Sechi, Leonardo A.; Zanetti, Stefania; Dupré, Ilaria; Delogu, Giovanni; Fadda, Giovanni
1998-01-01
The presence of enterobacterial repetitive intergenic consensus (ERIC) sequences was demonstrated for the first time in the genome of Mycobacterium tuberculosis; these sequences have been found in transcribed regions of the chromosomes of gram-negative bacteria. In this study genetic diversity among clinical isolates of M. tuberculosis was determined by PCR with ERIC primers (ERIC-PCR). The study isolates comprised 71 clinical isolates collected from Sardinia, Italy. ERIC-PCR was able to identify 59 distinct profiles. The results obtained were compared with IS6110 and PCR-GTG fingerprinting. We found that the level of differentiation obtained by ERIC-PCR is greater than that obtained by IS6110 fingerprinting and comparable to that obtained by PCR-GTG. This method of fingerprinting is rapid and sensitive and can be applied to the study of the epidemiology of M. tuberculosis infections, especially when IS6110 fingerprinting is not of any help. PMID:9431935
Wellehan, James F. X.; Johnson, April J.; Harrach, Balázs; Benkö, Mária; Pessier, Allan P.; Johnson, Calvin M.; Garner, Michael M.; Childress, April; Jacobson, Elliott R.
2004-01-01
A consensus nested-PCR method was designed for investigation of the DNA polymerase gene of adenoviruses. Gene fragments were amplified and sequenced from six novel adenoviruses from seven lizard species, including four species from which adenoviruses had not previously been reported. Host species included Gila monster, leopard gecko, fat-tail gecko, blue-tongued skink, Tokay gecko, bearded dragon, and mountain chameleon. This is the first sequence information from lizard adenoviruses. Phylogenetic analysis indicated that these viruses belong to the genus Atadenovirus, supporting the reptilian origin of atadenoviruses. This PCR method may be useful for obtaining templates for initial sequencing of novel adenoviruses. PMID:15542689
Wellehan, James F X; Johnson, April J; Harrach, Balázs; Benkö, Mária; Pessier, Allan P; Johnson, Calvin M; Garner, Michael M; Childress, April; Jacobson, Elliott R
2004-12-01
A consensus nested-PCR method was designed for investigation of the DNA polymerase gene of adenoviruses. Gene fragments were amplified and sequenced from six novel adenoviruses from seven lizard species, including four species from which adenoviruses had not previously been reported. Host species included Gila monster, leopard gecko, fat-tail gecko, blue-tongued skink, Tokay gecko, bearded dragon, and mountain chameleon. This is the first sequence information from lizard adenoviruses. Phylogenetic analysis indicated that these viruses belong to the genus Atadenovirus, supporting the reptilian origin of atadenoviruses. This PCR method may be useful for obtaining templates for initial sequencing of novel adenoviruses.
CODEHOP (COnsensus-DEgenerate Hybrid Oligonucleotide Primer) PCR primer design
Rose, Timothy M.; Henikoff, Jorja G.; Henikoff, Steven
2003-01-01
We have developed a new primer design strategy for PCR amplification of distantly related gene sequences based on consensus-degenerate hybrid oligonucleotide primers (CODEHOPs). An interactive program has been written to design CODEHOP PCR primers from conserved blocks of amino acids within multiply-aligned protein sequences. Each CODEHOP consists of a pool of related primers containing all possible nucleotide sequences encoding 3–4 highly conserved amino acids within a 3′ degenerate core. A longer 5′ non-degenerate clamp region contains the most probable nucleotide predicted for each flanking codon. CODEHOPs are used in PCR amplification to isolate distantly related sequences encoding the conserved amino acid sequence. The primer design software and the CODEHOP PCR strategy have been utilized for the identification and characterization of new gene orthologs and paralogs in different plant, animal and bacterial species. In addition, this approach has been successful in identifying new pathogen species. The CODEHOP designer (http://blocks.fhcrc.org/codehop.html) is linked to BlockMaker and the Multiple Alignment Processor within the Blocks Database World Wide Web (http://blocks.fhcrc.org). PMID:12824413
Quick, Josh; Grubaugh, Nathan D; Pullan, Steven T; Claro, Ingra M; Smith, Andrew D; Gangavarapu, Karthik; Oliveira, Glenn; Robles-Sikisaka, Refugio; Rogers, Thomas F; Beutler, Nathan A; Burton, Dennis R; Lewis-Ximenez, Lia Laura; de Jesus, Jaqueline Goes; Giovanetti, Marta; Hill, Sarah; Black, Allison; Bedford, Trevor; Carroll, Miles W; Nunes, Marcio; Alcantara, Luiz Carlos; Sabino, Ester C; Baylis, Sally A; Faria, Nuno; Loose, Matthew; Simpson, Jared T; Pybus, Oliver G; Andersen, Kristian G; Loman, Nicholas J
2018-01-01
Genome sequencing has become a powerful tool for studying emerging infectious diseases; however, genome sequencing directly from clinical samples without isolation remains challenging for viruses such as Zika, where metagenomic sequencing methods may generate insufficient numbers of viral reads. Here we present a protocol for generating coding-sequence complete genomes comprising an online primer design tool, a novel multiplex PCR enrichment protocol, optimised library preparation methods for the portable MinION sequencer (Oxford Nanopore Technologies) and the Illumina range of instruments, and a bioinformatics pipeline for generating consensus sequences. The MinION protocol does not require an internet connection for analysis, making it suitable for field applications with limited connectivity. Our method relies on multiplex PCR for targeted enrichment of viral genomes from samples containing as few as 50 genome copies per reaction. Viral consensus sequences can be achieved starting with clinical samples in 1-2 days following a simple laboratory workflow. This method has been successfully used by several groups studying Zika virus evolution and is facilitating an understanding of the spread of the virus in the Americas. PMID:28538739
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stenger, Drake C., E-mail: drake.stenger@ars.usda.
Population structure of Homalodisca coagulata Virus-1 (HoCV-1) among and within field-collected insects sampled from a single point in space and time was examined. Polymorphism in complete consensus sequences among single-insect isolates was dominated by synonymous substitutions. The mutant spectrum of the C2 helicase region within each single-insect isolate was unique and dominated by nonsynonymous singletons. Bootstrapping was used to correct the within-isolate nonsynonymous:synonymous arithmetic ratio (N:S) for RT-PCR error, yielding an N:S value ~one log-unit greater than that of consensus sequences. Probability of all possible single-base substitutions for the C2 region predicted N:S values within 95% confidence limits of themore » corrected within-isolate N:S when the only constraint imposed was viral polymerase error bias for transitions over transversions. These results indicate that bottlenecks coupled with strong negative/purifying selection drive consensus sequences toward neutral sequence space, and that most polymorphism within single-insect isolates is composed of newly-minted mutations sampled prior to selection. -- Highlights: •Sampling protocol minimized differential selection/history among isolates. •Polymorphism among consensus sequences dominated by negative/purifying selection. •Within-isolate N:S ratio corrected for RT-PCR error by bootstrapping. •Within-isolate mutant spectrum dominated by new mutations yet to undergo selection.« less
USDA-ARS?s Scientific Manuscript database
Lipase (lip) and lipase-specific foldase (lif) genes of a biodegradable polyhydroxyalkanoate- (PHA-) synthesizing Pseudomonas resinovorans NRRL B-2649 were cloned using primers based on consensus sequences, followed by PCR-based genome walking. Sequence analyses showed a putative Lip gene-product (...
Molecular Diagnostic Analysis of Outbreak Scenarios
ERIC Educational Resources Information Center
Morsink, M. C.; Dekter, H. E.; Dirks-Mulder, A.; van Leeuwen, W. B.
2012-01-01
In the current laboratory assignment, technical aspects of the polymerase chain reaction (PCR) are integrated in the context of six different bacterial outbreak scenarios. The "Enterobacterial Repetitive Intergenic Consensus Sequence" (ERIC) PCR was used to analyze different outbreak scenarios. First, groups of 2-4 students determined optimal…
Comparison of MY09/11 consensus PCR and type-specific PCRs in the detection of oncogenic HPV types.
Depuydt, C E; Boulet, G A V; Horvath, C A J; Benoy, I H; Vereecken, A J; Bogers, J J
2007-01-01
The causal relationship between persistent infection with high-risk HPV and cervical cancer has resulted in the development of HPV DNA detection systems. The widely used MY09/11 consensus PCR targets a 450bp conserved sequence in the HPV L1 gene, and can therefore amplify a broad spectrum of HPV types. However, limitations of these consensus primers are evident, particularly in regard to the variability in detection sensitivity among different HPV types. This study compared MY09/11 PCR with type-specific PCRs in the detection of oncogenic HPV types. The study population comprised 15, 774 patients. Consensus PCR failed to detect 522 (10.9%) HPV infections indicated by type-specific PCRs. A significant correlation between failure of consensus PCR and HPV type was found. HPV types 51, 68 and 45 were missed most frequently. The clinical relevance of the HPV infections missed by MY09/11 PCR was reflected in the fraction of cases with cytological abnormalities and in follow-up, showing 104 (25.4%) CIN2+ cases. The MY09/11 false negativity could be the result of poor sensitivity, mismatch of MY09/11 primers or disruption of L1 target by HPV integration or DNA degradation. Furthermore, MY09/11 PCR lacked specificity for oncogenic HPVs. Diagnostic accuracy of the PCR systems, in terms of sensitivity (MY09/11 PCR: 87.9%; type-specific PCRs: 98.3%) and specificity (MY09/11 PCR: 38.7%; type-specific PCRs: 76.14%), and predictive values for histologically confirmed CIN2+, suggest that type-specific PCRs could be used in a clinical setting as a reliable screening tool.
Stephen, Alexa A; Leone, Angelique M; Toplon, David E; Archer, Linda L; Wellehan, James F X
2016-12-01
A juvenile female bald eagle ( Haliaeetus leucocephalus ) was presented with emaciation and proliferative periocular lesions. The eagle did not respond to supportive therapy and was euthanatized. Histopathologic examination of the skin lesions revealed plaques of marked epidermal hyperplasia parakeratosis, marked acanthosis and spongiosis, and eosinophilic intracytoplasmic inclusion bodies. Novel polymerase chain reaction (PCR) assays were done to amplify and sequence DNA polymerase and rpo147 genes. The 4b gene was also analyzed by a previously developed assay. Bayesian and maximum likelihood phylogenetic analyses of the obtained sequences found it to be poxvirus of the genus Avipoxvirus and clustered with other raptor isolates. Better phylogenetic resolution was found in rpo147 rather than the commonly used DNA polymerase. The novel consensus rpo147 PCR assay will create more accurate phylogenic trees and allow better insight into poxvirus history.
Quick, Joshua; Grubaugh, Nathan D; Pullan, Steven T; Claro, Ingra M; Smith, Andrew D; Gangavarapu, Karthik; Oliveira, Glenn; Robles-Sikisaka, Refugio; Rogers, Thomas F; Beutler, Nathan A; Burton, Dennis R; Lewis-Ximenez, Lia Laura; de Jesus, Jaqueline Goes; Giovanetti, Marta; Hill, Sarah C; Black, Allison; Bedford, Trevor; Carroll, Miles W; Nunes, Marcio; Alcantara, Luiz Carlos; Sabino, Ester C; Baylis, Sally A; Faria, Nuno R; Loose, Matthew; Simpson, Jared T; Pybus, Oliver G; Andersen, Kristian G; Loman, Nicholas J
2017-06-01
Genome sequencing has become a powerful tool for studying emerging infectious diseases; however, genome sequencing directly from clinical samples (i.e., without isolation and culture) remains challenging for viruses such as Zika, for which metagenomic sequencing methods may generate insufficient numbers of viral reads. Here we present a protocol for generating coding-sequence-complete genomes, comprising an online primer design tool, a novel multiplex PCR enrichment protocol, optimized library preparation methods for the portable MinION sequencer (Oxford Nanopore Technologies) and the Illumina range of instruments, and a bioinformatics pipeline for generating consensus sequences. The MinION protocol does not require an Internet connection for analysis, making it suitable for field applications with limited connectivity. Our method relies on multiplex PCR for targeted enrichment of viral genomes from samples containing as few as 50 genome copies per reaction. Viral consensus sequences can be achieved in 1-2 d by starting with clinical samples and following a simple laboratory workflow. This method has been successfully used by several groups studying Zika virus evolution and is facilitating an understanding of the spread of the virus in the Americas. The protocol can be used to sequence other viral genomes using the online Primal Scheme primer designer software. It is suitable for sequencing either RNA or DNA viruses in the field during outbreaks or as an inexpensive, convenient method for use in the lab.
Logan, Grace; Freimanis, Graham L; King, David J; Valdazo-González, Begoña; Bachanek-Bankowska, Katarzyna; Sanderson, Nicholas D; Knowles, Nick J; King, Donald P; Cottam, Eleanor M
2014-09-30
Next-Generation Sequencing (NGS) is revolutionizing molecular epidemiology by providing new approaches to undertake whole genome sequencing (WGS) in diagnostic settings for a variety of human and veterinary pathogens. Previous sequencing protocols have been subject to biases such as those encountered during PCR amplification and cell culture, or are restricted by the need for large quantities of starting material. We describe here a simple and robust methodology for the generation of whole genome sequences on the Illumina MiSeq. This protocol is specific for foot-and-mouth disease virus (FMDV) or other polyadenylated RNA viruses and circumvents both the use of PCR and the requirement for large amounts of initial template. The protocol was successfully validated using five FMDV positive clinical samples from the 2001 epidemic in the United Kingdom, as well as a panel of representative viruses from all seven serotypes. In addition, this protocol was successfully used to recover 94% of an FMDV genome that had previously been identified as cell culture negative. Genome sequences from three other non-FMDV polyadenylated RNA viruses (EMCV, ERAV, VESV) were also obtained with minor protocol amendments. We calculated that a minimum coverage depth of 22 reads was required to produce an accurate consensus sequence for FMDV O. This was achieved in 5 FMDV/O/UKG isolates and the type O FMDV from the serotype panel with the exception of the 5' genomic termini and area immediately flanking the poly(C) region. We have developed a universal WGS method for FMDV and other polyadenylated RNA viruses. This method works successfully from a limited quantity of starting material and eliminates the requirement for genome-specific PCR amplification. This protocol has the potential to generate consensus-level sequences within a routine high-throughput diagnostic environment.
Molecular detection of Sarcocystis lutrae in the European badger (Meles meles) in Scotland.
Lepore, T; Bartley, P M; Chianini, F; Macrae, A I; Innes, E A; Katzer, F
2017-09-01
Neck samples from 54 badgers and 32 tongue samples of the same badgers (Meles meles), collected in the Lothians and Borders regions of Scotland, were tested using polymerase chain reactions (PCRs) directed against the 18S ribosomal DNA and the internal transcribed spacer (ITS1) region of protozoan parasites of the family Sarcocystidae. Positive results were obtained from 36/54 (67%) neck and 24/32 (75%) tongue samples using an 18S rDNA PCR. A 468 base pair consensus sequence that was generated from the 18S rDNA PCR amplicons (KX229728) showed 100% identity to Sarcocystis lutrae. The ITS1 PCR results revealed that 12/20 (60%) neck and 10/20 (50%) tongue samples were positive for Sarcocystidae DNA. A 1074 bp consensus sequence was generated from the ITS1 PCR amplicons (KX431307) and showed 100% identity to S. lutrae. Multiple sequence alignments and phylogenetic analysis support the finding that the rDNA found in badgers is identical to that of S. lutrae. This parasite has not been previously reported in badgers or in the UK. Sarcocystis lutrae has previously only been detected in tongue, skeletal muscle and diaphragm samples of the Eurasian otter (Lutra lutra) in Norway and potentially in the Arctic fox (Vulpes lagopus).
USDA-ARS?s Scientific Manuscript database
Lipase gene (lip) of a biodegradable polyhydroxyalkanoate- (PHA-) synthesizing bacterium P. resinovorans NRRL B-2649 was cloned, sequenced and characterized by using consensus primers and PCR-based genome walking method. The ORF of the putative Lip (314 amino acids) and its active site (Ser111, Asp...
Detection of a novel herpesvirus from bats in the Philippines.
Sano, Kaori; Okazaki, Sachiko; Taniguchi, Satoshi; Masangkay, Joseph S; Puentespina, Roberto; Eres, Eduardo; Cosico, Edison; Quibod, Niña; Kondo, Taisuke; Shimoda, Hiroshi; Hatta, Yuuki; Mitomo, Shumpei; Oba, Mami; Katayama, Yukie; Sassa, Yukiko; Furuya, Tetsuya; Nagai, Makoto; Une, Yumi; Maeda, Ken; Kyuwa, Shigeru; Yoshikawa, Yasuhiro; Akashi, Hiroomi; Omatsu, Tsutomu; Mizutani, Tetsuya
2015-08-01
Bats are natural hosts of many zoonotic viruses. Monitoring bat viruses is important to detect novel bat-borne infectious diseases. In this study, next generation sequencing techniques and conventional PCR were used to analyze intestine, lung, and blood clot samples collected from wild bats captured at three locations in Davao region, in the Philippines in 2012. Different viral genes belonging to the Retroviridae and Herpesviridae families were identified using next generation sequencing. The existence of herpesvirus in the samples was confirmed by PCR using herpesvirus consensus primers. The nucleotide sequences of the resulting PCR amplicons were 166-bp. Further phylogenetic analysis identified that the virus from which this nucleotide sequence was obtained belonged to the Gammaherpesvirinae subfamily. PCR using primers specific to the nucleotide sequence obtained revealed that the infection rate among the captured bats was 30 %. In this study, we present the partial genome of a novel gammaherpesvirus detected from wild bats. Our observations also indicate that this herpesvirus may be widely distributed in bat populations in Davao region.
Berger, Cordula; Parson, Walther
2009-06-01
The degradation state of some biological traces recovered from the crime scene requires the amplification of very short fragments to attain a useful mitochondrial (mt)DNA sequence. We have previously introduced two mini-multiplex assays that amplify 10 overlapping control region (CR) fragments in two separate multiplex PCRs, which brought successful CR consensus sequences from even highly degraded DNA extracts. This procedure requires a total of 20 sequencing reactions per sample, which is laborious and cost intensive. For only moderately degraded samples that we encounter more frequently with typical mtDNA casework material, we developed two new multiplex assays that use a subset of the mini-amplicon primers but embrace larger fragments (midis) and require only 10 sequencing reactions to build a double-stranded CR consensus sequence. We used a preceding mtDNA quantitation step by real-time PCR with two different target fragments (143 and 283 bp) that roughly correspond to the average fragment sizes of the different multiplex approaches to estimate size-dependent mtDNA quantities and to aid the choice of the appropriate PCR multiplexes with respect to quality of the results and required costs.
Hwang, Yusun; Lee, Miae
2012-05-01
We evaluated the performance of various commercial assays for the molecular detection of human papillomavirus (HPV); the recently developed AdvanSure HPV Screening real-time PCR assay (AdvanSure PCR) and the Abbott RealTime High Risk HPV PCR assay (Abbott PCR) were compared with the Hybrid Capture 2 HPV DNA Test (HC2). All 3 tests were performed on 177 samples, and any sample that showed a discrepancy in any of the 3 tests was genotyped using INNO-LiPA HPV genotyping and/or sequencing. On the basis of these results, we obtained a consensus HPV result, and the performance of each test was evaluated. We also evaluated high-risk HPV 16/18 detection by using the 2 real-time PCR assays. Among the 177 samples, 65 were negative and 75 were positive in all 3 assays; however, the results of the 3 assays with 37 samples were discrepant. Compared with the consensus HPV result, the sensitivities and specificities of HC2, AdvanSure PCR, and Abbott PCR were 97.6%, 91.7%, and 86.9% and 83.9%, 98.8%, and 100.0%, respectively. For HPV type 16/18 detection, the concordance rate between the AdvanSure PCR and Abbott PCR assays was 98.3%; however, 3 samples were discrepant (positive in AdvanSure PCR and negative in Abbott PCR) and were confirmed as HPV type 16 by INNO-LiPA genotyping and/or sequencing. For HPV detection, the AdvanSure HPV Screening real-time PCR assay and the Abbott PCR assay are less sensitive but more specific than the HC2 assay, but can simultaneously differentiate type 16/18 HPV from other types.
Provencher, Cathy; LaPointe, Gisèle; Sirois, Stéphane; Van Calsteren, Marie-Rose; Roy, Denis
2003-01-01
A primer design strategy named CODEHOP (consensus-degenerate hybrid oligonucleotide primer) for amplification of distantly related sequences was used to detect the priming glycosyltransferase (GT) gene in strains of the Lactobacillus casei group. Each hybrid primer consisted of a short 3′ degenerate core based on four highly conserved amino acids and a longer 5′ consensus clamp region based on six sequences of the priming GT gene products from exopolysaccharide (EPS)-producing bacteria. The hybrid primers were used to detect the priming GT gene of 44 commercial isolates and reference strains of Lactobacillus rhamnosus, L. casei, Lactobacillus zeae, and Streptococcus thermophilus. The priming GT gene was detected in the genome of both non-EPS-producing (EPS−) and EPS-producing (EPS+) strains of L. rhamnosus. The sequences of the cloned PCR products were similar to those of the priming GT gene of various gram-negative and gram-positive EPS+ bacteria. Specific primers designed from the L. rhamnosus RW-9595M GT gene were used to sequence the end of the priming GT gene in selected EPS+ strains of L. rhamnosus. Phylogenetic analysis revealed that Lactobacillus spp. form a distinctive group apart from other lactic acid bacteria for which GT genes have been characterized to date. Moreover, the sequences show a divergence existing among strains of L. rhamnosus with respect to the terminal region of the priming GT gene. Thus, the PCR approach with consensus-degenerate hybrid primers designed with CODEHOP is a practical approach for the detection of similar genes containing conserved motifs in different bacterial genomes. PMID:12788729
Detection of a new bat gammaherpesvirus in the Philippines.
Watanabe, Shumpei; Ueda, Naoya; Iha, Koichiro; Masangkay, Joseph S; Fujii, Hikaru; Alviola, Phillip; Mizutani, Tetsuya; Maeda, Ken; Yamane, Daisuke; Walid, Azab; Kato, Kentaro; Kyuwa, Shigeru; Tohya, Yukinobu; Yoshikawa, Yasuhiro; Akashi, Hiroomi
2009-08-01
A new bat herpesvirus was detected in the spleen of an insectivorous bat (Hipposideros diadema, family Hipposideridae) collected on Panay Island, the Philippines. PCR analyses were performed using COnsensus-DEgenerate Hybrid Oligonucleotide Primers (CODEHOPs) targeting the herpesvirus DNA polymerase (DPOL) gene. Although we obtained PCR products with CODEHOPs, direct sequencing using the primers was not possible because of high degree of degeneracy. Direct sequencing technology developed in our rapid determination system of viral RNA sequences (RDV) was applied in this study, and a partial DPOL nucleotide sequence was determined. In addition, a partial gB gene nucleotide sequence was also determined using the same strategy. We connected the partial gB and DPOL sequences with long-distance PCR, and a 3741-bp nucleotide fragment, including the 3' part of the gB gene and the 5' part of the DPOL gene, was finally determined. Phylogenetic analysis showed that the sequence was novel and most similar to those of the subfamily Gammaherpesvirinae.
Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR.
D'Souza, T M; Boominathan, K; Reddy, C A
1996-01-01
Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. PMID:8837429
Dourado, Ana Catarina; Alves, Paula I L; Tenreiro, Tania; Ferreira, Eugénio M; Tenreiro, Rogério; Fareleira, Paula; Crespo, M Teresa Barreto
2009-12-01
A collection of nodule isolates from Medicago polymorpha obtained from southern and central Portugal was evaluated by M13-PCR fingerprinting and hierarchical cluster analysis. Several genomic clusters were obtained which, by 16S rRNA gene sequencing of selected representatives, were shown to be associated with particular taxonomic groups of rhizobia and other soil bacteria. The method provided a clear separation between rhizobia and co-isolated non-symbiotic soil contaminants. Ten M13-PCR groups were assigned to Sinorhizobium (Ensifer) medicae and included all isolates responsible for the formation of nitrogen-fixing nodules upon re-inoculation of M. polymorpha test-plants. In addition, enterobacterial repetitive intergenic consensus (ERIC)-PCR fingerprinting indicated a high genomic heterogeneity within the major M13- PCR clusters of S. medicae isolates. Based on nucleotide sequence data of an M13-PCR amplicon of ca. 1500 bp, observed only in S. medicae isolates and spanning locus Smed_3707 to Smed_3709 from the pSMED01 plasmid sequence of S. medicae WSM419 genome's sequence, a pair of PCR primers was designed and used for direct PCR amplification of a 1399-bp sequence within this fragment. Additional in silico and in vitro experiments, as well as phylogenetic analysis, confirmed the specificity of this primer combination and therefore the reliability of this approach in the prompt identification of S. medicae isolates and their distinction from other soil bacteria.
Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR
DOE Office of Scientific and Technical Information (OSTI.GOV)
D`Souza, T.M.; Boominathan, K.; Reddy, C.A.
1996-10-01
Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum,more » Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.« less
Pooler, M R; Ritchie, D F; Hartung, J S
1996-01-01
Genetic relationships among 25 isolates of Xanthomonas fragariae from diverse geographic regions were determined by three PCR methods that rely on different amplification priming strategies: random amplified polymorphic DNA (RAPD) PCR, repetitive extragenic palindromic (REP) PCR, and enterobacterial repetitive intergenic consensus (ERIC) PCR. The results of these assays are mutually consistent and indicate that pathogenic strains are very closely related to each other. RAPD, ERIC, and REP PCR assays identified nine, four, and two genotypes, respectively, within X. fragariae isolates. A single nonpathogenic isolate of X. fragariae was not distinguishable by these methods. The results of the PCR assays were also fully confirmed by physiological tests. There was no correlation between DNA amplification product patterns and geographic sites of isolation, suggesting that this bacterium has spread largely through exchange of infected plant germ plasm. Sequences identified through the RAPD assays were used to develop three primer pairs for standard PCR assays to identify X. fragariae. In addition, we developed a stringent multiplexed PCR assay to identify X. fragariae by simultaneously using the three independently derived sets of primers specific for pathogenic strains of the bacteria. PMID:8795198
Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR
Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan
2002-01-01
AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381
Reid-Bayliss, Kate S; Loeb, Lawrence A
2017-08-29
Transcriptional mutagenesis (TM) due to misincorporation during RNA transcription can result in mutant RNAs, or epimutations, that generate proteins with altered properties. TM has long been hypothesized to play a role in aging, cancer, and viral and bacterial evolution. However, inadequate methodologies have limited progress in elucidating a causal association. We present a high-throughput, highly accurate RNA sequencing method to measure epimutations with single-molecule sensitivity. Accurate RNA consensus sequencing (ARC-seq) uniquely combines RNA barcoding and generation of multiple cDNA copies per RNA molecule to eliminate errors introduced during cDNA synthesis, PCR, and sequencing. The stringency of ARC-seq can be scaled to accommodate the quality of input RNAs. We apply ARC-seq to directly assess transcriptome-wide epimutations resulting from RNA polymerase mutants and oxidative stress.
2014-01-01
Background Next-generation DNA sequencing (NGS) technologies have made huge impacts in many fields of biological research, but especially in evolutionary biology. One area where NGS has shown potential is for high-throughput sequencing of complete mtDNA genomes (of humans and other animals). Despite the increasing use of NGS technologies and a better appreciation of their importance in answering biological questions, there remain significant obstacles to the successful implementation of NGS-based projects, especially for new users. Results Here we present an ‘A to Z’ protocol for obtaining complete human mitochondrial (mtDNA) genomes – from DNA extraction to consensus sequence. Although designed for use on humans, this protocol could also be used to sequence small, organellar genomes from other species, and also nuclear loci. This protocol includes DNA extraction, PCR amplification, fragmentation of PCR products, barcoding of fragments, sequencing using the 454 GS FLX platform, and a complete bioinformatics pipeline (primer removal, reference-based mapping, output of coverage plots and SNP calling). Conclusions All steps in this protocol are designed to be straightforward to implement, especially for researchers who are undertaking next-generation sequencing for the first time. The molecular steps are scalable to large numbers (hundreds) of individuals and all steps post-DNA extraction can be carried out in 96-well plate format. Also, the protocol has been assembled so that individual ‘modules’ can be swapped out to suit available resources. PMID:24460871
Kovács, Endre R; Benko, Mária
2009-03-01
Partial genome characterisation of a novel adenovirus, found recently in organ samples of multiple species of dead birds of prey, was carried out by sequence analysis of PCR-amplified DNA fragments. The virus, named as raptor adenovirus 1 (RAdV-1), has originally been detected by a nested PCR method with consensus primers targeting the adenoviral DNA polymerase gene. Phylogenetic analysis with the deduced amino acid sequence of the small PCR product has implied a new siadenovirus type present in the samples. Since virus isolation attempts remained unsuccessful, further characterisation of this putative novel siadenovirus was carried out with the use of PCR on the infected organ samples. The DNA sequence of the central genome part of RAdV-1, encompassing nine full (pTP, 52K, pIIIa, III, pVII, pX, pVI, hexon, protease) and two partial (DNA polymerase and DBP) genes and exceeding 12 kb pairs in size, was determined. Phylogenetic tree reconstructions, based on several genes, unambiguously confirmed the preliminary classification of RAdV-1 as a new species within the genus Siadenovirus. Further study of RAdV-1 is of interest since it represents a rare adenovirus genus of yet undetermined host origin.
Lee, Chin Mei; Sieo, Chin Chin; Cheah, Yoke-Kqueen; Abdullah, Norhani; Ho, Yin Wan
2012-02-01
Four repetitive element sequence-based polymerase chain reaction (rep-PCR) methods, namely repetitive extragenic palindromic PCR (REP-PCR), enterobacterial repetitive intergenic consensus PCR (ERIC-PCR), polytrinucleotide (GTG)₅ -PCR and BOX-PCR, were evaluated for the molecular differentiation of 12 probiotic Lactobacillus strains previously isolated from the gastrointestinal tract of chickens and used as a multistrain probiotic. This study represents the first analysis of the comparative efficacy of these four rep-PCR methods and their combination (composite rep-PCR) in the molecular typing of Lactobacillus strains based on a discriminatory index (D). Species-specific and strain-specific profiles were observed from rep-PCR. From the numerical analysis of composite rep-PCR, BOX-PCR, (GTG)₅ -PCR, REP-PCR and ERIC-PCR, D values of 0.9118, 0.9044, 0.8897, 0.8750 and 0.8529 respectively were obtained. Composite rep-PCR analysis was the most discriminative method, with eight Lactobacillus strains, namely L. brevis ATCC 14869(T) , L. reuteri C 10, L. reuteri ATCC 23272(T) , L. gallinarum ATCC 33199(T) , L. salivarius ATCC 11741(T) , L. salivarius I 24, L. panis JCM 11053(T) and L. panis C 17, being differentiated at the strain level. Composite rep-PCR analysis is potentially a useful fingerprinting method to discriminate probiotic Lactobacillus strains isolated from the gastrointestinal tract of chickens. Copyright © 2011 Society of Chemical Industry.
Sechi, Leonardo A.; Leori, Guido; Lollai, Stefano A.; Duprè, Ilaria; Molicotti, Paola; Fadda, Giovanni; Zanetti, Stefania
1999-01-01
Different genetic markers were used to analyze 22 Mycobacterium bovis strains isolated from cattle in Sardinia and one human isolate. IS6110 DNA fingerprinting differentiated the strains into six patterns, whereas with enterobacterial repetitive consensus sequence primers produced seven clusters. PCR ribotyping followed by digestion with HaeIII and PvuII produced five and seven patterns, respectively. PCR with the (GTG)5 oligonucleotide primer showed the best discriminatory power, generating eight clusters among the strains analyzed. PMID:10103282
Maluping, R P; Ravelo, C; Lavilla-Pitogo, C R; Krovacek, K; Romalde, J L
2005-01-01
The main aim of the present study was to use three PCR-based techniques for the analysis of genetic variability among Vibrio parahaemolyticus strains isolated from the Philippines. Seventeen strains of V. parahaemolyticus isolated from shrimps (Penaeus monodon) and from the environments where these shrimps are being cultivated were analysed by random amplified polymorphic DNA PCR (RAPD-PCR), enterobacterial repetitive intergenic consensus sequence PCR (ERIC-PCR) and repetitive extragenic palindromic PCR (REP-PCR). The results of this work have demonstrated genetic variability within the V. parahaemolyticus strains that were isolated from the Philippines. In addition, RAPD, ERIC and REP-PCR are suitable rapid typing methods for V. parahaemolyticus. All three methods have good discriminative ability and can be used as a rapid means of comparing V. parahaemolyticus strains for epidemiological investigation. Based on the results of this study, we could say that REP-PCR is inferior to RAPD and ERIC-PCR owing to the fact that it is less reproducible. Moreover, the REP-PCR analysis yielded a relatively small number of products. This may suggests that the REP sequences may not be widely distributed in the V. parahaemolyticus genome. Genetic variability within V. parahaemolyticus strains isolated in the Philippines has been demonstrated. The presence of ERIC and REP sequences in the genome of this bacterial species was confirmed. The RAPD, ERIC and REP-PCR techniques are useful methods for molecular typing of V. parahaemolyticus strains. To our knowledge this is the first study of this kind carried out on V. parahaemolyticus strains isolated from the Philippines.
Millard, T P; Ashton, G H S; Kondeatis, E; Vaughan, R W; Hughes, G R V; Khamashta, M A; Hawk, J L M; McGregor, J M; McGrath, J A
2002-02-01
The Ro 60 kDa protein (Ro60 or SSA2) is the major component of the Ro ribonucleoprotein (Ro RNP) complex, to which an immune response is a specific feature of several autoimmune diseases. The genomic organization and any sequence variation within the DNA encoding Ro60 are unknown. To characterize the Ro60 gene structure and to assess whether any sequence alterations might be associated with serum anti-Ro antibody in subacute cutaneous lupus erythematosus (SCLE), thus potentially providing new insight into disease pathogenesis. The cDNA sequence for Ro60 was obtained from the NCBI database and used for a BLAST search for a clone containing the entire genomic sequence. The intron-exon borders were confirmed by designing intronic primer pairs to flank each exon, which were then used to amplify genomic DNA for automated sequencing from 36 caucasian patients with SCLE (anti-Ro positive) and 49 with discoid LE (DLE, anti-Ro negative), in addition to 36 healthy caucasian controls. Heteroduplex analysis of polymerase chain reaction (PCR) products from patients and controls spanning all Ro60 exons (1-8) revealed a common bandshift in the PCR products spanning exon 7. Sequencing of the corresponding PCR products demonstrated an A > G substitution at nucleotide position 1318-7, within the consensus acceptor splice site of exon 7 (GenBank XM001901). The allele frequencies were major allele A (0.71) and minor allele G (0.29) in 72 control chromosomes, with no significant differences found between SCLE patients, DLE patients and controls. The genomic organization of the DNA encoding the Ro60 protein is described, including a common polymorphism within the consensus acceptor splice site of exon 7. Our delineation of a strategy for the genomic amplification of Ro60 forms a basis for further examination of the pathological functions of the Ro RNP in autoimmune disease.
Gomez-De-Leon, Patricia; Santos, Jose I.; Caballero, Javier; Gomez, Demostenes; Espinosa, Luz E.; Moreno, Isabel; Piñero, Daniel; Cravioto, Alejandro
2000-01-01
Genomic fingerprints from 92 capsulated and noncapsulated strains of Haemophilus influenzae from Mexican children with different diseases and healthy carriers were generated by PCR using the enterobacterial repetitive intergenic consensus (ERIC) sequences. A cluster analysis by the unweighted pair-group method with arithmetic averages based on the overall similarity as estimated from the characteristics of the genomic fingerprints, was conducted to group the strains. A total of 69 fingerprint patterns were detected in the H. influenzae strains. Isolates from patients with different diseases were represented by a variety of patterns, which clustered into two major groups. Of the 37 strains isolated from cases of meningitis, 24 shared patterns and were clustered into five groups within a similarity level of 1.0. One fragment of 1.25 kb was common to all meningitis strains. H. influenzae strains from healthy carriers presented fingerprint patterns different from those found in strains from sick children. Isolates from healthy individuals were more variable and were distributed differently from those from patients. The results show that ERIC-PCR provides a powerful tool for the determination of the distinctive pathogenicity potentials of H. influenzae strains and encourage its use for molecular epidemiology investigations. PMID:10878033
Ture, M; Altinok, I; Capkin, E
2015-01-01
Biochemical test, pulsed-field gel electrophoresis (PFGE) and enterobacterial repetitive intergenic consensus sequence PCR (ERIC-PCR) were used to compare 42 strains of Lactococcus garvieae isolated from different regions of Turkey, Italy, France and Spain. Twenty biotypes of L. garvieae were formed based on 54 biochemical tests. ERIC-PCR of genomic DNA from different L. garvieae strains resulted in amplification of multiple fragments of DNA in sizes ranging between 200 and 5000 bp with various band intensities. After cutting DNA with ApaI restriction enzyme and running on the PFGE, 11–22 resolvable bands ranging from 2 to 194 kb were observed. Turkish isolates were grouped into two clusters, and only A58 (Italy) strain was connected with Turkish isolates. Similarities between Turkish, Spanish, Italian and French isolates were <50% except 216-6 Rize strain. In Turkey, first lactococcosis occurred in Mugla, and then, it has been spread all over the country. Based on ERIC-PCR, Spanish and Italian strains of L. garvieae were related to Mugla strains. Therefore, after comparing PFGE profiles, ERIC-PCR profiles and phenotypic characteristics of 42 strains of L. garvieae, there were no relationships found between these three typing methods. PFGE method was more discriminative than the other methods. © 2014 John Wiley & Sons Ltd.
The intron 1 of HPV 16 has a suboptimal branch point at a guanosine.
De la Rosa-Rios, Marco Antonio; Martínez-Salazar, Martha; Martínez-Garcia, Martha; González-Bonilla, César; Villegas-Sepúlveda, Nicolás
2006-06-01
The branch point sequence (BPS) of intron 1 of the HPV-16 was determined via RT-PCR in a cell free system, using lariat intermediates obtained by in vitro splicing reactions. We used synthetic E6/E7 transcripts and HeLa nuclear protein extracts to obtain the splicing intermediates. Then, a divergent oligonucleotide primer set, pairing on the lariat RNA that encompassed the 2'-5' phosphodiester bond formed between the 5' end of the intron and the BPS, was used for cDNA synthesis and PCR amplification. Subsequent RT-PCR assays revealed four splicing intermediates, made up of a major intermediary corresponding to the BPS and four cryptic branched sequences. Only intermediates bound at the 5' end of the intron are probably the authentic branch point sequence, and all of them branch at guanosine 328 instead of the typical adenosine. Unusually, the BPS of intron 1 of HPV-16 is a suboptimal sequence (AGUGAGU) that differs from the eukaryotic consensus BPS, which correlates with the splicing profile observed for early transcripts of HPV-16 in tumors and tumor derived cell lines. The implications of this unusual branch point sequence for splicing of the HPV-16 pre-mRNA are discussed.
Jalal Kiani, Seyed; Shatizadeh Malekshahi, Somayeh; Yousefi Ghalejoogh, Zohreh; Ghavvami, Nastaran; Shafiei Jandaghi, Nazanin Zahra; Shahsiah, Reza; Jahanzad, Isa; Yavarian, Jila
2015-01-01
Background: Cervical cancer is the leading cause of death from cancer in under-developed countries. Human papilloma virus (HPV) 16 and 18 are the most prevalent types associated with carcinogenesis in the cervix. Conventional Polymerase Chain Reaction (PCR), type-specific and consensus primer-based PCR followed by sequencing, Restriction Fragment Length Polymorphism (RFLP) or hybridization by specific probes are common methods for HPV detection and typing. In addition, some researchers have developed a multiplex PCR for simultaneous detection and typing of different HPVs. Objectives: The aim of the present study was to investigate the prevalence of HPV infection and its types in cervical Squamous Cell Carcinoma (SCC) using the Nested Multiplex PCR (NMPCR) assay. Patients and Methods: Sixty-six samples with histologically confirmed SCC were evaluated. Total DNA was isolated by phenol–chloroform extraction and ethanol precipitation. Nested multiplex PCR was performed with first-round PCR by GP-E6/E7 consensus primers for amplification of the genomic DNA of all known mucosal HPV genotypes and second-round PCR by type-specific multiplex PCR primer cocktails. Results: Human papilloma virus infection was detected in 78.8% of samples, with the highest prevalence of HPV 16 (60.6%) while concurrent infections with two types was detected in 10.6%. Conclusions: The NMPCR assay is more convenient and easy for analysis of results, which is important for fast diagnosis and patient management, in a type-specific manner. PMID:26865940
3'-terminal sequence of a small round structured virus (SRSV) in Japan.
Utagawa, E T; Takeda, N; Inouye, S; Kasuga, K; Yamazaki, S
1994-01-01
We determined the nucleotide sequence of about 1,000 bases from the 3'-terminus of a small round structured virus (SRSV), which caused a gastroenteritis outbreak in Chiba Prefecture, Japan, in 1987. The sequence was compared with the corresponding sequence region of Norwalk virus; it consisted of a part of the open reading frame 2 (ORF2), whole ORF3, and 3'-noncoding region (NCR). The 624-base-long ORF3 had sequence homology of 68% with the corresponding region of Norwalk virus. (The amino acid sequence homology was 74%.) The 94-base-long NCR had 65% homology with Norwalk virus. We then selected two consensus-sequence portions in the above sequence between Chiba and Norwalk viruses for primers in the reverse transcriptase-polymerase chain reaction (RT-PCR). Using this primer set, we detected 669-bp bands in agarose gel electrophoresis of RT-PCR products from feces containing Chiba or Norwalk viruses. Furthermore, in Southern hybridization with Chiba probes which were labeled with digoxigenin-dUTP in PCR, the bands of the two viruses were clearly stained under a low stringency condition. Since both Chiba and Norwalk viruses were detected by the above primer set although they are geographically and chronologically different viruses, our primer-pair may be useful for detection of a broad range of SRSVs which cause gastroenteritis in different areas.
Diversity of Cronobacter spp. isolates from the vegetables in the middle-east coastline of China.
Chen, Wanyi; Yang, Jielin; You, Chunping; Liu, Zhenmin
2016-06-01
Cronobacter spp. has caused life-threatening neonatal infections mainly resulted from consumption of contaminated powdered infant formula. A total of 102 vegetable samples from retail markets were evaluated for the presence of Cronobacter spp. Thirty-five presumptive Cronobacter isolates were isolated and identified using API 20E and 16S rDNA sequencing analyses. All isolates and type strains were characterized using enterobacterial repetitive intergenic consensus sequence PCR (ERIC-PCR), and genetic profiles of cluster analysis from this molecular typing test clearly showed that there were differences among isolates from different vegetables. A polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) based on the amplification of the gyrB gene (1258 bp) was developed to differentiate among Cronobacter species. A new PCR-RFLP assay based on the amplification of the gyrB gene using Alu I and Hinf I endonuclease combination is established and it has been confirmed an accurate and rapid subtyping method to differentiate Cronobacter species. Sequence analysis of the gyrB gene was proven to be suitable for the phylogenetic analysis of the Cronobacter strains, which has much better resolution based on SNPs in the identification of Cronobacter species specificity than PCR-RFLP and ERIC-PCR. Our study further confirmed that vegetables are one of the most common habitats or sources of Cronobacter spp. contamination in the middle-east coastline of China.
High resolution identity testing of inactivated poliovirus vaccines
Mee, Edward T.; Minor, Philip D.; Martin, Javier
2015-01-01
Background Definitive identification of poliovirus strains in vaccines is essential for quality control, particularly where multiple wild-type and Sabin strains are produced in the same facility. Sequence-based identification provides the ultimate in identity testing and would offer several advantages over serological methods. Methods We employed random RT-PCR and high throughput sequencing to recover full-length genome sequences from monovalent and trivalent poliovirus vaccine products at various stages of the manufacturing process. Results All expected strains were detected in previously characterised products and the method permitted identification of strains comprising as little as 0.1% of sequence reads. Highly similar Mahoney and Sabin 1 strains were readily discriminated on the basis of specific variant positions. Analysis of a product known to contain incorrect strains demonstrated that the method correctly identified the contaminants. Conclusion Random RT-PCR and shotgun sequencing provided high resolution identification of vaccine components. In addition to the recovery of full-length genome sequences, the method could also be easily adapted to the characterisation of minor variant frequencies and distinction of closely related products on the basis of distinguishing consensus and low frequency polymorphisms. PMID:26049003
Guinea Pig ID-Like Families of SINEs
Kass, David H.; Schaetz, Brian A.; Beitler, Lindsey; Bonney, Kevin M.; Jamison, Nicole; Wiesner, Cathy
2009-01-01
Previous studies have indicated a paucity of SINEs within the genomes of the guinea pig and nutria, representatives of the Hystricognathi suborder of rodents. More recent work has shown that the guinea pig genome contains a large number of B1 elements, expanding to various levels among different rodents. In this work we utilized A–B PCR and screened GenBank with sequences from isolated clones to identify potentially uncharacterized SINEs within the guinea pig genome, and identified numerous sequences with a high degree of similarity (>92%) specific to the guinea pig. The presence of A-tails and flanking direct repeats associated with these sequences supported the identification of a full-length SINE, with a consensus sequence notably distinct from other rodent SINEs. Although most similar to the ID SINE, it clearly was not derived from the known ID master gene (BC1), hence we refer to this element as guinea pig ID-like (GPIDL). Using the consensus to screen the guinea pig genomic database (Assembly CavPor2) with Ensembl BlastView, we estimated at least 100,000 copies, which contrasts markedly to just over 100 copies of ID elements. Additionally we provided evidence of recent integrations of GPIDL as two of seven analyzed conserved GPIDL-containing loci demonstrated presence/absence variants in Cavia porcellus and C. aperea. Using intra-IDL PCR and sequence analyses we also provide evidence that GPIDL is derived from a hystricognath-specific SINE family. These results demonstrate that this SINE family continues to contribute to the dynamics of genomes of hystricognath rodents. PMID:19232383
Guinea pig ID-like families of SINEs.
Kass, David H; Schaetz, Brian A; Beitler, Lindsey; Bonney, Kevin M; Jamison, Nicole; Wiesner, Cathy
2009-05-01
Previous studies have indicated a paucity of SINEs within the genomes of the guinea pig and nutria, representatives of the Hystricognathi suborder of rodents. More recent work has shown that the guinea pig genome contains a large number of B1 elements, expanding to various levels among different rodents. In this work we utilized A-B PCR and screened GenBank with sequences from isolated clones to identify potentially uncharacterized SINEs within the guinea pig genome, and identified numerous sequences with a high degree of similarity (>92%) specific to the guinea pig. The presence of A-tails and flanking direct repeats associated with these sequences supported the identification of a full-length SINE, with a consensus sequence notably distinct from other rodent SINEs. Although most similar to the ID SINE, it clearly was not derived from the known ID master gene (BC1), hence we refer to this element as guinea pig ID-like (GPIDL). Using the consensus to screen the guinea pig genomic database (Assembly CavPor2) with Ensembl BlastView, we estimated at least 100,000 copies, which contrasts markedly to just over 100 copies of ID elements. Additionally we provided evidence of recent integrations of GPIDL as two of seven analyzed conserved GPIDL-containing loci demonstrated presence/absence variants in Cavia porcellus and C. aperea. Using intra-IDL PCR and sequence analyses we also provide evidence that GPIDL is derived from a hystricognath-specific SINE family. These results demonstrate that this SINE family continues to contribute to the dynamics of genomes of hystricognath rodents.
Genotypic and phenotypic diversity of Alicyclobacillus acidocaldarius isolates.
Félix-Valenzuela, L; Guardiola-Avila, I; Burgara-Estrella, A; Ibarra-Zavala, M; Mata-Haro, V
2015-10-01
The fruit juice industry recognizes Alicyclobacillus as a major quality control target micro-organism. In this study, we analysed 19 bacterial isolates to identify Alicyclobacillus species by polymerase chain reaction (PCR) and sequencing analyses. Phenotypic and genomic diversity among isolates were investigated by API 50CHB system and ERIC-PCR (enterobacterial repetitive intergenic consensus-PCR) respectively. All bacterial isolates were identified as Alicyclobacillus acidocaldarius, and almost all showed identical DNA sequences according to their 16S rRNA (rDNA) gene partial sequences. Only few carbohydrates were fermented by A. acidocaldarius isolates, and there was little variability in the biochemical profile. Genotypic fingerprinting of the A. acidocaldarius isolates showed high diversity, and clusters by ERIC-PCR were distinct to those obtained from the 16S rRNA gene phylogenetic tree. There was no correlation between phenotypic and genotypic variability in the A. acidocaldarius isolates analysed in this study. Detection of Alicyclobacillus strains is imperative in fruit concentrates and juices due to the production of guaiacol. Identification of the genera originates rejection of the product by processing industry. However, not all the Alicyclobacillus species are deteriorative and hence the importance to differentiate among them. In this study, partial 16S ribosomal RNA sequence alignment allowed the differentiation of species. In addition, ERIC-PCR was introduced for the genotypic characterization of Alicyclobacillus, as an alternative for differentiation among isolates from the same species. © 2015 The Society for Applied Microbiology.
Zhou, Shuntai; Jones, Corbin; Mieczkowski, Piotr
2015-01-01
ABSTRACT Validating the sampling depth and reducing sequencing errors are critical for studies of viral populations using next-generation sequencing (NGS). We previously described the use of Primer ID to tag each viral RNA template with a block of degenerate nucleotides in the cDNA primer. We now show that low-abundance Primer IDs (offspring Primer IDs) are generated due to PCR/sequencing errors. These artifactual Primer IDs can be removed using a cutoff model for the number of reads required to make a template consensus sequence. We have modeled the fraction of sequences lost due to Primer ID resampling. For a typical sequencing run, less than 10% of the raw reads are lost to offspring Primer ID filtering and resampling. The remaining raw reads are used to correct for PCR resampling and sequencing errors. We also demonstrate that Primer ID reveals bias intrinsic to PCR, especially at low template input or utilization. cDNA synthesis and PCR convert ca. 20% of RNA templates into recoverable sequences, and 30-fold sequence coverage recovers most of these template sequences. We have directly measured the residual error rate to be around 1 in 10,000 nucleotides. We use this error rate and the Poisson distribution to define the cutoff to identify preexisting drug resistance mutations at low abundance in an HIV-infected subject. Collectively, these studies show that >90% of the raw sequence reads can be used to validate template sampling depth and to dramatically reduce the error rate in assessing a genetically diverse viral population using NGS. IMPORTANCE Although next-generation sequencing (NGS) has revolutionized sequencing strategies, it suffers from serious limitations in defining sequence heterogeneity in a genetically diverse population, such as HIV-1 due to PCR resampling and PCR/sequencing errors. The Primer ID approach reveals the true sampling depth and greatly reduces errors. Knowing the sampling depth allows the construction of a model of how to maximize the recovery of sequences from input templates and to reduce resampling of the Primer ID so that appropriate multiplexing can be included in the experimental design. With the defined sampling depth and measured error rate, we are able to assign cutoffs for the accurate detection of minority variants in viral populations. This approach allows the power of NGS to be realized without having to guess about sampling depth or to ignore the problem of PCR resampling, while also being able to correct most of the errors in the data set. PMID:26041299
Evaluation of next generation sequencing for the analysis of Eimeria communities in wildlife.
Vermeulen, Elke T; Lott, Matthew J; Eldridge, Mark D B; Power, Michelle L
2016-05-01
Next-generation sequencing (NGS) techniques are well-established for studying bacterial communities but not yet for microbial eukaryotes. Parasite communities remain poorly studied, due in part to the lack of reliable and accessible molecular methods to analyse eukaryotic communities. We aimed to develop and evaluate a methodology to analyse communities of the protozoan parasite Eimeria from populations of the Australian marsupial Petrogale penicillata (brush-tailed rock-wallaby) using NGS. An oocyst purification method for small sample sizes and polymerase chain reaction (PCR) protocol for the 18S rRNA locus targeting Eimeria was developed and optimised prior to sequencing on the Illumina MiSeq platform. A data analysis approach was developed by modifying methods from bacterial metagenomics and utilising existing Eimeria sequences in GenBank. Operational taxonomic unit (OTU) assignment at a high similarity threshold (97%) was more accurate at assigning Eimeria contigs into Eimeria OTUs but at a lower threshold (95%) there was greater resolution between OTU consensus sequences. The assessment of two amplification PCR methods prior to Illumina MiSeq, single and nested PCR, determined that single PCR was more sensitive to Eimeria as more Eimeria OTUs were detected in single amplicons. We have developed a simple and cost-effective approach to a data analysis pipeline for community analysis of eukaryotic organisms using Eimeria communities as a model. The pipeline provides a basis for evaluation using other eukaryotic organisms and potential for diverse community analysis studies. Copyright © 2016 Elsevier B.V. All rights reserved.
Bradley, Ian M; Pinto, Ameet J; Guest, Jeremy S
2016-10-01
The use of high-throughput sequencing technologies with the 16S rRNA gene for characterization of bacterial and archaeal communities has become routine. However, the adoption of sequencing methods for eukaryotes has been slow, despite their significance to natural and engineered systems. There are large variations among the target genes used for amplicon sequencing, and for the 18S rRNA gene, there is no consensus on which hypervariable region provides the most suitable representation of diversity. Additionally, it is unclear how much PCR/sequencing bias affects the depiction of community structure using current primers. The present study amplified the V4 and V8-V9 regions from seven microalgal mock communities as well as eukaryotic communities from freshwater, coastal, and wastewater samples to examine the effect of PCR/sequencing bias on community structure and membership. We found that degeneracies on the 3' end of the current V4-specific primers impact read length and mean relative abundance. Furthermore, the PCR/sequencing error is markedly higher for GC-rich members than for communities with balanced GC content. Importantly, the V4 region failed to reliably capture 2 of the 12 mock community members, and the V8-V9 hypervariable region more accurately represents mean relative abundance and alpha and beta diversity. Overall, the V4 and V8-V9 regions show similar community representations over freshwater, coastal, and wastewater environments, but specific samples show markedly different communities. These results indicate that multiple primer sets may be advantageous for gaining a more complete understanding of community structure and highlight the importance of including mock communities composed of species of interest. The quantification of error associated with community representation by amplicon sequencing is a critical challenge that is often ignored. When target genes are amplified using currently available primers, differential amplification efficiencies result in inaccurate estimates of community structure. The extent to which amplification bias affects community representation and the accuracy with which different gene targets represent community structure are not known. As a result, there is no consensus on which region provides the most suitable representation of diversity for eukaryotes. This study determined the accuracy with which commonly used 18S rRNA gene primer sets represent community structure and identified particular biases related to PCR amplification and Illumina MiSeq sequencing in order to more accurately study eukaryotic microbial communities. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
High resolution identity testing of inactivated poliovirus vaccines.
Mee, Edward T; Minor, Philip D; Martin, Javier
2015-07-09
Definitive identification of poliovirus strains in vaccines is essential for quality control, particularly where multiple wild-type and Sabin strains are produced in the same facility. Sequence-based identification provides the ultimate in identity testing and would offer several advantages over serological methods. We employed random RT-PCR and high throughput sequencing to recover full-length genome sequences from monovalent and trivalent poliovirus vaccine products at various stages of the manufacturing process. All expected strains were detected in previously characterised products and the method permitted identification of strains comprising as little as 0.1% of sequence reads. Highly similar Mahoney and Sabin 1 strains were readily discriminated on the basis of specific variant positions. Analysis of a product known to contain incorrect strains demonstrated that the method correctly identified the contaminants. Random RT-PCR and shotgun sequencing provided high resolution identification of vaccine components. In addition to the recovery of full-length genome sequences, the method could also be easily adapted to the characterisation of minor variant frequencies and distinction of closely related products on the basis of distinguishing consensus and low frequency polymorphisms. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.
A Cluster of Legionella-Associated Pneumonia Cases in a Population of Military Recruits
2007-06-01
this cluster may suggest a previously unrecognized suscep- FIG. 1. Phylogenic analysis of the training center strain (represented by the MCRD consensus...military recruits during population- based surveillance for pneumonia pathogens. Results were confirmed by sequence analysis . Cases cluster tightly...17 April 2007 A Legionella cluster was identified through retrospective PCR analysis of 240 throat swab samples from X-ray-confirmed pneumonia cases
Russell, Jessica S; Caly, Leon; Kostecki, Renata; McGuinness, Sarah L; Carter, Glen; Bulach, Dieter; Seemann, Torsten; Stinear, Tim P; Baird, Rob; Catton, Mike; Druce, Julian
2018-06-11
Murray Valley Encephalitis virus (MVEV) is a mosquito-borne Flavivirus. Clinical presentation is rare but severe, with a case fatality rate of 15⁻30%. Here we report a case of MVEV from the cerebrospinal fluid (CSF) of a patient in the Northern Territory in Australia. Initial diagnosis was performed using both MVEV-specific real-time, and Pan- Flavivirus conventional, Polymerase Chain Reaction (PCR), with confirmation by Sanger sequencing. Subsequent isolation, the first from CSF, was conducted in Vero cells and the observed cytopathic effect was confirmed by increasing viral titre in the real-time PCR. Isolation allowed for full genome sequencing using the Scriptseq V2 RNASeq library preparation kit. A consensus genome for VIDRL-MVE was generated and phylogenetic analysis identified it as Genotype 2. This is the first reported isolation, and full genome sequencing of MVEV from CSF. It is also the first time Genotype 2 has been identified in humans. As such, this case has significant implications for public health surveillance, epidemiology, and the understanding of MVEV evolution.
Salazar, Edith L; Mercado, E; Calzada, L
2005-01-01
The prevalence of human papillomavirus HPV-16DNA sequences in 57 penile carcinoma biopsies was examined using the polymerase chain reaction (PCR) with type specific internal probes, employing HPV consensus primers from the L1 region. The cases comprised 39 typical squamous cell carcinoma and 18 specimens with different subtype. PCR products were analyzed and HPV-16DNA was detected in a high percentage of specimens. Thirty-eight biopsies were HPV-16DNA positive. This determination was correlated with cellular differentiation and growth pattern. Our data corroborates that squamous cell carcinoma was invariably associated with HPV-16DNA.
Burmeister, Thomas; Schwartz, Stefan; Hummel, Michael; Hoelzer, Dieter; Thiel, Eckhard
2007-01-01
Background The Deltaretrovirus genus comprises viruses that infect humans (HTLV), various simian species (STLV) and cattle (BLV). HTLV-I is the main causative agent in adult T-cell leukemia in endemic areas and some of the simian T-cell lymphotropic viruses have been implicated in the induction of malignant lymphomas in their hosts. BLV causes enzootic bovine leukosis in infected cattle or sheep. During the past few years several new Deltaretrovirus isolates have been described in various primate species. Two new HTLV-like viruses in humans have recently been identified and provisionally termed HTLV-III and HTLV-IV. In order to identify a broad spectrum of Deltaretroviruses by a single PCR approach we have established a novel consensus PCR based on nucleotide sequence data obtained from 42 complete virus isolates (HTLV-I/-II, STLV-I/-II/-III, BLV). The primer sequences were based on highly interspecies-conserved virus genome regions. We used this PCR to detect Deltaretroviruses in samples from adult patients with a variety of rare T-cell neoplasms in Germany. Results The sensitivity of the consensus PCR was at least between 10-2 and 10-3 with 100% specificity as demonstrated by serial dilutions of cell lines infected with either HTLV-I, HTLV-II or BLV. Fifty acute T-cell lymphoblastic leukemia (T-ALL) samples and 33 samples from patients with various rare mature T-cell neoplasms (T-PLL, Sézary syndrome and other T-NHL) were subsequently investigated. There were no cases with HTLV-I, HTLV-II or any other Deltaretroviruses. Conclusion The results rule out a significant involvement of HTLV-I or HTLV-II in these disease entities and show that other related Deltaretroviruses are not likely to be involved. The newly established Deltaretrovirus PCR may be a useful tool for identifying new Deltaretroviruses. PMID:17284327
Cruz, V P; Oliveira, C; Foresti, F
2015-01-01
5S rDNA genes of the stingray Potamotrygon motoro were PCR replicated, purified, cloned and sequenced. Two distinct classes of segments of different sizes were obtained. The smallest, with 342 bp units, was classified as class I, and the largest, with 1900 bp units, was designated as class II. Alignment with the consensus sequences for both classes showed changes in a few bases in the 5S rDNA genes. TATA-like sequences were detected in the nontranscribed spacer (NTS) regions of class I and a microsatellite (GCT) 10 sequence was detected in the NTS region of class II. The results obtained can help to understand the molecular organization of ribosomal genes and the mechanism of gene dispersion.
Comparison of four molecular methods to type Salmonella Enteritidis strains.
Campioni, Fábio; Pitondo-Silva, André; Bergamini, Alzira M M; Falcão, Juliana P
2015-05-01
This study compared the pulsed-field gel electrophoresis (PFGE), enterobacterial repetitive intergenic consensus-PCR (ERIC-PCR), multilocus variable-number of tanden-repeat analysis (MLVA), and multilocus sequence typing (MLST) methods for typing 188 Salmonella Enteritidis strains from different sources isolated over a 24-year period in Brazil. PFGE and ERIC-PCR were more efficient than MLVA for subtyping the strains. However, MLVA provided additional epidemiological information for those strains. In addition, MLST showed the Brazilian strains as belonging to the main clonal complex of S. Enteritidis, CC11, and provided the first report of two new STs in the S. enterica database but could not properly subtype the strains. Our results showed that the use of PFGE or ERIC-PCR together with MLVA is suitable to efficiently subtype S. Enteritidis strains and provide important epidemiological information. © 2015 APMIS. Published by John Wiley & Sons Ltd.
Böttcher, S; Ritgen, M; Pott, C; Brüggemann, M; Raff, T; Stilgenbauer, S; Döhner, H; Dreger, P; Kneba, M
2004-10-01
The clinically most suitable method for minimal residual disease (MRD) detection in chronic lymphocytic leukemia is still controversial. We prospectively compared MRD assessment in 158 blood samples of 74 patients with CLL after stem cell transplantation (SCT) using four-color flow cytometry (MRD flow) in parallel with consensus IgH-PCR and ASO IgH real-time PCR (ASO IgH RQ-PCR). In 25 out of 106 samples (23.6%) with a polyclonal consensus IgH-PCR pattern, MRD flow still detected CLL cells, proving higher sensitivity of flow cytometry over PCR-genescanning with consensus IgH-primers. Of 92 samples, 14 (15.2%) analyzed in parallel by MRD flow and by ASO IgH RQ-PCR were negative by our flow cytometric assay but positive by PCR, thus demonstrating superior sensitivity of RQ-PCR with ASO primers. Quantitative MRD levels measured by both methods correlated well (r=0.93). MRD detection by flow and ASO IgH RQ-PCR were equally suitable to monitor MRD kinetics after allogeneic SCT, but the PCR method detected impending relapses after autologous SCT earlier. An analysis of factors that influence sensitivity and specificity of flow cytometry for MRD detection allowed to devise further improvements of this technique.
Vera-Cabrera, L; Johnson, W M; Welsh, O; Resendiz-Uresti, F L; Salinas-Carmona, M C
1999-06-01
An immunodominant protein from Nocardia brasiliensis, P61, was subjected to amino-terminal and internal sequence analysis. Three sequences of 22, 17, and 38 residues, respectively, were obtained and compared with the protein database from GenBank by using the BLAST system. The sequences showed homology to some eukaryotic catalases and to a bromoperoxidase-catalase from Streptomyces violaceus. Its identity as a catalase was confirmed by analysis of its enzymatic activity on H2O2 and by a double-staining method on a nondenaturing polyacrylamide gel with 3,3'-diaminobenzidine and ferricyanide; the result showed only catalase activity, but no peroxidase. By using one of the internal amino acid sequences and a consensus catalase motif (VGNNTP), we were able to design a PCR assay that generated a 500-bp PCR product. The amplicon was analyzed, and the nucleotide sequence was compared to the GenBank database with the observation of high homology to other bacterial and eukaryotic catalases. A PCR assay based on this target sequence was performed with primers NB10 and NB11 to confirm the presence of the NB10-NB11 gene fragment in several N. brasiliensis strains isolated from mycetoma. The same assay was used to determine whether there were homologous sequences in several type strains from the genera Nocardia, Rhodococcus, Gordona, and Streptomyces. All of the N. brasiliensis strains presented a positive result but only some of the actinomycetes species tested were positive in the PCR assay. In order to confirm these findings, genomic DNA was subjected to Southern blot analysis. A 1.7-kbp band was observed in the N. brasiliensis strains, and bands of different molecular weight were observed in cross-reacting actinomycetes. Sequence analysis of the amplicons of selected actinomycetes showed high homology in this catalase fragment, thus demonstrating that this protein is highly conserved in this group of bacteria.
Kolanko, C J; Pyle, M D; Nath, J; Prasanna, P G; Loats, H; Blakely, W F
2000-03-01
We report a low cost and efficient method for synthesizing a human pancentromeric DNA probe by the polymerase chain reaction (PRC) and an optimized protocol for in situ detection using color pigment immunostaining. The DNA template used in the PCR was a 2.4 kb insert containing human alphoid repeated sequences of pancentromeric DNA subcloned into pUC9 (Miller et al. 1988) and the primers hybridized to internal sequences of the 172 bp consensus tandem repeat associated with human centromeres. PCR was performed in the presence of biotin-11-dUTP, and the product was used for in situ hybridization to detect the pancentromeric region of human chromosomes in metaphase spreads. Detection of pancentromeric probe was achieved by immunoenzymatic color pigment painting to yield a permanent image detected at high resolution by bright field microscopy. The ability to synthesize the centromeric probe rapidly and to detect it with color pigment immunostaining will lead to enhanced identification and eventually to automation of various chromosome aberration assays.
Ståhlberg, Anders; Krzyzanowski, Paul M; Jackson, Jennifer B; Egyud, Matthew; Stein, Lincoln; Godfrey, Tony E
2016-06-20
Detection of cell-free DNA in liquid biopsies offers great potential for use in non-invasive prenatal testing and as a cancer biomarker. Fetal and tumor DNA fractions however can be extremely low in these samples and ultra-sensitive methods are required for their detection. Here, we report an extremely simple and fast method for introduction of barcodes into DNA libraries made from 5 ng of DNA. Barcoded adapter primers are designed with an oligonucleotide hairpin structure to protect the molecular barcodes during the first rounds of polymerase chain reaction (PCR) and prevent them from participating in mis-priming events. Our approach enables high-level multiplexing and next-generation sequencing library construction with flexible library content. We show that uniform libraries of 1-, 5-, 13- and 31-plex can be generated. Utilizing the barcodes to generate consensus reads for each original DNA molecule reduces background sequencing noise and allows detection of variant alleles below 0.1% frequency in clonal cell line DNA and in cell-free plasma DNA. Thus, our approach bridges the gap between the highly sensitive but specific capabilities of digital PCR, which only allows a limited number of variants to be analyzed, with the broad target capability of next-generation sequencing which traditionally lacks the sensitivity to detect rare variants. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Investigating intra-host and intra-herd sequence diversity of foot-and-mouth disease virus.
King, David J; Freimanis, Graham L; Orton, Richard J; Waters, Ryan A; Haydon, Daniel T; King, Donald P
2016-10-01
Due to the poor-fidelity of the enzymes involved in RNA genome replication, foot-and-mouth disease (FMD) virus samples comprise of unique polymorphic populations. In this study, deep sequencing was utilised to characterise the diversity of FMD virus (FMDV) populations in 6 infected cattle present on a single farm during the series of outbreaks in the UK in 2007. A novel RT-PCR method was developed to amplify a 7.6kb nucleotide fragment encompassing the polyprotein coding region of the FMDV genome. Illumina sequencing of each sample identified the fine polymorphic structures at each nucleotide position, from consensus level changes to variants present at a 0.24% frequency. These data were used to investigate population dynamics of FMDV at both herd and host levels, evaluate the impact of host on the viral swarm structure and to identify transmission links with viruses recovered from other farms in the same series of outbreaks. In 7 samples, from 6 different animals, a total of 5 consensus level variants were identified, in addition to 104 sub-consensus variants of which 22 were shared between 2 or more animals. Further analysis revealed differences in swarm structures from samples derived from the same animal suggesting the presence of distinct viral populations evolving independently at different lesion sites within the same infected animal. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
A Ribeiroia spp. (Class: Trematoda) - Specific PCR-based diagnostic
Reinitz, David M.; Yoshino, T.P.; Cole, Rebecca A.
2007-01-01
Increased reporting of amphibian malformations in North America has been noted with concern in light of reports that amphibian numbers and species are declining worldwide. Ribeiroia ondatrae has been shown to cause a variety of types of malformations in amphibians. However, little is known about the prevalence of R. ondatrae in North America. To aid in conducting field studies of Ribeiroia spp., we have developed a polymerase chain reaction (PCR)-based diagnostic. Herein, we describe the development of an accurate, rapid, simple, and cost-effective diagnostic for detection of Ribeiroia spp. infection in snails (Planorbella trivolvis). Candidate oligonucleotide primers for PCR were designed via DNA sequence analyses of multiple ribosomal internal transcribed spacer-2 regions from Ribeiroia spp. and Echinostoma spp. Comparison of consensus sequences determined from both genera identified areas of sequence potentially unique to Ribeiroia spp. The PCR reliably produced a diagnostic 290-base pair (bp) product in the presence of a wide concentration range of snail or frog DNA. Sensitivity was examined with DNA extracted from single R. ondatrae cercaria. The single-tube PCR could routinely detect less than 1 cercariae equivalent, because DNA isolated from a single cercaria could be diluted at least 1:50 and still yield a positive result via gel electrophoresis. An even more sensitive nested PCR also was developed that routinely detected 100 fg of the 290-bp fragment. The assay did not detect furcocercous cercariae of certain Schistosomatidae, Echinostoma sp., or Sphaeridiotrema globulus nor adults of Clinostomum sp. or Cyathocotyle bushiensis. Field testing of 137 P. trivolvis identified 3 positives with no overt environmental cross-reactivity, and results concurred with microscopic examinations in all cases. ?? American Society of Parasitologists 2007.
Harrison, Robert A; Ibison, Frances; Wilbraham, Davina; Wagstaff, Simon C
2007-05-01
The immobilisation of prey by snakes is most efficiently achieved by the rapid dissemination of venom from its site of injection into the blood stream. Hyaluronidase is a common component of snake venoms and has been termed the "venom spreading factor". In the absence of nucleotide or protein sequence data to confirm the functional identity of this venom component, we interrogated a venom gland EST database for the saw-scaled viper, Echis ocellatus (Nigeria), using the gene ontology (GO) term "carbohydrate metabolism". A single hyalurononglucosaminadase-activity matching sequence (EOC00242) was found and used to design PCR primers to acquire the full-length cDNA sequence. Although very different from the bee venom and mammalian hyaluronidase sequences, the E. ocellatus sequence retained all the catalytic, positional and structural residues that characterise this class of carbohydrate metabolising hydrolases. An extraordinarily high level of sequence identity (>95%) was observed in analogous venom gland cDNA sequences isolated (by PCR) from another saw-scaled viper species, E. pyramidum leakeyi (Kenya), and from the sahara horned viper, Cerastes cerastes cerastes (Egypt) and the puff adder, Bitis arietans (Nigeria). Smaller amplicons, lacking hyaluronidase catalytic residues because of 768 bp or 855 bp central deletions, appear to encode either truncated peptides without hyaluronidase activity, or are non-translated transcripts because they lack consensus translation initiating motifs.
Snelling, A M; Gerner-Smidt, P; Hawkey, P M; Heritage, J; Parnell, P; Porter, C; Bodenham, A R; Inglis, T
1996-01-01
Acinetobacter spp. are being reported with increasing frequency as causes of nosocomial infection. In order to identify reservoirs of infection as quickly as possible, a rapid typing method that can differentiate epidemic strains from environmental and nonepidemic strains is needed. In 1993, a cluster of Acinetobacter baumannii isolates from five patients in the adult intensive therapy unit of our tertiary-care teaching hospital led us to develop and optimize a rapid repetitive extragenic palindromic sequence-based PCR (REP-PCR) typing protocol for members of the Acinetobacter calcoaceticus-A. baumannii complex that uses boiled colonies and consensus primers aimed at repetitive extragenic palindromic sequences. Four of the five patient isolates gave the same REP-PCR typing pattern as isolates of A. baumannii obtained from the temperature probe of a Bennett humidifier; the fifth isolate had a unique profile. Disinfection of the probe with 70% ethanol, as recommended by the manufacturer, proved ineffective, as A. baumannii with the same REP-PCR pattern was isolated from it 10 days after cleaning, necessitating a change in our decontamination procedure. Results obtained with REP-PCR were subsequently confirmed by ribotyping. To evaluate the discriminatory power (D) of REP-PCR for typing members of the A. calcoaceticus-A. baumannii complex, compared with that of ribotyping, we have applied both methods to a collection of 85 strains that included representatives of six DNA groups within the complex. Ribotyping using EcoRI digests yielded 53 patterns (D = 0.98), whereas 68 different REP-PCR patterns were observed (D = 0.99). By computer-assisted analysis of gel images, 74 patterns were observed with REP-PCR (D = 1.0). Overall, REP-PCR typing proved to be slightly more discriminatory than ribotyping. Our results indicate that REP-PCR typing used boiled colonies is a simple, rapid, and effective means of typing members of the A. calcoaceticus-A. baumannii complex. PMID:8727902
Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G
1995-01-01
The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961
Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.
Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P
1999-08-02
Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.
Dobhal, Shefali; Olson, Jennifer D; Arif, Mohammad; Garcia Suarez, Johnny A; Ochoa-Corona, Francisco M
2016-06-01
Rose rosette disease is a disorder associated with infection by Rose rosette virus (RRV), a pathogen of roses that causes devastating effects on most garden cultivated varieties, and the wild invasive rose especially Rosa multiflora. Reliable and sensitive detection of this disease in early phases is needed to implement proper control measures. This study assesses a single primer-set based detection method for RRV and demonstrates its application in three different chemistries: Endpoint RT-PCR, TaqMan-quantitative RT-PCR (RT-qPCR) and SYBR Green RT-qPCR with High Resolution Melting analyses. A primer set (RRV2F/2R) was designed from consensus sequences of the nucleocapsid protein gene p3 located in the RNA 3 region of RRV. The specificity of primer set RRV2F/2R was validated in silico against published GenBank sequences and in-vitro against infected plant samples and an exclusivity panel of near-neighbor and other viruses that commonly infect Rosa spp. The developed assay is sensitive with a detection limit of 1fg from infected plant tissue. Thirty rose samples from 8 different states of the United States were tested using the developed methods. The developed methods are sensitive and reliable, and can be used by diagnostic laboratories for routine testing and disease management decisions. Copyright © 2016 Elsevier B.V. All rights reserved.
Rivera, I G; Chowdhury, M A; Huq, A; Jacobs, D; Martins, M T; Colwell, R R
1995-08-01
Enterobacterial repetitive intergenic consensus (ERIC) sequence polymorphism was studied in Vibrio Cholerae strains isolated before and after the cholera epidemic in Brazil (in 1991), along with epidemic strains from Peru, Mexico, and India, by PCR. A total of 17 fingerprint patterns (FPs) were detected in the V. cholerae strains examined; 96.7% of the toxigenic V. cholerae O1 strains and 100% of the O139 serogroup strains were found to belong to the same FP group comprising four fragments (FP1). The nontoxigenic V. cholerae O1 also yielded four fragments but constituted a different FP group (FP2). A total of 15 different patterns were observed among the V. cholerae non-O1 strains. Two patterns were observed most frequently for V. cholerae non-01 strains, 25% of which have FP3, with five fragments, and 16.7% of which have FP4, with two fragments. Three fragments, 1.75, 0.79, and 0.5 kb, were found to be common to both toxigenic and nontoxigenic V. cholerae O1 strains as well as to group FP3, containing V. cholerae non-O1 strains. Two fragments of group FP3, 1.3 and 1.0 kb, were present in FP1 and FP2 respectively. The 0.5-kb fragment was common to all strains and serogroups of V. cholerae analyzed. It is concluded from the results of this study, based on DNA FPs of environmental isolates, that it is possible to detect an emerging virulent strain in a cholera-endemic region. ERIC-PCR constitutes a powerful tool for determination of the virulence potential of V. cholerae O1 strains isolated in surveillance programs and for molecular epidemiological investigations.
Wellehan, James F.X.; Pessier, Allan P.; Archer, Linda L.; Childress, April L.; Jacobson, Elliott R.; Tesh, Robert B.
2012-01-01
Rhabdoviruses infect a variety of hosts, including non-avian reptiles. Consensus PCR techniques were used to obtain partial RNA-dependent RNA polymerase gene sequence from five rhabdoviruses of South American lizards; Marco, Chaco, Timbo, Sena Madureira, and a rhabdovirus from a caiman lizard (Dracaena guianensis). The caiman lizard rhabdovirus formed inclusions in erythrocytes, which may be a route for infecting hematophagous insects. This is the first information on behavior of a rhabdovirus in squamates. We also obtained sequence from two rhabdoviruses of Australian lizards, confirming previous Charleville virus sequence and finding that, unlike a previous sequence report but in agreement with serologic reports, Almpiwar virus is clearly distinct from Charleville virus. Bayesian and maximum likelihood phylogenetic analysis revealed that most known rhabdoviruses of squamates cluster in the Almpiwar subgroup. The exception is Marco virus, which is found in the Hart Park group. PMID:22397930
Amexis, Georgios; Oeth, Paul; Abel, Kenneth; Ivshina, Anna; Pelloquin, Francois; Cantor, Charles R.; Braun, Andreas; Chumakov, Konstantin
2001-01-01
RNA viruses exist as quasispecies, heterogeneous and dynamic mixtures of mutants having one or more consensus sequences. An adequate description of the genomic structure of such viral populations must include the consensus sequence(s) plus a quantitative assessment of sequence heterogeneities. For example, in quality control of live attenuated viral vaccines, the presence of even small quantities of mutants or revertants may indicate incomplete or unstable attenuation that may influence vaccine safety. Previously, we demonstrated the monitoring of oral poliovirus vaccine with the use of mutant analysis by PCR and restriction enzyme cleavage (MAPREC). In this report, we investigate genetic variation in live attenuated mumps virus vaccine by using both MAPREC and a platform (DNA MassArray) based on matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry. Mumps vaccines prepared from the Jeryl Lynn strain typically contain at least two distinct viral substrains, JL1 and JL2, which have been characterized by full length sequencing. We report the development of assays for characterizing sequence variants in these substrains and demonstrate their use in quantitative analysis of substrains and sequence variations in mixed virus cultures and mumps vaccines. The results obtained from both the MAPREC and MALDI-TOF methods showed excellent correlation. This suggests the potential utility of MALDI-TOF for routine quality control of live viral vaccines and for assessment of genetic stability and quantitative monitoring of genetic changes in other RNA viruses of clinical interest. PMID:11593021
Hara, Yasushi; Hayashi, Kyohei; Nakajima, Takuya; Kagawa, Shizuko; Tazumi, Akihiro; Moore, John E; Matsuda, Motoo
2013-09-01
Clustered regularly interspaced short palindromic repeats (CRISPRs), of approximately 10,000 base pairs (bp) in length, were shown to occur in the Japanese Taylorella equigenitalis strain, EQ59. The locus was composed of the putative CRISPRs-associated with 5 (cas5), RAMP csd1, csd2, recB, cas1, a leader region, 13 CRISPR consensus sequence repeats (each 32 bp; 5'-TCAGCCACGTTCGCGTGGCTGTGTGTTTAAAG-3'). These were in turn separated by 12 non repetitive unique spacer regions of similar length. In addition, a leader region, a transposase/IS protein, a leader region, and cas3 were also seen. All seven putative open reading frames carry their ribosome binding sites. Promoter consensus sequences at the -35 and -10 regions and putative intrinsic ρ-independent transcription terminator regions also occurred. A possible long overlap of 170 bp in length occurred between the recB and cas1 loci. Positive reverse transcription PCR signals of cas5, RAMP csd1, csd2-recB/cas1, and cas3 were generated. A putative secondary structure of the CRISPR consensus repeats was constructed. Following this, CRISPR results of the T. equigenitalis EQ59 isolate were subsequently compared with those from the Taylorella asinigenitalis MCE3 isolate.
Vaira, A M; Accotto, G P; Costantini, A; Milne, R G
2003-06-01
A 4018 nucleotide sequence was obtained for RNA 1 of Ranunculus white mottle virus (RWMV), genus Ophiovirus, representing an incomplete ORF of 1339 aa. Amino acid sequence analysis revealed significant similarities with RNA polymerases of viruses in the family Rhabdoviridae and a conserved domain of 685 aa, corresponding to the RdRp domain of those in the order Mononegavirales. Phylogenetic analysis indicated that the genus Ophiovirus is not related to the genus Tenuivirus or the family Bunyaviridae, with which it has been linked, and probably deserves a special taxonomic position, within a new family. A pair of degenerate primers was designed from a consensus sequence obtained from a relatively conserved region in the RNA 1 of two members of the genus, Citrus psorosis virus (CPsV) and RWMV. The primers, used in RT-PCR experiments, amplified a 136 bp DNA fragment from all the three recognized members of the genus, i.e. CPsV, RWMV and Tulip mild mottle mosaic virus (TMMMV) and from two tentative ophioviruses from lettuce and freesia. The amplified DNAs were sequenced and compared with the corresponding sequences of CPsV and RWMV and phylogenetic relationships were evaluated. Assays using extracts from plants infected by viruses belonging to the genera Tospovirus, Tenuivirus, Rhabdovirus and Varicosavirus indicated that the primers are genus-specific.
Xie, Tengfei; Xu, Xiaoke; Wu, Qingping; Zhang, Jumei; Cheng, Jianheng
2016-01-01
Vibrio parahaemolyticus is the leading cause of foodborne outbreaks, particularly outbreaks associated with consumption of fish and shellfish, and represents a major threat to human health worldwide. This bacterium harbors two main virulence factors: the thermostable direct hemolysin (TDH) and TDH-related hemolysin (TRH). Additionally, various serotypes have been identified. The extensive use of antibiotics is a contributing factor to the increasing incidence of antimicrobial-resistant V. parahaemolyticus. In the current study, we aimed to determine the incidence and features of V. parahaemolyticus in ready-to-eat (RTE) foods in China. We found 39 V. parahaemolyticus strains on Chinese RTE foods through investigation of 511 RTE foods samples from 24 cities in China. All isolates were analyzed for the presence of tdh and trh gene by PCR, serotyping was performed using multiplex PCR, antibiotic susceptibility analysis was carried out using the disk diffusion method, and molecular typing was performed using enterobacterial repetitive intergenic consensus sequence PCR (ERIC-PCR) typing and multilocus sequence typing (MLST). The results showed that none of the isolates were positive for tdh and trh. Most of the isolates (33.3%) were serotype O2. Antimicrobial susceptibility results indicated that most strains were resistant to streptomycin (89.7%), cefazolin (51.3%), and ampicillin (51.3%). The isolates were grouped into five clusters by ERIC-PCR and four clusters by MLST. We updated 10 novel loci and 33 sequence types (STs) in the MLST database. Thus, our findings demonstrated the presence of V. parahaemolyticus in Chinese RTE foods, provided insights into the dissemination of antibiotic-resistant strains, and improved our knowledge of methods of microbiological risk assessment in RTE foods. PMID:27148231
Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.
2010-01-01
Location analysis for estrogen receptor-α (ERα)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERα-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10–20% nucleotide deviation from the canonical ERE sequence. We demonstrate that ∼50% of all ERα-bound loci do not have a discernable ERE and show that most ERα-bound EREs are not perfect consensus EREs. Approximately one-third of all ERα-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERα-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERα binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers. PMID:20047966
Mason, Christopher E; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M; Kallen, Roland G; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B
2010-04-01
Location analysis for estrogen receptor-alpha (ERalpha)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERalpha-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10-20% nucleotide deviation from the canonical ERE sequence. We demonstrate that approximately 50% of all ERalpha-bound loci do not have a discernable ERE and show that most ERalpha-bound EREs are not perfect consensus EREs. Approximately one-third of all ERalpha-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERalpha-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERalpha binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers.
Winata, Patrick; Williams, Marissa; McGowan, Eileen; Nassif, Najah; van Zandwijk, Nico; Reid, Glen
2017-11-17
MicroRNAs are frequently downregulated in cancer, and restoring expression has tumour suppressive activity in tumour cells. Our recent phase I clinical trial investigated microRNA-based therapy in patients with malignant pleural mesothelioma. Treatment with TargomiRs, microRNA mimics with novel sequence packaged in EGFR antibody-targeted bacterial minicells, revealed clear signs of clinical activity. In order to detect delivery of microRNA mimics to tumour cells in future clinical trials, we tested hydrolysis probe-based assays specific for the sequence of the novel mimics in transfected mesothelioma cell lines using RT-qPCR. The custom assays efficiently and specifically amplified the consensus mimics. However, we found that these assays gave a signal when total RNA from untransfected and control mimic-transfected cells were used as templates. Further investigation revealed that the reverse transcription step using stem-loop primers appeared to introduce substantial non-specific amplification with either total RNA or synthetic RNA templates. This suggests that reverse transcription using stem-loop primers suffers from an intrinsic lack of specificity for the detection of highly similar microRNAs in the same family, especially when analysing total RNA. These results suggest that RT-qPCR is unlikely to be an effective means to detect delivery of microRNA mimic-based drugs to tumour cells in patients.
Ramazanzadeh, Rashid; Rouhi, Samaneh; Shakib, Pegah; Shahbazi, Babak; Bidarpour, Farzam; Karimi, Mohammad
2015-05-01
Vibrio cholerae causes diarrhoeal disease that afflicts thousands of people annually. V. cholerae is classified on the basis of somatic antigens into serovars or serogroups and there are at least 200 known serogroup. Two serogroups, O1 and O139 have been associated with epidemic diseases. Virulence genes of these bacteria are OmpW, ctxA and tcpA. Due to the importance of V. cholerae infection and developing molecular diagnostics of this organism in medical and microbiology sciences, this study aimed to describe molecular characterization of V. cholerae isolated from clinical samples using a molecular method. In this study, 48 samples were provided during summer 2013 (late August and early September) by reference laboratory. Samples were assessed using biochemical tests initially. The primer of OmpW, ctxA and tcpA genes was used in Polymerase Chain Reaction (PCR) protocols. Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR and Repetitive Extragenic Palindromic (REP)-PCR methods were used to subtype V. cholerae. In this study, from a total of 48 clinical stool samples 39 (81.2 %) were positive for V. cholerae in biochemical tests and bacteria culture tests. The PCR results showed that of 39 positive isolates 35 (89.7%), 34 (87.1%) and 37 (94.8%) were positive for ctxA, tcpA and OmpW gene, respectively. Also, in the REP-PCR method with ERIC primer strains were divided into 10 groups. In the REP-PCR method with REP primer, strains were divided into 13 groups. Polymerase chain reaction has specificity and accuracy for identification of the organism and is able to differentiate biotypes. Enterobacterial repetitive intergenic consensus sequence is one of the informative and discriminative methods for the analysis of V. cholerae diversity. The REP-PCR is a less informative and discriminative method compared to other methods for the analysis of V. cholerae diversity.
Valdés, I; Jaureguiberry, B; Romalde, J L; Toranzo, A E; Magariños, B; Avendaño-Herrera, R
2009-04-01
Streptococcus phocae is a beta-haemolytic bacterium frequently involved in disease outbreaks in seals causing pneumonia or respiratory infection. Since 1999, this pathogen has been isolated from diseased Atlantic salmon, Salmo salar, causing serious economic losses in the salmon industry in Chile. In this study, we used different molecular typing methods, such as pulsed-field gel electrophoresis (PFGE), randomly amplified polymorphic DNA (RAPD), enterobacterial repetitive intergenic consensus sequence PCR (ERIC-PCR), repetitive extragenic palindromic PCR (REP-PCR) and restriction of 16S-23S rDNA intergenic spacer regions to evaluate the genetic diversity in S. phocae. Thirty-four strains isolated in different years were analysed. The S. phocae type strain ATCC 51973(T) was included for comparative purposes. The results demonstrated genetic homogeneity within the S. phocae strains isolated in Chile over several years, suggesting the existence of clonal relationships among S. phocae isolated from Atlantic salmon. The type strain ATCC 51973(T) presented a different genetic pattern with the PFGE, RAPD, ERIC-PCR and REP-PCR methods. However, the fingerprint patterns of two seal isolates were distinct from those of the type strain.
Complete genome sequence of the phenanthrene-degrading soil bacterium Delftia acidovorans Cs1-4
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shetty, Ameesha R.; de Gannes, Vidya; Obi, Chioma C.
Polycyclic aromatic hydrocarbons (PAH) are ubiquitous environmental pollutants and microbial biodegradation is an important means of remediation of PAH-contaminated soil. Delftia acidovorans Cs1-4 (formerly Delftia sp. Cs1-4) was isolated by using phenanthrene as the sole carbon source from PAH contaminated soil in Wisconsin. Its full genome sequence was determined to gain insights into a mechanisms underlying biodegradation of PAH. Three genomic libraries were constructed and sequenced: an Illumina GAii shotgun library (916,416,493 reads), a 454 Titanium standard library (770,171 reads) and one paired-end 454 library (average insert size of 8 kb, 508,092 reads). The initial assembly contained 40 contigs inmore » two scaffolds. The 454 Titanium standard data and the 454 paired end data were assembled together and the consensus sequences were computationally shredded into 2 kb overlapping shreds. Illumina sequencing data was assembled, and the consensus sequence was computationally shredded into 1.5 kb overlapping shreds. Gaps between contigs were closed by editing in Consed, by PCR and by Bubble PCR primer walks. A total of 182 additional reactions were needed to close gaps and to raise the quality of the finished sequence. The final assembly is based on 253.3 Mb of 454 draft data (averaging 38.4 X coverage) and 590.2 Mb of Illumina draft data (averaging 89.4 X coverage). The genome of strain Cs1-4 consists of a single circular chromosome of 6,685,842 bp (66.7 %G+C) containing 6,028 predicted genes; 5,931 of these genes were protein-encoding and 4,425 gene products were assigned to a putative function. Genes encoding phenanthrene degradation were localized to a 232 kb genomic island (termed the phn island), which contained near its 3’ end a bacteriophage P4-like integrase, an enzyme often associated with chromosomal integration of mobile genetic elements. Other biodegradation pathways reconstructed from the genome sequence included: benzoate (by the acetyl-CoA pathway), styrene, nicotinic acid (by the maleamate pathway) and the pesticides Dicamba and Fenitrothion. Lastly, determination of the complete genome sequence of D. acidovorans Cs1-4 has provided new insights the microbial mechanisms of PAH biodegradation that may shape the process in the environment.« less
Complete genome sequence of the phenanthrene-degrading soil bacterium Delftia acidovorans Cs1-4
Shetty, Ameesha R.; de Gannes, Vidya; Obi, Chioma C.; ...
2015-08-15
Polycyclic aromatic hydrocarbons (PAH) are ubiquitous environmental pollutants and microbial biodegradation is an important means of remediation of PAH-contaminated soil. Delftia acidovorans Cs1-4 (formerly Delftia sp. Cs1-4) was isolated by using phenanthrene as the sole carbon source from PAH contaminated soil in Wisconsin. Its full genome sequence was determined to gain insights into a mechanisms underlying biodegradation of PAH. Three genomic libraries were constructed and sequenced: an Illumina GAii shotgun library (916,416,493 reads), a 454 Titanium standard library (770,171 reads) and one paired-end 454 library (average insert size of 8 kb, 508,092 reads). The initial assembly contained 40 contigs inmore » two scaffolds. The 454 Titanium standard data and the 454 paired end data were assembled together and the consensus sequences were computationally shredded into 2 kb overlapping shreds. Illumina sequencing data was assembled, and the consensus sequence was computationally shredded into 1.5 kb overlapping shreds. Gaps between contigs were closed by editing in Consed, by PCR and by Bubble PCR primer walks. A total of 182 additional reactions were needed to close gaps and to raise the quality of the finished sequence. The final assembly is based on 253.3 Mb of 454 draft data (averaging 38.4 X coverage) and 590.2 Mb of Illumina draft data (averaging 89.4 X coverage). The genome of strain Cs1-4 consists of a single circular chromosome of 6,685,842 bp (66.7 %G+C) containing 6,028 predicted genes; 5,931 of these genes were protein-encoding and 4,425 gene products were assigned to a putative function. Genes encoding phenanthrene degradation were localized to a 232 kb genomic island (termed the phn island), which contained near its 3’ end a bacteriophage P4-like integrase, an enzyme often associated with chromosomal integration of mobile genetic elements. Other biodegradation pathways reconstructed from the genome sequence included: benzoate (by the acetyl-CoA pathway), styrene, nicotinic acid (by the maleamate pathway) and the pesticides Dicamba and Fenitrothion. Lastly, determination of the complete genome sequence of D. acidovorans Cs1-4 has provided new insights the microbial mechanisms of PAH biodegradation that may shape the process in the environment.« less
Hoffmann, B.; Freuling, C. M.; Wakeley, P. R.; Rasmussen, T. B.; Leech, S.; Fooks, A. R.; Beer, M.; Müller, T.
2010-01-01
To improve the diagnosis of classical rabies virus with molecular methods, a validated, ready-to-use, real-time reverse transcription-PCR (RT-PCR) assay was developed. In a first step, primers and 6-carboxyfluorescien-labeled TaqMan probes specific for rabies virus were selected from the consensus sequence of the nucleoprotein gene of 203 different rabies virus sequences derived from GenBank. The selected primer-probe combination was highly specific and sensitive. During validation using a sample set of rabies virus strains from the virus archives of the Friedrich-Loeffler-Institut (FLI; Germany), the Veterinary Laboratories Agency (VLA; United Kingdom), and the DTU National Veterinary Institute (Lindholm, Denmark), covering the global diversity of rabies virus lineages, it was shown that both the newly developed assay and a previously described one had some detection failures. This was overcome by a combined assay that detected all samples as positive. In addition, the introduction of labeled positive controls (LPC) increased the diagnostic safety of the single as well as the combined assay. Based on the newly developed, alternative assay for the detection of rabies virus and the application of LPCs, an improved diagnostic sensitivity and reliability can be ascertained for postmortem and intra vitam real-time RT-PCR analyses in rabies reference laboratories. PMID:20739489
Hoffmann, B; Freuling, C M; Wakeley, P R; Rasmussen, T B; Leech, S; Fooks, A R; Beer, M; Müller, T
2010-11-01
To improve the diagnosis of classical rabies virus with molecular methods, a validated, ready-to-use, real-time reverse transcription-PCR (RT-PCR) assay was developed. In a first step, primers and 6-carboxyfluorescien-labeled TaqMan probes specific for rabies virus were selected from the consensus sequence of the nucleoprotein gene of 203 different rabies virus sequences derived from GenBank. The selected primer-probe combination was highly specific and sensitive. During validation using a sample set of rabies virus strains from the virus archives of the Friedrich-Loeffler-Institut (FLI; Germany), the Veterinary Laboratories Agency (VLA; United Kingdom), and the DTU National Veterinary Institute (Lindholm, Denmark), covering the global diversity of rabies virus lineages, it was shown that both the newly developed assay and a previously described one had some detection failures. This was overcome by a combined assay that detected all samples as positive. In addition, the introduction of labeled positive controls (LPC) increased the diagnostic safety of the single as well as the combined assay. Based on the newly developed, alternative assay for the detection of rabies virus and the application of LPCs, an improved diagnostic sensitivity and reliability can be ascertained for postmortem and intra vitam real-time RT-PCR analyses in rabies reference laboratories.
Alu Sb2 subfamily is present in all higher primates but was most succesfully amplified in humans
DOE Office of Scientific and Technical Information (OSTI.GOV)
Richer, C.; Zietkiewicz, E.; Labuda, D.
Alu repeats can be classified into subfamilies which amplified in primate genomes at different evolutionary time periods. A young Alu subfamily, Sb2, with a characteristic 7-nucleotide duplication at position 256, has been described in seven human loci. An Sb2 insertion found near the HD gene was unique to two HD families, indicating that Sb2 was still retropositionally active. Here, we have shown that the Sb2 insertion in the CHOL locus was similarly rare, being absent in 120 individuals of Caucasian, Oriental and Black origin. In contrast, Sb2 inserts in five other loci were found fixed (non-polymorphic), based on measurements inmore » the same population sample, but absent from orthologous positions in higher apes. This suggest that Sb2 repeats spread relatively early in the human lineage following divergence from other primates and that these elements may be human-specific. By quantitative PCR, we investigated the presence of Sb2 sequences in different primate DNA, using one PCR primer anchored at the 5{prime} Alu-end and the other complementary to the duplicated Sb2-specific segment. With an Sb2-containing plasmid as a standard, we estimated the number of Sb2 repeats at 1500-1800 copies per human haploid equivalent; corresponding numbers in chimpanzee and gorilla were almost two orders of magnitude lower, while the signal observed in orangutan and gibbon DNAs was consistent with the presence of a single copy. The analysis of 22 human, 11 chimpanzee and 10 gorilla sequences indicates that the Alu Sb2 dispersed independently in these three primate lineages; gorilla consensus differs from the human Sb2 sequence by one position, while all chimpanzee repeats have their linker expanded by up to eight A-residues. Should they be thus considered as separate subfamilies? It is possible that sequence modifications with respect to the human consensus are responsible for poor retroposition of Sb2 in apes.« less
Schmidt, L M; Preston, J F; Nong, G; Dickson, D W; Aldrich, H C
2004-06-01
We report on the development of a PCR-based assay to detect Pasteuria penetrans infection of Meloidogyne arenaria in planta using specific primers for recently sequenced sigE, spoIIAB and atpF genes of P. penetrans biotype P20. Amplification of these genes in crude DNA extracts of ground tomato root galls using real-time kinetic PCR distinguished infected from uninfected M. arenaria race 1 by analysis of consensus thresholds for single copy genes. Fluorescent in situ hybridization (FISH) using the sigE primer sequence as a probe shows hybridization to P. penetrans cells in various stages of vegetative (pre-endospore) development. Ratios of gene copies for sigE and 16S rDNA were obtained for P. penetrans and compared to Bacillus subtilis as a genomic paradigm of endospore-forming bacteria. Phylogenetic analysis of the sigE gene from Gram-positive, endospore-forming bacteria finds P. penetrans most closely related Paenbacillus polymyxa. The sporulation genes (spo genes), particularly sigE, have sequence diversity that recommends them for species and biotype differentiation of the numerous Pasteuria isolates that infect a large number of plant-parasitic nematodes.
Tank, David C.
2016-01-01
Advances in high-throughput sequencing (HTS) have allowed researchers to obtain large amounts of biological sequence information at speeds and costs unimaginable only a decade ago. Phylogenetics, and the study of evolution in general, is quickly migrating towards using HTS to generate larger and more complex molecular datasets. In this paper, we present a method that utilizes microfluidic PCR and HTS to generate large amounts of sequence data suitable for phylogenetic analyses. The approach uses the Fluidigm Access Array System (Fluidigm, San Francisco, CA, USA) and two sets of PCR primers to simultaneously amplify 48 target regions across 48 samples, incorporating sample-specific barcodes and HTS adapters (2,304 unique amplicons per Access Array). The final product is a pooled set of amplicons ready to be sequenced, and thus, there is no need to construct separate, costly genomic libraries for each sample. Further, we present a bioinformatics pipeline to process the raw HTS reads to either generate consensus sequences (with or without ambiguities) for every locus in every sample or—more importantly—recover the separate alleles from heterozygous target regions in each sample. This is important because it adds allelic information that is well suited for coalescent-based phylogenetic analyses that are becoming very common in conservation and evolutionary biology. To test our approach and bioinformatics pipeline, we sequenced 576 samples across 96 target regions belonging to the South American clade of the genus Bartsia L. in the plant family Orobanchaceae. After sequencing cleanup and alignment, the experiment resulted in ~25,300bp across 486 samples for a set of 48 primer pairs targeting the plastome, and ~13,500bp for 363 samples for a set of primers targeting regions in the nuclear genome. Finally, we constructed a combined concatenated matrix from all 96 primer combinations, resulting in a combined aligned length of ~40,500bp for 349 samples. PMID:26828929
Chen, J; Chen, J; Adams, M J
2001-01-01
A universal primer (Sprimer: 5'-GGX AAY AAY AGY GGX CAZ CC-3', X = A, G, C or T; Y = T or C; Z = A or G), designed from the consensus sequences that code for the conserved sequence GNNSGQP in the NIb region of members of the family Potyviridae, was used to amplify by RT-PCR the 3'-terminal genome regions from infected plant samples representing 21 different viruses in the family. Sequencing of some of the fragments (c. 1.7 kb) showed that the type strain (ATTC PV-107) of Oat necrotic mottle virus is not a distinct species in the genus Rymovirus, but is synonymous with Brome streak mosaic virus (genus Tritimovirus) and that Celery mosaic virus is a distinct member of the genus Potyvirus not closely related to any other sequenced species. Potyviruses infecting crops in China were also investigated, showing that viruses on cowpea and maize in Hangzhou, Zhejiang province were respectively Bean common mosaic virus and Sugarcane mosaic virus and that one on garlic in Nanjing, Jiangsu province was Onion yellow dwarf virus. Fragments were also sequenced from Chinese isolates of Lettuce mosaic virus and Soybean mosaic virus (from Hangzhou), Turnip mosaic virus (2 different isolates from Zhejiang province) and RNA1 of Wheat yellow mosaic virus (from Rongcheng, Shandong province).
Liu, Wendy Y Y; Ridgway, Hayley J; James, Trevor K; James, Euan K; Chen, Wen-Ming; Sprent, Janet I; Young, J Peter W; Andrews, Mitchell
2014-10-01
The South African invasive legume Dipogon lignosus (Phaseoleae) produces nodules with both determinate and indeterminate characteristics in New Zealand (NZ) soils. Ten bacterial isolates produced functional nodules on D. lignosus. The 16S ribosomal RNA (rRNA) gene sequences identified one isolate as Bradyrhizobium sp., one isolate as Rhizobium sp. and eight isolates as Burkholderia sp. The Bradyrhizobium sp. and Rhizobium sp. 16S rRNA sequences were identical to those of strains previously isolated from crop plants and may have originated from inocula used on crops. Both 16S rRNA and DNA recombinase A (recA) gene sequences placed the eight Burkholderia isolates separate from previously described Burkholderia rhizobial species. However, the isolates showed a very close relationship to Burkholderia rhizobial strains isolated from South African plants with respect to their nitrogenase iron protein (nifH), N-acyltransferase nodulation protein A (nodA) and N-acetylglucosaminyl transferase nodulation protein C (nodC) gene sequences. Gene sequences and enterobacterial repetitive intergenic consensus (ERIC) PCR and repetitive element palindromic PCR (rep-PCR) banding patterns indicated that the eight Burkholderia isolates separated into five clones of one strain and three of another. One strain was tested and shown to produce functional nodules on a range of South African plants previously reported to be nodulated by Burkholderia tuberum STM678(T) which was isolated from the Cape Region. Thus, evidence is strong that the Burkholderia strains isolated here originated in South Africa and were somehow transported with the plants from their native habitat to NZ. It is possible that the strains are of a new species capable of nodulating legumes.
Chaouachi, Maher; El Malki, Redouane; Berard, Aurélie; Romaniuk, Marcel; Laval, Valérie; Brunel, Dominique; Bertheau, Yves
2008-03-26
The labeling of products containing genetically modified organisms (GMO) is linked to their quantification since a threshold for the presence of fortuitous GMOs in food has been established. This threshold is calculated from a combination of two absolute quantification values: one for the specific GMO target and the second for an endogenous reference gene specific to the taxon. Thus, the development of reliable methods to quantify GMOs using endogenous reference genes in complex matrixes such as food and feed is needed. Plant identification can be difficult in the case of closely related taxa, which moreover are subject to introgression events. Based on the homology of beta-fructosidase sequences obtained from public databases, two couples of consensus primers were designed for the detection, quantification, and differentiation of four Solanaceae: potato (Solanum tuberosum), tomato (Solanum lycopersicum), pepper (Capsicum annuum), and eggplant (Solanum melongena). Sequence variability was studied first using lines and cultivars (intraspecies sequence variability), then using taxa involved in gene introgressions, and finally, using taxonomically close taxa (interspecies sequence variability). This study allowed us to design four highly specific TaqMan-MGB probes. A duplex real time PCR assay was developed for simultaneous quantification of tomato and potato. For eggplant and pepper, only simplex real time PCR tests were developed. The results demonstrated the high specificity and sensitivity of the assays. We therefore conclude that beta-fructosidase can be used as an endogenous reference gene for GMO analysis.
Chen, W L; Luo, D F; Gao, C; Ding, Y; Wang, S Y
2015-07-01
The familial acute myeloid leukemia related factor gene (FAMLF) was previously identified from a familial AML subtractive cDNA library and shown to undergo alternative splicing. This study used real-time quantitative PCR to investigate the expression of the FAMLF alternative-splicing transcript consensus sequence (FAMLF-CS) in peripheral blood mononuclear cells (PBMCs) from 119 patients with de novo acute leukemia (AL) and 104 healthy controls, as well as in CD34+ cells from 12 AL patients and 10 healthy donors. A 429-bp fragment from a novel splicing variant of FAMLF was obtained, and a 363-bp consensus sequence was targeted to quantify total FAMLF expression. Kruskal-Wallis, Nemenyi, Spearman's correlation, and Mann-Whitney U-tests were used to analyze the data. FAMLF-CS expression in PBMCs from AL patients and CD34+ cells from AL patients and controls was significantly higher than in control PBMCs (P < 0.0001). Moreover, FAMLF-CS expression in PBMCs from the AML group was positively correlated with red blood cell count (rs =0.317, P=0.006), hemoglobin levels (rs = 0.210, P = 0.049), and percentage of peripheral blood blasts (rs = 0.256, P = 0.027), but inversely correlated with hemoglobin levels in the control group (rs = -0.391, P < 0.0001). AML patients with high CD34+ expression showed significantly higher FAMLF-CS expression than those with low CD34+ expression (P = 0.041). Our results showed that FAMLF is highly expressed in both normal and malignant immature hematopoietic cells, but that expression is lower in normal mature PBMCs.
Chouhy, Diego; Kocjan, Boštjan J; Staheli, Jeannette P; Bolatti, Elisa M; Hošnjak, Lea; Sagadin, Martin; Giri, Adriana A; Rose, Timothy M; Poljak, Mario
2018-01-01
A modified pan-PV consensus-degenerate hybrid oligonucleotide primer (CODEHOP) PCR was developed for generic and sensitive detection of a broad-spectrum of human papillomaviruses (HPVs) infecting the cutaneous epithelium. To test the analytical sensitivity of the assay we examined 149 eyebrow hair follicle specimens from immunocompetent male patients. HPV DNA was detected in 60 % (89/149) of analysed eyebrow samples with a total of 48 different HPV sequences, representing 21 previously described HPVs and 27 putative novel HPV types. Evidence for ten novel HPV subtypes and seven viral variants, clustering to three out of five genera containing cutaneous HPVs, was also obtained. Thus, we have shown that the modified pan-PV CODEHOP PCR assay is able to identify multiple HPV types, even from different genera, in the same clinical sample. Overall, these results demonstrate that the pan-PV CODEHOP PCR is an excellent tool for screening and identification of novel cutaneous HPVs, even in samples with low viral loads.
Wellehan, James F X; Pessier, Allan P; Archer, Linda L; Childress, April L; Jacobson, Elliott R; Tesh, Robert B
2012-08-17
Rhabdoviruses infect a variety of hosts, including non-avian reptiles. Consensus PCR techniques were used to obtain partial RNA-dependent RNA polymerase gene sequence from five rhabdoviruses of South American lizards; Marco, Chaco, Timbo, Sena Madureira, and a rhabdovirus from a caiman lizard (Dracaena guianensis). The caiman lizard rhabdovirus formed inclusions in erythrocytes, which may be a route for infecting hematophagous insects. This is the first information on behavior of a rhabdovirus in squamates. We also obtained sequence from two rhabdoviruses of Australian lizards, confirming previous Charleville virus sequence and finding that, unlike a previous sequence report but in agreement with serologic reports, Almpiwar virus is clearly distinct from Charleville virus. Bayesian and maximum likelihood phylogenetic analysis revealed that most known rhabdoviruses of squamates cluster in the Almpiwar subgroup. The exception is Marco virus, which is found in the Hart Park group. Copyright © 2012 Elsevier B.V. All rights reserved.
Vauloup-Fellous, C
2017-12-01
To describe serological and molecular tools available for genital and neonatal herpes, and their use in different clinical situations. Bibliographic investigations from MedLine database and consultation of international clinical practice guidelines. Virological confirmation of genital herpes during pregnancy or neonatal herpes must rely on PCR (Professional consensus). HSV type-specific serology (IgG) will allow determining the immune status of a patient (in the absence of clinical lesions). However, there is currently no evidence to justify universal HSV serological testing during pregnancy (Professional consensus). In case of genital lesions in a pregnant woman that do not report any genital herpes before, it is recommended to perform a virological confirmation by PCR and HSV type-specific IgG in order to distinguish a true primary infection, a non-primary infection associated with first genital manifestation, from a recurrence (Grade C). HSV IgM is useless for diagnosis of genital herpes (Grade C). If a pregnant woman has personal history of genital herpes but no lesions, whatever the gestational age, it is not recommended to perform genital sampling nor serology (Professional consensus). In case of recurrence, if the lesion is characteristic of herpes, virological confirmation is not necessary (Professional Agreement). However, if the lesion is not characteristic, virological confirmation by PCR should be performed (Professional consensus). At birth, HSV PCR samples should be collected as soon as neonatal herpes is suspected (symptomatic neonate) (best before beginning antiviral treatment but must not delay the treatment), or after 24hours of life in case of asymptomatic neonate born to a mother with herpes lesions at delivery (Professional consensus). Clinical samples for virological confirmation should include at least blood and a peripheral location. In case of clinical manifestations of herpes in the neonate, first samples PCR positive, preterm birth, or maternal primary infection or non-primary infection associated with first genital manifestation at delivery, CSF should also be collected as well as samples of lesions in the neonate if present (Professional consensus). Sampling should be repeated in case of PCR negative but strong evidence of neonatal herpes (Professional consensus). HSV serology is useless for diagnosis of neonatal herpes (Grade C). Virological confirmation for diagnosis of genital herpes during pregnancy or neonatal herpes must rely on PCR. PCR assays available in France are very reliable. Specific IgG are dedicated to restricted indications. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Bhowmick, P P; Khushiramani, R; Raghunath, P; Karunasagar, I; Karunasagar, I
2008-02-01
Evaluation of protein profiling for typing Vibrio parahaemolyticus using 71 strains isolated from different seafood and comparison with other molecular typing techniques such as random amplified polymorphic DNA analysis (RAPD) and enterobacterial repetitive intergenic consensus sequence (ERIC)-PCR. Three molecular typing methods were used for the typing of 71 V. parahaemolyticus isolates from seafood. RAPD had a discriminatory index (DI) of 0.95, while ERIC-PCR showed a DI of 0.94. Though protein profiling had less discriminatory power, use of this method can be helpful in identifying new proteins which might have a role in establishment in the host or virulence of the organism. The use of protein profiling in combination with other established typing methods such as RAPD and ERIC-PCR generates useful information in the case of V. parahaemolyticus associated with seafood. The study demonstrates the usefulness of nucleic acid and protein-based studies in understanding the relationship between various isolates from seafood.
Species identification and molecular typing of human Brucella isolates from Kuwait.
Mustafa, Abu S; Habibi, Nazima; Osman, Amr; Shaheed, Faraz; Khan, Mohd W
2017-01-01
Brucellosis is a zoonotic disease of major concern in Kuwait and the Middle East. Human brucellosis can be caused by several Brucella species with varying degree of pathogenesis, and relapses are common after apparently successful therapy. The classical biochemical methods for identification of Brucella are time-consuming, cumbersome, and provide information limited to the species level only. In contrast, molecular methods are rapid and provide differentiation at intra-species level. In this study, four molecular methods [16S rRNA gene sequencing, real-time PCR, enterobacterial repetitive intergenic consensus (ERIC)-PCR and multilocus variable-number tandem-repeat analysis (MLVA)-8, MLVA-11 and MLVA-16 were evaluated for the identification and typing of 75 strains of Brucella isolated in Kuwait. 16S rRNA gene sequencing of all isolates showed 90-99% sequence identity with B. melitensis and real-time PCR with genus- and species- specific primers identified all isolates as B. melitensis. The results of ERIC-PCR suggested the existence of 75 ERIC genotypes of B. melitensis with a discriminatory index of 0.997. Cluster classification of these genotypes divided them into two clusters, A and B, diverging at ~25%. The maximum number of genotypes (n = 51) were found in cluster B5. MLVA-8 analysis identified all isolates as B. melitensis, and MLVA-8, MLVA-11 and MLVA-16 typing divided the isolates into 10, 32 and 71 MLVA types, respectively. Furthermore, the combined minimum spanning tree analysis demonstrated that, compared to MLVA types discovered all over the world, the Kuwaiti isolates were a distinct group of MLVA-11 and MLVA-16 types in the East Mediterranean Region.
Species identification and molecular typing of human Brucella isolates from Kuwait
Osman, Amr; Shaheed, Faraz; Khan, Mohd W.
2017-01-01
Brucellosis is a zoonotic disease of major concern in Kuwait and the Middle East. Human brucellosis can be caused by several Brucella species with varying degree of pathogenesis, and relapses are common after apparently successful therapy. The classical biochemical methods for identification of Brucella are time-consuming, cumbersome, and provide information limited to the species level only. In contrast, molecular methods are rapid and provide differentiation at intra-species level. In this study, four molecular methods [16S rRNA gene sequencing, real-time PCR, enterobacterial repetitive intergenic consensus (ERIC)-PCR and multilocus variable-number tandem-repeat analysis (MLVA)-8, MLVA-11 and MLVA-16 were evaluated for the identification and typing of 75 strains of Brucella isolated in Kuwait. 16S rRNA gene sequencing of all isolates showed 90–99% sequence identity with B. melitensis and real-time PCR with genus- and species- specific primers identified all isolates as B. melitensis. The results of ERIC-PCR suggested the existence of 75 ERIC genotypes of B. melitensis with a discriminatory index of 0.997. Cluster classification of these genotypes divided them into two clusters, A and B, diverging at ~25%. The maximum number of genotypes (n = 51) were found in cluster B5. MLVA-8 analysis identified all isolates as B. melitensis, and MLVA-8, MLVA-11 and MLVA-16 typing divided the isolates into 10, 32 and 71 MLVA types, respectively. Furthermore, the combined minimum spanning tree analysis demonstrated that, compared to MLVA types discovered all over the world, the Kuwaiti isolates were a distinct group of MLVA-11 and MLVA-16 types in the East Mediterranean Region. PMID:28800594
Hammoudi, D; Moubareck, C Ayoub; Hakime, N; Houmani, M; Barakat, A; Najjar, Z; Suleiman, M; Fayad, N; Sarraf, R; Sarkis, D Karam
2015-07-01
The acquisition of carbapenemases by Acinetobacter baumannii is reported increasingly worldwide, but data from Lebanon are limited. The aims of this study were to evaluate the prevalence of imipenem-resistant A. baumannii in Lebanon, identify resistance determinants, and detect clonal relatedness. Imipenem-resistant A. baumannii were collected from nine Lebanese hospitals during 2012. Antimicrobial susceptibility, the cloxacillin effect, and ethylenediaminetetraacetic acid (EDTA) synergy were determined. Genes encoding carbapenemases and insertion sequence ISAba1 were screened via PCR sequencing. ISAba1 position relative to genes encoding Acinetobacter-derived cephalosporinases (ADCs) and OXA-23 was studied by PCR mapping. Clonal linkage was examined by enterobacterial repetitive intergenic consensus PCR (ERIC-PCR). Out of 724 A. baumannii isolated in 2012, 638 (88%) were imipenem-resistant. Of these, 142 were analyzed. Clavulanic acid-imipenem synergy suggested carbapenem-hydrolyzing extended-spectrum β-lactamase. A positive cloxacillin test indicated ADCs, while EDTA detection strips were negative. Genotyping indicated that 90% of isolates co-harbored blaOXA-23 and blaGES-11. The remaining strains had blaOXA-23, blaOXA-24, blaGES-11, or blaOXA-24 with blaGES-11. ISAba1 was located upstream of blaADC and blaOXA-23 in 97% and 100% of isolates, respectively. ERIC-PCR fingerprinting revealed 18 pulsotypes spread via horizontal gene transfer and clonal dissemination. This survey established baseline evidence of OXA-23 and GES-11-producing A. baumannii in Lebanon, indicating the need for further surveillance. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.
Ho, Cynthia K. Y.; Raghwani, Jayna; Koekkoek, Sylvie; Liang, Richard H.; Van der Meer, Jan T. M.; Van Der Valk, Marc; De Jong, Menno; Pybus, Oliver G.
2016-01-01
ABSTRACT In contrast to other available next-generation sequencing platforms, PacBio single-molecule, real-time (SMRT) sequencing has the advantage of generating long reads albeit with a relatively higher error rate in unprocessed data. Using this platform, we longitudinally sampled and sequenced the hepatitis C virus (HCV) envelope genome region (1,680 nucleotides [nt]) from individuals belonging to a cluster of sexually transmitted cases. All five subjects were coinfected with HIV-1 and a closely related strain of HCV genotype 4d. In total, 50 samples were analyzed by using SMRT sequencing. By using 7 passes of circular consensus sequencing, the error rate was reduced to 0.37%, and the median number of sequences was 612 per sample. A further reduction of insertions was achieved by alignment against a sample-specific reference sequence. However, in vitro recombination during PCR amplification could not be excluded. Phylogenetic analysis supported close relationships among HCV sequences from the four male subjects and subsequent transmission from one subject to his female partner. Transmission was characterized by a strong genetic bottleneck. Viral genetic diversity was low during acute infection and increased upon progression to chronicity but subsequently fluctuated during chronic infection, caused by the alternate detection of distinct coexisting lineages. SMRT sequencing combines long reads with sufficient depth for many phylogenetic analyses and can therefore provide insights into within-host HCV evolutionary dynamics without the need for haplotype reconstruction using statistical algorithms. IMPORTANCE Next-generation sequencing has revolutionized the study of genetically variable RNA virus populations, but for phylogenetic and evolutionary analyses, longer sequences than those generated by most available platforms, while minimizing the intrinsic error rate, are desired. Here, we demonstrate for the first time that PacBio SMRT sequencing technology can be used to generate full-length HCV envelope sequences at the single-molecule level, providing a data set with large sequencing depth for the characterization of intrahost viral dynamics. The selection of consensus reads derived from at least 7 full circular consensus sequencing rounds significantly reduced the intrinsic high error rate of this method. We used this method to genetically characterize a unique transmission cluster of sexually transmitted HCV infections, providing insight into the distinct evolutionary pathways in each patient over time and identifying the transmission-associated genetic bottleneck as well as fluctuations in viral genetic diversity over time, accompanied by dynamic shifts in viral subpopulations. PMID:28077634
Nguyen, David; Valenzuela, Nicole; Takemura, Ping; Bolon, Yung-Tsi; Springer, Brianna; Saito, Katsuyuki; Zheng, Ying; Hague, Tim; Pasztor, Agnes; Horvath, Gyorgy; Rigo, Krisztina; Reed, Elaine F.; Zhang, Qiuheng
2016-01-01
Background Unambiguous HLA typing is important in hematopoietic stem cell transplantation (HSCT), HLA disease association studies, and solid organ transplantation. However, current molecular typing methods only interrogate the antigen recognition site (ARS) of HLA genes, resulting in many cis-trans ambiguities that require additional typing methods to resolve. Here we report high-resolution HLA typing of 10,063 National Marrow Donor Program (NMDP) registry donors using long-range PCR by next generation sequencing (NGS) approach on buccal swab DNA. Methods Multiplex long-range PCR primers amplified the full-length of HLA class I genes (A, B, C) from promotor to 3’ UTR. Class II genes (DRB1, DQB1) were amplified from exon 2 through part of exon 4. PCR amplicons were pooled and sheared using Covaris fragmentation. Library preparation was performed using the Illumina TruSeq Nano kit on the Beckman FX automated platform. Each sample was tagged with a unique barcode, followed by 2×250 bp paired-end sequencing on the Illumina MiSeq. HLA typing was assigned using Omixon Twin software that combines two independent computational algorithms to ensure high confidence in allele calling. Consensus sequence and typing results were reported in Histoimmunogenetics Markup Language (HML) format. All homozygous alleles were confirmed by Luminex SSO typing and exon novelties were confirmed by Sanger sequencing. Results Using this automated workflow, over 10,063 NMDP registry donors were successfully typed under high-resolution by NGS. Despite known challenges of nucleic acid degradation and low DNA concentration commonly associated with buccal-based specimens, 97.8% of samples were successfully amplified using long-range PCR. Among these, 98.2% were successfully reported by NGS, with an accuracy rate of 99.84% in an independent blind Quality Control audit performed by the NDMP. In this study, NGS-HLA typing identified 23 null alleles (0.023%), 92 rare alleles (0.091%) and 42 exon novelties (0.042%). Conclusion Long-range, unambiguous HLA genotyping is achievable on clinical buccal swab-extracted DNA. Importantly, full-length gene sequencing and the ability to curate full sequence data will permit future interrogation of the impact of introns, expanded exons, and other gene regulatory sequences on clinical outcomes in transplantation. PMID:27798706
Yin, Yuxin; Lan, James H; Nguyen, David; Valenzuela, Nicole; Takemura, Ping; Bolon, Yung-Tsi; Springer, Brianna; Saito, Katsuyuki; Zheng, Ying; Hague, Tim; Pasztor, Agnes; Horvath, Gyorgy; Rigo, Krisztina; Reed, Elaine F; Zhang, Qiuheng
2016-01-01
Unambiguous HLA typing is important in hematopoietic stem cell transplantation (HSCT), HLA disease association studies, and solid organ transplantation. However, current molecular typing methods only interrogate the antigen recognition site (ARS) of HLA genes, resulting in many cis-trans ambiguities that require additional typing methods to resolve. Here we report high-resolution HLA typing of 10,063 National Marrow Donor Program (NMDP) registry donors using long-range PCR by next generation sequencing (NGS) approach on buccal swab DNA. Multiplex long-range PCR primers amplified the full-length of HLA class I genes (A, B, C) from promotor to 3' UTR. Class II genes (DRB1, DQB1) were amplified from exon 2 through part of exon 4. PCR amplicons were pooled and sheared using Covaris fragmentation. Library preparation was performed using the Illumina TruSeq Nano kit on the Beckman FX automated platform. Each sample was tagged with a unique barcode, followed by 2×250 bp paired-end sequencing on the Illumina MiSeq. HLA typing was assigned using Omixon Twin software that combines two independent computational algorithms to ensure high confidence in allele calling. Consensus sequence and typing results were reported in Histoimmunogenetics Markup Language (HML) format. All homozygous alleles were confirmed by Luminex SSO typing and exon novelties were confirmed by Sanger sequencing. Using this automated workflow, over 10,063 NMDP registry donors were successfully typed under high-resolution by NGS. Despite known challenges of nucleic acid degradation and low DNA concentration commonly associated with buccal-based specimens, 97.8% of samples were successfully amplified using long-range PCR. Among these, 98.2% were successfully reported by NGS, with an accuracy rate of 99.84% in an independent blind Quality Control audit performed by the NDMP. In this study, NGS-HLA typing identified 23 null alleles (0.023%), 92 rare alleles (0.091%) and 42 exon novelties (0.042%). Long-range, unambiguous HLA genotyping is achievable on clinical buccal swab-extracted DNA. Importantly, full-length gene sequencing and the ability to curate full sequence data will permit future interrogation of the impact of introns, expanded exons, and other gene regulatory sequences on clinical outcomes in transplantation.
Pomerantz, Aaron; Peñafiel, Nicolás; Arteaga, Alejandro; Bustamante, Lucas; Pichardo, Frank; Coloma, Luis A; Barrio-Amorós, César L; Salazar-Valenzuela, David; Prost, Stefan
2018-04-01
Advancements in portable scientific instruments provide promising avenues to expedite field work in order to understand the diverse array of organisms that inhabit our planet. Here, we tested the feasibility for in situ molecular analyses of endemic fauna using a portable laboratory fitting within a single backpack in one of the world's most imperiled biodiversity hotspots, the Ecuadorian Chocó rainforest. We used portable equipment, including the MinION nanopore sequencer (Oxford Nanopore Technologies) and the miniPCR (miniPCR), to perform DNA extraction, polymerase chain reaction amplification, and real-time DNA barcoding of reptile specimens in the field. We demonstrate that nanopore sequencing can be implemented in a remote tropical forest to quickly and accurately identify species using DNA barcoding, as we generated consensus sequences for species resolution with an accuracy of >99% in less than 24 hours after collecting specimens. The flexibility of our mobile laboratory further allowed us to generate sequence information at the Universidad Tecnológica Indoamérica in Quito for rare, endangered, and undescribed species. This includes the recently rediscovered Jambato toad, which was thought to be extinct for 28 years. Sequences generated on the MinION required as few as 30 reads to achieve high accuracy relative to Sanger sequencing, and with further multiplexing of samples, nanopore sequencing can become a cost-effective approach for rapid and portable DNA barcoding. Overall, we establish how mobile laboratories and nanopore sequencing can help to accelerate species identification in remote areas to aid in conservation efforts and be applied to research facilities in developing countries. This opens up possibilities for biodiversity studies by promoting local research capacity building, teaching nonspecialists and students about the environment, tackling wildlife crime, and promoting conservation via research-focused ecotourism.
Prevalence of asinine herpesvirus type 5 (AsHV-5) infection in clinically normal Lipizzaner horses.
Rushton, James Oliver; Kolodziejek, Jolanta; Nell, Barbara; Nowotny, Norbert
2014-04-01
The aim of this study was to assess the extent of asinine herpesvirus (AsHV) type 5 infection in 'closed' populations of clinically normal Lipizzaner horses. Peripheral blood mononuclear cells plus nasal and conjunctival swabs were obtained on four occasions over an 18 month period from 266 animals as part of a health surveillance programme. Sequence analysis of samples that were positive by nested consensus herpesvirus PCR but negative using quantified equid herpesvirus (EHV) type 2 and 5 PCR, revealed a total of 51 samples from 39 horses positive for AsHV-5. No statistically significant association between animal age, gender or geographical location and infection status was identified. The findings suggest sub-clinical AsHV-5 infection may be encountered more frequently than previously reported. Copyright © 2013 Elsevier Ltd. All rights reserved.
[Identification of Tibetan medicine "Dida" of Gentianaceae using DNA barcoding].
Liu, Chuan; Zhang, Yu-Xin; Liu, Yue; Chen, Yi-Long; Fan, Gang; Xiang, Li; Xu, Jiang; Zhang, Yi
2016-02-01
The ITS2 barcode was used toidentify Tibetan medicine "Dida", and tosecure its quality and safety in medication. A total of 13 species, 151 experimental samples for the study from the Tibetan Plateau, including Gentianaceae Swertia, Halenia, Gentianopsis, Comastoma, Lomatogonium ITS2 sequences were amplified, and purified PCR products were sequenced. Sequence assembly and consensus sequence generation were performed using the CodonCode Aligner V3.7.1. The Kimura 2-Parameter (K2P) distances were calculated using MEGA 6.0. The neighbor-joining (NJ) phylogenetic trees were constructed. There are 31 haplotypes among 231 bp after alignment of all ITS2 sequence haplotypes, and the average G±C content of 61.40%. The NJ tree strongly supported that every species clustered into their own clade and high identification success rate, except that Swertia bifolia and Swertia wolfangiana could not be distinguished from each other based on the sequence divergences. DNA barcoding could be used as a fast and accurate identification method to distinguish Tibetan medicine "Dida" to ensure its safe use. Copyright© by the Chinese Pharmaceutical Association.
2012-01-01
Background Recent emerging evidences identify Human Papillomavirus (HPV) related Head and Neck squamous cell carcinomas (HN-SCCs) as a separate subgroup among Head and Neck Cancers with different epidemiology, histopathological characteristics, therapeutic response to chemo-radiation treatment and clinical outcome. However, there is not a worldwide consensus on the methods to be used in clinical practice. The endpoint of this study was to demonstrate the reliability of a triple method which combines evaluation of: 1. p16 protein expression by immunohistochemistry (p16-IHC); 2. HPV-DNA genotyping by consensus HPV-DNA PCR methods (Consensus PCR); and 3 viral integration into the host by in situ hybridization method (ISH). This triple method has been applied to HN-SCC originated from oral cavity (OSCC) and oropharynx (OPSCC), the two anatomical sites in which high risk (HR) HPVs have been clearly implicated as etiologic factors. Methylation-Specific PCR (MSP) was performed to study inactivation of p16-CDKN2a locus by epigenetic events. Reliability of multiple methods was measured by Kappa statistics. Results All the HN-SCCs confirmed HPV positive by PCR and/or ISH were also p16 positive by IHC, with the latter showing a very high level of sensitivity as single test (100% in both OSCC and OPSCC) but lower specificity level (74% in OSCC and 93% in OPSCC). Concordance analysis between ISH and Consensus PCR showed a faint agreement in OPSCC (κ = 0.38) and a moderate agreement in OSCC (κ = 0.44). Furthermore, the addition of double positive score (ISHpositive and Consensus PCR positive) increased significantly the specificity of HR-HPV detection on formalin-fixed paraffin embedded (FFPE) samples (100% in OSCC and 78.5% in OPSCC), but reduced the sensitivity (33% in OSCC and 60% in OPSCC). The significant reduction of sensitivity by the double method was compensated by a very high sensitivity of p16-IHC detection in the triple approach. Conclusions Although HR-HPVs detection is of utmost importance in clinical settings for the Head and Neck Cancer patients, there is no consensus on which to consider the 'golden standard' among the numerous detection methods available either as single test or combinations. Until recently, quantitative E6 RNA PCR has been considered the 'golden standard' since it was demonstrated to have very high accuracy level and very high statistical significance associated with prognostic parameters. In contrast, quantitative E6 DNA PCR has proven to have very high level of accuracy but lesser prognostic association with clinical outcome than the HPV E6 oncoprotein RNA PCR. However, although it is theoretically possible to perform quantitative PCR detection methods also on FFPE samples, they reach the maximum of accuracy on fresh frozen tissue. Furthermore, worldwide diagnostic laboratories have not all the same ability to analyze simultaneously both FFPE and fresh tissues with these quantitative molecular detection methods. Therefore, in the current clinical practice a p16-IHC test is considered as sufficient for HPV diagnostic in accordance with the recently published Head and Neck Cancer international guidelines. Although p16-IHC may serve as a good prognostic indicator, our study clearly demonstrated that it is not satisfactory when used exclusively as the only HPV detecting method. Adding ISH, although known as less sensitive than PCR-based detection methods, has the advantage to preserve the morphological context of HPV-DNA signals in FFPE samples and, thus increase the overall specificity of p16/Consensus PCR combination tests. PMID:22376902
Consensus generation and variant detection by Celera Assembler.
Denisov, Gennady; Walenz, Brian; Halpern, Aaron L; Miller, Jason; Axelrod, Nelson; Levy, Samuel; Sutton, Granger
2008-04-15
We present an algorithm to identify allelic variation given a Whole Genome Shotgun (WGS) assembly of haploid sequences, and to produce a set of haploid consensus sequences rather than a single consensus sequence. Existing WGS assemblers take a column-by-column approach to consensus generation, and produce a single consensus sequence which can be inconsistent with the underlying haploid alleles, and inconsistent with any of the aligned sequence reads. Our new algorithm uses a dynamic windowing approach. It detects alleles by simultaneously processing the portions of aligned reads spanning a region of sequence variation, assigns reads to their respective alleles, phases adjacent variant alleles and generates a consensus sequence corresponding to each confirmed allele. This algorithm was used to produce the first diploid genome sequence of an individual human. It can also be applied to assemblies of multiple diploid individuals and hybrid assemblies of multiple haploid organisms. Being applied to the individual human genome assembly, the new algorithm detects exactly two confirmed alleles and reports two consensus sequences in 98.98% of the total number 2,033311 detected regions of sequence variation. In 33,269 out of 460,373 detected regions of size >1 bp, it fixes the constructed errors of a mosaic haploid representation of a diploid locus as produced by the original Celera Assembler consensus algorithm. Using an optimized procedure calibrated against 1 506 344 known SNPs, it detects 438 814 new heterozygous SNPs with false positive rate 12%. The open source code is available at: http://wgs-assembler.cvs.sourceforge.net/wgs-assembler/
Jabbar, Abdul; Papini, Roberto; Ferrini, Nadia; Gasser, Robin B
2012-10-01
A 9 year-old male, neutered cat with a history of a sudden onset of lethargy, anorexia and respiratory distress was presented in a veterinary practice in Lucca, Italy. A clinical examination revealed that the cat was severely dehydrated, and had pale mucous membranes and tachypnoea. No pain or discomfort was detected at the time of physical examination. The cat was administered fluids, antibiotics and supportive therapy, but died overnight. The owner of the cat requested for a post mortem examination to be conducted. At necropsy, acephalic structures, consistent with proliferative tapeworm (cestode) larvae, were detected in the thoracic cavity on pleural surfaces. As these larvae could not be identified to genus or species by microscopy, a PCR-based sequencing-phylogenetic approach was used. Part of the cytochrome c oxidase subunit 1 gene was PCR-amplified from genomic DNAs from five individual larvae and sequenced; all five sequences obtained were identical. This consensus sequence was aligned (over 355 nucleotide positions) with homologous sequences representing a range of cestodes (including Echinococcus granulosus, Echinococcus multilocularis, Hymenolepis microstoma, Mesocestoides spp. and Taenia saginata) from previously published studies and then subjected to phylogenetic analysis. The sequence representing the larval cestode from the affected cat grouped, with strong statistical support, with those representing Mesocestoides corti and Mesocestoides lineatus. Therefore, a definitive diagnosis of pleural proliferative larval mesocestoidiasis could be made. This study illustrates the value of using molecular tools to directly assist clinical and pathological investigations of cestodiases of animals. Copyright © 2012 Elsevier B.V. All rights reserved.
Evaluation of the genetic diversity of Plum pox virus in a single plum tree.
Predajňa, Lukáš; Šubr, Zdeno; Candresse, Thierry; Glasa, Miroslav
2012-07-01
Genetic diversity of Plum pox virus (PPV) and its distribution within a single perennial woody host (plum, Prunus domestica) has been evaluated. A plum tree was triply infected by chip-budding with PPV-M, PPV-D and PPV-Rec isolates in 2003 and left to develop untreated under open field conditions. In September 2010 leaf and fruit samples were collected from different parts of the tree canopy. A 745-bp NIb-CP fragment of PPV genome, containing the hypervariable region encoding the CP N-terminal end was amplified by RT-PCR from each sample and directly sequenced to determine the dominant sequence. In parallel, the PCR products were cloned and a total of 105 individual clones were sequenced. Sequence analysis revealed that after 7 years of infection, only PPV-M was still detectable in the tree and that the two other isolates (PPV-Rec and PPV-D) had been displaced. Despite the fact that the analysis targeted a relatively short portion of the genome, a substantial amount of intra-isolate variability was observed for PPV-M. A total of 51 different haplotypes could be identified from the 105 individual sequences, two of which were largely dominant. However, no clear-cut structuration of the viral population by the tree architecture could be highlighted although the results obtained suggest the possibility of intra-leaf/fruit differentiation of the viral population. Comparison of the consensus sequence with the original source isolate showed no difference, suggesting within-plant stability of this original isolate under open field conditions. Copyright © 2012 Elsevier B.V. All rights reserved.
Kirby, Patrick J; Greaves, Ian K; Koina, Edda; Waters, Paul D; Marshall Graves, Jennifer A
2007-01-01
The genomes of the egg-laying platypus and echidna are of particular interest because monotremes are the most basal mammal group. The chromosomal distribution of an ancient family of short interspersed repeats (SINEs), the core-SINEs, was investigated to better understand monotreme genome organization and evolution. Previous studies have identified the core-SINE as the predominant SINE in the platypus genome, and in this study we quantified, characterized and localized subfamilies. Dot blot analysis suggested that a very large fraction (32% of the platypus and 16% of the echidna genome) is composed of Mon core-SINEs. Core-SINE-specific primers were used to amplify PCR products from platypus and echidna genomic DNA. Sequence analysis suggests a common consensus sequence Mon 1-B, shared by platypus and echidna, as well as platypus-specific Mon 1-C and echidna specific Mon 1-D consensus sequences. FISH mapping of the Mon core-SINE products to platypus metaphase spreads demonstrates that the Mon-1C subfamily is responsible for the striking Mon core-SINE accumulation in the distal regions of the six large autosomal pairs and the largest X chromosome. This unusual distribution highlights the dichotomy between the seven large chromosome pairs and the 19 smaller pairs in the monotreme karyotype, which has some similarity to the macro- and micro-chromosomes of birds and reptiles, and suggests that accumulation of repetitive sequences may have enlarged small chromosomes in an ancestral vertebrate. In the forthcoming sequence of the platypus genome there are still large gaps, and the extensive Mon core-SINE accumulation on the distal regions of the six large autosomal pairs may provide one explanation for this missing sequence.
Anbar, Michael; Gul, Ozgur; Lamed, Raphael; Sezerman, Ugur O.
2012-01-01
The use of thermostable cellulases is advantageous for the breakdown of lignocellulosic biomass toward the commercial production of biofuels. Previously, we have demonstrated the engineering of an enhanced thermostable family 8 cellulosomal endoglucanase (EC 3.2.1.4), Cel8A, from Clostridium thermocellum, using random error-prone PCR and a combination of three beneficial mutations, dominated by an intriguing serine-to-glycine substitution (M. Anbar, R. Lamed, E. A. Bayer, ChemCatChem 2:997–1003, 2010). In the present study, we used a bioinformatics-based approach involving sequence alignment of homologous family 8 glycoside hydrolases to create a library of consensus mutations in which residues of the catalytic module are replaced at specific positions with the most prevalent amino acids in the family. One of the mutants (G283P) displayed a higher thermal stability than the wild-type enzyme. Introducing this mutation into the previously engineered Cel8A triple mutant resulted in an optimized enzyme, increasing the half-life of activity by 14-fold at 85°C. Remarkably, no loss of catalytic activity was observed compared to that of the wild-type endoglucanase. The structural changes were simulated by molecular dynamics analysis, and specific regions were identified that contributed to the observed thermostability. Intriguingly, most of the proteins used for sequence alignment in determining the consensus residues were derived from mesophilic bacteria, with optimal temperatures well below that of C. thermocellum Cel8A. PMID:22389377
Elgroud, Rachid; Granier, Sophie A.; Marault, Muriel; Kerouanton, Annaëlle; Lezzar, Abdesslem; Bouzitouna-Bentchouala, Chafia; Brisabois, Anne; Millemann, Yves
2015-01-01
An epidemiological investigation was carried out on one hundred Salmonella isolates from broiler farms, slaughterhouses, and human patients in the Constantine region of Algeria, in order to explore the contribution of avian strains to human salmonellosis cases in this region over the same period of time. The isolates were characterized by phenotypic as well as genotypic methods. A large variety of antimicrobial resistance profiles was found among human isolates, while only seven profiles were found among avian isolates. Enterobacterial Repetitive Intergenic Consensus-PCR (ERIC-PCR), Insertion Sequence 200-PCR (IS200-PCR), and Pulsed Field Gel Electrophoresis (PFGE) resulted in the allocation of the isolates to 16, 20, and 34 different profiles, respectively. The 3 genotyping methods led to complementary results by underlining the clonality of some serovars with the diffusion and persistence of a single clone in the Constantine area as well as stressing the polymorphism present in isolates belonging to other serovars, indicating the diversity of potential reservoirs of nontyphoidal Salmonella. Altogether, our results seem to indicate that nontyphoidal avian Salmonella may play an important role in human salmonellosis in the Constantine region. PMID:26543858
Li, Yinsheng; Zhao, Chun; Lu, Xiaoxu; Ai, Xiaojie; Qiu, Jiangping
2018-04-15
Cytochrome P450 (CYP450) enzymes are a family of hemoproteins primarily responsible for detoxification functions. Earthworms have been used as a bioindicator of soil pollution in numerous studies, but no CYP450 gene has so far been cloned. RT-PCR and RACE-PCR were employed to construct and sequence the CYP450 gene DNA from the extracted mRNA in the earthworm Eisenia fetida. The cloned gene (EW1) has an open reading frame of 477bp. The 3'-terminal region contained both the consensus and the signature sequences characteristic of CYP450. It was closely related to the CYP450 gene from the flatworm genus Opisthorchis felineus with 87% homology. The predicted structure of the putative protein was 97% homologous to human CYP450 family 27. This gene has been deposited in GenBank (accession no. KM881474). Earthworms (E. fetida) were then exposed to 1, 10, 100, and 500mgkg -1 enrofloxacin in soils to explore the mRNA expression by real time qPCR. The effect of enrofloxacin on mRNA expression levels of EW1 exhibited a marked hormesis pattern across the enrofloxacin dose range tested. This is believed to be the first reported CYP450 gene in earthworms, with reference value for molecular studies on detoxification processes in earthworms. Copyright © 2017 Elsevier Inc. All rights reserved.
Wong, Danny Ka-Ho; Tsoi, Ottilia; Huang, Fung-Yu; Seto, Wai-Kay; Fung, James; Lai, Ching-Lung
2014-01-01
Nucleoside/nucleotide analogue for the treatment of chronic hepatitis B virus (HBV) infection is hampered by the emergence of drug resistance mutations. Conventional PCR sequencing cannot detect minor variants of <20%. We developed a modified co-amplification at lower denaturation temperature-PCR (COLD-PCR) method for the detection of HBV minority drug resistance mutations. The critical denaturation temperature for COLD-PCR was determined to be 78°C. Sensitivity of COLD-PCR sequencing was determined using serially diluted plasmids containing mixed proportions of HBV reverse transcriptase (rt) wild-type and mutant sequences. Conventional PCR sequencing detected mutations only if they existed in ≥25%, whereas COLD-PCR sequencing detected mutations when they existed in 5 to 10% of the viral population. The performance of COLD-PCR was compared to conventional PCR sequencing and a line probe assay (LiPA) using 215 samples obtained from 136 lamivudine- or telbivudine-treated patients with virological breakthrough. Among these 215 samples, drug resistance mutations were detected in 155 (72%), 148 (69%), and 113 samples (53%) by LiPA, COLD-PCR, and conventional PCR sequencing, respectively. Nineteen (9%) samples had mutations detectable by COLD-PCR but not LiPA, while 26 (12%) samples had mutations detectable by LiPA but not COLD-PCR, indicating both methods were comparable (P = 0.371). COLD-PCR was more sensitive than conventional PCR sequencing. Thirty-five (16%) samples had mutations detectable by COLD-PCR but not conventional PCR sequencing, while none had mutations detected by conventional PCR sequencing but not COLD-PCR (P < 0.0001). COLD-PCR sequencing is a simple method which is comparable to LiPA and superior to conventional PCR sequencing in detecting minor lamivudine/telbivudine resistance mutations. PMID:24951803
Stephens, E B; Mukherjee, S; Sahni, M; Zhuge, W; Raghavan, R; Singh, D K; Leung, K; Atkinson, B; Li, Z; Joag, S V; Liu, Z Q; Narayan, O
1997-05-12
We have examined both the sequence changes in the LTR, gag, vif, vpr, vpx, tat, rev, vpu, env, and nef genes and the cell tropism of a cell-free stock of chimeric simian-human immunodeficiency virus (SHIV) isolated from the cerebrospinal fluid of a pig-tailed macaque (PNb) that developed AIDS. This virus (SHIVKU-1) is highly pathogenic when inoculated into other macaques. DNA sequence analysis of PCR-amplified products revealed a total of 5 nucleotide changes in the LTR while vif had 2 consensus amino acid changes. The gag, vif, and vpx had no consensus amino acid substitutions, whereas vpr had 1 consensus substitution. The tat and rev genes of the HXB2 region of SHIVKU-1 had 2 and 1 consensus amino acid changes, respectively. The vpu gene of the HXB2 region of SHIV, which originally had an ACG at the beginning of the gene, reverted to an initiation ATG codon and in addition contained a consensus amino acid substitution at position 69 of this protein. As expected, the majority of the nucleotide substitutions were found in the env and nef genes. Thirteen and 5 amino acid changes were predicted for the corresponding Env and Nef proteins, respectively. In addition, one-third of the env gene clones isolated from the SHIVKU-1 stock had a 5-amino-acid deletion in the V4 region. Using three independent assays, we determined that the changes in the SHIVKU-1 were associated with an increase in the efficiency of replication in macrophages. The strikingly few consensus changes in the virus suggest that conversion of this virus to one capable of causing AIDS in pig-tailed macaques was associated with relatively few changes in the viral envelope and/or accessory genes. These results will provide the basis for the development of a pathogenic, molecular clone of SHIV capable of causing AIDS in pig-tailed macaques.
Structure of the coding region and mRNA variants of the apyrase gene from pea (Pisum sativum)
NASA Technical Reports Server (NTRS)
Shibata, K.; Abe, S.; Davies, E.
2001-01-01
Partial amino acid sequences of a 49 kDa apyrase (ATP diphosphohydrolase, EC 3.6.1.5) from the cytoskeletal fraction of etiolated pea stems were used to derive oligonucleotide DNA primers to generate a cDNA fragment of pea apyrase mRNA by RT-PCR and these primers were used to screen a pea stem cDNA library. Two almost identical cDNAs differing in just 6 nucleotides within the coding regions were found, and these cDNA sequences were used to clone genomic fragments by PCR. Two nearly identical gene fragments containing 8 exons and 7 introns were obtained. One of them (H-type) encoded the mRNA sequence described by Hsieh et al. (1996) (DDBJ/EMBL/GenBank Z32743), while the other (S-type) differed by the same 6 nucleotides as the mRNAs, suggesting that these genes may be alleles. The six nucleotide differences between these two alleles were found solely in the first exon, and these mutation sites had two types of consensus sequences. These mRNAs were found with varying lengths of 3' untranslated regions (3'-UTR). There are some similarities between the 3'-UTR of these mRNAs and those of actin and actin binding proteins in plants. The putative roles of the 3'-UTR and alternative polyadenylation sites are discussed in relation to their possible role in targeting the mRNAs to different subcellular compartments.
Rector, Annabel; Tachezy, Ruth; Van Ranst, Marc
2004-01-01
The discovery of novel viruses has often been accomplished by using hybridization-based methods that necessitate the availability of a previously characterized virus genome probe or knowledge of the viral nucleotide sequence to construct consensus or degenerate PCR primers. In their natural replication cycle, certain viruses employ a rolling-circle mechanism to propagate their circular genomes, and multiply primed rolling-circle amplification (RCA) with φ29 DNA polymerase has recently been applied in the amplification of circular plasmid vectors used in cloning. We employed an isothermal RCA protocol that uses random hexamer primers to amplify the complete genomes of papillomaviruses without the need for prior knowledge of their DNA sequences. We optimized this RCA technique with extracted human papillomavirus type 16 (HPV-16) DNA from W12 cells, using a real-time quantitative PCR assay to determine amplification efficiency, and obtained a 2.4 × 104-fold increase in HPV-16 DNA concentration. We were able to clone the complete HPV-16 genome from this multiply primed RCA product. The optimized protocol was subsequently applied to a bovine fibropapillomatous wart tissue sample. Whereas no papillomavirus DNA could be detected by restriction enzyme digestion of the original sample, multiply primed RCA enabled us to obtain a sufficient amount of papillomavirus DNA for restriction enzyme analysis, cloning, and subsequent sequencing of a novel variant of bovine papillomavirus type 1. The multiply primed RCA method allows the discovery of previously unknown papillomaviruses, and possibly also other circular DNA viruses, without a priori sequence information. PMID:15113879
Fantin, Yuri S.; Neverov, Alexey D.; Favorov, Alexander V.; Alvarez-Figueroa, Maria V.; Braslavskaya, Svetlana I.; Gordukova, Maria A.; Karandashova, Inga V.; Kuleshov, Konstantin V.; Myznikova, Anna I.; Polishchuk, Maya S.; Reshetov, Denis A.; Voiciehovskaya, Yana A.; Mironov, Andrei A.; Chulanov, Vladimir P.
2013-01-01
Sanger sequencing is a common method of reading DNA sequences. It is less expensive than high-throughput methods, and it is appropriate for numerous applications including molecular diagnostics. However, sequencing mixtures of similar DNA of pathogens with this method is challenging. This is important because most clinical samples contain such mixtures, rather than pure single strains. The traditional solution is to sequence selected clones of PCR products, a complicated, time-consuming, and expensive procedure. Here, we propose the base-calling with vocabulary (BCV) method that computationally deciphers Sanger chromatograms obtained from mixed DNA samples. The inputs to the BCV algorithm are a chromatogram and a dictionary of sequences that are similar to those we expect to obtain. We apply the base-calling function on a test dataset of chromatograms without ambiguous positions, as well as one with 3–14% sequence degeneracy. Furthermore, we use BCV to assemble a consensus sequence for an HIV genome fragment in a sample containing a mixture of viral DNA variants and to determine the positions of the indels. Finally, we detect drug-resistant Mycobacterium tuberculosis strains carrying frameshift mutations mixed with wild-type bacteria in the pncA gene, and roughly characterize bacterial communities in clinical samples by direct 16S rRNA sequencing. PMID:23382983
Jurka, Jerzy W.
1997-01-01
Enhanced homologous recombination is obtained by employing a consensus sequence which has been found to be associated with integration of repeat sequences, such as Alu and ID. The consensus sequence or sequence having a single transition mutation determines one site of a double break which allows for high efficiency of integration at the site. By introducing single or double stranded DNA having the consensus sequence flanking region joined to a sequence of interest, one can reproducibly direct integration of the sequence of interest at one or a limited number of sites. In this way, specific sites can be identified and homologous recombination achieved at the site by employing a second flanking sequence associated with a sequence proximal to the 3'-nick.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chain, P; Garcia, E
2003-02-06
The goal of this proposed effort was to assess the difficulty in identifying and characterizing virulence candidate genes in an organism for which very limited data exists. This was accomplished by first addressing the finishing phase of draft-sequenced F. tularensis genomes and conducting comparative analyses to determine the coding potential of each genome; to discover the differences in genome structure and content, and to identify potential genes whose products may be involved in the F. tularensis virulence process. The project was divided into three parts: (1) Genome finishing: This part involves determining the order and orientation of the consensus sequencesmore » of contigs obtained from Phrap assemblies of random draft genomic sequences. This tedious process consists of linking contig ends using information embedded in each sequence file that relates the sequence to the original cloned insert. Since inserts are sequenced from both ends, we can establish a link between these paired-ends in different contigs and thus order and orient contigs. Since these genomes carry numerous copies of insertion sequences, these repeated elements ''confuse'' the Phrap assembly program. It is thus necessary to break these contigs apart at the repeated sequences and individually join the proper flanking regions using paired-end information, or using results of comparisons against a similar genome. Larger repeated elements such as the small subunit ribosomal RNA operon require verification with PCR. Tandem repeats require manual intervention and typically rely on single nucleotide polymorphisms to be resolved. Remaining gaps require PCR reactions and sequencing. Once the genomes have been ''closed'', low quality regions are addressed by resequencing reactions. (2) Genome analysis: The final consensus sequences are processed by combining the results of three gene modelers: Glimmer, Critica and Generation. The final gene models are submitted to a battery of homology searches and domain prediction programs in order to annotate them (e.g. BLAST, Pfam, TIGRfam, COG, KEGG, InterPro, TMhmm, SignalP). The genome structure is also assessed in terms of G+C content, GC bias (GC skew), and locations of repeated regions (e.g. IS elements) and phage-like genes. (3) Comparative genomics: The results of the various genome analyses are compared between the finished (or almost finished) genomes. Here, we have compared the F. tularensis genomes from the extremely lethal strain Schu4 (subsp. tularensis), the vaccine strain LVS (subsp. holartica), and strain UT01-4992 of the less virulent, opportunistic subsp. novicida. Regions present in the highly virulent strain that are absent from the other less virulent strains may provide insight into what factors are required for the high level of virulence.« less
Oba, Mami; Tsuchiaka, Shinobu; Omatsu, Tsutomu; Katayama, Yukie; Otomaru, Konosuke; Hirata, Teppei; Aoki, Hiroshi; Murata, Yoshiteru; Makino, Shinji; Nagai, Makoto; Mizutani, Tetsuya
2018-01-08
We tested usefulness of a target enrichment system SureSelect, a comprehensive viral nucleic acid detection method, for rapid identification of viral pathogens in feces samples of cattle, pigs and goats. This system enriches nucleic acids of target viruses in clinical/field samples by using a library of biotinylated RNAs with sequences complementary to the target viruses. The enriched nucleic acids are amplified by PCR and subjected to next generation sequencing to identify the target viruses. In many samples, SureSelect target enrichment method increased efficiencies for detection of the viruses listed in the biotinylated RNA library. Furthermore, this method enabled us to determine nearly full-length genome sequence of porcine parainfluenza virus 1 and greatly increased Breadth, a value indicating the ratio of the mapping consensus length in the reference genome, in pig samples. Our data showed usefulness of SureSelect target enrichment system for comprehensive analysis of genomic information of various viruses in field samples. Copyright © 2017 Elsevier Inc. All rights reserved.
PCR Methods for Rapid Identification and Characterization of Actinobacillus seminis Strains
Appuhamy, S.; Coote, J. G.; Low, J. C.; Parton, R.
1998-01-01
Twenty-four isolates of Actinobacillus seminis were typed by PCR ribotyping, repetitive extragenic palindromic element (REP)-based PCR, and enterobacterial repetitive intergenic consensus (ERIC)-based PCR. Five types were distinguished by REP-PCR, and nine types were distinguished by ERIC-PCR. PCR ribotyping produced the simplest pattern and could be useful for identification of A. seminis and for its differentiation from related species. REP- and ERIC-PCR could be used for strain differentiation in epidemiological studies of A. seminis. PMID:9508320
Peñafiel, Nicolás; Arteaga, Alejandro; Bustamante, Lucas; Pichardo, Frank; Coloma, Luis A; Barrio-Amorós, César L; Salazar-Valenzuela, David; Prost, Stefan
2018-01-01
Abstract Background Advancements in portable scientific instruments provide promising avenues to expedite field work in order to understand the diverse array of organisms that inhabit our planet. Here, we tested the feasibility for in situ molecular analyses of endemic fauna using a portable laboratory fitting within a single backpack in one of the world's most imperiled biodiversity hotspots, the Ecuadorian Chocó rainforest. We used portable equipment, including the MinION nanopore sequencer (Oxford Nanopore Technologies) and the miniPCR (miniPCR), to perform DNA extraction, polymerase chain reaction amplification, and real-time DNA barcoding of reptile specimens in the field. Findings We demonstrate that nanopore sequencing can be implemented in a remote tropical forest to quickly and accurately identify species using DNA barcoding, as we generated consensus sequences for species resolution with an accuracy of >99% in less than 24 hours after collecting specimens. The flexibility of our mobile laboratory further allowed us to generate sequence information at the Universidad Tecnológica Indoamérica in Quito for rare, endangered, and undescribed species. This includes the recently rediscovered Jambato toad, which was thought to be extinct for 28 years. Sequences generated on the MinION required as few as 30 reads to achieve high accuracy relative to Sanger sequencing, and with further multiplexing of samples, nanopore sequencing can become a cost-effective approach for rapid and portable DNA barcoding. Conclusions Overall, we establish how mobile laboratories and nanopore sequencing can help to accelerate species identification in remote areas to aid in conservation efforts and be applied to research facilities in developing countries. This opens up possibilities for biodiversity studies by promoting local research capacity building, teaching nonspecialists and students about the environment, tackling wildlife crime, and promoting conservation via research-focused ecotourism. PMID:29617771
New PCR Test That Recognizes All Human Prototypes of Enterovirus: Application for Clinical Diagnosis
Bourlet, Thomas; Caro, Valerie; Minjolle, Sophie; Jusselin, Isabelle; Pozzetto, Bruno; Crainic, Radu; Colimon, Ronald
2003-01-01
We describe a new PCR test (Penter RT-PCR) that recognizes all 64 prototypes of enterovirus. Sixty clinical samples were analyzed in parallel with this Penter RT-PCR and previously described PCR tests: 34 and 32 samples tested positive, respectively. This assay is suitable for use in clinical diagnosis, and its ability to amplify all known serotypes makes it more useful than other consensus PCR tests. PMID:12682177
Comparative isolation and genetic diversity of Arcobacter sp. from fish and the coastal environment.
Rathlavath, S; Kumar, S; Nayak, B B
2017-07-01
Arcobacter species are emerging food-borne and water-borne human pathogens associated mostly with food animals and their environment. The present study was aimed to isolate Arcobacter species from fish, shellfish and coastal water samples using two methods and to determine their genetic diversity. Of 201 samples of fish, shellfish and water samples analysed, 66 (32·8%) samples showed the presence of Arcobacter DNA from both Arcobacter enrichment broth and Bolton broth. Arcobacters were isolated from 58 (87·8%) and 38 (57·5%) of Arcobacter DNA-positive samples using Arcobacter blood agar and Preston blood agar, respectively. Arcobacter sp. identified by biochemical tests were further analysed by a genus-specific PCR, followed by a multiplex-PCR and 16S rRNA-RFLP. From both the methods, four different Arcobacter species namely Arcobacter butzleri, Arcobacter skirrowii, Arcobacter mytili and Arcobacter defluvii were isolated, of which A. butzleri was the predominant species. Enterobacterial repetitive intergenic consensus (ERIC)-PCR fingerprint analysis revealed that the arcobacters isolated in this study were genetically very diverse and no specific genotype was found associated with a specific source (seafood or water). Since pathogenic arcobacters are not known to be natural inhabitants of coastal marine environment, identifying the sources of contamination will be crucial for effective management of this problem. Arcobacter sp. are emerging food- and water-borne human pathogens. In this study, comparison of two selective media suggested Arcobacter blood agar to be more efficient in yielding Arcobacter sp. from seafood. Furthermore, the isolation of Arcobacter sp. such as Arcobacter butzleri, A. skirrowii, A. mytili and A. defluvii from seafood suggests diverse sources of contamination of seafood by Arcobacter sp. Analysis of enterobacterial repetitive intergenic consensus sequence-PCR patterns of A. butzleri showed high genetic diversity and lack of clonality among the isolates. Arcobacter contamination of seafood is an emerging issue both from seafood safety and seafood trade point of view. © 2017 The Society for Applied Microbiology.
To Clone or Not To Clone: Method Analysis for Retrieving Consensus Sequences In Ancient DNA Samples
Winters, Misa; Barta, Jodi Lynn; Monroe, Cara; Kemp, Brian M.
2011-01-01
The challenges associated with the retrieval and authentication of ancient DNA (aDNA) evidence are principally due to post-mortem damage which makes ancient samples particularly prone to contamination from “modern” DNA sources. The necessity for authentication of results has led many aDNA researchers to adopt methods considered to be “gold standards” in the field, including cloning aDNA amplicons as opposed to directly sequencing them. However, no standardized protocol has emerged regarding the necessary number of clones to sequence, how a consensus sequence is most appropriately derived, or how results should be reported in the literature. In addition, there has been no systematic demonstration of the degree to which direct sequences are affected by damage or whether direct sequencing would provide disparate results from a consensus of clones. To address this issue, a comparative study was designed to examine both cloned and direct sequences amplified from ∼3,500 year-old ancient northern fur seal DNA extracts. Majority rules and the Consensus Confidence Program were used to generate consensus sequences for each individual from the cloned sequences, which exhibited damage at 31 of 139 base pairs across all clones. In no instance did the consensus of clones differ from the direct sequence. This study demonstrates that, when appropriate, cloning need not be the default method, but instead, should be used as a measure of authentication on a case-by-case basis, especially when this practice adds time and cost to studies where it may be superfluous. PMID:21738625
Karki, Hari S.; Shrestha, Bishnu K.; Han, Jae Woo; Groth, Donald E.; Barphagha, Inderjit K.; Rush, Milton C.; Melanson, Rebecca A.; Kim, Beom Seok; Ham, Jong Hyun
2012-01-01
Burkholderia glumae is the primary causal agent of bacterial panicle blight of rice. In this study, 11 naturally avirulent and nine virulent strains of B. glumae native to the southern United States were characterized in terms of virulence in rice and onion, toxofalvin production, antifungal activity, pigmentation and genomic structure. Virulence of B. glumae strains on rice panicles was highly correlated to virulence on onion bulb scales, suggesting that onion bulb can be a convenient alternative host system to efficiently determine the virulence of B. glumae strains. Production of toxoflavin, the phytotoxin that functions as a major virulence factor, was closely associated with the virulence phenotypes of B. glumae strains in rice. Some strains of B. glumae showed various levels of antifungal activity against Rhizoctonia solani, the causal agent of sheath blight, and pigmentation phenotypes on casamino acid-peptone-glucose (CPG) agar plates regardless of their virulence traits. Purple and yellow-green pigments were partially purified from a pigmenting strain of B. glumae, 411gr-6, and the purple pigment fraction showed a strong antifungal activity against Collectotrichum orbiculare. Genetic variations were detected among the B. glumae strains from DNA fingerprinting analyses by repetitive element sequence-based PCR (rep-PCR) for BOX-A1R-based repetitive extragenic palindromic (BOX) or enterobacterial repetitive intergenic consensus (ERIC) sequences of bacteria; and close genetic relatedness among virulent but pigment-deficient strains were revealed by clustering analyses of DNA fingerprints from BOX-and ERIC-PCR. PMID:23028972
Safeukui, Innocent; Millet, Pascal; Boucher, Sébastien; Melinard, Laurence; Fregeville, Frédéric; Receveur, Marie-Catherine; Pistone, Thierry; Fialon, Pierre; Vincendeau, Philippe; Fleury, Hervé; Malvy, Denis
2008-01-01
Background A simple real-time PCR assay using one set of primer and probe for rapid, sensitive and quantitative detection of Plasmodium species, with simultaneous differentiation of Plasmodium falciparum from the three other Plasmodium species (Plasmodium vivax, Plasmodium ovale and Plasmodium malariae) in febrile returning travellers and migrants was developed and evaluated. Methods Consensus primers were used to amplify a species-specific region of the multicopy 18S rRNA gene, and fluorescence resonance energy transfer hybridization probes were used for detection in a LightCycler platform (Roche). The anchor probe sequence was designed to be perfect matches to the 18S rRNA gene of the fourth Plasmodium species, while the acceptor probe sequence was designed for P. falciparum over a region containing one mismatched, which allowed differentiation of the three other Plasmodium species. The performance characteristics of the real-time PCR assay were compared with those of conventional PCR and microscopy-based diagnosis from 119 individuals with a suspected clinical diagnostic of imported malaria. Results Blood samples with parasite densities less than 0.01% were all detected, and analytical sensitivity was 0.5 parasite per PCR reaction. The melt curve means Tms (standard deviation) in clinical isolates were 60.5°C (0.6°C) for P. falciparum infection and 64.6°C (1.8°C) for non-P. falciparum species. These Tms values of the P. falciparum or non-P. falciparum species did not vary with the geographic origin of the parasite. The real-time PCR results correlated with conventional PCR using both genus-specific (Kappa coefficient: 0.95, 95% confidence interval: 0.9 – 1) or P. falciparum-specific (0.91, 0.8 – 1) primers, or with the microscopy results (0.70, 0.6 – 0.8). The real-time assay was 100% sensitive and specific for differentiation of P. falciparum to non-P. falciparum species, compared with conventional PCR or microscopy. The real-time PCR assay can also detect individuals with mixed infections (P. falciparum and non-P. falciparum sp.) in the same sample. Conclusion This real-time PCR assay with melting curve analysis is rapid, and specific for the detection and differentiation of P. falciparum to other Plasmodium species. The suitability for routine use of this assay in clinical diagnostic laboratories is discussed. PMID:18442362
Sensitive, microliter PCR with consensus degenerate primers for Epstein Barr virus amplification
Oh, Kyudam; Pak, Nikita; Saunders, D. Curtis; Conrardy, Christina; Landers, James P.; Tong, Suxiang; Forest, Craig R.
2016-01-01
Sensitive identification of the etiology of viral diseases is key to implementing appropriate prevention and treatment. The gold standard for virus identification is the polymerase chain reaction (PCR), a technique that allows for highly specific and sensitive detection of pathogens by exponentially amplifying a specific region of DNA from as little as a single copy through thermocycling a biochemical cocktail. Today, molecular biology laboratories use commercial instruments that operate in 0.5–2 h/analysis using reaction volumes of 5–50 μL contained within polymer tubes or chambers. Towards reducing this volume and maintaining performance, we present a semi-quantitative, systematic experimental study of how PCR yield is affected by tube/chamber substrate, surface-area-to-volume ratio (SA:V), and passivation methods. We perform PCR experiments using traditional PCR tubes as well as using disposable polymer microchips with 1 μL reaction volumes thermocycled using water baths. We report the first oil encapsulation microfluidic PCR method without fluid flow and its application to the first microfluidic amplification of Epstein Barr virus using consensus degenerate primers, a powerful and broad PCR method to screen for both known and novel members of a viral family. The limit of detection is measured as 140 starting copies of DNA from a starting concentration of 3×105 copies/mL, regarded as an accepted sensitivity threshold for diagnostic purposes, and reaction specificity was improved as compared to conventional methods. Also notable, these experiments were conducted with conventional reagent concentrations, rather than commonly spiked enzyme and/or template mixtures. This experimental study of the effects of substrate, SA:V, and passivation, together with sensitive and specific microfluidic PCR with consensus degenerate primers represent advances towards lower cost and higher throughput pathogen screening. PMID:23080522
Efficiency of MY09/11 consensus PCR in the detection of multiple HPV infections.
Şahiner, Fatih; Kubar, Ayhan; Gümral, Ramazan; Ardıç, Medine; Yiğit, Nuri; Şener, Kenan; Dede, Murat; Yapar, Mehmet
2014-09-01
Human papillomavirus (HPV) DNA testing has become an important component of cervical cancer screening programs. In this study, we aimed to evaluate the efficiency of MY09/11 consensus polymerase chain reaction (PCR) for the detection of multiple HPV infections. For this purpose, MY09/11 PCR was compared to an original TaqMan-based type-specific real-time PCR assay, which can detect 20 different HPV types. Of the 654 samples, 34.1% (223/654) were HPV DNA positive according to at least one method. The relative sensitivities of MY09/11 PCR and type-specific PCR were 80.7% (180/223) and 97.8% (218/223), respectively. In all, 352 different HPV isolates (66 low-risk and 286 high-risk or probable high-risk types) were identified in 218 samples, but 5 samples, which were positive by consensus PCR only, could not be genotyped. The distribution of the 286 high-risk or probable high-risk HPVs were as follows: 24.5% HPV-16, 8.4% HPV-52, 7.7% HPV-51, 6.3% HPV-39, 6.3% HPV-82, 5.6% HPV-35, 5.6% HPV-58, 5.6% HPV-66, 5.2% HPV-18, 5.2% HPV-68, and 19.6% the other 8 types. A single HPV type was detected in 57.3% (125/218) of the genotyped samples, and multiple HPV types were found in the remaining 42.7% (93/218). The false-negative rates of MY09/11 PCR were found to be 17.4% in single infections, 23.3% in multiple infections, and 34.6% in multiple infections that contained 3 or more HPV types, with the condition that the low-risk types HPV-6 and HPV-11 be considered as a monotype. These data suggest that broad-range PCR assays may lead to significant data loss and that type-specific PCR assays can provide accurate and reliable results during cervical cancer screening. Copyright © 2014 Elsevier Inc. All rights reserved.
Fernández-Caballero Rico, Jose Ángel; Chueca Porcuna, Natalia; Álvarez Estévez, Marta; Mosquera Gutiérrez, María Del Mar; Marcos Maeso, María Ángeles; García, Federico
2018-02-01
To show how to generate a consensus sequence from the information of massive parallel sequences data obtained from routine HIV anti-retroviral resistance studies, and that may be suitable for molecular epidemiology studies. Paired Sanger (Trugene-Siemens) and next-generation sequencing (NGS) (454 GSJunior-Roche) HIV RT and protease sequences from 62 patients were studied. NGS consensus sequences were generated using Mesquite, using 10%, 15%, and 20% thresholds. Molecular evolutionary genetics analysis (MEGA) was used for phylogenetic studies. At a 10% threshold, NGS-Sanger sequences from 17/62 patients were phylogenetically related, with a median bootstrap-value of 88% (IQR83.5-95.5). Association increased to 36/62 sequences, median bootstrap 94% (IQR85.5-98)], using a 15% threshold. Maximum association was at the 20% threshold, with 61/62 sequences associated, and a median bootstrap value of 99% (IQR98-100). A safe method is presented to generate consensus sequences from HIV-NGS data at 20% threshold, which will prove useful for molecular epidemiological studies. Copyright © 2016 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.
Chuang, Duen-yau; Chien, Yung-chei; Wu, Huang-Pin
2007-01-01
The purpose of this study was to clone the carocin S1 gene and express it in a non-carocin-producing strain of Erwinia carotovora. A mutant, TH22-10, which produced a high-molecular-weight bacteriocin but not a low-molecular-weight bacteriocin, was obtained by Tn5 insertional mutagenesis using H-rif-8-2 (a spontaneous rifampin-resistant mutant of Erwinia carotovora subsp. carotovora 89-H-4). Using thermal asymmetric interlaced PCR, the DNA sequence from the Tn5 insertion site and the DNA sequence of the contiguous 2,280-bp region were determined. Two complete open reading frames (ORF), designated ORF2 and ORF3, were identified within the sequence fragment. ORF2 and ORF3 were identified with the carocin S1 genes, caroS1K (ORF2) and caroS1I (ORF3), which, respectively, encode a killing protein (CaroS1K) and an immunity protein (CaroS1I). These genes were homologous to the pyocin S3 gene and the pyocin AP41 gene. Carocin S1 was expressed in E. carotovora subsp. carotovora Ea1068 and replicated in TH22-10 but could not be expressed in Escherichia coli (JM101) because a consensus sequence resembling an SOS box was absent. A putative sequence similar to the consensus sequence for the E. coli cyclic AMP receptor protein binding site (−312 bp) was found upstream of the start codon. Production of this bacteriocin was also induced by glucose and lactose. The homology search results indicated that the carocin S1 gene (between bp 1078 and bp 1704) was homologous to the pyocin S3 and pyocin AP41 genes in Pseudomonas aeruginosa. These genes encode proteins with nuclease activity (domain 4). This study found that carocin S1 also has nuclease activity. PMID:17071754
p53 Specifically Binds Triplex DNA In Vitro and in Cells
Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, Aneta; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, Martin L.; Subramaniam, Vinod; Bábková, Zuzana; Martínek, Tomáš; Lexa, Matej; Adámik, Matej
2016-01-01
Triplex DNA is implicated in a wide range of biological activities, including regulation of gene expression and genomic instability leading to cancer. The tumor suppressor p53 is a central regulator of cell fate in response to different type of insults. Sequence and structure specific modes of DNA recognition are core attributes of the p53 protein. The focus of this work is the structure-specific binding of p53 to DNA containing triplex-forming sequences in vitro and in cells and the effect on p53-driven transcription. This is the first DNA binding study of full-length p53 and its deletion variants to both intermolecular and intramolecular T.A.T triplexes. We demonstrate that the interaction of p53 with intermolecular T.A.T triplex is comparable to the recognition of CTG-hairpin non-B DNA structure. Using deletion mutants we determined the C-terminal DNA binding domain of p53 to be crucial for triplex recognition. Furthermore, strong p53 recognition of intramolecular T.A.T triplexes (H-DNA), stabilized by negative superhelicity in plasmid DNA, was detected by competition and immunoprecipitation experiments, and visualized by AFM. Moreover, chromatin immunoprecipitation revealed p53 binding T.A.T forming sequence in vivo. Enhanced reporter transactivation by p53 on insertion of triplex forming sequence into plasmid with p53 consensus sequence was observed by luciferase reporter assays. In-silico scan of human regulatory regions for the simultaneous presence of both consensus sequence and T.A.T motifs identified a set of candidate p53 target genes and p53-dependent activation of several of them (ABCG5, ENOX1, INSR, MCC, NFAT5) was confirmed by RT-qPCR. Our results show that T.A.T triplex comprises a new class of p53 binding sites targeted by p53 in a DNA structure-dependent mode in vitro and in cells. The contribution of p53 DNA structure-dependent binding to the regulation of transcription is discussed. PMID:27907175
Watada, Hirotaka; Mirmira, Raghavendra G.; Kalamaras, Julie; German, Michael S.
2000-01-01
The developmentally important homeodomain transcription factors of the NK-2 class contain a highly conserved region, the NK2-specific domain (NK2-SD). The function of this domain, however, remains unknown. The primary structure of the NK2-SD suggests that it might function as an accessory DNA-binding domain or as a protein–protein interaction interface. To assess the possibility that the NK2-SD may contribute to DNA-binding specificity, we used a PCR-based approach to identify a consensus DNA-binding sequences for Nkx2.2, an NK-2 family member involved in pancreas and central nervous system development. The consensus sequence (TCTAAGTGAGCTT) is similar to the known binding sequences for other NK-2 homeodomain proteins, but we show that the NK2-SD does not contribute significantly to specific DNA binding to this sequence. To determine whether the NK2-SD contributes to transactivation, we used GAL4-Nkx2.2 fusion constructs to map a powerful transcriptional activation domain in the C-terminal region beyond the conserved NK2-SD. Interestingly, this C-terminal region functions as a transcriptional activator only in the absence of an intact NK2-SD. The NK2-SD also can mask transactivation from the paired homeodomain transcription factor Pax6, but it has no effect on transcription by itself. These results demonstrate that the NK2-SD functions as an intramolecular regulator of the C-terminal activation domain in Nkx2.2 and support a model in which interactions through the NK2-SD regulate the ability of NK-2-class proteins to activate specific genes during development. PMID:10944215
Chiu, Charles Y
2015-01-01
Viral pathogen discovery is of critical importance to clinical microbiology, infectious diseases, and public health. Genomic approaches for pathogen discovery, including consensus polymerase chain reaction (PCR), microarrays, and unbiased next-generation sequencing (NGS), have the capacity to comprehensively identify novel microbes present in clinical samples. Although numerous challenges remain to be addressed, including the bioinformatics analysis and interpretation of large datasets, these technologies have been successful in rapidly identifying emerging outbreak threats, screening vaccines and other biological products for microbial contamination, and discovering novel viruses associated with both acute and chronic illnesses. Downstream studies such as genome assembly, epidemiologic screening, and a culture system or animal model of infection are necessary to establish an association of a candidate pathogen with disease. PMID:23725672
Molecular diagnosis of group B coltiviruses infections.
Billoir, F; Attoui, H; Simon, S; Gallian, P; de Micco, P; de Lamballerie, X
1999-08-01
The group-B of genus Coltivirus encompasses isolates from humans, ticks or mosquitoes collected in Indonesia and China. Subgroup-B1 includes the strain JKT/dsR-7075 and subgroup-B2 strains JKT/dsR-6423, JKT/dsR-6969, JKT/dsR-7043 and the Banna virus. Data are described for the PCR-based diagnosis of infection by group B coltiviruses. Sets of primers were designed from the sequences of the 7th, 9th and 12th viral segments and RT PCR assays were developed. Consensus primers permitted the detection of all known isolates of subgroup 1 or 2. Viral strains could be characterised further using primers specific for type B2a or B2b, or based on the length of the amplification products. All primers gave negative results when using RNAs from Orbiviruses or Group-A coltiviruses. These primers permitted the detection of Group-B coltiviruses-RNA in infected mouse blood at the acute stage of the disease. Accordingly, they could be used for the diagnosis of infection in humans.
Hedman, Lea; Dhanilall, Pravesh; Kantola, Kalle; Nurmi, Visa; Söderlund-Venermo, Maria; Brown, Kevin E.; Hedman, Klaus
2014-01-01
Parvovirus B19 (B19V) is a member of the family Parvoviridae, genus Erythrovirus. B19V-specific IgG and IgM react differently against conformational and linear epitopes of VP1 and VP2 antigens, leading to the development of IgG avidity and epitope type specificity (ETS) enzyme immunoassays (EIAs) for distinguishing past from recent infection. Additionally, B19V viral load determination (by quantitative PCR [qPCR]) is increasingly used in the staging of B19V infection. In this study, the utility of these methods is compared. A panel of 78 sera was jointly tested by the Virus Reference Department (VRD), London, United Kingdom, and the Haartman Institute (HI), Helsinki, Finland, using a number of EIAs, e.g., B19V-specific IgG and IgM, IgG avidity, and ETS EIAs. At VRD, the sera were also tested by a B19V viral load PCR (qPCR). By consensus analysis, 43 (55.1%) sera represented past infection, 28 (35.9%) sera represented recent infection, and 7 (9.0%) sera were indeterminate. Both VRD B19V qPCR and HI B19V VP2 IgM EIA gave the highest agreement with consensus interpretation for past or recent infection, with an overall agreement of 99% (95% confidence interval [CI], 92 to 100) and positive predictive value (PPV) of 100% (95% CI, 87 to 100). Nine sera designated as representing past infection by consensus analysis were B19V IgM positive by a commercial VRD B19V IgM EIA and B19V IgM negative by a new HI in-house B19V VP2 IgM EIA. A new VRD B19V IgG avidity EIA showed good (>95%) agreement (excluding equivocal results) with consensus interpretations for past or recent infection. Correct discrimination of past from recent B19V infection was achieved through application of qPCR or by appropriate selection of EIAs. PMID:24403307
Chang, F; Syrjänen, S; Shen, Q; Cintorino, M; Santopietro, R; Tosi, P; Syrjänen, K
2000-01-01
Certain viruses, notably human papillomavirus (HPV), cytomegalovirus (CMV), herpes simplex virus (HSV) and Epstein-Barr virus (EBV), are known to produce tumors in animals and cell transformation in vitro and they have been implicated in the pathogenesis of human cancers. All these viruses are also known to infect the esophagus. This study was aimed to determine whether these viruses play any causal role in the etiology of esophageal squamous cell carcinoma. A series of 103 esophageal squamous cell carcinomas derived from patients in the high-incidence area of northern China were analyzed by DNA in situ hybridization and polymerase chain reaction (PCR) for the presence of HPV DNA sequences and, using immunohistochemistry, for the demonstration of CMV, HSV and EBV infections. Six (5.8%) of the 103 tumors were found to contain HPV 16, 18 or 30 DNA sequences. HPV types 6, 11 and 53 were not detected in any of the cases. Amplified HPV DNA sequences were found in 17 out of 101 (16.8%) carcinoma specimens by PCR with L1 consensus primers. None of the 103 carcinomas tested was immunohistochemically positive for CMV, HSV or EBV. Our results confirmed the HPV involvement in esophageal carcinomas and provided further evidence to support a causal association of HPV infection with esophageal squamous cell carcinoma. However, the three herpesviruses, CMV, HSV and EBV, are highly unlikely to be involved in the pathogenesis of this malignancy in the high-incidence area of China.
Tsangaras, Kyriakos; Mayer, Jens; Alquezar-Planas, David E; Greenwood, Alex D
2015-11-24
Transcriptome analysis of polar bear (Ursus maritimus) tissues identified sequences with similarity to Porcine Endogenous Retroviruses (PERV). Based on these sequences, four proviral copies and 15 solo long terminal repeats (LTRs) of a newly described endogenous retrovirus were characterized from the polar bear draft genome sequence. Closely related sequences were identified by PCR analysis of brown bear (Ursus arctos) and black bear (Ursus americanus) but were absent in non-Ursinae bear species. The virus was therefore designated UrsusERV. Two distinct groups of LTRs were observed including a recombinant ERV that contained one LTR belonging to each group indicating that genomic invasions by at least two UrsusERV variants have recently occurred. Age estimates based on proviral LTR divergence and conservation of integration sites among ursids suggest the viral group is only a few million years old. The youngest provirus was polar bear specific, had intact open reading frames (ORFs) and could potentially encode functional proteins. Phylogenetic analyses of UrsusERV consensus protein sequences suggest that it is part of a pig, gibbon and koala retrovirus clade. The young age estimates and lineage specificity of the virus suggests UrsusERV is a recent cross species transmission from an unknown reservoir and places the viral group among the youngest of ERVs identified in mammals.
Tsangaras, Kyriakos; Mayer, Jens; Alquezar-Planas, David E.; Greenwood, Alex D.
2015-01-01
Transcriptome analysis of polar bear (Ursus maritimus) tissues identified sequences with similarity to Porcine Endogenous Retroviruses (PERV). Based on these sequences, four proviral copies and 15 solo long terminal repeats (LTRs) of a newly described endogenous retrovirus were characterized from the polar bear draft genome sequence. Closely related sequences were identified by PCR analysis of brown bear (Ursus arctos) and black bear (Ursus americanus) but were absent in non-Ursinae bear species. The virus was therefore designated UrsusERV. Two distinct groups of LTRs were observed including a recombinant ERV that contained one LTR belonging to each group indicating that genomic invasions by at least two UrsusERV variants have recently occurred. Age estimates based on proviral LTR divergence and conservation of integration sites among ursids suggest the viral group is only a few million years old. The youngest provirus was polar bear specific, had intact open reading frames (ORFs) and could potentially encode functional proteins. Phylogenetic analyses of UrsusERV consensus protein sequences suggest that it is part of a pig, gibbon and koala retrovirus clade. The young age estimates and lineage specificity of the virus suggests UrsusERV is a recent cross species transmission from an unknown reservoir and places the viral group among the youngest of ERVs identified in mammals. PMID:26610552
Sources of PCR-induced distortions in high-throughput sequencing data sets
Kebschull, Justus M.; Zador, Anthony M.
2015-01-01
PCR permits the exponential and sequence-specific amplification of DNA, even from minute starting quantities. PCR is a fundamental step in preparing DNA samples for high-throughput sequencing. However, there are errors associated with PCR-mediated amplification. Here we examine the effects of four important sources of error—bias, stochasticity, template switches and polymerase errors—on sequence representation in low-input next-generation sequencing libraries. We designed a pool of diverse PCR amplicons with a defined structure, and then used Illumina sequencing to search for signatures of each process. We further developed quantitative models for each process, and compared predictions of these models to our experimental data. We find that PCR stochasticity is the major force skewing sequence representation after amplification of a pool of unique DNA amplicons. Polymerase errors become very common in later cycles of PCR but have little impact on the overall sequence distribution as they are confined to small copy numbers. PCR template switches are rare and confined to low copy numbers. Our results provide a theoretical basis for removing distortions from high-throughput sequencing data. In addition, our findings on PCR stochasticity will have particular relevance to quantification of results from single cell sequencing, in which sequences are represented by only one or a few molecules. PMID:26187991
Embedding strategies for effective use of information from multiple sequence alignments.
Henikoff, S.; Henikoff, J. G.
1997-01-01
We describe a new strategy for utilizing multiple sequence alignment information to detect distant relationships in searches of sequence databases. A single sequence representing a protein family is enriched by replacing conserved regions with position-specific scoring matrices (PSSMs) or consensus residues derived from multiple alignments of family members. In comprehensive tests of these and other family representations, PSSM-embedded queries produced the best results overall when used with a special version of the Smith-Waterman searching algorithm. Moreover, embedding consensus residues instead of PSSMs improved performance with readily available single sequence query searching programs, such as BLAST and FASTA. Embedding PSSMs or consensus residues into a representative sequence improves searching performance by extracting multiple alignment information from motif regions while retaining single sequence information where alignment is uncertain. PMID:9070452
De Pittà, Cristiano; Bertolucci, Cristiano; Mazzotta, Gabriella M; Bernante, Filippo; Rizzo, Giorgia; De Nardi, Barbara; Pallavicini, Alberto; Lanfranchi, Gerolamo; Costa, Rodolfo
2008-01-01
Background Little is known about the genome sequences of Euphausiacea (krill) although these crustaceans are abundant components of the pelagic ecosystems in all oceans and used for aquaculture and pharmaceutical industry. This study reports the results of an expressed sequence tag (EST) sequencing project from different tissues of Euphausia superba (the Antarctic krill). Results We have constructed and sequenced five cDNA libraries from different Antarctic krill tissues: head, abdomen, thoracopods and photophores. We have identified 1.770 high-quality ESTs which were assembled into 216 overlapping clusters and 801 singletons resulting in a total of 1.017 non-redundant sequences. Quantitative RT-PCR analysis was performed to quantify and validate the expression levels of ten genes presenting different EST countings in krill tissues. In addition, bioinformatic screening of the non-redundant E. superba sequences identified 69 microsatellite containing ESTs. Clusters, consensuses and related similarity and gene ontology searches were organized in a dedicated E. superba database . Conclusion We defined the first tissue transcriptional signatures of E. superba based on functional categorization among the examined tissues. The analyses of annotated transcripts showed a higher similarity with genes from insects with respect to Malacostraca possibly as an effect of the limited number of Malacostraca sequences in the public databases. Our catalogue provides for the first time a genomic tool to investigate the biology of the Antarctic krill. PMID:18226200
Reid, Marion E; Hue-Roye, Kim; Velliquette, Randall W; Larimore, Kathleen; Moscarelli, Sue; Ohswaldt, Nicolas; Lomas-Francis, Christine
2013-01-01
Antigens in the SC blood group system are expressed by the human erythrocyte membrane-associated protein (ERMAP).Two molecular bases have been reported for the Sc,un phenotype:SC*307del2 and SC*994C>T. We report our investigation of the molecular background of five Sc,n1 individuals from the Pacific Islands and describe the successful transfusion of Sc3+ blood to a patient with anti-Sc3 in her plasma. SC (ERMAP) exons 2,3, and 12 and their flanking intronic regions were analyzed. TheSC*994C>T change introduces a restriction enzyme cleavage site for Tsp45I, and polymerase chain reaction (PCR) products from exon 12 were subjected to this PCR-restriction fragment length polymorphism (RFLP) assay. The five samples had the variant SC*994T/T. One sample, from a first cousin of one Marshallese proband, was heterozygous for SC*1514C/T (in the 3' untranslated region); the other four samples were SC*1514C/C(consensus sequence). Samples from white donors (n = 100) and African American donors (n = 99) were tested using the Tsp45IPCR-RFLP assay; all gave a banding pattern that was consistent with the SC*994C/C consensus sequence. In all five samples,our analyses showed homozygosity for the nonsense nucleotide change SC*994C>Tin an allele carrying the nucleotide associated with SLd. Further investigation determined that one of the probands reported previously with the SC*994C>T change was from the Marshall Islands (which form part of the Micronesian Pacific Islands) and the other was from an unspecified location within the large collection of Pacific Islands. Taken together, the five known probands with the SC*994C>T silencing nucleotide change were from the Pacific Islands.
Multiple splicing defects in an intronic false exon.
Sun, H; Chasin, L A
2000-09-01
Splice site consensus sequences alone are insufficient to dictate the recognition of real constitutive splice sites within the typically large transcripts of higher eukaryotes, and large numbers of pseudoexons flanked by pseudosplice sites with good matches to the consensus sequences can be easily designated. In an attempt to identify elements that prevent pseudoexon splicing, we have systematically altered known splicing signals, as well as immediately adjacent flanking sequences, of an arbitrarily chosen pseudoexon from intron 1 of the human hprt gene. The substitution of a 5' splice site that perfectly matches the 5' consensus combined with mutation to match the CAG/G sequence of the 3' consensus failed to get this model pseudoexon included as the central exon in a dhfr minigene context. Provision of a real 3' splice site and a consensus 5' splice site and removal of an upstream inhibitory sequence were necessary and sufficient to confer splicing on the pseudoexon. This activated context also supported the splicing of a second pseudoexon sequence containing no apparent enhancer. Thus, both the 5' splice site sequence and the polypyrimidine tract of the pseudoexon are defective despite their good agreement with the consensus. On the other hand, the pseudoexon body did not exert a negative influence on splicing. The introduction into the pseudoexon of a sequence selected for binding to ASF/SF2 or its replacement with beta-globin exon 2 only partially reversed the effect of the upstream negative element and the defective polypyrimidine tract. These results support the idea that exon-bridging enhancers are not a prerequisite for constitutive exon definition and suggest that intrinsically defective splice sites and negative elements play important roles in distinguishing the real splicing signal from the vast number of false splicing signals.
Qin, X; Miranda, V S; Machado, M A; Lemos, E G; Hartung, J S
2001-06-01
ABSTRACT Strains of Xylella fastidiosa, isolated from sweet orange trees (Citrus sinensis) and coffee trees (Coffea arabica) with symptoms of citrus variegated chlorosis and Requeima do Café, respectively, were indistinguishable based on repetitive extragenic palindromic polymerase chain reaction (PCR) and enterobacterial repetitive intergenic consensus PCR assays. These strains were also indistinguishable with a previously described PCR assay that distinguished the citrus strains from all other strains of Xylella fastidiosa. Because we were not able to document any genomic diversity in our collection of Xylella fastidiosa strains isolated from diseased citrus, the observed gradient of increasing disease severity from southern to northern regions of São Paulo State is unlikely due to the presence of significantly different strains of the pathogen in the different regions. When comparisons were made to reference strains of Xylella fastidiosa isolated from other hosts using these methods, four groups were consistently identified consistent with the hosts and regions from which the strains originated: citrus and coffee, grapevine and almond, mulberry, and elm, plum, and oak. Independent results from random amplified polymorphic DNA (RAPD) PCR assays were also consistent with these results; however, two of the primers tested in RAPD-PCR were able to distinguish the coffee and citrus strains. Sequence comparisons of a PCR product amplified from all strains of Xylella fastidiosa confirmed the presence of a CfoI polymorphism that can be used to distinguish the citrus strains from all others. The ability to distinguish Xylella fastidiosa strains from citrus and coffee with a PCR-based assay will be useful in epidemiological and etiological studies of this pathogen.
2011-01-01
Background Two clinically relevant high-risk HPV (HR-HPV) types 16 and 18 are etiologically associated with the development of cervical carcinoma and are also reported to be present in many other carcinomas in extra-genital organ sites. Presence of HPV has been reported in breast carcinoma which is the second most common cancer in India and is showing a fast rising trend in urban population. The two early genes E6 and E7 of HPV type 16 have been shown to immortalize breast epithelial cells in vitro, but the role of HPV infection in breast carcinogenesis is highly controversial. Present study has therefore been undertaken to analyze the prevalence of HPV infection in both breast cancer tissues and blood samples from a large number of Indian women with breast cancer from different geographic regions. Methods The presence of all mucosal HPVs and the most common high-risk HPV types 16 and 18 DNA was detected by two different PCR methods - (i) conventional PCR assays using consensus primers (MY09/11, or GP5+/GP6+) or HPV16 E6/E7 primers and (ii) highly sensitive Real-Time PCR. A total of 228 biopsies and corresponding 142 blood samples collected prospectively from 252 patients from four different regions of India with significant socio-cultural, ethnic and demographic variations were tested. Results All biopsies and blood samples of breast cancer patients tested by PCR methods did not show positivity for HPV DNA sequences in conventional PCRs either by MY09/11 or by GP5+/GP6+/HPV16 E6/E7 primers. Further testing of these samples by real time PCR also failed to detect HPV DNA sequences. Conclusions Lack of detection of HPV DNA either in the tumor or in the blood DNA of breast cancer patients by both conventional and real time PCR does not support a role of genital HPV in the pathogenesis of breast cancer in Indian women. PMID:21247504
Coverdill, Christopher C; Barnes, Julie A; Garner, Michael M; Hinton, Kevin L; Childress, April L; Wellehan, James F X
2016-05-01
A novel herpesvirus was detected in a 17-day-old Chilean flamingo (Phoenicopterus chilensis) with pneumonia, hepatopathy, and severe anemia that was housed in California. Postmortem examination identified a pale, enlarged liver, mildly increased fluid in the lungs, and red foci in the spleen. Histologic examination revealed marked hepatic necrosis with syncytia, splenic necrosis, and interstitial pneumonia with eosinophilic intranuclear inclusions within hepatocytes and in unidentified cells of the lung. Transmission electron microscopy identified virions consistent with a herpesvirus in the nucleus and cytoplasm of degenerative hepatocytes. Nested consensus PCR, sequencing, and phylogenetic analysis identified a novel herpesvirus within the genus Iltovirus in the subfamily Alphaherpesvirinae. © 2016 The Author(s).
Zepeda-Mendoza, Marie Lisandra; Bohmann, Kristine; Carmona Baez, Aldo; Gilbert, M Thomas P
2016-05-03
DNA metabarcoding is an approach for identifying multiple taxa in an environmental sample using specific genetic loci and taxa-specific primers. When combined with high-throughput sequencing it enables the taxonomic characterization of large numbers of samples in a relatively time- and cost-efficient manner. One recent laboratory development is the addition of 5'-nucleotide tags to both primers producing double-tagged amplicons and the use of multiple PCR replicates to filter erroneous sequences. However, there is currently no available toolkit for the straightforward analysis of datasets produced in this way. We present DAMe, a toolkit for the processing of datasets generated by double-tagged amplicons from multiple PCR replicates derived from an unlimited number of samples. Specifically, DAMe can be used to (i) sort amplicons by tag combination, (ii) evaluate PCR replicates dissimilarity, and (iii) filter sequences derived from sequencing/PCR errors, chimeras, and contamination. This is attained by calculating the following parameters: (i) sequence content similarity between the PCR replicates from each sample, (ii) reproducibility of each unique sequence across the PCR replicates, and (iii) copy number of the unique sequences in each PCR replicate. We showcase the insights that can be obtained using DAMe prior to taxonomic assignment, by applying it to two real datasets that vary in their complexity regarding number of samples, sequencing libraries, PCR replicates, and used tag combinations. Finally, we use a third mock dataset to demonstrate the impact and importance of filtering the sequences with DAMe. DAMe allows the user-friendly manipulation of amplicons derived from multiple samples with PCR replicates built in a single or multiple sequencing libraries. It allows the user to: (i) collapse amplicons into unique sequences and sort them by tag combination while retaining the sample identifier and copy number information, (ii) identify sequences carrying unused tag combinations, (iii) evaluate the comparability of PCR replicates of the same sample, and (iv) filter tagged amplicons from a number of PCR replicates using parameters of minimum length, copy number, and reproducibility across the PCR replicates. This enables an efficient analysis of complex datasets, and ultimately increases the ease of handling datasets from large-scale studies.
Li, Fan; Ma, Liying; Feng, Yi; Hu, Jing; Ni, Na; Ruan, Yuhua; Shao, Yiming
2017-06-01
HIV-1 transmission in intravenous drug users (IDUs) has been characterized by high genetic multiplicity and suggests a greater challenge for HIV-1 infection blocking. We investigated a total of 749 sequences of full-length gp160 gene obtained by single genome sequencing (SGS) from 22 HIV-1 early infected IDUs in Xinjiang province, northwest China, and generated a transmitted and founder virus (T/F virus) consensus sequence (IDU.CON). The T/F virus was classified as subtype CRF07_BC and predicted to be CCR5-tropic virus. The variable region (V1, V2, and V4 loop) of IDU.CON showed length variation compared with the heterosexual T/F virus consensus sequence (HSX.CON) and homosexual T/F virus consensus sequence (MSM.CON). A total of 26 N-linked glycosylation sites were discovered in the IDU.CON sequence, which is less than that of MSM.CON and HSX.CON. Characterization of T/F virus from IDUs highlights the genetic make-up and complexity of virus near the moment of transmission or in early infection preceding systemic dissemination and is important toward the development of an effective HIV-1 preventive methods, including vaccines.
2012-01-01
Background The consensus profiling method was introduced to overcome the exaggerated stochastic effects associated with low copy number DNA typing. However, little empirical evidence has been provided which shows that a consensus profile, derived from dividing a sample into separate aliquots and including only alleles seen at least twice, gives the most informative profile, compared to a profile obtained by amplifying the entire low template DNA extract in one reaction. Therefore, this study aimed to investigate the quality of consensus profiles compared to profiles obtained using the whole low template extract for amplification. Methods A total of 100 pg and 25 pg DNA samples were amplified with the PowerPlex® ESI 16 Kits using 30 or 34 PCR cycles. A total of 100 pg and 25 pg DNA samples were then divided into three aliquots for a 34-cycle PCR and a consensus profile derived that included alleles that appeared in at least two of the replicates. Profiles from the non-split samples were compared to the consensus profiles focusing on peak heights, allele drop out, locus drop out and allele drop in. Results Performing DNA profiling on non-split extracts produced profiles with a higher percentage of correct loci compared to the consensus profiling technique. Consensus profiling did eliminate any spurious alleles from the final profile. However, there was a notable increase in allele and locus drop out when a LTDNA sample was divided prior to amplification. Conclusions The loss of information that occurs when a sample is split for amplification indicates that consensus profiling may not be producing the most informative DNA profile for samples where the template amount is limited. PMID:22748106
Zhou, Gaofeng; Jian, Jianbo; Wang, Penghao; Li, Chengdao; Tao, Ye; Li, Xuan; Renshaw, Daniel; Clements, Jonathan; Sweetingham, Mark; Yang, Huaan
2018-01-01
An ultra-high density genetic map containing 34,574 sequence-defined markers was developed in Lupinus angustifolius. Markers closely linked to nine genes of agronomic traits were identified. A physical map was improved to cover 560.5 Mb genome sequence. Lupin (Lupinus angustifolius L.) is a recently domesticated legume grain crop. In this study, we applied the restriction-site associated DNA sequencing (RADseq) method to genotype an F 9 recombinant inbred line population derived from a wild type × domesticated cultivar (W × D) cross. A high density linkage map was developed based on the W × D population. By integrating sequence-defined DNA markers reported in previous mapping studies, we established an ultra-high density consensus genetic map, which contains 34,574 markers consisting of 3508 loci covering 2399 cM on 20 linkage groups. The largest gap in the entire consensus map was 4.73 cM. The high density W × D map and the consensus map were used to develop an improved physical map, which covered 560.5 Mb of genome sequence data. The ultra-high density consensus linkage map, the improved physical map and the markers linked to genes of breeding interest reported in this study provide a common tool for genome sequence assembly, structural genomics, comparative genomics, functional genomics, QTL mapping, and molecular plant breeding in lupin.
Bannikova, A A; Bulatova, N Sh; Kramerov, D A
2006-06-01
Genetic exchange among chromosomal races of the common shrew Sorex araneus and the problem of reproductive barriers have been extensively studied by means of such molecular markers as mtDNA, microsatellites, and allozymes. In the present study, the interpopulation and interracial polymorphism in the common shrew was derived, using fingerprints generated by amplified DNA regions flanked by short interspersed repeats (SINEs)-interSINE PCR (IS-PCR). We used primers, complementary to consensus sequences of two short retroposons: mammalian element MIR and the SOR element from the genome of Sorex araneus. Genetic differentiation among eleven populations of the common shrew from eight chromosome races was estimated. The NP and MJ analyses, as well as multidimensional scaling showed that all samples examined grouped into two main clusters, corresponding to European Russia and Siberia. The bootstrap support of the European Russia cluster in the NJ and MP analyses was respectively 76 and 61%. The bootstrap index for the Siberian cluster was 100% in both analyses; the Tomsk race, included into this cluster, was separated with the bootstrap support of NJ/MP 92/95%.
Schiavo, Giuseppina; Hoffmann, Orsolya Ivett; Ribani, Anisa; Utzeri, Valerio Joe; Ghionda, Marco Ciro; Bertolini, Francesca; Geraci, Claudia; Bovo, Samuele; Fontanesi, Luca
2017-10-01
Nuclear DNA sequences of mitochondrial origin (numts) are derived by insertion of mitochondrial DNA (mtDNA), into the nuclear genome. In this study, we provide, for the first time, a genome picture of numts inserted in the pig nuclear genome. The Sus scrofa reference nuclear genome (Sscrofa10.2) was aligned with circularized and consensus mtDNA sequences using LAST software. A total of 430 numt sequences that may represent 246 different numt integration events (57 numt regions determined by at least two numt sequences and 189 singletons) were identified, covering about 0.0078% of the nuclear genome. Numt integration events were correlated (0.99) to the chromosome length. The longest numt sequence (about 11 kbp) was located on SSC2. Six numts were sequenced and PCR amplified in pigs of European commercial and local pig breeds, of the Chinese Meishan breed and in European wild boars. Three of them were polymorphic for the presence or absence of the insertion. Surprisingly, the estimated age of insertion of two of the three polymorphic numts was more ancient than that of the speciation time of the Sus scrofa, supporting that these polymorphic sites were originated from interspecies admixture that contributed to shape the pig genome. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Development of a reference material of a single DNA molecule for the quality control of PCR testing.
Mano, Junichi; Hatano, Shuko; Futo, Satoshi; Yoshii, Junji; Nakae, Hiroki; Naito, Shigehiro; Takabatake, Reona; Kitta, Kazumi
2014-09-02
We developed a reference material of a single DNA molecule with a specific nucleotide sequence. The double-strand linear DNA which has PCR target sequences at the both ends was prepared as a reference DNA molecule, and we named the PCR targets on each side as confirmation sequence and standard sequence. The highly diluted solution of the reference molecule was dispensed into 96 wells of a plastic PCR plate to make the average number of molecules in a well below one. Subsequently, the presence or absence of the reference molecule in each well was checked by real-time PCR targeting for the confirmation sequence. After an enzymatic treatment of the reaction mixture in the positive wells for the digestion of PCR products, the resultant solution was used as the reference material of a single DNA molecule with the standard sequence. PCR analyses revealed that the prepared samples included only one reference molecule with high probability. The single-molecule reference material developed in this study will be useful for the absolute evaluation of a detection limit of PCR-based testing methods, the quality control of PCR analyses, performance evaluations of PCR reagents and instruments, and the preparation of an accurate calibration curve for real-time PCR quantitation.
Forlano, M D; Teixeira, K R S; Scofield, A; Elisei, C; Yotoko, K S C; Fernandes, K R; Linhares, G F C; Ewing, S A; Massard, C L
2007-04-10
To characterize phylogenetically the species which causes canine hepatozoonosis at two rural areas of Rio de Janeiro State, Brazil, we used universal or Hepatozoon spp. primer sets for the 18S SSU rRNA coding region. DNA extracts were obtained from blood samples of thirteen dogs naturally infected, from four experimentally infected, and from five puppies infected by vertical transmission from a dam, that was experimentally infected. DNA of sporozoites of Hepatozoon americanum was used as positive control. The amplification of DNA extracts from blood of dogs infected with sporozoites of Hepatozoon spp. was observed in the presence of primers to 18S SSU rRNA gene of Hepatozoon spp., whereas DNA of H. americanum sporozoites was amplified in the presence of either universal or Hepatozoon spp.-specific primer sets; the amplified products were approximately 600bp in size. Cloned PCR products obtained from DNA extracts of blood from two dogs experimentally infected with Hepatozoon sp. were sequenced. The consensus sequence, derived from six sequence data sets, were blasted against sequences of 18S SSU rRNA of Hepatozoon spp. available at GenBank and aligned to homologous sequences to perform the phylogenetic analysis. This analysis clearly showed that our sequence clustered, independently of H. americanum sequences, within a group comprising other Hepatozoon canis sequences. Our results confirmed the hypothesis that the agent causing hepatozoonosis in the areas studied in Brazil is H. canis, supporting previous reports that were based on morphological and morphometric analyses.
Saingam, Prakit; Li, Bo; Yan, Tao
2018-06-01
DNA-based molecular detection of microbial pathogens in complex environments is still plagued by sensitivity, specificity and robustness issues. We propose to address these issues by viewing them as inadvertent consequences of requiring specific and adequate amplification (SAA) of target DNA molecules by current PCR methods. Using the invA gene of Salmonella as the model system, we investigated if next generation sequencing (NGS) can be used to directly detect target sequences in false-negative PCR reaction (PCR-NGS) in order to remove the SAA requirement from PCR. False-negative PCR and qPCR reactions were first created using serial dilutions of laboratory-prepared Salmonella genomic DNA and then analyzed directly by NGS. Target invA sequences were detected in all false-negative PCR and qPCR reactions, which lowered the method detection limits near the theoretical minimum of single gene copy detection. The capability of the PCR-NGS approach in correcting false negativity was further tested and confirmed under more environmentally relevant conditions using Salmonella-spiked stream water and sediment samples. Finally, the PCR-NGS approach was applied to ten urban stream water samples and detected invA sequences in eight samples that would be otherwise deemed Salmonella negative. Analysis of the non-target sequences in the false-negative reactions helped to identify primer dime-like short sequences as the main cause of the false negativity. Together, the results demonstrated that the PCR-NGS approach can significantly improve method sensitivity, correct false-negative detections, and enable sequence-based analysis for failure diagnostics in complex environmental samples. Copyright © 2018 Elsevier B.V. All rights reserved.
Gut Microbial Diversity in Rat Model Induced by Rhubarb
Peng, Ying; Wu, Chunfu; Yang, Jingyu; Li, Xiaobo
2014-01-01
Rhubarb is often used to establish chronic diarrhea and spleen (Pi)-deficiency syndrome animal models in China. In this study, we utilized the enterobacterial repetitive intergenic consensus-polymerase chain reaction (ERIC-PCR) method to detect changes in bacterial diversity in feces and the bowel mucosa associated with this model. Total microbial genomic DNA from the small bowel (duodenum, jejunum, and ileum), large bowel (proximal colon, distal colon, and rectum), cecum, and feces of normal and rhubarb-exposed rats were used as templates for the ERIC-PCR analysis. We found that the fecal microbial composition did not correspond to the bowel bacteria mix. More bacterial diversity was observed in the ileum of rhubarb-exposed rats (P<0.05). Furthermore, a 380 bp product was found to be increased in rhubarb-exposed rats both in faces and the bowel mucosa. The product was cloned and sequenced and showed high similarity with regions of the Bacteroides genome. AS a result of discriminant analysis with the SPSS software, the Canonical Discriminant Function Formulae for model rats was established. PMID:25048267
Sjö, Nicolai Christian; von Buchwald, Christian; Cassonnet, Patricia; Norrild, Bodil; Prause, Jan Ulrik; Vinding, Troels; Heegaard, Steffen
2007-08-01
To examine conjunctival papilloma and normal conjunctival tissue for the presence of human papillomavirus (HPV). Archival paraffin wax-embedded tissue from 165 conjunctival papillomas and from 20 histological normal conjunctival biopsy specimens was analysed for the presence of HPV by PCR. Specimens considered HPV positive using consensus primers, but with a negative or uncertain PCR result using type-specific HPV probes, were analysed with DNA sequencing. HPV was present in 86 of 106 (81%) beta-globin-positive papillomas. HPV type 6 was positive in 80 cases, HPV type 11 was identified in 5 cases and HPV type 45 was present in a single papilloma. All the 20 normal conjunctival biopsy specimens were beta-globin positive and HPV negative. There is a strong association between HPV and conjunctival papilloma. The study presents the largest material of conjunctival papilloma investigated for HPV and the first investigation of HPV in normal conjunctival tissue. HPV types 6 and 11 are the most common HPV types in conjunctival papilloma. This also is the first report of HPV type 45 in conjunctival papilloma.
p53 inactivation in chewing tobacco-induced oral cancers and leukoplakias from India.
Saranath, D; Tandle, A T; Teni, T R; Dedhia, P M; Borges, A M; Parikh, D; Sanghavi, V; Mehta, A R
1999-05-01
The inactivation of p53 tumour suppressor gene vis-á-vis point mutation, overexpression and degradation due to Human Papilloma virus (HPV) 16/18 infection, was examined in chewing tobacco-associated oral cancers and oral leukoplakias from India. The analysis of mutations was assessed by polymerase chain reaction (PCR) with single strand conformation polymorphism (PCR-SSCP) of exons 5-9 on DNA from 83 oral cancer cases, and the mutations confirmed by direct nucleotide sequencing of the PCR products. p53 protein expression was evaluated by immunohistochemical analysis on paraffin-embedded sections of 62 representative oral cancer biopsies and 22 leukoplakias, using p53-specific monoclonal antibody DO-7. The presence of HPV16/18 was detected in the 83 oral cancer cases by PCR analysis using HPV L1 consensus sequences, followed by Southern hybridization with type-specific oligonucleotide probes. Forty-six per cent (38/83) of oral cancer tumours showed p53 alterations, with 17% (14/83) showing point mutations, 37% (23/62) with overexpression and 25% (21/83) with presence of HPV16 wherein the E6 HPV16 protein degrades p53. HPV18 was not detected in any of the samples. Ninety-two per cent concordance was observed between missense point mutations and overexpression of p53 protein. A significant correlation was not observed between p53 alterations in oral cancer and clinico-pathological profile of the patients. Twenty-seven per cent (6/22) of oral leukoplakias showed p53 overexpression. The overall p53 alterations in oral cancer tissues and oral lesions are comparable to data from the oral cancers reported in the Western countries with smoking and alcohol-associated oral cancers, and suggest a critical role for p53 gene in a significant proportion of oral cancers from India. The overexpression of p53 protein in leukoplakias may serve as a valuable biomarker for identifying individuals at high risk of transformation to malignant phenotype.
Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.
2015-01-01
This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030
A novel functional class 2 integron in clinical Proteus mirabilis isolates.
Wei, Quhao; Hu, Qingfeng; Li, Shanshan; Lu, Huoyang; Chen, Guoqiang; Shen, Beiqiong; Zhang, Ping; Zhou, Yonglie
2014-04-01
To describe a novel functional class 2 integron that was found in clinical Proteus mirabilis isolates. Class 1 and 2 integrons were screened by PCR in 153 clinical Proteus isolates. The variable regions of class 1 and 2 integrons were determined by restriction analysis and sequencing. The mutations of internal stop codons in class 2 integrons and their common promoters were also determined by sequencing. Enterobacterial repetitive intergenic consensus (ERIC)-PCR was used to analyse the phylogenetic relations of class 2 integron-positive P. mirabilis isolates. Class 1 integrons were detected in 96 (63%) of 153 Proteus isolates: eight different gene cassette arrays were detected, including dfrA32-ereA1-aadA2, which was detected for the first time in P. mirabilis. Class 2 integrons were detected in 101 (66%) of 153 Proteus isolates: four different gene cassette arrays were detected, including dfrA1-catB2-sat2-aadA1, which was detected for the first time in a class 2 integron. A novel functional class 2 integron was detected in 38 P. mirabilis isolates with a common promoter (-35 TTTAAT|16 bp|-10 TAAAGT). The variable region of this functional class 2 integron contained dfrA14 and three novel open reading frames with unknown functions. Very similar ERIC-PCR fingerprinting patterns were detected in these 38 P. mirabilis isolates and were different from other class 2 integron-positive isolates. A novel functional class 2 integron was found for the first time in P. mirabilis. These functional class 2 integron-harbouring P. mirabilis isolates were likely to be clonally spread in our hospital.
Manin, Benny O.; Daim, Sylvia; Vythilingam, Indra; Drakeley, Chris
2017-01-01
Background Anopheles balabacensis of the Leucospyrus group has been confirmed as the primary knowlesi malaria vector in Sabah, Malaysian Borneo for some time now. Presently, knowlesi malaria is the only zoonotic simian malaria in Malaysia with a high prevalence recorded in the states of Sabah and Sarawak. Methodology/Principal findings Anopheles spp. were sampled using human landing catch (HLC) method at Paradason village in Kudat district of Sabah. The collected Anopheles were identified morphologically and then subjected to total DNA extraction and polymerase chain reaction (PCR) to detect Plasmodium parasites in the mosquitoes. Identification of Plasmodium spp. was confirmed by sequencing the SSU rRNA gene with species specific primers. MEGA4 software was then used to analyse the SSU rRNA sequences and bulid the phylogenetic tree for inferring the relationship between simian malaria parasites in Sabah. PCR results showed that only 1.61% (23/1,425) of the screened An. balabacensis were infected with one or two of the five simian Plasmodium spp. found in Sabah, viz. Plasmodium coatneyi, P. inui, P. fieldi, P. cynomolgi and P. knowlesi. Sequence analysis of SSU rRNA of Plasmodium isolates showed high percentage of identity within the same Plasmodium sp. group. The phylogenetic tree based on the consensus sequences of P. knowlesi showed 99.7%–100.0% nucleotide identity among the isolates from An. balabacensis, human patients and a long-tailed macaque from the same locality. Conclusions/Significance This is the first study showing high molecular identity between the P. knowlesi isolates from An. balabacensis, human patients and a long-tailed macaque in Sabah. The other common simian Plasmodium spp. found in long-tailed macaques and also detected in An. balabacensis were P. coatneyi, P. inui, P. fieldi and P. cynomolgi. The high percentage identity of nucleotide sequences between the P. knowlesi isolates from the long-tailed macaque, An. balabacensis and human patients suggests a close genetic relationship between the parasites from these hosts. PMID:28968395
Holcomb, C L; Rastrou, M; Williams, T C; Goodridge, D; Lazaro, A M; Tilanus, M; Erlich, H A
2014-01-01
The high-resolution human leukocyte antigen (HLA) genotyping assay that we developed using 454 sequencing and Conexio software uses generic polymerase chain reaction (PCR) primers for DRB exon 2. Occasionally, we observed low abundance DRB amplicon sequences that resulted from in vitro PCR 'crossing over' between DRB1 and DRB3/4/5. These hybrid sequences, revealed by the clonal sequencing property of the 454 system, were generally observed at a read depth of 5%-10% of the true alleles. They usually contained at least one mismatch with the IMGT/HLA database, and consequently, were easily recognizable and did not cause a problem for HLA genotyping. Sometimes, however, these artifactual sequences matched a rare allele and the automatic genotype assignment was incorrect. These observations raised two issues: (1) could PCR conditions be modified to reduce such artifacts? and (2) could some of the rare alleles listed in the IMGT/HLA database be artifacts rather than true alleles? Because PCR crossing over occurs during late cycles of PCR, we compared DRB genotypes resulting from 28 and (our standard) 35 cycles of PCR. For all 21 cell line DNAs amplified for 35 cycles, crossover products were detected. In 33% of the cases, these hybrid sequences corresponded to named alleles. With amplification for only 28 cycles, these artifactual sequences were not detectable. To investigate whether some rare alleles in the IMGT/HLA database might be due to PCR artifacts, we analyzed four samples obtained from the investigators who submitted the sequences. In three cases, the sequences were generated from true alleles. In one case, our 454 sequencing revealed an error in the previously submitted sequence. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Takahashi, Mayumi; Wu, Xiwei; Ho, Michelle; Chomchan, Pritsana; Rossi, John J; Burnett, John C; Zhou, Jiehua
2016-09-22
The systemic evolution of ligands by exponential enrichment (SELEX) technique is a powerful and effective aptamer-selection procedure. However, modifications to the process can dramatically improve selection efficiency and aptamer performance. For example, droplet digital PCR (ddPCR) has been recently incorporated into SELEX selection protocols to putatively reduce the propagation of byproducts and avoid selection bias that result from differences in PCR efficiency of sequences within the random library. However, a detailed, parallel comparison of the efficacy of conventional solution PCR versus the ddPCR modification in the RNA aptamer-selection process is needed to understand effects on overall SELEX performance. In the present study, we took advantage of powerful high throughput sequencing technology and bioinformatics analysis coupled with SELEX (HT-SELEX) to thoroughly investigate the effects of initial library and PCR methods in the RNA aptamer identification. Our analysis revealed that distinct "biased sequences" and nucleotide composition existed in the initial, unselected libraries purchased from two different manufacturers and that the fate of the "biased sequences" was target-dependent during selection. Our comparison of solution PCR- and ddPCR-driven HT-SELEX demonstrated that PCR method affected not only the nucleotide composition of the enriched sequences, but also the overall SELEX efficiency and aptamer efficacy.
Chemidlin Prévost-Bouré, Nicolas; Christen, Richard; Dequiedt, Samuel; Mougel, Christophe; Lelièvre, Mélanie; Jolivet, Claudy; Shahbazkia, Hamid Reza; Guillou, Laure; Arrouays, Dominique; Ranjard, Lionel
2011-01-01
Fungi constitute an important group in soil biological diversity and functioning. However, characterization and knowledge of fungal communities is hampered because few primer sets are available to quantify fungal abundance by real-time quantitative PCR (real-time Q-PCR). The aim in this study was to quantify fungal abundance in soils by incorporating, into a real-time Q-PCR using the SYBRGreen® method, a primer set already used to study the genetic structure of soil fungal communities. To satisfy the real-time Q-PCR requirements to enhance the accuracy and reproducibility of the detection technique, this study focused on the 18S rRNA gene conserved regions. These regions are little affected by length polymorphism and may provide sufficiently small targets, a crucial criterion for enhancing accuracy and reproducibility of the detection technique. An in silico analysis of 33 primer sets targeting the 18S rRNA gene was performed to select the primer set with the best potential for real-time Q-PCR: short amplicon length; good fungal specificity and coverage. The best consensus between specificity, coverage and amplicon length among the 33 sets tested was the primer set FR1 / FF390. This in silico analysis of the specificity of FR1 / FF390 also provided additional information to the previously published analysis on this primer set. The specificity of the primer set FR1 / FF390 for Fungi was validated in vitro by cloning - sequencing the amplicons obtained from a real time Q-PCR assay performed on five independent soil samples. This assay was also used to evaluate the sensitivity and reproducibility of the method. Finally, fungal abundance in samples from 24 soils with contrasting physico-chemical and environmental characteristics was examined and ranked to determine the importance of soil texture, organic carbon content, C∶N ratio and land use in determining fungal abundance in soils. PMID:21931659
Life Cycle Evolution and Systematics of Campanulariid Hydrozoans
2004-09-01
kit according to manufacturer’s protocol. Purified PCR product was cycle-sequenced using either Big Dye 2 or 3 sequencing chemistry (ABI), following...ethidium bromide and purified with PCR purification kits (Qiagen). Purified products were cycle- sequenced with either Big Dye 2 or 3 sequencing chemistry...PCR purification kit (Qiagen). The purified product was cycle-sequenced using Big Dye 2 sequencing chemistry (ABI) following the manufacturer’s
Fujibuchi, Wataru; Anderson, John S. J.; Landsman, David
2001-01-01
Consensus pattern and matrix-based searches designed to predict cis-acting transcriptional regulatory sequences have historically been subject to large numbers of false positives. We sought to decrease false positives by incorporating expression profile data into a consensus pattern-based search method. We have systematically analyzed the expression phenotypes of over 6000 yeast genes, across 121 expression profile experiments, and correlated them with the distribution of 14 known regulatory elements over sequences upstream of the genes. Our method is based on a metric we term probabilistic element assessment (PEA), which is a ranking of potential sites based on sequence similarity in the upstream regions of genes with similar expression phenotypes. For eight of the 14 known elements that we examined, our method had a much higher selectivity than a naïve consensus pattern search. Based on our analysis, we have developed a web-based tool called PROSPECT, which allows consensus pattern-based searching of gene clusters obtained from microarray data. PMID:11574681
Agarwal, Meetu; Bhowmick, Krishanu; Shah, Kushal; Krishnamachari, Annangarachari; Dhar, Suman Kumar
2017-08-01
DNA replication is a fundamental process in genome maintenance, and initiates from several genomic sites (origins) in eukaryotes. In Saccharomyces cerevisiae, conserved sequences known as autonomously replicating sequences (ARSs) provide a landing pad for the origin recognition complex (ORC), leading to replication initiation. Although origins from higher eukaryotes share some common sequence features, the definitive genomic organization of these sites remains elusive. The human malaria parasite Plasmodium falciparum undergoes multiple rounds of DNA replication; therefore, control of initiation events is crucial to ensure proper replication. However, the sites of DNA replication initiation and the mechanism by which replication is initiated are poorly understood. Here, we have identified and characterized putative origins in P. falciparum by bioinformatics analyses and experimental approaches. An autocorrelation measure method was initially used to search for regions with marked fluctuation (dips) in the chromosome, which we hypothesized might contain potential origins. Indeed, S. cerevisiae ARS consensus sequences were found in dip regions. Several of these P. falciparum sequences were validated with chromatin immunoprecipitation-quantitative PCR, nascent strand abundance and a plasmid stability assay. Subsequently, the same sequences were used in yeast to confirm their potential as origins in vivo. Our results identify the presence of functional ARSs in P. falciparum and provide meaningful insights into replication origins in these deadly parasites. These data could be useful in designing transgenic vectors with improved stability for transfection in P. falciparum. © 2017 Federation of European Biochemical Societies.
Hartoyo, Edi; Wiyatno, Ageng; Jaya, Ungke Anton; Ma'roef, Chairin Nisa; Monagin, Corina; Myint, Khin Saw; Safari, Dodi
2017-01-01
An outbreak of measles symptoms occurring in children in Banjarmasin, South Kalimantan, Indonesia in 2014 was investigated. Nasal swabs were collected from 23 children (median age 41 months) with fever and other symptoms of measles hospitalized in Ulin General Hospital and Islamic Hospital, Banjarmasin, South Kalimantan. Viral RNA was extracted for cDNA synthesis, followed by PCR and sequencing using paramyxovirus family consensus and N-gene primers. Sixteen measles-positive patients (70%) were identified. Fifteen virus strains belonged to genotype D8 and the remaining one strain was confirmed as belonging to genotype D9. Measles virus genotype D8 was detected in an outbreak of measles in South Kalimantan, Indonesia, in 2014. Copyright © 2016 The Author(s). Published by Elsevier Ltd.. All rights reserved.
PCR Amplification Strategies towards full-length HIV-1 Genome sequencing.
Liu, Chao Chun; Ji, Hezhao
2018-06-26
The advent of next generation sequencing has enabled greater resolution of viral diversity and improved feasibility of full viral genome sequencing allowing routine HIV-1 full genome sequencing in both research and diagnostic settings. Regardless of the sequencing platform selected, successful PCR amplification of the HIV-1 genome is essential for sequencing template preparation. As such, full HIV-1 genome amplification is a crucial step in dictating the successful and reliable sequencing downstream. Here we reviewed existing PCR protocols leading to HIV-1 full genome sequencing. In addition to the discussion on basic considerations on relevant PCR design, the advantages as well as the pitfalls of published protocols were reviewed. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Roberts, C H; Turino, C; Madrigal, J A; Marsh, S G E
2007-06-01
DNA enrichment by allele-specific hybridization (DEASH) was used as a means to isolate individual alleles of the killer cell immunoglobulin-like receptor (KIR2DL4) gene from heterozygous genomic DNA. Using long-template polymerase chain reaction (LT-PCR), the complete KIR2DL4 gene was amplified from a cell line that had previously been characterized for its KIR gene content by PCR using sequence-specific primers (PCR-SSP). The whole gene amplicons were sequenced and we identified two heterozygous positions in accordance with the predictions of the PCR-SSP. The amplicons were then hybridized to allele-specific, biotinylated oligonucleotide probes and through binding to streptavidin-coated beads, the targeted alleles were enriched. A second PCR amplified only the exonic regions of the enriched allele, and these were then sequenced in full. We show DEASH to be capable of enriching single alleles from a heterozygous PCR product, and through sequencing the enriched DNA, we are able to produce complete coding sequences of the KIR2DL4 alleles in accordance with the typing predicted by PCR-SSP.
Chutiwitoonchai, Nopporn; Kakisaka, Michinori; Yamada, Kazunori; Aida, Yoko
2014-01-01
The assembly of influenza virus progeny virions requires machinery that exports viral genomic ribonucleoproteins from the cell nucleus. Currently, seven nuclear export signal (NES) consensus sequences have been identified in different viral proteins, including NS1, NS2, M1, and NP. The present study examined the roles of viral NES consensus sequences and their significance in terms of viral replication and nuclear export. Mutation of the NP-NES3 consensus sequence resulted in a failure to rescue viruses using a reverse genetics approach, whereas mutation of the NS2-NES1 and NS2-NES2 sequences led to a strong reduction in viral replication kinetics compared with the wild-type sequence. While the viral replication kinetics for other NES mutant viruses were also lower than those of the wild-type, the difference was not so marked. Immunofluorescence analysis after transient expression of NP-NES3, NS2-NES1, or NS2-NES2 proteins in host cells showed that they accumulated in the cell nucleus. These results suggest that the NP-NES3 consensus sequence is mostly required for viral replication. Therefore, each of the hydrophobic (Φ) residues within this NES consensus sequence (Φ1, Φ2, Φ3, or Φ4) was mutated, and its viral replication and nuclear export function were analyzed. No viruses harboring NP-NES3 Φ2 or Φ3 mutants could be rescued. Consistent with this, the NP-NES3 Φ2 and Φ3 mutants showed reduced binding affinity with CRM1 in a pull-down assay, and both accumulated in the cell nucleus. Indeed, a nuclear export assay revealed that these mutant proteins showed lower nuclear export activity than the wild-type protein. Moreover, the Φ2 and Φ3 residues (along with other Φ residues) within the NP-NES3 consensus were highly conserved among different influenza A viruses, including human, avian, and swine. Taken together, these results suggest that the Φ2 and Φ3 residues within the NP-NES3 protein are important for its nuclear export function during viral replication.
Palzkill, T G; Oliver, S G; Newlon, C S
1986-01-01
Four fragments of Saccharomyces cerevisiae chromosome III DNA which carry ARS elements have been sequenced. Each fragment contains multiple copies of sequences that have at least 10 out of 11 bases of homology to a previously reported 11 bp core consensus sequence. A survey of these new ARS sequences and previously reported sequences revealed the presence of an additional 11 bp conserved element located on the 3' side of the T-rich strand of the core consensus. Subcloning analysis as well as deletion and transposon insertion mutagenesis of ARS fragments support a role for 3' conserved sequence in promoting ARS activity. PMID:3529036
Moreira, Otacilio C; Yadon, Zaida E; Cupolillo, Elisa
2017-09-29
Cutaneous leishmaniasis (CL) is spread worldwide and is the most common manifestation of leishmaniasis. Diagnosis is performed by combining clinical and epidemiological features, and through the detection of Leishmania parasites (or DNA) in tissue specimens or trough parasite isolation in culture medium. Diagnosis of CL is challenging, reflecting the pleomorphic clinical manifestations of this disease. Skin lesions vary in severity, clinical appearance, and duration, and in some cases, they can be indistinguishable from lesions related to other diseases. Over the past few decades, PCR-based methods, including real-time PCR assays, have been developed for Leishmania detection, quantification and species identification, improving the molecular diagnosis of CL. This review provides an overview of many real-time PCR methods reported for the diagnostic evaluation of CL and some recommendations for the application of these methods for quantification purposes for clinical management and epidemiological studies. Furthermore, the use of real-time PCR for Leishmania species identification is also presented. The advantages of real-time PCR protocols are numerous, including increased sensitivity and specificity and simpler standardization of diagnostic procedures. However, despite the numerous assays described, there is still no consensus regarding the methods employed. Furthermore, the analytical and clinical validation of CL molecular diagnosis has not followed international guidelines so far. A consensus methodology comprising a DNA extraction protocol with an exogenous quality control and an internal reference to normalize parasite load is still needed. In addition, the analytical and clinical performance of any consensus methodology must be accurately assessed. This review shows that a standardization initiative is essential to guide researchers and clinical laboratories towards the achievement of a robust and reproducible methodology, which will permit further evaluation of parasite load as a surrogate marker of prognosis and monitoring of aetiological treatment, particularly in multi-centric observational studies and clinical trials. Copyright © 2017 Elsevier B.V. All rights reserved.
The Functional Human C-Terminome
Hedden, Michael; Lyon, Kenneth F.; Brooks, Steven B.; David, Roxanne P.; Limtong, Justin; Newsome, Jacklyn M.; Novakovic, Nemanja; Rajasekaran, Sanguthevar; Thapar, Vishal; Williams, Sean R.; Schiller, Martin R.
2016-01-01
All translated proteins end with a carboxylic acid commonly called the C-terminus. Many short functional sequences (minimotifs) are located on or immediately proximal to the C-terminus. However, information about the function of protein C-termini has not been consolidated into a single source. Here, we built a new “C-terminome” database and web system focused on human proteins. Approximately 3,600 C-termini in the human proteome have a minimotif with an established molecular function. To help evaluate the function of the remaining C-termini in the human proteome, we inferred minimotifs identified by experimentation in rodent cells, predicted minimotifs based upon consensus sequence matches, and predicted novel highly repetitive sequences in C-termini. Predictions can be ranked by enrichment scores or Gene Evolutionary Rate Profiling (GERP) scores, a measurement of evolutionary constraint. By searching for new anchored sequences on the last 10 amino acids of proteins in the human proteome with lengths between 3–10 residues and up to 5 degenerate positions in the consensus sequences, we have identified new consensus sequences that predict instances in the majority of human genes. All of this information is consolidated into a database that can be accessed through a C-terminome web system with search and browse functions for minimotifs and human proteins. A known consensus sequence-based predicted function is assigned to nearly half the proteins in the human proteome. Weblink: http://cterminome.bio-toolkit.com. PMID:27050421
Fingerprinting and quantification of GMOs in the agro-food sector.
Taverniers, I; Van Bockstaele, E; De Loose, M
2003-01-01
Most strategies for analyzing GMOs in plants and derived food and feed products, are based on the polymerase chain reaction (PCR) technique. In conventional PCR methods, a 'known' sequence between two specific primers is amplified. To the contrary, with the 'anchor PCR' technique, unknown sequences adjacent to a known sequence, can be amplified. Because T-DNA/plant border sequences are being amplified, anchor PCR is the perfect tool for unique identification of transgenes, including non-authorized GMOs. In this work, anchor PCR was applied to characterize the 'transgene locus' and to clarify the complete molecular structure of at least six different commercial transgenic plants. Based on sequences of T-DNA/plant border junctions, obtained by anchor PCR, event specific primers were developed. The junction fragments, together with endogeneous reference gene targets, were cloned in plasmids. The latter were then used as event specific calibrators in real-time PCR, a new technique for the accurate relative quantification of GMOs. We demonstrate here the importance of anchor PCR for identification and the usefulness of plasmid DNA calibrators in quantification strategies for GMOs, throughout the agro-food sector.
Vuran, Emre; Karaarslan, Aydın; Karasartova, Djursun; Turegun, Buse; Sahin, Fikret
2014-02-01
Despite the fact that a range of molecular methods have been developed as tools for the diagnosis of Malassezia species, there are several drawbacks associated with them, such as inefficiency of differentiating all the species, high cost, and questionable reproducibility. In addition, most of the molecular methods require cultivation to enhance sensitivity. Therefore, alternative methods eliminating cultivation and capable of identifying species with high accuracy and reliability are needed. Herein, a multiplex polymerase chain reaction (PCR)-based method was especially developed for the detection of eleven Malassezia species. The multiplex PCR was standardized by incorporating a consensus forward primer, along with Malassezia species-specific reverse primers considering the sizes of the PCR products. In the method, the multiplex-PCR primer content is divided into three parts to circumvent the problem of increased nonspecific background resulting from the use of a large number of primers. DNA extraction protocol described by Harju and colleagues was modified using liquid nitrogen instead of -80 °C to break down the yeast membrane. By a modified extraction procedure followed by multiplex PCR and electrophoresis, the method enables identification and differentiation of Malassezia species from both of the samples obtained directly from skin and yeast colonies grown in culture. Fifty-five patients who were confirmed with pityriasis versicolor were enrolled in the study. Multiplex PCR detected and differentiated all 55 samples obtained directly from the patients' skin. However, 50 out of 55 samples yielded Malassezia colony in the culture. In addition, eight of 50 colonies were misdiagnosed or not completely differentiated by conventional methods based on the sequence analysis of eight colonies. The method is capable of identifying species with high accuracy and reliability. In addition, it is simple, quick, and cost-effective. More importantly, the method works efficiently for the diagnosis of Malassezia species obtained directly from patient samples.
2011-01-01
Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR) for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs). These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures. PMID:22093809
Karimi, S; Izadi, H; Askari Seyahooei, M; Bagheri, A; Khodaygan, P
2018-04-01
The date palm hopper, Ommatissus lybicus, is a key pest of the date palm, which is expected to be comprised of many allopatric populations. The current study was carried out to determine bacterial endosymbiont diversity in the different populations of this pest. Ten date palm hopper populations were collected from the main date palm growing regions in Iran and an additional four samples from Pakistan, Oman, Egypt and Tunisia for detection of primary and secondary endosymbionts using polymerase chain reaction (PCR) assay with their specific primers. The PCR products were directly sequenced and edited using SeqMan software. The consensus sequences were subjected to a BLAST similarity search. The results revealed the presence of 'Candidatus Sulcia muelleri' (primary endosymbiont) and Wolbachia, Arsenophonus and Enterobacter (secondary endosymbionts) in all populations. This assay failed to detect 'Candidatus Nasuia deltocephalinicola' and Serratia in these populations. 'Ca. S. muelleri' exhibited a 100% infection frequency in populations and Wolbachia, Arsenophonus and Enterobacter demonstrated 100, 93.04 and 97.39% infection frequencies, respectively. The infection rate of Arsenophonus and Enterobacter ranged from 75 to 100% and 62.5 to 100%, respectively, in different populations of the insect. The results demonstrated multiple infections by 'Ca. Sulcia muelleri', Wolbachia, Arsenophonus and Enterobacter in the populations and may suggest significant roles for these endosymbionts on date palm hopper population fitness. This study provides an insight to endosymbiont variation in the date palm hopper populations; however, further investigation is needed to examine how these endosymbionts may affect host fitness.
Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum
DOE Office of Scientific and Technical Information (OSTI.GOV)
C.A.Reddy, PI
2005-06-30
G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all themore » three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in other basidiomycete laccases are conserved in the LAC1 protein of G.lucidum. Eight putative N-glycosylation sites as well as consensus eukaryotic promoter sequence and polyadenylation signal sequences are also found. Coding sequence of lac4 is interrupted by 7 introns, encodes a mature protein of 525aa (Mr: 57,750), and has 98% nt homology to lac1, but was otherwise identical. Molecular masses of GLAC1 and GLAC4 were 49.8 kDa (462aa) and 52.5 kDa (524aa) in comparison to T. versicolr laccase which was 56.3 kDa (524aa). Predicted PI values of GLAC1, GLAC4 and T. versicolor laccase are, respectively 4.5, 4.7, and 4.2. Eight other laccase clones, distinct from lac1 and lac4 have recently been isolated from G. lucidum Our results show the existence of a laccase multi-gene family in G. lucidum in agreement with our earlier results showing multiple isoforms of laccase in this organism.« less
Isolation and characterization of target sequences of the chicken CdxA homeobox gene.
Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A
1993-01-01
The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943
[Assessment of HPV detection assays for use in cervical cancer screening programs].
Cañadas, M Paz; Lloveras, Belén; Lorincz, Attila; Ejarque, Maijo; Font, Rebeca; Bosch, F Xavier; de Sanjosé, Silvia
2006-01-01
Detection of high-risk human papillomavirus types (HPV) infection is an important tool in the screening of cervical cancer and triage of cytological abnormalities. The different techniques for detection of this cancer need to be contrasted and validated for use in population screening. Cervical cell samples were collected from 166 women attending a dermatology clinic in Oviedo (Spain). We evaluated the performance of three different assays for VPH detection. The methods utilized were 1) In-house PCR-EIA using LI consensus primers MY09/ MY11, 2) A PCR-reverse line blot hybridization (PCR-LBH) that uses LI consensus PGMY primers. 3) Hybrid Capture 2. All assays were performed blinded. The kappa statistic was used to test for global agreement between assay pairs. HPV DNA was detected in 24,7%, 25,3% and 29,5% of the women, respective to the assay. The overall agreement between the in-house PCR, PCR-LBH and HC2 was (73.5%) with all kappa values between assay pairs exceeding 0.56 (p<0.001). The three HPV assays were equally accurate in estimating high-risk HPV prevalence and HPV-related lesions. The method for HPV detection must be decided depending on the goals of the search (screening, follow-up or molecular studies).
Janardhanan, Jeshina; Prakash, John Antony Jude; Abraham, Ooriapadickal C; Varghese, George M
2014-05-01
A nested polymerase chain reaction (PCR) targeting the 56-kDa antigen gene is currently the most commonly used molecular technique for confirmation of scrub typhus and genotyping of Orientia tsutsugamushi. In this study, we have compared the commonly used nested PCR (N-PCR) with a single-step conventional PCR (C-PCR) for amplification and genotyping. Eschar samples collected from 24 patients with scrub typhus confirmed by IgM enzyme-linked immunosorbent assay were used for DNA extraction following which amplifications were carried out using nested and C-PCR methods. The amplicons were sequenced and compared to other sequences in the database using BLAST. Conventional PCR showed a high positivity rate of 95.8% compared to the 75% observed using N-PCR. On sequence analysis, the N-PCR amplified region showed more variation among strains than the C-PCR amplified region. The C-PCR, which is more economical, provided faster and better results compared to N-PCR. Copyright © 2014 Elsevier Inc. All rights reserved.
Paydar, Mohammadjavad; Thong, Kwai Lin
2013-10-01
Vibrio vulnificus is a highly invasive human pathogen that exists naturally in estuarine environment and coastal waters. In this study, we used different PCR assays to detect V. vulnificus in 260 seafood and 80 seawater samples. V. vulnificus was present in about 34 (13%) of the 260 seafood samples and 18 (23%) of the 80 seawater samples. Repetitive extragenic palindromic PCR (REP-PCR) and enterobacterial repetitive intergenic consensus PCR (ERIC-PCR) were applied to subtype the V. vulnificus isolates. Twenty-five REP profiles and 45 ERIC profiles were observed, and the isolates were categorized into 9 and 10 distinct clusters at the similarity of 80%, by REP-PCR and ERIC-PCR, respectively. ERIC-PCR is more discriminative than REP-PCR in subtyping V. vulnificus, demonstrating high genetic diversity among the isolates.
Kalendar, Ruslan; Tselykh, Timofey V; Khassenov, Bekbolat; Ramanculov, Erlan M
2017-01-01
This chapter introduces the FastPCR software as an integrated tool environment for PCR primer and probe design, which predicts properties of oligonucleotides based on experimental studies of the PCR efficiency. The software provides comprehensive facilities for designing primers for most PCR applications and their combinations. These include the standard PCR as well as the multiplex, long-distance, inverse, real-time, group-specific, unique, overlap extension PCR for multi-fragments assembling cloning and loop-mediated isothermal amplification (LAMP). It also contains a built-in program to design oligonucleotide sets both for long sequence assembly by ligase chain reaction and for design of amplicons that tile across a region(s) of interest. The software calculates the melting temperature for the standard and degenerate oligonucleotides including locked nucleic acid (LNA) and other modifications. It also provides analyses for a set of primers with the prediction of oligonucleotide properties, dimer and G/C-quadruplex detection, linguistic complexity as well as a primer dilution and resuspension calculator. The program consists of various bioinformatical tools for analysis of sequences with the GC or AT skew, CG% and GA% content, and the purine-pyrimidine skew. It also analyzes the linguistic sequence complexity and performs generation of random DNA sequence as well as restriction endonucleases analysis. The program allows to find or create restriction enzyme recognition sites for coding sequences and supports the clustering of sequences. It performs efficient and complete detection of various repeat types with visual display. The FastPCR software allows the sequence file batch processing that is essential for automation. The program is available for download at http://primerdigital.com/fastpcr.html , and its online version is located at http://primerdigital.com/tools/pcr.html .
Daniel, Hubert D-J; David, Joel; Raghuraman, Sukanya; Gnanamony, Manu; Chandy, George M; Sridharan, Gopalan; Abraham, Priya
2017-05-01
Based on genetic heterogeneity, hepatitis C virus (HCV) is classified into seven major genotypes and 64 subtypes. In spite of the sequence heterogeneity, all genotypes share an identical complement of colinear genes within the large open reading frame. The genetic interrelationships between these genes are consistent among genotypes. Due to this property, complete sequencing of the HCV genome is not required. HCV genotypes along with subtypes are critical for planning antiviral therapy. Certain genotypes are also associated with higher progression to liver cirrhosis. In this study, 100 blood samples were collected from individuals who came for routine HCV genotype identification. These samples were used for the comparison of two different genotyping methods (5'NCR PCR-RFLP and HCV core type-specific PCR) with NS5b sequencing. Of the 100 samples genotyped using 5'NCR PCR-RFLP and HCV core type-specific PCR, 90% (κ = 0.913, P < 0.00) and 96% (κ = 0.794, P < 0.00) correlated with NS5b sequencing, respectively. Sixty percent and 75% of discordant samples by 5'NCR PCR-RFLP and HCV core type-specific PCR, respectively, belonged to genotype 6. All the HCV genotype 1 subtypes were classified accurately by both the methods. This study shows that the 5'NCR-based PCR-RFLP and the HCV core type-specific PCR-based assays correctly identified HCV genotypes except genotype 6 from this region. Direct sequencing of the HCV core region was able to identify all the genotype 6 from this region and serves as an alternative to NS5b sequencing. © 2016 Wiley Periodicals, Inc.
Singh, Aditya; Bhatia, Prateek
2016-12-01
Sanger sequencing platforms, such as applied biosystems instruments, generate chromatogram files. Generally, for 1 region of a sequence, we use both forward and reverse primers to sequence that area, in that way, we have 2 sequences that need to be aligned and a consensus generated before mutation detection studies. This work is cumbersome and takes time, especially if the gene is large with many exons. Hence, we devised a rapid automated command system to filter, build, and align consensus sequences and also optionally extract exonic regions, translate them in all frames, and perform an amino acid alignment starting from raw sequence data within a very short time. In full capabilities of Automated Mutation Analysis Pipeline (ASAP), it is able to read "*.ab1" chromatogram files through command line interface, convert it to the FASTQ format, trim the low-quality regions, reverse-complement the reverse sequence, create a consensus sequence, extract the exonic regions using a reference exonic sequence, translate the sequence in all frames, and align the nucleic acid and amino acid sequences to reference nucleic acid and amino acid sequences, respectively. All files are created and can be used for further analysis. ASAP is available as Python 3.x executable at https://github.com/aditya-88/ASAP. The version described in this paper is 0.28.
Gonzalez, Patrice; Labarère, Jacques
1998-01-01
A comparative study of variable domains V4, V6, and V9 of the mitochondrial small-subunit (SSU) rRNA was carried out with the genus Agrocybe by PCR amplification of 42 wild isolates belonging to 10 species, Agrocybe aegerita, Agrocybe dura, Agrocybe chaxingu, Agrocybe erebia, Agrocybe firma, Agrocybe praecox, Agrocybe paludosa, Agrocybe pediades, Agrocybe alnetorum, and Agrocybe vervacti. Sequencing of the PCR products showed that the three domains in the isolates belonging to the same species were the same length and had the same sequence, while variations were found among the 10 species. Alignment of the sequences showed that nucleotide motifs encountered in the smallest sequence of each variable domain were also found in the largest sequence, indicating that the sequences evolved by insertion-deletion events. Determination of the secondary structure of each domain revealed that the insertion-deletion events commonly occurred in regions not directly involved in the secondary structure (i.e., the loops). Moreover, conserved sequences ranging from 4 to 25 nucleotides long were found at the beginning and end of each domain and could constitute genus-specific sequences. Comparisons of the V4, V6, and V9 secondary structures resulted in identification of the following four groups: (i) group I, which was characterized by the presence of additional P23-1 and P23-3 helices in the V4 domain and the lack of the P49-1 helix in V9 and included A. aegerita, A. chaxingu, and A. erebia; (ii) group II, which had the P23-3 helix in V4 and the P49-1 helix in V9 and included A. pediades; (iii) group III, which did not have additional helices in V4, had the P49-1 helix in V9 and included A. paludosa, A. firma, A. alnetorum, and A. praecox; and (iv) group IV, which lacked both the V4 additional helices and the P49-1 helix in V9 and included A. vervacti and A. dura. This grouping of species was supported by the structure of a consensus tree based on the variable domain sequences. The conservation of the sequences of the V4, V6, and V9 domains of the mitochondrial SSU rRNA within species and the high degree of interspecific variation found in the Agrocybe species studied open the way for these sequences to be used as specific molecular markers of the Basidiomycota. PMID:9797259
Gonzalez, P; Labarère, J
1998-11-01
A comparative study of variable domains V4, V6, and V9 of the mitochondrial small-subunit (SSU) rRNA was carried out with the genus Agrocybe by PCR amplification of 42 wild isolates belonging to 10 species, Agrocybe aegerita, Agrocybe dura, Agrocybe chaxingu, Agrocybe erebia, Agrocybe firma, Agrocybe praecox, Agrocybe paludosa, Agrocybe pediades, Agrocybe alnetorum, and Agrocybe vervacti. Sequencing of the PCR products showed that the three domains in the isolates belonging to the same species were the same length and had the same sequence, while variations were found among the 10 species. Alignment of the sequences showed that nucleotide motifs encountered in the smallest sequence of each variable domain were also found in the largest sequence, indicating that the sequences evolved by insertion-deletion events. Determination of the secondary structure of each domain revealed that the insertion-deletion events commonly occurred in regions not directly involved in the secondary structure (i.e., the loops). Moreover, conserved sequences ranging from 4 to 25 nucleotides long were found at the beginning and end of each domain and could constitute genus-specific sequences. Comparisons of the V4, V6, and V9 secondary structures resulted in identification of the following four groups: (i) group I, which was characterized by the presence of additional P23-1 and P23-3 helices in the V4 domain and the lack of the P49-1 helix in V9 and included A. aegerita, A. chaxingu, and A. erebia; (ii) group II, which had the P23-3 helix in V4 and the P49-1 helix in V9 and included A. pediades; (iii) group III, which did not have additional helices in V4, had the P49-1 helix in V9 and included A. paludosa, A. firma, A. alnetorum, and A. praecox; and (iv) group IV, which lacked both the V4 additional helices and the P49-1 helix in V9 and included A. vervacti and A. dura. This grouping of species was supported by the structure of a consensus tree based on the variable domain sequences. The conservation of the sequences of the V4, V6, and V9 domains of the mitochondrial SSU rRNA within species and the high degree of interspecific variation found in the Agrocybe species studied open the way for these sequences to be used as specific molecular markers of the Basidiomycota.
Epistatic determinism of durum wheat resistance to the wheat spindle streak mosaic virus.
Holtz, Yan; Bonnefoy, Michel; Viader, Véronique; Ardisson, Morgane; Rode, Nicolas O; Poux, Gérard; Roumet, Pierre; Marie-Jeanne, Véronique; Ranwez, Vincent; Santoni, Sylvain; Gouache, David; David, Jacques L
2017-07-01
The resistance of durum wheat to the Wheat spindle streak mosaic virus (WSSMV) is controlled by two main QTLs on chromosomes 7A and 7B, with a huge epistatic effect. Wheat spindle streak mosaic virus (WSSMV) is a major disease of durum wheat in Europe and North America. Breeding WSSMV-resistant cultivars is currently the only way to control the virus since no treatment is available. This paper reports studies of the inheritance of WSSMV resistance using two related durum wheat populations obtained by crossing two elite cultivars with a WSSMV-resistant emmer cultivar. In 2012 and 2015, 354 recombinant inbred lines (RIL) were phenotyped using visual notations, ELISA and qPCR and genotyped using locus targeted capture and sequencing. This allowed us to build a consensus genetic map of 8568 markers and identify three chromosomal regions involved in WSSMV resistance. Two major regions (located on chromosomes 7A and 7B) jointly explain, on the basis of epistatic interactions, up to 43% of the phenotypic variation. Flanking sequences of our genetic markers are provided to facilitate future marker-assisted selection of WSSMV-resistant cultivars.
Danesi, Patrizia; Firacative, Carolina; Cogliati, Massimo; Otranto, Domenico; Capelli, Gioia; Meyer, Wieland
2014-09-01
Cryptococcosis represents a fungal disease acquired from the environment with animals serving as host sentinels for human exposure. The aim of this study was to investigate the genetic characteristics of Cryptococcus isolates from veterinary sources (cats, dogs and birds) to understand their epidemiology and the genetic variability of the casual isolates. Mating-type PCR in connection with MLST analysis using the ISHAM consensus MLST scheme for the C. neoformans/C. gattii species complex was used to genotype 17 C. neoformans isolates. In the absence of an MLST typing scheme Cryptococcus adeliensis, C. albidus, C. aureus, C. carnescens, C. laurentii, C. magnus and C. uniguttulatus strains were typed using M13 PCR fingerprinting. All C. neoformans isolates were MATα mating type, but hybrids possessed αADa and aADα mating and serotypes. Two C. neoformans molecular types VNI, VNIV and VNIII and VNII/VNIV hybrids were identified. Amongst the 66 non-C. neoformans strains investigated 55 M13 PCR fingerprinting types were identified. The wide variety of MLST types of C. neoformans and the occurrence of αADa and aADα hybrids in our study supports the notion of genetic recombination in the area studied. The heterogeneity of the non-C. neoformans isolates remains open to further investigations and should be taken into consideration when identifying emergent pathogens. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Nanda, Kumiko; Taniguchi, Mariko; Ujike, Satoshi; Ishihara, Nobuhiro; Mori, Hirotaka; Ono, Hisayo; Murooka, Yoshikatsu
2001-01-01
Bacterial strains were isolated from samples of Japanese rice vinegar (komesu) and unpolished rice vinegar (kurosu) fermented by the traditional static method. Fermentations have never been inoculated with a pure culture since they were started in 1907. A total of 178 isolates were divided into groups A and B on the basis of enterobacterial repetitive intergenic consensus-PCR and random amplified polymorphic DNA fingerprinting analyses. The 16S ribosomal DNA sequences of strains belonging to each group showed similarities of more than 99% with Acetobacter pasteurianus. Group A strains overwhelmingly dominated all stages of fermentation of both types of vinegar. Our results indicate that appropriate strains of acetic acid bacteria have spontaneously established almost pure cultures during nearly a century of komesu and kurosu fermentation. PMID:11157275
Knierim, Dennis; Maiss, Edgar; Kenyon, Lawrence; Winter, Stephan; Menzel, Wulf
2015-10-01
Luffa aphid-borne yellows virus (LABYV) was proposed as the name for a previously undescribed polerovirus based on partial genome sequences obtained from samples of cucurbit plants collected in Thailand between 2008 and 2013. In this study, we determined the first full-length genome sequence of LABYV. Based on phylogenetic analysis and genome properties, it is clear that this virus represents a distinct species in the genus Polerovirus. Analysis of sequences from sample TH24, which was collected in 2010 from a luffa plant in Thailand, reveals the presence of two different full-length genome consensus sequences.
Zeng, Lu; Kortschak, R Daniel; Raison, Joy M; Bertozzi, Terry; Adelson, David L
2018-01-01
Transposable Elements (TEs) are mobile DNA sequences that make up significant fractions of amniote genomes. However, they are difficult to detect and annotate ab initio because of their variable features, lengths and clade-specific variants. We have addressed this problem by refining and developing a Comprehensive ab initio Repeat Pipeline (CARP) to identify and cluster TEs and other repetitive sequences in genome assemblies. The pipeline begins with a pairwise alignment using krishna, a custom aligner. Single linkage clustering is then carried out to produce families of repetitive elements. Consensus sequences are then filtered for protein coding genes and then annotated using Repbase and a custom library of retrovirus and reverse transcriptase sequences. This process yields three types of family: fully annotated, partially annotated and unannotated. Fully annotated families reflect recently diverged/young known TEs present in Repbase. The remaining two types of families contain a mixture of novel TEs and segmental duplications. These can be resolved by aligning these consensus sequences back to the genome to assess copy number vs. length distribution. Our pipeline has three significant advantages compared to other methods for ab initio repeat identification: 1) we generate not only consensus sequences, but keep the genomic intervals for the original aligned sequences, allowing straightforward analysis of evolutionary dynamics, 2) consensus sequences represent low-divergence, recently/currently active TE families, 3) segmental duplications are annotated as a useful by-product. We have compared our ab initio repeat annotations for 7 genome assemblies to other methods and demonstrate that CARP compares favourably with RepeatModeler, the most widely used repeat annotation package.
Zeng, Lu; Kortschak, R. Daniel; Raison, Joy M.
2018-01-01
Transposable Elements (TEs) are mobile DNA sequences that make up significant fractions of amniote genomes. However, they are difficult to detect and annotate ab initio because of their variable features, lengths and clade-specific variants. We have addressed this problem by refining and developing a Comprehensive ab initio Repeat Pipeline (CARP) to identify and cluster TEs and other repetitive sequences in genome assemblies. The pipeline begins with a pairwise alignment using krishna, a custom aligner. Single linkage clustering is then carried out to produce families of repetitive elements. Consensus sequences are then filtered for protein coding genes and then annotated using Repbase and a custom library of retrovirus and reverse transcriptase sequences. This process yields three types of family: fully annotated, partially annotated and unannotated. Fully annotated families reflect recently diverged/young known TEs present in Repbase. The remaining two types of families contain a mixture of novel TEs and segmental duplications. These can be resolved by aligning these consensus sequences back to the genome to assess copy number vs. length distribution. Our pipeline has three significant advantages compared to other methods for ab initio repeat identification: 1) we generate not only consensus sequences, but keep the genomic intervals for the original aligned sequences, allowing straightforward analysis of evolutionary dynamics, 2) consensus sequences represent low-divergence, recently/currently active TE families, 3) segmental duplications are annotated as a useful by-product. We have compared our ab initio repeat annotations for 7 genome assemblies to other methods and demonstrate that CARP compares favourably with RepeatModeler, the most widely used repeat annotation package. PMID:29538441
Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P; Panitz, Frank; Bendixen, Christian; Nielsen, Rasmus; Willerslev, Eske
2007-02-14
The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources. We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences). Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis. We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%). Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial analyses, population genetics, and phylogenetics.
Rivera, Rebecca; Robles-Sikisaka, Refugio; Hoffman, Elizabeth M; Stacy, Brian A; Jensen, Eric D; Nollens, Hendrik H; Wellehan, James F X
2012-03-23
A seven-year old California sea lion (Zalophus californianus) presented with focally extensive, bilaterally symmetric, proliferative axillary skin lesions and preputial lesions. A second California sea lion in the same population presented with similar proliferative lesions on the underside of the tail. Histopathology revealed epidermal hyperplasia with severe hyperkeratosis, with proliferating keratinocytes forming broad, branching pegs that extended into the dermis. Pan-papillomaviral consensus PCR was used to obtain initial E1 sequence template and the complete genome was determined using a combination of rolling circle amplification and specific-primer PCR. Analysis revealed a novel papillomavirus, Zalophus californianus papillomavirus 1 (ZcPV1), with seven open reading frames encoding five early proteins (E6, E7, E1, E2 and E4) and two late proteins (L1 and L2). Phylogenetic analysis revealed that (ZcPV1) is most closely related to Equine papillomavirus 1 (EcPV1) in the genus Zetapapillomavirus, and Canine papillomaviruses 3 and 4 (CPV3, CPV4) in the genus Chipapillomavirus. The lesions regressed without intervention over a period of several months. Copyright © 2011 Elsevier B.V. All rights reserved.
Sjö, Nicolai Christian; von Buchwald, Christian; Cassonnet, Patricia; Norrild, Bodil; Prause, Jan Ulrik; Vinding, Troels; Heegaard, Steffen
2007-01-01
Aim To examine conjunctival papilloma and normal conjunctival tissue for the presence of human papillomavirus (HPV). Methods Archival paraffin wax‐embedded tissue from 165 conjunctival papillomas and from 20 histological normal conjunctival biopsy specimens was analysed for the presence of HPV by PCR. Specimens considered HPV positive using consensus primers, but with a negative or uncertain PCR result using type‐specific HPV probes, were analysed with DNA sequencing. Results HPV was present in 86 of 106 (81%) β‐globin‐positive papillomas. HPV type 6 was positive in 80 cases, HPV type 11 was identified in 5 cases and HPV type 45 was present in a single papilloma. All the 20 normal conjunctival biopsy specimens were β‐globin positive and HPV negative. Conclusion There is a strong association between HPV and conjunctival papilloma. The study presents the largest material of conjunctival papilloma investigated for HPV and the first investigation of HPV in normal conjunctival tissue. HPV types 6 and 11 are the most common HPV types in conjunctival papilloma. This also is the first report of HPV type 45 in conjunctival papilloma. PMID:17166894
Diversity of acetic acid bacteria present in healthy grapes from the Canary Islands.
Valera, Maria José; Laich, Federico; González, Sara S; Torija, Maria Jesús; Mateo, Estibaliz; Mas, Albert
2011-11-15
The identification of acetic acid bacteria (AAB) from sound grapes from the Canary Islands is reported in the present study. No direct recovery of bacteria was possible in the most commonly used medium, so microvinifications were performed on grapes from Tenerife, La Palma and Lanzarote islands. Up to 396 AAB were isolated from those microvinifications and identified by 16S rRNA gene sequencing and phylogenetic analysis. With this method, Acetobacter pasteurianus, Acetobacter tropicalis, Gluconobacter japonicus and Gluconacetobacter saccharivorans were identified. However, no discrimination between the closely related species Acetobacter malorum and Acetobacter cerevisiae was possible. As previously described, 16S-23S rRNA gene internal transcribed spacer (ITS) region phylogenetic analysis was required to classify isolates as one of those species. These two species were the most frequently occurring, accounting for more than 60% of the isolates. For typing the AAB isolates, both the Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR and (GTG)5-PCR techniques gave similar resolution. A total of 60 profiles were identified. Thirteen of these profiles were found in more than one vineyard, and only one profile was found on two different islands (Tenerife and La Palma). Copyright © 2011 Elsevier B.V. All rights reserved.
Shiroguchi, Katsuyuki; Jia, Tony Z.; Sims, Peter A.; Xie, X. Sunney
2012-01-01
RNA sequencing (RNA-Seq) is a powerful tool for transcriptome profiling, but is hampered by sequence-dependent bias and inaccuracy at low copy numbers intrinsic to exponential PCR amplification. We developed a simple strategy for mitigating these complications, allowing truly digital RNA-Seq. Following reverse transcription, a large set of barcode sequences is added in excess, and nearly every cDNA molecule is uniquely labeled by random attachment of barcode sequences to both ends. After PCR, we applied paired-end deep sequencing to read the two barcodes and cDNA sequences. Rather than counting the number of reads, RNA abundance is measured based on the number of unique barcode sequences observed for a given cDNA sequence. We optimized the barcodes to be unambiguously identifiable, even in the presence of multiple sequencing errors. This method allows counting with single-copy resolution despite sequence-dependent bias and PCR-amplification noise, and is analogous to digital PCR but amendable to quantifying a whole transcriptome. We demonstrated transcriptome profiling of Escherichia coli with more accurate and reproducible quantification than conventional RNA-Seq. PMID:22232676
Toprak Ülger, Nurver; Sayın, Elvan; Soyad, Ad; Dane, Faysal; Söyletir, Güner
2013-10-01
Bacteroides species, the predominant constituents of the human intestinal microbiota can cause serious intraabdominal and postoperative wound infections and bacteremia. Moreover, these bacteria are more resistant to antimicrobial agents than the other anaerobes. The limited number of the antimicrobials, such as carbapenems, beta-lactam/beta-lactamase inhibitors and nitroimidazoles are highly effective in eliminating Bacteroides. However, a few metronidazole-resistant isolates have been reported from several countries recently. The nim genes (nim A-G) are suggested to be responsible for the majority of the metronidazole resistance. Here, we describe a metronidazole-resistant Bacteroides thetaiotaomicron isolated from a blood culture. A gram-negative obligate anaerobic rod was isolated from the postoperative 5th day blood culture of a 62-year-old male patient with adenocarcinoma of the pancreas head. The strain was identified as B.thetaiotaomicron by using a combination of conventional tests and commercially available biochemical kits. Antimicrobial susceptibility testing was performed by agar dilution method. The resistance genes were investigated by means of PCR using specific primer pairs for nim gene. The purified PCR product was sequenced and analyzed by comparison of the consensus sequences with GenBank sequences. The MIC for metronidazole was 16 mg/L. Although the strain was intermediate according the CLSI criteria, it was resistant (> 4 mg/L) according to EUCAST criteria. The isolate was nim gene positive, and nucleotide sequencing of the PCR product shared 100% similarity with nimE gene (emb |AM042593.1 |). On the other hand the isolate was susceptible to carbapenems and sulbactam-ampicillin. Following administration of ampicillin-sulbactam, the patient's fever disappeared after 24 hours. The clinical condition improved considerably and he was discharged at day 8. The patient was followed up at the medical oncology clinic; however he died due to disease progression six months after surgery. Since anaerobic bacteremia is associated with high mortality rate, prompt diagnosis and proper management are critical. The studies on Bacteroides bacteremia have revealed adverse outcomes in patients receiving antibiotics to which the bacterium was resistant. In the present case, the metronidazole-resistant organism would be reported as susceptible according to CLSI breakpoint value and on account of this result the treatment might lead to clinical failure. Therefore EUCAST MIC values seem to be more rational in case of Bacteroides antibiotic susceptibility testing.
Bowen, David M; Lewis, Jessica A; Lu, Wenzhe; Schein, Catherine H
2012-09-14
Designing proteins that reflect the natural variability of a pathogen is essential for developing novel vaccines and drugs. Flaviviruses, including Dengue (DENV) and West Nile (WNV), evolve rapidly and can "escape" neutralizing monoclonal antibodies by mutation. Designing antigens that represent many distinct strains is important for DENV, where infection with a strain from one of the four serotypes may lead to severe hemorrhagic disease on subsequent infection with a strain from another serotype. Here, a DENV physicochemical property (PCP)-consensus sequence was derived from 671 unique sequences from the Flavitrack database. PCP-consensus proteins for domain 3 of the envelope protein (EdomIII) were expressed from synthetic genes in Escherichia coli. The ability of the purified consensus proteins to bind polyclonal antibodies generated in response to infection with strains from each of the four DENV serotypes was determined. The initial consensus protein bound antibodies from DENV-1-3 in ELISA and Western blot assays. This sequence was altered in 3 steps to incorporate regions of maximum variability, identified as significant changes in the PCPs, characteristic of DENV-4 strains. The final protein was recognized by antibodies against all four serotypes. Two amino acids essential for efficient binding to all DENV antibodies are part of a discontinuous epitope previously defined for a neutralizing monoclonal antibody. The PCP-consensus method can significantly reduce the number of experiments required to define a multivalent antigen, which is particularly important when dealing with pathogens that must be tested at higher biosafety levels. Copyright © 2012 Elsevier Ltd. All rights reserved.
Fine-tuning structural RNA alignments in the twilight zone.
Bremges, Andreas; Schirmer, Stefanie; Giegerich, Robert
2010-04-30
A widely used method to find conserved secondary structure in RNA is to first construct a multiple sequence alignment, and then fold the alignment, optimizing a score based on thermodynamics and covariance. This method works best around 75% sequence similarity. However, in a "twilight zone" below 55% similarity, the sequence alignment tends to obscure the covariance signal used in the second phase. Therefore, while the overall shape of the consensus structure may still be found, the degree of conservation cannot be estimated reliably. Based on a combination of available methods, we present a method named planACstar for improving structure conservation in structural alignments in the twilight zone. After constructing a consensus structure by alignment folding, planACstar abandons the original sequence alignment, refolds the sequences individually, but consistent with the consensus, aligns the structures, irrespective of sequence, by a pure structure alignment method, and derives an improved sequence alignment from the alignment of structures, to be re-submitted to alignment folding, etc.. This circle may be iterated as long as structural conservation improves, but normally, one step suffices. Employing the tools ClustalW, RNAalifold, and RNAforester, we find that for sequences with 30-55% sequence identity, structural conservation can be improved by 10% on average, with a large variation, measured in terms of RNAalifold's own criterion, the structure conservation index.
Hoshino, Tatsuhiko; Inagaki, Fumio
2017-01-01
Next-generation sequencing (NGS) is a powerful tool for analyzing environmental DNA and provides the comprehensive molecular view of microbial communities. For obtaining the copy number of particular sequences in the NGS library, however, additional quantitative analysis as quantitative PCR (qPCR) or digital PCR (dPCR) is required. Furthermore, number of sequences in a sequence library does not always reflect the original copy number of a target gene because of biases caused by PCR amplification, making it difficult to convert the proportion of particular sequences in the NGS library to the copy number using the mass of input DNA. To address this issue, we applied stochastic labeling approach with random-tag sequences and developed a NGS-based quantification protocol, which enables simultaneous sequencing and quantification of the targeted DNA. This quantitative sequencing (qSeq) is initiated from single-primer extension (SPE) using a primer with random tag adjacent to the 5' end of target-specific sequence. During SPE, each DNA molecule is stochastically labeled with the random tag. Subsequently, first-round PCR is conducted, specifically targeting the SPE product, followed by second-round PCR to index for NGS. The number of random tags is only determined during the SPE step and is therefore not affected by the two rounds of PCR that may introduce amplification biases. In the case of 16S rRNA genes, after NGS sequencing and taxonomic classification, the absolute number of target phylotypes 16S rRNA gene can be estimated by Poisson statistics by counting random tags incorporated at the end of sequence. To test the feasibility of this approach, the 16S rRNA gene of Sulfolobus tokodaii was subjected to qSeq, which resulted in accurate quantification of 5.0 × 103 to 5.0 × 104 copies of the 16S rRNA gene. Furthermore, qSeq was applied to mock microbial communities and environmental samples, and the results were comparable to those obtained using digital PCR and relative abundance based on a standard sequence library. We demonstrated that the qSeq protocol proposed here is advantageous for providing less-biased absolute copy numbers of each target DNA with NGS sequencing at one time. By this new experiment scheme in microbial ecology, microbial community compositions can be explored in more quantitative manner, thus expanding our knowledge of microbial ecosystems in natural environments.
Hong, Jungeui; Gresham, David
2017-11-01
Quantitative analysis of next-generation sequencing (NGS) data requires discriminating duplicate reads generated by PCR from identical molecules that are of unique origin. Typically, PCR duplicates are identified as sequence reads that align to the same genomic coordinates using reference-based alignment. However, identical molecules can be independently generated during library preparation. Misidentification of these molecules as PCR duplicates can introduce unforeseen biases during analyses. Here, we developed a cost-effective sequencing adapter design by modifying Illumina TruSeq adapters to incorporate a unique molecular identifier (UMI) while maintaining the capacity to undertake multiplexed, single-index sequencing. Incorporation of UMIs into TruSeq adapters (TrUMIseq adapters) enables identification of bona fide PCR duplicates as identically mapped reads with identical UMIs. Using TrUMIseq adapters, we show that accurate removal of PCR duplicates results in improved accuracy of both allele frequency (AF) estimation in heterogeneous populations using DNA sequencing and gene expression quantification using RNA-Seq.
Droplet Digital™ PCR Next-Generation Sequencing Library QC Assay.
Heredia, Nicholas J
2018-01-01
Digital PCR is a valuable tool to quantify next-generation sequencing (NGS) libraries precisely and accurately. Accurately quantifying NGS libraries enable accurate loading of the libraries on to the sequencer and thus improve sequencing performance by reducing under and overloading error. Accurate quantification also benefits users by enabling uniform loading of indexed/barcoded libraries which in turn greatly improves sequencing uniformity of the indexed/barcoded samples. The advantages gained by employing the Droplet Digital PCR (ddPCR™) library QC assay includes the precise and accurate quantification in addition to size quality assessment, enabling users to QC their sequencing libraries with confidence.
2017-01-01
Amplicon (targeted) sequencing by massively parallel sequencing (PCR-MPS) is a potential method for use in forensic DNA analyses. In this application, PCR-MPS may supplement or replace other instrumental analysis methods such as capillary electrophoresis and Sanger sequencing for STR and mitochondrial DNA typing, respectively. PCR-MPS also may enable the expansion of forensic DNA analysis methods to include new marker systems such as single nucleotide polymorphisms (SNPs) and insertion/deletions (indels) that currently are assayable using various instrumental analysis methods including microarray and quantitative PCR. Acceptance of PCR-MPS as a forensic method will depend in part upon developing protocols and criteria that define the limitations of a method, including a defensible analytical threshold or method detection limit. This paper describes an approach to establish objective analytical thresholds suitable for multiplexed PCR-MPS methods. A definition is proposed for PCR-MPS method background noise, and an analytical threshold based on background noise is described. PMID:28542338
Young, Brian; King, Jonathan L; Budowle, Bruce; Armogida, Luigi
2017-01-01
Amplicon (targeted) sequencing by massively parallel sequencing (PCR-MPS) is a potential method for use in forensic DNA analyses. In this application, PCR-MPS may supplement or replace other instrumental analysis methods such as capillary electrophoresis and Sanger sequencing for STR and mitochondrial DNA typing, respectively. PCR-MPS also may enable the expansion of forensic DNA analysis methods to include new marker systems such as single nucleotide polymorphisms (SNPs) and insertion/deletions (indels) that currently are assayable using various instrumental analysis methods including microarray and quantitative PCR. Acceptance of PCR-MPS as a forensic method will depend in part upon developing protocols and criteria that define the limitations of a method, including a defensible analytical threshold or method detection limit. This paper describes an approach to establish objective analytical thresholds suitable for multiplexed PCR-MPS methods. A definition is proposed for PCR-MPS method background noise, and an analytical threshold based on background noise is described.
Molecular Methods To Improve Diagnosis and Identification of Mucormycosis▿
Hammond, Sarah P.; Bialek, Ralf; Milner, Danny A.; Petschnigg, Eva M.; Baden, Lindsey R.; Marty, Francisco M.
2011-01-01
Mucormycosis is difficult to diagnose. Samples from suspected cases often fail to grow Mucorales in microbiologic cultures. We identified all hematologic malignancy and stem cell transplant patients diagnosed with proven mucormycosis between 2001 and 2009 at Brigham and Women's Hospital/Dana-Farber Cancer Institute. Seminested PCR targeting Mucorales 18S ribosomal DNA and sequencing were performed on formalin-fixed paraffin-embedded tissue samples. Of 29 cases of mucormycosis, 27 had tissue samples available for PCR and sequencing. Mucorales PCR was positive in 22. Among 12 culture-positive cases, 10 were PCR positive and sequencing was concordant with culture results to the genus level in 9. Among 15 culture-negative cases, PCR was positive and sequencing allowed genus identification in 12. Mucorales PCR is useful for confirmation of the diagnosis of mucormycosis and for further characterization of the infection in cases where cultures are negative. PMID:21508149
Molecular methods to improve diagnosis and identification of mucormycosis.
Hammond, Sarah P; Bialek, Ralf; Milner, Danny A; Petschnigg, Eva M; Baden, Lindsey R; Marty, Francisco M
2011-06-01
Mucormycosis is difficult to diagnose. Samples from suspected cases often fail to grow Mucorales in microbiologic cultures. We identified all hematologic malignancy and stem cell transplant patients diagnosed with proven mucormycosis between 2001 and 2009 at Brigham and Women's Hospital/Dana-Farber Cancer Institute. Seminested PCR targeting Mucorales 18S ribosomal DNA and sequencing were performed on formalin-fixed paraffin-embedded tissue samples. Of 29 cases of mucormycosis, 27 had tissue samples available for PCR and sequencing. Mucorales PCR was positive in 22. Among 12 culture-positive cases, 10 were PCR positive and sequencing was concordant with culture results to the genus level in 9. Among 15 culture-negative cases, PCR was positive and sequencing allowed genus identification in 12. Mucorales PCR is useful for confirmation of the diagnosis of mucormycosis and for further characterization of the infection in cases where cultures are negative.
Genotype diversity of Escherichia coli isolates in natural waters determined by PFGE and ERIC-PCR.
Casarez, Elizabeth A; Pillai, Suresh D; Di Giovanni, George D
2007-08-01
Most library-dependent bacterial source tracking studies using Escherichia coli (E. coli) have focused on strain diversity of isolates obtained from known human and animal faecal sources for library development. In contrast, this study evaluated the genotype variation of E. coli isolated from natural surface water using pulsed field gel electrophoresis (PFGE) and enterobacterial repetitive intergenic consensus sequence polymerase chain reaction (ERIC-PCR) to better understand these naturally occurring populations. A total of 650 water samples were collected over a nine month period from eleven sampling stations from Lake Waco and Belton Lake in Central Texas. Of the 650 water samples collected, 412 were positive for E. coli, yielding a total of 631 E. coli isolates (1-12 isolates collected per sample). PFGE and ERIC-PCR patterns were successfully generated for 555 isolates and were compared using the curve-based Pearson's product-moment correlation coefficient. The 555 E. coli isolates represented 461 PFGE genotypes, with 84% (386/461) of the genotypes being represented by individual isolates. The remaining 75 genotypes were represented by 2-5 isolates each. Using ERIC-PCR, the 555 E. coli isolates represented 175 genotypes, with 63% (109/175) of the genotypes being represented by individual isolates. In contrast to the PFGE results, two ERIC-PCR genotypes represented 37% of the E. coli isolates, (83 and 124 isolates, respectively), and were found throughout the watersheds both spatially and temporally. Based on the PFGE genotype diversity of water isolates, there is little evidence that a small number of environmentally-adapted E. coli represent dominant populations in the studied waterbodies. However, with the lower discriminatory power technique ERIC-PCR, an opposing conclusion might have been drawn. These results emphasize the importance of considering the resolving power of the source tracking technique being used when assessing strain diversity and geographical stability.
A computational method for estimating the PCR duplication rate in DNA and RNA-seq experiments.
Bansal, Vikas
2017-03-14
PCR amplification is an important step in the preparation of DNA sequencing libraries prior to high-throughput sequencing. PCR amplification introduces redundant reads in the sequence data and estimating the PCR duplication rate is important to assess the frequency of such reads. Existing computational methods do not distinguish PCR duplicates from "natural" read duplicates that represent independent DNA fragments and therefore, over-estimate the PCR duplication rate for DNA-seq and RNA-seq experiments. In this paper, we present a computational method to estimate the average PCR duplication rate of high-throughput sequence datasets that accounts for natural read duplicates by leveraging heterozygous variants in an individual genome. Analysis of simulated data and exome sequence data from the 1000 Genomes project demonstrated that our method can accurately estimate the PCR duplication rate on paired-end as well as single-end read datasets which contain a high proportion of natural read duplicates. Further, analysis of exome datasets prepared using the Nextera library preparation method indicated that 45-50% of read duplicates correspond to natural read duplicates likely due to fragmentation bias. Finally, analysis of RNA-seq datasets from individuals in the 1000 Genomes project demonstrated that 70-95% of read duplicates observed in such datasets correspond to natural duplicates sampled from genes with high expression and identified outlier samples with a 2-fold greater PCR duplication rate than other samples. The method described here is a useful tool for estimating the PCR duplication rate of high-throughput sequence datasets and for assessing the fraction of read duplicates that correspond to natural read duplicates. An implementation of the method is available at https://github.com/vibansal/PCRduplicates .
Dogan, Fırat; Dorttas, Selvi Deniz; Bilge Dagalp, Seval; Ataseven, Veysel Soydal; Alkan, Feray
2018-06-01
Papillomaviruses (PVs) are epitheliotropic viruses that cause benign proliferative lesions in the skin (warts or papillomas) and mucous membranes of their natural hosts. Recently, new PVs have been found in many animal species. The most common current approach for identifying novel PV types is based on PCR, using various consensus or degenerated primer (broad-range primers), designed on the basis of the multiple alignment of nucleotide or amino acid sequences of a large number of different human papillomaviruses (HPV). PVs have been classified according to the sequence similarity of one of their capsid proteins, L1, without taking into account other regions of the genome and without considering the phenotypic characteristics of the viral infection. In this study, we performed molecular detection and typing of a PV in a goat with teat papillomatosis. Firstly, PCR was performed using the FAP59/FAP64 and MY09/MY11 primer pairs for the L1 gene region. The PV DNA was found to be positive only with the FAP59/FAP64 primer pair. PV DNA was then tested with three primer sets in four different combinations (L2Bf/FAP64, L2Bf/L1Br, FAP59/FAP64, L1Bf/LCRBr) for the gene region encoding the L1, L2 and LCR proteins. The goat teat papilloma sample was amplified using FAP59/FAP64 primers and two primer pairs (L2Bf/FAP64 and L2Bf/L1Br). We obtained products matching approximately 604 bp of the L1 region of the virus. PV DNA was used for typing using sequence analysis/PCR with some type-specific primers for bovids, caprids and cervids. The results of the sequence analysis suggested one new putative PV type with sequence identity ranging from 46.45 to 80.09% to other known papillomaviruses, including Capra hircus papillomavirus (ChPV-2), bovine papillomavirus (BPV) 6, 7, 10, 11 and 12, Rangifer tarandus papillomavirus 3 (RtPV-3) and BPV-7Z (Alpine wild ruminant papillomavirus; Cervus elaphus papillomavirus). We therefore propose that this is the first identification of a new putative type, MG523274 (HTY-goat-TR2016), in a goat with teat papillomatosis. It is essential to identify PV types in different animal species and investigate their prevalence/distribution and clinical consequences in order to develop appropriate prophylactic and/or therapeutic procedures and to determine the interspecies transmission potential and evolution of PVs.
Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou
2011-01-01
DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738
Villard, Pierre; Malausa, Thibaut
2013-07-01
SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from http://www2.sophia.inra.fr/urih/sophia_mart/sp_designer/info_sp_designer.php. © 2013 John Wiley & Sons Ltd.
Williams-Woods, Jacquelina; González-Escalona, Narjol; Burkhardt, William
2011-12-01
Human norovirus (HuNoV) and hepatitis A (HAV) are recognized as leading causes of non-bacterial foodborne associated illnesses in the United States. DNA sequencing is generally considered the standard for accurate viral genotyping in support of epidemiological investigations. Due to the genetic diversity of noroviruses (NoV), degenerate primer sets are often used in conventional reverse transcription (RT) PCR and real-time RT-quantitative PCR (RT-qPCR) for the detection of these viruses and cDNA fragments are generally cloned prior to sequencing. HAV detection methods that are sensitive and specific for real-time RT-qPCR yields small fragments sizes of 89-150bp, which can be difficult to sequence. In order to overcome these obstacles, norovirus and HAV primers were tailed with M13 forward and reverse primers. This modification increases the sequenced product size and allows for direct sequencing of the amplicons utilizing complementary M13 primers. HuNoV and HAV cDNA products from environmentally contaminated oysters were analyzed using this method. Alignments of the sequenced samples revealed ≥95% nucleotide identities. Tailing NoV and HAV primers with M13 sequence increases the cDNA product size, offers an alternative to cloning, and allows for rapid, accurate and direct sequencing of cDNA products produced by conventional or real time RT-qPCR assays. Published by Elsevier B.V.
Molecular cloning and characterization of novel phytocystatin gene from turmeric, Curcuma longa.
Chan, Seow-Neng; Abu Bakar, Norliza; Mahmood, Maziah; Ho, Chai-Ling; Shaharuddin, Noor Azmi
2014-01-01
Phytocystatin, a type of protease inhibitor (PI), plays major roles in plant defense mechanisms and has been reported to show antipathogenic properties and plant stress tolerance. Recombinant plant PIs are gaining popularity as potential candidates in engineering of crop protection and in synthesizing medicine. It is therefore crucial to identify PI from novel sources like Curcuma longa as it is more effective in combating against pathogens due to its novelty. In this study, a novel cDNA fragment encoding phytocystatin was isolated using degenerate PCR primers, designed from consensus regions of phytocystatin from other plant species. A full-length cDNA of the phytocystatin gene, designated CypCl, was acquired using 5'/3' rapid amplification of cDNA ends method and it has been deposited in NCBI database (accession number KF545954.1). It has a 687 bp long open reading frame (ORF) which encodes 228 amino acids. BLAST result indicated that CypCl is similar to cystatin protease inhibitor from Cucumis sativus with 74% max identity. Sequence analysis showed that CypCl contains most of the motifs found in a cystatin, including a G residue, LARFAV-, QxVxG sequence, PW dipeptide, and SNSL sequence at C-terminal extension. Phylogenetic studies also showed that CypCl is related to phytocystatin from Elaeis guineensis.
A surprisingly large RNase P RNA in Candida glabrata
KACHOURI, RYM; STRIBINSKIS, VILIUS; ZHU, YANGLONG; RAMOS, KENNETH S.; WESTHOF, ERIC; LI, YONG
2005-01-01
We have found an extremely large ribonuclease P (RNase P) RNA (RPR1) in the human pathogen Candida glabrata and verified that this molecule is expressed and present in the active enzyme complex of this hemiascomycete yeast. A structural alignment of the C. glabrata sequence with 36 other hemiascomycete RNase P RNAs (abbreviated as P RNAs) allows us to characterize the types of insertions. In addition, 15 P RNA sequences were newly characterized by searching in the recently sequenced genomes Candida albicans, C. glabrata, Debaryomyces hansenii, Eremothecium gossypii, Kluyveromyces lactis, Kluyveromyces waltii, Naumovia castellii, Saccharomyces kudriavzevii, Saccharomyces mikatae, and Yarrowia lipolytica; and by PCR amplification for other Candida species (Candida guilliermondii, Candida krusei, Candida parapsilosis, Candida stellatoidea, and Candida tropicalis). The phylogenetic comparative analysis identifies a hemiascomycete secondary structure consensus that presents a conserved core in all species with variable insertions or deletions. The most significant variability is found in C. glabrata P RNA in which three insertions exceeding in total 700 nt are present in the Specificity domain. This P RNA is more than twice the length of any other homologous P RNAs known in the three domains of life and is eight times the size of the smallest. RNase P RNA, therefore, represents one of the most diversified noncoding RNAs in terms of size variation and structural diversity. PMID:15987816
Molecular Cloning and Characterization of Novel Phytocystatin Gene from Turmeric, Curcuma longa
Chan, Seow-Neng; Abu Bakar, Norliza; Mahmood, Maziah; Ho, Chai-Ling
2014-01-01
Phytocystatin, a type of protease inhibitor (PI), plays major roles in plant defense mechanisms and has been reported to show antipathogenic properties and plant stress tolerance. Recombinant plant PIs are gaining popularity as potential candidates in engineering of crop protection and in synthesizing medicine. It is therefore crucial to identify PI from novel sources like Curcuma longa as it is more effective in combating against pathogens due to its novelty. In this study, a novel cDNA fragment encoding phytocystatin was isolated using degenerate PCR primers, designed from consensus regions of phytocystatin from other plant species. A full-length cDNA of the phytocystatin gene, designated CypCl, was acquired using 5′/3′ rapid amplification of cDNA ends method and it has been deposited in NCBI database (accession number KF545954.1). It has a 687 bp long open reading frame (ORF) which encodes 228 amino acids. BLAST result indicated that CypCl is similar to cystatin protease inhibitor from Cucumis sativus with 74% max identity. Sequence analysis showed that CypCl contains most of the motifs found in a cystatin, including a G residue, LARFAV-, QxVxG sequence, PW dipeptide, and SNSL sequence at C-terminal extension. Phylogenetic studies also showed that CypCl is related to phytocystatin from Elaeis guineensis. PMID:25853138
Detection of dengue virus serotypes 1, 2 and 3 in selected regions of Kenya: 2011-2014.
Konongoi, Limbaso; Ofula, Victor; Nyunja, Albert; Owaka, Samuel; Koka, Hellen; Makio, Albina; Koskei, Edith; Eyase, Fredrick; Langat, Daniel; Schoepp, Randal J; Rossi, Cynthia Ann; Njeru, Ian; Coldren, Rodney; Sang, Rosemary
2016-11-04
Dengue fever, a mosquito-borne disease, is associated with illness of varying severity in countries in the tropics and sub tropics. Dengue cases continue to be detected more frequently and its geographic range continues to expand. We report the largest documented laboratory confirmed circulation of dengue virus in parts of Kenya since 1982. From September 2011 to December 2014, 868 samples from febrile patients were received from hospitals in Nairobi, northern and coastal Kenya. The immunoglobulin M enzyme linked immunosorbent assay (IgM ELISA) was used to test for the presence of IgM antibodies against dengue, yellow fever, West Nile and Zika. Reverse transcription polymerase chain reaction (RT-PCR) utilizing flavivirus family, yellow fever, West Nile, consensus and sero type dengue primers were used to detect acute arbovirus infections and determine the infecting serotypes. Representative samples of PCR positive samples for each of the three dengue serotypes detected were sequenced to confirm circulation of the various dengue serotypes. Forty percent (345/868) of the samples tested positive for dengue by either IgM ELISA (14.6 %) or by RT-PCR (25.1 %). Three dengue serotypes 1-3 (DENV1-3) were detected by serotype specific RT-PCR and sequencing with their numbers varying from year to year and by region. The overall predominant serotype detected from 2011-2014 was DENV1 accounting for 44 % (96/218) of all the serotypes detected, followed by DENV2 accounting for 38.5 % (84/218) and then DENV3 which accounted for 17.4 % (38/218). Yellow fever, West Nile and Zika was not detected in any of the samples tested. From 2011-2014 serotypes 1, 2 and 3 were detected in the Northern and Coastal parts of Kenya. This confirmed the occurrence of cases and active circulation of dengue in parts of Kenya. These results have documented three circulating serotypes and highlight the need for the establishment of active dengue surveillance to continuously detect cases, circulating serotypes, and determine dengue fever disease burden in the country and region.
Piri, Fahimeh; Zarei Mahmoudabadi, Ali; Ronagh, Ali; Ahmadi, Bahram; Makimura, Koichi; Rezaei-Matehkolaei, Ali
2018-06-26
Conventional direct microscopy with potassium hydroxide (KOH) and culture were found to lack the ability to establish a fast and specific diagnosis of dermatophytosis. A pan-dermatophyte nested-PCR assay was developed using a novel primer pair targeting the translation elongation factor 1-α (Tef-1α) sequences for direct detection and identification of most veterinary relevant dermatophytes in animal samples suspected to dermatophytosis. A total of 140 animal skin and hair samples were subjected to direct microscopy, culture, and ITS-RFLP/ITS-sequencing of culture isolates for the detection and identification of dermatophytosis agents. Nested-PCR sequencing was performed on all the extracted DNAs using a commercial kit after dissolving the specimens by mechanical beating. Nested-PCR was positive in 90% of samples, followed by direct microscopy (85.7%) and culture (75%). The degree of agreement between nested-PCR and direct microscopy (94.4%) was higher than with culture (83.3%). In 105 culture positive cases, the measures of agreement for the identification of dermatophytosis agents were as follows: 100% between nested-PCR sequencing and ITS-RFLP/ITS-sequencing and 63.8% between nested-PCR sequencing and culture. The developed nested-PCR was faster as well as more sensitive and specific than conventional methods for detection and identification of dermatophytes in clinical samples, which was particularly suitable for epidemiological studies. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Ghosh, Jayadri Sekhar; Bhattacharya, Samik; Pal, Amita
2017-06-01
The unavailability of the reproductive structure and unpredictability of vegetative characters for the identification and phylogenetic study of bamboo prompted the application of molecular techniques for greater resolution and consensus. We first employed internal transcribed spacer (ITS1, 5.8S rRNA and ITS2) sequences to construct the phylogenetic tree of 21 tropical bamboo species. While the sequence alone could grossly reconstruct the traditional phylogeny amongst the 21-tropical species studied, some anomalies were encountered that prompted a further refinement of the phylogenetic analyses. Therefore, we integrated the secondary structure of the ITS sequences to derive individual sequence-structure matrix to gain more resolution on the phylogenetic reconstruction. The results showed that ITS sequence-structure is the reliable alternative to the conventional phenotypic method for the identification of bamboo species. The best-fit topology obtained by the sequence-structure based phylogeny over the sole sequence based one underscores closer clustering of all the studied Bambusa species (Sub-tribe Bambusinae), while Melocanna baccifera, which belongs to Sub-Tribe Melocanneae, disjointedly clustered as an out-group within the consensus phylogenetic tree. In this study, we demonstrated the dependability of the combined (ITS sequence+structure-based) approach over the only sequence-based analysis for phylogenetic relationship assessment of bamboo.
Takahashi, Mayumi; Wu, Xiwei; Ho, Michelle; Chomchan, Pritsana; Rossi, John J.; Burnett, John C.; Zhou, Jiehua
2016-01-01
The systemic evolution of ligands by exponential enrichment (SELEX) technique is a powerful and effective aptamer-selection procedure. However, modifications to the process can dramatically improve selection efficiency and aptamer performance. For example, droplet digital PCR (ddPCR) has been recently incorporated into SELEX selection protocols to putatively reduce the propagation of byproducts and avoid selection bias that result from differences in PCR efficiency of sequences within the random library. However, a detailed, parallel comparison of the efficacy of conventional solution PCR versus the ddPCR modification in the RNA aptamer-selection process is needed to understand effects on overall SELEX performance. In the present study, we took advantage of powerful high throughput sequencing technology and bioinformatics analysis coupled with SELEX (HT-SELEX) to thoroughly investigate the effects of initial library and PCR methods in the RNA aptamer identification. Our analysis revealed that distinct “biased sequences” and nucleotide composition existed in the initial, unselected libraries purchased from two different manufacturers and that the fate of the “biased sequences” was target-dependent during selection. Our comparison of solution PCR- and ddPCR-driven HT-SELEX demonstrated that PCR method affected not only the nucleotide composition of the enriched sequences, but also the overall SELEX efficiency and aptamer efficacy. PMID:27652575
Gardner, Shea N; Wagner, Mark C
2005-01-01
Background Microbial forensics is important in tracking the source of a pathogen, whether the disease is a naturally occurring outbreak or part of a criminal investigation. Results A method and SPR Opt (SNP and PCR-RFLP Optimization) software to perform a comprehensive, whole-genome analysis to forensically discriminate multiple sequences is presented. Tools for the optimization of forensic typing using Single Nucleotide Polymorphism (SNP) and PCR-Restriction Fragment Length Polymorphism (PCR-RFLP) analyses across multiple isolate sequences of a species are described. The PCR-RFLP analysis includes prediction and selection of optimal primers and restriction enzymes to enable maximum isolate discrimination based on sequence information. SPR Opt calculates all SNP or PCR-RFLP variations present in the sequences, groups them into haplotypes according to their co-segregation across those sequences, and performs combinatoric analyses to determine which sets of haplotypes provide maximal discrimination among all the input sequences. Those set combinations requiring that membership in the fewest haplotypes be queried (i.e. the fewest assays be performed) are found. These analyses highlight variable regions based on existing sequence data. These markers may be heterogeneous among unsequenced isolates as well, and thus may be useful for characterizing the relationships among unsequenced as well as sequenced isolates. The predictions are multi-locus. Analyses of mumps and SARS viruses are summarized. Phylogenetic trees created based on SNPs, PCR-RFLPs, and full genomes are compared for SARS virus, illustrating that purported phylogenies based only on SNP or PCR-RFLP variations do not match those based on multiple sequence alignment of the full genomes. Conclusion This is the first software to optimize the selection of forensic markers to maximize information gained from the fewest assays, accepting whole or partial genome sequence data as input. As more sequence data becomes available for multiple strains and isolates of a species, automated, computational approaches such as those described here will be essential to make sense of large amounts of information, and to guide and optimize efforts in the laboratory. The software and source code for SPR Opt is publicly available and free for non-profit use at . PMID:15904493
Watanabe, K; Yoshioka, K; Ito, H; Ishigami, M; Takagi, K; Utsunomiya, S; Kobayashi, M; Kishimoto, H; Yano, M; Kakumu, S
1999-11-10
Hypervariable region 1 (HVR1) proteins of hepatitis C virus (HCV) have been reported to react broadly with sera of patients with HCV infection. However, the variability of the broad reactivity of individual HVR1 proteins has not been elucidated. We assessed the reactivity of 25 different HVR1 proteins (genotype 1b) with sera of 81 patients with HCV infection (genotype 1b) by Western blot. HVR1 proteins reacted with 2-60 sera. The number of sera reactive with each HVR1 protein significantly correlated with the number of amino acid residues identical to the consensus sequence defined by Puntoriero et al. (G. Puntoriero, A. Lahm, S. Zucchelli, B. B. Ercole, R. Tafi, M. Penzzanera, M. U. Mondelli, R. Cortese, A. Tramontano, G. Galfre', and A. Nicosia. 1998. EMBO J. 17, 3521-3533. ) (r = 0.561, P < 0.005). The most widely reactive HVR1 protein, 12-22, had a sequence similar to the consensus sequence. The peptide with C-terminal 13-amino-acids sequence of HVR1 protein 12-22 (NH2-CSFTSLFTPGPSQK) was injected into rabbits as an immunogen. The rabbit immune sera reacted with 9 of 25 HVR1 proteins of genotype 1b including HVR1 protein 12-22 and with 3 of 12 proteins of genotype 2a. These results indicate that the HVR1 protein broadly reactive with patients' sera has a sequence similar to the consensus sequence, can induce broadly reactive sera, and could be one of the candidate immunogens in a prophylactic vaccine against HCV. Copyright 1999 Academic Press.
USDA-ARS?s Scientific Manuscript database
Quantitative PCR (Q-PCR) utilizing specific primer sequences and a fluorogenic, 5’-exonuclease linear hydrolysis probe is well established as a detection and identification method for Phakopsora pachyrhizi, the soybean rust pathogen. Because of the extreme sensitivity of Q-PCR, the DNA of a single u...
Data Analysis of Sequences and qPCR for Microbial Communities during Algal Blooms
A training opportunity is open to a highly microbial-research-motivated student to conduct sequence analysis, explore novel genes and metabolic pathways, validate resultant findings using qPCR/RT-qPCR and summarize the findings
Verstappen, Koen M; Huijbregts, Loes; Spaninks, Mirlin; Wagenaar, Jaap A; Fluit, Ad C; Duim, Birgitta
2017-01-01
Staphylococcus pseudintermedius is an opportunistic pathogen in dogs and cats and occasionally causes infections in humans. S. pseudintermedius is often resistant to multiple classes of antimicrobials. It requires a reliable detection so that it is not misidentified as S. aureus. Phenotypic and currently-used molecular-based diagnostic assays lack specificity or are labour-intensive using multiplex PCR or nucleic acid sequencing. The aim of this study was to identify a specific target for real-time PCR by comparing whole genome sequences of S. pseudintermedius and non-pseudintermedius.Genome sequences were downloaded from public repositories and supplemented by isolates that were sequenced in this study. A Perl-script was written that analysed 300-nt fragments from a reference genome sequence of S. pseudintermedius and checked if this sequence was present in other S. pseudintermedius genomes (n = 74) and non-pseudintermedius genomes (n = 138). Six sequences specific for S. pseudintermedius were identified (sequence length between 300-500 nt). One sequence, which was located in the spsJ gene, was used to develop primers and a probe. The real-time PCR showed 100% specificity when testing for S. pseudintermedius isolates (n = 54), and eight other staphylococcal species (n = 43). In conclusion, a novel approach by comparing whole genome sequences identified a sequence that is specific for S. pseudintermedius and provided a real-time PCR target for rapid and reliable detection of S. pseudintermedius.
Goossens, Dirk; Moens, Lotte N; Nelis, Eva; Lenaerts, An-Sofie; Glassee, Wim; Kalbe, Andreas; Frey, Bruno; Kopal, Guido; De Jonghe, Peter; De Rijk, Peter; Del-Favero, Jurgen
2009-03-01
We evaluated multiplex PCR amplification as a front-end for high-throughput sequencing, to widen the applicability of massive parallel sequencers for the detailed analysis of complex genomes. Using multiplex PCR reactions, we sequenced the complete coding regions of seven genes implicated in peripheral neuropathies in 40 individuals on a GS-FLX genome sequencer (Roche). The resulting dataset showed highly specific and uniform amplification. Comparison of the GS-FLX sequencing data with the dataset generated by Sanger sequencing confirmed the detection of all variants present and proved the sensitivity of the method for mutation detection. In addition, we showed that we could exploit the multiplexed PCR amplicons to determine individual copy number variation (CNV), increasing the spectrum of detected variations to both genetic and genomic variants. We conclude that our straightforward procedure substantially expands the applicability of the massive parallel sequencers for sequencing projects of a moderate number of amplicons (50-500) with typical applications in resequencing exons in positional or functional candidate regions and molecular genetic diagnostics. 2008 Wiley-Liss, Inc.
Jia, Xianbo; Lin, Xinjian; Chen, Jichen
2017-11-02
Current genome walking methods are very time consuming, and many produce non-specific amplification products. To amplify the flanking sequences that are adjacent to Tn5 transposon insertion sites in Serratia marcescens FZSF02, we developed a genome walking method based on TAIL-PCR. This PCR method added a 20-cycle linear amplification step before the exponential amplification step to increase the concentration of the target sequences. Products of the linear amplification and the exponential amplification were diluted 100-fold to decrease the concentration of the templates that cause non-specific amplification. Fast DNA polymerase with a high extension speed was used in this method, and an amplification program was used to rapidly amplify long specific sequences. With this linear and exponential TAIL-PCR (LETAIL-PCR), we successfully obtained products larger than 2 kb from Tn5 transposon insertion mutant strains within 3 h. This method can be widely used in genome walking studies to amplify unknown sequences that are adjacent to known sequences.
Genetic diversity of Babesia bovis in virulent and attenuated strains.
Mazuz, M L; Molad, T; Fish, L; Leibovitz, B; Wolkomirsky, R; Fleiderovitz, L; Shkap, V
2012-03-01
The aim of this study was to compare the genetic diversity of the single copy Bv80 gene sequences of Babesia bovis in populations of attenuated and virulent parasites. PCR/ RT-PCR followed by cloning and sequence analyses of 4 attenuated and 4 virulent strains were performed. Multiple fragments in the range of 420 to 744 bp were amplified by PCR or RT-PCR. Cloning of the PCR fragments and sequence analyses revealed the presence of mixed subpopulations in either virulent or attenuated parasites with a total of 19 variants with 12 different sequences that differed in number and type of tandem repeats. High levels of intra- and inter-strain diversity of the Bv80 gene, with the presence of mixed populations of parasites were found in both the virulent field isolates and the attenuated vaccine strains. In addition, during the attenuation process, sequence analyses showed changes in the pattern of the parasite subpopulations. Despite high polymorphism found by sequence analyses, the patterns observed and the number of repeats, order, or motifs found could not discriminate between virulent field isolates and attenuated vaccine strains of the parasite.
Letek, Michal; Valbuena, Noelia; Ramos, Angelina; Ordóñez, Efrén; Gil, José A.; Mateos, Luís M.
2006-01-01
The genes involved in gluconate catabolism (gntP and gntK) in Corynebacterium glutamicum are scattered in the chromosome, and no regulatory genes are apparently associated with them, in contrast with the organization of the gnt operon in Escherichia coli and Bacillus subtilis. In C. glutamicum, gntP and gntK are essential genes when gluconate is the only carbon and energy source. Both genes contain upstream regulatory regions consisting of a typical promoter and a hypothetical cyclic AMP (cAMP) receptor protein (CRP) binding region but lack the expected consensus operator region for binding of the GntR repressor protein. Expression analysis by Northern blotting showed monocistronic transcripts for both genes. The expression of gntP and gntK is not induced by gluconate, and the gnt genes are subject to catabolite repression by sugars, such as glucose, fructose, and sucrose, as was detected by quantitative reverse transcription-PCR (qRT-PCR). Specific analysis of the DNA promoter sequences (PgntK and PgntP) was performed using bifunctional promoter probe vectors containing mel (involved in melanin production) or egfp2 (encoding a green fluorescent protein derivative) as the reporter gene. Using this approach, we obtained results parallel to those from qRT-PCR. An applied example of in vivo gene expression modulation of the divIVA gene in C. glutamicum is shown, corroborating the possible use of the gnt promoters to control gene expression. glxR (which encodes GlxR, the hypothetical CRP protein) was subcloned from the C. glutamicum chromosomal DNA and overexpressed in corynebacteria; we found that the level of gnt expression was slightly decreased compared to that of the control strains. The purified GlxR protein was used in gel shift mobility assays, and a specific interaction of GlxR with sequences present on PgntP and PgntK fragments was detected only in the presence of cAMP. PMID:16385030
Letek, Michal; Valbuena, Noelia; Ramos, Angelina; Ordóñez, Efrén; Gil, José A; Mateos, Luís M
2006-01-01
The genes involved in gluconate catabolism (gntP and gntK) in Corynebacterium glutamicum are scattered in the chromosome, and no regulatory genes are apparently associated with them, in contrast with the organization of the gnt operon in Escherichia coli and Bacillus subtilis. In C. glutamicum, gntP and gntK are essential genes when gluconate is the only carbon and energy source. Both genes contain upstream regulatory regions consisting of a typical promoter and a hypothetical cyclic AMP (cAMP) receptor protein (CRP) binding region but lack the expected consensus operator region for binding of the GntR repressor protein. Expression analysis by Northern blotting showed monocistronic transcripts for both genes. The expression of gntP and gntK is not induced by gluconate, and the gnt genes are subject to catabolite repression by sugars, such as glucose, fructose, and sucrose, as was detected by quantitative reverse transcription-PCR (qRT-PCR). Specific analysis of the DNA promoter sequences (PgntK and PgntP) was performed using bifunctional promoter probe vectors containing mel (involved in melanin production) or egfp2 (encoding a green fluorescent protein derivative) as the reporter gene. Using this approach, we obtained results parallel to those from qRT-PCR. An applied example of in vivo gene expression modulation of the divIVA gene in C. glutamicum is shown, corroborating the possible use of the gnt promoters to control gene expression. glxR (which encodes GlxR, the hypothetical CRP protein) was subcloned from the C. glutamicum chromosomal DNA and overexpressed in corynebacteria; we found that the level of gnt expression was slightly decreased compared to that of the control strains. The purified GlxR protein was used in gel shift mobility assays, and a specific interaction of GlxR with sequences present on PgntP and PgntK fragments was detected only in the presence of cAMP.
da Fonseca, Allex Jardim; Galvão, Renata Silva; Miranda, Angelica Espinosa; Ferreira, Luiz Carlos de Lima; Chen, Zigui
2016-05-01
To compare the diagnostic performance for HPV infection using three laboratorial techniques. Ninty-five cervicovaginal samples were randomly selected; each was tested for HPV DNA and genotypes using 3 methods in parallel: Multiplex-PCR, the Nested PCR followed by Sanger sequencing, and the Next_Gen Sequencing (NGS) with two assays (NGS-A1, NGS-A2). The study was approved by the Brazilian National IRB (CONEP protocol 16,800). The prevalence of HPV by the NGS assays was higher than that using the Multiplex-PCR (64.2% vs. 45.2%, respectively; P = 0.001) and the Nested-PCR (64.2% vs. 49.5%, respectively; P = 0.003). NGS also showed better performance in detecting high-risk HPV (HR-HPV) and HPV16. There was a weak interobservers agreement between the results of Multiplex-PCR and Nested-PCR in relation to NGS for the diagnosis of HPV infection, and a moderate correlation for HR-HPV detection. Both NGS assays showed a strong correlation for detection of HPVs (k = 0.86), HR-HPVs (k = 0.91), HPV16 (k = 0.92) and HPV18 (k = 0.91). NGS is more sensitive than the traditional Sanger sequencing and the Multiplex PCR to genotype HPVs, with promising ability to detect multiple infections, and may have the potential to establish an alternative method for the diagnosis and genotyping of HPV. © 2015 Wiley Periodicals, Inc.
Fine-tuning structural RNA alignments in the twilight zone
2010-01-01
Background A widely used method to find conserved secondary structure in RNA is to first construct a multiple sequence alignment, and then fold the alignment, optimizing a score based on thermodynamics and covariance. This method works best around 75% sequence similarity. However, in a "twilight zone" below 55% similarity, the sequence alignment tends to obscure the covariance signal used in the second phase. Therefore, while the overall shape of the consensus structure may still be found, the degree of conservation cannot be estimated reliably. Results Based on a combination of available methods, we present a method named planACstar for improving structure conservation in structural alignments in the twilight zone. After constructing a consensus structure by alignment folding, planACstar abandons the original sequence alignment, refolds the sequences individually, but consistent with the consensus, aligns the structures, irrespective of sequence, by a pure structure alignment method, and derives an improved sequence alignment from the alignment of structures, to be re-submitted to alignment folding, etc.. This circle may be iterated as long as structural conservation improves, but normally, one step suffices. Conclusions Employing the tools ClustalW, RNAalifold, and RNAforester, we find that for sequences with 30-55% sequence identity, structural conservation can be improved by 10% on average, with a large variation, measured in terms of RNAalifold's own criterion, the structure conservation index. PMID:20433706
Yang, Litao; Xu, Songci; Pan, Aihu; Yin, Changsong; Zhang, Kewei; Wang, Zhenying; Zhou, Zhigang; Zhang, Dabing
2005-11-30
Because of the genetically modified organisms (GMOs) labeling policies issued in many countries and areas, polymerase chain reaction (PCR) methods were developed for the execution of GMO labeling policies, such as screening, gene specific, construct specific, and event specific PCR detection methods, which have become a mainstay of GMOs detection. The event specific PCR detection method is the primary trend in GMOs detection because of its high specificity based on the flanking sequence of the exogenous integrant. This genetically modified maize, MON863, contains a Cry3Bb1 coding sequence that produces a protein with enhanced insecticidal activity against the coleopteran pest, corn rootworm. In this study, the 5'-integration junction sequence between the host plant DNA and the integrated gene construct of the genetically modified maize MON863 was revealed by means of thermal asymmetric interlaced-PCR, and the specific PCR primers and TaqMan probe were designed based upon the revealed 5'-integration junction sequence; the conventional qualitative PCR and quantitative TaqMan real-time PCR detection methods employing these primers and probes were successfully developed. In conventional qualitative PCR assay, the limit of detection (LOD) was 0.1% for MON863 in 100 ng of maize genomic DNA for one reaction. In the quantitative TaqMan real-time PCR assay, the LOD and the limit of quantification were eight and 80 haploid genome copies, respectively. In addition, three mixed maize samples with known MON863 contents were detected using the established real-time PCR systems, and the ideal results indicated that the established event specific real-time PCR detection systems were reliable, sensitive, and accurate.
A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis
Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo
2012-01-01
In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223
Best, Katharine; Oakes, Theres; Heather, James M.; Shawe-Taylor, John; Chain, Benny
2015-01-01
The polymerase chain reaction (PCR) is one of the most widely used techniques in molecular biology. In combination with High Throughput Sequencing (HTS), PCR is widely used to quantify transcript abundance for RNA-seq, and in the context of analysis of T and B cell receptor repertoires. In this study, we combine DNA barcoding with HTS to quantify PCR output from individual target molecules. We develop computational tools that simulate both the PCR branching process itself, and the subsequent subsampling which typically occurs during HTS sequencing. We explore the influence of different types of heterogeneity on sequencing output, and compare them to experimental results where the efficiency of amplification is measured by barcodes uniquely identifying each molecule of starting template. Our results demonstrate that the PCR process introduces substantial amplification heterogeneity, independent of primer sequence and bulk experimental conditions. This heterogeneity can be attributed both to inherited differences between different template DNA molecules, and the inherent stochasticity of the PCR process. The results demonstrate that PCR heterogeneity arises even when reaction and substrate conditions are kept as constant as possible, and therefore single molecule barcoding is essential in order to derive reproducible quantitative results from any protocol combining PCR with HTS. PMID:26459131
Liu, Jia; Guo, Jinchao; Zhang, Haibo; Li, Ning; Yang, Litao; Zhang, Dabing
2009-11-25
Various polymerase chain reaction (PCR) methods were developed for the execution of genetically modified organism (GMO) labeling policies, of which an event-specific PCR detection method based on the flanking sequence of exogenous integration is the primary trend in GMO detection due to its high specificity. In this study, the 5' and 3' flanking sequences of the exogenous integration of MON89788 soybean were revealed by thermal asymmetric interlaced PCR. The event-specific PCR primers and TaqMan probe were designed based upon the revealed 5' flanking sequence, and the qualitative and quantitative PCR assays were established employing these designed primers and probes. In qualitative PCR, the limit of detection (LOD) was about 0.01 ng of genomic DNA corresponding to 10 copies of haploid soybean genomic DNA. In the quantitative PCR assay, the LOD was as low as two haploid genome copies, and the limit of quantification was five haploid genome copies. Furthermore, the developed PCR methods were in-house validated by five researchers, and the validated results indicated that the developed event-specific PCR methods can be used for identification and quantification of MON89788 soybean and its derivates.
Characterization of an outbreak of astroviral diarrhea in a group of cheetahs (Acinonyx jubatus).
Atkins, Adrienne; Wellehan, James F X; Childress, April L; Archer, Linda L; Fraser, William A; Citino, Scott B
2009-04-14
A Mamastrovirus was identified in an outbreak of diarrhea in cheetahs (Acinonyx jubatus). Five young adult and two adult cheetahs presented with lethargy, anorexia, watery diarrhea and regurgitation over an 11-day period. Fecal samples were submitted for electron microscopy and culture. Electron microscopy results revealed particles morphologically consistent with an astrovirus, and no other viral pathogens or significant bacterial pathogens were identified. The astrovirus was confirmed and sequenced using consensus astroviral PCR, resulting in a 367 base pair partial RNA-dependent-RNA polymerase (RdRp) product and a 628 base pair partial capsid product. Bayesian and maximum likelihood phylogenetic analyses were performed on both the RdRp and the capsid protein segments. All animals were monitored and treated with bismuth subsalicylate tablets (524mg PO BID for 5 days), and recovered without additional intervention. This is the first report we are aware of documenting an astrovirus outbreak in cheetah.
Ceccarelli, Marcello; Galluzzi, Luca; Diotallevi, Aurora; Andreoni, Francesca; Fowler, Hailie; Petersen, Christine; Vitale, Fabrizio; Magnani, Mauro
2017-05-16
Leishmaniasis is a neglected disease caused by many Leishmania species, belonging to subgenera Leishmania (Leishmania) and Leishmania (Viannia). Several qPCR-based molecular diagnostic approaches have been reported for detection and quantification of Leishmania species. Many of these approaches use the kinetoplast DNA (kDNA) minicircles as the target sequence. These assays had potential cross-species amplification, due to sequence similarity between Leishmania species. Previous works demonstrated discrimination between L. (Leishmania) and L. (Viannia) by SYBR green-based qPCR assays designed on kDNA, followed by melting or high-resolution melt (HRM) analysis. Importantly, these approaches cannot fully distinguish L. (L.) infantum from L. (L.) amazonensis, which can coexist in the same geographical area. DNA from 18 strains/isolates of L. (L.) infantum, L. (L.) amazonensis, L. (V.) braziliensis, L. (V.) panamensis, L. (V.) guyanensis, and 62 clinical samples from L. (L.) infantum-infected dogs were amplified by a previously developed qPCR (qPCR-ML) and subjected to HRM analysis; selected PCR products were sequenced using an ABI PRISM 310 Genetic Analyzer. Based on the obtained sequences, a new SYBR-green qPCR assay (qPCR-ama) intended to amplify a minicircle subclass more abundant in L. (L.) amazonensis was designed. The qPCR-ML followed by HRM analysis did not allow discrimination between L. (L.) amazonensis and L. (L.) infantum in 53.4% of cases. Hence, the novel SYBR green-based qPCR (qPCR-ama) has been tested. This assay achieved a detection limit of 0.1 pg of parasite DNA in samples spiked with host DNA and did not show cross amplification with Trypanosoma cruzi or host DNA. Although the qPCR-ama also amplified L. (L.) infantum strains, the C q values were dramatically increased compared to qPCR-ML. Therefore, the combined analysis of C q values from qPCR-ML and qPCR-ama allowed to distinguish L. (L.) infantum and L. (L.) amazonensis in 100% of tested samples. A new and affordable SYBR-green qPCR-based approach to distinguish between L. (L.) infantum and L. (L.) amazonensis was developed exploiting the major abundance of a minicircle sequence rather than targeting a hypothetical species-specific sequence. The fast and accurate discrimination between these species can be useful to provide adequate prognosis and treatment.
FUNGAL-SPECIFIC PCR PRIMERS DEVELOPED FOR ANALYSIS OF THE ITS REGION OF ENVIRONMENTAL DNA EXTRACTS
Background The Internal Transcribed Spacer (ITS) regions of fungal ribosomal DNA (rDNA) are highly variable sequences of great importance in distinguishing fungal species by PCR analysis. Previously published PCR primers available for amplifying these sequences from environmenta...
Chander, Vishal; Chakravarti, Soumendu; Gupta, Vikas; Nandi, Sukdeb; Singh, Mithilesh; Badasara, Surendra Kumar; Sharma, Chhavi; Mittal, Mitesh; Dandapat, S; Gupta, V K
2016-12-01
Canine parvovirus-2 antigenic variants (CPV-2a, CPV-2b and CPV-2c) ubiquitously distributed worldwide in canine population causes severe fatal gastroenteritis. Antigenic typing of CPV-2 remains a prime focus of research groups worldwide in understanding the disease epidemiology and virus evolution. The present study was thus envisioned to provide a simple sequencing independent, rapid, robust, specific, user-friendly technique for detecting and typing of presently circulating CPV-2 antigenic variants. ARMS-PCR strategy was employed using specific primers for CPV-2a, CPV-2b and CPV-2c to differentiate these antigenic types. ARMS-PCR was initially optimized with reference positive controls in two steps; where first reaction was used to differentiate CPV-2a from CPV-2b/CPV-2c. The second reaction was carried out with CPV-2c specific primers to confirm the presence of CPV-2c. Initial validation of the ARMS-PCR was carried out with 24 sequenced samples and the results were matched with the sequencing results. ARMS-PCR technique was further used to screen and type 90 suspected clinical samples. Randomly selected 15 suspected clinical samples that were typed with this technique were sequenced. The results of ARMS-PCR and the sequencing matched exactly with each other. The developed technique has a potential to become a sequencing independent method for simultaneous detection and typing of CPV-2 antigenic variants in veterinary disease diagnostic laboratories globally. Copyright © 2016 Elsevier B.V. All rights reserved.
Barbano, Raffaela; Pasculli, Barbara; Coco, Michelina; Fontana, Andrea; Copetti, Massimiliano; Rendina, Michelina; Valori, Vanna Maria; Graziano, Paolo; Maiello, Evaristo; Fazio, Vito Michele; Parrella, Paola
2015-01-01
BRAF codon 600 mutation testing of melanoma patients is mandatory for the choice of the most appropriate therapy in the clinical setting. Competitive allele specific TaqMan PCR (Cast-PCR) technology allows not only the selective amplification of minor alleles, but it also blocks the amplification of non-mutant allele. We genotyped codon 600 of the BRAF gene in 54 patients’ samples by Cast-PCR and bidirectional direct sequence analysis. All the mutations detected by sequencing were also identified by Cast-PCR. In addition, Cast-PCR assay detected four samples carrying mutations and was able to clearly identify two mutations of uncertain interpretation by Sanger sequencing. The limit of detection of Cast-PCR was evaluated by constructing dilution curves of BRAFV600E and BRAFV600K mutated clinical samples mixed with a not-mutated specimens. Both mutations could be detected until a 1:100 mutated/not mutated ratio. Cloning and sequencing of the clones was used to confirm mutations on representative discrepant cases. Cast PCR performances were not affected by intratumour heterogeneity, and less affected by melanin content. Our results indicate that Cast-PCR is a reliable diagnostic tool for the identification of melanoma patients as eligible to be treated with TKIs and might be implemented in the clinical setting as elective screening method. PMID:26690267
[Application of Nested PCR in the Diagnosis of Imported Plasmodium Ovale Infection].
Huang, Bing-cheng; Xu, Chao; Li, Jin; Xiao, Ting; Yin, Kun; Liu, Gong-zhen; Wang, Wei-yan; Zhao, Gui-hua; Wei, Yan-bin; Wang, Yong-bin; Zhao, Chang-lei; Wei, Qing-kuan
2015-02-01
To identity Plasmodium ovale infection by 18S rRNA gene nested PCR. Whole blood and filter paper blood samples of malaria patients in Shandong Province were collected during 2012-2013. The parasites were observed under a microscope with Giemsa staining. The genome DNA of blood samples were extracted as PCR templates. Genus- and species-specific primers were designed according to the Plasmodium 18S rRNA gene sequences. Plasmodium ovale-positive specimens were identified by nested PCR as well as verified by sequencing. There were 7 imported cases of P. ovale infection in the province during 2012-2013. Nested PCR results showed that the P. ovale specific band (800 bp) was amplified in all the 7 specimens. Blast results indicated that the PCR products were consistent with the Plasmodium ovale reference sequence in GenBank. Seven imported cases of ovale malaria in Shandong Province in 2012-2013 are confirmed by nested PCR.
Unveiling the Hybrid Genome Structure of Escherichia coli RR1 (HB101 RecA+)
Jeong, Haeyoung; Sim, Young Mi; Kim, Hyun Ju; Lee, Sang Jun
2017-01-01
There have been extensive genome sequencing studies for Escherichia coli strains, particularly for pathogenic isolates, because fast determination of pathogenic potential and/or drug resistance and their propagation routes is crucial. For laboratory E. coli strains, however, genome sequence information is limited except for several well-known strains. We determined the complete genome sequence of laboratory E. coli strain RR1 (HB101 RecA+), which has long been used as a general cloning host. A hybrid genome sequence of K-12 MG1655 and B BL21(DE3) was constructed based on the initial mapping of Illumina HiSeq reads to each reference, and iterative rounds of read mapping, variant detection, and consensus extraction were carried out. Finally, PCR and Sanger sequencing-based finishing were applied to resolve non-single nucleotide variant regions with aberrant read depths and breakpoints, most of them resulting from prophages and insertion sequence transpositions that are not present in the reference genome sequence. We found that 96.9% of the RR1 genome is derived from K-12, and identified exact crossover junctions between K-12 and B genomic fragments. However, because RR1 has experienced a series of genetic manipulations since branching from the common ancestor, it has a set of mutations different from those found in K-12 MG1655. As well as identifying all known genotypes of RR1 on the basis of genomic context, we found novel mutations. Our results extend current knowledge of the genotype of RR1 and its relatives, and provide insights into the pedigree, genomic background, and physiology of common laboratory strains. PMID:28421066
Analysis of Multiallelic CNVs by Emulsion Haplotype Fusion PCR.
Tyson, Jess; Armour, John A L
2017-01-01
Emulsion-fusion PCR recovers long-range sequence information by combining products in cis from individual genomic DNA molecules. Emulsion droplets act as very numerous small reaction chambers in which different PCR products from a single genomic DNA molecule are condensed into short joint products, to unite sequences in cis from widely separated genomic sites. These products can therefore provide information about the arrangement of sequences and variants at a larger scale than established long-read sequencing methods. The method has been useful in defining the phase of variants in haplotypes, the typing of inversions, and determining the configuration of sequence variants in multiallelic CNVs. In this description we outline the rationale for the application of emulsion-fusion PCR methods to the analysis of multiallelic CNVs, and give practical details for our own implementation of the method in that context.
Rogan, P K; Schneider, T D
1995-01-01
Predicting the effects of nucleotide substitutions in human splice sites has been based on analysis of consensus sequences. We used a graphic representation of sequence conservation and base frequency, the sequence logo, to demonstrate that a change in a splice acceptor of hMSH2 (a gene associated with familial nonpolyposis colon cancer) probably does not reduce splicing efficiency. This confirms a population genetic study that suggested that this substitution is a genetic polymorphism. The information theory-based sequence logo is quantitative and more sensitive than the corresponding splice acceptor consensus sequence for detection of true mutations. Information analysis may potentially be used to distinguish polymorphisms from mutations in other types of transcriptional, translational, or protein-coding motifs.
Mason, Amy; Foster, Dona; Bradley, Phelim; Golubchik, Tanya; Doumith, Michel; Gordon, N Claire; Pichon, Bruno; Iqbal, Zamin; Staves, Peter; Crook, Derrick; Walker, A Sarah; Kearns, Angela; Peto, Tim
2018-06-20
Background : In principle, whole genome sequencing (WGS) can predict phenotypic resistance directly from genotype, replacing laboratory-based tests. However, the contribution of different bioinformatics methods to genotype-phenotype discrepancies has not been systematically explored to date. Methods : We compared three WGS-based bioinformatics methods (Genefinder (read-based), Mykrobe (de Bruijn graph-based) and Typewriter (BLAST-based)) for predicting presence/absence of 83 different resistance determinants and virulence genes, and overall antimicrobial susceptibility, in 1379 Staphylococcus aureus isolates previously characterised by standard laboratory methods (disc diffusion, broth and/or agar dilution and PCR). Results : 99.5% (113830/114457) of individual resistance-determinant/virulence gene predictions were identical between all three methods, with only 627 (0.5%) discordant predictions, demonstrating high overall agreement (Fliess-Kappa=0.98, p<0.0001). Discrepancies when identified were in only one of the three methods for all genes except the cassette recombinase, ccrC(b ). Genotypic antimicrobial susceptibility prediction matched laboratory phenotype in 98.3% (14224/14464) cases (2720 (18.8%) resistant, 11504 (79.5%) susceptible). There was greater disagreement between the laboratory phenotypes and the combined genotypic predictions (97 (0.7%) phenotypically-susceptible but all bioinformatic methods reported resistance; 89 (0.6%) phenotypically-resistant, but all bioinformatics methods reported susceptible) than within the three bioinformatics methods (54 (0.4%) cases, 16 phenotypically-resistant, 38 phenotypically-susceptible). However, in 36/54 (67%), the consensus genotype matched the laboratory phenotype. Conclusions : In this study, the choice between these three specific bioinformatic methods to identify resistance-determinants or other genes in S. aureus did not prove critical, with all demonstrating high concordance with each other and phenotypic/molecular methods. However, each has some limitations and therefore consensus methods provide some assurance. Copyright © 2018 American Society for Microbiology.
Costa, Maria Eduarda S M; Oliveira, Claudio Bruno S; Andrade, Joelma Maria de A; Medeiros, Thatiany A; Neto, Valter F Andrade; Lanza, Daniel C F
2016-07-01
Toxoplasma gondii is a widespread parasite able to infect virtually any nucleated cells of warm-blooded hosts. In some cases, T. gondii detection using already developed PCR primers can be inefficient in routine laboratory tests, especially to detect atypical strains. Here we report a new nested-PCR protocol able to detect virtually all T. gondii isolates. Analyzing 685 sequences available in GenBank, we determine that GRA7 is one of the most conserved genes of T. gondii genome. Based on an alignment of 85 GRA7 sequences new primer sets that anneal in the highly conserved regions of this gene were designed. The new GRA7 nested-PCR assay providing sensitivity and specificity equal to or greater than the gold standard PCR assays for T. gondii detection, that amplify the B1 sequence or the repetitive 529bp element. Copyright © 2016 Elsevier B.V. All rights reserved.
Li, Yi; Sun, Hong-chen; Guo, Xue-jun; Feng, Shu-zhang
2005-02-01
To clone the recombinant fusion gene of Escherichia coli heat-liable enterotoxin B subunit (Ltb) and Actinobacillus actinomycetemcomitans fimbria associative protein (Fap). Two couples of primers were designed for PCR according to the known sequence of ltb and fap. The ltb and fap gene were obtained by amplification PCR technique from plasmid EWD299 of Escherichia coli and Actinobacillus actinomycetemcomitans 310 DNA respectively, and fused them by PCR. The fusion gene ltb-fap were cloning into plasmid pET28a(+). The recombined plasmid pET28a ltb-fap was transformed into Escherichia coli DH5alpha. The recombinant was screened and identified by restriction enzyme and PCR. The cloned gene was sequenced. The ltb-fap about 531bp in size was obtained successfully, and identified by PCR, restrictive enzyme and sequence analysis. The vector of pET28a ltb-fap was obtained.
Sun, Shumei; Zhou, Hao; Zhou, Bin; Hu, Ziyou; Hou, Jinlin; Sun, Jian
2012-05-01
To evaluate the sensitivity and specificity of nested PCR combined with pyrosequencing in the detection of HBV drug-resistance gene. RtM204I (ATT) mutant and rtM204 (ATG) nonmutant plasmids mixed at different ratios were detected for mutations using nested-PCR combined with pyrosequencing, and the results were compared with those by conventional PCR pyrosequencing to analyze the linearity and consistency of the two methods. Clinical specimens with different viral loads were examined for drug-resistant mutations using nested PCR pyrosequencing and nested PCR combined with dideoxy sequencing (Sanger) for comparison of the detection sensitivity and specificity. The fitting curves demonstrated good linearity of both conventional PCR pyrosequencing and nested PCR pyrosequencing (R(2)>0.99, P<0.05). Nested PCR showed a better consistency with the predicted value than conventional PCR, and was superior to conventional PCR for detection of samples containing 90% mutant plasmid. In the detection of clinical specimens, Sanger sequencing had a significantly lower sensitivity than nested PCR pyrosequencing (92% vs 100%, P<0.01). The detection sensitivity of Sanger sequencing varied with the viral loads, especially in samples with low viral copies (HBV DNA ≤3log10 copies/ml), where the sensitivity was 78%, significantly lower than that of pyrosequencing (100%, P<0.01). Neither of the two methods yielded positive results for the negative control samples, suggesting their good specificity. Compared with nested PCR and Sanger sequencing method, nested PCR pyrosequencing has a higher sensitivity especially in clinical specimens with low viral copies, which can be important for early detection of HBV mutant strains and hence more effective clinical management.
Hamilton, P T; Reeve, J N
1985-01-01
DNA fragments cloned from the methanogenic archaebacterium Methanobrevibacter smithii which complement mutations in the purE and proC genes of E. coli have been sequenced. Sequence analyses, transposon mutagenesis and expression in E. coli minicells indicate that purE and proC complementations result from the synthesis of M. smithii polypeptides with molecular weights of 36,697 and 27,836 respectively. The encoding genes appear to be located in operons. The M. smithii genome contains 69% A/T basepairs (bp) which is reflected in unusual codon usages and intergenic regions containing approximately 85% A/T bp. An insertion element, designated ISM1, was found within the cloned M. smithii DNA located adjacent to the proC complementing region. ISM1 is 1381 bp in length, has 29 bp terminal inverted repeat sequences and contains one major ORF encoded in 87% of the ISM1 sequence. ISM1 is mobile, present in approximately 10 copies per genome and integration duplicates 8 bp at the site of insertion. The duplicated sequences show homology with sequences within the 29 bp terminal repeat sequence of ISM1. Comparison of our data with sequences from halophilic archaebacteria suggests that 5'GAANTTTCA and 5'TTTTAATATAAA may be consensus promoter sequences for archaebacteria. These sequences closely resemble the consensus sequences which precede Drosophila heat-shock genes (Pelham 1982; Davidson et al. 1983). Methanogens appear to employ the eubacterial system of mRNA: 16SrRNA hybridization to ensure initiation of translation; the consensus ribosome binding sequence is 5'AGGTGA.
El-Assaad, Atlal; Dawy, Zaher; Nemer, Georges; Hajj, Hazem; Kobeissy, Firas H
2017-01-01
Degradomics is a novel discipline that involves determination of the proteases/substrate fragmentation profile, called the substrate degradome, and has been recently applied in different disciplines. A major application of degradomics is its utility in the field of biomarkers where the breakdown products (BDPs) of different protease have been investigated. Among the major proteases assessed, calpain and caspase proteases have been associated with the execution phases of the pro-apoptotic and pro-necrotic cell death, generating caspase/calpain-specific cleaved fragments. The distinction between calpain and caspase protein fragments has been applied to distinguish injury mechanisms. Advanced proteomics technology has been used to identify these BDPs experimentally. However, it has been a challenge to identify these BDPs with high precision and efficiency, especially if we are targeting a number of proteins at one time. In this chapter, we present a novel bioinfromatic detection method that identifies BDPs accurately and efficiently with validation against experimental data. This method aims at predicting the consensus sequence occurrences and their variants in a large set of experimentally detected protein sequences based on state-of-the-art sequence matching and alignment algorithms. After detection, the method generates all the potential cleaved fragments by a specific protease. This space and time-efficient algorithm is flexible to handle the different orientations that the consensus sequence and the protein sequence can take before cleaving. It is O(mn) in space complexity and O(Nmn) in time complexity, with N number of protein sequences, m length of the consensus sequence, and n length of each protein sequence. Ultimately, this knowledge will subsequently feed into the development of a novel tool for researchers to detect diverse types of selected BDPs as putative disease markers, contributing to the diagnosis and treatment of related disorders.
Kozutsumi, Daisuke; Tsunematsu, Masako; Yamaji, Taketo; Kino, Kohsuke
2007-01-01
Cry-consensus peptide is a linearly linked peptide of T-cell epitopes for the management of Japanese cedar (JC) pollinosis and is expected to become a new drug for immunotherapy. However, the mechanism of T-cell epitopes in allergic diseases is not well understood, and thus, a simple in vitro procedure for evaluation of its biological activity is desired. Peripheral blood mononuclear cells (PBMC) were isolated from 27 JC pollinosis patients and 10 healthy subjects, and cultured in vitro for 4 days in the presence of Cry-consensus peptide and (3)H-thymidine. The relationship between growth stimulation (stimulation index; SI) and antigen-specific IgE levels in serum was also investigated in JC pollinosis patients. Moreover, to confirm the importance of the primary sequence in Cry-consensus peptide, heat-treated Cry-consensus peptide and a mixture of the amino acids of which Cry-consensus peptide is composed, and their (3)H-thymidine uptake was compared with Cry-consensus peptide. Finally, whether Cry-consensus peptide stimulates PBMCs from healthy subjects was investigated. The mean SI of JC patients showed a good correlation with Cry-consensus peptide concentration in the culture medium; however, the SI was independent of the anti-Cry j 1 IgE level. Heat-denatured Cry-consensus peptide retained a PBMC proliferation stimulatory effect comparable to the original Cry-consensus peptide, while the mixture of amino acids constituting Cry-consensus peptide did not stimulate PBMC proliferation. PBMCs from healthy subjects did not respond to Cry-consensus peptide at all. These data indicate that the PBMC response of patients suffering from JC pollinosis to Cry-consensus peptide is specific for the sequence of T cell epitopes thereof and may be useful for the evaluation of the efficacy of Cry-consensus peptide in vivo.
The LAM-PCR Method to Sequence LV Integration Sites.
Wang, Wei; Bartholomae, Cynthia C; Gabriel, Richard; Deichmann, Annette; Schmidt, Manfred
2016-01-01
Integrating viral gene transfer vectors are commonly used gene delivery tools in clinical gene therapy trials providing stable integration and continuous gene expression of the transgene in the treated host cell. However, integration of the reverse-transcribed vector DNA into the host genome is a potentially mutagenic event that may directly contribute to unwanted side effects. A comprehensive and accurate analysis of the integration site (IS) repertoire is indispensable to study clonality in transduced cells obtained from patients undergoing gene therapy and to identify potential in vivo selection of affected cell clones. To date, next-generation sequencing (NGS) of vector-genome junctions allows sophisticated studies on the integration repertoire in vitro and in vivo. We have explored the use of the Illumina MiSeq Personal Sequencer platform to sequence vector ISs amplified by non-restrictive linear amplification-mediated PCR (nrLAM-PCR) and LAM-PCR. MiSeq-based high-quality IS sequence retrieval is accomplished by the introduction of a double-barcode strategy that substantially minimizes the frequency of IS sequence collisions compared to the conventionally used single-barcode protocol. Here, we present an updated protocol of (nr)LAM-PCR for the analysis of lentiviral IS using a double-barcode system and followed by deep sequencing using the MiSeq device.
Molecular diagnosis of lyssaviruses and sequence comparison of Australian bat lyssavirus samples.
Foord, A J; Heine, H G; Pritchard, L I; Lunt, R A; Newberry, K M; Rootes, C L; Boyle, D B
2006-07-01
To evaluate and implement molecular diagnostic tests for the detection of lyssaviruses in Australia. A published hemi-nested reverse transcriptase polymerase chain reaction (RT-PCR) for the detection of all lyssavirus genotypes was modified to a fully nested RT-PCR format and compared with the original assay. TaqMan assays for the detection of Australian bat lyssavirus (ABLV) were compared with both the nested and hemi-nested RT-PCR assays. The sequences of RT-PCR products were determined to assess sequence variations of the target region (nucleocapsid gene) in samples of ABLV originating from different regions. The nested RT-PCR assay was highly analytically specific, and at least as analytically sensitive as the hemi-nested assay. The TaqMan assays were highly analytically specific and more analytically sensitive than either RT-PCR assay, with a detection level of approximately 10 genome equivalents per microl. Sequence of the first 544 nucleotides of the nucleocapsid protein coding sequence was obtained from all samples of ABLV received at Australian Animal Health Laboratory during the study period. The nested RT-PCR provided a means for molecular diagnosis of all tested genotypes of lyssavirus including classical rabies virus and Australian bat lyssavirus. The published TaqMan assay proved to be superior to the RT-PCR assays for the detection of ABLV in terms of analytical sensitivity. The TaqMan assay would also be faster and cross contamination is less likely. Nucleotide sequence analyses of samples of ABLV from a wide geographical range in Australia demonstrated the conserved nature of this region of the genome and therefore the suitability of this region for molecular diagnosis.
Plucienniczak, A; Schroeder, E; Zettlmeissl, G; Streeck, R E
1985-01-01
The nucleotide sequence of a 7.6 kb vaccinia DNA segment from a genomic region conserved among different orthopox virus has been determined. This segment contains a tight cluster of 12 partly overlapping open reading frames most of which can be correlated with previously identified early and late proteins and mRNAs. Regulatory signals used by vaccinia virus have been studied. Presumptive promoter regions are rich in A, T and carry the consensus sequences TATA and AATAA spaced at 20-24 base pairs. Tandem repeats of a CTATTC consensus sequence are proposed to be involved in the termination of early transcription. PMID:2987815
Ishihara, Satoru; Kotomura, Naoe; Yamamoto, Naoki; Ochiai, Hiroshi
2017-08-15
Ligation-mediated polymerase chain reaction (LM-PCR) is a common technique for amplification of a pool of DNA fragments. Here, a double-stranded oligonucleotide consisting of two primer sequences in back-to-back orientation was designed as an adapter for LM-PCR. When DNA fragments were ligated with this adapter, the fragments were sandwiched between two adapters in random orientations. In the ensuing PCR, ligation products linked at each end to an opposite side of the adapter, i.e. to a distinct primer sequence, were preferentially amplified compared with products linked at each end to an identical primer sequence. The use of this adapter in LM-PCR reduced the impairment of PCR by substrate DNA with a high GC content, compared with the use of traditional LM-PCR adapters. This result suggested that our method has the potential to contribute to reduction of the amplification bias that is caused by an intrinsic property of the sequence context in substrate DNA. A DNA preparation obtained from a chromatin immunoprecipitation assay using pulldown of a specific form of histone H3 was successfully amplified using the modified LM-PCR, and the amplified products could be used as probes in a fluorescence in situ hybridization analysis. Copyright © 2017 Elsevier Inc. All rights reserved.
Luft, F; Klaes, R; Nees, M; Dürst, M; Heilmann, V; Melsheimer, P; von Knebel Doeberitz, M
2001-04-01
Human papillomavirus (HPV) genomes usually persist as episomal molecules in HPV associated preneoplastic lesions whereas they are frequently integrated into the host cell genome in HPV-related cancers cells. This suggests that malignant conversion of HPV-infected epithelia is linked to recombination of cellular and viral sequences. Due to technical limitations, precise sequence information on viral-cellular junctions were obtained only for few cell lines and primary lesions. In order to facilitate the molecular analysis of genomic HPV integration, we established a ligation-mediated PCR assay for the detection of integrated papillomavirus sequences (DIPS-PCR). DIPS-PCR was initially used to amplify genomic viral-cellular junctions from HPV-associated cervical cancer cell lines (C4-I, C4-II, SW756, and HeLa) and HPV-immortalized keratinocyte lines (HPKIA, HPKII). In addition to junctions already reported in public data bases, various new fusion fragments were identified. Subsequently, 22 different viral-cellular junctions were amplified from 17 cervical carcinomas and 1 vulval intraepithelial neoplasia (VIN III). Sequence analysis of each junction revealed that the viral E1 open reading frame (ORF) was fused to cellular sequences in 20 of 22 (91%) cases. Chromosomal integration loci mapped to chromosomes 1 (2n), 2 (3n), 7 (2n), 8 (3n), 10 (1n), 14 (5n), 16 (1n), 17 (2n), and mitochondrial DNA (1n), suggesting random distribution of chromosomal integration sites. Precise sequence information obtained by DIPS-PCR was further used to monitor the monoclonal origin of 4 cervical cancers, 1 case of recurrent premalignant lesions and 1 lymph node metastasis. Therefore, DIPS-PCR might allow efficient therapy control and prediction of relapse in patients with HPV-associated anogenital cancers. Copyright 2001 Wiley-Liss, Inc.
Strategies to Improve Efficiency and Specificity of Degenerate Primers in PCR.
Campos, Maria Jorge; Quesada, Alberto
2017-01-01
PCR with degenerate primers can be used to identify the coding sequence of an unknown protein or to detect a genetic variant within a gene family. These primers, which are complex mixtures of slightly different oligonucleotide sequences, can be optimized to increase the efficiency and/or specificity of PCR in the amplification of a sequence of interest by the introduction of mismatches with the target sequence and balancing their position toward the primers 5'- or 3'-ends. In this work, we explain in detail examples of rational design of primers in two different applications, including the use of specific determinants at the 3'-end, to: (1) improve PCR efficiency with coding sequences for members of a protein family by fully degeneration at a core box of conserved genetic information, with the reduction of degeneration at the 5'-end, and (2) optimize specificity of allelic discrimination of closely related orthologous by 5'-end degenerate primers.
Laurie, Matthew T; Bertout, Jessica A; Taylor, Sean D; Burton, Joshua N; Shendure, Jay A; Bielas, Jason H
2013-08-01
Due to the high cost of failed runs and suboptimal data yields, quantification and determination of fragment size range are crucial steps in the library preparation process for massively parallel sequencing (or next-generation sequencing). Current library quality control methods commonly involve quantification using real-time quantitative PCR and size determination using gel or capillary electrophoresis. These methods are laborious and subject to a number of significant limitations that can make library calibration unreliable. Herein, we propose and test an alternative method for quality control of sequencing libraries using droplet digital PCR (ddPCR). By exploiting a correlation we have discovered between droplet fluorescence and amplicon size, we achieve the joint quantification and size determination of target DNA with a single ddPCR assay. We demonstrate the accuracy and precision of applying this method to the preparation of sequencing libraries.
Wagner, K; Springer, B; Pires, V P; Keller, P M
2018-05-03
The rising incidence of invasive fungal infections and the expanding spectrum of fungal pathogens makes early and accurate identification of the causative pathogen a daunting task. Diagnostics using molecular markers enable rapid identification of fungi, offer new insights into infectious disease dynamics, and open new possibilities for infectious disease control and prevention. We performed a retrospective study using clinical specimens (N = 233) from patients with suspected fungal infection previously subjected to culture and/or internal transcribed spacer (ITS) PCR. We used these specimens to evaluate a high-throughput screening method for fungal detection using automated DNA extraction (QIASymphony), fungal ribosomal small subunit (18S) rDNA RT-PCR and amplicon sequencing. Fungal sequences were compared with sequences from the curated, commercially available SmartGene IDNS database for pathogen identification. Concordance between 18S rDNA RT-PCR and culture results was 91%, and congruence between 18S rDNA RT-PCR and ITS PCR results was 94%. In addition, 18S rDNA RT-PCR and Sanger sequencing detected fungal pathogens in culture negative (N = 13) and ITS PCR negative specimens (N = 12) from patients with a clinically confirmed fungal infection. Our results support the use of the 18S rDNA RT-PCR diagnostic workflow for rapid and accurate identification of fungal pathogens in clinical specimens.
R2R--software to speed the depiction of aesthetic consensus RNA secondary structures.
Weinberg, Zasha; Breaker, Ronald R
2011-01-04
With continuing identification of novel structured noncoding RNAs, there is an increasing need to create schematic diagrams showing the consensus features of these molecules. RNA structural diagrams are typically made either with general-purpose drawing programs like Adobe Illustrator, or with automated or interactive programs specific to RNA. Unfortunately, the use of applications like Illustrator is extremely time consuming, while existing RNA-specific programs produce figures that are useful, but usually not of the same aesthetic quality as those produced at great cost in Illustrator. Additionally, most existing RNA-specific applications are designed for drawing single RNA molecules, not consensus diagrams. We created R2R, a computer program that facilitates the generation of aesthetic and readable drawings of RNA consensus diagrams in a fraction of the time required with general-purpose drawing programs. Since the inference of a consensus RNA structure typically requires a multiple-sequence alignment, the R2R user annotates the alignment with commands directing the layout and annotation of the RNA. R2R creates SVG or PDF output that can be imported into Adobe Illustrator, Inkscape or CorelDRAW. R2R can be used to create consensus sequence and secondary structure models for novel RNA structures or to revise models when new representatives for known RNA classes become available. Although R2R does not currently have a graphical user interface, it has proven useful in our efforts to create 100 schematic models of distinct noncoding RNA classes. R2R makes it possible to obtain high-quality drawings of the consensus sequence and structural models of many diverse RNA structures with a more practical amount of effort. R2R software is available at http://breaker.research.yale.edu/R2R and as an Additional file.
Navarro, B; Daròs, J A; Flores, R
1996-01-01
Two PCR-based methods are described for obtaining clones of small circular RNAs of unknown sequence and for which only minute amounts are available. To avoid introducing any assumption about the RNA sequence, synthesis of the cDNAs is initiated with random primers. The cDNA population is then PCR-amplified using a primer whose sequence is present at both sides of the cDNAs, since they have been obtained with random hexamers and then a linker with the sequence of the PCR primer has been ligated to their termini, or because the cDNAs have been synthesized with an oligonucleotide that contains the sequence of the PCR primer at its 5' end and six randomized positions at its 3' end. The procedures need only approximately 50 ng of purified RNA template. The reasons for the emergence of cloning artifacts and precautions to avoid them are discussed.
Myamoto, D T; Pidde-Queiroz, G; Pedroso, A; Gonçalves-de-Andrade, R M; van den Berg, C W; Tambourgi, D V
2016-09-01
A transcriptome analysis of the venom glands of the spider Loxosceles laeta, performed by our group, in a previous study (Fernandes-Pedrosa et al., 2008), revealed a transcript with a sequence similar to the human complement component C3. Here we present the analysis of this transcript. cDNA fragments encoding the C3 homologue (Lox-C3) were amplified from total RNA isolated from the venom glands of L. laeta by RACE-PCR. Lox-C3 is a 5178 bps cDNA sequence encoding a 190kDa protein, with a domain configuration similar to human C3. Multiple alignments of C3-like proteins revealed two processing sites, suggesting that Lox-C3 is composed of three chains. Furthermore, the amino acids consensus sequences for the thioester was found, in addition to putative sequences responsible for FB binding. The phylogenetic analysis showed that Lox-C3 belongs to the same group as two C3 isoforms from the spider Hasarius adansoni (Family Salcitidae), showing 53% homology with these. This is the first characterization of a Loxosceles cDNA sequence encoding a human C3 homologue, and this finding, together with our previous finding of the expression of a FB-like molecule, suggests that this spider species also has a complement system. This work will help to improve our understanding of the innate immune system in these spiders and the ancestral structure of C3. Copyright © 2016 Elsevier GmbH. All rights reserved.
Mammeri, H.; Laurans, G.; Eveillard, M.; Castelain, S.; Eb, F.
2001-01-01
In 1996, a monitoring program was initiated at the teaching hospital of Amiens, France, and carried out for 3 years. All extended-spectrum β-lactamase (ESBL)-producing Enterobacter aerogenes isolates recovered from clinical specimens were collected for investigation of their epidemiological relatedness by pulsed-field gel electrophoresis and enterobacterial repetitive intergenic consensus PCR (ERIC-PCR) and determination of the type of ESBL harbored by isoelectric focusing and DNA sequencing. Molecular typing revealed the endemic coexistence, during the first 2 years, of two clones expressing, respectively, SHV-4 and TEM-24 ESBLs, while an outbreak of the TEM-24-producing strain raged in the hospital during the third year, causing the infection or colonization of 165 patients. Furthermore, this strain was identified as the prevalent clone responsible for outbreaks in many French hospitals since 1996. This study shows that TEM-24-producing E. aerogenes is an epidemic clone that is well established in the hospital's ecology and able to spread throughout wards. The management of the outbreak at the teaching hospital of Amiens, which included the reinforcement of infection control measures, failed to obtain complete eradication of the clone, which has become an endemic pathogen. PMID:11376055
Kircanski, Jasmina; Parreira, Valeria R; Whiteside, Samantha; Pei, Yanlong; Prescott, John F
2012-10-12
This study examined the prevalence and expression of the "consensus" and the "atypical"cpb2 genes in Clostridium perfringens isolates from cattle, chickens, dogs, goats, horses, pigs and sheep using polymerase chain reaction (PCR), sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by Western blotting. Almost all porcine isolates (12/14) carried and expressed the consensus form of cpb2 but, when present in 108 non-porcine isolates, the gene was usually the atypical form (40 atypical versus 9 consensus). Western blotting showed expression in 30 of 40 (75%) atypical cpb2-positive isolates, considerably more frequently than reported previously. CPB2 was expressed by almost all (20/21) the consensus cpb2-positive isolates, regardless of source. Copyright © 2012 Elsevier B.V. All rights reserved.
2014-01-01
Background Ambiscript is a graphically-designed nucleic acid notation that uses symbol symmetries to support sequence complementation, highlight biologically-relevant palindromes, and facilitate the analysis of consensus sequences. Although the original Ambiscript notation was designed to easily represent consensus sequences for multiple sequence alignments, the notation’s black-on-white ambiguity characters are unable to reflect the statistical distribution of nucleotides found at each position. We now propose a color-augmented ambigraphic notation to encode the frequency of positional polymorphisms in these consensus sequences. Results We have implemented this color-coding approach by creating an Adobe Flash® application ( http://www.ambiscript.org) that shades and colors modified Ambiscript characters according to the prevalence of the encoded nucleotide at each position in the alignment. The resulting graphic helps viewers perceive biologically-relevant patterns in multiple sequence alignments by uniquely combining color, shading, and character symmetries to highlight palindromes and inverted repeats in conserved DNA motifs. Conclusion Juxtaposing an intuitive color scheme over the deliberate character symmetries of an ambigraphic nucleic acid notation yields a highly-functional nucleic acid notation that maximizes information content and successfully embodies key principles of graphic excellence put forth by the statistician and graphic design theorist, Edward Tufte. PMID:24447494
Mihalov-Kovács, Eszter; Martella, Vito; Lanave, Gianvito; Bodnar, Livia; Fehér, Enikő; Marton, Szilvia; Kemenesi, Gábor; Jakab, Ferenc; Bányai, Krisztián
2017-03-15
Canine astrovirus RNA was detected in the stools of 17/63 (26.9%) samples, using either a broadly reactive consensus RT-PCR for astroviruses or random RT-PCR coupled with massive deep sequencing. The complete or nearly complete genome sequence of five canine astroviruses was reconstructed that allowed mapping the genome organization and to investigate the genetic diversity of these viruses. The genome was about 6.6kb in length and contained three open reading frames (ORFs) flanked by a 5' UTR, and a 3' UTR plus a poly-A tail. ORF1a and ORF1b overlapped by 43 nucleotides while the ORF2 overlapped by 8 nucleotides with the 3' end of ORF1b. Upon genome comparison, four strains (HUN/2012/2, HUN/2012/6, HUN/2012/115, and HUN/2012/135) were more related genetically to each other and to UK canine astroviruses (88-96% nt identity), whilst strain HUN/2012/126 was more divergent (75-76% nt identity). In the ORF1b and ORF2, strains HUN/2012/2, HUN/2012/6, and HUN/2012/135 were related genetically to other canine astroviruses identified formerly in Europe and China, whereas strain HUN/2012/126 was related genetically to a divergent canine astrovirus strain, ITA/2010/Zoid. For one canine astrovirus, HUN/2012/8, only a 3.2kb portion of the genome, at the 3' end, could be determined. Interestingly, this strain possessed unique genetic signatures (including a longer ORF1b/ORF2 overlap and a longer 3'UTR) and it was divergent in both ORF1b and ORF2 from all other canine astroviruses, with the highest nucleotide sequence identity (68% and 63%, respectively) to a mink astrovirus, thus suggesting a possible event of interspecies transmission. The genetic heterogeneity of canine astroviruses may pose a challenge for the diagnostics and for future prophylaxis strategies. Copyright © 2016 Elsevier B.V. All rights reserved.
Santos-Beneit, Fernando; Rodríguez-García, Antonio; Martín, Juan F.
2011-01-01
The afsS gene of several Streptomyces species encodes a small sigma factor-like protein that acts as an activator of several pathway-specific regulatory genes (e.g., actII-ORF4 and redD in Streptomyces coelicolor). The two pleiotropic regulators AfsR and PhoP bind to overlapping sequences in the −35 region of the afsS promoter and control its expression. Using mutated afsS promoters containing specific point mutations in the AfsR and PhoP binding sequences, we proved that the overlapping recognition sequences for AfsR and PhoP are displaced by 1 nucleotide. Different nucleotide positions are important for binding of AfsR or PhoP, as shown by electrophoretic mobility shift assays and by reporter studies using the luxAB gene coupled to the different promoters. Mutant promoter M5 (with a nucleotide change at position 5 of the consensus box) binds AfsR but not PhoP with high affinity (named “superAfsR”). Expression of the afsS gene from this promoter led to overproduction of actinorhodin. Mutant promoter M16 binds PhoP with extremely high affinity (“superPhoP”). Studies with ΔafsR and ΔphoP mutants (lacking AfsR and PhoP, respectively) showed that both global regulators are competitive transcriptional activators of afsS. AfsR has greater influence on expression of afsS than PhoP, as shown by reverse transcriptase PCR (RT-PCR) and promoter reporter (luciferase) studies. These two high-level regulators appear to integrate different nutritional signals (particularly phosphate limitation sensed by PhoR), S-adenosylmethionine, and other still unknown environmental signals (leading to AfsR phosphorylation) for the AfsS-mediated control of biosynthesis of secondary metabolites. PMID:21378195
Klein, Wolfgang; Westendorf, Carolin; Schmidt, Antje; Conill-Cortés, Mercè; Rutz, Claudia; Blohs, Marcus; Beyermann, Michael; Protze, Jonas; Krause, Gerd; Krause, Eberhard; Schülein, Ralf
2015-01-01
The cyclodepsipeptide cotransin was described to inhibit the biosynthesis of a small subset of proteins by a signal sequence-discriminatory mechanism at the Sec61 protein-conducting channel. However, it was not clear how selective cotransin is, i.e. how many proteins are sensitive. Moreover, a consensus motif in signal sequences mediating cotransin sensitivity has yet not been described. To address these questions, we performed a proteomic study using cotransin-treated human hepatocellular carcinoma cells and the stable isotope labelling by amino acids in cell culture technique in combination with quantitative mass spectrometry. We used a saturating concentration of cotransin (30 micromolar) to identify also less-sensitive proteins and to discriminate the latter from completely resistant proteins. We found that the biosynthesis of almost all secreted proteins was cotransin-sensitive under these conditions. In contrast, biosynthesis of the majority of the integral membrane proteins was cotransin-resistant. Cotransin sensitivity of signal sequences was neither related to their length nor to their hydrophobicity. Instead, in the case of signal anchor sequences, we identified for the first time a conformational consensus motif mediating cotransin sensitivity. PMID:25806945
Smith, J K; Parry, J D; Day, J G; Smith, R J
1998-10-01
The use of primers based on the Hip1 sequence as a typing technique for cyanobacteria has been investigated. The discovery of short repetitive sequence structures in bacterial DNA during the last decade has led to the development of PCR-based methods for typing, i.e., distinguishing and identifying, bacterial species and strains. An octameric palindromic sequence known as Hip1 has been shown to be present in the chromosomal DNA of many species of cyanobacteria as a highly repetitious interspersed sequence. PCR primers were constructed that extended the Hip1 sequence at the 3' end by two bases. Five of the 16 possible extended primers were tested. Each of the five primers produced a different set of products when used to prime PCR from cyanobacterial genomic DNA. Each primer produced a distinct set of products for each of the 15 cyanobacterial species tested. The ability of Hip1-based PCR to resolve taxonomic differences was assessed by analysis of independent isolates of Anabaena flos-aquae and Nostoc ellipsosporum obtained from the CCAP (Culture Collection of Algae and Protozoa, IFE, Cumbria, UK). A PCR-based RFLP analysis of products amplified from the 23S-16S rDNA intergenic region was used to characterize the isolates and to compare with the Hip1 typing data. The RFLP and Hip1 typing yielded similar results and both techniques were able to distinguish different strains. On the basis of these results it is suggested that the Hip1 PCR technique may assist in distinguishing cyanobacterial species and strains.
Whale, Alexandra S; Devonshire, Alison S; Karlin-Neumann, George; Regan, Jack; Javier, Leanne; Cowen, Simon; Fernandez-Gonzalez, Ana; Jones, Gerwyn M; Redshaw, Nicholas; Beck, Julia; Berger, Andreas W; Combaret, Valérie; Dahl Kjersgaard, Nina; Davis, Lisa; Fina, Frederic; Forshew, Tim; Fredslund Andersen, Rikke; Galbiati, Silvia; González Hernández, Álvaro; Haynes, Charles A; Janku, Filip; Lacave, Roger; Lee, Justin; Mistry, Vilas; Pender, Alexandra; Pradines, Anne; Proudhon, Charlotte; Saal, Lao H; Stieglitz, Elliot; Ulrich, Bryan; Foy, Carole A; Parkes, Helen; Tzonev, Svilen; Huggett, Jim F
2017-02-07
This study tested the claim that digital PCR (dPCR) can offer highly reproducible quantitative measurements in disparate laboratories. Twenty-one laboratories measured four blinded samples containing different quantities of a KRAS fragment encoding G12D, an important genetic marker for guiding therapy of certain cancers. This marker is challenging to quantify reproducibly using quantitative PCR (qPCR) or next generation sequencing (NGS) due to the presence of competing wild type sequences and the need for calibration. Using dPCR, 18 laboratories were able to quantify the G12D marker within 12% of each other in all samples. Three laboratories appeared to measure consistently outlying results; however, proper application of a follow-up analysis recommendation rectified their data. Our findings show that dPCR has demonstrable reproducibility across a large number of laboratories without calibration. This could enable the reproducible application of molecular stratification to guide therapy and, potentially, for molecular diagnostics.
Chan, Jasper Fuk-Woo; Choi, Garnet Kwan-Yue; Tsang, Alan Ka-Lun; Tee, Kah-Meng; Lam, Ho-Yin; Yip, Cyril Chik-Yan; To, Kelvin Kai-Wang; Cheng, Vincent Chi-Chung; Yeung, Man-Lung; Lau, Susanna Kar-Pui; Woo, Patrick Chiu-Yat; Chan, Kwok-Hung; Tang, Bone Siu-Fai
2015-01-01
Based on findings in small RNA-sequencing (Seq) data analysis, we developed highly sensitive and specific real-time reverse transcription (RT)-PCR assays with locked nucleic acid probes targeting the abundantly expressed leader sequences of Middle East respiratory syndrome coronavirus (MERS-CoV) and other human coronaviruses. Analytical and clinical evaluations showed their noninferiority to a commercial multiplex PCR test for the detection of these coronaviruses. PMID:26019210
Aigrain, Louise; Gu, Yong; Quail, Michael A
2016-06-13
The emergence of next-generation sequencing (NGS) technologies in the past decade has allowed the democratization of DNA sequencing both in terms of price per sequenced bases and ease to produce DNA libraries. When it comes to preparing DNA sequencing libraries for Illumina, the current market leader, a plethora of kits are available and it can be difficult for the users to determine which kit is the most appropriate and efficient for their applications; the main concerns being not only cost but also minimal bias, yield and time efficiency. We compared 9 commercially available library preparation kits in a systematic manner using the same DNA sample by probing the amount of DNA remaining after each protocol steps using a new droplet digital PCR (ddPCR) assay. This method allows the precise quantification of fragments bearing either adaptors or P5/P7 sequences on both ends just after ligation or PCR enrichment. We also investigated the potential influence of DNA input and DNA fragment size on the final library preparation efficiency. The overall library preparations efficiencies of the libraries show important variations between the different kits with the ones combining several steps into a single one exhibiting some final yields 4 to 7 times higher than the other kits. Detailed ddPCR data also reveal that the adaptor ligation yield itself varies by more than a factor of 10 between kits, certain ligation efficiencies being so low that it could impair the original library complexity and impoverish the sequencing results. When a PCR enrichment step is necessary, lower adaptor-ligated DNA inputs leads to greater amplification yields, hiding the latent disparity between kits. We describe a ddPCR assay that allows us to probe the efficiency of the most critical step in the library preparation, ligation, and to draw conclusion on which kits is more likely to preserve the sample heterogeneity and reduce the need of amplification.
Targeted RNA-Sequencing with Competitive Multiplex-PCR Amplicon Libraries
Blomquist, Thomas M.; Crawford, Erin L.; Lovett, Jennie L.; Yeo, Jiyoun; Stanoszek, Lauren M.; Levin, Albert; Li, Jia; Lu, Mei; Shi, Leming; Muldrew, Kenneth; Willey, James C.
2013-01-01
Whole transcriptome RNA-sequencing is a powerful tool, but is costly and yields complex data sets that limit its utility in molecular diagnostic testing. A targeted quantitative RNA-sequencing method that is reproducible and reduces the number of sequencing reads required to measure transcripts over the full range of expression would be better suited to diagnostic testing. Toward this goal, we developed a competitive multiplex PCR-based amplicon sequencing library preparation method that a) targets only the sequences of interest and b) controls for inter-target variation in PCR amplification during library preparation by measuring each transcript native template relative to a known number of synthetic competitive template internal standard copies. To determine the utility of this method, we intentionally selected PCR conditions that would cause transcript amplification products (amplicons) to converge toward equimolar concentrations (normalization) during library preparation. We then tested whether this approach would enable accurate and reproducible quantification of each transcript across multiple library preparations, and at the same time reduce (through normalization) total sequencing reads required for quantification of transcript targets across a large range of expression. We demonstrate excellent reproducibility (R2 = 0.997) with 97% accuracy to detect 2-fold change using External RNA Controls Consortium (ERCC) reference materials; high inter-day, inter-site and inter-library concordance (R2 = 0.97–0.99) using FDA Sequencing Quality Control (SEQC) reference materials; and cross-platform concordance with both TaqMan qPCR (R2 = 0.96) and whole transcriptome RNA-sequencing following “traditional” library preparation using Illumina NGS kits (R2 = 0.94). Using this method, sequencing reads required to accurately quantify more than 100 targeted transcripts expressed over a 107-fold range was reduced more than 10,000-fold, from 2.3×109 to 1.4×105 sequencing reads. These studies demonstrate that the competitive multiplex-PCR amplicon library preparation method presented here provides the quality control, reproducibility, and reduced sequencing reads necessary for development and implementation of targeted quantitative RNA-sequencing biomarkers in molecular diagnostic testing. PMID:24236095
A new sensitive PCR assay for one-step detection of 12 IDH1/2 mutations in glioma.
Catteau, Aurélie; Girardi, Hélène; Monville, Florence; Poggionovo, Cécile; Carpentier, Sabrina; Frayssinet, Véronique; Voss, Jesse; Jenkins, Robert; Boisselier, Blandine; Mokhtari, Karima; Sanson, Marc; Peyro-Saint-Paul, Hélène; Giannini, Caterina
2014-06-02
Mutations in isocitrate dehydrogenase genes IDH1 or IDH2 are frequent in glioma, and IDH mutation status is a strong diagnostic and prognostic marker. Current IDH mutation screening is performed with an immunohistochemistry (IHC) assay specific for IDH1 R132H, the most common mutation. Sequencing is recommended as a second-step test for IHC-negative or -equivocal cases. We developed and validated a new real-time quantitative polymerase chain reaction (PCR) assay for single-step detection of IDH1 R132H and 11 rare IDH1/2 mutations in formalin-fixed paraffin-embedded (FFPE) glioma samples. Performance of the IDH1/2 PCR assay was compared to IHC and Sanger sequencing. The IDH1/2 PCR assay combines PCR clamping for detection of 7 IDH1 and 5 IDH2 mutations, and Amplification Refractory Mutation System technology for specific identification of the 3 most common mutations (IDH1 R132H, IDH1 R132C, IDH2 R172K). Analytical sensitivity of the PCR assay for mutation detection was <5% for 11/12 mutations (mean: 3.3%), and sensitivity for mutation identification was very high (0.8% for IDH1 R132H; 1.2% for IDH1 R132C; 0.6% for IDH2 R172K). Assay performance was further validated on 171 clinical glioma FFPE samples; of these, 147 samples met the selection criteria and 146 DNA samples were successfully extracted. IDH1/2 status was successfully obtained in 91% of cases. All but one positive IDH1 R132H-IHC cases were concordantly detected by PCR and 3 were not detected by sequencing. Among the IHC-negative cases (n = 72), PCR detected 12 additional rare mutations (10 IDH1, 2 IDH2). All mutations detected by sequencing (n = 67) were concordantly detected by PCR and 5/66 sequencing-negative cases were PCR-positive (overall concordance: 96%). Analysis of synthetic samples representative of the 11 rare IDH1/2 mutations detected by the assay produced 100% correct results. The new IDH1/2 PCR assay has a high technical success rate and is more sensitive than Sanger sequencing. Positive concordance was 98% with IHC for IDH1 R132H detection and 100% with sequencing. The PCR assay can reliably be performed on FFPE samples and has a faster turnaround time than current IDH mutation detection algorithms. The assay should facilitate implementation of a comprehensive IDH1/2 testing protocol in routine clinical practice.
Kamau, Everlyn; Agoti, Charles N; Lewa, Clement S; Oketch, John; Owor, Betty E; Otieno, Grieven P; Bett, Anne; Cane, Patricia A; Nokes, D James
2017-03-01
Direct immuno-fluorescence test (IFAT) and multiplex real-time RT-PCR have been central to RSV diagnosis in Kilifi, Kenya. Recently, these two methods showed discrepancies with an increasing number of PCR undetectable RSV-B viruses. Establish if mismatches in the primer and probe binding sites could have reduced real-time RT-PCR sensitivity. Nucleoprotein (N) and glycoprotein (G) genes were sequenced for real-time RT-PCR positive and negative samples. Primer and probe binding regions in N gene were checked for mismatches and phylogenetic analyses done to determine molecular epidemiology of these viruses. New primers and probe were designed and tested on the previously real-time RT-PCR negative samples. N gene sequences revealed 3 different mismatches in the probe target site of PCR negative, IFAT positive viruses. The primers target sites had no mismatches. Phylogenetic analysis of N and G genes showed that real-time RT-PCR positive and negative samples fell into distinct clades. Newly designed primers-probe pair improved detection and recovered previous PCR undetectable viruses. An emerging RSV-B variant is undetectable by a quite widely used real-time RT-PCR assay due to polymorphisms that influence probe hybridization affecting PCR accuracy. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Apparent founder effect during the early years of the San Francisco HIV type 1 epidemic (1978-1979).
Foley, B; Pan, H; Buchbinder, S; Delwart, E L
2000-10-10
HIV-1 envelope sequence variants were RT-PCR amplified from serum samples cryopreserved in San Francisco in 1978-1979. The HIV-1 subtype B env V3-V5 sequences from four homosexual men clustered phylogenetically, with a median nucleotide distance of 2.8%, reflecting a recent common origin. These early U.S. HIV-1 env variants mapped close to the phylogenetic root of the subtype B tree while env variants collected in the United States throughout the 1980s and 1990s showed, on average, increasing genetic diversity and divergence from the subtype B consensus sequence. These results indicate that the majority of HIV-1 currently circulating in the United States may be descended from an initial introduction and rapid spread during the mid- to late 1970s of subtype B viruses with limited variability (i.e., a founder effect). As expected from the starburst-shaped phylogeny of HIV-1 subtype B, contemporary U.S. strains were, on average, more closely related at the nucleic acid and amino acid levels to the earlier 1978-1979 env variants than to each other. The growing levels of HIV-1 genetic diversity, one of multiple obstacles in designing a protective vaccine, may therefore be mitigated by using epidemic founding variants as antigenic strains for protection against contemporary strains.
CBS mutations and MTFHR SNPs causative of hyperhomocysteinemia in Pakistani children.
Ibrahim, Shahnaz; Maqbool, Saadia; Azam, Maleeha; Iqbal, Mohammad Perwaiz; Qamar, Raheel
2018-03-29
Three index patients with hyperhomocysteinemia and ocular anomalies were screened for cystathionine beta synthase (CBS) and methylenetetrahydrofolate reductase (MTHFR) polymorphisms. Genotyping of hyperhomocysteinemia associated MTHFR polymorphisms C677T (rs1801133) and A1298C (rs1801131) was done by PCR-restriction fragment length polymorphism. Sanger sequencing was performed for CBS exonic sequences along with consensus splice sites. In the case of MTHFR polymorphisms, all the patients were heterozygous CT for the single nucleotide polymorphism (SNP) C677T and were therefore carriers of the risk allele (T), while the patients were homozygous CC for the risk genotype of the SNP A1298C. CBS sequencing resulted in the identification of two novel mutations, a missense change (c.467T>C; p.Leu156Pro) in exon 7 and an in-frame deletion (c.808_810del; p.Glu270del) in exon 10. In addition, a recurrent missense mutation (c.770C>T; p.Thr257Met) in exon 10 of the gene was also identified. The mutations were present homozygously in the patients and were inherited from the carrier parents. This is the first report from Pakistan where novel as well as recurrent CBS mutations causing hyperhomocysteinemia and lens dislocation in three patients from different families are being reported with the predicted effect of the risk allele of the MTHFR SNP in causing hyperhomocysteinemia.
Yamamoto, T; Nakamura, Y
2000-10-01
Cerebrospinal fluid (CSF) specimens from 27 patients with encephalitis, meningitis, and other neurological diseases were studied for the presence of herpes simplex virus types 1 and 2 (HSV-1/-2), varicella-zoster virus (VZV), cytomegalovirus (CMV), human herpesviruses 6A and 6B (HHV-6A/-6B) and Epstein-Barr virus (EBV) DNA using the polymerase chain reaction (PCR) method. The DNAs were amplified using two sets of consensus primer pairs in a single tube, bringing simultaneous amplification of the herpesviruses. The PCR products were analyzed by agarose gel electrophoresis, and Southern blot hybridization with virus-type specific probes, thus allowing discrimination between the different types of herpesviruses to be made. Each virus-specific probe was highly specific for identifying the PCR product. Thirty CSF specimens from 13 patients with encephalitis and 10 specimens from 10 patients with meningitis, respectively, were examined using this method. Eight patients with encephalitis and six with meningitis were positive for different herpesviruses, including patients with coinfections (HSV-1/-2 and VZV, VZV and CMV). Among four CSF specimens from four patients with other neurological disorders, dual amplification of CMV and EBV was present. Since identification of the types of herpesviruses in this system requires a very small amount of CSF, and is completed with one PCR, it is useful for routine diagnosis of herpesvirus infections in diagnostic laboratories. The viruses responsible for central nervous system infection are easily detected with various coinfection and serial patterns of herpesviruses, by this consensus primer-based PCR method. This may give an insight into the relationship between virus-related neurological diseases (VRNDS) and herpesvirus infections.
MethPrimer: designing primers for methylation PCRs.
Li, Long-Cheng; Dahiya, Rajvir
2002-11-01
DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.
Abdel-Shafi, Iman R; Shoieb, Eman Y; Attia, Samar S; Rubio, José M; Ta-Tang, Thuy-Huong; El-Badry, Ayman A
2017-03-01
Lymphatic filariasis (LF) is a serious vector-borne health problem, and Wuchereria bancrofti (W.b) is the major cause of LF worldwide and is focally endemic in Egypt. Identification of filarial infection using traditional morphologic and immunological criteria can be difficult and lead to misdiagnosis. The aim of the present study was molecular detection of W.b in residents in endemic areas in Egypt, sequence variance analysis, and phylogenetic analysis of W.b DNA. Collected blood samples from residents in filariasis endemic areas in five governorates were subjected to semi-nested PCR targeting repeated DNA sequence, for detection of W.b DNA. PCR products were sequenced; subsequently, a phylogenetic analysis of the obtained sequences was performed. Out of 300 blood samples, W.b DNA was identified in 48 (16%). Sequencing analysis confirmed PCR results identifying only W.b species. Sequence alignment and phylogenetic analysis indicated genetically distinct clusters of W.b among the study population. Study results demonstrated that the semi-nested PCR proved to be an effective diagnostic tool for accurate and rapid detection of W.b infections in nano-epidemics and is applicable for samples collected in the daytime as well as the night time. PCR products sequencing and phylogenitic analysis revealed three different nucleotide sequences variants. Further genetic studies of W.b in Egypt and other endemic areas are needed to distinguish related strains and the various ecological as well as drug effects exerted on them to support W.b elimination.
Lauerman, Lloyd H
2004-12-01
Since the discovery of the polymerase chain reaction (PCR) 20 years ago, an avalanche of scientific publications have reported major developments and changes in specialized equipment, reagents, sample preparation, computer programs and techniques, generated through business, government and university research. The requirement for genetic sequences for primer selection and validation has been greatly facilitated by the development of new sequencing techniques, machines and computer programs. Genetic libraries, such as GenBank, EMBL and DDBJ continue to accumulate a wealth of genetic sequence information for the development and validation of molecular-based diagnostic procedures concerning human and veterinary disease agents. The mechanization of various aspects of the PCR assay, such as robotics, microfluidics and nanotechnology, has made it possible for the rapid advancement of new procedures. Real-time PCR, DNA microarray and DNA chips utilize these newer techniques in conjunction with computer and computer programs. Instruments for hand-held PCR assays are being developed. The PCR and reverse transcription-PCR (RT-PCR) assays have greatly accelerated the speed and accuracy of diagnoses of human and animal disease, especially of the infectious agents that are difficult to isolate or demonstrate. The PCR has made it possible to genetically characterize a microbial isolate inexpensively and rapidly for identification, typing and epidemiological comparison.
van Zanten, E; Wisselink, G J; Stoll, S; Alvarez, R; Kooistra-Smid, A M D
2011-02-01
A shortened DNA extraction protocol for the QIAsymphony SP was evaluated by quantitative and qualitative comparison of real-time PCR results of 150 co-extracted stool samples. The average ∆Cycle threshold value for positive pathogenic targets was 0.28 Ct. A consensus of 96.91%, with a correlation coefficient of 0.9880 was recorded. Copyright © 2010 Elsevier B.V. All rights reserved.
PCR Conditions for 16S Primers for Analysis of Microbes in the Colon of Rats.
Guillen, I A; Camacho, H; Tuero, A D; Bacardí, D; Palenzuela, D O; Aguilera, A; Silva, J A; Estrada, R; Gell, O; Suárez, J; Ancizar, J; Brown, E; Colarte, A B; Castro, J; Novoa, L I
2016-09-01
The study of the composition of the intestinal flora is important to the health of the host, playing a key role in maintaining intestinal homeostasis and the evolution of the immune system. For these studies, various universal primers of the 16S rDNA gene are used in microbial taxonomy. Here, we report an evaluation of 5 universal primers to explore the presence of microbial DNA in colon biopsies preserved in RNAlater solution. The DNA extracted was used for the amplification of PCR products containing the variable (V) regions of the microbial 16S rDNA gene. The PCR products were studied by restriction fragment length polymorphism (RFLP) analysis and DNA sequence, whose percent of homology with microbial sequences reported in GenBank was verified using bioinformatics tools. The presence of microbes in the colon of rats was quantified by the quantitative PCR (qPCR) technique. We obtained microbial DNA from rat, useful for PCR analysis with the universal primers for the bacteria 16S rDNA. The sequences of PCR products obtained from a colon biopsy of the animal showed homology with the classes bacilli (Lactobacillus spp) and proteobacteria, normally represented in the colon of rats. The proposed methodology allowed the attainment of DNA of bacteria with the quality and integrity for use in qPCR, sequencing, and PCR-RFLP analysis. The selected universal primers provided knowledge of the abundance of microorganisms and the formation of a preliminary test of bacterial diversity in rat colon biopsies.
Jenkins, Andrew; Allum, Anne-Gry; Strand, Linda; Aakre, Randi Kersten
2013-02-01
A consensus multiplex real-time PCR test (PT13-RT) for the oncogenic human papillomavirus (HPV) types 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59 and 66 is described. The test targets the L1 gene. Analytical sensitivity is between 4 and 400 GU (genomic units) in the presence of 500 ng of human DNA, corresponding to 75,000 human cells. HPV types are grouped into multiplex groups of 3 or 4 resulting in the use of 4 wells per sample and permitting up to 24 samples per run (including controls) in a standard 96-well real-time PCR instrument. False negative results are avoided by (a) measuring sample DNA concentration to control that sufficient cellular material is present and (b) including HPV type 6 as a homologous internal control in order to detect PCR inhibition or competition from other (non-oncogenic) HPV types. Analysis time from refrigerator to report is 8 h, including 2.5 h hands-on time. Relative to the HC2 test, the sensitivity and specificity were respectively 98% and 83%, the lower specificity being attributable to the higher analytical sensitivity of PT13-RT. To assess type determination comparison was made with a reversed line-blot test. Type concordance was high (κ=0.79) with discrepancies occurring mostly in multiple-positive samples. Copyright © 2012 Elsevier B.V. All rights reserved.
Fredholm, Daniel V; Coleman, James K; Childress, April L; Wellehan, James F X
2015-03-01
Agamid adenovirus 1 (AgAdv-1) is a significant cause of disease in bearded dragons (Pogona sp.). Clinical manifestations of AgAdv-1 infection are variable and often nonspecific; the manifestations range from lethargy, weight loss, and inappetence, to severe enteritis, hepatitis, and sudden death. Currently, diagnosis of AgAdv-1 infection is achieved through a single published method: standard nested polymerase chain reaction (nPCR) and sequencing. Standard nPCR with sequencing provides reliable sensitivity, specificity, and validation of PCR products. However, this process is comparatively expensive, laborious, and slow. Probe hybridization, as used in a TaqMan assay, represents the best option for validating PCR products aside from the time-consuming process of sequencing. This study developed a real-time PCR (qPCR) assay using a TaqMan probe-based assay, targeting a highly conserved region of the AgAdv-1 genome. Standard curves were generated, detection results were compared with the gold standard conventional PCR and sequencing assay, and limits of detection were determined. Additionally, the qPCR assay was run on samples known to be positive for AgAdv-1 and samples known to be positive for other adenoviruses. Based on the results of these evaluations, this assay allows for a less expensive, rapid, quantitative detection of AgAdv-1 in bearded dragons. © 2015 The Author(s).
PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection
O’Halloran, Damien M.
2016-01-01
Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558
Flores, María D; Gonzalez, Luis M; Hurtado, Carolina; Motta, Yamileth Monje; Domínguez-Hidalgo, Cristina; Merino, Francisco Jesús; Perteguer, María J; Gárate, Teresa
2018-02-27
Taenia solium, T. asiatica and T. saginata tapeworms cause human taeniasis and are the origin of porcine and bovine cysticercosis. Furthermore, T. solium eggs can cause human cysticercosis, with neurocysticercosis being the most serious form of the disease. These helminth infections are neglected tropical diseases and are endemic in several countries in the Americas, Asia and Africa. As a result of globalization, migration in particular, the infections have been extending to non-endemic territories. Species-specific diagnosis of taeniasis is subject to drawbacks that could be resolved using molecular approaches. In the present study, conventional and real-time amplification protocols (cPCR and qPCR) based on the T. saginata HDP2 sequence were applied in the differential diagnosis of taeniasis (T. saginata, T. solium) in both fecal samples and proglottids expelled by patients. The HDP2 homolog in T. solium was cloned and characterized. Semi-nested cPCR and qPCR (Sn-HDP2 cPCR and Sn-HDP2 qPCR) amplified T. saginata and T. solium DNA, with an analytical sensitivity of 40 and 400 fg, respectively, and identically in both protocols. Eighteen taeniasis patients were diagnosed directly with T. saginata or T. solium, either from proglottids or fecal samples with/without eggs (detected using microscopy), based on the optimized Sn-HDP2 qPCR. After cloning, the T. solium HDP2 homolog sequence was confirmed to be a ribosomal sequence. The HDP2 fragment corresponded to a non-transcribed sequence/external transcribed repeat (NTS/ETS) of ribosomal DNA. Compared with the T. saginata HDP2 homolog, the T solium HDP2 sequence lacked the first 900 nt at the 5' end and showed nucleotide substitutions and small deletions. Sn-HDP2 cPCR and Sn-HDP2 qPCR were set up for the diagnosis of human taeniasis, using proglottids and fecal samples from affected patients. The new Sn-HDP2 qPCR protocol was the best option, as it directly differentiated T. saginata from T. solium. The diagnosis of an imported T. solium-taeniasis case and nine European T. saginata cases was relevant. Finally, the cloning and sequencing of the T. solium HDP2 fragment confirmed that HDP2 was part of a ribosomal unit.
Preparation of 13C/15N-labeled oligomers using the polymerase chain reaction
Chen, Xian; Gupta, Goutam; Bradbury, E. Morton
2001-01-01
Preparation of .sup.13 C/.sup.15 N-labeled DNA oligomers using the polymerase chain reaction (PCR). A PCR based method for uniform (.sup.13 C/.sup.15 N)-labeling of DNA duplexes is described. Multiple copies of a blunt-ended duplex are cloned into a plasmid, each copy containing the sequence of interest and restriction Hinc II sequences at both the 5' and 3' ends. PCR using bi-directional primers and uniformly .sup.13 C/.sup.15 N-labeled dNTP precursors generates labeled DNA duplexes containing multiple copies of the sequence of interest. Twenty-four cycles of PCR, followed by restriction and purification, gave the uniformly .sup.13 C/.sup.15 N-labeled duplex sequence with a 30% yield. Such labeled duplexes find significant applications in multinuclear magnetic resonance spectroscopy.
Gemi: PCR Primers Prediction from Multiple Alignments
Sobhy, Haitham; Colson, Philippe
2012-01-01
Designing primers and probes for polymerase chain reaction (PCR) is a preliminary and critical step that requires the identification of highly conserved regions in a given set of sequences. This task can be challenging if the targeted sequences display a high level of diversity, as frequently encountered in microbiologic studies. We developed Gemi, an automated, fast, and easy-to-use bioinformatics tool with a user-friendly interface to design primers and probes based on multiple aligned sequences. This tool can be used for the purpose of real-time and conventional PCR and can deal efficiently with large sets of sequences of a large size. PMID:23316117
Steinmann, J; Schmidt, D; Buer, J; Rath, P-M
2011-07-01
The laboratory identification of Pseudallescheria and Scedosporium isolates at the species level is important for clinical and epidemiological purposes. This study used semiautomated repetitive sequence-based polymerase chain reaction (rep-PCR) to identify Pseudallescheria/Scedosporium. Reference strains of Pseudallescheria boydii (n = 12), Scedosporium prolificans (n = 8), Scedosporium apiospermum (n = 9), and clinical/environmental isolates (P. boydii, 7; S. prolificans, 7; S. apiospermum, 7) were analyzed by rep-PCR. All clinical isolates were identified by morphological and phenotypic characteristics and by sequence analysis. Species identification of reference strains was based on the results of available databases. Rep-PCR studies were also conducted with various molds to differentiate Pseudallescheria/Scedosporium spp. from other commonly encountered filamentous fungi. All tested Pseudallescheria/Scedosporium isolates were distinguishable from the other filamentous fungi. All Scedosporium prolificans strains clustered within the cutoff of 85%, and species identification by rep-PCR showed an agreement of 100% with sequence analysis. However, several isolates of P. boydii and S. apiospermum did not cluster within the 85% cutoff with the same species by rep-PCR. Although the identification of P. boydii and S. apiospermum was not correct, the semiautomated rep-PCR system is a promising tool for the identification of S. prolificans isolates.
MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR
Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo
2015-01-01
Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. PMID:26109350
Zowawi, Hosam M; Syrmis, Melanie W; Kidd, Timothy J; Balkhy, Hanan H; Walsh, Timothy R; Al Johani, Sameera M; Al Jindan, Reem Y; Alfaresi, Mubarak; Ibrahim, Emad; Al-Jardani, Amina; Al Salman, Jameela; Dashti, Ali A; Sidjabat, Hanna E; Baz, Omar; Trembizki, Ella; Whiley, David M; Paterson, David L
2018-04-17
The molecular epidemiology and resistance mechanisms of carbapenem-resistant Pseudomonas aeruginosa (CRPA) were determined in hospitals in the countries of the Gulf Cooperation Council (GCC), namely, Saudi Arabia, the United Arab Emirates, Oman, Qatar, Bahrain and Kuwait. Isolates were screened for common carbapenem-resistance genes by PCR. Relatedness between isolates was assessed using previously described genotyping methods: an informative-single nucleotide polymorphism MassARRAY iPLEX assay (iPLEX20SNP) and the enterobacterial repetitive intergenic consensus (ERIC)-PCR assay, with selected isolates being subjected to multilocus sequence typing (MLST). Ninety-five non-repetitive isolates that were found to be resistant to carbapenems were subjected to further investigation.Results/Key findings. The most prevalent carbapenemase-encoding gene, blaVIM-type, was found in 37/95 (39 %) isolates, while only 1 isolate (from UAE) was found to have blaIMP-type. None of the CRPA were found to have blaNDM-type or blaKPC-type. We found a total of 14 sequence type (ST) clusters, with 4 of these clusters being observed in more than 1 country. Several clusters belonged to the previously recognized internationally disseminated high-risk clones ST357, ST235, ST111, ST233 and ST654. We also found the less predominant ST316, ST308 and ST823 clones, and novel MLST types (ST2010, ST2011, ST2012 and ST2013), in our collection. Overall our data show that 'high-risk' CRPA clones are now detected in the region and highlight the need for strategies to limit further spread of such organisms, including enhanced surveillance, infection control precautions and further promotion of antibiotic stewardship programmes.
Lee, Sook-Young; Kim, Jeong-Hoon; Seo, Tae-Kun; No, Jin Sun; Kim, Hankyeom; Kim, Won-keun; Choi, Han-Gu; Kang, Sung-Ho; Song, Jin-Won
2016-01-01
Antarctica is considered a relatively uncontaminated region with regard to the infectious diseases because of its extreme environment, and isolated geography. For the genetic characterization and molecular epidemiology of the newly found penguin adenovirus in Antarctica, entire genome sequencing and annual survey of penguin adenovirus were conducted. The entire genome sequences of penguin adenoviruses were completed for two Chinstrap penguins (Pygoscelis antarctica) and two Gentoo penguins (Pygoscelis papua). The whole genome lengths and G+C content of penguin adenoviruses were found to be 24,630–24,662 bp and 35.5–35.6%, respectively. Notably, the presence of putative sialidase gene was not identified in penguin adenoviruses by Rapid Amplification of cDNA Ends (RACE-PCR) as well as consensus specific PCR. The penguin adenoviruses were demonstrated to be a new species within the genus Siadenovirus, with a distance of 29.9–39.3% (amino acid, 32.1–47.9%) in DNA polymerase gene, and showed the closest relationship with turkey adenovirus 3 (TAdV-3) in phylogenetic analysis. During the 2008–2013 study period, the penguin adenoviruses were annually detected in 22 of 78 penguins (28.2%), and the molecular epidemiological study of the penguin adenovirus indicates a predominant infection in Chinstrap penguin population (12/30, 40%). Interestingly, the genome of penguin adenovirus could be detected in several internal samples, except the lymph node and brain. In conclusion, an analysis of the entire adenoviral genomes from Antarctic penguins was conducted, and the penguin adenoviruses, containing unique genetic character, were identified as a new species within the genus Siadenovirus. Moreover, it was annually detected in Antarctic penguins, suggesting its circulation within the penguin population. PMID:27309961
USDA-ARS?s Scientific Manuscript database
Comparative sequence analysis of six independent chicken and turkey parvovirus nonstructural (NS) genes revealed specific genomic regions with 100% nucleotide sequence identity. A PCR assay with primers targeting these conserved genome sequences proved to be highly specific and sensitive to detect p...
Cloning and sequencing of a cellobiohydrolase gene from Trichoderma harzianum FP108
Patrick Guilfoile; Ron Burns; Zu-Yi Gu; Matt Amundson; Fu-Hsian Chang
1999-01-01
A cbbl cellobiohydrolase gene was cloned and sequenced from the fungus Trichoderrna harzianum FP108. The cloning was performed by PCR amplification of T. harzianum genomic DNA, using PCR primers whose sequence was based on the cbbl gene from Tricboderma reesei. The 3' end of the gene was isolated by inverse...
Pusch, Carsten M; Bachmann, Lutz
2004-05-01
Proof of authenticity is the greatest challenge in palaeogenetic research, and many safeguards have become standard routine in laboratories specialized on ancient DNA research. Here we describe an as-yet unknown source of artifacts that will require special attention in the future. We show that ancient DNA extracts on their own can have an inhibitory and mutagenic effect under PCR. We have spiked PCR reactions including known human test DNA with 14 selected ancient DNA extracts from human and nonhuman sources. We find that the ancient DNA extracts inhibit the amplification of large fragments to different degrees, suggesting that the usual control against contaminations, i.e., the absence of long amplifiable fragments, is not sufficient. But even more important, we find that the extracts induce mutations in a nonrandom fashion. We have amplified a 148-bp stretch of the mitochondrial HVRI from contemporary human template DNA in spiked PCR reactions. Subsequent analysis of 547 sequences from cloned amplicons revealed that the vast majority (76.97%) differed from the correct sequence by single nucleotide substitutions and/or indels. In total, 34 positions of a 103-bp alignment are affected, and most mutations occur repeatedly in independent PCR amplifications. Several of the induced mutations occur at positions that have previously been detected in studies of ancient hominid sequences, including the Neandertal sequences. Our data imply that PCR-induced mutations are likely to be an intrinsic and general problem of PCR amplifications of ancient templates. Therefore, ancient DNA sequences should be considered with caution, at least as long as the molecular basis for the extract-induced mutations is not understood.
Mikaeili, Fattaneh; Mathis, Alexander; Deplazes, Peter; Mirhendi, Hossein; Barazesh, Afshin; Ebrahimi, Sepideh; Kia, Eshrat Beigom
2017-09-26
The definitive genetic identification of Toxocara species is currently based on PCR/sequencing. The objectives of the present study were to design and conduct an in silico polymerase chain reaction-restriction fragment length polymorphism method for identification of Toxocara species. In silico analyses using the DNASIS and NEBcutter softwares were performed with rDNA internal transcribed spacers, and mitochondrial cox1 and nad1 sequences obtained in our previous studies along with relevant sequences deposited in GenBank. Consequently, RFLP profiles were designed and all isolates of T. canis and T. cati collected from dogs and cats in different geographical areas of Iran were investigated with the RFLP method using some of the identified suitable enzymes. The findings of in silico analyses predicted that on the cox1 gene only the MboII enzyme is appropriate for PCR-RFLP to reliably distinguish the two species. No suitable enzyme for PCR-RFLP on the nad1 gene was identified that yields the same pattern for all isolates of a species. DNASIS software showed that there are 241 suitable restriction enzymes for the differentiation of T. canis from T. cati based on ITS sequences. RsaI, MvaI and SalI enzymes were selected to evaluate the reliability of the in silico PCR-RFLP. The sizes of restriction fragments obtained by PCR-RFLP of all samples consistently matched the expected RFLP patterns. The ITS sequences are usually conserved and the PCR-RFLP approach targeting the ITS sequence is recommended for the molecular differentiation of Toxocara species and can provide a reliable tool for identification purposes particularly at the larval and egg stages.
Distribution and sequence homogeneity of an abundant satellite DNA in the beetle, Tenebrio molitor.
Davis, C A; Wyatt, G R
1989-01-01
The mealworm beetle, Tenebrio molitor, contains an unusually abundant and homogeneous satellite DNA which constitutes up to 60% of its genome. The satellite DNA is shown to be present in all of the chromosomes by in situ hybridization. 18 dimers of the repeat unit were cloned and sequenced. The consensus sequence is 142 nt long and lacks any internal repeat structure. Monomers of the sequence are very similar, showing on average a 2% divergence from the calculated consensus. Variant nucleotides are scattered randomly throughout the sequence although some variants are more common than others. Neighboring repeat units are no more alike than randomly chosen ones. The results suggest that some mechanism, perhaps gene conversion, is acting to maintain the homogeneity of the satellite DNA despite its abundance and distribution on all of the chromosomes. Images PMID:2762148
Abdalhamid, B.; Elhadi, N.; Alabdulqader, N.; Alsamman, K.; Aljindan, R.
2016-01-01
Carbapenem-resistant Enterobacteriaceae (CRE) and carbapenem-resistant Pseudomonas aeruginosa (CRPAE) are globally a major medical issue, especially in intensive care units. The digestive tract is the main reservoir for these isolates; therefore, rectal swab surveillance is highly recommended. The purpose of this study was to detect the prevalence of gastrointestinal tract colonization of CRE and CRPAE in patients admitted to intensive care units in Saudi Arabia. This project also aimed to characterize carbapenem-hydrolyzing enzyme production in these isolates. From February to May 2015, 200 rectal swab specimens were screened by CHROMagar KPC. Organism identification and susceptibility testing were performed using the Vitek 2 system. One CRE and 13 CRPAE strains were identified, for a prevalence of 0.5% (1/200) and 6.5% (13/200) respectively. Strains showed high genetic diversity using enterobacterial repetitive intergenic consensus sequence-based PCR. NDM type and VIM type were detected by PCR in four and one CRPAE isolates respectively. ampC overexpression was detected in eight CRPAE isolates using Mueller-Hinton agar containing 1000 μg/mL cloxacillin. CTX-M-15 type was detected in 1 CRE by PCR. The prevalence of CRE strain colonization was lower than that of CRPAE isolates. The detection of NDM and VIM in the colonizing CRPAE strains is a major infection control concern. To our knowledge, this is the first study in Saudi Arabia and the gulf region focusing on digestive tract colonization of CRE and CRPAE organisms and characterizing the mechanisms of carbapenem resistance. PMID:26933499
Lazinski, David W; Camilli, Andrew
2013-01-01
The amplification of DNA fragments, cloned between user-defined 5' and 3' end sequences, is a prerequisite step in the use of many current applications including massively parallel sequencing (MPS). Here we describe an improved method, called homopolymer tail-mediated ligation PCR (HTML-PCR), that requires very little starting template, minimal hands-on effort, is cost-effective, and is suited for use in high-throughput and robotic methodologies. HTML-PCR starts with the addition of homopolymer tails of controlled lengths to the 3' termini of a double-stranded genomic template. The homopolymer tails enable the annealing-assisted ligation of a hybrid oligonucleotide to the template's recessed 5' ends. The hybrid oligonucleotide has a user-defined sequence at its 5' end. This primer, together with a second primer composed of a longer region complementary to the homopolymer tail and fused to a second 5' user-defined sequence, are used in a PCR reaction to generate the final product. The user-defined sequences can be varied to enable compatibility with a wide variety of downstream applications. We demonstrate our new method by constructing MPS libraries starting from nanogram and sub-nanogram quantities of Vibrio cholerae and Streptococcus pneumoniae genomic DNA.
Zhang, Lahong; Dai, Yibei; Chen, Jiahuan; Hong, Liquan; Liu, Yuhua; Ke, Qiang; Chen, Yiwen; Cai, Chengsong; Liu, Xia; Chen, Zhaojun
2018-01-01
A new multiplex real-time PCR assay, the high-risk HPV genotyping real time PCR assay (HR HPV RT-PCR), has been developed to detect 15 high-risk HPV types with respective viral loads. In this report, a total of 684 cervical specimens from women diagnosed with vaginitis were assessed by the HR HPV RT-PCR and the PCR reaction and reverse dot blot (PCR-RDB) assays, using a PCR-sequencing method as a reference standard. A total coincidence of 97.7% between the HR HPV RT PCR and the PCR-RDB assays was determined with a Kappa value of 0.953. The HR HPV RT PCR assay had sensitivity, specificity, and concordance rates (accuracy) of 99.7%, 99.7%, and 99.7%, respectively, as confirmed by PCR-sequencing, while the PCR-RDB assay had respective rates of 98.8%, 97.1%, and 98.0%. The overall rate of HPV infection, determined by PCR-sequencing, in women diagnosed with vaginitis was 49.85%, including 36.26% of single infection and 13.6% of multiple infections. The most common infections among the 15 high-risk HPV types in women diagnosed with vaginitis were HPV-52, HPV-16, and HPV-58, with a total detection rate of 10.23%, 7.75%, and 5.85%, respectively. We conclude that the HR HPV RT PCR assay exhibits better clinical performance than the PCR-RDB assay, and is an ideal alternative method for HPV genotyping. In addition, the HR HPV RT PCR assay provides HPV DNA viral loads, and could serve as a quantitative marker in the diagnosis and treatment of single and multiple HPV infections. © 2017 Wiley Periodicals, Inc.
Characterization of Austrian koi herpesvirus samples based on the ORF40 region.
Marek, A; Schachner, O; Bilic, I; Hess, M
2010-02-17
Using a PCR that amplifies a region of the thymidine kinase (TK) gene, an epidemic spread of koi herpesvirus (KHV) was determined in koi carps in Austria in 2007. A total of 15 virus samples from different locations in Austria were analyzed to determine their genetic relatedness following PCR and nucleic acid sequencing of the open reading frame 40 (ORF40) region of the KHV genome. ORF40-specific PCR amplification products that were obtained from tissue samples shared 100% nucleotide sequence identity with the published sequence of the Japanese strain of KHV. The ORF40 sequence of one isolate from the UK that was included in the present study was 100% identical with the published sequence of an Israeli strain of KHV. This is the first study that used a larger number of samples and a PCR method, which allowed distinguishing all 3 strains of KHV. The present investigation provides information on the epidemiology of KHV infections in Europe and describes a useful molecular tool for epidemiological studies.
Molecular barcodes detect redundancy and contamination in hairpin-bisulfite PCR
Miner, Brooks E.; Stöger, Reinhard J.; Burden, Alice F.; Laird, Charles D.; Hansen, R. Scott
2004-01-01
PCR amplification of limited amounts of DNA template carries an increased risk of product redundancy and contamination. We use molecular barcoding to label each genomic DNA template with an individual sequence tag prior to PCR amplification. In addition, we include molecular ‘batch-stamps’ that effectively label each genomic template with a sample ID and analysis date. This highly sensitive method identifies redundant and contaminant sequences and serves as a reliable method for positive identification of desired sequences; we can therefore capture accurately the genomic template diversity in the sample analyzed. Although our application described here involves the use of hairpin-bisulfite PCR for amplification of double-stranded DNA, the method can readily be adapted to single-strand PCR. Useful applications will include analyses of limited template DNA for biomedical, ancient DNA and forensic purposes. PMID:15459281
Sequence Optimized Real-Time RT-PCR Assay for Detection of Crimean-Congo Hemorrhagic Fever Virus
2017-03-21
19-23]. Real-56 time reverse-transcription PCR remains the gold standard for quantitative , sensitive, and specific 57 detection of CCHFV; however...five-fold in two different series , and samples were run by real- time RT-PCR 116 in triplicate. The preliminary LOD was the lowest RNA dilution where...1 Sequence optimized real- time RT-PCR assay for detection of Crimean-Congo hemorrhagic fever 1 virus 2 3 JW Koehler1, KL Delp1, AT Hall1, SP
Hijjawi, Nawal; Yang, Rongchang; Hatmal, Ma'mon; Yassin, Yasmeen; Mharib, Taghrid; Mukbel, Rami; Mahmoud, Sameer Alhaj; Al-Shudifat, Abdel-Ellah; Ryan, Una
2018-02-01
Little is known about the prevalence of Giardia duodenalis in human patients in Jordan and all previous studies have used direct microscopy, which lacks sensitivity. The present study developed a novel quantitative PCR (qPCR) assay at the β-giardin (bg) locus and evaluated its use as a frontline test for the diagnosis of giardiasis in comparison with a commercially available ELISA using nested PCR and sequencing of the glutamate dehydrogenase (gdh) locus (gdh nPCR) as the gold standard. A total of 96 human faecal samples were collected from 96 patients suffering from diarrhoea from 5 regions of Jordan and were screened using the ELISA and qPCR. The analytical specificity of the bg qPCR assay revealed no cross-reactions with other genera and detected all the Giardia isolates tested. Analytical sensitivity was 1 Giardia cyst per μl of DNA extract. The overall prevalence of Giardia was 64.6%. The clinical sensitivity and specificity of the bg qPCR was 89.9% and 82.9% respectively compared to 76.5 and 68.0% for the ELISA. This study is the first to compare three different methods (ELISA, bg qPCR, nested PCR and sequencing at the gdh locus) to diagnose Jordanian patients suffering from giardiasis and to analyze their demographic data. Copyright © 2018 Elsevier Inc. All rights reserved.
Coleman, Russell E; Hochberg, Lisa P; Swanson, Katherine I; Lee, John S; McAvin, James C; Moulton, John K; Eddington, David O; Groebner, Jennifer L; O'Guinn, Monica L; Putnam, John L
2009-05-01
Sand flies collected between April 2003 and November 2004 at Tallil Air Base, Iraq, were evaluated for the presence of Leishmania parasites using a combination of a real-time Leishmania-generic polymerase chain reaction (PCR) assay and sequencing of a 360-bp fragment of the glucose-6-phosphate-isomerase (GPI) gene. A total of 2,505 pools containing 26,574 sand flies were tested using the real-time PCR assay. Leishmania DNA was initially detected in 536 pools; however, after extensive retesting with the real-time PCR assay, a total of 456 pools were considered positive and 80 were considered indeterminate. A total of 532 samples were evaluated for Leishmania GPI by sequencing, to include 439 PCR-positive samples, 80 PCR-indeterminate samples, and 13 PCR-negative samples. Leishmania GPI was detected in 284 samples that were sequenced, to include 281 (64%) of the PCR-positive samples and 3 (4%) of the PCR-indeterminate samples. Of the 284 sequences identified as Leishmania, 261 (91.9%) were L. tarentolae, 18 (6.3%) were L. donovani-complex parasites, 3 (1.1%) were L. tropica, and 2 were similar to both L. major and L. tropica. Minimum field infection rates were 0.09% for L. donovani-complex parasites, 0.02% for L. tropica, and 0.01% for the L. major/tropica-like parasite. Subsequent sequencing of a 600-bp region of the "Hyper" gene of 12 of the L. donovani-complex parasites showed that all 12 parasites were L. infantum. These data suggest that L. infantum was the primary leishmanial threat to U.S. military personnel deployed to Tallil Air Base. The implications of these findings are discussed.
Seyer, Ayse; Karasartova, Djursun; Ruh, Emrah; Güreser, Ayse Semra; Imir, Turgut; Taylan-Ozkan, Aysegul
2016-12-01
PCR and DNA sequencing are currently the diagnostic methods of choice for detection of Blastocystis spp. and their suptypes. Fresh or frozen stool samples have disadvantages in terms of several aspects such as transportation, storage, and existence of PCR inhibitors. Filter paper technology may provide a solution to these issues. The aim of the present study was to detect Blastocystis spp. and their subtypes by employing two different preservation methods: conventional frozen stool (FS) and dried stool spots on filter paper (DSSFP). Concentration and purity of DNA, sensitivity of PCR, and DNA sequencing results obtained from the two methods were also compared. A total of 230 fecal samples were included and separated into two parts: one part of the fecal samples were directly frozen and stored at -20 °C. The remaining portion of the specimens were homogenized with saline and spread onto the filter papers as thin layer with a diameter of approximately 3 cm. After air-dried, the filter papers were stored at room temperature. DSSFP samples were collected by scraping from the filter papers. DNA were extracted by EURx Stool DNA Extraction Kit from both samples. Concentration and purity were measured with Nano-Drop, then PCR and sequencing were conducted for detection of Blastocystis spp. and its genotypes. Pure DNA was obtained with a A260/A280 ratio of 1.7-2.2 in both methods. DNA yield from FS was 25-405 ng/μl and average DNA concentration was 151 ng/μl, while these were 7-339 and 122 ng/μl for DSSFP, respectively. No PCR inhibition was observed in two methods. DNA from DSSFP were found to be stable and PCR were reproducible for at least 1 year. FS-PCR- and DSSFP-PCR-positive samples were 49 (21.3 %) and 58 (25.3 %), respectively (p = 0.078). The 43 specimens were concordantly positive by both FS-PCR and DSSFP-PCR. When the microscopy was taken as the gold standard, sensitivity of DSSFP-PCR and FS-PCR was 95.5 and 86.4 %, while specificity of both tests was 99.4 and 98.3 %, respectively. DNA sequencing results of 19 microscopically confirmed cases were strictly identical (concordance 100 %) in both methods, and ST2:6, ST3:8, ST4:3, and ST6:2 were the detected subtypes. Among the 230 fecal samples, the most predominant subtypes were ST3, ST2, ST4, and ST1 by both FS and DSSFP methods. Concordance of DNA sequencing results obtained from the two methods was noted to be 90.7 %. To our knowledge, this is the first study that demonstrates DNA extraction from DSSFP is more sensitive and effective than the FS method for diagnosis of Blastocystis spp. and their subtypes by PCR and DNA sequencing.
Pilotte, Nils; Papaiakovou, Marina; Grant, Jessica R; Bierwert, Lou Ann; Llewellyn, Stacey; McCarthy, James S; Williams, Steven A
2016-03-01
The soil transmitted helminths are a group of parasitic worms responsible for extensive morbidity in many of the world's most economically depressed locations. With growing emphasis on disease mapping and eradication, the availability of accurate and cost-effective diagnostic measures is of paramount importance to global control and elimination efforts. While real-time PCR-based molecular detection assays have shown great promise, to date, these assays have utilized sub-optimal targets. By performing next-generation sequencing-based repeat analyses, we have identified high copy-number, non-coding DNA sequences from a series of soil transmitted pathogens. We have used these repetitive DNA elements as targets in the development of novel, multi-parallel, PCR-based diagnostic assays. Utilizing next-generation sequencing and the Galaxy-based RepeatExplorer web server, we performed repeat DNA analysis on five species of soil transmitted helminths (Necator americanus, Ancylostoma duodenale, Trichuris trichiura, Ascaris lumbricoides, and Strongyloides stercoralis). Employing high copy-number, non-coding repeat DNA sequences as targets, novel real-time PCR assays were designed, and assays were tested against established molecular detection methods. Each assay provided consistent detection of genomic DNA at quantities of 2 fg or less, demonstrated species-specificity, and showed an improved limit of detection over the existing, proven PCR-based assay. The utilization of next-generation sequencing-based repeat DNA analysis methodologies for the identification of molecular diagnostic targets has the ability to improve assay species-specificity and limits of detection. By exploiting such high copy-number repeat sequences, the assays described here will facilitate soil transmitted helminth diagnostic efforts. We recommend similar analyses when designing PCR-based diagnostic tests for the detection of other eukaryotic pathogens.
Sequencing on the SOLiD 5500xl System - in-depth characterization of the GC bias.
Roeh, Simone; Weber, Peter; Rex-Haffner, Monika; Deussing, Jan M; Binder, Elisabeth B; Jakovcevski, Mira
2017-07-04
Different types of sequencing biases have been described and subsequently improved for a variety of sequencing systems, mostly focusing on the widely used Illumina systems. Similar studies are missing for the SOLiD 5500xl system, a sequencer which produced many data sets available to researchers today. Describing and understanding the bias is important to accurately interpret and integrate these published data in various ongoing research projects. We report a particularly strong GC bias for this sequencing system when analyzing a defined gDNA mix of 5 microbes with a wide range of different GC contents (20-72%) when comparing to the expected distribution and Illumina MiSeq data from the same DNA pool. Since we observed this bias already under PCR-free conditions, changing the PCR conditions during library preparation - a common strategy to handle bias in the Illumina system - was not relevant. Source of the bias appeared to be an uneven heat distribution during the SOLiD emulsion PCR (ePCR) - for enrichment of libraries prior loading - since ePCR in either small pouches or in 96-well plates improved the GC bias. Sequencing of chromatin immunoprecipitated DNA (ChIP-seq) is a common approach in epigenetics. ChIP-seq of the mixed source histone mark H3K9ac (acetyl Histone H3 lysine 9), typically found on promoter regions and on gene bodies, including CpG islands, performed on a SOLiD 5500xl machine, resulted in major loss of reads at GC rich loci (GC content ≥ 62%), not explained by low sequencing depth. This was improved with adaptations of the ePCR.
Shahin, Arwa; Smulders, Marinus J. M.; van Tuyl, Jaap M.; Arens, Paul; Bakker, Freek T.
2014-01-01
Next Generation Sequencing (NGS) may enable estimating relationships among genotypes using allelic variation of multiple nuclear genes simultaneously. We explored the potential and caveats of this strategy in four genetically distant Lilium cultivars to estimate their genetic divergence from transcriptome sequences using three approaches: POFAD (Phylogeny of Organisms from Allelic Data, uses allelic information of sequence data), RAxML (Randomized Accelerated Maximum Likelihood, tree building based on concatenated consensus sequences) and Consensus Network (constructing a network summarizing among gene tree conflicts). Twenty six gene contigs were chosen based on the presence of orthologous sequences in all cultivars, seven of which also had an orthologous sequence in Tulipa, used as out-group. The three approaches generated the same topology. Although the resolution offered by these approaches is high, in this case there was no extra benefit in using allelic information. We conclude that these 26 genes can be widely applied to construct a species tree for the genus Lilium. PMID:25368628
Pena, S D; Barreto, G; Vago, A R; De Marco, L; Reinach, F C; Dias Neto, E; Simpson, A J
1994-01-01
Low-stringency single specific primer PCR (LSSP-PCR) is an extremely simple PCR-based technique that detects single or multiple mutations in gene-sized DNA fragments. A purified DNA fragment is subjected to PCR using high concentrations of a single specific oligonucleotide primer, large amounts of Taq polymerase, and a very low annealing temperature. Under these conditions the primer hybridizes specifically to its complementary region and nonspecifically to multiple sites within the fragment, in a sequence-dependent manner, producing a heterogeneous set of reaction products resolvable by electrophoresis. The complex banding pattern obtained is significantly altered by even a single-base change and thus constitutes a unique "gene signature." Therefore LSSP-PCR will have almost unlimited application in all fields of genetics and molecular medicine where rapid and sensitive detection of mutations and sequence variations is important. The usefulness of LSSP-PCR is illustrated by applications in the study of mutants of smooth muscle myosin light chain, analysis of a family with X-linked nephrogenic diabetes insipidus, and identity testing using human mitochondrial DNA. Images PMID:8127912
Ishii, Satoshi; Sadowsky, Michael J
2009-04-01
A large number of repetitive DNA sequences are found in multiple sites in the genomes of numerous bacteria, archaea and eukarya. While the functions of many of these repetitive sequence elements are unknown, they have proven to be useful as the basis of several powerful tools for use in molecular diagnostics, medical microbiology, epidemiological analyses and environmental microbiology. The repetitive sequence-based PCR or rep-PCR DNA fingerprint technique uses primers targeting several of these repetitive elements and PCR to generate unique DNA profiles or 'fingerprints' of individual microbial strains. Although this technique has been extensively used to examine diversity among variety of prokaryotic microorganisms, rep-PCR DNA fingerprinting can also be applied to microbial ecology and microbial evolution studies since it has the power to distinguish microbes at the strain or isolate level. Recent advancement in rep-PCR methodology has resulted in increased accuracy, reproducibility and throughput. In this minireview, we summarize recent improvements in rep-PCR DNA fingerprinting methodology, and discuss its applications to address fundamentally important questions in microbial ecology and evolution.
Multiplex PCR identification of Taenia spp. in rodents and carnivores.
Al-Sabi, Mohammad N S; Kapel, Christian M O
2011-11-01
The genus Taenia includes several species of veterinary and public health importance, but diagnosis of the etiological agent in definitive and intermediate hosts often relies on labor intensive and few specific morphometric criteria, especially in immature worms and underdeveloped metacestodes. In the present study, a multiplex PCR, based on five primers targeting the 18S rDNA and ITS2 sequences, produced a species-specific banding patterns for a range of Taenia spp. Species typing by the multiplex PCR was compared to morphological identification and sequencing of cox1 and/or 12S rDNA genes. As compared to sequencing, the multiplex PCR identified 31 of 32 Taenia metacestodes from rodents, whereas only 14 cysts were specifically identified by morphology. Likewise, the multiplex PCR identified 108 of 130 adult worms, while only 57 were identified to species by morphology. The tested multiplex PCR system may potentially be used for studies of Taenia spp. transmitted between rodents and carnivores.
Gerstner, Arpad; DeFord, James H; Papaconstantinou, John
2003-07-25
Ames dwarfism is caused by a homozygous single nucleotide mutation in the pituitary specific prop-1 gene, resulting in combined pituitary hormone deficiency, reduced growth and extended lifespan. Thus, these mice serve as an important model system for endocrinological, aging and longevity studies. Because the phenotype of wild type and heterozygous mice is undistinguishable, it is imperative for successful breeding to accurately genotype these animals. Here we report a novel, yet simple, approach for prop-1 genotyping using PCR-based allele-specific amplification (PCR-ASA). We also compare this method to other potential genotyping techniques, i.e. PCR-based restriction fragment length polymorphism analysis (PCR-RFLP) and fluorescence automated DNA sequencing. We demonstrate that the single-step PCR-ASA has several advantages over the classical PCR-RFLP because the procedure is simple, less expensive and rapid. To further increase the specificity and sensitivity of the PCR-ASA, we introduced a single-base mismatch at the 3' penultimate position of the mutant primer. Our results also reveal that the fluorescence automated DNA sequencing has limitations for detecting a single nucleotide polymorphism in the prop-1 gene, particularly in heterozygotes.
Detection of Grapevine Leafroll-associated virus 7 using real-time qRT-PCR and conventional RT-PCR
USDA-ARS?s Scientific Manuscript database
Nine isolates of Grapevine Leafroll-associated Virus 7 (GLRaV-7) from California have been sequenced to design more sensitive molecular diagnostic tools. These sequences were from the coat protein (CP) and the homologous heat shock protein (hHSP70) genes. Sequence identity among these isolates rang...
Altimari, Annalisa; de Biase, Dario; De Maglio, Giovanna; Gruppioni, Elisa; Capizzi, Elisa; Degiovanni, Alessio; D’Errico, Antonia; Pession, Annalisa; Pizzolitto, Stefano; Fiorentino, Michelangelo; Tallini, Giovanni
2013-01-01
Detection of KRAS mutations in archival pathology samples is critical for therapeutic appropriateness of anti-EGFR monoclonal antibodies in colorectal cancer. We compared the sensitivity, specificity, and accuracy of Sanger sequencing, ARMS-Scorpion (TheraScreen®) real-time polymerase chain reaction (PCR), pyrosequencing, chip array hybridization, and 454 next-generation sequencing to assess KRAS codon 12 and 13 mutations in 60 nonconsecutive selected cases of colorectal cancer. Twenty of the 60 cases were detected as wild-type KRAS by all methods with 100% specificity. Among the 40 mutated cases, 13 were discrepant with at least one method. The sensitivity was 85%, 90%, 93%, and 92%, and the accuracy was 90%, 93%, 95%, and 95% for Sanger sequencing, TheraScreen real-time PCR, pyrosequencing, and chip array hybridization, respectively. The main limitation of Sanger sequencing was its low analytical sensitivity, whereas TheraScreen real-time PCR, pyrosequencing, and chip array hybridization showed higher sensitivity but suffered from the limitations of predesigned assays. Concordance between the methods was k = 0.79 for Sanger sequencing and k > 0.85 for the other techniques. Tumor cell enrichment correlated significantly with the abundance of KRAS-mutated deoxyribonucleic acid (DNA), evaluated as ΔCt for TheraScreen real-time PCR (P = 0.03), percentage of mutation for pyrosequencing (P = 0.001), ratio for chip array hybridization (P = 0.003), and percentage of mutation for 454 next-generation sequencing (P = 0.004). Also, 454 next-generation sequencing showed the best cross correlation for quantification of mutation abundance compared with all the other methods (P < 0.001). Our comparison showed the superiority of next-generation sequencing over the other techniques in terms of sensitivity and specificity. Next-generation sequencing will replace Sanger sequencing as the reference technique for diagnostic detection of KRAS mutation in archival tumor tissues. PMID:23950653
Arakawa, C.K.; Deering, R.E.; Higman, K.H.; Oshima, K.H.; O'Hara, P.J.; Winton, J.R.
1990-01-01
The polymerase chain reaction [PCR) was used to amplify a portion of the nucleoprotein [NI gene of infectious hematopoietic necrosis virus (IHNV). Using a published sequence for the Round Butte isolate of IHNV, a pair of PCR pnmers was synthesized that spanned a 252 nucleotide region of the N gene from residue 319 to residue 570 of the open reading frame. This region included a 30 nucleotide target sequence for a synthetic oligonucleotide probe developed for detection of IHNV N gene messenger RNA. After 25 cycles of amplification of either messenger or genomic RNA, the PCR product (DNA) of the expected size was easily visible on agarose gels stained with ethidium bromide. The specificity of the amplified DNA was confirmed by Southern and dot-blot analysis using the biotinylated oligonucleotide probe. The PCR was able to amplify the N gene sequence of purified genomic RNA from isolates of IHNV representing 5 different electropherotypes. Using the IHNV primer set, no PCR product was obtained from viral hemorrhagic septicemia virus RNA, but 2 higher molecular weight products were synthesized from hirame rhabdovirus RNA that did not hybridize with the biotinylated probe. The PCR could be efficiently performed with all IHNV genomic RNA template concentrations tested (1 ng to 1 pg). The lowest level of sensitivity was not determined. The PCR was used to amplify RNA extracted from infected cell cultures and selected tissues of Infected rainbow trout. The combination of PCR and nucleic acid probe promises to provide a detection method for IHNV that is rapid, h~ghly specific, and sensitive.
Rapid RHD Zygosity Determination Using Digital PCR.
Sillence, Kelly A; Halawani, Amr J; Tounsi, Wajnat A; Clarke, Kirsty A; Kiernan, Michele; Madgett, Tracey E; Avent, Neil D
2017-08-01
Paternal zygosity testing is used for determining homo- or hemizygosity of RHD in pregnancies that are at a risk of hemolytic disease of the fetus and newborn. At present, this is achieved by using real-time PCR or the Rhesus box PCR, which can be difficult to interpret and unreliable, particularly for black African populations. DNA samples extracted from 53 blood donors were analyzed using 2 multiplex reactions for RHD -specific targets against a reference ( AGO1 ) 2 to determine gene dosage by digital PCR. Results were compared with serological data, and the correct genotype for 2 discordant results was determined by long-range PCR (LR-PCR), next-generation sequencing, and conventional Sanger sequencing. The results showed clear and reliable determination of RHD zygosity using digital PCR and revealed that 4 samples did not match the serologically predicted genotype. Sanger sequencing and long-range PCR followed by next-generation sequencing revealed that the correct genotypes for samples 729M and 351D, which were serologically typed as R 1 R 2 (DCe/DcE), were R 2 r' (DcE/dCe) for 729M and R 1 r″ (DCe/dcE), R 0 r y (Dce/dCE), or R Z r (DCE/dce) for 351D, in concordance with the digital PCR data. Digital PCR provides a highly accurate method to rapidly define blood group zygosity and has clinical application in the analysis of Rh phenotyped or genotyped samples. The vast majority of current blood group genotyping platforms are not designed to define zygosity, and thus, this technique may be used to define paternal RH zygosity in pregnancies that are at a risk of hemolytic disease of the fetus and newborn and can distinguish between homo- and hemizygous RHD -positive individuals. © 2017 American Association for Clinical Chemistry.
Miyazaki, Saori; Sato, Yutaka; Asano, Tomoya; Nagamura, Yoshiaki; Nonomura, Ken-Ichi
2015-10-01
Post-transcriptional gene regulation by RNA recognition motif (RRM) proteins through binding to cis-elements in the 3'-untranslated region (3'-UTR) is widely used in eukaryotes to complete various biological processes. Rice MEIOSIS ARRESTED AT LEPTOTENE2 (MEL2) is the RRM protein that functions in the transition to meiosis in proper timing. The MEL2 RRM preferentially associated with the U-rich RNA consensus, UUAGUU[U/A][U/G][A/U/G]U, dependently on sequences and proportionally to MEL2 protein amounts in vitro. The consensus sequences were located in the putative looped structures of the RNA ligand. A genome-wide survey revealed a tendency of MEL2-binding consensus appearing in 3'-UTR of rice genes. Of 249 genes that conserved the consensus in their 3'-UTR, 13 genes spatiotemporally co-expressed with MEL2 in meiotic flowers, and included several genes whose function was supposed in meiosis; such as Replication protein A and OsMADS3. The proteome analysis revealed that the amounts of small ubiquitin-related modifier-like protein and eukaryotic translation initiation factor3-like protein were dramatically altered in mel2 mutant anthers. Taken together with transcriptome and gene ontology results, we propose that the rice MEL2 is involved in the translational regulation of key meiotic genes on 3'-UTRs to achieve the faithful transition of germ cells to meiosis.
Evidence for Horizontal Gene Transfer in Evolution of Elongation Factor Tu in Enterococci
Ke, Danbing; Boissinot, Maurice; Huletsky, Ann; Picard, François J.; Frenette, Johanne; Ouellette, Marc; Roy, Paul H.; Bergeron, Michel G.
2000-01-01
The elongation factor Tu, encoded by tuf genes, is a GTP binding protein that plays a central role in protein synthesis. One to three tuf genes per genome are present, depending on the bacterial species. Most low-G+C-content gram-positive bacteria carry only one tuf gene. We have designed degenerate PCR primers derived from consensus sequences of the tuf gene to amplify partial tuf sequences from 17 enterococcal species and other phylogenetically related species. The amplified DNA fragments were sequenced either by direct sequencing or by sequencing cloned inserts containing putative amplicons. Two different tuf genes (tufA and tufB) were found in 11 enterococcal species, including Enterococcus avium, Enterococcus casseliflavus, Enterococcus dispar, Enterococcus durans, Enterococcus faecium, Enterococcus gallinarum, Enterococcus hirae, Enterococcus malodoratus, Enterococcus mundtii, Enterococcus pseudoavium, and Enterococcus raffinosus. For the other six enterococcal species (Enterococcus cecorum, Enterococcus columbae, Enterococcus faecalis, Enterococcus sulfureus, Enterococcus saccharolyticus, and Enterococcus solitarius), only the tufA gene was present. Based on 16S rRNA gene sequence analysis, the 11 species having two tuf genes all have a common ancestor, while the six species having only one copy diverged from the enterococcal lineage before that common ancestor. The presence of one or two copies of the tuf gene in enterococci was confirmed by Southern hybridization. Phylogenetic analysis of tuf sequences demonstrated that the enterococcal tufA gene branches with the Bacillus, Listeria, and Staphylococcus genera, while the enterococcal tufB gene clusters with the genera Streptococcus and Lactococcus. Primary structure analysis showed that four amino acid residues encoded within the sequenced regions are conserved and unique to the enterococcal tufB genes and the tuf genes of streptococci and Lactococcus lactis. The data suggest that an ancestral streptococcus or a streptococcus-related species may have horizontally transferred a tuf gene to the common ancestor of the 11 enterococcal species which now carry two tuf genes. PMID:11092850
Liu, Hong-Mei; Cheng, Peng; Huang, Xiaodan; Dai, Yu-Hua; Wang, Hai-Fang; Liu, Li-Juan; Zhao, Yu-Qiang; Wang, Huai-Wei; Gong, Mao-Qing
2013-02-01
The present study aimed to investigate deltamethrin resistance in Culex pipiens pallens (C. pipiens pallens) mosquitoes and its correlation with knockdown resistance (kdr) mutations. In addition, mosquito‑resistance testing methods were analyzed. Using specific primers in polymerase chain reaction (PCR) and allele-specific (AS)-PCR, kdr gene sequences isolated from wild C. pipiens pallens mosquitoes were sequenced. Linear regression analysis was used to determine the correlation between the mutations and deltamethrin resistance. A kdr allelic gene was cloned and sequenced. Analysis of the DNA sequences revealed the presence of two point mutations at the L1014 residue in the IIS6 transmembrane segment of the voltage‑gated sodium channel (VGSC): L1014F, TTA→TTT, replacing a leucine (L) with a phenylalanine (F); L1014S, TTA→TCA, replacing leucine (L) with serine (S). Two alternative kdr-like mutations, L1014F and L1014S, were identified to be positively correlated with the deltamethrin-resistant phenotype. In addition a novel mutation, TCT, was identified in the VGSC of C. pipiens pallens. PCR and AS-PCR yielded consistent results with respect to mosquito resistance. However, the detection rate of PCR was higher than that of AS-PCR. Further studies are required to determine the specific resistance mechanism. PCR and AS-PCR demonstrated suitability for mosquito resistance field tests, however, the former method may be superior to the latter.
STITCHER: A web resource for high-throughput design of primers for overlapping PCR applications.
O'Halloran, Damien M
2015-06-01
Overlapping PCR is routinely used in a wide number of molecular applications. These include stitching PCR fragments together, generating fluorescent transcriptional and translational fusions, inserting mutations, making deletions, and PCR cloning. Overlapping PCR is also used for genotyping by traditional PCR techniques and in detection experiments using techniques such as loop-mediated isothermal amplification (LAMP). STITCHER is a web tool providing a central resource for researchers conducting all types of overlapping PCR experiments with an intuitive interface for automated primer design that's fast, easy to use, and freely available online (http://ohalloranlab.net/STITCHER.html). STITCHER can handle both single sequence and multi-sequence input, and specific features facilitate numerous other PCR applications, including assembly PCR, adapter PCR, and primer walking. Field PCR, and in particular, LAMP, offers promise as an on site tool for pathogen detection in underdeveloped areas, and STITCHER includes off-target detection features for pathogens commonly targeted using LAMP technology.
Positive Streptobacillus moniliformis PCR in guinea pigs likely due to Leptotrichia spp.
Boot, Ron; Van de Berg, Lia; Reubsaet, Frans A G; Vlemminx, Maurice J
2008-04-30
Streptobacillus moniliformis is a zoonotic bacterium. We obtained positive S. moniliformis PCR results in oral swab samples from guinea pigs from an experimental colony and the breeding colony of origin. Comparison of the DNA sequence of an amplicon with deposited 16S rDNA sequences revealed that Leptotrichia sp. can be the source of a false positive S. moniliformis PCR outcome.
Position-dependent effects of locked nucleic acid (LNA) on DNA sequencing and PCR primers
Levin, Joshua D.; Fiala, Dean; Samala, Meinrado F.; Kahn, Jason D.; Peterson, Raymond J.
2006-01-01
Genomes are becoming heavily annotated with important features. Analysis of these features often employs oligonucleotides that hybridize at defined locations. When the defined location lies in a poor sequence context, traditional design strategies may fail. Locked Nucleic Acid (LNA) can enhance oligonucleotide affinity and specificity. Though LNA has been used in many applications, formal design rules are still being defined. To further this effort we have investigated the effect of LNA on the performance of sequencing and PCR primers in AT-rich regions, where short primers yield poor sequencing reads or PCR yields. LNA was used in three positional patterns: near the 5′ end (LNA-5′), near the 3′ end (LNA-3′) and distributed throughout (LNA-Even). Quantitative measures of sequencing read length (Phred Q30 count) and real-time PCR signal (cycle threshold, CT) were characterized using two-way ANOVA. LNA-5′ increased the average Phred Q30 score by 60% and it was never observed to decrease performance. LNA-5′ generated cycle thresholds in quantitative PCR that were comparable to high-yielding conventional primers. In contrast, LNA-3′ and LNA-Even did not improve read lengths or CT. ANOVA demonstrated the statistical significance of these results and identified significant interaction between the positional design rule and primer sequence. PMID:17071964
Molecular approaches to Taenia asiatica.
Jeon, Hyeong-Kyu; Eom, Keeseon S
2013-02-01
Taenia solium, T. saginata, and T. asiatica are taeniid tapeworms that cause taeniasis in humans and cysticercosis in intermediate host animals. Taeniases remain an important public health concerns in the world. Molecular diagnostic methods using PCR assays have been developed for rapid and accurate detection of human infecting taeniid tapeworms, including the use of sequence-specific DNA probes, PCR-RFLP, and multiplex PCR. More recently, DNA diagnosis using PCR based on histopathological specimens such as 10% formalin-fixed paraffin-embedded and stained sections mounted on slides has been applied to cestode infections. The mitochondrial gene sequence is believed to be a very useful molecular marker for not only studying evolutionary relationships among distantly related taxa, but also for investigating the phylo-biogeography of closely related species. The complete sequence of the human Taenia tapeworms mitochondrial genomes were determined, and its organization and structure were compared to other human-tropic Taenia tapeworms for which complete mitochondrial sequence data were available. The multiplex PCR assay with the Ta4978F, Ts5058F, Tso7421F, and Rev7915 primers will be useful for differential diagnosis, molecular characterization, and epidemiological surveys of human Taenia tapeworms.
MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR.
Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo
2015-11-16
Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
R2R - software to speed the depiction of aesthetic consensus RNA secondary structures
2011-01-01
Background With continuing identification of novel structured noncoding RNAs, there is an increasing need to create schematic diagrams showing the consensus features of these molecules. RNA structural diagrams are typically made either with general-purpose drawing programs like Adobe Illustrator, or with automated or interactive programs specific to RNA. Unfortunately, the use of applications like Illustrator is extremely time consuming, while existing RNA-specific programs produce figures that are useful, but usually not of the same aesthetic quality as those produced at great cost in Illustrator. Additionally, most existing RNA-specific applications are designed for drawing single RNA molecules, not consensus diagrams. Results We created R2R, a computer program that facilitates the generation of aesthetic and readable drawings of RNA consensus diagrams in a fraction of the time required with general-purpose drawing programs. Since the inference of a consensus RNA structure typically requires a multiple-sequence alignment, the R2R user annotates the alignment with commands directing the layout and annotation of the RNA. R2R creates SVG or PDF output that can be imported into Adobe Illustrator, Inkscape or CorelDRAW. R2R can be used to create consensus sequence and secondary structure models for novel RNA structures or to revise models when new representatives for known RNA classes become available. Although R2R does not currently have a graphical user interface, it has proven useful in our efforts to create 100 schematic models of distinct noncoding RNA classes. Conclusions R2R makes it possible to obtain high-quality drawings of the consensus sequence and structural models of many diverse RNA structures with a more practical amount of effort. R2R software is available at http://breaker.research.yale.edu/R2R and as an Additional file. PMID:21205310
Nonhybrid, finished microbial genome assemblies from long-read SMRT sequencing data.
Chin, Chen-Shan; Alexander, David H; Marks, Patrick; Klammer, Aaron A; Drake, James; Heiner, Cheryl; Clum, Alicia; Copeland, Alex; Huddleston, John; Eichler, Evan E; Turner, Stephen W; Korlach, Jonas
2013-06-01
We present a hierarchical genome-assembly process (HGAP) for high-quality de novo microbial genome assemblies using only a single, long-insert shotgun DNA library in conjunction with Single Molecule, Real-Time (SMRT) DNA sequencing. Our method uses the longest reads as seeds to recruit all other reads for construction of highly accurate preassembled reads through a directed acyclic graph-based consensus procedure, which we follow with assembly using off-the-shelf long-read assemblers. In contrast to hybrid approaches, HGAP does not require highly accurate raw reads for error correction. We demonstrate efficient genome assembly for several microorganisms using as few as three SMRT Cell zero-mode waveguide arrays of sequencing and for BACs using just one SMRT Cell. Long repeat regions can be successfully resolved with this workflow. We also describe a consensus algorithm that incorporates SMRT sequencing primary quality values to produce de novo genome sequence exceeding 99.999% accuracy.
Camargo, Vinícius da Silva; Santana, Bruna Nicoleti; Ferrari, Elis Domingos; Nakamura, Alex Akira; Nagata, Walter Bertequini; Nardi, Ana Rita Moraes; Meireles, Marcelo Vasconcelos
2018-01-01
This study used several diagnostic methods to examine the occurrence of and molecularly characterize Cryptosporidium spp. in captive canaries (Serinus canaria) in southern and southeastern Brazil. A total of 498 fecal samples were purified by centrifugal-flotation using Sheather's solution. Cryptosporidium spp. diagnosis was performed using three diagnostic methods: malachite green negative staining, nested PCR targeting the 18S rRNA gene, followed by sequencing the amplified fragments, and duplex real-time PCR targeting the 18S rRNA specific to detect Cryptosporidium galli and Cryptosporidium avian genotype III. The overall positivity for Cryptosporidium spp. (total samples positive in at least one protocol) from the microscopic analysis, nested PCR and duplex real-time PCR protocol results was 13.3% (66/498). The positivity rates were 2.0% (10/498) and 4.6% (23/498) for Cryptosporidium spp. by microscopy and nested PCR, respectively. Sequencing of 20 samples amplified by nested PCR identified C. galli (3.0%; 15/498), Cryptosporidium avian genotype I (0.8%; 4/498) and Cryptosporidium avium (0.2%; 1/498). Duplex real-time PCR revealed a positivity of 7.8% (39/498) for C. galli and 2.4% (12/498) for avian genotype III. Malachite green negative staining differed significantly from nested PCR in detecting Cryptosporidium spp. Duplex real-time PCR was more sensitive than nested PCR/sequencing for detecting gastric Cryptosporidium in canaries.
Singh, B N; Mudgil, Yashwanti; Sopory, S K; Reddy, M K
2003-07-01
We have successfully expressed enzymatically active plant topoisomerase II in Escherichia coli for the first time, which has enabled its biochemical characterization. Using a PCR-based strategy, we obtained a full-length cDNA and the corresponding genomic clone of tobacco topoisomerase II. The genomic clone has 18 exons interrupted by 17 introns. Most of the 5' and 3' splice junctions follow the typical canonical consensus dinucleotide sequence GU-AG present in other plant introns. The position of introns and phasing with respect to primary amino acid sequence in tobacco TopII and Arabidopsis TopII are highly conserved, suggesting that the two genes are evolved from the common ancestral type II topoisomerase gene. The cDNA encodes a polypeptide of 1482 amino acids. The primary amino acid sequence shows a striking sequence similarity, preserving all the structural domains that are conserved among eukaryotic type II topoisomerases in an identical spatial order. We have expressed the full-length polypeptide in E. coli and purified the recombinant protein to homogeneity. The full-length polypeptide relaxed supercoiled DNA and decatenated the catenated DNA in a Mg(2+)- and ATP-dependent manner, and this activity was inhibited by 4'-(9-acridinylamino)-3'-methoxymethanesulfonanilide (m-AMSA). The immunofluorescence and confocal microscopic studies, with antibodies developed against the N-terminal region of tobacco recombinant topoisomerase II, established the nuclear localization of topoisomerase II in tobacco BY2 cells. The regulated expression of tobacco topoisomerase II gene under the GAL1 promoter functionally complemented a temperature-sensitive TopII(ts) yeast mutant.
Kotásková, Iva; Mališová, Barbora; Obručová, Hana; Holá, Veronika; Peroutková, Tereza; Růžička, Filip; Freiberger, Tomáš
2017-01-01
Complex samples are a challenge for sequencing-based broad-range diagnostics. We analysed 19 urinary catheter, ureteral Double-J catheter, and urine samples using 3 methodological approaches. Out of the total 84 operational taxonomic units, 37, 61, and 88% were identified by culture, PCR-DGGE-SS (PCR denaturing gradient gel electrophoresis followed by Sanger sequencing), and PCR-DGGE-RM (PCR- DGGE combined with software chromatogram separation by RipSeq Mixed tool), respectively. The latter approach was shown to be an efficient tool to complement culture in complex sample assessment. © 2017 S. Karger AG, Basel.
Identification and application of self-binding zipper-like sequences in SARS-CoV spike protein.
Zhang, Si Min; Liao, Ying; Neo, Tuan Ling; Lu, Yanning; Liu, Ding Xiang; Vahlne, Anders; Tam, James P
2018-05-22
Self-binding peptides containing zipper-like sequences, such as the Leu/Ile zipper sequence within the coiled coil regions of proteins and the cross-β spine steric zippers within the amyloid-like fibrils, could bind to the protein-of-origin through homophilic sequence-specific zipper motifs. These self-binding sequences represent opportunities for the development of biochemical tools and/or therapeutics. Here, we report on the identification of a putative self-binding β-zipper-forming peptide within the severe acute respiratory syndrome-associated coronavirus spike (S) protein and its application in viral detection. Peptide array scanning of overlapping peptides covering the entire length of S protein identified 34 putative self-binding peptides of six clusters, five of which contained octapeptide core consensus sequences. The Cluster I consensus octapeptide sequence GINITNFR was predicted by the Eisenberg's 3D profile method to have high amyloid-like fibrillation potential through steric β-zipper formation. Peptide C6 containing the Cluster I consensus sequence was shown to oligomerize and form amyloid-like fibrils. Taking advantage of this, C6 was further applied to detect the S protein expression in vitro by fluorescence staining. Meanwhile, the coiled-coil-forming Leu/Ile heptad repeat sequences within the S protein were under-represented during peptide array scanning, in agreement with that long peptide lengths were required to attain high helix-mediated interaction avidity. The data suggest that short β-zipper-like self-binding peptides within the S protein could be identified through combining the peptide scanning and predictive methods, and could be exploited as biochemical detection reagents for viral infection. Copyright © 2018. Published by Elsevier Ltd.
Lazinski, David W.; Camilli, Andrew
2013-01-01
The amplification of DNA fragments, cloned between user-defined 5′ and 3′ end sequences, is a prerequisite step in the use of many current applications including massively parallel sequencing (MPS). Here we describe an improved method, called homopolymer tail-mediated ligation PCR (HTML-PCR), that requires very little starting template, minimal hands-on effort, is cost-effective, and is suited for use in high-throughput and robotic methodologies. HTML-PCR starts with the addition of homopolymer tails of controlled lengths to the 3′ termini of a double-stranded genomic template. The homopolymer tails enable the annealing-assisted ligation of a hybrid oligonucleotide to the template's recessed 5′ ends. The hybrid oligonucleotide has a user-defined sequence at its 5′ end. This primer, together with a second primer composed of a longer region complementary to the homopolymer tail and fused to a second 5′ user-defined sequence, are used in a PCR reaction to generate the final product. The user-defined sequences can be varied to enable compatibility with a wide variety of downstream applications. We demonstrate our new method by constructing MPS libraries starting from nanogram and sub-nanogram quantities of Vibrio cholerae and Streptococcus pneumoniae genomic DNA. PMID:23311318
Kutyavin, Igor V.
2013-01-01
Described in the article is a new approach for the sequence-specific detection of nucleic acids in real-time polymerase chain reaction (PCR) using fluorescently labeled oligonucleotide probes. The method is based on the production of PCR amplicons, which fold into dumbbell-like secondary structures carrying a specially designed ‘probe-luring’ sequence at their 5′ ends. Hybridization of this sequence to a complementary ‘anchoring’ tail introduced at the 3′ end of a fluorescent probe enables the probe to bind to its target during PCR, and the subsequent probe cleavage results in the florescence signal. As it has been shown in the study, this amplicon-endorsed and guided formation of the probe-target duplex allows the use of extremely short oligonucleotide probes, up to tetranucleotides in length. In particular, the short length of the fluorescent probes makes possible the development of a ‘universal’ probe inventory that is relatively small in size but represents all possible sequence variations. The unparalleled cost-effectiveness of the inventory approach is discussed. Despite the short length of the probes, this new method, named Angler real-time PCR, remains highly sequence specific, and the results of the study indicate that it can be effectively used for quantitative PCR and the detection of polymorphic variations. PMID:24013564
de Souza, Marcela; Matsuzawa, Tetsuhiro; Sakai, Kanae; Muraosa, Yasunori; Lyra, Luzia; Busso-Lopes, Ariane Fidelis; Levin, Anna Sara Shafferman; Schreiber, Angélica Zaninelli; Mikami, Yuzuru; Gonoi, Tohoru; Kamei, Katsuhiko; Moretti, Maria Luiza; Trabasso, Plínio
2017-08-01
The performance of three molecular biology techniques, i.e., DNA microarray, loop-mediated isothermal amplification (LAMP), and real-time PCR were compared with DNA sequencing for properly identification of 20 isolates of Fusarium spp. obtained from blood stream as etiologic agent of invasive infections in patients with hematologic malignancies. DNA microarray, LAMP and real-time PCR identified 16 (80%) out of 20 samples as Fusarium solani species complex (FSSC) and four (20%) as Fusarium spp. The agreement among the techniques was 100%. LAMP exhibited 100% specificity, while DNA microarray, LAMP and real-time PCR showed 100% sensitivity. The three techniques had 100% agreement with DNA sequencing. Sixteen isolates were identified as FSSC by sequencing, being five Fusarium keratoplasticum, nine Fusarium petroliphilum and two Fusarium solani. On the other hand, sequencing identified four isolates as Fusarium non-solani species complex (FNSSC), being three isolates as Fusarium napiforme and one isolate as Fusarium oxysporum. Finally, LAMP proved to be faster and more accessible than DNA microarray and real-time PCR, since it does not require a thermocycler. Therefore, LAMP signalizes as emerging and promising methodology to be used in routine identification of Fusarium spp. among cases of invasive fungal infections.
Casillas, Rosario; Tabernero, David; Gregori, Josep; Belmonte, Irene; Cortese, Maria Francesca; González, Carolina; Riveiro-Barciela, Mar; López, Rosa Maria; Quer, Josep; Esteban, Rafael; Buti, Maria; Rodríguez-Frías, Francisco
2018-01-01
AIM To determine the variability/conservation of the domain of hepatitis B virus (HBV) preS1 region that interacts with sodium-taurocholate cotransporting polypeptide (hereafter, NTCP-interacting domain) and the prevalence of the rs2296651 polymorphism (S267F, NTCP variant) in a Spanish population. METHODS Serum samples from 246 individuals were included and divided into 3 groups: patients with chronic HBV infection (CHB) (n = 41, 73% Caucasians), patients with resolved HBV infection (n = 100, 100% Caucasians) and an HBV-uninfected control group (n = 105, 100% Caucasians). Variability/conservation of the amino acid (aa) sequences of the NTCP-interacting domain, (aa 2-48 in viral genotype D) and a highly conserved preS1 domain associated with virion morphogenesis (aa 92-103 in viral genotype D) were analyzed by next-generation sequencing and compared in 18 CHB patients with viremia > 4 log IU/mL. The rs2296651 polymorphism was determined in all individuals in all 3 groups using an in-house real-time PCR melting curve analysis. RESULTS The HBV preS1 NTCP-interacting domain showed a high degree of conservation among the examined viral genomes especially between aa 9 and 21 (in the genotype D consensus sequence). As compared with the virion morphogenesis domain, the NTCP-interacting domain had a smaller proportion of HBV genotype-unrelated changes comprising > 1% of the quasispecies (25.5% vs 31.8%), but a larger proportion of genotype-associated viral polymorphisms (34% vs 27.3%), according to consensus sequences from GenBank patterns of HBV genotypes A to H. Variation/conservation in both domains depended on viral genotype, with genotype C being the most highly conserved and genotype E the most variable (limited finding, only 2 genotype E included). Of note, proline residues were highly conserved in both domains, and serine residues showed changes only to threonine or tyrosine in the virion morphogenesis domain. The rs2296651 polymorphism was not detected in any participant. CONCLUSION In our CHB population, the NTCP-interacting domain was highly conserved, particularly the proline residues and essential amino acids related with the NTCP interaction, and the prevalence of rs2296651 was low/null. PMID:29456407
Nucleotide sequence of the gene encoding the nitrogenase iron protein of Thiobacillus ferrooxidans
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pretorius, I.M.; Rawlings, D.E.; O'Neill, E.G.
1987-01-01
The DNA sequence was determined for the cloned Thiobacillus ferrooxidans nifH and part of the nifD genes. The DNA chains were radiolabeled with (..cap alpha..-/sup 32/P)dCTP (3000 Ci/mmol) or (..cap alpha..-/sup 35/S)dCTP (400 Ci/mmol). A putative T. ferrooxidans nifH promoter was identified whose sequences showed perfect consensus with those of the Klebsiella pneumoniae nif promoter. Two putative consensus upstream activator sequences were also identified. The amino acid sequence was deduced from the DNA sequence. In a comparison of nifH DNA sequences from T. ferrooxidans and eight other nitrogen-fixing microbes, a Rhizobium sp. isolated from Parasponia andersonii showed the greatest homologymore » (74%) and Clostridium pasteurianum (nifH1) showed the least homology (54%). In the comparison of the amino acid sequences of the Fe proteins, the Rhizobium sp. and Rhizobium japonicum showed the greatest homology (both 86%) and C. pasteurianum (nifH1 gene product) demonstrated the least homology (56%) to the T. ferrooxidans Fe protein.« less
Characterization of a new apple luteovirus identified by high-throughput sequencing.
Liu, Huawei; Wu, Liping; Nikolaeva, Ekaterina; Peter, Kari; Liu, Zongrang; Mollov, Dimitre; Cao, Mengji; Li, Ruhui
2018-05-15
'Rapid Apple Decline' (RAD) is a newly emerging problem of young, dwarf apple trees in the Northeastern USA. The affected trees show trunk necrosis, cracking and canker before collapse in summer. In this study, we discovered and characterized a new luteovirus from apple trees in RAD-affected orchards using high-throughput sequencing (HTS) technology and subsequent Sanger sequencing. Illumina NextSeq sequencing was applied to total RNAs prepared from three diseased apple trees. Sequence reads were de novo assembled, and contigs were annotated by BLASTx. RT-PCR and 5'/3' RACE sequencing were used to obtain the complete genome of a new virus. RT-PCR was used to detect the virus. Three common apple viruses and a new luteovirus were identified from the diseased trees by HTS and RT-PCR. Sequence analyses of the complete genome of the new virus show that it is a new species of the genus Luteovirus in the family Luteoviridae. The virus is graft transmissible and detected by RT-PCR in apple trees in a couple of orchards. A new luteovirus and/or three known viruses were found to be associated with RAD. Molecular characterization of the new luteovirus provides important information for further investigation of its distribution and etiological role.
Development and evaluation of a quantitative PCR assay for detection of Hepatozoon sp.
Criado-Fornelio, A; Buling, A; Cunha-Filho, N A; Ruas, J L; Farias, N A R; Rey-Valeiron, C; Pingret, J L; Etievant, M; Barba-Carretero, J C
2007-12-25
With the aim to improve current molecular diagnostic techniques of Hepatozoon sp. in carnivore mammals, we developed a quantitative PCR (qPCR) assay with SYBR Green I((R)). The method, consisting of amplification of a 235bp fragment of the 18S rRNA gene, is able to detect at least 0.1fg of parasite DNA. Reproducible quantitative results were obtained over a range of 0.1ng-0.1fg of Hepatozoon sp. DNA. To assess the performance of the qPCR assay, DNA samples from dogs (140) and cats (50) were tested with either standard PCR or qPCR. Positive samples were always confirmed by partial sequencing of the 18S rRNA gene. Quantitative PCR was 15.8% more sensitive than standard PCR to detect H. canis in dogs. In cats, no infections were detected by standard PCR, compared to two positives by qPCR (which were infected by H. canis as shown by sequencing).
Endemic and Epidemic Lineages of Escherichia coli that Cause Urinary Tract Infections
Tabor, Helen; Tellis, Patricia; Vincent, Caroline; Tellier, Pierre-Paul
2008-01-01
Women with urinary tract infections (UTIs) in California, USA (1999–2001), were infected with closely related or indistinguishable strains of Escherichia coli (clonal groups), which suggests point source dissemination. We compared strains of UTI-causing E. coli in California with strains causing such infections in Montréal, Québec, Canada. Urine specimens from women with community-acquired UTIs in Montréal (2006) were cultured for E. coli. Isolates that caused 256 consecutive episodes of UTI were characterized by antimicrobial drug susceptibility profile, enterobacterial repetitive intergenic consensus 2 PCR, serotyping, XbaI and NotI pulsed-field gel electrophoresis, multilocus sequence typing, and phylogenetic typing. We confirmed the presence of drug-resistant, genetically related, and temporally clustered E. coli clonal groups that caused community-acquired UTIs in unrelated women in 2 locations and 2 different times. Two clonal groups were identified in both locations. Epidemic transmission followed by endemic transmission of UTI-causing clonal groups may explain these clusters of UTI cases. PMID:18826822
Quan, Phenix-Lan; Sauzade, Martin
2018-01-01
Digital Polymerase Chain Reaction (dPCR) is a novel method for the absolute quantification of target nucleic acids. Quantification by dPCR hinges on the fact that the random distribution of molecules in many partitions follows a Poisson distribution. Each partition acts as an individual PCR microreactor and partitions containing amplified target sequences are detected by fluorescence. The proportion of PCR-positive partitions suffices to determine the concentration of the target sequence without a need for calibration. Advances in microfluidics enabled the current revolution of digital quantification by providing efficient partitioning methods. In this review, we compare the fundamental concepts behind the quantification of nucleic acids by dPCR and quantitative real-time PCR (qPCR). We detail the underlying statistics of dPCR and explain how it defines its precision and performance metrics. We review the different microfluidic digital PCR formats, present their underlying physical principles, and analyze the technological evolution of dPCR platforms. We present the novel multiplexing strategies enabled by dPCR and examine how isothermal amplification could be an alternative to PCR in digital assays. Finally, we determine whether the theoretical advantages of dPCR over qPCR hold true by perusing studies that directly compare assays implemented with both methods. PMID:29677144
Ruecker, Norma J.; Hoffman, Rebecca M.; Chalmers, Rachel M.; Neumann, Norman F.
2011-01-01
Molecular methods incorporating nested PCR-restriction fragment length polymorphism (RFLP) analysis of the 18S rRNA gene of Cryptosporidium species were validated to assess performance based on limit of detection (LoD) and for detecting and resolving mixtures of species and genotypes within a single sample. The 95% LoD was determined for seven species (Cryptosporidium hominis, C. parvum, C. felis, C. meleagridis, C. ubiquitum, C. muris, and C. andersoni) and ranged from 7 to 11 plasmid template copies with overlapping 95% confidence limits. The LoD values for genomic DNA from oocysts on microscope slides were 7 and 10 template copies for C. andersoni and C. parvum, respectively. The repetitive nested PCR-RFLP slide protocol had an LoD of 4 oocysts per slide. When templates of two species were mixed in equal ratios in the nested PCR-RFLP reaction mixture, there was no amplification bias toward one species over another. At high ratios of template mixtures (>1:10), there was a reduction or loss of detection of the less abundant species by RFLP analysis, most likely due to heteroduplex formation in the later cycles of the PCR. Replicate nested PCR was successful at resolving many mixtures of Cryptosporidium at template concentrations near or below the LoD. The cloning of nested PCR products resulted in 17% of the cloned sequences being recombinants of the two original templates. Limiting-dilution nested PCR followed by the sequencing of PCR products resulted in no sequence anomalies, suggesting that this method is an effective and accurate way to study the species diversity of Cryptosporidium, particularly for environmental water samples, in which mixtures of parasites are common. PMID:21498746
Ma, Lina; Wang, Liyan; Chu, Yuefeng; Li, Xuerui; Cui, Yujun; Chen, Shengli; Zhou, Jianhua; Li, Chunling; Lu, Zhongxin; Liu, Jixing; Liu, Yongsheng
2016-01-01
Haemophilus parasuis is classified mainly through serotyping, but traditional serotyping always yields non-typable (NT) strains and unreliable results via cross-reactions. Here, we surveyed the serotype prevalence of Chinese H. parasuis isolates using traditional serotyping (gel immuno-diffusion test, GID) and molecular serotyping (multiplex PCR, mPCR). We also investigated why discrepant results between these methods were obtained, and investigated mPCR failure through whole-genome sequencing. Of the 100 isolate tested, 73 (73%) and 93 (93%) were serotyped by the GID test and mPCR, respectively, with a concordance rate of 66% (66/100). Additionally, mPCR reduced the number of NT isolates from 27 (27%) for the GID testing, to seven (7%). Eleven isolates were sequenced, including nine serotype-discrepant isolates from mPCR and GID typing (excluding strains that were NT by GID only) and two NT isolates from both methods, and their in silico serotypes were obtained from genome sequencing based on their capsule loci. The mPCR results were supported by the in silico serotyping of the seven serotype-discrepant isolates. The discrepant results and NT isolates determined by mPCR were attributed to deletions and unknown sequences in the serotype-specific region of each capsule locus. Compared with previous investigations, this study found a similar predominant serotype profile, but a different prevalence frequency for H. parasuis, and the five most prevalent serotypes or strain groups were serotypes 5, 4, NT, 7 and 13 for mPCR, and serotypes 5, NT, 4, 7 and 13/10/14 for GID. Additionally, serotype 7 was recognized as a principal serotype in this work. PMID:28005999
Dias, Miguel de Sousa; Hernan, Imma; Pascual, Beatriz; Borràs, Emma; Mañé, Begoña; Gamundi, Maria José
2013-01-01
Purpose To devise an effective method for detecting mutations in 12 genes (CA4, CRX, IMPDH1, NR2E3, RP9, PRPF3, PRPF8, PRPF31, PRPH2, RHO, RP1, and TOPORS) commonly associated with autosomal dominant retinitis pigmentosa (adRP) that account for more than 95% of known mutations. Methods We used long-range PCR (LR-PCR) amplification and next-generation sequencing (NGS) performed in a GS Junior 454 benchtop sequencing platform. Twenty LR-PCR fragments, between 3,000 and 10,000 bp, containing all coding exons and flanking regions of the 12 genes, were obtained from DNA samples of patients with adRP. Sequencing libraries were prepared with an enzymatic (Fragmentase technology) method. Results Complete coverage of the coding and flanking sequences of the 12 genes assayed was obtained with NGS, with an average sequence depth of 380× (ranging from 128× to 1,077×). Five previous known mutations in the adRP genes were detected with a sequence variation percentage between 35% and 65%. We also performed a parallel sequence analysis of four samples, three of them new patients with index adRP, in which two novel mutations were detected in RHO (p.Asn73del) and PRPF31 (p.Ile109del). Conclusions The results demonstrate that genomic LR-PCR amplification together with NGS is an effective method for analyzing individual patient samples for mutations in a monogenic heterogeneous disease such as adRP. This approach proved effective for the parallel analysis of adRP and has been introduced as routine. Additionally, this approach could be extended to other heterogeneous genetic diseases. PMID:23559859
Picard, François J.; Ke, Danbing; Boudreau, Dominique K.; Boissinot, Maurice; Huletsky, Ann; Richard, Dave; Ouellette, Marc; Roy, Paul H.; Bergeron, Michel G.
2004-01-01
A 761-bp portion of the tuf gene (encoding the elongation factor Tu) from 28 clinically relevant streptococcal species was obtained by sequencing amplicons generated using broad-range PCR primers. These tuf sequences were used to select Streptococcus-specific PCR primers and to perform phylogenetic analysis. The specificity of the PCR assay was verified using 102 different bacterial species, including the 28 streptococcal species. Genomic DNA purified from all streptococcal species was efficiently detected, whereas there was no amplification with DNA from 72 of the 74 nonstreptococcal bacterial species tested. There was cross-amplification with DNAs from Enterococcus durans and Lactococcus lactis. However, the 15 to 31% nucleotide sequence divergence in the 761-bp tuf portion of these two species compared to any streptococcal tuf sequence provides ample sequence divergence to allow the development of internal probes specific to streptococci. The Streptococcus-specific assay was highly sensitive for all 28 streptococcal species tested (i.e., detection limit of 1 to 10 genome copies per PCR). The tuf sequence data was also used to perform extensive phylogenetic analysis, which was generally in agreement with phylogeny determined on the basis of 16S rRNA gene data. However, the tuf gene provided a better discrimination at the streptococcal species level that should be particularly useful for the identification of very closely related species. In conclusion, tuf appears more suitable than the 16S ribosomal RNA gene for the development of diagnostic assays for the detection and identification of streptococcal species because of its higher level of species-specific genetic divergence. PMID:15297518
Dash, Hirak R; Das, Surajit
2016-04-01
Both point and non-point sources increase the pollution status of mercury and increase the population of mercury-resistant marine bacteria (MRMB). They can be targeted as the indicator organism to access marine mercury pollution, besides utilization in bioremediation. Thus, sediment and water samples were collected for 2 years (2010-2012) along Odisha coast of Bay of Bengal, India. Mercury content of the study sites varied from 0.47 to 0.99 ppb irrespective of the seasons of sampling. A strong positive correlation was observed between mercury content and MRMB population (P < 0.05) suggesting the utilization of these bacteria to assess the level of mercury pollution in the marine environment. Seventy-eight percent of the MRMB isolates were under the phylum Firmicutes, and 36 and 31% of them could resist mercury by mer operon-mediated volatilization and mercury biosorption, respectively. In addition, most of the isolates could resist a number of antibiotics and toxic metals. All the MRMB isolates possess the potential of growth and survival at cardinal pH (4-8), temperature (25-37 °C), and salinity (5-35 psu). Enterobacteria repetitive intergenic consensus (ERIC) and repetitive element palindromic PCR (REP-PCR) produced fingerprints corroborating the results of 16S rRNA gene sequencing. Fourier transform infrared (FTIR) spectral analysis also revealed strain-level speciation and phylogenetic relationships.
Demeke, Tigst; Eng, Monika
2018-05-01
Droplet digital PCR (ddPCR) has been used for absolute quantification of genetically engineered (GE) events. Absolute quantification of GE events by duplex ddPCR requires the use of appropriate primers and probes for target and reference gene sequences in order to accurately determine the amount of GE materials. Single copy reference genes are generally preferred for absolute quantification of GE events by ddPCR. Study has not been conducted on a comparison of reference genes for absolute quantification of GE canola events by ddPCR. The suitability of four endogenous reference sequences ( HMG-I/Y , FatA(A), CruA and Ccf) for absolute quantification of GE canola events by ddPCR was investigated. The effect of DNA extraction methods and DNA quality on the assessment of reference gene copy numbers was also investigated. ddPCR results were affected by the use of single vs. two copy reference genes. The single copy, FatA(A), reference gene was found to be stable and suitable for absolute quantification of GE canola events by ddPCR. For the copy numbers measured, the HMG-I/Y reference gene was less consistent than FatA(A) reference gene. The expected ddPCR values were underestimated when CruA and Ccf (two copy endogenous Cruciferin sequences) were used because of high number of copies. It is important to make an adjustment if two copy reference genes are used for ddPCR in order to obtain accurate results. On the other hand, real-time quantitative PCR results were not affected by the use of single vs. two copy reference genes.
Qu, Wen; Cingolani, Pablo; Zeeberg, Barry R; Ruden, Douglas M
2017-01-01
Deep sequencing of cDNAs made from spliced mRNAs indicates that most coding genes in many animals and plants have pre-mRNA transcripts that are alternatively spliced. In pre-mRNAs, in addition to invariant exons that are present in almost all mature mRNA products, there are at least 6 additional types of exons, such as exons from alternative promoters or with alternative polyA sites, mutually exclusive exons, skipped exons, or exons with alternative 5' or 3' splice sites. Our bioinformatics-based hypothesis is that, in analogy to the genetic code, there is an "alternative-splicing code" in introns and flanking exon sequences, analogous to the genetic code, that directs alternative splicing of many of the 36 types of introns. In humans, we identified 42 different consensus sequences that are each present in at least 100 human introns. 37 of the 42 top consensus sequences are significantly enriched or depleted in at least one of the 36 types of introns. We further supported our hypothesis by showing that 96 out of 96 analyzed human disease mutations that affect RNA splicing, and change alternative splicing from one class to another, can be partially explained by a mutation altering a consensus sequence from one type of intron to that of another type of intron. Some of the alternative splicing consensus sequences, and presumably their small-RNA or protein targets, are evolutionarily conserved from 50 plant to animal species. We also noticed the set of introns within a gene usually share the same splicing codes, thus arguing that one sub-type of splicesosome might process all (or most) of the introns in a given gene. Our work sheds new light on a possible mechanism for generating the tremendous diversity in protein structure by alternative splicing of pre-mRNAs.
Diagnosis of Meningococcal Meningitis by Broad-Range Bacterial PCR with Cerebrospinal Fluid
Kotilainen, Pirkko; Jalava, Jari; Meurman, Olli; Lehtonen, Olli-Pekka; Rintala, Esa; Seppälä, Olli-Pekka; Eerola, Erkki; Nikkari, Simo
1998-01-01
We used broad-range bacterial PCR combined with DNA sequencing to examine prospectively cerebrospinal fluid (CSF) samples from patients with suspected meningitis. Fifty-six CSF samples from 46 patients were studied during the year 1995. Genes coding for bacterial 16S and/or 23S rRNA genes could be amplified from the CSF samples from five patients with a clinical picture consistent with acute bacterial meningitis. For these patients, the sequenced PCR product shared 98.3 to 100% homology with the Neisseria meningitidis sequence. For one patient, the diagnosis was initially made by PCR alone. Of the remaining 51 CSF samples, for 50 (98.0%) samples the negative PCR findings were in accordance with the negative findings by bacterial culture and Gram staining, as well as with the eventual clinical diagnosis for the patient. However, the PCR test failed to detect the bacterial rRNA gene in one CSF sample, the culture of which yielded Listeria monocytogenes. These results invite new research efforts to be focused on the application of PCR with broad-range bacterial primers to improve the etiologic diagnosis of bacterial meningitis. In a clinical setting, Gram staining and bacterial culture still remain the cornerstones of diagnosis. PMID:9665992
García-Mena, Jaime; Cano-Ramirez, Claudia; Garibay-Orijel, Claudio; Ramirez-Canseco, Sergio; Poggi-Varaldo, Héctor M
2005-06-01
A PCR-based method for the quantitative detection of Lentinus edodes and Trametes versicolor, two ligninolytic fungi applied for wastewater treatment and bioremediation, was developed. Genomic DNA was used to optimize a PCR method targeting the conserved copper-binding sequence of laccase genes. The method allowed the quantitative detection and differentiation of these fungi in single and defined-mixed cultures after fractionation of the PCR products by electrophoresis in agarose gels. Amplified products of about 150 bp for L. edodes, and about 200 bp for T. versicolor were purified and cloned. The PCR method showed a linear detection response in the 1.0 microg-1 ng range. The same method was tested with genomic DNA from a third fungus (Phanerochaete chrysosporium), yielding a fragment of about 400 bp. Southern-blot and DNA sequence analysis indicated that a specific PCR product was amplified from each genome, and that these corresponded to sequences of laccase genes. This PCR protocol permits the detection and differentiation of three ligninolytic fungi by amplifying DNA fragments of different sizes using a single pair of primers, without further enzymatic restriction of the PCR products. This method has potential use in the monitoring, evaluation, and improvement of fungal cultures used in wastewater treatment processes.
MELOGEN: an EST database for melon functional genomics
Gonzalez-Ibeas, Daniel; Blanca, José; Roig, Cristina; González-To, Mireia; Picó, Belén; Truniger, Verónica; Gómez, Pedro; Deleu, Wim; Caño-Delgado, Ana; Arús, Pere; Nuez, Fernando; Garcia-Mas, Jordi; Puigdomènech, Pere; Aranda, Miguel A
2007-01-01
Background Melon (Cucumis melo L.) is one of the most important fleshy fruits for fresh consumption. Despite this, few genomic resources exist for this species. To facilitate the discovery of genes involved in essential traits, such as fruit development, fruit maturation and disease resistance, and to speed up the process of breeding new and better adapted melon varieties, we have produced a large collection of expressed sequence tags (ESTs) from eight normalized cDNA libraries from different tissues in different physiological conditions. Results We determined over 30,000 ESTs that were clustered into 16,637 non-redundant sequences or unigenes, comprising 6,023 tentative consensus sequences (contigs) and 10,614 unclustered sequences (singletons). Many potential molecular markers were identified in the melon dataset: 1,052 potential simple sequence repeats (SSRs) and 356 single nucleotide polymorphisms (SNPs) were found. Sixty-nine percent of the melon unigenes showed a significant similarity with proteins in databases. Functional classification of the unigenes was carried out following the Gene Ontology scheme. In total, 9,402 unigenes were mapped to one or more ontology. Remarkably, the distributions of melon and Arabidopsis unigenes followed similar tendencies, suggesting that the melon dataset is representative of the whole melon transcriptome. Bioinformatic analyses primarily focused on potential precursors of melon micro RNAs (miRNAs) in the melon dataset, but many other genes potentially controlling disease resistance and fruit quality traits were also identified. Patterns of transcript accumulation were characterised by Real-Time-qPCR for 20 of these genes. Conclusion The collection of ESTs characterised here represents a substantial increase on the genetic information available for melon. A database (MELOGEN) which contains all EST sequences, contig images and several tools for analysis and data mining has been created. This set of sequences constitutes also the basis for an oligo-based microarray for melon that is being used in experiments to further analyse the melon transcriptome. PMID:17767721
Nasr Esfahani, Bahram; Moghim, Sharareh; Ghasemian Safaei, Hajieh; Moghoofei, Mohsen; Sedighi, Mansour; Hadifar, Shima
2016-01-01
Background Taxonomic and phylogenetic studies of Mycobacterium species have been based around the 16sRNA gene for many years. However, due to the high strain similarity between species in the Mycobacterium genus (94.3% - 100%), defining a valid phylogenetic tree is difficult; consequently, its use in estimating the boundaries between species is limited. The sequence of the rpoB gene makes it an appropriate gene for phylogenetic analysis, especially in bacteria with limited variation. Objectives In the present study, a 360bp sequence of rpoB was used for precise classification of Mycobacterium strains isolated in Isfahan, Iran. Materials and Methods From February to October 2013, 57 clinical and environmental isolates were collected, subcultured, and identified by phenotypic methods. After DNA extraction, a 360bp fragment was PCR-amplified and sequenced. The phylogenetic tree was constructed based on consensus sequence data, using MEGA5 software. Results Slow and fast-growing groups of the Mycobacterium strains were clearly differentiated based on the constructed tree of 56 common Mycobacterium isolates. Each species with a unique title in the tree was identified; in total, 13 nods with a bootstrap value of over 50% were supported. Among the slow-growing group was Mycobacterium kansasii, with M. tuberculosis in a cluster with a bootstrap value of 98% and M. gordonae in another cluster with a bootstrap value of 90%. In the fast-growing group, one cluster with a bootstrap value of 89% was defined, including all fast-growing members present in this study. Conclusions The results suggest that only the application of the rpoB gene sequence is sufficient for taxonomic categorization and definition of a new Mycobacterium species, due to its high resolution power and proper variation in its sequence (85% - 100%); the resulting tree has high validity. PMID:27284397
The last Viking King: a royal maternity case solved by ancient DNA analysis.
Dissing, Jørgen; Binladen, Jonas; Hansen, Anders; Sejrsen, Birgitte; Willerslev, Eske; Lynnerup, Niels
2007-02-14
The last of the Danish Viking Kings, Sven Estridsen, died in a.d. 1074 and is entombed in Roskilde Cathedral with other Danish kings and queens. Sven's mother, Estrid, is entombed in a pillar across the chancel. However, while there is no reasonable doubt about the identity of Sven, there have been doubts among historians whether the woman entombed was indeed Estrid. To shed light on this problem, we have extracted and analysed mitochondrial DNA (mtDNA) from pulp of teeth from each of the two royals. Four overlapping DNA-fragments covering about 400bp of hypervariable region 1 (HVR-1) of the D-loop were PCR amplified, cloned and a number of clones with each segment were sequenced. Also a segment containing the H/non-H specific nucleotide 7028 was sequenced. Consensus sequences were determined and D-loop results were replicated in an independent laboratory. This allowed the assignment of King Sven Estridsen to haplogroup H; Estrid's sequence differed from that of Sven at two positions in HVR-1, 16093T-->C and 16304T-->C, indicating that she belongs to subgroup H5a. Given the maternal inheritance of mtDNA, offspring will have the same mtDNA sequence as their mother with the exception of rare cases where the sequence has been altered by a germ line mutation. Therefore, the observation of two sequence differences makes it highly unlikely that the entombed woman was the mother of Sven. In addition, physical examination of the skeleton and the teeth strongly indicated that this woman was much younger (approximately 35 years) at the time of death than the 70 years history records tell. Although the entombed woman cannot be the Estrid, she may well be one of Sven's two daughters-in-law who were also called Estrid and who both became queens.
Matsuda, Yoshinori; Sameshima, Takeshi; Moriura, Nobuyuki; Inoue, Kanako; Nonomura, Teruo; Kakutani, Koji; Nishimura, Hiroaki; Kusakari, Shin-Ichi; Takamatsu, Susumu; Toyoda, Hideyoshi
2005-10-01
ABSTRACT Greenhouse-grown tomato seedlings were inoculated naturally with two genera of powdery mildew conidia forming appressorial germ tubes that could not be differentiated by length alone. For direct identification, single germinated conidia were removed from leaves by means of a glass pipette linked to the manipulator of a high-fidelity digital microscope. This microscope enabled in vivo observation of the fungi without leaf decoloration or fungal staining. The isolated conidia were subjected to PCR amplification of the 5.8S rDNA and its adjacent internal transcribed spacer sequences followed by nested PCR to attain sensitivity high enough to amplify target nucleotide sequences (PCR/nested PCR). Target sequences from the conidia were completely coincident with those of the pathogen Oidium neolycopersici or Erysiphe trifolii (syn. Microsphaera trifolii), which is nonpathogenic on tomato. Using RT-PCR/nested PCR or multiplex RT-PCR/nested PCR, it was possible to amplify transcripts expressed in single conidia. Conidia at pre- and postgermination stages were removed individually from tomato leaves, and two powdery mildew genes were monitored. The results indicated that the beta-tubulin homolog TUB2-ol was expressed at pre- and postgermination stages and the cutinase homolog CUT1-ol was only expressed postgermination. Combining digital microscopic micromanipulation and two-step PCR amplification is thus useful for investigation of individual propagules on the surface of plants.
Bulgari, Daniela; Casati, Paola; Brusetti, Lorenzo; Quaglino, Fabio; Brasca, Milena; Daffonchio, Daniele; Bianco, Piero Attilio
2009-08-01
Diversity of bacterial endophytes associated with grapevine leaf tissues was analyzed by cultivation and cultivation-independent methods. In order to identify bacterial endophytes directly from metagenome, a protocol for bacteria enrichment and DNA extraction was optimized. Sequence analysis of 16S rRNA gene libraries underscored five diverse Operational Taxonomic Units (OTUs), showing best sequence matches with gamma-Proteobacteria, family Enterobacteriaceae, with a dominance of the genus Pantoea. Bacteria isolation through cultivation revealed the presence of six OTUs, showing best sequence matches with Actinobacteria, genus Curtobacterium, and with Firmicutes genera Bacillus and Enterococcus. Length Heterogeneity-PCR (LH-PCR) electrophoretic peaks from single bacterial clones were used to setup a database representing the bacterial endophytes identified in association with grapevine tissues. Analysis of healthy and phytoplasma-infected grapevine plants showed that LH-PCR could be a useful complementary tool for examining the diversity of bacterial endophytes especially for diversity survey on a large number of samples.
Meghdadi, Hossein; Khosravi, Azar D.; Ghadiri, Ata A.; Sina, Amir H.; Alami, Ameneh
2015-01-01
Present study was aimed to examine the diagnostic utility of polymerase chain reaction (PCR) and nested PCR techniques for the detection of Mycobacterium tuberculosis (MTB) DNA in samples from patients with extra pulmonary tuberculosis (EPTB). In total 80 formalin-fixed, paraffin-embedded (FFPE) samples comprising 70 samples with definite diagnosis of EPTB and 10 samples from known non- EPTB on the basis of histopathology examination, were included in the study. PCR amplification targeting IS6110, rpoB gene and nested PCR targeting the rpoB gene were performed on the extracted DNAs from 80 FFPE samples. The strong positive samples were directly sequenced. For negative samples and those with weak band in nested-rpoB PCR, TA cloning was performed by cloning the products into the plasmid vector with subsequent sequencing. The 95% confidence intervals (CI) for the estimates of sensitivity and specificity were calculated for each method. Fourteen (20%), 34 (48.6%), and 60 (85.7%) of the 70 positive samples confirmed by histopathology, were positive by rpoB-PCR, IS6110-PCR, and nested-rpoB PCR, respectively. By performing TA cloning on samples that yielded weak (n = 8) or negative results (n = 10) in the PCR methods, we were able to improve their quality for later sequencing. All samples with weak band and 7 out of 10 negative samples, showed strong positive results after cloning. So nested-rpoB PCR cloning revealed positivity in 67 out of 70 confirmed samples (95.7%). The sensitivity of these combination methods was calculated as 95.7% in comparison with histopathology examination. The CI for sensitivity of the PCR methods were calculated as 11.39–31.27% for rpoB-PCR, 36.44–60.83% for IS6110- PCR, 75.29–92.93% for nested-rpoB PCR, and 87.98–99.11% for nested-rpoB PCR cloning. The 10 true EPTB negative samples by histopathology, were negative by all tested methods including cloning and were used to calculate the specificity of the applied methods. The CI for 100% specificity of each PCR method were calculated as 69.15–100%. Our results indicated that nested-rpoB PCR combined with TA cloning and sequencing is a preferred method for the detection of MTB DNA in EPTB samples with high sensitivity and specificity which confirm the histopathology results. PMID:26191059
Meghdadi, Hossein; Khosravi, Azar D; Ghadiri, Ata A; Sina, Amir H; Alami, Ameneh
2015-01-01
Present study was aimed to examine the diagnostic utility of polymerase chain reaction (PCR) and nested PCR techniques for the detection of Mycobacterium tuberculosis (MTB) DNA in samples from patients with extra pulmonary tuberculosis (EPTB). In total 80 formalin-fixed, paraffin-embedded (FFPE) samples comprising 70 samples with definite diagnosis of EPTB and 10 samples from known non- EPTB on the basis of histopathology examination, were included in the study. PCR amplification targeting IS6110, rpoB gene and nested PCR targeting the rpoB gene were performed on the extracted DNAs from 80 FFPE samples. The strong positive samples were directly sequenced. For negative samples and those with weak band in nested-rpoB PCR, TA cloning was performed by cloning the products into the plasmid vector with subsequent sequencing. The 95% confidence intervals (CI) for the estimates of sensitivity and specificity were calculated for each method. Fourteen (20%), 34 (48.6%), and 60 (85.7%) of the 70 positive samples confirmed by histopathology, were positive by rpoB-PCR, IS6110-PCR, and nested-rpoB PCR, respectively. By performing TA cloning on samples that yielded weak (n = 8) or negative results (n = 10) in the PCR methods, we were able to improve their quality for later sequencing. All samples with weak band and 7 out of 10 negative samples, showed strong positive results after cloning. So nested-rpoB PCR cloning revealed positivity in 67 out of 70 confirmed samples (95.7%). The sensitivity of these combination methods was calculated as 95.7% in comparison with histopathology examination. The CI for sensitivity of the PCR methods were calculated as 11.39-31.27% for rpoB-PCR, 36.44-60.83% for IS6110- PCR, 75.29-92.93% for nested-rpoB PCR, and 87.98-99.11% for nested-rpoB PCR cloning. The 10 true EPTB negative samples by histopathology, were negative by all tested methods including cloning and were used to calculate the specificity of the applied methods. The CI for 100% specificity of each PCR method were calculated as 69.15-100%. Our results indicated that nested-rpoB PCR combined with TA cloning and sequencing is a preferred method for the detection of MTB DNA in EPTB samples with high sensitivity and specificity which confirm the histopathology results.
Congenital analbuminemia caused by a novel aberrant splicing in the albumin gene.
Caridi, Gianluca; Dagnino, Monica; Erdeve, Omer; Di Duca, Marco; Yildiz, Duran; Alan, Serdar; Atasay, Begum; Arsan, Saadet; Campagnoli, Monica; Galliano, Monica; Minchiotti, Lorenzo
2014-01-01
Congenital analbuminemia is a rare autosomal recessive disorder manifested by the presence of a very low amount of circulating serum albumin. It is an allelic heterogeneous defect, caused by variety of mutations within the albumin gene in homozygous or compound heterozygous state. Herein we report the clinical and molecular characterization of a new case of congenital analbuminemia diagnosed in a female newborn of consanguineous (first degree cousins) parents from Ankara, Turkey, who presented with a low albumin concentration (< 8 g/L) and severe clinical symptoms. The albumin gene of the index case was screened by single-strand conformation polymorphism, heteroduplex analysis, and direct DNA sequencing. The effect of the splicing mutation was evaluated by examining the cDNA obtained by reverse transcriptase - polymerase chain reaction (RT-PCR) from the albumin mRNA extracted from proband's leukocytes. DNA sequencing revealed that the proband is homozygous, and both parents are heterozygous, for a novel G>A transition at position c.1652+1, the first base of intron 12, which inactivates the strongly conserved GT dinucleotide at the 5' splice site consensus sequence of this intron. The splicing defect results in the complete skipping of the preceding exon (exon 12) and in a frame-shift within exon 13 with a premature stop codon after the translation of three mutant amino acid residues. Our results confirm the clinical diagnosis of congenital analbuminemia in the proband and the inheritance of the trait and contribute to shed light on the molecular genetics of analbuminemia.
Cofactor specificity switch in Shikimate dehydrogenase by rational design and consensus engineering.
García-Guevara, Fernando; Bravo, Iris; Martínez-Anaya, Claudia; Segovia, Lorenzo
2017-08-01
Consensus engineering has been used to design more stable variants using the most frequent amino acid at each site of a multiple sequence alignment; sometimes consensus engineering modifies function, but efforts have mainly been focused on studying stability. Here we constructed a consensus Rossmann domain for the Shikimate dehydrogenase enzyme; separately we decided to switch the cofactor specificity through rational design in the Escherichia coli Shikimate dehydrogenase enzyme and then analyzed the effect of consensus mutations on top of our design. We found that consensus mutations closest to the 2' adenine moiety increased the activity in our design. Consensus engineering has been shown to result in more stable proteins and our findings suggest it could also be used as a complementary tool for increasing or modifying enzyme activity during design. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Structural and Functional Characterization of Pseudomonas aeruginosa Global Regulator AmpR
Caille, Olivier; Zincke, Diansy; Merighi, Massimo; Balasubramanian, Deepak; Kumari, Hansi; Kong, Kok-Fai; Silva-Herzog, Eugenia; Narasimhan, Giri; Schneper, Lisa; Lory, Stephen
2014-01-01
Pseudomonas aeruginosa is a dreaded pathogen in many clinical settings. Its inherent and acquired antibiotic resistance thwarts therapy. In particular, derepression of the AmpC β-lactamase is a common mechanism of β-lactam resistance among clinical isolates. The inducible expression of ampC is controlled by the global LysR-type transcriptional regulator (LTTR) AmpR. In the present study, we investigated the genetic and structural elements that are important for ampC induction. Specifically, the ampC (PampC) and ampR (PampR) promoters and the AmpR protein were characterized. The transcription start sites (TSSs) of the divergent transcripts were mapped using 5′ rapid amplification of cDNA ends-PCR (RACE-PCR), and strong σ54 and σ70 consensus sequences were identified at PampR and PampC, respectively. Sigma factor RpoN was found to negatively regulate ampR expression, possibly through promoter blocking. Deletion mapping revealed that the minimal PampC extends 98 bp upstream of the TSS. Gel shifts using membrane fractions showed that AmpR binds to PampC in vitro whereas in vivo binding was demonstrated using chromatin immunoprecipitation-quantitative PCR (ChIP-qPCR). Additionally, site-directed mutagenesis of the AmpR helix-turn-helix (HTH) motif identified residues critical for binding and function (Ser38 and Lys42) and critical for function but not binding (His39). Amino acids Gly102 and Asp135, previously implicated in the repression state of AmpR in the enterobacteria, were also shown to play a structural role in P. aeruginosa AmpR. Alkaline phosphatase fusion and shaving experiments suggest that AmpR is likely to be membrane associated. Lastly, an in vivo cross-linking study shows that AmpR dimerizes. In conclusion, a potential membrane-associated AmpR dimer regulates ampC expression by direct binding. PMID:25182487
2014-01-01
Background Shigellae have become increasingly resistant to the extended-spectrum cephalosporin (ESC) worldwide and pose a great challenge to anti-infection treatment options. The purpose of this study was to determine the resistance, cephalosporin resistance mechanisms, virulence characteristic and genotype of ESC-resistant Shigella. Methods From 2008 to 2012, Shigella isolates collected from diarrhea patients were detected for antibiotics sensitivity by disk diffusion, cephalosporin resistance determinants and virulence genes using polymerase chain reaction (PCR) and genotyping through enterobacterial repetitive intergenic consensus sequence PCR (ERIC-PCR). Results A total of 356 Shigella isolates were gathered, and 198 (55.6%, 58 S. flexneri and 140 S. sonnei) were resistant to ESC. All ESC-resistant isolates were susceptible to imipenem, and only 0.5% isolate was resistant to piperacillin/tazobactam. ESC-resistant S. flexneri showed high degrees of resistance to ampicillin (100%), ampicillin/sulbactam (96.6%), piperacillin (100%), trimethoprim/sulfamethoxazole (74.1%), ciprofloxacin (74.1%), levofloxacin (53.4%), ceftazidime (58.6%) and cefepime (58.6%). ESC-resistant S. sonnei exhibited high resistance rates to ampicillin (100%), piperacillin (100%) and trimethoprim/sulfamethoxazole (96.4%). Cephalosporin resistance genes were confirmed in 184 ESC-resistant isolates. blaCTX-M types (91.8%, mainly blaCTX-M-14, blaCTX-M-15 and blaCTX-M-57) were most prevalent, followed by blaOXA-30 (26.3%). Over 99.0% ESC-resistant isolates harbored virulence genes ial, ipaH, virA and sen. However, set1 were more prevalent in ESC-resistant S. flexneri isolates than in S. sonnei isolates. ERIC-PCR results showed that 2 and 3 main genotypes were detected in ESC-resistant S. flexneri and S. sonnei, respectively. Conclusion Our findings indicated that a high prevalence of ESC-resistant Shigella mediated mainly by blaCTX-M with stronger resistance and virulence, and the existence of specific clones responsible for these Shigella infection in the region studied. PMID:24886028
Zhang, Chuan-Ling; Liu, Qing-Zhong; Wang, Juan; Chu, Xu; Shen, Li-Meng; Guo, Yuan-Yu
2014-05-15
Shigellae have become increasingly resistant to the extended-spectrum cephalosporin (ESC) worldwide and pose a great challenge to anti-infection treatment options. The purpose of this study was to determine the resistance, cephalosporin resistance mechanisms, virulence characteristic and genotype of ESC-resistant Shigella. From 2008 to 2012, Shigella isolates collected from diarrhea patients were detected for antibiotics sensitivity by disk diffusion, cephalosporin resistance determinants and virulence genes using polymerase chain reaction (PCR) and genotyping through enterobacterial repetitive intergenic consensus sequence PCR (ERIC-PCR). A total of 356 Shigella isolates were gathered, and 198 (55.6%, 58 S. flexneri and 140 S. sonnei) were resistant to ESC. All ESC-resistant isolates were susceptible to imipenem, and only 0.5% isolate was resistant to piperacillin/tazobactam. ESC-resistant S. flexneri showed high degrees of resistance to ampicillin (100%), ampicillin/sulbactam (96.6%), piperacillin (100%), trimethoprim/sulfamethoxazole (74.1%), ciprofloxacin (74.1%), levofloxacin (53.4%), ceftazidime (58.6%) and cefepime (58.6%). ESC-resistant S. sonnei exhibited high resistance rates to ampicillin (100%), piperacillin (100%) and trimethoprim/sulfamethoxazole (96.4%). Cephalosporin resistance genes were confirmed in 184 ESC-resistant isolates. bla(CTX-M) types (91.8%, mainly bla(CTX-M-14), bla(CTX-M-15) and bla(CTX-M-57)) were most prevalent, followed by bla(OXA-30) (26.3%). Over 99.0% ESC-resistant isolates harbored virulence genes ial, ipaH, virA and sen. However, set1 were more prevalent in ESC-resistant S. flexneri isolates than in S. sonnei isolates. ERIC-PCR results showed that 2 and 3 main genotypes were detected in ESC-resistant S. flexneri and S. sonnei, respectively. Our findings indicated that a high prevalence of ESC-resistant Shigella mediated mainly by bla(CTX-M) with stronger resistance and virulence, and the existence of specific clones responsible for these Shigella infection in the region studied.
Repair of DNA damage caused by cytosine deamination in mitochondrial DNA of forensic case samples.
Gorden, Erin M; Sturk-Andreaggi, Kimberly; Marshall, Charla
2018-05-01
DNA sequence damage from cytosine deamination is well documented in degraded samples, such as those from ancient and forensic contexts. This study examined the effect of a DNA repair treatment on mitochondrial DNA (mtDNA) from aged and degraded skeletal samples. DNA extracts from 21 non-probative, degraded skeletal samples (aged 50-70 years) were utilized for the analysis. A portion of each sample extract was subjected to DNA repair using a commercial repair kit, the New England BioLabs' NEBNext FFPE DNA Repair Kit (Ipswich, MA). MtDNA was enriched using PCR and targeted capture in a side-by-side experiment of untreated and repaired DNA. Sequencing was performed using both traditional (Sanger-type; STS) and next-generation sequencing (NGS) methods Although cytosine deamination was evident in the mtDNA sequence data, the observed level of damaged bases varied by sequencing method as well as by enrichment type. The STS PCR amplicon data did not show evidence of cytosine deamination that could be distinguished from background signal in either the untreated or repaired sample set. However, the same PCR amplicons showed 850 C → T/G → A substitutions consistent with cytosine deamination with variant frequencies (VFs) of up to 25% when sequenced using NGS methods The occurrence of base misincorporation due to cytosine deamination was reduced by 98% (to 10) in the NGS amplicon data after repair. The NGS capture data indicated low levels (1-2%) of cytosine deamination in mtDNA fragments that was effectively mitigated by DNA repair. The observed difference in the level of cytosine deamination between the PCR and capture enrichment methods can be attributed to the greater propensity for stochastic effects from the PCR enrichment technique employed (e.g., low template input, increased PCR cycles). Altogether these results indicate that DNA repair may be required when sequencing PCR-amplified DNA from degraded forensic case samples with NGS methods. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Oshiki, Mamoru; Segawa, Takahiro; Ishii, Satoshi
2018-02-02
Various microorganisms play key roles in the Nitrogen (N) cycle. Quantitative PCR (qPCR) and PCR-amplicon sequencing of the N cycle functional genes allow us to analyze the abundance and diversity of microbes responsible in the N transforming reactions in various environmental samples. However, analysis of multiple target genes can be cumbersome and expensive. PCR-independent analysis, such as metagenomics and metatranscriptomics, is useful but expensive especially when we analyze multiple samples and try to detect N cycle functional genes present at relatively low abundance. Here, we present the application of microfluidic qPCR chip technology to simultaneously quantify and prepare amplicon sequence libraries for multiple N cycle functional genes as well as taxon-specific 16S rRNA gene markers for many samples. This approach, named as N cycle evaluation (NiCE) chip, was evaluated by using DNA from pure and artificially mixed bacterial cultures and by comparing the results with those obtained by conventional qPCR and amplicon sequencing methods. Quantitative results obtained by the NiCE chip were comparable to those obtained by conventional qPCR. In addition, the NiCE chip was successfully applied to examine abundance and diversity of N cycle functional genes in wastewater samples. Although non-specific amplification was detected on the NiCE chip, this could be overcome by optimizing the primer sequences in the future. As the NiCE chip can provide high-throughput format to quantify and prepare sequence libraries for multiple N cycle functional genes, this tool should advance our ability to explore N cycling in various samples. Importance. We report a novel approach, namely Nitrogen Cycle Evaluation (NiCE) chip by using microfluidic qPCR chip technology. By sequencing the amplicons recovered from the NiCE chip, we can assess diversities of the N cycle functional genes. The NiCE chip technology is applicable to analyze the temporal dynamics of the N cycle gene transcriptions in wastewater treatment bioreactors. The NiCE chip can provide high-throughput format to quantify and prepare sequence libraries for multiple N cycle functional genes. While there is a room for future improvement, this tool should significantly advance our ability to explore the N cycle in various environmental samples. Copyright © 2018 American Society for Microbiology.
Molecular Approaches to Taenia asiatica
Jeon, Hyeong-Kyu
2013-01-01
Taenia solium, T. saginata, and T. asiatica are taeniid tapeworms that cause taeniasis in humans and cysticercosis in intermediate host animals. Taeniases remain an important public health concerns in the world. Molecular diagnostic methods using PCR assays have been developed for rapid and accurate detection of human infecting taeniid tapeworms, including the use of sequence-specific DNA probes, PCR-RFLP, and multiplex PCR. More recently, DNA diagnosis using PCR based on histopathological specimens such as 10% formalin-fixed paraffin-embedded and stained sections mounted on slides has been applied to cestode infections. The mitochondrial gene sequence is believed to be a very useful molecular marker for not only studying evolutionary relationships among distantly related taxa, but also for investigating the phylo-biogeography of closely related species. The complete sequence of the human Taenia tapeworms mitochondrial genomes were determined, and its organization and structure were compared to other human-tropic Taenia tapeworms for which complete mitochondrial sequence data were available. The multiplex PCR assay with the Ta4978F, Ts5058F, Tso7421F, and Rev7915 primers will be useful for differential diagnosis, molecular characterization, and epidemiological surveys of human Taenia tapeworms. PMID:23467738
Colony-PCR Is a Rapid Method for DNA Amplification of Hyphomycetes
Walch, Georg; Knapp, Maria; Rainer, Georg; Peintner, Ursula
2016-01-01
Fungal pure cultures identified with both classical morphological methods and through barcoding sequences are a basic requirement for reliable reference sequences in public databases. Improved techniques for an accelerated DNA barcode reference library construction will result in considerably improved sequence databases covering a wider taxonomic range. Fast, cheap, and reliable methods for obtaining DNA sequences from fungal isolates are, therefore, a valuable tool for the scientific community. Direct colony PCR was already successfully established for yeasts, but has not been evaluated for a wide range of anamorphic soil fungi up to now, and a direct amplification protocol for hyphomycetes without tissue pre-treatment has not been published so far. Here, we present a colony PCR technique directly from fungal hyphae without previous DNA extraction or other prior manipulation. Seven hundred eighty-eight fungal strains from 48 genera were tested with a success rate of 86%. PCR success varied considerably: DNA of fungi belonging to the genera Cladosporium, Geomyces, Fusarium, and Mortierella could be amplified with high success. DNA of soil-borne yeasts was always successfully amplified. Absidia, Mucor, Trichoderma, and Penicillium isolates had noticeably lower PCR success. PMID:29376929
Mohkam, Milad; Nezafat, Navid; Berenjian, Aydin; Mobasher, Mohammad Ali; Ghasemi, Younes
2016-03-01
Some Bacillus species, especially Bacillus subtilis and Bacillus pumilus groups, have highly similar 16S rRNA gene sequences, which are hard to identify based on 16S rDNA sequence analysis. To conquer this drawback, rpoB, recA sequence analysis along with randomly amplified polymorphic (RAPD) fingerprinting was examined as an alternative method for differentiating Bacillus species. The 16S rRNA, rpoB and recA genes were amplified via a polymerase chain reaction using their specific primers. The resulted PCR amplicons were sequenced, and phylogenetic analysis was employed by MEGA 6 software. Identification based on 16S rRNA gene sequencing was underpinned by rpoB and recA gene sequencing as well as RAPD-PCR technique. Subsequently, concatenation and phylogenetic analysis showed that extent of diversity and similarity were better obtained by rpoB and recA primers, which are also reinforced by RAPD-PCR methods. However, in one case, these approaches failed to identify one isolate, which in combination with the phenotypical method offsets this issue. Overall, RAPD fingerprinting, rpoB and recA along with concatenated genes sequence analysis discriminated closely related Bacillus species, which highlights the significance of the multigenic method in more precisely distinguishing Bacillus strains. This research emphasizes the benefit of RAPD fingerprinting, rpoB and recA sequence analysis superior to 16S rRNA gene sequence analysis for suitable and effective identification of Bacillus species as recommended for probiotic products.
Zhao, Ying; Tsang, Chi-Ching; Xiao, Meng; Cheng, Jingwei; Xu, Yingchun; Lau, Susanna K P; Woo, Patrick C Y
2015-10-22
Internal transcribed spacer region (ITS) sequencing is the most extensively used technology for accurate molecular identification of fungal pathogens in clinical microbiology laboratories. Intra-genomic ITS sequence heterogeneity, which makes fungal identification based on direct sequencing of PCR products difficult, has rarely been reported in pathogenic fungi. During the process of performing ITS sequencing on 71 yeast strains isolated from various clinical specimens, direct sequencing of the PCR products showed ambiguous sequences in six of them. After cloning the PCR products into plasmids for sequencing, interpretable sequencing electropherograms could be obtained. For each of the six isolates, 10-49 clones were selected for sequencing and two to seven intra-genomic ITS copies were detected. The identities of these six isolates were confirmed to be Candida glabrata (n=2), Pichia (Candida) norvegensis (n=2), Candida tropicalis (n=1) and Saccharomyces cerevisiae (n=1). Multiple sequence alignment revealed that one to four intra-genomic ITS polymorphic sites were present in the six isolates, and all these polymorphic sites were located in the ITS1 and/or ITS2 regions. We report and describe the first evidence of intra-genomic ITS sequence heterogeneity in four different pathogenic yeasts, which occurred exclusively in the ITS1 and ITS2 spacer regions for the six isolates in this study.
Zhao, Ying; Tsang, Chi-Ching; Xiao, Meng; Cheng, Jingwei; Xu, Yingchun; Lau, Susanna K. P.; Woo, Patrick C. Y.
2015-01-01
Internal transcribed spacer region (ITS) sequencing is the most extensively used technology for accurate molecular identification of fungal pathogens in clinical microbiology laboratories. Intra-genomic ITS sequence heterogeneity, which makes fungal identification based on direct sequencing of PCR products difficult, has rarely been reported in pathogenic fungi. During the process of performing ITS sequencing on 71 yeast strains isolated from various clinical specimens, direct sequencing of the PCR products showed ambiguous sequences in six of them. After cloning the PCR products into plasmids for sequencing, interpretable sequencing electropherograms could be obtained. For each of the six isolates, 10–49 clones were selected for sequencing and two to seven intra-genomic ITS copies were detected. The identities of these six isolates were confirmed to be Candida glabrata (n = 2), Pichia (Candida) norvegensis (n = 2), Candida tropicalis (n = 1) and Saccharomyces cerevisiae (n = 1). Multiple sequence alignment revealed that one to four intra-genomic ITS polymorphic sites were present in the six isolates, and all these polymorphic sites were located in the ITS1 and/or ITS2 regions. We report and describe the first evidence of intra-genomic ITS sequence heterogeneity in four different pathogenic yeasts, which occurred exclusively in the ITS1 and ITS2 spacer regions for the six isolates in this study. PMID:26506340
Xu, Peiwen; Zou, Yang; Li, Jie; Huang, Sexin; Gao, Ming; Kang, Ranran; Xie, Hongqiang; Wang, Lijuan; Yan, Junhao; Gao, Yuan
2018-04-10
To assess the value of droplet digital PCR (ddPCR) for non-invasive prenatal diagnosis of single gene disease in two families. Paternal mutation in cell-free DNA derived from the maternal blood and amniotic fluid DNA was detected by ddPCR. Suspected mutation in the amniotic fluid DNA was verified with Sanger sequencing. The result of ddPCR and Sanger sequencing indicated that the fetuses have carried pathogenic mutations from the paternal side in both families. Droplet digital PCR can accurately detect paternal mutation carried by the fetus, and it is sensitive and reliable for analyzing trace samples. This method may be applied for the diagnosis of single gene diseases caused by paternal mutation using peripheral blood sample derived from the mother.
Miniprimer PCR, a New Lens for Viewing the Microbial World▿ †
Isenbarger, Thomas A.; Finney, Michael; Ríos-Velázquez, Carlos; Handelsman, Jo; Ruvkun, Gary
2008-01-01
Molecular methods based on the 16S rRNA gene sequence are used widely in microbial ecology to reveal the diversity of microbial populations in environmental samples. Here we show that a new PCR method using an engineered polymerase and 10-nucleotide “miniprimers” expands the scope of detectable sequences beyond those detected by standard methods using longer primers and Taq polymerase. After testing the method in silico to identify divergent ribosomal genes in previously cloned environmental sequences, we applied the method to soil and microbial mat samples, which revealed novel 16S rRNA gene sequences that would not have been detected with standard primers. Deeply divergent sequences were discovered with high frequency and included representatives that define two new division-level taxa, designated CR1 and CR2, suggesting that miniprimer PCR may reveal new dimensions of microbial diversity. PMID:18083877
Multiplex Reverse Transcription-PCR for Simultaneous Surveillance of Influenza A and B Viruses
Zhou, Bin; Barnes, John R.; Sessions, October M.; Chou, Tsui-Wen; Wilson, Malania; Stark, Thomas J.; Volk, Michelle; Spirason, Natalie; Halpin, Rebecca A.; Kamaraj, Uma Sangumathi; Ding, Tao; Stockwell, Timothy B.; Ghedin, Elodie; Barr, Ian G.
2017-01-01
ABSTRACT Influenza A and B viruses are the causative agents of annual influenza epidemics that can be severe, and influenza A viruses intermittently cause pandemics. Sequence information from influenza virus genomes is instrumental in determining mechanisms underpinning antigenic evolution and antiviral resistance. However, due to sequence diversity and the dynamics of influenza virus evolution, rapid and high-throughput sequencing of influenza viruses remains a challenge. We developed a single-reaction influenza A/B virus (FluA/B) multiplex reverse transcription-PCR (RT-PCR) method that amplifies the most critical genomic segments (hemagglutinin [HA], neuraminidase [NA], and matrix [M]) of seasonal influenza A and B viruses for next-generation sequencing, regardless of viral type, subtype, or lineage. Herein, we demonstrate that the strategy is highly sensitive and robust. The strategy was validated on thousands of seasonal influenza A and B virus-positive specimens using multiple next-generation sequencing platforms. PMID:28978683
Pham, Dien G.; Madico, Guillermo E.; Quinn, Thomas C.; Enzler, Mark J.; Smith, Thomas F.; Gaydos, Charlotte A.
1998-01-01
An inherent problem in the diagnostic PCR assay is the presence of ill-defined inhibitors of amplification which may cause false-negative results. Addition of an amplifiable fragment of foreign DNA in the PCR to serve as a hybrid internal control (HIC) would allow for a simple way to identify specimens containing inhibitors. Two oligonucleotide hybrid primers were synthesized to contain nucleic acid sequences of the Chlamydia pneumoniae 16S rRNA primers in a position flanking two primers that target the sequences of a 650-bp lambda phage DNA segment. By using the hybrid primers, hybrid DNA comprising a large sequence of lambda phage DNA flanked by short pieces of chlamydia DNA was subsequently generated by PCR, cloned into a plasmid vector, and purified. Plasmids containing the hybrid DNA were diluted and used as a HIC by adding them to each C. pneumoniae PCR test. Consequently, C. pneumoniae primers were able to amplify both chlamydia DNA and the HIC DNA. The production of a 689-bp HIC DNA band on an acrylamide gel indicated that the specimen contained no inhibitors and that internal conditions were compatible with PCR. Subsequently, a biotinylated RNA probe for the HIC was transcribed from a nested sequence of the HIC and was used for its hybridization. Detection of the HIC DNA-RNA hybrid was achieved by enzyme immunoassay (EIA). This PCR-EIA system with a HIC was initially tested with 12 previously PCR-positive and 14 previously PCR-negative specimens. Of the 12 PCR-positive specimens, 11 were reconfirmed as positive; 1 had a negative HIC value, indicating inhibition. Of the 14 previously PCR-negative specimens, 13 were confirmed as true negative; 1 had a negative HIC value, indicating inhibition. The assay was then used with 237 nasopharyngeal specimens from patients with pneumonia. Twenty-one of 237 (8.9%) were positive for C. pneumoniae, and 42 (17.7%) were found to inhibit the PCR. Specimens showing inhibitory activity were diluted 1:10 and were retested. Ten specimens were still inhibitory to the PCR and required further DNA purification. No additional positive samples were detected and 3 nasopharyngeal specimens remained inhibitory to PCR. Coamplification of a HIC DNA can help confirm true-negative PCR results by ruling out the presence of inhibitors of DNA amplification. PMID:9650936
Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.
Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C
2018-01-10
Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing cancer cells. Copyright © 2017 Elsevier B.V. All rights reserved.
Komaki-Yasuda, Kanako; Vincent, Jeanne Perpétue; Nakatsu, Masami; Kato, Yasuyuki; Ohmagari, Norio; Kano, Shigeyuki
2018-01-01
A microscopy-based diagnosis is the gold standard for the detection and identification of malaria parasites in a patient's blood. However, the detection of cases involving a low number of parasites and the differentiation of species sometimes requires a skilled microscopist. Although PCR-based diagnostic methods are already known to be very powerful tools, the time required to apply such methods is still much longer in comparison to traditional microscopic observation. Thus, improvements to PCR systems are sought to facilitate the more rapid and accurate detection of human malaria parasites Plasmodium falciparum, P. vivax, P. ovale, and P. malariae, as well as P. knowlesi, which is a simian malaria parasite that is currently widely distributed in Southeast Asia. A nested PCR that targets the small subunit ribosomal RNA genes of malaria parasites was performed using a "fast PCR enzyme". In the first PCR, universal primers for all parasite species were used. In the second PCR, inner-specific primers, which targeted sequences from P. falciparum, P. vivax, P. ovale, P. malariae, and P. knowlesi, were used. The PCR reaction time was reduced with the use of the "fast PCR enzyme", with only 65 minutes required to perform the first and second PCRs. The specific primers only reacted with the sequences of their targeted parasite species and never cross-reacted with sequences from other species under the defined PCR conditions. The diagnoses of 36 clinical samples that were obtained using this new PCR system were highly consistent with the microscopic diagnoses.
Komaki-Yasuda, Kanako; Vincent, Jeanne Perpétue; Nakatsu, Masami; Kato, Yasuyuki; Ohmagari, Norio
2018-01-01
A microscopy-based diagnosis is the gold standard for the detection and identification of malaria parasites in a patient’s blood. However, the detection of cases involving a low number of parasites and the differentiation of species sometimes requires a skilled microscopist. Although PCR-based diagnostic methods are already known to be very powerful tools, the time required to apply such methods is still much longer in comparison to traditional microscopic observation. Thus, improvements to PCR systems are sought to facilitate the more rapid and accurate detection of human malaria parasites Plasmodium falciparum, P. vivax, P. ovale, and P. malariae, as well as P. knowlesi, which is a simian malaria parasite that is currently widely distributed in Southeast Asia. A nested PCR that targets the small subunit ribosomal RNA genes of malaria parasites was performed using a “fast PCR enzyme”. In the first PCR, universal primers for all parasite species were used. In the second PCR, inner-specific primers, which targeted sequences from P. falciparum, P. vivax, P. ovale, P. malariae, and P. knowlesi, were used. The PCR reaction time was reduced with the use of the “fast PCR enzyme”, with only 65 minutes required to perform the first and second PCRs. The specific primers only reacted with the sequences of their targeted parasite species and never cross-reacted with sequences from other species under the defined PCR conditions. The diagnoses of 36 clinical samples that were obtained using this new PCR system were highly consistent with the microscopic diagnoses. PMID:29370297
[Influence of PCR cycle number on microbial diversity analysis through next generation sequencing].
An, Yunhe; Gao, Lijuan; Li, Junbo; Tian, Yanjie; Wang, Jinlong; Zheng, Xuejuan; Wu, Huijuan
2016-08-25
Using of high throughput sequencing technology to study the microbial diversity in complex samples has become one of the hottest issues in the field of microbial diversity research. In this study, the soil and sheep rumen chyme samples were used to extract DNA, respectively. Then the 25 ng total DNA was used to amplify the 16S rRNA V3 region with 20, 25, 30 PCR cycles, and the final sequencing library was constructed by mixing equal amounts of purified PCR products. Finally, the operational taxonomic unit (OUT) amount, rarefaction curve, microbial number and species were compared through data analysis. It was found that at the same amount of DNA template, the proportion of the community composition was not the best with more numbers of PCR cycle, although the species number was much more. In all, when the PCR cycle number is 25, the number of species and proportion of the community composition were the most optimal both in soil or chyme samples.
Moser, I.; Rieksneuwöhner, B.; Lentzsch, P.; Schwerk, P.; Wieler, L. H.
2001-01-01
A serotyping scheme based on heat-stable surface antigens was established for 101 Campylobacter upsaliensis and 10 Campylobacter helveticus strains isolated from 261 dogs and 46 cats of different ages originating from two geographically distinct regions in Germany. The prevalence of C. upsaliensis varied between 27.8% in juvenile dogs (<12 months of age) and 55.4% in adult dogs (P < 0.05). Of the cats, 19.6% harbored C. upsaliensis, whereas 21.7% carried C. helveticus. Of the C. upsaliensis isolates from both host species, 93.1% belonged to five different serogroups, two of them being prevalent at rates of 47.5 and 27.7%, with different frequencies in both regions. Six (54.6%) of the C. helveticus isolates also belonged to serotypes found among C. upsaliensis strains, whereas five (45.4%) possessed an O antigen unique for C. helveticus. In contrast, a considerable degree of genomic diversity of the isolates was assessed by macrorestriction analyses with the endonucleases SmaI and XhoI, using pulsed-field gel electrophoresis as well as enterobacterial repetitive intergenic consensus sequence PCR (ERIC PCR). Restriction with SmaI pointed towards the existence of clonal groups associated to some extent with serotypes, while restriction with XhoI disintegrated these groups to smaller noncoherent subgroups. Analysis of ERIC PCR profiles did not exhibit any associations with serotypes. In conclusion these data demonstrate the genomic heterogeneity among C. upsaliensis strains and indicate that the combination of SmaI restriction with serotyping is a useful tool to investigate the expansion of clonal groups of C. upsaliensis. PMID:11427567
A first report and complete genome sequence of alfalfa enamovirus from Sudan
USDA-ARS?s Scientific Manuscript database
A full genome sequence of a viral pathogen, provisionally named alfalfa enamovirus 2 (AEV-2), was reconstructed from short reads obtained by Illumina RNA sequencing of alfalfa sample originating from Sudan. Ambiguous nucleotides in the resultant consensus assembly and identity of the predicted virus...
A consensus linkage map of lentil based on DArT markers from three RIL mapping populations.
Ates, Duygu; Aldemir, Secil; Alsaleh, Ahmad; Erdogmus, Semih; Nemli, Seda; Kahriman, Abdullah; Ozkan, Hakan; Vandenberg, Albert; Tanyolac, Bahattin
2018-01-01
Lentil (Lens culinaris ssp. culinaris Medikus) is a diploid (2n = 2x = 14), self-pollinating grain legume with a haploid genome size of about 4 Gbp and is grown throughout the world with current annual production of 4.9 million tonnes. A consensus map of lentil (Lens culinaris ssp. culinaris Medikus) was constructed using three different lentils recombinant inbred line (RIL) populations, including "CDC Redberry" x "ILL7502" (LR8), "ILL8006" x "CDC Milestone" (LR11) and "PI320937" x "Eston" (LR39). The lentil consensus map was composed of 9,793 DArT markers, covered a total of 977.47 cM with an average distance of 0.10 cM between adjacent markers and constructed 7 linkage groups representing 7 chromosomes of the lentil genome. The consensus map had no gap larger than 12.67 cM and only 5 gaps were found to be between 12.67 cM and 6.0 cM (on LG3 and LG4). The localization of the SNP markers on the lentil consensus map were in general consistent with their localization on the three individual genetic linkage maps and the lentil consensus map has longer map length, higher marker density and shorter average distance between the adjacent markers compared to the component linkage maps. This high-density consensus map could provide insight into the lentil genome. The consensus map could also help to construct a physical map using a Bacterial Artificial Chromosome library and map based cloning studies. Sequence information of DArT may help localization of orientation scaffolds from Next Generation Sequencing data.
A consensus linkage map of lentil based on DArT markers from three RIL mapping populations
Ates, Duygu; Aldemir, Secil; Alsaleh, Ahmad; Erdogmus, Semih; Nemli, Seda; Kahriman, Abdullah; Ozkan, Hakan; Vandenberg, Albert
2018-01-01
Background Lentil (Lens culinaris ssp. culinaris Medikus) is a diploid (2n = 2x = 14), self-pollinating grain legume with a haploid genome size of about 4 Gbp and is grown throughout the world with current annual production of 4.9 million tonnes. Materials and methods A consensus map of lentil (Lens culinaris ssp. culinaris Medikus) was constructed using three different lentils recombinant inbred line (RIL) populations, including “CDC Redberry” x “ILL7502” (LR8), “ILL8006” x “CDC Milestone” (LR11) and “PI320937” x “Eston” (LR39). Results The lentil consensus map was composed of 9,793 DArT markers, covered a total of 977.47 cM with an average distance of 0.10 cM between adjacent markers and constructed 7 linkage groups representing 7 chromosomes of the lentil genome. The consensus map had no gap larger than 12.67 cM and only 5 gaps were found to be between 12.67 cM and 6.0 cM (on LG3 and LG4). The localization of the SNP markers on the lentil consensus map were in general consistent with their localization on the three individual genetic linkage maps and the lentil consensus map has longer map length, higher marker density and shorter average distance between the adjacent markers compared to the component linkage maps. Conclusion This high-density consensus map could provide insight into the lentil genome. The consensus map could also help to construct a physical map using a Bacterial Artificial Chromosome library and map based cloning studies. Sequence information of DArT may help localization of orientation scaffolds from Next Generation Sequencing data. PMID:29351563
Old, M O; Logan, L H; Maldonado, Y A
1997-11-01
Sabin type 3 polio vaccine virus is the most common cause of poliovaccine associated paralytic poliomyelitis. Vaccine associated paralytic poliomyelitis cases have been associated with Sabin type 3 revertants containing a single U to C substitution at bp 472 of Sabin type 3. A rapid method of identification of Sabin type 3 bp 472 mutants is described. An enterovirus group-specific probe for use in a chemiluminescent dot blot hybridization assay was developed to identify enterovirus positive viral lysates. A reverse transcription-polymerase chain reaction (RT-PCR) assay producing a 319 bp PCR product containing the Sabin type 3 bp 472 mutation site was then employed to identify Sabin type 3 isolates. Chemiluminescent nucleic acid cycle sequencing of the purified 319 bp PCR product was then employed to identify nucleic acid sequences at bp 472. The enterovirus group probe hybridization procedure and isolation of the Sabin type 3 PCR product were highly sensitive and specific; nucleic acid cycle sequencing corresponded to the known sequence of stock Sabin type 3 isolates. These methods will be used to identify the Sabin type 3 reversion rate from sequential stool samples of infants obtained after the first and second doses of oral poliovirus vaccine.
A PCR detection method for rapid identification of Melissococcus pluton in honeybee larvae.
Govan, V A; Brözel, V; Allsopp, M H; Davison, S
1998-05-01
Melissococcus pluton is the causative agent of European foulbrood, a disease of honeybee larvae. This bacterium is particularly difficult to isolate because of its stringent growth requirements and competition from other bacteria. PCR was used selectively to amplify specific rRNA gene sequences of M. pluton from pure culture, from crude cell lysates, and directly from infected bee larvae. The PCR primers were designed from M. pluton 16S rRNA sequence data. The PCR products were visualized by agarose gel electrophoresis and confirmed as originating from M. pluton by sequencing in both directions. Detection was highly specific, and the probes did not hybridize with DNA from other bacterial species tested. This method enabled the rapid and specific detection and identification of M. pluton from pure cultures and infected bee larvae.
A PCR Detection Method for Rapid Identification of Melissococcus pluton in Honeybee Larvae
Govan, V. A.; Brözel, V.; Allsopp, M. H.; Davison, S.
1998-01-01
Melissococcus pluton is the causative agent of European foulbrood, a disease of honeybee larvae. This bacterium is particularly difficult to isolate because of its stringent growth requirements and competition from other bacteria. PCR was used selectively to amplify specific rRNA gene sequences of M. pluton from pure culture, from crude cell lysates, and directly from infected bee larvae. The PCR primers were designed from M. pluton 16S rRNA sequence data. The PCR products were visualized by agarose gel electrophoresis and confirmed as originating from M. pluton by sequencing in both directions. Detection was highly specific, and the probes did not hybridize with DNA from other bacterial species tested. This method enabled the rapid and specific detection and identification of M. pluton from pure cultures and infected bee larvae. PMID:9572987
Pessôa, Rodrigo; Watanabe, Jaqueline Tomoko; Nukui, Youko; Pereira, Juliana; Casseb, Jorge; Kasseb, Jorge; de Oliveira, Augusto César Penalva; Segurado, Aluisio Cotrim; Sanabani, Sabri Saeed
2014-01-01
Here, we report on the partial and full-length genomic (FLG) variability of HTLV-1 sequences from 90 well-characterized subjects, including 48 HTLV-1 asymptomatic carriers (ACs), 35 HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP) and 7 adult T-cell leukemia/lymphoma (ATLL) patients, using an Illumina paired-end protocol. Blood samples were collected from 90 individuals, and DNA was extracted from the PBMCs to measure the proviral load and to amplify the HTLV-1 FLG from two overlapping fragments. The amplified PCR products were subjected to deep sequencing. The sequencing data were assembled, aligned, and mapped against the HTLV-1 genome with sufficient genetic resemblance and utilized for further phylogenetic analysis. A high-throughput sequencing-by-synthesis instrument was used to obtain an average of 3210- and 5200-fold coverage of the partial (n = 14) and FLG (n = 76) data from the HTLV-1 strains, respectively. The results based on the phylogenetic trees of consensus sequences from partial and FLGs revealed that 86 (95.5%) individuals were infected with the transcontinental sub-subtypes of the cosmopolitan subtype (aA) and that 4 individuals (4.5%) were infected with the Japanese sub-subtypes (aB). A comparison of the nucleotide and amino acids of the FLG between the three clinical settings yielded no correlation between the sequenced genotype and clinical outcomes. The evolutionary relationships among the HTLV sequences were inferred from nucleotide sequence, and the results are consistent with the hypothesis that there were multiple introductions of the transcontinental subtype in Brazil. This study has increased the number of subtype aA full-length genomes from 8 to 81 and HTLV-1 aB from 2 to 5 sequences. The overall data confirmed that the cosmopolitan transcontinental sub-subtypes were the most prevalent in the Brazilian population. It is hoped that this valuable genomic data will add to our current understanding of the evolutionary history of this medically important virus.
Nguyen, Bach Hoang; Phan, Dieu Hong Nu; Nguyen, Hien Xuan; Le, An Van; Alberti, Alberto
2015-07-04
Streptococcus suis (S. suis) serotype 2 has recently become the most prevalent cause of meningitis in adults in many areas of Vietnam. This study provides data on S. suis molecular diagnosis in central Vietnam using a real-time polymerase chain reaction (PCR) assay targeting the S. suis serotype 2 cps2J gene. Additionally, 16S-23S rDNA intragenic spacer (ITS)-based phylogenic analysis of strains isolated from cerebrospinal fluid (CSF) in Thua Thien Hue Province, Vietnam, is presented and discussed. Pathogenic bacteria were isolated from 40 CSF samples, and 18 were identified as S. suis by culture-dependent methods. Capsular serotyping was assessed by real-time PCR. ITS sequences were obtained after traditional PCR and were used in phylogenic analyses. Pathogenic bacteria were isolated from 36 out of 40 CSF samples. A total of 18 S. suis strains were isolated and assigned to serotype 2 by real-time PCR. One CSF sample, negative when tested by culture-dependent methods, was positive to S. suis serotype 2 by real-time PCR. Pairwise alignments of the 18 ITS sequences did not reveal any variable nucleotide position, and resulted in a single sequence type. Sequences were similar to S. suis serotype 2 reference ITS sequences (> 98.1%), and there was no lack of an ITS spacer region in the isolates. S. suis serotype 2 is the most prevalent serotype in central Vietnam. Real-time PCR assay proved to be a reliable diagnostic method for early detection of S. suis 2 in CSF samples.
Sequence verification as quality-control step for production of cDNA microarrays.
Taylor, E; Cogdell, D; Coombes, K; Hu, L; Ramdas, L; Tabor, A; Hamilton, S; Zhang, W
2001-07-01
To generate cDNA arrays in our core laboratory, we amplified about 2300 PCR products from a human, sequence-verified cDNA clone library. As a quality-control step, we sequenced the PCR products immediately before printing. The sequence information was used to search the GenBank database to confirm the identities. Although these clones were previously sequence verified by the company, we found that only 79% of the clones matched the original database after handling. Our experience strongly indicates the necessity to sequence verify the clones at the final stage before printing on microarray slides and to modify the gene list accordingly.
[Complete genome sequencing and sequence analysis of BCG Tice].
Wang, Zhiming; Pan, Yuanlong; Wu, Jun; Zhu, Baoli
2012-10-04
The objective of this study is to obtain the complete genome sequence of Bacillus Calmette-Guerin Tice (BCG Tice), in order to provide more information about the molecular biology of BCG Tice and design more reasonable vaccines to prevent tuberculosis. We assembled the data from high-throughput sequencing with SOAPdenovo software, with many contigs and scaffolds obtained. There are many sequence gaps and physical gaps remained as a result of regional low coverage and low quality. We designed primers at the end of contigs and performed PCR amplification in order to link these contigs and scaffolds. With various enzymes to perform PCR amplification, adjustment of PCR reaction conditions, and combined with clone construction to sequence, all the gaps were finished. We obtained the complete genome sequence of BCG Tice and submitted it to GenBank of National Center for Biotechnology Information (NCBI). The genome of BCG Tice is 4334064 base pairs in length, with GC content 65.65%. The problems and strategies during the finishing step of BCG Tice sequencing are illuminated here, with the hope of affording some experience to those who are involved in the finishing step of genome sequencing. The microarray data were verified by our results.
A systematic approach to novel virus discovery in emerging infectious disease outbreaks.
Sridhar, Siddharth; To, Kelvin K W; Chan, Jasper F W; Lau, Susanna K P; Woo, Patrick C Y; Yuen, Kwok-Yung
2015-05-01
The discovery of novel viruses is of great importance to human health-both in the setting of emerging infectious disease outbreaks and in disease syndromes of unknown etiology. Despite the recent proliferation of many efficient virus discovery methods, careful selection of a combination of methods is important to demonstrate a novel virus, its clinical associations, and its relevance in a timely manner. The identification of a patient or an outbreak with distinctive clinical features and negative routine microbiological workup is often the starting point for virus hunting. This review appraises the roles of culture, electron microscopy, and nucleic acid detection-based methods in optimizing virus discovery. Cell culture is generally slow but may yield viable virus. Although the choice of cell line often involves trial and error, it may be guided by the clinical syndrome. Electron microscopy is insensitive but fast, and may provide morphological clues to choice of cell line or consensus primers for nucleic acid detection. Consensus primer PCR can be used to detect viruses that are closely related to known virus families. Random primer amplification and high-throughput sequencing can catch any virus genome but cannot yield an infectious virion for testing Koch postulates. A systematic approach that incorporates carefully chosen combinations of virus detection techniques is required for successful virus discovery. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
Nong, Rachel Yuan; Wu, Di; Yan, Junhong; Hammond, Maria; Gu, Gucci Jijuan; Kamali-Moghaddam, Masood; Landegren, Ulf; Darmanis, Spyros
2013-06-01
Solid-phase proximity ligation assays share properties with the classical sandwich immunoassays for protein detection. The proteins captured via antibodies on solid supports are, however, detected not by single antibodies with detectable functions, but by pairs of antibodies with attached DNA strands. Upon recognition by these sets of three antibodies, pairs of DNA strands brought in proximity are joined by ligation. The ligated reporter DNA strands are then detected via methods such as real-time PCR or next-generation sequencing (NGS). We describe how to construct assays that can offer improved detection specificity by virtue of recognition by three antibodies, as well as enhanced sensitivity owing to reduced background and amplified detection. Finally, we also illustrate how the assays can be applied for parallel detection of proteins, taking advantage of the oligonucleotide ligation step to avoid background problems that might arise with multiplexing. The protocol for the singleplex solid-phase proximity ligation assay takes ~5 h. The multiplex version of the assay takes 7-8 h depending on whether quantitative PCR (qPCR) or sequencing is used as the readout. The time for the sequencing-based protocol includes the library preparation but not the actual sequencing, as times may vary based on the choice of sequencing platform.
Kim, Moon Jung; Bae, Il Kwon; Jeong, Seok Hoon; Kim, So Hyun; Song, Jae Hoon; Choi, Jae Young; Yoon, Sang Sun; Thamlikitkul, Visanu; Hsueh, Po-Ren; Yasin, Rohani Md; Lalitha, M K; Lee, Kyungwon
2013-12-01
To investigate the epidemiological traits of metallo-β-lactamase (MBL)-producing Pseudomonas aeruginosa (MPPA) clinical isolates collected by the Asian Network for Surveillance of Resistant Pathogens (ANSORP). A total of 16 MPPA clinical isolates were collected from six Asian countries in 2000 to 2009 by ANSORP. The MBL gene was detected by PCR amplification. The genetic organization of the class 1 integron carrying the MBL gene cassette was investigated by PCR mapping and sequencing. Southern blotting, repetitive sequence-based PCR and multilocus sequence typing (MLST) experiments were performed to characterize the isolates. PCR and sequencing experiments detected the blaVIM-2 (n = 12), blaVIM-3 (n = 1), blaIMP-6 (n = 2) and blaIMP-26 (n = 1) genes. The MBL genes were located on the chromosome in all isolates except one. Furthermore, all the MBL genes were located in a class 1 integron. All the MPPA isolates from Malaysia, Thailand, Sri Lanka and Korea were identified as sequence type (ST) 235 by MLST. Three VIM-2-producing isolates from India were identified as ST773, and one isolate harbouring VIM-3 from Taiwan was identified as ST298. P. aeruginosa ST235 might play a role in dissemination of MBL genes in Asian countries.
Amicarelli, Giulia; Adlerstein, Daniel; Shehi, Erlet; Wang, Fengfei; Makrigiorgos, G Mike
2006-10-01
Genotyping methods that reveal single-nucleotide differences are useful for a wide range of applications. We used digestion of 3-way DNA junctions in a novel technology, OneCutEventAmplificatioN (OCEAN) that allows sequence-specific signal generation and amplification. We combined OCEAN with peptide-nucleic-acid (PNA)-based variant enrichment to detect and simultaneously genotype v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) codon 12 sequence variants in human tissue specimens. We analyzed KRAS codon 12 sequence variants in 106 lung cancer surgical specimens. We conducted a PNA-PCR reaction that suppresses wild-type KRAS amplification and genotyped the product with a set of OCEAN reactions carried out in fluorescence microplate format. The isothermal OCEAN assay enabled a 3-way DNA junction to form between the specific target nucleic acid, a fluorescently labeled "amplifier", and an "anchor". The amplifier-anchor contact contains the recognition site for a restriction enzyme. Digestion produces a cleaved amplifier and generation of a fluorescent signal. The cleaved amplifier dissociates from the 3-way DNA junction, allowing a new amplifier to bind and propagate the reaction. The system detected and genotyped KRAS sequence variants down to approximately 0.3% variant-to-wild-type alleles. PNA-PCR/OCEAN had a concordance rate with PNA-PCR/sequencing of 93% to 98%, depending on the exact implementation. Concordance rate with restriction endonuclease-mediated selective-PCR/sequencing was 89%. OCEAN is a practical and low-cost novel technology for sequence-specific signal generation. Reliable analysis of KRAS sequence alterations in human specimens circumvents the requirement for sequencing. Application is expected in genotyping KRAS codon 12 sequence variants in surgical specimens or in bodily fluids, as well as single-base variations and sequence alterations in other genes.
Genetic diversity in Trypanosoma theileri from Sri Lankan cattle and water buffaloes.
Yokoyama, Naoaki; Sivakumar, Thillaiampalam; Fukushi, Shintaro; Tattiyapong, Muncharee; Tuvshintulga, Bumduuren; Kothalawala, Hemal; Silva, Seekkuge Susil Priyantha; Igarashi, Ikuo; Inoue, Noboru
2015-01-30
Trypanosoma theileri is a hemoprotozoan parasite that infects various ruminant species. We investigated the epidemiology of this parasite among cattle and water buffalo populations bred in Sri Lanka, using a diagnostic PCR assay based on the cathepsin L-like protein (CATL) gene. Blood DNA samples sourced from cattle (n=316) and water buffaloes (n=320) bred in different geographical areas of Sri Lanka were PCR screened for T. theileri. Parasite DNA was detected in cattle and water buffaloes alike in all the sampling locations. The overall T. theileri-positive rate was higher in water buffaloes (15.9%) than in cattle (7.6%). Subsequently, PCR amplicons were sequenced and the partial CATL sequences were phylogenetically analyzed. The identity values for the CATL gene were 89.6-99.7% among the cattle-derived sequences, compared with values of 90.7-100% for the buffalo-derived sequences. However, the cattle-derived sequences shared 88.2-100% identity values with those from buffaloes. In the phylogenetic tree, the Sri Lankan CATL gene sequences fell into two major clades (TthI and TthII), both of which contain CATL sequences from several other countries. Although most of the CATL sequences from Sri Lankan cattle and buffaloes clustered independently, two buffalo-derived sequences were observed to be closely related to those of the Sri Lankan cattle. Furthermore, a Sri Lankan buffalo sequence clustered with CATL gene sequences from Brazilian buffalo and Thai cattle. In addition to reporting the first PCR-based survey of T. theileri among Sri Lankan-bred cattle and water buffaloes, the present study found that some of the CATL gene fragments sourced from water buffaloes shared similarity with those determined from cattle in this country. Copyright © 2014 Elsevier B.V. All rights reserved.
Masatani, Tatsunori; Hayashi, Kei; Andoh, Masako; Tateno, Morihiro; Endo, Yasuyuki; Asada, Masahito; Kusakisako, Kodai; Tanaka, Tetsuya; Gokuden, Mutsuyo; Hozumi, Nodoka; Nakadohzono, Fumiko; Matsuo, Tomohide
2017-06-01
To reveal the distribution of tick-borne parasites, we established a novel nested polymerase chain reaction (PCR) system to detect the most common agents of tick-borne parasitic diseases, namely Babesia, Theileria, and Hepatozoon parasites. We collected host-seeking or animal-feeding ticks in Kagoshima Prefecture, the southernmost region of Kyusyu Island in southwestern Japan. Twenty of the total of 776 tick samples displayed a specific band of the appropriate size (approximately 1.4-1.6kbp) for the 18S rRNA genes in the novel nested PCR (20/776: 2.58%). These PCR products have individual sequences of Babesia spp. (from 8 ticks), Theileria spp. (from 9 ticks: one tick sample including at least two Theileria spp. sequences), and Hepatozoon spp. (from 3 ticks). Phylogenetic analyses revealed that these sequences were close to those of undescribed Babesia spp. detected in feral raccoons in Japan (5 sequences; 3 sequences being identical), Babesia gibsoni-like parasites detected in pigs in China (3 sequences; all sequences being identical), Theileria spp. detected in sika deer in Japan and China (10 sequences; 2 sequences being identical), Hepatozoon canis (one sequence), and Hepatozoon spp. detected in Japanese martens in Japan (two sequences). In summary, we showed that various tick-borne parasites exist in Kagoshima, the southern region in Japan by using the novel nested PCR system. These including undescribed species such as Babesia gibsoni-like parasites previously detected in pigs in China. Importantly, our results revealed new combinations of ticks and protozoan parasites in southern Japan. The results of this study will aid in the recognition of potential parasitic animal diseases caused by tick-borne parasites. Copyright © 2017 Elsevier GmbH. All rights reserved.
Ulrich, Alexander; Andersen, Kasper R.; Schwartz, Thomas U.
2012-01-01
We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts. PMID:23300917
Ulrich, Alexander; Andersen, Kasper R; Schwartz, Thomas U
2012-01-01
We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts.
Droplet digital PCR technology promises new applications and research areas.
Manoj, P
2016-01-01
Digital Polymerase Chain Reaction (dPCR) is used to quantify nucleic acids and its applications are in the detection and precise quantification of low-level pathogens, rare genetic sequences, quantification of copy number variants, rare mutations and in relative gene expressions. Here the PCR is performed in large number of reaction chambers or partitions and the reaction is carried out in each partition individually. This separation allows a more reliable collection and sensitive measurement of nucleic acid. Results are calculated by counting amplified target sequence (positive droplets) and the number of partitions in which there is no amplification (negative droplets). The mean number of target sequences was calculated by Poisson Algorithm. Poisson correction compensates the presence of more than one copy of target gene in any droplets. The method provides information with accuracy and precision which is highly reproducible and less susceptible to inhibitors than qPCR. It has been demonstrated in studying variations in gene sequences, such as copy number variants and point mutations, distinguishing differences between expression of nearly identical alleles, assessment of clinically relevant genetic variations and it is routinely used for clonal amplification of samples for NGS methods. dPCR enables more reliable predictors of tumor status and patient prognosis by absolute quantitation using reference normalizations. Rare mitochondrial DNA deletions associated with a range of diseases and disorders as well as aging can be accurately detected with droplet digital PCR.
Qiu, Jing; Kleineidam, Anna; Gouraud, Sabine; Yao, Song Tieng; Greenwood, Mingkwan; Hoe, See Ziau; Hindmarch, Charles
2014-01-01
The supraoptic nucleus (SON) of the hypothalamus is responsible for maintaining osmotic stability in mammals through its elaboration of the antidiuretic hormone arginine vasopressin. Upon dehydration, the SON undergoes a function-related plasticity, which includes remodeling of morphology, electrical properties, and biosynthetic activity. This process occurs alongside alterations in steady state transcript levels, which might be mediated by changes in the activity of transcription factors. In order to identify which transcription factors might be involved in changing patterns of gene expression, an Affymetrix protein-DNA array analysis was carried out. Nuclear extracts of SON from dehydrated and control male rats were analyzed for binding to the 345 consensus DNA transcription factor binding sequences of the array. Statistical analysis revealed significant changes in binding to 26 consensus elements, of which EMSA confirmed increased binding to signal transducer and activator of transcription (Stat) 1/Stat3, cellular Myelocytomatosis virus-like cellular proto-oncogene (c-Myc)-Myc-associated factor X (Max), and pre-B cell leukemia transcription factor 1 sequences after dehydration. Focusing on c-Myc and Max, we used quantitative PCR to confirm previous transcriptomic analysis that had suggested an increase in c-Myc, but not Max, mRNA levels in the SON after dehydration, and we demonstrated c-Myc- and Max-like immunoreactivities in SON arginine vasopressin-expressing cells. Finally, by comparing new data obtained from Roche-NimbleGen chromatin immunoprecipitation arrays with previously published transcriptomic data, we have identified putative c-Myc target genes whose expression changes in the SON after dehydration. These include known c-Myc targets, such as the Slc7a5 gene, which encodes the L-type amino acid transporter 1, ribosomal protein L24, histone deactylase 2, and the Rat sarcoma proto-oncogene (Ras)-related nuclear GTPase. PMID:25144923
Kamalakaran, Sitharthan; Radhakrishnan, Senthil K; Beck, William T
2005-06-03
We developed a pipeline to identify novel genes regulated by the steroid hormone-dependent transcription factor, estrogen receptor, through a systematic analysis of upstream regions of all human and mouse genes. We built a data base of putative promoter regions for 23,077 human and 19,984 mouse transcripts from National Center for Biotechnology Information annotation and 8793 human and 6785 mouse promoters from the Data Base of Transcriptional Start Sites. We used this data base of putative promoters to identify potential targets of estrogen receptor by identifying estrogen response elements (EREs) in their promoters. Our program correctly identified EREs in genes known to be regulated by estrogen in addition to several new genes whose putative promoters contained EREs. We validated six genes (KIAA1243, NRIP1, MADH9, NME3, TPD52L, and ABCG2) to be estrogen-responsive in MCF7 cells using reverse transcription PCR. To allow for extensibility of our program in identifying targets of other transcription factors, we have built a Web interface to access our data base and programs. Our Web-based program for Promoter Analysis of Genome, PAGen@UIC, allows a user to identify putative target genes for vertebrate transcription factors through the analysis of their upstream sequences. The interface allows the user to search the human and mouse promoter data bases for potential target genes containing one or more listed transcription factor binding sites (TFBSs) in their upstream elements, using either regular expression-based consensus or position weight matrices. The data base can also be searched for promoters harboring user-defined TFBSs given as a consensus or a position weight matrix. Furthermore, the user can retrieve putative promoter sequences for any given gene together with identified TFBSs located on its promoter. Orthologous promoters are also analyzed to determine conserved elements.
Coexistence of metallo-beta-lactamase-encoding genes in Pseudomonas aeruginosa.
Mohanam, Lavanya; Menon, Thangam
2017-07-01
The emergence and rapid spread of carbapenem resistance mediated by metallo-beta-lactamase (MBL) in Pseudomonas aeruginosa is of major concern due to limited therapeutic options. This study was aimed at detecting the presence of MBL and its association with integrons in imipenem-resistant P. aeruginosa isolates and to determine their genetic relatedness. A total of 213 P. aeruginosa isolates were collected from two tertiary care centres and tested against anti-pseudomonal antibiotics by antimicrobial susceptibility testing, followed by the detection of MBL production by combined disk method. Minimum inhibitory concentration (MIC) of meropenem was determined by E-test. Multiplex polymerase chain reaction (PCR) was performed for the detection of blaSPM, blaIMP, blaVIM, blaNDM, blaGIM and blaSIM. PCR was carried out to characterize the variable region of class 1 integron. Transcongujation assay was carried out for the confirmation of plasmid-mediated resistance. Enterobacterial repetitive intergenic consensus sequence (ERIC)-PCR was performed for determining the genetic relatedness among P. aeruginosa isolates. Of the 213 P. aeruginosa isolates, 22 (10%) were found to be carbapenem resistant and these were from pus 18 (82%), urine 2 (9%), sputum 1 (5%) and tracheal wash 1 (5%). Among 22 isolates, 18 (81.8%) were found to be MBL producers by phenotypic method and MIC range of meropenem was 8 to >32 μg/ml. PCR amplification showed that 20 (91%) isolates carried any one of the MBL genes tested: blaVIM and blaNDM in seven (32%) and six (27%) isolates, respectively; blaVIM and blaNDMin three (14%); blaIMP and blaNDM in two (9%); blaVIM and blaIMP in one (5%) isolate. The blaVIM, blaIMP and blaNDM were found to co-exist in one isolate. None of the isolates were positive for blaSPM, blaSIM and blaGIM. All 22 isolates carried class I integron. Of the 20 MBL-positive isolates, transconjugants were obtained for 15 isolates. ERIC-PCR analysis showed all isolates to be clonally independent. Our results showed 10.3 per cent of carbapenem resistance among P. aeruginosa isolates, and the coexistence of MBL-encoding genes among P. aeruginosa mediated by class I integron.
Human papillomavirus detection and typing using a nested-PCR-RFLP assay.
Coser, Janaina; Boeira, Thaís da Rocha; Fonseca, André Salvador Kazantzi; Ikuta, Nilo; Lunge, Vagner Ricardo
2011-01-01
It is clinically important to detect and type human papillomavirus (HPV) in a sensitive and specific manner. Development of a nested-polymerase chain reaction-restriction fragment length polymorphism (nested-PCR-RFLP) assay to detect and type HPV based on the analysis of L1 gene. Analysis of published DNA sequence of mucosal HPV types to select sequences of new primers. Design of an original nested-PCR assay using the new primers pair selected and classical MY09/11 primers. HPV detection and typing in cervical samples using the nested-PCR-RFLP assay. The nested-PCR-RFLP assay detected and typed HPV in cervical samples. Of the total of 128 clinical samples submitted to simple PCR and nested-PCR for detection of HPV, 37 (28.9%) were positive for the virus by both methods and 25 samples were positive only by nested-PCR (67.5% increase in detection rate compared with single PCR). All HPV positive samples were effectively typed by RFLP assay. The method of nested-PCR proved to be an effective diagnostic tool for HPV detection and typing.
Belaz, Sorya; Gangneux, Jean-Pierre; Dupretz, Peggy; Guiguen, Claude
2015-01-01
This study aimed to evaluate the repeated sequence REP-529 compared to that of the B1 gene in the molecular diagnosis of toxoplasmosis by quantitative PCR (qPCR) in routine diagnosis. Over a 10-year period (2003 to 2013), all patients prospectively diagnosed with a positive REP-529 qPCR result for toxoplasmosis were included. All DNA samples (76 samples from 56 patients) were simultaneously tested using the two qPCR methods (REP-529 and B1). The mean cycle threshold (CT) obtained with the B1 qPCR was significantly higher (+4.71 cycles) than that obtained with REP-529 qPCR (P < 0.0001). Thirty-one out of 69 extracts (45.6%) positive with REP-529 qPCR were not amplified with the B1 qPCR (relative sensitivity of 54.4% compared to that with REP-529), yielding false-negative results with 15/28 placenta, 5 cord blood, 2 amniotic fluid, 4 cerebrospinal fluid, 1 aqueous humor, 2 lymph node puncture, and 1 abortion product sample. This defect in sensitivity would have left 20/56 patients undiagnosed, distributed as follows: 12/40 congenital toxoplasmosis, 4/5 cerebral toxoplasmosis, 2/8 patients with retinochoroiditis, and 2 patients with chronic lymphadenopathy. This poor performance of B1 qPCR might be related to low parasite loads, since the mean Toxoplasma quantification in extracts with B1 false-negative results was 0.4 parasite/reaction. These results clearly show the superiority of the REP-529 sequence in the diagnosis of toxoplasmosis by PCR and suggest that this target should be adopted as part of the standardization of the PCR assay. PMID:25653416
Belaz, Sorya; Gangneux, Jean-Pierre; Dupretz, Peggy; Guiguen, Claude; Robert-Gangneux, Florence
2015-04-01
This study aimed to evaluate the repeated sequence REP-529 compared to that of the B1 gene in the molecular diagnosis of toxoplasmosis by quantitative PCR (qPCR) in routine diagnosis. Over a 10-year period (2003 to 2013), all patients prospectively diagnosed with a positive REP-529 qPCR result for toxoplasmosis were included. All DNA samples (76 samples from 56 patients) were simultaneously tested using the two qPCR methods (REP-529 and B1). The mean cycle threshold (CT) obtained with the B1 qPCR was significantly higher (+4.71 cycles) than that obtained with REP-529 qPCR (P<0.0001). Thirty-one out of 69 extracts (45.6%) positive with REP-529 qPCR were not amplified with the B1 qPCR (relative sensitivity of 54.4% compared to that with REP-529), yielding false-negative results with 15/28 placenta, 5 cord blood, 2 amniotic fluid, 4 cerebrospinal fluid, 1 aqueous humor, 2 lymph node puncture, and 1 abortion product sample. This defect in sensitivity would have left 20/56 patients undiagnosed, distributed as follows: 12/40 congenital toxoplasmosis, 4/5 cerebral toxoplasmosis, 2/8 patients with retinochoroiditis, and 2 patients with chronic lymphadenopathy. This poor performance of B1 qPCR might be related to low parasite loads, since the mean Toxoplasma quantification in extracts with B1 false-negative results was 0.4 parasite/reaction. These results clearly show the superiority of the REP-529 sequence in the diagnosis of toxoplasmosis by PCR and suggest that this target should be adopted as part of the standardization of the PCR assay. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
2012-01-01
Background Although modern sequencing technologies permit the ready detection of numerous DNA sequence variants in any organisms, converting such information to PCR-based genetic markers is hampered by a lack of simple, scalable tools. Onion is an example of an under-researched crop with a complex, heterozygous genome where genome-based research has previously been hindered by limited sequence resources and genetic markers. Results We report the development of generic tools for large-scale web-based PCR-based marker design in the Galaxy bioinformatics framework, and their application for development of next-generation genetics resources in a wide cross of bulb onion (Allium cepa L.). Transcriptome sequence resources were developed for the homozygous doubled-haploid bulb onion line ‘CUDH2150’ and the genetically distant Indian landrace ‘Nasik Red’, using 454™ sequencing of normalised cDNA libraries of leaf and shoot. Read mapping of ‘Nasik Red’ reads onto ‘CUDH2150’ assemblies revealed 16836 indel and SNP polymorphisms that were mined for portable PCR-based marker development. Tools for detection of restriction polymorphisms and primer set design were developed in BioPython and adapted for use in the Galaxy workflow environment, enabling large-scale and targeted assay design. Using PCR-based markers designed with these tools, a framework genetic linkage map of over 800cM spanning all chromosomes was developed in a subset of 93 F2 progeny from a very large F2 family developed from the ‘Nasik Red’ x ‘CUDH2150’ inter-cross. The utility of tools and genetic resources developed was tested by designing markers to transcription factor-like polymorphic sequences. Bin mapping these markers using a subset of 10 progeny confirmed the ability to place markers within 10 cM bins, enabling increased efficiency in marker assignment and targeted map refinement. The major genetic loci conditioning red bulb colour (R) and fructan content (Frc) were located on this map by QTL analysis. Conclusions The generic tools developed for the Galaxy environment enable rapid development of sets of PCR assays targeting sequence variants identified from Illumina and 454 sequence data. They enable non-specialist users to validate and exploit large volumes of next-generation sequence data using basic equipment. PMID:23157543
Baldwin, Samantha; Revanna, Roopashree; Thomson, Susan; Pither-Joyce, Meeghan; Wright, Kathryn; Crowhurst, Ross; Fiers, Mark; Chen, Leshi; Macknight, Richard; McCallum, John A
2012-11-19
Although modern sequencing technologies permit the ready detection of numerous DNA sequence variants in any organisms, converting such information to PCR-based genetic markers is hampered by a lack of simple, scalable tools. Onion is an example of an under-researched crop with a complex, heterozygous genome where genome-based research has previously been hindered by limited sequence resources and genetic markers. We report the development of generic tools for large-scale web-based PCR-based marker design in the Galaxy bioinformatics framework, and their application for development of next-generation genetics resources in a wide cross of bulb onion (Allium cepa L.). Transcriptome sequence resources were developed for the homozygous doubled-haploid bulb onion line 'CUDH2150' and the genetically distant Indian landrace 'Nasik Red', using 454™ sequencing of normalised cDNA libraries of leaf and shoot. Read mapping of 'Nasik Red' reads onto 'CUDH2150' assemblies revealed 16836 indel and SNP polymorphisms that were mined for portable PCR-based marker development. Tools for detection of restriction polymorphisms and primer set design were developed in BioPython and adapted for use in the Galaxy workflow environment, enabling large-scale and targeted assay design. Using PCR-based markers designed with these tools, a framework genetic linkage map of over 800cM spanning all chromosomes was developed in a subset of 93 F(2) progeny from a very large F(2) family developed from the 'Nasik Red' x 'CUDH2150' inter-cross. The utility of tools and genetic resources developed was tested by designing markers to transcription factor-like polymorphic sequences. Bin mapping these markers using a subset of 10 progeny confirmed the ability to place markers within 10 cM bins, enabling increased efficiency in marker assignment and targeted map refinement. The major genetic loci conditioning red bulb colour (R) and fructan content (Frc) were located on this map by QTL analysis. The generic tools developed for the Galaxy environment enable rapid development of sets of PCR assays targeting sequence variants identified from Illumina and 454 sequence data. They enable non-specialist users to validate and exploit large volumes of next-generation sequence data using basic equipment.
Bautista-de Los Santos, Quyen Melina; Schroeder, Joanna L; Blakemore, Oliver; Moses, Jonathan; Haffey, Mark; Sloan, William; Pinto, Ameet J
2016-03-01
High-throughput and deep DNA sequencing, particularly amplicon sequencing, is being increasingly utilized to reveal spatial and temporal dynamics of bacterial communities in drinking water systems. Whilst the sampling and methodological biases associated with PCR and sequencing have been studied in other environments, they have not been quantified for drinking water. These biases are likely to have the greatest effect on the ability to characterize subtle spatio-temporal patterns influenced by process/environmental conditions. In such cases, intra-sample variability may swamp any underlying small, systematic variation. To evaluate this, we undertook a study with replication at multiple levels including sampling sites, sample collection, PCR amplification, and high throughput sequencing of 16S rRNA amplicons. The variability inherent to the PCR amplification and sequencing steps is significant enough to mask differences between bacterial communities from replicate samples. This was largely driven by greater variability in detection of rare bacteria (relative abundance <0.01%) across PCR/sequencing replicates as compared to replicate samples. Despite this, we captured significant changes in bacterial community over diurnal time-scales and find that the extent and pattern of diurnal changes is specific to each sampling location. Further, we find diurnal changes in bacterial community arise due to differences in the presence/absence of the low abundance bacteria and changes in the relative abundance of dominant bacteria. Finally, we show that bacterial community composition is significantly different across sampling sites for time-periods during which there are typically rapid changes in water use. This suggests hydraulic changes (driven by changes in water demand) contribute to shaping the bacterial community in bulk drinking water over diurnal time-scales. Copyright © 2015 Elsevier Ltd. All rights reserved.
Chen, Y. C.; Eisner, J. D.; Kattar, M. M.; Rassoulian-Barrett, S. L.; LaFe, K.; Yarfitz, S. L.; Limaye, A. P.; Cookson, B. T.
2000-01-01
Identification of medically relevant yeasts can be time-consuming and inaccurate with current methods. We evaluated PCR-based detection of sequence polymorphisms in the internal transcribed spacer 2 (ITS2) region of the rRNA genes as a means of fungal identification. Clinical isolates (401), reference strains (6), and type strains (27), representing 34 species of yeasts were examined. The length of PCR-amplified ITS2 region DNA was determined with single-base precision in less than 30 min by using automated capillary electrophoresis. Unique, species-specific PCR products ranging from 237 to 429 bp were obtained from 92% of the clinical isolates. The remaining 8%, divided into groups with ITS2 regions which differed by ≤2 bp in mean length, all contained species-specific DNA sequences easily distinguishable by restriction enzyme analysis. These data, and the specificity of length polymorphisms for identifying yeasts, were confirmed by DNA sequence analysis of the ITS2 region from 93 isolates. Phenotypic and ITS2-based identification was concordant for 427 of 434 yeast isolates examined using sequence identity of ≥99%. Seven clinical isolates contained ITS2 sequences that did not agree with their phenotypic identification, and ITS2-based phylogenetic analyses indicate the possibility of new or clinically unusual species in the Rhodotorula and Candida genera. This work establishes an initial database, validated with over 400 clinical isolates, of ITS2 length and sequence polymorphisms for 34 species of yeasts. We conclude that size and restriction analysis of PCR-amplified ITS2 region DNA is a rapid and reliable method to identify clinically significant yeasts, including potentially new or emerging pathogenic species. PMID:10834993
Matray, Olivier; Mouhajir, Abdelmounaim; Giraud, Sandrine; Godon, Charlotte; Gargala, Gilles; Labbé, Franck; Rougeron, Amandine; Ballet, Jean-Jacques; Zouhair, Rachid; Bouchara, Jean-Philippe; Favennec, Loïc
2016-05-01
The Scedosporium apiospermum species complex usually ranks second among the filamentous fungi colonizing the airways of patients with cystic fibrosis (CF), but little is known about the molecular epidemiology of the airway colonization. Polymerase chain reaction (PCR) amplification of repetitive sequences (rep-PCR) was applied to the retrospective analysis of a panel of isolates already studied by random amplification of polymorphic DNA (RAPD) and comprising 63 isolates recovered from sputa from 9 CF patients. Results were compared to those obtained previously by RAPD, and herein by beta-tubulin (TUB) gene sequencing and Multilocus Sequence Typing (MLST). Within the panel of isolates studied,S. apiospermum sensu stricto and Scedosporium boydii, as expected, were the predominant species with 21 and 36 isolates, respectively. Four isolates from one patient were identified as Scedosporium aurantiacum, whereas two isolates belonged to the Pseudallescheria ellipsoidea subgroup of S. boydii rep-PCR analysis of these isolates clearly differentiated the three species and P. ellipsoidea isolates, whatever the rep-PCR kit used, and also permitted strain differentiation. When using the mold primer kit, results from rep-PCR were in close agreement with those obtained by MLST. For both S. apiospermum and S. boydii, 8 genotypes were differentiated by rep-PCR and MLST compared to 10 by RAPD. All S. aurantiacum isolates shared the same RAPD genotype and exhibited the same rep-PCR profile and sequence type. These results illustrate the efficacy of rep-PCR for both species identification within the S. apiospermum complex and genotyping for the two major species of this complex.Abstract presentation: Part of this work was presented during the 18th Congress of the International Society for Human and Animal Mycology, Berlin (Germany), June 2012.S. Giraud, C. Godon, A. Rougeron, J.P. Bouchara and L. Favennec are members of the ECMM/ISHAM working group on Fungal respiratory infections in Cystic Fibrosis(Fri-CF). © The Author 2015. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Han, Bang-Xing; Yuan, Yuan; Huang, Lu-Qi; Zhao, Qun; Tan, Ling-Ling; Song, Xiang-Wen; He, Xiao-Mei; Xu, Tao; Liu, Feng; Wang, Jian
2017-01-01
The traditional Chinese medicine (TCM) Qianhu and Zihuaqianhu are the dried roots of Peucedanum praeruptorum and Angelica decursiva , respectively. Since the plant sources of Qianhu and Zihuaqianhu are more complex, the chemical compositions of P. praeruptorum and A. decursiva are significantly different, and many adulterants exist because of the differences in traditional understanding and medication habits. Therefore, the rapid and accurate identification methods are required. The aim was to study the feasibility of using DNA barcoding to distinguish between Traditional Chinese medicine Qianhu ( Peucedanum praeruptorum ), Zihuaqianhu ( Angelica decursiva ), and common adulterants, based on internal transcribed spacer (ITS) sequences, as well as specific PCR identification between P. praeruptorum and A. decursiva . The ITS sequences of P. praeruptorum , A. decursiva , and adulterant were studied, and a phylogenetic tree was constructed. Based on the ITS barcode, the specific PCR primer pairs QH-CP19s/QH-CP19a and ZHQH-CP3s/ZHQH-CP3a were designed for P. praeruptorum and A. decursiva , respectively. The amplification conditions were optimized, and specific PCR products were obtained. The results showed that the phylogenetic trees constructed using the BI and MP methods were consistent, and P. praeruptorum and A. decursiva sequence haplotypes formed their own monophyly. The experimental results showed that in PCR products, the target bands appeared in the genuine drug and not in the adulterant, which suggests the high specificity of the two primer pairs. The ITS sequence was ideal DNA barcode to identify P. praeruptorum , A. decursiva , and adulterant. The specific PCR is a quick and effective method to distinguish between P. praeruptorum and A. decursiva . Peucedanum praeruptorum and Angelica decursiva sequence haplotypes formed their own monophyly.The ITS sequence was ideal DNA barcode to identify P. praeruptorum , A. decursiva , and adulterant.Specific PCR is a quick and effective method to distinguish between P. praeruptorum and A. decursiva . Abbreviations used: TCM: The traditional Chinese medicine, P.: Peucedanum , A.: Angelica , ITS: The internal transcribed spacer, PCR: Polymerase chain reaction, NCBI: National Center for Biotechnology Information, NI: Number of individuals, HN: Haplotype number; GAN: Gen Bank accession numbers, L.: Ligusticum , O.: Ostericum , A.: Angelica , P.: Pimpinella , BI: Bayesian inference, MP: Maximum parsimony, AIC: Akaike Information Criterion, MCMC: Markov Chains Monte Carlo, TBR: Tree bisection-reconnection, LPP: Length of PCR product, PRP: PCR reaction procedure, SNP: Single nucleotide polymorphisms, PP: Posterior probability, BS: Bootstrap.Qun Zhao.
Nachappa, Somanna Ajjamada; Neelambike, Sumana M; Amruthavalli, Chokkanna; Ramachandra, Nallur B
2018-05-01
Diagnosis of drug-resistant tuberculosis predominantly relies on culture-based drug susceptibility testing, which take weeks to produce a result and a more time-efficient alternative method is multiplex allele-specific PCR (MAS-PCR). Also, understanding the role of mutations in causing resistance helps better drug designing. To evaluate the ability of MAS-PCR in the detection of drug resistance and to understand the mechanism of interaction of drugs with mutant proteins in Mycobacterium tuberculosis. Detection of drug-resistant mutations using MAS-PCR and validation through DNA sequencing. MAS-PCR targeted five loci on three genes, katG 315 and inhA -15 for the drug isoniazid (INH), and rpoB 516, 526, and 531 for rifampicin (RIF). Furthermore, the sequence data were analyzed to study the effect on interaction of the anti-TB drug molecule with the target protein using in silico docking. We identified drug-resistant mutations in 8 out of 114 isolates with 2 of them as multidrug-resistant TB using MAS-PCR. DNA sequencing confirmed only six of these, recording a sensitivity of 85.7% and specificity of 99.3% for MAS-PCR. Molecular docking showed estimated free energy of binding (ΔG) being higher for RIF binding with RpoB S531L mutant. Codon 315 in KatG does not directly interact with INH but blocks the drug access to active site. We propose DNA sequencing-based drug resistance detection for TB, which is more accurate than MAS-PCR. Understanding the action of resistant mutations in disrupting the normal drug-protein interaction aids in designing effective drug alternatives.
URPD: a specific product primer design tool
2012-01-01
Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312
Fuller, Nicholas J.; Wilson, William H.; Joint, Ian R.; Mann, Nicholas H.
1998-01-01
Viruses are ubiquitous components of marine ecosystems and are known to infect unicellular phycoerythrin-containing cyanobacteria belonging to the genus Synechococcus. A conserved region from the cyanophage genome was identified in three genetically distinct cyanomyoviruses, and a sequence analysis revealed that this region exhibited significant similarity to a gene encoding a capsid assembly protein (gp20) from the enteric coliphage T4. The results of a comparison of gene 20 sequences from three cyanomyoviruses and T4 allowed us to design two degenerate PCR primers, CPS1 and CPS2, which specifically amplified a 165-bp region from the majority of cyanomyoviruses tested. A competitive PCR (cPCR) analysis revealed that cyanomyovirus strains could be accurately enumerated, and it was demonstrated that quantification was log-linear over ca. 3 orders of magnitude. Different calibration curves were obtained for each of the three cyanomyovirus strains tested; consequently, cPCR performed with primers CPS1 and CPS2 could lead to substantial inaccuracies in estimates of phage abundance in natural assemblages. Further sequence analysis of cyanomyovirus gene 20 homologs would be necessary in order to design primers which do not exhibit phage-to-phage variability in priming efficiency. It was demonstrated that PCR products of the correct size could be amplified from seawater samples following 100× concentration and even directly without any prior concentration. Hence, the use of degenerate primers in PCR analyses of cyanophage populations should provide valuable data on the diversity of cyanophages in natural assemblages. Further optimization of procedures may ultimately lead to a sensitive assay which can be used to analyze natural cyanophage populations both quantitatively (by cPCR) and qualitatively following phylogenetic analysis of amplified products. PMID:9603813
URPD: a specific product primer design tool.
Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong
2012-06-19
Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.
Kibenge, Molly Jt; Iwamoto, Tokinori; Wang, Yingwei; Morton, Alexandra; Routledge, Richard; Kibenge, Frederick Sb
2016-01-06
Infectious salmon anaemia (ISA) virus (ISAV) belongs to the genus Isavirus, family Orthomyxoviridae. ISAV occurs in two basic genotypes, North American and European. The European genotype is more widespread and shows greater genetic variation and greater virulence variation than the North American genotype. To date, all of the ISAV isolates from the clinical disease, ISA, have had deletions in the highly polymorphic region (HPR) on ISAV segment 6 (ISAV-HPRΔ) relative to ISAV-HPR0, named numerically from ISAV-HPR1 to over ISAV-HPR30. ISA outbreaks have only been reported in farmed Atlantic salmon, although ISAV has been detected by RT-PCR in wild fish. It is recognized that asymptomatically ISAV-infected fish exist. There is no universally accepted ISAV RT-qPCR TaqMan® assay. Most diagnostic laboratories use the primer-probe set targeting a 104 bp-fragment on ISAV segment 8. Some laboratories and researchers have found a primer-probe set targeting ISAV segment 7 to be more sensitive. Other researchers have published different ISAV segment 8 primer-probe sets that are highly sensitive. In this study, we tested 1,106 fish tissue samples collected from (i) market-bought farmed salmonids and (ii) wild salmon from throughout British Columbia (BC), Canada, for ISAV using real time RT-qPCR targeting segment 8 and/or conventional RT-PCR with segment 8 primers and segment 6 HPR primers, and by virus isolation attempts using Salmon head kidney (SHK-1 and ASK-2) cell line monolayers. The sequences from the conventional PCR products were compared by multiple alignment and phylogenetic analyses. Seventy-nine samples were "non-negative" with at least one of these tests in one or more replicates. The ISAV segment 6 HPR sequences from the PCR products matched ISAV variants, HPR5 on 29 samples, one sample had both HPR5 and HPR7b and one matched HPR0. All sequences were of European genotype. In addition, alignment of sequences of the conventional PCR product segment 8 showed they had a single nucleotide mutation in the region of the probe sequence and a 9-nucleotide overlap with the reverse primer sequence of the real time RT-qPCR assay. None of the classical ISAV segment 8 sequences in the GenBank have this mutation in the probe-binding site of the assay, suggesting the presence of a novel ISAV variant in BC. A phylogenetic tree of these sequences showed that some ISAV sequences diverted early from the classical European genotype sequences, while others have evolved separately. All virus isolation attempts on the samples were negative, and thus the samples were considered "negative" in terms of the threshold trigger set for Canadian federal regulatory action; i.e., successful virus isolation in cell culture. This is the first published report of the detection of ISAV sequences in fish from British Columbia, Canada. The sequences detected, both of ISAV-HPRΔ and ISAV-HPR0 are of European genotype. These sequences are different from the classical ISAV segment 8 sequences, and this difference suggests the presence of a new ISAV variant of European genotype in BC. Our results further suggest that ISAV-HPRΔ strains can be present without clinical disease in farmed fish and without being detected by virus isolation using fish cell lines.
Flanking sequence determination and event-specific detection of genetically modified wheat B73-6-1.
Xu, Junyi; Cao, Jijuan; Cao, Dongmei; Zhao, Tongtong; Huang, Xin; Zhang, Piqiao; Luan, Fengxia
2013-05-01
In order to establish a specific identification method for genetically modified (GM) wheat, exogenous insert DNA and flanking sequence between exogenous fragment and recombinant chromosome of GM wheat B73-6-1 were successfully acquired by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. Newly acquired exogenous fragment covered the full-length sequence of transformed genes such as transformed plasmid and corresponding functional genes including marker uidA, herbicide-resistant bar, ubiquitin promoter, and high-molecular-weight gluten subunit. The flanking sequence between insert DNA revealed high similarity with Triticum turgidum A gene (GenBank: AY494981.1). A specific PCR detection method for GM wheat B73-6-1 was established on the basis of primers designed according to the flanking sequence. This specific PCR method was validated by GM wheat, GM corn, GM soybean, GM rice, and non-GM wheat. The specifically amplified target band was observed only in GM wheat B73-6-1. This method is of high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of GM wheat B73-6-1.
Demidov, German; Simakova, Tamara; Vnuchkova, Julia; Bragin, Anton
2016-10-22
Multiplex polymerase chain reaction (PCR) is a common enrichment technique for targeted massive parallel sequencing (MPS) protocols. MPS is widely used in biomedical research and clinical diagnostics as the fast and accurate tool for the detection of short genetic variations. However, identification of larger variations such as structure variants and copy number variations (CNV) is still being a challenge for targeted MPS. Some approaches and tools for structural variants detection were proposed, but they have limitations and often require datasets of certain type, size and expected number of amplicons affected by CNVs. In the paper, we describe novel algorithm for high-resolution germinal CNV detection in the PCR-enriched targeted sequencing data and present accompanying tool. We have developed a machine learning algorithm for the detection of large duplications and deletions in the targeted sequencing data generated with PCR-based enrichment step. We have performed verification studies and established the algorithm's sensitivity and specificity. We have compared developed tool with other available methods applicable for the described data and revealed its higher performance. We showed that our method has high specificity and sensitivity for high-resolution copy number detection in targeted sequencing data using large cohort of samples.
Veldman, G M; Klootwijk, J; van Heerikhuizen, H; Planta, R J
1981-01-01
We have determined the nucleotide sequence of part of a cloned yeast ribosomal RNA operon extending from the 5.8S RNA gene downstream into the 5' -terminal region of the 26S RNA gene. We mapped the pertinent processing sites, viz. the 5' end of 26S rRNA and the 3'ends of 5.8S rRNA and its immediate precursor, 7S RNA. At the 3' end of 7S RNA we find the sequence UCGUUU which is very similar to the type I consensus sequence UCAUUA/U present at the 3' ends of 17S, 5.8S and 26S rRNA as well as 18S precursor rRNA in yeast. At the 5' end of the 26S RNA gene we find a sequence of thirteen nucleotides which is homologous to the type II sequence present at the 5' termini of both the 17S and the 5.8S RNA gene. These findings further support the suggestion put forward earlier (G.M. Veldman et al. (1980) Nucl. Acids Res. 8, 2907-2920) that both consensus sequences are involved in the recognition of precursor rRNA by the processing nuclease(s). We discuss a model for the processing of yeast rRNA in which a processing enzyme sequentially recognizes several combinations of a type I and a type II consensus sequence. We also describe the existence of a significant base complementarity between sequences in the 5' -terminal region of 26S rRNA and the 3' -terminal region of 5.8S rRNA. We suggest that base pairing between these sequences contributes to the binding between 5.8S and 26S rRNA. Images PMID:7312619
Consensus statement: Virus taxonomy in the age of metagenomics.
Simmonds, Peter; Adams, Mike J; Benkő, Mária; Breitbart, Mya; Brister, J Rodney; Carstens, Eric B; Davison, Andrew J; Delwart, Eric; Gorbalenya, Alexander E; Harrach, Balázs; Hull, Roger; King, Andrew M Q; Koonin, Eugene V; Krupovic, Mart; Kuhn, Jens H; Lefkowitz, Elliot J; Nibert, Max L; Orton, Richard; Roossinck, Marilyn J; Sabanadzovic, Sead; Sullivan, Matthew B; Suttle, Curtis A; Tesh, Robert B; van der Vlugt, René A; Varsani, Arvind; Zerbini, F Murilo
2017-03-01
The number and diversity of viral sequences that are identified in metagenomic data far exceeds that of experimentally characterized virus isolates. In a recent workshop, a panel of experts discussed the proposal that, with appropriate quality control, viruses that are known only from metagenomic data can, and should be, incorporated into the official classification scheme of the International Committee on Taxonomy of Viruses (ICTV). Although a taxonomy that is based on metagenomic sequence data alone represents a substantial departure from the traditional reliance on phenotypic properties, the development of a robust framework for sequence-based virus taxonomy is indispensable for the comprehensive characterization of the global virome. In this Consensus Statement article, we consider the rationale for why metagenomic sequence data should, and how it can, be incorporated into the ICTV taxonomy, and present proposals that have been endorsed by the Executive Committee of the ICTV.
Brylinski, Michal; Konieczny, Leszek; Kononowicz, Andrzej; Roterman, Irena
2008-03-21
The well-known procedure implemented in ClustalW oriented on the sequence comparison was applied to structure comparison. The consensus sequence as well as consensus structure has been defined for proteins belonging to serpine family. The structure of early stage intermediate was the object for similarity search. The high values of W(sequence) appeared to be accordant with high values of W(structure) making possible structure comparison using common criteria for sequence and structure comparison. Since the early stage structural form has been created according to limited conformational sub-space which does not include the beta-structure (this structure is mediated by C7eq structural form), is particularly important to see, that the C7eq structural form may be treated as the seed for beta-structure present in the final native structure of protein. The applicability of ClustalW procedure to structure comparison makes these two comparisons unified.
Nested PCR Biases in Interpreting Microbial Community Structure in 16S rRNA Gene Sequence Datasets
Yu, Guoqin; Fadrosh, Doug; Goedert, James J.; Ravel, Jacques; Goldstein, Alisa M.
2015-01-01
Background Sequencing of the PCR-amplified 16S rRNA gene has become a common approach to microbial community investigations in the fields of human health and environmental sciences. This approach, however, is difficult when the amount of DNA is too low to be amplified by standard PCR. Nested PCR can be employed as it can amplify samples with DNA concentration several-fold lower than standard PCR. However, potential biases with nested PCRs that could affect measurement of community structure have received little attention. Results In this study, we used 17 DNAs extracted from vaginal swabs and 12 DNAs extracted from stool samples to study the influence of nested PCR amplification of the 16S rRNA gene on the estimation of microbial community structure using Illumina MiSeq sequencing. Nested and standard PCR methods were compared on alpha- and beta-diversity metrics and relative abundances of bacterial genera. The effects of number of cycles in the first round of PCR (10 vs. 20) and microbial diversity (relatively low in vagina vs. high in stool) were also investigated. Vaginal swab samples showed no significant difference in alpha diversity or community structure between nested PCR and standard PCR (one round of 40 cycles). Stool samples showed significant differences in alpha diversity (except Shannon’s index) and relative abundance of 13 genera between nested PCR with 20 cycles in the first round and standard PCR (P<0.01), but not between nested PCR with 10 cycles in the first round and standard PCR. Operational taxonomic units (OTUs) that had low relative abundance (sum of relative abundance <0.167) accounted for most of the distortion (>27% of total OTUs in stool). Conclusions Nested PCR introduced bias in estimated diversity and community structure. The bias was more significant for communities with relatively higher diversity and when more cycles were applied in the first round of PCR. We conclude that nested PCR could be used when standard PCR does not work. However, rare taxa detected by nested PCR should be validated by other technologies. PMID:26196512
Nested PCR Biases in Interpreting Microbial Community Structure in 16S rRNA Gene Sequence Datasets.
Yu, Guoqin; Fadrosh, Doug; Goedert, James J; Ravel, Jacques; Goldstein, Alisa M
2015-01-01
Sequencing of the PCR-amplified 16S rRNA gene has become a common approach to microbial community investigations in the fields of human health and environmental sciences. This approach, however, is difficult when the amount of DNA is too low to be amplified by standard PCR. Nested PCR can be employed as it can amplify samples with DNA concentration several-fold lower than standard PCR. However, potential biases with nested PCRs that could affect measurement of community structure have received little attention. In this study, we used 17 DNAs extracted from vaginal swabs and 12 DNAs extracted from stool samples to study the influence of nested PCR amplification of the 16S rRNA gene on the estimation of microbial community structure using Illumina MiSeq sequencing. Nested and standard PCR methods were compared on alpha- and beta-diversity metrics and relative abundances of bacterial genera. The effects of number of cycles in the first round of PCR (10 vs. 20) and microbial diversity (relatively low in vagina vs. high in stool) were also investigated. Vaginal swab samples showed no significant difference in alpha diversity or community structure between nested PCR and standard PCR (one round of 40 cycles). Stool samples showed significant differences in alpha diversity (except Shannon's index) and relative abundance of 13 genera between nested PCR with 20 cycles in the first round and standard PCR (P<0.01), but not between nested PCR with 10 cycles in the first round and standard PCR. Operational taxonomic units (OTUs) that had low relative abundance (sum of relative abundance <0.167) accounted for most of the distortion (>27% of total OTUs in stool). Nested PCR introduced bias in estimated diversity and community structure. The bias was more significant for communities with relatively higher diversity and when more cycles were applied in the first round of PCR. We conclude that nested PCR could be used when standard PCR does not work. However, rare taxa detected by nested PCR should be validated by other technologies.
How-Kit, Alexandre; Tost, Jörg
2015-01-01
A number of molecular diagnostic assays have been developed in the last years for mutation detection. Although these methods have become increasingly sensitive, most of them are incompatible with a sequencing-based readout and require prior knowledge of the mutation present in the sample. Consequently, coamplification at low denaturation (COLD)-PCR-based methods have been developed and combine a high analytical sensitivity due to mutation enrichment in the sample with the identification of known or unknown mutations by downstream sequencing experiments. Among these methods, the recently developed Enhanced-ice-COLD-PCR appeared as the most powerful method as it outperformed the other COLD-PCR-based methods in terms of the mutation enrichment and due to the simplicity of the experimental setup of the assay. Indeed, E-ice-COLD-PCR is very versatile as it can be used on all types of PCR platforms and is applicable to different types of samples including fresh frozen, FFPE, and plasma samples. The technique relies on the incorporation of an LNA containing blocker probe in the PCR reaction followed by selective heteroduplex denaturation enabling amplification of the mutant allele while amplification of the wild-type allele is prevented. Combined with Pyrosequencing(®), which is a very quantitative high-resolution sequencing technology, E-ice-COLD-PCR can detect and identify mutations with a limit of detection down to 0.01 %.
Chen, Letian; Wang, Fengpin; Wang, Xiaoyu; Liu, Yao-Guang
2013-01-01
Functional genomics requires vector construction for protein expression and functional characterization of target genes; therefore, a simple, flexible and low-cost molecular manipulation strategy will be highly advantageous for genomics approaches. Here, we describe a Ω-PCR strategy that enables multiple types of sequence modification, including precise insertion, deletion and substitution, in any position of a circular plasmid. Ω-PCR is based on an overlap extension site-directed mutagenesis technique, and is named for its characteristic Ω-shaped secondary structure during PCR. Ω-PCR can be performed either in two steps, or in one tube in combination with exonuclease I treatment. These strategies have wide applications for protein engineering, gene function analysis and in vitro gene splicing. PMID:23335613
Fast and accurate de novo genome assembly from long uncorrected reads
Vaser, Robert; Sović, Ivan; Nagarajan, Niranjan
2017-01-01
The assembly of long reads from Pacific Biosciences and Oxford Nanopore Technologies typically requires resource-intensive error-correction and consensus-generation steps to obtain high-quality assemblies. We show that the error-correction step can be omitted and that high-quality consensus sequences can be generated efficiently with a SIMD-accelerated, partial-order alignment–based, stand-alone consensus module called Racon. Based on tests with PacBio and Oxford Nanopore data sets, we show that Racon coupled with miniasm enables consensus genomes with similar or better quality than state-of-the-art methods while being an order of magnitude faster. PMID:28100585
Amplification of Mitochondrial DNA for detection of Plasmodiumvivax in Balochistan.
Shahwani, Muhammad Naeem; Nisar, Samia; Aleem, Abdul; Panezai, Marina; Afridi, Sarwat; Malik, Shaukat Iqbal
2017-05-01
To access a new step using PCR to amplify the targeted mtDNA sequence for detecting specifically Plasmodium vivax and its co-infections, false positive and false negative results with Plasmodium falciparum. In this study we have standardized a new technical approach in which the target mitochondrial DNA sequence (mtDNA) was amplified by using a PCR technique as a tool to detect Plasmodium spp. Species specific primers were designed to hybridize with cytochrome c oxidase gene of P. vivax (cox I) and P. falciparum (cox III). Two hundred blood samples were collected on the basis of clinical symptoms which were initially examined through microscopic analysis after preparing Giemsa stained thick and thin blood smears. Afterwards genomic DNA was extracted from all samples and was then subjected to PCR amplification by using species specific primers and amplified segments were sequenced for confirmation of results. One-hundred and thirty-two blood samples were detected as positive for malaria by PCR, out of which 64 were found to be positive by PCR and 53 by both microscopy and PCR for P.vivax infection. Nine samples were found to be false negative, one P.vivax mono infection was declared as co infection by PCR and 3 samples identified as having P.falciparum gametes were confirmed as P.vivax by PCR amplification. Sensitivity and specificity were found to be 85% and 92% respectively. Results obtained through PCR method were comparatively better and reliable than microscopy.
de Almeida, Fernanda Losi Alves; Carvalho, Robson Francisco; Pinhal, Danillo; Padovani, Carlos Roberto; Martins, Cesar; Dal Pai-Silva, Maeli
2008-12-01
Skeletal muscle is the edible part of the fish. It grows by hypertrophy and hyperplasia, events regulated by differential expression of myogenic regulatory factors (MRFs). The study of muscle growth mechanisms in fish is very important in fish farming development. Pacu (Piaractus mesopotamicus) is one of the most important food species farmed in Brazil and has been extensively used in Brazilian aquaculture programs. The aim of this study was to analyze hyperplasia and hypertrophy and the MRF MyoD expression pattern in skeletal muscle of pacu (P. mesopotamicus) during juvenile and adult growth stages. Juvenile (n=5) and adult (n=5) fish were anaesthetized, sacrificed, and weight (g) and total length (cm) determined. White dorsal region muscle samples were collected and immersed in liquid nitrogen. Transverse sections (10 microm thick) were stained with Haematoxilin-Eosin (HE) for morphological and morphometric analysis. Smallest fiber diameter from 100 muscle fibers per animal was calculated in each growth phase. These fibers were grouped into three classes (<20, 20-50, and >50 microm) to evaluate hypertrophy and hyperplasia in white skeletal muscle. MyoD gene expression was determined by semi-quantitative RT-PCR. PCR products were cloned and sequenced. Juvenile and adult pacu skeletal muscle had similar morphology. The large number of <20 microm diameter muscle fibers observed in juvenile fish confirms active hyperplasia. In adult fish, most fibers were over 50 microm diameter and denote more intense muscle fiber hypertrophy. The MyoD mRNA level in juveniles was higher than in adults. A consensus partial sequence for MyoD gene (338 base pairs) was obtained. The Pacu MyoD nucleotide sequence displayed high similarity among several vertebrates, including teleosts. The differential MyoD gene expression observed in pacu white muscle is possibly related to differences in growth patterns during the phases analyzed, with hyperplasia predominant in juveniles and hypertrophy in adult fish. These results should provide a foundation for understanding the molecular control of skeletal muscle growth in economically important Brazilian species, with a view to improving production quality.
Sequence specificity of the human mRNA N6-adenosine methylase in vitro.
Harper, J E; Miceli, S M; Roberts, R J; Manley, J L
1990-01-01
N6-adenosine methylation is a frequent modification of mRNAs and their precursors, but little is known about the mechanism of the reaction or the function of the modification. To explore these questions, we developed conditions to examine N6-adenosine methylase activity in HeLa cell nuclear extracts. Transfer of the methyl group from S-[3H methyl]-adenosylmethionine to unlabeled random copolymer RNA substrates of varying ribonucleotide composition revealed a substrate specificity consistent with a previously deduced consensus sequence, Pu[G greater than A]AC[A/C/U]. 32-P labeled RNA substrates of defined sequence were used to examine the minimum sequence requirements for methylation. Each RNA was 20 nucleotides long, and contained either the core consensus sequence GGACU, or some variation of this sequence. RNAs containing GGACU, either in single or multiple copies, were good substrates for methylation, whereas RNAs containing single base substitutions within the GGACU sequence gave dramatically reduced methylation. These results demonstrate that the N6-adenosine methylase has a strict sequence specificity, and that there is no requirement for extended sequences or secondary structures for methylation. Recognition of this sequence does not require an RNA component, as micrococcal nuclease pretreatment of nuclear extracts actually increased methylation efficiency. Images PMID:2216767
Oyamada, Maremichi; Davoust, Bernard; Boni, Mickaël; Dereure, Jacques; Bucheton, Bruno; Hammad, Awad; Itamoto, Kazuhito; Okuda, Masaru; Inokuma, Hisashi
2005-01-01
Babesia and Hepatozoon infections of dogs in a village of eastern Sudan were analyzed by using a single PCR and sequencing. Among 78 dogs, 5 were infected with Babesia canis rossi and 2 others were infected with B. canis vogeli. Thirty-three dogs were positive for Hepatozoon. Hepatozoon canis was detected by sequence analysis. PMID:16275954
Oyamada, Maremichi; Davoust, Bernard; Boni, Mickaël; Dereure, Jacques; Bucheton, Bruno; Hammad, Awad; Itamoto, Kazuhito; Okuda, Masaru; Inokuma, Hisashi
2005-11-01
Babesia and Hepatozoon infections of dogs in a village of eastern Sudan were analyzed by using a single PCR and sequencing. Among 78 dogs, 5 were infected with Babesia canis rossi and 2 others were infected with B. canis vogeli. Thirty-three dogs were positive for Hepatozoon. Hepatozoon canis was detected by sequence analysis.
V, Pavana Jyothi; S, Akila; Selvan, Malini K; Naidu, Hariprasad; Raghunathan, Shwethaa; Kota, Sathish; Sundaram, R C Raja; Rana, Samir Kumar; Raj, G Dhinakar; Srinivasan, V A; Mohana Subramanian, B
2016-12-01
Canine parvovirus (CPV) is a non-enveloped single stranded DNA virus with an icosahedral capsid. Mini-sequencing based CPV typing was developed earlier to detect and differentiate all the CPV types and FPV in a single reaction. This technique was further evaluated in the present study by performing the mini-sequencing directly from fecal samples which avoided tedious virus isolation steps by cell culture system. Fecal swab samples were collected from 84 dogs with enteritis symptoms, suggestive of parvoviral infection from different locations across India. Seventy six of these samples were positive by PCR; the subsequent mini-sequencing reaction typed 74 of them as type 2a virus, and 2 samples as type 2b. Additionally, 25 of the positive samples were typed by cycle sequencing of PCR products. Direct CPV typing from fecal samples using mini-sequencing showed 100% correlation with CPV typing by cycle sequencing. Moreover, CPV typing was achieved by mini-sequencing even with faintly positive PCR amplicons which was not possible by cycle sequencing. Therefore, the mini-sequencing technique is recommended for regular epidemiological follow up of CPV types, since the technique is rapid, highly sensitive and high capacity method for CPV typing. Copyright © 2016. Published by Elsevier B.V.
Namouchi, Amine; Mardassi, Helmi
2006-11-01
Evidence suggests that insertion of the IS6110 element is not without consequence to the biology of Mycobacterium tuberculosis complex strains. Thus, mapping of multiple IS6110 insertion sites in the genome of biomedically relevant clinical isolates would result in a better understanding of the role of this mobile element, particularly with regard to transmission, adaptability and virulence. In the present paper, we describe a versatile strategy, referred to as GL-PCR, that amplifies IS6110-flanking sequences based on the construction of a genomic library. M. tuberculosis chromosomal DNA is fully digested with HincII and then ligated into a plasmid vector between T7 and T3 promoter sequences. The ligation reaction product is transformed into Escherichia coli and selective PCR amplification targeting both 5' and 3' IS6110-flanking sequences are performed on the plasmid library DNA. For this purpose, four separate PCR reactions are performed, each combining an outward primer specific for one IS6110 end with either T7 or T3 primer. Determination of the nucleotide sequence of the PCR products generated from a single ligation reaction allowed mapping of 21 out of the 24 IS6110 copies of two 12 banded M. tuberculosis strains, yielding an overall sensitivity of 87,5%. Furthermore, by simply comparing the migration pattern of GL-PCR-generated products, the strategy proved to be as valuable as IS6110 RFLP for molecular typing of M. tuberculosis complex strains. Importantly, GL-PCR was able to discriminate between strains differing by a single IS6110 band.
Chaban, Bonnie; Chu, Shirley; Hendrick, Steven; Waldner, Cheryl; Hill, Janet E.
2012-01-01
The detection and subspeciation of Campylobacter fetus subsp. venerealis (CFV) from veterinary samples is important for both clinical and economic reasons. Campylobacter fetus subsp. venerealis is the causative agent of bovine genital campylobacteriosis, a venereal disease that can lead to serious reproductive problems in cattle, and strict international regulations require animals and animal products to be CFV-free for trade. This study evaluated methods reported in the literature for CFV detection and reports the translation of an extensively tested CFV-specific polymerase chain reaction (PCR) primer set; including the VenSF/VenSR primers and a real-time, quantitative PCR (qPCR) platform using SYBR Green chemistry. Three methods of preputial sample preparation for direct qPCR were evaluated and a heat lysis DNA extraction method was shown to allow for CFV detection at the level of approximately one cell equivalent per reaction (or 1.0 × 103 CFU/mL) from prepuce. The optimized sample preparation and qPCR protocols were then used to evaluate 3 western Canadian bull cohorts, which included 377 bulls, for CFV. The qPCR assay detected 11 positive bulls for the CFV-specific parA gene target. DNA sequence data confirmed the identity of the amplified product and revealed that positive samples were comprised of 2 sequence types; one identical to previously reported CFV parA gene sequences and one with a 9% sequence divergence. These results add valuable information towards our understanding of an important CFV subspeciation target and offer a significantly improved format for an internationally recognized PCR test. PMID:23277694
Yang, Lei; Naylor, Gavin J P
2016-01-01
We determined the complete mitochondrial genome sequence (16,760 bp) of the peacock skate Pavoraja nitida using a long-PCR based next generation sequencing method. It has 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes, and 1 control region in the typical vertebrate arrangement. Primers, protocols, and procedures used to obtain this mitogenome are provided. We anticipate that this approach will facilitate rapid collection of mitogenome sequences for studies on phylogenetic relationships, population genetics, and conservation of cartilaginous fishes.
Baig, Tayyba T.; Lanchy, Jean-Marc; Lodmell, J. Stephen
2009-01-01
The packaging signal (ψ) of human immunodeficiency virus type 2 (HIV-2) is present in the 5′ noncoding region of RNA and contains a 10-nucleotide palindrome (pal; 5′-392-GGAGUGCUCC) located upstream of the dimerization signal stem-loop 1 (SL1). pal has been shown to be functionally important in vitro and in vivo. We previously showed that the 3′ side of pal (GCUCC-3′) is involved in base-pairing interactions with a sequence downstream of SL1 to make an extended SL1, which is important for replication in vivo and the regulation of dimerization in vitro. However, the role of the 5′ side of pal (5′-GGAGU) was less clear. Here, we characterized this role using an in vivo SELEX approach. We produced a population of HIV-2 DNA genomes with random sequences within the 5′ side of pal and transfected these into COS-7 cells. Viruses from COS-7 cells were used to infect C8166 permissive cells. After several weeks of serial passage in C8166 cells, surviving viruses were sequenced. On the 5′ side of pal there was a striking convergence toward a GGRGN consensus sequence. Individual clones with consensus and nonconsensus sequences were tested in infectivity and packaging assays. Analysis of individuals that diverged from the consensus sequence showed normal viral RNA and protein synthesis but had replication defects and impaired RNA packaging. These findings clearly indicate that the GGRG motif is essential for viral replication and genomic RNA packaging. PMID:18971263
Mares-Guia, Maria Angélica M M; Guterres, Alexandro; Rozental, Tatiana; Ferreira, Michelle Dos Santos; Lemos, Elba R S
Q fever is a worldwide zoonosis caused by Coxiella burnetii-a small obligate intracellular Gram-negative bacterium found in a variety of animals. It is transmitted to humans by inhalation of contaminated aerosols from urine, feces, milk, amniotic fluid, placenta, abortion products, wool, and rarely by ingestion of raw milk from infected animals. Nested PCR can improve the sensitivity and specificity of testing while offering a suitable amplicon size for sequencing. Serial dilutions were performed tenfold to test the limit of detection, and the result was 10× detection of C. burnetti DNA with internal nested PCR primers relative to trans-PCR. Different biological samples were tested and identified only in nested PCR. This demonstrates the efficiency and effectiveness of the primers. Of the 19 samples, which amplify the partial sequence of C. burnetii, 12 were positive by conventional PCR and nested PCR. Seven samples-five spleen tissue samples from rodents and two tick samples-were only positive in nested PCR. With these new internal primers for trans-PCR, we demonstrate that our nested PCR assay for C. burnetii can achieve better results than conventional PCR. Published by Elsevier Editora Ltda.
Hammondia heydorni oocysts in the faeces of a greyhound in New Zealand.
Ellis, J T; Pomroy, W E
2003-02-01
To identify oocysts found in faecal material of a greyhound. Polymerase chain reaction (PCR) and DNA sequencing were used to study genomic DNA isolated from oocysts purified from faeces of a greyhound. Database searches with the DNA sequences obtained showed they were derived from Hammondia heydorni. A species-specific PCR was developed to detect H. heydorni DNA. Light microscopy in conjunction with PCR and DNA sequencing definitively identified the presence of H. heydorni oocysts in faeces of a greyhound. This study confirms the presence of H. heydorni in New Zealand and indicates the need to correctly identify similar oocysts from dogs, rather than assume they are Neospora caninum.
Ouoba, L I I; Parkouda, C; Diawara, B; Scotti, C; Varnam, A H
2008-01-01
To identify Bacillus spp. responsible of the fermentation of Hibiscus sabdariffa for production of Bikalga, an alkaline fermented food used as a condiment in Burkina Faso. Seventy bacteria were isolated from Bikalga produced in different regions of Burkina Faso and identified by phenotyping and genotyping using PCR amplification of the 16S-23S rDNA intergenic transcribed spacer (ITS-PCR), repetitive sequence-based PCR (rep-PCR) and DNA sequencing. The isolates were characterized as motile, rod-shaped, endospore forming, catalase positive, Gram-positive bacteria. ITS-PCR allowed typing mainly at species level. Rep-PCR was more discriminative and allowed a typing at ssp. level. The DNA sequencing combined with the Blast search program and fermentation profiles using API 50CHB system allowed an identification of the bacteria as Bacillus subtilis, B. licheniformis, B. cereus, B. pumilus, B. badius, Brevibacillus bortelensis, B. sphaericus and B. fusiformis. B. subtilis were the predominant bacterium (42) followed by B. licheniformis (16). Various species and ssp. of Bacillus are involved in fermentation of H. sabdariffa for production of Bikalga. Selection of starter cultures of Bacillus for controlled production of Bikalga, selection of probiotic bacteria.
CapZyme-Seq Comprehensively Defines Promoter-Sequence Determinants for RNA 5' Capping with NAD.
Vvedenskaya, Irina O; Bird, Jeremy G; Zhang, Yuanchao; Zhang, Yu; Jiao, Xinfu; Barvík, Ivan; Krásný, Libor; Kiledjian, Megerditch; Taylor, Deanne M; Ebright, Richard H; Nickels, Bryce E
2018-05-03
Nucleoside-containing metabolites such as NAD + can be incorporated as 5' caps on RNA by serving as non-canonical initiating nucleotides (NCINs) for transcription initiation by RNA polymerase (RNAP). Here, we report CapZyme-seq, a high-throughput-sequencing method that employs NCIN-decapping enzymes NudC and Rai1 to detect and quantify NCIN-capped RNA. By combining CapZyme-seq with multiplexed transcriptomics, we determine efficiencies of NAD + capping by Escherichia coli RNAP for ∼16,000 promoter sequences. The results define preferred transcription start site (TSS) positions for NAD + capping and define a consensus promoter sequence for NAD + capping: HRRASWW (TSS underlined). By applying CapZyme-seq to E. coli total cellular RNA, we establish that sequence determinants for NCIN capping in vivo match the NAD + -capping consensus defined in vitro, and we identify and quantify NCIN-capped small RNAs (sRNAs). Our findings define the promoter-sequence determinants for NCIN capping with NAD + and provide a general method for analysis of NCIN capping in vitro and in vivo. Copyright © 2018 Elsevier Inc. All rights reserved.
Stöcher, Markus; Leb, Victoria; Hölzl, Gabriele; Berg, Jörg
2002-12-01
The real-time PCR technology allows convenient detection and quantification of virus derived DNA. This approach is used in many PCR based assays in clinical laboratories. Detection and quantification of virus derived DNA is usually performed against external controls or external standards. Thus, adequacy within a clinical sample is not monitored for. This can be achieved using internal controls that are co-amplified with the specific target within the same reaction vessel. We describe a convenient way to prepare heterologous internal controls as competitors for real-time PCR based assays. The internal controls were devised as competitors in real-time PCR, e.g. LightCycler-PCR. The bacterial neomycin phosphotransferase gene (neo) was used as source for heterologous DNA. Within the neo gene a box was chosen containing sequences for four differently spaced forward primers, one reverse primer, and a pair of neo specific hybridization probes. Pairs of primers were constructed to compose of virus-specific primer sequences and neo box specific primer sequences. Using those composite primers in conventional preparative PCR four types of internal controls were amplified from the neo box and subsequently cloned. A panel of the four differently sized internal controls was generated and tested by LightCycler PCR using their virus-specific primers. All four different PCR products were detected with the single pair of neo specific FRET-hybridization probes. The presented approach to generate competitive internal controls for use in LightCycler PCR assays proved convenient und rapid. The obtained internal controls match most PCR product sizes used in clinical routine molecular assays and will assist to discriminate true from false negative results.
Fong, Wai-Ying; Ho, Chi-Chun; Poon, Wing-Tat
2017-05-12
Thiopurine intolerance and treatment-related toxicity, such as fatal myelosuppression, is related to non-function genetic variants encoding thiopurine S-methyltransferase (TPMT) and Nudix hydrolase 15 (NUDT15). Genetic testing of the common variants NUDT15:NM_018283.2:c.415C>T (Arg139Cys, dbSNP rs116855232 T allele) and TPMT: NM_000367.4:c.719A>G (TPMT*3C, dbSNP rs1142345 G allele) in East Asians including Chinese can potentially prevent treatment-related complications. Two complementary genotyping approaches, real-time PCR-high resolution melt (PCR-HRM) and PCR-restriction fragment length morphism (PCR-RFLP) analysis were evaluated using conventional PCR and Sanger sequencing genotyping as the gold standard. Sixty patient samples were tested, revealing seven patients (11.7%) heterozygous for NUDT15 c.415C>T, one patient homozygous for the variant and one patient heterozygous for the TPMT*3C non-function allele. No patient was found to harbor both variants. In total, nine out of 60 (15%) patients tested had genotypic evidence of thiopurine intolerance, which may require dosage adjustment or alternative medication should they be started on azathioprine, mercaptopurine or thioguanine. The two newly developed assays were more efficient and showed complete concordance (60/60, 100%) compared to the Sanger sequencing results. Accurate and cost-effective genotyping assays by real-time PCR-HRM and PCR-RFLP for NUDT15 c.415C>T and TPMT*3C were successfully developed. Further studies may establish their roles in genotype-informed clinical decision-making in the prevention of morbidity and mortality due to thiopurine intolerance.
Valliere-Douglass, John F; Kodama, Paul; Mujacic, Mirna; Brady, Lowell J; Wang, Wes; Wallace, Alison; Yan, Boxu; Reddy, Pranhitha; Treuheit, Michael J; Balland, Alain
2009-11-20
We report that N-linked oligosaccharide structures can be present on an asparagine residue not adhering to the consensus site motif NX(S/T), where X is not proline, described in the literature. We have observed oligosaccharides on a non-consensus asparaginyl residue in the C(H)1 constant domain of IgG1 and IgG2 antibodies. The initial findings were obtained from characterization of charge variant populations evident in a recombinant human antibody of the IgG2 subclass. HPLC-MS results indicated that cation-exchange chromatography acidic variant populations were enriched in antibody with a second glycosylation site, in addition to the well documented canonical glycosylation site located in the C(H)2 domain. Subsequent tryptic and chymotryptic peptide map data indicated that the second glycosylation site was associated with the amino acid sequence TVSWN(162)SGAL in the C(H)1 domain of the antibody. This highly atypical modification is present at levels of 0.5-2.0% on most of the recombinant antibodies that have been tested and has also been observed in IgG1 antibodies derived from human donors. Site-directed mutagenesis of the C(H)1 domain sequence in a recombinant-human IgG1 antibody resulted in an increase in non-consensus glycosylation to 3.15%, a greater than 4-fold increase over the level observed in the wild type, by changing the -1 and +1 amino acids relative to the asparagine residue at position 162. We believe that further understanding of the phenomenon of non-consensus glycosylation can be used to gain fundamental insights into the fidelity of the cellular glycosylation machinery.
Dickinson, Louise; Ahmed, Hashim U; Allen, Clare; Barentsz, Jelle O; Carey, Brendan; Futterer, Jurgen J; Heijmink, Stijn W; Hoskin, Peter J; Kirkham, Alex; Padhani, Anwar R; Persad, Raj; Puech, Philippe; Punwani, Shonit; Sohaib, Aslam S; Tombal, Bertrand; Villers, Arnauld; van der Meulen, Jan; Emberton, Mark
2011-04-01
Multiparametric magnetic resonance imaging (mpMRI) may have a role in detecting clinically significant prostate cancer in men with raised serum prostate-specific antigen levels. Variations in technique and the interpretation of images have contributed to inconsistency in its reported performance characteristics. Our aim was to make recommendations on a standardised method for the conduct, interpretation, and reporting of prostate mpMRI for prostate cancer detection and localisation. A consensus meeting of 16 European prostate cancer experts was held that followed the UCLA-RAND Appropriateness Method and facilitated by an independent chair. Before the meeting, 520 items were scored for "appropriateness" by panel members, discussed face to face, and rescored. Agreement was reached in 67% of 260 items related to imaging sequence parameters. T2-weighted, dynamic contrast-enhanced, and diffusion-weighted MRI were the key sequences incorporated into the minimum requirements. Consensus was also reached on 54% of 260 items related to image interpretation and reporting, including features of malignancy on individual sequences. A 5-point scale was agreed on for communicating the probability of malignancy, with a minimum of 16 prostatic regions of interest, to include a pictorial representation of suspicious foci. Limitations relate to consensus methodology. Dominant personalities are known to affect the opinions of the group and were countered by a neutral chairperson. Consensus was reached on a number of areas related to the conduct, interpretation, and reporting of mpMRI for the detection, localisation, and characterisation of prostate cancer. Before optimal dissemination of this technology, these outcomes will require formal validation in prospective trials. Copyright © 2010 European Association of Urology. Published by Elsevier B.V. All rights reserved.
Cao, Chuanwang; Wang, Zhiying; Niu, Changying; Desneux, Nicolas; Gao, Xiwu
2013-01-01
Phenol is a major pollutant in aquatic ecosystems due to its chemical stability, water solubility and environmental mobility. To date, little is known about the molecular modifications of invertebrates under phenol stress. In the present study, we used Solexa sequencing technology to investigate the transcriptome and differentially expressed genes (DEGs) of midges (Chironomus kiinensis) in response to phenol stress. A total of 51,518,972 and 51,150,832 clean reads in the phenol-treated and control libraries, respectively, were obtained and assembled into 51,014 non-redundant (Nr) consensus sequences. A total of 6,032 unigenes were classified by Gene Ontology (GO), and 18,366 unigenes were categorized into 238 Kyoto Encyclopedia of Genes and Genomes (KEGG) categories. These genes included representatives from almost all functional categories. A total of 10,724 differentially expressed genes (P value <0.05) were detected in a comparative analysis of the expression profiles between phenol-treated and control C. kiinensis including 8,390 upregulated and 2,334 downregulated genes. The expression levels of 20 differentially expressed genes were confirmed by real-time RT-PCR, and the trends in gene expression that were observed matched the Solexa expression profiles, although the magnitude of the variations was different. Through pathway enrichment analysis, significantly enriched pathways were identified for the DEGs, including metabolic pathways, aryl hydrocarbon receptor (AhR), pancreatic secretion and neuroactive ligand-receptor interaction pathways, which may be associated with the phenol responses of C. kiinensis. Using Solexa sequencing technology, we identified several groups of key candidate genes as well as important biological pathways involved in the molecular modifications of chironomids under phenol stress. PMID:23527048
DOE Office of Scientific and Technical Information (OSTI.GOV)
Van Coillie, E.; Fiten, P.; Van Damme, J.
1997-03-01
Monocyte chemotactic proteins (MCPs) form a subfamily of chemokines that recruit leukocytes to sites of inflammation and that may contribute to tumor-associated leukocyte infiltration and to the antiviral state against HIV infection. With the use of degenerate primers that were based on CC chemokine consensus sequences, the known MIP-1{alpha}/LD78{alpha}, MCP-1, and MCP-3 genes and the previously unidentified eotaxin and MCP-2 genes were isolated from a YAC contig from human chromosome 17q11.2. The amplified genomic MCP-2 fragment was used to isolate an MCP-2 cosmid from which the gene sequence was determined. The MCP-2 gene shares with the MCP-1 and MCP-3 genesmore » a conserved intron-exon structure and a coding nucleotide sequence homology of 77%. By Northern blot analysis the 1.0-kb MCP-2 mRNA was predominantly detectable in the small intestine, peripheral blood, heart, placenta, lung, skeletal muscle, ovary, colon, spinal cord, pancreas, and thymus. Transcripts of 1.5 and 2.4 kb were found in the testis, the small intestine, and the colon. The isolation of the MCP-2 gene from the chemokine contig localized it on YAC clones of chromosome 17q11.2, which also contain the eotaxin, MCP-1, MCP-3, and NCC-1/MCP-4 genes. The combination of using degenerate primer PCR and YACs illustrates that novel genes can efficiently be isolated from gene cluster contigs with less redundancy and effort than the isolation of novel ESTs. 42 refs., 5 figs., 2 tabs.« less
Böer, Erik; Bode, Rüdiger; Mock, Hans-Peter; Piontek, Michael; Kunze, Gotthard
2009-06-01
The tannase-encoding Arxula adeninivorans gene ATAN1 was isolated from genomic DNA by PCR, using as primers oligonucleotide sequences derived from peptides obtained after tryptic digestion of the purified tannase protein. The gene harbours an ORF of 1764 bp, encoding a 587-amino acid protein, preceded by an N-terminal secretion sequence comprising 28 residues. The deduced amino acid sequence was similar to those of tannases from Aspergillus oryzae (50% identity), A. niger (48%) and putative tannases from A. fumigatus (52%) and A. nidulans (50%). The sequence contains the consensus pentapeptide motif (-Gly-X-Ser-X-Gly-) which forms part of the catalytic centre of serine hydrolases. Expression of ATAN1 is regulated by the carbon source. Supplementation with tannic acid or gallic acid leads to induction of ATAN1, and accumulation of the native tannase enzyme in the medium. The enzymes recovered from both wild-type and recombinant strains were essentially indistinguishable. A molecular mass of approximately 320 kDa was determined, indicating that the native, glycosylated tannase consists of four identical subunits. The enzyme has a temperature optimum at 35-40 degrees C and a pH optimum at approximately 6.0. The enzyme is able to remove gallic acid from both condensed and hydrolysable tannins. The wild-type strain LS3 secreted amounts of tannase equivalent to 100 U/l under inducing conditions, while the transformant strain, which overexpresses the ATAN1 gene from the strong, constitutively active A. adeninivorans TEF1 promoter, produced levels of up to 400 U/l when grown in glucose medium in shake flasks. Copyright (c) 2009 John Wiley & Sons, Ltd.
Radulović, Željko; Porter, Lindsay M.; Kim, Tae K.; Mulenga, Albert
2015-01-01
Organic anion-transporting polypeptides (Oatps) are an integral part of the detoxification mechanism in vertebrates and invertebrates. These cell surface proteins are involved in mediating the sodium-independent uptake and/or distribution of a broad array of organic amphipathic compounds and xenobiotic drugs. This study describes bioinformatics and biological characterization of 9 Oatp sequences in the Ixodes scapularis genome. These sequences have been annotated on the basis of 12 transmembrane domains, consensus motif D-X-RW-(I,V)-GAWW-X-G-(F,L)-L, and 11 conserved cysteine amino acid residues in the large extracellular loop 5 that characterize the Oatp superfamily. Ixodes scapularis Oatps may regulate non-redundant cross-tick species conserved functions in that they did not cluster as a monolithic group on the phylogeny tree and that they have orthologs in other ticks. Phylogeny clustering patterns also suggest that some tick Oatp sequences transport substrates that are similar to those of body louse, mosquito, eye worm, and filarial worm Oatps. Semi-quantitative RT-PCR analysis demonstrated that all 9 I. scapularis Oatp sequences were expressed during tick feeding. Ixodes scapularis Oatp genes potentially regulate functions during early and/or late-stage tick feeding as revealed by normalized mRNA profiles. Normalized transcript abundance indicates that I. scapularis Oatp genes are strongly expressed in unfed ticks during the first 24 h of feeding and/or at the end of the tick feeding process. Except for 2 I. scapularis Oatps, which were expressed in the salivary glands and ovaries, all other genes were expressed in all tested organs, suggesting the significance of I. scapularis Oatps in maintaining tick homeostasis. Different I. scapularis Oatp mRNA expression patterns were detected and discussed with reference to different physiological states of unfed and feeding ticks. PMID:24582512
NASA Astrophysics Data System (ADS)
Rozi; Rahayu, K.; Daruti, D. N.
2018-04-01
The goal of this study was to detect of Aeromonas hydrophila carrying the hlyA gene in guramy by PCR assay. A total of 5 A. hydrophila strains were isolated from gouramy with different location and furthermore genotypic of all A. hydrophila strains havedetected by PCR assay for 16S rRNA gene. The primers used in the PCR targeted a 592-bp fragment of the hlyA gene coding for the hemolysin gene. Particularly hlyA genes are responsible for haemolysin toxins production in this genus. After gel electrophoresis, the amplicons from representative strains of the A. hydrophila were purified using extraction kit and were subjected to the DNA sequencing analysis. The results showed that: (i) the 592bp amplicon of the hlyA gene was detected in 5/6 of the A. hydrophila; (ii) the nucleotide blast results of hemolysin gene sequences of the strains of A. hydrophila revealed a high homology of 90-97 % with published sequences, and;(iii) the protein blast showed 95-98 % homology when compared to the published sequences. The PCR clearly identified the haemolysin-producing strains of A. hydrophila by detection in hlyA genes and may have application as a rapid species-specific virulence test.
Li, P; Jia, J W; Jiang, L X; Zhu, H; Bai, L; Wang, J B; Tang, X M; Pan, A H
2012-04-27
To ensure the implementation of genetically modified organism (GMO)-labeling regulations, an event-specific detection method was developed based on the junction sequence of an exogenous integrant in the transgenic carnation variety Moonlite. The 5'-transgene integration sequence was isolated by thermal asymmetric interlaced PCR. Based upon the 5'-transgene integration sequence, the event-specific primers and TaqMan probe were designed to amplify the fragments, which spanned the exogenous DNA and carnation genomic DNA. Qualitative and quantitative PCR assays were developed employing the designed primers and probe. The detection limit of the qualitative PCR assay was 0.05% for Moonlite in 100 ng total carnation genomic DNA, corresponding to about 79 copies of the carnation haploid genome; the limit of detection and quantification of the quantitative PCR assay were estimated to be 38 and 190 copies of haploid carnation genomic DNA, respectively. Carnation samples with different contents of genetically modified components were quantified and the bias between the observed and true values of three samples were lower than the acceptance criterion (<25%) of the GMO detection method. These results indicated that these event-specific methods would be useful for the identification and quantification of the GMO carnation Moonlite.
A filtering method to generate high quality short reads using illumina paired-end technology.
Eren, A Murat; Vineis, Joseph H; Morrison, Hilary G; Sogin, Mitchell L
2013-01-01
Consensus between independent reads improves the accuracy of genome and transcriptome analyses, however lack of consensus between very similar sequences in metagenomic studies can and often does represent natural variation of biological significance. The common use of machine-assigned quality scores on next generation platforms does not necessarily correlate with accuracy. Here, we describe using the overlap of paired-end, short sequence reads to identify error-prone reads in marker gene analyses and their contribution to spurious OTUs following clustering analysis using QIIME. Our approach can also reduce error in shotgun sequencing data generated from libraries with small, tightly constrained insert sizes. The open-source implementation of this algorithm in Python programming language with user instructions can be obtained from https://github.com/meren/illumina-utils.
2014-01-01
We present primary results from the Sequencing Quality Control (SEQC) project, coordinated by the United States Food and Drug Administration. Examining Illumina HiSeq, Life Technologies SOLiD and Roche 454 platforms at multiple laboratory sites using reference RNA samples with built-in controls, we assess RNA sequencing (RNA-seq) performance for junction discovery and differential expression profiling and compare it to microarray and quantitative PCR (qPCR) data using complementary metrics. At all sequencing depths, we discover unannotated exon-exon junctions, with >80% validated by qPCR. We find that measurements of relative expression are accurate and reproducible across sites and platforms if specific filters are used. In contrast, RNA-seq and microarrays do not provide accurate absolute measurements, and gene-specific biases are observed, for these and qPCR. Measurement performance depends on the platform and data analysis pipeline, and variation is large for transcript-level profiling. The complete SEQC data sets, comprising >100 billion reads (10Tb), provide unique resources for evaluating RNA-seq analyses for clinical and regulatory settings. PMID:25150838
Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M
2016-01-01
Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.
Rahimi, Pooneh; Tabatabaie, H; Gouya, Mohammad M; Mahmudi, M; Musavi, T; Rad, K Samimi; Azad, T Mokhtari; Nategh, R
2009-06-01
The 66 serotypes of human enteroviruses (EVs) are classified into four species A-D, based on phylogenetic relationships in multiple genome regions. Partial VP(1) amplification and sequence analysis are reliable methods for identifying non-polio enterovirus serotypes, especially in negative cell culture specimens from patients with residual paralysis. In Iran during the years 2000-2002, there were 29 residual paralysis cases with negative cell (RD, HEp(2) and L(20)B) culture results. The genomic RNA was extracted from stool specimens from cases of residual paralysis and detected by amplification of the 5'-nontranslated region using RT-PCR with Pan-EV primers. Partial VP(1) amplification by semi-nested RT-PCR (snRT-PCR) and sequence analysis were done. Specimens from the 29 culture-negative cases contained echoviruses of six different serotypes. The global eradication of wild polioviruses is near and study of non-polio enteroviruses, which can cause poliomyelitis, is increasingly important to understand their pathogenesis. The VP(1) sequences, derived from the snRT-PCR products, allowed rapid molecular analysis of these non-polio strains.
Pan, Pinliang; Tao, Xiaoxia; Zhang, Qi; Xing, Wenge; Sun, Xianguang; Pei, Lijian; Jiang, Yan
2007-12-01
To investigate the correlation between three viral load assays for circulating recombinant form (CRF)_BC. Recent studies in HIV-1 molecular epidemiology, reveals that CRF_BC is the dominant subtype of HIV-1 virus in mainland China, representing over 45% of the HIV-1 infected population. The performances of nucleic acid sequence-based amplification (NASBA), branched DNA (bDNA) and reverse transcriptase polymerase chain reaction (RT-PCR) were compared for the HIV-1 viral load detection and quantitation of CRF_BC in China. Sixteen HIV-1 positive and three HIV-1 negative samples were collected. Sequencing of the positive samples in the gp41 region was conducted. The HIV-1 viral load values were determined using bDNA, RT-PCR and NASBA assays. Deming regression analysis with SPSS 12.0 (SPS Inc., Chicago, Illinois, USA) was performed for data analysis. Sequencing and phylogenetic analysis of env gene (gp41) region of the 16 HIV-1 positive clinical specimens from Guizhou Province in southwest China revealed the dominance of the subtype CRF_BC in that region. A good correlation of their viral load values was observed among three assays. Pearson's correlation between RT-PCR and bDNA is 0.969, Lg(VL)RT-PCR = 0.969 * Lg(VL)bDNA + 0.55; Pearson's correlation between RT-PCR and NASBA is 0.968, Lg(VL)RT-PCR = 0.968 * Lg(VL)NASBA + 0.937; Pearson's correlation between NASBA and bDNA is 0.980, Lg(VL)NASBA = 0.980 * Lg(VL)bDNA - 0.318. When testing with 3 different assays, RT-PCR, bDNA and NASBA, the group of 16 HIV-1 positive samples showed the viral load value was highest for RT-PCR, followed by bDNA then NASBA, which is consistent with the former results in subtype B. The three viral load assays are highly correlative for CRF_BC in China.
Zhuge, Jian; Vail, Eric; Bush, Jeffrey L; Singelakis, Lauren; Huang, Weihua; Nolan, Sheila M; Haas, Janet P; Engel, Helen; Della Posta, Millicent; Yoon, Esther C; Fallon, John T; Wang, Guiqing
2015-06-01
An outbreak of severe respiratory illness associated with enterovirus D68 (EV-D68) infection was reported in mid-August 2014 in the United States. In this study, we evaluated the diagnostic utility of an EV-D68-specific real-time reverse transcription-PCR (rRT-PCR) that was recently developed by the Centers for Disease Control and Prevention in clinical samples. Nasopharyngeal (NP) swab specimens from patients in a recent outbreak of respiratory illness in the lower Hudson Valley, New York State, were collected and examined for the presence of human rhinovirus or enterovirus using the FilmArray Respiratory Panel (RP) assay. Samples positive by RP were assessed using EV-D68 rRT-PCR, and the data were compared to results from sequencing analysis of partial VP1 and 5' untranslated region (5'-UTR) sequences of the EV genome. A total of 285 RP-positive NP specimens (260 from the 2014 outbreak and 25 from 2013) were analyzed by rRT-PCR; EV-D68 was detected in 74 of 285 (26.0%) specimens examined. Data for comparisons between rRT-PCR and sequencing analysis were obtained from 194 NP specimens. EV-D68 detection was confirmed by sequencing analysis in 71 of 74 positive and in 1 of 120 randomly selected negative specimens by rRT-PCR. The EV-D68 rRT-PCR showed diagnostic sensitivity and specificity of 98.6% and 97.5%, respectively. Our data suggest that the EV-D68 rRT-PCR is a reliable assay for detection of EV-D68 in clinical samples and has a potential to be used as a tool for rapid diagnosis and outbreak investigation of EV-D68-associated infections in clinical and public health laboratories. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Zhuge, Jian; Vail, Eric; Bush, Jeffrey L.; Singelakis, Lauren; Huang, Weihua; Nolan, Sheila M.; Haas, Janet P.; Engel, Helen; Della Posta, Millicent; Yoon, Esther C.; Fallon, John T.
2015-01-01
An outbreak of severe respiratory illness associated with enterovirus D68 (EV-D68) infection was reported in mid-August 2014 in the United States. In this study, we evaluated the diagnostic utility of an EV-D68-specific real-time reverse transcription-PCR (rRT-PCR) that was recently developed by the Centers for Disease Control and Prevention in clinical samples. Nasopharyngeal (NP) swab specimens from patients in a recent outbreak of respiratory illness in the lower Hudson Valley, New York State, were collected and examined for the presence of human rhinovirus or enterovirus using the FilmArray Respiratory Panel (RP) assay. Samples positive by RP were assessed using EV-D68 rRT-PCR, and the data were compared to results from sequencing analysis of partial VP1 and 5′ untranslated region (5′-UTR) sequences of the EV genome. A total of 285 RP-positive NP specimens (260 from the 2014 outbreak and 25 from 2013) were analyzed by rRT-PCR; EV-D68 was detected in 74 of 285 (26.0%) specimens examined. Data for comparisons between rRT-PCR and sequencing analysis were obtained from 194 NP specimens. EV-D68 detection was confirmed by sequencing analysis in 71 of 74 positive and in 1 of 120 randomly selected negative specimens by rRT-PCR. The EV-D68 rRT-PCR showed diagnostic sensitivity and specificity of 98.6% and 97.5%, respectively. Our data suggest that the EV-D68 rRT-PCR is a reliable assay for detection of EV-D68 in clinical samples and has a potential to be used as a tool for rapid diagnosis and outbreak investigation of EV-D68-associated infections in clinical and public health laboratories. PMID:25854481
Margall, N; March, F; Español, M; Torras, X; Gallego, A; Coll, P
2015-10-01
Many studies have reported the use of the NS5B gene to subtype hepatitis C virus (HCV). Other HCV genes, such as HCV-5' UTR, Core (C) and E1, have also been used. In some studies, NS5B have been used together with 5'-UTR or C genes to improve genotyping results obtained using commercial procedures. Only two studies in Spain have compared molecular techniques versus commercial procedures regarding the efficacy of HCV subtyping. The aim of this study was to determine whether nested PCR and sequencing of a NS5B region was more reliable than commercial procedures to subtype HCV. We analyzed the results of HCV genotyping in [726] serum specimens collected from 2001 to 2013. From 2001 to 2011, we used PCR and INNO-LiPA hybridization or its new version Versant HCV Genotype 2.0 assay (471 samples). From 2012 to 2013, we used nested PCR and sequencing of a NS5B region (255 cases). This method used two pairs of primers to amplify the RNA of the sample converted to DNA by retrotranscription. The amplification product of 270 base pairs was further sequenced. To identify the subtype, the sequences obtained were compared to those in the international database: http://hcv.lanl.gov./content/sequence/, HCV/ToolsOutline.html and Geno2pheno[hcv] http://hcv.bioinf.mpi-inf.mpg.de/index.php. Nested PCR of a NS5B region and sequencing identified all but one subtype (0.4%, 1/255), differentiated all 1a subtypes from 1b subtypes, and characterized all HCV 2-4 subtypes. This approach also distinguished two subtypes, 2j and 2q, that had rarely been detected previously in Spain. However, commercial procedures failed to subtype 12.7% (60/471) of samples and to genotype 0.6% of specimens (3/471). Nested PCR and sequencing of a NS5B region improved the subtyping of HCV in comparison with classical procedures and identified two rare subtypes in Spain: 2j and 2q. However, full length genome sequencing is recommended to confirm HCV 2j and 2q subtypes. Copyright © 2015. Published by Elsevier B.V.
RUCS: rapid identification of PCR primers for unique core sequences.
Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik; Kaya, Hülya; Lund, Ole
2017-12-15
Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs for the targets in silico. Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin resistance gene. Three of the predicted pairs were chosen for experimental validation using PCR and gel electrophoresis. All three pairs successfully produced an amplicon with the target length for the samples containing mcr-1 and no amplification products were produced for the negative samples. The novel methods presented in this manuscript can reduce the time needed to identify target sequences, and provide a quick virtual PCR validation to eliminate time wasted on ambiguously binding primers. Source code is freely available on https://bitbucket.org/genomicepidemiology/rucs. Web service is freely available on https://cge.cbs.dtu.dk/services/RUCS. mcft@cbs.dtu.dk. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.
ATYPICAL CHLAMYDIACEAE IN WILD POPULATIONS OF HAWKS ( BUTEO SPP.) IN CALIFORNIA.
Luján-Vega, Charlene; Hawkins, Michelle G; Johnson, Christine K; Briggs, Christopher; Vennum, Chris; Bloom, Peter H; Hull, Joshua M; Cray, Carolyn; Pesti, Denise; Johnson, Lisa; Ciembor, Paula; Ritchie, Branson R
2018-03-01
Chlamydiaceae bacteria infect many vertebrate hosts, and previous reports based on polymerase chain reaction (PCR) assays and serologic assays that are prone to cross-reaction among chlamydial organisms have been used to describe the prevalence of either DNA fragments or antibodies to Chlamydia spp. in wild raptorial populations. This study reports the PCR-based prevalence of Chlamydiaceae DNA that does not 100% match any avian or mammalian Chlamydiaceae in wild populations of hawks in California Buteo species. In this study, multimucosal swab samples ( n = 291) for quantitative PCR (qPCR) and plasma ( n = 78) for serology were collected from wild hawks. All available plasma samples were negative for antibodies using a C. psittaci-specific elementary body agglutination test (EBA; n = 78). For IgY antibodies all 51 available samples were negative using the indirect immunofluorescent assay. The overall prevalence of Chlamydiaceae DNA detection in wild Buteo species sampled was 1.37% (4/291) via qPCR-based analysis. Two fledgling Swainson's hawks ( Buteo swainsoni) and two juvenile red-tailed hawks ( Buteo jamaicensis) were positive by qPCR-based assay for an atypical chlamydial sequence that did not 100% match any known C. psittaci genotype. Positive swab samples from these four birds were sequenced based on the ompA gene and compared by high-resolution melt analysis with all known avian and mammalian Chlamydiaceae. The amplicon sequence did not 100% match any known avian chlamydial sequence; however, it was most similar (98.6%) to C. psittaci M56, a genotype that is typically found in muskrats and hares. Culture and full genome sequence analysis of Chlamydia spp. isolated from diseased hawks will be necessary to classify this organism and to better understand its epizootiology and potential health impact on wild Buteo populations in California.
Atalay, Altay; Koc, Ayse Nedret; Suel, Ahmet; Sav, Hafize; Demir, Gonca; Elmali, Ferhan; Cakir, Nuri; Seyedmousavi, Seyedmojtaba
2016-09-01
Aspergillus species cause a wide range of diseases in humans, including allergies, localized infections, or fatal disseminated diseases. Rapid detection and identification of Aspergillus spp. facilitate effective patient management. In the current study we compared conventional morphological methods with PCR sequencing, rep-PCR, and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) for the identification of Aspergillus strains. A total of 24 consecutive clinical isolates of Aspergillus were collected during 2012-2014. Conventional morphology and rep-PCR were performed in our Mycology Laboratory. The identification, evaluation, and reporting of strains using MALDI-TOF-MS were performed by BioMérieux Diagnostic, Inc. in Istanbul. DNA sequence analysis of the clinical isolates was performed by the BMLabosis laboratory in Ankara. Samples consisted of 18 (75%) lower respiratory tract specimens, 3 otomycosis (12.5%) ear tissues, 1 sample from keratitis, and 1 sample from a cutaneous wound. According to DNA sequence analysis, 12 (50%) specimens were identified as A. fumigatus, 8 (33.3%) as A. flavus, 3 (12.5%) as A. niger, and 1 (4.2%) as A. terreus. Statistically, there was good agreement between the conventional morphology and rep-PCR and MALDI-TOF methods; kappa values were κ = 0.869, 0.871, and 0.916, respectively (P < 0.001). The good level of agreement between the methods included in the present study and sequence method could be due to the identification of Aspergillus strains that were commonly encountered. Therefore, it was concluded that studies conducted with a higher number of isolates, which include other Aspergillus strains, are required. © 2016 Wiley Periodicals, Inc.
USDA-ARS?s Scientific Manuscript database
The pathogen causing corky root on lettuce, Sphingobium suberifaciens, is recalcitrant to standard epidemiological methods. Primers were selected from 16S rDNA sequences useful for the specific detection and quantification of S. suberifaciens. Conventional (PCR) and quantitative (qPCR) PCR protocols...
Bernardes, Juliana; Zaverucha, Gerson; Vaquero, Catherine; Carbone, Alessandra
2016-01-01
Traditional protein annotation methods describe known domains with probabilistic models representing consensus among homologous domain sequences. However, when relevant signals become too weak to be identified by a global consensus, attempts for annotation fail. Here we address the fundamental question of domain identification for highly divergent proteins. By using high performance computing, we demonstrate that the limits of state-of-the-art annotation methods can be bypassed. We design a new strategy based on the observation that many structural and functional protein constraints are not globally conserved through all species but might be locally conserved in separate clades. We propose a novel exploitation of the large amount of data available: 1. for each known protein domain, several probabilistic clade-centered models are constructed from a large and differentiated panel of homologous sequences, 2. a decision-making protocol combines outcomes obtained from multiple models, 3. a multi-criteria optimization algorithm finds the most likely protein architecture. The method is evaluated for domain and architecture prediction over several datasets and statistical testing hypotheses. Its performance is compared against HMMScan and HHblits, two widely used search methods based on sequence-profile and profile-profile comparison. Due to their closeness to actual protein sequences, clade-centered models are shown to be more specific and functionally predictive than the broadly used consensus models. Based on them, we improved annotation of Plasmodium falciparum protein sequences on a scale not previously possible. We successfully predict at least one domain for 72% of P. falciparum proteins against 63% achieved previously, corresponding to 30% of improvement over the total number of Pfam domain predictions on the whole genome. The method is applicable to any genome and opens new avenues to tackle evolutionary questions such as the reconstruction of ancient domain duplications, the reconstruction of the history of protein architectures, and the estimation of protein domain age. Website and software: http://www.lcqb.upmc.fr/CLADE. PMID:27472895
AMS 4.0: consensus prediction of post-translational modifications in protein sequences.
Plewczynski, Dariusz; Basu, Subhadip; Saha, Indrajit
2012-08-01
We present here the 2011 update of the AutoMotif Service (AMS 4.0) that predicts the wide selection of 88 different types of the single amino acid post-translational modifications (PTM) in protein sequences. The selection of experimentally confirmed modifications is acquired from the latest UniProt and Phospho.ELM databases for training. The sequence vicinity of each modified residue is represented using amino acids physico-chemical features encoded using high quality indices (HQI) obtaining by automatic clustering of known indices extracted from AAindex database. For each type of the numerical representation, the method builds the ensemble of Multi-Layer Perceptron (MLP) pattern classifiers, each optimising different objectives during the training (for example the recall, precision or area under the ROC curve (AUC)). The consensus is built using brainstorming technology, which combines multi-objective instances of machine learning algorithm, and the data fusion of different training objects representations, in order to boost the overall prediction accuracy of conserved short sequence motifs. The performance of AMS 4.0 is compared with the accuracy of previous versions, which were constructed using single machine learning methods (artificial neural networks, support vector machine). Our software improves the average AUC score of the earlier version by close to 7 % as calculated on the test datasets of all 88 PTM types. Moreover, for the selected most-difficult sequence motifs types it is able to improve the prediction performance by almost 32 %, when compared with previously used single machine learning methods. Summarising, the brainstorming consensus meta-learning methodology on the average boosts the AUC score up to around 89 %, averaged over all 88 PTM types. Detailed results for single machine learning methods and the consensus methodology are also provided, together with the comparison to previously published methods and state-of-the-art software tools. The source code and precompiled binaries of brainstorming tool are available at http://code.google.com/p/automotifserver/ under Apache 2.0 licensing.
Kaur, Gurpreet; Chandra, Mudit; Dwivedi, P N; Sharma, N S
2015-01-01
The aim of this study was to isolate Canine parvovirus (CPV) from suspected dogs on madin darby canine kidney (MDCK) cell line and its confirmation by polymerase chain reaction (PCR) and nested PCR (NPCR). Further, VP2 gene of the CPV isolates was amplified and sequenced to determine prevailing antigenic type. A total of 60 rectal swabs were collected from dogs showing signs of gastroenteritis, processed and subjected to isolation in MDCK cell line. The samples showing cytopathic effects (CPE) were confirmed by PCR and NPCR. These samples were subjected to PCR for amplification of VP2 gene of CPV, sequenced and analyzed to study the prevailing antigenic types of CPV. Out of the 60 samples subjected to isolation in MDCK cell line five samples showed CPE in the form of rounding of cells, clumping of cells and finally detachment of the cells. When these samples and the two commercially available vaccines were subjected to PCR for amplification of VP2 gene, a 1710 bp product was amplified. The sequence analysis revealed that the vaccines belonged to the CPV-2 type and the samples were of CPV-2b type. It can be concluded from the present study that out of a total of 60 samples 5 samples exhibited CPE as observed in MDCK cell line. Sequence analysis of the VP2 gene among the samples and vaccine strains revealed that samples belonged to CPV-2b type and vaccines belonging to CPV-2.
Equine infectious anemia virus in naturally infected horses from the Brazilian Pantanal.
Cursino, Andreia Elisa; Vilela, Ana Paula Pessoa; Franco-Luiz, Ana Paula Moreira; de Oliveira, Jaquelline Germano; Nogueira, Márcia Furlan; Júnior, João Pessoa Araújo; de Aguiar, Daniel Moura; Kroon, Erna Geessien
2018-05-11
Equine infectious anemia (EIA) has a worldwide distribution, and is widespread in Brazil. The Brazilian Pantanal presents with high prevalence comprising equine performance and indirectly the livestock industry, since the horses are used for cattle management. Although EIA is routinely diagnosed by the agar gel immunodiffusion test (AGID), this serological assay has some limitations, so PCR-based detection methods have the potential to overcome these limitations and act as complementary tests to those currently used. Considering the limited number of equine infectious anemia virus (EIAV) sequences which are available in public databases and the great genome variability, studies of EIAV detection and characterization molecular remain important. In this study we detected EIAV proviral DNA from 23 peripheral blood mononuclear cell (PBMCs) samples of naturally infected horses from Brazilian Pantanal using a semi-nested-PCR (sn-PCR). The serological profile of the animals was also evaluated by AGID and ELISA for gp90 and p26. Furthermore, the EIAV PCR amplified DNA was sequenced and phylogenetically analyzed. Here we describe the first EIAV sequences of the 5' LTR of the tat gene in naturally infected horses from Brazil, which presented with 91% similarity to EIAV reference sequences. The Brazilian EIAV sequences also presented variable nucleotide similarities among themselves, ranging from 93,5% to 100%. Phylogenetic analysis showed that Brazilian EIAV sequences grouped in a separate clade relative to other reference sequences. Thus this molecular detection and characterization may provide information about EIAV circulation in Brazilian territories and improve phylogenetic inferences.
First detection of canine parvovirus type 2b from diarrheic dogs in Himachal Pradesh.
Sharma, Shalini; Dhar, Prasenjit; Thakur, Aneesh; Sharma, Vivek; Sharma, Mandeep
2016-09-01
The present study was conducted to detect the presence of canine parvovirus (CPV) among diarrheic dogs in Himachal Pradesh and to identify the most prevalent antigenic variant of CPV based on molecular typing and sequence analysis of VP2 gene. A total of 102 fecal samples were collected from clinical cases of diarrhea or hemorrhagic gastroenteritis from CPV vaccinated or non-vaccinated dogs. Samples were tested using CPV-specific polymerase chain reaction (PCR) targeting VP2 gene, multiplex PCR for detection of CPV-2a and CPV-2b antigenic variants, and a PCR for the detection of CPV-2c. CPV-2b isolate was cultured on Madin-Darby canine kidney (MDCK) cell lines and sequenced using VP2 structural protein gene. Multiple alignment and phylogenetic analysis was done using ClustalW and MEGA6 and inferred using the Neighbor-Joining method. No sample was found positive for the original CPV strain usually present in the vaccine. However, about 50% (52 out of 102) of the samples were found to be positive with CPV-2ab PCR assay that detects newer variants of CPV circulating in the field. In addition, multiplex PCR assay that identifies both CPV-2ab and CPV-2b revealed that CPV-2b was the major antigenic variant present in the affected dogs. A PCR positive isolate of CPV-2b was adapted to grow in MDCK cells and produced characteristic cytopathic effect after 5 th passage. Multiple sequence alignment of VP2 structural gene of CPV-2b isolate (Accession number HG004610) used in the study was found to be similar to other sequenced isolates in NCBI sequence database and showed 98-99% homology. This study reports the first detection of CPV-2b in dogs with hemorrhagic gastroenteritis in Himachal Pradesh and absence of other antigenic types of CPV. Further, CPV-specific PCR assay can be used for rapid confirmation of circulating virus strains under field conditions.
Hennebique, Aurélie; Bidart, Marie; Jarraud, Sophie; Beraud, Laëtitia; Schwebel, Carole; Maurin, Max; Boisset, Sandrine
2017-09-01
The emergence of fluoroquinolone (FQ)-resistant mutants of Legionella pneumophila in infected humans was previously reported using a next-generation DNA sequencing (NGS) approach. This finding could explain part of the therapeutic failures observed in legionellosis patients treated with these antibiotics. The aim of this study was to develop digital PCR (dPCR) assays allowing rapid and accurate detection and quantification of these resistant mutants in respiratory samples, especially when the proportion of mutants in a wild-type background is low. We designed three dPCRgyrA assays to detect and differentiate the wild-type and one of the three gyrA mutations previously described as associated with FQ resistance in L. pneumophila : at positions 248C→T (T83I), 259G→A (D87N), and 259G→C (D87H). To assess the performance of these assays, mixtures of FQ-resistant and -susceptible strains of L. pneumophila were analyzed, and the results were compared with those obtained with Sanger DNA sequencing and real-time quantitative PCR (qPCR) technologies. The dPCRgyrA assays were able to detect mutated gyrA sequences in the presence of wild-type sequences at up to 1:1,000 resistant/susceptible allele ratios. By comparison, Sanger DNA sequencing and qPCR were less sensitive, allowing the detection of gyrA mutants at up to 1:1 and 1:10 ratios, respectively. When testing 38 respiratory samples from 23 legionellosis patients (69.6% treated with an FQ), dPCRgyrA detected small amounts of gyrA mutants in four (10.5%) samples from three (13.0%) patients. These results demonstrate that dPCR is a highly sensitive alternative to quantify FQ resistance in L. pneumophila , and it could be used in clinical practice to detect patients that could be at higher risk of therapeutic failure. Copyright © 2017 American Society for Microbiology.
Taverniers, Isabel; Van Bockstaele, Erik; De Loose, Marc
2004-03-01
Analytical real-time PCR technology is a powerful tool for implementation of the GMO labeling regulations enforced in the EU. The quality of analytical measurement data obtained by quantitative real-time PCR depends on the correct use of calibrator and reference materials (RMs). For GMO methods of analysis, the choice of appropriate RMs is currently under debate. So far, genomic DNA solutions from certified reference materials (CRMs) are most often used as calibrators for GMO quantification by means of real-time PCR. However, due to some intrinsic features of these CRMs, errors may be expected in the estimations of DNA sequence quantities. In this paper, two new real-time PCR methods are presented for Roundup Ready soybean, in which two types of plasmid DNA fragments are used as calibrators. Single-target plasmids (STPs) diluted in a background of genomic DNA were used in the first method. Multiple-target plasmids (MTPs) containing both sequences in one molecule were used as calibrators for the second method. Both methods simultaneously detect a promoter 35S sequence as GMO-specific target and a lectin gene sequence as endogenous reference target in a duplex PCR. For the estimation of relative GMO percentages both "delta C(T)" and "standard curve" approaches are tested. Delta C(T) methods are based on direct comparison of measured C(T) values of both the GMO-specific target and the endogenous target. Standard curve methods measure absolute amounts of target copies or haploid genome equivalents. A duplex delta C(T) method with STP calibrators performed at least as well as a similar method with genomic DNA calibrators from commercial CRMs. Besides this, high quality results were obtained with a standard curve method using MTP calibrators. This paper demonstrates that plasmid DNA molecules containing either one or multiple target sequences form perfect alternative calibrators for GMO quantification and are especially suitable for duplex PCR reactions.
2011-01-01
Background Big sagebrush (Artemisia tridentata) is one of the most widely distributed and ecologically important shrub species in western North America. This species serves as a critical habitat and food resource for many animals and invertebrates. Habitat loss due to a combination of disturbances followed by establishment of invasive plant species is a serious threat to big sagebrush ecosystem sustainability. Lack of genomic data has limited our understanding of the evolutionary history and ecological adaptation in this species. Here, we report on the sequencing of expressed sequence tags (ESTs) and detection of single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers in subspecies of big sagebrush. Results cDNA of A. tridentata sspp. tridentata and vaseyana were normalized and sequenced using the 454 GS FLX Titanium pyrosequencing technology. Assembly of the reads resulted in 20,357 contig consensus sequences in ssp. tridentata and 20,250 contigs in ssp. vaseyana. A BLASTx search against the non-redundant (NR) protein database using 29,541 consensus sequences obtained from a combined assembly resulted in 21,436 sequences with significant blast alignments (≤ 1e-15). A total of 20,952 SNPs and 119 polymorphic SSRs were detected between the two subspecies. SNPs were validated through various methods including sequence capture. Validation of SNPs in different individuals uncovered a high level of nucleotide variation in EST sequences. EST sequences of a third, tetraploid subspecies (ssp. wyomingensis) obtained by Illumina sequencing were mapped to the consensus sequences of the combined 454 EST assembly. Approximately one-third of the SNPs between sspp. tridentata and vaseyana identified in the combined assembly were also polymorphic within the two geographically distant ssp. wyomingensis samples. Conclusion We have produced a large EST dataset for Artemisia tridentata, which contains a large sample of the big sagebrush leaf transcriptome. SNP mapping among the three subspecies suggest the origin of ssp. wyomingensis via mixed ancestry. A large number of SNP and SSR markers provide the foundation for future research to address questions in big sagebrush evolution, ecological genetics, and conservation using genomic approaches. PMID:21767398
2009-01-01
Background Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. Methods We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. Results RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully generating primers for strong homologous sequences. Conclusion The improvements for primer design incorporated into RExPrimer were demonstrated to be effective in designing primers for challenging PCR experiments. Integration of SNP and structural variation databases allows for robust primer design for a variety of PCR applications, irrespective of the sequence complexity in the region of interest. This software is freely available at http://www4a.biotec.or.th/rexprimer. PMID:19958502
Nouri, Shahideh; Salem, Nidà; Falk, Bryce W
2016-07-21
We present here the complete nucleotide sequence and genome organization of a novel putative RNA virus identified in field populations of the Asian citrus psyllid, Diaphorina citri, through sequencing of the transcriptome followed by reverse transcription-PCR (RT-PCR). We tentatively named this virus Diaphorina citri-associated C virus (DcACV). DcACV is an unclassified positive-sense RNA virus. Copyright © 2016 Nouri et al.
Chimeric 16S rRNA sequence formation and detection in Sanger and 454-pyrosequenced PCR amplicons
Haas, Brian J.; Gevers, Dirk; Earl, Ashlee M.; Feldgarden, Mike; Ward, Doyle V.; Giannoukos, Georgia; Ciulla, Dawn; Tabbaa, Diana; Highlander, Sarah K.; Sodergren, Erica; Methé, Barbara; DeSantis, Todd Z.; Petrosino, Joseph F.; Knight, Rob; Birren, Bruce W.
2011-01-01
Bacterial diversity among environmental samples is commonly assessed with PCR-amplified 16S rRNA gene (16S) sequences. Perceived diversity, however, can be influenced by sample preparation, primer selection, and formation of chimeric 16S amplification products. Chimeras are hybrid products between multiple parent sequences that can be falsely interpreted as novel organisms, thus inflating apparent diversity. We developed a new chimera detection tool called Chimera Slayer (CS). CS detects chimeras with greater sensitivity than previous methods, performs well on short sequences such as those produced by the 454 Life Sciences (Roche) Genome Sequencer, and can scale to large data sets. By benchmarking CS performance against sequences derived from a controlled DNA mixture of known organisms and a simulated chimera set, we provide insights into the factors that affect chimera formation such as sequence abundance, the extent of similarity between 16S genes, and PCR conditions. Chimeras were found to reproducibly form among independent amplifications and contributed to false perceptions of sample diversity and the false identification of novel taxa, with less-abundant species exhibiting chimera rates exceeding 70%. Shotgun metagenomic sequences of our mock community appear to be devoid of 16S chimeras, supporting a role for shotgun metagenomics in validating novel organisms discovered in targeted sequence surveys. PMID:21212162
Specific Primers for Rapid Detection of Microsporum audouinii by PCR in Clinical Samples▿
Roque, H. D.; Vieira, R.; Rato, S.; Luz-Martins, M.
2006-01-01
This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis. PMID:17005755
Specific primers for rapid detection of Microsporum audouinii by PCR in clinical samples.
Roque, H D; Vieira, R; Rato, S; Luz-Martins, M
2006-12-01
This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis.
Uribe-Convers, Simon; Duke, Justin R.; Moore, Michael J.; Tank, David C.
2014-01-01
• Premise of the study: We present an alternative approach for molecular systematic studies that combines long PCR and next-generation sequencing. Our approach can be used to generate templates from any DNA source for next-generation sequencing. Here we test our approach by amplifying complete chloroplast genomes, and we present a set of 58 potentially universal primers for angiosperms to do so. Additionally, this approach is likely to be particularly useful for nuclear and mitochondrial regions. • Methods and Results: Chloroplast genomes of 30 species across angiosperms were amplified to test our approach. Amplification success varied depending on whether PCR conditions were optimized for a given taxon. To further test our approach, some amplicons were sequenced on an Illumina HiSeq 2000. • Conclusions: Although here we tested this approach by sequencing plastomes, long PCR amplicons could be generated using DNA from any genome, expanding the possibilities of this approach for molecular systematic studies. PMID:25202592
Flanking sequence determination and specific PCR identification of transgenic wheat B102-1-2.
Cao, Jijuan; Xu, Junyi; Zhao, Tongtong; Cao, Dongmei; Huang, Xin; Zhang, Piqiao; Luan, Fengxia
2014-01-01
The exogenous fragment sequence and flanking sequence between the exogenous fragment and recombinant chromosome of transgenic wheat B102-1-2 were successfully acquired using genome walking technology. The newly acquired exogenous fragment encoded the full-length sequence of transformed genes with transformed plasmid and corresponding functional genes including ubi, vector pBANF-bar, vector pUbiGUSPlus, vector HSP, reporter vector pUbiGUSPlus, promoter ubiquitin, and coli DH1. A specific polymerase chain reaction (PCR) identification method for transgenic wheat B102-1-2 was established on the basis of designed primers according to flanking sequence. This established specific PCR strategy was validated by using transgenic wheat, transgenic corn, transgenic soybean, transgenic rice, and non-transgenic wheat. A specifically amplified target band was observed only in transgenic wheat B102-1-2. Therefore, this method is characterized by high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of transgenic wheat B102-1-2.
Renesme, L
2017-12-01
To describe the epidemiology of neonatal herpes and its risk factors, clinical and paraclinic manifestations, propose guidelines for a newborn at risk of neonatal herpes, describe treatment modalities, describe post-natal transmission and its prevention. Bibliographic search from Medline, Cochrane Library databases and research of international clinical practice guidelines. Neonatal herpes is rare (about 20 cases per year in France) and mainly due to HSV 1 (level of evidence LE3). The main risk factors for mother-to-child transmission are maternal primary episode of genital herpes close to delivery and serotype HSV 1 (LE3). There are three clinical forms of neonatal herpes : SEM infection for skin, eyes and mucosa, central nervous system (CNS) associated infection, and the disseminated infection. Neurological mortality and morbidity depend on the clinical form and the HSV serotype (LE3). In most of the case of neonatal herpes, the mothers have no history of genital herpes (LE3). Fever and vesicular rash may be absent at the time of diagnosis (LE3). In case of suspicion of neonatal herpes, different samples (blood and cerebrospinal fluid) for HSV PCR must be carried out to confirm the diagnosis (Professional consensus). Any newborn suspected of neonatal herpes should be treated with intravenous aciclovir (Grade A) prior to the results of HSV PCR (Professional consensus). In case of maternal genital herpes at delivery, the management of an asymptomatic newborn depends on the evaluation of the risk of transmission. In case of maternal reactivation (low risk of transmission), HSV PCR samples are taken at 24hours of life and the newborn must be follow closely until results. In the case of maternal primary episode or non-primary infection first episode (high risk of transmission), the samples are taken at 24hours of life and intravenous treatment with aciclovir is started (Professional consensus). The treatment of neonatal herpes is based on intravenous aciclovir (60mg/kg/day divided into 3 injections) (Grade C). The duration of the treatment depends on the clinical form (14 days for the SEM infection, 21 days for the other forms) (Professional consensus). A relay with aciclovir per os (300mg/m 2 /day) for 6 months is recommended to improve the neurological outcome and reduce the risk of reactivation (grade B). Post-natal transmission is mainly due to HSV 1. The rules for the prevention of post-natal transmission must be known by parents and family, but also by nursing staff (Professional consensus). Breastfeeding is not contraindicated in cases of maternal herpes, except if there is herpetic lesion on the nipple (Professional consensus). Parents of newborns at risk for neonatal herpes should receive information on the clinical signs to be monitored at home after hospital discharge (Professional consensus). Neonatal herpes is a rare disease with a high morbidity and mortality. The management of a newborn at risk requires good coordination between the obstetric and pediatric teams and parent's information. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Sénat, Marie-Victoire; Anselem, Olivia; Picone, Olivier; Renesme, Laurent; Sananès, Nicolas; Vauloup-Fellous, Christelle; Sellier, Yann; Laplace, Jean-Pierre; Sentilhes, Loïc
2018-05-01
Identify measures to diagnose, prevent, and treat genital herpes infection during pregnancy and childbirth as well as neonatal herpes infection. Bibliographic search from the Medline and Cochrane Library databases and review of international clinical practice guidelines. Genital herpes lesions are most often due to HSV-2 (LE2). The risk of HSV seroconversion during pregnancy is 1-5% (LE2). Genital herpes lesions during pregnancy in a woman with a history of genital herpes is a recurrence. In this situation, there is no need for virologic confirmation (Grade B). In pregnant women with genital lesions who report they have not previously had genital herpes, virological confirmation by PCR and identifying the specific IgG type is necessary (professional consensus). A first episode of genital herpes during pregnancy should be treated with aciclovir (200 mg 5 times daily) or valaciclovir (1000 mg twice daily) for 5-10 days (Grade C), and recurrent herpes during pregnancy with aciclovir (200 mg 5 times daily) or valaciclovir (500 mg twice daily) (Grade C). The risk of neonatal herpes is estimated at between 25% and 44% if a non primary and primary first genital herpes episode is ongoing at delivery (LE2) and 1% for a recurrence (LE3). Antiviral prophylaxis should be offered to women with either a first or recurrent episode of genital herpes during pregnancy from 36 weeks of gestation until delivery (Grade B). Routine prophylaxis is not recommended for women with a history of genital herpes but no recurrence during pregnancy (professional consensus). A cesarean delivery is recommended if a first episode of genital herpes is suspected (or confirmed) at the onset of labor (Grade B) or if it occured less than 6 weeks before delivery (professional consensus) or in the event of premature rupture of the membranes at term. When a recurrence of genital herpes is underway at the onset of labor, cesarean delivery is most likely to be considered when the membranes are intact and vaginal delivery in cases of prolonged rupture of membranes (professional consensus). Neonatal herpes is rare and mainly due to HSV-1 (LE3). In most cases of neonatal herpes, mothers have no history of genital herpes (LE3). When neonatal herpes is suspected, various samples (blood and cerebrospinal fluid) for HSV PCR must be taken to confirm the diagnosis (professional consensus). Any newborn with suspected neonatal herpes should be treated with intravenous acyclovir (20 mg/kg 3 times daily) (grade A) before the PCR results are available (professional consensus). The duration of the treatment depends on the clinical form (professional consensus) CONCLUSION: There is no formal evidence that it is possible to reduce the risk of neonatal herpes in genital herpes during pregnancy. However, appropriate care can reduce the symptoms associated with herpes and the risk of recurrence at term, as well as cesarean rate because of herpes lesions. Copyright © 2018. Published by Elsevier B.V.
Type-Specific Detection of 30 Oncogenic Human Papillomaviruses by Genotyping both E6 and L1 Genes
Peng, Junping; Gao, Lei; Guo, Junhua; Wang, Ting; Wang, Ling; Yao, Qing; Zhu, Haijun
2013-01-01
Human papillomavirus (HPV) is the principal cause of invasive cervical cancer and benign genital lesions. There are currently 30 HPV types linked to cervical cancer. HPV infection also leads to other types of cancer. We developed a 61-plex analysis of these 30 HPV types by examining two genes, E6 and L1, using MassARRAY matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) (PCR-MS). Two hundred samples from homosexual males (HM) were screened by PCR-MS and MY09/MY11 primer set-mediated PCR (MY-PCR) followed by sequencing. One hundred thirty-five formalin-fixed, paraffin-embedded (FFPE) cervical cancer samples were also analyzed by PCR-MS, and results were compared to those of the commercially available GenoArray (GA) assay. One or more HPV types were identified in 64.5% (129/200) of the samples from HM. Comprising all 30 HPV types, PCR-MS detected 51.9% (67/129) of samples with multiple HPV types, whereas MY-PCR detected only one single HPV type in these samples. All PCR-MS results were confirmed by MY-PCR. In the cervical cancer samples, PCR-MS and GA detected 97% (131/135) and 90.4% (122/135) of HPV-positive samples, respectively. PCR-MS and GA results were fully concordant for 122 positive and 4 negative samples. The sequencing results for the 9 samples that tested negative by GA were completely concordant with the positive PCR-MS results. Multiple HPV types were identified in 25.2% (34/135) and 55.6% (75/135) of the cervical cancer samples by GA and PCR-MS, respectively, and results were confirmed by sequencing. The new assay allows the genotyping of >1,000 samples per day. It provides a good alternative to current methods, especially for large-scale investigations of multiple HPV infections and degraded FFPE samples. PMID:23152557
Wang, R F; Cao, W W; Cerniglia, C E
1996-01-01
In order to develop a PCR method to detect Fusobacterium prausnitzii in human feces and to clarify the phylogenetic position of this species, its 16S rRNA gene sequence was determined. The sequence described in this paper is different from the 16S rRNA gene sequence is specific for F. prausnitzii, and the results of this assay confirmed that F. prausnitzii is the most common species in human feces. However, a PCR assay based on the original GenBank sequence was negative when it was performed with two strains of F. prausnitzii obtained from the American Type Culture Collection. A phylogenetic tree based on the new 16S rRNA gene sequence was constructed. On this tree F. prausnitzii was not a member of the Fusobacterium group but was closer to some Eubacterium spp. and located between Clostridium "clusters III and IV" (M.D. Collins, P.A. Lawson, A. Willems, J.J. Cordoba, J. Fernandez-Garayzabal, P. Garcia, J. Cai, H. Hippe, and J.A.E. Farrow, Int. J. Syst. Bacteriol. 44:812-826, 1994).
Hyder, S M; Stancel, G M; Nawaz, Z; McDonnell, D P; Loose-Mitchell, D S
1992-09-05
We have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyltransferase, linked to regions of mouse c-fos, to identify a specific estrogen response element (ERE) in this protooncogene. This element is located in the untranslated 3'-flanking region of the c-fos gene, 5 kilobases (kb) downstream from the c-fos promoter and 1.5 kb downstream of the poly(A) signal. This element confers estrogen responsiveness to chloramphenicol acetyltransferase reporters linked to both the herpes simplex virus thymidine kinase promoter and the homologous c-fos promoter. Deletion analysis localized the response element to a 200-base pair fragment which contains the element GGTCACCACAGCC that resembles the consensus ERE sequence GGTCACAGTGACC originally identified in Xenopus vitellogenin A2 gene. A synthetic 36-base pair oligodeoxynucleotide containing this c-fos sequence conferred estrogen inducibility to the thymidine kinase promoter. The corresponding sequence also induced reporter activity when present in the c-fos gene fragment 3 kb from the thymidine kinase promoter. Gel-shift experiments demonstrated that synthetic oligonucleotides containing either the consensus ERE or the c-fos element bind human estrogen receptor obtained from a yeast expression system. However, the mobility of the shifted band is faster for the fos-ERE-complex than the consensus ERE complex suggesting that the three-dimensional structure of the protein-DNA complexes is different or that other factors are differentially involved in the two reactions. When the 5'-GGTCA sequence present in the c-fos ERE is mutated to 5'-TTTCA, transcriptional activation and receptor binding activities are both lost. Mutation of the CAGCC-3' element corresponding to the second half-site of the c-fos sequence also led to the loss of receptor binding activity, suggesting that both half-sites of this element are involved in this function. The estrogen induction mediated by either the c-fos or the consensus ERE was blunted by the antiestrogen tamoxifen. Based on these studies, we believe the 3'-fos ERE sequence we have identified may be a major cis-acting element involved in the physiological regulation of the gene by estrogens in vivo.
Hussing, C; Bytyci, R; Huber, C; Morling, N; Børsting, C
2018-05-24
Some STR loci have internal sequence variations, which are not revealed by the standard STR typing methods used in forensic genetics (PCR and fragment length analysis by capillary electrophoresis (CE)). Typing of STRs with next-generation sequencing (NGS) uncovers the sequence variation in the repeat region and in the flanking regions. In this study, 363 Danish individuals were typed for 56 STRs (26 autosomal STRs, 24 Y-STRs, and 6 X-STRs) using the ForenSeq™ DNA Signature Prep Kit to establish a Danish STR sequence database. Increased allelic diversity was observed in 34 STRs by the PCR-NGS assay. The largest increases were found in DYS389II and D12S391, where the numbers of sequenced alleles were around four times larger than the numbers of alleles determined by repeat length alone. Thirteen SNPs and one InDel were identified in the flanking regions of 12 STRs. Furthermore, 36 single positions and five longer stretches in the STR flanking regions were found to have dubious genotyping quality. The combined match probability of the 26 autosomal STRs was 10,000 times larger using the PCR-NGS assay than by using PCR-CE. The typical paternity indices for trios and duos were 500 and 100 times larger, respectively, than those obtained with PCR-CE. The assay also amplified 94 SNPs selected for human identification. Eleven of these loci were not in Hardy-Weinberg equilibrium in the Danish population, most likely because the minimum threshold for allele calling (30 reads) in the ForenSeq™ Universal Analysis Software was too low and frequent allele dropouts were not detected.
Nemati, Sara; Fazaeli, Asghar; Hajjaran, Homa; Khamesipour, Ali; Anbaran, Mohsen Falahati; Bozorgomid, Arezoo; Zarei, Fatah
2017-08-01
Despite the broad distribution of leishmaniasis among Iranians and animals across the country, little is known about the genetic characteristics of the causative agents. Applying both HSP70 PCR-RFLP and sequence analyses, this study aimed to evaluate the genetic diversity and phylogenetic relationships among Leishmania spp. isolated from Iranian endemic foci and available reference strains. A total of 36 Leishmania isolates from almost all districts across the country were genetically analyzed for the HSP70 gene using both PCR-RFLP and sequence analysis. The original HSP70 gene sequences were aligned along with homologous Leishmania sequences retrieved from NCBI, and subjected to the phylogenetic analysis. Basic parameters of genetic diversity were also estimated. The HSP70 PCR-RFLP presented 3 different electrophoretic patterns, with no further intraspecific variation, corresponding to 3 Leishmania species available in the country, L. tropica, L. major, and L. infantum. Phylogenetic analyses presented 5 major clades, corresponding to 5 species complexes. Iranian lineages, including L. major, L. tropica, and L. infantum, were distributed among 3 complexes L. major, L. tropica, and L. donovani. However, within the L. major and L. donovani species complexes, the HSP70 phylogeny was not able to distinguish clearly between the L. major and L. turanica isolates, and between the L. infantum, L. donovani, and L. chagasi isolates, respectively. Our results indicated that both HSP70 PCR-RFLP and sequence analyses are medically applicable tools for identification of Leishmania species in Iranian patients. However, the reduced genetic diversity of the target gene makes it inevitable that its phylogeny only resolves the major groups, namely, the species complexes.
Viau, Roberto A; Hujer, Andrea M; Marshall, Steven H; Perez, Federico; Hujer, Kristine M; Briceño, David F; Dul, Michael; Jacobs, Michael R; Grossberg, Richard; Toltzis, Philip; Bonomo, Robert A
2012-05-01
Klebsiella pneumoniae isolates harboring the K. pneumoniae carbapenemase gene (bla(KPC)) are creating a significant healthcare threat in both acute and long-term care facilities (LTCFs). As part of a study conducted in 2004 to determine the risk of stool colonization with extended-spectrum cephalosporin-resistant gram-negative bacteria, 12 isolates of K. pneumoniae that exhibited nonsusceptibility to extended-spectrum cephalosporins were detected. All were gastrointestinal carriage isolates that were not associated with infection. Reassessment of the carbapenem minimum inhibitory concentrations using revised 2011 Clinical Laboratory Standards Institute breakpoints uncovered carbapenem resistance. To further investigate, a DNA microarray assay, PCR-sequencing of bla genes, immunoblotting, repetitive-sequence-based PCR (rep-PCR) and multilocus sequence typing (MLST) were performed. The DNA microarray detected bla(KPC) in all 12 isolates, and bla(KPC-3) was identified by PCR amplification and sequencing of the amplicon. In addition, a bla(SHV-11) gene was detected in all isolates. Immunoblotting revealed "low-level" production of the K. pneumoniae carbapenemase, and rep-PCR indicated that all bla(KPC-3)-positive K. pneumoniae strains were genetically related (≥98% similar). According to MLST, all isolates belonged to sequence type 36. This sequence type has not been previously linked with bla(KPC) carriage. Plasmids from 3 representative isolates readily transferred the bla(KPC-3) to Escherichia coli J-53 recipients. Our findings reveal the "silent" dissemination of bla(KPC-3) as part of Tn4401b on a mobile plasmid in Northeast Ohio nearly a decade ago and establish the first report, to our knowledge, of K. pneumoniae containing bla(KPC-3) in an LTCF caring for neurologically impaired children and young adults.
[Detection of gene mutation in glucose-6-phosphate dehydrogenase deficiency by RT-PCR sequencing].
Lyu, Rong-Yu; Chen, Xiao-Wen; Zhang, Min; Chen, Yun-Sheng; Yu, Jie; Wen, Fei-Qiu
2016-07-01
Since glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common hereditary hemolytic erythrocyte enzyme deficiency, most cases have single nucleotide mutations in the coding region, and current test methods for gene mutation have some missed detections, this study aimed to investigate the feasibility of RT-PCR sequencing in the detection of gene mutation in G6PD deficiency. According to the G6PD/6GPD ratio, 195 children with anemia of unknown cause or who underwent physical examination between August 2013 and July 2014 were classified into G6PD-deficiency group with 130 children (G6PD/6GPD ratio <1.00) and control group with 65 children (G6PD/6GPD ratio≥1.00). The primer design and PCR amplification conditions were optimized, and RT-PCR sequencing was used to analyze the complete coding sequence and verify the genomic DNA sequence in the two groups. In the G6PD-deficiency group, the detection rate of gene mutation was 100% and 13 missense mutations were detected, including one new mutation. In the control group, no missense mutation was detected in 28 boys; 13 heterozygous missense mutations, 1 homozygous same-sense mutation (C1191T) which had not been reported in China and abroad, and 14 single nucleotide polymorphisms of C1311T were detected in 37 girls. The control group showed a high rate of missed detection of G6PD deficiency (carriers) in the specimens from girls (35%, 13/37). RT-PCR sequencing has a high detection rate of G6PD gene mutation and a certain value in clinical diagnosis of G6PD deficiency.
Nakamura, Kosuke; Kondo, Kazunari; Akiyama, Hiroshi; Ishigaki, Takumi; Noguchi, Akio; Katsumata, Hiroshi; Takasaki, Kazuto; Futo, Satoshi; Sakata, Kozue; Fukuda, Nozomi; Mano, Junichi; Kitta, Kazumi; Tanaka, Hidenori; Akashi, Ryo; Nishimaki-Mogami, Tomoko
2016-08-15
Identification of transgenic sequences in an unknown genetically modified (GM) papaya (Carica papaya L.) by whole genome sequence analysis was demonstrated. Whole genome sequence data were generated for a GM-positive fresh papaya fruit commodity detected in monitoring using real-time polymerase chain reaction (PCR). The sequences obtained were mapped against an open database for papaya genome sequence. Transgenic construct- and event-specific sequences were identified as a GM papaya developed to resist infection from a Papaya ringspot virus. Based on the transgenic sequences, a specific real-time PCR detection method for GM papaya applicable to various food commodities was developed. Whole genome sequence analysis enabled identifying unknown transgenic construct- and event-specific sequences in GM papaya and development of a reliable method for detecting them in papaya food commodities. Copyright © 2016 Elsevier Ltd. All rights reserved.
Deep Sequencing to Identify the Causes of Viral Encephalitis
Chan, Benjamin K.; Wilson, Theodore; Fischer, Kael F.; Kriesel, John D.
2014-01-01
Deep sequencing allows for a rapid, accurate characterization of microbial DNA and RNA sequences in many types of samples. Deep sequencing (also called next generation sequencing or NGS) is being developed to assist with the diagnosis of a wide variety of infectious diseases. In this study, seven frozen brain samples from deceased subjects with recent encephalitis were investigated. RNA from each sample was extracted, randomly reverse transcribed and sequenced. The sequence analysis was performed in a blinded fashion and confirmed with pathogen-specific PCR. This analysis successfully identified measles virus sequences in two brain samples and herpes simplex virus type-1 sequences in three brain samples. No pathogen was identified in the other two brain specimens. These results were concordant with pathogen-specific PCR and partially concordant with prior neuropathological examinations, demonstrating that deep sequencing can accurately identify viral infections in frozen brain tissue. PMID:24699691
Bokulich, Nicholas A.
2013-01-01
Ultra-high-throughput sequencing (HTS) of fungal communities has been restricted by short read lengths and primer amplification bias, slowing the adoption of newer sequencing technologies to fungal community profiling. To address these issues, we evaluated the performance of several common internal transcribed spacer (ITS) primers and designed a novel primer set and work flow for simultaneous quantification and species-level interrogation of fungal consortia. Primer comparison and validation were predicted in silico and by sequencing a “mock community” of mixed yeast species to explore the challenges of amplicon length and amplification bias for reconstructing defined yeast community structures. The amplicon size and distribution of this primer set are smaller than for all preexisting ITS primer sets, maximizing sequencing coverage of hypervariable ITS domains by very-short-amplicon, high-throughput sequencing platforms. This feature also enables the optional integration of quantitative PCR (qPCR) directly into the HTS preparatory work flow by substituting qPCR with these primers for standard PCR, yielding quantification of individual community members. The complete work flow described here, utilizing any of the qualified primer sets evaluated, can rapidly profile mixed fungal communities and capably reconstructed well-characterized beer and wine fermentation fungal communities. PMID:23377949
Sequences of Zika Virus Genomes from a Pediatric Cohort in Nicaragua.
Oldfield, Lauren M; Fedorova, Nadia; Puri, Vinita; Shrivastava, Susmita; Amedeo, Paolo; Durbin, Alan; Rocchi, Iara; Williams, Torrey; Shabman, Reed S; Tan, Gene S; Balmaseda, Angel; Kuan, Guillermina; Saborio, Saira; Gordon, Aubree; Harris, Eva; Pickett, Brett E
2018-06-14
We report here the whole-genome sequence of 11 Zika virus (ZIKV) samples from six pediatric patients in Nicaragua. Serum samples were collected, and ZIKV was isolated in tissue culture. Both serum and virus isolates were sequenced. The consensus ZIKV genomes are greater than 99% identical to each other. Copyright © 2018 Oldfield et al.
Liang, Chanjuan; van Dijk, Jeroen P; Scholtens, Ingrid M J; Staats, Martijn; Prins, Theo W; Voorhuijzen, Marleen M; da Silva, Andrea M; Arisi, Ana Carolina Maisonnave; den Dunnen, Johan T; Kok, Esther J
2014-04-01
The growing number of biotech crops with novel genetic elements increasingly complicates the detection of genetically modified organisms (GMOs) in food and feed samples using conventional screening methods. Unauthorized GMOs (UGMOs) in food and feed are currently identified through combining GMO element screening with sequencing the DNA flanking these elements. In this study, a specific and sensitive qPCR assay was developed for vip3A element detection based on the vip3Aa20 coding sequences of the recently marketed MIR162 maize and COT102 cotton. Furthermore, SiteFinding-PCR in combination with Sanger, Illumina or Pacific BioSciences (PacBio) sequencing was performed targeting the flanking DNA of the vip3Aa20 element in MIR162. De novo assembly and Basic Local Alignment Search Tool searches were used to mimic UGMO identification. PacBio data resulted in relatively long contigs in the upstream (1,326 nucleotides (nt); 95 % identity) and downstream (1,135 nt; 92 % identity) regions, whereas Illumina data resulted in two smaller contigs of 858 and 1,038 nt with higher sequence identity (>99 % identity). Both approaches outperformed Sanger sequencing, underlining the potential for next-generation sequencing in UGMO identification.
PMS2 gene mutational analysis: direct cDNA sequencing to circumvent pseudogene interference.
Wimmer, Katharina; Wernstedt, Annekatrin
2014-01-01
The presence of highly homologous pseudocopies can compromise the mutation analysis of a gene of interest. In particular, when using PCR-based strategies, pseudogene co-amplification has to be effectively prevented. This is often achieved by using primers designed to be parental gene specific according to the reference sequence and by applying stringent PCR conditions. However, there are cases in which this approach is of limited utility. For example, it has been shown that the PMS2 gene exchanges sequences with one of its pseudogenes, named PMS2CL. This results in functional PMS2 alleles containing pseudogene-derived sequences at their 3'-end and in nonfunctional PMS2CL pseudogene alleles that contain gene-derived sequences. Hence, the paralogues cannot be distinguished according to the reference sequence. This shortcoming can be effectively circumvented by using direct cDNA sequencing. This approach is based on the selective amplification of PMS2 transcripts in two overlapping 1.6-kb RT-PCR products. In addition to avoiding pseudogene co-amplification and allele dropout, this method has also the advantage that it allows to effectively identify deletions, splice mutations, and de novo retrotransposon insertions that escape the detection of most DNA-based mutation analysis protocols.
Identification of tissue-embedded ascarid larvae by ribosomal DNA sequencing.
Ishiwata, Kenji; Shinohara, Akio; Yagi, Kinpei; Horii, Yoichiro; Tsuchiya, Kimiyuki; Nawa, Yukifumi
2004-01-01
Polymerase chain reaction (PCR) was applied to identify tissue-embedded ascarid nematode larvae. Two sequences of the internal transcribed spacer (ITS) regions of ribosomal DNA (rDNA), ITS1 and ITS2, of the ascarid parasites were amplified and compared with those of ascarid-nematodes registered in a DNA database (GenBank). The ITS sequences of the PCR products obtained from the ascarid parasite specimen in our laboratory were compatible with those of registered adult Ascaris and Toxocara parasites. PCR amplification of the ITS regions was sensitive enough to detect a single larva of Ascaris suum mixed with porcine liver tissue. Using this method, ascarid larvae embedded in the liver of a naturally infected turkey were identified as Toxocara canis. These results suggest that even a single larva embedded in tissues from patients with larva migrans could be identified by sequencing the ITS regions.
Cao, Youfang; Wang, Lianjie; Xu, Kexue; Kou, Chunhai; Zhang, Yulei; Wei, Guifang; He, Junjian; Wang, Yunfang; Zhao, Liping
2005-07-26
A new algorithm for assessing similarity between primer and template has been developed based on the hypothesis that annealing of primer to template is an information transfer process. Primer sequence is converted to a vector of the full potential hydrogen numbers (3 for G or C, 2 for A or T), while template sequence is converted to a vector of the actual hydrogen bond numbers formed after primer annealing. The former is considered as source information and the latter destination information. An information coefficient is calculated as a measure for fidelity of this information transfer process and thus a measure of similarity between primer and potential annealing site on template. Successful prediction of PCR products from whole genomic sequences with a computer program based on the algorithm demonstrated the potential of this new algorithm in areas like in silico PCR and gene finding.
The Spleen Is an HIV-1 Sanctuary During Combined Antiretroviral Therapy.
Nolan, David J; Rose, Rebecca; Rodriguez, Patricia H; Salemi, Marco; Singer, Elyse J; Lamers, Susanna L; McGrath, Michael S
2018-01-01
Combined antiretroviral therapy (cART) does not eradicate HIV, which persists for years and can re-establish replication if treatment is stopped. The current challenge is identifying those tissues harboring virus through cART. Here, we used HIV env-nef single genome sequencing and HIV gag droplet digital PCR (ddPCR) to survey 50 tissues from five subjects on cART with no detectable plasma viral load at death. The spleen most consistently contained multiple proviral and expressed sequences (4/5 participants). Spleen-derived HIV demonstrated two distinct phylogenetic patterns: multiple identical sequences, often from different tissues, as well as diverse viral sequences on long terminal branches. Our results suggested that ddPCR may overestimate the size of the tissue-based viral reservoir. The spleen, a lymphatic organ at the intersection of the immune and circulatory systems, may play a key role in viral persistence.
Rapid and Easy Protocol for Quantification of Next-Generation Sequencing Libraries.
Hawkins, Steve F C; Guest, Paul C
2018-01-01
The emergence of next-generation sequencing (NGS) over the last 10 years has increased the efficiency of DNA sequencing in terms of speed, ease, and price. However, the exact quantification of a NGS library is crucial in order to obtain good data on sequencing platforms developed by the current market leader Illumina. Different approaches for DNA quantification are available currently and the most commonly used are based on analysis of the physical properties of the DNA through spectrophotometric or fluorometric methods. Although these methods are technically simple, they do not allow exact quantification as can be achieved using a real-time quantitative PCR (qPCR) approach. A qPCR protocol for DNA quantification with applications in NGS library preparation studies is presented here. This can be applied in various fields of study such as medical disorders resulting from nutritional programming disturbances.
RNA circularization reveals terminal sequence heterogeneity in a double-stranded RNA virus.
Widmer, G
1993-03-01
Double-stranded RNA viruses (dsRNA), termed LRV1, have been found in several strains of the protozoan parasite Leishmania. With the aim of constructing a full-length cDNA copy of the viral genome, including its terminal sequences, a protocol based on PCR amplification across the 3'-5' junction of circularized RNA was developed. This method proved to be applicable to dsRNA. It provided a relatively simple alternative to one-sided PCR, without loss of specificity inherent in the use of generic primers. LRV1 terminal nucleotide sequences obtained by this method showed a considerable variation in length, particularly at the 5' end of the positive strand, as well as the potential for forming 3' overhangs. The opposite genomic end terminates in 0, 1, or 2 TCA trinucleotide repeats. These results are compared with terminal sequences derived from one-sided PCR experiments.
Nie, Hui; Evans, Alison A.; London, W. Thomas; Block, Timothy M.; Ren, Xiangdong David
2011-01-01
Hepatitis B virus (HBV) carrying the A1762T/G1764A double mutation in the basal core promoter (BCP) region is associated with HBe antigen seroconversion and increased risk of liver cirrhosis and hepatocellular carcinoma (HCC). Quantification of the mutant viruses may help in predicting the risk of HCC. However, the viral genome tends to have nucleotide polymorphism, which makes it difficult to design hybridization-based assays including real-time PCR. Ultrasensitive quantification of the mutant viruses at the early developmental stage is even more challenging, as the mutant is masked by excessive amounts of the wild-type (WT) viruses. In this study, we developed a selective inhibitory PCR (siPCR) using a locked nucleic acid-based PCR blocker to selectively inhibit the amplification of the WT viral DNA but not the mutant DNA. At the end of siPCR, the proportion of the mutant could be increased by about 10,000-fold, making the mutant more readily detectable by downstream applications such as real-time PCR and DNA sequencing. We also describe a primer-probe partial overlap approach which significantly simplified the melting curve patterns and minimized the influence of viral genome polymorphism on assay accuracy. Analysis of 62 patient samples showed a complete match of the melting curve patterns with the sequencing results. More than 97% of HBV BCP sequences in the GenBank database can be correctly identified by the melting curve analysis. The combination of siPCR and the SimpleProbe real-time PCR enabled mutant quantification in the presence of a 100,000-fold excess of the WT DNA. PMID:21562108
Regulation of the alpha-glucuronidase-encoding gene ( aguA) from Aspergillus niger.
de Vries, R P; van de Vondervoort, P J I; Hendriks, L; van de Belt, M; Visser, J
2002-09-01
The alpha-glucuronidase gene aguA from Aspergillus niger was cloned and characterised. Analysis of the promoter region of aguA revealed the presence of four putative binding sites for the major carbon catabolite repressor protein CREA and one putative binding site for the transcriptional activator XLNR. In addition, a sequence motif was detected which differed only in the last nucleotide from the XLNR consensus site. A construct in which part of the aguA coding region was deleted still resulted in production of a stable mRNA upon transformation of A. niger. The putative XLNR binding sites and two of the putative CREA binding sites were mutated individually in this construct and the effects on expression were examined in A. niger transformants. Northern analysis of the transformants revealed that the consensus XLNR site is not actually functional in the aguA promoter, whereas the sequence that diverges from the consensus at a single position is functional. This indicates that XLNR is also able to bind to the sequence GGCTAG, and the XLNR binding site consensus should therefore be changed to GGCTAR. Both CREA sites are functional, indicating that CREA has a strong influence on aguA expression. A detailed expression analysis of aguA in four genetic backgrounds revealed a second regulatory system involved in activation of aguA gene expression. This system responds to the presence of glucuronic and galacturonic acids, and is not dependent on XLNR.
Yuryev, A.; Corden, J. L.
1996-01-01
The largest subunit of RNA polymerase II contains a repetitive C-terminal domain (CTD) consisting of tandem repeats of the consensus sequence Tyr(1)Ser(2)Pro(3)Thr(4) Ser(5)Pro(6) Ser(7). Substitution of nonphosphorylatable amino acids at positions two or five of the Saccharomyces cerevisiae CTD is lethal. We developed a selection ssytem for isolating suppressors of this lethal phenotype and cloned a gene, SCA1 (suppressor of CTD alanine), which complements recessive suppressors of lethal multiple-substitution mutations. A partial deletion of SCA1 (sca1Δ::hisG) suppresses alanine or glutamate substitutions at position two of the consensus CTD sequence, and a lethal CTD truncation mutation, but SCA1 deletion does not suppress alanine or glutamate substitutions at position five. SCA1 is identical to SRB9, a suppressor of a cold-sensitive CTD truncation mutation. Strains carrying dominant SRB mutations have the same suppression properties as a sca1Δ::hisG strain. These results reveal a functional difference between positions two and five of the consensus CTD heptapeptide repeat. The ability of SCA1 and SRB mutant alleles to suppress CTD truncation mutations suggest that substitutions at position two, but not at position five, cause a defect in RNA polymerase II function similar to that introduced by CTD truncation. PMID:8725217
Food Fish Identification from DNA Extraction through Sequence Analysis
ERIC Educational Resources Information Center
Hallen-Adams, Heather E.
2015-01-01
This experiment exposed 3rd and 4th y undergraduates and graduate students taking a course in advanced food analysis to DNA extraction, polymerase chain reaction (PCR), and DNA sequence analysis. Students provided their own fish sample, purchased from local grocery stores, and the class as a whole extracted DNA, which was then subjected to PCR,…
Molecular cloning of IGλ rearrangements using long-distance inverse PCR (LDI-PCR).
Shimanuki, Masaya; Sonoki, Takashi; Hosoi, Hiroki; Watanuki, Jyuri; Murata, Shogo; Kawakami, Keiki; Matsuoka, Hiroshi; Hanaoka, Nobuyoshi; Nakakuma, Hideki
2013-01-01
Malignant cells of mature B-cell origin show tumor-specific clonal immunoglobulin gene (IG) rearrangements, including V(D)J recombinations, nucleotide mutations, or translocations. Rapid molecular cloning of the breakpoint sequence by long-distance inverse PCR (LDI-PCR) has so far been applied to rearrangements targeted to IGH joining, IGH switch, and IGκ regions. We tended to apply LDI-PCR method for cloning of IGλ rearrangements. To identify which IGλ isotype segment was rearranged, we performed Southern blot analysis using isotype-specific probes. We set inverse primers on the telomeric side of each joining region and amplified rearranged bands detected by Southern blot analysis as corresponding PCR products. All germline IGλ segments were successfully amplified as expected PCR products. We determined breakpoint sequences of five chromosome translocations involving IGλ locus: three novel t(8;22)(q24;q11), one known t(3;22)(q27;q11), and one partially known t(11;22)(q13;q11). Two of the three t(8;22)(q24;q11) were involved in Jλ with a recombination signal sequence and one of three in the first exon of IGLL5, which lies upstream of Jλ1. Three 8q24 breakpoints were widespread at 132, 260 and 366 kb downstream of MYC locus. The t(3;22)(q27;q11) showed a juxtaposition of Jλ2 and the first intron of BCL6, as previously reported. In t(11;22)(q13;q11), 3'UTR of cyclin D1 fused to the constant region of λ7 with nucleotide mutations. We also amplified four Vλ/Jλ recombination sequences. Our method is a useful tool for molecular analysis of genetic events in IGλ. © 2012 John Wiley & Sons A/S.
Borsu, Laetitia; Intrieri, Julie; Thampi, Linta; Yu, Helena; Riely, Gregory; Nafa, Khedoudja; Chandramohan, Raghu; Ladanyi, Marc; Arcila, Maria E
2016-11-01
Although next-generation sequencing (NGS) is a robust technology for comprehensive assessment of EGFR-mutant lung adenocarcinomas with acquired resistance to tyrosine kinase inhibitors, it may not provide sufficiently rapid and sensitive detection of the EGFR T790M mutation, the most clinically relevant resistance biomarker. Here, we describe a digital PCR (dPCR) assay for rapid T790M detection on aliquots of NGS libraries prepared for comprehensive profiling, fully maximizing broad genomic analysis on limited samples. Tumor DNAs from patients with EGFR-mutant lung adenocarcinomas and acquired resistance to epidermal growth factor receptor inhibitors were prepared for Memorial Sloan-Kettering-Integrated Mutation Profiling of Actionable Cancer Targets sequencing, a hybrid capture-based assay interrogating 410 cancer-related genes. Precapture library aliquots were used for rapid EGFR T790M testing by dPCR, and results were compared with NGS and locked nucleic acid-PCR Sanger sequencing (reference high sensitivity method). Seventy resistance samples showed 99% concordance with the reference high sensitivity method in accuracy studies. Input as low as 2.5 ng provided a sensitivity of 1% and improved further with increasing DNA input. dPCR on libraries required less DNA and showed better performance than direct genomic DNA. dPCR on NGS libraries is a robust and rapid approach to EGFR T790M testing, allowing most economical utilization of limited material for comprehensive assessment. The same assay can also be performed directly on any limited DNA source and cell-free DNA. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
Trung, Le Quang; VAN Puyvelde, Karolien; Triest, Ludwig
2008-03-01
Consensus primers, based on exon sequences of the cyp73 gene family coding for cinnamate 4-hydroxylase (C4H) of the lignin biosynthesis pathway, were designed for the tetraploid willow species Salix alba and Salix fragilis. Diagnostic alleles at species level were observed among introns of three cyp73 genes and allowed unambiguous detection of the first generation and introgressed hybrids in populations. Progeny analysis of a female S. alba with a male introgressed hybrid confirmed the codominant inheritance of each intron. Sequences of the diagnostic alleles of both species were similar to those found in the hybrids. © 2007 The Authors.
2013-01-01
Background Cucumber is an important vegetable crop that is susceptible to many pathogens, but no disease resistance (R) genes have been cloned. The availability of whole genome sequences provides an excellent opportunity for systematic identification and characterization of the nucleotide binding and leucine-rich repeat (NB-LRR) type R gene homolog (RGH) sequences in the genome. Cucumber has a very narrow genetic base making it difficult to construct high-density genetic maps. Development of a consensus map by synthesizing information from multiple segregating populations is a method of choice to increase marker density. As such, the objectives of the present study were to identify and characterize NB-LRR type RGHs, and to develop a high-density, integrated cucumber genetic-physical map anchored with RGH loci. Results From the Gy14 draft genome, 70 NB-containing RGHs were identified and characterized. Most RGHs were in clusters with uneven distribution across seven chromosomes. In silico analysis indicated that all 70 RGHs had EST support for gene expression. Phylogenetic analysis classified 58 RGHs into two clades: CNL and TNL. Comparative analysis revealed high-degree sequence homology and synteny in chromosomal locations of these RGH members between the cucumber and melon genomes. Fifty-four molecular markers were developed to delimit 67 of the 70 RGHs, which were integrated into a genetic map through linkage analysis. A 1,681-locus cucumber consensus map including 10 gene loci and spanning 730.0 cM in seven linkage groups was developed by integrating three component maps with a bin-mapping strategy. Physically, 308 scaffolds with 193.2 Mbp total DNA sequences were anchored onto this consensus map that covered 52.6% of the 367 Mbp cucumber genome. Conclusions Cucumber contains relatively few NB-LRR RGHs that are clustered and unevenly distributed in the genome. All RGHs seem to be transcribed and shared significant sequence homology and synteny with the melon genome suggesting conservation of these RGHs in the Cucumis lineage. The 1,681-locus consensus genetic-physical map developed and the RGHs identified and characterized herein are valuable genomics resources that may have many applications such as quantitative trait loci identification, map-based gene cloning, association mapping, marker-assisted selection, as well as assembly of a more complete cucumber genome. PMID:23531125