essential for accurate communication and data sharing. Currently, nomenclature for describing the sequencing data of these aberrations is lacking. Herein, we present a system called Next-Gen Cytogenetic Nomenclature, which is concordant with the International System for Human Cytogenetic Nomenclature (2013). This system starts with the alignment of rearrangement sequences by BLAT or BLAST (alignment tools) and arrives at a concise and detailed description of chromosomal changes. To facilitate usage and implementation of this nomenclature, we are developing a program designated BLA(S)T Output Sequence Tool of Nomenclature (BOSToN), a demonstrative version of which is accessible online. A standardized characterization of structural chromosomal rearrangements is essential both for research analyses and for application in the clinical setting. Copyright © 2014 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.

PubMed

Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

2012-05-01

To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.

37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.

Code of Federal Regulations, 2011 CFR

2011-07-01

... for nucleotide and/or amino acid sequence data. 1.822 Section 1.822 Patents, Trademarks, and... Amino Acid Sequences § 1.822 Symbols and format to be used for nucleotide and/or amino acid sequence data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...

The short interspersed repetitive element of Trypanosoma cruzi, SIRE, is part of VIPER, an unusual retroelement related to long terminal repeat retrotransposons

PubMed Central

Vázquez, Martín; Ben-Dov, Claudia; Lorenzi, Hernan; Moore, Troy; Schijman, Alejandro; Levin, Mariano J.

2000-01-01

The short interspersed repetitive element (SIRE) of Trypanosoma cruzi was first detected when comparing the sequences of loci that encode the TcP2β genes. It is present in about 1,500–3,000 copies per genome, depending on the strain, and it is distributed in all chromosomes. An initial analysis of SIRE sequences from 21 genomic fragments allowed us to derive a consensus nucleotide sequence and structure for the element, consisting of three regions (I, II, and III) each harboring distinctive features. Analysis of 158 transcribed SIREs demonstrates that the consensus is highly conserved. The sequences of 51 cDNAs show that SIRE is included in the 3′ end of several mRNAs, always transcribed from the sense strand, contributing the polyadenylation site in 63% of the cases. This study led to the characterization of VIPER (vestigial interposed retroelement), a 2,326-bp-long unusual retroelement. VIPER's 5′ end is formed by the first 182 bp of SIRE, whereas its 3′ end is formed by the last 220 bp of the element. Both SIRE moieties are connected by a 1,924-bp-long fragment that carries a unique ORF encoding a complete reverse transcriptase-RNase H gene whose 15 C-terminal amino acids derive from codons specified by SIRE's region II. The amino acid sequence of VIPER's reverse transcriptase-RNase H shares significant homology to that of long terminal repeat retrotransposons. The fact that SIRE and VIPER sequences are found only in the T. cruzi genome may be of relevance for studies concerning the evolution and the genome flexibility of this protozoan parasite. PMID:10688909

Polyomavirus BK non-coding control region rearrangements in health and disease.

PubMed

Sharma, Preety M; Gupta, Gaurav; Vats, Abhay; Shapiro, Ron; Randhawa, Parmjeet S

2007-08-01

BK virus is an increasingly recognized pathogen in transplanted patients. DNA sequencing of this virus shows considerable genomic variability. To understand the clinical significance of rearrangements in the non-coding control region (NCCR) of BK virus (BKV), we report a meta-analysis of 507 sequences, including 40 sequences generated in our own laboratory, for associations between rearrangements and disease, tissue tropism, geographic origin, and viral genotype. NCCR rearrangements were less frequent in (a) asymptomatic BKV viruria compared to patients viral nephropathy (1.7% vs. 22.5%), and (b) viral genotype 1 compared to other genotypes (2.4% vs. 11.2%). Rearrangements were commoner in malignancy (78.6%), and Norwegians (45.7%), and less common in East Indians (0%), and Japanese (4.3%). A surprising number of rearranged sequences were reported from mononuclear cells of healthy subjects, whereas most plasma sequences were archetypal. This difference could not be related to potential recombinase activity in lymphocytes, as consensus recombination signal sequences could not be found in the NCCR region. NCCR rearrangements are neither required nor a sufficient condition to produce clinical disease. BKV nephropathy and hemorrhagic cystitis are not associated with any unique NCCR configuration or nucleotide sequence.

RNA-Seq analysis and transcriptome assembly for blackberry (Rubus sp. Var. Lochness) fruit.

PubMed

Garcia-Seco, Daniel; Zhang, Yang; Gutierrez-Mañero, Francisco J; Martin, Cathie; Ramos-Solano, Beatriz

2015-01-22

There is an increasing interest in berries, especially blackberries in the diet, because of recent reports of their health benefits due to their high content of flavonoids. A broad range of genomic tools are available for other Rosaceae species but these tools are still lacking in the Rubus genus, thus limiting gene discovery and the breeding of improved varieties. De novo RNA-seq of ripe blackberries grown under field conditions was performed using Illumina Hiseq 2000. Almost 9 billion nucleotide bases were sequenced in total. Following assembly, 42,062 consensus sequences were detected. For functional annotation, 33,040 (NR), 32,762 (NT), 21,932 (Swiss-Prot), 20,134 (KEGG), 13,676 (COG), 24,168 (GO) consensus sequences were annotated using different databases; in total 34,552 annotated sequences were identified. For protein prediction analysis, the number of coding DNA sequences (CDS) that mapped to the protein database was 32,540. Non redundant (NR), annotation showed that 25,418 genes (73.5%) has the highest similarity with Fragaria vesca subspecies vesca. Reanalysis was undertaken by aligning the reads with this reference genome for a deeper analysis of the transcriptome. We demonstrated that de novo assembly, using Trinity and later annotation with Blast using different databases, were complementary to alignment to the reference sequence using SOAPaligner/SOAP2. The Fragaria reference genome belongs to a species in the same family as blackberry (Rosaceae) but to a different genus. Since blackberries are tetraploids, the possibility of artefactual gene chimeras resulting from mis-assembly was tested with one of the genes sequenced by RNAseq, Chalcone Synthase (CHS). cDNAs encoding this protein were cloned and sequenced. Primers designed to the assembled sequences accurately distinguished different contigs, at least for chalcone synthase genes. We prepared and analysed transcriptome data from ripe blackberries, for which prior genomic information was limited. This new sequence information will improve the knowledge of this important and healthy fruit, providing an invaluable new tool for biological research.

Diversity and Evolution of Bacterial Twin Arginine Translocase Protein, TatC, Reveals a Protein Secretion System That Is Evolving to Fit Its Environmental Niche

PubMed Central

Simone, Domenico; Bay, Denice C.; Leach, Thorin; Turner, Raymond J.

2013-01-01

Background The twin-arginine translocation (Tat) protein export system enables the transport of fully folded proteins across a membrane. This system is composed of two integral membrane proteins belonging to TatA and TatC protein families and in some systems a third component, TatB, a homolog of TatA. TatC participates in substrate protein recognition through its interaction with a twin arginine leader peptide sequence. Methodology/Principal Findings The aim of this study was to explore TatC diversity, evolution and sequence conservation in bacteria to identify how TatC is evolving and diversifying in various bacterial phyla. Surveying bacterial genomes revealed that 77% of all species possess one or more tatC loci and half of these classes possessed only tatC and tatA genes. Phylogenetic analysis of diverse TatC homologues showed that they were primarily inherited but identified a small subset of taxonomically unrelated bacteria that exhibited evidence supporting lateral gene transfer within an ecological niche. Examination of bacilli tatCd/tatCy isoform operons identified a number of known and potentially new Tat substrate genes based on their frequent association to tatC loci. Evolutionary analysis of these Bacilli isoforms determined that TatCy was the progenitor of TatCd. A bacterial TatC consensus sequence was determined and highlighted conserved and variable regions within a three dimensional model of the Escherichia coli TatC protein. Comparative analysis between the TatC consensus sequence and Bacilli TatCd/y isoform consensus sequences revealed unique sites that may contribute to isoform substrate specificity or make TatA specific contacts. Synonymous to non-synonymous nucleotide substitution analyses of bacterial tatC homologues determined that tatC sequence variation differs dramatically between various classes and suggests TatC specialization in these species. Conclusions/Significance TatC proteins appear to be diversifying within particular bacterial classes and its specialization may be driven by the substrates it transports and the environment of its host. PMID:24236045

The maize stripe virus major noncapsid protein messenger RNA transcripts contain heterogeneous leader sequences at their 5' termini.

PubMed

Huiet, L; Feldstein, P A; Tsai, J H; Falk, B W

1993-12-01

Primer extension analyses and a PCR-based cloning strategy were used to identify and characterize 5' nucleotide sequences on the maize stripe virus (MStV) RNA4 mRNA transcripts encoding the major noncapsid protein (NCP). Direct RNA sequence analysis by primer extension showed that the NCP mRNA transcripts had 10-15 nucleotides beyond the 5' terminus of the MStV RNA4 nucleotide sequence. MStV genomic RNAs isolated from ribonucleoprotein particles (RNPs) lacked the additional 5' nucleotides. cDNA clones representing the 5' region of the mRNA transcripts were constructed, and the nucleotide sequences of the 5' regions were determined for 16 clones. Each was found to have a distinct 10-15 nucleotide sequence immediately 5' of the MStV RNA4 sequence. Eleven of 16 clones had the correct MStV RNA4 5' nucleotide sequence, while five showed minor variations at or near the 5' most MStV RNA4 nucleotide. These characteristics show strong similarities to other viral mRNA transcripts which are synthesized by cap snatching.

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 37 Patents, Trademarks, and Copyrights 1 2011-07-01 2011-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...

Stereochemical analysis of the functional significance of the conserved inverted CCAAT and TATA elements in the rat bone sialoprotein gene promoter.

PubMed

Su, Ming; Lee, Daniel; Ganss, Bernhard; Sodek, Jaro

2006-04-14

Basal transcription of the bone sialoprotein gene is mediated by highly conserved inverted CCAAT (ICE; ATTGG) and TATA elements (TTTATA) separated by precisely 21 nucleotides. Here we studied the importance of the relative position and orientation of the CCAAT and TATA elements in the proximal promoter by measuring the transcriptional activity of a series of mutated reporter constructs in transient transfection assays. Whereas inverting the TTTATA (wild type) to a TATAAA (consensus TATA) sequence increased transcription slightly, transcription was reduced when the flanking dinucleotides were also inverted. In contrast, reversing the ATTGG (wild type; ICE) to a CCAAT (RICE) sequence caused a marked reduction in transcription, whereas both transcription and NF-Y binding were progressively increased with the simultaneous inversion of flanking nucleotides (f-RICE-f). Reducing the distance between the ICE and TATA elements produced cyclical changes in transcriptional activity that correlated with progressive alterations in the relative positions of the CCAAT and TATA elements on the face of the DNA helix. Minimal transcription was observed after 5 nucleotides were deleted (equivalent to approximately one half turn of the helix), whereas transcription was fully restored after deleting 10 nucleotides (approximately one full turn of the DNA helix), transcriptional activity being progressively lost with deletions beyond 10 nucleotides. In comparison, when deletions were made with the ICE in the reversed (f-RICE-f) orientation transcriptional activity was progressively lost with no recovery. These results show that, although transcription can still occur when the CCAAT box is reversed and/or displaced relative to the TATA box, the activity is dependent upon the flexibility of the intervening DNA helix needed to align the NF-Y complex on the CCAAT box with preinitiation complex proteins that bind to the TATA box. Thus, the precise location and orientation of the CCAAT element is necessary for optimizing basal transcription of the bone sialoprotein gene.

Performance of an in-house human immunodeficiency virus type 1 genotyping system for assessment of drug resistance in Cuba.

PubMed

Alemán, Yoan; Vinken, Lore; Kourí, Vivian; Pérez, Lissette; Álvarez, Alina; Abrahantes, Yeissel; Fonseca, Carlos; Pérez, Jorge; Correa, Consuelo; Soto, Yudira; Schrooten, Yoeri; Vandamme, Anne-Mieke; Van Laethem, Kristel

2015-01-01

As commercial human immunodeficiency virus type 1 drug resistance assays are expensive, they are not commonly used in resource-limited settings. Hence, a more affordable in-house procedure was set up taking into account the specific epidemiological and economic circumstances of Cuba. The performance characteristics of the in-house assay were evaluated using clinical samples with various subtypes and resistance patterns. The lower limit of amplification was determined on dilutions series of 20 clinical isolates and ranged from 84 to 529 RNA copies/mL. For the assessment of trueness, 14 clinical samples were analyzed and the ViroSeq HIV-1 Genotyping System v2.0 was used as the reference standard. The mean nucleotide sequence identity between the two assays was 98.7% ± 1.0. Additionally, 99.0% of the amino acids at drug resistance positions were identical. The sensitivity and specificity in detecting drug resistance mutations was respectively 94.1% and 99.5%. Only few discordances in drug resistance interpretation patterns were observed. The repeatability and reproducibility were evaluated using 10 clinical samples with 3 replicates per sample. The in-house test was very precise as nucleotide sequence identity among paired nucleotide sequences ranged from 98.7% to 99.9%. The acceptance criteria were met by the in-house test for all performance characteristics, demonstrating a high degree of accuracy. Subsequently, the applicability in routine clinical practice was evaluated on 380 plasma samples. The amplification success rate was 91% and good quality consensus sequences encoding the entire protease and the first 335 codons in reverse transcriptase could be obtained for 99% of the successful amplicons. The reagent cost per sample using the in-house procedure was around € 80 per genotyping attempt. Overall, the in-house assay provided good results, was feasible with equipment and reagents available in Cuba and was half as expensive as commercial assays.

Cassava Brown Streak Virus (Potyviridae) Encodes a Putative Maf/HAM1 Pyrophosphatase Implicated in Reduction of Mutations and a P1 Proteinase That Suppresses RNA Silencing but Contains No HC-Pro ▿

PubMed Central

Mbanzibwa, Deusdedith R.; Tian, Yanping; Mukasa, Settumba B.; Valkonen, Jari P. T.

2009-01-01

The complete positive-sense single-stranded RNA genome of Cassava brown streak virus (CBSV; genus Ipomovirus; Potyviridae) was found to consist of 9,069 nucleotides and predicted to produce a polyprotein of 2,902 amino acids. It was lacking helper-component proteinase but contained a single P1 serine proteinase that strongly suppressed RNA silencing. Besides the exceptional structure of the 5′-proximal part of the genome, CBSV also contained a Maf/HAM1-like sequence (678 nucleotides, 226 amino acids) recombined between the replicase and coat protein domains in the 3′-proximal part of the genome, which is highly conserved in Potyviridae. HAM1 was flanked by consensus proteolytic cleavage sites for ipomovirus NIaPro cysteine proteinase. Homology of CBSV HAM1 with cellular Maf/HAM1 pyrophosphatases suggests that it may intercept noncanonical nucleoside triphosphates to reduce mutagenesis of viral RNA. PMID:19386713

Genome-wide comparison and taxonomic relatedness of multiple Xylella fastidiosa strains reveal the occurrence of three subspecies and a new Xylella species.

PubMed

Marcelletti, Simone; Scortichini, Marco

2016-10-01

A total of 21 Xylella fastidiosa strains were assessed by comparing their genomes to infer their taxonomic relationships. The whole-genome-based average nucleotide identity and tetranucleotide frequency correlation coefficient analyses were performed. In addition, a consensus tree based on comparisons of 956 core gene families, and a genome-wide phylogenetic tree and a Neighbor-net network were constructed with 820,088 nucleotides (i.e., approximately 30-33 % of the entire X. fastidiosa genome). All approaches revealed the occurrence of three well-demarcated genetic clusters that represent X. fastidiosa subspecies fastidiosa, multiplex and pauca, with the latter appeared to diverge. We suggest that the proposed but never formally described subspecies 'sandyi' and 'morus' are instead members of the subspecies fastidiosa. These analyses support the view that the Xylella strain isolated from Pyrus pyrifolia in Taiwan is likely to be a new species. A widely used multilocus sequence typing analysis yielded conflicting results.

A reference bacterial genome dataset generated on the MinION™ portable single-molecule nanopore sequencer.

PubMed

Quick, Joshua; Quinlan, Aaron R; Loman, Nicholas J

2014-01-01

The MinION™ is a new, portable single-molecule sequencer developed by Oxford Nanopore Technologies. It measures four inches in length and is powered from the USB 3.0 port of a laptop computer. The MinION™ measures the change in current resulting from DNA strands interacting with a charged protein nanopore. These measurements can then be used to deduce the underlying nucleotide sequence. We present a read dataset from whole-genome shotgun sequencing of the model organism Escherichia coli K-12 substr. MG1655 generated on a MinION™ device during the early-access MinION™ Access Program (MAP). Sequencing runs of the MinION™ are presented, one generated using R7 chemistry (released in July 2014) and one using R7.3 (released in September 2014). Base-called sequence data are provided to demonstrate the nature of data produced by the MinION™ platform and to encourage the development of customised methods for alignment, consensus and variant calling, de novo assembly and scaffolding. FAST5 files containing event data within the HDF5 container format are provided to assist with the development of improved base-calling methods.

77 FR 65537 - Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-10-29

... DEPARTMENT OF COMMERCE Patent and Trademark Office Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence Disclosures ACTION: Proposed collection; comment request... Patent applications that contain nucleotide and/or amino acid sequence disclosures must include a copy of...

Nucleotide sequence and expression of a novel pectate lyase gene (pel-3) and a closely linked endopolygalacturonase gene (peh-1) of Erwinia carotovora subsp. carotovora 71.

PubMed Central

Liu, Y; Chatterjee, A; Chatterjee, A K

1994-01-01

Our previous genetic analysis (J. W. Willis, J. K. Engwall, and A. K. Chatterjee, Phytopathology 77:1199-1205, 1987) had revealed a tight linkage between pel-3 (pel, pectate lyase gene) and peh-1 (peh, polygalacturonase gene) within the chromosome of Erwinia carotovora subsp. carotovora 71. Nucleotide sequencing, transcript assays, and expression of enzymatic activities in Escherichia coli have now confirmed that a 3,500-bp segment contains the open reading frames (ORFs) for Pel-3 and Peh-1. The 1,041-bp pel-3 ORF and the 1,206-bp peh-1 ORF are separated by a 579-bp sequence. The genes are transcribed divergently from their own promoters. In E. coli and E. carotovora subsp. carotovora 71, peh-1 is better expressed than pel-3. However, plant signals activate the expression of both the genes in E. carotovora subsp. carotovora. A consensus integration host factor (IHF)-binding sequence upstream of pel-3 appears physiologically significant, since pel-3 promoter activity is higher in an E. coli IHF+ strain than in an IHF- strain. While peh-1 has extensive homology with plant and bacterial peh genes, pel-3 appears not to have significant homology with the pel genes belonging to the pelBC, pelADE, or periplasmic pel families. Pel-3 also is unusual in that it is predicted to contain an ATP- and GTP-binding site motif A (P-loop) not found in the other Pels. Images PMID:8074530

Divergence and evolution of homologous regions of Bombyx mori nuclear polyhedrosis virus.

PubMed Central

Majima, K; Kobara, R; Maeda, S

1993-01-01

Homologous regions (hrs) (hr1,hr2-left,hr2-right,hr3,hr4-left,hr 4-right, and hr5) similar to those found in the Autographa californica nuclear polyhedrosis virus (AcNPV) genome were found in the Bombyx mori NPV (BmNPV) genome. The BmNPV hrs contained two to eight repeats of a homologous nucleotide sequence which were on average about 75 bp long. All of these homologous sequence repeats contained a 26-bp-long palindrome motif with an EcoRI or EcoRI-like site at its core. The consensus sequence of the BmNPV hrs showed 95% conservation with respect to those found in AcNPV. Nucleotide sequence analysis indicated that hr2-left and hr2-right of BmNPV evolved from an ancestor similar to hr2 of AcNPV by inversion, cleavage, and ligation. The polarities of the BmNPV and AcNPV hrs were conserved except for that of hr4-left. Within hr4-right of BmNPV, four repeats of a previously underscribed palindrome motif were found. Bmhr5D, a BmNPV mutant which lacked hr5, replicated at a rate similar to that of wild-type BmNPV in BmN cells and silkworm larvae, indicating that hr5 was not essential for viral replication. After ten passages of Bmhr5D in BmN cells, no detectable changes in its genome were observed by restriction endonuclease analysis. The evolution and divergence of the BmNPV genome are also discussed. Images PMID:8230471

A retrotransposable element from the mosquito Anopheles gambiae .

PubMed Central

Besansky, N J

1990-01-01

A family of middle repetitive elements from the African malaria vector Anopheles gambiae is described. Approximately 100 copies of the element, designated T1Ag, are dispersed in the genome. Full-length elements are 4.6 kilobase pairs in length, but truncation of the 5' end is common. Nucleotide sequences of one full-length, two 5'-truncated, and two 5' ends of T1Ag elements were determined and aligned to define a consensus sequence. Sequence analysis revealed two long, overlapping open reading frames followed by a polyadenylation signal, AATAAA, and a tail consisting of tandem repetitions of the motif TGAAA. No direct or inverted long terminal repeats (LTRs) were detected. The first open reading frame, 442 amino acids in length, includes a domain resembling that of nucleic acid-binding proteins. The second open reading frame, 975 amino acids long, resembles the reverse transcriptases of a category of retrotransposable elements without LTRs, variously termed class II retrotransposons, class III elements or non-LTR retrotransposons. Similarity at the sequence and structural levels places T1Ag in this category. Images PMID:1689457

Complete genome sequences of avian paramyxovirus type 8 strains goose/Delaware/1053/76 and pintail/Wakuya/20/78

PubMed Central

Paldurai, Anandan; Subbiah, Madhuri; Kumar, Sachin; Collins, Peter L.; Samal, Siba K.

2009-01-01

Complete consensus genome sequences were determined for avian paramyxovirus type 8 (APMV-8) strains goose/Delaware/1053/76 (prototype strain) and pintail/Wakuya/20/78. The genome of each strain is 15,342 nucleotides (nt) long, which follows the “rule of six”. The genome consists of six genes in the order of 3′-N-P/V/W-M-F-HN-L-5′. The genes are flanked on either side by conserved transcription start and stop signals, and have intergenic regions ranging from 1 to 30 nt. The genome contains a 55 nt leader region at the 3′-end and a 171 nt trailer region at the 5′-end. Comparison of sequences of strains Delaware and Wakuya showed nucleotide identity of 96.8% at the genome level and amino acid identities of 99.3%, 96.5%, 98.6%, 99.4%, 98.6% and 99.1% for the predicted N, P, M, F, HN and L proteins, respectively. Both strains grew in embryonated chicken eggs and in primary chicken embryo kidney cells, and 293T cells. Both strains contained only a single basic residue at the cleavage activation site of the F protein and their efficiency of replication in vitro depended on and was augmented by, the presence of exogenous protease in most cell lines. Sequence alignment and phylogenic analysis of the predicted amino acid sequence of APMV-8 strain Delaware proteins with the cognate proteins of other available APMV serotypes showed that APMV-8 is more closely related to APMV-2 and -6 than to APMV-1, -3 and -4. PMID:19341613

Structural basis for allosteric cross-talk between the asymmetric nucleotide binding sites of a heterodimeric ABC exporter.

PubMed

Hohl, Michael; Hürlimann, Lea M; Böhm, Simon; Schöppe, Jendrik; Grütter, Markus G; Bordignon, Enrica; Seeger, Markus A

2014-07-29

ATP binding cassette (ABC) transporters mediate vital transport processes in every living cell. ATP hydrolysis, which fuels transport, displays positive cooperativity in numerous ABC transporters. In particular, heterodimeric ABC exporters exhibit pronounced allosteric coupling between a catalytically impaired degenerate site, where nucleotides bind tightly, and a consensus site, at which ATP is hydrolyzed in every transport cycle. Whereas the functional phenomenon of cooperativity is well described, its structural basis remains poorly understood. Here, we present the apo structure of the heterodimeric ABC exporter TM287/288 and compare it to the previously solved structure with adenosine 5'-(β,γ-imido)triphosphate (AMP-PNP) bound at the degenerate site. In contrast to other ABC exporter structures, the nucleotide binding domains (NBDs) of TM287/288 remain in molecular contact even in the absence of nucleotides, and the arrangement of the transmembrane domains (TMDs) is not influenced by AMP-PNP binding, a notion confirmed by double electron-electron resonance (DEER) measurements. Nucleotide binding at the degenerate site results in structural rearrangements, which are transmitted to the consensus site via two D-loops located at the NBD interface. These loops owe their name from a highly conserved aspartate and are directly connected to the catalytically important Walker B motif. The D-loop at the degenerate site ties the NBDs together even in the absence of nucleotides and substitution of its aspartate by alanine is well-tolerated. By contrast, the D-loop of the consensus site is flexible and the aspartate to alanine mutation and conformational restriction by cross-linking strongly reduces ATP hydrolysis and substrate transport.

Control of artefactual variation in reported inter-sample relatedness during clinical use of a Mycobacterium tuberculosis sequencing pipeline.

PubMed

Wyllie, David H; Sanderson, Nicholas; Myers, Richard; Peto, Tim; Robinson, Esther; Crook, Derrick W; Smith, E Grace; Walker, A Sarah

2018-06-06

Contact tracing requires reliable identification of closely related bacterial isolates. When we noticed the reporting of artefactual variation between M. tuberculosis isolates during routine next generation sequencing of Mycobacterium spp, we investigated its basis in 2,018 consecutive M. tuberculosis isolates. In the routine process used, clinical samples were decontaminated and inoculated into broth cultures; from positive broth cultures DNA was extracted, sequenced, reads mapped, and consensus sequences determined. We investigated the process of consensus sequence determination, which selects the most common nucleotide at each position. Having determined the high-quality read depth and depth of minor variants across 8,006 M. tuberculosis genomic regions, we quantified the relationship between the minor variant depth and the amount of non-Mycobacterial bacterial DNA, which originates from commensal microbes killed during sample decontamination. In the presence of non-Mycobacterial bacterial DNA, we found significant increases in minor variant frequencies of more than 1.5 fold in 242 regions covering 5.1% of the M. tuberculosis genome. Included within these were four high variation regions strongly influenced by the amount of non-Mycobacterial bacterial DNA. Excluding these four regions from pairwise distance comparisons reduced biologically implausible variation from 5.2% to 0% in an independent validation set derived from 226 individuals. Thus, we have demonstrated an approach identifying critical genomic regions contributing to clinically relevant artefactual variation in bacterial similarity searches. The approach described monitors the outputs of the complex multi-step laboratory and bioinformatics process, allows periodic process adjustments, and will have application to quality control of routine bacterial genomics. Copyright © 2018 Wyllie et al.

In silico prediction of splice-altering single nucleotide variants in the human genome.

PubMed

Jian, Xueqiu; Boerwinkle, Eric; Liu, Xiaoming

2014-12-16

In silico tools have been developed to predict variants that may have an impact on pre-mRNA splicing. The major limitation of the application of these tools to basic research and clinical practice is the difficulty in interpreting the output. Most tools only predict potential splice sites given a DNA sequence without measuring splicing signal changes caused by a variant. Another limitation is the lack of large-scale evaluation studies of these tools. We compared eight in silico tools on 2959 single nucleotide variants within splicing consensus regions (scSNVs) using receiver operating characteristic analysis. The Position Weight Matrix model and MaxEntScan outperformed other methods. Two ensemble learning methods, adaptive boosting and random forests, were used to construct models that take advantage of individual methods. Both models further improved prediction, with outputs of directly interpretable prediction scores. We applied our ensemble scores to scSNVs from the Catalogue of Somatic Mutations in Cancer database. Analysis showed that predicted splice-altering scSNVs are enriched in recurrent scSNVs and known cancer genes. We pre-computed our ensemble scores for all potential scSNVs across the human genome, providing a whole genome level resource for identifying splice-altering scSNVs discovered from large-scale sequencing studies.

The gamma subunit of transducin is farnesylated.

PubMed Central

Lai, R K; Perez-Sala, D; Cañada, F J; Rando, R R

1990-01-01

Protein prenylation with farnesyl or geranylgeranyl moieties is an important posttranslational modification that affects the activity of such diverse proteins as the nuclear lamins, the yeast mating factor mata, and the ras oncogene products. In this article, we show that whole retinal cultures incorporate radioactive mevalonic acid into proteins of 23-26 kDa and one of 8 kDa. The former proteins are probably the "small" guanine nucleotide-binding regulatory proteins (G proteins) and the 8-kDa protein is the gamma subunit of the well-studied retinal heterotrimeric G protein (transducin). After deprenylating purified transducin and its subunits with Raney nickel or methyl iodide/base, the adducted prenyl group can be identified as an all-trans-farnesyl moiety covalently linked to a cysteine residue. Thus far, prenylation reactions have been found to occur at cysteine in a carboxyl-terminal consensus CAAX sequence, where C is the cysteine, A is an aliphatic amino acid, and X is undefined. Both the alpha and gamma subunits of transducin have this consensus sequence, but only the gamma subunit is prenylated. Therefore, the CAAX motif is not necessary and sufficient to direct prenylation. Finally, since transducin is the best understood G protein, both structurally and mechanistically, the discovery that it is farnesylated should allow for a quantitative understanding of this post-translational modification. Images PMID:2217200

Analysis of a cis-Acting Element Involved in Regulation by Estrogen of Human Angiotensinogen Gene Expression.

PubMed

Zhao, Yan-Yan; Sun, Kai-Lai; Ashok, Kumar

1998-01-01

The work was aimed to identify the estrogen responsive element in the human angiotensinogen gene. The nucleotide sequence between the transcription initiation site and TATA box in angiotensinogen gene promoter was found to be strongly homologous with the consensus estrogen responsive element. This sequence was confirmed as the estrogen responsive element (HAG ERE) by electrophoretic mobility shift assay. The recombinant expression vectors were constructed in which chloramphenicol acetyltransferase (CAT) reporter gene was driven by angiotensinogen core promoter with HAG ERE of by TK core promoter with multiplied HAG ERE, and were used in cotransfection with the human estrogen receptor expression vector into HepG(2) cells; CAT assays showed an increase of the CAT activity on 17beta-estradiol treatment in those transfectants. These results suggest that the human angiotensinogen gene is transcriptionally up-regulated by estrogen through the estrogen responsive element near TATA box of the promoter.

Nucleotide sequences specific to Yersinia pestis and methods for the detection of Yersinia pestis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Motin, Vladinir L [League City, TX

2009-02-24

Nucleotide sequences specific to Yersinia pestis that serve as markers or signatures for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Nucleotide sequences specific to Brucella and methods for the detection of Brucella

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCready, Paula M; Radnedge, Lyndsay; Andersen, Gary L

Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Structure of the human gene encoding the protein repair L-isoaspartyl (D-aspartyl) O-methyltransferase.

PubMed

DeVry, C G; Tsai, W; Clarke, S

1996-11-15

The protein L-isoaspartyl/D-aspartyl O-methyltransferase (EC 2.1.1.77) catalyzes the first step in the repair of proteins damaged in the aging process by isomerization or racemization reactions at aspartyl and asparaginyl residues. A single gene has been localized to human chromosome 6 and multiple transcripts arising through alternative splicing have been identified. Restriction enzyme mapping, subcloning, and DNA sequence analysis of three overlapping clones from a human genomic library in bacteriophage P1 indicate that the gene spans approximately 60 kb and is composed of 8 exons interrupted by 7 introns. Analysis of intron/exon splice junctions reveals that all of the donor and acceptor splice sites are in agreement with the mammalian consensus splicing sequence. Determination of transcription initiation sites by primer extension analysis of poly(A)+ mRNA from human brain identifies multiple start sites, with a major site 159 nucleotides upstream from the ATG start codon. Sequence analysis of the 5'-untranslated region demonstrates several potential cis-acting DNA elements including SP1, ETF, AP1, AP2, ARE, XRE, CREB, MED-1, and half-palindromic ERE motifs. The promoter of this methyltransferase gene lacks an identifiable TATA box but is characterized by a CpG island which begins approximately 723 nucleotides upstream of the major transcriptional start site and extends through exon 1 and into the first intron. These features are characteristic of housekeeping genes and are consistent with the wide tissue distribution observed for this methyltransferase activity.

Nucleotide sequence and structural organization of the human vasopressin pituitary receptor (V3) gene.

PubMed

René, P; Lenne, F; Ventura, M A; Bertagna, X; de Keyzer, Y

2000-01-04

In the pituitary, vasopressin triggers ACTH release through a specific receptor subtype, termed V3 or V1b. We cloned the V3 cDNA and showed that its expression was almost exclusive to pituitary corticotrophs and some corticotroph tumors. To study the determinants of this tissue specificity, we have now cloned the gene for the human (h) V3 receptor and characterized its structure. It is composed of two exons, spanning 10kb, with the coding region interrupted between transmembrane domains 6 and 7. We established that the transcription initiation site is located 498 nucleotides upstream of the initiator codon and showed that two polyadenylation sites may be used, while the most frequent is the most downstream. Sequence analysis of the promoter region showed no TATA box but identified consensus binding motifs for Sp1, CREB, and half sites of the estrogen receptor binding site. However comparison with another corticotroph-specific gene, proopiomelanocortin, did not identify common regulatory elements in the two promoters except for a short GC-rich region. Unexpectedly, hV3 gene analysis revealed that a formerly cloned 'artifactual' hV3 cDNA indeed corresponded to a spliced antisense transcript, overlapping the 5' part of the coding sequence in exon 1 and the promoter region. This transcript, hV3rev, was detected in normal pituitary and in many corticotroph tumors expressing hV3 sense mRNA and may therefore play a role in hV3 gene expression.

Mechanisms of radiation-induced gene responses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Woloschak, G.E.; Paunesku, T.

1996-10-01

In the process of identifying genes differentially expressed in cells exposed ultraviolet radiation, we have identified a transcript having a 26-bp region that is highly conserved in a variety of species including Bacillus circulans, yeast, pumpkin, Drosophila, mouse, and man. When the 5` region (flanking region or UTR) of a gene, the sequence is predominantly in +/+ orientation with respect to the coding DNA strand; while in the coding region and the 3` region (UTR), the sequence is most frequently in the +/-orientation with respect to the coding DNA strand. In two genes, the element is split into two parts;more » however, in most cases, it is found only once but with a minimum of 11 consecutive nucleotides precisely depicting the original sequence. The element is found in a large number of different genes with diverse functions (from human ras p21 to B. circulans chitonase). Gel shift assays demonstrated the presence of a protein in HeLa cell extracts that binds to the sense and antisense single-stranded consensus oligomers, as well as to the double- stranded oligonucleotide. When double-stranded oligomer was used, the size shift demonstrated as additional protein-oligomer complex larger than the one bound to either sense or antisense single-stranded consensus oligomers alone. It is speculated either that this element binds to protein(s) important in maintaining DNA is a single-stranded orientation for transcription or, alternatively that this element is important in the transcription-coupled DNA repair process.« less

Characterization of avian paramyxovirus serotype 14, a novel serotype, isolated from a duck fecal sample in Japan.

PubMed

Thampaisarn, Rapeewan; Bui, Vuong N; Trinh, Dai Q; Nagai, Makoto; Mizutani, Tetsuya; Omatsu, Tsutomu; Katayama, Yukie; Gronsang, Dulyatad; Le, Duong H T; Ogawa, Haruko; Imai, Kunitoshi

2017-01-15

A hemagglutinating virus isolate designated 11OG0352, was obtained from a duck fecal sample. Genetic and virological analyses indicated that it might represent a novel serotype of avian paramyxovirus (APMV). Electron micrographs showed that the morphology of the virus particle was similar to that of APMV. The complete genome of this virus comprised 15,444 nucleotides complying with the paramyxovirus "rule of six" and contains six open reading frames (3'-N-P-M-F-HN-L-5'). The phylogenetic analysis of the whole genome revealed that the virus was a member of the genus Avulavirus, but that it was distinct from APMV-1 to APMV-13. Although the F-protein cleavage site was TREGK↓L, which resembles a lentogenic strain of APMV-1, the K residue at position -1 of the cleavage site was first discovered in APMV members. The phosphoprotein gene of isolate 11OG0352 contains a putative RNA editing site, 3'-AUUUUCCC-5' (negative sense) which sequence differs from that of other APMVs. The intracerebral pathogenicity index test did not detect virulence in infected chicks. In hemagglutination inhibition (HI) tests, an antiserum against this virus did not detectably react with other APMVs (serotypes 1-4, 6-9) except for low reciprocal cross-reactivity with APMV-6. We designated this isolate, as APMV-14/duck/Japan/11OG0352/2011 and propose that it is a novel APMV serotype. The HI test may not be widely applicable for the classification of a new serotype because of the limited availability of reference antisera against all serotypes and cross-reactivity data. The nucleotide sequence identities of the whole genome of 11OG0352 and other APMVs ranged from 46.3% to 56.1%. Such comparison may provide a useful tool for classifying new APMV isolates. However, the nucleotide sequence identity between APMV-12 and APMV-13 was higher (64%), which was nearly identical to the lowest nucleotide identity (67%) reported in subgroups within the serotype. Therefore, consensus criteria for using whole genome analysis should be established. Copyright © 2016 Elsevier B.V. All rights reserved.

Complete nucleotide sequence of a monopartite Begomovirus and associated satellites infecting Carica papaya in Nepal.

PubMed

Shahid, M S; Yoshida, S; Khatri-Chhetri, G B; Briddon, R W; Natsuaki, K T

2013-06-01

Carica papaya (papaya) is a fruit crop that is cultivated mostly in kitchen gardens throughout Nepal. Leaf samples of C. papaya plants with leaf curling, vein darkening, vein thickening, and a reduction in leaf size were collected from a garden in Darai village, Rampur, Nepal in 2010. Full-length clones of a monopartite Begomovirus, a betasatellite and an alphasatellite were isolated. The complete nucleotide sequence of the Begomovirus showed the arrangement of genes typical of Old World begomoviruses with the highest nucleotide sequence identity (>99 %) to an isolate of Ageratum yellow vein virus (AYVV), confirming it as an isolate of AYVV. The complete nucleotide sequence of betasatellite showed greater than 89 % nucleotide sequence identity to an isolate of Tomato leaf curl Java betasatellite originating from Indonesian. The sequence of the alphasatellite displayed 92 % nucleotide sequence identity to Sida yellow vein China alphasatellite. This is the first identification of these components in Nepal and the first time they have been identified in papaya.

Human Ro60 (SSA2) genomic organization and sequence alterations, examined in cutaneous lupus erythematosus.

PubMed

Millard, T P; Ashton, G H S; Kondeatis, E; Vaughan, R W; Hughes, G R V; Khamashta, M A; Hawk, J L M; McGregor, J M; McGrath, J A

2002-02-01

The Ro 60 kDa protein (Ro60 or SSA2) is the major component of the Ro ribonucleoprotein (Ro RNP) complex, to which an immune response is a specific feature of several autoimmune diseases. The genomic organization and any sequence variation within the DNA encoding Ro60 are unknown. To characterize the Ro60 gene structure and to assess whether any sequence alterations might be associated with serum anti-Ro antibody in subacute cutaneous lupus erythematosus (SCLE), thus potentially providing new insight into disease pathogenesis. The cDNA sequence for Ro60 was obtained from the NCBI database and used for a BLAST search for a clone containing the entire genomic sequence. The intron-exon borders were confirmed by designing intronic primer pairs to flank each exon, which were then used to amplify genomic DNA for automated sequencing from 36 caucasian patients with SCLE (anti-Ro positive) and 49 with discoid LE (DLE, anti-Ro negative), in addition to 36 healthy caucasian controls. Heteroduplex analysis of polymerase chain reaction (PCR) products from patients and controls spanning all Ro60 exons (1-8) revealed a common bandshift in the PCR products spanning exon 7. Sequencing of the corresponding PCR products demonstrated an A > G substitution at nucleotide position 1318-7, within the consensus acceptor splice site of exon 7 (GenBank XM001901). The allele frequencies were major allele A (0.71) and minor allele G (0.29) in 72 control chromosomes, with no significant differences found between SCLE patients, DLE patients and controls. The genomic organization of the DNA encoding the Ro60 protein is described, including a common polymorphism within the consensus acceptor splice site of exon 7. Our delineation of a strategy for the genomic amplification of Ro60 forms a basis for further examination of the pathological functions of the Ro RNP in autoimmune disease.

A High Quality Draft Consensus Sequence of the Genome of a Heterozygous Grapevine Variety

PubMed Central

Cartwright, Dustin A.; Cestaro, Alessandro; Pruss, Dmitry; Pindo, Massimo; FitzGerald, Lisa M.; Vezzulli, Silvia; Reid, Julia; Malacarne, Giulia; Iliev, Diana; Coppola, Giuseppina; Wardell, Bryan; Micheletti, Diego; Macalma, Teresita; Facci, Marco; Mitchell, Jeff T.; Perazzolli, Michele; Eldredge, Glenn; Gatto, Pamela; Oyzerski, Rozan; Moretto, Marco; Gutin, Natalia; Stefanini, Marco; Chen, Yang; Segala, Cinzia; Davenport, Christine; Demattè, Lorenzo; Mraz, Amy; Battilana, Juri; Stormo, Keith; Costa, Fabrizio; Tao, Quanzhou; Si-Ammour, Azeddine; Harkins, Tim; Lackey, Angie; Perbost, Clotilde; Taillon, Bruce; Stella, Alessandra; Solovyev, Victor; Fawcett, Jeffrey A.; Sterck, Lieven; Vandepoele, Klaas; Grando, Stella M.; Toppo, Stefano; Moser, Claudio; Lanchbury, Jerry; Bogden, Robert; Skolnick, Mark; Sgaramella, Vittorio; Bhatnagar, Satish K.; Fontana, Paolo; Gutin, Alexander; Van de Peer, Yves; Salamini, Francesco; Viola, Roberto

2007-01-01

Background Worldwide, grapes and their derived products have a large market. The cultivated grape species Vitis vinifera has potential to become a model for fruit trees genetics. Like many plant species, it is highly heterozygous, which is an additional challenge to modern whole genome shotgun sequencing. In this paper a high quality draft genome sequence of a cultivated clone of V. vinifera Pinot Noir is presented. Principal Findings We estimate the genome size of V. vinifera to be 504.6 Mb. Genomic sequences corresponding to 477.1 Mb were assembled in 2,093 metacontigs and 435.1 Mb were anchored to the 19 linkage groups (LGs). The number of predicted genes is 29,585, of which 96.1% were assigned to LGs. This assembly of the grape genome provides candidate genes implicated in traits relevant to grapevine cultivation, such as those influencing wine quality, via secondary metabolites, and those connected with the extreme susceptibility of grape to pathogens. Single nucleotide polymorphism (SNP) distribution was consistent with a diffuse haplotype structure across the genome. Of around 2,000,000 SNPs, 1,751,176 were mapped to chromosomes and one or more of them were identified in 86.7% of anchored genes. The relative age of grape duplicated genes was estimated and this made possible to reveal a relatively recent Vitis-specific large scale duplication event concerning at least 10 chromosomes (duplication not reported before). Conclusions Sanger shotgun sequencing and highly efficient sequencing by synthesis (SBS), together with dedicated assembly programs, resolved a complex heterozygous genome. A consensus sequence of the genome and a set of mapped marker loci were generated. Homologous chromosomes of Pinot Noir differ by 11.2% of their DNA (hemizygous DNA plus chromosomal gaps). SNP markers are offered as a tool with the potential of introducing a new era in the molecular breeding of grape. PMID:18094749

Filovirus RefSeq Entries: Evaluation and Selection of Filovirus Type Variants, Type Sequences, and Names

PubMed Central

Kuhn, Jens H.; Andersen, Kristian G.; Bào, Yīmíng; Bavari, Sina; Becker, Stephan; Bennett, Richard S.; Bergman, Nicholas H.; Blinkova, Olga; Bradfute, Steven; Brister, J. Rodney; Bukreyev, Alexander; Chandran, Kartik; Chepurnov, Alexander A.; Davey, Robert A.; Dietzgen, Ralf G.; Doggett, Norman A.; Dolnik, Olga; Dye, John M.; Enterlein, Sven; Fenimore, Paul W.; Formenty, Pierre; Freiberg, Alexander N.; Garry, Robert F.; Garza, Nicole L.; Gire, Stephen K.; Gonzalez, Jean-Paul; Griffiths, Anthony; Happi, Christian T.; Hensley, Lisa E.; Herbert, Andrew S.; Hevey, Michael C.; Hoenen, Thomas; Honko, Anna N.; Ignatyev, Georgy M.; Jahrling, Peter B.; Johnson, Joshua C.; Johnson, Karl M.; Kindrachuk, Jason; Klenk, Hans-Dieter; Kobinger, Gary; Kochel, Tadeusz J.; Lackemeyer, Matthew G.; Lackner, Daniel F.; Leroy, Eric M.; Lever, Mark S.; Mühlberger, Elke; Netesov, Sergey V.; Olinger, Gene G.; Omilabu, Sunday A.; Palacios, Gustavo; Panchal, Rekha G.; Park, Daniel J.; Patterson, Jean L.; Paweska, Janusz T.; Peters, Clarence J.; Pettitt, James; Pitt, Louise; Radoshitzky, Sheli R.; Ryabchikova, Elena I.; Saphire, Erica Ollmann; Sabeti, Pardis C.; Sealfon, Rachel; Shestopalov, Aleksandr M.; Smither, Sophie J.; Sullivan, Nancy J.; Swanepoel, Robert; Takada, Ayato; Towner, Jonathan S.; van der Groen, Guido; Volchkov, Viktor E.; Volchkova, Valentina A.; Wahl-Jensen, Victoria; Warren, Travis K.; Warfield, Kelly L.; Weidmann, Manfred; Nichol, Stuart T.

2014-01-01

Sequence determination of complete or coding-complete genomes of viruses is becoming common practice for supporting the work of epidemiologists, ecologists, virologists, and taxonomists. Sequencing duration and costs are rapidly decreasing, sequencing hardware is under modification for use by non-experts, and software is constantly being improved to simplify sequence data management and analysis. Thus, analysis of virus disease outbreaks on the molecular level is now feasible, including characterization of the evolution of individual virus populations in single patients over time. The increasing accumulation of sequencing data creates a management problem for the curators of commonly used sequence databases and an entry retrieval problem for end users. Therefore, utilizing the data to their fullest potential will require setting nomenclature and annotation standards for virus isolates and associated genomic sequences. The National Center for Biotechnology Information’s (NCBI’s) RefSeq is a non-redundant, curated database for reference (or type) nucleotide sequence records that supplies source data to numerous other databases. Building on recently proposed templates for filovirus variant naming [ ()////-], we report consensus decisions from a majority of past and currently active filovirus experts on the eight filovirus type variants and isolates to be represented in RefSeq, their final designations, and their associated sequences. PMID:25256396

Nucleotide sequences encoding a thermostable alkaline protease

DOEpatents

Wilson, David B.; Lao, Guifang

1998-01-01

Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.

Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA

2007-02-06

Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA

2009-02-24

Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Nucleotide sequences encoding a thermostable alkaline protease

DOEpatents

Wilson, D.B.; Lao, G.

1998-01-06

Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.

Evolutionary conservation analysis increases the colocalization of predicted exonic splicing enhancers in the BRCA1 gene with missense sequence changes and in-frame deletions, but not polymorphisms

PubMed Central

Pettigrew, Christopher; Wayte, Nicola; Lovelock, Paul K; Tavtigian, Sean V; Chenevix-Trench, Georgia; Spurdle, Amanda B; Brown, Melissa A

2005-01-01

Introduction Aberrant pre-mRNA splicing can be more detrimental to the function of a gene than changes in the length or nature of the encoded amino acid sequence. Although predicting the effects of changes in consensus 5' and 3' splice sites near intron:exon boundaries is relatively straightforward, predicting the possible effects of changes in exonic splicing enhancers (ESEs) remains a challenge. Methods As an initial step toward determining which ESEs predicted by the web-based tool ESEfinder in the breast cancer susceptibility gene BRCA1 are likely to be functional, we have determined their evolutionary conservation and compared their location with known BRCA1 sequence variants. Results Using the default settings of ESEfinder, we initially detected 669 potential ESEs in the coding region of the BRCA1 gene. Increasing the threshold score reduced the total number to 464, while taking into consideration the proximity to splice donor and acceptor sites reduced the number to 211. Approximately 11% of these ESEs (23/211) either are identical at the nucleotide level in human, primates, mouse, cow, dog and opossum Brca1 (conserved) or are detectable by ESEfinder in the same position in the Brca1 sequence (shared). The frequency of conserved and shared predicted ESEs between human and mouse is higher in BRCA1 exons (2.8 per 100 nucleotides) than in introns (0.6 per 100 nucleotides). Of conserved or shared putative ESEs, 61% (14/23) were predicted to be affected by sequence variants reported in the Breast Cancer Information Core database. Applying the filters described above increased the colocalization of predicted ESEs with missense changes, in-frame deletions and unclassified variants predicted to be deleterious to protein function, whereas they decreased the colocalization with known polymorphisms or unclassified variants predicted to be neutral. Conclusion In this report we show that evolutionary conservation analysis may be used to improve the specificity of an ESE prediction tool. This is the first report on the prediction of the frequency and distribution of ESEs in the BRCA1 gene, and it is the first reported attempt to predict which ESEs are most likely to be functional and therefore which sequence variants in ESEs are most likely to be pathogenic. PMID:16280041

Echinococcus granulosus Sensu Stricto in Dogs and Jackals from Caspian Sea Region, Northern Iran

PubMed Central

GHOLAMI, Shirzad; JAHANDAR, Hefzallah; ABASTABAR, Mahdi; PAGHEH, Abdolsatar; MOBEDI, Iraj; SHARBATKHORI, Mitra

2016-01-01

Background: The aim of the present study was genotyping of Echinococcus granulosus isolates from dogs and jackals in Mazandaran Province, northern Iran, and using partial sequence of the mitochondrial cytochrome c oxidase subunit 1 gene (cox1). Methods: E. granulosus isolates (n = 15) were collected from 42 stray dogs and 16 jackals found in south of the Caspian Sea in northern Iran. After morphological study, the isolates were genetically characterized using consensus sequences (366bp) of the cox1 gene. Phylogenetic analysis of cox1 nucleotide sequence data was performed using a Bayesian Inference approach. Results: Four different sequences were observed among the isolates. Two genotypes [G1 (66.7%) and G3 (33.3%)] were identified among the isolates. The G1 sequences indicated three sequence profiles. One profile (Maz1) had 100% homology with reference sequence (AN: KP339045). Two other profiles, designated Maz2 and Maz3, had 99% homology with the G1 genotype (ANs: KP339046 and KP339047). A G3 sequence designated Maz4 showed 100% homology with a G3 reference sequence (AN: KP339048). Conclusion: The occurrence of the G1 genotype of E. granulosus sensu stricto as a frequent genotype in dogs is emphasized. This study established the first molecular characterization of E. granulosus in the province. PMID:28096852

Consensus generation and variant detection by Celera Assembler.

PubMed

Denisov, Gennady; Walenz, Brian; Halpern, Aaron L; Miller, Jason; Axelrod, Nelson; Levy, Samuel; Sutton, Granger

2008-04-15

We present an algorithm to identify allelic variation given a Whole Genome Shotgun (WGS) assembly of haploid sequences, and to produce a set of haploid consensus sequences rather than a single consensus sequence. Existing WGS assemblers take a column-by-column approach to consensus generation, and produce a single consensus sequence which can be inconsistent with the underlying haploid alleles, and inconsistent with any of the aligned sequence reads. Our new algorithm uses a dynamic windowing approach. It detects alleles by simultaneously processing the portions of aligned reads spanning a region of sequence variation, assigns reads to their respective alleles, phases adjacent variant alleles and generates a consensus sequence corresponding to each confirmed allele. This algorithm was used to produce the first diploid genome sequence of an individual human. It can also be applied to assemblies of multiple diploid individuals and hybrid assemblies of multiple haploid organisms. Being applied to the individual human genome assembly, the new algorithm detects exactly two confirmed alleles and reports two consensus sequences in 98.98% of the total number 2,033311 detected regions of sequence variation. In 33,269 out of 460,373 detected regions of size >1 bp, it fixes the constructed errors of a mosaic haploid representation of a diploid locus as produced by the original Celera Assembler consensus algorithm. Using an optimized procedure calibrated against 1 506 344 known SNPs, it detects 438 814 new heterozygous SNPs with false positive rate 12%. The open source code is available at: http://wgs-assembler.cvs.sourceforge.net/wgs-assembler/

Molecular characterization of human T-cell lymphotropic virus type 1 full and partial genomes by Illumina massively parallel sequencing technology.

PubMed

Pessôa, Rodrigo; Watanabe, Jaqueline Tomoko; Nukui, Youko; Pereira, Juliana; Casseb, Jorge; Kasseb, Jorge; de Oliveira, Augusto César Penalva; Segurado, Aluisio Cotrim; Sanabani, Sabri Saeed

2014-01-01

Here, we report on the partial and full-length genomic (FLG) variability of HTLV-1 sequences from 90 well-characterized subjects, including 48 HTLV-1 asymptomatic carriers (ACs), 35 HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP) and 7 adult T-cell leukemia/lymphoma (ATLL) patients, using an Illumina paired-end protocol. Blood samples were collected from 90 individuals, and DNA was extracted from the PBMCs to measure the proviral load and to amplify the HTLV-1 FLG from two overlapping fragments. The amplified PCR products were subjected to deep sequencing. The sequencing data were assembled, aligned, and mapped against the HTLV-1 genome with sufficient genetic resemblance and utilized for further phylogenetic analysis. A high-throughput sequencing-by-synthesis instrument was used to obtain an average of 3210- and 5200-fold coverage of the partial (n = 14) and FLG (n = 76) data from the HTLV-1 strains, respectively. The results based on the phylogenetic trees of consensus sequences from partial and FLGs revealed that 86 (95.5%) individuals were infected with the transcontinental sub-subtypes of the cosmopolitan subtype (aA) and that 4 individuals (4.5%) were infected with the Japanese sub-subtypes (aB). A comparison of the nucleotide and amino acids of the FLG between the three clinical settings yielded no correlation between the sequenced genotype and clinical outcomes. The evolutionary relationships among the HTLV sequences were inferred from nucleotide sequence, and the results are consistent with the hypothesis that there were multiple introductions of the transcontinental subtype in Brazil. This study has increased the number of subtype aA full-length genomes from 8 to 81 and HTLV-1 aB from 2 to 5 sequences. The overall data confirmed that the cosmopolitan transcontinental sub-subtypes were the most prevalent in the Brazilian population. It is hoped that this valuable genomic data will add to our current understanding of the evolutionary history of this medically important virus.

Genome analysis of canine astroviruses reveals genetic heterogeneity and suggests possible inter-species transmission.

PubMed

Mihalov-Kovács, Eszter; Martella, Vito; Lanave, Gianvito; Bodnar, Livia; Fehér, Enikő; Marton, Szilvia; Kemenesi, Gábor; Jakab, Ferenc; Bányai, Krisztián

2017-03-15

Canine astrovirus RNA was detected in the stools of 17/63 (26.9%) samples, using either a broadly reactive consensus RT-PCR for astroviruses or random RT-PCR coupled with massive deep sequencing. The complete or nearly complete genome sequence of five canine astroviruses was reconstructed that allowed mapping the genome organization and to investigate the genetic diversity of these viruses. The genome was about 6.6kb in length and contained three open reading frames (ORFs) flanked by a 5' UTR, and a 3' UTR plus a poly-A tail. ORF1a and ORF1b overlapped by 43 nucleotides while the ORF2 overlapped by 8 nucleotides with the 3' end of ORF1b. Upon genome comparison, four strains (HUN/2012/2, HUN/2012/6, HUN/2012/115, and HUN/2012/135) were more related genetically to each other and to UK canine astroviruses (88-96% nt identity), whilst strain HUN/2012/126 was more divergent (75-76% nt identity). In the ORF1b and ORF2, strains HUN/2012/2, HUN/2012/6, and HUN/2012/135 were related genetically to other canine astroviruses identified formerly in Europe and China, whereas strain HUN/2012/126 was related genetically to a divergent canine astrovirus strain, ITA/2010/Zoid. For one canine astrovirus, HUN/2012/8, only a 3.2kb portion of the genome, at the 3' end, could be determined. Interestingly, this strain possessed unique genetic signatures (including a longer ORF1b/ORF2 overlap and a longer 3'UTR) and it was divergent in both ORF1b and ORF2 from all other canine astroviruses, with the highest nucleotide sequence identity (68% and 63%, respectively) to a mink astrovirus, thus suggesting a possible event of interspecies transmission. The genetic heterogeneity of canine astroviruses may pose a challenge for the diagnostics and for future prophylaxis strategies. Copyright © 2016 Elsevier B.V. All rights reserved.

Complex Transcriptional Control of the Antibiotic Regulator afsS in Streptomyces: PhoP and AfsR Are Overlapping, Competitive Activators▿

PubMed Central

Santos-Beneit, Fernando; Rodríguez-García, Antonio; Martín, Juan F.

2011-01-01

The afsS gene of several Streptomyces species encodes a small sigma factor-like protein that acts as an activator of several pathway-specific regulatory genes (e.g., actII-ORF4 and redD in Streptomyces coelicolor). The two pleiotropic regulators AfsR and PhoP bind to overlapping sequences in the −35 region of the afsS promoter and control its expression. Using mutated afsS promoters containing specific point mutations in the AfsR and PhoP binding sequences, we proved that the overlapping recognition sequences for AfsR and PhoP are displaced by 1 nucleotide. Different nucleotide positions are important for binding of AfsR or PhoP, as shown by electrophoretic mobility shift assays and by reporter studies using the luxAB gene coupled to the different promoters. Mutant promoter M5 (with a nucleotide change at position 5 of the consensus box) binds AfsR but not PhoP with high affinity (named “superAfsR”). Expression of the afsS gene from this promoter led to overproduction of actinorhodin. Mutant promoter M16 binds PhoP with extremely high affinity (“superPhoP”). Studies with ΔafsR and ΔphoP mutants (lacking AfsR and PhoP, respectively) showed that both global regulators are competitive transcriptional activators of afsS. AfsR has greater influence on expression of afsS than PhoP, as shown by reverse transcriptase PCR (RT-PCR) and promoter reporter (luciferase) studies. These two high-level regulators appear to integrate different nutritional signals (particularly phosphate limitation sensed by PhoR), S-adenosylmethionine, and other still unknown environmental signals (leading to AfsR phosphorylation) for the AfsS-mediated control of biosynthesis of secondary metabolites. PMID:21378195

Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.

PubMed

Popova, Olga V; Mikhailov, Kirill V; Nikitin, Mikhail A; Logacheva, Maria D; Penin, Aleksey A; Muntyan, Maria S; Kedrova, Olga S; Petrov, Nikolai B; Panchin, Yuri V; Aleoshin, Vladimir V

2016-01-01

Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida) and Pycnophyes kielensis (Allomalorhagida). Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even Protostomia.

Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals

PubMed Central

Popova, Olga V.; Mikhailov, Kirill V.; Nikitin, Mikhail A.; Logacheva, Maria D.; Penin, Aleksey A.; Muntyan, Maria S.; Kedrova, Olga S.; Petrov, Nikolai B.; Panchin, Yuri V.

2016-01-01

Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha—an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida) and Pycnophyes kielensis (Allomalorhagida). Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even Protostomia. PMID:27755612

Transcription activation mediated by a cyclic AMP receptor protein from Thermus thermophilus HB8.

PubMed

Shinkai, Akeo; Kira, Satoshi; Nakagawa, Noriko; Kashihara, Aiko; Kuramitsu, Seiki; Yokoyama, Shigeyuki

2007-05-01

The extremely thermophilic bacterium Thermus thermophilus HB8, which belongs to the phylum Deinococcus-Thermus, has an open reading frame encoding a protein belonging to the cyclic AMP (cAMP) receptor protein (CRP) family present in many bacteria. The protein named T. thermophilus CRP is highly homologous to the CRP family proteins from the phyla Firmicutes, Actinobacteria, and Cyanobacteria, and it forms a homodimer and interacts with cAMP. CRP mRNA and intracellular cAMP were detected in this strain, which did not drastically fluctuate during cultivation in a rich medium. The expression of several genes was altered upon disruption of the T. thermophilus CRP gene. We found six CRP-cAMP-dependent promoters in in vitro transcription assays involving DNA fragments containing the upstream regions of the genes exhibiting decreased expression in the CRP disruptant, indicating that the CRP is a transcriptional activator. The consensus T. thermophilus CRP-binding site predicted upon nucleotide sequence alignment is 5'-(C/T)NNG(G/T)(G/T)C(A/C)N(A/T)NNTCACAN(G/C)(G/C)-3'. This sequence is unique compared with the known consensus binding sequences of CRP family proteins. A putative -10 hexamer sequence resides at 18 to 19 bp downstream of the predicted T. thermophilus CRP-binding site. The CRP-regulated genes found in this study comprise clustered regularly interspaced short palindromic repeat (CRISPR)-associated (cas) ones, and the genes of a putative transcriptional regulator, a protein containing the exonuclease III-like domain of DNA polymerase, a GCN5-related acetyltransferase homolog, and T. thermophilus-specific proteins of unknown function. These results suggest a role for cAMP signal transduction in T. thermophilus and imply the T. thermophilus CRP is a cAMP-responsive regulator.

3'-terminal sequence of a small round structured virus (SRSV) in Japan.

PubMed

Utagawa, E T; Takeda, N; Inouye, S; Kasuga, K; Yamazaki, S

1994-01-01

We determined the nucleotide sequence of about 1,000 bases from the 3'-terminus of a small round structured virus (SRSV), which caused a gastroenteritis outbreak in Chiba Prefecture, Japan, in 1987. The sequence was compared with the corresponding sequence region of Norwalk virus; it consisted of a part of the open reading frame 2 (ORF2), whole ORF3, and 3'-noncoding region (NCR). The 624-base-long ORF3 had sequence homology of 68% with the corresponding region of Norwalk virus. (The amino acid sequence homology was 74%.) The 94-base-long NCR had 65% homology with Norwalk virus. We then selected two consensus-sequence portions in the above sequence between Chiba and Norwalk viruses for primers in the reverse transcriptase-polymerase chain reaction (RT-PCR). Using this primer set, we detected 669-bp bands in agarose gel electrophoresis of RT-PCR products from feces containing Chiba or Norwalk viruses. Furthermore, in Southern hybridization with Chiba probes which were labeled with digoxigenin-dUTP in PCR, the bands of the two viruses were clearly stained under a low stringency condition. Since both Chiba and Norwalk viruses were detected by the above primer set although they are geographically and chronologically different viruses, our primer-pair may be useful for detection of a broad range of SRSVs which cause gastroenteritis in different areas.

Identification of cDNAs encoding viper venom hyaluronidases: cross-generic sequence conservation of full-length and unusually short variant transcripts.

PubMed

Harrison, Robert A; Ibison, Frances; Wilbraham, Davina; Wagstaff, Simon C

2007-05-01

The immobilisation of prey by snakes is most efficiently achieved by the rapid dissemination of venom from its site of injection into the blood stream. Hyaluronidase is a common component of snake venoms and has been termed the "venom spreading factor". In the absence of nucleotide or protein sequence data to confirm the functional identity of this venom component, we interrogated a venom gland EST database for the saw-scaled viper, Echis ocellatus (Nigeria), using the gene ontology (GO) term "carbohydrate metabolism". A single hyalurononglucosaminadase-activity matching sequence (EOC00242) was found and used to design PCR primers to acquire the full-length cDNA sequence. Although very different from the bee venom and mammalian hyaluronidase sequences, the E. ocellatus sequence retained all the catalytic, positional and structural residues that characterise this class of carbohydrate metabolising hydrolases. An extraordinarily high level of sequence identity (>95%) was observed in analogous venom gland cDNA sequences isolated (by PCR) from another saw-scaled viper species, E. pyramidum leakeyi (Kenya), and from the sahara horned viper, Cerastes cerastes cerastes (Egypt) and the puff adder, Bitis arietans (Nigeria). Smaller amplicons, lacking hyaluronidase catalytic residues because of 768 bp or 855 bp central deletions, appear to encode either truncated peptides without hyaluronidase activity, or are non-translated transcripts because they lack consensus translation initiating motifs.

Chimaeric Virus-Like Particles Derived from Consensus Genome Sequences of Human Rotavirus Strains Co-Circulating in Africa

PubMed Central

Jere, Khuzwayo C.; O'Neill, Hester G.; Potgieter, A. Christiaan; van Dijk, Alberdina A.

2014-01-01

Rotavirus virus-like particles (RV-VLPs) are potential alternative non-live vaccine candidates due to their high immunogenicity. They mimic the natural conformation of native viral proteins but cannot replicate because they do not contain genomic material which makes them safe. To date, most RV-VLPs have been derived from cell culture adapted strains or common G1 and G3 rotaviruses that have been circulating in communities for some time. In this study, chimaeric RV-VLPs were generated from the consensus sequences of African rotaviruses (G2, G8, G9 or G12 strains associated with either P[4], P[6] or P[8] genotypes) characterised directly from human stool samples without prior adaptation of the wild type strains to cell culture. Codon-optimised sequences for insect cell expression of genome segments 2 (VP2), 4 (VP4), 6 (VP6) and 9 (VP7) were cloned into a modified pFASTBAC vector, which allowed simultaneous expression of up to four genes using the Bac-to-Bac Baculovirus Expression System (BEVS; Invitrogen). Several combinations of the genome segments originating from different field strains were cloned to produce double-layered RV-VLPs (dRV-VLP; VP2/6), triple-layered RV-VLPs (tRV-VLP; VP2/6/7 or VP2/6/7/4) and chimaeric tRV-VLPs. The RV-VLPs were produced by infecting Spodoptera frugiperda 9 and Trichoplusia ni cells with recombinant baculoviruses using multi-cistronic, dual co-infection and stepwise-infection expression strategies. The size and morphology of the RV-VLPs, as determined by transmission electron microscopy, revealed successful production of RV-VLPs. The novel approach of producing tRV-VLPs, by using the consensus insect cell codon-optimised nucleotide sequence derived from dsRNA extracted directly from clinical specimens, should speed-up vaccine research and development by by-passing the need to adapt rotaviruses to cell culture. Other problems associated with cell culture adaptation, such as possible changes in epitopes, can also be circumvented. Thus, it is now possible to generate tRV-VLPs for evaluation as non-live vaccine candidates for any human or animal field rotavirus strain. PMID:25268783

Dual Regulation of Bacillus subtilis kinB Gene Encoding a Sporulation Trigger by SinR through Transcription Repression and Positive Stringent Transcription Control.

PubMed

Fujita, Yasutaro; Ogura, Mitsuo; Nii, Satomi; Hirooka, Kazutake

2017-01-01

It is known that transcription of kinB encoding a trigger for Bacillus subtilis sporulation is under repression by SinR, a master repressor of biofilm formation, and under positive stringent transcription control depending on the adenine species at the transcription initiation nucleotide (nt). Deletion and base substitution analyses of the kinB promoter (P kinB ) region using lacZ fusions indicated that either a 5-nt deletion (Δ5, nt -61/-57, +1 is the transcription initiation nt) or the substitution of G at nt -45 with A (G-45A) relieved kinB repression. Thus, we found a pair of SinR-binding consensus sequences (GTTCTYT; Y is T or C) in an inverted orientation (SinR-1) between nt -57/-42, which is most likely a SinR-binding site for kinB repression. This relief from SinR repression likely requires SinI, an antagonist of SinR. Surprisingly, we found that SinR is essential for positive stringent transcription control of P kinB . Electrophoretic mobility shift assay (EMSA) analysis indicated that SinR bound not only to SinR-1 but also to SinR-2 (nt -29/-8) consisting of another pair of SinR consensus sequences in a tandem repeat arrangement; the two sequences partially overlap the '-35' and '-10' regions of P kinB . Introduction of base substitutions (T-27C C-26T) in the upstream consensus sequence of SinR-2 affected positive stringent transcription control of P kinB , suggesting that SinR binding to SinR-2 likely causes this positive control. EMSA also implied that RNA polymerase and SinR are possibly bound together to SinR-2 to form a transcription initiation complex for kinB transcription. Thus, it was suggested in this work that derepression of kinB from SinR repression by SinI induced by Spo0A∼P and occurrence of SinR-dependent positive stringent transcription control of kinB might induce effective sporulation cooperatively, implying an intimate interplay by stringent response, sporulation, and biofilm formation.

Characterization of apple stem grooving virus and apple chlorotic leaf spot virus identified in a crab apple tree.

PubMed

Li, Yongqiang; Deng, Congliang; Bian, Yong; Zhao, Xiaoli; Zhou, Qi

2017-04-01

Apple stem grooving virus (ASGV), apple chlorotic leaf spot virus (ACLSV), and prunus necrotic ringspot virus (PNRSV) were identified in a crab apple tree by small RNA deep sequencing. The complete genome sequence of ACLSV isolate BJ (ACLSV-BJ) was 7554 nucleotides and shared 67.0%-83.0% nucleotide sequence identity with other ACLSV isolates. A phylogenetic tree based on the complete genome sequence of all available ACLSV isolates showed that ACLSV-BJ clustered with the isolates SY01 from hawthorn, MO5 from apple, and JB, KMS and YH from pear. The complete nucleotide sequence of ASGV-BJ was 6509 nucleotides (nt) long and shared 78.2%-80.7% nucleotide sequence identity with other isolates. ASGV-BJ and the isolate ASGV_kfp clustered together in the phylogenetic tree as an independent clade. Recombination analysis showed that isolate ASGV-BJ was a naturally occurring recombinant.

Composition for nucleic acid sequencing

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2008-08-26

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Method for sequencing nucleic acid molecules

DOEpatents

Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

2006-06-06

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Method for sequencing nucleic acid molecules

DOEpatents

Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

2006-05-30

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Model for an RNA tertiary interaction from the structure of an intermolecular complex between a GAAA tetraloop and an RNA helix.

PubMed

Pley, H W; Flaherty, K M; McKay, D B

1994-11-03

In large structured RNAs, RNA hairpins in which the strands of the duplex stem are connected by a tetraloop of the consensus sequence 5'-GNRA (where N is any nucleotide, and R is either G or A) are unusually frequent. In group I introns there is a covariation in sequence between nucleotides in the third and fourth positions of the loop with specific distant base pairs in putative RNA duplex stems: GNAA loops correlate with successive 5'-C-C.G-C base pairs in stems, whereas GNGA loops correlate with 5'-C-U.G-A. This has led to the suggestion that GNRA tetraloops may be involved in specific long-range tertiary interactions, with each A in position 3 or 4 of the loop interacting with a C-G base pair in the duplex, and G in position 3 interacting with a U-A base pair. This idea is supported experimentally for the GAAA loop of the P5b extension of the group I intron of Tetrahymena thermophila and the L9 GUGA terminal loop of the td intron of bacteriophage T4 (ref. 4). NMR has revealed the overall structure of the tetraloop for 12-nucleotide hairpins with GCAA and GAAA loops and models have been proposed for the interaction of GNRA tetraloops with base pairs in the minor groove of A-form RNA. Here we describe the crystal structure of an intermolecular complex between a GAAA tetraloop and an RNA helix. The interactions we observe correlate with the specificity of GNRA tetraloops inferred from phylogenetic studies, suggesting that this complex is a legitimate model for intramolecular tertiary interactions mediated by GNRA tetraloops in large structured RNAs.

Molecular phylogeny and SNP variation of polar bears (Ursus maritimus), brown bears (U. arctos), and black bears (U. americanus) derived from genome sequences.

PubMed

Cronin, Matthew A; Rincon, Gonzalo; Meredith, Robert W; MacNeil, Michael D; Islas-Trejo, Alma; Cánovas, Angela; Medrano, Juan F

2014-01-01

We assessed the relationships of polar bears (Ursus maritimus), brown bears (U. arctos), and black bears (U. americanus) with high throughput genomic sequencing data with an average coverage of 25× for each species. A total of 1.4 billion 100-bp paired-end reads were assembled using the polar bear and annotated giant panda (Ailuropoda melanoleuca) genome sequences as references. We identified 13.8 million single nucleotide polymorphisms (SNP) in the 3 species aligned to the polar bear genome. These data indicate that polar bears and brown bears share more SNP with each other than either does with black bears. Concatenation and coalescence-based analysis of consensus sequences of approximately 1 million base pairs of ultraconserved elements in the nuclear genome resulted in a phylogeny with black bears as the sister group to brown and polar bears, and all brown bears are in a separate clade from polar bears. Genotypes for 162 SNP loci of 336 bears from Alaska and Montana showed that the species are genetically differentiated and there is geographic population structure of brown and black bears but not polar bears.

Diverse Dengue Type 2 Virus Populations Contain Recombinant and Both Parental Viruses in a Single Mosquito Host

PubMed Central

Craig, Scott; Thu, Hlaing Myat; Lowry, Kym; Wang, Xiao-fang; Holmes, Edward C.; Aaskov, John

2003-01-01

Envelope (E) protein genes sampled from populations of dengue 2 (DEN-2) virus in individual Aedes aegypti mosquitoes and in serum from dengue patients were copied to cDNA, cloned, and sequenced. The nucleotide sequences of the E genes in more than 70% of the clones differed from the consensus sequence for the corresponding virus population at up to 11 sites, and 24 of the 94 clones contained at least one stop codon. Virus populations recovered up to 2 years apart yielded clones with similar polymorphisms in the E gene. For one mosquito, the clones obtained fell into two genotypes. One group of sequences was closely related to those of viruses recovered from dengue patients in the same locality (Yangon, Myanmar) since 1995 and were classified as Asian 1 genotype. The second group were Cosmopolitan genotype viruses which were also circulating in Yangon in 2000 and which were related to DEN-2 viruses sampled from southern China in 1999. Finally, one clone was identified as a recombinant genome composed of portions of these two “parental” genotypes. This is the first report of recombinant and parental dengue viruses in a single host. PMID:12634407

Labeled nucleotide phosphate (NP) probes

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2009-02-03

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

The primary structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase.

PubMed Central

Hitzeman, R A; Hagie, F E; Hayflick, J S; Chen, C Y; Seeburg, P H; Derynck, R

1982-01-01

The DNA sequence of the gene for the yeast glycolytic enzyme, 3-phosphoglycerate kinase (PGK), has been obtained by sequencing part of a 3.1 kbp HindIII fragment obtained from the yeast genome. The structural gene sequence corresponds to a reading frame of 1251 bp coding for 416 amino acids with no intervening DNA sequences. The amino acid sequence is approximately 65 percent homologous with human and horse PGK protein sequences and is in general agreement with the published protein sequence for yeast PGK. As for other highly expressed structural genes in yeast, the coding sequence is highly codon biased with 95 percent of the amino acids coded for by a select 25 codons (out of 61 possible). Besides structural DNA sequence, 291 bp of 5'-flanking sequence and 286 bp of 3'-flanking sequence were determined. Transcription starts 36 nucleotides upstream from the translational start and stops 86-93 nucleotides downstream from the translational stop. These results suggest a non-polyadenylated mRNA length of 1373 to 1380 nucleotides, which is consistent with the observed length of 1500 nucleotides for polyadenylated PGK mRNA. A sequence TATATATAAA is found at 145 nucleotides upstream from the translational start. This sequence resembles the TATAAA box that is possibly associated with RNA polymerase II binding. Images PMID:6296791

37 CFR 5.31-5.33 - [Reserved

Code of Federal Regulations, 2011 CFR

2011-07-01

... from abandonment 1.135 Amino Acid Sequences. (See Nucleotide and/or Amino Acid Sequences) Appeal to... Appeals and Interference 41.47 Of rejection of an application 1.104(a) Nucleotide and/or Amino Acid...) Symbols for nucleotide and/or amino acid sequence data 1.822 T Tables in patent applications 1.58 Terminal...

WEB-server for search of a periodicity in amino acid and nucleotide sequences

NASA Astrophysics Data System (ADS)

E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

2017-12-01

A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

PubMed

Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

1987-06-01

The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

Chloroplast Phylogenomics Indicates that Ginkgo biloba Is Sister to Cycads

PubMed Central

Wu, Chung-Shien; Chaw, Shu-Miaw; Huang, Ya-Yi

2013-01-01

Molecular phylogenetic studies have not yet reached a consensus on the placement of Ginkgoales, which is represented by the only living species, Ginkgo biloba (common name: ginkgo). At least six discrepant placements of ginkgo have been proposed. This study aimed to use the chloroplast phylogenomic approach to examine possible factors that lead to such disagreeing placements. We found the sequence types used in the analyses as the most critical factor in the conflicting placements of ginkgo. In addition, the placement of ginkgo varied in the trees inferred from nucleotide (NU) sequences, which notably depended on breadth of taxon sampling, tree-building methods, codon positions, positions of Gnetopsida (common name: gnetophytes), and including or excluding gnetophytes in data sets. In contrast, the trees inferred from amino acid (AA) sequences congruently supported the monophyly of a ginkgo and Cycadales (common name: cycads) clade, regardless of which factors were examined. Our site-stripping analysis further revealed that the high substitution saturation of NU sequences mainly derived from the third codon positions and contributed to the variable placements of ginkgo. In summary, the factors we surveyed did not affect results inferred from analyses of AA sequences. Congruent topologies in our AA trees give more confidence in supporting the ginkgo–cycad sister-group hypothesis. PMID:23315384

Complete sequence of the genome of avian paramyxovirus type 9 and comparison with other paramyxoviruses

PubMed Central

Samuel, Arthur S.; Kumar, Sachin; Madhuri, Subbiah; Collins, Peter L.; Samal, Siba K.

2009-01-01

The complete genome consensus sequence was determined for avian paramyxovirus (APMV) serotype 9 prototype strain PMV-9/domestic Duck/New York/22/78. The genome is 15,438 nucleotides (nt) long and encodes six non-overlapping genes in the order of 3′-N-P/V/W-M-F-HN-L-5′ with intergenic regions of 0–30 nt. The genome length follows the “rule of six” and contains a 55-nt leader sequence at the 3′ end and a 47-nt trailer sequence at the 5′ end. The cleavage site of the F protein is I-R-E-G-R-I↓F, which does not conform to the conventional cleavage site of the ubiquitous cellular protease furin. The virus required exogenous protease for in vitro replication and grew only in a few established cell lines, indicating a restricted host range. Alignment and phylogenetic analysis of the predicted amino acid sequences of APMV-9 proteins with the cognate proteins of viruses of all five genera of family Paramyxoviridae showed that APMV-9 is more closely related to APMV-1 than to other APMVs. The mean death time in embryonated chicken eggs was found to be more than 120 h, indicating APMV-9 to be avirulent for chickens. PMID:19185593

Fine definition of the pedigree haplotypes of closely related rice cultivars by means of genome-wide discovery of single-nucleotide polymorphisms.

PubMed

Yamamoto, Toshio; Nagasaki, Hideki; Yonemaru, Jun-ichi; Ebana, Kaworu; Nakajima, Maiko; Shibaya, Taeko; Yano, Masahiro

2010-04-27

To create useful gene combinations in crop breeding, it is necessary to clarify the dynamics of the genome composition created by breeding practices. A large quantity of single-nucleotide polymorphism (SNP) data is required to permit discrimination of chromosome segments among modern cultivars, which are genetically related. Here, we used a high-throughput sequencer to conduct whole-genome sequencing of an elite Japanese rice cultivar, Koshihikari, which is closely related to Nipponbare, whose genome sequencing has been completed. Then we designed a high-throughput typing array based on the SNP information by comparison of the two sequences. Finally, we applied this array to analyze historical representative rice cultivars to understand the dynamics of their genome composition. The total 5.89-Gb sequence for Koshihikari, equivalent to 15.7 x the entire rice genome, was mapped using the Pseudomolecules 4.0 database for Nipponbare. The resultant Koshihikari genome sequence corresponded to 80.1% of the Nipponbare sequence and led to the identification of 67,051 SNPs. A high-throughput typing array consisting of 1917 SNP sites distributed throughout the genome was designed to genotype 151 representative Japanese cultivars that have been grown during the past 150 years. We could identify the ancestral origin of the pedigree haplotypes in 60.9% of the Koshihikari genome and 18 consensus haplotype blocks which are inherited from traditional landraces to current improved varieties. Moreover, it was predicted that modern breeding practices have generally decreased genetic diversity Detection of genome-wide SNPs by both high-throughput sequencer and typing array made it possible to evaluate genomic composition of genetically related rice varieties. With the aid of their pedigree information, we clarified the dynamics of chromosome recombination during the historical rice breeding process. We also found several genomic regions decreasing genetic diversity which might be caused by a recent human selection in rice breeding. The definition of pedigree haplotypes by means of genome-wide SNPs will facilitate next-generation breeding of rice and other crops.

Nucleotide cleaving agents and method

DOEpatents

Que, Jr., Lawrence; Hanson, Richard S.; Schnaith, Leah M. T.

2000-01-01

The present invention provides a unique series of nucleotide cleaving agents and a method for cleaving a nucleotide sequence, whether single-stranded or double-stranded DNA or RNA, using and a cationic metal complex having at least one polydentate ligand to cleave the nucleotide sequence phosphate backbone to yield a hydroxyl end and a phosphate end.

Nucleotide sequence analysis of the recA gene and discrimination of the three isolates of urease-positive thermophilic Campylobacter (UPTC) isolated from seagulls (Larus spp.) in Northern Ireland.

PubMed

Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O

2004-01-01

Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Middle East Respiratory Syndrome Coronavirus Intra-Host Populations Are Characterized by Numerous High Frequency Variants

DOE Office of Scientific and Technical Information (OSTI.GOV)

Borucki, Monica K.; Lao, Victoria; Hwang, Mona

Middle East respiratory syndrome coronavirus (MERS-CoV) is an emerging human pathogen related to SARS virus. In vitro studies indicate this virus may have a broad host range suggesting an increased pandemic potential. Genetic and epidemiological evidence indicate camels serve as a reservoir for MERS virus but the mechanism of cross species transmission is unclear and many questions remain regarding the susceptibility of humans to infection. Deep sequencing data was obtained from the nasal samples of three camels that had been experimentally infected with a human MERS-CoV isolate. A majority of the genome was covered and average coverage was greater thanmore » 12,000x depth. Although only 5 mutations were detected in the consensus sequences, 473 intrahost single nucleotide variants were identified. Lastly, many of these variants were present at high frequencies and could potentially influence viral phenotype and the sensitivity of detection assays that target these regions for primer or probe binding.« less

Middle East Respiratory Syndrome Coronavirus Intra-Host Populations Are Characterized by Numerous High Frequency Variants

DOE PAGES

Borucki, Monica K.; Lao, Victoria; Hwang, Mona; ...

2016-01-20

Middle East respiratory syndrome coronavirus (MERS-CoV) is an emerging human pathogen related to SARS virus. In vitro studies indicate this virus may have a broad host range suggesting an increased pandemic potential. Genetic and epidemiological evidence indicate camels serve as a reservoir for MERS virus but the mechanism of cross species transmission is unclear and many questions remain regarding the susceptibility of humans to infection. Deep sequencing data was obtained from the nasal samples of three camels that had been experimentally infected with a human MERS-CoV isolate. A majority of the genome was covered and average coverage was greater thanmore » 12,000x depth. Although only 5 mutations were detected in the consensus sequences, 473 intrahost single nucleotide variants were identified. Lastly, many of these variants were present at high frequencies and could potentially influence viral phenotype and the sensitivity of detection assays that target these regions for primer or probe binding.« less

Nucleic acid analysis using terminal-phosphate-labeled nucleotides

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2008-04-22

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Nucleotide sequence analysis of the L gene of Newcastle disease virus: homologies with Sendai and vesicular stomatitis viruses.

PubMed Central

Yusoff, K; Millar, N S; Chambers, P; Emmerson, P T

1987-01-01

The nucleotide sequence of the L gene of the Beaudette C strain of Newcastle disease virus (NDV) has been determined. The L gene is 6704 nucleotides long and encodes a protein of 2204 amino acids with a calculated molecular weight of 248822. Mung bean nuclease mapping of the 5' terminus of the L gene mRNA indicates that the transcription of the L gene is initiated 11 nucleotides upstream of the translational start site. Comparison with the amino acid sequences of the L genes of Sendai virus and vesicular stomatitis virus (VSV) suggests that there are several regions of homology between the sequences. These data provide further evidence for an evolutionary relationship between the Paramyxoviridae and the Rhabdoviridae. A non-coding sequence of 46 nucleotides downstream of the presumed polyadenylation site of the L gene may be part of a negative strand leader RNA. Images PMID:3035486

Phylogenetic analysis of simian Plasmodium spp. infecting Anopheles balabacensis Baisas in Sabah, Malaysia

PubMed Central

Manin, Benny O.; Daim, Sylvia; Vythilingam, Indra; Drakeley, Chris

2017-01-01

Background Anopheles balabacensis of the Leucospyrus group has been confirmed as the primary knowlesi malaria vector in Sabah, Malaysian Borneo for some time now. Presently, knowlesi malaria is the only zoonotic simian malaria in Malaysia with a high prevalence recorded in the states of Sabah and Sarawak. Methodology/Principal findings Anopheles spp. were sampled using human landing catch (HLC) method at Paradason village in Kudat district of Sabah. The collected Anopheles were identified morphologically and then subjected to total DNA extraction and polymerase chain reaction (PCR) to detect Plasmodium parasites in the mosquitoes. Identification of Plasmodium spp. was confirmed by sequencing the SSU rRNA gene with species specific primers. MEGA4 software was then used to analyse the SSU rRNA sequences and bulid the phylogenetic tree for inferring the relationship between simian malaria parasites in Sabah. PCR results showed that only 1.61% (23/1,425) of the screened An. balabacensis were infected with one or two of the five simian Plasmodium spp. found in Sabah, viz. Plasmodium coatneyi, P. inui, P. fieldi, P. cynomolgi and P. knowlesi. Sequence analysis of SSU rRNA of Plasmodium isolates showed high percentage of identity within the same Plasmodium sp. group. The phylogenetic tree based on the consensus sequences of P. knowlesi showed 99.7%–100.0% nucleotide identity among the isolates from An. balabacensis, human patients and a long-tailed macaque from the same locality. Conclusions/Significance This is the first study showing high molecular identity between the P. knowlesi isolates from An. balabacensis, human patients and a long-tailed macaque in Sabah. The other common simian Plasmodium spp. found in long-tailed macaques and also detected in An. balabacensis were P. coatneyi, P. inui, P. fieldi and P. cynomolgi. The high percentage identity of nucleotide sequences between the P. knowlesi isolates from the long-tailed macaque, An. balabacensis and human patients suggests a close genetic relationship between the parasites from these hosts. PMID:28968395

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2014 CFR

2014-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2014-07-01 2014-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2013 CFR

2013-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2013-07-01 2013-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2012 CFR

2012-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2012-07-01 2012-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

Quasispecies Analyses of the HIV-1 Near-full-length Genome With Illumina MiSeq

PubMed Central

Ode, Hirotaka; Matsuda, Masakazu; Matsuoka, Kazuhiro; Hachiya, Atsuko; Hattori, Junko; Kito, Yumiko; Yokomaku, Yoshiyuki; Iwatani, Yasumasa; Sugiura, Wataru

2015-01-01

Human immunodeficiency virus type-1 (HIV-1) exhibits high between-host genetic diversity and within-host heterogeneity, recognized as quasispecies. Because HIV-1 quasispecies fluctuate in terms of multiple factors, such as antiretroviral exposure and host immunity, analyzing the HIV-1 genome is critical for selecting effective antiretroviral therapy and understanding within-host viral coevolution mechanisms. Here, to obtain HIV-1 genome sequence information that includes minority variants, we sought to develop a method for evaluating quasispecies throughout the HIV-1 near-full-length genome using the Illumina MiSeq benchtop deep sequencer. To ensure the reliability of minority mutation detection, we applied an analysis method of sequence read mapping onto a consensus sequence derived from de novo assembly followed by iterative mapping and subsequent unique error correction. Deep sequencing analyses of aHIV-1 clone showed that the analysis method reduced erroneous base prevalence below 1% in each sequence position and discarded only < 1% of all collected nucleotides, maximizing the usage of the collected genome sequences. Further, we designed primer sets to amplify the HIV-1 near-full-length genome from clinical plasma samples. Deep sequencing of 92 samples in combination with the primer sets and our analysis method provided sufficient coverage to identify >1%-frequency sequences throughout the genome. When we evaluated sequences of pol genes from 18 treatment-naïve patients' samples, the deep sequencing results were in agreement with Sanger sequencing and identified numerous additional minority mutations. The results suggest that our deep sequencing method would be suitable for identifying within-host viral population dynamics throughout the genome. PMID:26617593

Site directed recombination

DOEpatents

Jurka, Jerzy W.

1997-01-01

Enhanced homologous recombination is obtained by employing a consensus sequence which has been found to be associated with integration of repeat sequences, such as Alu and ID. The consensus sequence or sequence having a single transition mutation determines one site of a double break which allows for high efficiency of integration at the site. By introducing single or double stranded DNA having the consensus sequence flanking region joined to a sequence of interest, one can reproducibly direct integration of the sequence of interest at one or a limited number of sites. In this way, specific sites can be identified and homologous recombination achieved at the site by employing a second flanking sequence associated with a sequence proximal to the 3'-nick.

Leishmania UDP-sugar pyrophosphorylase: the missing link in galactose salvage?

PubMed

Damerow, Sebastian; Lamerz, Anne-Christin; Haselhorst, Thomas; Führing, Jana; Zarnovican, Patricia; von Itzstein, Mark; Routier, Françoise H

2010-01-08

The Leishmania parasite glycocalyx is rich in galactose-containing glycoconjugates that are synthesized by specific glycosyltransferases that use UDP-galactose as a glycosyl donor. UDP-galactose biosynthesis is thought to be predominantly a de novo process involving epimerization of the abundant nucleotide sugar UDP-glucose by the UDP-glucose 4-epimerase, although galactose salvage from the environment has been demonstrated for Leishmania major. Here, we present the characterization of an L. major UDP-sugar pyrophosphorylase able to reversibly activate galactose 1-phosphate into UDP-galactose thus proving the existence of the Isselbacher salvage pathway in this parasite. The ordered bisubstrate mechanism and high affinity of the enzyme for UTP seem to favor the synthesis of nucleotide sugar rather than their pyrophosphorolysis. Although L. major UDP-sugar pyrophosphorylase preferentially activates galactose 1-phosphate and glucose 1-phosphate, the enzyme is able to act on a variety of hexose 1-phosphates as well as pentose 1-phosphates but not hexosamine 1-phosphates and hence presents a broad in vitro specificity. The newly identified enzyme exhibits a low but significant homology with UDP-glucose pyrophosphorylases and conserved in particular is the pyrophosphorylase consensus sequence and residues involved in nucleotide and phosphate binding. Saturation transfer difference NMR spectroscopy experiments confirm the importance of these moieties for substrate binding. The described leishmanial enzyme is closely related to plant UDP-sugar pyrophosphorylases and presents a similar substrate specificity suggesting their common origin.

Nucleotide sequence determination of guinea-pig casein B mRNA reveals homology with bovine and rat alpha s1 caseins and conservation of the non-coding regions of the mRNA.

PubMed Central

Hall, L; Laird, J E; Craig, R K

1984-01-01

Nucleotide sequence analysis of cloned guinea-pig casein B cDNA sequences has identified two casein B variants related to the bovine and rat alpha s1 caseins. Amino acid homology was largely confined to the known bovine or predicted rat phosphorylation sites and within the 'signal' precursor sequence. Comparison of the deduced nucleotide sequence of the guinea-pig and rat alpha s1 casein mRNA species showed greater sequence conservation in the non-coding than in the coding regions, suggesting a functional and possibly regulatory role for the non-coding regions of casein mRNA. The results provide insight into the evolution of the casein genes, and raise questions as to the role of conserved nucleotide sequences within the non-coding regions of mRNA species. Images Fig. 1. PMID:6548375

Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

PubMed Central

Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

2006-01-01

Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

PubMed

Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

2014-06-01

The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

Human ribosomal RNA gene: nucleotide sequence of the transcription initiation region and comparison of three mammalian genes.

PubMed Central

Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M

1982-01-01

The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460

Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

PubMed

Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

2017-11-28

Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

The partial sequence of RNA 1 of the ophiovirus Ranunculus white mottle virus indicates its relationship to rhabdoviruses and provides candidate primers for an ophiovirus-specific RT-PCR test.

PubMed

Vaira, A M; Accotto, G P; Costantini, A; Milne, R G

2003-06-01

A 4018 nucleotide sequence was obtained for RNA 1 of Ranunculus white mottle virus (RWMV), genus Ophiovirus, representing an incomplete ORF of 1339 aa. Amino acid sequence analysis revealed significant similarities with RNA polymerases of viruses in the family Rhabdoviridae and a conserved domain of 685 aa, corresponding to the RdRp domain of those in the order Mononegavirales. Phylogenetic analysis indicated that the genus Ophiovirus is not related to the genus Tenuivirus or the family Bunyaviridae, with which it has been linked, and probably deserves a special taxonomic position, within a new family. A pair of degenerate primers was designed from a consensus sequence obtained from a relatively conserved region in the RNA 1 of two members of the genus, Citrus psorosis virus (CPsV) and RWMV. The primers, used in RT-PCR experiments, amplified a 136 bp DNA fragment from all the three recognized members of the genus, i.e. CPsV, RWMV and Tulip mild mottle mosaic virus (TMMMV) and from two tentative ophioviruses from lettuce and freesia. The amplified DNAs were sequenced and compared with the corresponding sequences of CPsV and RWMV and phylogenetic relationships were evaluated. Assays using extracts from plants infected by viruses belonging to the genera Tospovirus, Tenuivirus, Rhabdovirus and Varicosavirus indicated that the primers are genus-specific.

Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.

PubMed

Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook

2014-11-01

As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of our knowledge, this is the first attempt to predict protein-binding nucleotides in a given DNA sequence from the sequence data alone. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Array of nucleic acid probes on biological chips for diagnosis of HIV and methods of using the same

DOEpatents

Chee, Mark; Gingeras, Thomas R.; Fodor, Stephen P. A.; Hubble, Earl A.; Morris, MacDonald S.

1999-01-19

The invention provides an array of oligonucleotide probes immobilized on a solid support for analysis of a target sequence from a human immunodeficiency virus. The array comprises at least four sets of oligonucleotide probes 9 to 21 nucleotides in length. A first probe set has a probe corresponding to each nucleotide in a reference sequence from a human immunodeficiency virus. A probe is related to its corresponding nucleotide by being exactly complementary to a subsequence of the reference sequence that includes the corresponding nucleotide. Thus, each probe has a position, designated an interrogation position, that is occupied by a complementary nucleotide to the corresponding nucleotide. The three additional probe sets each have a corresponding probe for each probe in the first probe set. Thus, for each nucleotide in the reference sequence, there are four corresponding probes, one from each of the probe sets. The three corresponding probes in the three additional probe sets are identical to the corresponding probe from the first probe or a subsequence thereof that includes the interrogation position, except that the interrogation position is occupied by a different nucleotide in each of the four corresponding probes.

The use of sequence-based SSR mining for the development of a vast collection of microsatellites in Aquilegia Formosa

Treesearch

Brandon Schlautman; Vera Pfeiffer; Juan Zalapa; Johanne Brunet

2014-01-01

Numerous microsatellite markers were developed for Aquilegia formosafrom sequences deposited within the Expressed Sequence Tag (EST), Genomic Survey Sequence (GSS), and Nucleotide databases in NCBI. Microsatellites (SSRs) were identified and primers were designed for 9 SSR containing sequences in the Nucleotide database, 3803 sequences in the EST...

Genotyping External Quality Assurance in the World Health Organization HIV Drug Resistance Laboratory Network During 2007–2010

PubMed Central

Bremer, James; Bertagnolio, Silvia

2012-01-01

The World Health Organization (WHO) has developed a global laboratory network to support human immunodeficiency virus drug resistance genotyping for public health surveillance in resource-limited countries. Blinded proficiency panels are an essential part of a genotyping quality-assurance program and are used to monitor the reliability of genotyping data in the WHO laboratory network. Laboratories in Europe, North America, Asia, Africa, and the Caribbean have tested panels annually since 2007; 103 of 131 submissions (79%) had >99% nucleotide sequence identity and resistance mutation concordance, compared with consensus. Most errors were associated with mixtures in the test specimen, leading to subjectivity in base-calling or amplification bias. Overall, genotyping assays used by the WHO laboratory network are reliable. PMID:22544186

Switchgrass ubiquitin promoter (PVUBI2) and uses thereof

DOEpatents

Stewart, C. Neal; Mann, David George James

2013-12-10

The subject application provides polynucleotides, compositions thereof and methods for regulating gene expression in a plant. Polynucleotides disclosed herein comprise novel sequences for a promoter isolated from Panicum virgatum (switchgrass) that initiates transcription of an operably linked nucleotide sequence. Thus, various embodiments of the invention comprise the nucleotide sequence of SEQ ID NO: 2 or fragments thereof comprising nucleotides 1 to 692 of SEQ ID NO: 2 that are capable of driving the expression of an operably linked nucleic acid sequence.

Primer ID Validates Template Sampling Depth and Greatly Reduces the Error Rate of Next-Generation Sequencing of HIV-1 Genomic RNA Populations

PubMed Central

Zhou, Shuntai; Jones, Corbin; Mieczkowski, Piotr

2015-01-01

ABSTRACT Validating the sampling depth and reducing sequencing errors are critical for studies of viral populations using next-generation sequencing (NGS). We previously described the use of Primer ID to tag each viral RNA template with a block of degenerate nucleotides in the cDNA primer. We now show that low-abundance Primer IDs (offspring Primer IDs) are generated due to PCR/sequencing errors. These artifactual Primer IDs can be removed using a cutoff model for the number of reads required to make a template consensus sequence. We have modeled the fraction of sequences lost due to Primer ID resampling. For a typical sequencing run, less than 10% of the raw reads are lost to offspring Primer ID filtering and resampling. The remaining raw reads are used to correct for PCR resampling and sequencing errors. We also demonstrate that Primer ID reveals bias intrinsic to PCR, especially at low template input or utilization. cDNA synthesis and PCR convert ca. 20% of RNA templates into recoverable sequences, and 30-fold sequence coverage recovers most of these template sequences. We have directly measured the residual error rate to be around 1 in 10,000 nucleotides. We use this error rate and the Poisson distribution to define the cutoff to identify preexisting drug resistance mutations at low abundance in an HIV-infected subject. Collectively, these studies show that >90% of the raw sequence reads can be used to validate template sampling depth and to dramatically reduce the error rate in assessing a genetically diverse viral population using NGS. IMPORTANCE Although next-generation sequencing (NGS) has revolutionized sequencing strategies, it suffers from serious limitations in defining sequence heterogeneity in a genetically diverse population, such as HIV-1 due to PCR resampling and PCR/sequencing errors. The Primer ID approach reveals the true sampling depth and greatly reduces errors. Knowing the sampling depth allows the construction of a model of how to maximize the recovery of sequences from input templates and to reduce resampling of the Primer ID so that appropriate multiplexing can be included in the experimental design. With the defined sampling depth and measured error rate, we are able to assign cutoffs for the accurate detection of minority variants in viral populations. This approach allows the power of NGS to be realized without having to guess about sampling depth or to ignore the problem of PCR resampling, while also being able to correct most of the errors in the data set. PMID:26041299

The case for the continuing use of the revised Cambridge Reference Sequence (rCRS) and the standardization of notation in human mitochondrial DNA studies.

PubMed

Bandelt, Hans-Jürgen; Kloss-Brandstätter, Anita; Richards, Martin B; Yao, Yong-Gang; Logan, Ian

2014-02-01

Since the determination in 1981 of the sequence of the human mitochondrial DNA (mtDNA) genome, the Cambridge Reference Sequence (CRS), has been used as the reference sequence to annotate mtDNA in molecular anthropology, forensic science and medical genetics. The CRS was eventually upgraded to the revised version (rCRS) in 1999. This reference sequence is a convenient device for recording mtDNA variation, although it has often been misunderstood as a wild-type (WT) or consensus sequence by medical geneticists. Recently, there has been a proposal to replace the rCRS with the so-called Reconstructed Sapiens Reference Sequence (RSRS). Even if it had been estimated accurately, the RSRS would be a cumbersome substitute for the rCRS, as the new proposal fuses--and thus confuses--the two distinct concepts of ancestral lineage and reference point for human mtDNA. Instead, we prefer to maintain the rCRS and to report mtDNA profiles by employing the hitherto predominant circumfix style. Tree diagrams could display mutations by using either the profile notation (in conventional short forms where appropriate) or in a root-upwards way with two suffixes indicating ancestral and derived nucleotides. This would guard against misunderstandings about reporting mtDNA variation. It is therefore neither necessary nor sensible to change the present reference sequence, the rCRS, in any way. The proposed switch to RSRS would inevitably lead to notational chaos, mistakes and misinterpretations.

Evaluation of anonymous and expressed sequence tag derived polymorphic microsatellite markers in the tobacco budworm Heliothis virescens (Lepidoptera: noctuidae)

USDA-ARS?s Scientific Manuscript database

Polymorphic genetic markers were identified and characterized using a partial genomic library of Heliothis virescens enriched for simple sequence repeats (SSR) and nucleotide sequences of expressed sequence tags (EST). Nucleotide sequences of 192 clones from the partial genomic library yielded 147 u...

Extension of the COG and arCOG databases by amino acid and nucleotide sequences

PubMed Central

Meereis, Florian; Kaufmann, Michael

2008-01-01

Background The current versions of the COG and arCOG databases, both excellent frameworks for studies in comparative and functional genomics, do not contain the nucleotide sequences corresponding to their protein or protein domain entries. Results Using sequence information obtained from GenBank flat files covering the completely sequenced genomes of the COG and arCOG databases, we constructed NUCOCOG (nucleotide sequences containing COG databases) as an extended version including all nucleotide sequences and in addition the amino acid sequences originally utilized to construct the current COG and arCOG databases. We make available three comprehensive single XML files containing the complete databases including all sequence information. In addition, we provide a web interface as a utility suitable to browse the NUCOCOG database for sequence retrieval. The database is accessible at . Conclusion NUCOCOG offers the possibility to analyze any sequence related property in the context of the COG and arCOG framework simply by using script languages such as PERL applied to a large but single XML document. PMID:19014535

DNA Nucleotide Sequence Restricted by the RI Endonuclease

PubMed Central

Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

1972-01-01

The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

ESTree db: a Tool for Peach Functional Genomics

PubMed Central

Lazzari, Barbara; Caprera, Andrea; Vecchietti, Alberto; Stella, Alessandra; Milanesi, Luciano; Pozzi, Carlo

2005-01-01

Background The ESTree db represents a collection of Prunus persica expressed sequenced tags (ESTs) and is intended as a resource for peach functional genomics. A total of 6,155 successful EST sequences were obtained from four in-house prepared cDNA libraries from Prunus persica mesocarps at different developmental stages. Another 12,475 peach EST sequences were downloaded from public databases and added to the ESTree db. An automated pipeline was prepared to process EST sequences using public software integrated by in-house developed Perl scripts and data were collected in a MySQL database. A php-based web interface was developed to query the database. Results The ESTree db version as of April 2005 encompasses 18,630 sequences representing eight libraries. Contig assembly was performed with CAP3. Putative single nucleotide polymorphism (SNP) detection was performed with the AutoSNP program and a search engine was implemented to retrieve results. All the sequences and all the contig consensus sequences were annotated both with blastx against the GenBank nr db and with GOblet against the viridiplantae section of the Gene Ontology db. Links to NiceZyme (Expasy) and to the KEGG metabolic pathways were provided. A local BLAST utility is available. A text search utility allows querying and browsing the database. Statistics were provided on Gene Ontology occurrences to assign sequences to Gene Ontology categories. Conclusion The resulting database is a comprehensive resource of data and links related to peach EST sequences. The Sequence Report and Contig Report pages work as the web interface core structures, giving quick access to data related to each sequence/contig. PMID:16351742

ESTree db: a tool for peach functional genomics.

PubMed

Lazzari, Barbara; Caprera, Andrea; Vecchietti, Alberto; Stella, Alessandra; Milanesi, Luciano; Pozzi, Carlo

2005-12-01

The ESTree db http://www.itb.cnr.it/estree/ represents a collection of Prunus persica expressed sequenced tags (ESTs) and is intended as a resource for peach functional genomics. A total of 6,155 successful EST sequences were obtained from four in-house prepared cDNA libraries from Prunus persica mesocarps at different developmental stages. Another 12,475 peach EST sequences were downloaded from public databases and added to the ESTree db. An automated pipeline was prepared to process EST sequences using public software integrated by in-house developed Perl scripts and data were collected in a MySQL database. A php-based web interface was developed to query the database. The ESTree db version as of April 2005 encompasses 18,630 sequences representing eight libraries. Contig assembly was performed with CAP3. Putative single nucleotide polymorphism (SNP) detection was performed with the AutoSNP program and a search engine was implemented to retrieve results. All the sequences and all the contig consensus sequences were annotated both with blastx against the GenBank nr db and with GOblet against the viridiplantae section of the Gene Ontology db. Links to NiceZyme (Expasy) and to the KEGG metabolic pathways were provided. A local BLAST utility is available. A text search utility allows querying and browsing the database. Statistics were provided on Gene Ontology occurrences to assign sequences to Gene Ontology categories. The resulting database is a comprehensive resource of data and links related to peach EST sequences. The Sequence Report and Contig Report pages work as the web interface core structures, giving quick access to data related to each sequence/contig.

A High-Density Consensus Map of Common Wheat Integrating Four Mapping Populations Scanned by the 90K SNP Array

PubMed Central

Wen, Weie; He, Zhonghu; Gao, Fengmei; Liu, Jindong; Jin, Hui; Zhai, Shengnan; Qu, Yanying; Xia, Xianchun

2017-01-01

A high-density consensus map is a powerful tool for gene mapping, cloning and molecular marker-assisted selection in wheat breeding. The objective of this study was to construct a high-density, single nucleotide polymorphism (SNP)-based consensus map of common wheat (Triticum aestivum L.) by integrating genetic maps from four recombinant inbred line populations. The populations were each genotyped using the wheat 90K Infinium iSelect SNP assay. A total of 29,692 SNP markers were mapped on 21 linkage groups corresponding to 21 hexaploid wheat chromosomes, covering 2,906.86 cM, with an overall marker density of 10.21 markers/cM. Compared with the previous maps based on the wheat 90K SNP chip detected 22,736 (76.6%) of the SNPs with consistent chromosomal locations, whereas 1,974 (6.7%) showed different chromosomal locations, and 4,982 (16.8%) were newly mapped. Alignment of the present consensus map and the wheat expressed sequence tags (ESTs) Chromosome Bin Map enabled assignment of 1,221 SNP markers to specific chromosome bins and 819 ESTs were integrated into the consensus map. The marker orders of the consensus map were validated based on physical positions on the wheat genome with Spearman rank correlation coefficients ranging from 0.69 (4D) to 0.97 (1A, 4B, 5B, and 6A), and were also confirmed by comparison with genetic position on the previously 40K SNP consensus map with Spearman rank correlation coefficients ranging from 0.84 (6D) to 0.99 (6A). Chromosomal rearrangements reported previously were confirmed in the present consensus map and new putative rearrangements were identified. In addition, an integrated consensus map was developed through the combination of five published maps with ours, containing 52,607 molecular markers. The consensus map described here provided a high-density SNP marker map and a reliable order of SNPs, representing a step forward in mapping and validation of chromosomal locations of SNPs on the wheat 90K array. Moreover, it can be used as a reference for quantitative trait loci (QTL) mapping to facilitate exploitation of genes and QTL in wheat breeding. PMID:28848588

To Clone or Not To Clone: Method Analysis for Retrieving Consensus Sequences In Ancient DNA Samples

PubMed Central

Winters, Misa; Barta, Jodi Lynn; Monroe, Cara; Kemp, Brian M.

2011-01-01

The challenges associated with the retrieval and authentication of ancient DNA (aDNA) evidence are principally due to post-mortem damage which makes ancient samples particularly prone to contamination from “modern” DNA sources. The necessity for authentication of results has led many aDNA researchers to adopt methods considered to be “gold standards” in the field, including cloning aDNA amplicons as opposed to directly sequencing them. However, no standardized protocol has emerged regarding the necessary number of clones to sequence, how a consensus sequence is most appropriately derived, or how results should be reported in the literature. In addition, there has been no systematic demonstration of the degree to which direct sequences are affected by damage or whether direct sequencing would provide disparate results from a consensus of clones. To address this issue, a comparative study was designed to examine both cloned and direct sequences amplified from ∼3,500 year-old ancient northern fur seal DNA extracts. Majority rules and the Consensus Confidence Program were used to generate consensus sequences for each individual from the cloned sequences, which exhibited damage at 31 of 139 base pairs across all clones. In no instance did the consensus of clones differ from the direct sequence. This study demonstrates that, when appropriate, cloning need not be the default method, but instead, should be used as a measure of authentication on a case-by-case basis, especially when this practice adds time and cost to studies where it may be superfluous. PMID:21738625

Resequencing of IRS2 reveals rare variants for obesity but not fasting glucose homeostasis in Hispanic children.

PubMed

Butte, Nancy F; Voruganti, V Saroja; Cole, Shelley A; Haack, Karin; Comuzzie, Anthony G; Muzny, Donna M; Wheeler, David A; Chang, Kyle; Hawes, Alicia; Gibbs, Richard A

2011-09-22

Our objective was to resequence insulin receptor substrate 2 (IRS2) to identify variants associated with obesity- and diabetes-related traits in Hispanic children. Exonic and intronic segments, 5' and 3' flanking regions of IRS2 (∼14.5 kb), were bidirectionally sequenced for single nucleotide polymorphism (SNP) discovery in 934 Hispanic children using 3730XL DNA Sequencers. Additionally, 15 SNPs derived from Illumina HumanOmni1-Quad BeadChips were analyzed. Measured genotype analysis tested associations between SNPs and obesity and diabetes-related traits. Bayesian quantitative trait nucleotide analysis was used to statistically infer the most likely functional polymorphisms. A total of 140 SNPs were identified with minor allele frequencies (MAF) ranging from 0.001 to 0.47. Forty-two of the 70 coding SNPs result in nonsynonymous amino acid substitutions relative to the consensus sequence; 28 SNPs were detected in the promoter, 12 in introns, 28 in the 3'-UTR, and 2 in the 5'-UTR. Two insertion/deletions (indels) were detected. Ten independent rare SNPs (MAF = 0.001-0.009) were associated with obesity-related traits (P = 0.01-0.00002). SNP 10510452_139 in the promoter region was shown to have a high posterior probability (P = 0.77-0.86) of influencing BMI, fat mass, and waist circumference in Hispanic children. SNP 10510452_139 contributed between 2 and 4% of the population variance in body weight and composition. None of the SNPs or indels were associated with diabetes-related traits or accounted for a previously identified quantitative trait locus on chromosome 13 for fasting serum glucose. Rare but not common IRS2 variants may play a role in the regulation of body weight but not an essential role in fasting glucose homeostasis in Hispanic children.

HIV1 V3 loop hypermutability is enhanced by the guanine usage bias in the part of env gene coding for it.

PubMed

Khrustalev, Vladislav Victorovich

2009-01-01

Guanine is the most mutable nucleotide in HIV genes because of frequently occurring G to A transitions, which are caused by cytosine deamination in viral DNA minus strands catalyzed by APOBEC enzymes. Distribution of guanine between three codon positions should influence the probability for G to A mutation to be nonsynonymous (to occur in first or second codon position). We discovered that nucleotide sequences of env genes coding for third variable regions (V3 loops) of gp120 from HIV1 and HIV2 have different kinds of guanine usage biases. In the HIV1 reference strain and 100 additionally analyzed HIV1 strains the guanine usage bias in V3 loop coding regions (2G>1G>3G) should lead to elevated nonsynonymous G to A transitions occurrence rates. In the HIV2 reference strain and 100 other HIV2 strains guanine usage bias in V3 loop coding regions (3G>2G>1G) should protect V3 loops from hypermutability. According to the HIV1 and HIV2 V3 alignment, insertion of the sequence enriched with 2G (21 codons in length) occurred during the evolution of HIV1 predecessor, while insertion of the different sequence enriched with 3G (19 codons in length) occurred during the evolution of HIV2 predecessor. The higher is the level of 3G in the V3 coding region, the lower should be the immune escaping mutation occurrence rates. This hypothesis was tested in this study by comparing the guanine usage in V3 loop coding regions from HIV1 fast and slow progressors. All calculations have been performed by our algorithms "VVK In length", "VVK Dinucleotides" and "VVK Consensus" (www.barkovsky.hotmail.ru).

Sequence of a cDNA encoding pancreatic preprosomatostatin-22.

PubMed Central

Magazin, M; Minth, C D; Funckes, C L; Deschenes, R; Tavianini, M A; Dixon, J E

1982-01-01

We report the nucleotide sequence of a precursor to somatostatin that upon proteolytic processing may give rise to a hormone of 22 amino acids. The nucleotide sequence of a cDNA from the channel catfish (Ictalurus punctatus) encodes a precursor to somatostatin that is 105 amino acids (Mr, 11,500). The cDNA coding for somatostatin-22 consists of 36 nucleotides in the 5' untranslated region, 315 nucleotides that code for the precursor to somatostatin-22, 269 nucleotides at the 3' untranslated region, and a variable length of poly(A). The putative preprohormone contains a sequence of hydrophobic amino acids at the amino terminus that has the properties of a "signal" peptide. A connecting sequence of approximately 57 amino acids is followed by a single Arg-Arg sequence, which immediately precedes the hormone. Somatostatin-22 is homologous to somatostatin-14 in 7 of the 14 amino acids, including the Phe-Trp-Lys sequence. Hybridization selection of mRNA, followed by its translation in a wheat germ cell-free system, resulted in the synthesis of a single polypeptide having a molecular weight of approximately 10,000 as estimated on Na-DodSO4/polyacrylamide gels. Images PMID:6127673

Plant nitrogen regulatory P-PII genes

DOEpatents

Coruzzi, Gloria M.; Lam, Hon-Ming; Hsieh, Ming-Hsiun

2001-01-01

The present invention generally relates to plant nitrogen regulatory PII gene (hereinafter P-PII gene), a gene involved in regulating plant nitrogen metabolism. The invention provides P-PII nucleotide sequences, expression constructs comprising said nucleotide sequences, and host cells and plants having said constructs and, optionally expressing the P-PII gene from said constructs. The invention also provides substantially pure P-PII proteins. The P-PII nucleotide sequences and constructs of the

A novel thermophilic and halophilic esterase from Janibacter sp. R02, the first member of a new lipase family (Family XVII).

PubMed

Castilla, Agustín; Panizza, Paola; Rodríguez, Diego; Bonino, Luis; Díaz, Pilar; Irazoqui, Gabriela; Rodríguez Giordano, Sonia

2017-03-01

Janibacter sp. strain R02 (BNM 560) was isolated in our laboratory from an Antarctic soil sample. A remarkable trait of the strain was its high lipolytic activity, detected in Rhodamine-olive oil supplemented plates. Supernatants of Janibacter sp. R02 displayed superb activity on transesterification of acyl glycerols, thus being a good candidate for lipase prospection. Considering the lack of information concerning lipases of the genus Janibacter, we focused on the identification, cloning, expression and characterization of the extracellular lipases of this strain. By means of sequence alignment and clustering of consensus nucleotide sequences, a DNA fragment of 1272bp was amplified, cloned and expressed in E. coli. The resulting recombinant enzyme, named LipJ2, showed preference for short to medium chain-length substrates, and displayed maximum activity at 80°C and pH 8-9, being strongly activated by a mixture of Na + and K + . The enzyme presented an outstanding stability regarding both pH and temperature. Bioinformatics analysis of the amino acid sequence of LipJ2 revealed the presence of a consensus catalytic triad and a canonical pentapeptide. However, two additional rare motifs were found in LipJ2: an SXXL β-lactamase motif and two putative Y-type oxyanion holes (YAP). Although some of the previous features could allow assigning LipJ2 to the bacterial lipase families VIII or X, the phylogenetic analysis showed that LipJ2 clusters apart from other members of known lipase families, indicating that the newly isolated Janibacter esterase LipJ2 would be the first characterized member of a new family of bacterial lipases. Published by Elsevier Inc.

Synthesis and evaluations of an acid-cleavable, fluorescently labeled nucleotide as a reversible terminator for DNA sequencing.

PubMed

Tan, Lianjiang; Liu, Yazhi; Li, Xiaowei; Wu, Xin-Yan; Gong, Bing; Shen, Yu-Mei; Shao, Zhifeng

2016-02-11

An acid-cleavable linker based on a dimethylketal moiety was synthesized and used to connect a nucleotide with a fluorophore to produce a 3'-OH unblocked nucleotide analogue as an excellent reversible terminator for DNA sequencing by synthesis.

Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

PubMed Central

Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

2016-01-01

DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

PubMed Central

Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.

2015-01-01

This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

Molecular Cloning and Sequencing of Hemoglobin-Beta Gene of Channel Catfish, Ictalurus Punctatus Rafinesque

USDA-ARS?s Scientific Manuscript database

: Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...

Novel methodologies for spectral classification of exon and intron sequences

NASA Astrophysics Data System (ADS)

Kwan, Hon Keung; Kwan, Benjamin Y. M.; Kwan, Jennifer Y. Y.

2012-12-01

Digital processing of a nucleotide sequence requires it to be mapped to a numerical sequence in which the choice of nucleotide to numeric mapping affects how well its biological properties can be preserved and reflected from nucleotide domain to numerical domain. Digital spectral analysis of nucleotide sequences unfolds a period-3 power spectral value which is more prominent in an exon sequence as compared to that of an intron sequence. The success of a period-3 based exon and intron classification depends on the choice of a threshold value. The main purposes of this article are to introduce novel codes for 1-sequence numerical representations for spectral analysis and compare them to existing codes to determine appropriate representation, and to introduce novel thresholding methods for more accurate period-3 based exon and intron classification of an unknown sequence. The main findings of this study are summarized as follows: Among sixteen 1-sequence numerical representations, the K-Quaternary Code I offers an attractive performance. A windowed 1-sequence numerical representation (with window length of 9, 15, and 24 bases) offers a possible speed gain over non-windowed 4-sequence Voss representation which increases as sequence length increases. A winner threshold value (chosen from the best among two defined threshold values and one other threshold value) offers a top precision for classifying an unknown sequence of specified fixed lengths. An interpolated winner threshold value applicable to an unknown and arbitrary length sequence can be estimated from the winner threshold values of fixed length sequences with a comparable performance. In general, precision increases as sequence length increases. The study contributes an effective spectral analysis of nucleotide sequences to better reveal embedded properties, and has potential applications in improved genome annotation.

Limitations and potentials of current motif discovery algorithms

PubMed Central

Hu, Jianjun; Li, Bin; Kihara, Daisuke

2005-01-01

Computational methods for de novo identification of gene regulation elements, such as transcription factor binding sites, have proved to be useful for deciphering genetic regulatory networks. However, despite the availability of a large number of algorithms, their strengths and weaknesses are not sufficiently understood. Here, we designed a comprehensive set of performance measures and benchmarked five modern sequence-based motif discovery algorithms using large datasets generated from Escherichia coli RegulonDB. Factors that affect the prediction accuracy, scalability and reliability are characterized. It is revealed that the nucleotide and the binding site level accuracy are very low, while the motif level accuracy is relatively high, which indicates that the algorithms can usually capture at least one correct motif in an input sequence. To exploit diverse predictions from multiple runs of one or more algorithms, a consensus ensemble algorithm has been developed, which achieved 6–45% improvement over the base algorithms by increasing both the sensitivity and specificity. Our study illustrates limitations and potentials of existing sequence-based motif discovery algorithms. Taking advantage of the revealed potentials, several promising directions for further improvements are discussed. Since the sequence-based algorithms are the baseline of most of the modern motif discovery algorithms, this paper suggests substantial improvements would be possible for them. PMID:16284194

Complete nucleotide sequence of a novel Hibiscus-infecting Cilevirus from Florida and its relationship with closely associated Cileviruses

USDA-ARS?s Scientific Manuscript database

The complete nucleotide sequence of a recently discovered Florida (FL) isolate of Hibiscus infecting Cilevirus (HiCV) was determined by Sanger sequencing. The movement- and coat- protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HA (Ha...

Statistical analysis of nucleotide sequences of the hemagglutinin gene of human influenza A viruses.

PubMed Central

Ina, Y; Gojobori, T

1994-01-01

To examine whether positive selection operates on the hemagglutinin 1 (HA1) gene of human influenza A viruses (H1 subtype), 21 nucleotide sequences of the HA1 gene were statistically analyzed. The nucleotide sequences were divided into antigenic and nonantigenic sites. The nucleotide diversities for antigenic and nonantigenic sites of the HA1 gene were computed at synonymous and nonsynonymous sites separately. For nonantigenic sites, the nucleotide diversities were larger at synonymous sites than at nonsynonymous sites. This is consistent with the neutral theory of molecular evolution. For antigenic sites, however, the nucleotide diversities at nonsynonymous sites were larger than those at synonymous sites. These results suggest that positive selection operates on antigenic sites of the HA1 gene of human influenza A viruses (H1 subtype). PMID:8078892

In-depth comparison of somatic point mutation callers based on different tumor next-generation sequencing depth data

NASA Astrophysics Data System (ADS)

Cai, Lei; Yuan, Wei; Zhang, Zhou; He, Lin; Chou, Kuo-Chen

2016-11-01

Four popular somatic single nucleotide variant (SNV) calling methods (Varscan, SomaticSniper, Strelka and MuTect2) were carefully evaluated on the real whole exome sequencing (WES, depth of ~50X) and ultra-deep targeted sequencing (UDT-Seq, depth of ~370X) data. The four tools returned poor consensus on candidates (only 20% of calls were with multiple hits by the callers). For both WES and UDT-Seq, MuTect2 and Strelka obtained the largest proportion of COSMIC entries as well as the lowest rate of dbSNP presence and high-alternative-alleles-in-control calls, demonstrating their superior sensitivity and accuracy. Combining different callers does increase reliability of candidates, but narrows the list down to very limited range of tumor read depth and variant allele frequency. Calling SNV on UDT-Seq data, which were of much higher read-depth, discovered additional true-positive variations, despite an even more tremendous growth in false positive predictions. Our findings not only provide valuable benchmark for state-of-the-art SNV calling methods, but also shed light on the access to more accurate SNV identification in the future.

In silico analysis of β-1,3-glucanase from a psychrophilic yeast, Glaciozyma antarctica PI12

NASA Astrophysics Data System (ADS)

Mohammadi, Salimeh; Bakar, Farah Diba Abu; Rabu, Amir; Murad, Abdul Munir Abdul

2014-09-01

1,3-beta-glucanase is an industrially important enzyme having wide range of applications especially in food industry. It is crucial to gain an understanding about the structure and functional aspects of various beta-1,3-glucanase produced from diverse sources. In this, study a cDNA encoding β-1,3-glucanase (GaExg55) was isolated from a psychrophilic yeast, Glaciozyma antarctica PI12. The cDNA sequence has been submitted to Genbank with an accession number (KJ436377). Subsequently, the perdition protein was analyzed using various bioinformatics tools to explore the properties of the protein. GaEXG55 is consisting of 1,440-bp nucleotides encoding 480 amino acid residues. Alignment of the deduced amino acid for GaExg55 with other exo-β-1,3-glucanase available at the NCBI database indicate that deduced amino acids shared a consensus motif NEP, which is signature pattern of GH5 hydrolases. Predicted molecular weight of GaExg55 is 53.66 kDa. GaExg55 sequences possesses signal peptide sequence and it is highly conserved with other fungal exo-beta-1,3 glucanase.

The pig CYP2E1 promoter is activated by COUP-TF1 and HNF-1 and is inhibited by androstenone.

PubMed

Tambyrajah, Winston S; Doran, Elena; Wood, Jeffrey D; McGivan, John D

2004-11-15

Functional analysis of the pig cytochrome P4502E1 (CYP2E1) promoter identified two major activating elements. One corresponded to the hepatic nuclear factor 1 (HNF-1) consensus binding sequence at nucleotides -128/-98 and the other was located in the region -292/-266. The binding of proteins in pig liver nuclear extracts to a synthetic double-stranded oligonucleotide corresponding to this more distal activating sequence was studied by electrophoretic mobility shift assay. The minimum protein binding sequence was identified as TGTTCTGACCTCTGGG. Gel super-shift assays identified the protein binding to this site as chick ovalbumin upstream promoter transcription factor 1 (COUP-TF1). Androstenone inhibited promoter activity in transfection experiments only with constructs which included the COUP-TF1 binding site. Androstenone inhibited COUP-TF1 binding to synthetic oligonucleotides but did not affect HNF-1 binding. The results offer an explanation for the inhibition of CYP2E1 protein expression by androstenone in isolated pig hepatocytes and may be relevant to the low expression of hepatic CYP2E1 in those pigs which accumulate high levels of androstenone in vivo.

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2010 CFR

2010-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2012 CFR

2012-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2013 CFR

2013-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2011 CFR

2011-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2014 CFR

2014-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

Genome sequences of a mouse-avirulent and a mouse-virulent strain of Ross River virus.

PubMed

Faragher, S G; Meek, A D; Rice, C M; Dalgarno, L

1988-04-01

The nucleotide sequence of the genomic RNA of a mouse-avirulent strain of Ross River virus, RRV NB5092 (isolated in 1969), has been determined and the corresponding sequence for the prototype mouse-virulent strain, RRV T48 (isolated in 1959), has been completed. The RRV NB5092 genome is approximately 11,674 nucleotides in length, compared with 11,853 nucleotides for RRV T48. RRV NB5092 and RRV T48 have the same genome organization. For both viruses an untranslated region of 80 nucleotides at the 5' end of the genome is followed by a 7440-nucleotide open reading frame which is interrupted after 5586 nucleotides by a single opal termination codon. By homology with other alphaviruses, the 5586-nucleotide open reading frame encodes the nonstructural proteins nsP1, nsP2, and nsP3; a fourth nonstructural protein, nsP4, is produced by read-through of the opal codon. The RRV nonstructural proteins show strong homology with the corresponding proteins of Sindbis virus and Semliki Forest virus in terms of size, net charge, and hydropathy characteristics. However, homology is not uniform between or within the proteins; nsP1, nsP2, and nsP4 contain extended domains which are highly conserved between alphaviruses, while the C-terminal region of nsP3 shows little conservation in sequence or length between alphaviruses. An untranslated "junction" region of 44 nucleotides (for RRV NB5092) or 47 nucleotides (for RRV T48) separates the nonstructural and structural protein coding regions. The structural proteins (capsid-E3-E2-6K-E1) are translated from an open reading frame of 3762 nucleotides which is followed by a 3'-untranslated region of approximately 348 nucleotides (for RRV NB5092) or 524 nucleotides (for RRV T48). Excluding deletions and insertions, the genomes of RRV NB5092 and RRV T48 differ at 284 nucleotides, representing a sequence divergence of 2.38%. Sequence deletions or insertions were found only in the noncoding regions and include a 173-nucleotide deletion in the 3'-untranslated region of RRV NB5092, compared with RRV T48. In the coding regions, most of the nucleotide differences are silent; there are 36 amino acid differences in the nonstructural proteins and 12 in the structural proteins. The distribution of amino acid differences between the two RRV strains correlates with the location of domains which are poorly conserved in sequence between alphaviruses. The possible role of amino acid differences in envelope glycoproteins E1 and E2 in determining the different antigenic and biological properties of RRV NB5092 and RRV T48 is discussed.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lapidus, Alla L.

From the date its role in heredity was discovered, DNA has been generating interest among scientists from different fields of knowledge: physicists have studied the three dimensional structure of the DNA molecule, biologists tried to decode the secrets of life hidden within these long molecules, and technologists invent and improve methods of DNA analysis. The analysis of the nucleotide sequence of DNA occupies a special place among the methods developed. Thanks to the variety of sequencing technologies available, the process of decoding the sequence of genomic DNA (or whole genome sequencing) has become robust and inexpensive. Meanwhile the assembly ofmore » whole genome sequences remains a challenging task. In addition to the need to assemble millions of DNA fragments of different length (from 35 bp (Solexa) to 800 bp (Sanger)), great interest in analysis of microbial communities (metagenomes) of different complexities raises new problems and pushes some new requirements for sequence assembly tools to the forefront. The genome assembly process can be divided into two steps: draft assembly and assembly improvement (finishing). Despite the fact that automatically performed assembly (or draft assembly) is capable of covering up to 98% of the genome, in most cases, it still contains incorrectly assembled reads. The error rate of the consensus sequence produced at this stage is about 1/2000 bp. A finished genome represents the genome assembly of much higher accuracy (with no gaps or incorrectly assembled areas) and quality ({approx}1 error/10,000 bp), validated through a number of computer and laboratory experiments.« less

Phylogenetic study of Class Armophorea (Alveolata, Ciliophora) based on 18S-rDNA data.

PubMed

da Silva Paiva, Thiago; do Nascimento Borges, Bárbara; da Silva-Neto, Inácio Domingos

2013-12-01

The 18S rDNA phylogeny of Class Armophorea, a group of anaerobic ciliates, is proposed based on an analysis of 44 sequences (out of 195) retrieved from the NCBI/GenBank database. Emphasis was placed on the use of two nucleotide alignment criteria that involved variation in the gap-opening and gap-extension parameters and the use of rRNA secondary structure to orientate multiple-alignment. A sensitivity analysis of 76 data sets was run to assess the effect of variations in indel parameters on tree topologies. Bayesian inference, maximum likelihood and maximum parsimony phylogenetic analyses were used to explore how different analytic frameworks influenced the resulting hypotheses. A sensitivity analysis revealed that the relationships among higher taxa of the Intramacronucleata were dependent upon how indels were determined during multiple-alignment of nucleotides. The phylogenetic analyses rejected the monophyly of the Armophorea most of the time and consistently indicated that the Metopidae and Nyctotheridae were related to the Litostomatea. There was no consensus on the placement of the Caenomorphidae, which could be a sister group of the Metopidae + Nyctorheridae, or could have diverged at the base of the Spirotrichea branch or the Intramacronucleata tree.

Phylogenetic study of Class Armophorea (Alveolata, Ciliophora) based on 18S-rDNA data

PubMed Central

da Silva Paiva, Thiago; do Nascimento Borges, Bárbara; da Silva-Neto, Inácio Domingos

2013-01-01

The 18S rDNA phylogeny of Class Armophorea, a group of anaerobic ciliates, is proposed based on an analysis of 44 sequences (out of 195) retrieved from the NCBI/GenBank database. Emphasis was placed on the use of two nucleotide alignment criteria that involved variation in the gap-opening and gap-extension parameters and the use of rRNA secondary structure to orientate multiple-alignment. A sensitivity analysis of 76 data sets was run to assess the effect of variations in indel parameters on tree topologies. Bayesian inference, maximum likelihood and maximum parsimony phylogenetic analyses were used to explore how different analytic frameworks influenced the resulting hypotheses. A sensitivity analysis revealed that the relationships among higher taxa of the Intramacronucleata were dependent upon how indels were determined during multiple-alignment of nucleotides. The phylogenetic analyses rejected the monophyly of the Armophorea most of the time and consistently indicated that the Metopidae and Nyctotheridae were related to the Litostomatea. There was no consensus on the placement of the Caenomorphidae, which could be a sister group of the Metopidae + Nyctorheridae, or could have diverged at the base of the Spirotrichea branch or the Intramacronucleata tree. PMID:24385862

The complete nucleotide sequence of the glnALG operon of Escherichia coli K12.

PubMed Central

Miranda-Ríos, J; Sánchez-Pescador, R; Urdea, M; Covarrubias, A A

1987-01-01

The nucleotide sequence of the E. coli glnALG operon has been determined. The glnL (ntrB) and glnG (ntrC) genes present a high homology, at the nucleotide and aminoacid levels, with the corresponding genes of Klebsiella pneumoniae. The predicted aminoacid sequence for glutamine synthetase allowed us to locate some of the enzyme domains. The structure of this operon is discussed. PMID:2882477

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

PubMed

Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

1982-11-11

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).

A safe an easy method for building consensus HIV sequences from 454 massively parallel sequencing data.

PubMed

Fernández-Caballero Rico, Jose Ángel; Chueca Porcuna, Natalia; Álvarez Estévez, Marta; Mosquera Gutiérrez, María Del Mar; Marcos Maeso, María Ángeles; García, Federico

2018-02-01

To show how to generate a consensus sequence from the information of massive parallel sequences data obtained from routine HIV anti-retroviral resistance studies, and that may be suitable for molecular epidemiology studies. Paired Sanger (Trugene-Siemens) and next-generation sequencing (NGS) (454 GSJunior-Roche) HIV RT and protease sequences from 62 patients were studied. NGS consensus sequences were generated using Mesquite, using 10%, 15%, and 20% thresholds. Molecular evolutionary genetics analysis (MEGA) was used for phylogenetic studies. At a 10% threshold, NGS-Sanger sequences from 17/62 patients were phylogenetically related, with a median bootstrap-value of 88% (IQR83.5-95.5). Association increased to 36/62 sequences, median bootstrap 94% (IQR85.5-98)], using a 15% threshold. Maximum association was at the 20% threshold, with 61/62 sequences associated, and a median bootstrap value of 99% (IQR98-100). A safe method is presented to generate consensus sequences from HIV-NGS data at 20% threshold, which will prove useful for molecular epidemiological studies. Copyright © 2016 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

Reducing false-positive incidental findings with ensemble genotyping and logistic regression based variant filtering methods.

PubMed

Hwang, Kyu-Baek; Lee, In-Hee; Park, Jin-Ho; Hambuch, Tina; Choe, Yongjoon; Kim, MinHyeok; Lee, Kyungjoon; Song, Taemin; Neu, Matthew B; Gupta, Neha; Kohane, Isaac S; Green, Robert C; Kong, Sek Won

2014-08-01

As whole genome sequencing (WGS) uncovers variants associated with rare and common diseases, an immediate challenge is to minimize false-positive findings due to sequencing and variant calling errors. False positives can be reduced by combining results from orthogonal sequencing methods, but costly. Here, we present variant filtering approaches using logistic regression (LR) and ensemble genotyping to minimize false positives without sacrificing sensitivity. We evaluated the methods using paired WGS datasets of an extended family prepared using two sequencing platforms and a validated set of variants in NA12878. Using LR or ensemble genotyping based filtering, false-negative rates were significantly reduced by 1.1- to 17.8-fold at the same levels of false discovery rates (5.4% for heterozygous and 4.5% for homozygous single nucleotide variants (SNVs); 30.0% for heterozygous and 18.7% for homozygous insertions; 25.2% for heterozygous and 16.6% for homozygous deletions) compared to the filtering based on genotype quality scores. Moreover, ensemble genotyping excluded > 98% (105,080 of 107,167) of false positives while retaining > 95% (897 of 937) of true positives in de novo mutation (DNM) discovery in NA12878, and performed better than a consensus method using two sequencing platforms. Our proposed methods were effective in prioritizing phenotype-associated variants, and an ensemble genotyping would be essential to minimize false-positive DNM candidates. © 2014 WILEY PERIODICALS, INC.

A novel paired domain DNA recognition motif can mediate Pax2 repression of gene transcription.

PubMed

Håvik, B; Ragnhildstveit, E; Lorens, J B; Saelemyr, K; Fauske, O; Knudsen, L K; Fjose, A

1999-12-20

The paired domain (PD) is an evolutionarily conserved DNA-binding domain encoded by the Pax gene family of developmental regulators. The Pax proteins are transcription factors and are involved in a variety of processes such as brain development, patterning of the central nervous system (CNS), and B-cell development. In this report we demonstrate that the zebrafish Pax2 PD can interact with a novel type of DNA sequences in vitro, the triple-A motif, consisting of a heptameric nucleotide sequence G/CAAACA/TC with an invariant core of three adjacent adenosines. This recognition sequence was found to be conserved in known natural Pax5 repressor elements involved in controlling the expression of the p53 and J-chain genes. By identifying similar high affinity binding sites in potential target genes of the Pax2 protein, including the pax2 gene itself, we obtained further evidence that the triple-A sites are biologically significant. The putative natural target sites also provide a basis for defining an extended consensus recognition sequence. In addition, we observed in transformation assays a direct correlation between Pax2 repressor activity and the presence of triple-A sites. The results suggest that a transcriptional regulatory function of Pax proteins can be modulated by PD binding to different categories of target sequences. Copyright 1999 Academic Press.

Homology analyses of the protein sequences of fatty acid synthases from chicken liver, rat mammary gland, and yeast

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chang, Soo-Ik; Hammes, G.G.

1989-11-01

Homology analyses of the protein sequences of chicken liver and rat mammary gland fatty acid synthases were carried out. The amino acid sequences of the chicken and rat enzymes are 67% identical. If conservative substitutions are allowed, 78% of the amino acids are matched. A region of low homologies exists between the functional domains, in particular around amino acid residues 1059-1264 of the chicken enzyme. Homologies between the active sites of chicken and rat and of chicken and yeast enzymes have been analyzed by an alignment method. A high degree of homology exists between the active sites of the chickenmore » and rat enzymes. However, the chicken and yeast enzymes show a lower degree of homology. The DADPH-binding dinucleotide folds of the {beta}-ketoacyl reductase and the enoyl reductase sites were identified by comparison with a known consensus sequence for the DADP- and FAD-binding dinucleotide folds. The active sites of all of the enzymes are primarily in hydrophobic regions of the protein. This study suggests that the genes for the functional domains of fatty acid synthase were originally separated, and these genes were connected to each other by using different connecting nucleotide sequences in different species. An alternative explanation for the differences in rat and chicken is a common ancestry and mutations in the joining regions during evolution.« less

The EMBL nucleotide sequence database

PubMed Central

Stoesser, Guenter; Baker, Wendy; van den Broek, Alexandra; Camon, Evelyn; Garcia-Pastor, Maria; Kanz, Carola; Kulikova, Tamara; Lombard, Vincent; Lopez, Rodrigo; Parkinson, Helen; Redaschi, Nicole; Sterk, Peter; Stoehr, Peter; Tuli, Mary Ann

2001-01-01

The EMBL Nucleotide Sequence Database (http://www.ebi.ac.uk/embl/) is maintained at the European Bioinformatics Institute (EBI) in an international collaboration with the DNA Data Bank of Japan (DDBJ) and GenBank at the NCBI (USA). Data is exchanged amongst the collaborating databases on a daily basis. The major contributors to the EMBL database are individual authors and genome project groups. Webin is the preferred web-based submission system for individual submitters, whilst automatic procedures allow incorporation of sequence data from large-scale genome sequencing centres and from the European Patent Office (EPO). Database releases are produced quarterly. Network services allow free access to the most up-to-date data collection via ftp, email and World Wide Web interfaces. EBI’s Sequence Retrieval System (SRS), a network browser for databanks in molecular biology, integrates and links the main nucleotide and protein databases plus many specialized databases. For sequence similarity searching a variety of tools (e.g. Blitz, Fasta, BLAST) are available which allow external users to compare their own sequences against the latest data in the EMBL Nucleotide Sequence Database and SWISS-PROT. PMID:11125039

Interactive computer programs for the graphic analysis of nucleotide sequence data.

PubMed Central

Luckow, V A; Littlewood, R K; Rownd, R H

1984-01-01

A group of interactive computer programs have been developed which aid in the collection and graphical analysis of nucleotide and protein sequence data. The programs perform the following basic functions: a) enter, edit, list, and rearrange sequence data; b) permit automatic entry of nucleotide sequence data directly from an autoradiograph into the computer; c) search for restriction sites or other specified patterns and plot a linear or circular restriction map, or print their locations; d) plot base composition; e) analyze homology between sequences by plotting a two-dimensional graphic matrix; and f) aid in plotting predicted secondary structures of RNA molecules. PMID:6546437

Nucleotide sequence analysis establishes the role of endogenous murine leukemia virus DNA segments in formation of recombinant mink cell focus-forming murine leukemia viruses.

PubMed Central

Khan, A S

1984-01-01

The sequence of 363 nucleotides near the 3' end of the pol gene and 564 nucleotides from the 5' terminus of the env gene in an endogenous murine leukemia viral (MuLV) DNA segment, cloned from AKR/J mouse DNA and designated as A-12, was obtained. For comparison, the nucleotide sequence in an analogous portion of AKR mink cell focus-forming (MCF) 247 MuLV provirus was also determined. Sequence features unique to MCF247 MuLV DNA in the 3' pol and 5' env regions were identified by comparison with nucleotide sequences in analogous regions of NFS -Th-1 xenotropic and AKR ecotropic MuLV proviruses. These included (i) an insertion of 12 base pairs encoding four amino acids located 60 base pairs from the 3' terminus of the pol gene and immediately preceding the env gene, (ii) the deletion of 12 base pairs (encoding four amino acids) and the insertion of 3 base pairs (encoding one amino acid) in the 5' portion of the env gene, and (iii) single base substitutions resulting in 2 MCF247 -specific amino acids in the 3' pol and 23 in the 5' env regions. Nucleotide sequence comparison involving the 3' pol and 5' env regions of AKR MCF247 , NFS xenotropic, and AKR ecotropic MuLV proviruses with the cloned endogenous MuLV DNA indicated that MCF247 proviral DNA sequences were conserved in the cloned endogenous MuLV proviral segment. In fact, total nucleotide sequence identity existed between the endogenous MuLV DNA and the MCF247 MuLV provirus in the 3' portion of the pol gene. In the 5' env region, only 4 of 564 nucleotides were different, resulting in three amino acid changes between AKR MCF247 MuLV DNA and the endogenous MuLV DNA present in clone A-12. In addition, nucleotide sequence comparison indicated that Moloney-and Friend-MCF MuLVs were also highly related in the 3' pol and 5' env regions to the cloned endogenous MuLV DNA. These results establish the role of endogenous MuLV DNA segments in generation of recombinant MCF viruses. PMID:6328017

Complete nucleotide sequence and genome organization of a novel allexivirus from alfalfa (Medicago sativa)

USDA-ARS?s Scientific Manuscript database

A new species of the family Alphaflexiviridae provisionally named Alfalfa virus S (AVS) was diagnosed in alfalfa samples originating from Sudan. A complete nucleotide sequence of the viral genome consisting of 8,349 nucleotides excluding the 3’ poly(A) tail was determined by Illumina NGS technology ...

Genetic Diversity of Hepatitis A Virus in China: VP3-VP1-2A Genes and Evidence of Quasispecies Distribution in the Isolates

PubMed Central

Cao, Jingyuan; Zhou, Wenting; Yi, Yao; Jia, Zhiyuan; Bi, Shengli

2013-01-01

Hepatitis A virus (HAV) is the most common cause of infectious hepatitis throughout the world, spread largely by the fecal-oral route. To characterize the genetic diversity of the virus circulating in China where HAV in endemic, we selected the outbreak cases with identical sequences in VP1-2A junction region and compiled a panel of 42 isolates. The VP3-VP1-2A regions of the HAV capsid-coding genes were further sequenced and analyzed. The quasispecies distribution was evaluated by cloning the VP3 and VP1-2A genes in three clinical samples. Phylogenetic analysis demonstrated that the same genotyping results could be obtained whether using the complete VP3, VP1, or partial VP1-2A genes for analysis in this study, although some differences did exist. Most isolates clustered in sub-genotype IA, and fewer in sub-genotype IB. No amino acid mutations were found at the published neutralizing epitope sites, however, several unique amino acid substitutions in the VP3 or VP1 region were identified, with two amino acid variants closely located to the immunodominant site. Quasispecies analysis showed the mutation frequencies were in the range of 7.22x10-4 -2.33x10-3 substitutions per nucleotide for VP3, VP1, or VP1-2A. When compared with the consensus sequences, mutated nucleotide sites represented the minority of all the analyzed sequences sites. HAV replicated as a complex distribution of closely genetically related variants referred to as quasispecies, and were under negative selection. The results indicate that diverse HAV strains and quasispecies inside the viral populations are presented in China, with unique amino acid substitutions detected close to the immunodominant site, and that the possibility of antigenic escaping mutants cannot be ruled out and needs to be further analyzed. PMID:24069343

The primary structure of the thymidine kinase gene of fish lymphocystis disease virus.

PubMed

Schnitzler, P; Handermann, M; Szépe, O; Darai, G

1991-06-01

The DNA nucleotide sequence of the thymidine kinase (TK) gene of fish lymphocystis disease virus (FLDV) which has been localized between the coordinates 0.678 to 0.688 of the viral genome was determined. The analysis of the DNA nucleotide sequence located between the recognition sites of HindIII (0.669 map unit; nucleotide position 1) and AccI (nucleotide position 2032) revealed the presence of an open reading frame of 954 bp on the lower strand of this region between nucleotide positions 1868 (ATG) and 915 (TAA). It encodes for a protein of 318 amino acid residues. The evolutionary relationships of the TK gene of FLDV to the other known TK genes was investigated using the method of progressive sequence alignment. These analyses revealed a high degree of diversity between the protein sequence of FLDV TK gene and the amino acid composition of other TKs tested. However, significant conservations were detected at several regions of amino acid residues of the FLDV TK protein when compared to the amino acid sequence of TKs of African swine fever virus, fowlpox virus, shope fibroma virus, and vaccinia virus and to the amino acid sequences of the cellular cytoplasmic TK of chicken, mouse, and man.

Alu Sb2 subfamily is present in all higher primates but was most succesfully amplified in humans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Richer, C.; Zietkiewicz, E.; Labuda, D.

Alu repeats can be classified into subfamilies which amplified in primate genomes at different evolutionary time periods. A young Alu subfamily, Sb2, with a characteristic 7-nucleotide duplication at position 256, has been described in seven human loci. An Sb2 insertion found near the HD gene was unique to two HD families, indicating that Sb2 was still retropositionally active. Here, we have shown that the Sb2 insertion in the CHOL locus was similarly rare, being absent in 120 individuals of Caucasian, Oriental and Black origin. In contrast, Sb2 inserts in five other loci were found fixed (non-polymorphic), based on measurements inmore » the same population sample, but absent from orthologous positions in higher apes. This suggest that Sb2 repeats spread relatively early in the human lineage following divergence from other primates and that these elements may be human-specific. By quantitative PCR, we investigated the presence of Sb2 sequences in different primate DNA, using one PCR primer anchored at the 5{prime} Alu-end and the other complementary to the duplicated Sb2-specific segment. With an Sb2-containing plasmid as a standard, we estimated the number of Sb2 repeats at 1500-1800 copies per human haploid equivalent; corresponding numbers in chimpanzee and gorilla were almost two orders of magnitude lower, while the signal observed in orangutan and gibbon DNAs was consistent with the presence of a single copy. The analysis of 22 human, 11 chimpanzee and 10 gorilla sequences indicates that the Alu Sb2 dispersed independently in these three primate lineages; gorilla consensus differs from the human Sb2 sequence by one position, while all chimpanzee repeats have their linker expanded by up to eight A-residues. Should they be thus considered as separate subfamilies? It is possible that sequence modifications with respect to the human consensus are responsible for poor retroposition of Sb2 in apes.« less

Sequence diversity within the reovirus S2 gene: reovirus genes reassort in nature, and their termini are predicted to form a panhandle motif.

PubMed Central

Chapell, J D; Goral, M I; Rodgers, S E; dePamphilis, C W; Dermody, T S

1994-01-01

To better understand genetic diversity within mammalian reoviruses, we determined S2 nucleotide and deduced sigma 2 amino acid sequences of nine reovirus strains and compared these sequences with those of prototype strains of the three reovirus serotypes. The S2 gene and sigma 2 protein are highly conserved among the four type 1, one type 2, and seven type 3 strains studied. Phylogenetic analyses based on S2 nucleotide sequences of the 12 reovirus strains indicate that diversity within the S2 gene is independent of viral serotype. Additionally, we found marked topological differences between phylogenetic trees generated from S1 and S2 gene nucleotide sequences of the seven type 3 strains. These results demonstrate that reovirus S1 and S2 genes have distinct evolutionary histories, thus providing phylogenetic evidence for lateral transfer of reovirus genes in nature. When variability among the 12 sigma 2-encoding S2 nucleotide sequences was analyzed at synonymous positions, we found that approximately 60 nucleotides at the 5' terminus and 30 nucleotides at the 3' terminus were markedly conserved in comparison with other sigma 2-encoding regions of S2. Predictions of RNA secondary structures indicate that the more conserved S2 sequences participate in the formation of an extended region of duplex RNA interrupted by a pair of stem-loops. Among the 12 deduced sigma 2 amino acid sequences examined, substitutions were observed at only 11% of amino acid positions. This finding suggests that constraints on the structure or function of sigma 2, perhaps in part because of its location in the virion core, have limited sequence diversity within this protein. PMID:8289378

DNA sequence analysis of simian virus 40 mutants with deletions mapping in the leader region of the late viral mRNA's: mutants with deletions similar in size and position exhibit varied phenotypes.

PubMed

Barkan, A; Mertz, J E

1981-02-01

The nucleotide sequences of 10 viable yet partially defective deletion mutants of simian virus 40 were determined. The deletions mapped within, and, in many cases, 5' to, the predominant leader sequence of the late viral mRNA's. They ranged from 74 to 187 nucleotide pairs in length. Six of the mutants had lost the sequence that corresponds to the "cap" site (5' terminus) of the most abundant class of 16S mRNA's. One of these mutants had a deletion that extended 103 nucleotide pairs into the region preceding this primary cap site and, therefore, was missing many secondary cap sites as well. A seventh mutant lacked the entire major 16S leader sequence except for the first six nucleotides at its 5' end and the last nine at its 3' end. Although these mutants differed in the size and position of their deletions, we were unable to discover any simple correlations between their growth characteristics and their DNA sequences. This finding indicates that the secondary structures of the RNA transcripts may play a more important role than the exact nucleotide sequence of the RNAs in determining how they function within the cell.

Antifungal polypeptides

DOEpatents

Altier, Daniel J.; Dahlbacka, Glen; Ellanskaya, legal representative, Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser; Ellanskaya, deceased, Irina

2007-12-11

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Antifungal polypeptides

DOEpatents

Altier, Daniel J.; Dahlbacka, Glen; Elleskaya, Irina; Ellanskaya, legal representative; Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser

2010-08-10

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Antifungal polypeptides

DOEpatents

Altier, Daniel J [Waukee, IA; Dahlbacka, Glen [Oakland, CA; Elleskaya, Irina [Kyiv, UA; Ellanskaya, legal representative, Natalia; Herrmann, Rafael [Wilmington, DE; Hunter-Cevera, Jennie [Elliott City, MD; McCutchen, Billy F [College Station, IA; Presnail, James K [Avondale, PA; Rice, Janet A [Wilmington, DE; Schepers, Eric [Port Deposit, MD; Simmons, Carl R [Des Moines, IA; Torok, Tamas [Richmond, CA; Yalpani, Nasser [Johnston, IA

2011-04-12

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Antifungal polypeptides

DOEpatents

Altier, Daniel J [Granger, IA; Dahlbacka, Glen [Oakland, CA; Ellanskaya, Irina [Kyiv, UA; Ellanskaya, legal representative, Natalia; Herrmann, Rafael [Wilmington, DE; Hunter-Cevera, Jennie [Elliott City, MD; McCutchen, Billy F [College Station, TX; Presnail, James K [Avondale, PA; Rice, Janet A [Wilmington, DE; Schepers, Eric [Port Deposit, MD; Simmons, Carl R [Des Moines, IA; Torok, Tamas [Richmond, CA; Yalpani, Nasser [Johnston, IA

2012-04-03

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

PubMed

Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

2012-05-01

The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

PubMed Central

Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

1982-01-01

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%). PMID:6891053

Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

DOEpatents

McCutchen-Maloney, Sandra L.

2002-01-01

DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

Distinct profiles of TERT promoter mutations and telomerase expression in head and neck cancer and cervical carcinoma.

PubMed

Annunziata, Clorinda; Pezzuto, Francesca; Greggi, Stefano; Ionna, Franco; Losito, Simona; Botti, Gerardo; Buonaguro, Luigi; Buonaguro, Franco M; Tornesello, Maria Lina

2018-03-31

Two recurrent mutations (-124 G > A and -146 G > A) in the core promoter region of the human telomerase reverse transcriptase (TERT) gene create consensus binding sites for ETS transcription factors and cause increased TERT expression in several tumour types. We analyzed TERT promoter mutations and TERT mRNA levels in head and neck cancer, cervical carcinoma and cervical intraepithelial neoplasia (CIN) as well as in C-4I, CaSki, HeLa and SiHa cervical cell lines. Nucleotide sequence analysis of TERT promoter region showed that 33.3% of oral squamous cell carcinoma (SCC) and 16.8% of cervical SCC harboured mutually exclusive G to A transitions at nucleotide position -124 or -146. TERT promoter was mutated at nucleotide -146 (G > A) in SiHa cell line. Other nucleotide changes creating in some cases putative ETS binding sites were more frequent in oral SCC (26.7%) than in cervical carcinoma (4.8%). The frequency of mutations was independent of human papillomavirus (HPV) tumour status in both cervical and oral cancer. Expression of TERT gene was significantly higher in TERT promoter mutated (-124G > A or -146G > A) cervical SCC compared to not mutated SCC irrespective of HPV16 E6 and E7 levels. Such hot spot changes were not detected in oropharyngeal SCC, cervical adenocarcinoma and CIN lesions. Our results suggest that TERT promoter mutations play a relevant role in oral SCC as well as in cervical SCC, besides the already known effect of HPV16 E6 protein on TERT expression. © 2018 UICC.

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2011 CFR

2011-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2013 CFR

2013-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2012 CFR

2012-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2010 CFR

2010-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2014 CFR

2014-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

Genetic heterogeneity of L-Zagreb mumps virus vaccine strain.

PubMed

Kosutic-Gulija, Tanja; Forcic, Dubravko; Santak, Maja; Ramljak, Ana; Mateljak-Lukacevic, Sanja; Mazuran, Renata

2008-07-10

The most often used mumps vaccine strains Jeryl Lynn (JL), RIT4385, Urabe-AM9, L-Zagreb and L-3 differ in immunogenicity and reactogenicity. Previous analyses showed that JL, Urabe-AM9 and L-3 are genetically heterogeneous. We identified the heterogeneity of L-Zagreb throughout the entire genome. Two major variants were defined: variant A being identical to the consensus sequence of viral seeds and vaccine(s) and variant B which differs from variant A in three nucleotide positions. The difference between viral variants in L-Zagreb strain is insufficient for distinct viral strains to be defined. We demonstrated that proportion of variants in L-Zagreb viral population depends on cell substrate used for viral replication in vitro and in vivo. L-Zagreb strain should be considered as a single strain composed of at least two variant viral genomes.

Biological nanopore MspA for DNA sequencing

NASA Astrophysics Data System (ADS)

Manrao, Elizabeth A.

Unlocking the information hidden in the human genome provides insight into the inner workings of complex biological systems and can be used to greatly improve health-care. In order to allow for widespread sequencing, new technologies are required that provide fast and inexpensive readings of DNA. Nanopore sequencing is a third generation DNA sequencing technology that is currently being developed to fulfill this need. In nanopore sequencing, a voltage is applied across a small pore in an electrolyte solution and the resulting ionic current is recorded. When DNA passes through the channel, the ionic current is partially blocked. If the DNA bases uniquely modulate the ionic current flowing through the channel, the time trace of the current can be related to the sequence of DNA passing through the pore. There are two main challenges to realizing nanopore sequencing: identifying a pore with sensitivity to single nucleotides and controlling the translocation of DNA through the pore so that the small single nucleotide current signatures are distinguishable from background noise. In this dissertation, I explore the use of Mycobacterium smegmatis porin A (MspA) for nanopore sequencing. In order to determine MspA's sensitivity to single nucleotides, DNA strands of various compositions are held in the pore as the resulting ionic current is measured. DNA is immobilized in MspA by attaching it to a large molecule which acts as an anchor. This technique confirms the single nucleotide resolution of the pore and additionally shows that MspA is sensitive to epigenetic modifications and single nucleotide polymorphisms. The forces from the electric field within MspA, the effective charge of nucleotides, and elasticity of DNA are estimated using a Freely Jointed Chain model of single stranded DNA. These results offer insight into the interactions of DNA within the pore. With the nucleotide sensitivity of MspA confirmed, a method is introduced to controllably pass DNA through the pore. Using a DNA polymerase, DNA strands are stepped through MspA one nucleotide at a time. The steps are observable as distinct levels on the ionic-current time-trace and are related to the DNA sequence. These experiments overcome the two fundamental challenges to realizing MspA nanopore sequencing and pave the way to the development of a commercial technology.

Sequence and Secondary Structure of the Mitochondrial Small-Subunit rRNA V4, V6, and V9 Domains Reveal Highly Species-Specific Variations within the Genus Agrocybe

PubMed Central

Gonzalez, Patrice; Labarère, Jacques

1998-01-01

A comparative study of variable domains V4, V6, and V9 of the mitochondrial small-subunit (SSU) rRNA was carried out with the genus Agrocybe by PCR amplification of 42 wild isolates belonging to 10 species, Agrocybe aegerita, Agrocybe dura, Agrocybe chaxingu, Agrocybe erebia, Agrocybe firma, Agrocybe praecox, Agrocybe paludosa, Agrocybe pediades, Agrocybe alnetorum, and Agrocybe vervacti. Sequencing of the PCR products showed that the three domains in the isolates belonging to the same species were the same length and had the same sequence, while variations were found among the 10 species. Alignment of the sequences showed that nucleotide motifs encountered in the smallest sequence of each variable domain were also found in the largest sequence, indicating that the sequences evolved by insertion-deletion events. Determination of the secondary structure of each domain revealed that the insertion-deletion events commonly occurred in regions not directly involved in the secondary structure (i.e., the loops). Moreover, conserved sequences ranging from 4 to 25 nucleotides long were found at the beginning and end of each domain and could constitute genus-specific sequences. Comparisons of the V4, V6, and V9 secondary structures resulted in identification of the following four groups: (i) group I, which was characterized by the presence of additional P23-1 and P23-3 helices in the V4 domain and the lack of the P49-1 helix in V9 and included A. aegerita, A. chaxingu, and A. erebia; (ii) group II, which had the P23-3 helix in V4 and the P49-1 helix in V9 and included A. pediades; (iii) group III, which did not have additional helices in V4, had the P49-1 helix in V9 and included A. paludosa, A. firma, A. alnetorum, and A. praecox; and (iv) group IV, which lacked both the V4 additional helices and the P49-1 helix in V9 and included A. vervacti and A. dura. This grouping of species was supported by the structure of a consensus tree based on the variable domain sequences. The conservation of the sequences of the V4, V6, and V9 domains of the mitochondrial SSU rRNA within species and the high degree of interspecific variation found in the Agrocybe species studied open the way for these sequences to be used as specific molecular markers of the Basidiomycota. PMID:9797259

Sequence and secondary structure of the mitochondrial small-subunit rRNA V4, V6, and V9 domains reveal highly species-specific variations within the genus Agrocybe.

PubMed

Gonzalez, P; Labarère, J

1998-11-01

A comparative study of variable domains V4, V6, and V9 of the mitochondrial small-subunit (SSU) rRNA was carried out with the genus Agrocybe by PCR amplification of 42 wild isolates belonging to 10 species, Agrocybe aegerita, Agrocybe dura, Agrocybe chaxingu, Agrocybe erebia, Agrocybe firma, Agrocybe praecox, Agrocybe paludosa, Agrocybe pediades, Agrocybe alnetorum, and Agrocybe vervacti. Sequencing of the PCR products showed that the three domains in the isolates belonging to the same species were the same length and had the same sequence, while variations were found among the 10 species. Alignment of the sequences showed that nucleotide motifs encountered in the smallest sequence of each variable domain were also found in the largest sequence, indicating that the sequences evolved by insertion-deletion events. Determination of the secondary structure of each domain revealed that the insertion-deletion events commonly occurred in regions not directly involved in the secondary structure (i.e., the loops). Moreover, conserved sequences ranging from 4 to 25 nucleotides long were found at the beginning and end of each domain and could constitute genus-specific sequences. Comparisons of the V4, V6, and V9 secondary structures resulted in identification of the following four groups: (i) group I, which was characterized by the presence of additional P23-1 and P23-3 helices in the V4 domain and the lack of the P49-1 helix in V9 and included A. aegerita, A. chaxingu, and A. erebia; (ii) group II, which had the P23-3 helix in V4 and the P49-1 helix in V9 and included A. pediades; (iii) group III, which did not have additional helices in V4, had the P49-1 helix in V9 and included A. paludosa, A. firma, A. alnetorum, and A. praecox; and (iv) group IV, which lacked both the V4 additional helices and the P49-1 helix in V9 and included A. vervacti and A. dura. This grouping of species was supported by the structure of a consensus tree based on the variable domain sequences. The conservation of the sequences of the V4, V6, and V9 domains of the mitochondrial SSU rRNA within species and the high degree of interspecific variation found in the Agrocybe species studied open the way for these sequences to be used as specific molecular markers of the Basidiomycota.

First report of Beet western yellows virus infecting Epiphyllum spp

USDA-ARS?s Scientific Manuscript database

Beet western yellow virus (BWYV) was identified from an orchid cactus (Epiphyllum spp.) hybrid without obvious symptoms by high-throughput sequencing. The nearly complete genomic sequence of 5,458 nucleotides of the virus was determined. The isolate has the highest nucleotide sequence identity (93%)...

A new single-nucleotide polymorphism database for rainbow trout generated through whole genome re-sequencing

USDA-ARS?s Scientific Manuscript database

Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

Embedding strategies for effective use of information from multiple sequence alignments.

PubMed Central

Henikoff, S.; Henikoff, J. G.

1997-01-01

We describe a new strategy for utilizing multiple sequence alignment information to detect distant relationships in searches of sequence databases. A single sequence representing a protein family is enriched by replacing conserved regions with position-specific scoring matrices (PSSMs) or consensus residues derived from multiple alignments of family members. In comprehensive tests of these and other family representations, PSSM-embedded queries produced the best results overall when used with a special version of the Smith-Waterman searching algorithm. Moreover, embedding consensus residues instead of PSSMs improved performance with readily available single sequence query searching programs, such as BLAST and FASTA. Embedding PSSMs or consensus residues into a representative sequence improves searching performance by extracting multiple alignment information from motif regions while retaining single sequence information where alignment is uncertain. PMID:9070452

Identification of Sinorhizobium (Ensifer) medicae based on a specific genomic sequence unveiled by M13-PCR fingerprinting.

PubMed

Dourado, Ana Catarina; Alves, Paula I L; Tenreiro, Tania; Ferreira, Eugénio M; Tenreiro, Rogério; Fareleira, Paula; Crespo, M Teresa Barreto

2009-12-01

A collection of nodule isolates from Medicago polymorpha obtained from southern and central Portugal was evaluated by M13-PCR fingerprinting and hierarchical cluster analysis. Several genomic clusters were obtained which, by 16S rRNA gene sequencing of selected representatives, were shown to be associated with particular taxonomic groups of rhizobia and other soil bacteria. The method provided a clear separation between rhizobia and co-isolated non-symbiotic soil contaminants. Ten M13-PCR groups were assigned to Sinorhizobium (Ensifer) medicae and included all isolates responsible for the formation of nitrogen-fixing nodules upon re-inoculation of M. polymorpha test-plants. In addition, enterobacterial repetitive intergenic consensus (ERIC)-PCR fingerprinting indicated a high genomic heterogeneity within the major M13- PCR clusters of S. medicae isolates. Based on nucleotide sequence data of an M13-PCR amplicon of ca. 1500 bp, observed only in S. medicae isolates and spanning locus Smed_3707 to Smed_3709 from the pSMED01 plasmid sequence of S. medicae WSM419 genome's sequence, a pair of PCR primers was designed and used for direct PCR amplification of a 1399-bp sequence within this fragment. Additional in silico and in vitro experiments, as well as phylogenetic analysis, confirmed the specificity of this primer combination and therefore the reliability of this approach in the prompt identification of S. medicae isolates and their distinction from other soil bacteria.

Consequences of germline variation disrupting the constitutional translational initiation codon start sites of MLH1 and BRCA2: use of potential alternative start sites and implications for predicting variant pathogenicity

PubMed Central

Parsons, Michael T.; Whiley, Phillip J.; Beesley, Jonathan; Drost, Mark; de Wind, Niels; Thompson, Bryony A.; Marquart, Louise; Hopper, John L.; Jenkins, Mark A.; Brown, Melissa A.; Tucker, Kathy; Warwick, Linda; Buchanan, Daniel D.; Spurdle, Amanda B.

2014-01-01

Variants that disrupt the translation initiation sequences in cancer predisposition genes are generally assumed to be deleterious. However few studies have validated these assumptions with functional and clinical data. Two cancer syndrome gene variants likely to affect native translation initiation were identified by clinical genetic testing: MLH1:c.1A>G p.(Met1?) and BRCA2:c.67+3A>G. In vitro GFP-reporter assays were conducted to assess the consequences of translation initiation disruption on alternative downstream initiation codon usage. Analysis of MLH1:c.1A>G p.(Met1?) showed that translation was mostly initiated at an in-frame position 103 nucleotides downstream, but also at two ATG sequences downstream. The protein product encoded by the in-frame transcript initiating from position c.103 showed loss of in vitro mismatch repair activity comparable to known pathogenic mutations. BRCA2:c.67+3A>G was shown by mRNA analysis to result in an aberrantly spliced transcript deleting exon 2 and the consensus ATG site. In the absence of exon 2, translation initiated mostly at an out-of-frame ATG 323 nucleotides downstream, and to a lesser extent at an in-frame ATG 370 nucleotides downstream. Initiation from any of the downstream alternative sites tested in both genes would lead to loss of protein function, but further clinical data is required to confirm if these variants are associated with a high cancer risk. Importantly, our results highlight the need for caution in interpreting the functional and clinical consequences of variation that leads to disruption of the initiation codon, since translation may not necessarily occur from the first downstream alternative start site, or from a single alternative start site. PMID:24302565

U14 small nucleolar RNA makes multiple contacts with the pre-ribosomal RNA.

PubMed

Morrissey, J P; Tollervey, D

1997-06-01

The small nucleolar RNA (snoRNA) U14 has two regions of extended primary sequence complementarity to the 18S rRNA. The 3' region (domain B) shows the consensus structure for the methylation guide class of snoRNAs, whereas base-pairing between the 5' region (domain A) and the 18S rRNA sequence is required for the formation of functional ribosomes. Between domains A and B lies another essential region (domain Y). Here we report that yeast U14 can be cross-linked in vivo to the pre-rRNA; cross-linking is detected exclusively with the 35S primary transcript. Many nucleotides in U14 that lie outside of domains A and B are cross-linked to the pre-rRNA; in particular the essential domain Y region is cross-linked at several sites. U14 is, therefore, in far more extensive contact with the pre-rRNA than predicted from simple base-pairing models. Moreover, U14 can be cross-linked to other small RNA species. The functional interactions made by U14 during ribosome synthesis are likely to be very complex.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vidaud, M.; Vidaud, D.; Amselem, S.

The authors have characterized a Mediterranean {beta}-thalassemia allele containing a sequence change at codon 30 that alters both {beta}-globin pre-mRNA splicing and the structure of the homoglobin product. Presumably, this G {yields} C transversion at position {minus}1 of intron 1 reduces severely the utilization of the normal 5{prime} splice site since the level of the Arg {yields} Thr mutant hemoglobin (designated hemoglobin Kairouan) found in the erythrocytes of the patient is very low (2% of total hemoglobin). Since no natural mutations of the guanine located at position {minus}1 of the CAG/GTAAGT consensus sequence had been isolated previously. They investigated themore » role of this nucleotide in the constitution of an active 5{prime} splice site by studying the splicing of the pre-mRNA in cell-free extracts. They demonstrate that correct splicing of the mutant pre-mRNA is 98% inhibited. Their results provide further insights into the mechanisms of pre-mRNA maturation by revealing that the last residue of the exon plays a role at least equivalent to that of the intron residue at position +5.« less

[Study on the genetic difference of SEO type Hantaviruses].

PubMed

Zhang, X; Zhou, S; Wang, H; Hu, J; Guan, Z; Liu, H

2000-10-01

To understand the genetic type of Hantaviruses and the difference between them caused by rodents in Beijing and to furhter explore the source of the infectious factors. Hantavirus RNA, isolated from lungs of rodents captured in Beijing and positive with Hantavirus antigens with frozen sectioning and Immunofluorescent assay, were reverse-transcribed and amplified with PCR with Hantavirus-specific primers. Five of the PCR amplifications were discovered and sequenced with 300 bp sequence data of M segments (from 2003 - 2302nt according cDNA of seoul 8039 strain). Nucleotide sequence homology showed that they were sequences of SEO-type Hantavirus. Compared with SEO type Hantavirus, the nucleotide sequence homology of these samples was more than 94% while the homology of amonia acid sequence was more than 98%. When compared with HNT type Hantavirus, the homology of nucleotide sequence became less than 72% with the homology of amonia acid sequence less than 81%. Similar to other Hantavirus of SEO type, their nucleotide sequences and deduced amino acid sequences were highly preserved. Phylogenetic tree analysis showed that the five viruses could be divided into at least 4 branches. It was quite likely that there were at least two sub-type SEO viruses with 4 branches that were circulating in Beijing.

Multiple splicing defects in an intronic false exon.

PubMed

Sun, H; Chasin, L A

2000-09-01

Splice site consensus sequences alone are insufficient to dictate the recognition of real constitutive splice sites within the typically large transcripts of higher eukaryotes, and large numbers of pseudoexons flanked by pseudosplice sites with good matches to the consensus sequences can be easily designated. In an attempt to identify elements that prevent pseudoexon splicing, we have systematically altered known splicing signals, as well as immediately adjacent flanking sequences, of an arbitrarily chosen pseudoexon from intron 1 of the human hprt gene. The substitution of a 5' splice site that perfectly matches the 5' consensus combined with mutation to match the CAG/G sequence of the 3' consensus failed to get this model pseudoexon included as the central exon in a dhfr minigene context. Provision of a real 3' splice site and a consensus 5' splice site and removal of an upstream inhibitory sequence were necessary and sufficient to confer splicing on the pseudoexon. This activated context also supported the splicing of a second pseudoexon sequence containing no apparent enhancer. Thus, both the 5' splice site sequence and the polypyrimidine tract of the pseudoexon are defective despite their good agreement with the consensus. On the other hand, the pseudoexon body did not exert a negative influence on splicing. The introduction into the pseudoexon of a sequence selected for binding to ASF/SF2 or its replacement with beta-globin exon 2 only partially reversed the effect of the upstream negative element and the defective polypyrimidine tract. These results support the idea that exon-bridging enhancers are not a prerequisite for constitutive exon definition and suggest that intrinsically defective splice sites and negative elements play important roles in distinguishing the real splicing signal from the vast number of false splicing signals.

Sequencing and phylogenetic analysis of tobacco virus 2, a polerovirus from Nicotiana tabacum.

PubMed

Zhou, Benguo; Wang, Fang; Zhang, Xuesong; Zhang, Lina; Lin, Huafeng

2017-07-01

The complete genome sequence of a new virus, provisionally named tobacco virus 2 (TV2), was determined and identified from leaves of tobacco (Nicotiana tabacum) exhibiting leaf mosaic, yellowing, and deformity, in Anhui Province, China. The genome sequence of TV2 comprises 5,979 nucleotides, with 87% nucleotide sequence identity to potato leafroll virus (PLRV). Its genome organization is similar to that of PLRV, containing six open reading frames (ORFs) that potentially encode proteins with putative functions in cell-to-cell movement and suppression of RNA silencing. Phylogenetic analysis of the nucleotide sequence placed TV2 alongside members of the genus Polerovirus in the family Luteoviridae. To the best our knowledge, this study is the first report of a complete genome sequence of a new polerovirus identified in tobacco.

Complete nucleotide sequences of the coat protein messenger RNAs of brome mosaic virus and cowpea chlorotic mottle virus.

PubMed Central

Dasgupta, R; Kaesberg, P

1982-01-01

The nucleotide sequences of the subgenomic coat protein messengers (RNA4's) of two related bromoviruses, brome mosaic virus (BMV) and cowpea chlorotic mottle virus (CCMV), have been determined by direct RNA and CDNA sequencing without cloning. BMV RNA4 is 876 b long including a 5' noncoding region of nine nucleotides and a 3' noncoding region of 300 nucleotides. CCMV RNA 4 is 824 b long, including a 5' noncoding region of 10 nucleotides and a 3' noncoding region of 244 nucleotides. The encoded coat proteins are similar in length (188 amino acids for BMV and 189 amino acids for CCMV) and display about 70% homology in their amino acid sequences. Length difference between the two RNAs is due mostly to a single deletion, in CCMV with respect to BMV, of about 57 b immediately following the coding region. Allowing for this deletion the RNAs are indicate that mutations leading to divergence were constrained in the coding region primarily by the requirement of maintaining a favorable coat protein structure and in the 3' noncoding region primarily by the requirement of maintaining a favorable RNA spatial configuration. PMID:6895941

Nucleotide sequence analysis of the 3' terminal region of a wasabi strain of crucifer tobamovirus genomic RNA: subgrouping of crucifer tobamoviruses.

PubMed

Shimamoto, I; Sonoda, S; Vazquez, P; Minaka, N; Nishiguchi, M

1998-01-01

The 3' terminal 2378 nucleotides of a wasabi strain of crucifer tobamovirus (CTMV-W) infectious to crucifer plants was determined. This includes the 3' non-coding region of 235 nucleotides, coat protein (CP) gene (468 nucleotides), movement protein (MP) gene (798 nucleotides) and C-terminal partial readthrough portion of 180 K protein gene (940 nucleotides). Comparison of the sequence with homologous regions of thirteen other tobamovirus genomes showed that it had much higher identity to those of four other crucifer tobamoviruses, 85.2% to cr-TMV and turnip vein-clearing virus (TVCV), 87.4% to oilseed rape mosaic virus (ORMV) and 87.1% to TMV-Cg, than to those of other tobamoviruses. Thus CTMV-W was most similar to ORMV and TMV-Cg in sequence, but only marginally so, whereas the location and size of its MP gene was the same as cr-TMV amd TVCV. These results, together with other analyses, show that CTMV-W is a new crucifer tobamovirus, that the five crucifer tobamoviruses can be classified into two subgroups based on MP gene organization, and that the rate of sequence change is not the same in all lineages.

Comparative genomic sequence analysis of novel Helicoverpa armigera nucleopolyhedrovirus (NPV) isolated from Kenya and three other previously sequenced Helicoverpa spp. NPVs.

PubMed

Ogembo, Javier Gordon; Caoili, Barbara L; Shikata, Masamitsu; Chaeychomsri, Sudawan; Kobayashi, Michihiro; Ikeda, Motoko

2009-10-01

A newly cloned Helicoverpa armigera nucleopolyhedrovirus (HearNPV) from Kenya, HearNPV-NNg1, has a higher insecticidal activity than HearNPV-G4, which also exhibits lower insecticidal activity than HearNPV-C1. In the search for genes and/or nucleotide sequences that might be involved in the observed virulence differences among Helicoverpa spp. NPVs, the entire genome of NNg1 was sequenced and compared with previously sequenced genomes of G4, C1 and Helicoverpa zea single-nucleocapsid NPV (Hz). The NNg1 genome was 132,425 bp in length, with a total of 143 putative open reading frames (ORFs), and shared high levels of overall amino acid and nucleotide sequence identities with G4, C1 and Hz. Three NNg1 ORFs, ORF5, ORF100 and ORF124, which were shared with C1, were absent in G4 and Hz, while NNg1 and C1 were missing a homologue of G4/Hz ORF5. Another three ORFs, ORF60 (bro-b), ORF119 and ORF120, and one direct repeat sequence (dr) were unique to NNg1. Relative to the overall nucleotide sequence identity, lower sequence identities were observed between NNg1 hrs and the homologous hrs in the other three Helicoverpa spp. NPVs, despite containing the same number of hrs located at essentially the same positions on the genomes. Differences were also observed between NNg1 and each of the other three Helicoverpa spp. NPVs in the diversity of bro genes encoded on the genomes. These results indicate several putative genes and nucleotide sequences that may be responsible for the virulence differences observed among Helicoverpa spp., yet the specific genes and/or nucleotide sequences responsible have not been identified.

Isolation of nucleotide binding site-leucine rich repeat and kinase resistance gene analogues from sugarcane (Saccharum spp.).

PubMed

Glynn, Neil C; Comstock, Jack C; Sood, Sushma G; Dang, Phat M; Chaparro, Jose X

2008-01-01

Resistance gene analogues (RGAs) have been isolated from many crops and offer potential in breeding for disease resistance through marker-assisted selection, either as closely linked or as perfect markers. Many R-gene sequences contain kinase domains, and indeed kinase genes have been reported as being proximal to R-genes, making kinase analogues an additionally promising target. The first step towards utilizing RGAs as markers for disease resistance is isolation and characterization of the sequences. Sugarcane clone US01-1158 was identified as resistant to yellow leaf caused by the sugarcane yellow leaf virus (SCYLV) and moderately resistant to rust caused by Puccinia melanocephala Sydow & Sydow. Degenerate primers that had previously proved useful for isolating RGAs and kinase analogues in wheat and soybean were used to amplify DNA from sugarcane (Saccharum spp.) clone US-01-1158. Sequences generated from 1512 positive clones were assembled into 134 contigs of between two and 105 sequences. Comparison of the contig consensuses with the NCBI sequence database using BLASTx showed that 20 had sequence homology to nuclear binding site and leucine rich repeat (NBS-LRR) RGAs, and eight to kinase genes. Alignment of the deduced amino acid sequences with similar sequences from the NCBI database allowed the identification of several conserved domains. The alignment and resulting phenetic tree showed that many of the sequences had greater similarity to sequences from other species than to one another. The use of degenerate primers is a useful method for isolating novel sugarcane RGA and kinase gene analogues. Further studies are needed to evaluate the role of these genes in disease resistance.

Characterization of the Structural Gene Promoter of Aedes aegypti Densovirus

PubMed Central

Ward, Todd W.; Kimmick, Michael W.; Afanasiev, Boris N.; Carlson, Jonathan O.

2001-01-01

Aedes aegypti densonucleosis virus (AeDNV) has two promoters that have been shown to be active by reporter gene expression analysis (B. N. Afanasiev, Y. V. Koslov, J. O. Carlson, and B. J. Beaty, Exp. Parasitol. 79:322–339, 1994). Northern blot analysis of cells infected with AeDNV revealed two transcripts 1,200 and 3,500 nucleotides in length that are assumed to express the structural protein (VP) gene and nonstructural protein genes, respectively. Primer extension was used to map the transcriptional start site of the structural protein gene. Surprisingly, the structural protein gene transcript began at an initiator consensus sequence, CAGT, 60 nucleotides upstream from the map unit 61 TATAA sequence previously thought to define the promoter. Constructs with the β-galactosidase gene fused to the structural protein gene were used to determine elements necessary for promoter function. Deletion or mutation of the initiator sequence, CAGT, reduced protein expression by 93%, whereas mutation of the TATAA sequence at map unit 61 had little effect. An additional open reading frame was observed upstream of the structural protein gene that can express β-galactosidase at a low level (20% of that of VP fusions). Expression of the AeDNV structural protein gene was shown to be stimulated by the major nonstructural protein NS1 (Afanasiev et al., Exp. parasitol., 1994). To determine the sequences required for transactivation, expression of structural protein gene–β-galactosidase gene fusion constructs differing in AeDNV genome content was measured with and without NS1. The presence of NS1 led to an 8- to 10-fold increase in expression when either genomic end was present, compared to a 2-fold increase with a construct lacking the genomic ends. An even higher (37-fold) increase in expression occurred with both genomic ends present; however, this was in part due to template replication as shown by Southern blot analysis. These data indicate the location and importance of various elements necessary for efficient protein expression and transactivation from the structural protein gene promoter of AeDNV. PMID:11152505

Building a stable RNA U-turn with a protonated cytidine

PubMed Central

Gottstein-Schmidtke, Sina R.; Duchardt-Ferner, Elke; Groher, Florian; Weigand, Julia E.; Gottstein, Daniel; Suess, Beatrix; Wöhnert, Jens

2014-01-01

The U-turn is a classical three-dimensional RNA folding motif first identified in the anticodon and T-loops of tRNAs. It also occurs frequently as a building block in other functional RNA structures in many different sequence and structural contexts. U-turns induce sharp changes in the direction of the RNA backbone and often conform to the 3-nt consensus sequence 5′-UNR-3′ (N = any nucleotide, R = purine). The canonical U-turn motif is stabilized by a hydrogen bond between the N3 imino group of the U residue and the 3′ phosphate group of the R residue as well as a hydrogen bond between the 2′-hydroxyl group of the uridine and the N7 nitrogen of the R residue. Here, we demonstrate that a protonated cytidine can functionally and structurally replace the uridine at the first position of the canonical U-turn motif in the apical loop of the neomycin riboswitch. Using NMR spectroscopy, we directly show that the N3 imino group of the protonated cytidine forms a hydrogen bond with the backbone phosphate 3′ from the third nucleotide of the U-turn analogously to the imino group of the uridine in the canonical motif. In addition, we compare the stability of the hydrogen bonds in the mutant U-turn motif to the wild type and describe the NMR signature of the C+-phosphate interaction. Our results have implications for the prediction of RNA structural motifs and suggest simple approaches for the experimental identification of hydrogen bonds between protonated C-imino groups and the phosphate backbone. PMID:24951555

Predicted stem-loop structures and variation in nucleotide sequence of 3' noncoding regions among animal calicivirus genomes.

PubMed

Seal, B S; Neill, J D; Ridpath, J F

1994-07-01

Caliciviruses are nonenveloped with a polyadenylated genome of approximately 7.6 kb and a single capsid protein. The "RNA Fold" computer program was used to analyze 3'-terminal noncoding sequences of five feline calicivirus (FCV), rabbit hemorrhagic disease virus (RHDV), and two San Miguel sea lion virus (SMSV) isolates. The FCV 3'-terminal sequences are 40-46 nucleotides in length and 72-91% similar. The FCV sequences were predicted to contain two possible duplex structures and one stem-loop structure with free energies of -2.1 to -18.2 kcal/mole. The RHDV genomic 3'-terminal RNA sequences are 54 nucleotides in length and share 49% sequence similarity to homologous regions of the FCV genome. The RHDV sequence was predicted to form two duplex structures in the 3'-terminal noncoding region with a single stem-loop structure, resembling that of FCV. In contrast, the SMSV 1 and 4 genomic 3'-terminal noncoding sequences were 185 and 182 nucleotides in length, respectively. Ten possible duplex structures were predicted with an average structural free energy of -35 kcal/mole. Sequence similarity between the two SMSV isolates was 75%. Furthermore, extensive cloverleaflike structures are predicted in the 3' noncoding region of the SMSV genome, in contrast to the predicted single stem-loop structures of FCV or RHDV.

Terminal Duplex Stability and Nucleotide Identity Differentially Control siRNA Loading and Activity in RNA Interference

PubMed Central

Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi

2016-01-01

Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870

Correlation approach to identify coding regions in DNA sequences

NASA Technical Reports Server (NTRS)

Ossadnik, S. M.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.

1994-01-01

Recently, it was observed that noncoding regions of DNA sequences possess long-range power-law correlations, whereas coding regions typically display only short-range correlations. We develop an algorithm based on this finding that enables investigators to perform a statistical analysis on long DNA sequences to locate possible coding regions. The algorithm is particularly successful in predicting the location of lengthy coding regions. For example, for the complete genome of yeast chromosome III (315,344 nucleotides), at least 82% of the predictions correspond to putative coding regions; the algorithm correctly identified all coding regions larger than 3000 nucleotides, 92% of coding regions between 2000 and 3000 nucleotides long, and 79% of coding regions between 1000 and 2000 nucleotides. The predictive ability of this new algorithm supports the claim that there is a fundamental difference in the correlation property between coding and noncoding sequences. This algorithm, which is not species-dependent, can be implemented with other techniques for rapidly and accurately locating relatively long coding regions in genomic sequences.

Porcine insulin receptor substrate 4 (IRS4) gene: cloning, polymorphism and association study

USDA-ARS?s Scientific Manuscript database

Using PCR and IPCR techniques we obtained a 4498 bp nucleotide sequence FN424076 encompassing the complete coding sequence of the porcine IRS4 gene and its proximal promoter. The 1269-amino acid porcine protein deduced from the nucleotide sequence shares 92% identity with the human IRS4 and possesse...

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

PubMed Central

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

Regions of conservation and divergence in the 3' untranslated sequences of genomic RNA from Ross River virus isolates.

PubMed

Faragher, S G; Dalgarno, L

1986-07-20

The 3' untranslated (UT) sequences of the genomic RNAs of five geographic variants of the alphavirus Ross River virus (RRV) were determined and compared with the 3' UT sequence of RRV T48, the prototype strain. Part of the 3' UT region of Getah virus, a close serological relative of RRV, was also sequenced. The RRV 3' UT region varies markedly in length between variants. Large deletions or insertions, sequence rearrangements and single nucleotide substitutions are observed. A sequence tract of 49 to 58 nucleotides, which is repeated as four blocks in the RRV T48 3' UT region, occurs only once in the 3' UT region of one RRV strain (NB5092), indicating that the existence of repeat sequence blocks is not essential for RRV replication. However, the precise sequence of the 3' proximal copy of the repeat block and its position relative to the poly(A) tail were identical in all RRV isolates examined, suggesting that it has an important role in RRV replication. Nucleotide substitutions between RRV variants are distributed non-randomly along the length of the 3' UT region. The sequence of 120 to 130 nucleotides adjacent to the poly(A) tail is strongly conserved. Getah virus RNA contains three repeat sequence blocks in the 3' UT region. These are similar in sequence to those in RRV RNA but differ in their arrangement. Homology between the RRV and Getah 3' UT sequences is greatest in the 3' proximal repeat sequence block that shows three differences in 49 nucleotides. The 3' proximal repeat in Getah RNA occurs at the same position, relative to the poly(A) tail, as in all RRV variants. The RRV and Getah virus 3' UT sequences show extensive homology in the region between the 3' proximal repeat and the poly(A) tail but, apart from the repeat blocks themselves, they show no significant homology elsewhere.

Structural and genetic analysis of a mutant of Rhodobacter sphaeroides WS8 deficient in hook length control.

PubMed Central

González-Pedrajo, B; Ballado, T; Campos, A; Sockett, R E; Camarena, L; Dreyfus, G

1997-01-01

Motility in the photosynthetic bacterium Rhodobacter sphaeroides is achieved by the unidirectional rotation of a single subpolar flagellum. In this study, transposon mutagenesis was used to obtain nonmotile flagellar mutants from this bacterium. We report here the isolation and characterization of a mutant that shows a polyhook phenotype. Morphological characterization of the mutant was done by electron microscopy. Polyhooks were obtained by shearing and were used to purify the hook protein monomer (FlgE). The apparent molecular mass of the hook protein was 50 kDa. N-terminal amino acid sequencing and comparisons with the hook proteins of other flagellated bacteria indicated that the Rhodobacter hook protein has consensus sequences common to axial flagellar components. A 25-kb fragment from an R. sphaeroides WS8 cosmid library restored wild-type flagellation and motility to the mutant. Using DNA adjacent to the inserted transposon as a probe, we identified a 4.6-kb SalI restriction fragment that contained the gene responsible for the polyhook phenotype. Nucleotide sequence analysis of this region revealed an open reading frame with a deduced amino acid sequence that was 23.4% identical to that of FliK of Salmonella typhimurium, the polypeptide responsible for hook length control in that enteric bacterium. The relevance of a gene homologous to fliK in the uniflagellated bacterium R. sphaeroides is discussed. PMID:9352903

Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prody, C.A.; Zevin-Sonkin, D.; Gnatt, A.

1987-06-01

To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase and Torpedo electric organ true acetylcholinesterase. Using these probes, the authors isolated several cDNA clones from lambdagt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. Inmore » RNA blots of poly(A)/sup +/ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These finding demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species.« less

VCGDB: a dynamic genome database of the Chinese population

PubMed Central

2014-01-01

Background The data released by the 1000 Genomes Project contain an increasing number of genome sequences from different nations and populations with a large number of genetic variations. As a result, the focus of human genome studies is changing from single and static to complex and dynamic. The currently available human reference genome (GRCh37) is based on sequencing data from 13 anonymous Caucasian volunteers, which might limit the scope of genomics, transcriptomics, epigenetics, and genome wide association studies. Description We used the massive amount of sequencing data published by the 1000 Genomes Project Consortium to construct the Virtual Chinese Genome Database (VCGDB), a dynamic genome database of the Chinese population based on the whole genome sequencing data of 194 individuals. VCGDB provides dynamic genomic information, which contains 35 million single nucleotide variations (SNVs), 0.5 million insertions/deletions (indels), and 29 million rare variations, together with genomic annotation information. VCGDB also provides a highly interactive user-friendly virtual Chinese genome browser (VCGBrowser) with functions like seamless zooming and real-time searching. In addition, we have established three population-specific consensus Chinese reference genomes that are compatible with mainstream alignment software. Conclusions VCGDB offers a feasible strategy for processing big data to keep pace with the biological data explosion by providing a robust resource for genomics studies; in particular, studies aimed at finding regions of the genome associated with diseases. PMID:24708222

Update on Pneumocystis carinii f. sp. hominis Typing Based on Nucleotide Sequence Variations in Internal Transcribed Spacer Regions of rRNA Genes

PubMed Central

Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.

1998-01-01

Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304

Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

PubMed

He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

2015-01-01

Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

Complete genomic sequence of Powassan virus: evaluation of genetic elements in tick-borne versus mosquito-borne flaviviruses.

PubMed

Mandl, C W; Holzmann, H; Kunz, C; Heinz, F X

1993-05-01

The complete nucleotide sequence of the positive-stranded RNA genome of the tick-borne flavivirus Powassan (10,839 nucleotides) was elucidated and the amino acid sequence of all viral proteins was derived. Based on this sequence as well as serological data, Powassan virus represents the most divergent member of the tick-borne serocomplex within the genus flaviviruses, family Flaviviridae. The primary nucleotide sequence and potential RNA secondary structures of the Powassan virus genome as well as the protein sequences and the reactivities of the virion with a panel of monoclonal antibodies were compared to other tick-borne and mosquito-borne flaviviruses. These analyses corroborated significant differences between tick-borne and mosquito-borne flaviviruses, but also emphasized structural elements that are conserved among both vector groups. The comparisons among tick-borne flaviviruses revealed conserved sequence elements that might represent important determinants of the tick-borne flavivirus phenotype.

Detection of a divergent variant of grapevine virus F by next-generation sequencing.

PubMed

Molenaar, Nicholas; Burger, Johan T; Maree, Hans J

2015-08-01

The complete genome sequence of a South African isolate of grapevine virus F (GVF) is presented. It was first detected by metagenomic next-generation sequencing of field samples and validated through direct Sanger sequencing. The genome sequence of GVF isolate V5 consists of 7539 nucleotides and contains a poly(A) tail. It has a typical vitivirus genome arrangement that comprises five open reading frames (ORFs), which share only 88.96 % nucleotide sequence identity with the existing complete GVF genome sequence (JX105428).

Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating sequences, and telomeres in Saccharomyces cerevisiae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buchman, A.R.; Kimmerly, W.J.; Rine, J.

1988-01-01

Two DNA-binding factors from Saccharomyces cerevisiae have been characterized, GRFI (general regulatory factor I) and ABFI (ARS-binding factor I), that recognize specific sequences within diverse genetic elements. GRFI bound to sequences at the negative regulatory elements (silencers) of the silent mating type loci HML E and HMR E and to the upstream activating sequence (UAS) required for transcription of the MAT ..cap alpha.. genes. A putative conserved UAS located at genes involved in translation (RPG box) was also recognized by GRFI. In addition, GRFI bound with high affinity to sequences within the (C/sub 1-3/A)-repeat region at yeast telomeres. Binding sitesmore » for GRFI with the highest affinity appeared to be of the form 5'-(A/G)(A/C)ACCCAN NCA(T/C)(T/C)-3', where N is any nucleotide. ABFI-binding sites were located next to autonomously replicating sequences (ARSs) at controlling elements of the silent mating type loci HMR E, HMR I, and HML I and were associated with ARS1, ARS2, and the 2..mu..m plasmid ARS. Two tandem ABFI binding sites were found between the HIS3 and DED1 genes, several kilobase pairs from any ARS, indicating that ABFI-binding sites are not restricted to ARSs. The sequences recognized by AFBI showed partial dyad-symmetry and appeared to be variations of the consensus 5'-TATCATTNNNNACGA-3'. GRFI and ABFI were both abundant DNA-binding factors and did not appear to be encoded by the SIR genes, whose product are required for repression of the silent mating type loci. Together, these results indicate that both GRFI and ABFI play multiple roles within the cell.« less

Generation and Characterization of HIV-1 Transmitted and Founder Virus Consensus Sequence from Intravenous Drug Users in Xinjiang, China.

PubMed

Li, Fan; Ma, Liying; Feng, Yi; Hu, Jing; Ni, Na; Ruan, Yuhua; Shao, Yiming

2017-06-01

HIV-1 transmission in intravenous drug users (IDUs) has been characterized by high genetic multiplicity and suggests a greater challenge for HIV-1 infection blocking. We investigated a total of 749 sequences of full-length gp160 gene obtained by single genome sequencing (SGS) from 22 HIV-1 early infected IDUs in Xinjiang province, northwest China, and generated a transmitted and founder virus (T/F virus) consensus sequence (IDU.CON). The T/F virus was classified as subtype CRF07_BC and predicted to be CCR5-tropic virus. The variable region (V1, V2, and V4 loop) of IDU.CON showed length variation compared with the heterosexual T/F virus consensus sequence (HSX.CON) and homosexual T/F virus consensus sequence (MSM.CON). A total of 26 N-linked glycosylation sites were discovered in the IDU.CON sequence, which is less than that of MSM.CON and HSX.CON. Characterization of T/F virus from IDUs highlights the genetic make-up and complexity of virus near the moment of transmission or in early infection preceding systemic dissemination and is important toward the development of an effective HIV-1 preventive methods, including vaccines.

Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.

Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

DOE PAGES

Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.; ...

2014-01-01

Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lo, A.; Yang, H.L.

1990-02-13

This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

Whole exome sequencing to estimate alloreactivity potential between donors and recipients in stem cell transplantation

PubMed Central

Sampson, Juliana K.; Sheth, Nihar U.; Koparde, Vishal N.; Scalora, Allison F.; Serrano, Myrna G.; Lee, Vladimir; Roberts, Catherine H.; Jameson-Lee, Max; Ferreira-Gonzalez, Andrea; Manjili, Masoud H.; Buck, Gregory A.; Neale, Michael C.; Toor, Amir A.

2016-01-01

Summary Whole exome sequencing (WES) was performed on stem cell transplant donor-recipient (D-R) pairs to determine the extent of potential antigenic variation at a molecular level. In a small cohort of D-R pairs, a high frequency of sequence variation was observed between the donor and recipient exomes independent of human leucocyte antigen (HLA) matching. Nonsynonymous, nonconservative single nucleotide polymorphisms were approximately twice as frequent in HLA-matched unrelated, compared with related D-R pairs. When mapped to individual chromosomes, these polymorphic nucleotides were uniformly distributed across the entire exome. In conclusion, WES reveals extensive nucleotide sequence variation in the exomes of HLA-matched donors and recipients. PMID:24749631

The nucleotide sequences of 5S rRNAs from a fern Dryopteris acuminata and a horsetail Equisetum arvense.

PubMed Central

Hori, H; Osawa, S; Takaiwa, F; Sugiura, M

1984-01-01

The nucleotide sequences from two Pteridophyta species, a fern Dryopteris acuminata and a horsetail Equisetum arvense have been determined. These two sequences are more related to those of the Bryophyta species (88% identity on average) than to those of seed plants (84% identity on average). PMID:6538332

Energy efficiency trade-offs drive nucleotide usage in transcribed regions

PubMed Central

Chen, Wei-Hua; Lu, Guanting; Bork, Peer; Hu, Songnian; Lercher, Martin J.

2016-01-01

Efficient nutrient usage is a trait under universal selection. A substantial part of cellular resources is spent on making nucleotides. We thus expect preferential use of cheaper nucleotides especially in transcribed sequences, which are often amplified thousand-fold compared with genomic sequences. To test this hypothesis, we derive a mutation-selection-drift equilibrium model for nucleotide skews (strand-specific usage of ‘A' versus ‘T' and ‘G' versus ‘C'), which explains nucleotide skews across 1,550 prokaryotic genomes as a consequence of selection on efficient resource usage. Transcription-related selection generally favours the cheaper nucleotides ‘U' and ‘C' at synonymous sites. However, the information encoded in mRNA is further amplified through translation. Due to unexpected trade-offs in the codon table, cheaper nucleotides encode on average energetically more expensive amino acids. These trade-offs apply to both strand-specific nucleotide usage and GC content, causing a universal bias towards the more expensive nucleotides ‘A' and ‘G' at non-synonymous coding sites. PMID:27098217

Detection of possible restriction sites for type II restriction enzymes in DNA sequences.

PubMed

Gagniuc, P; Cimponeriu, D; Ionescu-Tîrgovişte, C; Mihai, Andrada; Stavarachi, Monica; Mihai, T; Gavrilă, L

2011-01-01

In order to make a step forward in the knowledge of the mechanism operating in complex polygenic disorders such as diabetes and obesity, this paper proposes a new algorithm (PRSD -possible restriction site detection) and its implementation in Applied Genetics software. This software can be used for in silico detection of potential (hidden) recognition sites for endonucleases and for nucleotide repeats identification. The recognition sites for endonucleases may result from hidden sequences through deletion or insertion of a specific number of nucleotides. Tests were conducted on DNA sequences downloaded from NCBI servers using specific recognition sites for common type II restriction enzymes introduced in the software database (n = 126). Each possible recognition site indicated by the PRSD algorithm implemented in Applied Genetics was checked and confirmed by NEBcutter V2.0 and Webcutter 2.0 software. In the sequence NG_008724.1 (which includes 63632 nucleotides) we found a high number of potential restriction sites for ECO R1 that may be produced by deletion (n = 43 sites) or insertion (n = 591 sites) of one nucleotide. The second module of Applied Genetics has been designed to find simple repeats sizes with a real future in understanding the role of SNPs (Single Nucleotide Polymorphisms) in the pathogenesis of the complex metabolic disorders. We have tested the presence of simple repetitive sequences in five DNA sequence. The software indicated exact position of each repeats detected in the tested sequences. Future development of Applied Genetics can provide an alternative for powerful tools used to search for restriction sites or repetitive sequences or to improve genotyping methods.

Information Entropy of Influenza A Segment 7

NASA Astrophysics Data System (ADS)

Thompson, William A.; Fan, Shaohua; Weltman, Joel K.

2008-12-01

Information entropy (H) is a measure of uncertainty at each position within in a sequence of nucleotides.H was used to characterize a set of influenza A segment 7 nucleotide sequences. Nucleotide locations of high entropy were identified near the 5’ start of all of the sequences and the sequences were assigned to subsets according to synonymous nucleotide variants at those positions: either uracil at position six (U6), cytosine at position six (C6), adenine (A12) at position 12, guanine at position 12 (G12), adenine at position 15 (A15) or cytosine (C15) at position 15. H values were found to be correlated/corresponding (Kendall tau) along the lengths of the nucleotide segments of the subset pairs at each position. However, the H values of each subset of sequences were statistically distinguishable from those of the other member of the pair (Kolmogorov-Smirnov test). The joint probability of uncorrelated distributions of U6 and C6 sequences to viral subtypes and to viral host species was 34 times greater than for the A12:G12 subset pair and 214 times greater than for the A15:C15 pair. This result indicates that the high entropy position six of segment 7 is either a reporter or a sentinel location. The fact that not one of the H5N1 sequences in the dataset was a member of the C6 subset, but all 125 H5N1 sequences are members of the U6 subset suggests a non-random sentinel function.

Genetic heterogeneity of L-Zagreb mumps virus vaccine strain

PubMed Central

Kosutic-Gulija, Tanja; Forcic, Dubravko; Šantak, Maja; Ramljak, Ana; Mateljak-Lukacevic, Sanja; Mazuran, Renata

2008-01-01

Background The most often used mumps vaccine strains Jeryl Lynn (JL), RIT4385, Urabe-AM9, L-Zagreb and L-3 differ in immunogenicity and reactogenicity. Previous analyses showed that JL, Urabe-AM9 and L-3 are genetically heterogeneous. Results We identified the heterogeneity of L-Zagreb throughout the entire genome. Two major variants were defined: variant A being identical to the consensus sequence of viral seeds and vaccine(s) and variant B which differs from variant A in three nucleotide positions. The difference between viral variants in L-Zagreb strain is insufficient for distinct viral strains to be defined. We demonstrated that proportion of variants in L-Zagreb viral population depends on cell substrate used for viral replication in vitro and in vivo. Conclusion L-Zagreb strain should be considered as a single strain composed of at least two variant viral genomes. PMID:18616793

Influence of codon usage bias on FGLamide-allatostatin mRNA secondary structure.

PubMed

Martínez-Pérez, Francisco; Bendena, William G; Chang, Belinda S W; Tobe, Stephen S

2011-03-01

The FGLamide allatostatins (ASTs) are invertebrate neuropeptides which inhibit juvenile hormone biosynthesis in Dictyoptera and related orders. They also show myomodulatory activity. FGLamide AST nucleotide frequencies and codon bias were investigated with respect to possible effects on mRNA secondary structure. 367 putative FGLamide ASTs and their potential endoproteolytic cleavage sites were identified from 40 species of crustaceans, chelicerates and insects. Among these, 55% comprised only 11 amino acids. An FGLamide AST consensus was identified to be (X)(1→16)Y(S/A/N/G)FGLGKR, with a strong bias for the codons UUU encoding for Phe and AAA for Lys, which can form strong Watson-Crick pairing in all peptides analyzed. The physical distance between these codons favor a loop structure from Ser/Ala-Phe to Lys-Arg. Other loop and hairpin loops were also inferred from the codon frequencies in the N-terminal motif, and the first amino acids from the C-terminal motif, or the dibasic potential endoproteolytic cleavage site. Our results indicate that nucleotide frequencies and codon usage bias in FGLamide ASTs tend to favor mRNA folds in the codon sequence in the C-terminal active peptide core and at the dibasic potential endoproteolytic cleavage site. Copyright © 2010 Elsevier Inc. All rights reserved.

Phylogeny of marattioid ferns (Marattiaceae): inferring a root in the absence of a closely related outgroup.

PubMed

Murdock, Andrew G

2008-05-01

Closely related outgroups are optimal for rooting phylogenetic trees; however, such ideal outgroups are not always available. A phylogeny of the marattioid ferns (Marattiaceae), an ancient lineage with no close relatives, was reconstructed using nucleotide sequences of multiple chloroplast regions (rps4 + rps4-trnS spacer, trnS-trnG spacer + trnG intron, rbcL, atpB), from 88 collections, selected to cover the broadest possible range of morphologies and geographic distributions within the extant taxa. Because marattioid ferns are phylogenetically isolated from other lineages, and internal branches are relatively short, rooting was problematic. Root placement was strongly affected by long-branch attraction under maximum parsimony and by model choice under maximum likelihood. A multifaceted approach to rooting was employed to isolate the sources of bias and produce a consensus root position. In a statistical comparison of all possible root positions with three different outgroups, most root positions were not significantly less optimal than the maximum likelihood root position, including the consensus root position. This phylogeny has several important taxonomic implications for marattioid ferns: Marattia in the broad sense is paraphyletic; the Hawaiian endemic Marattia douglasii is most closely related to tropical American taxa; and Angiopteris is monophyletic only if Archangiopteris and Macroglossum are included.

Construction of an ultra-high density consensus genetic map, and enhancement of the physical map from genome sequencing in Lupinus angustifolius.

PubMed

Zhou, Gaofeng; Jian, Jianbo; Wang, Penghao; Li, Chengdao; Tao, Ye; Li, Xuan; Renshaw, Daniel; Clements, Jonathan; Sweetingham, Mark; Yang, Huaan

2018-01-01

An ultra-high density genetic map containing 34,574 sequence-defined markers was developed in Lupinus angustifolius. Markers closely linked to nine genes of agronomic traits were identified. A physical map was improved to cover 560.5 Mb genome sequence. Lupin (Lupinus angustifolius L.) is a recently domesticated legume grain crop. In this study, we applied the restriction-site associated DNA sequencing (RADseq) method to genotype an F 9 recombinant inbred line population derived from a wild type × domesticated cultivar (W × D) cross. A high density linkage map was developed based on the W × D population. By integrating sequence-defined DNA markers reported in previous mapping studies, we established an ultra-high density consensus genetic map, which contains 34,574 markers consisting of 3508 loci covering 2399 cM on 20 linkage groups. The largest gap in the entire consensus map was 4.73 cM. The high density W × D map and the consensus map were used to develop an improved physical map, which covered 560.5 Mb of genome sequence data. The ultra-high density consensus linkage map, the improved physical map and the markers linked to genes of breeding interest reported in this study provide a common tool for genome sequence assembly, structural genomics, comparative genomics, functional genomics, QTL mapping, and molecular plant breeding in lupin.

PUTATIVE GENE PROMOTER SEQUENCES IN THE CHLORELLA VIRUSES

PubMed Central

Fitzgerald, Lisa A.; Boucher, Philip T.; Yanai-Balser, Giane; Suhre, Karsten; Graves, Michael V.; Van Etten, James L.

2008-01-01

Three short (7 to 9 nucleotides) highly conserved nucleotide sequences were identified in the putative promoter regions (150 bp upstream and 50 bp downstream of the ATG translation start site) of three members of the genus Chlorovirus, family Phycodnaviridae. Most of these sequences occurred in similar locations within the defined promoter regions. The sequence and location of the motifs were often conserved among homologous ORFs within the Chlorovirus family. One of these conserved sequences (AATGACA) is predominately associated with genes expressed early in virus replication. PMID:18768195

The complete sequence of Cymbidium mosaic virus from Vanilla fragrans in Hainan, China.

PubMed

He, Zhen; Jiang, Dongmei; Liu, Aiqin; Sang, Liwei; Li, Wenfeng; Li, Shifang

2011-06-01

The complete nucleotide sequence of Cymbidium mosaic virus (CymMV) isolated from vanilla in Hainan province, China was determined for the first time. It comprised 6,224 nucleotides; sequence analysis suggested that the isolate we obtained was a member of the genus Potexvirus, and its sequence shared 86.67-96.61% identities with previously reported sequences. Phylogenetic analysis suggested that CymMV from vanilla fragrans was clustered into subgroup A and the isolates in this subgroup displayed little regional difference.

Human papillomavirus type 18 variant lineages in United States populations characterized by sequence analysis of LCR-E6, E2, and L1 regions.

PubMed

Arias-Pulido, Hugo; Peyton, Cheri L; Torrez-Martínez, Norah; Anderson, D Nelson; Wheeler, Cosette M

2005-07-20

While HPV 16 variant lineages have been well characterized, the knowledge about HPV 18 variants is limited. In this study, HPV 18 nucleotide variations in the E2 hinge region were characterized by sequence analysis in 47 control and 51 tumor specimens. Fifty of these specimens were randomly selected for sequencing of an LCR-E6 segment and 20 samples representative of LCR-E6 and E2 sequence variants were examined across the L1 region. A total of 2770 nucleotides per HPV 18 variant genome were considered in this study. HPV 18 variant nucleotides were linked among all gene segments analyzed and grouped into three main branches: Asian-American (AA), European (E), and African (Af). These three branches were equally distributed among controls and cases and when stratified by Hispanic and non-Hispanic ethnicities. Among invasive cervical cancer cases, no significant differences in the three HPV variant branches were observed among ethnic groups or when stratified by histopathology (squamous vs. adenocarcinoma). The Af branch showed the greatest nucleotide variability when compared to the HPV 18 reference sequence and was more closely related to HPV 45 than either AA or E branches. Our data also characterize nucleotide and amino acid variations in the L1 capsid gene among HPV 18 variants, which may be relevant to vaccine strategies and subsequent studies of naturally occurring HPV 18 variants. Several novel HPV 18 nucleotide variations were identified in this study.

The repeating nucleotide sequence in the repetitive mitochondrial DNA from a "low-density" petite mutant of yeast.

PubMed Central

Van Kreijl, C F; Bos, J L

1977-01-01

The repeating nucleotide sequence of 68 base pairs in the mtDNA from an ethidium-induced cytoplasmic petite mutant of yeast has been determined. For sequence analysis specifically primed and terminated RNA copies, obtained by in vitro transcription of the separated strands, were use. The sequence consists of 66 consecutive AT base pairs flanked by two GC pairs and comprises nearly all of the mutant mitochondrial genome. The sequence, moreover, also represents the first part of wild-type mtDNA sequence so far. Images PMID:198740

Phenomenological Partial Specific Volumes for G-Quadruplex DNAs

PubMed Central

Hellman, Lance M.; Rodgers, David W.; Fried, Michael G.

2009-01-01

Accurate partial specific volume (ν̄) values are required for sedimentation velocity and sedimentation equilibrium analyses. For nucleic acids, the estimation of these values is complicated by the fact that ν̄ depends on base composition, secondary structure, solvation and the concentrations and identities of ions in the surrounding buffer. Here we describe sedimentation equilibrium measurements of the apparent isopotential partial specific volume φ′ for two G-quadruplex DNAs and a single-stranded DNA of similar molecular weight and base composition. The G-quadruplex DNAs are a 22 nucleotide fragment of the human telomere consensus sequence and a 27 nucleotide fragment from the human c-myc promoter. The single-stranded DNA is 26 nucleotides long and is designed to have low propensity to form secondary structures. Parallel measurements were made in buffers containing NaCl and in buffers containing KCl, spanning the range 0.09M ≤ [salt] ≤ 2.3M. Limiting values of φ′, extrapolated to [salt] = 0M, were: 22-mer (NaCl-form), 0.525 ± 0.004 mL/g; 22-mer (KCl-form), 0.531 ± 0.006 mL/g; 27-mer (NaCl-form), 0.548 ± 0.005 mL/g; 27-mer (KCl-form), 0.557 ± 0.006 mL/g; 26-mer (NaCl-form), 0.555 ± 0.004 mL/g; 26-mer (KCl-form), 0.564 ± 0.006 mL/g. Small changes in φ′ with [salt] suggest that large changes in counterion association or hydration are unlikely to take place over these concentration ranges. PMID:19238377

Use of a molecular approach for the definitive diagnosis of proliferative larval mesocestoidiasis in a cat.

PubMed

Jabbar, Abdul; Papini, Roberto; Ferrini, Nadia; Gasser, Robin B

2012-10-01

A 9 year-old male, neutered cat with a history of a sudden onset of lethargy, anorexia and respiratory distress was presented in a veterinary practice in Lucca, Italy. A clinical examination revealed that the cat was severely dehydrated, and had pale mucous membranes and tachypnoea. No pain or discomfort was detected at the time of physical examination. The cat was administered fluids, antibiotics and supportive therapy, but died overnight. The owner of the cat requested for a post mortem examination to be conducted. At necropsy, acephalic structures, consistent with proliferative tapeworm (cestode) larvae, were detected in the thoracic cavity on pleural surfaces. As these larvae could not be identified to genus or species by microscopy, a PCR-based sequencing-phylogenetic approach was used. Part of the cytochrome c oxidase subunit 1 gene was PCR-amplified from genomic DNAs from five individual larvae and sequenced; all five sequences obtained were identical. This consensus sequence was aligned (over 355 nucleotide positions) with homologous sequences representing a range of cestodes (including Echinococcus granulosus, Echinococcus multilocularis, Hymenolepis microstoma, Mesocestoides spp. and Taenia saginata) from previously published studies and then subjected to phylogenetic analysis. The sequence representing the larval cestode from the affected cat grouped, with strong statistical support, with those representing Mesocestoides corti and Mesocestoides lineatus. Therefore, a definitive diagnosis of pleural proliferative larval mesocestoidiasis could be made. This study illustrates the value of using molecular tools to directly assist clinical and pathological investigations of cestodiases of animals. Copyright © 2012 Elsevier B.V. All rights reserved.

37 CFR 1.824 - Form and format for nucleotide and/or amino acid sequence submissions in computer readable form.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Form and format for... And/or Amino Acid Sequences § 1.824 Form and format for nucleotide and/or amino acid sequence... Code for Information Interchange (ASCII) text. No other formats shall be allowed. (3) The computer...

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

PubMed Central

Hori, H; Osawa, S; Iwabuchi, M

1980-01-01

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421

A nucleotide sequence comparison of coxsackievirus B4 isolates from aquatic samples and clinical specimens.

PubMed Central

Hughes, M. S.; Hoey, E. M.; Coyle, P. V.

1993-01-01

Ten coxsackievirus B4 (CVB4) strains isolated from clinical and environmental sources in Northern Ireland in 1985-7, were compared at the nucleotide sequence level. Dideoxynucleotide sequencing of a polymerase chain reaction (PCR) amplified fragment, spanning the VP1/P2A genomic region, classified the isolates into two distinct groups or genotypes as defined by Rico-Hesse and colleagues for poliovirus type 1. Isolates within each group shared approximately 99% sequence identity at the nucleotide level whereas < or = 86% sequence identity was shared between groups. One isolate derived from a clinical specimen in 1987 was grouped with six CVB4 isolates recovered from the aquatic environment in 1986-7. The second group comprised CVB4 isolates from clinical specimens in 1985-6. Both groups were different at the nucleotide level from the prototype strain isolated in 1950. It was concluded that the method could be used to sub-type CVB4 isolates and would be of value in epidemiological studies of CVB4. Predicted amino acid sequences revealed non-conservation of the tyrosine residue at the VP1/P2A cleavage site but were of little value in distinguishing CVB4 variants. PMID:8386098

The complete nucleotide sequence of RNA beta from the type strain of barley stripe mosaic virus.

PubMed Central

Gustafson, G; Armour, S L

1986-01-01

The complete nucleotide sequence of RNA beta from the type strain of barley stripe mosaic virus (BSMV) has been determined. The sequence is 3289 nucleotides in length and contains four open reading frames (ORFs) which code for proteins of Mr 22,147 (ORF1), Mr 58,098 (ORF2), Mr 17,378 (ORF3), and Mr 14,119 (ORF4). The predicted N-terminal amino acid sequence of the polypeptide encoded by the ORF nearest the 5'-end of the RNA (ORF1) is identical (after the initiator methionine) to the published N-terminal amino acid sequence of BSMV coat protein for 29 of the first 30 amino acids. ORF2 occupies the central portion of the coding region of RNA beta and ORF3 is located at the 3'-end. The ORF4 sequence overlaps the 3'-region of ORF2 and the 5'-region of ORF3 and differs in codon usage from the other three RNA beta ORFs. The coding region of RNA beta is followed by a poly(A) tract and a 238 nucleotide tRNA-like structure which are common to all three BSMV genomic RNAs. Images PMID:3754962

Control of total GFP expression by alterations to the 3′ region nucleotide sequence

PubMed Central

2013-01-01

Background Previously, we distinguished the Escherichia coli type II cytoplasmic membrane translocation pathways of Tat, Yid, and Sec for unfolded and folded soluble target proteins. The translocation of folded protein to the periplasm for soluble expression via the Tat pathway was controlled by an N-terminal hydrophilic leader sequence. In this study, we investigated the effect of the hydrophilic C-terminal end and its nucleotide sequence on total and soluble protein expression. Results The native hydrophilic C-terminal end of GFP was obtained by deleting the C-terminal peptide LeuGlu-6×His, derived from pET22b(+). The corresponding clones induced total and soluble GFP expression that was either slightly increased or dramatically reduced, apparently through reconstruction of the nucleotide sequence around the stop codon in the 3′ region. In the expression-induced clones, the hydrophilic C-terminus showed increased Tat pathway specificity for soluble expression. However, in the expression-reduced clone, after analyzing the role of the 5′ poly(A) coding sequence with a substituted synonymous codon, we proved that the longer 5′ poly(A) coding sequence interacted with the reconstructed 3′ region nucleotide sequence to create a new mRNA tertiary structure between the 5′ and 3′ regions, which resulted in reduced total GFP expression. Further, to recover the reduced expression by changing the 3′ nucleotide sequence, after replacing selected C-terminal 5′ codons and the stop codon in the ORF with synonymous codons, total GFP expression in most of the clones was recovered to the undeleted control level. The insertion of trinucleotides after the stop codon in the 3′-UTR recovered or reduced total GFP expression. RT-PCR revealed that the level of total protein expression was controlled by changes in translational or transcriptional regulation, which were induced or reduced by the substitution or insertion of 3′ region nucleotides. Conclusions We found that the hydrophilic C-terminal end of GFP increased Tat pathway specificity and that the 3′ nucleotide sequence played an important role in total protein expression through translational and transcriptional regulation. These findings may be useful for efficiently producing recombinant proteins as well as for potentially controlling the expression level of specific genes in the body for therapeutic purposes. PMID:23834827

Molecular characterization of the vitamin D receptor (VDR) gene in Holstein cows.

PubMed

Ali, Mayar O; El-Adl, Mohamed A; Ibrahim, Hussam M M; Elseedy, Youssef Y; Rizk, Mohamed A; El-Khodery, Sabry A

2018-06-01

Vitamin D plays a vital role in calcium homeostasis, growth, and immunoregulation. Because little is known about the vitamin D receptor (VDR) gene in cattle, the aim of the present investigation was to present the molecular characterization of exons 5 and 6 of the VDR gene in Holstein cows. DNA extraction, genomic sequencing, phylogenetic analysis, synteny mapping and single nucleotide gene polymorphism analysis of the VDR gene were performed to assess blood samples collected from 50 clinically healthy Holstein cows. The results revealed the presence of a 450-base pair (bp) nucleotide sequence that resembled exons 5 and 6 with intron 5 enclosed between these exons. Sequence alignment and phylogenetic analysis revealed a close relationship between the sequenced VDR region and that found in Hereford cattle. A close association between this region and the corresponding region in small ruminants was also documented. Moreover, a single nucleotide polymorphism (SNP) that caused the replacement of a glutamate with an arginine in the deduced amino acid sequence was detected at position 7 of exon 5. In conclusion, Holstein and Hereford cattle differ with respect to exon 5 of the VDR gene. Phylogenetic analysis of the VDR gene based on nucleotide sequence produced different results from prior analyses based on amino acid sequence. Copyright © 2018 Elsevier Ltd. All rights reserved.

The CD8α gene in duck (Anatidae): cloning, characterization, and expression during viral infection.

PubMed

Xu, Qi; Chen, Yang; Zhao, Wen Ming; Huang, Zheng Yang; Duan, Xiu Jun; Tong, Yi Yu; Zhang, Yang; Li, Xiu; Chang, Guo Bin; Chen, Guo Hong

2015-02-01

Cluster of differentiation 8 alpha (CD8α) is critical for cell-mediated immune defense and T-cell development. Although CD8α sequences have been reported for several species, very little is known about CD8α in ducks. To elucidate the mechanisms involved in the innate and adaptive immune responses of ducks, we cloned CD8α coding sequences from domestic, Muscovy, Mallard, and Spotbill ducks using reverse transcription polymerase chain reaction (RT-PCR). Each sequence consisted of 714 nucleotides and encoded a signal peptide, an IgV-like domain, a stalk region, a transmembrane region, and a cytoplasmic tail. We identified 58 nucleotide differences and 37 amino acid differences among the four types of duck; of these, 53 nucleotide and 33 amino acid differences were between Muscovy ducks and the other duck species. The CD8α cDNA sequence from domestic duck consisted of a 61-nucleotide 5' untranslated region (UTR), a 714-nucleotide open reading frame, and an 849-nucleotide 3' UTR. Multiple sequence alignments showed that the amino acid sequence of CD8α is conserved in vertebrates. RT-PCR revealed that expression of CD8α mRNA of domestic ducks was highest in the thymus and very low in the kidney, cerebrum, cerebellum, and muscle. Immunohistochemical analyses detected CD8α on the splenic corpuscle and periarterial lymphatic sheath of the spleen. CD8α mRNA in domestic ducklings was initially up-regulated, and then down-regulated, in the thymus, spleen, and liver after treatment with duck hepatitis virus type I (DHV-1) or the immunostimulant polyriboinosinic polyribocytidylic acid (poly I:C).

Whole exome sequencing to estimate alloreactivity potential between donors and recipients in stem cell transplantation.

PubMed

Sampson, Juliana K; Sheth, Nihar U; Koparde, Vishal N; Scalora, Allison F; Serrano, Myrna G; Lee, Vladimir; Roberts, Catherine H; Jameson-Lee, Max; Ferreira-Gonzalez, Andrea; Manjili, Masoud H; Buck, Gregory A; Neale, Michael C; Toor, Amir A

2014-08-01

Whole exome sequencing (WES) was performed on stem cell transplant donor-recipient (D-R) pairs to determine the extent of potential antigenic variation at a molecular level. In a small cohort of D-R pairs, a high frequency of sequence variation was observed between the donor and recipient exomes independent of human leucocyte antigen (HLA) matching. Nonsynonymous, nonconservative single nucleotide polymorphisms were approximately twice as frequent in HLA-matched unrelated, compared with related D-R pairs. When mapped to individual chromosomes, these polymorphic nucleotides were uniformly distributed across the entire exome. In conclusion, WES reveals extensive nucleotide sequence variation in the exomes of HLA-matched donors and recipients. © 2014 John Wiley & Sons Ltd.

Common position of indels that cause deviations from canonical genome organization in different measles virus strains.

PubMed

Ivancic-Jelecki, Jelena; Slovic, Anamarija; Šantak, Maja; Tešović, Goran; Forcic, Dubravko

2016-07-29

The canonical genome organization of measles virus (MV) is characterized by total size of 15 894 nucleotides (nts) and defined length of every genomic region, both coding and non-coding. Only rarely have reports of strains possessing non-canonical genomic properties (possessing indels, with or without the change of total genome length) been published. The observed mutations are mutually compensatory in a sense that the total genome length remains polyhexameric. Although programmed and highly precise pseudo-templated nucleotide additions during transcription are inherent to polymerases of all viruses belonging to family Paramyxoviridae, a similar mechanism that would serve to non-randomly correct genome length, if an indel has occurred during replication, has so far not been described in the context of a complete virus genome. We compiled all complete MV genomic sequences (64 in total) available in open access sequence databases. Multiple sequence comparisons and phylogenetic analyses were performed with the aim of exploring whether non-recombinant and non-evolutionary linked measles strains that show deviations from canonical genome organization possess a common genetic characteristic. In 11 MV sequences we detected deviations from canonical genome organization due to short indels located within homopolymeric stretches or next to them. In nine out of 11 identified non-canonical MV sequences, a common feature was observed: one mutation, either an insertion or a deletion, was located in a 28 nts long region in F gene 5' untranslated region (positions 5051-5078 in genomic cDNA of canonical strains). This segment is composed of five tandemly linked homopolymeric stretches, its consensus sequence is G6-7C7-8A6-7G1-3C5-6. Although none of the mononucleotide repeats within this segment has fixed length, the total number of nts in canonical strains is always 28. These nine non-canonical strains, as well as the tenth (not mutated in 5051-5078 segment), can be grouped in three clusters, based on their passage histories/epidemiological data/genetic similarities. There are no indications that the 3 clusters are evolutionary linked, other than the fact that they all belong to clade D. A common narrow genomic region was found to be mutated in different, non-related, wild type strains suggesting that this region might have a function in non-random genome length corrections occurring during MV replication.

Molecular characterization of the virulent infectious hematopoietic necrosis virus (IHNV) strain 220-90

PubMed Central

2010-01-01

Background Infectious hematopoietic necrosis virus (IHNV) is the type species of the genus Novirhabdovirus, within the family Rhabdoviridae, infecting several species of wild and hatchery reared salmonids. Similar to other rhabdoviruses, IHNV has a linear single-stranded, negative-sense RNA genome of approximately 11,000 nucleotides. The IHNV genome encodes six genes; the nucleocapsid, phosphoprotein, matrix protein, glycoprotein, non-virion protein and polymerase protein genes, respectively. This study describes molecular characterization of the virulent IHNV strain 220-90, belonging to the M genogroup, and its phylogenetic relationships with available sequences of IHNV isolates worldwide. Results The complete genomic sequence of IHNV strain 220-90 was determined from the DNA of six overlapping clones obtained by RT-PCR amplification of genomic RNA. The complete genome sequence of 220-90 comprises 11,133 nucleotides (GenBank GQ413939) with the gene order of 3'-N-P-M-G-NV-L-5'. These genes are separated by conserved gene junctions, with di-nucleotide gene spacers. An additional uracil nucleotide was found at the end of the 5'-trailer region, which was not reported before in other IHNV strains. The first 15 of the 16 nucleotides at the 3'- and 5'-termini of the genome are complementary, and the first 4 nucleotides at 3'-ends of the IHNV are identical to other novirhadoviruses. Sequence homology and phylogenetic analysis of the glycoprotein genes show that 220-90 strain is 97% identical to most of the IHNV strains. Comparison of the virulent 220-90 genomic sequences with less virulent WRAC isolate shows more than 300 nucleotides changes in the genome, which doesn't allow one to speculate putative residues involved in the virulence of IHNV. Conclusion We have molecularly characterized one of the well studied IHNV isolates, 220-90 of genogroup M, which is virulent for rainbow trout, and compared phylogenetic relationship with North American and other strains. Determination of the complete nucleotide sequence is essential for future studies on pathogenesis of IHNV using a reverse genetics approach and developing efficient control strategies. PMID:20085652

Hop stunt viroid: molecular cloning and nucleotide sequence of the complete cDNA copy.

PubMed Central

Ohno, T; Takamatsu, N; Meshi, T; Okada, Y

1983-01-01

The complete cDNA of hop stunt viroid (HSV) has been cloned by the method of Okayama and Berg (Mol.Cell.Biol.2,161-170. (1982] and the complete nucleotide sequence has been established. The covalently closed circular single-stranded HSV RNA consists of 297 nucleotides. The secondary structure predicted for HSV contains 67% of its residues base-paired. The native HSV can possess an extended rod-like structure characteristic of viroids previously established. The central region of the native HSV has a similar structure to the conserved region found in all viroids sequenced so far except for avocado sunblotch viroid. The sequence homologous to the 5'-end of U1a RNA is also found in the sequence of HSV but not in the central conserved region. Images PMID:6312412

Nucleotide sequences of Japanese isolates of citrus vein enation virus.

PubMed

Nakazono-Nagaoka, Eiko; Fujikawa, Takashi; Iwanami, Toru

2017-03-01

The genomic sequences of five Japanese isolates of citrus vein enation virus (CVEV) isolates that induce vein enation were determined and compared with that of the Spanish isolate VE-1. The nucleotide sequences of all Japanese isolates were 5,983 nt in length. The genomic RNA of Japanese isolates had five potential open reading frames (ORF 0, ORF 1, ORF 2, ORF 3, and ORF 5) in the positive-sense strand. The nucleotide sequence identity among the Japanese isolates and Spanish isolate VE-1 ranged from 98.0% to 99.8%. Comparison of the partial amino acid sequences of ten Japanese isolates and three Spanish isolates suggested that four amino acid residues, at positions of 83, 104, and 113 in ORF 2 and position 41 in ORF 5, might be unique to some Japanese isolates.

Detecting and Analyzing Genetic Recombination Using RDP4.

PubMed

Martin, Darren P; Murrell, Ben; Khoosal, Arjun; Muhire, Brejnev

2017-01-01

Recombination between nucleotide sequences is a major process influencing the evolution of most species on Earth. The evolutionary value of recombination has been widely debated and so too has its influence on evolutionary analysis methods that assume nucleotide sequences replicate without recombining. When nucleic acids recombine, the evolution of the daughter or recombinant molecule cannot be accurately described by a single phylogeny. This simple fact can seriously undermine the accuracy of any phylogenetics-based analytical approach which assumes that the evolutionary history of a set of recombining sequences can be adequately described by a single phylogenetic tree. There are presently a large number of available methods and associated computer programs for analyzing and characterizing recombination in various classes of nucleotide sequence datasets. Here we examine the use of some of these methods to derive and test recombination hypotheses using multiple sequence alignments.

Resequencing of IRS2 reveals rare variants for obesity but not fasting glucose homeostasis in Hispanic children

PubMed Central

Voruganti, V. Saroja; Cole, Shelley A.; Haack, Karin; Comuzzie, Anthony G.; Muzny, Donna M.; Wheeler, David A.; Chang, Kyle; Hawes, Alicia; Gibbs, Richard A.

2011-01-01

Our objective was to resequence insulin receptor substrate 2 (IRS2) to identify variants associated with obesity- and diabetes-related traits in Hispanic children. Exonic and intronic segments, 5′ and 3′ flanking regions of IRS2 (∼14.5 kb), were bidirectionally sequenced for single nucleotide polymorphism (SNP) discovery in 934 Hispanic children using 3730XL DNA Sequencers. Additionally, 15 SNPs derived from Illumina HumanOmni1-Quad BeadChips were analyzed. Measured genotype analysis tested associations between SNPs and obesity and diabetes-related traits. Bayesian quantitative trait nucleotide analysis was used to statistically infer the most likely functional polymorphisms. A total of 140 SNPs were identified with minor allele frequencies (MAF) ranging from 0.001 to 0.47. Forty-two of the 70 coding SNPs result in nonsynonymous amino acid substitutions relative to the consensus sequence; 28 SNPs were detected in the promoter, 12 in introns, 28 in the 3′-UTR, and 2 in the 5′-UTR. Two insertion/deletions (indels) were detected. Ten independent rare SNPs (MAF = 0.001–0.009) were associated with obesity-related traits (P = 0.01–0.00002). SNP 10510452_139 in the promoter region was shown to have a high posterior probability (P = 0.77–0.86) of influencing BMI, fat mass, and waist circumference in Hispanic children. SNP 10510452_139 contributed between 2 and 4% of the population variance in body weight and composition. None of the SNPs or indels were associated with diabetes-related traits or accounted for a previously identified quantitative trait locus on chromosome 13 for fasting serum glucose. Rare but not common IRS2 variants may play a role in the regulation of body weight but not an essential role in fasting glucose homeostasis in Hispanic children. PMID:21771880

Nucleotide sequence of a resistance breaking mutant of southern bean mosaic virus.

PubMed

Lee, L; Anderson, E J

1998-01-01

SBMV-S is a resistance-breaking mutant of an Arkansas isolate of the bean strain of southern bean mosaic virus (SBMV-BARK) that is able to move systemically in Phaseolus vulgaris cvs. Pinto and Great Northern, whereas the wild-type SBMV-BARK causes local necrotic lesions and is restricted to the inoculated leaves of these hosts. Sequence analysis of the 4136 nucleotide genomes of SBMV-BARK and SBMV-S revealed seven nucleotide differences, but only four deduced amino acid changes. A single amino acid change occurred in the C-terminal region of the putative RNA-dependent RNA polymerase and three differences were identified in the N-terminal portion of the virus coat protein. SBMV-BARK and SBMV-S were compared with other sobemoviruses and were found to contain a high level of nucleotide sequence identity (91.3%) to SBMV-B. Unlike SBMV-B however, SBMV-BARK and SBMV-S contained four putative overlapping open reading frames, making them more similar in genome organization to the cowpea strain, SBMV-C. The possibility exists that mutations or even errors, that resulted in mis-identification of open reading frames, occurred in previously published information on nucleotide sequence and genomic organization for SBMV-B.

Normalization of Complete Genome Characteristics: Application to Evolution from Primitive Organisms to Homo sapiens.

PubMed

Sorimachi, Kenji; Okayasu, Teiji; Ohhira, Shuji

2015-04-01

Normalized nucleotide and amino acid contents of complete genome sequences can be visualized as radar charts. The shapes of these charts depict the characteristics of an organism's genome. The normalized values calculated from the genome sequence theoretically exclude experimental errors. Further, because normalization is independent of both target size and kind, this procedure is applicable not only to single genes but also to whole genomes, which consist of a huge number of different genes. In this review, we discuss the applications of the normalization of the nucleotide and predicted amino acid contents of complete genomes to the investigation of genome structure and to evolutionary research from primitive organisms to Homo sapiens. Some of the results could never have been obtained from the analysis of individual nucleotide or amino acid sequences but were revealed only after the normalization of nucleotide and amino acid contents was applied to genome research. The discovery that genome structure was homogeneous was obtained only after normalization methods were applied to the nucleotide or predicted amino acid contents of genome sequences. Normalization procedures are also applicable to evolutionary research. Thus, normalization of the contents of whole genomes is a useful procedure that can help to characterize organisms.

Identification of amino acid substitutions with compensational effects in the attachment protein of canine distemper virus.

PubMed

Sattler, Ursula; Khosravi, Mojtaba; Avila, Mislay; Pilo, Paola; Langedijk, Johannes P; Ader-Ebert, Nadine; Alves, Lisa A; Plattet, Philippe; Origgi, Francesco C

2014-07-01

The hemagglutinin (H) gene of canine distemper virus (CDV) encodes the receptor-binding protein. This protein, together with the fusion (F) protein, is pivotal for infectivity since it contributes to the fusion of the viral envelope with the host cell membrane. Of the two receptors currently known for CDV (nectin-4 and the signaling lymphocyte activation molecule [SLAM]), SLAM is considered the most relevant for host susceptibility. To investigate how evolution might have impacted the host-CDV interaction, we examined the functional properties of a series of missense single nucleotide polymorphisms (SNPs) naturally accumulating within the H-gene sequences during the transition between two distinct but related strains. The two strains, a wild-type strain and a consensus strain, were part of a single continental outbreak in European wildlife and occurred in distinct geographical areas 2 years apart. The deduced amino acid sequence of the two H genes differed at 5 residues. A panel of mutants carrying all the combinations of the SNPs was obtained by site-directed mutagenesis. The selected mutant, wild type, and consensus H proteins were functionally evaluated according to their surface expression, SLAM binding, fusion protein interaction, and cell fusion efficiencies. The results highlight that the most detrimental functional effects are associated with specific sets of SNPs. Strikingly, an efficient compensational system driven by additional SNPs appears to come into play, virtually neutralizing the negative functional effects. This system seems to contribute to the maintenance of the tightly regulated function of the H-gene-encoded attachment protein. Importance: To investigate how evolution might have impacted the host-canine distemper virus (CDV) interaction, we examined the functional properties of naturally occurring single nucleotide polymorphisms (SNPs) in the hemagglutinin gene of two related but distinct strains of CDV. The hemagglutinin gene encodes the attachment protein, which is pivotal for infection. Our results show that few SNPs have a relevant detrimental impact and they generally appear in specific combinations (molecular signatures). These drastic negative changes are neutralized by compensatory mutations, which contribute to maintenance of an overall constant bioactivity of the attachment protein. This compensational mechanism might reflect the reaction of the CDV machinery to the changes occurring in the virus following antigenic variations critical for virulence. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Plant nitrogen regulatory P-PII polypeptides

DOEpatents

Coruzzi, Gloria M.; Lam, Hon-Ming; Hsieh, Ming-Hsiun

2004-11-23

The present invention generally relates to plant nitrogen regulatory PII gene (hereinafter P-PII gene), a gene involved in regulating plant nitrogen metabolism. The invention provides P-PII nucleotide sequences, expression constructs comprising said nucleotide sequences, and host cells and plants having said constructs and, optionally expressing the P-PII gene from said constructs. The invention also provides substantially pure P-PII proteins. The P-PII nucleotide sequences and constructs of the invention may be used to engineer organisms to overexpress wild-type or mutant P-PII regulatory protein. Engineered plants that overexpress or underexpress P-PII regulatory protein may have increased nitrogen assimilation capacity. Engineered organisms may be used to produce P-PII proteins which, in turn, can be used for a variety of purposes including in vitro screening of herbicides. P-PII nucleotide sequences have additional uses as probes for isolating additional genomic clones having the promoters of P-PII gene. P-PII promoters are light- and/or sucrose-inducible and may be advantageously used in genetic engineering of plants.

Greater numbers of nucleotide substitutions are introduced into the genomic RNA of bovine viral diarrhea virus during acute infections of pregnant cattle than of non-pregnant cattle.

PubMed

Neill, John D; Newcomer, Benjamin W; Marley, Shonda D; Ridpath, Julia F; Givens, M Daniel

2012-08-06

Bovine viral diarrhea virus (BVDV) strains circulating in livestock herds show significant sequence variation. Conventional wisdom states that most sequence variation arises during acute infections in response to immune or other environmental pressures. A recent study showed that more nucleotide changes were introduced into the BVDV genomic RNA during the establishment of a single fetal persistent infection than following a series of acute infections of naïve cattle. However, it was not known if nucleotide changes were introduce when the virus crossed the placenta and infected the fetus or during the acute infection of the dam. The sequence of the open reading frame (ORF) from viruses isolated from four acutely infected pregnant heifers following exposure to persistently infected (PI) calves was compared to the sequences of the virus from the progenitor PI calf and the virus from the resulting progeny PI calf to determine when genetic change was introduced. This was compared to genetic change found in viruses isolated from a pregnant PI cow and its PI calf, and in three viruses isolated from acutely infected, non-pregnant cattle exposed to PI calves. Most genetic changes previously identified between the progenitor and progeny PI viruses were in place in the acute phase viruses isolated from the dams six days post-exposure to the progenitor PI calf. Additionally, each progeny PI virus had two to three unique nucleotide substitutions that were introduced in crossing the placenta and infection of the fetus. The nucleotide sequence of two acute phase viruses isolated from steers exposed to PI calves revealed that six and seven nucleotide changes were introduced during the acute infection. The sequence of the BVDV-2 virus isolated from an acute infection of a PI calf (BVDV-1a) co-housed with a BVDV-2 PI calf had ten nucleotides that were different from the progenitor PI virus. Finally, twenty nucleotide changes were identified in the PI virus of a calf born to a PI dam. These results demonstrate that nucleotide changes are introduced into the BVDV infecting pregnant cattle at rates of 2.3 to 8 fold higher then during the acute infection of non-pregnant animals.

PredictSNP: Robust and Accurate Consensus Classifier for Prediction of Disease-Related Mutations

PubMed Central

Bendl, Jaroslav; Stourac, Jan; Salanda, Ondrej; Pavelka, Antonin; Wieben, Eric D.; Zendulka, Jaroslav; Brezovsky, Jan; Damborsky, Jiri

2014-01-01

Single nucleotide variants represent a prevalent form of genetic variation. Mutations in the coding regions are frequently associated with the development of various genetic diseases. Computational tools for the prediction of the effects of mutations on protein function are very important for analysis of single nucleotide variants and their prioritization for experimental characterization. Many computational tools are already widely employed for this purpose. Unfortunately, their comparison and further improvement is hindered by large overlaps between the training datasets and benchmark datasets, which lead to biased and overly optimistic reported performances. In this study, we have constructed three independent datasets by removing all duplicities, inconsistencies and mutations previously used in the training of evaluated tools. The benchmark dataset containing over 43,000 mutations was employed for the unbiased evaluation of eight established prediction tools: MAPP, nsSNPAnalyzer, PANTHER, PhD-SNP, PolyPhen-1, PolyPhen-2, SIFT and SNAP. The six best performing tools were combined into a consensus classifier PredictSNP, resulting into significantly improved prediction performance, and at the same time returned results for all mutations, confirming that consensus prediction represents an accurate and robust alternative to the predictions delivered by individual tools. A user-friendly web interface enables easy access to all eight prediction tools, the consensus classifier PredictSNP and annotations from the Protein Mutant Database and the UniProt database. The web server and the datasets are freely available to the academic community at http://loschmidt.chemi.muni.cz/predictsnp. PMID:24453961

HIV-1 Full-Genome Phylogenetics of Generalized Epidemics in Sub-Saharan Africa: Impact of Missing Nucleotide Characters in Next-Generation Sequences

PubMed Central

Wymant, Chris; Colijn, Caroline; Danaviah, Siva; Essex, Max; Frost, Simon; Gall, Astrid; Gaseitsiwe, Simani; Grabowski, Mary K.; Gray, Ronald; Guindon, Stephane; von Haeseler, Arndt; Kaleebu, Pontiano; Kendall, Michelle; Kozlov, Alexey; Manasa, Justen; Minh, Bui Quang; Moyo, Sikhulile; Novitsky, Vlad; Nsubuga, Rebecca; Pillay, Sureshnee; Quinn, Thomas C.; Serwadda, David; Ssemwanga, Deogratius; Stamatakis, Alexandros; Trifinopoulos, Jana; Wawer, Maria; Brown, Andy Leigh; de Oliveira, Tulio; Kellam, Paul; Pillay, Deenan; Fraser, Christophe

2017-01-01

Abstract To characterize HIV-1 transmission dynamics in regions where the burden of HIV-1 is greatest, the “Phylogenetics and Networks for Generalised HIV Epidemics in Africa” consortium (PANGEA-HIV) is sequencing full-genome viral isolates from across sub-Saharan Africa. We report the first 3,985 PANGEA-HIV consensus sequences from four cohort sites (Rakai Community Cohort Study, n = 2,833; MRC/UVRI Uganda, n = 701; Mochudi Prevention Project, n = 359; Africa Health Research Institute Resistance Cohort, n = 92). Next-generation sequencing success rates varied: more than 80% of the viral genome from the gag to the nef genes could be determined for all sequences from South Africa, 75% of sequences from Mochudi, 60% of sequences from MRC/UVRI Uganda, and 22% of sequences from Rakai. Partial sequencing failure was primarily associated with low viral load, increased for amplicons closer to the 3′ end of the genome, was not associated with subtype diversity except HIV-1 subtype D, and remained significantly associated with sampling location after controlling for other factors. We assessed the impact of the missing data patterns in PANGEA-HIV sequences on phylogeny reconstruction in simulations. We found a threshold in terms of taxon sampling below which the patchy distribution of missing characters in next-generation sequences (NGS) has an excess negative impact on the accuracy of HIV-1 phylogeny reconstruction, which is attributable to tree reconstruction artifacts that accumulate when branches in viral trees are long. The large number of PANGEA-HIV sequences provides unprecedented opportunities for evaluating HIV-1 transmission dynamics across sub-Saharan Africa and identifying prevention opportunities. Molecular epidemiological analyses of these data must proceed cautiously because sequence sampling remains below the identified threshold and a considerable negative impact of missing characters on phylogeny reconstruction is expected. PMID:28540766

HIV-1 full-genome phylogenetics of generalized epidemics in sub-Saharan Africa: impact of missing nucleotide characters in next-generation sequences.

PubMed

Ratmann, Oliver; Wymant, Chris; Colijn, Caroline; Danaviah, Siva; Essex, M; Frost, Simon D W; Gall, Astrid; Gaiseitsiwe, Simani; Grabowski, Mary; Gray, Ronald; Guindon, Stephane; von Haeseler, Arndt; Kaleebu, Pontiano; Kendall, Michelle; Kozlov, Alexey; Manasa, Justen; Minh, Bui Quang; Moyo, Sikhulile; Novitsky, Vladimir; Nsubuga, Rebecca; Pillay, Sureshnee; Quinn, Thomas C; Serwadda, David; Ssemwanga, Deogratius; Stamatakis, Alexandros; Trifinopoulos, Jana; Wawer, Maria; Leigh Brown, Andrew; de Oliveira, Tulio; Kellam, Paul; Pillay, Deenan; Fraser, Christophe

2017-05-25

To characterize HIV-1 transmission dynamics in regions where the burden of HIV-1 is greatest, the 'Phylogenetics and Networks for Generalised HIV Epidemics in Africa' consortium (PANGEA-HIV) is sequencing full-genome viral isolates from across sub-Saharan Africa. We report the first 3,985 PANGEA-HIV consensus sequences from four cohort sites (Rakai Community Cohort Study, n=2,833; MRC/UVRI Uganda, n=701; Mochudi Prevention Project, n=359; Africa Health Research Institute Resistance Cohort, n=92). Next-generation sequencing success rates varied: more than 80% of the viral genome from the gag to the nef genes could be determined for all sequences from South Africa, 75% of sequences from Mochudi, 60% of sequences from MRC/UVRI Uganda, and 22% of sequences from Rakai. Partial sequencing failure was primarily associated with low viral load, increased for amplicons closer to the 3' end of the genome, was not associated with subtype diversity except HIV-1 subtype D, and remained significantly associated with sampling location after controlling for other factors. We assessed the impact of the missing data patterns in PANGEA-HIV sequences on phylogeny reconstruction in simulations. We found a threshold in terms of taxon sampling below which the patchy distribution of missing characters in next-generation sequences has an excess negative impact on the accuracy of HIV-1 phylogeny reconstruction, which is attributable to tree reconstruction artifacts that accumulate when branches in viral trees are long. The large number of PANGEA-HIV sequences provides unprecedented opportunities for evaluating HIV-1 transmission dynamics across sub-Saharan Africa and identifying prevention opportunities. Molecular epidemiological analyses of these data must proceed cautiously because sequence sampling remains below the identified threshold and a considerable negative impact of missing characters on phylogeny reconstruction is expected.

Ancestral sequence reconstruction in primate mitochondrial DNA: compositional bias and effect on functional inference.

PubMed

Krishnan, Neeraja M; Seligmann, Hervé; Stewart, Caro-Beth; De Koning, A P Jason; Pollock, David D

2004-10-01

Reconstruction of ancestral DNA and amino acid sequences is an important means of inferring information about past evolutionary events. Such reconstructions suggest changes in molecular function and evolutionary processes over the course of evolution and are used to infer adaptation and convergence. Maximum likelihood (ML) is generally thought to provide relatively accurate reconstructed sequences compared to parsimony, but both methods lead to the inference of multiple directional changes in nucleotide frequencies in primate mitochondrial DNA (mtDNA). To better understand this surprising result, as well as to better understand how parsimony and ML differ, we constructed a series of computationally simple "conditional pathway" methods that differed in the number of substitutions allowed per site along each branch, and we also evaluated the entire Bayesian posterior frequency distribution of reconstructed ancestral states. We analyzed primate mitochondrial cytochrome b (Cyt-b) and cytochrome oxidase subunit I (COI) genes and found that ML reconstructs ancestral frequencies that are often more different from tip sequences than are parsimony reconstructions. In contrast, frequency reconstructions based on the posterior ensemble more closely resemble extant nucleotide frequencies. Simulations indicate that these differences in ancestral sequence inference are probably due to deterministic bias caused by high uncertainty in the optimization-based ancestral reconstruction methods (parsimony, ML, Bayesian maximum a posteriori). In contrast, ancestral nucleotide frequencies based on an average of the Bayesian set of credible ancestral sequences are much less biased. The methods involving simpler conditional pathway calculations have slightly reduced likelihood values compared to full likelihood calculations, but they can provide fairly unbiased nucleotide reconstructions and may be useful in more complex phylogenetic analyses than considered here due to their speed and flexibility. To determine whether biased reconstructions using optimization methods might affect inferences of functional properties, ancestral primate mitochondrial tRNA sequences were inferred and helix-forming propensities for conserved pairs were evaluated in silico. For ambiguously reconstructed nucleotides at sites with high base composition variability, ancestral tRNA sequences from Bayesian analyses were more compatible with canonical base pairing than were those inferred by other methods. Thus, nucleotide bias in reconstructed sequences apparently can lead to serious bias and inaccuracies in functional predictions.

Intramolecular interactions in aminoacyl nucleotides: Implications regarding the origin of genetic coding and protein synthesis

NASA Technical Reports Server (NTRS)

Lacey, J. C., Jr.; Mullins, D. W., Jr.; Watkins, C. L.; Hall, L. M.

1986-01-01

Cellular organisms store information as sequences of nucleotides in double stranded DNA. This information is useless unless it can be converted into the active molecular species, protein. This is done in contemporary creatures first by transcription of one strand to give a complementary strand of mRNA. The sequence of nucleotides is then translated into a specific sequence of amino acids in a protein. Translation is made possible by a genetic coding system in which a sequence of three nucleotides codes for a specific amino acid. The origin and evolution of any chemical system can be understood through elucidation of the properties of the chemical entities which make up the system. There is an underlying logic to the coding system revealed by a correlation of the hydrophobicities of amino acids and their anticodonic nucleotides (i.e., the complement of the codon). Its importance lies in the fact that every amino acid going into protein synthesis must first be activated. This is universally accomplished with ATP. Past studies have concentrated on the chemistry of the adenylates, but more recently we have found, through the use of NMR, that we can observe intramolecular interactions even at low concentrations, between amino acid side chains and nucleotide base rings in these adenylates. The use of this type of compound thus affords a novel way of elucidating the manner in which amino acids and nucleotides interact with each other. In aqueous solution, when a hydrophobic amino acid is attached to the most hydrophobic nucleotide, AMP, a hydrophobic interaction takes place between the amino acid side chain and the adenine ring. The studies to be reported concern these hydrophobic interactions.

High speed nucleic acid sequencing

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2011-05-17

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid. Each type of labeled nucleotide comprises an acceptor fluorophore attached to a phosphate portion of the nucleotide such that the fluorophore is removed upon incorporation into a growing strand. Fluorescent signal is emitted via fluorescent resonance energy transfer between the donor fluorophore and the acceptor fluorophore as each nucleotide is incorporated into the growing strand. The sequence is deduced by identifying which base is being incorporated into the growing strand.

PROSPECT improves cis-acting regulatory element prediction by integrating expression profile data with consensus pattern searches

PubMed Central

Fujibuchi, Wataru; Anderson, John S. J.; Landsman, David

2001-01-01

Consensus pattern and matrix-based searches designed to predict cis-acting transcriptional regulatory sequences have historically been subject to large numbers of false positives. We sought to decrease false positives by incorporating expression profile data into a consensus pattern-based search method. We have systematically analyzed the expression phenotypes of over 6000 yeast genes, across 121 expression profile experiments, and correlated them with the distribution of 14 known regulatory elements over sequences upstream of the genes. Our method is based on a metric we term probabilistic element assessment (PEA), which is a ranking of potential sites based on sequence similarity in the upstream regions of genes with similar expression phenotypes. For eight of the 14 known elements that we examined, our method had a much higher selectivity than a naïve consensus pattern search. Based on our analysis, we have developed a web-based tool called PROSPECT, which allows consensus pattern-based searching of gene clusters obtained from microarray data. PMID:11574681

Information capacity of nucleotide sequences and its applications.

PubMed

Sadovsky, M G

2006-05-01

The information capacity of nucleotide sequences is defined through the specific entropy of frequency dictionary of a sequence determined with respect to another one containing the most probable continuations of shorter strings. This measure distinguishes a sequence both from a random one, and from ordered entity. A comparison of sequences based on their information capacity is studied. An order within the genetic entities is found at the length scale ranged from 3 to 8. Some other applications of the developed methodology to genetics, bioinformatics, and molecular biology are discussed.

Nucleic acid constructs containing orthogonal site selective recombinases (OSSRs)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gilmore, Joshua M.; Anderson, J. Christopher; Dueber, John E.

The present invention provides for a recombinant nucleic acid comprising a nucleotide sequence comprising a plurality of constructs, wherein each construct independently comprises a nucleotide sequence of interest flanked by a pair of recombinase recognition sequences. Each pair of recombinase recognition sequences is recognized by a distinct recombinase. Optionally, each construct can, independently, further comprise one or more genes encoding a recombinase capable of recognizing the pair of recombinase recognition sequences of the construct. The recombinase can be an orthogonal (non-cross reacting), site-selective recombinase (OSSR).

Complete genome sequence and phylogenetic analyses of an aquabirnavirus isolated from a diseased marbled eel culture in Taiwan.

PubMed

Wen, Chiu-Ming

2017-08-01

An aquabirnavirus was isolated from diseased marbled eels (Anguilla marmorata; MEIPNV1310) with gill haemorrhages and associated mortality. Its genome segment sequences were obtained through next-generation sequencing and compared with published aquabirnavirus sequences. The results indicated that the genome sequence of MEIPNV1310 contains segment A (3099 nucleotides) and segment B (2789 nucleotides). Phylogenetic analysis showed that MEIPNV1310 is closely related to the infectious pancreatic necrosis Ab strain within genogroup II. This genome sequence is beneficial for studying the geographic distribution and evolution of aquabirnaviruses.

Unlinking the methylome pattern from nucleotide sequence, revealed by large-scale in vivo genome engineering and methylome editing in medaka fish

PubMed Central

Nakamura, Ryohei; Uno, Ayako; Kumagai, Masahiko; Fukushima, Hiroto S.; Morishita, Shinichi; Takeda, Hiroyuki

2017-01-01

The heavily methylated vertebrate genomes are punctuated by stretches of poorly methylated DNA sequences that usually mark gene regulatory regions. It is known that the methylation state of these regions confers transcriptional control over their associated genes. Given its governance on the transcriptome, cellular functions and identity, genome-wide DNA methylation pattern is tightly regulated and evidently predefined. However, how is the methylation pattern determined in vivo remains enigmatic. Based on in silico and in vitro evidence, recent studies proposed that the regional hypomethylated state is primarily determined by local DNA sequence, e.g., high CpG density and presence of specific transcription factor binding sites. Nonetheless, the dependency of DNA methylation on nucleotide sequence has not been carefully validated in vertebrates in vivo. Herein, with the use of medaka (Oryzias latipes) as a model, the sequence dependency of DNA methylation was intensively tested in vivo. Our statistical modeling confirmed the strong statistical association between nucleotide sequence pattern and methylation state in the medaka genome. However, by manipulating the methylation state of a number of genomic sequences and reintegrating them into medaka embryos, we demonstrated that artificially conferred DNA methylation states were predominantly and robustly maintained in vivo, regardless of their sequences and endogenous states. This feature was also observed in the medaka transgene that had passed across generations. Thus, despite the observed statistical association, nucleotide sequence was unable to autonomously determine its own methylation state in medaka in vivo. Our results apparently argue against the notion of the governance on the DNA methylation by nucleotide sequence, but instead suggest the involvement of other epigenetic factors in defining and maintaining the DNA methylation landscape. Further investigation in other vertebrate models in vivo will be needed for the generalization of our observations made in medaka. PMID:29267279

Using expected sequence features to improve basecalling accuracy of amplicon pyrosequencing data.

PubMed

Rask, Thomas S; Petersen, Bent; Chen, Donald S; Day, Karen P; Pedersen, Anders Gorm

2016-04-22

Amplicon pyrosequencing targets a known genetic region and thus inherently produces reads highly anticipated to have certain features, such as conserved nucleotide sequence, and in the case of protein coding DNA, an open reading frame. Pyrosequencing errors, consisting mainly of nucleotide insertions and deletions, are on the other hand likely to disrupt open reading frames. Such an inverse relationship between errors and expectation based on prior knowledge can be used advantageously to guide the process known as basecalling, i.e. the inference of nucleotide sequence from raw sequencing data. The new basecalling method described here, named Multipass, implements a probabilistic framework for working with the raw flowgrams obtained by pyrosequencing. For each sequence variant Multipass calculates the likelihood and nucleotide sequence of several most likely sequences given the flowgram data. This probabilistic approach enables integration of basecalling into a larger model where other parameters can be incorporated, such as the likelihood for observing a full-length open reading frame at the targeted region. We apply the method to 454 amplicon pyrosequencing data obtained from a malaria virulence gene family, where Multipass generates 20 % more error-free sequences than current state of the art methods, and provides sequence characteristics that allow generation of a set of high confidence error-free sequences. This novel method can be used to increase accuracy of existing and future amplicon sequencing data, particularly where extensive prior knowledge is available about the obtained sequences, for example in analysis of the immunoglobulin VDJ region where Multipass can be combined with a model for the known recombining germline genes. Multipass is available for Roche 454 data at http://www.cbs.dtu.dk/services/MultiPass-1.0 , and the concept can potentially be implemented for other sequencing technologies as well.

The nucleotide sequence and genome organization of Plasmopara halstedii virus.

PubMed

Heller-Dohmen, Marion; Göpfert, Jens C; Pfannstiel, Jens; Spring, Otmar

2011-03-17

Only very few viruses of Oomycetes have been studied in detail. Isometric virions were found in different isolates of the oomycete Plasmopara halstedii, the downy mildew pathogen of sunflower. However, complete nucleotide sequences and data on the genome organization were lacking. Viral RNA of different P. halstedii isolates was subjected to nucleotide sequencing and analysis of the viral genome. The N-terminal sequence of the viral coat protein was determined using Top-Down MALDI-TOF analysis. The complete nucleotide sequences of both single-stranded RNA segments (RNA1 and RNA2) were established. RNA1 consisted of 2793 nucleotides (nt) exclusive its 3' poly(A) tract and a single open-reading frame (ORF1) of 2745 nt. ORF1 was framed by a 5' untranslated region (5' UTR) of 18 nt and a 3' untranslated region (3' UTR) of 30 nt. ORF1 contained motifs of RNA-dependent RNA polymerases (RdRp) and showed similarities to RdRp of Scleropthora macrospora virus A (SmV A) and viruses within the Nodaviridae family. RNA2 consisted of 1526 nt exclusive its 3' poly(A) tract and a second ORF (ORF2) of 1128 nt. ORF2 coded for the single viral coat protein (CP) and was framed by a 5' UTR of 164 nt and a 3' UTR of 234 nt. The deduced amino acid sequence of ORF2 was verified by nano-LC-ESI-MS/MS experiments. Top-Down MALDI-TOF analysis revealed the N-terminal sequence of the CP. The N-terminal sequence represented a region within ORF2 suggesting a proteolytic processing of the CP in vivo. The CP showed similarities to CP of SmV A and viruses within the Tombusviridae family. Fragments of RNA1 (ca. 1.9 kb) and RNA2 (ca. 1.4 kb) were used to analyze the nucleotide sequence variation of virions in different P. halstedii isolates. Viral sequence variation was 0.3% or less regardless of their host's pathotypes, the geographical origin and the sensitivity towards the fungicide metalaxyl. The results showed the presence of a single and new virus type in different P. halstedii isolates. Insignificant viral sequence variation indicated that the virus did not account for differences in pathogenicity of the oomycete P. halstedii.

Unveiling the Hybrid Genome Structure of Escherichia coli RR1 (HB101 RecA+)

PubMed Central

Jeong, Haeyoung; Sim, Young Mi; Kim, Hyun Ju; Lee, Sang Jun

2017-01-01

There have been extensive genome sequencing studies for Escherichia coli strains, particularly for pathogenic isolates, because fast determination of pathogenic potential and/or drug resistance and their propagation routes is crucial. For laboratory E. coli strains, however, genome sequence information is limited except for several well-known strains. We determined the complete genome sequence of laboratory E. coli strain RR1 (HB101 RecA+), which has long been used as a general cloning host. A hybrid genome sequence of K-12 MG1655 and B BL21(DE3) was constructed based on the initial mapping of Illumina HiSeq reads to each reference, and iterative rounds of read mapping, variant detection, and consensus extraction were carried out. Finally, PCR and Sanger sequencing-based finishing were applied to resolve non-single nucleotide variant regions with aberrant read depths and breakpoints, most of them resulting from prophages and insertion sequence transpositions that are not present in the reference genome sequence. We found that 96.9% of the RR1 genome is derived from K-12, and identified exact crossover junctions between K-12 and B genomic fragments. However, because RR1 has experienced a series of genetic manipulations since branching from the common ancestor, it has a set of mutations different from those found in K-12 MG1655. As well as identifying all known genotypes of RR1 on the basis of genomic context, we found novel mutations. Our results extend current knowledge of the genotype of RR1 and its relatives, and provide insights into the pedigree, genomic background, and physiology of common laboratory strains. PMID:28421066

The immediate upstream region of the 5′-UTR from the AUG start codon has a pronounced effect on the translational efficiency in Arabidopsis thaliana

PubMed Central

Kim, Younghyun; Lee, Goeun; Jeon, Eunhyun; Sohn, Eun ju; Lee, Yongjik; Kang, Hyangju; Lee, Dong wook; Kim, Dae Heon; Hwang, Inhwan

2014-01-01

The nucleotide sequence around the translational initiation site is an important cis-acting element for post-transcriptional regulation. However, it has not been fully understood how the sequence context at the 5′-untranslated region (5′-UTR) affects the translational efficiency of individual mRNAs. In this study, we provide evidence that the 5′-UTRs of Arabidopsis genes showing a great difference in the nucleotide sequence vary greatly in translational efficiency with more than a 200-fold difference. Of the four types of nucleotides, the A residue was the most favourable nucleotide from positions −1 to −21 of the 5′-UTRs in Arabidopsis genes. In particular, the A residue in the 5′-UTR from positions −1 to −5 was required for a high-level translational efficiency. In contrast, the T residue in the 5′-UTR from positions −1 to −5 was the least favourable nucleotide in translational efficiency. Furthermore, the effect of the sequence context in the −1 to −21 region of the 5′-UTR was conserved in different plant species. Based on these observations, we propose that the sequence context immediately upstream of the AUG initiation codon plays a crucial role in determining the translational efficiency of plant genes. PMID:24084084

In silico analysis of the polygalacturonase inhibiting protein 1 from apple, Malus domestica.

PubMed

Matsaunyane, Lerato Bt; Oelofse, Dean; Dubery, Ian A

2015-03-11

The Malus domestica polygalacturonase inhibiting protein 1 (MdPGIP1) gene, encoding the M. domestica polygalacturonase inhibiting protein 1 (MdPGIP1), was isolated from the Granny Smith apple cultivar (GenBank accession no. DQ185063). The gene was used to transform tobacco and potato for enhanced resistance against fungal diseases. Analysis of the MdPGIP1 nucleotide sequence revealed that the gene comprises 993 nucleotides that encode a 330 amino acid polypeptide. In silico characterization of the MdPGIP1 polypeptide revealed domains typical of PGIP proteins, which include a 24 amino acid putative signal peptide, a potential cleavage site [Alanine-Leucine-Serine (ALS)] for the signal peptide, a 238 amino acid leucine-rich repeat (LRR) domain, a 46 amino acid N-terminal domain and a 22 amino acid C-terminal domain. The hydropathic evaluation of MdPGIP1 indicated a repetitive hydrophobic motif in the LRR domain and a hydrophilic surface area consistent with a globular protein. The typical consensus glycosylation sequence of Asn-X-Ser/Thr was identified in MdPGIP1, indicating potential N-linked glycosylation of MdPGIP1. The molecular mass of non-glycosylated MdPGIP1 was calculated as 36.615 kDa and the theoretical isoelectric point as 6.98. Furthermore, the secondary and tertiary structure of MdPGIP1 was modelled, and revealed that MdPGIP1 is a curved and elongated molecule that contains sheet B1, sheet B2 and 310-helices on its LRR domain. The overall properties of the MdPGIP1 protein is similar to that of the prototypical Phaseolus vulgaris PGIP 2 (PvPGIP2), and the detected differences supported its use in biotechnological applications as an inhibitor of targeted fungal polygalacturonases (PGs).

Isolation and characterization of multiple F-box genes linked to the S9- and S10-RNase in apple (Malus × domestica Borkh.).

PubMed

Okada, Kazuma; Moriya, Shigeki; Haji, Takashi; Abe, Kazuyuki

2013-06-01

Using 11 consensus primer pairs designed from S-linked F-box genes of apple and Japanese pear, 10 new F-box genes (MdFBX21 to 30) were isolated from the apple cultivar 'Spartan' (S(9)S(10)). MdFBX21 to 23 and MdFBX24 to 30 were completely linked to the S(9) -RNase and S(10-)RNase, respectively, and showed pollen-specific expression and S-haplotype-specific polymorphisms. Therefore, these 10 F-box genes are good candidates for the pollen determinant of self-incompatibility in apple. Phylogenetic analysis and comparison of deduced amino acid sequences of MdFBX21 to 30 with those of 25 S-linked F-box genes previously isolated from apple showed that a deduced amino acid identity of greater than 88.0 % can be used as the tentative criterion to classify F-box genes into one type. Using this criterion, 31 of 35 F-box genes of apple were classified into 11 types (SFBB1-11). All types included F-box genes derived from S(3-) and S(9-)haplotypes, and seven types included F-box genes derived from S(3-), S(9-), and S(10-)haplotypes. Moreover, comparison of nucleotide sequences of S-RNases and multiple F-box genes among S(3-), S(9-), and S(10-)haplotypes suggested that F-box genes within each type showed high nucleotide identity regardless of the identity of the S-RNase. The large number of F-box genes as candidates for the pollen determinant and the high degree of conservation within each type are consistent with the collaborative non-self-recognition model reported for Petunia. These findings support that the collaborative non-self-recognition system also exists in apple.

Determination of the small RNA GcvB regulon in the Gram-negative bacterial pathogen Pasteurella multocida and identification of the GcvB seed binding region.

PubMed

Gulliver, Emily L; Wright, Amy; Lucas, Deanna Deveson; Mégroz, Marianne; Kleifeld, Oded; Schittenhelm, Ralf B; Powell, David R; Seemann, Torsten; Bulitta, Jürgen B; Harper, Marina; Boyce, John D

2018-05-01

Pasteurella multocida is a Gram-negative bacterium responsible for many important animal diseases. While a number of P. multocida virulence factors have been identified, very little is known about how gene expression and protein production is regulated in this organism. Small RNA (sRNA) molecules are critical regulators that act by binding to specific mRNA targets, often in association with the RNA chaperone protein Hfq. In this study, transcriptomic analysis of the P. multocida strain VP161 revealed a putative sRNA with high identity to GcvB from Escherichia coli and Salmonella enterica serovar Typhimurium. High-throughput quantitative liquid proteomics was used to compare the proteomes of the P. multocida VP161 wild-type strain, a gcvB mutant, and a GcvB overexpression strain. These analyses identified 46 proteins that displayed significant differential production after inactivation of gcvB , 36 of which showed increased production. Of the 36 proteins that were repressed by GcvB, 27 were predicted to be involved in amino acid biosynthesis or transport. Bioinformatic analyses of putative P. multocida GcvB target mRNAs identified a strongly conserved 10 nucleotide consensus sequence, 5'-AACACAACAT-3', with the central eight nucleotides identical to the seed binding region present within GcvB mRNA targets in E. coli and S. Typhimurium. Using a defined set of seed region mutants, together with a two-plasmid reporter system that allowed for quantification of sRNA-mRNA interactions, this sequence was confirmed to be critical for the binding of the P. multocida GcvB to the target mRNA, gltA . © 2018 Gulliver et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Unique CD44 intronic SNP is associated with tumor grade in breast cancer: a case control study and in silico analysis.

PubMed

Esmaeili, Rezvan; Abdoli, Nasrin; Yadegari, Fatemeh; Neishaboury, Mohamadreza; Farahmand, Leila; Kaviani, Ahmad; Majidzadeh-A, Keivan

2018-01-01

CD44 encoded by a single gene is a cell surface transmembrane glycoprotein. Exon 2 is one of the important exons to bind CD44 protein to hyaluronan. Experimental evidences show that hyaluronan-CD44 interaction intensifies the proliferation, migration, and invasion of breast cancer cells. Therefore, the current study aimed at investigating the association between specific polymorphisms in exon 2 and its flanking region of CD44 with predisposition to breast cancer. In the current study, 175 Iranian female patients with breast cancer and 175 age-matched healthy controls were recruited in biobank, Breast Cancer Research Center, Tehran, Iran. Single nucleotide polymorphisms of CD44 exon 2 and its flanking were analyzed via polymerase chain reaction and gene sequencing techniques. Association between the observed variation with breast cancer risk and clinico-pathological characteristics were studied. Subsequently, bioinformatics analysis was conducted to predict potential exonic splicing enhancer (ESE) motifs changed as the result of a mutation. A unique polymorphism of the gene encoding CD44 was identified at position 14 nucleotide upstream of exon 2 (A37692→G) by the sequencing method. The A > G polymorphism exhibited a significant association with higher-grades of breast cancer, although no significant relation was found between this polymorphism and breast cancer risk. Finally, computational analysis revealed that the intronic mutation generated a new consensus-binding motif for the splicing factor, SC35, within intron 1. The current study results indicated that A > G polymorphism was associated with breast cancer development; in addition, in silico analysis with ESE finder prediction software showed that the change created a new SC35 binding site.

The specificity and flexibility of l1 reverse transcription priming at imperfect T-tracts.

PubMed

Monot, Clément; Kuciak, Monika; Viollet, Sébastien; Mir, Ashfaq Ali; Gabus, Caroline; Darlix, Jean-Luc; Cristofari, Gaël

2013-05-01

L1 retrotransposons have a prominent role in reshaping mammalian genomes. To replicate, the L1 ribonucleoprotein particle (RNP) first uses its endonuclease (EN) to nick the genomic DNA. The newly generated DNA end is subsequently used as a primer to initiate reverse transcription within the L1 RNA poly(A) tail, a process known as target-primed reverse transcription (TPRT). Prior studies demonstrated that most L1 insertions occur into sequences related to the L1 EN consensus sequence (degenerate 5'-TTTT/A-3' sites) and frequently preceded by imperfect T-tracts. However, it is currently unclear whether--and to which degree--the liberated 3'-hydroxyl extremity on the genomic DNA needs to be accessible and complementary to the poly(A) tail of the L1 RNA for efficient priming of reverse transcription. Here, we employed a direct assay for the initiation of L1 reverse transcription to define the molecular rules that guide this process. First, efficient priming is detected with as few as 4 matching nucleotides at the primer 3' end. Second, L1 RNP can tolerate terminal mismatches if they are compensated within the 10 last bases of the primer by an increased number of matching nucleotides. All terminal mismatches are not equally detrimental to DNA extension, a C being extended at higher levels than an A or a G. Third, efficient priming in the context of duplex DNA requires a 3' overhang. This suggests the possible existence of additional DNA processing steps, which generate a single-stranded 3' end to allow L1 reverse transcription. Based on these data we propose that the specificity of L1 reverse transcription initiation contributes, together with the specificity of the initial EN cleavage, to the distribution of new L1 insertions within the human genome.

Building a stable RNA U-turn with a protonated cytidine.

PubMed

Gottstein-Schmidtke, Sina R; Duchardt-Ferner, Elke; Groher, Florian; Weigand, Julia E; Gottstein, Daniel; Suess, Beatrix; Wöhnert, Jens

2014-08-01

The U-turn is a classical three-dimensional RNA folding motif first identified in the anticodon and T-loops of tRNAs. It also occurs frequently as a building block in other functional RNA structures in many different sequence and structural contexts. U-turns induce sharp changes in the direction of the RNA backbone and often conform to the 3-nt consensus sequence 5'-UNR-3' (N = any nucleotide, R = purine). The canonical U-turn motif is stabilized by a hydrogen bond between the N3 imino group of the U residue and the 3' phosphate group of the R residue as well as a hydrogen bond between the 2'-hydroxyl group of the uridine and the N7 nitrogen of the R residue. Here, we demonstrate that a protonated cytidine can functionally and structurally replace the uridine at the first position of the canonical U-turn motif in the apical loop of the neomycin riboswitch. Using NMR spectroscopy, we directly show that the N3 imino group of the protonated cytidine forms a hydrogen bond with the backbone phosphate 3' from the third nucleotide of the U-turn analogously to the imino group of the uridine in the canonical motif. In addition, we compare the stability of the hydrogen bonds in the mutant U-turn motif to the wild type and describe the NMR signature of the C+-phosphate interaction. Our results have implications for the prediction of RNA structural motifs and suggest simple approaches for the experimental identification of hydrogen bonds between protonated C-imino groups and the phosphate backbone. © 2014 Gottstein-Schmidtke et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Global regulator Anr represses PlcH phospholipase activity in Pseudomonas aeruginosa when oxygen is limiting.

PubMed

Jackson, Angelyca A; Daniels, Emily F; Hammond, John H; Willger, Sven D; Hogan, Deborah A

2014-10-01

Haemolytic phospholipase C (PlcH) is a potent virulence and colonization factor that is expressed at high levels by Pseudomonas aeruginosa within the mammalian host. The phosphorylcholine liberated from phosphatidylcholine and sphingomyelin by PlcH is further catabolized into molecules that both support growth and further induce plcH expression. We have shown previously that the catabolism of PlcH-released choline leads to increased activity of Anr, a global transcriptional regulator that promotes biofilm formation and virulence. Here, we demonstrated the presence of a negative feedback loop in which Anr repressed plcH transcription and we proposed that this regulation allowed for PlcH levels to be maintained in a way that promotes productive host-pathogen interactions. Evidence for Anr-mediated regulation of PlcH came from data showing that growth at low oxygen (1%) repressed PlcH abundance and plcH transcription in the WT, and that plcH transcription was enhanced in an Δanr mutant. The plcH promoter featured an Anr consensus sequence that was conserved across all P. aeruginosa genomes and mutation of conserved nucleotides within the Anr consensus sequence increased plcH expression under hypoxic conditions. The Anr-regulated transcription factor Dnr was not required for this effect. The loss of Anr was not sufficient to completely derepress plcH transcription as GbdR, a positive regulator of plcH, was required for expression. Overexpression of Anr was sufficient to repress plcH transcription even at 21 % oxygen. Anr repressed plcH expression and phospholipase C activity in a cell culture model for P. aeruginosa-epithelial cell interactions. The Authors.

Nucleotide Sequence and Genetic Structure of a Novel Carbaryl Hydrolase Gene (cehA) from Rhizobium sp. Strain AC100

PubMed Central

Hashimoto, Masayuki; Fukui, Mitsuru; Hayano, Kouichi; Hayatsu, Masahito

2002-01-01

Rhizobium sp. strain AC100, which is capable of degrading carbaryl (1-naphthyl-N-methylcarbamate), was isolated from soil treated with carbaryl. This bacterium hydrolyzed carbaryl to 1-naphthol and methylamine. Carbaryl hydrolase from the strain was purified to homogeneity, and its N-terminal sequence, molecular mass (82 kDa), and enzymatic properties were determined. The purified enzyme hydrolyzed 1-naphthyl acetate and 4-nitrophenyl acetate indicating that the enzyme is an esterase. We then cloned the carbaryl hydrolase gene (cehA) from the plasmid DNA of the strain and determined the nucleotide sequence of the 10-kb region containing cehA. No homologous sequences were found by a database homology search using the nucleotide and deduced amino acid sequences of the cehA gene. Six open reading frames including the cehA gene were found in the 10-kb region, and sequencing analysis shows that the cehA gene is flanked by two copies of insertion sequence-like sequence, suggesting that it makes part of a composite transposon. PMID:11872471

The complete nucleotide sequence and genome organization of a novel betaflexivirus infecting Citrullus lanatus.

PubMed

Xin, Min; Zhang, Peipei; Liu, Wenwen; Ren, Yingdang; Cao, Mengji; Wang, Xifeng

2017-10-01

The complete nucleotide sequence of a novel positive single-stranded (+ss) RNA virus, tentatively named watermelon virus A (WVA), was determined using a combination of three methods: RNA sequencing, small RNA sequencing, and Sanger sequencing. The full genome of WVA is comprised of 8,372 nucleotides (nt), excluding the poly (A) tail, and contains four open reading frames (ORFs). The largest ORF, ORF1 encodes a putative replication-associated polyprotein (RP) with three conserved domains. ORF2 and ORF4 encode a movement protein (MP) and coat protein (CP), respectively. The putative product encoded by ORF3, of an estimated molecular mass of 25 kDa, has no significant similarity with other proteins. Identity and phylogenetic analysis indicate that WVA is a new virus, closely related to members of the family Betaflexiviridae. However, the final taxonomic allocation of WVA within the family is yet to be determined.

Manipulation of lignin composition in plants using a tissue-specific promoter

DOEpatents

Chapple, Clinton C. S.

2003-08-26

The present invention relates to methods and materials in the field of molecular biology, the manipulation of the phenylpropanoid pathway and the regulation of proteins synthesis through plant genetic engineering. More particularly, the invention relates to the introduction of a foreign nucleotide sequence into a plant genome, wherein the introduction of the nucleotide sequence effects an increase in the syringyl content of the plant's lignin. In one specific aspect, the invention relates to methods for modifying the plant lignin composition in a plant cell by the introduction there into of a foreign nucleotide sequence comprising at issue specific plant promoter sequence and a sequence encoding an active ferulate-5-hydroxylase (F5H) enzyme. Plant transformants harboring an inventive promoter-F5H construct demonstrate increased levels of syringyl monomer residues in their lignin, rendering the polymer more readily delignified and, thereby, rendering the plant more readily pulped or digested.

Dietary nitrogen alters codon bias and genome composition in parasitic microorganisms.

PubMed

Seward, Emily A; Kelly, Steven

2016-11-15

Genomes are composed of long strings of nucleotide monomers (A, C, G and T) that are either scavenged from the organism's environment or built from metabolic precursors. The biosynthesis of each nucleotide differs in atomic requirements with different nucleotides requiring different quantities of nitrogen atoms. However, the impact of the relative availability of dietary nitrogen on genome composition and codon bias is poorly understood. Here we show that differential nitrogen availability, due to differences in environment and dietary inputs, is a major determinant of genome nucleotide composition and synonymous codon use in both bacterial and eukaryotic microorganisms. Specifically, low nitrogen availability species use nucleotides that require fewer nitrogen atoms to encode the same genes compared to high nitrogen availability species. Furthermore, we provide a novel selection-mutation framework for the evaluation of the impact of metabolism on gene sequence evolution and show that it is possible to predict the metabolic inputs of related organisms from an analysis of the raw nucleotide sequence of their genes. Taken together, these results reveal a previously hidden relationship between cellular metabolism and genome evolution and provide new insight into how genome sequence evolution can be influenced by adaptation to different diets and environments.

Alfalfa virus S, a new species in the family Alphaflexiviridae

USDA-ARS?s Scientific Manuscript database

A new species of the family Alphaflexiviridae provisionally named alfalfa virus S (AVS) was discovered in alfalfa samples originating from Sudan. A complete nucleotide sequence of the viral genome consisting of 8,349 nucleotides excluding the 3’ poly(A) tail was determined by high throughput sequenc...

Developing Single Nucleotide Polymorphism (SNP) markers from transcriptome sequences for the identification of longan (Dimocarpus longan) germplasm

USDA-ARS?s Scientific Manuscript database

Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in...

Molecular Characterization of an Avian Astrovirus

PubMed Central

Koci, Matthew D.; Seal, Bruce S.; Schultz-Cherry, Stacey

2000-01-01

Astroviruses are known to cause enteric disease in several animal species, including turkeys. However, only human astroviruses have been well characterized at the nucleotide level. Herein we report the nucleotide sequence, genomic organization, and predicted amino acid sequence of a turkey astrovirus isolated from poults with an emerging enteric disease. PMID:10846102

A new single-nucleotide polymorphisms database for rainbow trout generated through whole genome resequencing of selected samples

USDA-ARS?s Scientific Manuscript database

Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

Nucleotide sequencing and identification of some wild mushrooms.

PubMed

Das, Sudip Kumar; Mandal, Aninda; Datta, Animesh K; Gupta, Sudha; Paul, Rita; Saha, Aditi; Sengupta, Sonali; Dubey, Priyanka Kumari

2013-01-01

The rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) fragment of the genomic DNA of 8 wild edible mushrooms (collected from Eastern Chota Nagpur Plateau of West Bengal, India) was amplified using ITS1 (Internal Transcribed Spacers 1) and ITS2 primers and subjected to nucleotide sequence determination for identification of mushrooms as mentioned. The sequences were aligned using ClustalW software program. The aligned sequences revealed identity (homology percentage from GenBank data base) of Amanita hemibapha [CN (Chota Nagpur) 1, % identity 99 (JX844716.1)], Amanita sp. [CN 2, % identity 98 (JX844763.1)], Astraeus hygrometricus [CN 3, % identity 87 (FJ536664.1)], Termitomyces sp. [CN 4, % identity 90 (JF746992.1)], Termitomyces sp. [CN 5, % identity 99 (GU001667.1)], T. microcarpus [CN 6, % identity 82 (EF421077.1)], Termitomyces sp. [CN 7, % identity 76 (JF746993.1)], and Volvariella volvacea [CN 8, % identity 100 (JN086680.1)]. Although out of 8 mushrooms 4 could be identified up to species level, the nucleotide sequences of the rest may be relevant to further characterization. A phylogenetic tree is constructed using Neighbor-Joining method showing interrelationship between/among the mushrooms. The determined nucleotide sequences of the mushrooms may provide additional information enriching GenBank database aiding to molecular taxonomy and facilitating its domestication and characterization for human benefits.

Comparative analysis of seven viral nuclear export signals (NESs) reveals the crucial role of nuclear export mediated by the third NES consensus sequence of nucleoprotein (NP) in influenza A virus replication.

PubMed

Chutiwitoonchai, Nopporn; Kakisaka, Michinori; Yamada, Kazunori; Aida, Yoko

2014-01-01

The assembly of influenza virus progeny virions requires machinery that exports viral genomic ribonucleoproteins from the cell nucleus. Currently, seven nuclear export signal (NES) consensus sequences have been identified in different viral proteins, including NS1, NS2, M1, and NP. The present study examined the roles of viral NES consensus sequences and their significance in terms of viral replication and nuclear export. Mutation of the NP-NES3 consensus sequence resulted in a failure to rescue viruses using a reverse genetics approach, whereas mutation of the NS2-NES1 and NS2-NES2 sequences led to a strong reduction in viral replication kinetics compared with the wild-type sequence. While the viral replication kinetics for other NES mutant viruses were also lower than those of the wild-type, the difference was not so marked. Immunofluorescence analysis after transient expression of NP-NES3, NS2-NES1, or NS2-NES2 proteins in host cells showed that they accumulated in the cell nucleus. These results suggest that the NP-NES3 consensus sequence is mostly required for viral replication. Therefore, each of the hydrophobic (Φ) residues within this NES consensus sequence (Φ1, Φ2, Φ3, or Φ4) was mutated, and its viral replication and nuclear export function were analyzed. No viruses harboring NP-NES3 Φ2 or Φ3 mutants could be rescued. Consistent with this, the NP-NES3 Φ2 and Φ3 mutants showed reduced binding affinity with CRM1 in a pull-down assay, and both accumulated in the cell nucleus. Indeed, a nuclear export assay revealed that these mutant proteins showed lower nuclear export activity than the wild-type protein. Moreover, the Φ2 and Φ3 residues (along with other Φ residues) within the NP-NES3 consensus were highly conserved among different influenza A viruses, including human, avian, and swine. Taken together, these results suggest that the Φ2 and Φ3 residues within the NP-NES3 protein are important for its nuclear export function during viral replication.

Sequence variation and phylogenetic analysis of envelope glycoprotein of hepatitis G virus.

PubMed

Lim, M Y; Fry, K; Yun, A; Chong, S; Linnen, J; Fung, K; Kim, J P

1997-11-01

A transfusion-transmissible agent provisionally designated hepatitis G virus (HGV) was recently identified. In this study, we examined the variability of the HGV genome by analysing sequences in the putative envelope region from 72 isolates obtained from diverse geographical sources. The 1561 nucleotide sequence of the E1/E2/NS2a region of HGV was determined from 12 isolates, and compared with three published sequences. The most variability was observed in 400 nucleotides at the N terminus of E2. We next analysed this 400 nucleotide envelope variable region (EV) from an additional 60 HGV isolates. This sequence varied considerably among the 75 isolates, with overall identity ranging from 79.3% to 99.5% at the nucleotide level, and from 83.5% to 100% at the amino acid level. However, hypervariable regions were not identified. Phylogenetic analyses indicated that the 75 HGV isolates belong to a single genotype. A single-tier distribution of evolutionary distances was observed among the 15 E1/E2/NS2a sequences and the 75 EV sequences. In contrast, 11 isolates of HCV were analysed and showed a three-tiered distribution, representing genotypes, subtypes, and isolates. The 75 isolates of HGV fell into four clusters on the phylogenetic tree. Tight geographical clustering was observed among the HGV isolates from Japan and Korea.

Ariadne: a database search engine for identification and chemical analysis of RNA using tandem mass spectrometry data.

PubMed

Nakayama, Hiroshi; Akiyama, Misaki; Taoka, Masato; Yamauchi, Yoshio; Nobe, Yuko; Ishikawa, Hideaki; Takahashi, Nobuhiro; Isobe, Toshiaki

2009-04-01

We present here a method to correlate tandem mass spectra of sample RNA nucleolytic fragments with an RNA nucleotide sequence in a DNA/RNA sequence database, thereby allowing tandem mass spectrometry (MS/MS)-based identification of RNA in biological samples. Ariadne, a unique web-based database search engine, identifies RNA by two probability-based evaluation steps of MS/MS data. In the first step, the software evaluates the matches between the masses of product ions generated by MS/MS of an RNase digest of sample RNA and those calculated from a candidate nucleotide sequence in a DNA/RNA sequence database, which then predicts the nucleotide sequences of these RNase fragments. In the second step, the candidate sequences are mapped for all RNA entries in the database, and each entry is scored for a function of occurrences of the candidate sequences to identify a particular RNA. Ariadne can also predict post-transcriptional modifications of RNA, such as methylation of nucleotide bases and/or ribose, by estimating mass shifts from the theoretical mass values. The method was validated with MS/MS data of RNase T1 digests of in vitro transcripts. It was applied successfully to identify an unknown RNA component in a tRNA mixture and to analyze post-transcriptional modification in yeast tRNA(Phe-1).

Low dose rectal inoculation of rhesus macaques by SIV smE660 or SIVmac251 recapitulates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hraber, Peter; Giorgi, Elena E; Keele, Brandon

2008-01-01

We recently developed a novel strategy to identify transmitted HIV-1 genomes in acutely infected humans using single-genome amplification and a model of random virus evolution. Here, we used this approach to determine the molecular features of simian immunodeficiency virus (SIV) transmission in 18 experimentally infected Indian rhesus macaques. Animals were inoculated intrarectally (i.r.) or intravenously (i.v.) with stocks of SIVmac251 or SIVsmE660 that exhibited sequence diversity typical of early-chronic HIV-1 infection. 987 full-length SIV env sequences (median of 48 per animal) were determined from plasma virion RNA 1--5 wk after infection. i.r. inoculation was followed by productive infection by onemore » or a few viruses (median 1; range 1--5) that diversified randomly with near starlike phylogeny and a Poisson distribution of mutations. Consensus viral sequences from ramp-up and peak viremia were identical to viruses found in the inocula or differed from them by only one or a few nucleotides, providing direct evidence that early plasma viral sequences coalesce to transmitted/founder viruses. i.v. infection was >2,000-fold more efficient than i.r. infection, and viruses transmitted by either route represented the full genetic spectra of the inocula. These findings identify key similarities in mucosal transmission and early diversification between SIV and HIV-1, and thus validate the SIV-macaque mucosal infection model for HIV-1 vaccine and microbicide research.« less

Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues.

PubMed Central

Prody, C A; Zevin-Sonkin, D; Gnatt, A; Goldberg, O; Soreq, H

1987-01-01

To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase (BtChoEase; EC 3.1.1.8) and Torpedo electric organ "true" acetylcholinesterase (AcChoEase; EC 3.1.1.7). Using these probes, we isolated several cDNA clones from lambda gt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. In RNA blots of poly(A)+ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These findings demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species. Images PMID:3035536

Detection of hepatitis C virus sequences in brain tissue obtained in recurrent hepatitis C after liver transplantation.

PubMed

Vargas, Hugo E; Laskus, Tomasz; Radkowski, Marek; Wilkinson, Jeff; Balan, Vijay; Douglas, David D; Harrison, M Edwyn; Mulligan, David C; Olden, Kevin; Adair, Debra; Rakela, Jorge

2002-11-01

Patients with chronic hepatitis C frequently report tiredness, easy fatigability, and depression. The aim of this study is to determine whether hepatitis C virus (HCV) replication could be found in brain tissue in patients with hepatitis C and depression. We report two patients with recurrent hepatitis C after liver transplantation who also developed severe depression. One patient died of multiorgan failure and the other, septicemia caused by Staphylococcus aureussis. Both patients had evidence of severe hepatitis C recurrence with features of cholestatic fibrosing hepatitis. We were able to study samples of their central nervous system obtained at autopsy for evidence of HCV replication. The presence of HCV RNA-negative strand, which is the viral replicative form, was determined by strand-specific Tth-based reverse-transcriptase polymerase chain reaction. Viral sequences were compared by means of single-strand conformation polymorphism and direct sequencing. HCV RNA-negative strands were found in subcortical white matter from one patient and cerebral cortex from the other patient. HCV RNA-negative strands amplified from brain tissue differed by several nucleotide substitutions from serum consensus sequences in the 5' untranslated region. These findings support the concept of HCV neuroinvasion, and we speculate that it may provide a biological substrate to neuropsychiatric disorders observed in patients with chronic hepatitis C. The exact lineage of cells permissive for HCV replication and the possible interaction between viral replication and cerebral function that may lead to depression remain to be elucidated.

PCV: An Alignment Free Method for Finding Homologous Nucleotide Sequences and its Application in Phylogenetic Study.

PubMed

Kumar, Rajnish; Mishra, Bharat Kumar; Lahiri, Tapobrata; Kumar, Gautam; Kumar, Nilesh; Gupta, Rahul; Pal, Manoj Kumar

2017-06-01

Online retrieval of the homologous nucleotide sequences through existing alignment techniques is a common practice against the given database of sequences. The salient point of these techniques is their dependence on local alignment techniques and scoring matrices the reliability of which is limited by computational complexity and accuracy. Toward this direction, this work offers a novel way for numerical representation of genes which can further help in dividing the data space into smaller partitions helping formation of a search tree. In this context, this paper introduces a 36-dimensional Periodicity Count Value (PCV) which is representative of a particular nucleotide sequence and created through adaptation from the concept of stochastic model of Kolekar et al. (American Institute of Physics 1298:307-312, 2010. doi: 10.1063/1.3516320 ). The PCV construct uses information on physicochemical properties of nucleotides and their positional distribution pattern within a gene. It is observed that PCV representation of gene reduces computational cost in the calculation of distances between a pair of genes while being consistent with the existing methods. The validity of PCV-based method was further tested through their use in molecular phylogeny constructs in comparison with that using existing sequence alignment methods.

Sequence of rat alpha- and gamma-casein mRNAs: evolutionary comparison of the calcium-dependent rat casein multigene family.

PubMed Central

Hobbs, A A; Rosen, J M

1982-01-01

The complete sequences of rat alpha- and gamma-casein mRNAs have been determined. The 1402-nucleotide alpha- and 864-nucleotide gamma-casein mRNAs both encode 15 amino acid signal peptides and mature proteins of 269 and 164 residues, respectively. Considerable homology between the 5' non-coding regions, and the regions encoding the signal peptides and the phosphorylation sites, in these mRNAs as compared to several other rodent casein mRNAs, was observed. Significant homology was also detected between rat alpha- and bovine alpha s1-casein. Comparison of the rodent and bovine sequences suggests that the caseins evolved at about the time of the appearance of the primitive mammals. This may have occurred by intragenic duplication of a nucleotide sequence encoding a primitive phosphorylation site, -(Ser)n-Glu-Glu-, and intergenic duplication resulting in the small casein multigene family. A unique feature of the rat alpha-casein sequence is an insertion in the coding region containing 10 repeated elements of 18 nucleotides each. This insertion appears to have occurred 7-12 million years ago, just prior to the divergence of rat and mouse. Images PMID:6298707

EvoDB: a database of evolutionary rate profiles, associated protein domains and phylogenetic trees for PFAM-A

PubMed Central

Ndhlovu, Andrew; Durand, Pierre M.; Hazelhurst, Scott

2015-01-01

The evolutionary rate at codon sites across protein-coding nucleotide sequences represents a valuable tier of information for aligning sequences, inferring homology and constructing phylogenetic profiles. However, a comprehensive resource for cataloguing the evolutionary rate at codon sites and their corresponding nucleotide and protein domain sequence alignments has not been developed. To address this gap in knowledge, EvoDB (an Evolutionary rates DataBase) was compiled. Nucleotide sequences and their corresponding protein domain data including the associated seed alignments from the PFAM-A (protein family) database were used to estimate evolutionary rate (ω = dN/dS) profiles at codon sites for each entry. EvoDB contains 98.83% of the gapped nucleotide sequence alignments and 97.1% of the evolutionary rate profiles for the corresponding information in PFAM-A. As the identification of codon sites under positive selection and their position in a sequence profile is usually the most sought after information for molecular evolutionary biologists, evolutionary rate profiles were determined under the M2a model using the CODEML algorithm in the PAML (Phylogenetic Analysis by Maximum Likelihood) suite of software. Validation of nucleotide sequences against amino acid data was implemented to ensure high data quality. EvoDB is a catalogue of the evolutionary rate profiles and provides the corresponding phylogenetic trees, PFAM-A alignments and annotated accession identifier data. In addition, the database can be explored and queried using known evolutionary rate profiles to identify domains under similar evolutionary constraints and pressures. EvoDB is a resource for evolutionary, phylogenetic studies and presents a tier of information untapped by current databases. Database URL: http://www.bioinf.wits.ac.za/software/fire/evodb PMID:26140928

EvoDB: a database of evolutionary rate profiles, associated protein domains and phylogenetic trees for PFAM-A.

PubMed

Ndhlovu, Andrew; Durand, Pierre M; Hazelhurst, Scott

2015-01-01

The evolutionary rate at codon sites across protein-coding nucleotide sequences represents a valuable tier of information for aligning sequences, inferring homology and constructing phylogenetic profiles. However, a comprehensive resource for cataloguing the evolutionary rate at codon sites and their corresponding nucleotide and protein domain sequence alignments has not been developed. To address this gap in knowledge, EvoDB (an Evolutionary rates DataBase) was compiled. Nucleotide sequences and their corresponding protein domain data including the associated seed alignments from the PFAM-A (protein family) database were used to estimate evolutionary rate (ω = dN/dS) profiles at codon sites for each entry. EvoDB contains 98.83% of the gapped nucleotide sequence alignments and 97.1% of the evolutionary rate profiles for the corresponding information in PFAM-A. As the identification of codon sites under positive selection and their position in a sequence profile is usually the most sought after information for molecular evolutionary biologists, evolutionary rate profiles were determined under the M2a model using the CODEML algorithm in the PAML (Phylogenetic Analysis by Maximum Likelihood) suite of software. Validation of nucleotide sequences against amino acid data was implemented to ensure high data quality. EvoDB is a catalogue of the evolutionary rate profiles and provides the corresponding phylogenetic trees, PFAM-A alignments and annotated accession identifier data. In addition, the database can be explored and queried using known evolutionary rate profiles to identify domains under similar evolutionary constraints and pressures. EvoDB is a resource for evolutionary, phylogenetic studies and presents a tier of information untapped by current databases. © The Author(s) 2015. Published by Oxford University Press.

DNA Sequence-Dependent Ionic Currents in Ultra-Small Solid-State Nanopores†

PubMed Central

Comer, Jeffrey

2016-01-01

Measurements of ionic currents through nanopores partially blocked by DNA have emerged as a powerful method for characterization of the DNA nucleotide sequence. Although the effect of the nucleotide sequence on the nanopore blockade current has been experimentally demonstrated, prediction and interpretation of such measurements remain a formidable challenge. Using atomic resolution computational approaches, here we show how the sequence, molecular conformation, and pore geometry affect the blockade ionic current in model solid-state nanopores. We demonstrate that the blockade current from a DNA molecule is determined by the chemical identities and conformations of at least three consecutive nucleotides. We find the blockade currents produced by the nucleotide triplets to vary considerably with their nucleotide sequence despite having nearly identical molecular conformations. Encouragingly, we find blockade current differences as large as 25% for single-base substitutions in ultra small (1.6 nm × 1.1 nm cross section; 2 nm length) solid-state nanopores. Despite the complex dependence of the blockade current on the sequence and conformation of the DNA triplets, we find that, under many conditions, the number of thymine bases is positively correlated with the current, whereas the number of purine bases and the presence of both purine and pyrimidines in the triplet are negatively correlated with the current. Based on these observations, we construct a simple theoretical model that relates the ion current to the base content of a solid-state nanopore. Furthermore, we show that compact conformations of DNA in narrow pores provide the greatest signal-to-noise ratio for single base detection, whereas reduction of the nanopore length increases the ionic current noise. Thus, the sequence dependence of nanopore blockade current can be theoretically rationalized, although the predictions will likely need to be customized for each nanopore type. PMID:27103233

DNA sequence analysis of ARS elements from chromosome III of Saccharomyces cerevisiae: identification of a new conserved sequence.

PubMed Central

Palzkill, T G; Oliver, S G; Newlon, C S

1986-01-01

Four fragments of Saccharomyces cerevisiae chromosome III DNA which carry ARS elements have been sequenced. Each fragment contains multiple copies of sequences that have at least 10 out of 11 bases of homology to a previously reported 11 bp core consensus sequence. A survey of these new ARS sequences and previously reported sequences revealed the presence of an additional 11 bp conserved element located on the 3' side of the T-rich strand of the core consensus. Subcloning analysis as well as deletion and transposon insertion mutagenesis of ARS fragments support a role for 3' conserved sequence in promoting ARS activity. PMID:3529036

[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

PubMed

Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

1985-11-01

The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

Sequence-specific bias correction for RNA-seq data using recurrent neural networks.

PubMed

Zhang, Yao-Zhong; Yamaguchi, Rui; Imoto, Seiya; Miyano, Satoru

2017-01-25

The recent success of deep learning techniques in machine learning and artificial intelligence has stimulated a great deal of interest among bioinformaticians, who now wish to bring the power of deep learning to bare on a host of bioinformatical problems. Deep learning is ideally suited for biological problems that require automatic or hierarchical feature representation for biological data when prior knowledge is limited. In this work, we address the sequence-specific bias correction problem for RNA-seq data redusing Recurrent Neural Networks (RNNs) to model nucleotide sequences without pre-determining sequence structures. The sequence-specific bias of a read is then calculated based on the sequence probabilities estimated by RNNs, and used in the estimation of gene abundance. We explore the application of two popular RNN recurrent units for this task and demonstrate that RNN-based approaches provide a flexible way to model nucleotide sequences without knowledge of predetermined sequence structures. Our experiments show that training a RNN-based nucleotide sequence model is efficient and RNN-based bias correction methods compare well with the-state-of-the-art sequence-specific bias correction method on the commonly used MAQC-III data set. RNNs provides an alternative and flexible way to calculate sequence-specific bias without explicitly pre-determining sequence structures.

Molecular analysis of HIV strains from a cluster of worker infections in the adult film industry, Los Angeles 2004.

PubMed

Brooks, John T; Robbins, Kenneth E; Youngpairoj, Ae S; Rotblatt, Harlan; Kerndt, Peter R; Taylor, Melanie M; Daar, Eric S; Kalish, Marcia L

2006-04-04

In April 2004, 13 susceptible women were exposed to a single acutely HIV-1-infected man while employed to perform various sex acts for the production of adult films; three women were subsequently found to have acquired HIV infection (23% attack rate). As part of the investigation of this infection cluster, we evaluated whether viral strains collected from infected individuals were significantly related. We determined nucleotide sequences from the C2V3C3 and gp41 region of env and the p17 region of gag in viruses from the three infected individuals from whom specimens were available. We then compared these sequences phylogenetically to comparable sequences from available reference strains. Genotypic and phenotypic antiretroviral drug resistance was determined for plasma virus from the male index case and one female contact at a separate commercial laboratory. The env and gag sequences of the HIV strains from the male index case and two of the infected women were 100% similar. Genotyping of the male index case's virus identified 12 mutations, which represented known naturally occurring polymorphisms in the subtype B consensus sequence that are not associated with antiretroviral drug resistance. Genotyping of the virus from the female contact identified 10 mutations, all of which were shared by the virus from the male index case. Phenotyping demonstrated that both viruses were susceptible to all antiretroviral drugs tested. Molecular and virological data strongly support the epidemiological conclusion that these women were infected with an identical strain of HIV through occupational exposure to an individual with an acute HIV infection.

A Sequence-Independent Strategy for Detection and Cloning of Circular DNA Virus Genomes by Using Multiply Primed Rolling-Circle Amplification

PubMed Central

Rector, Annabel; Tachezy, Ruth; Van Ranst, Marc

2004-01-01

The discovery of novel viruses has often been accomplished by using hybridization-based methods that necessitate the availability of a previously characterized virus genome probe or knowledge of the viral nucleotide sequence to construct consensus or degenerate PCR primers. In their natural replication cycle, certain viruses employ a rolling-circle mechanism to propagate their circular genomes, and multiply primed rolling-circle amplification (RCA) with φ29 DNA polymerase has recently been applied in the amplification of circular plasmid vectors used in cloning. We employed an isothermal RCA protocol that uses random hexamer primers to amplify the complete genomes of papillomaviruses without the need for prior knowledge of their DNA sequences. We optimized this RCA technique with extracted human papillomavirus type 16 (HPV-16) DNA from W12 cells, using a real-time quantitative PCR assay to determine amplification efficiency, and obtained a 2.4 × 104-fold increase in HPV-16 DNA concentration. We were able to clone the complete HPV-16 genome from this multiply primed RCA product. The optimized protocol was subsequently applied to a bovine fibropapillomatous wart tissue sample. Whereas no papillomavirus DNA could be detected by restriction enzyme digestion of the original sample, multiply primed RCA enabled us to obtain a sufficient amount of papillomavirus DNA for restriction enzyme analysis, cloning, and subsequent sequencing of a novel variant of bovine papillomavirus type 1. The multiply primed RCA method allows the discovery of previously unknown papillomaviruses, and possibly also other circular DNA viruses, without a priori sequence information. PMID:15113879

Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

PubMed

Levis, R; Schlesinger, S; Huang, H V

1990-04-01

Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA.

The Functional Human C-Terminome

PubMed Central

Hedden, Michael; Lyon, Kenneth F.; Brooks, Steven B.; David, Roxanne P.; Limtong, Justin; Newsome, Jacklyn M.; Novakovic, Nemanja; Rajasekaran, Sanguthevar; Thapar, Vishal; Williams, Sean R.; Schiller, Martin R.

2016-01-01

All translated proteins end with a carboxylic acid commonly called the C-terminus. Many short functional sequences (minimotifs) are located on or immediately proximal to the C-terminus. However, information about the function of protein C-termini has not been consolidated into a single source. Here, we built a new “C-terminome” database and web system focused on human proteins. Approximately 3,600 C-termini in the human proteome have a minimotif with an established molecular function. To help evaluate the function of the remaining C-termini in the human proteome, we inferred minimotifs identified by experimentation in rodent cells, predicted minimotifs based upon consensus sequence matches, and predicted novel highly repetitive sequences in C-termini. Predictions can be ranked by enrichment scores or Gene Evolutionary Rate Profiling (GERP) scores, a measurement of evolutionary constraint. By searching for new anchored sequences on the last 10 amino acids of proteins in the human proteome with lengths between 3–10 residues and up to 5 degenerate positions in the consensus sequences, we have identified new consensus sequences that predict instances in the majority of human genes. All of this information is consolidated into a database that can be accessed through a C-terminome web system with search and browse functions for minimotifs and human proteins. A known consensus sequence-based predicted function is assigned to nearly half the proteins in the human proteome. Weblink: http://cterminome.bio-toolkit.com. PMID:27050421

Design and characterization of a nanopore-coupled polymerase for single-molecule DNA sequencing by synthesis on an electrode array

PubMed Central

Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.

2016-01-01

Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524

Molecular detection of viral agents in free-ranging and captive neotropical felids in Brazil.

PubMed

Furtado, Mariana M; Taniwaki, Sueli A; de Barros, Iracema N; Brandão, Paulo E; Catão-Dias, José L; Cavalcanti, Sandra; Cullen, Laury; Filoni, Claudia; Jácomo, Anah T de Almeida; Jorge, Rodrigo S P; Silva, Nairléia Dos Santos; Silveira, Leandro; Ferreira Neto, José S

2017-09-01

We describe molecular testing for felid alphaherpesvirus 1 (FHV-1), carnivore protoparvovirus 1 (CPPV-1), feline calicivirus (FCV), alphacoronavirus 1 (feline coronavirus [FCoV]), feline leukemia virus (FeLV), feline immunodeficiency virus (FIV), and canine distemper virus (CDV) in whole blood samples of 109 free-ranging and 68 captive neotropical felids from Brazil. Samples from 2 jaguars ( Panthera onca) and 1 oncilla ( Leopardus tigrinus) were positive for FHV-1; 2 jaguars, 1 puma ( Puma concolor), and 1 jaguarundi ( Herpairulus yagouaroundi) tested positive for CPPV-1; and 1 puma was positive for FIV. Based on comparison of 103 nucleotides of the UL24-UL25 gene, the FHV-1 sequences were 99-100% similar to the FHV-1 strain of domestic cats. Nucleotide sequences of CPPV-1 were closely related to sequences detected in other wild carnivores, comparing 294 nucleotides of the VP1 gene. The FIV nucleotide sequence detected in the free-ranging puma, based on comparison of 444 nucleotides of the pol gene, grouped with other lentiviruses described in pumas, and had 82.4% identity with a free-ranging puma from Yellowstone Park and 79.5% with a captive puma from Brazil. Our data document the circulation of FHV-1, CPPV-1, and FIV in neotropical felids in Brazil.

T box transcription antitermination riboswitch: Influence of nucleotide sequence and orientation on tRNA binding by the antiterminator element

PubMed Central

Fauzi, Hamid; Agyeman, Akwasi; Hines, Jennifer V.

2008-01-01

Many bacteria utilize riboswitch transcription regulation to monitor and appropriately respond to cellular levels of important metabolites or effector molecules. The T box transcription antitermination riboswitch responds to cognate uncharged tRNA by specifically stabilizing an antiterminator element in the 5′-untranslated mRNA leader region and precluding formation of a thermodynamically more stable terminator element. Stabilization occurs when the tRNA acceptor end base pairs with the first four nucleotides in the seven nucleotide bulge of the highly conserved antiterminator element. The significance of the conservation of the antiterminator bulge nucleotides that do not base pair with the tRNA is unknown, but they are required for optimal function. In vitro selection was used to determine if the isolated antiterminator bulge context alone dictates the mode in which the tRNA acceptor end binds the bulge nucleotides. No sequence conservation beyond complementarity was observed and the location was not constrained to the first four bases of the bulge. The results indicate that formation of a structure that recognizes the tRNA acceptor end in isolation is not the determinant driving force for the high phylogenetic sequence conservation observed within the antiterminator bulge. Additional factors or T box leader features more likely influenced the phylogenetic sequence conservation. PMID:19152843

A space-efficient algorithm for local similarities.

PubMed

Huang, X Q; Hardison, R C; Miller, W

1990-10-01

Existing dynamic-programming algorithms for identifying similar regions of two sequences require time and space proportional to the product of the sequence lengths. Often this space requirement is more limiting than the time requirement. We describe a dynamic-programming local-similarity algorithm that needs only space proportional to the sum of the sequence lengths. The method can also find repeats within a single long sequence. To illustrate the algorithm's potential, we discuss comparison of a 73,360 nucleotide sequence containing the human beta-like globin gene cluster and a corresponding 44,594 nucleotide sequence for rabbit, a problem well beyond the capabilities of other dynamic-programming software.

RoboOligo: software for mass spectrometry data to support manual and de novo sequencing of post-transcriptionally modified ribonucleic acids

PubMed Central

Sample, Paul J.; Gaston, Kirk W.; Alfonzo, Juan D.; Limbach, Patrick A.

2015-01-01

Ribosomal ribonucleic acid (RNA), transfer RNA and other biological or synthetic RNA polymers can contain nucleotides that have been modified by the addition of chemical groups. Traditional Sanger sequencing methods cannot establish the chemical nature and sequence of these modified-nucleotide containing oligomers. Mass spectrometry (MS) has become the conventional approach for determining the nucleotide composition, modification status and sequence of modified RNAs. Modified RNAs are analyzed by MS using collision-induced dissociation tandem mass spectrometry (CID MS/MS), which produces a complex dataset of oligomeric fragments that must be interpreted to identify and place modified nucleosides within the RNA sequence. Here we report the development of RoboOligo, an interactive software program for the robust analysis of data generated by CID MS/MS of RNA oligomers. There are three main functions of RoboOligo: (i) automated de novo sequencing via the local search paradigm. (ii) Manual sequencing with real-time spectrum labeling and cumulative intensity scoring. (iii) A hybrid approach, coined ‘variable sequencing’, which combines the user intuition of manual sequencing with the high-throughput sampling of automated de novo sequencing. PMID:25820423

Isolation and characterisation of mRNA encoding the salmon- and chicken-II type gonadotrophin-releasing hormones in the teleost fish Rutilus rutilus (Cyprinidae).

PubMed

Penlington, M C; Williams, M A; Sumpter, J P; Rand-Weaver, M; Hoole, D; Arme, C

1997-12-01

The complementary DNAs (cDNA) encoding the [Trp7,Leu8]-gonadotrophin-releasing hormone (salmon-type GnRH; sGnRH:GeneBank accession no. u60667) and the [His5,Trp7,Tyr8]-GnRH (chicken-II-type GnRH; cGnRH-II: GeneBank accession no. u60668) precursor in the roach (Rutilus rutilus) were isolated and sequenced following reverse transcription and rapid amplification of cDNA ends (RACE). The sGnRH and cGnRH-II precursor cDNAs consisted of 439 and 628 bp, and included open reading frames of 282 and 255 bp respectively. The structures of the encoded peptides were the same as GnRHs previously identified in other vertebrates. The sGnRH and cGnRH-II precursor cDNAs, including the non-coding regions, had 88.6 and 79.9% identity respectively, to those identified in goldfish (Carassius auratus). However, significant similarity was not observed between the non-coding regions of the GnRH cDNAs of Cyprinidae and other fish. The presumed third exon, encoding partial sGnRH associated peptide (GAP) of roach, demonstrated significant nucleotide and amino acid similarity with the appropriate regions in the goldfish, but not with other species, and this may indicate functional differences of GAP between different families of fish. cGnRH-II precursor cDNAs from roach had relatively high nucleotide similarity across this GnRH variant. Cladistic analysis classified the sGnRH and cGnRH-II precursor cDNAs into three and two groups respectively. However, the divergence between nucleotide sequences within the sGnRH variant was greater than those encoding the cGnRH-II precursors. Consistent with the consensus developed from previous studies, Northern blot analysis demonstrated that expression of sGnRH and cGnRH-II was restricted to the olfactory bulbs and midbrain of roach respectively. This work forms the basis for further study on the mechanisms by which the tapeworm, Ligula intestinalis, interacts with the pituitary-gonadal axis of its fish host.

Molecular characterization of a novel rhabdovirus infecting blackcurrant identified by high-throughput sequencing.

PubMed

Wu, L-P; Yang, T; Liu, H-W; Postman, J; Li, R

2018-05-01

A large contig with sequence similarities to several nucleorhabdoviruses was identified by high-throughput sequencing analysis from a black currant (Ribes nigrum L.) cultivar. The complete genome sequence of this new nucleorhabdovirus is 14,432 nucleotides long. Its genomic organization is very similar to those of unsegmented plant rhabdoviruses, containing six open reading frames in the order 3'-N-P-P3-M-G-L-5. The virus, which is provisionally named "black currant-associated rhabdovirus", is 41-52% identical in its genome nucleotide sequence to other nucleorhabdoviruses and may represent a new species in the genus Nucleorhabdovirus.

Differential sequence diversity at merozoite surface protein-1 locus of Plasmodium knowlesi from humans and macaques in Thailand.

PubMed

Putaporntip, Chaturong; Thongaree, Siriporn; Jongwutiwes, Somchai

2013-08-01

To determine the genetic diversity and potential transmission routes of Plasmodium knowlesi, we analyzed the complete nucleotide sequence of the gene encoding the merozoite surface protein-1 of this simian malaria (Pkmsp-1), an asexual blood-stage vaccine candidate, from naturally infected humans and macaques in Thailand. Analysis of Pkmsp-1 sequences from humans (n=12) and monkeys (n=12) reveals five conserved and four variable domains. Most nucleotide substitutions in conserved domains were dimorphic whereas three of four variable domains contained complex repeats with extensive sequence and size variation. Besides purifying selection in conserved domains, evidence of intragenic recombination scattering across Pkmsp-1 was detected. The number of haplotypes, haplotype diversity, nucleotide diversity and recombination sites of human-derived sequences exceeded that of monkey-derived sequences. Phylogenetic networks based on concatenated conserved sequences of Pkmsp-1 displayed a character pattern that could have arisen from sampling process or the presence of two independent routes of P. knowlesi transmission, i.e. from macaques to human and from human to humans in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.

First Complete Genome Sequence of an Isolate of Tomato Mottle Mosaic Virus Infecting Plants of Solanum lycopersicum in South America.

PubMed

Nagai, Alice; Duarte, Lígia M L; Chaves, Alexandre L R; Alexandre, Maria A V; Ramos-González, Pedro L; Chabi-Jesus, Camila; Harakava, Ricardo; Dos Santos, Déborah Y A C

2018-05-10

The complete nucleotide sequence of an isolate of tomato mottle mosaic virus (ToMMV) was determined. The virus, originally isolated from symptomatic tomato plants found in a county near the city of São Paulo, Brazil, has a genome with 99% nucleotide sequence identity with ToMMV from Mexico, China, Spain, and the United States. Copyright © 2018 Nagai et al.

A resource of single-nucleotide polymorphisms for rainbow trout generated by restriction-site associated DNA sequencing of doubled haploids

USDA-ARS?s Scientific Manuscript database

Salmonid genomes are considered to be in a pseudo-tetraploid state as a result of an evolutionarily recent genome duplication event. This situation complicates single nucleotide polymorphism (SNP) discovery in rainbow trout as many putative SNPs are actually paralogous sequence variants (PSVs) and ...

Nucleotide sequencing and serological evidence that the recently recognized deer tick virus is a genotype of Powassan virus.

PubMed

Beasley, D W; Suderman, M T; Holbrook, M R; Barrett, A D

2001-11-05

Deer tick virus (DTV) is a recently recognized North American virus isolated from Ixodes dammini ticks. Nucleotide sequencing of fragments of structural and non-structural protein genes suggested that this virus was most closely related to the tick-borne flavivirus Powassan (POW), which causes potentially fatal encephalitis in humans. To determine whether DTV represents a new and distinct member of the Flavivirus genus of the family Flaviviridae, we sequenced the structural protein genes and 5' and 3' non-coding regions of this virus. In addition, we compared the reactivity of DTV and POW in hemagglutination inhibition tests with a panel of polyclonal and monoclonal antisera, and performed cross-neutralization experiments using anti-DTV antisera. Nucleotide sequencing revealed a high degree of homology between DTV and POW at both nucleotide (>80% homology) and amino acid (>90% homology) levels, and the two viruses were indistinguishable in serological assays and mouse neuroinvasiveness. On the basis of these results, we suggest that DTV should be classified as a genotype of POW virus.

Application of Broad-Spectrum Resequencing Microarray for Genotyping Rhabdoviruses▿

PubMed Central

Dacheux, Laurent; Berthet, Nicolas; Dissard, Gabriel; Holmes, Edward C.; Delmas, Olivier; Larrous, Florence; Guigon, Ghislaine; Dickinson, Philip; Faye, Ousmane; Sall, Amadou A.; Old, Iain G.; Kong, Katherine; Kennedy, Giulia C.; Manuguerra, Jean-Claude; Cole, Stewart T.; Caro, Valérie; Gessain, Antoine; Bourhy, Hervé

2010-01-01

The rapid and accurate identification of pathogens is critical in the control of infectious disease. To this end, we analyzed the capacity for viral detection and identification of a newly described high-density resequencing microarray (RMA), termed PathogenID, which was designed for multiple pathogen detection using database similarity searching. We focused on one of the largest and most diverse viral families described to date, the family Rhabdoviridae. We demonstrate that this approach has the potential to identify both known and related viruses for which precise sequence information is unavailable. In particular, we demonstrate that a strategy based on consensus sequence determination for analysis of RMA output data enabled successful detection of viruses exhibiting up to 26% nucleotide divergence with the closest sequence tiled on the array. Using clinical specimens obtained from rabid patients and animals, this method also shows a high species level concordance with standard reference assays, indicating that it is amenable for the development of diagnostic assays. Finally, 12 animal rhabdoviruses which were currently unclassified, unassigned, or assigned as tentative species within the family Rhabdoviridae were successfully detected. These new data allowed an unprecedented phylogenetic analysis of 106 rhabdoviruses and further suggest that the principles and methodology developed here may be used for the broad-spectrum surveillance and the broader-scale investigation of biodiversity in the viral world. PMID:20610710

Apparent founder effect during the early years of the San Francisco HIV type 1 epidemic (1978-1979).

PubMed

Foley, B; Pan, H; Buchbinder, S; Delwart, E L

2000-10-10

HIV-1 envelope sequence variants were RT-PCR amplified from serum samples cryopreserved in San Francisco in 1978-1979. The HIV-1 subtype B env V3-V5 sequences from four homosexual men clustered phylogenetically, with a median nucleotide distance of 2.8%, reflecting a recent common origin. These early U.S. HIV-1 env variants mapped close to the phylogenetic root of the subtype B tree while env variants collected in the United States throughout the 1980s and 1990s showed, on average, increasing genetic diversity and divergence from the subtype B consensus sequence. These results indicate that the majority of HIV-1 currently circulating in the United States may be descended from an initial introduction and rapid spread during the mid- to late 1970s of subtype B viruses with limited variability (i.e., a founder effect). As expected from the starburst-shaped phylogeny of HIV-1 subtype B, contemporary U.S. strains were, on average, more closely related at the nucleic acid and amino acid levels to the earlier 1978-1979 env variants than to each other. The growing levels of HIV-1 genetic diversity, one of multiple obstacles in designing a protective vaccine, may therefore be mitigated by using epidemic founding variants as antigenic strains for protection against contemporary strains.

CBS mutations and MTFHR SNPs causative of hyperhomocysteinemia in Pakistani children.

PubMed

Ibrahim, Shahnaz; Maqbool, Saadia; Azam, Maleeha; Iqbal, Mohammad Perwaiz; Qamar, Raheel

2018-03-29

Three index patients with hyperhomocysteinemia and ocular anomalies were screened for cystathionine beta synthase (CBS) and methylenetetrahydrofolate reductase (MTHFR) polymorphisms. Genotyping of hyperhomocysteinemia associated MTHFR polymorphisms C677T (rs1801133) and A1298C (rs1801131) was done by PCR-restriction fragment length polymorphism. Sanger sequencing was performed for CBS exonic sequences along with consensus splice sites. In the case of MTHFR polymorphisms, all the patients were heterozygous CT for the single nucleotide polymorphism (SNP) C677T and were therefore carriers of the risk allele (T), while the patients were homozygous CC for the risk genotype of the SNP A1298C. CBS sequencing resulted in the identification of two novel mutations, a missense change (c.467T>C; p.Leu156Pro) in exon 7 and an in-frame deletion (c.808_810del; p.Glu270del) in exon 10. In addition, a recurrent missense mutation (c.770C>T; p.Thr257Met) in exon 10 of the gene was also identified. The mutations were present homozygously in the patients and were inherited from the carrier parents. This is the first report from Pakistan where novel as well as recurrent CBS mutations causing hyperhomocysteinemia and lens dislocation in three patients from different families are being reported with the predicted effect of the risk allele of the MTHFR SNP in causing hyperhomocysteinemia.

A High Density Genetic Map Derived from RAD Sequencing and Its Application in QTL Analysis of Yield-Related Traits in Vigna unguiculata

PubMed Central

Pan, Lei; Wang, Nian; Wu, Zhihua; Guo, Rui; Yu, Xiaolu; Zheng, Yu; Xia, Qiuju; Gui, Songtao; Chen, Chanyou

2017-01-01

Cowpea [Vigna unguiculata (L.) Walp.] is an annual legume of economic importance and widely grown in the semi-arid tropics. However, high-density genetic maps of cowpea are still lacking. Here, we identified 34,868 SNPs (single nucleotide polymorphisms) that were distributed in the cowpea genome based on the RAD sequencing (restriction-site associated DNA sequencing) technique using a population of 170 individuals (two cowpea parents and 168 F2:3 progenies). Of these, 17,996 reliable SNPs were allotted to 11 consensus linkage groups (LGs). The length of the genetic map was 1,194.25 cM in total with a mean distance of 0.066 cM/SNP marker locus. Using this map and the F2:3 population, combined with the CIM (composite interval mapping) method, eleven quantitative trait loci (QTL) of yield-related trait were detected on seven LGs (LG4, 5, 6, 7, 9, 10, and 11) in cowpea. These QTL explained 0.05–17.32% of the total phenotypic variation. Among these, four QTL were for pod length, four QTL for thousand-grain weight (TGW), two QTL for grain number per pod, and one QTL for carpopodium length. Our results will provide a foundation for understanding genes related to grain yield in the cowpea and genus Vigna. PMID:28936219

Tidying Up International Nucleotide Sequence Databases: Ecological, Geographical and Sequence Quality Annotation of ITS Sequences of Mycorrhizal Fungi

PubMed Central

Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R. Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M.; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas

2011-01-01

Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi. PMID:21949797

Gause's Principle and the Effect of Resource Partitioning on the Dynamical Coexistence of Replicating Templates

PubMed Central

Szilágyi, András; Zachar, István; Szathmáry, Eörs

2013-01-01

Models of competitive template replication, although basic for replicator dynamics and primordial evolution, have not yet taken different sequences explicitly into account, neither have they analyzed the effect of resource partitioning (feeding on different resources) on coexistence. Here we show by analytical and numerical calculations that Gause's principle of competitive exclusion holds for template replicators if resources (nucleotides) affect growth linearly and coexistence is at fixed point attractors. Cases of complementary or homologous pairing between building blocks with parallel or antiparallel strands show no deviation from the rule that the nucleotide compositions of stably coexisting species must be different and there cannot be more coexisting replicator species than nucleotide types. Besides this overlooked mechanism of template coexistence we show also that interesting sequence effects prevail as parts of sequences that are copied earlier affect coexistence more strongly due to the higher concentration of the corresponding replication intermediates. Template and copy always count as one species due their constraint of strict stoichiometric coupling. Stability of fixed-point coexistence tends to decrease with the length of sequences, although this effect is unlikely to be detrimental for sequences below 100 nucleotides. In sum, resource partitioning (niche differentiation) is the default form of competitive coexistence for replicating templates feeding on a cocktail of different nucleotides, as it may have been the case in the RNA world. Our analysis of different pairing and strand orientation schemes is relevant for artificial and potentially astrobiological genetics. PMID:23990769

Genome Survey Sequencing of Luffa Cylindrica L. and Microsatellite High Resolution Melting (SSR-HRM) Analysis for Genetic Relationship of Luffa Genotypes.

PubMed

An, Jianyu; Yin, Mengqi; Zhang, Qin; Gong, Dongting; Jia, Xiaowen; Guan, Yajing; Hu, Jin

2017-09-11

Luffa cylindrica (L.) Roem. is an economically important vegetable crop in China. However, the genomic information on this species is currently unknown. In this study, for the first time, a genome survey of L. cylindrica was carried out using next-generation sequencing (NGS) technology. In total, 43.40 Gb sequence data of L. cylindrica , about 54.94× coverage of the estimated genome size of 789.97 Mb, were obtained from HiSeq 2500 sequencing, in which the guanine plus cytosine (GC) content was calculated to be 37.90%. The heterozygosity of genome sequences was only 0.24%. In total, 1,913,731 contigs (>200 bp) with 525 bp N 50 length and 1,410,117 scaffolds (>200 bp) with 885.01 Mb total length were obtained. From the initial assembled L. cylindrica genome, 431,234 microsatellites (SSRs) (≥5 repeats) were identified. The motif types of SSR repeats included 62.88% di-nucleotide, 31.03% tri-nucleotide, 4.59% tetra-nucleotide, 0.96% penta-nucleotide and 0.54% hexa-nucleotide. Eighty genomic SSR markers were developed, and 51/80 primers could be used in both "Zheda 23" and "Zheda 83". Nineteen SSRs were used to investigate the genetic diversity among 32 accessions through SSR-HRM analysis. The unweighted pair group method analysis (UPGMA) dendrogram tree was built by calculating the SSR-HRM raw data. SSR-HRM could be effectively used for genotype relationship analysis of Luffa species.

DNA sequence-based comparative studies between non-extremophile and extremophile organisms with implications in exobiology

NASA Astrophysics Data System (ADS)

Holden, Todd; Marchese, P.; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Sullivan, R.; Schneider, P.; Flamholz, A.; Lieberman, D.; Cheung, T.

2008-08-01

We have characterized function related DNA sequences of various organisms using informatics techniques, including fractal dimension calculation, nucleotide and multi-nucleotide statistics, and sequence fluctuation analysis. Our analysis shows trends which differentiate extremophile from non-extremophile organisms, which could be reproduced in extraterrestrial life. Among the systems studied are radiation repair genes, genes involved in thermal shocks, and genes involved in drug resistance. We also evaluate sequence level changes that have occurred during short term evolution (several thousand generations) under extreme conditions.

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

PubMed

Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome

PubMed Central

Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274

Isolation and characterization of target sequences of the chicken CdxA homeobox gene.

PubMed Central

Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A

1993-01-01

The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943

Compilation of mRNA Polyadenylation Signals in Arabidopsis Revealed a New Signal Element and Potential Secondary Structures1[w

PubMed Central

Loke, Johnny C.; Stahlberg, Eric A.; Strenski, David G.; Haas, Brian J.; Wood, Paul Chris; Li, Qingshun Quinn

2005-01-01

Using a novel program, SignalSleuth, and a database containing authenticated polyadenylation [poly(A)] sites, we analyzed the composition of mRNA poly(A) signals in Arabidopsis (Arabidopsis thaliana), and reevaluated previously described cis-elements within the 3′-untranslated (UTR) regions, including near upstream elements and far upstream elements. As predicted, there are absences of high-consensus signal patterns. The AAUAAA signal topped the near upstream elements patterns and was found within the predicted location to only approximately 10% of 3′-UTRs. More importantly, we identified a new set, named cleavage elements, of poly(A) signals flanking both sides of the cleavage site. These cis-elements were not previously revealed by conventional mutagenesis and are contemplated as a cluster of signals for cleavage site recognition. Moreover, a single-nucleotide profile scan on the 3′-UTR regions unveiled a distinct arrangement of alternate stretches of U and A nucleotides, which led to a prediction of the formation of secondary structures. Using an RNA secondary structure prediction program, mFold, we identified three main types of secondary structures on the sequences analyzed. Surprisingly, these observed secondary structures were all interrupted in previously constructed mutations in these regions. These results will enable us to revise the current model of plant poly(A) signals and to develop tools to predict 3′-ends for gene annotation. PMID:15965016

Nucleotide Sequence Database Comparison for Routine Dermatophyte Identification by Internal Transcribed Spacer 2 Genetic Region DNA Barcoding.

PubMed

Normand, A C; Packeu, A; Cassagne, C; Hendrickx, M; Ranque, S; Piarroux, R

2018-05-01

Conventional dermatophyte identification is based on morphological features. However, recent studies have proposed to use the nucleotide sequences of the rRNA internal transcribed spacer (ITS) region as an identification barcode of all fungi, including dermatophytes. Several nucleotide databases are available to compare sequences and thus identify isolates; however, these databases often contain mislabeled sequences that impair sequence-based identification. We evaluated five of these databases on a clinical isolate panel. We selected 292 clinical dermatophyte strains that were prospectively subjected to an ITS2 nucleotide sequence analysis. Sequences were analyzed against the databases, and the results were compared to clusters obtained via DNA alignment of sequence segments. The DNA tree served as the identification standard throughout the study. According to the ITS2 sequence identification, the majority of strains (255/292) belonged to the genus Trichophyton , mainly T. rubrum complex ( n = 184), T. interdigitale ( n = 40), T. tonsurans ( n = 26), and T. benhamiae ( n = 5). Other genera included Microsporum (e.g., M. canis [ n = 21], M. audouinii [ n = 10], Nannizzia gypsea [ n = 3], and Epidermophyton [ n = 3]). Species-level identification of T. rubrum complex isolates was an issue. Overall, ITS DNA sequencing is a reliable tool to identify dermatophyte species given that a comprehensive and correctly labeled database is consulted. Since many inaccurate identification results exist in the DNA databases used for this study, reference databases must be verified frequently and amended in line with the current revisions of fungal taxonomy. Before describing a new species or adding a new DNA reference to the available databases, its position in the phylogenetic tree must be verified. Copyright © 2018 American Society for Microbiology.

Complete genome sequence analysis of novel human bocavirus reveals genetic recombination between human bocavirus 2 and human bocavirus 4.

PubMed

Khamrin, Pattara; Okitsu, Shoko; Ushijima, Hiroshi; Maneekarn, Niwat

2013-07-01

Epidemiological surveillance of human bocavirus (HBoV) was conducted on fecal specimens collected from hospitalized children with diarrhea in Chiang Mai, Thailand in 2011. By partial sequence analysis of VP1 gene, an unusual strain of HBoV (CMH-S011-11), was initially identified as HBoV4. The complete genome sequence of CMH-S011-11 was performed and analyzed further to clarify whether it was a recombinant strain or a new HBoV variant. Analysis of complete genome sequence revealed that the coding sequence starting from NS1, NP1 to VP1/VP2 was 4795 nucleotides long. Interestingly, the nucleotide sequence of NS1 gene of CMH-S011-11 was most closely related to the HBoV2 reference strains detected in Pakistan, which contradicted to the initial genotyping result of the partial VP1 region in the previous study. In addition, comparison of NP1 nucleotide sequence of CMH-S011-11 with those of other HBoV1-4 reference strains also revealed a high level of sequence identity with HBoV2. On the other hand, nucleotide sequence of VP1/VP2 gene of CMH-S011-11 was most closely related to those of HBoV4 reference strains detected in Nigeria. The overall full-length sequence analysis revealed that this CMH-S011-11 was grouped within HBoV4 species, but located in a separate branch from other HBoV4 prototype strains. Recombination analysis revealed that CMH-S011-11 was the result of recombination between HBoV2 and HBoV4 strains with the break point located near the start codon of VP2. Copyright © 2013 Elsevier B.V. All rights reserved.

Masking as an effective quality control method for next-generation sequencing data analysis.

PubMed

Yun, Sajung; Yun, Sijung

2014-12-13

Next generation sequencing produces base calls with low quality scores that can affect the accuracy of identifying simple nucleotide variation calls, including single nucleotide polymorphisms and small insertions and deletions. Here we compare the effectiveness of two data preprocessing methods, masking and trimming, and the accuracy of simple nucleotide variation calls on whole-genome sequence data from Caenorhabditis elegans. Masking substitutes low quality base calls with 'N's (undetermined bases), whereas trimming removes low quality bases that results in a shorter read lengths. We demonstrate that masking is more effective than trimming in reducing the false-positive rate in single nucleotide polymorphism (SNP) calling. However, both of the preprocessing methods did not affect the false-negative rate in SNP calling with statistical significance compared to the data analysis without preprocessing. False-positive rate and false-negative rate for small insertions and deletions did not show differences between masking and trimming. We recommend masking over trimming as a more effective preprocessing method for next generation sequencing data analysis since masking reduces the false-positive rate in SNP calling without sacrificing the false-negative rate although trimming is more commonly used currently in the field. The perl script for masking is available at http://code.google.com/p/subn/. The sequencing data used in the study were deposited in the Sequence Read Archive (SRX450968 and SRX451773).

Characterization of the repetitive DNA elements in the genome of fish lymphocystis disease viruses.

PubMed

Schnitzler, P; Darai, G

1989-09-01

The complete DNA nucleotide sequence of the repetitive DNA elements in the genome of fish lymphocystis disease virus (FLDV) isolated from two different species (flounder and dab) was determined. The size of these repetitive DNA elements was found to be 1413 bp which corresponds to the DNA sequences of the 5' terminus of the EcoRI DNA fragment B (0.034 to 0.052 m.u.) and to the EcoRI DNA fragment M (0.718 to 0.736 m.u.) of the FLDV genome causing lymphocystis disease in flounder and plaice. The degree of DNA nucleotide homology between both regions was found to be 99%. The repetitive DNA element in the genome of FLDV isolated from other fish species (dab) was identified and is located within the EcoRI DNA fragment B and J of the viral genome. The DNA nucleotide sequence of one duplicate of this repetition (EcoRI DNA fragment J) was determined (1410 bp) and compared to the DNA nucleotide sequences of the repetitive DNA elements of the genome of FLDV isolated from flounder. It was found that the repetitive DNA elements of the genome of FLDV derived from two different fish species are highly conserved and possess a degree of DNA sequence homology of 94%. The DNA sequences of each strand of the individual repetitive element possess one open reading frame.

ANCAC: amino acid, nucleotide, and codon analysis of COGs--a tool for sequence bias analysis in microbial orthologs.

PubMed

Meiler, Arno; Klinger, Claudia; Kaufmann, Michael

2012-09-08

The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

PubMed Central

2012-01-01

Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836

Automated Sanger Analysis Pipeline (ASAP): A Tool for Rapidly Analyzing Sanger Sequencing Data with Minimum User Interference.

PubMed

Singh, Aditya; Bhatia, Prateek

2016-12-01

Sanger sequencing platforms, such as applied biosystems instruments, generate chromatogram files. Generally, for 1 region of a sequence, we use both forward and reverse primers to sequence that area, in that way, we have 2 sequences that need to be aligned and a consensus generated before mutation detection studies. This work is cumbersome and takes time, especially if the gene is large with many exons. Hence, we devised a rapid automated command system to filter, build, and align consensus sequences and also optionally extract exonic regions, translate them in all frames, and perform an amino acid alignment starting from raw sequence data within a very short time. In full capabilities of Automated Mutation Analysis Pipeline (ASAP), it is able to read "*.ab1" chromatogram files through command line interface, convert it to the FASTQ format, trim the low-quality regions, reverse-complement the reverse sequence, create a consensus sequence, extract the exonic regions using a reference exonic sequence, translate the sequence in all frames, and align the nucleic acid and amino acid sequences to reference nucleic acid and amino acid sequences, respectively. All files are created and can be used for further analysis. ASAP is available as Python 3.x executable at https://github.com/aditya-88/ASAP. The version described in this paper is 0.28.

Single nucleotide polymorphisms in common bean: their discovery and genotyping using a multiplex detection system

USDA-ARS?s Scientific Manuscript database

Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...

An integrated genetic linkage map of watermelon and genetic diversity based on single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers

USDA-ARS?s Scientific Manuscript database

Watermelon (Citrullus lanatus var. lanatus) is an important vegetable fruit throughout the world. A high number of single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers should provide large coverage of the watermelon genome and high phylogenetic resolution of germplasm acces...

A new begomovirus associated with alpha- and betasatellite molecules isolated from Vernonia cinerea in China.

PubMed

Zulfiqar, Awais; Zhang, Jie; Cui, Xiaofeng; Qian, Yajuan; Zhou, Xueping; Xie, Yan

2012-01-01

A begomovirus disease complex associated with Vernonia cinerea showing yellow vein symptoms was studied. The full-length genomic DNA was comprised of 2739 nucleotides (nt) and contained the typical genome structure of begomoviruses. Comparison analysis showed that it shared the highest (78.9%) nucleotide sequence identity with recently characterized Vernonia yellow vein virus (VeYVV) from India. For associated satellites, betasatellite showed the highest nucleotide sequence identity (52.1%) with Vernonia yellow vein virus betasatellite (VeYVVB) and alphasatellite shared the highest sequence identity (70.7%) with Gossypium mustelinium symptomless alphasatellite (GMusSLA). It is a member of a distinct species with cognate alpha- and betasatellites for which the name Vernonia yellow vein Fujian virus (VeYVFjV) is proposed.

The complete nucleotide sequence of the barley yellow dwarf GPV isolate from China shows that it is a new member of the genus Polerovirus.

PubMed

Zhang, Wenwei; Cheng, Zhuomin; Xu, Lei; Wu, Maosen; Waterhouse, Peter; Zhou, Guanghe; Li, Shifang

2009-01-01

The complete nucleotide sequence of the ssRNA genome of a Chinese GPV isolate of barley yellow dwarf virus (BYDV) was determined. It comprised 5673 nucleotides, and the deduced genome organization resembled that of members of the genus Polerovirus. It was most closely related to cereal yellow dwarf virus-RPV (77% nt identity over the entire genome; coat protein amino acid identity 79%). The GPV isolate also differs in vector specificity from other BYDV strains. Biological properties, phylogenetic analyses and detailed sequence comparisons suggest that GPV should be considered a member of a new species within the genus, and the name Wheat yellow dwarf virus-GPV is proposed.

Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

PubMed Central

Levis, R; Schlesinger, S; Huang, H V

1990-01-01

Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA. Images PMID:2319651

Molecular identification of Trichuris vulpis and Trichuris suis isolated from different hosts.

PubMed

Cutillas, Cristina; de Rojas, Manuel; Ariza, Concepción; Ubeda, José Manuel; Guevara, Diego

2007-01-01

Trichuris suis was isolated from the cecum of two different hosts (Sus scrofa domestica -- swine and Sus scrofa scrofa -- wild boar) and Trichuris vulpis from dogs in Sevilla, Spain. Genomic DNA was isolated and internal transcribed spacers (ITS)1-5.8S-ITS2 segment from the ribosomal DNA (rDNA) was amplified and sequenced using polymerase chain reaction techniques. The sequence of T. suis from both hosts was 1,396 bp in length while that of T. vulpis was 1,044 bp. ITS1 of both populations isolated of T. suis was 661 nucleotides in length, while the ITS2 was 534 nucleotides in length. Furthermore, the ITS1 of T. vulpis was 410 nucleotides in length, while the ITS2 was 433 nucleotides in length. One hundred fifty-four nucleotides were observed along the 5.8S gene of T. suis and T. vulpis. Intraindividual and intraspecific variations were detected in the rDNA of both species. The presence of microsatellites was observed in all the individuals assayed. Sequence analysis of the ITSs and the 5.8S gene has demonstrated no sequence differences between T. suis isolated from both hosts (S. scrofa domestica -- swine and S. scrofa scrofa -- wild boar). Nevertheless, clear differences were detected between the ITS1 and ITS2 of T. suis and T. vulpis. Furthermore, a comparative molecular analysis between both species and the previously published ITS1-5.8S-ITS2 sequence data of Trichuris ovis, Trichuris leporis, Trichuris muris, Trichuris arvicolae, and Trichuris skrjabini was carried out. A common homology zone was detected in the ITS1 sequence of all species of trichurids.

Genetic variation in potential Giardia vaccine candidates cyst wall protein 2 and α1-giardin.

PubMed

Radunovic, Matej; Klotz, Christian; Saghaug, Christina Skår; Brattbakk, Hans-Richard; Aebischer, Toni; Langeland, Nina; Hanevik, Kurt

2017-08-01

Giardia is a prevalent intestinal parasitic infection. The trophozoite structural protein a1-giardin (a1-g) and the cyst protein cyst wall protein 2 (CWP2) have shown promise as Giardia vaccine antigen candidates in murine models. The present study assesses the genetic diversity of a1-g and CWP2 between and within assemblages A and B in human clinical isolates. a1-g and CWP2 sequences were acquired from 15 Norwegian isolates by PCR amplification and 20 sequences from German cultured isolates by whole genome sequencing. Sequences were aligned to reference genomes from assemblage A2 and B to identify genetic variance. Genetic diversity was found between assemblage A and B reference sequences for both a1-g (90.8% nucleotide identity) and CWP2 (82.5% nucleotide identity). However, for a1-g, this translated into only 3 amino acid (aa) substitutions, while for CWP2 there were 41 aa substitutions, and also one aa deletion. Genetic diversity within assemblage B was larger; nucleotide identity 92.0% for a1-g and 94.3% for CWP2, than within assemblage A (nucleotide identity 99.0% for a1-g and 99.7% for CWP2). For CWP2, the diversity on both nucleotide and protein level was higher in the C-terminal end. Predicted antigenic epitopes were not affected for a1-g, but partially for CWP2. Despite genetic diversity in a1-g, we found aa sequence, characteristics, and antigenicity to be well preserved. CWP2 showed more aa variance and potential antigenic differences. Several CWP2 antigens might be necessary in a future Giardia vaccine to provide cross protection against both Giardia assemblages infecting humans.

Complete nucleotide sequence and genome structure of a Japanese isolate of hibiscus latent Fort Pierce virus, a unique tobamovirus that contains an internal poly(A) region in its 3' end.

PubMed

Yoshida, Tetsuya; Kitazawa, Yugo; Komatsu, Ken; Neriya, Yutaro; Ishikawa, Kazuya; Fujita, Naoko; Hashimoto, Masayoshi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou

2014-11-01

In this study, we detected a Japanese isolate of hibiscus latent Fort Pierce virus (HLFPV-J), a member of the genus Tobamovirus, in a hibiscus plant in Japan and determined the complete sequence and organization of its genome. HLFPV-J has four open reading frames (ORFs), each of which shares more than 98 % nucleotide sequence identity with those of other HLFPV isolates. Moreover, HLFPV-J contains a unique internal poly(A) region of variable length, ranging from 44 to 78 nucleotides, in its 3'-untranslated region (UTR), as is the case with hibiscus latent Singapore virus (HLSV), another hibiscus-infecting tobamovirus. The length of the HLFPV-J genome was 6431 nucleotides, including the shortest internal poly(A) region. The sequence identities of ORFs 1, 2, 3 and 4 of HLFPV-J to other tobamoviruses were 46.6-68.7, 49.9-70.8, 31.0-70.8 and 39.4-70.1 %, respectively, at the nucleotide level and 39.8-75.0, 43.6-77.8, 19.2-70.4 and 31.2-74.2 %, respectively, at the amino acid level. The 5'- and 3'-UTRs of HLFPV-J showed 24.3-58.6 and 13.0-79.8 % identity, respectively, to other tobamoviruses. In particular, when compared to other tobamoviruses, each ORF and UTR of HLFPV-J showed the highest sequence identity to those of HLSV. Phylogenetic analysis showed that HLFPV-J, other HLFPV isolates and HLSV constitute a malvaceous-plant-infecting tobamovirus cluster. These results indicate that the genomic structure of HLFPV-J has unique features similar to those of HLSV. To our knowledge, this is the first report of the complete genome sequence of HLFPV.

Final Report for LDRD Project 02-ERD-069: Discovering the Unknown Mechanism(s) of Virulence in a BW, Class A Select Agent

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chain, P; Garcia, E

2003-02-06

The goal of this proposed effort was to assess the difficulty in identifying and characterizing virulence candidate genes in an organism for which very limited data exists. This was accomplished by first addressing the finishing phase of draft-sequenced F. tularensis genomes and conducting comparative analyses to determine the coding potential of each genome; to discover the differences in genome structure and content, and to identify potential genes whose products may be involved in the F. tularensis virulence process. The project was divided into three parts: (1) Genome finishing: This part involves determining the order and orientation of the consensus sequencesmore » of contigs obtained from Phrap assemblies of random draft genomic sequences. This tedious process consists of linking contig ends using information embedded in each sequence file that relates the sequence to the original cloned insert. Since inserts are sequenced from both ends, we can establish a link between these paired-ends in different contigs and thus order and orient contigs. Since these genomes carry numerous copies of insertion sequences, these repeated elements ''confuse'' the Phrap assembly program. It is thus necessary to break these contigs apart at the repeated sequences and individually join the proper flanking regions using paired-end information, or using results of comparisons against a similar genome. Larger repeated elements such as the small subunit ribosomal RNA operon require verification with PCR. Tandem repeats require manual intervention and typically rely on single nucleotide polymorphisms to be resolved. Remaining gaps require PCR reactions and sequencing. Once the genomes have been ''closed'', low quality regions are addressed by resequencing reactions. (2) Genome analysis: The final consensus sequences are processed by combining the results of three gene modelers: Glimmer, Critica and Generation. The final gene models are submitted to a battery of homology searches and domain prediction programs in order to annotate them (e.g. BLAST, Pfam, TIGRfam, COG, KEGG, InterPro, TMhmm, SignalP). The genome structure is also assessed in terms of G+C content, GC bias (GC skew), and locations of repeated regions (e.g. IS elements) and phage-like genes. (3) Comparative genomics: The results of the various genome analyses are compared between the finished (or almost finished) genomes. Here, we have compared the F. tularensis genomes from the extremely lethal strain Schu4 (subsp. tularensis), the vaccine strain LVS (subsp. holartica), and strain UT01-4992 of the less virulent, opportunistic subsp. novicida. Regions present in the highly virulent strain that are absent from the other less virulent strains may provide insight into what factors are required for the high level of virulence.« less

De-MetaST-BLAST: A Tool for the Validation of Degenerate Primer Sets and Data Mining of Publicly Available Metagenomes

PubMed Central

Gulvik, Christopher A.; Effler, T. Chad; Wilhelm, Steven W.; Buchan, Alison

2012-01-01

Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies). Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s) and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI’s BLAST (De-MetaST-BLAST), the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications. PMID:23189198

Iterative Correction of Reference Nucleotides (iCORN) using second generation sequencing technology.

PubMed

Otto, Thomas D; Sanders, Mandy; Berriman, Matthew; Newbold, Chris

2010-07-15

The accuracy of reference genomes is important for downstream analysis but a low error rate requires expensive manual interrogation of the sequence. Here, we describe a novel algorithm (Iterative Correction of Reference Nucleotides) that iteratively aligns deep coverage of short sequencing reads to correct errors in reference genome sequences and evaluate their accuracy. Using Plasmodium falciparum (81% A + T content) as an extreme example, we show that the algorithm is highly accurate and corrects over 2000 errors in the reference sequence. We give examples of its application to numerous other eukaryotic and prokaryotic genomes and suggest additional applications. The software is available at http://icorn.sourceforge.net

Isolated nucleic acids encoding antipathogenic polypeptides and uses thereof

DOEpatents

Altier, Daniel J.; Crane, Virginia C.; Ellanskaya, Irina; Ellanskaya, Natalia; Gilliam, Jacob T.; Hunter-Cevera, Jennie; Presnail, James K.; Schepers, Eric J.; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser

2010-04-20

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from fungal fermentation broths. Nucleic acids that encode the antipathogenic polypeptides are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention are also disclosed.

Nucleotide sequence and proposed secondary structure of Columnea latent viroid: a natural mosaic of viroid sequences.

PubMed Central

Hammond, R; Smith, D R; Diener, T O

1989-01-01

The Columnea latent viroid (CLV) occurs latently in certain Columnea erythrophae plants grown commercially. In potato and tomato, CLV causes potato spindle tuber viroid (PSTV)-like symptoms. Its nucleotide sequence and proposed secondary structure reveal that CLV consists of a single-stranded circular RNA of 370 nucleotides which can assume a rod-like structure with extensive base-pairing characteristic of all known viroids. The electrophoretic mobility of circular CLV under nondenaturing conditions suggests a potential tertiary structure. CLV contains extensive sequence homologies to the PSTV group of viroids but contains a central conserved region identical to that of hop stunt viroid (HSV). CLV also shares some biological properties with each of the two types of viroids. Most probably, CLV is the result of intracellular RNA recombination between an HSV-type and one or more PSTV-type viroids replicating in the same plant. Images PMID:2602114

GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts

PubMed Central

Naito, Yuki; Bono, Hidemasa

2012-01-01

GGRNA (http://GGRNA.dbcls.jp/) is a Google-like, ultrafast search engine for genes and transcripts. The web server accepts arbitrary words and phrases, such as gene names, IDs, gene descriptions, annotations of gene and even nucleotide/amino acid sequences through one simple search box, and quickly returns relevant RefSeq transcripts. A typical search takes just a few seconds, which dramatically enhances the usability of routine searching. In particular, GGRNA can search sequences as short as 10 nt or 4 amino acids, which cannot be handled easily by popular sequence analysis tools. Nucleotide sequences can be searched allowing up to three mismatches, or the query sequences may contain degenerate nucleotide codes (e.g. N, R, Y, S). Furthermore, Gene Ontology annotations, Enzyme Commission numbers and probe sequences of catalog microarrays are also incorporated into GGRNA, which may help users to conduct searches by various types of keywords. GGRNA web server will provide a simple and powerful interface for finding genes and transcripts for a wide range of users. All services at GGRNA are provided free of charge to all users. PMID:22641850

GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.

PubMed

Naito, Yuki; Bono, Hidemasa

2012-07-01

GGRNA (http://GGRNA.dbcls.jp/) is a Google-like, ultrafast search engine for genes and transcripts. The web server accepts arbitrary words and phrases, such as gene names, IDs, gene descriptions, annotations of gene and even nucleotide/amino acid sequences through one simple search box, and quickly returns relevant RefSeq transcripts. A typical search takes just a few seconds, which dramatically enhances the usability of routine searching. In particular, GGRNA can search sequences as short as 10 nt or 4 amino acids, which cannot be handled easily by popular sequence analysis tools. Nucleotide sequences can be searched allowing up to three mismatches, or the query sequences may contain degenerate nucleotide codes (e.g. N, R, Y, S). Furthermore, Gene Ontology annotations, Enzyme Commission numbers and probe sequences of catalog microarrays are also incorporated into GGRNA, which may help users to conduct searches by various types of keywords. GGRNA web server will provide a simple and powerful interface for finding genes and transcripts for a wide range of users. All services at GGRNA are provided free of charge to all users.

Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.

PubMed Central

Schnare, M N; Gray, M W

1982-01-01

In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. Images PMID:7079176

The C-terminal Helix of Pseudomonas aeruginosa Elongation Factor Ts Tunes EF-Tu Dynamics to Modulate Nucleotide Exchange.

PubMed

De Laurentiis, Evelina Ines; Mercier, Evan; Wieden, Hans-Joachim

2016-10-28

Little is known about the conservation of critical kinetic parameters and the mechanistic strategies of elongation factor (EF) Ts-catalyzed nucleotide exchange in EF-Tu in bacteria and particularly in clinically relevant pathogens. EF-Tu from the clinically relevant pathogen Pseudomonas aeruginosa shares over 84% sequence identity with the corresponding elongation factor from Escherichia coli Interestingly, the functionally closely linked EF-Ts only shares 55% sequence identity. To identify any differences in the nucleotide binding properties, as well as in the EF-Ts-mediated nucleotide exchange reaction, we performed a comparative rapid kinetics and mutagenesis analysis of the nucleotide exchange mechanism for both the E. coli and P. aeruginosa systems, identifying helix 13 of EF-Ts as a previously unnoticed regulatory element in the nucleotide exchange mechanism with species-specific elements. Our findings support the base side-first entry of the nucleotide into the binding pocket of the EF-Tu·EF-Ts binary complex, followed by displacement of helix 13 and rapid binding of the phosphate side of the nucleotide, ultimately leading to the release of EF-Ts. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

First full-length genome sequence of the polerovirus luffa aphid-borne yellows virus (LABYV) reveals the presence of at least two consensus sequences in an isolate from Thailand.

PubMed

Knierim, Dennis; Maiss, Edgar; Kenyon, Lawrence; Winter, Stephan; Menzel, Wulf

2015-10-01

Luffa aphid-borne yellows virus (LABYV) was proposed as the name for a previously undescribed polerovirus based on partial genome sequences obtained from samples of cucurbit plants collected in Thailand between 2008 and 2013. In this study, we determined the first full-length genome sequence of LABYV. Based on phylogenetic analysis and genome properties, it is clear that this virus represents a distinct species in the genus Polerovirus. Analysis of sequences from sample TH24, which was collected in 2010 from a luffa plant in Thailand, reveals the presence of two different full-length genome consensus sequences.

Superior ab initio identification, annotation and characterisation of TEs and segmental duplications from genome assemblies.

PubMed

Zeng, Lu; Kortschak, R Daniel; Raison, Joy M; Bertozzi, Terry; Adelson, David L

2018-01-01

Transposable Elements (TEs) are mobile DNA sequences that make up significant fractions of amniote genomes. However, they are difficult to detect and annotate ab initio because of their variable features, lengths and clade-specific variants. We have addressed this problem by refining and developing a Comprehensive ab initio Repeat Pipeline (CARP) to identify and cluster TEs and other repetitive sequences in genome assemblies. The pipeline begins with a pairwise alignment using krishna, a custom aligner. Single linkage clustering is then carried out to produce families of repetitive elements. Consensus sequences are then filtered for protein coding genes and then annotated using Repbase and a custom library of retrovirus and reverse transcriptase sequences. This process yields three types of family: fully annotated, partially annotated and unannotated. Fully annotated families reflect recently diverged/young known TEs present in Repbase. The remaining two types of families contain a mixture of novel TEs and segmental duplications. These can be resolved by aligning these consensus sequences back to the genome to assess copy number vs. length distribution. Our pipeline has three significant advantages compared to other methods for ab initio repeat identification: 1) we generate not only consensus sequences, but keep the genomic intervals for the original aligned sequences, allowing straightforward analysis of evolutionary dynamics, 2) consensus sequences represent low-divergence, recently/currently active TE families, 3) segmental duplications are annotated as a useful by-product. We have compared our ab initio repeat annotations for 7 genome assemblies to other methods and demonstrate that CARP compares favourably with RepeatModeler, the most widely used repeat annotation package.

Superior ab initio identification, annotation and characterisation of TEs and segmental duplications from genome assemblies

PubMed Central

Zeng, Lu; Kortschak, R. Daniel; Raison, Joy M.

2018-01-01

Transposable Elements (TEs) are mobile DNA sequences that make up significant fractions of amniote genomes. However, they are difficult to detect and annotate ab initio because of their variable features, lengths and clade-specific variants. We have addressed this problem by refining and developing a Comprehensive ab initio Repeat Pipeline (CARP) to identify and cluster TEs and other repetitive sequences in genome assemblies. The pipeline begins with a pairwise alignment using krishna, a custom aligner. Single linkage clustering is then carried out to produce families of repetitive elements. Consensus sequences are then filtered for protein coding genes and then annotated using Repbase and a custom library of retrovirus and reverse transcriptase sequences. This process yields three types of family: fully annotated, partially annotated and unannotated. Fully annotated families reflect recently diverged/young known TEs present in Repbase. The remaining two types of families contain a mixture of novel TEs and segmental duplications. These can be resolved by aligning these consensus sequences back to the genome to assess copy number vs. length distribution. Our pipeline has three significant advantages compared to other methods for ab initio repeat identification: 1) we generate not only consensus sequences, but keep the genomic intervals for the original aligned sequences, allowing straightforward analysis of evolutionary dynamics, 2) consensus sequences represent low-divergence, recently/currently active TE families, 3) segmental duplications are annotated as a useful by-product. We have compared our ab initio repeat annotations for 7 genome assemblies to other methods and demonstrate that CARP compares favourably with RepeatModeler, the most widely used repeat annotation package. PMID:29538441

Simian virus 40 major late promoter: an upstream DNA sequence required for efficient in vitro transcription.

PubMed Central

Brady, J; Radonovich, M; Thoren, M; Das, G; Salzman, N P

1984-01-01

We have previously identified an 11-base DNA sequence, 5'-G-G-T-A-C-C-T-A-A-C-C-3' (simian virus 40 [SV40] map position 294 to 304), which is important in the control of SV40 late RNA expression in vitro and in vivo (Brady et al., Cell 31:625-633, 1982). We report here the identification of another domain of the SV40 late promoter. A series of mutants with deletions extending from SV40 map position 0 to 300 was prepared by nuclease BAL 31 treatment. The cloned templates were then analyzed for efficiency and accuracy of late SV40 RNA expression in the Manley in vitro transcription system. Our studies showed that, in addition to the promoter domain near map position 300, there are essential DNA sequences between nucleotide positions 74 and 95 that are required for efficient expression of late SV40 RNA. Included in this SV40 DNA sequence were two of the six GGGCGG SV40 repeat sequences and an 11-nucleotide segment which showed strong homology with the upstream sequences required for the efficient in vitro and in vivo expression of the histone H2A gene. This upstream promoter sequence supported transcription with the same efficiency even when it was moved 72 nucleotides closer to the major late cap site. In vitro promoter competition analysis demonstrated that the upstream promoter sequence, independent of the 294 to 304 promoter element, is capable of binding polymerase-transcription factors required for SV40 late gene transcription. Finally, we show that DNA sequences which control the specificity of RNA initiation at nucleotide 325 lie downstream of map position 294. Images PMID:6321950

Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

PubMed Central

Le Gall, O; Candresse, T; Brault, V; Dunez, J

1989-01-01

The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein. PMID:2798128

A novel representation of the conformational structure of transfer RNAs. Correlation of the folding patterns of the polynucleotide chain with the base sequence and the nucleotide backbone torsions.

PubMed Central

Srinivasan, A R; Yathindra, N

1977-01-01

A novel description of the conformational characteristics of all the individual nucleotides and the phosphodiesters in tRNAs is presented in the form of a circular plot. This representation furnishes information of the base sequence with the folding patterns of the polynucleotide chain as one traverses along the circumference and with the individual nucleotide and phosphodiester linkage torsions along the radii. The circular plot obtained for yeast tRNAPhe strikingly distinguishes the helical and the loop regions. The variation of the different nucleotide torsions along the entire chain length and their effect on the secondary helical and tertiary loop regions become readily apparent. PMID:339206

A Bioluminometric Method of DNA Sequencing

NASA Technical Reports Server (NTRS)

Ronaghi, Mostafa; Pourmand, Nader; Stolc, Viktor; Arnold, Jim (Technical Monitor)

2001-01-01

Pyrosequencing is a bioluminometric single-tube DNA sequencing method that takes advantage of co-operativity between four enzymes to monitor DNA synthesis. In this sequencing-by-synthesis method, a cascade of enzymatic reactions yields detectable light, which is proportional to incorporated nucleotides. Pyrosequencing has the advantages of accuracy, flexibility and parallel processing. It can be easily automated. Furthermore, the technique dispenses with the need for labeled primers, labeled nucleotides and gel-electrophoresis. In this chapter, the use of this technique for different applications is discussed.

Information Entropy Analysis of the H1N1 Genetic Code

NASA Astrophysics Data System (ADS)

Martwick, Andy

2010-03-01

During the current H1N1 pandemic, viral samples are being obtained from large numbers of infected people world-wide and are being sequenced on the NCBI Influenza Virus Resource Database. The information entropy of the sequences was computed from the probability of occurrence of each nucleotide base at every position of each set of sequences using Shannon's definition of information entropy, [ H=∑bpb,2( 1pb ) ] where H is the observed information entropy at each nucleotide position and pb is the probability of the base pair of the nucleotides A, C, G, U. Information entropy of the current H1N1 pandemic is compared to reference human and swine H1N1 entropy. As expected, the current H1N1 entropy is in a low entropy state and has a very large mutation potential. Using the entropy method in mature genes we can identify low entropy regions of nucleotides that generally correlate to critical protein function.

Inferring epidemiological dynamics of infectious diseases using Tajima's D statistic on nucleotide sequences of pathogens.

PubMed

Kim, Kiyeon; Omori, Ryosuke; Ito, Kimihito

2017-12-01

The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1) 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD) between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth-death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Genome Survey Sequencing of Luffa Cylindrica L. and Microsatellite High Resolution Melting (SSR-HRM) Analysis for Genetic Relationship of Luffa Genotypes

PubMed Central

An, Jianyu; Yin, Mengqi; Zhang, Qin; Gong, Dongting; Jia, Xiaowen; Guan, Yajing; Hu, Jin

2017-01-01

Luffa cylindrica (L.) Roem. is an economically important vegetable crop in China. However, the genomic information on this species is currently unknown. In this study, for the first time, a genome survey of L. cylindrica was carried out using next-generation sequencing (NGS) technology. In total, 43.40 Gb sequence data of L. cylindrica, about 54.94× coverage of the estimated genome size of 789.97 Mb, were obtained from HiSeq 2500 sequencing, in which the guanine plus cytosine (GC) content was calculated to be 37.90%. The heterozygosity of genome sequences was only 0.24%. In total, 1,913,731 contigs (>200 bp) with 525 bp N50 length and 1,410,117 scaffolds (>200 bp) with 885.01 Mb total length were obtained. From the initial assembled L. cylindrica genome, 431,234 microsatellites (SSRs) (≥5 repeats) were identified. The motif types of SSR repeats included 62.88% di-nucleotide, 31.03% tri-nucleotide, 4.59% tetra-nucleotide, 0.96% penta-nucleotide and 0.54% hexa-nucleotide. Eighty genomic SSR markers were developed, and 51/80 primers could be used in both “Zheda 23” and “Zheda 83”. Nineteen SSRs were used to investigate the genetic diversity among 32 accessions through SSR-HRM analysis. The unweighted pair group method analysis (UPGMA) dendrogram tree was built by calculating the SSR-HRM raw data. SSR-HRM could be effectively used for genotype relationship analysis of Luffa species. PMID:28891982

Pstl repeat: a family of short interspersed nucleotide element (SINE)-like sequences in the genomes of cattle, goat, and buffalo.

PubMed

Sheikh, Faruk G; Mukhopadhyay, Sudit S; Gupta, Prabhakar

2002-02-01

The PstI family of elements are short, highly repetitive DNA sequences interspersed throughout the genome of the Bovidae. We have cloned and sequenced some members of the PstI family from cattle, goat, and buffalo. These elements are approximately 500 bp, have a copy number of 2 x 10(5) - 4 x 10(5), and comprise about 4% of the haploid genome. Studies of nucleotide sequence homology indicate that the buffalo and goat PstI repeats (type II) are similar types of short interspersed nucleotide element (SINE) sequences, but the cattle PstI repeat (type I) is considerably more divergent. Additionally, the goat PstI sequence showed significant sequence homology with bovine serine tRNA, and is therefore likely derived from serine tRNA. Interestingly, Southern hybridization suggests that both types of SINEs (I and II) are present in all the species of Bovidae. Dendrogram analysis indicates that cattle PstI SINE is similar to bovine Alu-like SINEs. Goat and buffalo SINEs formed a separate cluster, suggesting that these two types of SINEs evolved separately in the genome of the Bovidae.

DNA sequencing using polymerase substrate-binding kinetics

PubMed Central

Previte, Michael John Robert; Zhou, Chunhong; Kellinger, Matthew; Pantoja, Rigo; Chen, Cheng-Yao; Shi, Jin; Wang, BeiBei; Kia, Amirali; Etchin, Sergey; Vieceli, John; Nikoomanzar, Ali; Bomati, Erin; Gloeckner, Christian; Ronaghi, Mostafa; He, Molly Min

2015-01-01

Next-generation sequencing (NGS) has transformed genomic research by decreasing the cost of sequencing. However, whole-genome sequencing is still costly and complex for diagnostics purposes. In the clinical space, targeted sequencing has the advantage of allowing researchers to focus on specific genes of interest. Routine clinical use of targeted NGS mandates inexpensive instruments, fast turnaround time and an integrated and robust workflow. Here we demonstrate a version of the Sequencing by Synthesis (SBS) chemistry that potentially can become a preferred targeted sequencing method in the clinical space. This sequencing chemistry uses natural nucleotides and is based on real-time recording of the differential polymerase/DNA-binding kinetics in the presence of correct or mismatch nucleotides. This ensemble SBS chemistry has been implemented on an existing Illumina sequencing platform with integrated cluster amplification. We discuss the advantages of this sequencing chemistry for targeted sequencing as well as its limitations for other applications. PMID:25612848

Simplifying complex sequence information: a PCP-consensus protein binds antibodies against all four Dengue serotypes.

PubMed

Bowen, David M; Lewis, Jessica A; Lu, Wenzhe; Schein, Catherine H

2012-09-14

Designing proteins that reflect the natural variability of a pathogen is essential for developing novel vaccines and drugs. Flaviviruses, including Dengue (DENV) and West Nile (WNV), evolve rapidly and can "escape" neutralizing monoclonal antibodies by mutation. Designing antigens that represent many distinct strains is important for DENV, where infection with a strain from one of the four serotypes may lead to severe hemorrhagic disease on subsequent infection with a strain from another serotype. Here, a DENV physicochemical property (PCP)-consensus sequence was derived from 671 unique sequences from the Flavitrack database. PCP-consensus proteins for domain 3 of the envelope protein (EdomIII) were expressed from synthetic genes in Escherichia coli. The ability of the purified consensus proteins to bind polyclonal antibodies generated in response to infection with strains from each of the four DENV serotypes was determined. The initial consensus protein bound antibodies from DENV-1-3 in ELISA and Western blot assays. This sequence was altered in 3 steps to incorporate regions of maximum variability, identified as significant changes in the PCPs, characteristic of DENV-4 strains. The final protein was recognized by antibodies against all four serotypes. Two amino acids essential for efficient binding to all DENV antibodies are part of a discontinuous epitope previously defined for a neutralizing monoclonal antibody. The PCP-consensus method can significantly reduce the number of experiments required to define a multivalent antigen, which is particularly important when dealing with pathogens that must be tested at higher biosafety levels. Copyright © 2012 Elsevier Ltd. All rights reserved.

Fine-tuning structural RNA alignments in the twilight zone.

PubMed

Bremges, Andreas; Schirmer, Stefanie; Giegerich, Robert

2010-04-30

A widely used method to find conserved secondary structure in RNA is to first construct a multiple sequence alignment, and then fold the alignment, optimizing a score based on thermodynamics and covariance. This method works best around 75% sequence similarity. However, in a "twilight zone" below 55% similarity, the sequence alignment tends to obscure the covariance signal used in the second phase. Therefore, while the overall shape of the consensus structure may still be found, the degree of conservation cannot be estimated reliably. Based on a combination of available methods, we present a method named planACstar for improving structure conservation in structural alignments in the twilight zone. After constructing a consensus structure by alignment folding, planACstar abandons the original sequence alignment, refolds the sequences individually, but consistent with the consensus, aligns the structures, irrespective of sequence, by a pure structure alignment method, and derives an improved sequence alignment from the alignment of structures, to be re-submitted to alignment folding, etc.. This circle may be iterated as long as structural conservation improves, but normally, one step suffices. Employing the tools ClustalW, RNAalifold, and RNAforester, we find that for sequences with 30-55% sequence identity, structural conservation can be improved by 10% on average, with a large variation, measured in terms of RNAalifold's own criterion, the structure conservation index.

VarDetect: a nucleotide sequence variation exploratory tool

PubMed Central

Ngamphiw, Chumpol; Kulawonganunchai, Supasak; Assawamakin, Anunchai; Jenwitheesuk, Ekachai; Tongsima, Sissades

2008-01-01

Background Single nucleotide polymorphisms (SNPs) are the most commonly studied units of genetic variation. The discovery of such variation may help to identify causative gene mutations in monogenic diseases and SNPs associated with predisposing genes in complex diseases. Accurate detection of SNPs requires software that can correctly interpret chromatogram signals to nucleotides. Results We present VarDetect, a stand-alone nucleotide variation exploratory tool that automatically detects nucleotide variation from fluorescence based chromatogram traces. Accurate SNP base-calling is achieved using pre-calculated peak content ratios, and is enhanced by rules which account for common sequence reading artifacts. The proposed software tool is benchmarked against four other well-known SNP discovery software tools (PolyPhred, novoSNP, Genalys and Mutation Surveyor) using fluorescence based chromatograms from 15 human genes. These chromatograms were obtained from sequencing 16 two-pooled DNA samples; a total of 32 individual DNA samples. In this comparison of automatic SNP detection tools, VarDetect achieved the highest detection efficiency. Availability VarDetect is compatible with most major operating systems such as Microsoft Windows, Linux, and Mac OSX. The current version of VarDetect is freely available at . PMID:19091032

A Laboratory Exercise for Genotyping Two Human Single Nucleotide Polymorphisms

ERIC Educational Resources Information Center

Fernando, James; Carlson, Bradley; LeBard, Timothy; McCarthy, Michael; Umali, Finianne; Ashton, Bryce; Rose, Ferrill F., Jr.

2016-01-01

The dramatic decrease in the cost of sequencing a human genome is leading to an era in which a wide range of students will benefit from having an understanding of human genetic variation. Since over 90% of sequence variation between humans is in the form of single nucleotide polymorphisms (SNPs), a laboratory exercise has been devised in order to…

OrthoANI: An improved algorithm and software for calculating average nucleotide identity.

PubMed

Lee, Imchang; Ouk Kim, Yeong; Park, Sang-Cheol; Chun, Jongsik

2016-02-01

Species demarcation in Bacteria and Archaea is mainly based on overall genome relatedness, which serves a framework for modern microbiology. Current practice for obtaining these measures between two strains is shifting from experimentally determined similarity obtained by DNA-DNA hybridization (DDH) to genome-sequence-based similarity. Average nucleotide identity (ANI) is a simple algorithm that mimics DDH. Like DDH, ANI values between two genome sequences may be different from each other when reciprocal calculations are compared. We compared 63 690 pairs of genome sequences and found that the differences in reciprocal ANI values are significantly high, exceeding 1 % in some cases. To resolve this problem of not being symmetrical, a new algorithm, named OrthoANI, was developed to accommodate the concept of orthology for which both genome sequences were fragmented and only orthologous fragment pairs taken into consideration for calculating nucleotide identities. OrthoANI is highly correlated with ANI (using BLASTn) and the former showed approximately 0.1 % higher values than the latter. In conclusion, OrthoANI provides a more robust and faster means of calculating average nucleotide identity for taxonomic purposes. The standalone software tools are freely available at http://www.ezbiocloud.net/sw/oat.

Recombination-dependent replication and gene conversion homogenize repeat sequences and diversify plastid genome structure.

PubMed

Ruhlman, Tracey A; Zhang, Jin; Blazier, John C; Sabir, Jamal S M; Jansen, Robert K

2017-04-01

There is a misinterpretation in the literature regarding the variable orientation of the small single copy region of plastid genomes (plastomes). The common phenomenon of small and large single copy inversion, hypothesized to occur through intramolecular recombination between inverted repeats (IR) in a circular, single unit-genome, in fact, more likely occurs through recombination-dependent replication (RDR) of linear plastome templates. If RDR can be primed through both intra- and intermolecular recombination, then this mechanism could not only create inversion isomers of so-called single copy regions, but also an array of alternative sequence arrangements. We used Illumina paired-end and PacBio single-molecule real-time (SMRT) sequences to characterize repeat structure in the plastome of Monsonia emarginata (Geraniaceae). We used OrgConv and inspected nucleotide alignments to infer ancestral nucleotides and identify gene conversion among repeats and mapped long (>1 kb) SMRT reads against the unit-genome assembly to identify alternative sequence arrangements. Although M. emarginata lacks the canonical IR, we found that large repeats (>1 kilobase; kb) represent ∼22% of the plastome nucleotide content. Among the largest repeats (>2 kb), we identified GC-biased gene conversion and mapping filtered, long SMRT reads to the M. emarginata unit-genome assembly revealed alternative, substoichiometric sequence arrangements. We offer a model based on RDR and gene conversion between long repeated sequences in the M. emarginata plastome and provide support that both intra-and intermolecular recombination between large repeats, particularly in repeat-rich plastomes, varies unit-genome structure while homogenizing the nucleotide sequence of repeats. © 2017 Botanical Society of America.

Genetic Characteristics of Coronaviruses from Korean Bats in 2016.

PubMed

Lee, Saemi; Jo, Seong-Deok; Son, Kidong; An, Injung; Jeong, Jipseol; Wang, Seung-Jun; Kim, Yongkwan; Jheong, Weonhwa; Oem, Jae-Ku

2018-01-01

Bats have increasingly been recognized as the natural reservoir of severe acute respiratory syndrome (SARS), coronavirus, and other coronaviruses found in mammals. However, little research has been conducted on bat coronaviruses in South Korea. In this study, bat samples (332 oral swabs, 245 fecal samples, 38 urine samples, and 57 bat carcasses) were collected at 33 natural bat habitat sites in South Korea. RT-PCR and sequencing were performed for specific coronavirus genes to identify the bat coronaviruses in different bat samples. Coronaviruses were detected in 2.7% (18/672) of the samples: 13 oral swabs from one species of the family Rhinolophidae, and four fecal samples and one carcass (intestine) from three species of the family Vespertiliodae. To determine the genetic relationships of the 18 sequences obtained in this study and previously known coronaviruses, the nucleotide sequences of a 392-nt region of the RNA-dependent RNA polymerase (RdRp) gene were analyzed phylogenetically. Thirteen sequences belonging to SARS-like betacoronaviruses showed the highest nucleotide identity (97.1-99.7%) with Bat-CoV-JTMC15 reported in China. The other five sequences were most similar to MERS-like betacoronaviruses. Four nucleotide sequences displayed the highest identity (94.1-95.1%) with Bat-CoV-HKU5 from Hong Kong. The one sequence from a carcass showed the highest nucleotide identity (99%) with Bat-CoV-SC2013 from China. These results suggest that careful surveillance of coronaviruses from bats should be continued, because animal and human infections may result from the genetic variants present in bat coronavirus reservoirs.

Evaluation of targeted exome sequencing for 28 protein-based blood group systems, including the homologous gene systems, for blood group genotyping.

PubMed

Schoeman, Elizna M; Lopez, Genghis H; McGowan, Eunike C; Millard, Glenda M; O'Brien, Helen; Roulis, Eileen V; Liew, Yew-Wah; Martin, Jacqueline R; McGrath, Kelli A; Powley, Tanya; Flower, Robert L; Hyland, Catherine A

2017-04-01

Blood group single nucleotide polymorphism genotyping probes for a limited range of polymorphisms. This study investigated whether massively parallel sequencing (also known as next-generation sequencing), with a targeted exome strategy, provides an extended blood group genotype and the extent to which massively parallel sequencing correctly genotypes in homologous gene systems, such as RH and MNS. Donor samples (n = 28) that were extensively phenotyped and genotyped using single nucleotide polymorphism typing, were analyzed using the TruSight One Sequencing Panel and MiSeq platform. Genes for 28 protein-based blood group systems, GATA1, and KLF1 were analyzed. Copy number variation analysis was used to characterize complex structural variants in the GYPC and RH systems. The average sequencing depth per target region was 66.2 ± 39.8. Each sample harbored on average 43 ± 9 variants, of which 10 ± 3 were used for genotyping. For the 28 samples, massively parallel sequencing variant sequences correctly matched expected sequences based on single nucleotide polymorphism genotyping data. Copy number variation analysis defined the Rh C/c alleles and complex RHD hybrids. Hybrid RHD*D-CE-D variants were correctly identified, but copy number variation analysis did not confidently distinguish between D and CE exon deletion versus rearrangement. The targeted exome sequencing strategy employed extended the range of blood group genotypes detected compared with single nucleotide polymorphism typing. This single-test format included detection of complex MNS hybrid cases and, with copy number variation analysis, defined RH hybrid genes along with the RHCE*C allele hitherto difficult to resolve by variant detection. The approach is economical compared with whole-genome sequencing and is suitable for a red blood cell reference laboratory setting. © 2017 AABB.

Identification and nucleotide sequence analysis of the repetitive DNA element in the genome of fish lymphocystis disease virus.

PubMed

Schnitzler, P; Delius, H; Scholz, J; Touray, M; Orth, E; Darai, G

1987-12-01

The genome of the fish lymphocystis disease virus (FLDV) was screened for the existence of repetitive DNA sequences using a defined and complete gene library of the viral genome (98 kbp) by DNA-DNA hybridization, heteroduplex analysis, and restriction fine mapping. A repetitive DNA sequence was detected at the coordinates 0.034 to 0.057 and 0.718 to 0.736 map units (m.u.) of the FLDV genome. The first region (0.034 to 0.057 m.u.) corresponds to the 5' terminus of the EcoRI FLDV DNA fragment B (0.034 to 0.165 m.u.) and the second region (0.718 to 0.736 m.u.) is identical to the EcoRI DNA fragment M of the viral genome. The DNA nucleotide sequence of the EcoRI FLDV DNA fragment M was determined. This analysis revealed the presence of many short direct and inverted repetitions, e.g., a 18-mer direct repetition (TTTAAAATTTAATTAA) that started at nucleotide positions 812 and 942 and a 14-mer inverted repeat (TTAAATTTAAATTT) at nucleotide positions 820 and 959. Only short open reading frames were detected within this region. The DNA repetitions are discussed as sequences that play a possible regulatory role for virus replication. Furthermore, hybridization experiments revealed that the repetitive DNA sequences are conserved in the genome of different strains of fish lymphocystis disease virus isolated from two species of Pleuronectidae (flounder and dab).

Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

PubMed

Rehm, Charlotte; Wurmthaler, Lena A; Li, Yuanhao; Frickey, Tancred; Hartig, Jörg S

2015-01-01

In prokaryotes simple sequence repeats (SSRs) with unit sizes of 1-5 nucleotides (nt) are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4) structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc), Xanthomonas axonopodis pv. citri str. 306 (Xac), and Nostoc sp. strain PCC7120 (Ana). In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs) and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.

Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

PubMed Central

Rehm, Charlotte; Wurmthaler, Lena A.; Li, Yuanhao; Frickey, Tancred; Hartig, Jörg S.

2015-01-01

In prokaryotes simple sequence repeats (SSRs) with unit sizes of 1–5 nucleotides (nt) are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6–9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4) structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc), Xanthomonas axonopodis pv. citri str. 306 (Xac), and Nostoc sp. strain PCC7120 (Ana). In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs) and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria. PMID:26695179

Distribution of a Nocardia brasiliensis catalase gene fragment in members of the genera Nocardia, Gordona, and Rhodococcus.

PubMed

Vera-Cabrera, L; Johnson, W M; Welsh, O; Resendiz-Uresti, F L; Salinas-Carmona, M C

1999-06-01

An immunodominant protein from Nocardia brasiliensis, P61, was subjected to amino-terminal and internal sequence analysis. Three sequences of 22, 17, and 38 residues, respectively, were obtained and compared with the protein database from GenBank by using the BLAST system. The sequences showed homology to some eukaryotic catalases and to a bromoperoxidase-catalase from Streptomyces violaceus. Its identity as a catalase was confirmed by analysis of its enzymatic activity on H2O2 and by a double-staining method on a nondenaturing polyacrylamide gel with 3,3'-diaminobenzidine and ferricyanide; the result showed only catalase activity, but no peroxidase. By using one of the internal amino acid sequences and a consensus catalase motif (VGNNTP), we were able to design a PCR assay that generated a 500-bp PCR product. The amplicon was analyzed, and the nucleotide sequence was compared to the GenBank database with the observation of high homology to other bacterial and eukaryotic catalases. A PCR assay based on this target sequence was performed with primers NB10 and NB11 to confirm the presence of the NB10-NB11 gene fragment in several N. brasiliensis strains isolated from mycetoma. The same assay was used to determine whether there were homologous sequences in several type strains from the genera Nocardia, Rhodococcus, Gordona, and Streptomyces. All of the N. brasiliensis strains presented a positive result but only some of the actinomycetes species tested were positive in the PCR assay. In order to confirm these findings, genomic DNA was subjected to Southern blot analysis. A 1.7-kbp band was observed in the N. brasiliensis strains, and bands of different molecular weight were observed in cross-reacting actinomycetes. Sequence analysis of the amplicons of selected actinomycetes showed high homology in this catalase fragment, thus demonstrating that this protein is highly conserved in this group of bacteria.

Pestoides F, an atypical Yersinia pestis strain from the former Soviet Union.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garcia, Emilio; Worsham, Patricia; Bearden, S.

2007-01-01

Unlike the classical Yersinia pestis strains, members of an atypical group of Y. pestis from Central Asia, denominated Y. pestis subspecies caucasica (also known as one of several pestoides types), are distinguished by a number of characteristics including their ability to ferment rhamnose and melibiose, their lack of the small plasmid encoding the plasminogen activator (pla) and pesticin, and their exceptionally large variants of the virulence plasmid pMT (encoding murine toxin and capsular antigen). We have obtained the entire genome sequence of Y. pestis Pestoides F, an isolate from the former Soviet Union that has enabled us to carryout amore » comprehensive genome-wide comparison of this organism's genomic content against the six published sequences of Y. pestis and their Y. pseudotuberculosis ancestor. Based on classical glycerol fermentation (+ve) and nitrate reduction (+ve) Y. pestis Pestoides F is an isolate that belongs to the biovar antiqua. This strain is unusual in other characteristics such as the fact that it carries a non-consensus V antigen (lcrV) sequence, and that unlike other Pla(-) strains, Pestoides F retains virulence by the parenteral and aerosol routes. The chromosome of Pestoides F is 4,517,345 bp in size comprising some 3,936 predicted coding sequences, while its pCD and pMT plasmids are 71,507 bp and 137,010 bp in size respectively. Comparison of chromosome-associated genes in Pestoides F with those in the other sequenced Y. pestis strains reveals differences ranging from strain-specific rearrangements, insertions, deletions, single nucleotide polymorphisms, and a unique distribution of insertion sequences. There is a single approximately 7 kb unique region in the chromosome not found in any of the completed Y. pestis strains sequenced to date, but which is present in the Y. pseudotuberculosis ancestor. Taken together, these findings are consistent with Pestoides F being derived from the most ancient lineage of Y. pestis yet sequenced.« less

Pestoides F, and Atypical Yersinia pestis Strain from the Former Soviet Union

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garcia, E; Worsham, P; Bearden, S

2007-01-05

Unlike the classical Yersinia pestis strains, members of an atypical group of Y. pestis from Central Asia, denominated Y. pestis subspecies caucasica (also known as one of several pestoides types), are distinguished by a number of characteristics including their ability to ferment rhamnose and melibiose, their lacking the small plasmid encoding the plasminogen activator (pla) and pesticin, and their exceptionally large variants of the virulence plasmid pMT (encoding murine toxin and capsular antigen). We have obtained the entire genome sequence of Y. pestis Pestoides F, an isolate from the former Soviet Union that has enabled us to carryout a comprehensivemore » genome-wide comparison of this organism's genomic content against the six published sequences of Y. pestis and their Y. pseudotuberculosis ancestor. Based on classical glycerol fermentation (+ve) and nitrate reduction (+ve) Y. pestis Pestoides F is an isolate that belongs to the biovar antiqua. This strain is unusual in other characteristics such as the fact that it carries a non-consensus V antigen (lcrV) sequence, and that unlike other Pla{sup -} strains, Pestoides F retains virulence by the parenteral and aerosol routes. The chromosome of Pestoides F is 4,517,345 bp in size comprising some 3,936 predicted coding sequences, while its pCD and pMT plasmids are 71,507 bp and 137,010 bp in size respectively. Comparison of chromosome-associated genes in Pestoides F with those in the other sequenced Y. pestis strains, reveals a series of differences ranging from strain-specific rearrangements, insertions, deletions, single nucleotide polymorphisms, and a unique distribution of insertion sequences. There is a single {approx}7 kb unique region in the chromosome not found in any of the completed Y. pestis strains sequenced to date, but which is present in the Y. pseudotuberculosis ancestor. Taken together, these findings are consistent with Pestoides F being derived from the most ancient lineage of Y. pestis yet sequenced.« less

A high-density intraspecific SNP linkage map of pigeonpea (Cajanas cajan L. Millsp.)

PubMed Central

Mandal, Paritra; Bhutani, Shefali; Dutta, Sutapa; Kumawat, Giriraj; Singh, Bikram Pratap; Chaudhary, A. K.; Yadav, Rekha; Gaikwad, K.; Sevanthi, Amitha Mithra; Datta, Subhojit; Raje, Ranjeet S.; Sharma, Tilak R.; Singh, Nagendra Kumar

2017-01-01

Pigeonpea (Cajanus cajan (L.) Millsp.) is a major food legume cultivated in semi-arid tropical regions including the Indian subcontinent, Africa, and Southeast Asia. It is an important source of protein, minerals, and vitamins for nearly 20% of the world population. Due to high carbon sequestration and drought tolerance, pigeonpea is an important crop for the development of climate resilient agriculture and nutritional security. However, pigeonpea productivity has remained low for decades because of limited genetic and genomic resources, and sparse utilization of landraces and wild pigeonpea germplasm. Here, we present a dense intraspecific linkage map of pigeonpea comprising 932 markers that span a total adjusted map length of 1,411.83 cM. The consensus map is based on three different linkage maps that incorporate a large number of single nucleotide polymorphism (SNP) markers derived from next generation sequencing data, using Illumina GoldenGate bead arrays, and genotyping with restriction site associated DNA (RAD) sequencing. The genotyping-by-sequencing enhanced the marker density but was met with limited success due to lack of common markers across the genotypes of mapping population. The integrated map has 547 bead-array SNP, 319 RAD-SNP, and 65 simple sequence repeat (SSR) marker loci. We also show here correspondence between our linkage map and published genome pseudomolecules of pigeonpea. The availability of a high-density linkage map will help improve the anchoring of the pigeonpea genome to its chromosomes and the mapping of genes and quantitative trait loci associated with useful agronomic traits. PMID:28654689

A complete high-quality MinION nanopore assembly of an extensively drug-resistant Mycobacterium tuberculosis Beijing lineage strain identifies novel variation in repetitive PE/PPE gene regions.

PubMed

Bainomugisa, Arnold; Duarte, Tania; Lavu, Evelyn; Pandey, Sushil; Coulter, Chris; Marais, Ben J; Coin, Lachlan M

2018-06-15

A better understanding of the genomic changes that facilitate the emergence and spread of drug-resistant Mycobacterium tuberculosis strains is currently required. Here, we report the use of the MinION nanopore sequencer (Oxford Nanopore Technologies) to sequence and assemble an extensively drug-resistant (XDR) isolate, which is part of a modern Beijing sub-lineage strain, prevalent in Western Province, Papua New Guinea. Using 238-fold coverage obtained from a single flow-cell, de novo assembly of nanopore reads resulted into one contiguous assembly with 99.92 % assembly accuracy. Incorporation of complementary short read sequences (Illumina) as part of consensus error correction resulted in a 4 404 064 bp genome with 99.98 % assembly accuracy. This assembly had an average nucleotide identity of 99.7 % relative to the reference genome, H37Rv. We assembled nearly all GC-rich repetitive PE/PPE family genes (166/168) and identified variants within these genes. With an estimated genotypic error rate of 5.3 % from MinION data, we demonstrated identification of variants to include the conventional drug resistance mutations, and those that contribute to the resistance phenotype (efflux pumps/transporter) and virulence. Reference-based alignment of the assembly allowed detection of deletions and insertions. MinION sequencing provided a fully annotated assembly of a transmissible XDR strain from an endemic setting and showed its utility to provide further understanding of genomic processes within Mycobacterium tuberculosis.

Effective de novo assembly of fish genome using haploid larvae.

PubMed

Iwasaki, Yuki; Nishiki, Issei; Nakamura, Yoji; Yasuike, Motoshige; Kai, Wataru; Nomura, Kazuharu; Yoshida, Kazunori; Nomura, Yousuke; Fujiwara, Atushi; Kobayashi, Takanori; Ototake, Mitsuru

2016-02-01

Recent improvements in next-generation sequencing technology have made it possible to do whole genome sequencing, on even non-model eukaryote species with no available reference genomes. However, de novo assembly of diploid genomes is still a big challenge because of allelic variation. The aim of this study was to determine the feasibility of utilizing the genome of haploid fish larvae for de novo assembly of whole-genome sequences. We compared the efficiency of assembly using the haploid genome of yellowtail (Seriola quinqueradiata) with that using the diploid genome obtained from the dam. De novo assembly from the haploid and the diploid sequence reads (100 million reads per each datasets) generated by the Ion Proton sequencer (200 bp) was done under two different assembly algorithms, namely overlap-layout-consensus (OLC) and de Bruijn graph (DBG). This revealed that the assembly of the haploid genome significantly reduced (approximately 22% for OLC, 9% for DBG) the total number of contigs (with longer average and N50 contig lengths) when compared to the diploid genome assembly. The haploid assembly also improved the quality of the scaffolds by reducing the number of regions with unassigned nucleotides (Ns) (total length of Ns; 45,331,916 bp for haploids and 67,724,360 bp for diploids) in OLC-based assemblies. It appears clear that the haploid genome assembly is better because the allelic variation in the diploid genome disrupts the extension of contigs during the assembly process. Our results indicate that utilizing the genome of haploid larvae leads to a significant improvement in the de novo assembly process, thus providing a novel strategy for the construction of reference genomes from non-model diploid organisms such as fish. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

PubMed

Sugimura; Sawabe; Ezura

2000-01-01

The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

Formation of cis-diamminedichloroplatinum(II) 1,2-intrastrand cross-links on DNA is flanking-sequence independent.

PubMed

Burstyn, J N; Heiger-Bernays, W J; Cohen, S M; Lippard, S J

2000-11-01

Mapping of cis-diamminedichloroplatinum(II) (cis-DDP, cisplatin) DNA adducts over >3000 nucleotides was carried out using a replication blockage assay. The sites of inhibition of modified T4 DNA polymerase, also referred to as stop sites, were analyzed to determine the effects of local sequence context on the distribution of intrastrand cisplatin cross-links. In a 3120 base fragment from replicative form M13mp18 DNA containing 24.6% guanine, 25.5% thymine, 26.9% adenine and 23.0% cytosine, 166 individual stop sites were observed at a bound platinum/nucleotide ratio of 1-2 per thousand. The majority of stop sites (90%) occurred at G(n>2) sequences and the remainder were located at sites containing an AG dinucleotide. For all of the GG sites present in the mapped sequences, including those with Gn(>)2, 89% blocked replication, whereas for the AG sites only 17% blocked replication. These blockage sites were independent of flanking nucleotides in a sequence of N(1)G*G*N(2) where N(1), N(2) = A, C, G, T and G*G* indicates a 1,2-intrastrand platinum cross-link. The absence of long-range sequence dependence was confirmed by monitoring the reaction of cisplatin with a plasmid containing an 800 bp insert of the human telomere repeat sequence (TTAGGG)(n). Platination reactions monitored at several formal platinum/nucleotide ratios or as a function of time reveal that the telomere insert was not preferentially damaged by cisplatin. Both replication blockage and telomere-insert plasmid platination experiments indicate that cisplatin 1,2-intrastrand adducts do not form preferentially at G-rich sequences in vitro.

Sequence analysis of porcine kobuvirus VP1 region detected in pigs in Japan and Thailand.

PubMed

Okitsu, Shoko; Khamrin, Pattara; Thongprachum, Aksara; Hidaka, Satoshi; Kongkaew, Sompreeya; Kongkaew, Apisek; Maneekarn, Niwat; Mizuguchi, Masashi; Hayakawa, Satoshi; Ushijima, Hiroshi

2012-04-01

Porcine kobuvirus is a new candidate species of the genus Kobuvirus in the family Picornaviridae, and information is still limited. The identification of porcine kobuvirus has been performed by the sequence analyses of the 3D region of the viruses. Therefore, the purpose of this study was to characterize the molecular properties of VP1 nucleotide sequences of the porcine kobuviruses isolated from porcine stool samples in Japan during 2009 and Thailand between 2006 and 2008. In addition, previous identification of a unique porcine kobuvirus; Japanese H023/2009/JP, which is a bovine kobuvirus-like strain based on sequence analysis of the 3D region, was also included in this study. All of the strains were amplified by the VP1-specific primer pair: the amplicons were subjected to direct sequencing and compared with the VP1 nucleotide sequences of reference strains. The VP1 sequences of strains from the GenBank database revealed high nucleotide sequence identity at 84.3-100%. On the other hand, the nucleotide identities among the 15 porcine kobuvirus strains analyzed in this study ranged from 78.8 to 99.8%. The results revealed that diversity of the strains in this study were higher than those of the strains in previous studies. Furthermore, it was found that the VP1 region of the bovine kobuvirus-like strain, H023/2009/JP, clustered with nine porcine kobuvirus strains that were isolated in Thailand and Japan. Since this strain was previously found to be closely related to bovine kobuviruses in the 3D gene region, it may be a natural recombinant.

Terminator oligo blocking efficiently eliminates rRNA from Drosophila small RNA sequencing libraries.

PubMed

Wickersheim, Michelle L; Blumenstiel, Justin P

2013-11-01

A large number of methods are available to deplete ribosomal RNA reads from high-throughput RNA sequencing experiments. Such methods are critical for sequencing Drosophila small RNAs between 20 and 30 nucleotides because size selection is not typically sufficient to exclude the highly abundant class of 30 nucleotide 2S rRNA. Here we demonstrate that pre-annealing terminator oligos complimentary to Drosophila 2S rRNA prior to 5' adapter ligation and reverse transcription efficiently depletes 2S rRNA sequences from the sequencing reaction in a simple and inexpensive way. This depletion is highly specific and is achieved with minimal perturbation of miRNA and piRNA profiles.

The ura5 gene of the ascomycete Sordaria macrospora: molecular cloning, characterization and expression in Escherichia coli.

PubMed

Le Chevanton, L; Leblon, G

1989-04-15

We cloned the ura5 gene coding for the orotate phosphoribosyl transferase from the ascomycete Sordaria macrospora by heterologous probing of a Sordaria genomic DNA library with the corresponding Podospora anserina sequence. The Sordaria gene was expressed in an Escherichia coli pyrE mutant strain defective for the same enzyme, and expression was shown to be promoted by plasmid sequences. The nucleotide sequence of the 1246-bp DNA fragment encompassing the region of homology with the Podospora gene has been determined. This sequence contains an open reading frame of 699 nucleotides. The deduced amino acid sequence shows 72% similarity with the corresponding Podospora protein.

Quantum-Sequencing: Fast electronic single DNA molecule sequencing

NASA Astrophysics Data System (ADS)

Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

2014-03-01

A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

LISTA, a comprehensive compilation of nucleotide sequences encoding proteins from the yeast Saccharomyces.

PubMed Central

Linder, P; Dölz, R; Mossé, M O; Lazowska, J; Slonimski, P P

1993-01-01

The amount of nucleotide sequence data is increasing exponentially. We therefore made an effort to make a comprehensive database (LISTA) for the yeast Saccharomyces cerevisiae. Each sequence has been attributed a single genetic name and in the case of allelic duplicated sequences, synonyms are given, if necessary. For the nomenclature we have introduced a standard principle for naming gene sequences based on priority rules. We have also applied a simple method to distinguish duplicated sequences of one and the same gene from non-allelic sequences of duplicated genes. By using these principles we have sorted out a lot of confusion in the literature and databanks. Along with the genetic name, the mnemonic from the EMBL databank, the codon bias, reference of the publication of the sequence and the EMBL accession numbers are included in each entry. PMID:8332521

Molecular phylogeny of 21 tropical bamboo species reconstructed by integrating non-coding internal transcribed spacer (ITS1 and 2) sequences and their consensus secondary structure.

PubMed

Ghosh, Jayadri Sekhar; Bhattacharya, Samik; Pal, Amita

2017-06-01

The unavailability of the reproductive structure and unpredictability of vegetative characters for the identification and phylogenetic study of bamboo prompted the application of molecular techniques for greater resolution and consensus. We first employed internal transcribed spacer (ITS1, 5.8S rRNA and ITS2) sequences to construct the phylogenetic tree of 21 tropical bamboo species. While the sequence alone could grossly reconstruct the traditional phylogeny amongst the 21-tropical species studied, some anomalies were encountered that prompted a further refinement of the phylogenetic analyses. Therefore, we integrated the secondary structure of the ITS sequences to derive individual sequence-structure matrix to gain more resolution on the phylogenetic reconstruction. The results showed that ITS sequence-structure is the reliable alternative to the conventional phenotypic method for the identification of bamboo species. The best-fit topology obtained by the sequence-structure based phylogeny over the sole sequence based one underscores closer clustering of all the studied Bambusa species (Sub-tribe Bambusinae), while Melocanna baccifera, which belongs to Sub-Tribe Melocanneae, disjointedly clustered as an out-group within the consensus phylogenetic tree. In this study, we demonstrated the dependability of the combined (ITS sequence+structure-based) approach over the only sequence-based analysis for phylogenetic relationship assessment of bamboo.

Novel C8orf37 mutations cause retinitis pigmentosa in consanguineous families of Pakistani origin

PubMed Central

Ravesh, Zeinab; El Asrag, Mohammed E.; Weisschuh, Nicole; McKibbin, Martin; Reuter, Peggy; Watson, Christopher M.; Baumann, Britta; Poulter, James A.; Sajid, Sundus; Panagiotou, Evangelia S.; O’Sullivan, James; Abdelhamed, Zakia; Bonin, Michael; Soltanifar, Mehdi; Black, Graeme C.M.; Din, Muhammad Amin-ud; Toomes, Carmel; Ansar, Muhammad; Inglehearn, Chris F.; Wissinger, Bernd

2015-01-01

Purpose To investigate the molecular basis of retinitis pigmentosa in two consanguineous families of Pakistani origin with multiple affected members. Methods Homozygosity mapping and Sanger sequencing of candidate genes were performed in one family while the other was analyzed with whole exome next-generation sequencing. A minigene splicing assay was used to confirm the splicing defects. Results In family MA48, a novel homozygous nucleotide substitution in C8orf37, c.244–2A>C, that disrupted the consensus splice acceptor site of exon 3 was found. The minigene splicing assay revealed that this mutation activated a cryptic splice site within exon 3, causing a 22 bp deletion in the transcript that is predicted to lead to a frameshift followed by premature protein truncation. In family MA13, a novel homozygous null mutation in C8orf37, c.555G>A, p.W185*, was identified. Both mutations segregated with the disease phenotype as expected in a recessive manner and were absent in 8,244 unrelated individuals of South Asian origin. Conclusions In this report, we describe C8orf37 mutations that cause retinal dystrophy in two families of Pakistani origin, contributing further data on the phenotype and the spectrum of mutations in this form of retinitis pigmentosa. PMID:25802487

Magnetic resonance spectroscopy and molecular studies in ornithine transcarbamylase deficiency novel mutation c.802A>G in exon 8 (p.Met268Val).

PubMed

Jamroz, E; Paprocka, J; Sokół, M; Popowska, E; Ciara, E

2013-01-01

Ornithine transcarbamylase (OTC) deficiency, an X-linked, semidominant disorder, is the most common inherited de-fect in ureagenesis, resulting in hyperammonaemia type II. The OTC gene, localised on chromosome X, has been mapp-ed to band Xp21.1, proximate to the Duchenne muscular dystrophy (DMD) gene. More than 350 different mutations, including missense, nonsense, splice-site changes, small de-letions or insertions and gross deletions, have been describ-ed so far. Almost all mutations in consensus splicing sites confer a neonatal phenotype. Most mutations in the OTC gene are 'private' and are distributed throughout the gene with a paucity of mutation in the sequence encoding the leader peptide (exon 1 and beginning of exon 2) and in exon 7. They have familial origin or occur de novo. Even with sequencing of the entire reading frame and exon/intron boundaries, only about 80% of the mutations are detected in patients with proven OTC deficiency. The remainder probably occur within the introns or in regulatory domains. The authors present a 4-year-old boy with the unreported missense mutation c.802A>G. The nucleotide transition leads to amino acid substitution Met to Val at codon 268 of the OTC protein.

Extensive frameshift at all AGG and CCC codons in the mitochondrial cytochrome c oxidase subunit 1 gene of Perkinsus marinus (Alveolata; Dinoflagellata).

PubMed

Masuda, Isao; Matsuzaki, Motomichi; Kita, Kiyoshi

2010-10-01

Diverse mitochondrial (mt) genetic systems have evolved independently of the more uniform nuclear system and often employ modified genetic codes. The organization and genetic system of dinoflagellate mt genomes are particularly unusual and remain an evolutionary enigma. We determined the sequence of full-length cytochrome c oxidase subunit 1 (cox1) mRNA of the earliest diverging dinoflagellate Perkinsus and show that this gene resides in the mt genome. Apparently, this mRNA is not translated in a single reading frame with standard codon usage. Our examination of the nucleotide sequence and three-frame translation of the mRNA suggest that the reading frame must be shifted 10 times, at every AGG and CCC codon, to yield a consensus COX1 protein. We suggest two possible mechanisms for these translational frameshifts: a ribosomal frameshift in which stalled ribosomes skip the first bases of these codons or specialized tRNAs recognizing non-triplet codons, AGGY and CCCCU. Regardless of the mechanism, active and efficient machinery would be required to tolerate the frameshifts predicted in Perkinsus mitochondria. To our knowledge, this is the first evidence of translational frameshifts in protist mitochondria and, by far, is the most extensive case in mitochondria.

Sequence polymorphism in an insect RNA virus field population: A snapshot from a single point in space and time reveals stochastic differences among and within individual hosts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stenger, Drake C., E-mail: drake.stenger@ars.usda.

Population structure of Homalodisca coagulata Virus-1 (HoCV-1) among and within field-collected insects sampled from a single point in space and time was examined. Polymorphism in complete consensus sequences among single-insect isolates was dominated by synonymous substitutions. The mutant spectrum of the C2 helicase region within each single-insect isolate was unique and dominated by nonsynonymous singletons. Bootstrapping was used to correct the within-isolate nonsynonymous:synonymous arithmetic ratio (N:S) for RT-PCR error, yielding an N:S value ~one log-unit greater than that of consensus sequences. Probability of all possible single-base substitutions for the C2 region predicted N:S values within 95% confidence limits of themore » corrected within-isolate N:S when the only constraint imposed was viral polymerase error bias for transitions over transversions. These results indicate that bottlenecks coupled with strong negative/purifying selection drive consensus sequences toward neutral sequence space, and that most polymorphism within single-insect isolates is composed of newly-minted mutations sampled prior to selection. -- Highlights: •Sampling protocol minimized differential selection/history among isolates. •Polymorphism among consensus sequences dominated by negative/purifying selection. •Within-isolate N:S ratio corrected for RT-PCR error by bootstrapping. •Within-isolate mutant spectrum dominated by new mutations yet to undergo selection.« less

cDNA cloning of the human peroxisomal enoyl-CoA hydratase: 3-Hydroxyacyl-CoA dehydrogenase bifunctional enzyme and localization to chromosome 3q26. 3-3q28: A free left Alu arm is inserted in the 3[prime] noncoding region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hoefler, G.; Forstner, M.; Hulla, W.

1994-01-01

Enoyl-CoA hydratase:3-hydroxyacyl-CoA dehydrogenase bifunctional enzyme is one of the four enzymes of the peroxisomal, [beta]-oxidation pathway. Here, the authors report the full-length human cDNA sequence and the localization of the corresponding gene on chromosome 3q26.3-3q28. The cDNA sequence spans 3779 nucleotides with an open reading frame of 2169 nucleotides. The tripeptide SKL at the carboxy terminus, known to serve as a peroxisomal targeting signal, is present. DNA sequence comparison of the coding region showed an 80% homology between human and rat bifunctional enzyme cDNA. The 3[prime] noncoding sequence contains 117 nucleotides homologous to an Alu repeat. Based on sequence comparison,more » they propose that these nucleotides are a free left Alu arm with 86% homology to the Alu-J family. RNA analysis shows one band with highest intensity in liver and kidney. This cDNA will allow in-depth studies of molecular defects in patients with defective peroxisomal bifunctional enzyme. Moreover, it will also provide a means for studying the regulation of peroxisomal [beta]-oxidation in humans. 33 refs., 5 figs.« less

Phylogenetic Analysis of Myobia musculi (Schranck, 1781) by Using the 18S Small Ribosomal Subunit Sequence

PubMed Central

Feldman, Sanford H; Ntenda, Abraham M

2011-01-01

We used high-fidelity PCR to amplify 2 overlapping regions of the ribosomal gene complex from the rodent fur mite Myobia musculi. The amplicons encompassed a large portion of the mite's ribosomal gene complex spanning 3128 nucleotides containing the entire 18S rRNA, internal transcribed spacer (ITS) 1, 5.8S rRNA, ITS2, and a portion of the 5′-end of the 28S rRNA. M. musculi’s 179-nucleotide 5.8S rRNA nucleotide sequence was not conserved, so this region was identified by conservation of rRNA secondary structure. Maximum likelihood and Bayesian inference phylogenetic analyses were performed by using multiple sequence alignment consisting of 1524 nucleotides of M. musculi 18S rRNA and homologous sequences from 42 prostigmatid mites and the tick Dermacentor andersoni. The phylograms produced by both methods were in agreement regarding terminal, secondary, and some tertiary phylogenetic relationships among mites. Bayesian inference discriminated most infraordinal relationships between Eleutherengona and Parasitengona mites in the suborder Anystina. Basal relationships between suborders Anystina and Eupodina historically determined by comparing differences in anatomic characteristics were less well-supported by our molecular analysis. Our results recapitulated similar 18S rRNA sequence analyses recently reported. Our study supports M. musculi as belonging to the suborder Anystina, infraorder Eleutherenona, and superfamily Cheyletoidea. PMID:22330574

The hypervariable region 1 protein of hepatitis C virus broadly reactive with sera of patients with chronic hepatitis C has a similar amino acid sequence with the consensus sequence.

PubMed

Watanabe, K; Yoshioka, K; Ito, H; Ishigami, M; Takagi, K; Utsunomiya, S; Kobayashi, M; Kishimoto, H; Yano, M; Kakumu, S

1999-11-10

Hypervariable region 1 (HVR1) proteins of hepatitis C virus (HCV) have been reported to react broadly with sera of patients with HCV infection. However, the variability of the broad reactivity of individual HVR1 proteins has not been elucidated. We assessed the reactivity of 25 different HVR1 proteins (genotype 1b) with sera of 81 patients with HCV infection (genotype 1b) by Western blot. HVR1 proteins reacted with 2-60 sera. The number of sera reactive with each HVR1 protein significantly correlated with the number of amino acid residues identical to the consensus sequence defined by Puntoriero et al. (G. Puntoriero, A. Lahm, S. Zucchelli, B. B. Ercole, R. Tafi, M. Penzzanera, M. U. Mondelli, R. Cortese, A. Tramontano, G. Galfre', and A. Nicosia. 1998. EMBO J. 17, 3521-3533. ) (r = 0.561, P < 0.005). The most widely reactive HVR1 protein, 12-22, had a sequence similar to the consensus sequence. The peptide with C-terminal 13-amino-acids sequence of HVR1 protein 12-22 (NH2-CSFTSLFTPGPSQK) was injected into rabbits as an immunogen. The rabbit immune sera reacted with 9 of 25 HVR1 proteins of genotype 1b including HVR1 protein 12-22 and with 3 of 12 proteins of genotype 2a. These results indicate that the HVR1 protein broadly reactive with patients' sera has a sequence similar to the consensus sequence, can induce broadly reactive sera, and could be one of the candidate immunogens in a prophylactic vaccine against HCV. Copyright 1999 Academic Press.

Mapping RNA Structure In Vitro with SHAPE Chemistry and Next-Generation Sequencing (SHAPE-Seq).

PubMed

Watters, Kyle E; Lucks, Julius B

2016-01-01

Mapping RNA structure with selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) chemistry has proven to be a versatile method for characterizing RNA structure in a variety of contexts. SHAPE reagents covalently modify RNAs in a structure-dependent manner to create adducts at the 2'-OH group of the ribose backbone at nucleotides that are structurally flexible. The positions of these adducts are detected using reverse transcriptase (RT) primer extension, which stops one nucleotide before the modification, to create a pool of cDNAs whose lengths reflect the location of SHAPE modification. Quantification of the cDNA pools is used to estimate the "reactivity" of each nucleotide in an RNA molecule to the SHAPE reagent. High reactivities indicate nucleotides that are structurally flexible, while low reactivities indicate nucleotides that are inflexible. These SHAPE reactivities can then be used to infer RNA structures by restraining RNA structure prediction algorithms. Here, we provide a state-of-the-art protocol describing how to perform in vitro RNA structure probing with SHAPE chemistry using next-generation sequencing to quantify cDNA pools and estimate reactivities (SHAPE-Seq). The use of next-generation sequencing allows for higher throughput, more consistent data analysis, and multiplexing capabilities. The technique described herein, SHAPE-Seq v2.0, uses a universal reverse transcription priming site that is ligated to the RNA after SHAPE modification. The introduced priming site allows for the structural analysis of an RNA independent of its sequence.

Transcript-specific, single-nucleotide polymorphism discovery and linkage analysis in hexaploid bread wheat (Triticum aestivum L.).

PubMed

Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J

2011-12-01

Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

Natural History of Human Respiratory Syncytial Virus Inferred from Phylogenetic Analysis of the Attachment (G) Glycoprotein with a 60-Nucleotide Duplication

PubMed Central

Trento, Alfonsina; Viegas, Mariana; Galiano, Mónica; Videla, Cristina; Carballal, Guadalupe; Mistchenko, Alicia S.; Melero, José A.

2006-01-01

A total of 47 clinical samples were identified during an active surveillance program of respiratory infections in Buenos Aires (BA) (1999 to 2004) that contained sequences of human respiratory syncytial virus (HRSV) with a 60-nucleotide duplication in the attachment (G) protein gene. This duplication was analogous to that previously described for other three viruses also isolated in Buenos Aires in 1999 (A. Trento et al., J. Gen. Virol. 84:3115-3120, 2003). Phylogenetic analysis indicated that BA sequences with that duplication shared a common ancestor (dated about 1998) with other HRSV G sequences reported worldwide after 1999. The duplicated nucleotide sequence was an exact copy of the preceding 60 nucleotides in early viruses, but both copies of the duplicated segment accumulated nucleotide substitutions in more recent viruses at a rate apparently higher than in other regions of the G protein gene. The evolution of the viruses with the duplicated G segment apparently followed the overall evolutionary pattern previously described for HRSV, and this genotype has replaced other prevailing antigenic group B genotypes in Buenos Aires and other places. Thus, the duplicated segment represents a natural tag that can be used to track the dissemination and evolution of HRSV in an unprecedented setting. We have taken advantage of this situation to reexamine the molecular epidemiology of HRSV and to explore the natural history of this important human pathogen. PMID:16378999

UrQt: an efficient software for the Unsupervised Quality trimming of NGS data.

PubMed

Modolo, Laurent; Lerat, Emmanuelle

2015-04-29

Quality control is a necessary step of any Next Generation Sequencing analysis. Although customary, this step still requires manual interventions to empirically choose tuning parameters according to various quality statistics. Moreover, current quality control procedures that provide a "good quality" data set, are not optimal and discard many informative nucleotides. To address these drawbacks, we present a new quality control method, implemented in UrQt software, for Unsupervised Quality trimming of Next Generation Sequencing reads. Our trimming procedure relies on a well-defined probabilistic framework to detect the best segmentation between two segments of unreliable nucleotides, framing a segment of informative nucleotides. Our software only requires one user-friendly parameter to define the minimal quality threshold (phred score) to consider a nucleotide to be informative, which is independent of both the experiment and the quality of the data. This procedure is implemented in C++ in an efficient and parallelized software with a low memory footprint. We tested the performances of UrQt compared to the best-known trimming programs, on seven RNA and DNA sequencing experiments and demonstrated its optimality in the resulting tradeoff between the number of trimmed nucleotides and the quality objective. By finding the best segmentation to delimit a segment of good quality nucleotides, UrQt greatly increases the number of reads and of nucleotides that can be retained for a given quality objective. UrQt source files, binary executables for different operating systems and documentation are freely available (under the GPLv3) at the following address: https://lbbe.univ-lyon1.fr/-UrQt-.html .

Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms

PubMed Central

Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

2015-01-01

Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450

Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms.

PubMed

Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

2015-01-01

Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.

Molecular cloning and nucleotide sequence of a transforming gene detected by transfection of chicken B-cell lymphoma DNA

NASA Astrophysics Data System (ADS)

Goubin, Gerard; Goldman, Debra S.; Luce, Judith; Neiman, Paul E.; Cooper, Geoffrey M.

1983-03-01

A transforming gene detected by transfection of chicken B-cell lymphoma DNA has been isolated by molecular cloning. It is homologous to a conserved family of sequences present in normal chicken and human DNAs but is not related to transforming genes of acutely transforming retroviruses. The nucleotide sequence of the cloned transforming gene suggests that it encodes a protein that is partially homologous to the amino terminus of transferrin and related proteins although only about one tenth the size of transferrin.

Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA

PubMed Central

Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco

1974-01-01

Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714

Mosaic organization of DNA nucleotides

NASA Technical Reports Server (NTRS)

Peng, C. K.; Buldyrev, S. V.; Havlin, S.; Simons, M.; Stanley, H. E.; Goldberger, A. L.

1994-01-01

Long-range power-law correlations have been reported recently for DNA sequences containing noncoding regions. We address the question of whether such correlations may be a trivial consequence of the known mosaic structure ("patchiness") of DNA. We analyze two classes of controls consisting of patchy nucleotide sequences generated by different algorithms--one without and one with long-range power-law correlations. Although both types of sequences are highly heterogenous, they are quantitatively distinguishable by an alternative fluctuation analysis method that differentiates local patchiness from long-range correlations. Application of this analysis to selected DNA sequences demonstrates that patchiness is not sufficient to account for long-range correlation properties.

Asystasia mosaic Madagascar virus: a novel bipartite begomovirus infecting the weed Asystasia gangetica in Madagascar.

PubMed

De Bruyn, Alexandre; Harimalala, Mireille; Hoareau, Murielle; Ranomenjanahary, Sahondramalala; Reynaud, Bernard; Lefeuvre, Pierre; Lett, Jean-Michel

2015-06-01

Here, we describe for the first time the complete genome sequence of a new bipartite begomovirus in Madagascar isolated from the weed Asystasia gangetica (Acanthaceae), for which we propose the tentative name asystasia mosaic Madagascar virus (AMMGV). DNA-A and -B nucleotide sequences of AMMGV were only distantly related to known begomovirus sequence and shared highest nucleotide sequence identity of 72.9 % (DNA-A) and 66.9 % (DNA-B) with a recently described bipartite begomovirus infecting Asystasia sp. in West Africa. Phylogenetic analysis demonstrated that this novel virus from Madagascar belongs to a new lineage of Old World bipartite begomoviruses.

Nucleotide sequence of a chickpea chlorotic stunt virus relative that infects pea and faba bean in China.

PubMed

Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

2012-07-01

We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were <90%. This suggests that it is a new member of the genus Polerovirus, and the name pea mild chlorosis virus is proposed.

FALDO: a semantic standard for describing the location of nucleotide and protein feature annotation.

PubMed

Bolleman, Jerven T; Mungall, Christopher J; Strozzi, Francesco; Baran, Joachim; Dumontier, Michel; Bonnal, Raoul J P; Buels, Robert; Hoehndorf, Robert; Fujisawa, Takatomo; Katayama, Toshiaki; Cock, Peter J A

2016-06-13

Nucleotide and protein sequence feature annotations are essential to understand biology on the genomic, transcriptomic, and proteomic level. Using Semantic Web technologies to query biological annotations, there was no standard that described this potentially complex location information as subject-predicate-object triples. We have developed an ontology, the Feature Annotation Location Description Ontology (FALDO), to describe the positions of annotated features on linear and circular sequences. FALDO can be used to describe nucleotide features in sequence records, protein annotations, and glycan binding sites, among other features in coordinate systems of the aforementioned "omics" areas. Using the same data format to represent sequence positions that are independent of file formats allows us to integrate sequence data from multiple sources and data types. The genome browser JBrowse is used to demonstrate accessing multiple SPARQL endpoints to display genomic feature annotations, as well as protein annotations from UniProt mapped to genomic locations. Our ontology allows users to uniformly describe - and potentially merge - sequence annotations from multiple sources. Data sources using FALDO can prospectively be retrieved using federalised SPARQL queries against public SPARQL endpoints and/or local private triple stores.

Nucleotide sequences of immunoglobulin eta genes of chimpanzee and orangutan: DNA molecular clock and hominoid evolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sakoyama, Y.; Hong, K.J.; Byun, S.M.

To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: themore » mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.« less

FALDO: a semantic standard for describing the location of nucleotide and protein feature annotation

DOE PAGES

Bolleman, Jerven T.; Mungall, Christopher J.; Strozzi, Francesco; ...

2016-06-13

Nucleotide and protein sequence feature annotations are essential to understand biology on the genomic, transcriptomic, and proteomic level. Using Semantic Web technologies to query biological annotations, there was no standard that described this potentially complex location information as subject-predicate-object triples. In this paper, we have developed an ontology, the Feature Annotation Location Description Ontology (FALDO), to describe the positions of annotated features on linear and circular sequences. FALDO can be used to describe nucleotide features in sequence records, protein annotations, and glycan binding sites, among other features in coordinate systems of the aforementioned “omics” areas. Using the same data formatmore » to represent sequence positions that are independent of file formats allows us to integrate sequence data from multiple sources and data types. The genome browser JBrowse is used to demonstrate accessing multiple SPARQL endpoints to display genomic feature annotations, as well as protein annotations from UniProt mapped to genomic locations. Our ontology allows users to uniformly describe – and potentially merge – sequence annotations from multiple sources. Finally, data sources using FALDO can prospectively be retrieved using federalised SPARQL queries against public SPARQL endpoints and/or local private triple stores.« less

Discovery, genotyping and characterization of structural variation and novel sequence at single nucleotide resolution from de novo genome assemblies on a population scale.

PubMed

Liu, Siyang; Huang, Shujia; Rao, Junhua; Ye, Weijian; Krogh, Anders; Wang, Jun

2015-01-01

Comprehensive recognition of genomic variation in one individual is important for understanding disease and developing personalized medication and treatment. Many tools based on DNA re-sequencing exist for identification of single nucleotide polymorphisms, small insertions and deletions (indels) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction of population-scale pan-genomes. Our study also highlights the usefulness of the de novo assembly strategy for definition of genome structure.

FALDO: a semantic standard for describing the location of nucleotide and protein feature annotation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bolleman, Jerven T.; Mungall, Christopher J.; Strozzi, Francesco

Nucleotide and protein sequence feature annotations are essential to understand biology on the genomic, transcriptomic, and proteomic level. Using Semantic Web technologies to query biological annotations, there was no standard that described this potentially complex location information as subject-predicate-object triples. In this paper, we have developed an ontology, the Feature Annotation Location Description Ontology (FALDO), to describe the positions of annotated features on linear and circular sequences. FALDO can be used to describe nucleotide features in sequence records, protein annotations, and glycan binding sites, among other features in coordinate systems of the aforementioned “omics” areas. Using the same data formatmore » to represent sequence positions that are independent of file formats allows us to integrate sequence data from multiple sources and data types. The genome browser JBrowse is used to demonstrate accessing multiple SPARQL endpoints to display genomic feature annotations, as well as protein annotations from UniProt mapped to genomic locations. Our ontology allows users to uniformly describe – and potentially merge – sequence annotations from multiple sources. Finally, data sources using FALDO can prospectively be retrieved using federalised SPARQL queries against public SPARQL endpoints and/or local private triple stores.« less

NullSeq: A Tool for Generating Random Coding Sequences with Desired Amino Acid and GC Contents.

PubMed

Liu, Sophia S; Hockenberry, Adam J; Lancichinetti, Andrea; Jewett, Michael C; Amaral, Luís A N

2016-11-01

The existence of over- and under-represented sequence motifs in genomes provides evidence of selective evolutionary pressures on biological mechanisms such as transcription, translation, ligand-substrate binding, and host immunity. In order to accurately identify motifs and other genome-scale patterns of interest, it is essential to be able to generate accurate null models that are appropriate for the sequences under study. While many tools have been developed to create random nucleotide sequences, protein coding sequences are subject to a unique set of constraints that complicates the process of generating appropriate null models. There are currently no tools available that allow users to create random coding sequences with specified amino acid composition and GC content for the purpose of hypothesis testing. Using the principle of maximum entropy, we developed a method that generates unbiased random sequences with pre-specified amino acid and GC content, which we have developed into a python package. Our method is the simplest way to obtain maximally unbiased random sequences that are subject to GC usage and primary amino acid sequence constraints. Furthermore, this approach can easily be expanded to create unbiased random sequences that incorporate more complicated constraints such as individual nucleotide usage or even di-nucleotide frequencies. The ability to generate correctly specified null models will allow researchers to accurately identify sequence motifs which will lead to a better understanding of biological processes as well as more effective engineering of biological systems.

Predicting protein-binding regions in RNA using nucleotide profiles and compositions.

PubMed

Choi, Daesik; Park, Byungkyu; Chae, Hanju; Lee, Wook; Han, Kyungsook

2017-03-14

Motivated by the increased amount of data on protein-RNA interactions and the availability of complete genome sequences of several organisms, many computational methods have been proposed to predict binding sites in protein-RNA interactions. However, most computational methods are limited to finding RNA-binding sites in proteins instead of protein-binding sites in RNAs. Predicting protein-binding sites in RNA is more challenging than predicting RNA-binding sites in proteins. Recent computational methods for finding protein-binding sites in RNAs have several drawbacks for practical use. We developed a new support vector machine (SVM) model for predicting protein-binding regions in mRNA sequences. The model uses sequence profiles constructed from log-odds scores of mono- and di-nucleotides and nucleotide compositions. The model was evaluated by standard 10-fold cross validation, leave-one-protein-out (LOPO) cross validation and independent testing. Since actual mRNA sequences have more non-binding regions than protein-binding regions, we tested the model on several datasets with different ratios of protein-binding regions to non-binding regions. The best performance of the model was obtained in a balanced dataset of positive and negative instances. 10-fold cross validation with a balanced dataset achieved a sensitivity of 91.6%, a specificity of 92.4%, an accuracy of 92.0%, a positive predictive value (PPV) of 91.7%, a negative predictive value (NPV) of 92.3% and a Matthews correlation coefficient (MCC) of 0.840. LOPO cross validation showed a lower performance than the 10-fold cross validation, but the performance remains high (87.6% accuracy and 0.752 MCC). In testing the model on independent datasets, it achieved an accuracy of 82.2% and an MCC of 0.656. Testing of our model and other state-of-the-art methods on a same dataset showed that our model is better than the others. Sequence profiles of log-odds scores of mono- and di-nucleotides were much more powerful features than nucleotide compositions in finding protein-binding regions in RNA sequences. But, a slight performance gain was obtained when using the sequence profiles along with nucleotide compositions. These are preliminary results of ongoing research, but demonstrate the potential of our approach as a powerful predictor of protein-binding regions in RNA. The program and supporting data are available at http://bclab.inha.ac.kr/RBPbinding .

Effects of transcriptional start site sequence and position on nucleotide-sensitive selection of alternative start sites at the pyrC promoter in Escherichia coli.

PubMed Central

Liu, J; Turnbough, C L

1994-01-01

In Escherichia coli, expression of the pyrC gene is regulated primarily by a translational control mechanism based on nucleotide-sensitive selection of transcriptional start sites at the pyrC promoter. When intracellular levels of CTP are high, pyrC transcripts are initiated predominantly with CTP at a site 7 bases downstream of the Pribnow box. These transcripts form a stable hairpin at their 5' ends that blocks ribosome binding. When the CTP level is low and the GTP level is high, conditions found in pyrimidine-limited cells, transcripts are initiated primarily with GTP at a site 9 bases downstream of the Pribnow box. These shorter transcripts are unable to form a hairpin at their 5' ends and are readily translated. In this study, we examined the effects of nucleotide sequence and position on the selection of transcriptional start sites at the pyrC promoter. We characterized promoter mutations that systematically alter the sequence at position 7 or 9 downstream of the Pribnow box or vary the spacing between the Pribnow box and wild-type transcriptional initiation region. The results reveal preferences for particular initiating nucleotides (ATP > or = GTP > UTP >> CTP) and for starting positions downstream of the Pribnow box (7 >> 6 and 8 > 9 > 10). The results indicate that optimal nucleotide-sensitive start site switching at the wild-type pyrC promoter is the result of competition between the preferred start site (position 7) that uses the poorest initiating nucleotide (CTP) and a weak start site (position 9) that uses a good initiating nucleotide (GTP). The sequence of the pyrC promoter also minimizes the synthesis of untranslatable transcripts and provides for maximum stability of the regulatory transcript hairpin. In addition, the results show that the effects of the mutations on pyrC expression and regulation are consistent with the current model for translational control. Possible effects of preferences for initiating nucleotides and start sites on the expression and regulation of other genes are discussed. Images PMID:7910603

Development and validation of the JAX Cancer Treatment Profile™ for detection of clinically actionable mutations in solid tumors

PubMed Central

Ananda, Guruprasad; Mockus, Susan; Lundquist, Micaela; Spotlow, Vanessa; Simons, Al; Mitchell, Talia; Stafford, Grace; Philip, Vivek; Stearns, Timothy; Srivastava, Anuj; Barter, Mary; Rowe, Lucy; Malcolm, Joan; Bult, Carol; Karuturi, Radha Krishna Murthy; Rasmussen, Karen; Hinerfeld, Douglas

2015-01-01

Background The continued development of targeted therapeutics for cancer treatment has required the concomitant development of more expansive methods for the molecular profiling of the patient’s tumor. We describe the validation of the JAX Cancer Treatment Profile™ (JAX-CTP™), a next generation sequencing (NGS)-based molecular diagnostic assay that detects actionable mutations in solid tumors to inform the selection of targeted therapeutics for cancer treatment. Methods NGS libraries are generated from DNA extracted from formalin fixed paraffin embedded tumors. Using hybrid capture, the genes of interest are enriched and sequenced on the Illumina HiSeq 2500 or MiSeq sequencers followed by variant detection and functional and clinical annotation for the generation of a clinical report. Results The JAX-CTP™ detects actionable variants, in the form of single nucleotide variations and small insertions and deletions (≤50bp) in 190 genes in specimens with a neoplastic cell content of ≥10%. The JAX-CTP™ is also validated for the detection of clinically actionable gene amplifications. Conclusions There is a lack of consensus in the molecular diagnostics field on the best method for the validation of NGS-based assays in oncology, thus the importance of communicating methods, as contained in this report. The growing number of targeted therapeutics and the complexity of the tumor genome necessitates continued development and refinement of advanced assays for tumor profiling to enable precision cancer treatment. PMID:25562415

StructRNAfinder: an automated pipeline and web server for RNA families prediction.

PubMed

Arias-Carrasco, Raúl; Vásquez-Morán, Yessenia; Nakaya, Helder I; Maracaja-Coutinho, Vinicius

2018-02-17

The function of many noncoding RNAs (ncRNAs) depend upon their secondary structures. Over the last decades, several methodologies have been developed to predict such structures or to use them to functionally annotate RNAs into RNA families. However, to fully perform this analysis, researchers should utilize multiple tools, which require the constant parsing and processing of several intermediate files. This makes the large-scale prediction and annotation of RNAs a daunting task even to researchers with good computational or bioinformatics skills. We present an automated pipeline named StructRNAfinder that predicts and annotates RNA families in transcript or genome sequences. This single tool not only displays the sequence/structural consensus alignments for each RNA family, according to Rfam database but also provides a taxonomic overview for each assigned functional RNA. Moreover, we implemented a user-friendly web service that allows researchers to upload their own nucleotide sequences in order to perform the whole analysis. Finally, we provided a stand-alone version of StructRNAfinder to be used in large-scale projects. The tool was developed under GNU General Public License (GPLv3) and is freely available at http://structrnafinder.integrativebioinformatics.me . The main advantage of StructRNAfinder relies on the large-scale processing and integrating the data obtained by each tool and database employed along the workflow, of which several files are generated and displayed in user-friendly reports, useful for downstream analyses and data exploration.

Nucleic acids encoding antifungal polypeptides and uses thereof

DOEpatents

Altier, Daniel J.; Ellanskaya, I. A.; Gilliam, Jacob T.; Hunter-Cevera, Jennie; Presnail, James K; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser

2010-11-02

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include an amino acid sequence, and variants and fragments thereof, for an antipathogenic polypeptide that was isolated from a fungal fermentation broth. Nucleic acid molecules that encode the antipathogenic polypeptides of the invention, and antipathogenic domains thereof, are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention are also disclosed.

RNA Editing in Plant Mitochondria

NASA Astrophysics Data System (ADS)

Hiesel, Rudolf; Wissinger, Bernd; Schuster, Wolfgang; Brennicke, Axel

1989-12-01

Comparative sequence analysis of genomic and complementary DNA clones from several mitochondrial genes in the higher plant Oenothera revealed nucleotide sequence divergences between the genomic and the messenger RNA-derived sequences. These sequence alterations could be most easily explained by specific post-transcriptional nucleotide modifications. Most of the nucleotide exchanges in coding regions lead to altered codons in the mRNA that specify amino acids better conserved in evolution than those encoded by the genomic DNA. Several instances show that the genomic arginine codon CGG is edited in the mRNA to the tryptophan codon TGG in amino acid positions that are highly conserved as tryptophan in the homologous proteins of other species. This editing suggests that the standard genetic code is used in plant mitochondria and resolves the frequent coincidence of CGG codons and tryptophan in different plant species. The apparently frequent and non-species-specific equivalency of CGG and TGG codons in particular suggests that RNA editing is a common feature of all higher plant mitochondria.

Simian immunodeficiency viruses from African green monkeys display unusual genetic diversity.

PubMed Central

Johnson, P R; Fomsgaard, A; Allan, J; Gravell, M; London, W T; Olmsted, R A; Hirsch, V M

1990-01-01

African green monkeys are asymptomatic carriers of simian immunodeficiency viruses (SIV), commonly called SIVagm. As many as 50% of African green monkeys in the wild may be SIV seropositive. This high seroprevalence rate and the potential for genetic variation of lentiviruses suggested to us that African green monkeys may harbor widely differing genotypes of SIVagm. To investigate this hypothesis, we determined the entire nucleotide sequence of an infectious proviral molecular clone of SIVagm (155-4) and partial sequences (long terminal repeat and Gag) of three other distinct SIVagm isolates (90, gri-1, and ver-1). Comparisons among the SIVagm isolates revealed extreme diversity at the nucleotide and amino acid levels. Long terminal repeat nucleotide sequences varied up to 35% and Gag protein sequences varied up to 30%. The variability among SIVagm isolates exceeded the variability among any other group of primate lentiviruses. Our data suggest that SIVagm has been in the African green monkey population for a long time and may be the oldest primate lentivirus group in existence. PMID:2304139

Molecular characterization of chikungunya virus from Andhra Pradesh, India & phylogenetic relationship with Central African isolates.

PubMed

M Naresh Kumar, C V; Anthony Johnson, A M; R Sai Gopal, D V

2007-12-01

Chikungunya virus has caused numerous large outbreaks in India. Suspected blood samples from the epidemic were collected and characterized for the identification of the responsible causative from Rayalaseema region of Andhra Pradesh. RT-PCR was used for screening of suspected blood samples. Primers were designed to amplify partial E1 gene and the amplified fragment was cloned and sequenced. The sequence was analyzed and compared with other geographical isolates to find the phylogenetic relationship. The sequence was submitted to the Gen bank DNA database (accession DQ888620). Comparative nucleotide homology analysis of the AP Ra-CTR isolate with the other isolates revealed 94.7+/-3.6 per cent of homology of CHIKAPRa-CTR with other isolates of Chikungunya virus at nucleotide level and 96.8+/-3.2 per cent of homology at amino acid level. The current epidemic was caused by the Central African genotype of CHIKV, grouped in Central Africa cluster in phylogenetic trees generated based on nucleotide and amino acid sequences.