Sample records for conserved actinobacteria-specific protein

  1. Structural and Phylogenetic Analysis of a Conserved Actinobacteria-Specific Protein (ASP1; SCO1997) from Streptomyces Coelicolor

    SciTech Connect

    Gao, B.; Sugiman-Marangos, S; Junop, M; Gupta, R


    The Actinobacteria phylum represents one of the largest and most diverse groups of bacteria, encompassing many important and well-characterized organisms including Streptomyces, Bifidobacterium, Corynebacterium and Mycobacterium. Members of this phylum are remarkably diverse in terms of life cycle, morphology, physiology and ecology. Recent comparative genomic analysis of 19 actinobacterial species determined that only 5 genes of unknown function uniquely define this large phylum [1]. The cellular functions of these actinobacteria-specific proteins (ASP) are not known.

  2. Evolutionarily Conserved Herpesviral Protein Interaction Networks

    PubMed Central

    Fossum, Even; Friedel, Caroline C.; Rajagopala, Seesandra V.; Titz, Björn; Baiker, Armin; Schmidt, Tina; Kraus, Theo; Stellberger, Thorsten; Rutenberg, Christiane; Suthram, Silpa; Bandyopadhyay, Sourav; Rose, Dietlind; von Brunn, Albrecht; Uhlmann, Mareike; Zeretzke, Christine; Dong, Yu-An; Boulet, Hélène; Koegl, Manfred; Bailer, Susanne M.; Koszinowski, Ulrich; Ideker, Trey; Uetz, Peter; Zimmer, Ralf; Haas, Jürgen


    Herpesviruses constitute a family of large DNA viruses widely spread in vertebrates and causing a variety of different diseases. They possess dsDNA genomes ranging from 120 to 240 kbp encoding between 70 to 170 open reading frames. We previously reported the protein interaction networks of two herpesviruses, varicella-zoster virus (VZV) and Kaposi's sarcoma-associated herpesvirus (KSHV). In this study, we systematically tested three additional herpesvirus species, herpes simplex virus 1 (HSV-1), murine cytomegalovirus and Epstein-Barr virus, for protein interactions in order to be able to perform a comparative analysis of all three herpesvirus subfamilies. We identified 735 interactions by genome-wide yeast-two-hybrid screens (Y2H), and, together with the interactomes of VZV and KSHV, included a total of 1,007 intraviral protein interactions in the analysis. Whereas a large number of interactions have not been reported previously, we were able to identify a core set of highly conserved protein interactions, like the interaction between HSV-1 UL33 with the nuclear egress proteins UL31/UL34. Interactions were conserved between orthologous proteins despite generally low sequence similarity, suggesting that function may be more conserved than sequence. By combining interactomes of different species we were able to systematically address the low coverage of the Y2H system and to extract biologically relevant interactions which were not evident from single species. PMID:19730696

  3. Evolutionary Conserved Positions Define Protein Conformational Diversity.


    Saldaño, Tadeo E; Monzon, Alexander M; Parisi, Gustavo; Fernandez-Alberti, Sebastian


    Conformational diversity of the native state plays a central role in modulating protein function. The selection paradigm sustains that different ligands shift the conformational equilibrium through their binding to highest-affinity conformers. Intramolecular vibrational dynamics associated to each conformation should guarantee conformational transitions, which due to its importance, could possibly be associated with evolutionary conserved traits. Normal mode analysis, based on a coarse-grained model of the protein, can provide the required information to explore these features. Herein, we present a novel procedure to identify key positions sustaining the conformational diversity associated to ligand binding. The method is applied to an adequate refined dataset of 188 paired protein structures in their bound and unbound forms. Firstly, normal modes most involved in the conformational change are selected according to their corresponding overlap with structural distortions introduced by ligand binding. The subspace defined by these modes is used to analyze the effect of simulated point mutations on preserving the conformational diversity of the protein. We find a negative correlation between the effects of mutations on these normal mode subspaces associated to ligand-binding and position-specific evolutionary conservations obtained from multiple sequence-structure alignments. Positions whose mutations are found to alter the most these subspaces are defined as key positions, that is, dynamically important residues that mediate the ligand-binding conformational change. These positions are shown to be evolutionary conserved, mostly buried aliphatic residues localized in regular structural regions of the protein like β-sheets and α-helix. PMID:27008419

  4. Evolutionary Conserved Positions Define Protein Conformational Diversity

    PubMed Central

    Saldaño, Tadeo E.; Monzon, Alexander M.; Parisi, Gustavo; Fernandez-Alberti, Sebastian


    Conformational diversity of the native state plays a central role in modulating protein function. The selection paradigm sustains that different ligands shift the conformational equilibrium through their binding to highest-affinity conformers. Intramolecular vibrational dynamics associated to each conformation should guarantee conformational transitions, which due to its importance, could possibly be associated with evolutionary conserved traits. Normal mode analysis, based on a coarse-grained model of the protein, can provide the required information to explore these features. Herein, we present a novel procedure to identify key positions sustaining the conformational diversity associated to ligand binding. The method is applied to an adequate refined dataset of 188 paired protein structures in their bound and unbound forms. Firstly, normal modes most involved in the conformational change are selected according to their corresponding overlap with structural distortions introduced by ligand binding. The subspace defined by these modes is used to analyze the effect of simulated point mutations on preserving the conformational diversity of the protein. We find a negative correlation between the effects of mutations on these normal mode subspaces associated to ligand-binding and position-specific evolutionary conservations obtained from multiple sequence-structure alignments. Positions whose mutations are found to alter the most these subspaces are defined as key positions, that is, dynamically important residues that mediate the ligand-binding conformational change. These positions are shown to be evolutionary conserved, mostly buried aliphatic residues localized in regular structural regions of the protein like β-sheets and α-helix. PMID:27008419

  5. [Conserved motifs in voltage sensing proteins].


    Wang, Chang-He; Xie, Zhen-Li; Lv, Jian-Wei; Yu, Zhi-Dan; Shao, Shu-Li


    This paper was aimed to study conserved motifs of voltage sensing proteins (VSPs) and establish a voltage sensing model. All VSPs were collected from the Uniprot database using a comprehensive keyword search followed by manual curation, and the results indicated that there are only two types of known VSPs, voltage gated ion channels and voltage dependent phosphatases. All the VSPs have a common domain of four helical transmembrane segments (TMS, S1-S4), which constitute the voltage sensing module of the VSPs. The S1 segment was shown to be responsible for membrane targeting and insertion of these proteins, while S2-S4 segments, which can sense membrane potential, for protein properties. Conserved motifs/residues and their functional significance of each TMS were identified using profile-to-profile sequence alignments. Conserved motifs in these four segments are strikingly similar for all VSPs, especially, the conserved motif [RK]-X(2)-R-X(2)-R-X(2)-[RK] was presented in all the S4 segments, with positively charged arginine (R) alternating with two hydrophobic or uncharged residues. Movement of these arginines across the membrane electric field is the core mechanism by which the VSPs detect changes in membrane potential. The negatively charged aspartate (D) in the S3 segment is universally conserved in all the VSPs, suggesting that the aspartate residue may be involved in voltage sensing properties of VSPs as well as the electrostatic interactions with the positively charged residues in the S4 segment, which may enhance the thermodynamic stability of the S4 segments in plasma membrane. PMID:22907298

  6. Dual-targeted proteins tend to be more evolutionarily conserved.


    Kisslov, Irit; Naamati, Adi; Shakarchy, Nitzan; Pines, Ophry


    In eukaryotic cells, identical proteins can be located in more than a single subcellular compartment, a phenomenon termed dual targeting. We hypothesized that dual-targeted proteins should be more evolutionary conserved than exclusive mitochondrial proteins, due to separate selective pressures administered by the different compartments to maintain the functions associated with the protein sequences. We employed codon usage bias, propensity for gene loss, phylogenetic relationships, conservation analysis at the DNA level, and gene expression, to test our hypothesis. Our findings indicate that, indeed, dual-targeted proteins are significantly more conserved than their exclusively targeted counterparts. We then used this trait of gene conservation, together with previously identified traits of dual-targeted proteins (such as protein net charge and mitochondrial targeting sequence strength) to 1) create, for the first time (due to addition of conservation parameters), a tool for the prediction of dual-targeted mitochondrial proteins based on protein and mRNA sequences, and 2) show that molecular mechanisms involving one versus two translation products are not correlated with specific dual-targeting parameters. Finally, we discuss what evolutionary pressure maintains protein dual targeting in eukaryotes and deduce, as we initially hypothesized, that it is the discrete functions of these proteins in the different subcellular compartments, regardless of their dual-targeting mechanism. PMID:25063438

  7. Conservation and diversification of Msx protein in metazoan evolution.


    Takahashi, Hirokazu; Kamiya, Akiko; Ishiguro, Akira; Suzuki, Atsushi C; Saitou, Naruya; Toyoda, Atsushi; Aruga, Jun


    Msx (/msh) family genes encode homeodomain (HD) proteins that control ontogeny in many animal species. We compared the structures of Msx genes from a wide range of Metazoa (Porifera, Cnidaria, Nematoda, Arthropoda, Tardigrada, Platyhelminthes, Mollusca, Brachiopoda, Annelida, Echiura, Echinodermata, Hemichordata, and Chordata) to gain an understanding of the role of these genes in phylogeny. Exon-intron boundary analysis suggested that the position of the intron located N-terminally to the HDs was widely conserved in all the genes examined, including those of cnidarians. Amino acid (aa) sequence comparison revealed 3 new evolutionarily conserved domains, as well as very strong conservation of the HDs. Two of the three domains were associated with Groucho-like protein binding in both a vertebrate and a cnidarian Msx homolog, suggesting that the interaction between Groucho-like proteins and Msx proteins was established in eumetazoan ancestors. Pairwise comparison among the collected HDs and their C-flanking aa sequences revealed that the degree of sequence conservation varied depending on the animal taxa from which the sequences were derived. Highly conserved Msx genes were identified in the Vertebrata, Cephalochordata, Hemichordata, Echinodermata, Mollusca, Brachiopoda, and Anthozoa. The wide distribution of the conserved sequences in the animal phylogenetic tree suggested that metazoan ancestors had already acquired a set of conserved domains of the current Msx family genes. Interestingly, although strongly conserved sequences were recovered from the Vertebrata, Cephalochordata, and Anthozoa, the sequences from the Urochordata and Hydrozoa showed weak conservation. Because the Vertebrata-Cephalochordata-Urochordata and Anthozoa-Hydrozoa represent sister groups in the Chordata and Cnidaria, respectively, Msx sequence diversification may have occurred differentially in the course of evolution. We speculate that selective loss of the conserved domains in Msx family

  8. CDD: a Conserved Domain Database for protein classification.


    Marchler-Bauer, Aron; Anderson, John B; Cherukuri, Praveen F; DeWeese-Scott, Carol; Geer, Lewis Y; Gwadz, Marc; He, Siqian; Hurwitz, David I; Jackson, John D; Ke, Zhaoxi; Lanczycki, Christopher J; Liebert, Cynthia A; Liu, Chunlei; Lu, Fu; Marchler, Gabriele H; Mullokandov, Mikhail; Shoemaker, Benjamin A; Simonyan, Vahan; Song, James S; Thiessen, Paul A; Yamashita, Roxanne A; Yin, Jodie J; Zhang, Dachuan; Bryant, Stephen H


    The Conserved Domain Database (CDD) is the protein classification component of NCBI's Entrez query and retrieval system. CDD is linked to other Entrez databases such as Proteins, Taxonomy and PubMed, and can be accessed at CD-Search, which is available at, is a fast, interactive tool to identify conserved domains in new protein sequences. CD-Search results for protein sequences in Entrez are pre-computed to provide links between proteins and domain models, and computational annotation visible upon request. Protein-protein queries submitted to NCBI's BLAST search service at are scanned for the presence of conserved domains by default. While CDD started out as essentially a mirror of publicly available domain alignment collections, such as SMART, Pfam and COG, we have continued an effort to update, and in some cases replace these models with domain hierarchies curated at the NCBI. Here, we report on the progress of the curation effort and associated improvements in the functionality of the CDD information retrieval system. PMID:15608175

  9. Deep Conservation of Human Protein Tandem Repeats within the Eukaryotes

    PubMed Central

    Schaper, Elke; Gascuel, Olivier; Anisimova, Maria


    Tandem repeats (TRs) are a major element of protein sequences in all domains of life. They are particularly abundant in mammals, where by conservative estimates one in three proteins contain a TR. High generation-scale duplication and deletion rates were reported for nucleic TR units. However, it is not known whether protein TR units can also be frequently lost or gained providing a source of variation for rapid adaptation of protein function, or alternatively, tend to have conserved TR unit configurations over long evolutionary times. To obtain a systematic picture, we performed a proteome-wide analysis of the mode of evolution for human protein TRs. For this purpose, we propose a novel method for the detection of orthologous TRs based on circular profile hidden Markov models. For all detected TRs, we reconstructed bispecies TR unit phylogenies across 61 eukaryotes ranging from human to yeast. Moreover, we performed additional analyses to correlate functional and structural annotations of human TRs with their mode of evolution. Surprisingly, we find that the vast majority of human TRs are ancient, with TR unit number and order preserved intact since distant speciation events. For example, ≥61% of all human TRs have been strongly conserved at least since the root of all mammals, approximately 300 Ma. Further, we find no human protein TR that shows evidence for strong recent duplications and deletions. The results are in contrast to the high generation-scale mutability of nucleic TRs. Presumably, most protein TRs fold into stable and conserved structures that are indispensable for the function of the TR-containing protein. All of our data and results are available for download from PMID:24497029

  10. Short Communication Molecular conservation of the mammalian leptin protein.


    Gabriel, J E; Lidani, K C F


    In this study, we comparatively assessed multiple sequences of the leptin protein from different animal species to establish new insights into conservation degree of biological sequences and evolutionary biology among mammals using computational biology tools. First, amino acid sequences of the leptin protein from Homo sapiens (human, P41159), Sus scrofa (wild pig, Q29406), Felis catus (domestic cat, Q29406), Rattus norvegicus (rat, P50596), and Mus musculus (mouse, P41160) were randomly searched in the high-quality annotated and non-redundant protein sequence database UniProtKB/Swiss-Prot. A dendogram showing the evolutionary relationships among specimens was constructed from the sequences of interest using the Mega 6.0 software with the neighbor-joining method. The resulting tree presenting the evolutionary relationships among specimens inferred from amino acid sequences of the leptin protein in mammals demonstrated 2 main branches: 1 cluster including the rat and mouse species (0.02) and a second cluster containing both wild pig and domestic cat species grouped in a sub-branch (0.04 and 0.06, respectively), linking them to the human sequence (0.08). These findings were reinforced by comparing estimates of evolutionary divergence among leptin sequences analyzed. Based on comparative analyses of multiple sequence alignments in the present study, there was a stronger conservation degree of the leptin protein in evolutionarily close species and several conservative changes along the sequences of interest, revealing information regarding the evolutionary biology among mammals. PMID:25729957

  11. Functional and Structural Analysis of the Conserved EFhd2 Protein

    PubMed Central

    Acosta, Yancy Ferrer; Rodríguez Cruz, Eva N.; Vaquer, Ana del C.; Vega, Irving E.


    EFhd2 is a novel protein conserved from C. elegans to H. sapiens. This novel protein was originally identified in cells of the immune and central nervous systems. However, it is most abundant in the central nervous system, where it has been found associated with pathological forms of the microtubule-associated protein tau. The physiological or pathological roles of EFhd2 are poorly understood. In this study, a functional and structural analysis was carried to characterize the molecular requirements for EFhd2’s calcium binding activity. The results showed that mutations of a conserved aspartate on either EF-hand motif disrupted the calcium binding activity, indicating that these motifs work in pair as a functional calcium binding domain. Furthermore, characterization of an identified single-nucleotide polymorphisms (SNP) that introduced a missense mutation indicates the importance of a conserved phenylalanine on EFhd2 calcium binding activity. Structural analysis revealed that EFhd2 is predominantly composed of alpha helix and random coil structures and that this novel protein is thermostable. EFhd2’s thermo stability depends on its N-terminus. In the absence of the N-terminus, calcium binding restored EFhd2’s thermal stability. Overall, these studies contribute to our understanding on EFhd2 functional and structural properties, and introduce it into the family of canonical EF-hand domain containing proteins. PMID:22973849

  12. Conservation of protein structure over four billion years

    PubMed Central

    Ingles-Prieto, Alvaro; Ibarra-Molero, Beatriz; Delgado-Delgado, Asuncion; Perez-Jimenez, Raul; Fernandez, Julio M.; Gaucher, Eric A.; Sanchez-Ruiz, Jose M.; Gavira, Jose A.


    SUMMARY Little is known with certainty about the evolution of protein structures in general and the degree of protein structure conservation over planetary time scales in particular. Here we report the X-ray crystal structures of seven laboratory resurrections of Precambrian thioredoxins dating back up to ~4 billion years before present. Despite considerable sequence differences compared with extant enzymes, the ancestral proteins display the canonical thioredoxin fold while only small structural changes have occurred over 4 billion years. This remarkable degree of structure conservation since a time near the last common ancestor of life supports a punctuated-equilibrium model of structure evolution in which the generation of new folds occurs over comparatively short periods of time and is followed by long periods of structural stasis. PMID:23932589

  13. Conservation of protein structure over four billion years.


    Ingles-Prieto, Alvaro; Ibarra-Molero, Beatriz; Delgado-Delgado, Asuncion; Perez-Jimenez, Raul; Fernandez, Julio M; Gaucher, Eric A; Sanchez-Ruiz, Jose M; Gavira, Jose A


    Little is known about the evolution of protein structures and the degree of protein structure conservation over planetary time scales. Here, we report the X-ray crystal structures of seven laboratory resurrections of Precambrian thioredoxins dating up to approximately four billion years ago. Despite considerable sequence differences compared with extant enzymes, the ancestral proteins display the canonical thioredoxin fold, whereas only small structural changes have occurred over four billion years. This remarkable degree of structure conservation since a time near the last common ancestor of life supports a punctuated-equilibrium model of structure evolution in which the generation of new folds occurs over comparatively short periods and is followed by long periods of structural stasis. PMID:23932589

  14. Functional conservation of an ancestral Pellino protein in helminth species.


    Cluxton, Christopher D; Caffrey, Brian E; Kinsella, Gemma K; Moynagh, Paul N; Fares, Mario A; Fallon, Padraic G


    The immune system of H. sapiens has innate signaling pathways that arose in ancestral species. This is exemplified by the discovery of the Toll-like receptor (TLR) pathway using free-living model organisms such as Drosophila melanogaster. The TLR pathway is ubiquitous and controls sensitivity to pathogen-associated molecular patterns (PAMPs) in eukaryotes. There is, however, a marked absence of this pathway from the plathyhelminthes, with the exception of the Pellino protein family, which is present in a number of species from this phylum. Helminth Pellino proteins are conserved having high similarity, both at the sequence and predicted structural protein level, with that of human Pellino proteins. Pellino from a model helminth, Schistosoma mansoni Pellino (SmPellino), was shown to bind and poly-ubiquitinate human IRAK-1, displaying E3 ligase activity consistent with its human counterparts. When transfected into human cells SmPellino is functional, interacting with signaling proteins and modulating mammalian signaling pathways. Strict conservation of a protein family in species lacking its niche signalling pathway is rare and provides a platform to examine the ancestral functions of Pellino proteins that may translate into novel mechanisms of immune regulation in humans. PMID:26120048

  15. Genomic analysis of membrane protein families: abundance and conserved motifs

    PubMed Central

    Liu, Yang; Engelman, Donald M; Gerstein, Mark


    Background Polytopic membrane proteins can be related to each other on the basis of the number of transmembrane helices and sequence similarities. Building on the Pfam classification of protein domain families, and using transmembrane-helix prediction and sequence-similarity searching, we identified a total of 526 well-characterized membrane protein families in 26 recently sequenced genomes. To this we added a clustering of a number of predicted but unclassified membrane proteins, resulting in a total of 637 membrane protein families. Results Analysis of the occurrence and composition of these families revealed several interesting trends. The number of assigned membrane protein domains has an approximately linear relationship to the total number of open reading frames (ORFs) in 26 genomes studied. Caenorhabditis elegans is an apparent outlier, because of its high representation of seven-span transmembrane (7-TM) chemoreceptor families. In all genomes, including that of C. elegans, the number of distinct membrane protein families has a logarithmic relation to the number of ORFs. Glycine, proline, and tyrosine locations tend to be conserved in transmembrane regions within families, whereas isoleucine, valine, and methionine locations are relatively mutable. Analysis of motifs in putative transmembrane helices reveals that GxxxG and GxxxxxxG (which can be written GG4 and GG7, respectively; see Materials and methods) are among the most prevalent. This was noted in earlier studies; we now find these motifs are particularly well conserved in families, however, especially those corresponding to transporters, symporters, and channels. Conclusions We carried out a genome-wide analysis on patterns of the classified polytopic membrane protein families and analyzed the distribution of conserved amino acids and motifs in the transmembrane helix regions in these families. PMID:12372142

  16. Defining and predicting structurally conserved regions in protein superfamilies

    PubMed Central

    Huang, Ivan K.; Grishin, Nick V.


    Motivation: The structures of homologous proteins are generally better conserved than their sequences. This phenomenon is demonstrated by the prevalence of structurally conserved regions (SCRs) even in highly divergent protein families. Defining SCRs requires the comparison of two or more homologous structures and is affected by their availability and divergence, and our ability to deduce structurally equivalent positions among them. In the absence of multiple homologous structures, it is necessary to predict SCRs of a protein using information from only a set of homologous sequences and (if available) a single structure. Accurate SCR predictions can benefit homology modelling and sequence alignment. Results: Using pairwise DaliLite alignments among a set of homologous structures, we devised a simple measure of structural conservation, termed structural conservation index (SCI). SCI was used to distinguish SCRs from non-SCRs. A database of SCRs was compiled from 386 SCOP superfamilies containing 6489 protein domains. Artificial neural networks were then trained to predict SCRs with various features deduced from a single structure and homologous sequences. Assessment of the predictions via a 5-fold cross-validation method revealed that predictions based on features derived from a single structure perform similarly to ones based on homologous sequences, while combining sequence and structural features was optimal in terms of accuracy (0.755) and Matthews correlation coefficient (0.476). These results suggest that even without information from multiple structures, it is still possible to effectively predict SCRs for a protein. Finally, inspection of the structures with the worst predictions pinpoints difficulties in SCR definitions. Availability: The SCR database and the prediction server can be found at Contact: or Supplementary information: Supplementary data are available at Bioinformatics

  17. Role of conservative mutations in protein multi-property adaptation.


    Rodriguez-Larrea, David; Perez-Jimenez, Raul; Sanchez-Romero, Inmaculada; Delgado-Delgado, Asuncion; Fernandez, Julio M; Sanchez-Ruiz, Jose M


    Protein physicochemical properties must undergo complex changes during evolution, as a response to modifications in the organism environment, the result of the proteins taking up new roles or because of the need to cope with the evolution of molecular interacting partners. Recent work has emphasized the role of stability and stability-function trade-offs in these protein adaptation processes. In the present study, on the other hand, we report that combinations of a few conservative, high-frequency-of-fixation mutations in the thioredoxin molecule lead to largely independent changes in both stability and the diversity of catalytic mechanisms, as revealed by single-molecule atomic force spectroscopy. Furthermore, the changes found are evolutionarily significant, as they combine typically hyperthermophilic stability enhancements with modulations in function that span the ranges defined by the quite different catalytic patterns of thioredoxins from bacterial and eukaryotic origin. These results suggest that evolutionary protein adaptation may use, in some cases at least, the potential of conservative mutations to originate a multiplicity of evolutionarily allowed mutational paths leading to a variety of protein modulation patterns. In addition the results support the feasibility of using evolutionary information to achieve protein multi-feature optimization, an important biotechnological goal. PMID:20446918

  18. Global Conservation of Protein Status between Cell Lines and Xenografts.


    Biau, Julian; Chautard, Emmanuel; Court, Frank; Pereira, Bruno; Verrelle, Pierre; Devun, Flavien; De Koning, Leanne; Dutreix, Marie


    Common preclinical models for testing anticancer treatment include cultured human tumor cell lines in monolayer, and xenografts derived from these cell lines in immunodeficient mice. Our goal was to determine how similar the xenografts are compared with their original cell line and to determine whether it is possible to predict the stability of a xenograft model beforehand. We studied a selection of 89 protein markers of interest in 14 human cell cultures and respective subcutaneous xenografts using the reverse-phase protein array technology. We specifically focused on proteins and posttranslational modifications involved in DNA repair, PI3K pathway, apoptosis, tyrosine kinase signaling, stress, cell cycle, MAPK/ERK signaling, SAPK/JNK signaling, NFκB signaling, and adhesion/cytoskeleton. Using hierarchical clustering, most cell culture-xenograft pairs cluster together, suggesting a global conservation of protein signature. Particularly, Akt, NFkB, EGFR, and Vimentin showed very stable protein expression and phosphorylation levels highlighting that 4 of 10 pathways were highly correlated whatever the model. Other proteins were heterogeneously conserved depending on the cell line. Finally, cell line models with low Akt pathway activation and low levels of Vimentin gave rise to more reliable xenograft models. These results may be useful for the extrapolation of cell culture experiments to in vivo models in novel targeted drug discovery. PMID:27567954

  19. Conservation and Variability of West Nile Virus Proteins

    PubMed Central

    Jung, Keun-Ok; Ramdas, Shweta; Miotto, Olivo; Tan, Tin Wee; Brusic, Vladimir; Salmon, Jerome; August, J. Thomas


    West Nile virus (WNV) has emerged globally as an increasingly important pathogen for humans and domestic animals. Studies of the evolutionary diversity of the virus over its known history will help to elucidate conserved sites, and characterize their correspondence to other pathogens and their relevance to the immune system. We describe a large-scale analysis of the entire WNV proteome, aimed at identifying and characterizing evolutionarily conserved amino acid sequences. This study, which used 2,746 WNV protein sequences collected from the NCBI GenPept database, focused on analysis of peptides of length 9 amino acids or more, which are immunologically relevant as potential T-cell epitopes. Entropy-based analysis of the diversity of WNV sequences, revealed the presence of numerous evolutionarily stable nonamer positions across the proteome (entropy value of ≤1). The representation (frequency) of nonamers variant to the predominant peptide at these stable positions was, generally, low (≤10% of the WNV sequences analyzed). Eighty-eight fragments of length 9–29 amino acids, representing ∼34% of the WNV polyprotein length, were identified to be identical and evolutionarily stable in all analyzed WNV sequences. Of the 88 completely conserved sequences, 67 are also present in other flaviviruses, and several have been associated with the functional and structural properties of viral proteins. Immunoinformatic analysis revealed that the majority (78/88) of conserved sequences are potentially immunogenic, while 44 contained experimentally confirmed human T-cell epitopes. This study identified a comprehensive catalogue of completely conserved WNV sequences, many of which are shared by other flaviviruses, and majority are potential epitopes. The complete conservation of these immunologically relevant sequences through the entire recorded WNV history suggests they will be valuable as components of peptide-specific vaccines or other therapeutic applications, for

  20. Mutational effects on stability are largely conserved during protein evolution.


    Ashenberg, Orr; Gong, L Ian; Bloom, Jesse D


    Protein stability and folding are the result of cooperative interactions among many residues, yet phylogenetic approaches assume that sites are independent. This discrepancy has engendered concerns about large evolutionary shifts in mutational effects that might confound phylogenetic approaches. Here we experimentally investigate this issue by introducing the same mutations into a set of diverged homologs of the influenza nucleoprotein and measuring the effects on stability. We find that mutational effects on stability are largely conserved across the homologs. We reach qualitatively similar conclusions when we simulate protein evolution with molecular-mechanics force fields. Our results do not mean that proteins evolve without epistasis, which can still arise even when mutational stability effects are conserved. However, our findings indicate that large evolutionary shifts in mutational effects on stability are rare, at least among homologs with similar structures and functions. We suggest that properly describing the clearly observable and highly conserved amino acid preferences at individual sites is likely to be far more important for phylogenetic analyses than accounting for rare shifts in amino acid propensities due to site covariation. PMID:24324165

  1. A protein trisulfide couples dissimilatory sulfate reduction to energy conservation

    NASA Astrophysics Data System (ADS)

    Santos, André A.; Venceslau, Sofia S.; Grein, Fabian; Leavitt, William D.; Dahl, Christiane; Johnston, David T.; Pereira, Inês A. C.


    Microbial sulfate reduction has governed Earth’s biogeochemical sulfur cycle for at least 2.5 billion years. However, the enzymatic mechanisms behind this pathway are incompletely understood, particularly for the reduction of sulfite—a key intermediate in the pathway. This critical reaction is performed by DsrAB, a widespread enzyme also involved in other dissimilatory sulfur metabolisms. Using in vitro assays with an archaeal DsrAB, supported with genetic experiments in a bacterial system, we show that the product of sulfite reduction by DsrAB is a protein-based trisulfide, in which a sulfite-derived sulfur is bridging two conserved cysteines of DsrC. Physiological studies also reveal that sulfate reduction rates are determined by cellular levels of DsrC. Dissimilatory sulfate reduction couples the four-electron reduction of the DsrC trisulfide to energy conservation.

  2. Cluster conservation as a novel tool for studying protein-protein interactions evolution.


    Rahat, Ofer; Yitzhaky, Assif; Schreiber, Gideon


    Protein-protein interactions networks has come to be a buzzword associated with nets containing edges that represent a pair of interacting proteins (e.g. hormone-receptor, enzyme-inhibitor, antigen-antibody, and a subset of multichain biological machines). Yet, each such interaction composes its own unique network, in which vertices represent amino acid residues, and edges represent atomic contacts. Recent studies have shown that analyses of the data encapsulated in these detailed networks may impact predictions of structure-function correlation. Here, we study homologous families of protein-protein interfaces, which share the same fold but vary in sequence. In this context, we address what properties of the network are shared among relatives with different sequences (and hence different atomic interactions) and which are not. Herein, we develop the general mathematical framework needed to compare the modularity of homologous networks. We then apply this analysis to the structural data of a few interface families, including hemoglobin alpha-beta, growth hormone-receptor, and Serine protease-inhibitor. Our results suggest that interface modularity is an evolutionarily conserved property. Hence, protein-protein interfaces can be clustered down to a few modules, with the boundaries being evolutionarily conserved along homologous complexes. This suggests that protein engineering of protein-protein binding sites may be simplified by varying each module, but retaining the overall modularity of the interface. PMID:17972288

  3. Homology Inference of Protein-Protein Interactions via Conserved Binding Sites

    PubMed Central

    Tyagi, Manoj; Thangudu, Ratna R.; Zhang, Dachuan; Bryant, Stephen H.; Madej, Thomas; Panchenko, Anna R.


    The coverage and reliability of protein-protein interactions determined by high-throughput experiments still needs to be improved, especially for higher organisms, therefore the question persists, how interactions can be verified and predicted by computational approaches using available data on protein structural complexes. Recently we developed an approach called IBIS (Inferred Biomolecular Interaction Server) to predict and annotate protein-protein binding sites and interaction partners, which is based on the assumption that the structural location and sequence patterns of protein-protein binding sites are conserved between close homologs. In this study first we confirmed high accuracy of our method and found that its accuracy depends critically on the usage of all available data on structures of homologous complexes, compared to the approaches where only a non-redundant set of complexes is employed. Second we showed that there exists a trade-off between specificity and sensitivity if we employ in the prediction only evolutionarily conserved binding site clusters or clusters supported by only one observation (singletons). Finally we addressed the question of identifying the biologically relevant interactions using the homology inference approach and demonstrated that a large majority of crystal packing interactions can be correctly identified and filtered by our algorithm. At the same time, about half of biological interfaces that are not present in the protein crystallographic asymmetric unit can be reconstructed by IBIS from homologous complexes without the prior knowledge of crystal parameters of the query protein. PMID:22303436

  4. Evolutionarily Conserved Network Properties of Intrinsically Disordered Proteins

    PubMed Central

    Rangarajan, Nivedita; Kulkarni, Prakash; Hannenhalli, Sridhar


    Background Intrinsically disordered proteins (IDPs) lack a stable tertiary structure in isolation. Remarkably, however, a substantial portion of IDPs undergo disorder-to-order transitions upon binding to their cognate partners. Structural flexibility and binding plasticity enable IDPs to interact with a broad range of partners. However, the broader network properties that could provide additional insights into the functional role of IDPs are not known. Results Here, we report the first comprehensive survey of network properties of IDP-induced sub-networks in multiple species from yeast to human. Our results show that IDPs exhibit greater-than-expected modularity and are connected to the rest of the protein interaction network (PIN) via proteins that exhibit the highest betweenness centrality and connect to fewer-than-expected IDP communities, suggesting that they form critical communication links from IDP modules to the rest of the PIN. Moreover, we found that IDPs are enriched at the top level of regulatory hierarchy. Conclusion Overall, our analyses reveal coherent and remarkably conserved IDP-centric network properties, namely, modularity in IDP-induced network and a layer of critical nodes connecting IDPs with the rest of the PIN. PMID:25974317

  5. A conserved patch of hydrophobic amino acids modulates Myb activity by mediating protein-protein interactions.


    Dukare, Sandeep; Klempnauer, Karl-Heinz


    The transcription factor c-Myb plays a key role in the control of proliferation and differentiation in hematopoietic progenitor cells and has been implicated in the development of leukemia and certain non-hematopoietic tumors. c-Myb activity is highly dependent on the interaction with the coactivator p300 which is mediated by the transactivation domain of c-Myb and the KIX domain of p300. We have previously observed that conservative valine-to-isoleucine amino acid substitutions in a conserved stretch of hydrophobic amino acids have a profound effect on Myb activity. Here, we have explored the function of the hydrophobic region as a mediator of protein-protein interactions. We show that the hydrophobic region facilitates Myb self-interaction and binding of the histone acetyl transferase Tip60, a previously identified Myb interacting protein. We show that these interactions are affected by the valine-to-isoleucine amino acid substitutions and suppress Myb activity by interfering with the interaction of Myb and the KIX domain of p300. Taken together, our work identifies the hydrophobic region in the Myb transactivation domain as a binding site for homo- and heteromeric protein interactions and leads to a picture of the c-Myb transactivation domain as a composite protein binding region that facilitates interdependent protein-protein interactions of Myb with regulatory proteins. PMID:27080133

  6. Interaction prediction using conserved network motifs in protein-protein interaction networks

    NASA Astrophysics Data System (ADS)

    Albert, Reka


    High-throughput protein interaction detection methods are strongly affected by false positive and false negative results. Focused experiments are needed to complement the large-scale methods by validating previously detected interactions but it is often difficult to decide which proteins to probe as interaction partners. Developing reliable computational methods assisting this decision process is a pressing need in bioinformatics. This talk will describe the recent developments in analyzing and understanding protein interaction networks, then present a method that uses the conserved properties of the protein network to identify and validate interaction candidates. We apply a number of machine learning algorithms to the protein connectivity information and achieve a surprisingly good overall performance in predicting interacting proteins. Using a ``leave-one-ou approach we find average success rates between 20-50% for predicting the correct interaction partner of a protein. We demonstrate that the success of these methods is based on the presence of conserved interaction motifs within the network. A reference implementation and a table with candidate interacting partners for each yeast protein are available at

  7. Conservation of Oxidative Protein Stabilization in an Insect Homologue of Parkinsonism-Associated Protein DJ-1

    SciTech Connect

    Lin, Jiusheng; Prahlad, Janani; Wilson, Mark A.


    DJ-1 is a conserved, disease-associated protein that protects against oxidative stress and mitochondrial damage in multiple organisms. Human DJ-1 contains a functionally essential cysteine residue (Cys106) whose oxidation is important for regulating protein function by an unknown mechanism. This residue is well-conserved in other DJ-1 homologues, including two (DJ-1{alpha} and DJ-1{beta}) in Drosophila melanogaster. Because D. melanogaster is a powerful model system for studying DJ-1 function, we have determined the crystal structure and impact of cysteine oxidation on Drosophila DJ-1{beta}. The structure of D. melanogaster DJ-1{beta} is similar to that of human DJ-1, although two important residues in the human protein, Met26 and His126, are not conserved in DJ-1{beta}. His126 in human DJ-1 is substituted with a tyrosine in DJ-1{beta}, and this residue is not able to compose a putative catalytic dyad with Cys106 that was proposed to be important in the human protein. The reactive cysteine in DJ-1 is oxidized readily to the cysteine-sulfinic acid in both flies and humans, and this may regulate the cytoprotective function of the protein. We show that the oxidation of this conserved cysteine residue to its sulfinate form (Cys-SO{sub 2{sup -}}) results in considerable thermal stabilization of both Drosophila DJ-1{beta} and human DJ-1. Therefore, protein stabilization is one potential mechanism by which cysteine oxidation may regulate DJ-1 function in vivo. More generally, most close DJ-1 homologues are likely stabilized by cysteine-sulfinic acid formation but destabilized by further oxidation, suggesting that they are biphasically regulated by oxidative modification.

  8. Functional phosphorylation sites in cardiac myofilament proteins are evolutionarily conserved in skeletal myofilament proteins.


    Gross, Sean M; Lehman, Steven L


    Protein phosphorylation plays an important role in regulating cardiac contractile function, but phosphorylation is not thought to play a regulatory role in skeletal muscle. To examine how myofilament phosphorylation arose in the human heart, we analyzed the amino acid sequences of 25 cardiac phosphorylation sites in animals ranging from fruit flies to humans. These analyses indicated that of the 25 human phosphorylation sites examined, 11 have been conserved across vertebrates and four have been sporadically present in vertebrates. Furthermore, all 11 of the cardiac sites found across vertebrates were present in skeletal muscle isoforms, along with three sites that were sporadically present. Based on the conservation of amino acid sequences between cardiac and skeletal contractile proteins, we tested for phosphorylation in mammalian skeletal muscle using several biochemical techniques and found evidence that multiple myofilament proteins were phosphorylated. Several of these phosphorylation sites were validated using mass spectrometry, including one site that is present in slow- and fast-twitch troponin I (TnI), but was lost in cardiac TnI. Thus, several myofilament phosphorylation sites present in the human heart likely arose in invertebrate muscle, have been evolutionarily conserved in skeletal muscle, and potentially have functional effects in both skeletal and cardiac muscle. PMID:26993364

  9. Hierarchical partitioning of metazoan protein conservation profiles provides new functional insights.


    Witztum, Jonathan; Persi, Erez; Horn, David; Pasmanik-Chor, Metsada; Chor, Benny


    The availability of many complete, annotated proteomes enables the systematic study of the relationships between protein conservation and functionality. We explore this question based solely on the presence or absence of protein homologues (a.k.a. conservation profiles). We study 18 metazoans, from two distinct points of view: the human's and the fly's. Using the GOrilla gene ontology (GO) analysis tool, we explore functional enrichment of the "universal proteins", those with homologues in all 17 other species, and of the "non-universal proteins". A large number of GO terms are strongly enriched in both human and fly universal proteins. Most of these functions are known to be essential. A smaller number of GO terms, exhibiting markedly different properties, are enriched in both human and fly non-universal proteins. We further explore the non-universal proteins, whose conservation profiles are consistent with the "tree of life" (TOL consistent), as well as the TOL inconsistent proteins. Finally, we applied Quantum Clustering to the conservation profiles of the TOL consistent proteins. Each cluster is strongly associated with one or a small number of specific monophyletic clades in the tree of life. The proteins in many of these clusters exhibit strong functional enrichment associated with the "life style" of the related clades. Most previous approaches for studying function and conservation are "bottom up", studying protein families one by one, and separately assessing the conservation of each. By way of contrast, our approach is "top down". We globally partition the set of all proteins hierarchically, as described above, and then identify protein families enriched within different subdivisions. While supporting previous findings, our approach also provides a tool for discovering novel relations between protein conservation profiles, functionality, and evolutionary history as represented by the tree of life. PMID:24594619

  10. Forage Management Effects on Protein and Fiber Fractions, Protein Degradability, and Dry Matter Yield of Red Clover Conserved as Silage

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Due to the action of o-quinones formed via polyphenol oxidase, conserved red clover (Trifolium pratense L.) contains abundant rumen undegradable protein (RUP), but inadequate rumen degradable protein (RDP) for dairy cattle. This study examined how forage management influences RDP, RUP, crude protein...

  11. Protein conservation and variation suggest mechanisms of cell type-specific modulation of signaling pathways.


    Schaefer, Martin H; Yang, Jae-Seong; Serrano, Luis; Kiel, Christina


    Many proteins and signaling pathways are present in most cell types and tissues and yet perform specialized functions. To elucidate mechanisms by which these ubiquitous pathways are modulated, we overlaid information about cross-cell line protein abundance and variability, and evolutionary conservation onto functional pathway components and topological layers in the pathway hierarchy. We found that the input (receptors) and the output (transcription factors) layers evolve more rapidly than proteins in the intermediary transmission layer. In contrast, protein expression variability decreases from the input to the output layer. We observed that the differences in protein variability between the input and transmission layer can be attributed to both the network position and the tendency of variable proteins to physically interact with constitutively expressed proteins. Differences in protein expression variability and conservation are also accompanied by the tendency of conserved and constitutively expressed proteins to acquire somatic mutations, while germline mutations tend to occur in cell type-specific proteins. Thus, conserved core proteins in the transmission layer could perform a fundamental role in most cell types and are therefore less tolerant to germline mutations. In summary, we propose that the core signal transmission machinery is largely modulated by a variable input layer through physical protein interactions. We hypothesize that the bow-tie organization of cellular signaling on the level of protein abundance variability contributes to the specificity of the signal response in different cell types. PMID:24922536

  12. Conservation.

    ERIC Educational Resources Information Center

    National Audubon Society, New York, NY.

    This set of teaching aids consists of seven Audubon Nature Bulletins, providing the teacher and student with informational reading on various topics in conservation. The bulletins have these titles: Plants as Makers of Soil, Water Pollution Control, The Ground Water Table, Conservation--To Keep This Earth Habitable, Our Threatened Air Supply,…

  13. Local Geometry and Evolutionary Conservation of Protein Surfaces Reveal the Multiple Recognition Patches in Protein-Protein Interactions

    PubMed Central

    Laine, Elodie; Carbone, Alessandra


    Protein-protein interactions (PPIs) are essential to all biological processes and they represent increasingly important therapeutic targets. Here, we present a new method for accurately predicting protein-protein interfaces, understanding their properties, origins and binding to multiple partners. Contrary to machine learning approaches, our method combines in a rational and very straightforward way three sequence- and structure-based descriptors of protein residues: evolutionary conservation, physico-chemical properties and local geometry. The implemented strategy yields very precise predictions for a wide range of protein-protein interfaces and discriminates them from small-molecule binding sites. Beyond its predictive power, the approach permits to dissect interaction surfaces and unravel their complexity. We show how the analysis of the predicted patches can foster new strategies for PPIs modulation and interaction surface redesign. The approach is implemented in JET2, an automated tool based on the Joint Evolutionary Trees (JET) method for sequence-based protein interface prediction. JET2 is freely available at PMID:26690684

  14. Structure-sequence based analysis for identification of conserved regions in proteins


    Zemla, Adam T; Zhou, Carol E; Lam, Marisa W; Smith, Jason R; Pardes, Elizabeth


    Disclosed are computational methods, and associated hardware and software products for scoring conservation in a protein structure based on a computationally identified family or cluster of protein structures. A method of computationally identifying a family or cluster of protein structures in also disclosed herein.

  15. Polyphenol, Conditioning, and Conservation Effects on Protein Fractions and Degradability in Forage Legumes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Forage legume proteins were fractionated by the Cornell Net Carbohydrate and Protein System or ruminally incubated to assess how conditioning and conservation methods interact with polyphenols (condensed tannins or o-quinones) to alter protein degradability. The presence of polyphenols, conditioning...

  16. ORMDL proteins are a conserved new family of endoplasmic reticulum membrane proteins

    PubMed Central

    Hjelmqvist, Lars; Tuson, Miquel; Marfany, Gemma; Herrero, Enric; Balcells, Susana; Gonzàlez-Duarte, Roser


    Background Annotations of completely sequenced genomes reveal that nearly half of the genes identified are of unknown function, and that some belong to uncharacterized gene families. To help resolve such issues, information can be obtained from the comparative analysis of homologous genes in model organisms. Results While characterizing genes from the retinitis pigmentosa locus RP26 at 2q31-q33, we have identified a new gene, ORMDL1, that belongs to a novel gene family comprising three genes in humans (ORMDL1, ORMDL2 and ORMDL3), and homologs in yeast, microsporidia, plants, Drosophila, urochordates and vertebrates. The human genes are expressed ubiquitously in adult and fetal tissues. The Drosophila ORMDL homolog is also expressed throughout embryonic and larval stages, particularly in ectodermally derived tissues. The ORMDL genes encode transmembrane proteins anchored in the endoplasmic reticulum (ER). Double knockout of the two Saccharomyces cerevisiae homologs leads to decreased growth rate and greater sensitivity to tunicamycin and dithiothreitol. Yeast mutants can be rescued by human ORMDL homologs. Conclusions From protein sequence comparisons we have defined a novel gene family, not previously recognized because of the absence of a characterized functional signature. The sequence conservation of this family from yeast to vertebrates, the maintenance of duplicate copies in different lineages, the ubiquitous pattern of expression in human and Drosophila, the partial functional redundancy of the yeast homologs and phenotypic rescue by the human homologs, strongly support functional conservation. Subcellular localization and the response of yeast mutants to specific agents point to the involvement of ORMDL in protein folding in the ER. PMID:12093374

  17. Quantitative and Functional Characterization of the Hyper-Conserved Protein of Prochlorococcus and Marine Synechococcus

    PubMed Central

    Zorz, Jackie K.; Joy, Andrew P.; Barnett, David A.; Johnson, Milo S.; Zhaxybayeva, Olga; Cockshutt, Amanda M.


    A large fraction of any bacterial genome consists of hypothetical protein-coding open reading frames (ORFs). While most of these ORFs are present only in one or a few sequenced genomes, a few are conserved, often across large phylogenetic distances. Such conservation provides clues to likely uncharacterized cellular functions that need to be elucidated. Marine cyanobacteria from the Prochlorococcus/marine Synechococcus clade are dominant bacteria in oceanic waters and are significant contributors to global primary production. A Hyper Conserved Protein (PSHCP) of unknown function is 100% conserved at the amino acid level in genomes of Prochlorococcus/marine Synechococcus, but lacks homologs outside of this clade. In this study we investigated Prochlorococcus marinus strains MED4 and MIT 9313 and Synechococcus sp. strain WH 8102 for the transcription of the PSHCP gene using RT-Q-PCR, for the presence of the protein product through quantitative immunoblotting, and for the protein's binding partners in a pull down assay. Significant transcription of the gene was detected in all strains. The PSHCP protein content varied between 8±1 fmol and 26±9 fmol per ug total protein, depending on the strain. The 50 S ribosomal protein L2, the Photosystem I protein PsaD and the Ycf48-like protein were found associated with the PSHCP protein in all strains and not appreciably or at all in control experiments. We hypothesize that PSHCP is a protein associated with the ribosome, and is possibly involved in photosystem assembly. PMID:25360678

  18. Fold of the conserved DTC domain in deltex proteins

    SciTech Connect

    Obiero, Josiah; Walker, John R.; Dhe-Paganon, Sirano


    Human Deltex 3-like (DTX3L) is a member of the Deltex family of proteins. Initially identified as a B-lymphoma and BAL-associated protein, DTX3L is an E3 ligase that regulates subcellular localization of its partner protein, BAL, by a dynamic nucleocytoplasmic trafficking mechanism. Unlike other members of the Deltex family of proteins, DTX3L lacks the highly basic N-terminal motif and the central proline-rich motif present in other Deltex proteins, and instead contains other unique N-terminal domains. The C-terminal domains are, however, homologous with other members of the Deltex family of proteins; these include a RING domain and a previously unidentified C-terminal domain. In this study, we report the high-resolution crystal structure of this previously uncharacterized C-terminal domain of human DTX3L, which we term the Deltex C-terminal domain.

  19. A Fast Alignment-Free Approach for De Novo Detection of Protein Conserved Regions

    PubMed Central

    Abnousi, Armen; Broschat, Shira L.; Kalyanaraman, Ananth


    Background Identifying conserved regions in protein sequences is a fundamental operation, occurring in numerous sequence-driven analysis pipelines. It is used as a way to decode domain-rich regions within proteins, to compute protein clusters, to annotate sequence function, and to compute evolutionary relationships among protein sequences. A number of approaches exist for identifying and characterizing protein families based on their domains, and because domains represent conserved portions of a protein sequence, the primary computation involved in protein family characterization is identification of such conserved regions. However, identifying conserved regions from large collections (millions) of protein sequences presents significant challenges. Methods In this paper we present a new, alignment-free method for detecting conserved regions in protein sequences called NADDA (No-Alignment Domain Detection Algorithm). Our method exploits the abundance of exact matching short subsequences (k-mers) to quickly detect conserved regions, and the power of machine learning is used to improve the prediction accuracy of detection. We present a parallel implementation of NADDA using the MapReduce framework and show that our method is highly scalable. Results We have compared NADDA with Pfam and InterPro databases. For known domains annotated by Pfam, accuracy is 83%, sensitivity 96%, and specificity 44%. For sequences with new domains not present in the training set an average accuracy of 63% is achieved when compared to Pfam. A boost in results in comparison with InterPro demonstrates the ability of NADDA to capture conserved regions beyond those present in Pfam. We have also compared NADDA with ADDA and MKDOM2, assuming Pfam as ground-truth. On average NADDA shows comparable accuracy, more balanced sensitivity and specificity, and being alignment-free, is significantly faster. Excluding the one-time cost of training, runtimes on a single processor were 49s, 10,566s, and 456s

  20. A complex of three related membrane proteins is conserved on malarial merozoites

    PubMed Central

    Rayavara, Kempaiah; Rajapandi, Thavamani; Wollenberg, Kurt; Kabat, Juraj; Fischer, Elizabeth R.; Desai, Sanjay A.


    Invasion of human red blood cells by the malaria parasite P. falciparum is a coordinated, multi-step process. Here, we describe three novel integral membrane proteins that colocalize on the inner membrane complex immediately beneath the merozoite plasma membrane. Each has 6 predicted transmembrane domains and is conserved in diverse apicomplexan parasites. Immunoprecipitation studies using specific antibodies reveal that these proteins assemble into a heteromeric complex. Each protein was also expressed on insect cells using the baculovirus vector system with a truncated SUMO tag that facilitates maximal expression and protein purification while permitting cleavage with SUMO protease to release unmodified parasite protein. The expressed proteins were successfully reconstituted into artificial liposomes, but were not recognized by human immune sera. Because all three genes are highly conserved in apicomplexan parasites, the complex formed by their encoded proteins likely serves an essential role for invasive merozoites. PMID:19465059

  1. An Experimental Approach for the Identification of Conserved Secreted Proteins in Trypanosomatids

    PubMed Central

    Corrales, Rosa M.; Mathieu-Daudé, Françoise; Garcia, Déborah; Brenière, Simone F.; Sereno, Denis


    Extracellular factors produced by Leishmania spp., Trypanosoma cruzi, and Trypanosoma brucei are important in the host-parasite relationship. Here, we describe a genome-based approach to identify putative extracellular proteins conserved among trypanosomatids that are likely involved in the classical secretory pathway. Potentially secreted proteins were identified by bioinformatic analysis of the T. cruzi genome. A subset of thirteen genes encoding unknown proteins with orthologs containing a signal peptide sequence in L. infantum, L. major, and T. brucei were transfected into L. infantum. Tagged proteins detected in the extracellular medium confirmed computer predictions in about 25% of the hits. Secretion was confirmed for two L. infantum orthologs proteins using the same experimental system. Infectivity studies of transgenic Leishmania parasites suggest that one of the secreted proteins increases parasite replication inside macrophages. This methodology can identify conserved secreted proteins involved in the classical secretory pathway, and they may represent potential virulence factors in trypanosomatids. PMID:20145711

  2. Functional Constraint Profiling of a Viral Protein Reveals Discordance of Evolutionary Conservation and Functionality

    PubMed Central

    Wu, Nicholas C.; Olson, C. Anders; Du, Yushen; Le, Shuai; Tran, Kevin; Remenyi, Roland; Gong, Danyang; Al-Mawsawi, Laith Q.; Qi, Hangfei; Wu, Ting-Ting; Sun, Ren


    Viruses often encode proteins with multiple functions due to their compact genomes. Existing approaches to identify functional residues largely rely on sequence conservation analysis. Inferring functional residues from sequence conservation can produce false positives, in which the conserved residues are functionally silent, or false negatives, where functional residues are not identified since they are species-specific and therefore non-conserved. Furthermore, the tedious process of constructing and analyzing individual mutations limits the number of residues that can be examined in a single study. Here, we developed a systematic approach to identify the functional residues of a viral protein by coupling experimental fitness profiling with protein stability prediction using the influenza virus polymerase PA subunit as the target protein. We identified a significant number of functional residues that were influenza type-specific and were evolutionarily non-conserved among different influenza types. Our results indicate that type-specific functional residues are prevalent and may not otherwise be identified by sequence conservation analysis alone. More importantly, this technique can be adapted to any viral (and potentially non-viral) protein where structural information is available. PMID:26132554

  3. Structural consequences of chromophore formation and exploration of conserved lid residues amongst naturally occurring fluorescent proteins

    NASA Astrophysics Data System (ADS)

    Zimmer, Matthew H.; Li, Binsen; Shahid, Ramza; Peshkepija, Paola; Zimmer, Marc


    Computational methods were used to generate the lowest energy conformations of the immature precyclized forms of the 28 naturally occurring GFP-like proteins deposited in the pdb. In all 28 GFP-like proteins, the beta-barrel contracts upon chromophore formation and becomes more rigid. Our prior analysis of over 260 distinct naturally occurring GFP-like proteins revealed that most of the conserved residues are located in the top and bottom of the barrel in the turns between the β-sheets (Ong et al. 2011) [1]. Structural analyses, molecular dynamics simulations and the Anisotropic Network Model were used to explore the role of these conserved lid residues as possible folding nuclei. Our results are internally consistent and show that the conserved residues in the top and bottom lids undergo relatively less translational movement than other lid residues, and a number of these residues may play an important role as hinges or folding nuclei in the fluorescent proteins.

  4. A conserved BURP domain defines a novel group of plant proteins with unusual primary structures.


    Hattori, J; Boutilier, K A; van Lookeren Campagne, M M; Miki, B L


    We have identified a new class of plant proteins containing a common C-terminal region, which we have termed the BURP domain. These proteins are defined not only by the BURP domain, but also by the overall similarity in their modular construction. The BURP domain proteins consist of either three or four modules: (i) an N-terminal hydrophobic domain -- a presumptive transit peptide, joined to (ii) a short conserved segment or other short segment, (iii) an optional segment consisting of repeated units which is unique to each member, and (iv) the C-terminal BURP domain. These individual modules appear to be combined to form two main classes of BURP domain proteins. The BURP domain proteins, despite the similarities in their primary structural features, show no obvious similarities in the tissues or conditions under which they are expressed. The presence of the conserved BURP domain in diverse plant proteins suggests an important and fundamental functional role for this domain. PMID:9790599

  5. Structural Conservation of the Myoviridae Phage Tail Sheath Protein Fold

    SciTech Connect

    Aksyuk, Anastasia A.; Kurochkina, Lidia P.; Fokine, Andrei; Forouhar, Farhad; Mesyanzhinov, Vadim V.; Tong, Liang; Rossmann, Michael G.


    Bacteriophage phiKZ is a giant phage that infects Pseudomonas aeruginosa, a human pathogen. The phiKZ virion consists of a 1450 {angstrom} diameter icosahedral head and a 2000 {angstrom}-long contractile tail. The structure of the whole virus was previously reported, showing that its tail organization in the extended state is similar to the well-studied Myovirus bacteriophage T4 tail. The crystal structure of a tail sheath protein fragment of phiKZ was determined to 2.4 {angstrom} resolution. Furthermore, crystal structures of two prophage tail sheath proteins were determined to 1.9 and 3.3 {angstrom} resolution. Despite low sequence identity between these proteins, all of these structures have a similar fold. The crystal structure of the phiKZ tail sheath protein has been fitted into cryo-electron-microscopy reconstructions of the extended tail sheath and of a polysheath. The structural rearrangement of the phiKZ tail sheath contraction was found to be similar to that of phage T4.

  6. TOPDOM: database of conservatively located domains and motifs in proteins

    PubMed Central

    Varga, Julia; Dobson, László; Tusnády, Gábor E.


    Summary: The TOPDOM database—originally created as a collection of domains and motifs located consistently on the same side of the membranes in α-helical transmembrane proteins—has been updated and extended by taking into consideration consistently localized domains and motifs in globular proteins, too. By taking advantage of the recently developed CCTOP algorithm to determine the type of a protein and predict topology in case of transmembrane proteins, and by applying a thorough search for domains and motifs as well as utilizing the most up-to-date version of all source databases, we managed to reach a 6-fold increase in the size of the whole database and a 2-fold increase in the number of transmembrane proteins. Availability and implementation: TOPDOM database is available at The webpage utilizes the common Apache, PHP5 and MySQL software to provide the user interface for accessing and searching the database. The database itself is generated on a high performance computer. Contact: Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27153630

  7. Conservation of Transit Peptide-Independent Protein Import into the Mitochondrial and Hydrogenosomal Matrix

    PubMed Central

    Garg, Sriram; Stölting, Jan; Zimorski, Verena; Rada, Petr; Tachezy, Jan; Martin, William F.; Gould, Sven B.


    The origin of protein import was a key step in the endosymbiotic acquisition of mitochondria. Though the main translocon of the mitochondrial outer membrane, TOM40, is ubiquitous among organelles of mitochondrial ancestry, the transit peptides, or N-terminal targeting sequences (NTSs), recognised by the TOM complex, are not. To better understand the nature of evolutionary conservation in mitochondrial protein import, we investigated the targeting behavior of Trichomonas vaginalis hydrogenosomal proteins in Saccharomyces cerevisiae and vice versa. Hydrogenosomes import yeast mitochondrial proteins even in the absence of their native NTSs, but do not import yeast cytosolic proteins. Conversely, yeast mitochondria import hydrogenosomal proteins with and without their short NTSs. Conservation of an NTS-independent mitochondrial import route from excavates to opisthokonts indicates its presence in the eukaryote common ancestor. Mitochondrial protein import is known to entail electrophoresis of positively charged NTSs across the electrochemical gradient of the inner mitochondrial membrane. Our present findings indicate that mitochondrial transit peptides, which readily arise from random sequences, were initially selected as a signal for charge-dependent protein targeting specifically to the mitochondrial matrix. Evolutionary loss of the electron transport chain in hydrogenosomes and mitosomes lifted the selective constraints that maintain positive charge in NTSs, allowing first the NTS charge, and subsequently the NTS itself, to be lost. This resulted in NTS-independent matrix targeting, which is conserved across the evolutionary divide separating trichomonads and yeast, and which we propose is the ancestral state of mitochondrial protein import. PMID:26338186

  8. Conservation and variation in enamel protein distribution during vertebrate tooth development.


    Satchell, Paul G; Anderton, Xochitl; Ryu, Okhee H; Luan, Xianghong; Ortega, Adam J; Opamen, Rene; Berman, Brett J; Witherspoon, David E; Gutmann, James L; Yamane, Akira; Zeichner-David, Margerita; Simmer, James P; Shuler, Charles F; Diekwisch, Thomas G H


    Vertebrate enamel formation is a unique synthesis of the function of highly specialized enamel proteins and their effect on the growth and organization of apatite crystals. Among tetrapods, the physical structure of enamel is highly conserved, while there is a greater variety of enameloid tooth coverings in fish. In the present study, we postulated that in enamel microstructures of similar organization, the principle components of the enamel protein matrix would have to be highly conserved. In order to identify the enamel proteins that might be most highly conserved and thus potentially most essential to the process of mammalian enamel formation, we used immunoscreening with enamel protein antibodies as a means to assay for degrees of homology to mammalian enamel proteins. Enamel preparations from mouse, gecko, frog, lungfish, and shark were screened with mammalian enamel protein antibodies, including amelogenin, enamelin, tuftelin, MMP20, and EMSP1. Our results demonstrated that amelogenin was the most highly conserved enamel protein associated with the enamel organ, enamelin featured a distinct presence in shark enameloid but was also present in the enamel organ of other species, while the other enamel proteins, tuftelin, MMP20, and EMSP1, were detected in both in the enamel organ and in other tissues of all species investigated. We thus conclude that the investigated enamel proteins, amelogenin, enamelin, tuftelin, MMP20, and EMSP1, were highly conserved in a variety of vertebrate species. We speculate that there might be a unique correlation between amelogenin-rich tetrapod and lungfish enamel with long and parallel crystals and enamelin-rich basal vertebrate enameloid with diverse patterns of crystal organization. PMID:12210110

  9. Evolutionary Conservation of a GPCR-Independent Mechanism of Trimeric G Protein Activation

    PubMed Central

    Coleman, Brantley D.; Marivin, Arthur; Parag-Sharma, Kshitij; DiGiacomo, Vincent; Kim, Seongseop; Pepper, Judy S.; Casler, Jason; Nguyen, Lien T.; Koelle, Michael R.; Garcia-Marcos, Mikel


    Trimeric G protein signaling is a fundamental mechanism of cellular communication in eukaryotes. The core of this mechanism consists of activation of G proteins by the guanine-nucleotide exchange factor (GEF) activity of G protein coupled receptors. However, the duration and amplitude of G protein-mediated signaling are controlled by a complex network of accessory proteins that appeared and diversified during evolution. Among them, nonreceptor proteins with GEF activity are the least characterized. We recently found that proteins of the ccdc88 family possess a Gα-binding and activating (GBA) motif that confers GEF activity and regulates mammalian cell behavior. A sequence similarity-based search revealed that ccdc88 genes are highly conserved across metazoa but the GBA motif is absent in most invertebrates. This prompted us to investigate whether the GBA motif is present in other nonreceptor proteins in invertebrates. An unbiased bioinformatics search in Caenorhabditis elegans identified GBAS-1 (GBA and SPK domain containing-1) as a GBA motif-containing protein with homologs only in closely related worm species. We demonstrate that GBAS-1 has GEF activity for the nematode G protein GOA-1 and that the two proteins are coexpressed in many cells of living worms. Furthermore, we show that GBAS-1 can activate mammalian Gα-subunits and provide structural insights into the evolutionarily conserved determinants of the GBA–G protein interface. These results demonstrate that the GBA motif is a functional GEF module conserved among highly divergent proteins across evolution, indicating that the GBA-Gα binding mode is strongly constrained under selective pressure to mediate receptor-independent G protein activation in metazoans. PMID:26659249

  10. Evolutionary Conservation of a GPCR-Independent Mechanism of Trimeric G Protein Activation.


    Coleman, Brantley D; Marivin, Arthur; Parag-Sharma, Kshitij; DiGiacomo, Vincent; Kim, Seongseop; Pepper, Judy S; Casler, Jason; Nguyen, Lien T; Koelle, Michael R; Garcia-Marcos, Mikel


    Trimeric G protein signaling is a fundamental mechanism of cellular communication in eukaryotes. The core of this mechanism consists of activation of G proteins by the guanine-nucleotide exchange factor (GEF) activity of G protein coupled receptors. However, the duration and amplitude of G protein-mediated signaling are controlled by a complex network of accessory proteins that appeared and diversified during evolution. Among them, nonreceptor proteins with GEF activity are the least characterized. We recently found that proteins of the ccdc88 family possess a Gα-binding and activating (GBA) motif that confers GEF activity and regulates mammalian cell behavior. A sequence similarity-based search revealed that ccdc88 genes are highly conserved across metazoa but the GBA motif is absent in most invertebrates. This prompted us to investigate whether the GBA motif is present in other nonreceptor proteins in invertebrates. An unbiased bioinformatics search in Caenorhabditis elegans identified GBAS-1 (GBA and SPK domain containing-1) as a GBA motif-containing protein with homologs only in closely related worm species. We demonstrate that GBAS-1 has GEF activity for the nematode G protein GOA-1 and that the two proteins are coexpressed in many cells of living worms. Furthermore, we show that GBAS-1 can activate mammalian Gα-subunits and provide structural insights into the evolutionarily conserved determinants of the GBA-G protein interface. These results demonstrate that the GBA motif is a functional GEF module conserved among highly divergent proteins across evolution, indicating that the GBA-Gα binding mode is strongly constrained under selective pressure to mediate receptor-independent G protein activation in metazoans. PMID:26659249

  11. Identification of the conserved hypothetical protein BPSL0317 in Burkholderia pseudomallei K96243

    NASA Astrophysics Data System (ADS)

    Yusoff, Nur Syamimi; Damiri, Nadzirah; Firdaus-Raih, Mohd


    Burkholderia pseudomallei K96243 is the causative agent of melioidosis, a disease which is endemic in Northern Australia and Southeastern Asia. The genome encodes several essential proteins including those currently annotated as hypothetical proteins. We studied the conservation and the essentiality of expressed hypothetical proteins in normal and different stress conditions. Based on the comparative genomics, we identified a hypothetical protein, BPSL0317, a potential essential gene that is being expressed in all normal and stress conditions. BPSL0317 is also phylogenetically conserved in the Burkholderiales order suggesting that this protein is crucial for survival among the order's members. BPSL0317 therefore has a potential to be a candidate antimicrobial drug target for this group of bacteria.

  12. Proteomic Analysis of Pathogenic Fungi Reveals Highly Expressed Conserved Cell Wall Proteins

    PubMed Central

    Champer, Jackson; Ito, James I.; Clemons, Karl V.; Stevens, David A.; Kalkum, Markus


    We are presenting a quantitative proteomics tally of the most commonly expressed conserved fungal proteins of the cytosol, the cell wall, and the secretome. It was our goal to identify fungi-typical proteins that do not share significant homology with human proteins. Such fungal proteins are of interest to the development of vaccines or drug targets. Protein samples were derived from 13 fungal species, cultured in rich or in minimal media; these included clinical isolates of Aspergillus, Candida, Mucor, Cryptococcus, and Coccidioides species. Proteomes were analyzed by quantitative MSE (Mass Spectrometry—Elevated Collision Energy). Several thousand proteins were identified and quantified in total across all fractions and culture conditions. The 42 most abundant proteins identified in fungal cell walls or supernatants shared no to very little homology with human proteins. In contrast, all but five of the 50 most abundant cytosolic proteins had human homologs with sequence identity averaging 59%. Proteomic comparisons of the secreted or surface localized fungal proteins highlighted conserved homologs of the Aspergillus fumigatus proteins 1,3-β-glucanosyltransferases (Bgt1, Gel1-4), Crf1, Ecm33, EglC, and others. The fact that Crf1 and Gel1 were previously shown to be promising vaccine candidates, underlines the value of the proteomics data presented here. PMID:26878023

  13. Conservation and topology of protein interaction networks under duplication-divergence evolution

    PubMed Central

    Evlampiev, Kirill; Isambert, Hervé


    Genomic duplication-divergence processes are the primary source of new protein functions and thereby contribute to the evolutionary expansion of functional molecular networks. Yet, it is still unclear to what extent such duplication-divergence processes also restrict by construction the emerging properties of molecular networks, regardless of any specific cellular functions. We address this question, here, focusing on the evolution of protein–protein interaction (PPI) networks. We solve a general duplication-divergence model, based on the statistically necessary deletions of protein–protein interactions arising from stochastic duplications at various genomic scales, from single-gene to whole-genome duplications. Major evolutionary scenarios are shown to depend on two global parameters only: (i) a protein conservation index (M), which controls the evolutionary history of PPI networks, and (ii) a distinct topology index (M′) controlling their resulting structure. We then demonstrate that conserved, nondense networks, which are of prime biological relevance, are also necessarily scale-free by construction, irrespective of any evolutionary variations or fluctuations of the model parameters. It is shown to result from a fundamental linkage between individual protein conservation and network topology under general duplication-divergence evolution. By contrast, we find that conservation of network motifs with two or more proteins cannot be indefinitely preserved under general duplication-divergence evolution (independently from any network rewiring dynamics), in broad agreement with empirical evidence between phylogenetically distant species. All in all, these evolutionary constraints, inherent to duplication-divergence processes, appear to have largely controlled the overall topology and scale-dependent conservation of PPI networks, regardless of any specific biological function. PMID:18632555

  14. Bacterial periplasmic sialic acid-binding proteins exhibit a conserved binding site

    SciTech Connect

    Gangi Setty, Thanuja; Cho, Christine; Govindappa, Sowmya; Apicella, Michael A.; Ramaswamy, S.


    Structure–function studies of sialic acid-binding proteins from F. nucleatum, P. multocida, V. cholerae and H. influenzae reveal a conserved network of hydrogen bonds involved in conformational change on ligand binding. Sialic acids are a family of related nine-carbon sugar acids that play important roles in both eukaryotes and prokaryotes. These sialic acids are incorporated/decorated onto lipooligosaccharides as terminal sugars in multiple bacteria to evade the host immune system. Many pathogenic bacteria scavenge sialic acids from their host and use them for molecular mimicry. The first step of this process is the transport of sialic acid to the cytoplasm, which often takes place using a tripartite ATP-independent transport system consisting of a periplasmic binding protein and a membrane transporter. In this paper, the structural characterization of periplasmic binding proteins from the pathogenic bacteria Fusobacterium nucleatum, Pasteurella multocida and Vibrio cholerae and their thermodynamic characterization are reported. The binding affinities of several mutations in the Neu5Ac binding site of the Haemophilus influenzae protein are also reported. The structure and the thermodynamics of the binding of sugars suggest that all of these proteins have a very well conserved binding pocket and similar binding affinities. A significant conformational change occurs when these proteins bind the sugar. While the C1 carboxylate has been identified as the primary binding site, a second conserved hydrogen-bonding network is involved in the initiation and stabilization of the conformational states.

  15. Unconventional conservation among genes encoding small secreted salivary sland proteins from a gall midge

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Due to functional constraints associated with protein-coding sequences, introns and the 3’-untranslated region (UTR) of most genes vary the most, followed by the 5’-UTR. The coding region is the most conserved due to stronger functional constraints. During characterization of transcripts and gene...

  16. Sequence-related human proteins cluster by degree of evolutionary conservation

    NASA Astrophysics Data System (ADS)

    Mrowka, Ralf; Patzak, Andreas; Herzel, Hanspeter; Holste, Dirk


    Gene duplication followed by adaptive evolution is thought to be a central mechanism for the emergence of novel genes. To illuminate the contribution of duplicated protein-coding sequences to the complexity of the human genome, we study the connectivity of pairwise sequence-related human proteins and construct a network (N) of linked protein sequences with shared similarities. We find that (i) the connectivity distribution P(k) for k sequence-related proteins decays as a power law P(k)˜k-γ with γ≈1.2 , (ii) the top rank of N consists of a single large cluster of proteins (≈70%) , while bottom ranks consist of multiple isolated clusters, and (iii) structural characteristics of N show both a high degree of clustering and an intermediate connectivity (“small-world” features). We gain further insight into structural properties of N by studying the relationship between the connectivity distribution and the phylogenetic conservation of proteins in bacteria, plants, invertebrates, and vertebrates. We find that (iv) the proportion of sequence-related proteins increases with increasing extent of evolutionary conservation. Our results support that small-world network properties constitute a footprint of an evolutionary mechanism and extend the traditional interpretation of protein families.

  17. Structural and functional analysis of hypothetical and conserved proteins of Clostridium tetani.


    Enany, Shymaa


    The progress in biological technologies has led to rapid accumulation of microbial genomic sequences with a vast number of uncharacterized genes. Proteins encoded by these genes are usually uncharacterized, hypothetical, and/or conserved. In Clostridium tetani (C. tetani), these proteins constitute up to 50% of the expressed proteins. In this regard, understanding the functions and the structures of these proteins is crucially important, particularly in C. tetani, which is a medically important pathogen. Here, we used a variety of bioinformatics tools and databases to analyze 10 hypothetical and conserved proteins in C. tetani. We were able to provide a detailed overview of the functional contributions of some of these proteins in several cellular functions, including (1) evolving antibiotic resistance, (2) interaction with enzymes pathways, and (3) involvement in drug transportation. Among these candidates, we postulated the involvement of one of these hypothetical proteins in the pathogenic activity of tetanus. The structural and functional prediction of these proteins should serve in uncovering and better understanding the function of C. tetani cells to ultimately discover new possible drug targets. PMID:24802661

  18. Conserved patterns hidden within group A Streptococcus M protein hypervariability recognize human C4b-binding protein.


    Buffalo, Cosmo Z; Bahn-Suh, Adrian J; Hirakis, Sophia P; Biswas, Tapan; Amaro, Rommie E; Nizet, Victor; Ghosh, Partho


    No vaccine exists against group A Streptococcus (GAS), a leading cause of worldwide morbidity and mortality. A severe hurdle is the hypervariability of its major antigen, the M protein, with >200 different M types known. Neutralizing antibodies typically recognize M protein hypervariable regions (HVRs) and confer narrow protection. In stark contrast, human C4b-binding protein (C4BP), which is recruited to the GAS surface to block phagocytic killing, interacts with a remarkably large number of M protein HVRs (apparently ∼90%). Such broad recognition is rare, and we discovered a unique mechanism for this through the structure determination of four sequence-diverse M proteins in complexes with C4BP. The structures revealed a uniform and tolerant 'reading head' in C4BP, which detected conserved sequence patterns hidden within hypervariability. Our results open up possibilities for rational therapies that target the M-C4BP interaction, and also inform a path towards vaccine design. PMID:27595425

  19. Loss of ancestral N-glycosylation sites in conserved proteins during human evolution.


    Kim, Dong Seon; Choi, Dongjin; Hahn, Yoonsoo


    N-linked protein glycosylation is involved in various biological processes, such as protein quality control and adhesion or signaling among cells. The loss of ancestrally conserved N-glycosylation sites may result in the evolution of protein structure and function. In the present study, a mouse glycoproteome dataset and mammalian proteome data were assessed to identify 40 ancestral N-glycosylation sites in 37 proteins that disappeared during human evolution since the last common ancestor of the Euarchonta (primates and treeshrews). The results showed that each of the human proteins, CELSR1, ST3GAL5 and VSIG10, lost an ancestrally conserved N-glycosylation site following human-chimpanzee divergence. Notably, CELSR1 and ST3GAL5 are crucial for normal development and function of the mammalian nervous system, suggesting an association with the evolution of human cognitive function. Thus, the lost ancestrally conserved N-glycosylation sites identified in the present study may be useful targets for functional analyses to identify molecular changes linked with the evolution of human phenotypes. PMID:26458842

  20. Amino Acids of Conserved Kinase Motifs of Cytomegalovirus Protein UL97 Are Essential for Autophosphorylation

    PubMed Central

    Michel, Detlef; Kramer, Silke; Höhn, Simone; Schaarschmidt, Peter; Wunderlich, Kirsten; Mertens, Thomas


    Thirteen point mutations targeting predicted domains conserved in homologous protein kinases were introduced into the UL97 coding region of the human cytomegalovirus. All mutagenized proteins were expressed in cells infected with recombinant vaccinia viruses (rVV). Several mutations drastically reduced ganciclovir (GCV) phosphorylation. Mutations at amino acids G340, A442, L446, and F523 resulted in a complete loss of pUL97 phosphorylation, which was strictly associated with a loss of GCV phosphorylation. Our results confirm that in rVV-infected cells pUL97 phosphorylation is due to autophosphorylation and show that several amino acids conserved within domains of protein kinases are essential for this pUL97 phosphorylation. GCV phosphorylation is dependent on pUL97 phosphorylation. PMID:10482650

  1. The evolutionarily conserved Krueppel-associated box domain defines a subfamily of eukaryotic multifingered proteins

    SciTech Connect

    Bellefroid, E.J.; Poncelet, D.A.; Lecocq, P.J.; Revelant, O.; Martial, J.A. )


    The authors have previously shown that the human genome includes hundreds of genes coding for putative factors related to the Krueppel zinc-finger protein, which regulates Drosophila segmentation. They report herein that about one-third of these genes code for proteins that share a very conserved region of about 75 amino acids in their N-terminal nonfinger portion. Homologous regions are found in a number of previously described finger proteins, including mouse Zfp-1 and Xenopus Xfin. They named this region the Krueppel-associated box (KRAB). This domain has the potential to form two amphipathic {alpha}-helices. Southern blot analysis of zoo blots suggests that the Krueppel-associated box is highly conserved during evolution. Northern blot analysis shows that these genes are expressed in most adult tissues and are down-regulated during in vitro terminal differentiation of human myeloid cells.

  2. A general tendency for conservation of protein length across eukaryotic kingdoms.


    Wang, Daryi; Hsieh, Mufen; Li, Wen-Hsiung


    Protein elongation can occur in many ways, such as domain duplication or insertion and as recruitment of a transposable element fragment into the coding region, and it is believed to be a general tendency in protein evolution. Indeed, a previous study showed that yeast proteins are, on average, longer than their orthologs in bacteria, and in this study, we found that proteins in yeast, nematode, Drosophila, human, and Arabidopsis are, on average, longer than their orthologs in Escherichia coli. Surprisingly, however, we found conservation of protein sequence length across eukaryotic kingdoms. We collected 1,252 orthologous proteins from yeast, nematode, Drosophila, human, and Arabidopsis and found that the total length of these proteins is very similar among the five species and that there is no general tendency for a protein to increase or decrease in length. Furthermore, although paralogous proteins tend to undergo more sequence-length changes, there is also no general tendency for length increase. However, proteins that are commonly shared by Drosophila and human but not by yeast are, on average, substantially longer than proteins that are shared by yeast, Drosophila, and human. This is a puzzle that begs for an answer. PMID:15371528

  3. SLiMPrints: conservation-based discovery of functional motif fingerprints in intrinsically disordered protein regions

    PubMed Central

    Davey, Norman E.; Cowan, Joanne L.; Shields, Denis C.; Gibson, Toby J.; Coldwell, Mark J.; Edwards, Richard J.


    Large portions of higher eukaryotic proteomes are intrinsically disordered, and abundant evidence suggests that these unstructured regions of proteins are rich in regulatory interaction interfaces. A major class of disordered interaction interfaces are the compact and degenerate modules known as short linear motifs (SLiMs). As a result of the difficulties associated with the experimental identification and validation of SLiMs, our understanding of these modules is limited, advocating the use of computational methods to focus experimental discovery. This article evaluates the use of evolutionary conservation as a discriminatory technique for motif discovery. A statistical framework is introduced to assess the significance of relatively conserved residues, quantifying the likelihood a residue will have a particular level of conservation given the conservation of the surrounding residues. The framework is expanded to assess the significance of groupings of conserved residues, a metric that forms the basis of SLiMPrints (short linear motif fingerprints), a de novo motif discovery tool. SLiMPrints identifies relatively overconstrained proximal groupings of residues within intrinsically disordered regions, indicative of putatively functional motifs. Finally, the human proteome is analysed to create a set of highly conserved putative motif instances, including a novel site on translation initiation factor eIF2A that may regulate translation through binding of eIF4E. PMID:22977176

  4. A conserved family of proteins facilitates nascent lipid droplet budding from the ER

    PubMed Central

    Choudhary, Vineet; Ojha, Namrata; Golden, Andy


    Lipid droplets (LDs) are found in all cells and play critical roles in lipid metabolism. De novo LD biogenesis occurs in the endoplasmic reticulum (ER) but is not well understood. We imaged early stages of LD biogenesis using electron microscopy and found that nascent LDs form lens-like structures that are in the ER membrane, raising the question of how these nascent LDs bud from the ER as they grow. We found that a conserved family of proteins, fat storage-inducing transmembrane (FIT) proteins, is required for proper budding of LDs from the ER. Elimination or reduction of FIT proteins in yeast and higher eukaryotes causes LDs to remain in the ER membrane. Deletion of the single FIT protein in Caenorhabditis elegans is lethal, suggesting that LD budding is an essential process in this organism. Our findings indicated that FIT proteins are necessary to promote budding of nascent LDs from the ER. PMID:26504167

  5. Polyclonal antibody against conserved sequences of mce1A protein blocks MTB infection in macrophages.


    Sivagnanam, Sasikala; Namasivayam, Nalini; Chellam, Rajamanickam


    The pathogenesis of Mycobacterium tuberculosis is largely due to its ability to enter and survive within human macrophages. It is suggested that a specific protein namely mammalian cell entry protein is involved in the pathogenesis and the specific gene for this protein mce1A has been identified in several pathogenic organisms such as Rickettsia, Shigella, Escherichia coli, Helicobacter, Streptomyces, Klebsiella, Vibrio, Neisseria, Rhodococcus, Nocardioides, Saccharopolyspora erthyrae, and Pseudomonas. Analysis of mce1 operons in the above mentioned organisms through bioinformatics tools has revealed the presence of unique sequences (conserved regions) suggesting that these sequences may be involved in the process of infection. Presently, the mce1A full-length (1,365 bp) region from Mycobacterium bovis and its conserved regions (303 bp) were cloned in to an expression vector and the purified expressed proteins of molecular weight ~47 and ~11 kDa, respectively, were injected to rabbits to raise the polyclonal antibodies. The purified polyclonal antibodies were checked for their ability to inhibit the Mycobacterium infection in cultured human macrophages. In macrophage invasion assay, when antibody added at high concentration, decrease in viable counts was observed in all cell cultures within the first 5 days after infection, where the intracellular bacterial CFU obtained from the infected MTB increased by the 3rd day at low concentration of antibody. The macrophage invasion assay has indicated that the purified antibodies of mce1A conserved region can inhibit the infection of Mycobacterium. PMID:22159737

  6. Search for conserved amino acid residues of the [Formula: see text]-crystallin proteins of vertebrates.


    Shiliaev, Nikita G; Selivanova, Olga M; Galzitskaya, Oxana V


    [Formula: see text]-crystallin is the major eye lens protein and a member of the small heat-shock protein (sHsp) family. [Formula: see text]-crystallins have been shown to support lens clarity by preventing the aggregation of lens proteins. We performed the bioinformatics analysis of [Formula: see text]-crystallin sequences from vertebrates to find conserved amino acid residues as the three-dimensional (3D) structure of [Formula: see text]-crystallin is not identified yet. We are the first who demonstrated that the N-terminal region is conservative along with the central domain for vertebrate organisms. We have found that there is correlation between the conserved and structured regions. Moreover, amyloidogenic regions also correspond to the structured regions. We analyzed the amino acid composition of [Formula: see text]-crystallin A and B chains. Analyzing the occurrence of each individual amino acid residue, we have found that such amino acid residues as leucine, serine, lysine, proline, phenylalanine, histidine, isoleucine, glutamic acid, and valine change their content simultaneously in A and B chains in different classes of vertebrates. Aromatic amino acids occur more often in [Formula: see text]-crystallins from vertebrates than on the average in proteins among 17 animal proteomes. We obtained that the identity between A and B chains in the mammalian group is 0.35, which is lower than the published 0.60. PMID:26972563

  7. Comparative proteomics reveals a significant bias toward alternative protein isoforms with conserved structure and function.


    Ezkurdia, Iakes; del Pozo, Angela; Frankish, Adam; Rodriguez, Jose Manuel; Harrow, Jennifer; Ashman, Keith; Valencia, Alfonso; Tress, Michael L


    Advances in high-throughput mass spectrometry are making proteomics an increasingly important tool in genome annotation projects. Peptides detected in mass spectrometry experiments can be used to validate gene models and verify the translation of putative coding sequences (CDSs). Here, we have identified peptides that cover 35% of the genes annotated by the GENCODE consortium for the human genome as part of a comprehensive analysis of experimental spectra from two large publicly available mass spectrometry databases. We detected the translation to protein of "novel" and "putative" protein-coding transcripts as well as transcripts annotated as pseudogenes and nonsense-mediated decay targets. We provide a detailed overview of the population of alternatively spliced protein isoforms that are detectable by peptide identification methods. We found that 150 genes expressed multiple alternative protein isoforms. This constitutes the largest set of reliably confirmed alternatively spliced proteins yet discovered. Three groups of genes were highly overrepresented. We detected alternative isoforms for 10 of the 25 possible heterogeneous nuclear ribonucleoproteins, proteins with a key role in the splicing process. Alternative isoforms generated from interchangeable homologous exons and from short indels were also significantly enriched, both in human experiments and in parallel analyses of mouse and Drosophila proteomics experiments. Our results show that a surprisingly high proportion (almost 25%) of the detected alternative isoforms are only subtly different from their constitutive counterparts. Many of the alternative splicing events that give rise to these alternative isoforms are conserved in mouse. It was striking that very few of these conserved splicing events broke Pfam functional domains or would damage globular protein structures. This evidence of a strong bias toward subtle differences in CDS and likely conserved cellular function and structure is remarkable and

  8. Functional Advantages of Conserved Intrinsic Disorder in RNA-Binding Proteins

    PubMed Central

    Varadi, Mihaly; Zsolyomi, Fruzsina; Guharoy, Mainak; Tompa, Peter


    Proteins form large macromolecular assemblies with RNA that govern essential molecular processes. RNA-binding proteins have often been associated with conformational flexibility, yet the extent and functional implications of their intrinsic disorder have never been fully assessed. Here, through large-scale analysis of comprehensive protein sequence and structure datasets we demonstrate the prevalence of intrinsic structural disorder in RNA-binding proteins and domains. We addressed their functionality through a quantitative description of the evolutionary conservation of disordered segments involved in binding, and investigated the structural implications of flexibility in terms of conformational stability and interface formation. We conclude that the functional role of intrinsically disordered protein segments in RNA-binding is two-fold: first, these regions establish extended, conserved electrostatic interfaces with RNAs via induced fit. Second, conformational flexibility enables them to target different RNA partners, providing multi-functionality, while also ensuring specificity. These findings emphasize the functional importance of intrinsically disordered regions in RNA-binding proteins. PMID:26439842

  9. Conserved lamin A protein expression in differentiated cells in the earthworm Eudrilus eugeniae.


    Kalidas, Ramamoorthy M; Raja, Subramanian Elaiya; Mydeen, Sheik Abdul Kader Nagoor Meeran; Samuel, Selvan Christyraj Johnson Retnaraj; Durairaj, Selvan Christyraj Jackson; Nino, Gopi D; Palanichelvam, Karuppaiah; Vaithi, Arumugaswami; Sudhakar, Sivasubramaniam


    Lamin A is an intermediate filament protein found in most of the differentiated vertebrate cells but absent in stem cells. It shapes the skeletal frame structure beneath the inner nuclear membrane of the cell nucleus. As there are few studies of the expression of lamin A in invertebrates, in the present work, we have analyzed the sequence, immunochemical conservation and expression pattern of lamin A protein in the earthworm Eudrilus eugeniae, a model organism for tissue regeneration. The expression of lamin A has been confirmed in E. eugeniae by immunoblot. Its localization in the nuclear membrane has been observed by immunohistochemistry using two different rabbit anti-sera raised against human lamin A peptides, which are located at the C-terminus of the lamin A protein. These two antibodies detected 70 kDa lamin A protein in mice and a single 65 kDa protein in the earthworm. The Oct-4 positive undifferentiated blastemal tissues of regenerating earthworm do not express lamin A, while the Oct-4 negative differentiated cells express lamin A. This pattern was also confirmed in the earthworm prostate gland. The present study is the first evidence for the immunochemical identification of lamin A and Oct-4 in the earthworm. Along with the partial sequence obtained from the earthworm genome, the present results suggest that lamin A protein and its expression pattern is conserved from the earthworm to humans. PMID:25858151

  10. Role of the conserved oligomeric Golgi (COG) complex in protein glycosylation☆

    PubMed Central

    Smith, Richard D.; Lupashin, Vladimir V.


    The Golgi apparatus is a central hub for both protein and lipid trafficking/sorting and is also a major site for glycosylation in the cell. This organelle employs a cohort of peripheral membrane proteins and protein complexes to keep its structural and functional organization. The conserved oligomeric Golgi (COG) complex is an evolutionary conserved peripheral membrane protein complex that is proposed to act as a retrograde vesicle tethering factor in intra-Golgi trafficking. The COG protein complex consists of eight subunits, distributed in two lobes, Lobe A (Cog1–4) and Lobe B (Cog5–8). Malfunctions in the COG complex have a significant impact on processes such as protein sorting, glycosylation, and Golgi integrity. A deletion of Lobe A COG subunits in yeasts causes severe growth defects while mutations in COG1, COG7, and COG8 in humans cause novel types of congenital disorders of glycosylation. These pathologies involve a change in structural Golgi phenotype and function. Recent results indicate that down-regulation of COG function results in the resident Golgi glycosyltransferases/glycosidases to be mislocalized or degraded. PMID:18353293

  11. Properties of Sequence Conservation in Upstream Regulatory and Protein Coding Sequences among Paralogs in Arabidopsis thaliana

    NASA Astrophysics Data System (ADS)

    Richardson, Dale N.; Wiehe, Thomas

    Whole genome duplication (WGD) has catalyzed the formation of new species, genes with novel functions, altered expression patterns, complexified signaling pathways and has provided organisms a level of genetic robustness. We studied the long-term evolution and interrelationships of 5’ upstream regulatory sequences (URSs), protein coding sequences (CDSs) and expression correlations (EC) of duplicated gene pairs in Arabidopsis. Three distinct methods revealed significant evolutionary conservation between paralogous URSs and were highly correlated with microarray-based expression correlation of the respective gene pairs. Positional information on exact matches between sequences unveiled the contribution of micro-chromosomal rearrangements on expression divergence. A three-way rank analysis of URS similarity, CDS divergence and EC uncovered specific gene functional biases. Transcription factor activity was associated with gene pairs exhibiting conserved URSs and divergent CDSs, whereas a broad array of metabolic enzymes was found to be associated with gene pairs showing diverged URSs but conserved CDSs.

  12. A predicted protein interactome identifies conserved global networks and disease resistance subnetworks in maize

    PubMed Central

    Musungu, Bryan; Bhatnagar, Deepak; Brown, Robert L.; Fakhoury, Ahmad M.; Geisler, Matt


    Interactomes are genome-wide roadmaps of protein-protein interactions. They have been produced for humans, yeast, the fruit fly, and Arabidopsis thaliana and have become invaluable tools for generating and testing hypotheses. A predicted interactome for Zea mays (PiZeaM) is presented here as an aid to the research community for this valuable crop species. PiZeaM was built using a proven method of interologs (interacting orthologs) that were identified using both one-to-one and many-to-many orthology between genomes of maize and reference species. Where both maize orthologs occurred for an experimentally determined interaction in the reference species, we predicted a likely interaction in maize. A total of 49,026 unique interactions for 6004 maize proteins were predicted. These interactions are enriched for processes that are evolutionarily conserved, but include many otherwise poorly annotated proteins in maize. The predicted maize interactions were further analyzed by comparing annotation of interacting proteins, including different layers of ontology. A map of pairwise gene co-expression was also generated and compared to predicted interactions. Two global subnetworks were constructed for highly conserved interactions. These subnetworks showed clear clustering of proteins by function. Another subnetwork was created for disease response using a bait and prey strategy to capture interacting partners for proteins that respond to other organisms. Closer examination of this subnetwork revealed the connectivity between biotic and abiotic hormone stress pathways. We believe PiZeaM will provide a useful tool for the prediction of protein function and analysis of pathways for Z. mays researchers and is presented in this paper as a reference tool for the exploration of protein interactions in maize. PMID:26089837

  13. Novel hexamerization motif is discovered in a conserved cytoplasmic protein from Salmonella typhimurium.

    SciTech Connect

    Petrova, T.; Cuff, M.; Wu, R.; Kim, Y.; Holzle, D.; Joachimiak, A.; Biosciences Division; Inst. of Mathematical Problems of Biology


    The cytoplasmic protein Stm3548 of unknown function obtained from a strain of Salmonella typhimurium was determined by X-ray crystallography at a resolution of 2.25 A. The asymmetric unit contains a hexamer of structurally identical monomers. The monomer is a globular domain with a long beta-hairpin protrusion that distinguishes this structure. This beta-hairpin occupies a central position in the hexamer, and its residues participate in the majority of interactions between subunits of the hexamer. We suggest that the structure of Stm3548 presents a new hexamerization motif. Because the residues participating in interdomain interactions are highly conserved among close members of protein family DUF1355 and buried solvent accessible area for the hexamer is significant, the hexamer is most likely conserved as well. A light scattering experiment confirmed the presence of hexamer in solution.

  14. S-Bacillithiolation Protects Conserved and Essential Proteins Against Hypochlorite Stress in Firmicutes Bacteria

    PubMed Central

    Chi, Bui Khanh; Roberts, Alexandra A.; Huyen, Tran Thi Thanh; Bäsell, Katrin; Becher, Dörte; Albrecht, Dirk; Hamilton, Chris J.


    Abstract Aims: Protein S-bacillithiolations are mixed disulfides between protein thiols and the bacillithiol (BSH) redox buffer that occur in response to NaOCl in Bacillus subtilis. We used BSH-specific immunoblots, shotgun liquid chromatography (LC)–tandem mass spectrometry (MS/MS) analysis and redox proteomics to characterize the S-bacillithiolomes of B. subtilis, B. megaterium, B. pumilus, B. amyloliquefaciens, and Staphylococcus carnosus and also measured the BSH/oxidized bacillithiol disulfide (BSSB) redox ratio after NaOCl stress. Results: In total, 54 proteins with characteristic S-bacillithiolation (SSB) sites were identified, including 29 unique proteins and eight proteins conserved in two or more of these bacteria. The methionine synthase MetE is the most abundant S-bacillithiolated protein in Bacillus species after NaOCl exposure. Further, S-bacillithiolated proteins include the translation elongation factor EF-Tu and aminoacyl-tRNA synthetases (ThrS), the DnaK and GrpE chaperones, the two-Cys peroxiredoxin YkuU, the ferredoxin–NADP+ oxidoreductase YumC, the inorganic pyrophosphatase PpaC, the inosine-5′-monophosphate dehydrogenase GuaB, proteins involved in thiamine biosynthesis (ThiG and ThiM), queuosine biosynthesis (QueF), biosynthesis of aromatic amino acids (AroA and AroE), serine (SerA), branched-chain amino acids (YwaA), and homocysteine (LuxS and MetI). The thioredoxin-like proteins, YphP and YtxJ, are S-bacillithiolated at their active sites, suggesting a function in the de-bacillithiolation process. S-bacillithiolation is accompanied by a two-fold increase in the BSSB level and a decrease in the BSH/BSSB redox ratio in B. subtilis. Innovation: Many essential and conserved proteins, including the dominant MetE, were identified in the S-bacillithiolome of different Bacillus species and S. carnosus using shotgun-LC-MS/MS analyses. Conclusion: S-bacillithiolation is a widespread redox control mechanism among Firmicutes bacteria that protects

  15. Conserved Hydration Sites in Pin1 Reveal a Distinctive Water Recognition Motif in Proteins.


    Barman, Arghya; Smitherman, Crystal; Souffrant, Michael; Gadda, Giovanni; Hamelberg, Donald


    Structurally conserved water molecules are important for biomolecular stability, flexibility, and function. X-ray crystallographic studies of Pin1 have resolved a number of water molecules around the enzyme, including two highly conserved water molecules within the protein. The functional role of these localized water molecules remains unknown and unexplored. Pin1 catalyzes cis/trans isomerizations of peptidyl prolyl bonds that are preceded by a phosphorylated serine or threonine residue. Pin1 is involved in many subcellular signaling processes and is a potential therapeutic target for the treatment of several life threatening diseases. Here, we investigate the significance of these structurally conserved water molecules in the catalytic domain of Pin1 using molecular dynamics (MD) simulations, free energy calculations, analysis of X-ray crystal structures, and circular dichroism (CD) experiments. MD simulations and free energy calculations suggest the tighter binding water molecule plays a crucial role in maintaining the integrity and stability of a critical hydrogen-bonding network in the active site. The second water molecule is exchangeable with bulk solvent and is found in a distinctive helix-turn-coil motif. Structural bioinformatics analysis of nonredundant X-ray crystallographic protein structures in the Protein Data Bank (PDB) suggest this motif is present in several other proteins and can act as a water site, akin to the calcium EF hand. CD experiments suggest the isolated motif is in a distorted PII conformation and requires the protein environment to fully form the α-helix-turn-coil motif. This study provides valuable insights into the role of hydration in the structural integrity of Pin1 that can be exploited in protein engineering and drug design. PMID:26651388

  16. Structure of the conserved hypothetical protein MAL13P1.257 from Plasmodium falciparum

    PubMed Central

    Holmes, Margaret A.; Buckner, Frederick S.; Van Voorhis, Wesley C.; Mehlin, Christopher; Boni, Erica; Earnest, Thomas N.; DeTitta, George; Luft, Joseph; Lauricella, Angela; Anderson, Lori; Kalyuzhniy, Oleksandr; Zucker, Frank; Schoenfeld, Lori W.; Hol, Wim G. J.; Merritt, Ethan A.


    The structure of a conserved hypothetical protein, PlasmoDB sequence MAL13P1.257 from Plasmodium falciparum, Pfam sequence family PF05907, has been determined as part of the structural genomics effort of the Structural Genomics of Pathogenic Protozoa consortium. The structure was determined by multiple-wavelength anomalous dispersion at 2.17 Å resolution. The structure is almost entirely β-sheet; it consists of 15 β-strands and one short 310-helix and represents a new protein fold. The packing of the two monomers in the asymmetric unit indicates that the biological unit may be a dimer. PMID:16511296

  17. Cytoskeletal proteins participate in conserved viral strategies across kingdoms of life.


    Erb, Marcella L; Pogliano, Joe


    The discovery of tubulin-like cytoskeletal proteins carried on the genomes of bacteriophages that are actively used for phage propagation during both the lytic and lysogenic cycle have revealed that there at least two ways that viruses can utilize a cytoskeleton; co-opt the host cytoskeleton or bring their own homologues. Either strategy underscores the deep evolutionary relationship between viruses and cytoskeletal proteins and points to a conservation of viral strategies that crosses the kingdoms of life. Here we review some of the most recent discoveries about tubulin cytoskeletal elements encoded by phages and compare them to some of the strategies utilized by the gammaherpesvirues of mammalian cells. PMID:24055040

  18. Computational Design of Proteins Targeting the Conserved Stem Region of Influenza Hemagglutinin

    SciTech Connect

    Fleishman, Sarel J.; Whitehead, Timothy A.; Ekiert, Damian C.; Dreyfus, Cyrille; Corn, Jacob E.; Strauch, Eva-Maria; Wilson, Ian A.; Baker, David


    We describe a general computational method for designing proteins that bind a surface patch of interest on a target macromolecule. Favorable interactions between disembodied amino acid residues and the target surface are identified and used to anchor de novo designed interfaces. The method was used to design proteins that bind a conserved surface patch on the stem of the influenza hemagglutinin (HA) from the 1918 H1N1 pandemic virus. After affinity maturation, two of the designed proteins, HB36 and HB80, bind H1 and H5 HAs with low nanomolar affinity. Further, HB80 inhibits the HA fusogenic conformational changes induced at low pH. The crystal structure of HB36 in complex with 1918/H1 HA revealed that the actual binding interface is nearly identical to that in the computational design model. Such designed binding proteins may be useful for both diagnostics and therapeutics.

  19. Conserved transmembrane glycine residues in the Shigella flexneri polysaccharide co-polymerase protein WzzB influence protein-protein interactions.


    Papadopoulos, Magdalene; Tran, Elizabeth Ngoc Hoa; Murray, Gerald Laurence; Morona, Renato


    The O antigen (Oag) component of lipopolysaccharides (LPS) is crucial for virulence and Oag chain-length regulation is controlled by the polysaccharide co-polymerase class 1 (PCP1) proteins. Crystal structure analyses indicate that structural conservation among PCP1 proteins is highly maintained, however the mechanism of Oag modal-chain-length control remains to be fully elucidated. Shigella flexneri PCP1 protein WzzBSF confers a modal-chain length of 10-17 Oag repeat units (RUs), whereas the Salmonella enterica Typhimurium PCP1 protein WzzBST confers a modal-chain length of ~16-28 Oag RUs. Both proteins share >70 % overall sequence identity and contain two transmembrane (TM1 and TM2) regions, whereby a conserved proline-glycine-rich motif overlapping the TM2 region is identical in both proteins. Conserved glycine residues within TM2 are functionally important, as glycine to alanine substitutions at positions 305 and 311 confer very short Oag modal-chain length (~2-6 Oag RUs). In this study, WzzBSF was co-expressed with WzzBST in S. flexneri and a single intermediate modal-chain length of ~11-21 Oag RUs was observed, suggesting the presence of Wzz:Wzz interactions. Interestingly, co-expression of WzzBSF with WzzBG305A/G311A conferred a bimodal LPS Oag chain length (despite over 99 % protein sequence identity), and we hypothesized that the proteins fail to interact. Co-purification assays detected His6-WzzBSF co-purifying with FLAG-tagged WzzBST but not with FLAG-tagged WzzBG305A/G311A, supporting our hypothesis. These data indicate that the conserved glycine residues in TM2 are involved in Wzz:Wzz interactions, and provide insight into key interactions that drive Oag modal length control. PMID:27028755

  20. Evolutionarily conserved autoregulation of alternative pre-mRNA splicing by ribosomal protein L10a

    PubMed Central

    Takei, Satomi; Togo-Ohno, Marina; Suzuki, Yutaka; Kuroyanagi, Hidehito


    Alternative splicing of pre-mRNAs can regulate expression of protein-coding genes by generating unproductive mRNAs rapidly degraded by nonsense-mediated mRNA decay (NMD). Many of the genes directly regulated by alternative splicing coupled with NMD (AS-NMD) are related to RNA metabolism, but the repertoire of genes regulated by AS-NMD in vivo is to be determined. Here, we analyzed transcriptome data of wild-type and NMD-defective mutant strains of the nematode worm Caenorhabditis elegans and demonstrate that eight of the 82 cytoplasmic ribosomal protein (rp) genes generate unproductively spliced mRNAs. Knockdown of any of the eight rp genes exerted a dynamic and compensatory effect on alternative splicing of its own transcript and inverse effects on that of the other rp genes. A large subunit protein L10a, termed RPL-1 in nematodes, directly and specifically binds to an evolutionarily conserved 39-nt stretch termed L10ARE between the two alternative 5′ splice sites in its own pre-mRNA to switch the splice site choice. Furthermore, L10ARE-mediated splicing autoregulation of the L10a-coding gene is conserved in vertebrates. These results indicate that L10a is an evolutionarily conserved splicing regulator and that homeostasis of a subset of the rp genes are regulated at the level of pre-mRNA splicing in vivo. PMID:26961311

  1. The conserved KNOX domain mediates specificity of tobacco KNOTTED1-type homeodomain proteins.

    PubMed Central

    Sakamoto, T; Nishimura, A; Tamaoki, M; Kuba, M; Tanaka, H; Iwahori, S; Matsuoka, M


    Overproduction of the tobacco KNOTTED1-type homeodomain proteins NTH1, NTH15, and NTH23 in transgenic tobacco plants causes mild, severe, and no morphological alterations, respectively. The deduced amino acid sequences of the homeodomains and adjacent ELK domains are highly conserved, and the N-terminal KNOX domains also are moderately conserved. To investigate the contributions of both the conserved and divergent regions to the severity of morphological alterations, we generated chimeric proteins by exchanging different regions of NTH1, NTH15, and NTH23. The severity of the abnormal phenotype was dependent upon the synergistic action of both the N terminus, containing the KNOX domain, and the C terminus, containing the ELK homeodomain. Detailed analysis focusing on the C terminus revealed that the C-terminal half of the ELK domain is more effective in inducing the abnormal phenotypes than are the homeodomains. For the N terminus, severe morphological alterations were induced by exchanging a part of the KNOX domain of NTH1 with the corresponding region of NTH15. This limited region in the KNOX domain of all homeodomain proteins includes a predicted alpha-helical region, but only that in NTH15 is predicted to form a typical amphipathic structure. We discuss the possibility, based on these results, that the secondary structure of the KNOX domain is important for the induction of abnormal morphology in transgenic tobacco plants. PMID:10449577

  2. LRR Conservation Mapping to Predict Functional Sites within Protein Leucine-Rich Repeat Domains

    PubMed Central

    Helft, Laura; Reddy, Vignyan; Chen, Xiyang; Koller, Teresa; Federici, Luca; Fernández-Recio, Juan; Gupta, Rishabh; Bent, Andrew


    Computational prediction of protein functional sites can be a critical first step for analysis of large or complex proteins. Contemporary methods often require several homologous sequences and/or a known protein structure, but these resources are not available for many proteins. Leucine-rich repeats (LRRs) are ligand interaction domains found in numerous proteins across all taxonomic kingdoms, including immune system receptors in plants and animals. We devised Repeat Conservation Mapping (RCM), a computational method that predicts functional sites of LRR domains. RCM utilizes two or more homologous sequences and a generic representation of the LRR structure to identify conserved or diversified patches of amino acids on the predicted surface of the LRR. RCM was validated using solved LRR+ligand structures from multiple taxa, identifying ligand interaction sites. RCM was then used for de novo dissection of two plant microbe-associated molecular pattern (MAMP) receptors, EF-TU RECEPTOR (EFR) and FLAGELLIN-SENSING 2 (FLS2). In vivo testing of Arabidopsis thaliana EFR and FLS2 receptors mutagenized at sites identified by RCM demonstrated previously unknown functional sites. The RCM predictions for EFR, FLS2 and a third plant LRR protein, PGIP, compared favorably to predictions from ODA (optimal docking area), Consurf, and PAML (positive selection) analyses, but RCM also made valid functional site predictions not available from these other bioinformatic approaches. RCM analyses can be conducted with any LRR-containing proteins at, and the approach should be modifiable for use with other types of repeat protein domains. PMID:21789174

  3. Conserved evolutionary units in the heme-copper oxidase superfamily revealed by novel homologous protein families

    PubMed Central

    Pei, Jimin; Li, Wenlin; Kinch, Lisa N; Grishin, Nick V


    The heme-copper oxidase (HCO) superfamily includes HCOs in aerobic respiratory chains and nitric oxide reductases (NORs) in the denitrification pathway. The HCO/NOR catalytic subunit has a core structure consisting of 12 transmembrane helices (TMHs) arranged in three-fold rotational pseudosymmetry, with six conserved histidines for heme and metal binding. Using sensitive sequence similarity searches, we detected a number of novel HCO/NOR homologs and named them HCO Homology (HCOH) proteins. Several HCOH families possess only four TMHs that exhibit the most pronounced similarity to the last four TMHs (TMHs 9–12) of HCOs/NORs. Encoded by independent genes, four-TMH HCOH proteins represent a single evolutionary unit (EU) that relates to each of the three homologous EUs of HCOs/NORs comprising TMHs 1–4, TMHs 5–8, and TMHs 9–12. Single-EU HCOH proteins could form homotrimers or heterotrimers to maintain the general structure and ligand-binding sites defined by the HCO/NOR catalytic subunit fold. The remaining HCOH families, including NnrS, have 12-TMHs and three EUs. Most three-EU HCOH proteins possess two conserved histidines and could bind a single heme. Limited experimental studies and genomic context analysis suggest that many HCOH proteins could function in the denitrification pathway and in detoxification of reactive molecules such as nitric oxide. HCO/NOR catalytic subunits exhibit remarkable structural similarity to the homotrimers of MAPEG (membrane-associated proteins in eicosanoid and glutathione metabolism) proteins. Gene duplication, fusion, and fission likely play important roles in the evolution of HCOs/NORs and HCOH proteins. PMID:24931479

  4. Identification of human proteins functionally conserved with the yeast putative adaptors ADA2 and GCN5.

    PubMed Central

    Candau, R; Moore, P A; Wang, L; Barlev, N; Ying, C Y; Rosen, C A; Berger, S L


    Transcriptional adaptor proteins are required for full function of higher eukaryotic acidic activators in the yeast Saccharomyces cerevisiae, suggesting that this pathway of activation is evolutionarily conserved. Consistent with this view, we have identified possible human homologs of yeast ADA2 (yADA2) and yeast GCN5 (yGCN5), components of a putative adaptor complex. While there is overall sequence similarity between the yeast and human proteins, perhaps more significant is conservation of key sequence features with other known adaptors. We show several functional similarities between the human and yeast adaptors. First, as shown for yADA2 and yGCN5, human ADA2 (hADA2) and human GCN5 (hGCN5) interacted in vivo in a yeast two-hybrid assay. Moreover, hGCN5 interacted with yADA2 in this assay, suggesting that the human proteins form similar complexes. Second, both yADA2 and hADA2 contain cryptic activation domains. Third, hGCN5 and yGCN5 had similar stabilizing effects on yADA2 in vivo. Furthermore, the region of yADA2 that interacted with yGCN5 mapped to the amino terminus of yADA2, which is highly conserved in hADA2. Most striking, is the behavior of the human proteins in human cells. First, GAL4-hADA2 activated transcription in HeLa cells, and second, either hADA2 or hGCN5 augmented GAL4-VP16 activation. These data indicated that the human proteins correspond to functional homologs of the yeast adaptors, suggesting that these cofactors play a key role in transcriptional activation. PMID:8552087

  5. Crystal structure of AFV3-109, a highly conserved protein from crenarchaeal viruses

    PubMed Central

    Keller, Jenny; Leulliot, Nicolas; Cambillau, Christian; Campanacci, Valérie; Porciero, Stéphanie; Prangishvili, David; Forterre, Patrick; Cortez, Diego; Quevillon-Cheruel, Sophie; van Tilbeurgh, Herman


    The extraordinary morphologies of viruses infecting hyperthermophilic archaea clearly distinguish them from bacterial and eukaryotic viruses. Moreover, their genomes code for proteins that to a large extend have no related sequences in the extent databases. However, a small pool of genes is shared by overlapping subsets of these viruses, and the most conserved gene, exemplified by the ORF109 of the Acidianus Filamentous Virus 3, AFV3, is present on genomes of members of three viral familes, the Lipothrixviridae, Rudiviridae, and "Bicaudaviridae", as well as of the unclassified Sulfolobus Turreted Icosahedral Virus, STIV. We present here the crystal structure of the protein (Mr = 13.1 kD, 109 residues) encoded by the AFV3 ORF 109 in two different crystal forms at 1.5 and 1.3 Å resolution. The structure of AFV3-109 is a five stranded β-sheet with loops on one side and three helices on the other. It forms a dimer adopting the shape of a cradle that encompasses the best conserved regions of the sequence. No protein with a related fold could be identified except for the ortholog from STIV1, whose structure was deposited at the Protein Data Bank. We could clearly identify a well bound glycerol inside the cradle, contacting exclusively totally conserved residues. This interaction was confirmed in solution by fluorescence titration. Although the function of AFV3-109 cannot be deduced directly from its structure, structural homology with the STIV1 protein, and the size and charge distribution of the cavity suggested it could interact with nucleic acids. Fluorescence quenching titrations also showed that AFV3-109 interacts with dsDNA. Genomic sequence analysis revealed bacterial homologs of AFV3-109 as a part of a putative previously unidentified prophage sequences in some Firmicutes. PMID:17241456

  6. Structure of YqgQ Protein from Bacillus subtilis, a Conserved Hypothetical Protein

    SciTech Connect

    Lakshminarasimhan, D.; Eswaramoorthy, S; Burley, S; Swaminathan, S


    The crystal structure of the hypothetical protein YqgQ from Bacillus subtilis has been determined to 2.1 {angstrom} resolution. The crystals belonged to space group P2{sub 1}, with unit-cell parameters a = 51.85, b = 41.25, c = 55.18 {angstrom}, {beta} = 113.4{sup o}, and contained three protein molecules in the asymmetric unit. The structure was determined by the single-wavelength anomalous dispersion method using selenium-labeled protein and was refined to a final R factor of 24.7% (R{sub free} = 28.0%). The protein molecule mainly comprises a three-helical bundle. Its putative function is inferred to be single-stranded nucleic acid binding based on sequence and structural homology.

  7. Ser/Thr motifs in transmembrane proteins: conservation patterns and effects on local protein structure and dynamics.


    Del Val, Coral; White, Stephen H; Bondar, Ana-Nicoleta


    We combined systematic bioinformatics analyses and molecular dynamics simulations to assess the conservation patterns of Ser and Thr motifs in membrane proteins, and the effect of such motifs on the structure and dynamics of α-helical transmembrane (TM) segments. We find that Ser/Thr motifs are often present in β-barrel TM proteins. At least one Ser/Thr motif is present in almost half of the sequences of α-helical proteins analyzed here. The extensive bioinformatics analyses and inspection of protein structures led to the identification of molecular transporters with noticeable numbers of Ser/Thr motifs within the TM region. Given the energetic penalty for burying multiple Ser/Thr groups in the membrane hydrophobic core, the observation of transporters with multiple membrane-embedded Ser/Thr is intriguing and raises the question of how the presence of multiple Ser/Thr affects protein local structure and dynamics. Molecular dynamics simulations of four different Ser-containing model TM peptides indicate that backbone hydrogen bonding of membrane-buried Ser/Thr hydroxyl groups can significantly change the local structure and dynamics of the helix. Ser groups located close to the membrane interface can hydrogen bond to solvent water instead of protein backbone, leading to an enhanced local solvation of the peptide. PMID:22836667

  8. Ser/Thr Motifs in Transmembrane Proteins: Conservation Patterns and Effects on Local Protein Structure and Dynamics

    PubMed Central

    del Val, Coral; White, Stephen H.


    We combined systematic bioinformatics analyses and molecular dynamics simulations to assess the conservation patterns of Ser and Thr motifs in membrane proteins, and the effect of such motifs on the structure and dynamics of α-helical transmembrane (TM) segments. We find that Ser/Thr motifs are often present in β-barrel TM proteins. At least one Ser/Thr motif is present in almost half of the sequences of α-helical proteins analyzed here. The extensive bioinformatics analyses and inspection of protein structures led to the identification of molecular transporters with noticeable numbers of Ser/Thr motifs within the TM region. Given the energetic penalty for burying multiple Ser/Thr groups in the membrane hydrophobic core, the observation of transporters with multiple membrane-embedded Ser/Thr is intriguing and raises the question of how the presence of multiple Ser/Thr affects protein local structure and dynamics. Molecular dynamics simulations of four different Ser-containing model TM peptides indicate that backbone hydrogen bonding of membrane-buried Ser/Thr hydroxyl groups can significantly change the local structure and dynamics of the helix. Ser groups located close to the membrane interface can hydrogen bond to solvent water instead of protein backbone, leading to an enhanced local solvation of the peptide. PMID:22836667

  9. Topologically Conserved Residues Direct Heme Transport in HRG-1-related Proteins*

    PubMed Central

    Yuan, Xiaojing; Protchenko, Olga; Philpott, Caroline C.; Hamza, Iqbal


    Caenorhabditis elegans and human HRG-1-related proteins are conserved, membrane-bound permeases that bind and translocate heme in metazoan cells via a currently uncharacterized mechanism. Here, we show that cellular import of heme by HRG-1-related proteins from worms and humans requires strategically located amino acids that are topologically conserved across species. We exploit a heme synthesis-defective Saccharomyces cerevisiae mutant to model the heme auxotrophy of C. elegans and demonstrate that, under heme-deplete conditions, the endosomal CeHRG-1 requires both a specific histidine in the predicted second transmembrane domain (TMD2) and the FARKY motif in the C terminus tail for heme transport. By contrast, the plasma membrane CeHRG-4 transports heme by utilizing a histidine in the exoplasmic (E2) loop and the FARKY motif. Optimal activity under heme-limiting conditions, however, requires histidine in the E2 loop of CeHRG-1 and tyrosine in TMD2 of CeHRG-4. An analogous system exists in humans, because mutation of the synonymous histidine in TMD2 of hHRG-1 eliminates heme transport activity, implying an evolutionary conserved heme transport mechanism that predates vertebrate origins. Our results support a model in which heme is translocated across membranes facilitated by conserved amino acids positioned on the exoplasmic, cytoplasmic, and transmembrane regions of HRG-1-related proteins. These findings may provide a framework for understanding the structural basis of heme transport in eukaryotes and human parasites, which rely on host heme for survival. PMID:22174408

  10. A Conserved Apicomplexan Microneme Protein Contributes to Toxoplasma gondii Invasion and Virulence

    PubMed Central

    Huynh, My-Hang; Boulanger, Martin J.


    The obligate intracellular parasite Toxoplasma gondii critically relies on host cell invasion during infection. Proteins secreted from the apical micronemes are central components for host cell recognition, invasion, egress, and virulence. Although previous work established that the sporozoite protein with an altered thrombospondin repeat (SPATR) is a micronemal protein conserved in other apicomplexan parasites, including Plasmodium, Neospora, and Eimeria, no genetic evidence of its contribution to invasion has been reported. SPATR contains a predicted epidermal growth factor domain and two thrombospondin type 1 repeats, implying a role in host cell recognition. In this study, we assess the contribution of T. gondii SPATR (TgSPATR) to T. gondii invasion by genetically ablating it and restoring its expression by genetic complementation. Δspatr parasites were ∼50% reduced in invasion compared to parental strains, a defect that was reversed in the complemented strain. In mouse virulence assays, Δspatr parasites were significantly attenuated, with ∼20% of mice surviving infection. Given the conservation of this protein among the Apicomplexa, we assessed whether the Plasmodium falciparum SPATR ortholog (PfSPATR) could complement the absence of the TgSPATR. Although PfSPATR showed correct micronemal localization, it did not reverse the invasion deficiency of Δspatr parasites, because of an apparent failure in secretion. Overall, the results suggest that TgSPATR contributes to invasion and virulence, findings that have implications for the many genera and life stages of apicomplexans that express SPATR. PMID:25092910

  11. Structural conservation among the rhodopsin-like and other G protein-coupled receptors

    PubMed Central

    Kinoshita, Mikitaka; Okada, Tetsuji


    Intramolecular remote coupling within the polypeptide backbones of membrane proteins is difficult to analyze owing to the limited structural information available at the atomic level. Nonetheless, recent progress in the crystallographic study of G protein-coupled receptors (GPCRs) has provided an unprecedented opportunity for understanding the sophisticated architecture of heptahelical transmembrane (7TM) bundles. These 7TM bundles can respond to a wide range of extracellular stimuli while retaining the common function of binding trimeric G proteins. Here we have systematically analyzed select sets of inactive-like 7TM bundles to highlight the structural conservation of the receptors, in terms of intramolecular Cα-Cα distances. Distances with the highest scores were found to be dominated by the intrahelical distances of helix III, regardless of the choice of bundles in the set, indicating that the intracellular half of this helix is highly conserved. Unexpectedly, the distances between the cytoplasmic side of helix I and the extracellular region of helix VI provided the largest contribution to the high score populations among the interhelical pairs in most of the selected sets, including class B, C and frizzled receptors. These findings are expected to be valuable in further studies of GPCRs with unknown structure and of other protein families. PMID:25775952

  12. Two evolutionarily conserved repression domains in the Drosophila Kruppel protein differ in activator specificity.

    PubMed Central

    Hanna-Rose, W; Licht, J D; Hansen, U


    To identify biologically functional regions in the product of the Drosophila melanogaster gene Kruppel, we cloned the Kruppel homolog from Drosophila virilis. Both the previously identified amino (N)-terminal repression region and the DNA-binding region of the D. virilis Kruppel protein are greater than 96% identical to those of the D. melanogaster Kruppel protein, demonstrating a selective pressure to maintain the integrity of each region during 60 million to 80 million years of evolution. An additional region in the carboxyl (C) terminus of Kruppel that was most highly conserved was examined further. A 42-amino-acid stretch within the conserved C-terminal region also encoded a transferable repression domain. The short, C-terminal repression region is a composite of three subregions of distinct amino acid composition, each containing a high proportion of either basic, proline, or acidic residues. Mutagenesis experiments demonstrated, unexpectedly, that the acidic residues contribute to repression function. Both the N-terminal and C-terminal repression regions were tested for the ability to affect transcription mediated by a variety of activator proteins. The N-terminal repression region was able to inhibit transcription in the presence of multiple activators. However, the C-terminal repression region inhibited transcription by only a subset of the activator proteins. The different activator specificities of the two regions suggest that they repress transcription by different mechanisms and may play distinct biological roles during Drosophila development. PMID:9234738

  13. Subdominant Outer Membrane Antigens in Anaplasma marginale: Conservation, Antigenicity, and Protective Capacity Using Recombinant Protein

    PubMed Central

    Ducken, Deirdre R.; Brown, Wendy C.; Alperin, Debra C.; Brayton, Kelly A.; Reif, Kathryn E.; Turse, Joshua E.; Palmer, Guy H.; Noh, Susan M.


    Anaplasma marginale is a tick-borne rickettsial pathogen of cattle with a worldwide distribution. Currently a safe and efficacious vaccine is unavailable. Outer membrane protein (OMP) extracts or a defined surface protein complex reproducibly induce protective immunity. However, there are several knowledge gaps limiting progress in vaccine development. First, are these OMPs conserved among the diversity of A. marginale strains circulating in endemic regions? Second, are the most highly conserved outer membrane proteins in the immunogens recognized by immunized and protected animals? Lastly, can this subset of OMPs recognized by antibody from protected vaccinates and conserved among strains recapitulate the protection of outer membrane vaccines? To address the first goal, genes encoding OMPs AM202, AM368, AM854, AM936, AM1041, and AM1096, major subdominant components of the outer membrane, were cloned and sequenced from geographically diverse strains and isolates. AM202, AM936, AM854, and AM1096 share 99.9 to 100% amino acid identity. AM1041 has 97.1 to 100% and AM368 has 98.3 to 99.9% amino acid identity. While all four of the most highly conserved OMPs were recognized by IgG from animals immunized with outer membranes, linked surface protein complexes, or unlinked surface protein complexes and shown to be protected from challenge, the highest titers and consistent recognition among vaccinates were to AM854 and AM936. Consequently, animals were immunized with recombinant AM854 and AM936 and challenged. Recombinant vaccinates and purified outer membrane vaccinates had similar IgG and IgG2 responses to both proteins. However, the recombinant vaccinates developed higher bacteremia after challenge as compared to adjuvant-only controls and outer membrane vaccinates. These results provide the first evidence that vaccination with specific antigens may exacerbate disease. Progressing from the protective capacity of outer membrane formulations to recombinant vaccines

  14. Conservation of antigen components from two recombinant hybrid proteins protective against malaria.

    PubMed Central

    Knapp, B; Nau, U; Hundt, E


    Recently, we have shown that two hybrid proteins carrying partial sequences of the blood-stage antigens SERP, HRPII, and MSAI from Plasmodium falciparum confer protective immunity on Aotus monkeys against an experimental parasite infection (B. Knapp, E. Hundt, B. Enders, and H. A. Küpper, Infect. Immun. 60:2397-2401, 1992). The malarial components of the hybrid proteins consist of amino acid residues 630 to 892 of SERP, amino acid residues 146 to 260 of MSAI, and the 189 C-terminal residues of HRPII. We have studied the diversity of these protein regions in field isolates of P. falciparum. Genomic DNA was extracted from the blood of six donors from two different areas where malaria is endemic. The gene regions of SERP and MSAI coding for the corresponding sequences of the protective hybrid proteins and the exon II region of the HRPII gene were amplified by polymerase chain reaction and sequenced. All three regions were found to be highly conserved. In the 262-amino-acid fragment of SERP, one single conservative amino acid substitution was found. The exon II region of HRPII showed only a slight variability in number and arrangement of the repeat units. The 115-amino-acid fragment of MSAI which is located within an N-terminal region known to be conserved among different parasite strains was shown to be the most variable among the vaccine components: amino acid substitutions were found in 14 different positions of this MSAI region when both laboratory strains and field isolates were compared. PMID:8432609

  15. The evolutionarily conserved BMP-binding protein Twisted gastrulation promotes BMP signalling

    PubMed Central

    Oelgeschläger, Michael; Larraín, Juan; Geissert, Douglas; De Robertis, Eddy M.


    Dorsal-ventral patterning in vertebrate and Drosophila embryos requires a conserved system of extracellular proteins to generate a positional information gradient. The components involved include bone morphogenetic proteins (BMP/Dpp), a BMP antagonist (Chordin/Short gastrulation; Chd/Sog) and a secreted metalloproteinase (Xolloid/Tolloid) that cleaves Chd/Sog. Here we describe Xenopus Twisted gastrulation (xTsg), another member of this signalling pathway. xTsg is expressed ventrally as part of the BMP-4 synexpression group and encodes a secreted BMP-binding protein that is a BMP signalling agonist. The data suggest a molecular mechanism by which xTsg dislodges latent BMPs bound to Chordin BMP-binding fragments generated by Xolloid cleavage, providing a permissive signal that allows high BMP signalling in the embryo. Drosophila Tsg also binds BMPs and is expressed dorsally, supporting the proposal that the dorsal-ventral axis was inverted in the course of animal evolution. PMID:10866189

  16. Expression of the highly conserved vaccinia virus E6 protein is required for virion morphogenesis

    SciTech Connect

    Resch, Wolfgang; Weisberg, Andrea S.; Moss, Bernard


    The vaccinia virus E6R gene (VACVWR062) is conserved in all members of the poxvirus family and encodes a protein associated with the mature virion. We confirmed this association and provided evidence for an internal location. An inducible mutant that conditionally expresses E6 was constructed. In the absence of inducer, plaque formation and virus production were severely inhibited in several cell lines, whereas some replication occurred in others. This difference could be due to variation in the stringency of repression, since we could not isolate a stable deletion mutant even in the more 'permissive' cells. Under non-permissive conditions, viral late proteins were synthesized but processing of core proteins was inefficient, indicative of an assembly block. Transmission electron microscopy of sections of cells infected with the mutant in the absence of inducer revealed morphogenetic defects with crescents and empty immature virions adjacent to dense inclusions of viroplasm. Mature virions were infrequent and cores appeared to have lucent centers.

  17. PCNA-binding proteins in the archaea: novel functionality beyond the conserved core.


    MacNeill, Stuart A


    Sliding clamps play an essential role in coordinating protein activity in DNA metabolism in all three domains of life. In eukaryotes and archaea, the sliding clamp is PCNA (proliferating cell nuclear antigen). Across the diversity of the archaea PCNA interacts with a highly conserved set of proteins with key roles in DNA replication and repair, including DNA polymerases B and D, replication factor C, the Fen1 nuclease and RNAseH2, but this core set of factors is likely to represent a fraction of the PCNA interactome only. Here, I review three recently characterised non-core archaeal PCNA-binding proteins NusS, NreA/NreB and TIP, highlighting what is known of their interactions with PCNA and their functions in vivo and in vitro. Gaining a detailed understanding of the non-core PCNA interactome will provide significant insights into key aspects of chromosome biology in divergent archaeal lineages. PMID:26886233

  18. Hydra meiosis reveals unexpected conservation of structural synaptonemal complex proteins across metazoans

    PubMed Central

    Fraune, Johanna; Alsheimer, Manfred; Volff, Jean-Nicolas; Busch, Karoline; Fraune, Sebastian; Bosch, Thomas C. G.; Benavente, Ricardo


    The synaptonemal complex (SC) is a key structure of meiosis, mediating the stable pairing (synapsis) of homologous chromosomes during prophase I. Its remarkable tripartite structure is evolutionarily well conserved and can be found in almost all sexually reproducing organisms. However, comparison of the different SC protein components in the common meiosis model organisms Saccharomyces cerevisiae, Arabidopsis thaliana, Caenorhabditis elegans, Drosophila melanogaster, and Mus musculus revealed no sequence homology. This discrepancy challenged the hypothesis that the SC arose only once in evolution. To pursue this matter we focused on the evolution of SYCP1 and SYCP3, the two major structural SC proteins of mammals. Remarkably, our comparative bioinformatic and expression studies revealed that SYCP1 and SYCP3 are also components of the SC in the basal metazoan Hydra. In contrast to previous assumptions, we therefore conclude that SYCP1 and SYCP3 form monophyletic groups of orthologous proteins across metazoans. PMID:23012415

  19. Haemophilus influenzae vaccine candidate outer membrane protein P6 is not conserved in all strains

    PubMed Central

    Chang, Arthur; Kaur, Ravinder; Michel, Lea Vacca; Casey, Janet R


    An outer membrane protein (OMP) of nontypeable Haemophilus influenzae (NTHi), P6, is a vaccine candidate because it has been characterized as conserved among all H. influenzae strains. Among 151 isolates from children, age 6 to 30 months, evaluating NTHi nasopharyngeal (NP) and oropharyngeal (OP) colonization and tympanocentesis confirmed acute otitis media we identified 14 strains (9.3%) that had variant protein sequences of P6. One atypical omp P6 isolate had sequence mutations in the binding site of a proposed major antigenic epitope of omp P6 identified by monoclonal antibody 7F3. Eight strains (5.3%) had non-homologous variations in amino acids that could result in significant changes to the protein structure of P6, and 5 other strains had amino acid substitutions at four previously described key residue sites. These results show that NTHi omp P6 is not invariant in its structure among respiratory isolates from children. PMID:21285530

  20. A Conserved Streptococcal Membrane Protein, LsrS, Exhibits a Receptor-Like Function for Lantibiotics

    PubMed Central

    Biswas, Saswati


    Streptococcus mutans strain GS-5 produces a two-peptide lantibiotic, Smb, which displays inhibitory activity against a broad spectrum of bacteria, including other streptococci. For inhibition, lantibiotics must recognize specific receptor molecules present on the sensitive bacterial cells. However, so far no such receptor proteins have been identified for any lantibiotics. In this study, using a powerful transposon mutagenesis approach, we have identified in Streptococcus pyogenes a gene that exhibits a receptor-like function for Smb. The protein encoded by that gene, which we named LsrS, is a membrane protein belonging to the CAAX protease family. We also found that nisin, a monopeptide lantibiotic, requires LsrS for its optimum inhibitory activity. However, we found that LsrS is not required for inhibition by haloduracin and galolacticin, both of which are two-peptide lantibiotics closely related to Smb. LsrS appears to be a well-conserved protein that is present in many streptococci, including S. mutans. Inactivation of SMU.662, an LsrS homolog, in S. mutans strains UA159 and V403 rendered the cells refractory to Smb-mediated killing. Furthermore, overexpression of LsrS in S. mutans created cells more susceptible to Smb. Although LsrS and its homolog contain the CAAX protease domain, we demonstrate that inactivation of the putative active sites on the LsrS protein has no effect on its receptor-like function. This is the first report describing a highly conserved membrane protein that displays a receptor-like function for lantibiotics. PMID:24509319

  1. A conserved streptococcal membrane protein, LsrS, exhibits a receptor-like function for lantibiotics.


    Biswas, Saswati; Biswas, Indranil


    Streptococcus mutans strain GS-5 produces a two-peptide lantibiotic, Smb, which displays inhibitory activity against a broad spectrum of bacteria, including other streptococci. For inhibition, lantibiotics must recognize specific receptor molecules present on the sensitive bacterial cells. However, so far no such receptor proteins have been identified for any lantibiotics. In this study, using a powerful transposon mutagenesis approach, we have identified in Streptococcus pyogenes a gene that exhibits a receptor-like function for Smb. The protein encoded by that gene, which we named LsrS, is a membrane protein belonging to the CAAX protease family. We also found that nisin, a monopeptide lantibiotic, requires LsrS for its optimum inhibitory activity. However, we found that LsrS is not required for inhibition by haloduracin and galolacticin, both of which are two-peptide lantibiotics closely related to Smb. LsrS appears to be a well-conserved protein that is present in many streptococci, including S. mutans. Inactivation of SMU.662, an LsrS homolog, in S. mutans strains UA159 and V403 rendered the cells refractory to Smb-mediated killing. Furthermore, overexpression of LsrS in S. mutans created cells more susceptible to Smb. Although LsrS and its homolog contain the CAAX protease domain, we demonstrate that inactivation of the putative active sites on the LsrS protein has no effect on its receptor-like function. This is the first report describing a highly conserved membrane protein that displays a receptor-like function for lantibiotics. PMID:24509319

  2. Targeting of nucleotide-binding proteins by HAMLET--a conserved tumor cell death mechanism.


    Ho, J C S; Nadeem, A; Rydström, A; Puthia, M; Svanborg, C


    HAMLET (Human Alpha-lactalbumin Made LEthal to Tumor cells) kills tumor cells broadly suggesting that conserved survival pathways are perturbed. We now identify nucleotide-binding proteins as HAMLET binding partners, accounting for about 35% of all HAMLET targets in a protein microarray comprising 8000 human proteins. Target kinases were present in all branches of the Kinome tree, including 26 tyrosine kinases, 10 tyrosine kinase-like kinases, 13 homologs of yeast sterile kinases, 4 casein kinase 1 kinases, 15 containing PKA, PKG, PKC family kinases, 15 calcium/calmodulin-dependent protein kinase kinases and 13 kinases from CDK, MAPK, GSK3, CLK families. HAMLET acted as a broad kinase inhibitor in vitro, as defined in a screen of 347 wild-type, 93 mutant, 19 atypical and 17 lipid kinases. Inhibition of phosphorylation was also detected in extracts from HAMLET-treated lung carcinoma cells. In addition, HAMLET recognized 24 Ras family proteins and bound to Ras, RasL11B and Rap1B on the cytoplasmic face of the plasma membrane. Direct cellular interactions between HAMLET and activated Ras family members including Braf were confirmed by co-immunoprecipitation. As a consequence, oncogenic Ras and Braf activity was inhibited and HAMLET and Braf inhibitors synergistically increased tumor cell death in response to HAMLET. Unlike most small molecule kinase inhibitors, HAMLET showed selectivity for tumor cells in vitro and in vivo. The results identify nucleotide-binding proteins as HAMLET targets and suggest that dysregulation of the ATPase/kinase/GTPase machinery contributes to cell death, following the initial, selective recognition of HAMLET by tumor cells. The findings thus provide a molecular basis for the conserved tumoricidal effect of HAMLET, through dysregulation of kinases and oncogenic GTPases, to which tumor cells are addicted. PMID:26028028

  3. Identification and characterization of an Eimeria-conserved protein in Eimeria tenella.


    Dong, Hui; Wang, Yange; Han, Hongyu; Li, Ting; Zhao, Qiping; Zhu, Shunhai; Li, Liujia; Wu, Youling; Huang, Bing


    The precocious lines of Eimeria spp. have unique phenotypes. However, the genetic basis of the precocious phenotype is still poorly understood. The identification of Eimeria genes controlling the precocious phenotype is of immense importance in the fight against coccidiosis. In the present study, a novel gene of Eimeria maxima was cloned using rapid amplification of cDNA ends (RACE) based on the expressed sequence tag (EST). Homologous genes were also found in Eimeria tenella and Eimeria acervulina. Alignment of the amino acid sequences from E. tenella, E. maxima, and E. acervulina showed 80-86 % identity, demonstrating a conserved protein in different Eimeria spp. This gene, designated Eimeria-conserved protein (ECP), contained 235 amino acids with a predicted molecular mass of 25.4 kDa and had 100 % identity with one annotated protein from E. maxima (Emax_0517). Real-time PCR and Western blot analysis revealed that the expression of ECP at mRNA and protein level in E. tenella is developmentally regulated. Messenger RNA levels from the ECP gene were higher in sporozoites than in other developmental stages (unsporulated oocysts, sporulated oocysts, and second-generation merozoites). Expression of ECP protein was detected in unsporulated oocysts, increased in abundance in sporulated oocysts, and was most prominent in sporozoites. Thereafter, the level of the ECP protein decreased, and no ECP-specific protein was detected in second-generation merozoites. Immunostaining with anti-rECP indicated that ECP is highly concentrated in both refractile bodies (RB) of free sporozoites, but is located at the apical end of the sporozoites after invasion of DF-1 cells. The specific staining of the ECP protein becomes more intense in trophozoites and immature first-generation schizonts, but decreases in mature first-generation schizonts. Inhibition of the function of ECP using specific antibodies reduced the ability of E. tenella sporozoites to invade host cells. Compared with the

  4. Cep295 is a conserved scaffold protein required for generation of a bona fide mother centriole

    PubMed Central

    Tsuchiya, Yuki; Yoshiba, Satoko; Gupta, Akshari; Watanabe, Koki; Kitagawa, Daiju


    Centrioles surrounded by pericentriolar material (PCM) serve as the core structure of the centrosome. A newly formed daughter centriole grows into a functional mother centriole. However, the underlying mechanisms remain poorly understood. Here we show that Cep295, an evolutionarily conserved protein, is required for generation of a bona fide mother centriole organizing a functional centrosome. We find that Cep295 is recruited to the proximal centriole wall in the early stages of procentriole assembly. Cep295 then acts as a scaffold for the proper assembly of the daughter centriole. We also find that Cep295 binds directly to and recruits Cep192 onto the daughter centriole wall, which presumably endows the function of the new mother centriole for PCM assembly, microtubule-organizing centre activity and the ability for centriole formation. These findings led us to propose that Cep295 acts upstream of the conserved pathway for centriole formation and promotes the daughter-to-mother centriole conversion. PMID:27562453

  5. A conserved abundant cytoplasmic long noncoding RNA modulates repression by Pumilio proteins in human cells.


    Tichon, Ailone; Gil, Noa; Lubelsky, Yoav; Havkin Solomon, Tal; Lemze, Doron; Itzkovitz, Shalev; Stern-Ginossar, Noam; Ulitsky, Igor


    Thousands of long noncoding RNA (lncRNA) genes are encoded in the human genome, and hundreds of them are evolutionarily conserved, but their functions and modes of action remain largely obscure. Particularly enigmatic lncRNAs are those that are exported to the cytoplasm, including NORAD-an abundant and highly conserved cytoplasmic lncRNA. Here we show that most of the sequence of NORAD is comprised of repetitive units that together contain at least 17 functional binding sites for the two mammalian Pumilio homologues. Through binding to PUM1 and PUM2, NORAD modulates the mRNA levels of their targets, which are enriched for genes involved in chromosome segregation during cell division. Our results suggest that some cytoplasmic lncRNAs function by modulating the activities of RNA-binding proteins, an activity which positions them at key junctions of cellular signalling pathways. PMID:27406171

  6. Rbfox proteins regulate alternative mRNA splicing through evolutionarily conserved RNA bridges

    PubMed Central

    Lovci, Michael T; Ghanem, Dana; Marr, Henry; Arnold, Justin; Gee, Sherry; Parra, Marilyn; Liang, Tiffany Y; Stark, Thomas J; Gehman, Lauren T; Hoon, Shawn; Massirer, Katlin B; Pratt, Gabriel A; Black, Douglas L; Gray, Joe W; Conboy, John G; Yeo, Gene W


    Alternative splicing (AS) enables programmed diversity of gene expression across tissues and development. We show here that binding in distal intronic regions (>500 nucleotides (nt) from any exon) by Rbfox splicing factors important in development is extensive and is an active mode of splicing regulation. Similarly to exon-proximal sites, distal sites contain evolutionarily conserved GCATG sequences and are associated with AS activation and repression upon modulation of Rbfox abundance in human and mouse experimental systems. As a proof of principle, we validated the activity of two specific Rbfox enhancers in KIF21A and ENAH distal introns and showed that a conserved long-range RNA-RNA base-pairing interaction (an RNA bridge) is necessary for Rbfox-mediated exon inclusion in the ENAH gene. Thus we demonstrate a previously unknown RNA-mediated mechanism for AS control by distally bound RNA-binding proteins. PMID:24213538

  7. Rbfox proteins regulate alternative mRNA splicing through evolutionarily conserved RNA bridges.


    Lovci, Michael T; Ghanem, Dana; Marr, Henry; Arnold, Justin; Gee, Sherry; Parra, Marilyn; Liang, Tiffany Y; Stark, Thomas J; Gehman, Lauren T; Hoon, Shawn; Massirer, Katlin B; Pratt, Gabriel A; Black, Douglas L; Gray, Joe W; Conboy, John G; Yeo, Gene W


    Alternative splicing (AS) enables programmed diversity of gene expression across tissues and development. We show here that binding in distal intronic regions (>500 nucleotides (nt) from any exon) by Rbfox splicing factors important in development is extensive and is an active mode of splicing regulation. Similarly to exon-proximal sites, distal sites contain evolutionarily conserved GCATG sequences and are associated with AS activation and repression upon modulation of Rbfox abundance in human and mouse experimental systems. As a proof of principle, we validated the activity of two specific Rbfox enhancers in KIF21A and ENAH distal introns and showed that a conserved long-range RNA-RNA base-pairing interaction (an RNA bridge) is necessary for Rbfox-mediated exon inclusion in the ENAH gene. Thus we demonstrate a previously unknown RNA-mediated mechanism for AS control by distally bound RNA-binding proteins. PMID:24213538

  8. A conserved abundant cytoplasmic long noncoding RNA modulates repression by Pumilio proteins in human cells

    PubMed Central

    Tichon, Ailone; Gil, Noa; Lubelsky, Yoav; Havkin Solomon, Tal; Lemze, Doron; Itzkovitz, Shalev; Stern-Ginossar, Noam; Ulitsky, Igor


    Thousands of long noncoding RNA (lncRNA) genes are encoded in the human genome, and hundreds of them are evolutionarily conserved, but their functions and modes of action remain largely obscure. Particularly enigmatic lncRNAs are those that are exported to the cytoplasm, including NORAD—an abundant and highly conserved cytoplasmic lncRNA. Here we show that most of the sequence of NORAD is comprised of repetitive units that together contain at least 17 functional binding sites for the two mammalian Pumilio homologues. Through binding to PUM1 and PUM2, NORAD modulates the mRNA levels of their targets, which are enriched for genes involved in chromosome segregation during cell division. Our results suggest that some cytoplasmic lncRNAs function by modulating the activities of RNA-binding proteins, an activity which positions them at key junctions of cellular signalling pathways. PMID:27406171

  9. A conserved OmpA-like protein in Legionella pneumophila required for efficient intracellular replication.


    Goodwin, Ian P; Kumova, Ogan K; Ninio, Shira


    The OmpA-like protein domain has been associated with peptidoglycan-binding proteins, and is often found in virulence factors of bacterial pathogens. The intracellular pathogen Legionella pneumophila encodes for six proteins that contain the OmpA-like domain, among them the highly conserved uncharacterized protein we named CmpA. Here we set out to characterize the CmpA protein and determine its contribution to intracellular survival of L. pneumophila Secondary structure analysis suggests that CmpA is an inner membrane protein with a peptidoglycan-binding domain at the C-teminus. A cmpA mutant was able to replicate normally in broth, but failed to compete with an isogenic wild-type strain in an intracellular growth competition assay. The cmpA mutant also displayed significant intracellular growth defects in both the protozoan host Acanthamoeba castellanii and in primary bone marrow-derived macrophages, where uptake into the cells was also impaired. The cmpA phenotypes were completely restored upon expression of CmpA in trans The data presented here establish CmpA as a novel virulence factor of L. pneumophila that is required for efficient intracellular replication in both mammalian and protozoan hosts. PMID:27421957

  10. Conserved interdomain linker promotes phase separation of the multivalent adaptor protein Nck

    PubMed Central

    Banjade, Sudeep; Wu, Qiong; Mittal, Anuradha; Peeples, William B.; Pappu, Rohit V.; Rosen, Michael K.


    The organization of membranes, the cytosol, and the nucleus of eukaryotic cells can be controlled through phase separation of lipids, proteins, and nucleic acids. Collective interactions of multivalent molecules mediated by modular binding domains can induce gelation and phase separation in several cytosolic and membrane-associated systems. The adaptor protein Nck has three SRC-homology 3 (SH3) domains that bind multiple proline-rich segments in the actin regulatory protein neuronal Wiskott-Aldrich syndrome protein (N-WASP) and an SH2 domain that binds to multiple phosphotyrosine sites in the adhesion protein nephrin, leading to phase separation. Here, we show that the 50-residue linker between the first two SH3 domains of Nck enhances phase separation of Nck/N-WASP/nephrin assemblies. Two linear motifs within this element, as well as its overall positively charged character, are important for this effect. The linker increases the driving force for self-assembly of Nck, likely through weak interactions with the second SH3 domain, and this effect appears to promote phase separation. The linker sequence is highly conserved, suggesting that the sequence determinants of the driving forces for phase separation may be generally important to Nck functions. Our studies demonstrate that linker regions between modular domains can contribute to the driving forces for self-assembly and phase separation of multivalent proteins. PMID:26553976

  11. Two Conserved Cysteine Residues Are Required for the Masculinizing Activity of the Silkworm Masc Protein.


    Katsuma, Susumu; Sugano, Yudai; Kiuchi, Takashi; Shimada, Toru


    We have recently discovered that the Masculinizer (Masc) gene encodes a CCCH tandem zinc finger protein, which controls both masculinization and dosage compensation in the silkworm Bombyx mori. In this study, we attempted to identify functional regions or residues that are required for the masculinizing activity of the Masc protein. We constructed a series of plasmids that expressed the Masc derivatives and transfected them into a B. mori ovary-derived cell line, BmN-4. To assess the masculinizing activity of the Masc derivatives, we investigated the splicing patterns of B. mori doublesex (Bmdsx) and the expression levels of B. mori IGF-II mRNA-binding protein, a splicing regulator of Bmdsx, in Masc cDNA-transfected BmN-4 cells. We found that two zinc finger domains are not required for the masculinizing activity. We also identified that the C-terminal 288 amino acid residues are sufficient for the masculinizing activity of the Masc protein. Further detailed analyses revealed that two cysteine residues, Cys-301 and Cys-304, in the highly conserved region among lepidopteran Masc proteins are essential for the masculinizing activity in BmN-4 cells. Finally, we showed that Masc is a nuclear protein, but its nuclear localization is not tightly associated with the masculinizing activity. PMID:26342076

  12. Laa1p, a Conserved AP-1 Accessory Protein Important for AP-1 Localization in Yeast

    PubMed Central

    Fernández, G. Esteban


    AP-1 and Gga adaptors participate in clathrin-mediated protein transport between the trans-Golgi network and endosomes. Both adaptors contain homologous domains that act to recruit accessory proteins involved in clathrin-coated vesicle formation, but the spectrum of known adaptor-binding partners is limited. This study describes an evolutionarily conserved protein of Saccharomyces cerevisiae, Laa1p (Yjl207cp), that interacts and functions specifically with AP-1. Deletion of LAA1, when combined with a conditional mutation in clathrin heavy chain or deletion of GGA genes, accentuated growth defects and increased disruption of clathrin-dependent α-factor maturation and transport of carboxypeptidase Y to the vacuole. In contrast, such genetic interactions were not observed between deletions of LAA1 and AP-1 subunit genes. Laa1p preferentially interacted with AP-1 compared with Gga proteins by glutathione S-transferase-fusion affinity binding and coimmunoprecipitations. Localization of AP-1 and Laa1p, but not Gga proteins, was highly sensitive to brefeldin A, an inhibitor of ADP-ribosylation factor (Arf) activation. Importantly, deletion of LAA1 caused mislocalization of AP-1, especially in cells at high density (postdiauxic shift), but it did not affect Gga protein distribution. Our results identify Laa1p as a new determinant of AP-1 localization, suggesting a model in which Laa1p and Arf cooperate to direct stable association of AP-1 with appropriate intracellular membranes. PMID:16687571

  13. CENP-T proteins are conserved centromere receptors of the Ndc80 complex.


    Schleiffer, Alexander; Maier, Michael; Litos, Gabriele; Lampert, Fabienne; Hornung, Peter; Mechtler, Karl; Westermann, Stefan


    Centromeres direct the assembly of kinetochores, microtubule-attachment sites that allow chromosome segregation on the mitotic spindle. Fundamental differences in size and organization between evolutionarily distant eukaryotic centromeres have in many cases obscured general principles of their function. Here we demonstrate that centromere-binding proteins are highly conserved between budding yeast and humans. We identify the histone-fold protein Cnn1(CENP-T) as a direct centromere receptor of the microtubule-binding Ndc80 complex. The amino terminus of Cnn1 contains a conserved peptide motif that mediates stoichiometric binding to the Spc24-25 domain of the Ndc80 complex. Consistent with the critical role of this interaction, artificial tethering of the Ndc80 complex through Cnn1 allows mini-chromosomes to segregate in the absence of a natural centromere. Our results reveal the molecular function of CENP-T proteins and demonstrate how the Ndc80 complex is anchored to centromeres in a manner that couples chromosome movement to spindle dynamics. PMID:22561346

  14. Golgi Anti-apoptotic Proteins Are Highly Conserved Ion Channels That Affect Apoptosis and Cell Migration*

    PubMed Central

    Carrara, Guia; Saraiva, Nuno; Parsons, Maddy; Byrne, Bernadette; Prole, David L.; Taylor, Colin W.; Smith, Geoffrey L.


    Golgi anti-apoptotic proteins (GAAPs) are multitransmembrane proteins that are expressed in the Golgi apparatus and are able to homo-oligomerize. They are highly conserved throughout eukaryotes and are present in some prokaryotes and orthopoxviruses. Within eukaryotes, GAAPs regulate the Ca2+ content of intracellular stores, inhibit apoptosis, and promote cell adhesion and migration. Data presented here demonstrate that purified viral GAAPs (vGAAPs) and human Bax inhibitor 1 form ion channels and that vGAAP from camelpox virus is selective for cations. Mutagenesis of vGAAP, including some residues conserved in the recently solved structure of a related bacterial protein, BsYetJ, altered the conductance (E207Q and D219N) and ion selectivity (E207Q) of the channel. Mutation of residue Glu-207 or -178 reduced the effects of GAAP on cell migration and adhesion without affecting protection from apoptosis. In contrast, mutation of Asp-219 abrogated the anti-apoptotic activity of GAAP but not its effects on cell migration and adhesion. These results demonstrate that GAAPs are ion channels and define residues that contribute to the ion-conducting pore and affect apoptosis, cell adhesion, and migration independently. PMID:25713081

  15. Biochemical Roles for Conserved Residues in the Bacterial Fatty Acid-binding Protein Family.


    Broussard, Tyler C; Miller, Darcie J; Jackson, Pamela; Nourse, Amanda; White, Stephen W; Rock, Charles O


    Fatty acid kinase (Fak) is a ubiquitous Gram-positive bacterial enzyme consisting of an ATP-binding protein (FakA) that phosphorylates the fatty acid bound to FakB. In Staphylococcus aureus, Fak is a global regulator of virulence factor transcription and is essential for the activation of exogenous fatty acids for incorporation into phospholipids. The 1.2-Å x-ray structure of S. aureus FakB2, activity assays, solution studies, site-directed mutagenesis, and in vivo complementation were used to define the functions of the five conserved residues that define the FakB protein family (Pfam02645). The fatty acid tail is buried within the protein, and the exposed carboxyl group is bound by a Ser-93-fatty acid carboxyl-Thr-61-His-266 hydrogen bond network. The guanidinium of the invariant Arg-170 is positioned to potentially interact with a bound acylphosphate. The reduced thermal denaturation temperatures of the T61A, S93A, and H266A FakB2 mutants illustrate the importance of the hydrogen bond network in protein stability. The FakB2 T61A, S93A, and H266A mutants are 1000-fold less active in the Fak assay, and the R170A mutant is completely inactive. All FakB2 mutants form FakA(FakB2)2 complexes except FakB2(R202A), which is deficient in FakA binding. Allelic replacement shows that strains expressing FakB2 mutants are defective in fatty acid incorporation into phospholipids and virulence gene transcription. These conserved residues are likely to perform the same critical functions in all bacterial fatty acid-binding proteins. PMID:26774272

  16. A Broadly Conserved G-Protein-Coupled Receptor Kinase Phosphorylation Mechanism Controls Drosophila Smoothened Activity

    PubMed Central

    Maier, Dominic; Cheng, Shuofei; Faubert, Denis; Hipfner, David R.


    Hedgehog (Hh) signaling is essential for normal growth, patterning, and homeostasis of many tissues in diverse organisms, and is misregulated in a variety of diseases including cancer. Cytoplasmic Hedgehog signaling is activated by multisite phosphorylation of the seven-pass transmembrane protein Smoothened (Smo) in its cytoplasmic C-terminus. Aside from a short membrane-proximal stretch, the sequence of the C-terminus is highly divergent in different phyla, and the evidence suggests that the precise mechanism of Smo activation and transduction of the signal to downstream effectors also differs. To clarify the conserved role of G-protein-coupled receptor kinases (GRKs) in Smo regulation, we mapped four clusters of phosphorylation sites in the membrane-proximal C-terminus of Drosophila Smo that are phosphorylated by Gprk2, one of the two fly GRKs. Phosphorylation at these sites enhances Smo dimerization and increases but is not essential for Smo activity. Three of these clusters overlap with regulatory phosphorylation sites in mouse Smo and are highly conserved throughout the bilaterian lineages, suggesting that they serve a common function. Consistent with this, we find that a C-terminally truncated form of Drosophila Smo consisting of just the highly conserved core, including Gprk2 regulatory sites, can recruit the downstream effector Costal-2 and activate target gene expression, in a Gprk2-dependent manner. These results indicate that GRK phosphorylation in the membrane proximal C-terminus is an evolutionarily ancient mechanism of Smo regulation, and point to a higher degree of similarity in the regulation and signaling mechanisms of bilaterian Smo proteins than has previously been recognized. PMID:25009998

  17. A conserved archaeal pathway for tail-anchored membrane protein insertion

    PubMed Central

    Sherrill, John; Mariappan, Malaiyalam; Dominik, Pawel; Hegde, Ramanujan S.; Keenan, Robert J.


    Eukaryotic tail-anchored (TA) membrane proteins are inserted into the endoplasmic reticulum by a post-translational TRC40 pathway, but no comparable pathway is known in other domains of life. The crystal structure of an archaebacterial TRC40 sequence homolog bound to ADP•AlF4− reveals characteristic features of eukaryotic TRC40 including a zinc-mediated dimer and a large hydrophobic groove. Moreover, archaeal TRC40 interacts with the transmembrane domain of TA substrates and directs their membrane insertion. Thus, the TRC40 pathway is more broadly conserved than previously recognized. PMID:21658170

  18. Complex architecture of major histocompatibility complex class II promoters: reiterated motifs and conserved protein-protein interactions.

    PubMed Central

    Jabrane-Ferrat, N; Fontes, J D; Boss, J M; Peterlin, B M


    The S box (also known as at the H, W, or Z box) is the 5'-most element of the conserved upstream sequences in promoters of major histocompatibility complex class II genes. It is important for their B-cell-specific and interferon gamma-inducible expression. In this study, we demonstrate that the S box represents a duplication of the downstream X box. First, RFX, which is composed of the RFX5-p36 heterodimer that binds to the X box, also binds to the S box and its 5'-flanking sequence. Second, NF-Y, which binds to the Y box and increases interactions between RFX and the X box, also increases the binding of RFX to the S box. Third, RFXs bound to S and X boxes interact with each other in a spatially constrained manner. Finally, we confirmed these protein-protein and protein-DNA interactions by expressing a hybrid RFX5-VP16 protein in cells. We conclude that RFX binds to S and X boxes and that complex interactions between RFX and NF-Y direct B-cell-specific and interferon gamma-inducible expression or major histocompatibility complex class II genes. PMID:8756625

  19. The presence of disulfide bonds reveals an evolutionarily conserved mechanism involved in mitochondrial protein translocase assembly

    PubMed Central

    Wrobel, Lidia; Sokol, Anna M.; Chojnacka, Magdalena; Chacinska, Agnieszka


    Disulfide bond formation is crucial for the biogenesis and structure of many proteins that are localized in the intermembrane space of mitochondria. The importance of disulfide bond formation within mitochondrial proteins was extended beyond soluble intermembrane space proteins. Tim22, a membrane protein and core component of the mitochondrial translocase TIM22, forms an intramolecular disulfide bond in yeast. Tim22 belongs to the Tim17/Tim22/Tim23 family of protein translocases. Here, we present evidence of the high evolutionary conservation of disulfide bond formation in Tim17 and Tim22 among fungi and metazoa. Topological models are proposed that include the location of disulfide bonds relative to the predicted transmembrane regions. Yeast and human Tim22 variants that are not oxidized do not properly integrate into the membrane complex. Moreover, the lack of Tim17 oxidation disrupts the TIM23 translocase complex. This underlines the importance of disulfide bond formation for mature translocase assembly through membrane stabilization of weak transmembrane domains. PMID:27265872

  20. Conservation of distantly related membrane proteins: photosynthetic reaction centers share a common structural core.


    Sadekar, Sumedha; Raymond, Jason; Blankenship, Robert E


    Photosynthesis was established on Earth more than 3 billion years ago. All available evidences suggest that the earliest photosynthetic organisms were anoxygenic and that oxygen-evolving photosynthesis is a more recent development. The reaction center complexes that form the heart of the energy storage process are integral membrane pigment proteins that span the membrane in vectorial fashion to carry out electron transfer. The origin and extent of distribution of these proteins has been perplexing from a phylogenetic point of view mostly because of extreme sequence divergence. A series of integral membrane proteins of known structure and varying degrees of sequence identity have been compared using combinatorial extension-Monte Carlo methods. The proteins include photosynthetic reaction centers from proteobacteria and cyanobacterial photosystems I and II, as well as cytochrome oxidase, bacteriorhodopsin, and cytochrome b. The reaction center complexes show a remarkable conservation of the core structure of 5 transmembrane helices, strongly implying common ancestry, even though the residual sequence identity is less than 10%, whereas the other proteins have structures that are unrelated. A relationship of sequence with structure was derived from the reaction center structures; with characteristic decay length of 1.6 A. Phylogenetic trees derived from the structural alignments give insights into the earliest photosynthetic reaction center, strongly suggesting that it was a homodimeric complex that did not evolve oxygen. PMID:16887904

  1. Deletion of conserved protein phosphatases reverses defects associated with mitochondrial DNA damage in Saccharomyces cerevisiae.


    Garipler, Görkem; Mutlu, Nebibe; Lack, Nathan A; Dunn, Cory D


    Mitochondrial biogenesis is regulated by signaling pathways sensitive to extracellular conditions and to the internal environment of the cell. Therefore, treatments for disease caused by mutation of mtDNA may emerge from studies of how signal transduction pathways command mitochondrial function. We have examined the role of phosphatases under the control of the conserved α4/Tap42 protein in cells lacking a mitochondrial genome. We found that deletion of protein phosphatase 2A (PP2A) or of protein phosphatase 6 (PP6) protects cells from the reduced proliferation, mitochondrial protein import defects, lower mitochondrial electrochemical potential, and nuclear transcriptional response associated with mtDNA damage. Moreover, PP2A or PP6 deletion allows viability of a sensitized yeast strain after mtDNA loss. Interestingly, the Saccharomyces cerevisiae ortholog of the mammalian AMP-activated protein kinase was required for the full benefits of PP6 deletion and also for proliferation of otherwise wild-type cells lacking mtDNA. Our work highlights the important role that nutrient-responsive signaling pathways can play in determining the response to mitochondrial dysfunction. PMID:24474773

  2. Eukaryotic Initiation Factor 6, an evolutionarily conserved regulator of ribosome biogenesis and protein translation

    SciTech Connect

    Guo, Jianjun; Jin, Zhaoqing; Yang, Xiaohan; Li, Jian-Feng; Chen, Jay


    We recently identified Receptor for Activated C Kinase 1 (RACK1) as one of the molecular links between abscisic acid (ABA) signaling and its regulation on protein translation. Moreover, we identified Eukaryotic Initiation Factor 6 (eIF6) as an interacting partner of RACK1. Because the interaction between RACK1 and eIF6 in mammalian cells is known to regulate the ribosome assembly step of protein translation initiation, it was hypothesized that the same process of protein translation in Arabidopsis is also regulated by RACK1 and eIF6. In this article, we analyzed the amino acid sequences of eIF6 in different species from different lineages and discovered some intriguing differences in protein phosphorylation sites that may contribute to its action in ribosome assembly and biogenesis. In addition, we discovered that, distinct from non-plant organisms in which eIF6 is encoded by a single gene, all sequenced plant genomes contain two or more copies of eIF6 genes. While one copy of plant eIF6 is expressed ubiquitously and might possess the conserved function in ribosome biogenesis and protein translation, the other copy seems to be only expressed in specific organs and therefore may have gained some new functions. We proposed some important studies that may help us better understand the function of eIF6 in plants.

  3. 3D model for Cancerous Inhibitor of Protein Phosphatase 2A armadillo domain unveils highly conserved protein-protein interaction characteristics.


    Dahlström, Käthe M; Salminen, Tiina A


    Cancerous Inhibitor of Protein Phosphatase 2A (CIP2A) is a human oncoprotein, which exerts its cancer-promoting function through interaction with other proteins, for example Protein Phosphatase 2A (PP2A) and MYC. The lack of structural information for CIP2A significantly prevents the design of anti-cancer therapeutics targeting this protein. In an attempt to counteract this fact, we modeled the three-dimensional structure of the N-terminal domain (CIP2A-ArmRP), analyzed key areas and amino acids, and coupled the results to the existing literature. The model reliably shows a stable armadillo repeat fold with a positively charged groove. The fact that this conserved groove highly likely binds peptides is corroborated by the presence of a conserved polar ladder, which is essential for the proper peptide-binding mode of armadillo repeat proteins and, according to our results, several known CIP2A interaction partners appropriately possess an ArmRP-binding consensus motif. Moreover, we show that Arg229Gln, which has been linked to the development of cancer, causes a significant change in charge and surface properties of CIP2A-ArmRP. In conclusion, our results reveal that CIP2A-ArmRP shares the typical fold, protein-protein interaction site and interaction patterns with other natural armadillo proteins and that, presumably, several interaction partners bind into the central groove of the modeled CIP2A-ArmRP. By providing essential structural characteristics of CIP2A, the present study significantly increases our knowledge on how CIP2A interacts with other proteins in cancer progression and how to develop new therapeutics targeting CIP2A. PMID:26393783

  4. Evolutionary Conservation and Diversification of Puf RNA Binding Proteins and Their mRNA Targets

    PubMed Central

    Hogan, Gregory J.; Brown, Patrick O.; Herschlag, Daniel


    Reprogramming of a gene’s expression pattern by acquisition and loss of sequences recognized by specific regulatory RNA binding proteins may be a major mechanism in the evolution of biological regulatory programs. We identified that RNA targets of Puf3 orthologs have been conserved over 100–500 million years of evolution in five eukaryotic lineages. Focusing on Puf proteins and their targets across 80 fungi, we constructed a parsimonious model for their evolutionary history. This model entails extensive and coordinated changes in the Puf targets as well as changes in the number of Puf genes and alterations of RNA binding specificity including that: 1) Binding of Puf3 to more than 200 RNAs whose protein products are predominantly involved in the production and organization of mitochondrial complexes predates the origin of budding yeasts and filamentous fungi and was maintained for 500 million years, throughout the evolution of budding yeast. 2) In filamentous fungi, remarkably, more than 150 of the ancestral Puf3 targets were gained by Puf4, with one lineage maintaining both Puf3 and Puf4 as regulators and a sister lineage losing Puf3 as a regulator of these RNAs. The decrease in gene expression of these mRNAs upon deletion of Puf4 in filamentous fungi (N. crassa) in contrast to the increase upon Puf3 deletion in budding yeast (S. cerevisiae) suggests that the output of the RNA regulatory network is different with Puf4 in filamentous fungi than with Puf3 in budding yeast. 3) The coregulated Puf4 target set in filamentous fungi expanded to include mitochondrial genes involved in the tricarboxylic acid (TCA) cycle and other nuclear-encoded RNAs with mitochondrial function not bound by Puf3 in budding yeast, observations that provide additional evidence for substantial rewiring of post-transcriptional regulation. 4) Puf3 also expanded and diversified its targets in filamentous fungi, gaining interactions with the mRNAs encoding the mitochondrial electron transport

  5. Insights into Antiparallel Microtubule Crosslinking by PRC1, a Conserved Nonmotor Microtubule Binding Protein

    SciTech Connect

    Subramanian, Radhika; Wilson-Kubalek, Elizabeth M.; Arthur, Christopher P.; Bick, Matthew J.; Campbell, Elizabeth A.; Darst, Seth A.; Milligan, Ronald A.; Kapoor, Tarun M.


    Formation of microtubule architectures, required for cell shape maintenance in yeast, directional cell expansion in plants and cytokinesis in eukaryotes, depends on antiparallel microtubule crosslinking by the conserved MAP65 protein family. Here, we combine structural and single molecule fluorescence methods to examine how PRC1, the human MAP65, crosslinks antiparallel microtubules. We find that PRC1's microtubule binding is mediated by a structured domain with a spectrin-fold and an unstructured Lys/Arg-rich domain. These two domains, at each end of a homodimer, are connected by a linkage that is flexible on single microtubules, but forms well-defined crossbridges between antiparallel filaments. Further, we show that PRC1 crosslinks are compliant and do not substantially resist filament sliding by motor proteins in vitro. Together, our data show how MAP65s, by combining structural flexibility and rigidity, tune microtubule associations to establish crosslinks that selectively mark antiparallel overlap in dynamic cytoskeletal networks.

  6. A New DNA Binding Protein Highly Conserved in Diverse Crenarchaeal Viruses

    SciTech Connect

    Larson, E.T.; Eilers, B.J.; Reiter, D.; Ortmann, A.C.; Young, M.J.; Lawrence, C.M.; /Montana State U. /Tubingen U.


    Sulfolobus turreted icosahedral virus (STIV) infects Sulfolobus species found in the hot springs of Yellowstone National Park. Its 37 open reading frames (ORFs) generally lack sequence similarity to other genes. One exception, however, is ORF B116. While its function is unknown, orthologs are found in three additional crenarchaeal viral families. Due to the central importance of this protein family to crenarchaeal viruses, we have undertaken structural and biochemical studies of B116. The structure reveals a previously unobserved fold consisting of a five-stranded beta-sheet flanked on one side by three alpha helices. Two subunits come together to form a homodimer with a 10-stranded mixed beta-sheet, where the topology of the central strands resembles an unclosed beta-barrel. Highly conserved loops rise above the surface of the saddle-shaped protein and suggest an interaction with the major groove of DNA. The predicted B116-DNA interaction is confirmed by electrophoretic mobility shift assays.

  7. Nmf9 Encodes a Highly Conserved Protein Important to Neurological Function in Mice and Flies

    PubMed Central

    Zhang, Shuxiao; Ross, Kevin D.; Seidner, Glen A.; Gorman, Michael R.; Poon, Tiffany H.; Wang, Xiaobo; Keithley, Elizabeth M.; Lee, Patricia N.; Martindale, Mark Q.; Joiner, William J.; Hamilton, Bruce A.


    Many protein-coding genes identified by genome sequencing remain without functional annotation or biological context. Here we define a novel protein-coding gene, Nmf9, based on a forward genetic screen for neurological function. ENU-induced and genome-edited null mutations in mice produce deficits in vestibular function, fear learning and circadian behavior, which correlated with Nmf9 expression in inner ear, amygdala, and suprachiasmatic nuclei. Homologous genes from unicellular organisms and invertebrate animals predict interactions with small GTPases, but the corresponding domains are absent in mammalian Nmf9. Intriguingly, homozygotes for null mutations in the Drosophila homolog, CG45058, show profound locomotor defects and premature death, while heterozygotes show striking effects on sleep and activity phenotypes. These results link a novel gene orthology group to discrete neurological functions, and show conserved requirement across wide phylogenetic distance and domain level structural changes. PMID:26131556

  8. Vaccine-elicited Human T Cells Recognizing Conserved Protein Regions Inhibit HIV-1

    PubMed Central

    Borthwick, Nicola; Ahmed, Tina; Ondondo, Beatrice; Hayes, Peter; Rose, Annie; Ebrahimsa, Umar; Hayton, Emma-Jo; Black, Antony; Bridgeman, Anne; Rosario, Maximillian; Hill, Adrian VS; Berrie, Eleanor; Moyle, Sarah; Frahm, Nicole; Cox, Josephine; Colloca, Stefano; Nicosia, Alfredo; Gilmour, Jill; McMichael, Andrew J; Dorrell, Lucy; Hanke, Tomáš


    Virus diversity and escape from immune responses are the biggest challenges to the development of an effective vaccine against HIV-1. We hypothesized that T-cell vaccines targeting the most conserved regions of the HIV-1 proteome, which are common to most variants and bear fitness costs when mutated, will generate effectors that efficiently recognize and kill virus-infected cells early enough after transmission to potentially impact on HIV-1 replication and will do so more efficiently than whole protein-based T-cell vaccines. Here, we describe the first-ever administration of conserved immunogen vaccines vectored using prime-boost regimens of DNA, simian adenovirus and modified vaccinia virus Ankara to uninfected UK volunteers. The vaccine induced high levels of effector T cells that recognized virus-infected autologous CD4+ cells and inhibited HIV-1 replication by up to 5.79 log10. The virus inhibition was mediated by both Gag- and Pol- specific effector CD8+ T cells targeting epitopes that are typically subdominant in natural infection. These results provide proof of concept for using a vaccine to target T cells at conserved epitopes, showing that these T cells can control HIV-1 replication in vitro. PMID:24166483

  9. Characterization of a highly conserved baculovirus structural protein that is specific for occlusion-derived virions.


    Theilmann, D A; Chantler, J K; Stweart, S; Flipsen, H T; Vlak, J M; Crook, N E


    A highly conserved baculovirus late gene called odvp-6e was shown to be a structural protein that is specific for occlusion-derived virus (ODV) envelopes. The complete sequence of this gene is presented for both Orgyia pseudotsugata nuclear polyhedrosis virus (OpMNPV) and Cydia pomonella granulosis virus (CpGV). The predicted sizes of the OpMNPV and CpGV ODVP-6E are 40, 241, and 38,655 respectively. The OpMNPV odvp-6e gene was transcriptionally mapped and was shown to initiate from a consensus late gene motif, TTAAG, and is expressed from 18-120 hr postinfection. Polyclonal antiserum was generated against a bacterial fusion protein and used to analyze the cellular steady-state levels of ODVP-6E and to determine if this protein was a component of either budded virus (BV) or ODV. Western blots showed that ODVP-6E is a component of the ODV but not BV. This was confirmed by immunoelectron microscopy of ODV from Autographa californica NPV (AcMNPV) which localized ODVP-6E to the ODV envelope. The sequences of the odvp-6e gene from the baculoviruses Choristoneura fumiferana NPV (CfMNPV), AcMNPV, and Helicoverpa zea NPV (HzSNPV) were obtained from GenBank. Comparisons of the predicted amino acid sequences of OpMNPV, CpGV, AcMNPV, CfMNPV, and HzSNPV show that there are two possible membrane-spanning domains and a cysteine-rich domain that are conserved in all of the proteins. PMID:8615018

  10. Conservation of structural fluctuations in homologous protein kinases and its implications on functional sites.


    Kalaivani, Raju; de Brevern, Alexandre G; Srinivasan, Narayanaswamy


    Our aim is to explore the similarities in structural fluctuations of homologous kinases. Gaussian Network Model based Normal Mode Analysis was performed on 73 active conformation structures in Ser/Thr/Tyr kinase superfamily. Categories of kinases with progressive evolutionary divergence, viz. (i) Same kinase with many crystal structures, (ii) Within-Subfamily, (iii) Within-Family, (iv) Within-Group, and (v) Across-Group, were analyzed. We identified a flexibility signature conserved in all kinases involving residues in and around the catalytic loop with consistent low-magnitude fluctuations. However, the overall structural fluctuation profiles are conserved better in closely related kinases (Within-Subfamily and Within-family) than in distant ones (Within-Group and Across-Group). A substantial 65.4% of variation in flexibility was not accounted by variation in sequences or structures. Interestingly, we identified substructural residue-wise fluctuation patterns characteristic of kinases of different categories. Specifically, we recognized statistically significant fluctuations unique to families of protein kinase A, cyclin-dependent kinases, and nonreceptor tyrosine kinases. These fluctuation signatures localized to sites known to participate in protein-protein interactions typical of these kinase families. We report for the first time that residues characterized by fluctuations unique to the group/family are involved in interactions specific to the group/family. As highlighted for Src family, local regions with differential fluctuations are proposed as attractive targets for drug design. Overall, our study underscores the importance of consideration of fluctuations, over and above sequence and structural features, in understanding the roles of sites characteristic of kinases. Proteins 2016; 84:957-978. © 2016 Wiley Periodicals, Inc. PMID:27028938

  11. Prediction of functional sites in proteins using conserved functional group analysis.


    Innis, C Axel; Anand, A Prem; Sowdhamini, R


    A detailed knowledge of a protein's functional site is an absolute prerequisite for understanding its mode of action at the molecular level. However, the rapid pace at which sequence and structural information is being accumulated for proteins greatly exceeds our ability to determine their biochemical roles experimentally. As a result, computational methods are required which allow for the efficient processing of the evolutionary information contained in this wealth of data, in particular that related to the nature and location of functionally important sites and residues. The method presented here, referred to as conserved functional group (CFG) analysis, relies on a simplified representation of the chemical groups found in amino acid side-chains to identify functional sites from a single protein structure and a number of its sequence homologues. We show that CFG analysis can fully or partially predict the location of functional sites in approximately 96% of the 470 cases tested and that, unlike other methods available, it is able to tolerate wide variations in sequence identity. In addition, we discuss its potential in a structural genomics context, where automation, scalability and efficiency are critical, and an increasing number of protein structures are determined with no prior knowledge of function. This is exemplified by our analysis of the hypothetical protein Ydde_Ecoli, whose structure was recently solved by members of the North East Structural Genomics consortium. Although the proposed active site for this protein needs to be validated experimentally, this example illustrates the scope of CFG analysis as a general tool for the identification of residues likely to play an important role in a protein's biochemical function. Thus, our method offers a convenient solution to rapidly and automatically process the vast amounts of data that are beginning to emerge from structural genomics projects. PMID:15033369

  12. Conservation of protein abundance patterns reveals the regulatory architecture of the EGFR-MAPK pathway.


    Shi, Tujin; Niepel, Mario; McDermott, Jason E; Gao, Yuqian; Nicora, Carrie D; Chrisler, William B; Markillie, Lye M; Petyuk, Vladislav A; Smith, Richard D; Rodland, Karin D; Sorger, Peter K; Qian, Wei-Jun; Wiley, H Steven


    Various genetic mutations associated with cancer are known to alter cell signaling, but it is not clear whether they dysregulate signaling pathways by altering the abundance of pathway proteins. Using a combination of RNA sequencing and ultrasensitive targeted proteomics, we defined the primary components-16 core proteins and 10 feedback regulators-of the epidermal growth factor receptor (EGFR)-mitogen-activated protein kinase (MAPK) pathway in normal human mammary epithelial cells and then quantified their absolute abundance across a panel of normal and breast cancer cell lines as well as fibroblasts. We found that core pathway proteins were present at very similar concentrations across all cell types, with a variance similar to that of proteins previously shown to display conserved abundances across species. In contrast, EGFR and transcriptionally controlled feedback regulators were present at highly variable concentrations. The absolute abundance of most core proteins was between 50,000 and 70,000 copies per cell, but the adaptors SOS1, SOS2, and GAB1 were found at far lower amounts (2000 to 5000 copies per cell). MAPK signaling showed saturation in all cells between 3000 and 10,000 occupied EGFRs, consistent with the idea that adaptors limit signaling. Our results suggest that the relative stoichiometry of core MAPK pathway proteins is very similar across different cell types, with cell-specific differences mostly restricted to variable amounts of feedback regulators and receptors. The low abundance of adaptors relative to EGFR could be responsible for previous observations that only a fraction of total cell surface EGFR is capable of rapid endocytosis, high-affinity binding, and mitogenic signaling. PMID:27405981

  13. Conserved Arabidopsis ECHIDNA protein mediates trans-Golgi-network trafficking and cell elongation.


    Gendre, Delphine; Oh, Jaesung; Boutté, Yohann; Best, Jacob G; Samuels, Lacey; Nilsson, Robert; Uemura, Tomohiro; Marchant, Alan; Bennett, Malcolm J; Grebe, Markus; Bhalerao, Rishikesh P


    Multiple steps of plant growth and development rely on rapid cell elongation during which secretory and endocytic trafficking via the trans-Golgi network (TGN) plays a central role. Here, we identify the ECHIDNA (ECH) protein from Arabidopsis thaliana as a TGN-localized component crucial for TGN function. ECH partially complements loss of budding yeast TVP23 function and a Populus ECH complements the Arabidopsis ech mutant, suggesting functional conservation of the genes. Compared with wild-type, the Arabidopsis ech mutant exhibits severely perturbed cell elongation as well as defects in TGN structure and function, manifested by the reduced association between Golgi bodies and TGN as well as mislocalization of several TGN-localized proteins including vacuolar H(+)-ATPase subunit a1 (VHA-a1). Strikingly, ech is defective in secretory trafficking, whereas endocytosis appears unaffected in the mutant. Some aspects of the ech mutant phenotype can be phenocopied by treatment with a specific inhibitor of vacuolar H(+)-ATPases, concanamycin A, indicating that mislocalization of VHA-a1 may account for part of the defects in ech. Hence, ECH is an evolutionarily conserved component of the TGN with a central role in TGN structure and function. PMID:21512130

  14. Frataxin, a conserved mitochondrial protein, in the hydrogenosome of Trichomonas vaginalis.


    Dolezal, Pavel; Dancis, Andrew; Lesuisse, Emmanuel; Sutak, Róbert; Hrdý, Ivan; Embley, T Martin; Tachezy, Jan


    Recent data suggest that frataxin plays a key role in eukaryote cellular iron metabolism, particularly in mitochondrial heme and iron-sulfur (FeS) cluster biosynthesis. We have now identified a frataxin homologue (T. vaginalis frataxin) from the human parasite Trichomonas vaginalis. Instead of mitochondria, this unicellular eukaryote possesses hydrogenosomes, peculiar organelles that produce hydrogen but nevertheless share common ancestry with mitochondria. T. vaginalis frataxin contains conserved residues implicated in iron binding, and in silico, it is predicted to form a typical alpha-beta sandwich motif. The short N-terminal extension of T. vaginalis frataxin resembles presequences that target proteins to hydrogenosomes, a prediction confirmed by the results of overexpression of T. vaginalis frataxin in T. vaginalis. When expressed in the mitochondria of a frataxin-deficient Saccharomyces cerevisiae strain, T. vaginalis frataxin partially restored defects in heme and FeS cluster biosynthesis. Although components of heme synthesis or heme-containing proteins have not been found in T. vaginalis to date, T. vaginalis frataxin was also shown to interact with S. cerevisiae ferrochelatase by using a Biacore assay. The discovery of conserved iron-metabolizing pathways in mitochondria and hydrogenosomes provides additional evidence not only of their common evolutionary history, but also of the fundamental importance of this pathway for eukaryotes. PMID:17573543

  15. Vesicle formation from the nuclear membrane is induced by coexpression of two conserved herpesvirus proteins

    PubMed Central

    Klupp, Barbara G.; Granzow, Harald; Fuchs, Walter; Keil, Günther M.; Finke, Stefan; Mettenleiter, Thomas C.


    Although the nuclear envelope is a dynamic structure that disassembles and reforms during mitosis, the formation of membranous vesicles derived from the nuclear envelope has not yet been described in noninfected cells. However, during herpesvirus maturation, intranuclear capsids initiate transit to the cytosol for final maturation by budding at the inner nuclear membrane. Two conserved herpesvirus proteins are required for this primary envelopment, designated in the alphaherpesviruses as pUL31 and pUL34. Here, we show that simultaneous expression of pUL31 and pUL34 of the alphaherpesvirus pseudorabies virus in stably transfected rabbit kidney cells resulted in the formation of vesicles in the perinuclear space that resemble primary envelopes without a nucleocapsid. They contain pUL31 and pUL34 as shown by immunolabeling and are derived from the nuclear envelope. Thus, coexpression of only two conserved herpesvirus proteins without any other viral factor is sufficient to induce the formation of vesicles from the nuclear membrane. This argues for the contribution of cellular factors in this process either recruited from their natural cytoplasmic location or not yet identified as components of the nuclear compartment. PMID:17426144

  16. Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase.


    Kim, Meong Il; Hong, Minsun


    BA1544 from Bacillus anthracis was previously annotated as a transcription factor for the gene cluster ba1554 - ba1558, but has not been experimentally characterized. B. anthracis is an obligate pathogen causing fatal inhalational anthrax, and BA1544 is absolutely conserved in Bacillus species, including Bacillus cereus, Bacillus thuringiensis and Bacillus mycoides, with 100% sequence identity. To address the function of BA1544, we performed structural and biochemical studies, which revealed that BA1544 is a MazG protein. Thus, herein, the protein is defined as Bacillus-conserved MazG (BcMazG). Like other MazG structures, BcMazG assembles into a tetrameric architecture. Each monomer adopts a four-α-helix bundle that accommodates a metal ion using four acidic residues, and presents one putative substrate-binding site. Enzymatic characterization demonstrated that BcMazG is a nucleoside triphosphate (NTP) pyrophosphohydrolase and prefers adenosine triphosphate as a substrate among canonical NTPs. Moreover, structural comparison of BcMazG with its homologues revealed a potential regulation mechanism whereby the enzymatic activity of BcMazG is regulated by its C-terminal region. PMID:26920050

  17. The putative cell cycle gene, enhancer of rudimentary, encodes a highly conserved protein found in plants and animals.


    Gelsthorpe, M; Pulumati, M; McCallum, C; Dang-Vu, K; Tsubota, S I


    The enhancer of rudimentary gene, e(r), in Drosophila melanogaster encodes a protein, ER, whose function has been implicated in pyrimidine biosynthesis and the cell cycle (Wojcik et al. (1994) Genetics 138, 1163-1170). In order to identify conserved regions of the protein and potentially important functional domains, the e(r) gene was cloned and sequenced from two other insects (Drosophila virilis and Aedes aegypti) and three vertebrates (Homo sapiens, Mus musculus, and Brachydanio rerio) and sequenced from a flowering plant (Arabidopsis thaliana). These sequences along with those of a nematode (Caenorhabditis elegans) exhibit a high degree of identity. ER of Drosophila melanogaster is 76% identical to the three vertebrate proteins, 49% identical to the nematode protein, and 40% identical to the plant protein. There is high evolutionary conservation among the vertebrates. The mouse and human proteins are identical and differ from that of the zebrafish by a single conservative amino-acid change (valine for isoleucine). A dramatic sequence conservation is seen in the position of the hydrophobic amino acids. Of the 27 positions occupied by hydrophobic amino acids in ER of Drosophila melanogaster, 25 of the corresponding positions in the human protein, 23 of the positions in Caenorhabditis elegans, and 20 of the positions in Arabidopsis thaliana have hydrophobic amino acids. Most of these residues are present in three conserved amphipathic alpha-helices, which are proposed to function in protein-protein interactions. Two phosphorylation sites for casein kinase II (CKII) have also been conserved within the animal groups. Purified ER from Drosophila melanogaster is phosphorylated in vitro by CKII, arguing that these two sites are functional in vivo. A putative shift in the secondary structure of ER caused by the phosphorylation of these sites suggests that CKII may be regulating the activity of the ER in vivo. PMID:9074495

  18. A Large Gene Cluster Encoding Several Magnetosome Proteins Is Conserved in Different Species of Magnetotactic Bacteria

    PubMed Central

    Grünberg, Karen; Wawer, Cathrin; Tebo, Bradley M.; Schüler, Dirk


    In magnetotactic bacteria, a number of specific proteins are associated with the magnetosome membrane (MM) and may have a crucial role in magnetite biomineralization. We have cloned and sequenced the genes of several of these polypeptides in the magnetotactic bacterium Magnetospirillum gryphiswaldense that could be assigned to two different genomic regions. Except for mamA, none of these genes have been previously reported to be related to magnetosome formation. Homologous genes were found in the genome sequences of M. magnetotacticum and magnetic coccus strain MC-1. The MM proteins identified display homology to tetratricopeptide repeat proteins (MamA), cation diffusion facilitators (MamB), and HtrA-like serine proteases (MamE) or bear no similarity to known proteins (MamC and MamD). A major gene cluster containing several magnetosome genes (including mamA and mamB) was found to be conserved in all three of the strains investigated. The mamAB cluster also contains additional genes that have no known homologs in any nonmagnetic organism, suggesting a specific role in magnetosome formation. PMID:11571158

  19. An archaeal protein evolutionarily conserved in prokaryotes is a zinc-dependent metalloprotease

    PubMed Central

    Hu, Yongmei; Peng, Nan; Han, Wenyuan; Mei, Yuxia; Chen, Zhengjun; Feng, Xu; Liang, Yun Xiang; She, Qunxin


    A putative protease gene (tldD) was previously identified from studying tolerance of letD encoding the CcdB toxin of a toxin–antidote system of the F plasmid in Escherichia coli. While this gene is evolutionarily conserved in archaea and bacteria, the proteolytic activity of encoded proteins remained to be demonstrated experimentally. Here we studied Sso0660, an archaeal TldD homologue encoded in Sulfolobus solfataricus by overexpression of the recombinant protein and characterization of the purified enzyme. We found that the enzyme is active in degrading azocasein and FITC–BSA substrates. Protease inhibitor studies showed that EDTA and o-phenanthroline, two well-known metalloprotease inhibitors, either abolished completely or strongly inhibited the enzyme activity, and flame spectrometric analysis showed that a zinc ion is a cofactor of the protease. Furthermore, the protein forms disulfide bond via the Cys416 residue, yielding protein dimer that is the active form of the enzyme. These results establish for the first time that tidD genes encode zinc-containing proteases, classifying them as a family in the metalloprotease class. PMID:22950735

  20. Mammalian ets-1 and ets-2 genes encode highly conserved proteins

    SciTech Connect

    Watson, D.K.; McWilliams, M.J.; Lapis, P.; Lautenberger, J.A.; Schweinfest, C.W.; Papas, T.S. )


    Cellular ets sequences homologous to v-ets of the avian leukemia virus E26 are highly conserved. In mammals the ets sequences are dispersed on two separate chromosomal loci, called ets-1 and ets-2. To determine the structure of these two genes and identify the open reading frames that code for the putative proteins, the authors have sequenced human ets-1 cDNAs and ets-2 cDNA clones obtained from both human and mouse. The human ETS1 gene is capable of encoding a protein of 441 amino acids. This protein is >95% identical to the chicken c-ets-1 gene product. Thus, the human ETS1 gene is homologous to the chicken c-ets-1 gene, the protooncogene that the E26 virus transduced. Human and mouse ets-2 cDNA clones are closely related and contain open reading frames capable of encoding proteins of 469 and 468 residues, respectively. Direct comparison of these data with previously published finding indicates that ets is a family of genes whose members share distinct domains.

  1. Mammalian ets-1 and ets-2 genes encode highly conserved proteins.

    PubMed Central

    Watson, D K; McWilliams, M J; Lapis, P; Lautenberger, J A; Schweinfest, C W; Papas, T S


    Cellular ets sequences homologous to v-ets of the avian leukemia virus E26 are highly conserved. In mammals the ets sequences are dispersed on two separate chromosomal loci, called ets-1 and ets-2. To determine the structure of these two genes and identify the open reading frames that code for the putative proteins, we have sequenced human ets-1 cDNAs and ets-2 cDNA clones obtained from both human and mouse. The human ETS1 gene is capable of encoding a protein of 441 amino acids. This protein is greater than 95% identical to the chicken c-ets-1 gene product. Thus, the human ETS1 gene is homologous to the chicken c-ets-1 gene, the protooncogene that the E26 virus transduced. Human and mouse ets-2 cDNA clones are closely related and contain open reading frames capable of encoding proteins of 469 and 468 residues, respectively. Direct comparison of these data with previously published findings indicates that ets is a family of genes whose members share distinct domains. PMID:2847145

  2. Conserved cellular function and stress-mediated regulation among members of the proteolipid protein family.


    Fernández, María E; Alfonso, Julieta; Brocco, Marcela A; Frasch, Alberto C


    Chronic stress causes morphological alterations in the hippocampus of rodents and tree shrews, including atrophy of CA3 dendrites and loss of synapses. The molecular mechanisms underlying these structural changes remain largely unknown. We have previously identified M6a as a stress responsive gene and shown that M6a is involved in filopodium/spine outgrowth and, likely, synapse formation. M6a belongs to the proteolipid protein (PLP) family, all of their members having four transmembrane domains that allow their localization at the plasma membrane. In the present work, we analyzed other members of this family, the closely related M6b as well as PLP and its splice variant DM20. We found that chronic restraint stress in mice reduces M6b and DM20, but not PLP, mRNA levels in the hippocampus. In addition, M6b and DM20, but again not PLP, induce filopodium formation in primary cultures of hippocampal neurons. Several M6b protein isoforms were studied, all of them having similar effects except for the one lacking the transmembrane domains. Our results reveal a conserved cellular function and a stress-mediated regulation among members of the proteolipid protein family, suggesting an involvement of proteolipid proteins in the stress response. PMID:19937804

  3. CyDiv, a Conserved and Novel Filamentous Cyanobacterial Cell Division Protein Involved in Septum Localization

    PubMed Central

    Mandakovic, Dinka; Trigo, Carla; Andrade, Derly; Riquelme, Brenda; Gómez-Lillo, Gabriela; Soto-Liebe, Katia; Díez, Beatriz; Vásquez, Mónica


    Cell division in bacteria has been studied mostly in Escherichia coli and Bacillus subtilis, model organisms for Gram-negative and Gram-positive bacteria, respectively. However, cell division in filamentous cyanobacteria is poorly understood. Here, we identified a novel protein, named CyDiv (Cyanobacterial Division), encoded by the all2320 gene in Anabaena sp. PCC 7120. We show that CyDiv plays a key role during cell division. CyDiv has been previously described only as an exclusive and conserved hypothetical protein in filamentous cyanobacteria. Using polyclonal antibodies against CyDiv, we showed that it localizes at different positions depending on cell division timing: poles, septum, in both daughter cells, but also in only one of the daughter cells. The partial deletion of CyDiv gene generates partial defects in cell division, including severe membrane instability and anomalous septum localization during late division. The inability to complete knock out CyDiv strains suggests that it is an essential gene. In silico structural protein analyses and our experimental results suggest that CyDiv is an FtsB/DivIC-like protein, and could therefore, be part of an essential late divisome complex in Anabaena sp. PCC 7120. PMID:26903973

  4. Identification of a Novel Conserved B Cell Epitope in the N Protein of Equine Arteritis Virus (Bucyrus Strain).


    Chen, Jie; Guo, Xinggang; Li, Lianwei


    The nucleocapsid (N) protein is the most conserved structural protein in equine arteritis virus (EAV). This study aimed to identify the minimal conserved B cell epitope on the EAV N protein. The purified N protein was used to immunize mice for preparing monoclonal antibody (mAb). The reactivity of mAb was evaluated by Western blot and immunofluorescence assay. Moreover, 11 overlapping peptides (named MBP-N1 to MBP-N11) were designed to localize the linear antigenic epitope within the N protein. The peptides were identified by indirect enzyme-linked immunosorbent assay (ELISA) and Western blot. The minimal conserved B cell epitope on the EAV N protein was identified. The homology analysis was also performed. An EAV N-reactive mAb was selected and designated as 1C11. Indirect ELISA results showed that overlapping domain between MBP-N10 and MBP-N11 was recognized by the mAb 1C11. Furthermore, the indirect ELISA and Western blot showed that (101)QRKVAP(106) was the minimal linear epitope of the EAV N protein. The homology analysis showed that the identified epitope was conserved among all EAV strains analyzed in this work, with the exception of the ARVAC. One EAV N-specific mAb (1C11) was developed, and a minimal linear peptide epitope ((101)QRKVAP(106)) within the N protein was identified. PMID:26331346

  5. Molecular Characterization and Immune Protection of a New Conserved Hypothetical Protein of Eimeria tenella

    PubMed Central

    Zhai, Qi; Huang, Bing; Dong, Hui; Zhao, Qiping; Zhu, Shunhai; Liang, Siting; Li, Sha; Yang, Sihan; Han, Hongyu


    The genome sequences of Eimeria tenella have been sequenced, but >70% of these genes are currently categorized as having an unknown function or annotated as conserved hypothetical proteins, and few of them have been studied. In the present study, a conserved hypothetical protein gene of E. tenella, designated EtCHP559, was cloned using rapid amplification of cDNA 5'-ends (5'RACE) based on the expressed sequence tag (EST). The 1746-bp full-length cDNA of EtCHP559 contained a 1224-bp open reading frame (ORF) that encoded a 407-amino acid polypeptide with the predicted molecular weight of 46.04 kDa. Real-time quantitative PCR analysis revealed that EtCHP559 was expressed at higher levels in sporozoites than in the other developmental stages (unsporulated oocysts, sporulated oocysts and second generation merozoites). The ORF was inserted into pCold-TF to produce recombinant EtCHP559. Using western blotting, the recombinant protein was successfully recognized by rabbit serum against E. tenella sporozoites. Immunolocalization by using EtCHP559 antibody showed that EtCHP559 was mainly distributed on the parasite surface in free sporozoites and became concentrated in the anterior region after sporozoites were incubated in complete medium. The EtCHP559 became uniformly dispersed in immature and mature schizonts. Inhibition of EtCHP559 function using anti-rEtCHP559 polyclonal antibody reduced the ability of E. tenella sporozoites to invade host cells by >70%. Animal challenge experiments demonstrated that the recombinant EtCHP559 significantly increased the average body weight gain, reduced the oocyst outputs, alleviated cecal lesions of the infected chickens, and resulted in anticoccidial index >160 against E. tenella. These results suggest that EtCHP559 plays an important role in sporozoite invasion and could be an effective candidate for the development of a new vaccine against E. tenella. PMID:27309852

  6. Genomic Locations of Conserved Noncoding Sequences and Their Proximal Protein-Coding Genes in Mammalian Expression Dynamics.


    Babarinde, Isaac Adeyemi; Saitou, Naruya


    Experimental studies have found the involvement of certain conserved noncoding sequences (CNSs) in the regulation of the proximal protein-coding genes in mammals. However, reported cases of long range enhancer activities and inter-chromosomal regulation suggest that proximity of CNSs to protein-coding genes might not be important for regulation. To test the importance of the CNS genomic location, we extracted the CNSs conserved between chicken and four mammalian species (human, mouse, dog, and cattle). These CNSs were confirmed to be under purifying selection. The intergenic CNSs are often found in clusters in gene deserts, where protein-coding genes are in paucity. The distribution pattern, ChIP-Seq, and RNA-Seq data suggested that the CNSs are more likely to be regulatory elements and not corresponding to long intergenic noncoding RNAs. Physical distances between CNS and their nearest protein coding genes were well conserved between human and mouse genomes, and CNS-flanking genes were often found in evolutionarily conserved genomic neighborhoods. ChIP-Seq signal and gene expression patterns also suggested that CNSs regulate nearby genes. Interestingly, genes with more CNSs have more evolutionarily conserved expression than those with fewer CNSs. These computationally obtained results suggest that the genomic locations of CNSs are important for their regulatory functions. In fact, various kinds of evolutionary constraints may be acting to maintain the genomic locations of CNSs and protein-coding genes in mammals to ensure proper regulation. PMID:27017584

  7. Deorphanization and target validation of cross-tick species conserved novel Amblyomma americanum tick saliva protein

    PubMed Central

    Mulenga, Albert; Kim, Tae Kwon; Ibelli, Adriana Mércia Guaratini


    We previously identified a cross-tick species conserved tick feeding stimuli responsive Amblyomma americanum (Aam) AV422 gene. This study demonstrates that AamAV422 belongs to a novel group of arthropod proteins that is characterized by 14 cysteine amino acid residues: C23-X7/9-C33-X23/24-C58-C8-C67X7-X75-X23-C99-X15-C115-X10-C126X24/25/33-C150C151-X7-C159-X8-X168-X23/24-C192-X9/10-C202 predicted to form seven disulfide bonds. We show that AamAV422 protein is a ubiquitously expressed protein that is injected into the host within the first 24 h of the tick attaching onto the host as revealed by western blotting analyses of recombinant (r)AamAV422, tick saliva and dissected tick organ protein extracts using antibodies to 24 h and 48 h tick saliva proteins (TSPs). Native AamAV422 is apparently involved with mediating tick anti-hemostasis and anti-complement functions in that rAamAV422 delayed plasma clotting time in a dose responsive manner by up to ~160 s, prevented platelet aggregation by up to ~16% and caused ~24% reduction in production of terminal complement complexes. Target validation analysis revealed that rAamAV422 is a potential candidate for a cocktail or multivalent tick vaccine preparation in that RNA interference (RNAi)-mediated silencing of AamAV422 mRNA caused a statistically significant (~44%) reduction in tick engorgement weights, which is proxy for amounts of ingested blood. We speculate that AamAV422 is a potential target antigen for development of the highly desired universal tick vaccine in that consistent with high conservation among ticks, antibodies to 24 h Ixodes scapularis TSPs specifically bound rAamAV422. We discuss data in this study in the context of advancing the biology of tick feeding physiology and discovery of potential target antigens for tick vaccine development. PMID:23428900

  8. Annotation of Protein Domains Reveals Remarkable Conservation in the Functional Make up of Proteomes Across Superkingdoms

    PubMed Central

    Nasir, Arshan; Naeem, Aisha; Khan, Muhammad Jawad; Lopez-Nicora, Horacio D.; Caetano-Anollés, Gustavo


    The functional repertoire of a cell is largely embodied in its proteome, the collection of proteins encoded in the genome of an organism. The molecular functions of proteins are the direct consequence of their structure and structure can be inferred from sequence using hidden Markov models of structural recognition. Here we analyze the functional annotation of protein domain structures in almost a thousand sequenced genomes, exploring the functional and structural diversity of proteomes. We find there is a remarkable conservation in the distribution of domains with respect to the molecular functions they perform in the three superkingdoms of life. In general, most of the protein repertoire is spent in functions related to metabolic processes but there are significant differences in the usage of domains for regulatory and extra-cellular processes both within and between superkingdoms. Our results support the hypotheses that the proteomes of superkingdom Eukarya evolved via genome expansion mechanisms that were directed towards innovating new domain architectures for regulatory and extra/intracellular process functions needed for example to maintain the integrity of multicellular structure or to interact with environmental biotic and abiotic factors (e.g., cell signaling and adhesion, immune responses, and toxin production). Proteomes of microbial superkingdoms Archaea and Bacteria retained fewer numbers of domains and maintained simple and smaller protein repertoires. Viruses appear to play an important role in the evolution of superkingdoms. We finally identify few genomic outliers that deviate significantly from the conserved functional design. These include Nanoarchaeum equitans, proteobacterial symbionts of insects with extremely reduced genomes, Tenericutes and Guillardia theta. These organisms spend most of their domains on information functions, including translation and transcription, rather than on metabolism and harbor a domain repertoire characteristic of

  9. Conserved Immune Recognition Hierarchy of Mycobacterial PE/PPE Proteins during Infection in Natural Hosts

    PubMed Central

    Vordermeier, H. Martin; Hewinson, R. Glyn; Wilkinson, Robert J.; Wilkinson, Katalin A.; Gideon, Hannah P.; Young, Douglas B.; Sampson, Samantha L.


    The Mycobacterium tuberculosis genome contains two large gene families encoding proteins of unknown function, characterized by conserved N-terminal proline and glutamate (PE and PPE) motifs. The presence of a large number of PE/PPE proteins with repetitive domains and evidence of strain variation has given rise to the suggestion that these proteins may play a role in immune evasion via antigenic variation, while emerging data suggests that some family members may play important roles in mycobacterial pathogenesis. In this study, we examined cellular immune responses to a panel of 36 PE/PPE proteins during human and bovine infection. We observed a distinct hierarchy of immune recognition, reflected both in the repertoire of PE/PPE peptide recognition in individual cows and humans and in the magnitude of IFN-γ responses elicited by stimulation of sensitized host cells. The pattern of immunodominance was strikingly similar between cattle that had been experimentally infected with Mycobacterium bovis and humans naturally infected with clinical isolates of M. tuberculosis. The same pattern was maintained as disease progressed throughout a four-month course of infection in cattle, and between humans with latent as well as active tuberculosis. Detailed analysis of PE/PPE responses at the peptide level suggests that antigenic cross-reactivity amongst related family members is a major determinant in the observed differences in immune hierarchy. Taken together, these results demonstrate that a subset of PE/PPE proteins are major targets of the cellular immune response to tuberculosis, and are recognized at multiple stages of infection and in different disease states. Thus this work identifies a number of novel antigens that could find application in vaccine development, and provides new insights into PE/PPE biology. PMID:22870206

  10. Solution structure of villin 14T, a domain conserved among actin-severing proteins.

    PubMed Central

    Markus, M. A.; Nakayama, T.; Matsudaira, P.; Wagner, G.


    The solution structure of the N-terminal domain of the actin-severing protein villin has been determined by multidimensional heteronuclear resonance spectroscopy. Villin is a member of a family of actin-severing proteins that regulate the organization of actin in the eukaryotic cytoskeleton. Members of this family are built from 3 or 6 homologous repeats of a structural domain of approximately 130 amino acids that is unrelated to any previously known structure. The N-terminal domain of villin (14T) contains a central beta-sheet with 4 antiparallel strands and a fifth parallel strand at one edge. This sheet is sandwiched between 2 helices on one side and a 2-stranded parallel beta-sheet with another helix on the other side. The strongly conserved sequence characteristic of the protein family corresponds to internal hydrophobic residues. Calcium titration experiments suggest that there are 2 binding sites for Ca2+, a stronger site near the N-terminal end of the longest helix, with a Kd of 1.8 +/- 0.4 mM, and a weaker site near the C-terminal end of the same helix, with a Kd of 11 +/- 2 mM. Mutational and biochemical studies of this domain in several members of the family suggest that the actin monomer binding site is near the parallel strand at the edge of the central beta-sheet. PMID:8142900

  11. The functional conservation of proteins in evolutionary alleles and the dominant role of enhancers in evolution.

    PubMed Central

    Xue, L; Noll, M


    Drosophila paired- embryos can be rescued to viable adults by the evolutionary alleles prd-Gsb and prd-Pax3, which express the Drosophila Gooseberry and mouse Pax3 proteins under the control of the paired cis-regulatory region. As prd-Gsb uncovers a prd function involved in the proper abdominal segmentation of adults, evolutionary alleles, defined and constructed in this manner, may often be weak and thus serve to discover hitherto unknown functions of a gene. Our findings show that the Gooseberry and Pax3 proteins have conserved most or all functions of the related Drosophila Paired protein although their C-terminal halves appear unrelated in sequence but not in 3-D structure essential for function. It follows that the acquisition of new cis-regulatory regions rather than the divergence of the C-terminal coding regions has been the primary device for the functional diversification of the Drosophila genes paired and gooseberry and the mouse Pax3 gene. The operation of this mechanism in insects as well as vertebrates suggests a major role in evolution. Images PMID:8670876

  12. Global Alignment of Pairwise Protein Interaction Networks for Maximal Common Conserved Patterns


    Tian, Wenhong; Samatova, Nagiza F.


    A number of tools for the alignment of protein-protein interaction (PPI) networks have laid the foundation for PPI network analysis. Most of alignment tools focus on finding conserved interaction regions across the PPI networks through either local or global mapping of similar sequences. Researchers are still trying to improve the speed, scalability, and accuracy of network alignment. In view of this, we introduce a connected-components based fast algorithm, HopeMap, for network alignment. Observing that the size of true orthologs across species is small comparing to the total number of proteins in all species, we take a different approach basedmore » on a precompiled list of homologs identified by KO terms. Applying this approach to S. cerevisiae (yeast) and D. melanogaster (fly), E. coli K12 and S. typhimurium , E. coli K12 and C. crescenttus , we analyze all clusters identified in the alignment. The results are evaluated through up-to-date known gene annotations, gene ontology (GO), and KEGG ortholog groups (KO). Comparing to existing tools, our approach is fast with linear computational cost, highly accurate in terms of KO and GO terms specificity and sensitivity, and can be extended to multiple alignments easily.« less

  13. Role of conserved nucleotides in building the 16 S rRNA binding site for ribosomal protein S15.


    Serganov, A; Bénard, L; Portier, C; Ennifar, E; Garber, M; Ehresmann, B; Ehresmann, C


    Ribosomal protein S15 recognizes a highly conserved target on 16 S rRNA, which consists of two distinct binding regions. Here, we used extensive site-directed mutagenesis on a Escherichia coli 16 S rRNA fragment containing the S15 binding site, to investigate the role of conserved nucleotides in protein recognition and to evaluate the relative contribution of the two sites. The effect of mutations on S15 recognition was studied by measuring the relative binding affinity, RNA probing and footprinting. The crystallographic structure of the Thermus thermophilus complex allowed molecular modelling of the E. coli complex and facilitated interpretation of biochemical data. Binding is essentially driven by site 1, which includes a three-way junction constrained by a conserved base triple and cross-strand stacking. Recognition is based mainly on shape complementarity, and the role of conserved nucleotides is to maintain a unique backbone geometry. The wild-type base triple is absolutely required for protein interaction, while changes in the conserved surrounding nucleotides are partially tolerated. Site 2, which provides functional groups in a conserved G-U/G-C motif, contributes only modestly to the stability of the interaction. Binding to this motif is dependent on binding at site 1 and is allowed only if the two sites are in the correct relative orientation. Non-conserved bulged nucleotides as well as a conserved purine interior loop, although not directly involved in recognition, are used to provide an appropriate flexibility between the two sites. In addition, correct binding at the two sites triggers conformational adjustments in the purine interior loop and in a distal region, which are known to be involved for subsequent binding of proteins S6 and S18. Thus, the role of site 1 is to anchor S15 to the rRNA, while binding at site 2 is aimed to induce a cascade of events required for subunit assembly. PMID:11162092

  14. Novel and Conserved Protein Macoilin Is Required for Diverse Neuronal Functions in Caenorhabditis elegans

    PubMed Central

    Miyara, Akiko; Ohta, Akane; Okochi, Yoshifumi; Tsukada, Yuki; Kuhara, Atsushi; Mori, Ikue


    Neural signals are processed in nervous systems of animals responding to variable environmental stimuli. This study shows that a novel and highly conserved protein, macoilin (MACO-1), plays an essential role in diverse neural functions in Caenorhabditis elegans. maco-1 mutants showed abnormal behaviors, including defective locomotion, thermotaxis, and chemotaxis. Expression of human macoilin in the C. elegans nervous system weakly rescued the abnormal thermotactic phenotype of the maco-1 mutants, suggesting that macoilin is functionally conserved across species. Abnormal thermotaxis may have been caused by impaired locomotion of maco-1 mutants. However, calcium imaging of AFD thermosensory neurons and AIY postsynaptic interneurons of maco-1 mutants suggest that macoilin is required for appropriate responses of AFD and AIY neurons to thermal stimuli. Studies on localization of MACO-1 showed that C. elegans and human macoilins are localized mainly to the rough endoplasmic reticulum. Our results suggest that macoilin is required for various neural events, such as the regulation of neuronal activity. PMID:21589894

  15. Novel and conserved protein macoilin is required for diverse neuronal functions in Caenorhabditis elegans.


    Miyara, Akiko; Ohta, Akane; Okochi, Yoshifumi; Tsukada, Yuki; Kuhara, Atsushi; Mori, Ikue


    Neural signals are processed in nervous systems of animals responding to variable environmental stimuli. This study shows that a novel and highly conserved protein, macoilin (MACO-1), plays an essential role in diverse neural functions in Caenorhabditis elegans. maco-1 mutants showed abnormal behaviors, including defective locomotion, thermotaxis, and chemotaxis. Expression of human macoilin in the C. elegans nervous system weakly rescued the abnormal thermotactic phenotype of the maco-1 mutants, suggesting that macoilin is functionally conserved across species. Abnormal thermotaxis may have been caused by impaired locomotion of maco-1 mutants. However, calcium imaging of AFD thermosensory neurons and AIY postsynaptic interneurons of maco-1 mutants suggest that macoilin is required for appropriate responses of AFD and AIY neurons to thermal stimuli. Studies on localization of MACO-1 showed that C. elegans and human macoilins are localized mainly to the rough endoplasmic reticulum. Our results suggest that macoilin is required for various neural events, such as the regulation of neuronal activity. PMID:21589894

  16. [Construction of recombinant adenoviral vector expressing genes of the conservative influenza proteins M2 and nucleoprotein].


    Esmagambetov, I B; Sedova, E S; Shcherbinin, D N; Lysenko, A A; Garas, M N; Shmarov, M M; Logunov, D Iu


    Influenza is a highly contagious and one of the most massive infection diseases. General epidemiological significance has a strain, which belongs to subtype A. A high degree of genetic variety leads to the permanent changes in the antigenic structure of the influenza virus. Therefore, the current influenza vaccines require periodic updating of the composition of strains. Presently, it is important to develop a universal vaccine that can protect against different strains of influenza A virus at the same time and is based on the conserved antigens of the influenza virus. The recombinant adenovirus vectors expressing genes of conserved viral antigenes may be a promising candidate vaccine against influenza A. Using the method of the homologous recombination, we developed in this study recombinant adenovirus of fifth serotype that expresses genes of the ion channel M2 and nucleoprotein NP of the influenza virus A. Genes of the consensus protein M2 and NP of human influenza A virus were included into the structure of the viral genome. The expression of the antigens M2 and NP using recombinant adenovirus vector was detected by a Western blot assay. The immunogenicity of the developed recombinant adenovirus vector was demonstrated by the intranasal immunization of laboratory mice. PMID:25080815

  17. Teneurins: a conserved family of transmembrane proteins involved in intercellular signaling during development.


    Tucker, R P; Chiquet-Ehrismann, R


    Teneurins, which were initially described as ten-a and the pair-rule gene ten-m/odz in Drosophila, are a family of highly conserved proteins that have recently been characterized in Caenorhabditis elegans and a number of vertebrates. We have proposed the nomenclature teneurin 1-4 for the four members of this gene family found in vertebrates. Recent evidence shows that teneurins belong to a novel class of signaling molecules that function both at the cell surface as type II transmembrane receptors and, after the release of the intracellular domain, as transcriptional regulators. Nuclear localization of the intracellular domain has been observed in vitro in mammalian cells and confirmed in vivo in C. elegans. RNAi studies and mutational analysis has revealed that Ten-1 in C. elegans is an important regulator of many aspects of morphogenesis, including germ cell development and neuronal pathfinding. In vertebrates, teneurins are concentrated in the developing and adult central nervous system and at sites of pattern formation, including the developing limb. Teneurins also possess a carboxy terminal sequence that may be processed to generate a neuromodulatory peptide. Teneurin function appears to be required for a fundamentally important signaling mechanism conserved between invertebrates and vertebrates having an impact on many processes relying on cell-cell contact throughout development. PMID:16406038

  18. Specific protein binding to a conserved region of the ornithine decarboxylase mRNA 5'-untranslated region.


    Manzella, J M; Blackshear, P J


    An RNA gel retardation assay was used to identify one or more cellular protein(s) (ornithine decarboxylase mRNA 5'-UTR binding protein (ODCBP)) that bind specifically to a conserved region of the 5'-untranslated region (5'-UTR) of rat ornithine decarboxylase (ODC) mRNA. Ultraviolet light cross-linking demonstrated that this protein has an apparent Mr = 58,000 in mammalian cells. Treatment with the oxidizing agent diamide prevented binding of the ODCBP to ODC mRNA; addition of beta-mercaptoethanol reversed this inhibition and permitted mRNA.ODCBP complex formation. Cytoplasmic extracts from a variety of animal cells and tissues demonstrated similar binding activities; however, there was marked tissue-specific expression of the protein in the rat, with brain, heart, lung, and testis containing large amounts, and kidney, spleen, and skeletal muscle expressing negligible amounts. Binding was completely prevented by several mutations within a highly conserved heptanucleotide region (CCAU/ACUC) that was within 61 bases of the initiation codon in ODC mRNAs from mammals, Xenopus, and Caenorhabditis elegans; mutations 5' and 3' of the conserved heptanucleotide domain had no effect on binding activity. Binding was not affected by manipulation of cellular polyamine levels or by treatment of cells with agents that stimulate ODC biosynthesis. Thus, we have identified a widely distributed cellular protein that binds to a conserved domain within the 5'-UTR of ODC mRNA from many animal species; functional consequences of this binding remain to be determined. PMID:1551914

  19. Identification of Plasmodium falciparum DNA Repair Protein Mre11 with an Evolutionarily Conserved Nuclease Function

    PubMed Central

    Badugu, Sugith Babu; Nabi, Shaik Abdul; Vaidyam, Pratap; Laskar, Shyamasree; Bhattacharyya, Sunanda; Bhattacharyya, Mrinal Kanti


    The eukaryotic Meiotic Recombination protein 11 (Mre11) plays pivotal roles in the DNA damage response (DDR). Specifically, Mre11 senses and signals DNA double strand breaks (DSB) and facilitates their repair through effector proteins belonging to either homologous recombination (HR) or non-homologous end joining (NHEJ) repair mechanisms. In the human malaria parasite Plasmodium falciparum, HR and alternative-NHEJ have been identified; however, little is known about the upstream factors involved in the DDR of this organism. In this report, we identify a putative ortholog of Mre11 in P. falciparum (PfalMre11) that shares 22% sequence similarity to human Mre11. Homology modeling reveals striking structural resemblance of the predicted PfalMre11 nuclease domain to the nuclease domain of Saccharomyces cerevisiae Mre11 (ScMre11). Complementation analyses reveal functional conservation of PfalMre11 nuclease activity as demonstrated by the ability of the PfalMre11 nuclease domain, in conjunction with the C-terminal domain of ScMre11, to functionally complement an mre11 deficient yeast strain. Functional complementation was virtually abrogated by an amino acid substitution in the PfalMre11 nuclease domain (D398N). PfalMre11 is abundant in the mitotically active trophozoite and schizont stages of P. falciparum and is up-regulated in response to DNA damage, suggesting a role in the DDR. PfalMre11 exhibits physical interaction with PfalRad50. In addition, yeast 2-hybrid studies show that PfalMre11 interacts with ScRad50 and ScXrs2, two important components of the well characterized Mre11-Rad50-Xrs2 complex which is involved in DDR signaling and repair in S. cerevisiae, further supporting a role for PfalMre11 in the DDR. Taken together, these findings provide evidence that PfalMre11 is an evolutionarily conserved component of the DDR in Plasmodium. PMID:25938776

  20. An actin cytoskeleton with evolutionarily conserved functions in the absence of canonical actin-binding proteins

    PubMed Central

    Paredez, Alexander R.; Assaf, Zoe June; Sept, David; Timofejeva, Ljudmilla; Dawson, Scott C.; Wang, Chung-Ju Rachel; Cande, W. Z.


    Giardia intestinalis, a human intestinal parasite and member of what is perhaps the earliest-diverging eukaryotic lineage, contains the most divergent eukaryotic actin identified to date and is the first eukaryote known to lack all canonical actin-binding proteins (ABPs). We sought to investigate the properties and functions of the actin cytoskeleton in Giardia to determine whether Giardia actin (giActin) has reduced or conserved roles in core cellular processes. In vitro polymerization of giActin produced filaments, indicating that this divergent actin is a true filament-forming actin. We generated an anti-giActin antibody to localize giActin throughout the cell cycle. GiActin localized to the cortex, nuclei, internal axonemes, and formed C-shaped filaments along the anterior of the cell and a flagella-bundling helix. These structures were regulated with the cell cycle and in encysting cells giActin was recruited to the Golgi-like cyst wall processing vesicles. Knockdown of giActin demonstrated that giActin functions in cell morphogenesis, membrane trafficking, and cytokinesis. Additionally, Giardia contains a single G protein, giRac, which affects the Giardia actin cytoskeleton independently of known target ABPs. These results imply that there exist ancestral and perhaps conserved roles for actin in core cellular processes that are independent of canonical ABPs. Of medical significance, the divergent giActin cytoskeleton is essential and commonly used actin-disrupting drugs do not depolymerize giActin structures. Therefore, the giActin cytoskeleton is a promising drug target for treating giardiasis, as we predict drugs that interfere with the Giardia actin cytoskeleton will not affect the mammalian host. PMID:21444821

  1. RipA, a cytoplasmic membrane protein conserved among Francisella species, is required for intracellular survival.


    Fuller, James R; Craven, Robin R; Hall, Joshua D; Kijek, Todd M; Taft-Benz, Sharon; Kawula, Thomas H


    Francisella tularensis is a highly virulent bacterial pathogen that invades and replicates within numerous host cell types, including macrophages and epithelial cells. In an effort to better understand this process, we screened a transposon insertion library of the F. tularensis live vaccine strain (LVS) for mutant strains that invaded but failed to replicate within alveolar epithelial cell lines. One such strain isolated from this screen contained an insertion in the gene FTL_1914, which is conserved among all sequenced Francisella species yet lacks significant homology to any gene with known function. A deletion strain lacking FTL_1914 was constructed. This strain did not replicate in either epithelial or macrophage-like cells, and intracellular replication was restored by the wild-type allele in trans. Based on the deletion mutant phenotype, FTL_1914 was termed ripA (required for intracellular proliferation, factor A). Following uptake by J774.A1 cells, F. tularensis LVS Delta ripA colocalized with LAMP-1 then escaped the phagosome at the same rate and frequency as wild-type LVS-infected cells. Electron micrographs of the F. tularensis LVS Delta ripA mutant demonstrated the reentry of the mutant bacteria into double membrane vacuoles characteristic of autophagosomes in a process that was not dependent on replication. The F. tularensis LVS Delta ripA mutant was significantly impaired in its ability to persist in the lung and in its capacity to disseminate and colonize the liver and spleen in a mouse model of pulmonary tularemia. The RipA protein was expressed during growth in laboratory media and localized to the cytoplasmic membrane. Thus, RipA is a cytoplasmic membrane protein conserved among Francisella species that is required for intracellular replication within the host cell cytoplasm as well as disease progression, dissemination, and virulence. PMID:18765722

  2. Direct and Indirect Targeting of PP2A by Conserved Bacterial Type-III Effector Proteins

    PubMed Central

    Jin, Lin; Ham, Jong Hyun; Hage, Rosemary; Zhao, Wanying; Soto-Hernández, Jaricelis; Lee, Sang Yeol; Paek, Seung-Mann; Kim, Min Gab; Boone, Charles; Coplin, David L.; Mackey, David


    Bacterial AvrE-family Type-III effector proteins (T3Es) contribute significantly to the virulence of plant-pathogenic species of Pseudomonas, Pantoea, Ralstonia, Erwinia, Dickeya and Pectobacterium, with hosts ranging from monocots to dicots. However, the mode of action of AvrE-family T3Es remains enigmatic, due in large part to their toxicity when expressed in plant or yeast cells. To search for targets of WtsE, an AvrE-family T3E from the maize pathogen Pantoea stewartii subsp. stewartii, we employed a yeast-two-hybrid screen with non-lethal fragments of WtsE and a synthetic genetic array with full-length WtsE. Together these screens indicate that WtsE targets maize protein phosphatase 2A (PP2A) heterotrimeric enzyme complexes via direct interaction with B’ regulatory subunits. AvrE1, another AvrE-family T3E from Pseudomonas syringae pv. tomato strain DC3000 (Pto DC3000), associates with specific PP2A B’ subunit proteins from its susceptible host Arabidopsis that are homologous to the maize B’ subunits shown to interact with WtsE. Additionally, AvrE1 was observed to associate with the WtsE-interacting maize proteins, indicating that PP2A B’ subunits are likely conserved targets of AvrE-family T3Es. Notably, the ability of AvrE1 to promote bacterial growth and/or suppress callose deposition was compromised in Arabidopsis plants with mutations of PP2A genes. Also, chemical inhibition of PP2A activity blocked the virulence activity of both WtsE and AvrE1 in planta. The function of HopM1, a Pto DC3000 T3E that is functionally redundant to AvrE1, was also impaired in specific PP2A mutant lines, although no direct interaction with B’ subunits was observed. These results indicate that sub-component specific PP2A complexes are targeted by bacterial T3Es, including direct targeting by members of the widely conserved AvrE-family. PMID:27191168

  3. Direct and Indirect Targeting of PP2A by Conserved Bacterial Type-III Effector Proteins.


    Jin, Lin; Ham, Jong Hyun; Hage, Rosemary; Zhao, Wanying; Soto-Hernández, Jaricelis; Lee, Sang Yeol; Paek, Seung-Mann; Kim, Min Gab; Boone, Charles; Coplin, David L; Mackey, David


    Bacterial AvrE-family Type-III effector proteins (T3Es) contribute significantly to the virulence of plant-pathogenic species of Pseudomonas, Pantoea, Ralstonia, Erwinia, Dickeya and Pectobacterium, with hosts ranging from monocots to dicots. However, the mode of action of AvrE-family T3Es remains enigmatic, due in large part to their toxicity when expressed in plant or yeast cells. To search for targets of WtsE, an AvrE-family T3E from the maize pathogen Pantoea stewartii subsp. stewartii, we employed a yeast-two-hybrid screen with non-lethal fragments of WtsE and a synthetic genetic array with full-length WtsE. Together these screens indicate that WtsE targets maize protein phosphatase 2A (PP2A) heterotrimeric enzyme complexes via direct interaction with B' regulatory subunits. AvrE1, another AvrE-family T3E from Pseudomonas syringae pv. tomato strain DC3000 (Pto DC3000), associates with specific PP2A B' subunit proteins from its susceptible host Arabidopsis that are homologous to the maize B' subunits shown to interact with WtsE. Additionally, AvrE1 was observed to associate with the WtsE-interacting maize proteins, indicating that PP2A B' subunits are likely conserved targets of AvrE-family T3Es. Notably, the ability of AvrE1 to promote bacterial growth and/or suppress callose deposition was compromised in Arabidopsis plants with mutations of PP2A genes. Also, chemical inhibition of PP2A activity blocked the virulence activity of both WtsE and AvrE1 in planta. The function of HopM1, a Pto DC3000 T3E that is functionally redundant to AvrE1, was also impaired in specific PP2A mutant lines, although no direct interaction with B' subunits was observed. These results indicate that sub-component specific PP2A complexes are targeted by bacterial T3Es, including direct targeting by members of the widely conserved AvrE-family. PMID:27191168

  4. The Unique Morgue Ubiquitination Protein Is Conserved in a Diverse but Restricted Set of Invertebrates

    PubMed Central

    Zhou, Ying; Carpenter, Zachary W.; Brennan, Gregory


    Drosophila Morgue is a unique ubiquitination protein that facilitates programmed cell death and associates with DIAP1, a critical cell death inhibitor with E3 ubiquitin ligase activity. Morgue possesses a unique combination of functional domains typically associated with distinct types of ubiquitination enzymes. This includes an F box characteristic of the substrate-binding subunit in Skp, Cullin, and F box (SCF)-type ubiquitin E3 ligase complexes and a variant ubiquitin E2 conjugase domain where the active site cysteine is replaced by a glycine. Morgue also contains a single C4-type zinc finger motif. This architecture suggests potentially novel ubiquitination activities for Morgue. In this study, we address the evolutionary origins of this distinctive protein utilizing a combination of bioinformatics and molecular biology approaches. We find that Morgue exhibits widespread but restricted phylogenetic distribution among metazoans. Morgue proteins were identified in a wide range of Protostome phyla, including Arthropoda, Annelida, Mollusca, Nematoda, and Platyhelminthes. However, with one potential exception, Morgue was not detected in Deuterostomes, including Chordates, Hemichordates, or Echinoderms. Morgue was also not found in Ctenophora, Cnidaria, Placozoa, or Porifera. Characterization of Morgue sequences within specific animal lineages suggests that gene deletion or acquisition has occurred during divergence of nematodes and that at least one arachnid expresses an atypical form of Morgue consisting only of the variant E2 conjugase domain. Analysis of the organization of several morgue genes suggests that exon-shuffling events have contributed to the evolution of the Morgue protein. These results suggest that Morgue mediates conserved and distinctive ubiquitination functions in specific cell death pathways. PMID:19602541

  5. Small ruminant lentiviral Vif proteins commonly utilize cyclophilin A, an evolutionarily and structurally conserved protein, to degrade ovine and caprine APOBEC3 proteins.


    Yoshikawa, Rokusuke; Izumi, Taisuke; Nakano, Yusuke; Yamada, Eri; Moriwaki, Miyu; Misawa, Naoko; Ren, Fengrong; Kobayashi, Tomoko; Koyanagi, Yoshio; Sato, Kei


    Mammals have co-evolved with retroviruses, including lentiviruses, over a long period. Evidence supporting this contention is that viral infectivity factor (Vif) encoded by lentiviruses antagonizes the anti-viral action of cellular apolipoprotein B mRNA editing enzyme catalytic polypeptide-like 3 (APOBEC3) of the host. To orchestrate E3 ubiquitin ligase complex for APOBEC3 degradation, Vifs utilize mammalian proteins such as core-binding factor beta (CBFB; for primate lentiviruses) or cyclophilin A (CYPA; for Maedi-Visna virus [MVV]). However, the co-evolutionary relationship between lentiviral Vif and the mammalian proteins associated with Vif-mediated APOBEC3 degradation is poorly understood. Moreover, it is unclear whether Vif proteins of small ruminant lentiviruses (SRLVs), including MVV and caprine arthritis encephalitis virus (CAEV), commonly utilize CYPA to degrade the APOBEC3 of their hosts. In this study, molecular phylogenetic and protein homology modeling revealed that Vif co-factors are evolutionarily and structurally conserved. It was also found that not only MVV but also CAEV Vifs degrade APOBEC3 of both sheep and goats and that CAEV Vifs interact with CYPA. These findings suggest that lentiviral Vifs chose evolutionarily and structurally stable proteins as their partners (e.g., CBFB or CYPA) for APOBEC3 degradation and, particularly, that SRLV Vifs evolved to utilize CYPA as their co-factor in degradation of ovine and caprine APOBEC3. PMID:27193350

  6. Nucleoplasmic Lamin A/C and Polycomb group of proteins: An evolutionarily conserved interplay

    PubMed Central

    Marullo, F.; Cesarini, E.; Antonelli, L.; Gregoretti, F.; Oliva, G.; Lanzuolo, C.


    ABSTRACT Nuclear lamins are the main components of the nuclear lamina at the nuclear periphery, providing mechanical support to the nucleus. However, recent findings suggest that lamins also reside in the nuclear interior, as a distinct and dynamic pool with critical roles in transcriptional regulation. In our work we found a functional and evolutionary conserved crosstalk between Lamin A/C and the Polycomb group (PcG) of proteins, this being required for the maintenance of the PcG repressive functions. Indeed, Lamin A/C knock-down causes PcG foci dispersion and defects in PcG-mediated higher order structures, thereby leading to impaired PcG mediated transcriptional repression. By using ad-hoc algorithms for image analysis and PLA approaches we hereby show that PcG proteins are preferentially located in the nuclear interior where they interact with nucleoplasmic Lamin A/C. Taken together, our findings suggest that nuclear components, such as Lamin A/C, functionally interact with epigenetic factors to ensure the correct transcriptional program maintenance. PMID:26930442

  7. A novel mosaic protein containing LDL receptor elements is highly conserved in humans and chickens.


    Mörwald, S; Yamazaki, H; Bujo, H; Kusunoki, J; Kanaki, T; Seimiya, K; Morisaki, N; Nimpf, J; Schneider, W J; Saito, Y


    Certain receptors belonging to the LDL receptor (LDLR) gene family appear to constitute a newly identified branch whose members are expressed in brain, in addition to other tissues. In support of this concept, we have now discovered the expression and delineated the molecular structures of a representative of this emerging branch from two such diverse species as human and chicken. This membrane receptor, called LR11 and thus far only known to exist in the rabbit, is a complex seven-domain mosaic protein containing, among other structural elements, a cluster of 11 LDLR ligand-binding repeats and a domain with homology to VPS10, a yeast receptor for vacuolar protein sorting. Cytoplasmic signature sequences define the receptor as competent for endocytosis. The most striking properties of LR11s are their (1) high degree of structural conservation (>80% identity among mammals and birds), with 100% identity in the membrane-spanning and cytoplasmic domains of rabbit and human; (2) lack of regulation by cholesterol and estrogen; and (3) expression in brain. The features of LR11 suggest important roles in intercellular and intracellular ligand transport processes, some of which it may share with other brain-specific LDLR family members. PMID:9157966

  8. Exploring the Conserved Role of MANF in the Unfolded Protein Response in Drosophila melanogaster

    PubMed Central

    Lindström, Riitta; Lindholm, Päivi; Kallijärvi, Jukka; Palgi, Mari; Saarma, Mart; Heino, Tapio I.


    Disturbances in the homeostasis of endoplasmic reticulum (ER) referred to as ER stress is involved in a variety of human diseases. ER stress activates unfolded protein response (UPR), a cellular mechanism the purpose of which is to restore ER homeostasis. Previous studies show that Mesencephalic Astrocyte-derived Neurotrophic Factor (MANF) is an important novel component in the regulation of UPR. In vertebrates, MANF is upregulated by ER stress and protects cells against ER stress-induced cell death. Biochemical studies have revealed an interaction between mammalian MANF and GRP78, the major ER chaperone promoting protein folding. In this study we discovered that the upregulation of MANF expression in response to drug-induced ER stress is conserved between Drosophila and mammals. Additionally, by using a genetic in vivo approach we found genetic interactions between Drosophila Manf and genes encoding for Drosophila homologues of GRP78, PERK and XBP1, the key components of UPR. Our data suggest a role for Manf in the regulation of Drosophila UPR. PMID:26975047

  9. Nucleoplasmic Lamin A/C and Polycomb group of proteins: An evolutionarily conserved interplay.


    Marullo, F; Cesarini, E; Antonelli, L; Gregoretti, F; Oliva, G; Lanzuolo, C


    Nuclear lamins are the main components of the nuclear lamina at the nuclear periphery, providing mechanical support to the nucleus. However, recent findings suggest that lamins also reside in the nuclear interior, as a distinct and dynamic pool with critical roles in transcriptional regulation. In our work we found a functional and evolutionary conserved crosstalk between Lamin A/C and the Polycomb group (PcG) of proteins, this being required for the maintenance of the PcG repressive functions. Indeed, Lamin A/C knock-down causes PcG foci dispersion and defects in PcG-mediated higher order structures, thereby leading to impaired PcG mediated transcriptional repression. By using ad-hoc algorithms for image analysis and PLA approaches we hereby show that PcG proteins are preferentially located in the nuclear interior where they interact with nucleoplasmic Lamin A/C. Taken together, our findings suggest that nuclear components, such as Lamin A/C, functionally interact with epigenetic factors to ensure the correct transcriptional program maintenance. PMID:26930442

  10. A Gene Mutated in Nephronophthisis and Retinitis Pigmentosa Encodes a Novel Protein, Nephroretinin, Conserved in Evolution

    PubMed Central

    Otto, Edgar; Hoefele, Julia; Ruf, Rainer; Mueller, Adelheid M.; Hiller, Karl S.; Wolf, Matthias T. F.; Schuermann, Maria J.; Becker, Achim; Birkenhäger, Ralf; Sudbrak, Ralf; Hennies, Hans C.; Nürnberg, Peter; Hildebrandt, Friedhelm


    Nephronophthisis (NPHP) comprises a group of autosomal recessive cystic kidney diseases, which constitute the most frequent genetic cause for end-stage renal failure in children and young adults. The most prominent histologic feature of NPHP consists of development of renal fibrosis, which, in chronic renal failure of any origin, represents the pathogenic event correlated most strongly to loss of renal function. Four gene loci for NPHP have been mapped to chromosomes 2q13 (NPHP1), 9q22 (NPHP2), 3q22 (NPHP3), and 1p36 (NPHP4). At all four loci, linkage has also been demonstrated in families with the association of NPHP and retinitis pigmentosa, known as “Senior-Løken syndrome” (SLS). Identification of the gene for NPHP type 1 had revealed nephrocystin as a novel docking protein, providing new insights into mechanisms of cell-cell and cell-matrix signaling. We here report identification of the gene (NPHP4) causing NPHP type 4, by use of high-resolution haplotype analysis and by demonstration of nine likely loss-of-function mutations in six affected families. NPHP4 encodes a novel protein, nephroretinin, that is conserved in evolution—for example, in the nematode Caenorhabditis elegans. In addition, we demonstrate two loss-of-function mutations of NPHP4 in patients from two families with SLS. Thus, we have identified a novel gene with critical roles in renal tissue architecture and ophthalmic function. PMID:12205563

  11. Comparative biology of the pentraxin protein family: evolutionarily conserved component of innate immune system.


    Armstrong, Peter B


    The immune system is based on the actions of the collection of specialized immune defense cells and their secreted proteins and peptides that defend the host against infection by parasites. Parasites are organisms that live part or all of their lives in close physical association with the host and extract nutrients from the host and, by releasing toxins and virulence factors, cause disease with the potential for injury and premature death of that host. Parasites of the metazoa can be viruses, eubacteria, fungi, protozoans, and other metazoans. The immune system operates to kill or eliminate parasites and eliminate or detoxify their toxins and virulence factors. Although some of the elements of immune systems are specific to a particular phylum of metazoans, others show extensive evolutionary conservation, being present in several or all major phyla of the metazoa. The pentraxins display this latter character in their roles in immune defense. Pentraxins have been documented in vertebrates, nonvertebrate chordates, arthropods, and mollusks and may be present in other taxa of metazoans. Presumably the pentraxins appeared early in the evolution of metazoa, prior to their evolutionary divergence in the Precambrian epoch into many phyla present today, and have been preserved for the 542 million years since that explosive evolutionary radiation. The fidelity with which these phyla have preserved the pentraxins suggests that the functions of these proteins are important for survival of the members of these diverse taxa of animals. PMID:25805121

  12. Exploring the Conserved Role of MANF in the Unfolded Protein Response in Drosophila melanogaster.


    Lindström, Riitta; Lindholm, Päivi; Kallijärvi, Jukka; Palgi, Mari; Saarma, Mart; Heino, Tapio I


    Disturbances in the homeostasis of endoplasmic reticulum (ER) referred to as ER stress is involved in a variety of human diseases. ER stress activates unfolded protein response (UPR), a cellular mechanism the purpose of which is to restore ER homeostasis. Previous studies show that Mesencephalic Astrocyte-derived Neurotrophic Factor (MANF) is an important novel component in the regulation of UPR. In vertebrates, MANF is upregulated by ER stress and protects cells against ER stress-induced cell death. Biochemical studies have revealed an interaction between mammalian MANF and GRP78, the major ER chaperone promoting protein folding. In this study we discovered that the upregulation of MANF expression in response to drug-induced ER stress is conserved between Drosophila and mammals. Additionally, by using a genetic in vivo approach we found genetic interactions between Drosophila Manf and genes encoding for Drosophila homologues of GRP78, PERK and XBP1, the key components of UPR. Our data suggest a role for Manf in the regulation of Drosophila UPR. PMID:26975047

  13. A new DNA binding protein highly conserved in diverse crenarchaeal viruses.


    Larson, Eric T; Eilers, Brian J; Reiter, Dirk; Ortmann, Alice C; Young, Mark J; Lawrence, C Martin


    Sulfolobus turreted icosahedral virus (STIV) infects Sulfolobus species found in the hot springs of Yellowstone National Park. Its 37 open reading frames (ORFs) generally lack sequence similarity to other genes. One exception, however, is ORF B116. While its function is unknown, orthologs are found in three additional crenarchaeal viral families. Due to the central importance of this protein family to crenarchaeal viruses, we have undertaken structural and biochemical studies of B116. The structure reveals a previously unobserved fold consisting of a five-stranded beta-sheet flanked on one side by three alpha helices. Two subunits come together to form a homodimer with a 10-stranded mixed beta-sheet, where the topology of the central strands resembles an unclosed beta-barrel. Highly conserved loops rise above the surface of the saddle-shaped protein and suggest an interaction with the major groove of DNA. The predicted B116-DNA interaction is confirmed by electrophoretic mobility shift assays. PMID:17336360

  14. Yeast Irc6p is a novel type of conserved clathrin coat accessory factor related to small G proteins

    PubMed Central

    Gorynia, Sabine; Lorenz, Todd C.; Costaguta, Giancarlo; Daboussi, Lydia; Cascio, Duilio; Payne, Gregory S.


    Clathrin coat accessory proteins play key roles in transport mediated by clathrin-coated vesicles. Yeast Irc6p and the related mammalian p34 are putative clathrin accessory proteins that interact with clathrin adaptor complexes. We present evidence that Irc6p functions in clathrin-mediated traffic between the trans-Golgi network and endosomes, linking clathrin adaptor complex AP-1 and the Rab GTPase Ypt31p. The crystal structure of the Irc6p N-terminal domain revealed a G-protein fold most related to small G proteins of the Rab and Arf families. However, Irc6p lacks G-protein signature motifs and high-affinity GTP binding. Also, mutant Irc6p lacking candidate GTP-binding residues retained function. Mammalian p34 rescued growth defects in irc6∆ cells, indicating functional conservation, and modeling predicted a similar N-terminal fold in p34. Irc6p and p34 also contain functionally conserved C-terminal regions. Irc6p/p34-related proteins with the same two-part architecture are encoded in genomes of species as diverse as plants and humans. Together these results define Irc6p/p34 as a novel type of conserved clathrin accessory protein and founding members of a new G protein–like family. PMID:22993212

  15. Protein subcellular localization prediction based on compartment-specific features and structure conservation

    PubMed Central

    Su, Emily Chia-Yu; Chiu, Hua-Sheng; Lo, Allan; Hwang, Jenn-Kang; Sung, Ting-Yi; Hsu, Wen-Lian


    Background Protein subcellular localization is crucial for genome annotation, protein function prediction, and drug discovery. Determination of subcellular localization using experimental approaches is time-consuming; thus, computational approaches become highly desirable. Extensive studies of localization prediction have led to the development of several methods including composition-based and homology-based methods. However, their performance might be significantly degraded if homologous sequences are not detected. Moreover, methods that integrate various features could suffer from the problem of low coverage in high-throughput proteomic analyses due to the lack of information to characterize unknown proteins. Results We propose a hybrid prediction method for Gram-negative bacteria that combines a one-versus-one support vector machines (SVM) model and a structural homology approach. The SVM model comprises a number of binary classifiers, in which biological features derived from Gram-negative bacteria translocation pathways are incorporated. In the structural homology approach, we employ secondary structure alignment for structural similarity comparison and assign the known localization of the top-ranked protein as the predicted localization of a query protein. The hybrid method achieves overall accuracy of 93.7% and 93.2% using ten-fold cross-validation on the benchmark data sets. In the assessment of the evaluation data sets, our method also attains accurate prediction accuracy of 84.0%, especially when testing on sequences with a low level of homology to the training data. A three-way data split procedure is also incorporated to prevent overestimation of the predictive performance. In addition, we show that the prediction accuracy should be approximately 85% for non-redundant data sets of sequence identity less than 30%. Conclusion Our results demonstrate that biological features derived from Gram-negative bacteria translocation pathways yield a significant

  16. WXG100 Protein Superfamily Consists of Three Subfamilies and Exhibits an α-Helical C-Terminal Conserved Residue Pattern

    PubMed Central

    Poulsen, Christian; Panjikar, Santosh; Holton, Simon J.; Wilmanns, Matthias; Song, Young-Hwa


    Members of the WXG100 protein superfamily form homo- or heterodimeric complexes. The most studied proteins among them are the secreted T-cell antigens CFP-10 (10 kDa culture filtrate protein, EsxB) and ESAT-6 (6 kDa early secreted antigen target, EsxA) from Mycobacterium tuberculosis. They are encoded on an operon within a gene cluster, named as ESX-1, that encodes for the Type VII secretion system (T7SS). WXG100 proteins are secreted in a full-length form and it is known that they adopt a four-helix bundle structure. In the current work we discuss the evolutionary relationship between the homo- and heterodimeric WXG100 proteins, the basis of the oligomeric state and the key structural features of the conserved sequence pattern of WXG100 proteins. We performed an iterative bioinformatics analysis of the WXG100 protein superfamily and correlated this with the atomic structures of the representative WXG100 proteins. We find, firstly, that the WXG100 protein superfamily consists of three subfamilies: CFP-10-, ESAT-6- and sagEsxA-like proteins (EsxA proteins similar to that of Streptococcus agalactiae). Secondly, that the heterodimeric complexes probably evolved from a homodimeric precursor. Thirdly, that the genes of hetero-dimeric WXG100 proteins are always encoded in bi-cistronic operons and finally, by combining the sequence alignments with the X-ray data we identify a conserved C-terminal sequence pattern. The side chains of these conserved residues decorate the same side of the C-terminal α-helix and therefore form a distinct surface. Our results lead to a putatively extended T7SS secretion signal which combines two reported T7SS recognition characteristics: Firstly that the T7SS secretion signal is localized at the C-terminus of T7SS substrates and secondly that the conserved residues YxxxD/E are essential for T7SS activity. Furthermore, we propose that the specific α-helical surface formed by the conserved sequence pattern including YxxxD/E motif is a key

  17. Multi-Signal Sedimentation Velocity Analysis with Mass Conservation for Determining the Stoichiometry of Protein Complexes

    PubMed Central

    Brautigam, Chad A.; Padrick, Shae B.; Schuck, Peter


    Multi-signal sedimentation velocity analytical ultracentrifugation (MSSV) is a powerful tool for the determination of the number, stoichiometry, and hydrodynamic shape of reversible protein complexes in two- and three-component systems. In this method, the evolution of sedimentation profiles of macromolecular mixtures is recorded simultaneously using multiple absorbance and refractive index signals and globally transformed into both spectrally and diffusion-deconvoluted component sedimentation coefficient distributions. For reactions with complex lifetimes comparable to the time-scale of sedimentation, MSSV reveals the number and stoichiometry of co-existing complexes. For systems with short complex lifetimes, MSSV reveals the composition of the reaction boundary of the coupled reaction/migration process, which we show here may be used to directly determine an association constant. A prerequisite for MSSV is that the interacting components are spectrally distinguishable, which may be a result, for example, of extrinsic chromophores or of different abundances of aromatic amino acids contributing to the UV absorbance. For interacting components that are spectrally poorly resolved, here we introduce a method for additional regularization of the spectral deconvolution by exploiting approximate knowledge of the total loading concentrations. While this novel mass conservation principle does not discriminate contributions to different species, it can be effectively combined with constraints in the sedimentation coefficient range of uncomplexed species. We show in theory, computer simulations, and experiment, how mass conservation MSSV as implemented in SEDPHAT can enhance or even substitute for the spectral discrimination of components. This should broaden the applicability of MSSV to the analysis of the composition of reversible macromolecular complexes. PMID:23696787

  18. Conservation of inner nuclear membrane targeting sequences in mammalian Pom121 and yeast Heh2 membrane proteins.


    Kralt, Annemarie; Jagalur, Noorjahan B; van den Boom, Vincent; Lokareddy, Ravi K; Steen, Anton; Cingolani, Gino; Fornerod, Maarten; Veenhoff, Liesbeth M


    Endoplasmic reticulum-synthesized membrane proteins traffic through the nuclear pore complex (NPC) en route to the inner nuclear membrane (INM). Although many membrane proteins pass the NPC by simple diffusion, two yeast proteins, ScSrc1/ScHeh1 and ScHeh2, are actively imported. In these proteins, a nuclear localization signal (NLS) and an intrinsically disordered linker encode the sorting signal for recruiting the transport factors for FG-Nup and RanGTP-dependent transport through the NPC. Here we address whether a similar import mechanism applies in metazoans. We show that the (putative) NLSs of metazoan HsSun2, MmLem2, HsLBR, and HsLap2β are not sufficient to drive nuclear accumulation of a membrane protein in yeast, but the NLS from RnPom121 is. This NLS of Pom121 adapts a similar fold as the NLS of Heh2 when transport factor bound and rescues the subcellular localization and synthetic sickness of Heh2ΔNLS mutants. Consistent with the conservation of these NLSs, the NLS and linker of Heh2 support INM localization in HEK293T cells. The conserved features of the NLSs of ScHeh1, ScHeh2, and RnPom121 and the effective sorting of Heh2-derived reporters in human cells suggest that active import is conserved but confined to a small subset of INM proteins. PMID:26179916

  19. Conservation of inner nuclear membrane targeting sequences in mammalian Pom121 and yeast Heh2 membrane proteins

    PubMed Central

    Kralt, Annemarie; Jagalur, Noorjahan B.; van den Boom, Vincent; Lokareddy, Ravi K.; Steen, Anton; Cingolani, Gino; Fornerod, Maarten; Veenhoff, Liesbeth M.


    Endoplasmic reticulum–synthesized membrane proteins traffic through the nuclear pore complex (NPC) en route to the inner nuclear membrane (INM). Although many membrane proteins pass the NPC by simple diffusion, two yeast proteins, ScSrc1/ScHeh1 and ScHeh2, are actively imported. In these proteins, a nuclear localization signal (NLS) and an intrinsically disordered linker encode the sorting signal for recruiting the transport factors for FG-Nup and RanGTP-dependent transport through the NPC. Here we address whether a similar import mechanism applies in metazoans. We show that the (putative) NLSs of metazoan HsSun2, MmLem2, HsLBR, and HsLap2β are not sufficient to drive nuclear accumulation of a membrane protein in yeast, but the NLS from RnPom121 is. This NLS of Pom121 adapts a similar fold as the NLS of Heh2 when transport factor bound and rescues the subcellular localization and synthetic sickness of Heh2ΔNLS mutants. Consistent with the conservation of these NLSs, the NLS and linker of Heh2 support INM localization in HEK293T cells. The conserved features of the NLSs of ScHeh1, ScHeh2, and RnPom121 and the effective sorting of Heh2-derived reporters in human cells suggest that active import is conserved but confined to a small subset of INM proteins. PMID:26179916

  20. Identification of an Ideal-like Fingerprint for a Protein Fold using Overlapped Conserved Residues based Approach

    PubMed Central

    Goyal, Amit; Sokalingam, Sriram; Hwang, Kyu-Suk; Lee, Sun-Gu


    Design of an efficient fingerprint that detects homologous proteins at distant sequence identity has been a great challenge. This paper proposes a strategy to extract an ideal-like fingerprint with high specificity and sensitivity from a group of sequences related to a fold. The approach is devised based on the assumptions that the critical residues for a protein fold may be conserved in three aspects, i.e. sequence, structure, and intramolecular interaction, and embedded in secondary structures. We hypothesized that the residues satisfying such conditions simultaneously may work as an efficient fingerprint. This idea was tested on protein folds of various classes, such as beta-strand rich, alpha + beta proteins and alpha/beta proteins with discrete sequence similarities. The fingerprint for each fold was generated by selecting the overlapped conserved residues (OCR) from the conserved residues obtained using independent three alignment methods, i.e. multiple sequence alignment, structure-based alignment, and alignment based on the interstrand hydrogen-bonds. The OCR fingerprints showed more than 90% detection efficiency for all the folds tested and were identified to be almost the minimal fingerprints composed of only critical residues. This study is expected to provide an important conceptual improvement in the identification or design of ideal fingerprints for a protein fold. PMID:25008052

  1. Highly Conserved Histidine Plays a Dual Catalytic Role in Protein Splicing: a pKa Shift Mechanism

    PubMed Central

    Du, Zhenming; Shemella, Philip T.; Liu, Yangzhong; McCallum, Scott A.; Pereira, Brian; Nayak, Saroj K.; Belfort, Georges; Belfort, Marlene; Wang, Chunyu


    Protein splicing is a precise auto-catalytic process in which an intein excises itself from a precursor with the concomitant ligation of the flanking sequences. Protein splicing occurs through acid-base catalysis in which the ionization states of active site residues are crucial to the reaction mechanism. In inteins, several conserved histidines have been shown to play important roles in protein splicing, including the most conserved “B-block” histidine. In this study, we have combined NMR pKa determination with quantum mechanics/molecular mechanics (QM/MM) modeling to study engineered inteins from Mycobacterium tuberculosis (Mtu) RecA intein. We demonstrate a dramatic pKa shift for the invariant B-block histidine, the most conserved residue among inteins. The B-block histidine has a pKa of 7.3 ± 0.6 in a precursor and a pKa of < 3.5 in a spliced intein. The pKa values and QM/MM data suggest that the B-block histidine has a dual role in the acid-base catalysis of protein splicing. This histidine likely acts as a general base to initiate splicing with an acyl shift and then as a general acid to cause the breakdown of the scissile bond. The proposed pKa shift mechanism accounts for the biochemical data supporting the essential role for the B-block histidine and for the absolute sequence conservation of this residue. PMID:19630416

  2. Localization of an evolutionarily conserved protein proton pyrophosphatase in evolutionarily distant plants oryza sativa and physcomitrella patens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Proton Pyrophosphatase (H+-PPase) is a highly evolutionarily conserved protein that is prevalent in the plant kingdom. One of the salient features of H+-PPase expression pattern, at least in vascular plants like Arabidopsis, is its conspicuous localization in both actively dividing cells and the phl...


    EPA Science Inventory

    The GRK4 subfamily of G protein-coupled receptor kinases. Alternative splicing, gene organization, and sequence conservation.

    Premont RT, Macrae AD, Aparicio SA, Kendall HE, Welch JE, Lefkowitz RJ.

    Department of Medicine, Howard Hughes Medical Institute, Duke Univer...

  4. Structural and sequence similarities of hydra xeroderma pigmentosum A protein to human homolog suggest early evolution and conservation.


    Barve, Apurva; Ghaskadbi, Saroj; Ghaskadbi, Surendra


    Xeroderma pigmentosum group A (XPA) is a protein that binds to damaged DNA, verifies presence of a lesion, and recruits other proteins of the nucleotide excision repair (NER) pathway to the site. Though its homologs from yeast, Drosophila, humans, and so forth are well studied, XPA has not so far been reported from protozoa and lower animal phyla. Hydra is a fresh-water cnidarian with a remarkable capacity for regeneration and apparent lack of organismal ageing. Cnidarians are among the first metazoa with a defined body axis, tissue grade organisation, and nervous system. We report here for the first time presence of XPA gene in hydra. Putative protein sequence of hydra XPA contains nuclear localization signal and bears the zinc-finger motif. It contains two conserved Pfam domains and various characterized features of XPA proteins like regions for binding to excision repair cross-complementing protein-1 (ERCC1) and replication protein A 70 kDa subunit (RPA70) proteins. Hydra XPA shows a high degree of similarity with vertebrate homologs and clusters with deuterostomes in phylogenetic analysis. Homology modelling corroborates the very close similarity between hydra and human XPA. The protein thus most likely functions in hydra in the same manner as in other animals, indicating that it arose early in evolution and has been conserved across animal phyla. PMID:24083246

  5. Structural and Sequence Similarities of Hydra Xeroderma Pigmentosum A Protein to Human Homolog Suggest Early Evolution and Conservation

    PubMed Central

    Ghaskadbi, Saroj


    Xeroderma pigmentosum group A (XPA) is a protein that binds to damaged DNA, verifies presence of a lesion, and recruits other proteins of the nucleotide excision repair (NER) pathway to the site. Though its homologs from yeast, Drosophila, humans, and so forth are well studied, XPA has not so far been reported from protozoa and lower animal phyla. Hydra is a fresh-water cnidarian with a remarkable capacity for regeneration and apparent lack of organismal ageing. Cnidarians are among the first metazoa with a defined body axis, tissue grade organisation, and nervous system. We report here for the first time presence of XPA gene in hydra. Putative protein sequence of hydra XPA contains nuclear localization signal and bears the zinc-finger motif. It contains two conserved Pfam domains and various characterized features of XPA proteins like regions for binding to excision repair cross-complementing protein-1 (ERCC1) and replication protein A 70 kDa subunit (RPA70) proteins. Hydra XPA shows a high degree of similarity with vertebrate homologs and clusters with deuterostomes in phylogenetic analysis. Homology modelling corroborates the very close similarity between hydra and human XPA. The protein thus most likely functions in hydra in the same manner as in other animals, indicating that it arose early in evolution and has been conserved across animal phyla. PMID:24083246

  6. Hearing in Drosophila Requires TilB, a Conserved Protein Associated With Ciliary Motility

    PubMed Central

    Kavlie, Ryan G.; Kernan, Maurice J.; Eberl, Daniel F.


    Cilia were present in the earliest eukaryotic ancestor and underlie many biological processes ranging from cell motility and propulsion of extracellular fluids to sensory physiology. We investigated the contribution of the touch insensitive larva B (tilB) gene to cilia function in Drosophila melanogaster. Mutants of tilB exhibit dysfunction in sperm flagella and ciliated dendrites of chordotonal organs that mediate hearing and larval touch sensitivity. Mutant sperm axonemes as well as sensory neuron dendrites of Johnston's organ, the fly's auditory organ, lack dynein arms. Through deficiency mapping and sequencing candidate genes, we identified tilB mutations in the annotated gene CG14620. A genomic CG14620 transgene rescued deafness and male sterility of tilB mutants. TilB is a 395-amino-acid protein with a conserved N-terminal leucine-rich repeat region at residues 16–164 and a coiled-coil domain at residues 171–191. A tilB-Gal4 transgene driving fluorescently tagged TilB proteins elicits cytoplasmic expression in embryonic chordotonal organs, in Johnston's organ, and in sperm flagella. TilB does not appear to affect tubulin polyglutamylation or polyglycylation. The phenotypes and expression of tilB indicate function in cilia construction or maintenance, but not in intraflagellar transport. This is also consistent with phylogenetic association of tilB homologs with presence of genes encoding axonemal dynein arm components. Further elucidation of tilB functional mechanisms will provide greater understanding of cilia function and will facilitate understanding ciliary diseases. PMID:20215474

  7. Structural and functional studies of conserved nucleotide-binding protein LptB in lipopolysaccharide transport

    SciTech Connect

    Wang, Zhongshan; Xiang, Quanju; Zhu, Xiaofeng; Dong, Haohao; He, Chuan; Wang, Haiyan; Zhang, Yizheng; Wang, Wenjian; Dong, Changjiang


    Highlights: • Determination of the structure of the wild-type LptB in complex with ATP and Mg{sup 2+}. • Demonstrated that ATP binding residues are essential for LptB’s ATPase activity and LPS transport. • Dimerization is required for the LptB’s function and LPS transport. • Revealed relationship between activity of the LptB and the vitality of E. coli cells. - Abstract: Lipopolysaccharide (LPS) is the main component of the outer membrane of Gram-negative bacteria, which plays an essential role in protecting the bacteria from harsh conditions and antibiotics. LPS molecules are transported from the inner membrane to the outer membrane by seven LPS transport proteins. LptB is vital in hydrolyzing ATP to provide energy for LPS transport, however this mechanism is not very clear. Here we report wild-type LptB crystal structure in complex with ATP and Mg{sup 2+}, which reveals that its structure is conserved with other nucleotide-binding proteins (NBD). Structural, functional and electron microscopic studies demonstrated that the ATP binding residues, including K42 and T43, are crucial for LptB’s ATPase activity, LPS transport and the vitality of Escherichia coli cells with the exceptions of H195A and Q85A; the H195A mutation does not lower its ATPase activity but impairs LPS transport, and Q85A does not alter ATPase activity but causes cell death. Our data also suggest that two protomers of LptB have to work together for ATP hydrolysis and LPS transport. These results have significant impacts in understanding the LPS transport mechanism and developing new antibiotics.

  8. Chorismatase Mechanisms Reveal Fundamentally Different Types of Reaction in a Single Conserved Protein Fold.


    Hubrich, Florian; Juneja, Puneet; Müller, Michael; Diederichs, Kay; Welte, Wolfram; Andexer, Jennifer N


    Chorismatases are a class of chorismate-converting enzymes involved in the biosynthetic pathways of different natural products, many of them with interesting pharmaceutical characteristics. So far, three subfamilies of chorismatases are described that convert chorismate into different (dihydro-)benzoate derivatives (CH-FkbO, CH-Hyg5, and CH-XanB2). Until now, the detailed enzyme mechanism and the molecular basis for the different reaction products were unknown. Here we show that the CH-FkbO and CH-Hyg5 subfamilies share the same protein fold, but employ fundamentally different reaction mechanisms. While the FkbO reaction is a typical hydrolysis, the Hyg5 reaction proceeds intramolecularly, most likely via an arene oxide intermediate. Two nonconserved active site residues were identified that are responsible for the different reaction mechanisms in CH-FkbO and CH-Hyg5. Further, we propose an additional amino acid residue to be responsible for the discrimination of the CH-XanB2 subfamily, which catalyzes the formation of two different hydroxybenzoate regioisomers, likely in a single active site. A multiple sequence alignment shows that these three crucial amino acid positions are located in conserved motifs and can therefore be used to assign unknown chorismatases to the corresponding subfamily. PMID:26247872

  9. Conserved S-Layer-Associated Proteins Revealed by Exoproteomic Survey of S-Layer-Forming Lactobacilli.


    Johnson, Brant R; Hymes, Jeffrey; Sanozky-Dawes, Rosemary; Henriksen, Emily DeCrescenzo; Barrangou, Rodolphe; Klaenhammer, Todd R


    The Lactobacillus acidophilus homology group comprises Gram-positive species that include L. acidophilus, L. helveticus, L. crispatus, L. amylovorus, L. gallinarum, L. delbrueckii subsp. bulgaricus, L. gasseri, and L. johnsonii. While these bacteria are closely related, they have varied ecological lifestyles as dairy and food fermenters, allochthonous probiotics, or autochthonous commensals of the host gastrointestinal tract. Bacterial cell surface components play a critical role in the molecular dialogue between bacteria and interaction signaling with the intestinal mucosa. Notably, the L. acidophilus complex is distinguished in two clades by the presence or absence of S-layers, which are semiporous crystalline arrays of self-assembling proteinaceous subunits found as the outermost layer of the bacterial cell wall. In this study, S-layer-associated proteins (SLAPs) in the exoproteomes of various S-layer-forming Lactobacillus species were proteomically identified, genomically compared, and transcriptionally analyzed. Four gene regions encoding six putative SLAPs were conserved in the S-layer-forming Lactobacillus species but not identified in the extracts of the closely related progenitor, L. delbrueckii subsp. bulgaricus, which does not produce an S-layer. Therefore, the presence or absence of an S-layer has a clear impact on the exoproteomic composition of Lactobacillus species. This proteomic complexity and differences in the cell surface properties between S-layer- and non-S-layer-forming lactobacilli reveal the potential for SLAPs to mediate intimate probiotic interactions and signaling with the host intestinal mucosa. PMID:26475115

  10. Sumoylation Influences DNA Break Repair Partly by Increasing the Solubility of a Conserved End Resection Protein

    PubMed Central

    Sarangi, Prabha; Steinacher, Roland; Altmannova, Veronika; Fu, Qiong; Paull, Tanya T.; Krejci, Lumir; Whitby, Matthew C.; Zhao, Xiaolan


    Protein modifications regulate both DNA repair levels and pathway choice. How each modification achieves regulatory effects and how different modifications collaborate with each other are important questions to be answered. Here, we show that sumoylation regulates double-strand break repair partly by modifying the end resection factor Sae2. This modification is conserved from yeast to humans, and is induced by DNA damage. We mapped the sumoylation site of Sae2 to a single lysine in its self-association domain. Abolishing Sae2 sumoylation by mutating this lysine to arginine impaired Sae2 function in the processing and repair of multiple types of DNA breaks. We found that Sae2 sumoylation occurs independently of its phosphorylation, and the two modifications act in synergy to increase soluble forms of Sae2. We also provide evidence that sumoylation of the Sae2-binding nuclease, the Mre11-Rad50-Xrs2 complex, further increases end resection. These findings reveal a novel role for sumoylation in DNA repair by regulating the solubility of an end resection factor. They also show that collaboration between different modifications and among multiple substrates leads to a stronger biological effect. PMID:25569253

  11. A conserved motif flags Acyl Carrier Proteins for β-branching in polyketide synthesis

    PubMed Central

    Song, Zhongshu; Farmer, Rohit; Williams, Christopher; Hothersall, Joanne; Płoskoń, Eliza; Wattana-amorn, Pakorn; Stephens, Elton R.; Yamada, Erika; Gurney, Rachel; Takebayashi, Yuiko; Masschelein, Joleen; Cox, Russell J.; Lavigne, Rob; Willis, Christine L.; Simpson, Thomas J.; Crosby, John; Winn, Peter J.; Thomas, Christopher M.; Crump, Matthew P.


    Type I PKSs often utilise programmed β-branching, via enzymes of an “HMG-CoA synthase (HCS) cassette”, to incorporate various side chains at the second carbon from the terminal carboxylic acid of growing polyketide backbones. We identified a strong sequence motif in Acyl Carrier Proteins (ACPs) where β-branching is known. Substituting ACPs confirmed a correlation of ACP type with β-branching specificity. While these ACPs often occur in tandem, NMR analysis of tandem β-branching ACPs indicated no ACP-ACP synergistic effects and revealed that the conserved sequence motif forms an internal core rather than an exposed patch. Modelling and mutagenesis identified ACP Helix III as a probable anchor point of the ACP-HCS complex whose position is determined by the core. Mutating the core affects ACP functionality while ACP-HCS interface substitutions modulate system specificity. Our method for predicting β-carbon branching expands the potential for engineering novel polyketides and lays a basis for determining specificity rules. PMID:24056399

  12. Trichohyalin-like proteins have evolutionarily conserved roles in the morphogenesis of skin appendages.


    Mlitz, Veronika; Strasser, Bettina; Jaeger, Karin; Hermann, Marcela; Ghannadan, Minoo; Buchberger, Maria; Alibardi, Lorenzo; Tschachler, Erwin; Eckhart, Leopold


    S100 fused-type proteins (SFTPs) such as filaggrin, trichohyalin, and cornulin are differentially expressed in cornifying keratinocytes of the epidermis and various skin appendages. To determine evolutionarily conserved, and thus presumably important, features of SFTPs, we characterized nonmammalian SFTPs and compared their amino acid sequences and expression patterns with those of mammalian SFTPs. We identified an ortholog of cornulin and a previously unknown SFTP, termed scaffoldin, in reptiles and birds, whereas filaggrin was confined to mammals. In contrast to mammalian SFTPs, both cornulin and scaffoldin of the chicken are expressed in the embryonic periderm. However, scaffoldin resembles mammalian trichohyalin with regard to its expression in the filiform papillae of the tongue and in the epithelium underneath the forming tips of the claws. Furthermore, scaffoldin is expressed in the epithelial sheath around growing feathers, reminiscent of trichohyalin expression in the inner root sheath of hair. The results of this study show that SFTP-positive epithelia function as scaffolds for the growth of diverse skin appendages such as claws, nails, hair, and feathers, indicating a common evolutionary origin. PMID:24780931

  13. Multiple cellular proteins interact with LEDGF/p75 through a conserved unstructured consensus motif.


    Tesina, Petr; Čermáková, Kateřina; Hořejší, Magdalena; Procházková, Kateřina; Fábry, Milan; Sharma, Subhalakshmi; Christ, Frauke; Demeulemeester, Jonas; Debyser, Zeger; De Rijck, Jan; Veverka, Václav; Řezáčová, Pavlína


    Lens epithelium-derived growth factor (LEDGF/p75) is an epigenetic reader and attractive therapeutic target involved in HIV integration and the development of mixed lineage leukaemia (MLL1) fusion-driven leukaemia. Besides HIV integrase and the MLL1-menin complex, LEDGF/p75 interacts with various cellular proteins via its integrase binding domain (IBD). Here we present structural characterization of IBD interactions with transcriptional repressor JPO2 and domesticated transposase PogZ, and show that the PogZ interaction is nearly identical to the interaction of LEDGF/p75 with MLL1. The interaction with the IBD is maintained by an intrinsically disordered IBD-binding motif (IBM) common to all known cellular partners of LEDGF/p75. In addition, based on IBM conservation, we identify and validate IWS1 as a novel LEDGF/p75 interaction partner. Our results also reveal how HIV integrase efficiently displaces cellular binding partners from LEDGF/p75. Finally, the similar binding modes of LEDGF/p75 interaction partners represent a new challenge for the development of selective interaction inhibitors. PMID:26245978

  14. Conserved S-Layer-Associated Proteins Revealed by Exoproteomic Survey of S-Layer-Forming Lactobacilli

    PubMed Central

    Johnson, Brant R.; Hymes, Jeffrey; Sanozky-Dawes, Rosemary; Henriksen, Emily DeCrescenzo


    The Lactobacillus acidophilus homology group comprises Gram-positive species that include L. acidophilus, L. helveticus, L. crispatus, L. amylovorus, L. gallinarum, L. delbrueckii subsp. bulgaricus, L. gasseri, and L. johnsonii. While these bacteria are closely related, they have varied ecological lifestyles as dairy and food fermenters, allochthonous probiotics, or autochthonous commensals of the host gastrointestinal tract. Bacterial cell surface components play a critical role in the molecular dialogue between bacteria and interaction signaling with the intestinal mucosa. Notably, the L. acidophilus complex is distinguished in two clades by the presence or absence of S-layers, which are semiporous crystalline arrays of self-assembling proteinaceous subunits found as the outermost layer of the bacterial cell wall. In this study, S-layer-associated proteins (SLAPs) in the exoproteomes of various S-layer-forming Lactobacillus species were proteomically identified, genomically compared, and transcriptionally analyzed. Four gene regions encoding six putative SLAPs were conserved in the S-layer-forming Lactobacillus species but not identified in the extracts of the closely related progenitor, L. delbrueckii subsp. bulgaricus, which does not produce an S-layer. Therefore, the presence or absence of an S-layer has a clear impact on the exoproteomic composition of Lactobacillus species. This proteomic complexity and differences in the cell surface properties between S-layer- and non-S-layer-forming lactobacilli reveal the potential for SLAPs to mediate intimate probiotic interactions and signaling with the host intestinal mucosa. PMID:26475115

  15. Conserved hypothetical protein Rv1977 in Mycobacterium tuberculosis strains contains sequence polymorphisms and might be involved in ongoing immune evasion

    PubMed Central

    Jiang, Yi; Liu, Haican; Wang, Xuezhi; Li, Guilian; Qiu, Yan; Dou, Xiangfeng; Wan, Kanglin


    Host immune pressure and associated parasite immune evasion are key features of host-pathogen co-evolution. A previous study showed that human T cell epitopes of Mycobacterium tuberculosis are evolutionarily hyperconserved and thus it was deduced that M. tuberculosis lacks antigenic variation and immune evasion. Here, we selected 151 clinical Mycobacterium tuberculosis isolates from China, amplified gene encoding Rv1977 and compared the sequences. The results showed that Rv1977, a conserved hypothetical protein, is not conserved in M. tuberculosis strains and there are polymorphisms existed in the protein. Some mutations, especially one frameshift mutation, occurred in the antigen Rv1977, which is uncommon in M.tb strains and may lead to the protein function altering. Mutations and deletion in the gene all affect one of three T cell epitopes and the changed T cell epitope contained more than one variable position, which may suggest ongoing immune evasion. PMID:26261576

  16. Specific Prenylation of Tomato Rab Proteins by Geranylgeranyl Type-II Transferase Requires a Conserved Cysteine-Cysteine Motif.

    PubMed Central

    Yalovsky, S.; Loraine, A. E.; Gruissem, W.


    Posttranslational isoprenylation of some small GTP-binding proteins is required for their biological activity. Rab geranylgeranyl transferase (Rab GGTase) uses geranylgeranyl pyrophosphate to modify Rab proteins, its only known substrates. Geranylgeranylation of Rabs is believed to promote their association with target membranes and interaction with other proteins. Plants, like other eukaryotes, contain Rab-like proteins that are associated with intracellular membranes. However, to our knowledge, the geranylgeranylation of Rab proteins has not yet been characterized from any plant source. This report presents an activity assay that allows the characterization of prenylation of Rab-like proteins in vitro, by protein extracts prepared from plants. Tomato Rab1 proteins and mammalian Rab1a were modified by geranylgeranyl pyrophosphate but not by farnesyl pyrophosphate. This modification required a conserved cysteine-cysteine motif. A mutant form lacking the cysteine-cysteine motif could not be modified, but inhibited the geranylgeranylation of its wild-type homolog. The tomato Rab proteins were modified in vitro by protein extract prepared from yeast, but failed to become modified when the protein extract was prepared from a yeast strain containing a mutant allele for the [alpha] subunit of yeast Rab GGTase (bet4 ts). These results demonstrate that plant cells, like other eukaryotes, contain Rab GGTase-like activity. PMID:12226265

  17. Two subclasses of odorant-binding proteins in Spodoptera exigua display structural conservation and functional divergence.


    Liu, N-Y; Yang, F; Yang, K; He, P; Niu, X-H; Xu, W; Anderson, A; Dong, S-L


    Although many studies on lepidopteran pheromone-binding proteins (PBPs)/ general odorant-binding proteins (GOBPs) have been reported, the functional differentiation within and between the two odorant-binding protein (OBP) subclasses is still elusive. Here we conducted a comparative study on three SexiPBPs and two SexiGOBPs in Spodoptera exigua. Results showed that all five SexiPBP/GOBP genes have the same intron numbers and conserved exon/intron splice sites. Reverse transcription PCR results showed that these five SexiPBP/GOBPs were primarily expressed in antennae of both sexes and some were also detected in other tissues. Further, quantitative real-time PCR showed that five SexiPBP/GOBPs had different sex-biased expression patterns, with PBP1 being highly male-biased (5.96-fold difference) and PBP3 slightly female-biased (2.43-fold difference), while PBP2 and two GOBPs were approximately sex-equivalent (the absolute value<1.90-fold difference). Binding assays showed that all three SexiPBPs could bind all six sex pheromone components, but SexiPBP1 had much higher affinities [dissociation constant (Ki ) <1.10 μM] than did the other two SexiPBPs (Ki  >1.20 μM). Very intriguingly, SexiGOBP2 displayed even stronger binding to five sex pheromone components (Ki  <0.40 μM) than SexiPBP1. In contrast, SexiGOBP1 only exhibited weak binding to three alcohol-pheromone components. Similar results were obtained for tested pheromone analogues. In addition, each of SexiPBP/GOBPs selectively bound some plant odorants with considerable affinities (Ki  <10.0 μM). Taken together, of the three SexiPBPs, SexiPBP1 may play the most important role in female sex pheromone reception, and additionally all three SexiPBPs can detect some plant odorants, while SexiGOBP2 may be involved in the detection of female sex pheromones in addition to plant odorants. The results strongly suggest functional differentiation within and between the two OBP sub-classes. PMID:25345813

  18. Identification of a Conserved Non-Protein-Coding Genomic Element that Plays an Essential Role in Alphabaculovirus Pathogenesis

    PubMed Central

    Kikhno, Irina


    Highly homologous sequences 154–157 bp in length grouped under the name of “conserved non-protein-coding element” (CNE) were revealed in all of the sequenced genomes of baculoviruses belonging to the genus Alphabaculovirus. A CNE alignment led to the detection of a set of highly conserved nucleotide clusters that occupy strictly conserved positions in the CNE sequence. The significant length of the CNE and conservation of both its length and cluster architecture were identified as a combination of characteristics that make this CNE different from known viral non-coding functional sequences. The essential role of the CNE in the Alphabaculovirus life cycle was demonstrated through the use of a CNE-knockout Autographa californica multiple nucleopolyhedrovirus (AcMNPV) bacmid. It was shown that the essential function of the CNE was not mediated by the presumed expression activities of the protein- and non-protein-coding genes that overlap the AcMNPV CNE. On the basis of the presented data, the AcMNPV CNE was categorized as a complex-structured, polyfunctional genomic element involved in an essential DNA transaction that is associated with an undefined function of the baculovirus genome. PMID:24740153

  19. Evolutionary and functional conservation of the DNA non-homologous end-joining protein, XLF/Cernunnos.


    Hentges, Pierre; Ahnesorg, Peter; Pitcher, Robert S; Bruce, Chris K; Kysela, Boris; Green, Andrew J; Bianchi, Julie; Wilson, Thomas E; Jackson, Stephen P; Doherty, Aidan J


    Non-homologous end-joining is a major pathway of DNA double-strand break repair in mammalian cells, deficiency in which confers radiosensitivity and immune deficiency at the whole organism level. A core protein complex comprising the Ku70/80 heterodimer together with a complex between DNA ligase IV and XRCC4 is conserved throughout eukaryotes and assembles at double-strand breaks to mediate ligation of broken DNA ends. In Saccharomyces cerevisiae an additional NHEJ protein, Nej1p, physically interacts with the ligase IV complex and is required in vivo for ligation of DNA double-strand breaks. Recent studies with cells derived from radiosensitive and immune-deficient patients have identified the human protein, XLF (also named Cernunnos), as a crucial NHEJ protein. Here we show that XLF and Nej1p are members of the same protein superfamily and that this family has members in diverse eukaryotes. Indeed, we show that a member of this family encoded by a previously uncharacterized open-reading frame in the Schizosaccharomyces pombe genome is required for NHEJ in this organism. Furthermore, our data reveal that XLF family proteins can bind to DNA and directly interact with the ligase IV-XRCC4 complex to promote DSB ligation. We therefore conclude that XLF family proteins interact with the ligase IV-XRCC4 complex to constitute the evolutionarily conserved enzymatic core of the NHEJ machinery. PMID:17038309

  20. Macoilin, a Conserved Nervous System–Specific ER Membrane Protein That Regulates Neuronal Excitability

    PubMed Central

    Couto, Africa; Cheung, Benny H. H.; Labouesse, Michel; de Bono, Mario


    Genome sequence comparisons have highlighted many novel gene families that are conserved across animal phyla but whose biological function is unknown. Here, we functionally characterize a member of one such family, the macoilins. Macoilins are characterized by several highly conserved predicted transmembrane domains towards the N-terminus and by coiled-coil regions C-terminally. They are found throughout Eumetazoa but not in other organisms. Mutants for the single Caenorhabditis elegans macoilin, maco-1, exhibit a constellation of behavioral phenotypes, including defects in aggregation, O2 responses, and swimming. MACO-1 protein is expressed broadly and specifically in the nervous system and localizes to the rough endoplasmic reticulum; it is excluded from dendrites and axons. Apart from subtle synapse defects, nervous system development appears wild-type in maco-1 mutants. However, maco-1 animals are resistant to the cholinesterase inhibitor aldicarb and sensitive to levamisole, suggesting pre-synaptic defects. Using in vivo imaging, we show that macoilin is required to evoke Ca2+ transients, at least in some neurons: in maco-1 mutants the O2-sensing neuron PQR is unable to generate a Ca2+ response to a rise in O2. By genetically disrupting neurotransmission, we show that pre-synaptic input is not necessary for PQR to respond to O2, indicating that the response is mediated by cell-intrinsic sensory transduction and amplification. Disrupting the sodium leak channels NCA-1/NCA-2, or the N-,P/Q,R-type voltage-gated Ca2+ channels, also fails to disrupt Ca2+ responses in the PQR cell body to O2 stimuli. By contrast, mutations in egl-19, which encodes the only Caenorhabditis elegans L-type voltage-gated Ca2+ channel α1 subunit, recapitulate the Ca2+ response defect we see in maco-1 mutants, although we do not see defects in localization of EGL-19. Together, our data suggest that macoilin acts in the ER to regulate assembly or traffic of ion channels or ion channel

  1. The role of a conserved tyrosine residue in high-potential iron sulfur proteins.

    PubMed Central

    Iwagami, S. G.; Creagh, A. L.; Haynes, C. A.; Borsari, M.; Felli, I. C.; Piccioli, M.; Eltis, L. D.


    Conserved tyrosine-12 of Ectothiorhodospira halophila high-potential iron sulphur protein (HiPIP) iso-I was substituted with phenylalanine (Y12F), histidine (Y12H), tryptophan (Y12W), isoleucine (Y12I), and alanine (Y12A). Variants Y12A and Y12I were expressed to reasonable levels in cells grown at lower temperatures, but decomposed during purification. Variants Y12F, Y12H, and Y12W were substantially destabilized with respect to the recombinant wild-type HiPIP (rcWT) as determined by differential scanning calorimetry over a pH range of 7.0-11.0. Characterization of the Y12F variant by NMR indicates that the principal structural differences between this variant and the rcWT HiPIP result from the loss of the two hydrogen bonds of the Tyr-12 hydroxyl group with Asn-14 O delta 1 and Lys-59 NH, respectively. The effect of the loss of the latter interaction is propagated through the Lys-59/Val-58 peptide bond, thereby perturbing Gly-46. The delta delta GDapp of Y12F of 2.3 kcal/mol with respect to rcWT HiPIP (25 degrees C, pH 7.0) is entirely consistent with the contribution of these two hydrogen bonds to the stability of the latter. CD measurements show that Tyr-12 influences several electronic transitions within the cluster. The midpoint reduction potentials of variants Y12F, Y12H, and Y12W were 17, 19, and 22 mV (20 mM MOPS, 0.2 M sodium chloride, pH 6.98, 25 degrees C), respectively, higher than that of rcWT HiPIP. The current results indicate that, although conserved Tyr-12 modulates the properties of the cluster, its principle function is to stabilize the HiPIP through hydrogen bonds involving its hydroxyl group and electrostatic interactions involving its aromatic ring. PMID:8580847

  2. Inter-phylum structural conservation of the magnetosome-associated TPR-containing protein, MamA.


    Zeytuni, Natalie; Baran, Dror; Davidov, Geula; Zarivach, Raz


    Magnetotactic bacteria enclose the magnetosome, a unique prokaryotic sub-cellular organelle that allows the biomineralization of magnetic nano-crystals. Membrane-coated magnetosomes are arranged into a linear chain that permits magnetotactic bacteria to navigate geomagnetic fields. Magnetosome assembly and biomineralization are controlled by conserved magnetosome-associated proteins, including MamA, a tetra-trico-peptide repeat (TPR)-containing protein that was shown to coat the magnetosome membrane. In this study, two MamA structures from Candidatus Magnetobacterium bavaricum (Mbav) were determined via X-ray crystallography. These structures confirm that Mbav MamA folds as a sequential TPR protein and shares a high degree of structural similarity with homologous MamA proteins from Magnetospirillum species. Furthermore, the two TPR-containing domains of MamA are separated by an interphylum-conserved region containing a flexible hinge that is involved in ligand binding and recognition. Finally, substantial differences were found in the local stabilization of the MamA N-terminal domain as a result of the loss of an evolutionary conserved salt bridge. PMID:22917855

  3. Protein fractions in forage legumes containing protein-binding polyphenols: Freeze-drying vs. conservation as hay or silage.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We compared protein fractions in freeze-dried herbage to hay or silage of forage legumes containing about 200 g/kg of crude protein. Protein was partitioned with buffer and detergents into rapidly (A and B1), moderately (B2), and slowly (B3) degraded and undegradable acid-detergent insoluble protein...

  4. RNA-binding proteins in eye development and disease: implication of conserved RNA granule components.


    Dash, Soma; Siddam, Archana D; Barnum, Carrie E; Janga, Sarath Chandra; Lachke, Salil A


    The molecular biology of metazoan eye development is an area of intense investigation. These efforts have led to the surprising recognition that although insect and vertebrate eyes have dramatically different structures, the orthologs or family members of several conserved transcription and signaling regulators such as Pax6, Six3, Prox1, and Bmp4 are commonly required for their development. In contrast, our understanding of posttranscriptional regulation in eye development and disease, particularly regarding the function of RNA-binding proteins (RBPs), is limited. We examine the present knowledge of RBPs in eye development in the insect model Drosophila as well as several vertebrate models such as fish, frog, chicken, and mouse. Interestingly, of the 42 RBPs that have been investigated for their expression or function in vertebrate eye development, 24 (~60%) are recognized in eukaryotic cells as components of RNA granules such as processing bodies, stress granules, or other specialized ribonucleoprotein (RNP) complexes. We discuss the distinct developmental and cellular events that may necessitate potential RBP/RNA granule-associated RNA regulon models to facilitate posttranscriptional control of gene expression in eye morphogenesis. In support of these hypotheses, three RBPs and RNP/RNA granule components Tdrd7, Caprin2, and Stau2 are linked to ocular developmental defects such as congenital cataract, Peters anomaly, and microphthalmia in human patients or animal models. We conclude by discussing the utility of interdisciplinary approaches such as the bioinformatics tool iSyTE (integrated Systems Tool for Eye gene discovery) to prioritize RBPs for deriving posttranscriptional regulatory networks in eye development and disease. WIREs RNA 2016, 7:527-557. doi: 10.1002/wrna.1355 For further resources related to this article, please visit the WIREs website. PMID:27133484

  5. Phylogenetic Relationships within the Opisthokonta Based on Phylogenomic Analyses of Conserved Single-Copy Protein Domains

    PubMed Central

    Torruella, Guifré; Derelle, Romain; Paps, Jordi; Lang, B. Franz; Roger, Andrew J.; Shalchian-Tabrizi, Kamran; Ruiz-Trillo, Iñaki


    Many of the eukaryotic phylogenomic analyses published to date were based on alignments of hundreds to thousands of genes. Frequently, in such analyses, the most realistic evolutionary models currently available are often used to minimize the impact of systematic error. However, controversy remains over whether or not idiosyncratic gene family dynamics (i.e., gene duplications and losses) and incorrect orthology assignments are always appropriately taken into account. In this paper, we present an innovative strategy for overcoming orthology assignment problems. Rather than identifying and eliminating genes with paralogy problems, we have constructed a data set comprised exclusively of conserved single-copy protein domains that, unlike most of the commonly used phylogenomic data sets, should be less confounded by orthology miss-assignments. To evaluate the power of this approach, we performed maximum likelihood and Bayesian analyses to infer the evolutionary relationships within the opisthokonts (which includes Metazoa, Fungi, and related unicellular lineages). We used this approach to test 1) whether Filasterea and Ichthyosporea form a clade, 2) the interrelationships of early-branching metazoans, and 3) the relationships among early-branching fungi. We also assessed the impact of some methods that are known to minimize systematic error, including reducing the distance between the outgroup and ingroup taxa or using the CAT evolutionary model. Overall, our analyses support the Filozoa hypothesis in which Ichthyosporea are the first holozoan lineage to emerge followed by Filasterea, Choanoflagellata, and Metazoa. Blastocladiomycota appears as a lineage separate from Chytridiomycota, although this result is not strongly supported. These results represent independent tests of previous phylogenetic hypotheses, highlighting the importance of sophisticated approaches for orthology assignment in phylogenomic analyses. PMID:21771718

  6. Phylogenetic relationships within the Opisthokonta based on phylogenomic analyses of conserved single-copy protein domains.


    Torruella, Guifré; Derelle, Romain; Paps, Jordi; Lang, B Franz; Roger, Andrew J; Shalchian-Tabrizi, Kamran; Ruiz-Trillo, Iñaki


    Many of the eukaryotic phylogenomic analyses published to date were based on alignments of hundreds to thousands of genes. Frequently, in such analyses, the most realistic evolutionary models currently available are often used to minimize the impact of systematic error. However, controversy remains over whether or not idiosyncratic gene family dynamics (i.e., gene duplications and losses) and incorrect orthology assignments are always appropriately taken into account. In this paper, we present an innovative strategy for overcoming orthology assignment problems. Rather than identifying and eliminating genes with paralogy problems, we have constructed a data set comprised exclusively of conserved single-copy protein domains that, unlike most of the commonly used phylogenomic data sets, should be less confounded by orthology miss-assignments. To evaluate the power of this approach, we performed maximum likelihood and Bayesian analyses to infer the evolutionary relationships within the opisthokonts (which includes Metazoa, Fungi, and related unicellular lineages). We used this approach to test 1) whether Filasterea and Ichthyosporea form a clade, 2) the interrelationships of early-branching metazoans, and 3) the relationships among early-branching fungi. We also assessed the impact of some methods that are known to minimize systematic error, including reducing the distance between the outgroup and ingroup taxa or using the CAT evolutionary model. Overall, our analyses support the Filozoa hypothesis in which Ichthyosporea are the first holozoan lineage to emerge followed by Filasterea, Choanoflagellata, and Metazoa. Blastocladiomycota appears as a lineage separate from Chytridiomycota, although this result is not strongly supported. These results represent independent tests of previous phylogenetic hypotheses, highlighting the importance of sophisticated approaches for orthology assignment in phylogenomic analyses. PMID:21771718

  7. The Highly Conserved MraZ Protein Is a Transcriptional Regulator in Escherichia coli

    PubMed Central

    Eraso, Jesus M.; Markillie, Lye M.; Mitchell, Hugh D.; Taylor, Ronald C.; Orr, Galya


    The mraZ and mraW genes are highly conserved in bacteria, both in sequence and in their position at the head of the division and cell wall (dcw) gene cluster. Located directly upstream of the mraZ gene, the Pmra promoter drives the transcription of mraZ and mraW, as well as many essential cell division and cell wall genes, but no regulator of Pmra has been found to date. Although MraZ has structural similarity to the AbrB transition state regulator and the MazE antitoxin and MraW is known to methylate the 16S rRNA, mraZ and mraW null mutants have no detectable phenotypes. Here we show that overproduction of Escherichia coli MraZ inhibited cell division and was lethal in rich medium at high induction levels and in minimal medium at low induction levels. Co-overproduction of MraW suppressed MraZ toxicity, and loss of MraW enhanced MraZ toxicity, suggesting that MraZ and MraW have antagonistic functions. MraZ-green fluorescent protein localized to the nucleoid, suggesting that it binds DNA. Consistent with this idea, purified MraZ directly bound a region of DNA containing three direct repeats between Pmra and the mraZ gene. Excess MraZ reduced the expression of an mraZ-lacZ reporter, suggesting that MraZ acts as a repressor of Pmra, whereas a DNA-binding mutant form of MraZ failed to repress expression. Transcriptome sequencing (RNA-seq) analysis suggested that MraZ also regulates the expression of genes outside the dcw cluster. In support of this, purified MraZ could directly bind to a putative operator site upstream of mioC, one of the repressed genes identified by RNA-seq. PMID:24659771

  8. An ER-directed transcriptional response to unfolded protein stress in the absence of conserved sensor-transducer proteins in Giardia lamblia.


    Spycher, Cornelia; Herman, Emily K; Morf, Laura; Qi, Weihong; Rehrauer, Hubert; Aquino Fournier, Catharine; Dacks, Joel B; Hehl, Adrian B


    The protozoan Giardia lamblia has a minimized organelle repertoire, and most strikingly lacks a classical stacked Golgi apparatus. Nevertheless, Giardia trophozoites constitutively secrete variant surface proteins, and dramatically increase the volume of protein secretion during differentiation to cysts. Eukaryotic cells have evolved an elaborate system for quality control (QC) of protein folding and capacity in the endoplasmic reticulum (ER). Upon ER-overload, an unfolded protein response (UPR) is triggered on transcriptional/translational level aiming at alleviating ER stress. In Giardia, a minimized secretory machinery and absence of glycan-dependent QC suggests that a genetically conserved UPR (or functional equivalent) to cope with insults to the secretory system has been eliminated. We tested this hypothesis of UPR elimination by profiling the transcriptional response during induced ER-folding stress. We show that on the contrary, ER-folding stress triggers a stressor-specific, ER-directed response with upregulation of only ~ 30 genes, with different kinetics and scope compared with the UPR of other eukaryotes. Computational genomics revealed conserved cis-acting motifs in upstream regions of responder genes capable of stressor-specific gene regulation in transfected cells. Interestingly, the sensors/transducers of folding stress, well conserved in model eukaryotes, are absent in Giardia suggesting the presence of a novel version of this essential eukaryotic function. PMID:23617761

  9. Novel Conserved Group A Streptococcal Proteins Identified by the Antigenome Technology as Vaccine Candidates for a Non-M Protein-Based Vaccine ▿

    PubMed Central

    Fritzer, Andrea; Senn, Beatrice M.; Minh, Duc Bui; Hanner, Markus; Gelbmann, Dieter; Noiges, Birgit; Henics, Tamás; Schulze, Kai; Guzman, Carlos A.; Goodacre, John; von Gabain, Alexander; Nagy, Eszter; Meinke, Andreas L.


    Group A streptococci (GAS) can cause a wide variety of human infections ranging from asymptomatic colonization to life-threatening invasive diseases. Although antibiotic treatment is very effective, when left untreated, Streptococcus pyogenes infections can lead to poststreptococcal sequelae and severe disease causing significant morbidity and mortality worldwide. To aid the development of a non-M protein-based prophylactic vaccine for the prevention of group A streptococcal infections, we identified novel immunogenic proteins using genomic surface display libraries and human serum antibodies from donors exposed to or infected by S. pyogenes. Vaccine candidate antigens were further selected based on animal protection in murine lethal-sepsis models with intranasal or intravenous challenge with two different M serotype strains. The nine protective antigens identified are highly conserved; eight of them show more than 97% sequence identity in 13 published genomes as well as in approximately 50 clinical isolates tested. Since the functions of the selected vaccine candidates are largely unknown, we generated deletion mutants for three of the protective antigens and observed that deletion of the gene encoding Spy1536 drastically reduced binding of GAS cells to host extracellular matrix proteins, due to reduced surface expression of GAS proteins such as Spy0269 and M protein. The protective, highly conserved antigens identified in this study are promising candidates for the development of an M-type-independent, protein-based vaccine to prevent infection by S. pyogenes. PMID:20624906

  10. Sequence analysis of the L protein of the Ebola 2014 outbreak: Insight into conserved regions and mutations.


    Ayub, Gohar; Waheed, Yasir


    The 2014 Ebola outbreak was one of the largest that have occurred; it started in Guinea and spread to Nigeria, Liberia and Sierra Leone. Phylogenetic analysis of the current virus species indicated that this outbreak is the result of a divergent lineage of the Zaire ebolavirus. The L protein of Ebola virus (EBOV) is the catalytic subunit of the RNA‑dependent RNA polymerase complex, which, with VP35, is key for the replication and transcription of viral RNA. Earlier sequence analysis demonstrated that the L protein of all non‑segmented negative‑sense (NNS) RNA viruses consists of six domains containing conserved functional motifs. The aim of the present study was to analyze the presence of these motifs in 2014 EBOV isolates, highlight their function and how they may contribute to the overall pathogenicity of the isolates. For this purpose, 81 2014 EBOV L protein sequences were aligned with 475 other NNS RNA viruses, including Paramyxoviridae and Rhabdoviridae viruses. Phylogenetic analysis of all EBOV outbreak L protein sequences was also performed. Analysis of the amino acid substitutions in the 2014 EBOV outbreak was conducted using sequence analysis. The alignment demonstrated the presence of previously conserved motifs in the 2014 EBOV isolates and novel residues. Notably, all the mutations identified in the 2014 EBOV isolates were tolerant, they were pathogenic with certain examples occurring within previously determined functional conserved motifs, possibly altering viral pathogenicity, replication and virulence. The phylogenetic analysis demonstrated that all sequences with the exception of the 2014 EBOV sequences were clustered together. The 2014 EBOV outbreak has acquired a great number of mutations, which may explain the reasons behind this unprecedented outbreak. Certain residues critical to the function of the polymerase remain conserved and may be targets for the development of antiviral therapeutic agents. PMID:27082438

  11. Conserved protein YecM from Escherichia coli shows structural homology to metal-binding isomerases and oxygenases.

    SciTech Connect

    Zhang, R.; Duke, N.; Laskowski, R.; Evdokimova, E.; Skarina, T.; Edwards, A.; Joachimiak, A.; Savchenko, A.; Univ. of Toronto; Univ. Health Network; Birbeck Coll.


    The crystal structure of protein YecM{sup 1} has been determined at 1.6 {angstrom} resolution as a part of the ongoing structural genomics initiative ( The YecM is a conserved, hypothetical Escherichia coli protein with sequence homologs found exclusively in bacteria, including Salmonella typhimunium, Yersinia pestis, Vibrio cholerae, Haemophilus influenza, and Pasteurella multocida. YecM (188 residues) shows also sequence similarity to proteins in COG database ( YecM (Pfam-B domain 24546) was selected as a structural genomics target it shows no sequence similarity with proteins of known three-dimensional structure and therefore, may contain a previously unobserved field.

  12. Conserved Arginines of Bovine Adenovirus-3 33K Protein Are Important for Transportin-3 Mediated Transport and Virus Replication

    PubMed Central

    Islam, Azharul; Tikoo, Suresh K.


    The L6 region of bovine adenovirus (BAdV)-3 encodes a spliced protein designated 33K. The 33K specific sera detected five major proteins and three minor proteins in transfected or virus infected cells, which could arise by internal initiation of translation and alternative splicing. The 33K protein is predominantly localized to the nucleus of BAdV-3 infected cells. The 33K nuclear transport utilizes both classical importin-α/-β and importin-β dependent nuclear import pathways and preferentially binds to importin-α5 and transportin-3 receptors, respectively. Analysis of mutant 33K proteins demonstrated that amino acids 201–240 of the conserved C-terminus of 33K containing RS repeat are required for nuclear localization and, binding to both importin-α5 and transportin-3 receptors. Interestingly, the arginine residues of conserved RS repeat are required for binding to transportin-3 receptor but not to importin-α5 receptor. Moreover, mutation of arginines residues of RS repeat proved lethal for production of progeny virus. Our results suggest that arginines of RS repeat are required for efficient nuclear transport of 33K mediated by transportin-3, which appears to be essential for replication and production of infectious virion. PMID:25019945

  13. MadR1, a Mycobacterium tuberculosis cell cycle stress response protein that is a member of a widely conserved protein class of prokaryotic, eukaryotic and archeal origin.


    Crew, Rebecca; Ramirez, Melissa V; England, Kathleen; Slayden, Richard A


    Stress-induced molecular programs designed to stall division progression are nearly ubiquitous in bacteria, with one well-known example being the participation of the SulA septum inhibiting protein in the SOS DNA damage repair response. Mycobacteria similarly demonstrate stress-altered growth kinetics, however no such regulators have been found in these organisms. We therefore set out to identify SulA-like regulatory proteins in Mycobacterium tuberculosis. A bioinformatics modeling-based approach led to the identification of rv2216 as encoding for a protein with weak similarity to SulA, further analysis distinguished this protein as belonging to a group of uncharacterized growth promoting proteins. We have named the mycobacterial protein encoded by rv2216 morphology altering division regulator protein 1, MadR1. Overexpression of madR1 modulated cell length while maintaining growth kinetics similar to wild-type, and increased the proportion of bent or V-form cells in the population. The presence of MadR1-GFP at regions of cellular elongation (poles) and morphological differentiation (V-form) suggests MadR1 involvement in phenotypic heterogeneity and longitudinal cellular growth. Global transcriptional analysis indicated that MadR1 functionality is linked to lipid editing programs required for growth and persistence. This is the first report to differentiate the larger class of these conserved proteins from SulA proteins and characterizes MadR1 effects on the mycobacterial cell. PMID:25829286

  14. Stress Responses of Small Heat Shock Protein Genes in Lepidoptera Point to Limited Conservation of Function across Phylogeny

    PubMed Central

    Zhang, Bo; Zheng, Jincheng; Peng, Yu; Liu, Xiaoxia; Hoffmann, Ary A.; Ma, Chun-Sen


    The small heat shock protein (sHsp) family is thought to play an important role in protein refolding and signal transduction, and thereby protect organisms from stress. However little is known about sHsp function and conservation across phylogenies. In the current study, we provide a comprehensive assessment of small Hsp genes and their stress responses in the oriental fruit moth (OFM), Grapholita molesta. Fourteen small heat shock proteins of OFM clustered with related Hsps in other Lepidoptera despite a high level of variability among them, and in contrast to the highly conserved Hsp11.1. The only known lepidopteran sHsp ortholog (Hsp21.3) was consistently unaffected under thermal stress in Lepidoptera where it has been characterized. However the phylogenetic position of the sHsps within the Lepidoptera was not associated with conservation of induction patterns under thermal extremes or diapause. These findings suggest that the sHsps have evolved rapidly to develop new functions within the Lepidoptera. PMID:26196395

  15. Conserved amino acids within the N-terminus of the West Nile virus NS4A protein contribute to virus replication, protein stability and membrane proliferation

    SciTech Connect

    Ambrose, R.L.; Mackenzie, J.M.


    The West Nile virus strain Kunjin virus (WNV{sub KUN}) NS4A protein is a multifunctional protein involved in many aspects of the virus life-cycle and is a major component of the WNV{sub KUN} replication complex (RC). Previously we identified a conserved region in the C-terminus of NS4A regulating proteolytic processing and RC assembly, and now investigate key conserved residues in the N-terminus of NS4A and their contribution to WNV{sub KUN} replication. Mutation of P13 completely ablated replication, whereas, mutation of P48 and D49, near the first transmembrane helix, and G66 within the helix, showed variable defects in replication, virion secretion and membrane proliferation. Intriguingly, the P48 and G66 NS4A mutants resulted in specific proteasome depletion of NS4A that could in part be rescued with a proteasome inhibitor. Our results suggest that the N-terminus of NS4A contributes to correct folding and stability, essential for facilitating the essential roles of NS4A during replication. - Highlights: • Mutation of Proline13 of the WNV NS4A protein is lethal to replication. • 1st TMB helix of NS4A contributes to protein stability and membrane remodelling. • Unstable mutants of NS4A can be rescued with a proteasome inhibitor. • This study (and of others) contributes to a functional mapping of the NS4A protein.

  16. Conservation and Variability of Synaptonemal Complex Proteins in Phylogenesis of Eukaryotes

    PubMed Central

    Grishaeva, Tatiana M.; Bogdanov, Yuri F.


    The problems of the origin and evolution of meiosis include the enigmatic variability of the synaptonemal complexes (SCs) which, being morphology similar, consist of different proteins in different eukaryotic phyla. Using bioinformatics methods, we monitored all available eukaryotic proteomes to find proteins similar to known SC proteins of model organisms. We found proteins similar to SC lateral element (LE) proteins and possessing the HORMA domain in the majority of the eukaryotic taxa and assume them the most ancient among all SC proteins. Vertebrate LE proteins SYCP2, SYCP3, and SC65 proved to have related proteins in many invertebrate taxa. Proteins of SC central space are most evolutionarily variable. It means that different protein-protein interactions can exist to connect LEs. Proteins similar to the known SC proteins were not found in Euglenophyta, Chrysophyta, Charophyta, Xanthophyta, Dinoflagellata, and primitive Coelomata. We conclude that different proteins whose common feature is the presence of domains with a certain conformation are involved in the formation of the SC in different eukaryotic phyla. This permits a targeted search for orthologs of the SC proteins using phylogenetic trees. Here we consider example of phylogenetic trees for protozoans, fungi, algae, mosses, and flowering plants. PMID:25147749

  17. Conservation and variability of synaptonemal complex proteins in phylogenesis of eukaryotes.


    Grishaeva, Tatiana M; Bogdanov, Yuri F


    The problems of the origin and evolution of meiosis include the enigmatic variability of the synaptonemal complexes (SCs) which, being morphology similar, consist of different proteins in different eukaryotic phyla. Using bioinformatics methods, we monitored all available eukaryotic proteomes to find proteins similar to known SC proteins of model organisms. We found proteins similar to SC lateral element (LE) proteins and possessing the HORMA domain in the majority of the eukaryotic taxa and assume them the most ancient among all SC proteins. Vertebrate LE proteins SYCP2, SYCP3, and SC65 proved to have related proteins in many invertebrate taxa. Proteins of SC central space are most evolutionarily variable. It means that different protein-protein interactions can exist to connect LEs. Proteins similar to the known SC proteins were not found in Euglenophyta, Chrysophyta, Charophyta, Xanthophyta, Dinoflagellata, and primitive Coelomata. We conclude that different proteins whose common feature is the presence of domains with a certain conformation are involved in the formation of the SC in different eukaryotic phyla. This permits a targeted search for orthologs of the SC proteins using phylogenetic trees. Here we consider example of phylogenetic trees for protozoans, fungi, algae, mosses, and flowering plants. PMID:25147749

  18. The viral transactivator HBx protein exhibits a high potential for regulation via phosphorylation through an evolutionarily conserved mechanism

    PubMed Central


    Background Hepatitis B virus (HBV) encodes an oncogenic factor, HBx, which is a multifunctional protein that can induce dysfunctional regulation of signaling pathways, transcription, and cell cycle progression, among other processes, through interactions with target host factors. The subcellular localization of HBx is both cytoplasmic and nuclear. This dynamic distribution of HBx could be essential to the multiple roles of the protein at different stages during HBV infection. Transactivational functions of HBx may be exerted both in the nucleus, via interaction with host DNA-binding proteins, and in the cytoplasm, via signaling pathways. Although there have been many studies describing different pathways altered by HBx, and its innumerable binding partners, the molecular mechanism that regulates its different roles has been difficult to elucidate. Methods In the current study, we took a bioinformatics approach to investigate whether the viral protein HBx might be regulated via phosphorylation by an evolutionarily conserved mechanism. Results We found that the phylogenetically conserved residues Ser25 and Ser41 (both within the negative regulatory domain), and Thr81 (in the transactivation domain) are predicted to be phosphorylated. By molecular 3D modeling of HBx, we further show these residues are all predicted to be exposed on the surface of the protein, making them easily accesible to these types of modifications. Furthermore, we have also identified Yin Yang sites that might have the potential to be phosphorylated and O-β-GlcNAc interplay at the same residues. Conclusions Thus, we propose that the different roles of HBx displayed in different subcellular locations might be regulated by an evolutionarily conserved mechanism of posttranslational modification, via phosphorylation. PMID:23079056

  19. Biochemical and Genetic Conservation of Fission Yeast Dsk1 and Human SR Protein-Specific Kinase 1

    PubMed Central

    Tang, Zhaohua; Kuo, Tiffany; Shen, Jenny; Lin, Ren-Jang


    Arginine/serine-rich (RS) domain-containing proteins and their phosphorylation by specific protein kinases constitute control circuits to regulate pre-mRNA splicing and coordinate splicing with transcription in mammalian cells. We present here the finding that similar SR networks exist in Schizosaccharomyces pombe. We previously showed that Dsk1 protein, originally described as a mitotic regulator, displays high activity in phosphorylating S. pombe Prp2 protein (spU2AF59), a homologue of human U2AF65. We now demonstrate that Dsk1 also phosphorylates two recently identified fission yeast proteins with RS repeats, Srp1 and Srp2, in vitro. The phosphorylated proteins bear the same phosphoepitope found in mammalian SR proteins. Consistent with its substrate specificity, Dsk1 forms kinase-competent complexes with those proteins. Furthermore, dsk1+ gene determines the phenotype of prp2+ overexpression, providing in vivo evidence that Prp2 is a target for Dsk1. The dsk1-null mutant strain became severely sick with the additional deletion of a related kinase gene. Significantly, human SR protein-specific kinase 1 (SRPK1) complements the growth defect of the double-deletion mutant. In conjunction with the resemblance of dsk1+ and SRPK1 in sequence homology, biochemical properties, and overexpression phenotypes, the complementation result indicates that SRPK1 is a functional homologue of Dsk1. Collectively, our studies illustrate the conserved SR networks in S. pombe consisting of RS domain-containing proteins and SR protein-specific kinases and thus establish the importance of the networks in eucaryotic organisms. PMID:10629038

  20. Dissociation of Paramyxovirus Interferon Evasion Activities: Universal and Virus-Specific Requirements for Conserved V Protein Amino Acids in MDA5 Interference ▿

    PubMed Central

    Ramachandran, Aparna; Horvath, Curt M.


    The V protein of the paramyxovirus subfamily Paramyxovirinae is an important virulence factor that can interfere with host innate immunity by inactivating the cytosolic pathogen recognition receptor MDA5. This interference is a result of a protein-protein interaction between the highly conserved carboxyl-terminal domain of the V protein and the helicase domain of MDA5. The V protein C-terminal domain (CTD) is an evolutionarily conserved 49- to 68-amino-acid region that coordinates two zinc atoms per protein chain. Site-directed mutagenesis of conserved residues in the V protein CTD has revealed both universal and virus-specific requirements for zinc coordination in MDA5 engagement and has also identified other conserved residues as critical for MDA5 interaction and interference. Mutation of these residues produces V proteins that are specifically defective for MDA5 interference and not impaired in targeting STAT1 for proteasomal degradation via the VDC ubiquitin ligase complex. Results demonstrate that mutation of conserved charged residues in the V proteins of Nipah virus, measles virus, and mumps virus also abolishes MDA5 interaction. These findings clearly define molecular determinants for MDA5 inhibition by the paramyxovirus V proteins. PMID:20719949

  1. Grouping of amino acids and recognition of protein structurally conserved regions by reduced alphabets of amino acids.


    Li, Jing; Wang, Wei


    Sequence alignment is a common method for finding protein structurally conserved/similar regions. However, sequence alignment is often not accurate if sequence identities between to-be-aligned sequences are less than 30%. This is because that for these sequences, different residues may play similar structural roles and they are incorrectly aligned during the sequence alignment using substitution matrix consisting of 20 types of residues. Based on the similarity of physicochemical features, residues can be clustered into a few groups. Using such simplified alphabets, the complexity of protein sequences is reduced and at the same time the key information encoded in the sequences remains. As a result, the accuracy of sequence alignment might be improved if the residues are properly clustered. Here, by using a database of aligned protein structures (DAPS), a new clustering method based on the substitution scores is proposed for the grouping of residues, and substitution matrices of residues at different levels of simplification are constructed. The validity of the reduced alphabets is confirmed by relative entropy analysis. The reduced alphabets are applied to recognition of protein structurally conserved/similar regions by sequence alignment. The results indicate that the accuracy or efficiency of sequence alignment can be improved with the optimal reduced alphabet with N around 9. PMID:17609897

  2. BAR-SH3 sorting nexins are conserved interacting proteins of Nervous wreck that organize synapses and promote neurotransmission

    PubMed Central

    Ukken, Fiona P.; Bruckner, Joseph J.; Weir, Kurt L.; Hope, Sarah J.; Sison, Samantha L.; Birschbach, Ryan M.; Hicks, Lawrence; Taylor, Kendra L.; Dent, Erik W.; Gonsalvez, Graydon B.; O'Connor-Giles, Kate M.


    ABSTRACT Nervous wreck (Nwk) is a conserved F-BAR protein that attenuates synaptic growth and promotes synaptic function in Drosophila. In an effort to understand how Nwk carries out its dual roles, we isolated interacting proteins using mass spectrometry. We report a conserved interaction between Nwk proteins and BAR-SH3 sorting nexins, a family of membrane-binding proteins implicated in diverse intracellular trafficking processes. In mammalian cells, BAR-SH3 sorting nexins induce plasma membrane tubules that localize NWK2, consistent with a possible functional interaction during the early stages of endocytic trafficking. To study the role of BAR-SH3 sorting nexins in vivo, we took advantage of the lack of genetic redundancy in Drosophila and employed CRISPR-based genome engineering to generate null and endogenously tagged alleles of SH3PX1. SH3PX1 localizes to neuromuscular junctions where it regulates synaptic ultrastructure, but not synapse number. Consistently, neurotransmitter release was significantly diminished in SH3PX1 mutants. Double-mutant and tissue-specific-rescue experiments indicate that SH3PX1 promotes neurotransmitter release presynaptically, at least in part through functional interactions with Nwk, and might act to distinguish the roles of Nwk in regulating synaptic growth and function. PMID:26567222

  3. The Sec1/Munc18 Protein Groove Plays a Conserved Role in Interaction with Sec9p/SNAP-25.


    Weber-Boyvat, Marion; Chernov, Konstantin G; Aro, Nina; Wohlfahrt, Gerd; Olkkonen, Vesa M; Jäntti, Jussi


    The Sec1/Munc18 (SM) proteins constitute a conserved family with essential functions in SNARE-mediated membrane fusion. Recently, a new protein-protein interaction site in Sec1p, designated the groove, was proposed. Here, we show that a sec1 groove mutant yeast strain, sec1(w24), displays temperature-sensitive growth and secretion defects. The yeast Sec1p and mammalian Munc18-1 grooves were shown to play an important role in the interaction with the SNAREs Sec9p and SNAP-25b, respectively. Incubation of SNAP-25b with the Munc18-1 groove mutant resulted in a lag in the kinetics of SNARE complex assembly in vitro when compared with wild-type Munc18-1. The SNARE regulator SRO7 was identified as a multicopy suppressor of sec1(w24) groove mutant and an intact Sec1p groove was required for the plasma membrane targeting of Sro7p-SNARE complexes. Simultaneous inactivation of Sec1p groove and SRO7 resulted in reduced levels of exocytic SNARE complexes. Our results identify the groove as a conserved interaction surface in SM proteins. The results indicate that this structural element is important for interactions with Sec9p/SNAP-25 and participates, in concert with Sro7p, in the initial steps of SNARE complex assembly. PMID:26572066

  4. Prevalent distribution and conservation of Streptococcus suis Lmb protein and its protective capacity against the Chinese highly virulent strain infection.


    Zhang, Yan-Mei; Shao, Zhu-Qing; Wang, Jing; Wang, Ling; Li, Xianfu; Wang, Changjun; Tang, Jiaqi; Pan, Xiuzhen


    Streptococcus suis (S. suis) is an important zoonotic pathogen that causes multiple diseases in both pigs and humans. Many studies suggest that Streptococcus utilizes host extracellular matrix proteins, including laminin, for adhesion and invasion of host cells. Recently, we identified a putative Lmb protein (CDS 0330) of a highly virulent strain of S. suis (serotype 2). In this study, we characterized the ability of CDS 0330 to bind human laminin, and evaluated the protective efficacy of a recombinant protein vaccine. Bioinformatic analysis revealed that both the amino acid sequence and tertiary structure of CDS 0330 were similar to Lmb proteins in other Streptococcus. In addition, the sequence of CDS 0330 was present in the genomes of 26 of the 38 sequenced streptococci species, indicating an early origin and conservation of this gene. Particularly, all 17 sequenced S. suis genomes, regardless of serotype or geographic origin, contained CDS 0330 gene in their genome with a minimum pair-wise amino acid identity of 92%. PCR amplification revealed that CDS 0330 gene is distributed throughout 35 S. suis serotypes in the lmb-htp format. Flow cytometry analysis confirmed that CDS 0330 was expressed on the cell surface of S. suis, and ELISA revealed the recombinant CDS 0330 protein could bind laminin in vitro. Finally, vaccinating mice with recombinant CDS 0330 protein significantly prolonged survival after S. suis infection. Together, these data reveal that CDS 0330 is a laminin binding protein of S. suis 2, and open new avenues for preventing S. suis 2 infection. PMID:24120016

  5. Crystal Structure of pb9, the Distal Tail Protein of Bacteriophage T5: a Conserved Structural Motif among All Siphophages

    PubMed Central

    Flayhan, Ali; Vellieux, Frédéric M. D.; Lurz, Rudi; Maury, Olivier; Contreras-Martel, Carlos; Girard, Eric; Boulanger, Pascale


    The tail of Caudovirales bacteriophages serves as an adsorption device, a host cell wall-perforating machine, and a genome delivery pathway. In Siphoviridae, the assembly of the long and flexible tail is a highly cooperative and regulated process that is initiated from the proteins forming the distal tail tip complex. In Gram-positive-bacterium-infecting siphophages, the distal tail (Dit) protein has been structurally characterized and is proposed to represent a baseplate hub docking structure. It is organized as a hexameric ring that connects the tail tube and the adsorption device. In this study, we report the characterization of pb9, a tail tip protein of Escherichia coli bacteriophage T5. By immunolocalization, we show that pb9 is located in the upper part of the cone of the T5 tail tip, at the end of the tail tube. The crystal structure of pb9 reveals a two-domain protein. Domain A exhibits remarkable structural similarity with the N-terminal domain of known Dit proteins, while domain B adopts an oligosaccharide/oligonucleotide-binding fold (OB-fold) that is not shared by these proteins. We thus propose that pb9 is the Dit protein of T5, making it the first Dit protein described for a Gram-negative-bacterium-infecting siphophage. Multiple sequence alignments suggest that pb9 is a paradigm for a large family of Dit proteins of siphophages infecting mostly Gram-negative hosts. The modular structure of the Dit protein maintains the basic building block that would be conserved among all siphophages, combining it with a more divergent domain that might serve specific host adhesion properties. PMID:24155371

  6. Polyphenol, Conditioning, and Conservation Effects on Protein Fractions and Degradability in Forage Legumes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Alfalfa herbage contains excessive levels of proteins that are highly susceptible to proteolysis during ensiling and rumen fermentation. As a result, only 10 to 30% of the protein in alfalfa, principally membrane proteins of inferior nutritional value, undergoes direct gastrointestinal digestion and...

  7. Mutational Studies on Resurrected Ancestral Proteins Reveal Conservation of Site-Specific Amino Acid Preferences throughout Evolutionary History

    PubMed Central

    Risso, Valeria A.; Manssour-Triedo, Fadia; Delgado-Delgado, Asunción; Arco, Rocio; Barroso-delJesus, Alicia; Ingles-Prieto, Alvaro; Godoy-Ruiz, Raquel; Gavira, Jose A.; Gaucher, Eric A.; Ibarra-Molero, Beatriz; Sanchez-Ruiz, Jose M.


    Local protein interactions (“molecular context” effects) dictate amino acid replacements and can be described in terms of site-specific, energetic preferences for any different amino acid. It has been recently debated whether these preferences remain approximately constant during evolution or whether, due to coevolution of sites, they change strongly. Such research highlights an unresolved and fundamental issue with far-reaching implications for phylogenetic analysis and molecular evolution modeling. Here, we take advantage of the recent availability of phenotypically supported laboratory resurrections of Precambrian thioredoxins and β-lactamases to experimentally address the change of site-specific amino acid preferences over long geological timescales. Extensive mutational analyses support the notion that evolutionary adjustment to a new amino acid may occur, but to a large extent this is insufficient to erase the primitive preference for amino acid replacements. Generally, site-specific amino acid preferences appear to remain conserved throughout evolutionary history despite local sequence divergence. We show such preference conservation to be readily understandable in molecular terms and we provide crystallographic evidence for an intriguing structural-switch mechanism: Energetic preference for an ancestral amino acid in a modern protein can be linked to reorganization upon mutation to the ancestral local structure around the mutated site. Finally, we point out that site-specific preference conservation naturally leads to one plausible evolutionary explanation for the existence of intragenic global suppressor mutations. PMID:25392342

  8. Mutational studies on resurrected ancestral proteins reveal conservation of site-specific amino acid preferences throughout evolutionary history.


    Risso, Valeria A; Manssour-Triedo, Fadia; Delgado-Delgado, Asunción; Arco, Rocio; Barroso-delJesus, Alicia; Ingles-Prieto, Alvaro; Godoy-Ruiz, Raquel; Gavira, Jose A; Gaucher, Eric A; Ibarra-Molero, Beatriz; Sanchez-Ruiz, Jose M


    Local protein interactions ("molecular context" effects) dictate amino acid replacements and can be described in terms of site-specific, energetic preferences for any different amino acid. It has been recently debated whether these preferences remain approximately constant during evolution or whether, due to coevolution of sites, they change strongly. Such research highlights an unresolved and fundamental issue with far-reaching implications for phylogenetic analysis and molecular evolution modeling. Here, we take advantage of the recent availability of phenotypically supported laboratory resurrections of Precambrian thioredoxins and β-lactamases to experimentally address the change of site-specific amino acid preferences over long geological timescales. Extensive mutational analyses support the notion that evolutionary adjustment to a new amino acid may occur, but to a large extent this is insufficient to erase the primitive preference for amino acid replacements. Generally, site-specific amino acid preferences appear to remain conserved throughout evolutionary history despite local sequence divergence. We show such preference conservation to be readily understandable in molecular terms and we provide crystallographic evidence for an intriguing structural-switch mechanism: Energetic preference for an ancestral amino acid in a modern protein can be linked to reorganization upon mutation to the ancestral local structure around the mutated site. Finally, we point out that site-specific preference conservation naturally leads to one plausible evolutionary explanation for the existence of intragenic global suppressor mutations. PMID:25392342

  9. Key dynamics of conserved asparagine in a cryptochrome/photolyase family protein by fourier transform infrared spectroscopy.


    Iwata, Tatsuya; Zhang, Yu; Hitomi, Kenichi; Getzoff, Elizabeth D; Kandori, Hideki


    Cryptochromes (Crys) and photolyases (Phrs) are flavoproteins that contain an identical cofactor (flavin adenine dinucleotide, FAD) within the same protein architecture but whose physiological functions are entirely different. In this study, we investigated light-induced conformational changes of a cyanobacterium Cry/Phr-like protein (SCry-DASH) with UV-visible and Fourier transform infrared (FTIR) spectroscopy. We developed a system for measuring light-induced difference spectra under the concentrated conditions. In the presence of a reducing agent, SCry-DASH showed photoreduction to the reduced form, and we identified a signal unique for an anionic form in the process. Difference FTIR spectra enabled us to assign characteristic FTIR bands to the respective redox forms of FAD. An asparagine residue, which anchors the FAD embedded within the protein, is conserved not only in the cyanobacterial protein but also in Phrs and other Crys, including the mammalian clock-related Crys. By characterizing an asparagine-to-cysteine (N392C) mutant of SCry-DASH, which mimics an insect specific Cry, we identified structural changes of the carbonyl group of this conserved asparagine upon light irradiation. We also found that the N392C mutant is stabilized in the anionic form. We did not observe a signal from protonated carboxylic acid residues during the reduction process, suggesting that the carboxylic acid moiety would not be directly involved as a proton donor to FAD in the system. These results are in contrast to plant specific Crys represented by Arabidopsis thaliana Cry1 that carry Asp at the position. We discuss potential roles for this conserved asparagine position and functional diversity in the Cry/Phr frame. PMID:20828134

  10. DisoMCS: Accurately Predicting Protein Intrinsically Disordered Regions Using a Multi-Class Conservative Score Approach

    PubMed Central

    Wang, Zhiheng; Yang, Qianqian; Li, Tonghua; Cong, Peisheng


    The precise prediction of protein intrinsically disordered regions, which play a crucial role in biological procedures, is a necessary prerequisite to further the understanding of the principles and mechanisms of protein function. Here, we propose a novel predictor, DisoMCS, which is a more accurate predictor of protein intrinsically disordered regions. The DisoMCS bases on an original multi-class conservative score (MCS) obtained by sequence-order/disorder alignment. Initially, near-disorder regions are defined on fragments located at both the terminus of an ordered region connecting a disordered region. Then the multi-class conservative score is generated by sequence alignment against a known structure database and represented as order, near-disorder and disorder conservative scores. The MCS of each amino acid has three elements: order, near-disorder and disorder profiles. Finally, the MCS is exploited as features to identify disordered regions in sequences. DisoMCS utilizes a non-redundant data set as the training set, MCS and predicted secondary structure as features, and a conditional random field as the classification algorithm. In predicted near-disorder regions a residue is determined as an order or a disorder according to the optimized decision threshold. DisoMCS was evaluated by cross-validation, large-scale prediction, independent tests and CASP (Critical Assessment of Techniques for Protein Structure Prediction) tests. All results confirmed that DisoMCS was very competitive in terms of accuracy of prediction when compared with well-established publicly available disordered region predictors. It also indicated our approach was more accurate when a query has higher homologous with the knowledge database. Availability The DisoMCS is available at PMID:26090958

  11. A vertebrate model for the study of lipid binding/transfer protein function: conservation of OSBP-related proteins between zebrafish and human.


    Zhou, You; Wohlfahrt, Gerd; Paavola, Jere; Olkkonen, Vesa M


    Oxysterol-binding protein (OSBP) and OSBP-related (ORP) or OSBP-like (OSBPL) proteins constitute a family of lipid-binding/transfer proteins (LTPs) present in eukaryotes from yeast to man. The mechanisms of ORP function have remained incompletely understood. However, several ORPs are present at membrane contact sites and act as either lipid transporters or sensors that control lipid metabolism, cell signaling, and vesicle transport. Zebrafish, Danio rerio, has gained increasing popularity as a model organism in developmental biology, human disease, toxicology, and drug discovery. However, LTPs in the fish are thus far unexplored. In this article we report a series of bioinformatic analyses showing that the OSBPL gene family is highly conserved between the fish and human. The OSBPL subfamily structure is markedly similar between the two organisms, and all 12 human genes have orthologs, designated osbpl and located on 11 chromosomes in D. rerio. Interestingly, osbpl2 and osbpl3 are present as two closely related homologs (a and b), due to gene duplication events in the teleost lineage. Moreover, the domain structures of the distinct ORP proteins are almost identical between zebrafish and man, and molecular modeling in the present study suggests that ORD liganding by phosphatidylinositol-4-phosphate (PI4P) is a feature conserved between yeast Osh3p, human ORP3, and zebrafish Osbpl3. The present analysis identifies D. rerio as an attractive model to study the functions of ORPs in vertebrate development and metabolism. PMID:24326072

  12. Ankyrin-repeat containing proteins of microbes: a conserved structure with functional diversity

    PubMed Central

    Al-Khodor, Souhaila; Price, Christopher T.; Kalia, Awdhesh; Kwaik, Yousef Abu


    Summary The ankyrin repeat (ANK) is the most common protein-protein interaction motif in nature and predominantly found in eukaryotic proteins. The genome sequencing of various pathogenic or symbiotic bacteria and eukaryotic viruses identified numerous genes encoding ANK-containing proteins that were proposed to have been acquired from eukaryotes by horizontal gene transfer. However, the recent discovery of additional ANK-containing proteins encoded in the genomes of archaea and free-living bacteria suggests either a more ancient origin of the ANK motif or multiple convergent evolution events. Many bacterial pathogens employ various types of secretion systems to deliver ANK-containing proteins into eukaryotic cells where they mimic or manipulate various host functions. Understanding the molecular and biochemical functions of this family of proteins will enhance our understanding of important host-microbe interactions. PMID:19962898

  13. Conservation of Shannon's redundancy for proteins. [information theory applied to amino acid sequences

    NASA Technical Reports Server (NTRS)

    Gatlin, L. L.


    Concepts of information theory are applied to examine various proteins in terms of their redundancy in natural originators such as animals and plants. The Monte Carlo method is used to derive information parameters for random protein sequences. Real protein sequence parameters are compared with the standard parameters of protein sequences having a specific length. The tendency of a chain to contain some amino acids more frequently than others and the tendency of a chain to contain certain amino acid pairs more frequently than other pairs are used as randomness measures of individual protein sequences. Non-periodic proteins are generally found to have random Shannon redundancies except in cases of constraints due to short chain length and genetic codes. Redundant characteristics of highly periodic proteins are discussed. A degree of periodicity parameter is derived.

  14. Akirins are highly conserved nuclear proteins required for NF-kappaB-dependent gene expression in drosophila and mice.


    Goto, Akira; Matsushita, Kazufumi; Gesellchen, Viola; El Chamy, Laure; Kuttenkeuler, David; Takeuchi, Osamu; Hoffmann, Jules A; Akira, Shizuo; Boutros, Michael; Reichhart, Jean-Marc


    During a genome-wide screen with RNA-mediated interference, we isolated CG8580 as a gene involved in the innate immune response of Drosophila melanogaster. CG8580, which we called Akirin, encoded a protein that acted in parallel with the NF-kappaB transcription factor downstream of the Imd pathway and was required for defense against Gram-negative bacteria. Akirin is highly conserved, and the human genome contains two homologs, one of which was able to rescue the loss-of-function phenotype in drosophila cells. Akirins were strictly localized to the nucleus. Knockout of both Akirin homologs in mice showed that one had an essential function downstream of the Toll-like receptor, tumor necrosis factor and interleukin (IL)-1beta signaling pathways leading to the production of IL-6. Thus, Akirin is a conserved nuclear factor required for innate immune responses. PMID:18066067

  15. Drosophila UbcD1 encodes a highly conserved ubiquitin-conjugating enzyme involved in selective protein degradation.

    PubMed Central

    Treier, M; Seufert, W; Jentsch, S


    Ubiquitin-dependent selective protein degradation serves to eliminate abnormal proteins and provides controlled short half-lives to certain cellular proteins, including proteins of regulatory function such as phytochrome, yeast MAT alpha 2 repressor, p53 and cyclin. Moreover, ubiquitin-dependent proteolysis is thought to play an essential role during development and in programmed cell death. We have cloned a gene from Drosophila melanogaster, UbcD1, coding for a protein with striking sequence similarity to the yeast ubiquitin-conjugating enzymes UBC4 and UBC5. These closely related yeast enzymes are known to be central components of a major proteolytic pathway of Saccharomyces cerevisiae. By doing a precise open reading frame replacement in the yeast genome we could show that the Drosophila UbcD1 enzyme can functionally substitute for yeast UBC4. UbcD1 driven by the UBC4 promoter rescues growth defects and temperature sensitivity of yeast ubc4 ubc5 double mutant cells. Moreover, expression of UbcD1 restores proteolysis proficiency in the ubc4 ubc5 double mutant, indicating that the Drosophila enzyme also mediates protein degradation. This structural and functional conservation suggests that the UbcD1-UBC4-UBC5 class of enzymes defines a major proteolytic pathway in probably all eukaryotes. Images PMID:1310935

  16. Conserved function of the lysine-based KXD/E motif in Golgi retention for endomembrane proteins among different organisms.


    Woo, Cheuk Hang; Gao, Caiji; Yu, Ping; Tu, Linna; Meng, Zhaoyue; Banfield, David K; Yao, Xiaoqiang; Jiang, Liwen


    We recently identified a new COPI-interacting KXD/E motif in the C-terminal cytosolic tail (CT) of Arabidopsis endomembrane protein 12 (AtEMP12) as being a crucial Golgi retention mechanism for AtEMP12. This KXD/E motif is conserved in CTs of all EMPs found in plants, yeast, and humans and is also present in hundreds of other membrane proteins. Here, by cloning selective EMP isoforms from plants, yeast, and mammals, we study the localizations of EMPs in different expression systems, since there are contradictory reports on the localizations of EMPs. We show that the N-terminal and C-terminal GFP-tagged EMP fusions are localized to Golgi and post-Golgi compartments, respectively, in plant, yeast, and mammalian cells. In vitro pull-down assay further proves the interaction of the KXD/E motif with COPI coatomer in yeast. COPI loss of function in yeast and plants causes mislocalization of EMPs or KXD/E motif-containing proteins to vacuole. Ultrastructural studies further show that RNA interference (RNAi) knockdown of coatomer expression in transgenic Arabidopsis plants causes severe morphological changes in the Golgi. Taken together, our results demonstrate that N-terminal GFP fusions reflect the real localization of EMPs, and KXD/E is a conserved motif in COPI interaction and Golgi retention in eukaryotes. PMID:26378254

  17. Characterization of STIP, a multi-domain nuclear protein, highly conserved in metazoans, and essential for embryogenesis in Caenorhabditis elegans

    SciTech Connect

    Ji Qiongmei; Huang, C.-H. . E-mail:; Peng Jianbin; Hashmi, Sarwar; Ye Tianzhang; Chen Ying


    We report here the identification and characterization of STIP, a multi-domain nuclear protein that contains a G-patch, a coiled-coil, and several short tryptophan-tryptophan repeats highly conserved in metazoan species. To analyze their functional role in vivo, we cloned nematode stip-1 genes and determined the spatiotemporal pattern of Caenorhabditis elegans STIP-1 protein. RNA analyses and Western blots revealed that stip-1 mRNA was produced via trans-splicing and translated as a 95-kDa protein. Using reporter constructs, we found STIP-1 to be expressed at all developmental stages and in many tissue/cell types including worm oocyte nuclei. We found that STIP-1 is targeted to the nucleus and forms large polymers with a rod-like shape when expressed in mammalian cells. Using deletion mutants, we mapped the regions of STIP-1 involved in nuclear import and polymer assembly. We further showed that knockdown of C. elegans stip-1 by RNA interference arrested development and resulted in morphologic abnormalities around the 16-cell stage followed by 100% lethality, suggesting its essential role in worm embryogenesis. Importantly, the embryonic lethal phenotype could be faithfully rescued with Drosophila and human genes via transgenic expression. Our data provide the first direct evidence that STIP have a conserved essential nuclear function across metazoans from worms to humans.

  18. Phylogeny and molecular signatures (conserved proteins and indels) that are specific for the Bacteroidetes and Chlorobi species

    PubMed Central

    Gupta, Radhey S; Lorenzini, Emily


    Background The Bacteroidetes and Chlorobi species constitute two main groups of the Bacteria that are closely related in phylogenetic trees. The Bacteroidetes species are widely distributed and include many important periodontal pathogens. In contrast, all Chlorobi are anoxygenic obligate photoautotrophs. Very few (or no) biochemical or molecular characteristics are known that are distinctive characteristics of these bacteria, or are commonly shared by them. Results Systematic blast searches were performed on each open reading frame in the genomes of Porphyromonas gingivalis W83, Bacteroides fragilis YCH46, B. thetaiotaomicron VPI-5482, Gramella forsetii KT0803, Chlorobium luteolum (formerly Pelodictyon luteolum) DSM 273 and Chlorobaculum tepidum (formerly Chlorobium tepidum) TLS to search for proteins that are uniquely present in either all or certain subgroups of Bacteroidetes and Chlorobi. These studies have identified > 600 proteins for which homologues are not found in other organisms. This includes 27 and 51 proteins that are specific for most of the sequenced Bacteroidetes and Chlorobi genomes, respectively; 52 and 38 proteins that are limited to species from the Bacteroidales and Flavobacteriales orders, respectively, and 5 proteins that are common to species from these two orders; 185 proteins that are specific for the Bacteroides genus. Additionally, 6 proteins that are uniquely shared by species from the Bacteroidetes and Chlorobi phyla (one of them also present in the Fibrobacteres) have also been identified. This work also describes two large conserved inserts in DNA polymerase III (DnaE) and alanyl-tRNA synthetase that are distinctive characteristics of the Chlorobi species and a 3 aa deletion in ClpB chaperone that is mainly found in various Bacteroidales, Flavobacteriales and Flexebacteraceae, but generally not found in the homologs from other organisms. Phylogenetic analyses of the Bacteroidetes and Chlorobi species is also reported based on

  19. Chloroplast Elongation Factor Ts Pro-Protein Is an Evolutionarily Conserved Fusion with the S1 Domain-Containing Plastid-Specific Ribosomal Protein-7

    PubMed Central

    Beligni, María Verónica; Yamaguchi, Kenichi; Mayfield, Stephen P.


    The components of chloroplast translation are similar to those of prokaryotic translation but contain some additional unique features. Proteomic analysis of the Chlamydomonas reinhardtii chloroplast ribosome identified an S1-like protein, plastid-specific ribosomal protein-7 (PSRP-7), as a stoichiometric component of the 30S subunit. Here, we report that PSRP-7 is part of a polyprotein that contains PSRP-7 on its amino end and two translation elongation factor Ts (EF-Ts) domains at the carboxy end. We named this polyprotein PETs (for polyprotein of EF-Ts). Pets is a single-copy gene containing the only chloroplast PSRP-7 and EF-Ts sequences found in the C. reinhardtii genome. The pets precursor transcript undergoes alternative splicing to generate three mRNAs with open reading frames (ORFs) of 1.68, 1.8, and 3 kb. A 110-kD pro-protein is translated from the 3-kb ORF, and the majority of this protein is likely posttranslationally processed into the 65-kD protein PSRP-7 and a 55-kD EF-Ts. PETs homologs are found in Arabidopsis thaliana and rice (Oryza sativa). The conservation of the 110-kD PETs polyprotein in the plant kingdom suggests that PSRP-7 and EF-Ts function together in some aspects of chloroplast translation and that the PETs pro-protein may have a novel function as a whole. PMID:15548736

  20. Protein kinase and phosphoprotein phosphatase activities of nitrogen regulatory proteins NTRB and NTRC of enteric bacteria: roles of the conserved amino-terminal domain of NTRC.

    PubMed Central

    Keener, J; Kustu, S


    The NTRC protein (ntrC product) of enteric bacteria activates transcription of nitrogen-regulated genes by a holoenzyme form of RNA polymerase that contains the ntrA product (sigma 54) as sigma factor. Although unmodified NTRC will bind to DNA, it must be phosphorylated to activate transcription. Both phosphorylation and dephosphorylation of NTRC occur in the presence of the NTRB protein (ntrB product). We here demonstrate rigorously that it is the NTRB protein that is a protein kinase by showing that NTRB can phosphorylate itself, whereas NTRC cannot. Phosphorylated NTRC (NTRC-P) is capable of autodephosphorylation with a first-order rate constant of 0.14-0.19 min-1 (t 1/2 of 5.0-3.6 min) at 37 degrees C. In addition, there is regulated dephosphorylation of NTRC-P. By contrast to the autophosphatase activity, regulated dephosphorylation requires three components in addition to NTRC-P: the PII regulatory protein, NTRB, and ATP. NTRC is phosphorylated within its amino-terminal domain, which is conserved in one partner of a number of two-component regulatory systems in a wide variety of eubacteria. A purified amino-terminal fragment of NTRC (approximately equal to 12.5 kDa) is sufficient for recognition by NTRB and is autodephosphorylated at the same rate as the native protein. Images PMID:2839825

  1. Conserved Determinants for Membrane Association of Nonstructural Protein 5A from Hepatitis C Virus and Related Viruses▿

    PubMed Central

    Brass, Volker; Pal, Zsuzsanna; Sapay, Nicolas; Deléage, Gilbert; Blum, Hubert E.; Penin, François; Moradpour, Darius


    Nonstructural protein 5A (NS5A) is a membrane-associated essential component of the hepatitis C virus (HCV) replication complex. An N-terminal amphipathic alpha helix mediates in-plane membrane association of HCV NS5A and at the same time is likely involved in specific protein-protein interactions required for the assembly of a functional replication complex. The aim of this study was to identify the determinants for membrane association of NS5A from the related GB viruses and pestiviruses. Although primary amino acid sequences differed considerably, putative membrane anchor domains with amphipathic features were predicted in the N-terminal domains of NS5A proteins from these viruses. Confocal laser scanning microscopy, as well as membrane flotation analyses, demonstrated that NS5As from GB virus B (GBV-B), GBV-C, and bovine viral diarrhea virus, the prototype pestivirus, display membrane association characteristics very similar to those of HCV NS5A. The N-terminal 27 to 33 amino acid residues of these NS5A proteins were sufficient for membrane association. Circular dichroism analyses confirmed the capacity of these segments to fold into alpha helices upon association with lipid-like molecules. Despite structural conservation, only very limited exchanges with sequences from related viruses were tolerated in the context of functional HCV RNA replication, suggesting virus-specific interactions of these segments. In conclusion, membrane association of NS5A by an N-terminal amphipathic alpha helix is a feature shared by HCV and related members of the family Flaviviridae. This observation points to conserved roles of the N-terminal amphipathic alpha helices of NS5A in replication complex formation. PMID:17192310

  2. Evolutionary Conservation and Expression of Human RNA-Binding Proteins and Their Role in Human Genetic Disease

    PubMed Central

    Gerstberger, Stefanie; Hafner, Markus; Ascano, Manuel


    RNA-binding proteins (RBPs) are effectors and regulators of posttranscriptional gene regulation (PTGR). RBPs regulate stability, maturation, and turnover of all RNAs, often binding thousands of targets at many sites. The importance of RBPs is underscored by their dysregulation or mutations causing a variety of developmental and neurological diseases. This chapter globally discusses human RBPs and provides a brief introduction to their identification and RNA targets. We review RBPs based on common structural RNA-binding domains, study their evolutionary conservation and expression, and summarize disease associations of different RBP classes. PMID:25201102

  3. A highly conserved region of the Sendai virus nucleocapsid protein contributes to the NP-NP binding domain.


    Myers, T M; Pieters, A; Moyer, S A


    The nucleocapsid protein (NP) of Sendai virus is an essential component of both the nucleocapsid template and the NP-NP and NP0-P protein complexes required for viral RNA replication. When expressed alone in mammalian cells NP self-assembles into nucleocapsid-like particles which appear to contain cellular RNA. To identify putative NP-NP binding domains, fusions between the monomeric maltose-binding protein (MBP) and portions of NP were constructed. The fusion proteins which contain the central conserved region (CCR) (amino acids 258-357, MBP-NP1) and the N-terminal 255 amino acids (MBP-NP2) of NP both oligomerized, suggesting that these regions contain sequences important for NP-NP self-assembly. In addition, the MBP-NP1 fusion protein can function as an inhibitor of viral RNA replication. Complementary studies involving site-directed mutagenesis of the full-length NP protein have identified specific residues in the CCR which are essential for viral RNA replication in vitro. Two such replication-negative mutants, F324V and F324I, were defective in self-assembly, suggesting that the Phe residue at amino acid 324 is essential for the NP-NP interaction. A third mutant, NP260-1 (Y260D), self-assembled to form aberrant oligomers which exhibit an unusual helical structure and appear to lack any associated RNA. The mutants NP299-5 (L299I and I300V) and NP313-2 (I313F), in contrast, appear to form all the required protein complexes, but were inactive in viral RNA replication, suggesting that interactions specifically with Sendai RNA were disrupted. These data have thus identified specific residues in the CCR of the native NP protein which appear to be important for NP-NP or NP-RNA interactions and for genome replication. PMID:9126246

  4. NMR structure and dynamics of Q4D059, a kinetoplastid-specific and conserved protein from Trypanosoma cruzi.


    López-Castilla, Aracelys; Pons, Tirso; Pires, José R


    Q4D059 (UniProt accession number), is an 86-residue protein from Trypanosoma cruzi, conserved in the related kinetoplastid parasites Trypanosoma brucei and Leishmania major. These pathogens are the causal agents of the neglected diseases: Chagas, sleeping sickness and leishmaniases respectively and had recently their genomes sequenced. Q4D059 shows low sequence similarity with mammal proteins and because of its essentiality demonstrated in T. brucei, it is a potential target for anti-parasitic drugs. The 11 hypothetical proteins homologous to Q4D059 are all uncharacterized proteins of unknown function. Here, the solution structure of Q4D059 was solved by NMR and its backbone dynamics was characterized by (15)N relaxation parameters. The structure is composed by a parallel/anti-parallel three-stranded β-sheet packed against four helical regions. The structure is well defined by ca. 9 NOEs per residue and a backbone rmsd of 0.50±0.05 Å for the representative ensemble of 20 lowest-energy structures. The structure is overall rigid except for N-terminal residues A(9) to D(11) at the beginning of β1, K(38), V(39) at the end of helix H3 with rapid motion in the ps-ns timescale and G(25) (helix H2), I(68) (β2) and V(78) (loop 3) undergoing internal motion in the μs-ms timescale. Limited structural similarities were found in protein structures deposited in the PDB, therefore functional inferences based on protein structure information are not clear. Q4D059 adopts a α/β fold that is slightly similar to the ATPase sub-domain IIB of the heat-shock protein 70 (HSP70) and to the N-terminal domain of the ribosomal protein L11. PMID:25748338

  5. Subdominant outer membrane antigens in anaplasma marginale: conservation, antigenicity, and protective capacity using recombinant protein

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Anaplasma marginale is a tick-borne rickettsial pathogen of cattle with a worldwide distribution. Currently a safe and efficacious vaccine is unavailable. Outer membrane protein (OMP) extracts or a well- defined surface protein complex reproducibly induce protective immunity. However, there are seve...

  6. A predicted protein interactome identifies conserved global networks and disease resistance subnetworks in maize

    Technology Transfer Automated Retrieval System (TEKTRAN)

    An interactome is the genome-wide roadmap of protein-protein interactions that occur within an organism. Interactomes for humans, the fruit fly, and now plants such as Arabidopsis thaliana and Oryza sativa have been generated using high throughput experimental methods. It is possible to use these ...

  7. The conserved baculovirus protein p33 (Ac92) is a flavin adenine dinucleotide-linked sulfhydryl oxidase

    SciTech Connect

    Long, C.M.; Rohrmann, G.F.; Merrill, G.F.


    Open reading frame 92 of the Autographa californica baculovirus (Ac92) is one of about 30 core genes present in all sequenced baculovirus genomes. Computer analyses predicted that the Ac92 encoded protein (called p33) and several of its baculovirus orthologs were related to a family of flavin adenine dinucleotide (FAD)-linked sulfhydryl oxidases. Alignment of these proteins indicated that, although they were highly diverse, a number of amino acids in common with the Erv1p/Alrp family of sulfhydryl oxidases are present. Some of these conserved amino acids are predicted to stack against the isoalloxazine and adenine components of FAD, whereas others are involved in electron transfer. To investigate this relationship, Ac92 was expressed in bacteria as a His-tagged fusion protein, purified, and characterized both spectrophotometrically and for its enzymatic activity. The purified protein was found to have the color (yellow) and absorption spectrum consistent with it being a FAD-containing protein. Furthermore, it was demonstrated to have sulfhydryl oxidase activity using dithiothreitol and thioredoxin as substrates.

  8. Conserved RNA helicase FRH acts nonenzymatically to support the intrinsically disordered neurospora clock protein FRQ.


    Hurley, Jennifer M; Larrondo, Luis F; Loros, Jennifer J; Dunlap, Jay C


    Protein conformation dictates a great deal of protein function. A class of naturally unstructured proteins, termed intrinsically disordered proteins (IDPs), demonstrates that flexibility in structure can be as important mechanistically as rigid structure. At the core of the circadian transcription/translation feedback loop in Neurospora crassa is the protein FREQUENCY (FRQ), shown here shown to share many characteristics of IDPs. FRQ in turn binds to FREQUENCY-Interacting RNA Helicase (FRH), whose clock function has been assumed to relate to its predicted helicase function. However, mutational analyses reveal that the helicase function of FRH is not essential for the clock, and a region of FRH distinct from the helicase region is essential for stabilizing FRQ against rapid degradation via a pathway distinct from its typical ubiquitin-mediated turnover. These data lead to the hypothesis that FRQ is an IDP and that FRH acts nonenzymatically, stabilizing FRQ to enable proper clock circuitry/function. PMID:24316221

  9. Xenopus cytoskeletal actin and human c-fos gene promoters share a conserved protein-binding site.


    Mohun, T; Garrett, N; Treisman, R


    Xenopus laevis cytoskeletal actin gene promoters contain a 20-bp sequence homologous to the serum response element (SRE) required for transient human c-fos gene transcription in response to serum factors. Both sequences bind the same factor in HeLa cell extracts, as shown by binding competition, DNase I and dimethylsulphate (DMS) protection and DMS interference assays. A similar protein is present in Xenopus laevis oocytes. Sequences containing the SRE homology are essential for constitutive activity of the actin promoter in both Xenopus and mouse cells, and a synthetic SRE functions as a promoter element in these cells. In mouse cells, transcription of both transfected Xenopus actin and actin/c-fos fusion genes is activated following serum stimulation. These data suggest that the SRE and its cognate protein form part of a regulatory pathway that has been highly conserved during evolution. PMID:3582369

  10. Xenopus cytoskeletal actin and human c-fos gene promoters share a conserved protein-binding site.

    PubMed Central

    Mohun, T; Garrett, N; Treisman, R


    Xenopus laevis cytoskeletal actin gene promoters contain a 20-bp sequence homologous to the serum response element (SRE) required for transient human c-fos gene transcription in response to serum factors. Both sequences bind the same factor in HeLa cell extracts, as shown by binding competition, DNase I and dimethylsulphate (DMS) protection and DMS interference assays. A similar protein is present in Xenopus laevis oocytes. Sequences containing the SRE homology are essential for constitutive activity of the actin promoter in both Xenopus and mouse cells, and a synthetic SRE functions as a promoter element in these cells. In mouse cells, transcription of both transfected Xenopus actin and actin/c-fos fusion genes is activated following serum stimulation. These data suggest that the SRE and its cognate protein form part of a regulatory pathway that has been highly conserved during evolution. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:3582369

  11. The mRNA-binding protein which controls ferritin and transferrin receptor expression is conserved during evolution.

    PubMed Central

    Rothenberger, S; Müllner, E W; Kühn, L C


    A post-transcriptional regulatory protein, termed iron regulatory factor (IRF), that binds specifically to the iron-responsive elements of ferritin and transferrin receptor mRNA, has recently been identified in the cytoplasm of human and mouse cells. Activation of this factor by low intracellular iron levels leads to inhibition of ferritin translation and an increase of TR mRNA stability. To investigate whether these feedback regulatory mechanisms are conserved during evolution, we analysed cytoplasmic extracts from 12 different species for a specific IRE-binding activity. We found mRNA-binding proteins in chicken, frog, fish and fly, which are equivalent to human and mouse IRF in gel-retardation assays with radiolabeled RNA transcripts. Competition experiments, molecular weight determinations, and modulation of the mRNA-binding activity in response to intracellular iron levels or reduction by beta-mercaptoethanol indicate that IRF has similar structural and functional properties in these different species. Images PMID:2157191

  12. From Arabidopsis to cereal crops: Conservation of chloroplast protein degradation by autophagy indicates its fundamental role in plant productivity

    PubMed Central

    Izumi, Masanori; Hidema, Jun; Ishida, Hiroyuki


    Autophagy is an evolutionarily conserved process leading to the degradation of intracellular components in eukaryotes, which is important for nutrient recycling especially in response to starvation conditions. Nutrient recycling is an essential process that underpins productivity in crop plants, such that remobilized nitrogen derived from older organs supports the formation of new organs or grain-filling within a plant. We extended our understanding of autophagy in a model plant, Arabidopsis thaliana, to an important cereal, rice (Oryza sativa). Through analysis of transgenic rice plants stably expressing fluorescent marker proteins for autophagy or chloroplast stroma, we revealed that chloroplast proteins are partially degraded in the vacuole via Rubisco-containing bodies (RCBs), a type of autophagosomes containing stroma. We further reported evidence that the RCB pathway functions during natural leaf senescence to facilitate subsequent nitrogen remobilization into newly expanding leaves. Thus, our recent studies establish the importance of autophagy in biomass production of cereals. PMID:26440746

  13. Conserved Features in the Structure, Mechanism, and Biogenesis of the Inverse Autotransporter Protein Family.


    Heinz, Eva; Stubenrauch, Christopher J; Grinter, Rhys; Croft, Nathan P; Purcell, Anthony W; Strugnell, Richard A; Dougan, Gordon; Lithgow, Trevor


    The bacterial cell surface proteins intimin and invasin are virulence factors that share a common domain structure and bind selectively to host cell receptors in the course of bacterial pathogenesis. The β-barrel domains of intimin and invasin show significant sequence and structural similarities. Conversely, a variety of proteins with sometimes limited sequence similarity have also been annotated as "intimin-like" and "invasin" in genome datasets, while other recent work on apparently unrelated virulence-associated proteins ultimately revealed similarities to intimin and invasin. Here we characterize the sequence and structural relationships across this complex protein family. Surprisingly, intimins and invasins represent a very small minority of the sequence diversity in what has been previously the "intimin/invasin protein family". Analysis of the assembly pathway for expression of the classic intimin, EaeA, and a characteristic example of the most prevalent members of the group, FdeC, revealed a dependence on the translocation and assembly module as a common feature for both these proteins. While the majority of the sequences in the grouping are most similar to FdeC, a further and widespread group is two-partner secretion systems that use the β-barrel domain as the delivery device for secretion of a variety of virulence factors. This comprehensive analysis supports the adoption of the "inverse autotransporter protein family" as the most accurate nomenclature for the family and, in turn, has important consequences for our overall understanding of the Type V secretion systems of bacterial pathogens. PMID:27190006

  14. A Conserved Mode of Protein Recognition and Binding in a ParD−ParE Toxin−Antitoxin Complex

    SciTech Connect

    Dalton, Kevin M.; Crosson, Sean


    Toxin-antitoxin (TA) systems form a ubiquitous class of prokaryotic proteins with functional roles in plasmid inheritance, environmental stress response, and cell development. ParDE family TA systems are broadly conserved on plasmids and bacterial chromosomes and have been well characterized as genetic elements that promote stable plasmid inheritance. We present a crystal structure of a chromosomally encoded ParD-ParE complex from Caulobacter crescentus at 2.6 {angstrom} resolution. This TA system forms an {alpha}{sub 2}{beta}{sub 2} heterotetramer in the crystal and in solution. The toxin-antitoxin binding interface reveals extensive polar and hydrophobic contacts of ParD antitoxin helices with a conserved recognition and binding groove on the ParE toxin. A cross-species comparison of this complex structure with related toxin structures identified an antitoxin recognition and binding subdomain that is conserved between distantly related members of the RelE/ParE toxin superfamily despite a low level of overall primary sequence identity. We further demonstrate that ParD antitoxin is dimeric, stably folded, and largely helical when not bound to ParE toxin. Thus, the paradigmatic model in which antitoxin undergoes a disorder-to-order transition upon toxin binding does not apply to this chromosomal ParD-ParE TA system.

  15. A conserved mode of protein recognition and binding in a ParD-ParE toxin-antitoxin complex†

    PubMed Central

    Dalton, Kevin M.; Crosson, Sean


    Toxin-antitoxin (TA) systems form a ubiquitous class of prokaryotic proteins with functional roles in plasmid inheritance, environmental stress response, and cell development. ParDE-family TA systems are broadly conserved on plasmids and bacterial chromosomes, and have been well characterized as genetic elements that promote stable plasmid inheritance. We present a crystal structure of a chromosomally-encoded ParD-ParE complex from Caulobacter crescentus at 2.6 Å resolution. This TA system forms an α2β2 heterotetramer in the crystal and in solution. The toxin-antitoxin binding interface reveals extensive polar and hydrophobic contacts of ParD antitoxin helices with a conserved recognition and binding groove on the ParE toxin. A cross-species comparison of this complex structure with related toxin structures identified an antitoxin recognition and binding sub-domain that is conserved between distantly-related members of the RelE/ParE toxin superfamily despite low overall primary sequence identity. We further demonstrate that ParD antitoxin is dimeric, stably folded, and largely helical when not bound to ParE toxin. Thus, the paradigmatic model in which antitoxin undergoes a disorder-to-order transition upon toxin binding does not apply to this chromosomal ParD-ParE TA system. PMID:20143871

  16. Potential Conservation of Circadian Clock Proteins in the phylum Nematoda as Revealed by Bioinformatic Searches

    PubMed Central

    Romanowski, Andrés; Garavaglia, Matías Javier; Goya, María Eugenia; Ghiringhelli, Pablo Daniel; Golombek, Diego Andrés


    Although several circadian rhythms have been described in C. elegans, its molecular clock remains elusive. In this work we employed a novel bioinformatic approach, applying probabilistic methodologies, to search for circadian clock proteins of several of the best studied circadian model organisms of different taxa (Mus musculus, Drosophila melanogaster, Neurospora crassa, Arabidopsis thaliana and Synechoccocus elongatus) in the proteomes of C. elegans and other members of the phylum Nematoda. With this approach we found that the Nematoda contain proteins most related to the core and accessory proteins of the insect and mammalian clocks, which provide new insights into the nematode clock and the evolution of the circadian system. PMID:25396739

  17. Genetic characterization of conserved charged residues in the bacterial flagellar type III export protein FlhA.


    Hara, Noritaka; Namba, Keiichi; Minamino, Tohru


    For assembly of the bacterial flagellum, most of flagellar proteins are transported to the distal end of the flagellum by the flagellar type III protein export apparatus powered by proton motive force (PMF) across the cytoplasmic membrane. FlhA is an integral membrane protein of the export apparatus and is involved in an early stage of the export process along with three soluble proteins, FliH, FliI, and FliJ, but the energy coupling mechanism remains unknown. Here, we carried out site-directed mutagenesis of eight, highly conserved charged residues in putative juxta- and trans-membrane helices of FlhA. Only Asp-208 was an essential acidic residue. Most of the FlhA substitutions were tolerated, but resulted in loss-of-function in the ΔfliH-fliI mutant background, even with the second-site flhB(P28T) mutation that increases the probability of flagellar protein export in the absence of FliH and FliI. The addition of FliH and FliI allowed the D45A, R85A, R94K and R270A mutant proteins to work even in the presence of the flhB(P28T) mutation. Suppressor analysis of a flhA(K203W) mutation showed an interaction between FlhA and FliR. Taken all together, we suggest that Asp-208 is directly involved in PMF-driven protein export and that the cooperative interactions of FlhA with FlhB, FliH, FliI, and FliR drive the translocation of export substrate. PMID:21811603

  18. LRPPRC is a mitochondrial matrix protein that is conserved in metazoans

    SciTech Connect

    Sterky, Fredrik H.; Ruzzenente, Benedetta; Gustafsson, Claes M.; Samuelsson, Tore; Larsson, Nils-Goeran


    Research highlights: {yields} LRPPRC orthologs are restricted to metazoans. {yields} LRPPRC is imported to the mitochondrial matrix. {yields} No evidence of nuclear isoform. -- Abstract: LRPPRC (also called LRP130) is an RNA-binding pentatricopeptide repeat protein. LRPPRC has been recognized as a mitochondrial protein, but has also been shown to regulate nuclear gene transcription and to bind specific RNA molecules in both the nucleus and the cytoplasm. We here present a bioinformatic analysis of the LRPPRC primary sequence, which reveals that orthologs to the LRPPRC gene are restricted to metazoan cells and that all of the corresponding proteins contain mitochondrial targeting signals. To address the subcellular localization further, we have carefully analyzed LRPPRC in mammalian cells and identified a single isoform that is exclusively localized to mitochondria. The LRPPRC protein is imported to the mitochondrial matrix and its mitochondrial targeting sequence is cleaved upon entry.

  19. LRPPRC is a mitochondrial matrix protein that is conserved in metazoans.


    Sterky, Fredrik H; Ruzzenente, Benedetta; Gustafsson, Claes M; Samuelsson, Tore; Larsson, Nils-Göran


    LRPPRC (also called LRP130) is an RNA-binding pentatricopeptide repeat protein. LRPPRC has been recognized as a mitochondrial protein, but has also been shown to regulate nuclear gene transcription and to bind specific RNA molecules in both the nucleus and the cytoplasm. We here present a bioinformatic analysis of the LRPPRC primary sequence, which reveals that orthologs to the LRPPRC gene are restricted to metazoan cells and that all of the corresponding proteins contain mitochondrial targeting signals. To address the subcellular localization further, we have carefully analyzed LRPPRC in mammalian cells and identified a single isoform that is exclusively localized to mitochondria. The LRPPRC protein is imported to the mitochondrial matrix and its mitochondrial targeting sequence is cleaved upon entry. PMID:20633537

  20. Ice-binding site of snow mold fungus antifreeze protein deviates from structural regularity and high conservation

    PubMed Central

    Kondo, Hidemasa; Hanada, Yuichi; Sugimoto, Hiroshi; Hoshino, Tamotsu; Garnham, Christopher P.; Davies, Peter L.; Tsuda, Sakae


    Antifreeze proteins (AFPs) are found in organisms ranging from fish to bacteria, where they serve different functions to facilitate survival of their host. AFPs that protect freeze-intolerant fish and insects from internal ice growth bind to ice using a regular array of well-conserved residues/motifs. Less is known about the role of AFPs in freeze-tolerant species, which might be to beneficially alter the structure of ice in or around the host. Here we report the 0.95-Å high-resolution crystal structure of a 223-residue secreted AFP from the snow mold fungus Typhula ishikariensis. Its main structural element is an irregular β-helix with six loops of 18 or more residues that lies alongside an α-helix. β-Helices have independently evolved as AFPs on several occasions and seem ideally structured to bind to several planes of ice, including the basal plane. A novelty of the β-helical fold is the nonsequential arrangement of loops that places the N- and C termini inside the solenoid of β-helical coils. The ice-binding site (IBS), which could not be predicted from sequence or structure, was located by site-directed mutagenesis to the flattest surface of the protein. It is remarkable for its lack of regularity and its poor conservation in homologs from psychrophilic diatoms and bacteria and other fungi. PMID:22645341

  1. Conserved autophosphorylation pattern in activation loops and juxtamembrane regions of Mycobacterium tuberculosis Ser/Thr protein kinases.


    Durán, Rosario; Villarino, Andrea; Bellinzoni, Marco; Wehenkel, Annemarie; Fernandez, Pablo; Boitel, Brigitte; Cole, Stewart T; Alzari, Pedro M; Cerveñansky, Carlos


    The identification of phosphorylation sites in proteins provides a powerful tool to study signal transduction pathways and to establish interaction networks involving signaling elements. Using different strategies to identify phosphorylated residues, we report here mass spectrometry studies of the entire intracellular regions of four 'receptor-like' protein kinases from Mycobacterium tuberculosis (PknB, PknD, PknE, and PknF), each consisting of an N-terminal kinase domain and a juxtamembrane region of varying length (26-100 residues). The enzymes were observed to incorporate different numbers of phosphates, from five in PknB up to 11 in PknD or PknE, and all detected sites were dephosphorylated by the cognate mycobacterial phosphatase PstP. Comparison of the phosphorylation patterns reveals two recurrent clusters of pThr/pSer residues, respectively, in their activation loops and juxtamembrane regions, which have a distinct effect on kinase activity. All studied kinases have at least two conserved phosphorylated residues in their activation loop and mutations of these residues in PknB significantly decreased the kinase activity, whereas deletion of the entire juxtamembrane regions in PknB and PknF had little effect on their activities. These results reinforce the hypothesis that mycobacterial kinase regulation includes a conserved activation loop mechanism, and suggest that phosphorylation sites in the juxtamembrane region might be involved in putative kinase-mediated signaling cascades. PMID:15967413

  2. Conserved residues in Lassa fever virus Z protein modulate viral infectivity at the level of the ribonucleoprotein.


    Capul, Althea A; de la Torre, Juan Carlos; Buchmeier, Michael J


    Arenaviruses are negative-strand RNA viruses that cause human diseases such as lymphocytic choriomeningitis, Bolivian hemorrhagic fever, and Lassa hemorrhagic fever. No licensed vaccines exist, and current treatment is limited to ribavirin. The prototypic arenavirus, lymphocytic choriomeningitis virus (LCMV), is a model for dissecting virus-host interactions in persistent and acute disease. The RING finger protein Z has been identified as the driving force of arenaviral budding and acts as the viral matrix protein. While residues in Z required for viral budding have been described, residues that govern the Z matrix function(s) have yet to be fully elucidated. Because this matrix function is integral to viral assembly, we reasoned that this would be reflected in sequence conservation. Using sequence alignment, we identified several conserved residues in Z outside the RING and late domains. Nine residues were each mutated to alanine in Lassa fever virus Z. All of the mutations affected the expression of an LCMV minigenome and the infectivity of virus-like particles, but to greatly varying degrees. Interestingly, no mutations appeared to affect Z-mediated budding or association with viral GP. Our findings provide direct experimental evidence supporting a role for Z in the modulation of the activity of the viral ribonucleoprotein (RNP) complex and its packaging into mature infectious viral particles. PMID:21228230

  3. Conserved Residues in Lassa Fever Virus Z Protein Modulate Viral Infectivity at the Level of the Ribonucleoprotein▿

    PubMed Central

    Capul, Althea A.; de la Torre, Juan Carlos; Buchmeier, Michael J.


    Arenaviruses are negative-strand RNA viruses that cause human diseases such as lymphocytic choriomeningitis, Bolivian hemorrhagic fever, and Lassa hemorrhagic fever. No licensed vaccines exist, and current treatment is limited to ribavirin. The prototypic arenavirus, lymphocytic choriomeningitis virus (LCMV), is a model for dissecting virus-host interactions in persistent and acute disease. The RING finger protein Z has been identified as the driving force of arenaviral budding and acts as the viral matrix protein. While residues in Z required for viral budding have been described, residues that govern the Z matrix function(s) have yet to be fully elucidated. Because this matrix function is integral to viral assembly, we reasoned that this would be reflected in sequence conservation. Using sequence alignment, we identified several conserved residues in Z outside the RING and late domains. Nine residues were each mutated to alanine in Lassa fever virus Z. All of the mutations affected the expression of an LCMV minigenome and the infectivity of virus-like particles, but to greatly varying degrees. Interestingly, no mutations appeared to affect Z-mediated budding or association with viral GP. Our findings provide direct experimental evidence supporting a role for Z in the modulation of the activity of the viral ribonucleoprotein (RNP) complex and its packaging into mature infectious viral particles. PMID:21228230

  4. Conserved epitopes on HIV-1, FIV and SIV p24 proteins are recognized by HIV-1 infected subjects

    PubMed Central

    Roff, Shannon R; Sanou, Missa P; Rathore, Mobeen H; Levy, Jay A; Yamamoto, Janet K


    Cross-reactive peptides on HIV-1 and FIV p24 protein sequences were studied using peripheral blood mononuclear cells (PBMC) from untreated HIV-1-infected long-term survivors (LTS; >10 y of infection without antiretroviral therapy, ART), short-term HIV-1 infected subjects not on ART, and ART-treated HIV-1 infected subjects. IFNγ-ELISpot and CFSE-proliferation analyses were performed with PBMC using overlapping HIV-1 and FIV p24 peptides. Over half of the HIV-1 infected subjects tested (22/31 or 71%) responded to one or more FIV p24 peptide pools by either IFNγ or T-cell proliferation analysis. PBMC and T cells from infected subjects in all 3 HIV+ groups predominantly recognized one FIV p24 peptide pool (Fp14) by IFNγ production and one additional FIV p24 peptide pool (Fp9) by T-cell proliferation analysis. Furthermore, evaluation of overlapping SIV p24 peptide sequences identified conserved epitope(s) on the Fp14/Hp15-counterpart of SIV, Sp14, but none on Fp9-counterpart of SIV, Sp9. The responses to these FIV peptide pools were highly reproducible and persisted throughout 2–4 y of monitoring. Intracellular staining analysis for cytotoxins and phenotyping for CD107a determined that peptide epitopes from Fp9 and Fp14 pools induced cytotoxic T lymphocyte-associated molecules including perforin, granzyme B, granzyme A, and/or expression of CD107a. Selected FIV and corresponding SIV epitopes recognized by HIV-1 infected patients indicate that these protein sequences are evolutionarily conserved on both SIV and HIV-1 (e.g., Hp15:Fp14:Sp14). These studies demonstrate that comparative immunogenicity analysis of HIV-1, FIV, and SIV can identify evolutionarily-conserved T cell-associated lentiviral epitopes, which could be used as a vaccine for prophylaxis or immunotherapy. PMID:25844718

  5. A Highly-Conserved Single-Stranded DNA-Binding Protein in Xanthomonas Functions as a Harpin-Like Protein to Trigger Plant Immunity

    PubMed Central

    Che, Yi-Zhou; Zou, Li-Fang; Zakria, Muhammad; Zou, Hua-Song; Chen, Gong-You


    Harpins are produced by Gram-negative phytopathogenic bacteria and typically elicit hypersensitive response (HR) in non-host plants. The characterization of harpins in Xanthomonas species is largely unexplored. Here we demonstrate that Xanthomonas produce a highly conserved single-stranded DNA-binding protein (SSBX) that elicits HR in tobacco as by harpin Hpa1. SSBX, like Hpa1, is an acidic, glycine-rich, heat-stable protein that lacks cysteine residues. SSBX-triggered HR in tobacco, as by Hpa1, is characterized by the oxidative burst, the expression of HR markers (HIN1, HSR203J), pathogenesis-related genes, and callose deposition. Both SSBX- and Hpa1-induced HRs can be inhibited by general metabolism inhibitors actinomycin D, cycloheximide, and lanthanum chloride. Furthermore, those HRs activate the expression of BAK1 and BIK1 genes that are essential for induction of mitogen-activated protein kinase (MAPK) and salicylic acid pathways. Once applied to plants, SSBX induces resistance to the fungal pathogen Alternaria alternata and enhances plant growth. When ssbX was deleted in X. oryzae pv. oryzicola, the causal agent of bacterial leaf streak in rice, the resulting ssbXoc mutant was reduced in virulence and bacterial growth in planta, but retained its ability to trigger HR in tobacco. Interestingly, ssbXoc contains an imperfect PIP-box (plant-inducible promoter) and the expression of ssbXoc is regulated by HrpX, which belongs to the AraC family of transcriptional activators. Immunoblotting evidence showed that SSBx secretion requires a functional type-III secretion system as Hpa1 does. This is the first report demonstrating that Xanthomonas produce a highly-conserved SSBX that functions as a harpin-like protein for plant immunity. PMID:23418541

  6. NMR Structure of Conserved Eukaryotic Protein ZK652.3 from C. elegans: a Ubiquitin-like Fold

    SciTech Connect

    Cort, John R. ); Chiang, Yiwen; Zheng, Deyou; Kennedy, Michael A. ); Montelione, Gaetano


    Structural proteomics aims to provide one or more representative 3D structures for every structural domain family in nature. As part of an international effort in structural proteomics, the Northeast Structural Genomics Consortium has targeted clusters of strongly conserved eukaryotic protein families for structural and functional analysis. On this basis, protein ZK652.3 (nesg WR41 / YOY3{_}CAEEL / Swiss-Prot P34661 / gi|17557033) from Caenorhabditis elegans was selected for structure determination. Expression of the ZK652.3 gene has been observed in a transcriptional profile of C. elegans genes, where it was one of a cluster of 89 genes whose expression levels co-varied during development1. The biochemical function of this protein is presently unknown. Sequencing of cDNA libraries shows that homologues of ZK652.3 occur widely in vertebrates and plants (Fig. 1). However, ZK652.3 homologues are conspicuously absent from the yeast and Drosophila genomes. Here we describe the three-dimensional structure of ZK652.3 determined by NMR spectroscopy and discuss structural similarities with other proteins which provide clues to potential biochemical functions.

  7. Trypanosoma rangeli and Trypanosoma cruzi: molecular characterization of genes encoding putative calcium-binding proteins, highly conserved in trypanosomatids.


    Porcel, B M; Bontempi, E J; Henriksson, J; Rydåker, M; Aslund, L; Segura, E L; Pettersson, U; Ruiz, A M


    Genes encoding a 29-kDa flagellar calcium-binding protein (F29) in Trypanosoma cruzi, strongly homologous to EF-hand calcium-binding protein-encoding genes previously reported in this parasite, were isolated by immunoscreening. F29 is encoded by a number of very similar genes, highly conserved among different T. cruzi isolates. The genes are located on a pair of homologous chromosomes, arranged in one or two clusters of tandem repeats. PCR amplification of Trypanosoma rangeli genomic DNA, using primers derived from the T. cruzi F29 sequence made it possible to isolate the homologous gene in T. rangeli, encoding a 23-kDa protein called TrCaBP. Gene sequence comparisons showed homology to EF-hand calcium-binding proteins from T. cruzi (82.8%), Trypanosoma brucei brucei (60.2%), and Entamoeba histolytica (28.4%). Northern blot analysis revealed that the TrCaBP gene is expressed in T. rangeli as a polyadenylated transcript. The TrCaBP-encoding genes are present in at least 20 copies per cell, organized in tandem arrays, on large T. rangeli chromosomes in some isolates and on two smaller ones in others. This gene, however, seems to be absent from Leishmania. PMID:8948328

  8. Conserved and divergent expression patterns of the proteolipid protein gene family in the amphibian central nervous system.


    Yoshida, M; Shan, W S; Colman, D R


    The recent discovery of a proteolipid protein gene family has revealed that its members are in fact widely distributed and are not exclusively associated with myelination. To date, three different gene products, DMalpha/DM-20/PLP, DMbeta/M6a, and DMgamma/M6b, have been isolated from certain primitive fish species, mouse, and human central nervous system (CNS). We cloned Xenopus laevis orthologues of DMbeta/M6a and DMgamma/M6b and investigated the expression patterns of these gene transcripts as well as that of PLP in developing Xenopus CNS. As is the case in shark and mouse, the mRNA encoding the major myelin integral protein, PLP, is first detected at stage 42/43 in tadpoles and is exclusively found in morphologically recognizable oligodendrocytes throughout the brain, while DMbeta mRNA is solely expressed in young presumptive neurons in the gray matter. There exist two distinct DMgamma mRNAs and, in contrast to these evolutionarily conserved expression patterns, DMgamma mRNAs distribute uniquely within the ventricular zone in young tadpoles (stage 25) through maturity. Furthermore, both DMbeta and DMgamma are expressed in the developing retina, and their distributions are different from one other. In Xenopus CNS, therefore, the expression patterns of three proteolipid proteins, PLP, DMbeta, and DMgamma, are distinct from each other, implying very different roles for their protein products within the cell populations in which they are expressed. PMID:10397631

  9. The protonation state of histidine 111 regulates the aggregation of the evolutionary most conserved region of the human prion protein.


    Fonseca-Ornelas, Luis; Zweckstetter, Markus


    In a group of neurodegenerative diseases, collectively termed transmissible spongiform encephalopathies, the prion protein aggregates into β-sheet rich amyloid-like deposits. Because amyloid structure has been connected to different prion strains and cellular toxicity, it is important to obtain insight into the structural properties of prion fibrils. Using a combination of solution NMR spectroscopy, thioflavin-T fluorescence and electron microscopy we here show that within amyloid fibrils of a peptide containing residues 108-143 of the human prion protein [humPrP (108-143)]-the evolutionary most conserved part of the prion protein - residue H111 and S135 are in close spatial proximity and their interaction is critical for fibrillization. We further show that residues H111 and H140 share the same microenvironment in the unfolded, monomeric state of the peptide, but not in the fibrillar form. While protonation of H140 has little influence on fibrillization of humPrP (108-143), a positive charge at position 111 blocks the conformational change, which is necessary for amyloid formation of humPrP (108-143). Our study thus highlights the importance of protonation of histidine residues for protein aggregation and suggests point mutations to probe the structure of infectious prion particles. PMID:27184108

  10. Conserved Features in the Structure, Mechanism, and Biogenesis of the Inverse Autotransporter Protein Family

    PubMed Central

    Heinz, Eva; Stubenrauch, Christopher J.; Grinter, Rhys; Croft, Nathan P.; Purcell, Anthony W.; Strugnell, Richard A.; Dougan, Gordon; Lithgow, Trevor


    The bacterial cell surface proteins intimin and invasin are virulence factors that share a common domain structure and bind selectively to host cell receptors in the course of bacterial pathogenesis. The β-barrel domains of intimin and invasin show significant sequence and structural similarities. Conversely, a variety of proteins with sometimes limited sequence similarity have also been annotated as “intimin-like” and “invasin” in genome datasets, while other recent work on apparently unrelated virulence-associated proteins ultimately revealed similarities to intimin and invasin. Here we characterize the sequence and structural relationships across this complex protein family. Surprisingly, intimins and invasins represent a very small minority of the sequence diversity in what has been previously the “intimin/invasin protein family”. Analysis of the assembly pathway for expression of the classic intimin, EaeA, and a characteristic example of the most prevalent members of the group, FdeC, revealed a dependence on the translocation and assembly module as a common feature for both these proteins. While the majority of the sequences in the grouping are most similar to FdeC, a further and widespread group is two-partner secretion systems that use the β-barrel domain as the delivery device for secretion of a variety of virulence factors. This comprehensive analysis supports the adoption of the “inverse autotransporter protein family” as the most accurate nomenclature for the family and, in turn, has important consequences for our overall understanding of the Type V secretion systems of bacterial pathogens. PMID:27190006

  11. Conserved aspartate residues and phosphorylation in signal transduction by the chemotaxis protein CheY.

    PubMed Central

    Bourret, R B; Hess, J F; Simon, M I


    The CheY protein is phosphorylated by CheA and dephosphorylated by CheZ as part of the chemotactic signal transduction pathway in Escherichia coli. Phosphorylation of CheY has been proposed to occur on an aspartate residue. Each of the eight aspartate residues of CheY was replaced by using site-directed mutagenesis. Substitutions at Asp-12, Asp-13, or Asp-57 resulted in loss of chemotaxis. Most of the mutant CheY proteins were still phosphorylated by CheA but exhibited modified biochemical properties, including reduced ability to accept phosphate from CheA, altered phosphate group stability, and/or resistance to CheZ-mediated dephosphorylation. The properties of CheY proteins bearing a substitution at position 57 were most aberrant, consistent with the hypothesis that Asp-57 is the normal site of acyl phosphate formation. Evidence for an alternate site of phosphorylation in the Asp-57 mutants is presented. Phosphorylated CheY is believed to cause tumbling behavior. However, a dominant mutant CheY protein that was not phosphorylated in vitro caused tumbling in vivo in the absence of CheA. This phenotype suggests that the role of phosphorylation in the wild-type CheY protein is to stabilize a transient conformational change that can generate tumbling behavior. Images PMID:2404281

  12. Conserved DNA binding and self-association domains of the Drosophila zeste protein.

    PubMed Central

    Chen, J D; Chan, C S; Pirrotta, V


    The zeste gene product is involved in two types of genetic effects dependent on chromosome pairing: transvection and the zeste-white interaction. Comparison of the predicted amino acid sequence with that of the Drosophila virilis gene shows that several blocks of amino acid sequence have been very highly conserved. One of these regions corresponds to the DNA binding domain. Site-directed mutations in this region indicate that a sequence resembling that of the homeodomain DNA recognition helix is essential for DNA binding activity. The integrity of an amphipathic helical region is also essential for binding activity and is likely to be responsible for dimerization of the DNA binding domain. Another very strongly conserved domain of zeste is the C-terminal region, predicted to form a long helical structure with two sets of heptad repeats that constitute two long hydrophobic ridges at opposite ends and on opposite faces of the helix. We show that this domain is responsible for the extensive aggregation properties of zeste that are required for its role in transvection phenomena. A model is proposed according to which the hydrophobic ridges induce the formation of open-ended coiled-coil structures holding together many hundreds of zeste molecules and possibly anchoring these complexes to other nuclear structures. Images PMID:1732733

  13. Expression of a conserved cell-type-specific protein in nerve terminals coincides with synaptogenesis.

    PubMed Central

    Catsicas, S; Larhammar, D; Blomqvist, A; Sanna, P P; Milner, R J; Wilson, M C


    Contact of axons with target territories results in the formation of synapses, specific junctional complexes that may represent a final stage of neuronal maturation. Synaptosomal-associated protein 25 (SNAP-25) is a component of particular nerve terminals recently identified in rodent brain. To evaluate the structure and regulation of molecular components of the synapse, we investigated the expression of SNAP-25 in the developing chicken nervous system. Analysis of SNAP-25 cDNA clones demonstrated that the chicken homologue is identical in amino acid sequence to the mouse protein. In chicken retina and neural tube, the onset of SNAP-25 mRNA and protein expression was found to correspond to the time of synaptogenesis. These results suggest that SNAP-25 plays a role in the physiology of mature nerve terminals and that its expression may be regulated by specific cell-cell interactions occurring during synapse formation. Images PMID:1992470

  14. Highly Conserved Surface Proteins of Oral Spirochetes as Adhesins and Potent Inducers of Proinflammatory and Osteoclastogenic Factors▿

    PubMed Central

    Jun, Hye-Kyoung; Kang, Young-Mi; Lee, Hae-Ri; Lee, Sung-Hoon; Choi, Bong-Kyu


    Oral spirochetes include enormously heterogeneous Treponema species, and some have been implicated in the etiology of periodontitis. In this study, we characterized highly conserved surface proteins in four representative oral spirochetes (Treponema denticola, T. lecithinolyticum, T. maltophilum, and T. socranskii subsp. socranskii) that are homologs of T. pallidum Tp92, with opsonophagocytic potential and protective capacity against syphilis. Tp92 homologs of oral spirochetes had predicted signal peptides (20 to 31 amino acids) and molecular masses of 88 to 92 kDa for mature proteins. They showed amino acid sequence identities of 37.9 to 49.3% and similarities of 54.5 to 66.9% to Tp92. The sequence identities and similarities of Tp92 homologs of oral treponemes to one another were 41.6 to 71.6% and 59.9 to 85.6%, respectively. The tp92 gene homologs were successfully expressed in Escherichia coli, and the recombinant proteins were capable of binding to KB cells, an epithelial cell line, and inhibited the binding of the whole bacteria to the cells. Antiserum (the immunoglobulin G fraction) raised against a recombinant form of the T. denticola Tp92 homolog cross-reacted with homologs from three other species of treponemes. The Tp92 homologs stimulated various factors involved in inflammation and osteoclastogenesis, like interleukin-1β (IL-1β), tumor necrosis factor alpha, IL-6, prostaglandin E2, and matrix metalloproteinase 9, in host cells like monocytes and fibroblasts. Our results demonstrate that Tp92 homologs of oral spirochetes are highly conserved and may play an important role in cell attachment, inflammation, and tissue destruction. The coexistence of various Treponema species in a single periodontal pocket and, therefore, the accumulation of multiple Tp92 homologs may amplify the pathological effect in periodontitis. PMID:18390996

  15. Conserved differences in protein sequence determine the human pathogenicity of Ebolaviruses

    PubMed Central

    Pappalardo, Morena; Juliá, Miguel; Howard, Mark J.; Rossman, Jeremy S.; Michaelis, Martin; Wass, Mark N.


    Reston viruses are the only Ebolaviruses that are not pathogenic in humans. We analyzed 196 Ebolavirus genomes and identified specificity determining positions (SDPs) in all nine Ebolavirus proteins that distinguish Reston viruses from the four human pathogenic Ebolaviruses. A subset of these SDPs will explain the differences in human pathogenicity between Reston and the other four ebolavirus species. Structural analysis was performed to identify those SDPs that are likely to have a functional effect. This analysis revealed novel functional insights in particular for Ebolavirus proteins VP40 and VP24. The VP40 SDP P85T interferes with VP40 function by altering octamer formation. The VP40 SDP Q245P affects the structure and hydrophobic core of the protein and consequently protein function. Three VP24 SDPs (T131S, M136L, Q139R) are likely to impair VP24 binding to human karyopherin alpha5 (KPNA5) and therefore inhibition of interferon signaling. Since VP24 is critical for Ebolavirus adaptation to novel hosts, and only a few SDPs distinguish Reston virus VP24 from VP24 of other Ebolaviruses, human pathogenic Reston viruses may emerge. This is of concern since Reston viruses circulate in domestic pigs and can infect humans, possibly via airborne transmission. PMID:27009368

  16. The mitochondrial unfolded protein response, a conserved stress response pathway with implications in health and disease

    PubMed Central

    Jovaisaite, Virginija; Mouchiroud, Laurent; Auwerx, Johan


    The ability to respond to various intracellular and/or extracellular stresses allows the organism to adapt to changing environmental conditions and drives evolution. It is now well accepted that a progressive decline of the efficiency of stress response pathways occurs with aging. In this context, a correct proteostasis is essential for the functionality of the cell, and its dysfunction has been associated with protein aggregation and age-related degenerative diseases. Complex response mechanisms have evolved to deal with unfolded protein stress in different subcellular compartments and their moderate activation translates into positive effects on health. In this review, we focus on the mitochondrial unfolded protein response (UPRmt), a response to proteotoxic stress specifically in mitochondria, an organelle with a wide array of fundamental functions, most notably the harvesting of energy from food and the control of cell death. We compare UPRmt with the extensively characterized cytosolic heat shock response (HSR) and the unfolded protein response in endoplasmic reticulum (UPRER), and discuss the current knowledge about UPRmt signaling pathways as well as their potential involvement in physiology. PMID:24353213

  17. Contribution of the highly conserved EaeH surface protein to enterotoxigenic Escherichia coli pathogenesis.


    Sheikh, Alaullah; Luo, Qingwei; Roy, Koushik; Shabaan, Salwa; Kumar, Pardeep; Qadri, Firdausi; Fleckenstein, James M


    Enterotoxigenic Escherichia coli (ETEC) strains are among the most common causes of diarrheal illness worldwide. These pathogens disproportionately afflict children in developing countries, where they cause substantial morbidity and are responsible for hundreds of thousands of deaths each year. Although these organisms are important targets for enteric vaccines, most development efforts to date have centered on a subset of plasmid-encoded fimbrial adhesins known as colonization factors and heat-labile toxin (LT). Emerging data suggest that ETEC undergoes considerable changes in its surface architecture, sequentially deploying a number of putative adhesins during its interactions with the host. We demonstrate here that one putative highly conserved, chromosomally encoded adhesin, EaeH, engages the surfaces of intestinal epithelial cells and contributes to bacterial adhesion, LT delivery, and colonization of the small intestine. PMID:24935979

  18. Understanding the importance of conservative hypothetical protein LdBPK_070020 in Leishmania donovani and its role in subsistence of the parasite.


    Bhardwaj, Ruchika; Kumar, Ritesh; Singh, Sanjeev Kumar; Selvaraj, Chandrabose; Dubey, Vikash Kumar


    The genome of Leishmania donovani, the causative agent of visceral leishmaniasis, codes for approximately 65% of both conserved and non-conserved hypothetical proteins. Studies on 'conserved hypothetical' proteins are expected to reveal not only new and crucial aspects of Leishmania biochemistry, but it could also lead to discovery of novel drug candidates. Conserved hypothetical protein, LdBPK_070020, is a 31.14 kDa protein, encoded by an 810 bp gene. BLAST analysis of LdBPK_070020, performed against NCBI non-redundant database, showed 80-99% similarity with conserved hypothetical proteins of Leishmania belonging to other species. Using homologues recombination method, we have performed gene knockout of LdBPK_070020 and effects of the same were investigated on the parasite. The gene knocked out strain shows significant retardation in growth with respect to wild type. Detailed biochemical studies indicated towards important role of LdBPK_070020 in the parasite survival and growth. PMID:26926257

  19. Moving Fe2+ from ferritin ion channels to catalytic OH centers depends on conserved protein cage carboxylates

    PubMed Central

    Behera, Rabindra K.; Theil, Elizabeth C.


    Ferritin biominerals are protein-caged metabolic iron concentrates used for iron–protein cofactors and oxidant protection (Fe2+ and O2 sequestration). Fe2+ passage through ion channels in the protein cages, like membrane ion channels, required for ferritin biomineral synthesis, is followed by Fe2+ substrate movement to ferritin enzyme (Fox) sites. Fe2+ and O2 substrates are coupled via a diferric peroxo (DFP) intermediate, λmax 650 nm, which decays to [Fe3+–O–Fe3+] precursors of caged ferritin biominerals. Structural studies show multiple conformations for conserved, carboxylate residues E136 and E57, which are between ferritin ion channel exits and enzymatic sites, suggesting functional connections. Here we show that E136 and E57 are required for ferritin enzyme activity and thus are functional links between ferritin ion channels and enzymatic sites. DFP formation (Kcat and kcat/Km), DFP decay, and protein-caged hydrated ferric oxide accumulation decreased in ferritin E57A and E136A; saturation required higher Fe2+ concentrations. Divalent cations (both ion channel and intracage binding) selectively inhibit ferritin enzyme activity (block Fe2+ access), Mn2+ << Co2+ < Cu2+ < Zn2+, reflecting metal ion–protein binding stabilities. Fe2+–Cys126 binding in ferritin ion channels, observed as Cu2+–S–Cys126 charge-transfer bands in ferritin E130D UV-vis spectra and resistance to Cu2+ inhibition in ferritin C126S, was unpredicted. Identifying E57 and E136 links in Fe2+ movement from ferritin ion channels to ferritin enzyme sites completes a bucket brigade that moves external Fe2+ into ferritin enzymatic sites. The results clarify Fe2+ transport within ferritin and model molecular links between membrane ion channels and cytoplasmic destinations. PMID:24843174

  20. Nature of the promoter activated by C.PvuII, an unusual regulatory protein conserved among restriction-modification systems.


    Knowle, Dieter; Lintner, Robert E; Touma, Yara M; Blumenthal, Robert M


    A widely distributed family of small regulators, called C proteins, controls a subset of restriction-modification systems. The C proteins studied to date activate transcription of their own genes and that of downstream endonuclease genes; this arrangement appears to delay endonuclease expression relative to that of the protective methyltransferase when the genes enter a new cell. C proteins bind to conserved sequences called C boxes. In the PvuII system, the C boxes have been reported to extend from -23 to +3 relative to the transcription start for the gene for the C protein, an unexpected starting position relative to a bound activator. This study suggests that transcript initiation within the C boxes represents initial, C-independent transcription of pvuIICR. The major C protein-dependent transcript appears to be a leaderless mRNA starting farther downstream, at the initiation codon for the pvuIIC gene. This conclusion is based on nuclease S1 transcript mapping and the effects of a series of nested deletions in the promoter region. Furthermore, replacing the region upstream of the pvuIIC initiation codon with a library of random oligonucleotides, followed by selection for C-dependent transcription, yielded clones having sequences that resemble -10 promoter hexamers. The -35 hexamer of this promoter would lie within the C boxes. However, the spacing between C boxes/-35 and the apparent -10 hexamer can be varied by +/-4 bp with little effect. This suggests that, like some other activator-dependent promoters, PpvuIICR may not require a -35 hexamer. Features of this transcription activation system suggest explanations for its broad host range. PMID:15629920

  1. Autophagy, a Conserved Mechanism for Protein Degradation, Responds to Heat, and Other Abiotic Stresses in Capsicum annuum L.

    PubMed Central

    Zhai, Yufei; Guo, Meng; Wang, Hu; Lu, Jinping; Liu, Jinhong; Zhang, Chong; Gong, Zhenhui; Lu, Minghui


    Abiotic stresses negatively affect plants growth and development by inducing protein denaturation, and autophagy degrades the damaged proteins to alleviate their toxicity, however, little is known about the involvement of autophagy in pepper (Capsicum annuum L.) tolerances to abiotic stresses. In this study, we identified autophagy-related gene (ATG) members in the whole genome of pepper by HMM method and analyzed their expression profiles in response to heat and other abiotic stresses by quantitative real-time PCR. The results showed that the CaATG contained 15 core ATG members including 29 ATG proteins with their respective conserved functional domains, involving the whole process of autophagy. Under normal environmental condition, the expression of CaATG genes showed tissue- and developmental stage-specific patterns, while under abiotic stresses of salt, drought, heat, cold and carbohydrate starvation, the accumulation of autophagosome punctate increased and the expression level of CaATG genes changed with stress type-dependent pattern, which indicates the linkage of autophagy in pepper response to abiotic stresses. After treated with heat stress, both the number of up-regulated CaATG genes and the increment of autophagosome punctate were higher in pepper thermotolerant line R9 than those in thermosensitive line B6, implying an association of autophagy with heat tolerance. In addition, CaATG6 was predicted to interact with CaHSP90 family members. Our study suggests that autophagy is connected to pepper tolerances to heat and other abiotic stresses. PMID:26904087

  2. Roles of conserved and allelic regions of the major merozoite surface protein (gp195) in immunity against Plasmodium falciparum.

    PubMed Central

    Hui, G S; Hashimoto, A; Chang, S P


    The Plasmodium falciparum major merozoite surface protein gp195 is a candidate antigen for a vaccine against human malaria. The significance of allelism and polymorphism in vaccine-induced immunity to gp195 was investigated in this study. Rabbits were immunized with each of two allelic forms of gp195 that were affinity purified from the FUP and FVO parasite isolates. gp195-specific antibodies raised against one allelic form of gp195 cross-reacted extensively with the gp195 of the heterologous allele in enzyme-linked immunosorbent assays (ELISAs) and immunofluorescence assays. Competitive binding ELISAs with homologous and heterologous gp195s confirmed that a majority of the anti-gp195 antibodies produced against either allelic protein were cross-reactive. Moreover, the biological activities of the gp195 antibody responses were also highly cross-reactive, since anti-gp195 sera inhibited the in vitro growth of the homologous and heterologous parasites with equal efficiency. The degree of cross-reactivity with strain-specific and allele-specific determinants of gp195 in the ELISA was low. These results suggest that the immunological cross-reactivity between the two gp195 proteins is due to recognition of conserved determinants. They also suggest that a gp195-based vaccine may be effective against blood-stage infection with a diverse array of parasite isolates. Images PMID:1548068

  3. Volume-conserving trans-cis isomerization pathways in photoactive yellow protein visualized by picosecond X-ray crystallography

    NASA Astrophysics Data System (ADS)

    Jung, Yang Ouk; Lee, Jae Hyuk; Kim, Joonghan; Schmidt, Marius; Moffat, Keith; Šrajer, Vukica; Ihee, Hyotcherl


    Trans-to-cis isomerization, the key reaction in photoactive proteins, usually cannot occur through the standard one-bond-flip mechanism. Owing to spatial constraints imposed by a protein environment, isomerization probably proceeds through a volume-conserving mechanism in which highly choreographed atomic motions are expected, the details of which have not yet been observed directly. Here we employ time-resolved X-ray crystallography to visualize structurally the isomerization of the p-coumaric acid chromophore in photoactive yellow protein with a time resolution of 100 ps and a spatial resolution of 1.6 Å. The structure of the earliest intermediate (IT) resembles a highly strained transition state in which the torsion angle is located halfway between the trans- and cis-isomers. The reaction trajectory of IT bifurcates into two structurally distinct cis intermediates via hula-twist and bicycle-pedal pathways. The bifurcating reaction pathways can be controlled by weakening the hydrogen bond between the chromophore and an adjacent residue through E46Q mutation, which switches off the bicycle-pedal pathway.

  4. Structure is three to ten times more conserved than sequence--a study of structural response in protein cores.


    Illergård, Kristoffer; Ardell, David H; Elofsson, Arne


    Protein structures change during evolution in response to mutations. Here, we analyze the mapping between sequence and structure in a set of structurally aligned protein domains. To avoid artifacts, we restricted our attention only to the core components of these structures. We found that on average, using different measures of structural change, protein cores evolve linearly with evolutionary distance (amino acid substitutions per site). This is true irrespective of which measure of structural change we used, whether RMSD or discrete structural descriptors for secondary structure, accessibility, or contacts. This linear response allows us to quantify the claim that structure is more conserved than sequence. Using structural alphabets of similar cardinality to the sequence alphabet, structural cores evolve three to ten times slower than sequences. Although we observed an average linear response, we found a wide variance. Different domain families varied fivefold in structural response to evolution. An attempt to categorically analyze this variance among subgroups by structural and functional category revealed only one statistically significant trend. This trend can be explained by the fact that beta-sheets change faster than alpha-helices, most likely due to that they are shorter and that change occurs at the ends of the secondary structure elements. PMID:19507241

  5. Characterization of the fibronectin-attachment protein of Mycobacterium avium reveals a fibronectin-binding motif conserved among mycobacteria.


    Schorey, J S; Holsti, M A; Ratliff, T L; Allen, P M; Brown, E J


    Mycobacterium avium is an intracellular pathogen and a major opportunistic infectious agent observed in patients with acquired immune deficiency syndrome (AIDS). Evidence suggests that the initial portal of infection by M. avium is often the gastrointestinal tract. However, the mechanism by which the M. avium crosses the epithelial barrier is unclear. A possible mechanism is suggested by the ability of M. avium to bind fibronectin, an extracellular matrix protein that is a virulence factor for several extracellular pathogenic bacteria which bind to mucosal surfaces. To further characterize fibronectin binding by M. avium, we have cloned the M. avium fibronectin-attachment protein (FAP). The M. avium FAP (FAP-A) has an unusually large number of Pro and Ala residues (40% overall) and is 50% identical to FAP of both Mycobacterium leprae and Mycobacterium tuberculosis. Using recombinant FAP-A and FAP-A peptides, we show that two non-continuous regions in FAP-A bind fibronectin. Peptides from these regions and homologous sequences from M. leprae FAP inhibit fibronectin binding by both M. avium and Mycobacterium bovis Bacillus Calmette-Guerin (BCG). These regions have no homology to eukaryotic fibronectin-binding proteins and are only distantly related to fibronectin-binding peptides of Gram-positive bacteria. Nevertheless, these fibronectin-binding regions are highly conserved among the mycobacterial FAPs, suggesting an essential function for this interaction in mycobacteria infection of their metazoan hosts. PMID:8858587

  6. cDNA cloning and sequencing of human fibrillarin, a conserved nucleolar protein recognized by autoimmune antisera

    SciTech Connect

    Aris, J.P.; Blobel, G. )


    The authors have isolated a 1.1-kilobase cDNA clone that encodes human fibrillarin by screening a hepatoma library in parallel with DNA probes derived from the fibrillarin genes of Saccharomyces cerevisiae (NOP1) and Xenopus laevis. RNA blot analysis indicates that the corresponding mRNA is {approximately}1,300 nucleotides in length. Human fibrillarin expressed in vitro migrates on SDS gels as a 36-kDa protein that is specifically immunoprecipitated by antisera from humans with scleroderma autoimmune disease. Human fibrillarin contains an amino-terminal repetitive domain {approximately}75-80 amino acids in length that is rich in glycine and arginine residues and is similar to amino-terminal domains in the yeast and Xenopus fibrillarins. The occurrence of a putative RNA-binding domain and an RNP consensus sequence within the protein is consistent with the association of fibrillarin with small nucleolar RNAs. Protein sequence alignments show that 67% of amino acids from human fibrillarin are identical to those in yeast fibrillarin and that 81% are identical to those in Xenopus fibrillarin. This identity suggests the evolutionary conservation of an important function early in the pathway for ribosome biosynthesis.

  7. Molecular analysis of muskelin identifies a conserved discoidin-like domain that contributes to protein self-association.


    Prag, Soren; Collett, Georgina D M; Adams, Josephine C


    Muskelin is an intracellular protein with a C-terminal kelch-repeat domain that was initially characterized as having functional involvement in cell spreading on the extracellular matrix glycoprotein thrombospondin-1. As one approach to understanding the functional properties of muskelin, we have combined bioinformatic and biochemical studies. Through analysis of a new dataset of eight animal muskelins, we showed that the N-terminal region of the polypeptide corresponds to a predicted discoidin-like domain. This domain architecture is conserved in fungal muskelins and reveals a structural parallel between the muskelins and certain extracellular fungal galactose oxidases, although the phylogeny of the two groups appears distinct. In view of the fact that a number of kelch-repeat proteins have been shown to self-associate, co-immunoprecipitation, protein pull-down assays and studies of cellular localization were carried out with wild-type, deletion mutant and point mutant muskelins to investigate the roles of the discoidin-like and kelch-repeat domains. We obtained evidence for cis- and trans-interactions between the two domains. These studies provide evidence that muskelin self-associates through a head-to-tail mechanism involving the discoidin-like domain. PMID:15084145

  8. Volume-conserving trans-cis isomerization pathways in photoactive yellow protein visualized by picosecond X-ray crystallography

    SciTech Connect

    Jung, Yang Ouk; Lee, Jae Hyuk; Kim, Joonghan; Schmidt, Marius; Moffat, Keith; Šrajer, Vukica; Ihee, Hyotcherl


    Trans-to-cis isomerization, the key reaction in photoactive proteins, usually cannot occur through the standard one-bond-flip mechanism. Owing to spatial constraints imposed by a protein environment, isomerization probably proceeds through a volume-conserving mechanism in which highly choreographed atomic motions are expected, the details of which have not yet been observed directly. Here we employ time-resolved X-ray crystallography to visualize structurally the isomerization of the p-coumaric acid chromophore in photoactive yellow protein with a time resolution of 100 ps and a spatial resolution of 1.6 Å. The structure of the earliest intermediate (IT) resembles a highly strained transition state in which the torsion angle is located halfway between the trans- and cis-isomers. The reaction trajectory of IT bifurcates into two structurally distinct cis intermediates via hula-twist and bicycle-pedal pathways. The bifurcating reaction pathways can be controlled by weakening the hydrogen bond between the chromophore and an adjacent residue through E46Q mutation, which switches off the bicycle-pedal pathway.

  9. Repurposing of conserved autophagy-related protein ATG8 in a divergent eukaryote

    PubMed Central

    Lévêque, Maude F.; Nguyen, Hoa Mai; Besteiro, Sébastien


    ABSTRACT Toxoplasma gondii and other apicomplexan parasites contain a peculiar non-photosynthetic plastid called the apicoplast, which is essential for their survival. The localization of autophagy-related protein ATG8 to the apicoplast in several apicomplexan species and life stages has recently been described, and we have shown this protein is essential for proper inheritance of this complex plastid into daughter cells during cell division. Although the mechanism behind ATG8 association to the apicoplast in T. gondii is related to the canonical conjugation system leading to autophagosome formation, its singular role seems independent from the initial catabolic purpose of autophagy. Here we also discuss further the functional evolution and innovative adaptations of the autophagy machinery to maintain this organelle during parasite division. PMID:27574540

  10. Repurposing of conserved autophagy-related protein ATG8 in a divergent eukaryote.


    Lévêque, Maude F; Nguyen, Hoa Mai; Besteiro, Sébastien


    Toxoplasma gondii and other apicomplexan parasites contain a peculiar non-photosynthetic plastid called the apicoplast, which is essential for their survival. The localization of autophagy-related protein ATG8 to the apicoplast in several apicomplexan species and life stages has recently been described, and we have shown this protein is essential for proper inheritance of this complex plastid into daughter cells during cell division. Although the mechanism behind ATG8 association to the apicoplast in T. gondii is related to the canonical conjugation system leading to autophagosome formation, its singular role seems independent from the initial catabolic purpose of autophagy. Here we also discuss further the functional evolution and innovative adaptations of the autophagy machinery to maintain this organelle during parasite division. PMID:27574540

  11. Constitutive photomorphogenesis protein 1 (COP1) and COP9 signalosome, evolutionarily conserved photomorphogenic proteins as possible targets of melatonin.


    Sanchez-Barcelo, Emilio J; Mediavilla, Maria D; Vriend, Jerry; Reiter, Russel J


    The ubiquitin proteasome system has been proposed as a possible mechanism involved in the multiple actions of melatonin. COP1 (constitutive photomorphogenesis protein 1), a RING finger-type ubiquitin E3 ligase formerly identified in Arabidopsis, is a central switch for the transition from plant growth underground in darkness (etiolation) to growth under light exposure (photomorphogenesis). In darkness, COP1 binds to photomorphogenic transcription factors driving its degradation via the 26S proteasome; blue light, detected by cryptochromes, and red and far-red light detected by phytochromes, negatively regulate COP1. Homologues of plant COP1 containing all the structural features present in Arabidopsis as well as E3 ubiquitin ligase activity have been identified in mice and humans. Substrates for mammalian (m) COP1 include p53, AP-1 and c-Jun, p27(Kip1) , ETV1, MVP, 14-3-3σ, C/EBPα, MTA1, PEA3, ACC, TORC2 and FOXO1. This mCOP1 target suggests functions related to tumorigenesis, gluconeogenesis, and lipid metabolism. The role of mCOP1 in tumorigenesis (either as a tumor promoter or tumor suppressor), as well as in glucose metabolism (inhibition of gluconeogenesis) and lipid metabolism (inhibition of fatty acid synthesis), has been previously demonstrated. COP1, along with numerous other ubiquitin ligases, is regulated by the COP9 signalosome; this protein complex is associated with the oxidative stress sensor Keap1 and the deubiquitinase USP15. The objective of this review was to provide new information on the possible role of COP1 and COP9 as melatonin targets. The hypothesis is based on common functional aspects of melatonin and COP1 and COP9, including their dependence on light, regulation of the metabolism, and their control of tumor growth. PMID:27121162

  12. Placenta-Specific Protein 1 Is Conserved throughout the Placentalia under Purifying Selection

    PubMed Central

    Devor, Eric J.


    Placental mammals (Placentalia) are a very successful group that, today, comprise 94% of all mammalian species. Recent phylogenetic analyses, coupled with new, quite complete fossils, suggest that the crown orders were all established rapidly from a common ancestor just after the Cretaceous/Tertiary (K/T) boundary 65 million years ago. Extensive molecular and morphologic evidence has led to a description of the common ancestor of all Placentalia in which a two-horned uterus and a hemochorial placenta are present. Thus, the process of placentation in which the placenta invades and anchors to the uterine epithelium was already established. One factor that has been suggested as a crucial component of this process is placenta-specific protein 1 (PLAC1). A phylogenetic analysis of the PLAC1 protein in 25 placental mammal species, representing nine of the sixteen crown orders of the Placentalia, suggests that this protein was present in the placental common ancestor in the form we see it today, that it evolved in the Placentalia and has been subject to the effects of purifying selection since its appearance. PMID:25180201

  13. Placenta-specific protein 1 is conserved throughout the Placentalia under purifying selection.


    Devor, Eric J


    Placental mammals (Placentalia) are a very successful group that, today, comprise 94% of all mammalian species. Recent phylogenetic analyses, coupled with new, quite complete fossils, suggest that the crown orders were all established rapidly from a common ancestor just after the Cretaceous/Tertiary (K/T) boundary 65 million years ago. Extensive molecular and morphologic evidence has led to a description of the common ancestor of all Placentalia in which a two-horned uterus and a hemochorial placenta are present. Thus, the process of placentation in which the placenta invades and anchors to the uterine epithelium was already established. One factor that has been suggested as a crucial component of this process is placenta-specific protein 1 (PLAC1). A phylogenetic analysis of the PLAC1 protein in 25 placental mammal species, representing nine of the sixteen crown orders of the Placentalia, suggests that this protein was present in the placental common ancestor in the form we see it today, that it evolved in the Placentalia and has been subject to the effects of purifying selection since its appearance. PMID:25180201

  14. STT3, a highly conserved protein required for yeast oligosaccharyl transferase activity in vivo.

    PubMed Central

    Zufferey, R; Knauer, R; Burda, P; Stagljar, I; te Heesen, S; Lehle, L; Aebi, M


    N-linked glycosylation is a ubiquitous protein modification, and is essential for viability in eukaryotic cells. A lipid-linked core-oligosaccharide is assembled at the membrane of the endoplasmic reticulum and transferred to selected asparagine residues of nascent polypeptide chains by the oligosaccharyl transferase (OTase) complex. Based on the synthetic lethal phenotype of double mutations affecting the assembly of the lipid-linked core-oligosaccharide and the OTase activity, we have performed a novel screen for mutants in Saccharomyces cerevisiae with altered N-linked glycosylation. Besides novel mutants deficient in the assembly of the lipid-linked oligosaccharide (alg mutants), we identified the STT3 locus as being required for OTase activity in vivo. The essential STT3 protein is approximately 60% identical in amino acid sequence to its human homologue. A mutation in the STT3 locus affects substrate specificity of the OTase complex in vivo and in vitro. In stt3-3 cells very little glycosyl transfer occurs from incomplete lipid-linked oligosaccharide, whereas the transfer of full-length Glc3Man9GlcNAc2 is hardly affected as compared with wild-type cells. Depletion of the STT3 protein results in loss of transferase activity in vivo and a deficiency in the assembly of OTase complex. Images PMID:7588624

  15. Low molecular weight protein tyrosine phosphatase: Multifaceted functions of an evolutionarily conserved enzyme.


    Caselli, Anna; Paoli, Paolo; Santi, Alice; Mugnaioni, Camilla; Toti, Alessandra; Camici, Guido; Cirri, Paolo


    Originally identified as a low molecular weight acid phosphatase, LMW-PTP is actually a protein tyrosine phosphatase that acts on many phosphotyrosine-containing cellular proteins that are primarily involved in signal transduction. Differences in sequence, structure, and substrate recognition as well as in subcellular localization in different organisms enable LMW-PTP to exert many different functions. In fact, during evolution, the LMW-PTP structure adapted to perform different catalytic actions depending on the organism type. In bacteria, this enzyme is involved in the biosynthesis of group 1 and 4 capsules, but it is also a virulence factor in pathogenic strains. In yeast, LMW-PTPs dephosphorylate immunophilin Fpr3, a peptidyl-prolyl-cis-trans isomerase member of the protein chaperone family. In humans, LMW-PTP is encoded by the ACP1 gene, which is composed of three different alleles, each encoding two active enzymes produced by alternative RNA splicing. In animals, LMW-PTP dephosphorylates a number of growth factor receptors and modulates their signalling processes. The involvement of LMW-PTP in cancer progression and in insulin receptor regulation as well as its actions as a virulence factor in a number of pathogenic bacterial strains may promote the search for potent, selective and bioavailable LMW-PTP inhibitors. PMID:27421795

  16. Novel parasitic nematode-specific protein of bovine filarial parasite Setaria digitata displays conserved gene structure and ubiquitous expression.


    Rodrigo, W W; Dassanayake, R S; Weerasena, S J; Silva Gunawardene, Y I


    Setaria digitata is an animal filarial parasite, which can cause fatal diseases to livestock such as cattle, sheep, goat, buffaloes, horses etc. inflicting considerable economic losses to livelihood of livestock farmers. In spite of this, the biology and parasitic nature of this organism is largely unknown. As a step towards understanding these, we screened the cDNA library of S. digitata and identified an open reading frame that code for parasitic nematode-specific protein, which showed a significant homology to functionally and structurally unannotated sequences of parasitic nematodes Wuchereria bancrofti, Brugia malayi, Onchocerca volvulus, Loa loa etc., suggesting its role in parasitism. RT-PCR analysis indicated that the S. digitata novel gene (SDNP) is expressed in adult female and male, and microfilariae. Southern hybridization studies revealed that this gene is a single-copy gene. Sequence analysis of the genomic region obtained from overlapping PCR amplification indicated that the size of the genomic region is 1819 bp in which four exons encoding 205 amino acids were interrupted by three introns of varying lengths of 419, 659 and 123 bp, and also the expansion of the size of the introns of S. digitata compared to its orthologues by integrating micro and mini-satellite containing sequence. Sequences around the splice junctions were conserved and agreed with the general GT-AG splicing rule. The gene was found to be AT rich with a GC content of 38.1%. Bioinformatic analysis indicated that the gene structure of SDNP and its orthologues is conserved and it expressed ubiqutously in all the stages of nematode's life cycle. Therefore, taking these outcomes together, it can be concluded that SDNP is a parasitic nematode-specific, single copy gene having conserved gene structure of four exons interrupted by three introns and that the gene is expressed ubiquitously throughout nematode's life cycle. PMID:25382479

  17. Quantitation of Human Metallothionein Isoforms: A Family of Small, Highly Conserved, Cysteine-rich Proteins*

    PubMed Central

    Mehus, Aaron A.; Muhonen, Wallace W.; Garrett, Scott H.; Somji, Seema; Sens, Donald A.; Shabb, John B.


    Human metallothioneins (MTs) are important regulators of metal homeostasis and protectors against oxidative damage. Their altered mRNA expression has been correlated with metal toxicity and a variety of cancers. Current immunodetection methods lack the specificity to distinguish all 12 human isoforms. Each, however, can be distinguished by the mass of its acetylated, cysteine-rich, hydrophilic N-terminal tryptic peptides. These properties were exploited to develop a bottom-up MALDI-TOF/TOF-MS-based method for their simultaneous quantitation. Key features included enrichment of N-terminal acetylated peptides by strong cation exchange chromatography, optimization of C18 reversed-phase chromatography, and control of methionine oxidation. Combinations of nine isoforms were identified in seven cell lines and two tissues. Relative quantitation was accomplished by comparing peak intensities of peptides generated from pooled cytosolic proteins alkylated with 14N- or 15N-iodoacetamide. Absolute quantitation was achieved using 15N-iodoacetamide-labeled synthetic peptides as internal standards. The method was applied to the cadmium induction of MTs in human kidney HK-2 epithelial cells expressing recombinant MT-3. Seven isoforms were detected with abundances spanning almost 2 orders of magnitude and inductions up to 12-fold. The protein-to-mRNA ratio for MT-1E was one-tenth that of other MTs, suggesting isoform-specific differences in protein expression efficiency. Differential expression of MT-1G1 and MT-1G2 suggested tissue- and cell-specific alternative splicing for the MT-1G isoform. Protein expression of MT isoforms was also evaluated in human breast epithelial cancer cell lines. Estrogen-receptor-positive cell lines expressed only MT-2 and MT-1X, whereas estrogen-receptor-negative cell lines additionally expressed MT-1E. The combined expression of MT isoforms was 38-fold greater in estrogen-receptor-negative cell lines than in estrogen-receptor-positive cells. These

  18. The conserved proteins CHE-12 and DYF-11 are required for sensory cilium function in Caenorhabditis elegans.


    Bacaj, Taulant; Lu, Yun; Shaham, Shai


    Sensory neuron cilia are evolutionarily conserved dendritic appendages that convert environmental stimuli into neuronal activity. Although several cilia components are known, the functions of many remain uncharacterized. Furthermore, the basis of morphological and functional differences between cilia remains largely unexplored. To understand the molecular basis of cilia morphogenesis and function, we studied the Caenorhabditis elegans mutants che-12 and dyf-11. These mutants fail to concentrate lipophilic dyes from their surroundings in sensory neurons and are chemotaxis defective. In che-12 mutants, sensory neuron cilia lack distal segments, while in dyf-11 animals, medial and distal segments are absent. CHE-12 and DYF-11 are conserved ciliary proteins that function cell-autonomously and are continuously required for maintenance of cilium morphology and function. CHE-12, composed primarily of HEAT repeats, may not be part of the intraflagellar transport (IFT) complex and is not required for the localization of some IFT components. DYF-11 undergoes IFT-like movement and may function at an early stage of IFT-B particle assembly. Intriguingly, while DYF-11 is expressed in all C. elegans ciliated neurons, CHE-12 expression is restricted to some amphid sensory neurons, suggesting a specific role in these neurons. Our results provide insight into general and neuron-specific aspects of cilium development and function. PMID:18245347

  19. Conserved functional antagonism of CELF and MBNL proteins controls stem cell-specific alternative splicing in planarians.


    Solana, Jordi; Irimia, Manuel; Ayoub, Salah; Orejuela, Marta Rodriguez; Zywitza, Vera; Jens, Marvin; Tapial, Javier; Ray, Debashish; Morris, Quaid; Hughes, Timothy R; Blencowe, Benjamin J; Rajewsky, Nikolaus


    In contrast to transcriptional regulation, the function of alternative splicing (AS) in stem cells is poorly understood. In mammals, MBNL proteins negatively regulate an exon program specific of embryonic stem cells; however, little is known about the in vivo significance of this regulation. We studied AS in a powerful in vivo model for stem cell biology, the planarian Schmidtea mediterranea. We discover a conserved AS program comprising hundreds of alternative exons, microexons and introns that is differentially regulated in planarian stem cells, and comprehensively identify its regulators. We show that functional antagonism between CELF and MBNL factors directly controls stem cell-specific AS in planarians, placing the origin of this regulatory mechanism at the base of Bilaterians. Knockdown of CELF or MBNL factors lead to abnormal regenerative capacities by affecting self-renewal and differentiation sets of genes, respectively. These results highlight the importance of AS interactions in stem cell regulation across metazoans. PMID:27502555

  20. Evolutionarily conserved coupling of transcription and alternative splicing in the EPB41 (protein 4.1R) and EPB41L3 (protein 4.1B) genes.


    Tan, Jeff S; Mohandas, Narla; Conboy, John G


    Recent studies have shown that transcription and alternative splicing can be mechanistically coupled. In the EPB41 (protein 4.1R) and EPB41L3 (protein 4.1B) genes, we showed previously that promoter/alternative first exon choice is coupled to downstream splicing events in exon 2. Here we demonstrate that this coupling is conserved among several vertebrate classes from fish to mammals. The EPB41 and EPB41L3 genes from fish, bird, amphibian, and mammal genomes exhibit shared features including alternative first exons and differential splice acceptors in exon 2. In all cases, the 5'-most exon (exon 1A) splices exclusively to a weaker internal acceptor site in exon 2, skipping a fragment designated as exon 2'. Conversely, alternative first exons 1B and 1C always splice to the stronger first acceptor site, retaining exon 2'. These correlations are independent of cell type or species of origin. Since exon 2' contains a translation initiation site, splice variants generate protein isoforms with distinct N-termini. We propose that these genes represent a physiologically relevant model system for mechanistic analysis of transcription-coupled alternative splicing. PMID:16242908

  1. NOA36 Protein Contains a Highly Conserved Nucleolar Localization Signal Capable of Directing Functional Proteins to the Nucleolus, in Mammalian Cells

    PubMed Central

    de Melo, Ivan S.; Jimenez-Nuñez, Maria D.; Iglesias, Concepción; Campos-Caro, Antonio; Moreno-Sanchez, David; Ruiz, Felix A.; Bolívar, Jorge


    NOA36/ZNF330 is an evolutionarily well-preserved protein present in the nucleolus and mitochondria of mammalian cells. We have previously reported that the pro-apoptotic activity of this protein is mediated by a characteristic cysteine-rich domain. We now demonstrate that the nucleolar localization of NOA36 is due to a highly-conserved nucleolar localization signal (NoLS) present in residues 1–33. This NoLS is a sequence containing three clusters of two or three basic amino acids. We fused the amino terminal of NOA36 to eGFP in order to characterize this putative NoLS. We show that a cluster of three lysine residues at positions 3 to 5 within this sequence is critical for the nucleolar localization. We also demonstrate that the sequence as found in human is capable of directing eGFP to the nucleolus in several mammal, fish and insect cells. Moreover, this NoLS is capable of specifically directing the cytosolic yeast enzyme polyphosphatase to the target of the nucleolus of HeLa cells, wherein its enzymatic activity was detected. This NoLS could therefore serve as a very useful tool as a nucleolar marker and for directing particular proteins to the nucleolus in distant animal species. PMID:23516598

  2. Rewiring yeast sugar transporter preference through modifying a conserved protein motif

    PubMed Central

    Young, Eric M.; Tong, Alice; Bui, Hang; Spofford, Caitlin; Alper, Hal S.


    Utilization of exogenous sugars found in lignocellulosic biomass hydrolysates, such as xylose, must be improved before yeast can serve as an efficient biofuel and biochemical production platform. In particular, the first step in this process, the molecular transport of xylose into the cell, can serve as a significant flux bottleneck and is highly inhibited by other sugars. Here we demonstrate that sugar transport preference and kinetics can be rewired through the programming of a sequence motif of the general form G-G/F-XXX-G found in the first transmembrane span. By evaluating 46 different heterologously expressed transporters, we find that this motif is conserved among functional transporters and highly enriched in transporters that confer growth on xylose. Through saturation mutagenesis and subsequent rational mutagenesis, four transporter mutants unable to confer growth on glucose but able to sustain growth on xylose were engineered. Specifically, Candida intermedia gxs1 Phe38Ile39Met40, Scheffersomyces stipitis rgt2 Phe38 and Met40, and Saccharomyces cerevisiae hxt7 Ile39Met40Met340 all exhibit this phenotype. In these cases, primary hexose transporters were rewired into xylose transporters. These xylose transporters nevertheless remained inhibited by glucose. Furthermore, in the course of identifying this motif, novel wild-type transporters with superior monosaccharide growth profiles were discovered, namely S. stipitis RGT2 and Debaryomyces hansenii 2D01474. These findings build toward the engineering of efficient pentose utilization in yeast and provide a blueprint for reprogramming transporter properties. PMID:24344268

  3. An evolutionarily conserved protein CHORD regulates scaling of dendritic arbors with body size

    PubMed Central

    Shimono, Kohei; Fujishima, Kazuto; Nomura, Takafumi; Ohashi, Masayoshi; Usui, Tadao; Kengaku, Mineko; Toyoda, Atsushi; Uemura, Tadashi


    Most organs scale proportionally with body size through regulation of individual cell size and/or cell number. Here we addressed how postmitotic and morphologically complex cells such as neurons scale with the body size by using the dendritic arbor of one Drosophila sensory neuron as an assay system. In small adults eclosed under a limited-nutrition condition, the wild-type neuron preserved the branching complexity of the arbor, but scaled down the entire arbor, making a “miniature”. In contrast, mutant neurons for the Insulin/IGF signaling (IIS) or TORC1 pathway exhibited “undergrowth”, which was characterized by decreases in both the branching complexity and the arbor size, despite a normal diet. These contrasting phenotypes hinted that a novel regulatory mechanism contributes to the dendritic scaling in wild-type neurons. Indeed, we isolated a mutation in the gene CHORD/morgana that uncoupled the neuron size and the body size: CHORD mutant neurons generated miniature dendritic arbors regardless of the body size. CHORD encodes an evolutionarily conserved co-chaperone of HSP90. Our results support the notion that dendritic growth and branching are controlled by partly separate mechanisms. The IIS/TORC1 pathways control both growth and branching to avert underdevelopment, whereas CHORD together with TORC2 realizes proportional scaling of the entire arbor. PMID:24643112

  4. The highly conserved MraZ protein is a transcriptional regulator in Escherichia coli

    SciTech Connect

    Eraso, Jesus M.; Markillie, Lye Meng; Mitchell, Hugh D.; Taylor, Ronald C.; Orr, Galya; Margolin, William


    The mraZ and mraW genes are highly conserved in bacteria, both in sequence and location at the head of the division and cell wall (dcw) gene cluster. Although MraZ has structural similarity to the AbrB transition state regulator and the MazE antitoxin, and MraW is known to methylate ribosomal RNA, mraZ and mraW null mutants have no detectable growth phenotype in any species tested to date, hampering progress in understanding their physiological role. Here we show that overproduction of Escherichia coli MraZ perturbs cell division and the cell envelope, is more lethal at high levels or in minimal growth medium, and that MraW antagonizes these effects. MraZGFP localizes to the nucleoid, suggesting that it binds DNA. Indeed, purified MraZ directly binds a region upstream from its own promoter containing three direct repeats to regulate its own expression and that of downstream cell division and cell wall genes. MraZ-LacZ fusions are repressed by excess MraZ but not when DNA binding by MraZ is inhibited. RNAseq analysis indicates that MraZ is a global transcriptional regulator with numerous targets in addition to dcw genes. One of these targets, mioC, is directly bound by MraZ in a region with three direct repeats.

  5. Rewiring yeast sugar transporter preference through modifying a conserved protein motif.


    Young, Eric M; Tong, Alice; Bui, Hang; Spofford, Caitlin; Alper, Hal S


    Utilization of exogenous sugars found in lignocellulosic biomass hydrolysates, such as xylose, must be improved before yeast can serve as an efficient biofuel and biochemical production platform. In particular, the first step in this process, the molecular transport of xylose into the cell, can serve as a significant flux bottleneck and is highly inhibited by other sugars. Here we demonstrate that sugar transport preference and kinetics can be rewired through the programming of a sequence motif of the general form G-G/F-XXX-G found in the first transmembrane span. By evaluating 46 different heterologously expressed transporters, we find that this motif is conserved among functional transporters and highly enriched in transporters that confer growth on xylose. Through saturation mutagenesis and subsequent rational mutagenesis, four transporter mutants unable to confer growth on glucose but able to sustain growth on xylose were engineered. Specifically, Candida intermedia gxs1 Phe(38)Ile(39)Met(40), Scheffersomyces stipitis rgt2 Phe(38) and Met(40), and Saccharomyces cerevisiae hxt7 Ile(39)Met(40)Met(340) all exhibit this phenotype. In these cases, primary hexose transporters were rewired into xylose transporters. These xylose transporters nevertheless remained inhibited by glucose. Furthermore, in the course of identifying this motif, novel wild-type transporters with superior monosaccharide growth profiles were discovered, namely S. stipitis RGT2 and Debaryomyces hansenii 2D01474. These findings build toward the engineering of efficient pentose utilization in yeast and provide a blueprint for reprogramming transporter properties. PMID:24344268

  6. The Eps1p Protein Disulfide Isomerase Conserves Classic Thioredoxin Superfamily Amino Acid Motifs but Not Their Functional Geometries

    PubMed Central

    Biran, Shai; Gat, Yair; Fass, Deborah


    The widespread thioredoxin superfamily enzymes typically share the following features: a characteristic α-β fold, the presence of a Cys-X-X-Cys (or Cys-X-X-Ser) redox-active motif, and a proline in the cis configuration abutting the redox-active site in the tertiary structure. The Cys-X-X-Cys motif is at the solvent-exposed amino terminus of an α-helix, allowing the first cysteine to engage in nucleophilic attack on substrates, or substrates to attack the Cys-X-X-Cys disulfide, depending on whether the enzyme functions to reduce, isomerize, or oxidize its targets. We report here the X-ray crystal structure of an enzyme that breaks many of our assumptions regarding the sequence-structure relationship of thioredoxin superfamily proteins. The yeast Protein Disulfide Isomerase family member Eps1p has Cys-X-X-Cys motifs and proline residues at the appropriate primary structural positions in its first two predicted thioredoxin-fold domains. However, crystal structures show that the Cys-X-X-Cys of the second domain is buried and that the adjacent proline is in the trans, rather than the cis isomer. In these configurations, neither the “active-site” disulfide nor the backbone carbonyl preceding the proline is available to interact with substrate. The Eps1p structures thus expand the documented diversity of the PDI oxidoreductase family and demonstrate that conserved sequence motifs in common folds do not guarantee structural or functional conservation. PMID:25437863

  7. Conserved synteny at the protein family level reveals genes underlying Shewanella species cold tolerance and predicts their novel phenotypes

    SciTech Connect

    Karpinets, Tatiana V.; Obraztsova, Anna; Wang, Yanbing; Schmoyer, Denise D.; Kora, Guruprasad; Park, Byung H.; Serres, Margrethe H.; Romine, Margaret F.; Land, Miriam L.; Kothe, Terence B.; Fredrickson, Jim K.; Nealson, Kenneth H.; Uberbacher, Edward


    Bacteria of the genus Shewanella can thrive in different environments and demonstrate significant variability in their metabolic and ecophysiological capabilities including cold and salt tolerance. Genomic characteristics underlying this variability across species are largely unknown. In this study we address the problem by a comparison of the physiological, metabolic and genomic characteristics of 19 sequenced Shewanella species. We have employed two novel approaches based on association of a phenotypic trait with the number of the trait-specific protein families (Pfam domains) and on the conservation of synteny (order in the genome) of the trait-related genes. Our first approach is top-down and involves experimental evaluation and quantification of the species’ cold tolerance followed by identification of the correlated Pfam domains and genes with a conserved synteny. The second, a bottom-up approach, predicts novel phenotypes of the species by calculating profiles of each Pfam domain among their genomes and following pair-wise correlation of the profiles and their network clustering. Using the first approach we find a link between cold and salt tolerance of the species and the presence in the genome of a Na+/H+ antiporter gene cluster. Other cold tolerance related genes includes peptidases, chemotaxis sensory transducer proteins, a cysteine exporter, and helicases. Using the bottom-up approach we found several novel phenotypes in the newly sequenced Shewanella species, including degradation of aromatic compounds by an aerobic hybrid pathway in S. woodyi, degradation of ethanolamine by S. benthica, and propanediol degradation by S. putrefaciens CN32 and S. sp. W3-18-1.

  8. A conserved salt bridge in the G loop of multiple protein kinases is important for catalysis and for in vivo Lyn function.


    Barouch-Bentov, Rina; Che, Jianwei; Lee, Christian C; Yang, Yating; Herman, Ann; Jia, Yong; Velentza, Anastasia; Watson, James; Sternberg, Luise; Kim, Sunjun; Ziaee, Niusha; Miller, Andrew; Jackson, Carie; Fujimoto, Manabu; Young, Mike; Batalov, Serge; Liu, Yi; Warmuth, Markus; Wiltshire, Tim; Cooke, Michael P; Sauer, Karsten


    The glycine-rich G loop controls ATP binding and phosphate transfer in protein kinases. Here we show that the functions of Src family and Abl protein tyrosine kinases require an electrostatic interaction between oppositely charged amino acids within their G loops that is conserved in multiple other phylogenetically distinct protein kinases, from plants to humans. By limiting G loop flexibility, it controls ATP binding, catalysis, and inhibition by ATP-competitive compounds such as Imatinib. In WeeB mice, mutational disruption of the interaction results in expression of a Lyn protein with reduced catalytic activity, and in perturbed B cell receptor signaling. Like Lyn(-/-) mice, WeeB mice show profound defects in B cell development and function and succumb to autoimmune glomerulonephritis. This demonstrates the physiological importance of the conserved G loop salt bridge and at the same time distinguishes the in vivo requirement for the Lyn kinase activity from other potential functions of the protein. PMID:19150426

  9. Phylogenetic conservation and homology modeling help reveal a novel domain within the budding yeast heterochromatin protein Sir1.


    Hou, Zhonggang; Danzer, John R; Mendoza, Liza; Bose, Melissa E; Müller, Ulrika; Williams, Barry; Fox, Catherine A


    The yeast Sir1 protein's ability to bind and silence the cryptic mating-type locus HMRa requires a protein-protein interaction between Sir1 and the origin recognition complex (ORC). A domain within the C-terminal half of Sir1, the Sir1 ORC interaction region (Sir1OIR), and the conserved bromo-adjacent homology (BAH) domain within Orc1, the largest subunit of ORC, mediate this interaction. The structure of the Sir1OIR-Orc1BAH complex is known. Sir1OIR and Orc1BAH interacted with a high affinity in vitro, but the Sir1OIR did not inhibit Sir1-dependent silencing when overproduced in vivo, suggesting that other regions of Sir1 helped it bind HMRa. Comparisons of diverged Sir1 proteins revealed two highly conserved regions, N1 and N2, within Sir1's poorly characterized N-terminal half. An N-terminal portion of Sir1 (residues 27 to 149 [Sir1(27-149)]) is similar in sequence to the Sir1OIR; homology modeling predicted a structure for Sir1(27-149) in which N1 formed a submodule similar to the known Orc1BAH-interacting surface on Sir1. Consistent with these findings, two-hybrid assays indicated that the Sir1 N terminus could interact with BAH domains. Amino acid substitutions within or near N1 or N2 reduced full-length Sir1's ability to bind and silence HMRa and to interact with Orc1BAH in a two-hybrid assay. Purified recombinant Sir1 formed a large protease-resistant structure within which the Sir1OIR domain was protected, and Orc1BAH bound Sir1OIR more efficiently than full-length Sir1 in vitro. Thus, the Sir1 N terminus exhibited both positive and negative roles in the formation of a Sir1-ORC silencing complex. This functional duality might contribute to Sir1's selectivity for silencer-bound ORCs in vivo. PMID:19029247

  10. Characterization of Protective Epitopes in a Highly Conserved Plasmodium falciparum Antigenic Protein Containing Repeats of Acidic and Basic Residues

    PubMed Central

    Sharma, Pawan; Kumar, Anil; Singh, Balwan; Bharadwaj, Ashima; Sailaja, V. Naga; Adak, T.; Kushwaha, Ashima; Malhotra, Pawan; Chauhan, V. S.


    The delineation of putatively protective and immunogenic epitopes in vaccine candidate proteins constitutes a major research effort towards the development of an effective malaria vaccine. By virtue of its role in the formation of the immune clusters of merozoites, its location on the surface of merozoites, and its highly conserved nature both at the nucleotide sequence level and the amino acid sequence level, the antigen which contains repeats of acidic and basic residues (ABRA) of the human malaria parasite Plasmodium falciparum represents such an antigen. Based upon the predicted amino acid sequence of ABRA, we synthesized eight peptides, with six of these (AB-1 to AB-6) ranging from 12 to 18 residues covering the most hydrophilic regions of the protein, and two more peptides (AB-7 and AB-8) representing its repetitive sequences. We found that all eight constructs bound an appreciable amount of antibody in sera from a large proportion of P. falciparum malaria patients; two of these peptides (AB-1 and AB-3) also elicited a strong proliferation response in peripheral blood mononuclear cells from all 11 human subjects recovering from malaria. When used as carrier-free immunogens, six peptides induced a strong, boostable, immunoglobulin G-type antibody response in rabbits, indicating the presence of both B-cell determinants and T-helper-cell epitopes in these six constructs. These antibodies specifically cross-reacted with the parasite protein(s) in an immunoblot and in an immunofluorescence assay. In another immunoblot, rabbit antipeptide sera also recognized recombinant fragments of ABRA expressed in bacteria. More significantly, rabbit antibodies against two constructs (AB-1 and AB-5) inhibited the merozoite reinvasion of human erythrocytes in vitro up to ∼90%. These results favor further studies so as to determine possible inclusion of these two constructs in a multicomponent subunit vaccine against asexual blood stages of P. falciparum. PMID:9596765

  11. Sip1, a Conserved AP-1 Accessory Protein, Is Important for Golgi/Endosome Trafficking in Fission Yeast

    PubMed Central

    Yu, Yang; Kita, Ayako; Udo, Masako; Katayama, Yuta; Shintani, Mami; Park, Kwihwa; Hagihara, Kanako; Umeda, Nanae; Sugiura, Reiko


    We had previously identified the mutant allele of apm1+ that encodes a homolog of the mammalian μ 1A subunit of the clathrin-associated adaptor protein-1 (AP-1) complex and demonstrated that the AP-1 complex plays a role in Golgi/endosome trafficking, secretion, and vacuole fusion in fission yeast. Here, we isolated a mutant allele of its4+/sip1+, which encodes a conserved AP-1 accessory protein. The its4-1/sip1-i4 mutants and apm1-deletion cells exhibited similar phenotypes, including sensitivity to the calcineurin inhibitor FK506, Cl− and valproic acid as well as various defects in Golgi/endosomal trafficking and cytokinesis. Electron micrographs of sip1-i4 mutants revealed vacuole fragmentation and accumulation of abnormal Golgi-like structures and secretory vesicles. Overexpression of Apm1 suppressed defective membrane trafficking in sip1-i4 mutants. The Sip1-green fluorescent protein (GFP) co-localized with Apm1-mCherry at Golgi/endosomes, and Sip1 physically interacted with each subunit of the AP-1 complex. We found that Sip1 was a Golgi/endosomal protein and the sip1-i4 mutation affected AP-1 localization at Golgi/endosomes, thus indicating that Sip1 recruited the AP-1 complex to endosomal membranes by physically interacting with each subunit of this complex. Furthermore, Sip1 is required for the correct localization of Bgs1/Cps1, 1,3-β-D-glucan synthase to polarized growth sites. Consistently, the sip1-i4 mutants displayed a severe sensitivity to micafungin, a potent inhibitor of 1,3-β-D-glucan synthase. Taken together, our findings reveal a role for Sip1 in the regulation of Golgi/endosome trafficking in coordination with the AP-1 complex, and identified Bgs1, required for cell wall synthesis, as the new cargo of AP-1-dependent trafficking. PMID:23028933

  12. Identification of microtubule growth deceleration and its regulation by conserved and novel proteins.


    Lacroix, Benjamin; Ryan, Joël; Dumont, Julien; Maddox, Paul S; Maddox, Amy S


    Microtubules (MTs) are cytoskeletal polymers that participate in diverse cellular functions, including cell division, intracellular trafficking, and templating of cilia and flagella. MTs undergo dynamic instability, alternating between growth and shortening via catastrophe and rescue events. The rates and frequencies of MT dynamic parameters appear to be characteristic for a given cell type. We recently reported that all MT dynamic parameters vary throughout differentiation of a smooth muscle cell type in intact Caenorhabditis elegans. Here we describe local differences in MT dynamics and a novel MT behavior: an abrupt change in growth rate (deceleration) of single MTs occurring in the cell periphery of these cells. MT deceleration occurs where there is a decrease in local soluble tubulin concentration at the cell periphery. This local regulation of tubulin concentration and MT deceleration are dependent on two novel homologues of human cylicin. These novel ORFs, which we name cylc-1 and -2, share sequence homology with stathmins and encode small, very basic proteins containing several KKD/E repeats. The TOG domain-containing protein ZYG-9(TOGp) is responsible for the faster polymerization rate within the cell body. Thus we have defined two contributors to the molecular regulation for this novel MT behavior. PMID:26985017

  13. Linkage Groups of Protein-Coding Genes in Western Palearctic Water Frogs Reveal Extensive Evolutionary Conservation

    PubMed Central

    Hotz, H.; Uzzell, T.; Berger, L.


    Among progeny of a hybrid (Rana shqiperica X R. lessonae) X R. lessonae, 14 of 22 loci form four linkage groups (LGs): (1) mitochondrial aspartate aminotransferase, carbonate dehydratase-2, esterase 4, peptidase D; (2) mannosephosphate isomerase, lactate dehydrogenase-B, sex, hexokinase-1, peptidase B; (3) albumin, fructose-biphosphatase-1, guanine deaminase; (4) mitochondrial superoxide dismutase, cytosolic malic enzyme, xanthine oxidase. Fructose-biphosphate aldolase-2 and cytosolic aspartate aminotransferase possibly form a fifth LG. Mitochondrial aconitate hydratase, α-glucosidase, glyceraldehyde-3-phosphate dehydrogenase, phosphogluconate dehydrogenase, and phosphoglucomutase-2 are unlinked to other loci. All testable linkages (among eight loci of LGs 1, 2, 3, and 4) are shared with eastern Palearctic water frogs. Including published data, 44 protein loci can be assigned to 10 of the 13 chromosomes in Holarctic Rana. Of testable pairs among 18 protein loci, agreement between Palearctic and Nearctic Rana is complete (125 unlinked, 14 linked pairs among 14 loci of five syntenies), and Holarctic Rana and Xenopus laevis are highly concordant (125 shared nonlinkages, 13 shared linkages, three differences). Several Rana syntenies occur in mammals and fish. Many syntenies apparently have persisted for 60-140 X 10(6) years (frogs), some even for 350-400 X 10(6) years (mammals and teleosts). PMID:9286685

  14. Diverse high-torque bacterial flagellar motors assemble wider stator rings using a conserved protein scaffold.


    Beeby, Morgan; Ribardo, Deborah A; Brennan, Caitlin A; Ruby, Edward G; Jensen, Grant J; Hendrixson, David R


    Although it is known that diverse bacterial flagellar motors produce different torques, the mechanism underlying torque variation is unknown. To understand this difference better, we combined genetic analyses with electron cryo-tomography subtomogram averaging to determine in situ structures of flagellar motors that produce different torques, from Campylobacter and Vibrio species. For the first time, to our knowledge, our results unambiguously locate the torque-generating stator complexes and show that diverse high-torque motors use variants of an ancestrally related family of structures to scaffold incorporation of additional stator complexes at wider radii from the axial driveshaft than in the model enteric motor. We identify the protein components of these additional scaffold structures and elucidate their sequential assembly, demonstrating that they are required for stator-complex incorporation. These proteins are widespread, suggesting that different bacteria have tailored torques to specific environments by scaffolding alternative stator placement and number. Our results quantitatively account for different motor torques, complete the assignment of the locations of the major flagellar components, and provide crucial constraints for understanding mechanisms of torque generation and the evolution of multiprotein complexes. PMID:26976588

  15. An evolutionarily conserved autoinhibitory molecular switch in ELMO proteins regulates Rac signaling.


    Patel, Manishha; Margaron, Yoran; Fradet, Nadine; Yang, Qi; Wilkes, Brian; Bouvier, Michel; Hofmann, Kay; Côté, Jean-François


    Dedicator of cytokinesis (DOCK) proteins are guanine nucleotide exchange factors (GEFs) controlling the activity of Rac1/Cdc42 during migration, phagocytosis, and myoblast fusion [1-4]. Engulfment and cell motility (ELMO) proteins bind a subset of DOCK members and are emerging as critical regulators of Rac signaling [5-10]. Although formation of a DOCK180/ELMO complex is not essential for Rac1 activation, ELMO mutants deficient in binding to DOCK180 are unable to promote cytoskeleton remodeling [11]. How ELMO regulates signaling through DOCK GEFs is poorly understood. Here, we identify an autoinhibitory switch in ELMO presenting homology to a regulatory unit described for Dia formins. One part of the switch, composed of a Ras-binding domain (RBD) and Armadillo repeats, is positioned N-terminally while the other is housed in the C terminus. We demonstrate interaction between these fragments, suggesting autoinhibition of ELMO. Using a bioluminescence resonance energy transfer biosensor, we establish that ELMO undergoes conformational changes upon disruption of autoinhibition. We found that engagement of ELMO to RhoG, or with DOCK180, promotes the relief of autoinhibition in ELMO. Functionally, we found that ELMO mutants with impaired autoregulatory activity promote cell elongation. These results demonstrate an unsuspected level of regulation for Rac1 signaling via autoinhibition of ELMO. PMID:21035343

  16. Identification of microtubule growth deceleration and its regulation by conserved and novel proteins

    PubMed Central

    Lacroix, Benjamin; Ryan, Joël; Dumont, Julien; Maddox, Paul S.; Maddox, Amy S.


    Microtubules (MTs) are cytoskeletal polymers that participate in diverse cellular functions, including cell division, intracellular trafficking, and templating of cilia and flagella. MTs undergo dynamic instability, alternating between growth and shortening via catastrophe and rescue events. The rates and frequencies of MT dynamic parameters appear to be characteristic for a given cell type. We recently reported that all MT dynamic parameters vary throughout differentiation of a smooth muscle cell type in intact Caenorhabditis elegans. Here we describe local differences in MT dynamics and a novel MT behavior: an abrupt change in growth rate (deceleration) of single MTs occurring in the cell periphery of these cells. MT deceleration occurs where there is a decrease in local soluble tubulin concentration at the cell periphery. This local regulation of tubulin concentration and MT deceleration are dependent on two novel homologues of human cylicin. These novel ORFs, which we name cylc-1 and -2, share sequence homology with stathmins and encode small, very basic proteins containing several KKD/E repeats. The TOG domain–containing protein ZYG-9TOGp is responsible for the faster polymerization rate within the cell body. Thus we have defined two contributors to the molecular regulation for this novel MT behavior. PMID:26985017

  17. Diverse high-torque bacterial flagellar motors assemble wider stator rings using a conserved protein scaffold

    PubMed Central

    Ribardo, Deborah A.; Brennan, Caitlin A.; Ruby, Edward G.; Jensen, Grant J.; Hendrixson, David R.


    Although it is known that diverse bacterial flagellar motors produce different torques, the mechanism underlying torque variation is unknown. To understand this difference better, we combined genetic analyses with electron cryo-tomography subtomogram averaging to determine in situ structures of flagellar motors that produce different torques, from Campylobacter and Vibrio species. For the first time, to our knowledge, our results unambiguously locate the torque-generating stator complexes and show that diverse high-torque motors use variants of an ancestrally related family of structures to scaffold incorporation of additional stator complexes at wider radii from the axial driveshaft than in the model enteric motor. We identify the protein components of these additional scaffold structures and elucidate their sequential assembly, demonstrating that they are required for stator-complex incorporation. These proteins are widespread, suggesting that different bacteria have tailored torques to specific environments by scaffolding alternative stator placement and number. Our results quantitatively account for different motor torques, complete the assignment of the locations of the major flagellar components, and provide crucial constraints for understanding mechanisms of torque generation and the evolution of multiprotein complexes. PMID:26976588

  18. Protein engineering of selected residues from conserved sequence regions of a novel Anoxybacillus α-amylase.


    Ranjani, Velayudhan; Janeček, Stefan; Chai, Kian Piaw; Shahir, Shafinaz; Abdul Rahman, Raja Noor Zaliha Raja; Chan, Kok-Gan; Goh, Kian Mau


    The α-amylases from Anoxybacillus species (ASKA and ADTA), Bacillus aquimaris (BaqA) and Geobacillus thermoleovorans (GTA, Pizzo and GtamyII) were proposed as a novel group of the α-amylase family GH13. An ASKA yielding a high percentage of maltose upon its reaction on starch was chosen as a model to study the residues responsible for the biochemical properties. Four residues from conserved sequence regions (CSRs) were thus selected, and the mutants F113V (CSR-I), Y187F and L189I (CSR-II) and A161D (CSR-V) were characterised. Few changes in the optimum reaction temperature and pH were observed for all mutants. Whereas the Y187F (t1/2 43 h) and L189I (t1/2 36 h) mutants had a lower thermostability at 65°C than the native ASKA (t1/2 48 h), the mutants F113V and A161D exhibited an improved t1/2 of 51 h and 53 h, respectively. Among the mutants, only the A161D had a specific activity, k(cat) and k(cat)/K(m) higher (1.23-, 1.17- and 2.88-times, respectively) than the values determined for the ASKA. The replacement of the Ala-161 in the CSR-V with an aspartic acid also caused a significant reduction in the ratio of maltose formed. This finding suggests the Ala-161 may contribute to the high maltose production of the ASKA. PMID:25069018

  19. Activation and assembly of the inflammasomes through conserved protein domain families

    PubMed Central


    Inflammasomes are oligomeric protein complexes assembled through interactions among the death domain superfamily members, in particular the CARD and PYD domains. Recent progress has shed lights on how the ASC PYD can polymerize to form filaments using multiple domain:domain interfaces, and how the caspase4 CARD can recognize LPS to activate the non-classical inflammasome pathway. Comprehensive understanding of the molecular mechanisms of inflammasome activation and assembly require more extensive structural and biophysical dissection of the inflammasome components and complexes, in particular additional CARD or PYD filaments. Because of the variations in death domain structures and complexes observed so far, future work will undoubtedly shed lights on the mechanisms of inflammasome assembly as well as more surprises on the versatile structure and function of the death domain superfamily. PMID:25398536

  20. Simian immunodeficiency virus (mac 251-32H) transmembrane protein sequence remains conserved throughout the course of infection in macaques.


    Slade, A; Jones, S; Almond, N; Kitchin, P


    Two cynomolgus macaques were infected with a genetically complex challenge stock of simian immunodeficiency virus (SIVmac251-32H). The polymerase chain reaction (PCR) was used to amplify the env gp41, rev, and nef overlapping coding sequences from provirus present in the blood of both animals at 1, 6, and 15 months post infection (p.i.). The predominant, env sequences found in both animals at the three time points were very similar to that found in the original 11/88 challenge stock. The functionally important hydrophobic fusion and membrane-spanning domains within gp41 remained conserved throughout the course of infection. Nucleotide variation within the region corresponding to the REV response element (RRE) was limited to four positions, none of which were predicted to cause any significant disruption to the secondary structure of the RRE. Very little genetic variation was observed in and around the cluster of potential glycosylation sites of the external portion of gp41. However, the existence of a previously assigned variable region elsewhere in the cytoplasmic domain of gp41 was confirmed. The three gene loci (env, rev, and nef) examined varied independently. All changes in the predominant protein sequences were brought about by single nucleotide substitutions only. After 15 months of infection with SIV, 1 animal was sick from SIV-induced disease whereas the other remained healthy. In-frame stop codons within the transmembrane protein occurred with a much greater frequency in the healthy animal. PMID:8457380

  1. Recombinant Envelope-Proteins with Mutations in the Conserved Fusion Loop Allow Specific Serological Diagnosis of Dengue-Infections.


    Rockstroh, Alexandra; Barzon, Luisa; Pacenti, Monia; Palù, Giorgio; Niedrig, Matthias; Ulbert, Sebastian


    Dengue virus (DENV) is a mosquito-borne flavivirus and a major international public health concern in many tropical and sub-tropical areas worldwide. DENV is divided into four major serotypes, and infection with one serotype leads to immunity against the same, but not the other serotypes. The specific diagnosis of DENV-infections via antibody-detection is problematic due to the high degree of cross-reactivity displayed by antibodies against related flaviviruses, such as West Nile virus (WNV), Yellow Fever virus (YFV) or Tick-borne encephalitis virus (TBEV). Especially in areas where several flaviviruses co-circulate or in the context of vaccination e.g. against YFV or TBEV, this severely complicates diagnosis and surveillance. Most flavivirus cross-reactive antibodies are produced against the highly conserved fusion loop (FL) domain in the viral envelope (E) protein. We generated insect-cell derived recombinant E-proteins of the four DENV-serotypes which contain point mutations in the FL domain. By using specific mixtures of these mutant antigens, cross-reactivity against heterologous flaviviruses was strongly reduced, enabling sensitive and specific diagnosis of the DENV-infected serum samples in IgG and IgM-measurements. These results have indications for the development of serological DENV-tests with improved specificity. PMID:26565964

  2. Recombinant Envelope-Proteins with Mutations in the Conserved Fusion Loop Allow Specific Serological Diagnosis of Dengue-Infections

    PubMed Central

    Rockstroh, Alexandra; Barzon, Luisa; Pacenti, Monia; Palù, Giorgio; Niedrig, Matthias; Ulbert, Sebastian


    Dengue virus (DENV) is a mosquito-borne flavivirus and a major international public health concern in many tropical and sub-tropical areas worldwide. DENV is divided into four major serotypes, and infection with one serotype leads to immunity against the same, but not the other serotypes. The specific diagnosis of DENV-infections via antibody-detection is problematic due to the high degree of cross-reactivity displayed by antibodies against related flaviviruses, such as West Nile virus (WNV), Yellow Fever virus (YFV) or Tick-borne encephalitis virus (TBEV). Especially in areas where several flaviviruses co-circulate or in the context of vaccination e.g. against YFV or TBEV, this severely complicates diagnosis and surveillance. Most flavivirus cross-reactive antibodies are produced against the highly conserved fusion loop (FL) domain in the viral envelope (E) protein. We generated insect-cell derived recombinant E-proteins of the four DENV-serotypes which contain point mutations in the FL domain. By using specific mixtures of these mutant antigens, cross-reactivity against heterologous flaviviruses was strongly reduced, enabling sensitive and specific diagnosis of the DENV-infected serum samples in IgG and IgM-measurements. These results have indications for the development of serological DENV-tests with improved specificity. PMID:26565964

  3. A conserved flagella-associated protein in Chlamydomonas, FAP234, is essential for axonemal localization of tubulin polyglutamylase TTLL9.


    Kubo, Tomohiro; Yanagisawa, Haru-aki; Liu, Zhongmei; Shibuya, Rie; Hirono, Masafumi; Kamiya, Ritsu


    Tubulin undergoes various posttranslational modifications, including polyglutamylation, which is catalyzed by enzymes belonging to the tubulin tyrosine ligase-like protein (TTLL) family. A previously isolated Chlamydomonas reinhardtii mutant, tpg1, carries a mutation in a gene encoding a homologue of mammalian TTLL9 and displays lowered motility because of decreased polyglutamylation of axonemal tubulin. Here we identify a novel tpg1-like mutant, tpg2, which carries a mutation in the gene encoding FAP234, a flagella-associated protein of unknown function. Immunoprecipitation and sucrose density gradient centrifugation experiments show that FAP234 and TTLL9 form a complex. The mutant tpg1 retains FAP234 in the cell body and flagellar matrix but lacks it in the axoneme. In contrast, tpg2 lacks both TTLL9 and FAP234 in all fractions. In fla10, a temperature-sensitive mutant deficient in intraflagellar transport (IFT), both TTLL9 and FAP234 are lost from the flagellum at nonpermissive temperatures. These and other results suggest that FAP234 functions in stabilization and IFT-dependent transport of TTLL9. Both TTLL9 and FAP234 are conserved in most ciliated organisms. We propose that they constitute a polyglutamylation complex specialized for regulation of ciliary motility. PMID:24196831

  4. The clot gene of Drosophila melanogaster encodes a conserved member of the thioredoxin-like protein superfamily.


    Giordano, E; Peluso, I; Rendina, R; Digilio, A; Furia, M


    The conversion of pyruvoyl-H(4)-pterin to pyrimidodiazepine (PDA), which is an essential step in the biosynthesis of the red components of Drosophila eye pigments known as drosopterins, requires the products of the genes sepia and clot. While the product of sepia has been shown to correspond to the enzyme PDA-synthase, the role of clot remains unknown, although the clot(1) allele was one of the first eye-color mutants to be isolated in Drosophila melanogaster,and much genetic and biochemical data has become available since. Here we report the cloning of the clot gene, describe its molecular organization and characterize the sequence alterations associated with the alleles cl(1) and cl(2). The coding properties of the gene show that it encodes a protein related to the Glutaredoxin class of the Thioredoxin-like enzyme superfamily, conserved members of which are found in human, mouse and plants. We suggest that the Clot protein is an essential component of a glutathione redox system required for the final step in the biosynthetic pathway for drosopterins. PMID:12589444

  5. Cytoplasmic protein binding to highly conserved sequences in the 3' untranslated region of mouse protamine 2 mRNA, a translationally regulated transcript of male germ cells.


    Kwon, Y K; Hecht, N B


    The expression of the protamines, the predominant nuclear proteins of mammalian spermatozoa, is regulated translationally during male germ-cell development. The 3' untranslated region (UTR) of protamine 1 mRNA has been reported to control its time of translation. To understand the mechanisms controlling translation of the protamine mRNAs, we have sought to identify cis elements of the 3' UTR of protamine 2 mRNA that are recognized by cytoplasmic factors. From gel retardation assays, two sequence elements are shown to form specific RNA-protein complexes. Protein binding sites of the two complexes were determined by RNase T1 mapping, by blocking the putative binding sites with antisense oligonucleotides, and by competition assays. The sequences of these elements, located between nucleotides + 537 and + 572 in protamine 2 mRNA, are highly conserved among postmeiotic translationally regulated nuclear proteins of the mammalian testis. Two closely linked protein binding sites were detected. UV-crosslinking studies revealed that a protein of about 18 kDa binds to one of the conserved sequences. These data demonstrate specific protein binding to a highly conserved 3' UTR of translationally regulated testicular mRNA. PMID:2023906

  6. UK114, a YjgF/Yer057p/UK114 family protein highly conserved from bacteria to mammals, is localized in rat liver peroxisomes

    SciTech Connect

    Antonenkov, Vasily D. . E-mail:; Ohlmeier, Steffen; Sormunen, Raija T.; Hiltunen, J. Kalervo


    Mammalian UK114 belongs to a highly conserved family of proteins with unknown functions. Although it is believed that UK114 is a cytosolic or mitochondrial protein there is no detailed study of its intracellular localization. Using analytical subcellular fractionation, electron microscopic colloidal gold technique, and two-dimensional gel electrophoresis of peroxisomal matrix proteins combined with mass spectrometric analysis we show here that a large portion of UK114 is present in rat liver peroxisomes. The peroxisomal UK114 is a soluble matrix protein and it is not inducible by the peroxisomal proliferator clofibrate. The data predict involvement of UK114 in peroxisomal metabolism.

  7. Conserved distal promoter of the agouti signaling protein (ASIP) gene controls sexual dichromatism in chickens.


    Oribe, Eri; Fukao, Ayaka; Yoshihara, Chihiro; Mendori, Misa; Rosal, Karen G; Takahashi, Sumio; Takeuchi, Sakae


    Brilliant plumage is typical of male birds, thus sexual plumage dichromatism is seen in many avian species; however, the molecular mechanism underlying this remains unclear. The agouti signaling protein (ASIP) is a paracrine factor that stimulates yellow/red pigment (pheomelanin) synthesis and inhibits black/brown pigment (eumelanin) synthesis in follicular melanocytes. In mammals, the distal promoter of the ASIP gene acts exclusively on the ventral side of the body to create a countershading pigmentation pattern by stimulating pheomelanin synthesis in the ventrum. Here, we examined the role of the distal ASIP promoter in controlling estrogen-dependent sexual dichromatism in chickens. Reverse-transcription polymerase chain reaction analyses revealed that ASIP class 1 mRNAs transcribed by the distal promoter were expressed exclusively on the ventral side of chicks and adult females displaying countershading. In showy adult males, the ASIP class 1 mRNAs were expressed in gold-colored ornamental feathers grown on the back. In the presence of estrogen, males molted into female-like plumage and ASIP class 1 mRNAs expression was altered to female patterns. These results suggest that the distal ASIP promoter produces countershading in chicks and adult females, similar to the ventral-specific ASIP promoter in mammals. In addition, the class 1 promoter plays an important role for creating sexual plumage dichromatism controlled by estrogen. This is the first evidence for a pigmentation gene having been modified in its expression during evolution to develop phenotypic diversity between individuals of different sexes. PMID:22554923

  8. Structure and Function of the SWIRM Domain, a Conserved Protein Module Found in Chromatin Regulatory Complexes

    SciTech Connect

    Da,G.; Lenkart, J.; Zhao, K.; Shiekhattar, R.; Cairns, B.; Marmorstein, R.


    The SWIRM domain is a module found in the Swi3 and Rsc8 subunits of SWI/SNF-family chromatin remodeling complexes, and the Ada2 and BHC110/LSD1 subunits of chromatin modification complexes. Here we report the high-resolution crystal structure of the SWIRM domain from Swi3 and characterize the in vitro and in vivo function of the SWIRM domains from Saccharomyces cerevisiae Swi3 and Rsc8. The Swi3 SWIRM forms a four-helix bundle containing a pseudo 2-fold axis and a helix-turn-helix motif commonly found in DNA-binding proteins. We show that the Swi3 SWIRM binds free DNA and mononucleosomes with high and comparable affinity and that a subset of Swi3 substitution mutants that display growth defects in vivo also show impaired DNA-binding activity in vitro, consistent with a nucleosome targeting function of this domain. Genetic and biochemical studies also reveal that the Rsc8 and Swi3 SWIRM domains are essential for the proper assembly and in vivo functions of their respective complexes. Together, these studies identify the SWIRM domain as an essential multifunctional module for the regulation of gene expression.

  9. Study of immunogenicity of recombinant proteins based on hemagglutinin and neuraminidase conservative epitopes of Influenza A virus

    PubMed Central

    Dukhovlinov, Ilya; Al-Shekhadat, Ruslan; Fedorova, Ekaterina; Stepanova, Ludmila; Potapchuk, Marina; Repko, Irina; Rusova, Olga; Orlov, Anton; Tsybalova, Ludmila; Kiselev, Oleg


    Background Recombinant hemagglutinin (rHA) and neurominidase (rNA) developed in our investigation are amino acid sequence consensus variants of H1N1 2009 subtype influenza virus strain, also including immunogenic epitopes typical for other influenza virus subtypes (H3N1 and H5N1). Substitutions were made: typical for Russian virus isolates (in HA – S220T, NA – D248N) and in active centers of molecules – R118L, R293L, R368L; C92S, C417S to increase recombinant proteins stability in E. coli. The aim of the present work was to study immunogenicity of the obtained rHA and rNA. Material/Methods Fragments aa 83–469 of NA and aa 61–287 of HA were chosen because they include the main B-cell epitopes and are the minimal structures for correct folding of target proteins. The designed nucleotide sequences were synthesized and purified and the expression of rNA and rNA were analyzed. For immunization and virus challenge we used influenza viruses A/California/04/2009 (H1N1), A/PR/8/34 (H1N1), A/Perth/16/2009 (H3N2), A/Chicken/Kurgan/05/2005 R.G. (H5N1), and B/Florida/04/2006. Specific IgG levels were determined by ELISA in 96-well ELISA plates. Significant differences of survival in mouse groups were analyzed by Mantel-Cox (log-rank) and Gehan-Breslow-Wilcoxon tests. Results The obtained results demonstrate the high immunogenicity and ability of indicated proteins mixture to provide similar cross-protection against influenza viruses of the H1N1 subtype. Conclusions The data obtained suggest efficient pluripotent vaccine creation based on HA and NA conservative regions. PMID:23969554

  10. Human H/ACA Small Nucleolar RNPs and Telomerase Share Evolutionarily Conserved Proteins NHP2 and NOP10

    PubMed Central

    Pogacic, Vanda; Dragon, François; Filipowicz, Witold


    The H/ACA small nucleolar RNAs (snoRNAs) are involved in pseudouridylation of pre-rRNAs. In the yeast Saccharomyces cerevisiae, four common proteins are associated with H/ACA snoRNAs: Gar1p, Cbf5p, Nhp2p, and Nop10p. In vitro reconstitution studies showed that four proteins also specifically interact with H/ACA snoRNAs in mammalian cell extracts. Two mammalian proteins, NAP57/dyskerin (the ortholog of Cbf5p) and hGAR1, have been characterized. In this work we describe properties of hNOP10 and hNHP2, human orthologs of yeast Nop10p and Nhp2p, respectively, and further characterize hGAR1. hNOP10 and hNHP2 complement yeast cells depleted of Nhp2p and Nop10p, respectively. Immunoprecipitation experiments with extracts from transfected HeLa cells indicated that epitope-tagged hNOP10 and hNHP2 specifically associate with hGAR1 and H/ACA RNAs; they also interact with the RNA subunit of telomerase, which contains an H/ACA-like domain in its 3′ moiety. Immunofluorescence microscopy experiments showed that hGAR1, hNOP10, and hNHP2 are localized in the dense fibrillar component of the nucleolus and in Cajal (coiled) bodies. Deletion analysis of hGAR1 indicated that its evolutionarily conserved core domain contains all the signals required for localization, but progressive deletions from either the N or the C terminus of the core domain abolish localization in the nucleolus and/or the Cajal bodies. PMID:11074001

  11. Conserved zinc fingers mediate multiple functions of ZFP100, a U7snRNP associated protein

    PubMed Central

    Wagner, Eric J.; Ospina, Jason K.; Hu, Yue; Dundr, Miroslav; Matera, A. Gregory; Marzluff, William F.


    Formation of the 3′ end of replication-dependent histone mRNAs is most robust during S phase and is mediated by both the stem–loop binding protein (SLBP) and the U7 snRNP. We previously identified a 100-kDa zinc finger protein (ZFP100) as a component of U7 snRNP that interacts with the SLBP/pre-mRNA complex. Here, we show that myc- or GFP-tagged ZFP100 overexpressed after transfection is concentrated in Cajal bodies (CBs), and unlike components of the spliceosomal snRNPs, photobleaching experiments demonstrate that ZFP100 is stably associated with CBs. Of the 18 zinc fingers contained within ZFP100, the region encompassing fingers 2–6 is sufficient to maintain CB localization. Zn fingers 5–10 are required for maximal binding of ZFP100 to a 20-amino-acid region of Lsm11, a U7 snRNP core protein. Expression of ZFP100 stimulates histone mRNA processing in vivo, assayed by activation of a reporter gene that encodes a GFP mRNA ending in a histone 3′ end. Importantly, the domain that is required for CB localization and Lsm11 binding is also sufficient to stimulate histone pre-mRNA processing in vivo. Comparisons with other mammalian ZFP100 orthologs show that the central Zn fingers sufficient for in vivo activity are most highly conserved, whereas the number and sequence of the Zn fingers in the N- and C-terminal domains vary. PMID:16714279

  12. An evolutionarily conserved interaction of tumor suppressor protein Pdcd4 with the poly(A)-binding protein contributes to translation suppression by Pdcd4.


    Fehler, Olesja; Singh, Priyanka; Haas, Astrid; Ulrich, Diana; Müller, Jan P; Ohnheiser, Johanna; Klempnauer, Karl-Heinz


    The tumor suppressor protein programmed cell death 4 (Pdcd4) has been implicated in the translational regulation of specific mRNAs, however, the identities of the natural Pdcd4 target mRNAs and the mechanisms by which Pdcd4 affects their translation are not well understood. Pdcd4 binds to the eukaryotic translation initiation factor eIF4A and inhibits its helicase activity, which has suggested that Pdcd4 suppresses translation initiation of mRNAs containing structured 5'-untranslated regions. Recent work has revealed a second inhibitory mechanism, which is eIF4A-independent and involves direct RNA-binding of Pdcd4 to the target mRNAs. We have now identified the poly(A)-binding protein (PABP) as a novel direct interaction partner of Pdcd4. The ability to interact with PABP is shared between human and Drosophila Pdcd4, indicating that it has been highly conserved during evolution. Mutants of Pdcd4 that have lost the ability to interact with PABP fail to stably associate with ribosomal complexes in sucrose density gradients and to suppress translation, as exemplified by c-myb mRNA. Overall, our work identifies PABP as a novel functionally relevant Pdcd4 interaction partner that contributes to the regulation of translation by Pdcd4. PMID:25190455

  13. An evolutionarily conserved interaction of tumor suppressor protein Pdcd4 with the poly(A)-binding protein contributes to translation suppression by Pdcd4

    PubMed Central

    Fehler, Olesja; Singh, Priyanka; Haas, Astrid; Ulrich, Diana; Müller, Jan P.; Ohnheiser, Johanna; Klempnauer, Karl-Heinz


    The tumor suppressor protein programmed cell death 4 (Pdcd4) has been implicated in the translational regulation of specific mRNAs, however, the identities of the natural Pdcd4 target mRNAs and the mechanisms by which Pdcd4 affects their translation are not well understood. Pdcd4 binds to the eukaryotic translation initiation factor eIF4A and inhibits its helicase activity, which has suggested that Pdcd4 suppresses translation initiation of mRNAs containing structured 5′-untranslated regions. Recent work has revealed a second inhibitory mechanism, which is eIF4A-independent and involves direct RNA-binding of Pdcd4 to the target mRNAs. We have now identified the poly(A)-binding protein (PABP) as a novel direct interaction partner of Pdcd4. The ability to interact with PABP is shared between human and Drosophila Pdcd4, indicating that it has been highly conserved during evolution. Mutants of Pdcd4 that have lost the ability to interact with PABP fail to stably associate with ribosomal complexes in sucrose density gradients and to suppress translation, as exemplified by c-myb mRNA. Overall, our work identifies PABP as a novel functionally relevant Pdcd4 interaction partner that contributes to the regulation of translation by Pdcd4. PMID:25190455

  14. Comparative studies of Munc18c and Munc18-1 reveal conserved and divergent mechanisms of Sec1/Munc18 proteins

    PubMed Central

    Yu, Haijia; Rathore, Shailendra S.; Lopez, Jamie A.; Davis, Eric M.; James, David E.; Martin, Jennifer L.; Shen, Jingshi


    Sec1/Munc18 (SM) family proteins are essential for every vesicle fusion pathway. The best-characterized SM protein is the synaptic factor Munc18-1, but it remains unclear whether its functions represent conserved mechanisms of SM proteins or specialized activities in neurotransmitter release. To address this question, we dissected Munc18c, a functionally distinct SM protein involved in nonsynaptic exocytic pathways. We discovered that Munc18c binds to the trans-SNARE (soluble N-ethylmaleimide-sensitive factor attachment protein receptor) complex and strongly accelerates the fusion rate. Further analysis suggests that Munc18c recognizes both vesicle-rooted SNARE and target membrane-associated SNAREs, and promotes trans-SNARE zippering at the postdocking stage of the fusion reaction. The stimulation of fusion by Munc18c is specific to its cognate SNARE isoforms. Because Munc18-1 regulates fusion in a similar manner, we conclude that one conserved function of SM proteins is to bind their cognate trans-SNARE complexes and accelerate fusion kinetics. Munc18c also binds syntaxin-4 monomer but does not block target membrane-associated SNARE assembly, in agreement with our observation that six- to eightfold increases in Munc18c expression do not inhibit insulin-stimulated glucose uptake in adipocytes. Thus, the inhibitory “closed” syntaxin binding mode demonstrated for Munc18-1 is not conserved in Munc18c. Unexpectedly, we found that Munc18c recognizes the N-terminal region of the vesicle-rooted SNARE, whereas Munc18-1 requires the C-terminal sequences, suggesting that the architecture of the SNARE/SM complex likely differs across fusion pathways. Together, these comparative studies of two distinct SM proteins reveal conserved as well as divergent mechanisms of SM family proteins in intracellular vesicle fusion. PMID:23918365

  15. Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of alpha-Amy2 genes.


    Rushton, P J; Macdonald, H; Huttly, A K; Lazarus, C M; Hooley, R


    The promoters of wheat, barley and wild oat alpha-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56-58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4-5-C-X22-23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins. PMID:8541496

  16. The conserved lysine of the catalytic domain of protein kinases is actively involved in the phosphotransfer reaction and not required for anchoring ATP.

    PubMed Central

    Carrera, A C; Alexandrov, K; Roberts, T M


    The study of the various protein kinases reveals that, despite their considerably diversity, they have evolved from a common origin. Eleven conserved subdomains have been described that encompass the catalytic core of these enzymes. One of these conserved regions, subdomain II, contains an invariant lysine residue present in all known protein kinase catalytic domains. Two facts have suggested that this conserved lysine of subdomain II is essential for binding ATP: (i) several investigators have demonstrated that this residue is physically proximal to the ATP molecule, and (ii) conservative substitutions at this site render the kinase inactive. However, these results are also consistent with a functional role of the conserved lysine of subdomain II in orienting or facilitating the transfer of phosphate. To study in more detail the role of subdomain II, we have generated mutants of the protein-tyrosine kinase pp56lck that have single amino acid substitutions within the area surrounding the conserved residue Lys-273 in subdomain II. When compared with wild-type pp56lck, these mutants displayed profound reductions in their phosphotransfer efficiencies and small differences in their affinities for ATP. Further, the substitution of arginine for Lys-273 resulted in a mutant protein unable to transfer the gamma-phosphate of ATP but able to bind 8-azido-ATP with an efficiency similar to that of wild-type pp56lck. These results suggest that the region including Lys-273 of subdomain II is involved in the enzymatic process of phosphate transfer, rather than in anchoring ATP. Images PMID:8421674

  17. The YlmG protein has a conserved function related to the distribution of nucleoids in chloroplasts and cyanobacteria

    PubMed Central


    Background Reminiscent of their free-living cyanobacterial ancestor, chloroplasts proliferate by division coupled with the partition of nucleoids (DNA-protein complexes). Division of the chloroplast envelope membrane is performed by constriction of the ring structures at the division site. During division, nucleoids also change their shape and are distributed essentially equally to the daughter chloroplasts. Although several components of the envelope division machinery have been identified and characterized, little is known about the molecular components/mechanisms underlying the change of the nucleoid structure. Results In order to identify new factors that are involved in the chloroplast division, we isolated Arabidopsis thaliana chloroplast division mutants from a pool of random cDNA-overexpressed lines. We found that the overexpression of a previously uncharacterized gene (AtYLMG1-1) of cyanobacterial origin results in the formation of an irregular network of chloroplast nucleoids, along with a defect in chloroplast division. In contrast, knockdown of AtYLMG1-1 resulted in a concentration of the nucleoids into a few large structures, but did not affect chloroplast division. Immunofluorescence microscopy showed that AtYLMG1-1 localizes in small puncta on thylakoid membranes, to which a subset of nucleoids colocalize. In addition, in the cyanobacterium Synechococcus elongates, overexpression and deletion of ylmG also displayed defects in nucleoid structure and cell division. Conclusions These results suggest that the proper distribution of nucleoids requires the YlmG protein, and the mechanism is conserved between cyanobacteria and chloroplasts. Given that ylmG exists in a cell division gene cluster downstream of ftsZ in gram-positive bacteria and that ylmG overexpression impaired the chloroplast division, the nucleoid partitioning by YlmG might be related to chloroplast and cyanobacterial division processes. PMID:20359373

  18. Neverland is an evolutionally conserved Rieske-domain protein that is essential for ecdysone synthesis and insect growth.


    Yoshiyama, Takuji; Namiki, Toshiki; Mita, Kazuei; Kataoka, Hiroshi; Niwa, Ryusuke


    Steroid hormones mediate a wide variety of developmental and physiological events in multicellular organisms. During larval and pupal stages of insects, the principal steroid hormone is ecdysone, which is synthesized in the prothoracic gland (PG) and plays a central role in the control of development. Although many studies have revealed the biochemical features of ecdysone synthesis in the PG, many aspects of this pathway have remained unclear at the molecular level. We describe the neverland (nvd) gene, which encodes an oxygenase-like protein with a Rieske electron carrier domain, from the silkworm Bombyx mori and the fruitfly Drosophila melanogaster. nvd is expressed specifically in tissues that synthesize ecdysone, such as the PG. We also show that loss of nvd function in the PG causes arrest of both molting and growth during Drosophila development. Furthermore, the phenotype is rescued by application of 20-hydroxyecdysone or the precursor 7-dehydrocholesterol. Given that the nvd family is evolutionally conserved, these results suggest that Nvd is an essential regulator of cholesterol metabolism or trafficking in steroid synthesis across animal phyla. PMID:16763204

  19. In Vitro Properties of the Conserved Mammalian Protein hnRNP D Suggest a Role in Telomere Maintenance

    PubMed Central

    Eversole, Ashley; Maizels, Nancy


    Mammalian chromosomes terminate with a 3′ tail which consists of reiterations of the G-rich repeat, d(TTAGGG). The telomeric tail is the primer for replication by telomerase, and it may also invade telomeric duplex DNA to form terminal lariat structures, or T loops. Here we show that the ubiquitous and highly conserved mammalian protein hnRNP D interacts specifically with the G-rich strand of the telomeric repeat. A single gene encodes multiple isoforms of hnRNP D. All isoforms bind comparably to the G-rich strand, and certain isoforms can also bind tightly and specifically to the C-rich telomeric strand. G-rich telomeric sequences readily form structures stabilized by G-G pairing, which can interfere with telomere replication by telomerase. We show that hnRNP D binding to the G-rich strand destabilizes intrastrand G-G pairing and that hnRNP D interacts specifically with telomerase in human cell extracts. This biochemical analysis suggest that hnRNP D could function in vivo to destabilize structures formed by telomeric G-rich tails and facilitate their extension by telomerase. PMID:10891483

  20. The Conserved G-Protein Coupled Receptor FSHR-1 Regulates Protective Host Responses to Infection and Oxidative Stress.


    Miller, Elizabeth V; Grandi, Leah N; Giannini, Jennifer A; Robinson, Joseph D; Powell, Jennifer R


    The innate immune system's ability to sense an infection is critical so that it can rapidly respond if pathogenic microorganisms threaten the host, but otherwise maintain a quiescent baseline state to avoid causing damage to the host or to commensal microorganisms. One important mechanism for discriminating between pathogenic and non-pathogenic bacteria is the recognition of cellular damage caused by a pathogen during the course of infection. In Caenorhabditis elegans, the conserved G-protein coupled receptor FSHR-1 is an important constituent of the innate immune response. FSHR-1 activates the expression of antimicrobial infection response genes in infected worms and delays accumulation of the ingested pathogen Pseudomonas aeruginosa. FSHR-1 is central not only to the worm's survival of infection by multiple pathogens, but also to the worm's survival of xenobiotic cadmium and oxidative stresses. Infected worms produce reactive oxygen species to fight off the pathogens; FSHR-1 is required at the site of infection for the expression of detoxifying genes that protect the host from collateral damage caused by this defense response. Finally, the FSHR-1 pathway is important for the ability of worms to discriminate pathogenic from benign bacteria and subsequently initiate an aversive learning program that promotes selective pathogen avoidance. PMID:26360906

  1. Conserved globulin gene across eight grass genomes identify fundamental units of the loci encoding seed storage proteins.


    Gu, Yong Qiang; Wanjugi, Humphrey; Coleman-Derr, Devin; Kong, Xiuying; Anderson, Olin D


    The wheat high molecular weight (HMW) glutenins are important seed storage proteins that determine bread-making quality in hexaploid wheat (Triticum aestivum). In this study, detailed comparative sequence analyses of large orthologous HMW glutenin genomic regions from eight grass species, representing a wide evolutionary history of grass genomes, reveal a number of lineage-specific sequence changes. These lineage-specific changes, which resulted in duplications, insertions, and deletions of genes, are the major forces disrupting gene colinearity among grass genomes. Our results indicate that the presence of the HMW glutenin gene in Triticeae genomes was caused by lineage-specific duplication of a globulin gene. This tandem duplication event is shared by Brachypodium and Triticeae genomes, but is absent in rice, maize, and sorghum, suggesting the duplication occurred after Brachypodium and Triticeae genomes diverged from the other grasses ~35 Ma ago. Aside from their physical location in tandem, the sequence similarity, expression pattern, and conserved cis-acting elements responsible for endosperm-specific expression further support the paralogous relationship between the HMW glutenin and globulin genes. While the duplicated copy in Brachypodium has apparently become nonfunctional, the duplicated copy in wheat has evolved to become the HMW glutenin gene by gaining a central prolamin repetitive domain. PMID:19707805

  2. SPN1, a conserved gene identified by suppression of a postrecruitment-defective yeast TATA-binding protein mutant.

    PubMed Central

    Fischbeck, Julie A; Kraemer, Susan M; Stargell, Laurie A


    Little is known about TATA-binding protein (TBP) functions after recruitment to the TATA element, although several TBP mutants display postrecruitment defects. Here we describe a genetic screen for suppressors of a postrecruitment-defective TBP allele. Suppression was achieved by a single point mutation in a previously uncharacterized Saccharomyces cerevisiae gene, SPN1 (suppresses postrecruitment functions gene number 1). SPN1 is an essential yeast gene that is highly conserved throughout evolution. The suppressing mutation in SPN1 substitutes an asparagine for an invariant lysine at position 192 (spn1(K192N)). The spn1(K192N) strain is able to suppress additional alleles of TBP that possess postrecruitment defects, but not a TBP allele that is postrecruitment competent. In addition, Spn1p does not stably associate with TFIID in vivo. Cells containing the spn1(K192N) allele exhibit a temperature-sensitive phenotype and some defects in activated transcription, whereas constitutive transcription appears relatively robust in the mutant background. Consistent with an important role in postrecruitment functions, transcription from the CYC1 promoter, which has been shown to be regulated by postrecruitment mechanisms, is enhanced in spn1(K192N) cells. Moreover, we find that SPN1 is a member of the SPT gene family, further supporting a functional requirement for the SPN1 gene product in transcriptional processes. PMID:12524336

  3. The Conserved G-Protein Coupled Receptor FSHR-1 Regulates Protective Host Responses to Infection and Oxidative Stress

    PubMed Central

    Giannini, Jennifer A.; Robinson, Joseph D.; Powell, Jennifer R.


    The innate immune system’s ability to sense an infection is critical so that it can rapidly respond if pathogenic microorganisms threaten the host, but otherwise maintain a quiescent baseline state to avoid causing damage to the host or to commensal microorganisms. One important mechanism for discriminating between pathogenic and non-pathogenic bacteria is the recognition of cellular damage caused by a pathogen during the course of infection. In Caenorhabditis elegans, the conserved G-protein coupled receptor FSHR-1 is an important constituent of the innate immune response. FSHR-1 activates the expression of antimicrobial infection response genes in infected worms and delays accumulation of the ingested pathogen Pseudomonas aeruginosa. FSHR-1 is central not only to the worm’s survival of infection by multiple pathogens, but also to the worm’s survival of xenobiotic cadmium and oxidative stresses. Infected worms produce reactive oxygen species to fight off the pathogens; FSHR-1 is required at the site of infection for the expression of detoxifying genes that protect the host from collateral damage caused by this defense response. Finally, the FSHR-1 pathway is important for the ability of worms to discriminate pathogenic from benign bacteria and subsequently initiate an aversive learning program that promotes selective pathogen avoidance. PMID:26360906

  4. Conserved functional antagonism of CELF and MBNL proteins controls stem cell-specific alternative splicing in planarians

    PubMed Central

    Solana, Jordi; Irimia, Manuel; Ayoub, Salah; Orejuela, Marta Rodriguez; Zywitza, Vera; Jens, Marvin; Tapial, Javier; Ray, Debashish; Morris, Quaid; Hughes, Timothy R; Blencowe, Benjamin J; Rajewsky, Nikolaus


    In contrast to transcriptional regulation, the function of alternative splicing (AS) in stem cells is poorly understood. In mammals, MBNL proteins negatively regulate an exon program specific of embryonic stem cells; however, little is known about the in vivo significance of this regulation. We studied AS in a powerful in vivo model for stem cell biology, the planarian Schmidtea mediterranea. We discover a conserved AS program comprising hundreds of alternative exons, microexons and introns that is differentially regulated in planarian stem cells, and comprehensively identify its regulators. We show that functional antagonism between CELF and MBNL factors directly controls stem cell-specific AS in planarians, placing the origin of this regulatory mechanism at the base of Bilaterians. Knockdown of CELF or MBNL factors lead to abnormal regenerative capacities by affecting self-renewal and differentiation sets of genes, respectively. These results highlight the importance of AS interactions in stem cell regulation across metazoans. DOI: PMID:27502555

  5. Transactivation specificity is conserved among p53 family proteins and depends on a response element sequence code

    PubMed Central

    Ciribilli, Yari; Monti, Paola; Bisio, Alessandra; Nguyen, H. Thien; Ethayathulla, Abdul S.; Ramos, Ana; Foggetti, Giorgia; Menichini, Paola; Menendez, Daniel; Resnick, Michael A.; Viadiu, Hector; Fronza, Gilberto; Inga, Alberto


    Structural and biochemical studies have demonstrated that p73, p63 and p53 recognize DNA with identical amino acids and similar binding affinity. Here, measuring transactivation activity for a large number of response elements (REs) in yeast and human cell lines, we show that p53 family proteins also have overlapping transactivation profiles. We identified mutations at conserved amino acids of loops L1 and L3 in the DNA-binding domain that tune the transactivation potential nearly equally in p73, p63 and p53. For example, the mutant S139F in p73 has higher transactivation potential towards selected REs, enhanced DNA-binding cooperativity in vitro and a flexible loop L1 as seen in the crystal structure of the protein–DNA complex. By studying, how variations in the RE sequence affect transactivation specificity, we discovered a RE-transactivation code that predicts enhanced transactivation; this correlation is stronger for promoters of genes associated with apoptosis. PMID:23892287

  6. The conserved protein Dre2 uses essential [2Fe-2S] and [4Fe-4S] clusters for its function in cytosolic iron-sulfur protein assembly.


    Netz, Daili J A; Genau, Heide M; Weiler, Benjamin D; Bill, Eckhard; Pierik, Antonio J; Lill, Roland


    The cytosolic iron-sulfur (Fe-S) protein assembly (CIA) machinery comprises 11 essential components and matures Fe-S proteins involved in translation and genome maintenance. Maturation is initiated by the electron transfer chain NADPH-diflavin reductase Tah18-Fe-S protein Dre2 that facilitates the de novo assembly of a [4Fe-4S] cluster on the scaffold complex Cfd1-Nbp35. Tah18-Dre2 also play a critical role in the assembly of the diferric tyrosyl radical cofactor of ribonucleotide reductase. Dre2 contains eight conserved cysteine residues as potential co-ordinating ligands for Fe-S clusters but their functional importance and the type of bound clusters is unclear. In the present study, we use a combination of mutagenesis, cell biological and biochemical as well as UV-visible, EPR and Mössbauer spectroscopic approaches to show that the yeast Dre2 cysteine residues Cys(252), Cys(263), Cys(266) and Cys(268) (motif I) bind a [2Fe-2S] cluster, whereas cysteine residues Cys(311), Cys(314), Cys(322) and Cys(325) (motif II) co-ordinate a [4Fe-4S] cluster. All of these residues with the exception of Cys(252) are essential for cell viability, cytosolic Fe-S protein activity and in vivo (55)Fe-S cluster incorporation. The N-terminal methyltransferase-like domain of Dre2 is important for proper Fe-S cluster assembly at motifs I and II, which occurs in an interdependent fashion. Our findings further resolve why recombinant Dre2 from Arabidopsis, Trypanosoma or humans has previously been isolated with a single [2Fe-2S] instead of native [2Fe-2S] plus [4Fe-4S] clusters. In the presence of oxygen, the motif I-bound [2Fe-2S] cluster is labile and the motif II-bound [4Fe-4S] cluster is readily converted into a [2Fe-2S] cluster. PMID:27166425

  7. C-terminal-binding protein interacting protein binds directly to adenovirus early region 1A through its N-terminal region and conserved region 3.


    Bruton, R K; Rasti, M; Mapp, K L; Young, N; Carter, R Z; Abramowicz, I A; Sedgwick, G G; Onion, D F; Shuen, M; Mymryk, J S; Turnell, A S; Grand, R J A


    C-terminal-binding protein interacting protein (CtIP) was first isolated as a binding partner of C-terminal-binding protein (CtBP). It is considered to contribute to the transcriptional repression and cell cycle regulatory properties of the retinoblastoma (Rb) family of proteins and to have a role in the cellular response to DNA damage. Here, we have shown that CtIP is a novel target for the adenovirus oncoprotein early region 1A (AdE1A). AdE1A associates with CtIP in both Ad5E1-transformed cells and Ad5-infected cells and binds directly in glutathione-S-transferase pull-down assays. Two binding sites have been mapped on Ad5E1A - the N-terminal alpha-helical region (residues 1-30) and conserved region 3 (CR3) - the transcriptional activation domain. CtIP can bind AdE1A and CtBP independently, raising the possibility that ternary complexes exist in Ad-transformed and -infected cells. Significantly, reduction of CtIP expression with small interfering RNAs results in reduction of the ability of a Gal4 DNA-binding domain-CR3 construct to transactivate a Gal 4-responsive luciferase reporter and this effect is reversed by reduction of CtBP expression. Therefore, in this model, CtIP acts as a transcriptional co-activator of AdE1A when dissociated from CtBP, through the action of AdE1A. These data are consistent with observations that CtIP expression is induced by AdE1A during viral infection and that reduction of CtIP expression with RNA interference can retard virus replication. In addition, AdE1A causes disruption of the CtIP/Rb complex during viral infection by its interaction with CtIP, possibly contributing to transcriptional derepression. PMID:17546052

  8. The type 1 human immunodeficiency virus Tat binding protein is a transcriptional activator belonging to an additional family of evolutionarily conserved genes.

    PubMed Central

    Ohana, B; Moore, P A; Ruben, S M; Southgate, C D; Green, M R; Rosen, C A


    The type 1 human immunodeficiency virus Tat protein is a powerful transcriptional activator when bound to an RNA structure (TAR) present at the extreme 5' terminus of viral mRNA. Since transcriptional activation requires binding of Tat to RNA, it has been suggested that Tat enhances initiation or elongation through a direct interaction with cellular transcription factors. Here we show through protein fusion experiments that the previously identified cellular Tat binding protein, TBP-1, although unable to bind DNA, is a strong transcriptional activator when brought into proximity of several promoter elements. Transcriptional activity depends upon the integrity of at least two highly conserved domains: one resembling a nucleotide-binding motif and the other motif common to proteins with helicase activity. Our studies further reveal that TBP-1 represents one member of a large, highly conserved gene family that encodes proteins demonstrating strong amino acid conservation across species. Finally, we identified a second family member that, although 77% similar to TBP-1, does not activate transcription from the promoters examined. This finding, together with the observation that TBP-1 does not activate each promoter examined, suggests that this gene family may encode promoter-specific transcriptional activators. Images PMID:8419915

  9. Molecular cloning and sequence analysis of expansins--a highly conserved, multigene family of proteins that mediate cell wall extension in plants.

    PubMed Central

    Shcherban, T Y; Shi, J; Durachko, D M; Guiltinan, M J; McQueen-Mason, S J; Shieh, M; Cosgrove, D J


    Expansins are unusual proteins discovered by virtue of their ability to mediate cell wall extension in plants. We identified cDNA clones for two cucumber expansins on the basis of peptide sequences of proteins purified from cucumber hypocotyls. The expansin cDNAs encode related proteins with signal peptides predicted to direct protein secretion to the cell wall. Northern blot analysis showed moderate transcript abundance in the growing region of the hypocotyl and no detectable transcripts in the nongrowing region. Rice and Arabidopsis expansin cDNAs were identified from collections of anonymous cDNAs (expressed sequence tags). Sequence comparisons indicate at least four distinct expansin cDNAs in rice and at least six in Arabidopsis. Expansins are highly conserved in size and sequence (60-87% amino acid sequence identity and 75-95% similarity between any pairwise comparison), and phylogenetic trees indicate that this multigene family formed before the evolutionary divergence of monocotyledons and dicotyledons. Sequence and motif analyses show no similarities to known functional domains that might account for expansin action on wall extension. A series of highly conserved tryptophans may function in expansin binding to cellulose or other glycans. The high conservation of this multigene family indicates that the mechanism by which expansins promote wall extensin tolerates little variation in protein structure. Images Fig. 2 PMID:7568110

  10. Interactions of an Arabidopsis RanBPM homologue with LisH-CTLH domain proteins revealed high conservation of CTLH complexes in eukaryotes

    PubMed Central


    Background RanBPM (Ran-binding protein in the microtubule-organizing centre) was originally reported as a centrosome-associated protein in human cells. However, RanBPM protein containing highly conserved SPRY, LisH, CTLH and CRA domains is currently considered as a scaffolding protein with multiple cellular functions. A plant homologue of RanBPM has not yet been characterized. Results Based on sequence similarity, we identified a homologue of the human RanBPM in Arabidopsis thaliana. AtRanBPM protein has highly conserved SPRY, LisH, CTLH and CRA domains. Cell fractionation showed that endogenous AtRanBPM or expressed GFP-AtRanBPM are mainly cytoplasmic proteins with only a minor portion detectable in microsomal fractions. AtRanBPM was identified predominantly in the form of soluble cytoplasmic complexes ~230 – 500 kDa in size. Immunopurification of AtRanBPM followed by mass spectrometric analysis identified proteins containing LisH and CRA domains; LisH, CRA, RING-U-box domains and a transducin/WD40 repeats in a complex with AtRanBPM. Homologues of identified proteins are known to be components of the C-terminal to the LisH motif (CTLH) complexes in humans and budding yeast. Microscopic analysis of GFP-AtRanBPM in vivo and immunofluorescence localization of endogenous AtRanBPM protein in cultured cells and seedlings of Arabidopsis showed mainly cytoplasmic and nuclear localization. Absence of colocalization with γ-tubulin was consistent with the biochemical data and suggests another than a centrosomal role of the AtRanBPM protein. Conclusion We showed that as yet uncharacterized Arabidopsis RanBPM protein physically interacts with LisH-CTLH domain-containing proteins. The newly identified high molecular weight cytoplasmic protein complexes of AtRanBPM showed homology with CTLH types of complexes described in mammals and budding yeast. Although the exact functions of the CTLH complexes in scaffolding of protein degradation, in protein interactions and in

  11. Rv0216, a Conserved Hypothetical Protein from Myocbacterium Tuberculosis that is Essential for Bacterial Survival During Infection, has a Double Hotdog Fold

    SciTech Connect

    Castell,A.; Johansson, P.; Unge, T.; Jones, T.; Backbro, K.


    The Mycobacterium tuberculosis genome contains about 4000 genes, of which approximately a third code for proteins of unknown function or are classified as conserved hypothetical proteins. We have determined the three-dimensional structure of one of these, the rv0216 gene product, which has been shown to be essential for M. tuberculosis growth in vivo. The structure exhibits the greatest similarity to bacterial and eukaryotic hydratases that catalyse the R-specific hydration of 2-enoyl coenzyme A. However, only part of the catalytic machinery is conserved in Rv0216 and it showed no activity for the substrate crotonyl-CoA. The structure of Rv0216 allows us to assign new functional annotations to a family of seven other M. tuberculosis proteins, a number if which are essential for bacterial survival during infection and growth.

  12. Conservation of an ATP-binding domain among recA proteins from Proteus vulgaris, erwinia carotovora, Shigella flexneri, and Escherichia coli K-12 and B/r

    SciTech Connect

    Knight, K.L.; Hess, R.M.; McEntee, K.


    The purified RecA proteins encoded by the cloned genes from Proteus vulgaris, Erwinia carotovora, Shigella flexneri, and Escherichia coli B/r were compared with the RecA protein from E. coli K-12. Each of the proteins hydrolyzed ATP in the presence of single-stranded DNA, and each was covalently modified with the photoaffinity ATP analog 8-azidoadenosine 5'-triphosphate (8N/sub 3/ATP). Two-dimensional tryptic maps of the four heterologous RecA proteins demonstrated considerable structural conservation among these bacterial genera. Moreover, when the (..cap alpha..-/sup 32/P)8N/sub 3/ATP-modified proteins were digested with trypsin and analyzed by high-performance liquid chromatography, a single peak of radioactivity was detected in each of the digests and these peptides eluted identically with the tryptic peptide T/sub 31/ of the E. coli K-12 RecA protein, which was the unique site of 8N/sub 3/ATP photolabeling. Each of the heterologous recA genes hybridized to oligonucleotide probes derived from the ATP-binding domain sequence of the E. coli K-12 gene. These last results demonstrate that the ATP-binding domain of the RecA protein has been strongly conserved for greater than 10/sup 7/ years.

  13. Serological Conservation of Parasite-Infected Erythrocytes Predicts Plasmodium falciparum Erythrocyte Membrane Protein 1 Gene Expression but Not Severity of Childhood Malaria.


    Warimwe, George M; Abdi, Abdirahman I; Muthui, Michelle; Fegan, Gregory; Musyoki, Jennifer N; Marsh, Kevin; Bull, Peter C


    Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1), expressed on P. falciparum-infected erythrocytes, is a major family of clonally variant targets of naturally acquired immunity to malaria. Previous studies have demonstrated that in areas where malaria is endemic, antibodies to infected erythrocytes from children with severe malaria tend to be more seroprevalent than antibodies to infected erythrocytes from children with nonsevere malaria. These data have led to a working hypothesis that PfEMP1 variants associated with parasite virulence are relatively conserved in structure. However, the longevity of such serologically conserved variants in the parasite population is unknown. Here, using infected erythrocytes from recently sampled clinical P. falciparum samples, we measured serological conservation using pools of antibodies in sera that had been sampled 10 to 12 years earlier. The serological conservation of infected erythrocytes strongly correlated with the expression of specific PfEMP1 subsets previously found to be associated with severe malaria. However, we found no association between serological conservation per se and disease severity within these data. This contrasts with the simple hypothesis that P. falciparum isolates with a serologically conserved group of PfEMP1 variants cause severe malaria. The data are instead consistent with periodic turnover of the immunodominant epitopes of PfEMP1 associated with severe malaria. PMID:26883585

  14. Activation of anthocyanin biosynthesis in Gerbera hybrida (Asteraceae) suggests conserved protein-protein and protein-promoter interactions between the anciently diverged monocots and eudicots.


    Elomaa, Paula; Uimari, Anne; Mehto, Merja; Albert, Victor A; Laitinen, Roosa A E; Teeri, Teemu H


    We have identified an R2R3-type MYB factor, GMYB10, from Gerbera hybrida (Asteraceae) that shares high sequence homology to and is phylogenetically grouped together with the previously characterized regulators of anthocyanin pigmentation in petunia (Petunia hybrida) and Arabidopsis. GMYB10 is able to induce anthocyanin pigmentation in transgenic tobacco (Nicotiana tabacum), especially in vegetative parts and anthers. In G. hybrida, GMYB10 is involved in activation of anthocyanin biosynthesis in leaves, floral stems, and flowers. In flowers, its expression is restricted to petal epidermal cell layers in correlation with the anthocyanin accumulation pattern. We have shown, using yeast (Saccharomyces cerevisiae) two-hybrid assay, that GMYB10 interacts with the previously isolated bHLH factor GMYC1. Particle bombardment analysis was used to show that GMYB10 is required for activation of a late anthocyanin biosynthetic gene promoter, PGDFR2. cis-Analysis of the target PGDFR2 revealed a sequence element with a key role in activation by GMYB10/GMYC1. This element shares high homology with the anthocyanin regulatory elements characterized in maize (Zea mays) anthocyanin promoters, suggesting that the regulatory mechanisms involved in activation of anthocyanin biosynthesis have been conserved for over 125 million years not only at the level of transcriptional regulators but also at the level of the biosynthetic gene promoters. PMID:14605235

  15. Activation of Anthocyanin Biosynthesis in Gerbera hybrida (Asteraceae) Suggests Conserved Protein-Protein and Protein-Promoter Interactions between the Anciently Diverged Monocots and Eudicots1

    PubMed Central

    Elomaa, Paula; Uimari, Anne; Mehto, Merja; Albert, Victor A.; Laitinen, Roosa A.E.; Teeri, Teemu H.


    We have identified an R2R3-type MYB factor, GMYB10, from Gerbera hybrida (Asteraceae) that shares high sequence homology to and is phylogenetically grouped together with the previously characterized regulators of anthocyanin pigmentation in petunia (Petunia hybrida) and Arabidopsis. GMYB10 is able to induce anthocyanin pigmentation in transgenic tobacco (Nicotiana tabacum), especially in vegetative parts and anthers. In G. hybrida, GMYB10 is involved in activation of anthocyanin biosynthesis in leaves, floral stems, and flowers. In flowers, its expression is restricted to petal epidermal cell layers in correlation with the anthocyanin accumulation pattern. We have shown, using yeast (Saccharomyces cerevisiae) two-hybrid assay, that GMYB10 interacts with the previously isolated bHLH factor GMYC1. Particle bombardment analysis was used to show that GMYB10 is required for activation of a late anthocyanin biosynthetic gene promoter, PGDFR2. cis-Analysis of the target PGDFR2 revealed a sequence element with a key role in activation by GMYB10/GMYC1. This element shares high homology with the anthocyanin regulatory elements characterized in maize (Zea mays) anthocyanin promoters, suggesting that the regulatory mechanisms involved in activation of anthocyanin biosynthesis have been conserved for over 125 million years not only at the level of transcriptional regulators but also at the level of the biosynthetic gene promoters. PMID:14605235

  16. Mutations of Conserved Residues in the Major Homology Region Arrest Assembling HIV-1 Gag as a Membrane-Targeted Intermediate Containing Genomic RNA and Cellular Proteins

    PubMed Central

    Tanaka, Motoko; Robinson, Bridget A.; Chutiraka, Kasana; Geary, Clair D.; Reed, Jonathan C.


    ABSTRACT The major homology region (MHR) is a highly conserved motif that is found within the Gag protein of all orthoretroviruses and some retrotransposons. While it is widely accepted that the MHR is critical for assembly of HIV-1 and other retroviruses, how the MHR functions and why it is so highly conserved are not understood. Moreover, consensus is lacking on when HIV-1 MHR residues function during assembly. Here, we first addressed previous conflicting reports by confirming that MHR deletion, like conserved MHR residue substitution, leads to a dramatic reduction in particle production in human and nonhuman primate cells expressing HIV-1 proviruses. Next, we used biochemical analyses and immunoelectron microscopy to demonstrate that conserved residues in the MHR are required after assembling Gag has associated with genomic RNA, recruited critical host factors involved in assembly, and targeted to the plasma membrane. The exact point of inhibition at the plasma membrane differed depending on the specific mutation, with one MHR mutant arrested as a membrane-associated intermediate that is stable upon high-salt treatment and other MHR mutants arrested as labile, membrane-associated intermediates. Finally, we observed the same assembly-defective phenotypes when the MHR deletion or conserved MHR residue substitutions were engineered into Gag from a subtype B, lab-adapted provirus or Gag from a subtype C primary isolate that was codon optimized. Together, our data support a model in which MHR residues act just after membrane targeting, with some MHR residues promoting stability and another promoting multimerization of the membrane-targeted assembling Gag oligomer. IMPORTANCE The retroviral Gag protein exhibits extensive amino acid sequence variation overall; however, one region of Gag, termed the major homology region, is conserved among all retroviruses and even some yeast retrotransposons, although the reason for this conservation remains poorly understood. Highly

  17. The mitochondrial protein translocation motor: structural conservation between the human and yeast Tim14/Pam18-Tim16/Pam16 co-chaperones.


    Elsner, Shira; Simian, Dana; Iosefson, Ohad; Marom, Milit; Azem, Abdussalam


    Most of our knowledge regarding the process of protein import into mitochondria has come from research employing Saccharomyces cerevisiae as a model system. Recently, several mammalian homologues of the mitochondrial motor proteins were identified. Of particular interest for us is the human Tim14/Pam18-Tim16/Pam16 complex. We chose a structural approach in order to examine the evolutionary conservation between yeast Tim14/Pam18-Tim16/Pam16 proteins and their human homologues. For this purpose, we examined the structural properties of the purified human proteins and their interaction with their yeast homologues, in vitro. Our results show that the soluble domains of the human Tim14/Pam18 and Tim16/Pam16 proteins interact with their yeast counterparts, forming heterodimeric complexes and that these complexes interact with yeast mtHsp70. PMID:19564938

  18. The Mitochondrial Protein Translocation Motor: Structural Conservation between the Human and Yeast Tim14/Pam18-Tim16/Pam16 co-Chaperones

    PubMed Central

    Elsner, Shira; Simian, Dana; Iosefson, Ohad; Marom, Milit; Azem, Abdussalam


    Most of our knowledge regarding the process of protein import into mitochondria has come from research employing Saccharomyces cerevisiae as a model system. Recently, several mammalian homologues of the mitochondrial motor proteins were identified. Of particular interest for us is the human Tim14/Pam18-Tim16/Pam16 complex. We chose a structural approach in order to examine the evolutionary conservation between yeast Tim14/Pam18-Tim16/Pam16 proteins and their human homologues. For this purpose, we examined the structural properties of the purified human proteins and their interaction with their yeast homologues, in vitro. Our results show that the soluble domains of the human Tim14/Pam18 and Tim16/Pam16 proteins interact with their yeast counterparts, forming heterodimeric complexes and that these complexes interact with yeast mtHsp70. PMID:19564938

  19. Conserved charged residues in the leucine-rich repeat domain of the Ran GTPase activating protein are required for Ran binding and GTPase activation.

    PubMed Central

    Haberland, J; Gerke, V


    GTPase activating proteins (GAPs) for Ran, a Ras-related GTPase participating in nucleocytoplasmic transport, have been identified in different species ranging from yeast to man. All RanGAPs are characterized by a conserved domain consisting of eight leucine-rich repeats (LRRs) interrupted at two positions by so-called separating regions, the latter being unique for RanGAPs within the family of LRR proteins. The cytosolic RanGAP activity is essential for the Ran GTPase cycle which in turn provides directionality in nucleocytoplasmic transport, but the structural basis for the interaction between Ran and its GAP has not been elucidated. In order to gain a better understanding of this interaction we generated a number of mutant RanGAPs carrying amino acid substitutions in the LRR domain and analysed their complex formation with Ran as well as their ability to stimulate the intrinsic GTPase activity of the G protein. We show that conserved charged residues present in the separating regions of the LRR domain are indispensable for efficient Ran binding and GAP activity. These separating regions contain three conserved arginines which could possibly serve as catalytic residues similar to the arginine fingers identified in GAPs for other small GTPases. However, mutations in two of these arginines do not affect the GAP activity and replacement of the third conserved arginine (Arg91 in human RanGAP) severely interferes not only with GAP activity but also with Ran binding. This indicates that RanGAP-stimulated GTP hydrolysis on Ran does not involve a catalytic arginine residue but requires certain charged residues of the LRR domain of the GAP for mediating the protein-protein interaction. PMID:10527945

  20. A conserved arginine-containing motif crucial for the assembly and enzymatic activity of the mixed lineage leukemia protein-1 core complex.


    Patel, Anamika; Vought, Valarie E; Dharmarajan, Venkatasubramanian; Cosgrove, Michael S


    The mixed lineage leukemia protein-1 (MLL1) belongs to the SET1 family of histone H3 lysine 4 methyltransferases. Recent studies indicate that the catalytic subunits of SET1 family members are regulated by interaction with a conserved core group of proteins that include the WD repeat protein-5 (WDR5), retinoblastoma-binding protein-5 (RbBP5), and the absent small homeotic-2-like protein (Ash2L). It has been suggested that WDR5 functions to bridge the interactions between the catalytic and regulatory subunits of SET1 family complexes. However, the molecular details of these interactions are unknown. To gain insight into the interactions among these proteins, we have determined the biophysical basis for the interaction between the human WDR5 and MLL1. Our studies reveal that WDR5 preferentially recognizes a previously unidentified and conserved arginine-containing motif, called the "Win" or WDR5 interaction motif, which is located in the N-SET region of MLL1 and other SET1 family members. Surprisingly, our structural and functional studies show that WDR5 recognizes arginine 3765 of the MLL1 Win motif using the same arginine binding pocket on WDR5 that was previously shown to bind histone H3. We demonstrate that WDR5's recognition of arginine 3765 of MLL1 is essential for the assembly and enzymatic activity of the MLL1 core complex in vitro. PMID:18829457

  1. Functional homology of protein kinases required for sexual differentiation in Schizosaccharomyces pombe and Saccharomyces cerevisiae suggests a conserved signal transduction module in eukaryotic organisms.

    PubMed Central

    Neiman, A M; Stevenson, B J; Xu, H P; Sprague, G F; Herskowitz, I; Wigler, M; Marcus, S


    We present genetic evidence that three presumptive protein kinases of Schizosaccharomyces pombe, byr2, byr1, and spk1 that are structurally related to protein kinases of Saccharomyces cerevisiae, STE11, STE7, and FUS3, respectively, are also functionally related. In some cases, introduction of the heterologous protein kinase into a mutant was sufficient for complementation. In other cases (as in a ste11- mutant of S. cerevisiae), expression of two S. pombe protein kinases (byr2 and byr1) was required to observe complementation, suggesting that byr2 and byr1 act cooperatively. Complementation in S. pombe mutants is observed as restoration of sporulation and conjugation and in S. cerevisiae as restoration of conjugation, pheromone-induced cell cycle arrest, and pheromone-induced transcription of the FUS1 gene. We also show that the S. pombe kinases bear a similar relationship to the mating pheromone receptor apparatus as do their S. cerevisiae counterparts. Our results indicate that pheromone-induced signal transduction employs a conserved set of kinases in these two evolutionarily distant yeasts despite an apparently significant difference in function of the heterotrimeric G proteins. We suggest that the STE11/byr2, STE7/byr1, and FUS3/spk1 kinases comprise a signal transduction module that may be conserved in higher eukaryotes. Consistent with this hypothesis, we show that a mammalian mitogen-activated protein (MAP) kinase, ERK2, can partially replace spk1 function in S. pombe. Images PMID:8443406

  2. Conservation and antigenic cross-reactivity of the transferrin-binding proteins of Haemophilus influenzae, Actinobacillus pleuropneumoniae and Neisseria meningitidis.


    Holland, J; Parsons, T R; Hasan, A A; Cook, S M; Stevenson, P; Griffiths, E; Williams, P


    Haemophilus influenzae acquires iron from the iron-transporting glycoprotein transferrin via a receptor-mediated process. This involves two outer-membrane transferrin-binding proteins (Tbps) termed Tbp1 and Tbp2 which show considerable preference for the human form of transferrin. Since the Tbps are attracting considerable attention as potential vaccine components, we used transferrin affinity chromatography to examine their conservation amongst 28 H. influenzae type b strains belonging to different outer-membrane-protein subtypes as well as six non-typable strains. Whole cells of all type b and non-typable strains examined bound human transferrin; whilst most strains possessed a Tbp1 of approximately 105 kDa, the molecular mass of Tbp2 varied from 79 to 94 kDa. Antisera raised against affinity-purified native H. influenzae Tbp1/Tbp2 receptor complex cross-reacted on Western blots with the respective Tbps of all the Haemophilus strains examined. When used to probe Neisseria meningitidis Tbps, sera from each of four mice immunized with the Haemophilus Tbp1/2 complex recognized the 68 kDa Tbp2 of N. meningitidis strain B16B6 but not the 78 kDa Tbp2 of N. meningitidis strain 70942. Serum from one mouse also reacted weakly with Tbp1 of strain B16B6. Apart from a weak reaction with the Tbp2 of a serotype 5 strain, this mouse antiserum failed to recognize the Tbps of the porcine pathogen A. pleuropneumoniae. However, a monospecific polyclonal antiserum raised against the denatured Tbp2 of Neisseria meningitidis B16B6 recognized the Tbps of all Haemophilus and Actinobacillus strains examined. Since H. influenzae forms part of the natural flora of the upper respiratory tract, human sera were screened for the presence of antibodies to the Tbps. Sera from healthy adults contained antibodies which recognized both Tbp1 and Tbp2 from H. influenzae but not N. meningitidis. Convalescent sera from meningococcal meningitis patients contained antibodies which, on Western blots

  3. Microbial Relatives of the Seed Storage Proteins of Higher Plants: Conservation of Structure and Diversification of Function during Evolution of the Cupin Superfamily

    PubMed Central

    Dunwell, Jim M.; Khuri, Sawsan; Gane, Paul J.


    This review summarizes the recent discovery of the cupin superfamily (from the Latin term “cupa,” a small barrel) of functionally diverse proteins that initially were limited to several higher plant proteins such as seed storage proteins, germin (an oxalate oxidase), germin-like proteins, and auxin-binding protein. Knowledge of the three-dimensional structure of two vicilins, seed proteins with a characteristic β-barrel core, led to the identification of a small number of conserved residues and thence to the discovery of several microbial proteins which share these key amino acids. In particular, there is a highly conserved pattern of two histidine-containing motifs with a varied intermotif spacing. This cupin signature is found as a central component of many microbial proteins including certain types of phosphomannose isomerase, polyketide synthase, epimerase, and dioxygenase. In addition, the signature has been identified within the N-terminal effector domain in a subgroup of bacterial AraC transcription factors. As well as these single-domain cupins, this survey has identified other classes of two-domain bicupins including bacterial gentisate 1,2-dioxygenases and 1-hydroxy-2-naphthoate dioxygenases, fungal oxalate decarboxylases, and legume sucrose-binding proteins. Cupin evolution is discussed from the perspective of the structure-function relationships, using data from the genomes of several prokaryotes, especially Bacillus subtilis. Many of these functions involve aspects of sugar metabolism and cell wall synthesis and are concerned with responses to abiotic stress such as heat, desiccation, or starvation. Particular emphasis is also given to the oxalate-degrading enzymes from microbes, their biological significance, and their value in a range of medical and other applications. PMID:10704478

  4. The conserved helicase motifs of the herpes simplex virus type 1 origin-binding protein UL9 are important for function.

    PubMed Central

    Martinez, R; Shao, L; Weller, S K


    The UL9 gene of herpes simplex virus encodes a protein that specifically recognizes sequences within the viral origins of replication and exhibits helicase and DNA-dependent ATPase activities. The specific DNA binding domain of the UL9 protein was localized to the carboxy-terminal one-third of the molecule (H. M. Weir, J. M. Calder, and N. D. Stow, Nucleic Acids Res. 17:1409-1425, 1989). The N-terminal two-thirds of the UL9 gene contains six sequence motifs found in all members of a superfamily of DNA and RNA helicases, suggesting that this region may be important for helicase activity of UL9. In this report, we examined the functional significance of these six motifs for the UL9 protein through the introduction of site-specific mutations resulting in single amino acid substitutions of the most highly conserved residues within each motif. An in vivo complementation test was used to study the effect of each mutation on the function of the UL9 protein in viral DNA replication. In this assay, a mutant UL9 protein expressed from a transfected plasmid is used to complement a replication-deficient null mutant in the UL9 gene for the amplification of herpes simplex virus origin-containing plasmids. Mutations in five of the six conserved motifs inactivated the function of the UL9 protein in viral DNA replication, providing direct evidence for the importance of these conserved motifs. Insertion mutants resulting in the introduction of two alanines at 100-residue intervals in regions outside the conserved motifs were also constructed. Three of the insertion mutations were tolerated, whereas the other five abolished UL9 function. These data indicate that other regions of the protein, in addition to the helicase motifs, are important for function in vivo. Several mutations result in instability of the mutant products, presumably because of conformational changes in the protein. Taken together, these results suggest that UL9 is very sensitive to mutations with respect to both

  5. Isolation of the mouse (MFH-1) and human (FKHL14) mesenchyme fork head-1 genes reveals conservation of their gene and protein structures

    SciTech Connect

    Miura, Naoyuki; Iida, Kiyoshi; Yang, Xiao-Li


    The very recently found evolutionarily conserved DNA-binding domain of 100 amino acids, termed the fork head domain, emerged from a sequence comparison of the rat hepatocyte transcription factor HNF-3{alpha} and the homeotic gene fork head of Drosophila. We previously isolated a new member of this family, the mesenchyme fork head-1 (MFH-1) gene, which is expressed in developing mesenchyme. Here we describe the isolation of the mouse (MFH-1) and human (FKHL14) chromosomal MFH-1 genes and the determination of the gene and protein structures of MFH-1. We found that the MFH-1 gene has no introns and that the identity of the amino acid sequences of mouse and human MFH-1 proteins is 94%. We also investigated the transcriptional activity of the mouse and human MFH-1 proteins and found that both proteins act as positive transactivators. 31 refs., 3 figs.

  6. The chicken FMR1 gene is highly conserved with a CCT 5{prime} - untranslated repeat and encodes an RNA-binding protein

    SciTech Connect

    Price, D.K.; Zhang, F.; Ashley, C.T. Jr.; Warren, S.T.


    The transcriptional silencing of the human gene, fragile X metal retardation 1 (FMR1), is due to abnormal methylation in response to an expanded 5{prime}-untranslated CGG trinucleotide repeat and accounts for most cases of fragile X syndrome, a frequent inherited form of metal retardation. Although the encoded fragile X mental retardation protein (FMRP) is known to have properties of a RNA-binding protein, the precise function of FMRP remains to be elucidated. We report the cloning of the chicken homolog of FMR1 and show strong evolutionary conservation, with nucleotide and amino acid identities of 85 and 92%, respectively, between chicken and human. In place of the mammalian CGG trinucleotide repeat, a 99-nt tripartite repetitive element containing a CCT trinucleotide repeat flanked on both sides by dinucleotide repeats was identified. Blocks of highly conserved 3{prime}-untranslated sequence were also found. Within the coding region, two copies each of the highly conserved K homology motif and the Arg-Gly-Gly (RGG) box motif, both ribonucleotide particle family domains implicated in RNA binding, were identified. Chicken FMRP was found to bind RNA in vitro, and this activity correlated with the presence of the carboxy-terminal portion of the protein that includes the RGG motifs. 49 refs., 7 figs.

  7. Characterization of the Dictyostelium homolog of chromatin binding protein DET1 suggests a conserved pathway regulating cell type specification and developmental plasticity.


    Dubin, Manu J; Kasten, Sonja; Nellen, Wolfgang


    DET1 (De-etiolated 1) is a chromatin binding protein involved in developmental regulation in both plants and animals. DET1 is largely restricted to multicellular eukaryotes, and here we report the characterization of a DET1 homolog from the social amoeba Dictyostelium discoideum. As in other species, Dictyostelium DET1 is nuclear localized. In contrast to other species, where it is an essential protein, loss of DET1 is nonlethal in Dictyostelium, although viability is significantly reduced. The phenotype of the det1(-) mutant is highly pleiotropic and results in a large degree of heterogeneity in developmental parameters. Loss of DET1 results in delayed and abnormal development with enlarged aggregation territories. Mutant slugs displayed cell type patterning with a bias toward the prestalk pathway. A number of DET1-interacting proteins are conserved in Dictyostelium, and the apparently conserved role of DET1 in regulatory pathways involving the bZIP transcription factors DimB, c-Jun, and HY5 suggests a highly conserved mechanism regulating development in multicellular eukaryotes. While the mechanism by which DET1 functions is unclear, it appears that it has a key role in regulation of developmental plasticity and integration of information on environmental conditions into the developmental program of an organism. PMID:21193547

  8. MVA Vectors Expressing Conserved Influenza Proteins Protect Mice against Lethal Challenge with H5N1, H9N2 and H7N1 Viruses

    PubMed Central

    Hessel, Annett; Savidis-Dacho, Helga; Coulibaly, Sogue; Portsmouth, Daniel; Kreil, Thomas R.; Crowe, Brian A.; Schwendinger, Michael G.; Pilz, Andreas; Barrett, P. Noel; Falkner, Falko G.; Schäfer, Birgit


    Background The availability of a universal influenza vaccine able to induce broad cross-reactive immune responses against diverse influenza viruses would provide an alternative to currently available strain-specific vaccines. We evaluated the ability of vectors based on modified vaccinia virus Ankara (MVA) expressing conserved influenza proteins to protect mice against lethal challenge with multiple influenza subtypes. Methods Mice were immunized with MVA vectors expressing H5N1-derived nucleoprotein (NP), the stem region of hemagglutinin (HA), matrix proteins 1 and 2 (M1 and M2), the viral polymerase basic protein 1 (PB1), or the HA stem fused to a quadrivalent matrix protein 2 extracellular domain (M2e). Immunized mice were challenged with lethal doses of H5N1, H7N1 or H9N2 virus and monitored for disease symptoms and weight loss. To investigate the influence of previous exposure to influenza virus on protective immune responses induced by conserved influenza proteins, mice were infected with pandemic H1N1 virus (H1N1pdm09) prior to immunization and subsequently challenged with H5N1 virus. Antibody and T cell responses were assessed by ELISA and flow cytometry, respectively. Results MVA vectors expressing NP alone, or co-expressed with other conserved influenza proteins, protected mice against lethal challenge with H5N1, H7N1 or H9N2 virus. Pre-exposure to H1N1pdm09 increased protective efficacy against lethal H5N1 challenge. None of the other conserved influenza proteins provided significant levels of protection against lethal challenge. NP-expressing vectors induced high numbers of influenza-specific CD4+ and CD8+ T cells and high titer influenza-specific antibody responses. Higher influenza-specific CD4+ T cell responses and NP-specific CD8+ T cell responses were associated with increased protective efficacy. Conclusions MVA vectors expressing influenza NP protect mice against lethal challenge with H5N1, H7N1 and H9N2 viruses by a mechanism involving influenza

  9. Monoclonal Antibodies Directed against Conserved Epitopes on the Nucleocapsid Protein and the Major Envelope Glycoprotein of Equine Arteritis Virus

    PubMed Central

    Weiland, Emilie; Bolz, Sylvia; Weiland, Frank; Herbst, Werner; Raamsman, Martin J. B.; Rottier, Peter J. M.; De Vries, Antoine A. F.


    We recently developed a highly effective immunization procedure for the generation of monoclonal antibodies (MAbs) directed against the porcine reproductive and respiratory syndrome virus (E. Weiland, M. Wieczorek-Krohmer, D. Kohl, K. K. Conzelmann, and F. Weiland, Vet. Microbiol. 66:171–186, 1999). The same method was used to produce a panel of 16 MAbs specific for the equine arteritis virus (EAV). Ten MAbs were directed against the EAV nucleocapsid (N) protein, and five MAbs recognized the major viral envelope glycoprotein (GL). Two of the EAV GL-specific MAbs and one antibody of unknown specificity neutralized virus infectivity. A comparison of the reactivities of the MAbs with 1 U.S. and 22 newly obtained European field isolates of EAV demonstrated that all N-specific MAbs, the three nonneutralizing anti-GL MAbs, and the weakest neutralizing MAb (MAb E7/d15-c9) recognized conserved epitopes. In contrast, the two MAbs with the highest neutralization titers bound to 17 of 23 (MAb E6/A3) and 10 of 23 (MAb E7/d15-c1) of the field isolates. Ten of the virus isolates reacted with only one of these two MAbs, indicating that they recognized different epitopes. The GL-specific MAbs and the strongly neutralizing MAb of unknown specificity (MAb E6/A3) were used for the selection of neutralization-resistant (NR) virus variants. The observation that the E6/A3-specific NR virus variants were neutralized by MAb E7/d15-c1 and that MAb E6/A3 blocked the infectivity of the E7/d15-c1-specific NR escape mutant confirmed that these antibodies reacted with distinct antigenic sites. Immunoelectron microscopy revealed for the first time that the antigenic determinants recognized by the anti-GL MAbs were localized on the virion surface. Surprisingly, although the immunofluorescence signal obtained with the neutralizing antibodies was relatively weak, they mediated binding of about three times as much gold granules to the viral envelope than the nonneutralizing anti-GL MAbs. PMID

  10. Characterization of chicken octamer-binding proteins demonstrates that POU domain-containing homeobox transcription factors have been highly conserved during vertebrate evolution

    SciTech Connect

    Petryniak, B.; Postema, C.E.; McCormack, W.T.; Thompson, C.B. ); Staudt, L.M. )


    The DNA sequence motif ATTTGCAT (octamer) or its inverse complement has been identified as an evolutionarily conserved element in the promoter region of immunoglobulin genes. Two major DNA-binding proteins that bind in a sequence-specific manner to the octamer DNA sequence have been identified in mammalian species--a ubiquitously expressed protein (Oct-1) and a lymphoid-specific protein (Oct-2). During characterization of the promoter region of the chicken immunoglobulin light chain gene, the authors identified two homologous octamer-binding proteins in chicken B cells. when the cloning of the human gene for Oct-2 revealed it to be a member of a distinct family of homeobox genes, they sought to determine if the human Oct-2 cDNA could be used to identify homologous chicken homeobox genes. Using a human Oct-2 homeobox-specific DNA probe, they were able to identify 6-10 homeobox-containing genes in the chicken genome, demonstrating that the Oct-2-related subfamily of homeobox genes exists in avian species. DNA sequence analysis revealed it to be the chicken homologue of the human Oct-1 gene. Together, the data show that the POU-containing subfamily of homeobox genes have been highly conserved during vertebrate evolution, apparently as a result of selection for their DNA-binding and transcriptional regulatory properties.

  11. A conserved role for the zinc finger polyadenosine RNA binding protein, ZC3H14, in control of poly(A) tail length

    PubMed Central

    Kelly, Seth M.; Leung, Sara W.; Pak, ChangHui; Banerjee, Ayan; Moberg, Kenneth H.; Corbett, Anita H.


    The ZC3H14 gene, which encodes a ubiquitously expressed, evolutionarily conserved, nuclear, zinc finger polyadenosine RNA-binding protein, was recently linked to autosomal recessive, nonsyndromic intellectual disability. Although studies have been carried out to examine the function of putative orthologs of ZC3H14 in Saccharomyces cerevisiae, where the protein is termed Nab2, and Drosophila, where the protein has been designated dNab2, little is known about the function of mammalian ZC3H14. Work from both budding yeast and flies implicates Nab2/dNab2 in poly(A) tail length control, while a role in poly(A) RNA export from the nucleus has been reported only for budding yeast. Here we provide the first functional characterization of ZC3H14. Analysis of ZC3H14 function in a neuronal cell line as well as in vivo complementation studies in a Drosophila model identify a role for ZC3H14 in proper control of poly(A) tail length in neuronal cells. Furthermore, we show here that human ZC3H14 can functionally substitute for dNab2 in fly neurons and can rescue defects in development and locomotion that are present in dNab2 null flies. These rescue experiments provide evidence that this zinc finger-containing class of nuclear polyadenosine RNA-binding proteins plays an evolutionarily conserved role in controlling the length of the poly(A) tail in neurons. PMID:24671764

  12. Complex metabolic phenotypes caused by a mutation in yjgF, encoding a member of the highly conserved YER057c/YjgF family of proteins.


    Enos-Berlage, J L; Langendorf, M J; Downs, D M


    The oxidative pentose phosphate pathway is required for function of the alternative pyrimidine biosynthetic pathway, a pathway that allows thiamine synthesis in the absence of the PurF enzyme in Salmonella typhimurium. Mutants that no longer required function of the oxidative pentose phosphate pathway for thiamine synthesis were isolated. Further phenotypic analyses of these mutants demonstrated that they were also sensitive to the presence of serine in the medium, suggesting a partial defect in isoleucine biosynthesis. Genetic characterization showed that these pleiotropic phenotypes were caused by null mutations in yjgF, a previously uncharacterized open reading frame encoding a hypothetical 13.5-kDa protein. The YjgF protein belongs to a class of proteins of unknown function that exhibit striking conservation across a wide range of organisms, from bacteria to humans. This work represents the first detailed phenotypic characterization of yjgF mutants in any organism and provides important clues as to the function of this highly conserved class of proteins. Results also suggest a connection between function of the isoleucine biosynthetic pathway and the requirement for the pentose phosphate pathway in thiamine synthesis. PMID:9851994

  13. The black-pearl gene of Drosophila defines a novel conserved protein family and is required for larval growth and survival.


    Becker, S; Gehrsitz, A; Bork, P; Buchner, S; Buchner, E


    Using a transposon insertion line of the Drosophila Genome Project we have cloned the black-pearl gene (blp), analyzed cDNA clones, generated various mutants, and characterized their phenotypes. The blp gene codes for a protein of 15.7 kDa calculated molecular weight that has been conserved from yeast to plants and mammals with high homology. A domain of these new proteins shows distant similarity to DnaJ domains indicating a functionally relevant interaction with other proteins. The P element insertion in line P1539 lies within the 5' untranslated leader of the black-pearl gene. Flies homozygous for this insertion are semi-lethal, escapers produce very few offspring and show melanotic inclusions in the hemocoel ('black pearls') similar to various melanotic 'tumor' mutants. Two small deletions confined to the blp gene and two EMS-induced mutations are homozygous lethal. These null mutants appear normal up to a prolonged first instar larval stage but fail to grow and die. Thus in Drosophila the blp gene is specifically required for larval growth. The evolutionary conservation in both unicellular and multicellular organisms suggests for the new protein family described here a fundamental role in cell growth. PMID:11179663

  14. The Replacement of 10 Non-Conserved Residues in the Core Protein of JFH-1 Hepatitis C Virus Improves Its Assembly and Secretion

    PubMed Central

    Etienne, Loïc; Blanchard, Emmanuelle; Boyer, Audrey; Desvignes, Virginie; Gaillard, Julien; Meunier, Jean-Christophe; Roingeard, Philippe; Hourioux, Christophe


    Hepatitis C virus (HCV) assembly is still poorly understood. It is thought that trafficking of the HCV core protein to the lipid droplet (LD) surface is essential for its multimerization and association with newly synthesized HCV RNA to form the viral nucleocapsid. We carried out a mapping analysis of several complete HCV genomes of all genotypes, and found that the genotype 2 JFH-1 core protein contained 10 residues different from those of other genotypes. The replacement of these 10 residues of the JFH-1 strain sequence with the most conserved residues deduced from sequence alignments greatly increased virus production. Confocal microscopy of the modified JFH-1 strain in cell culture showed that the mutated JFH-1 core protein, C10M, was present mostly at the endoplasmic reticulum (ER) membrane, but not at the surface of the LDs, even though its trafficking to these organelles was possible. The non-structural 5A protein of HCV was also redirected to ER membranes and colocalized with the C10M core protein. Using a Semliki forest virus vector to overproduce core protein, we demonstrated that the C10M core protein was able to form HCV-like particles, unlike the native JFH-1 core protein. Thus, the substitution of a few selected residues in the JFH-1 core protein modified the subcellular distribution and assembly properties of the protein. These findings suggest that the early steps of HCV assembly occur at the ER membrane rather than at the LD surface. The C10M-JFH-1 strain will be a valuable tool for further studies of HCV morphogenesis. PMID:26339783

  15. Conservation of the gene for outer membrane protein OprF in the family Pseudomonadaceae: sequence of the Pseudomonas syringae oprF gene.

    PubMed Central

    Ullstrom, C A; Siehnel, R; Woodruff, W; Steinbach, S; Hancock, R E


    The conservation of the oprF gene for the major outer membrane protein OprF was determined by restriction mapping and Southern blot hybridization with the Pseudomonas aeruginosa oprF gene as a probe. The restriction map was highly conserved among 16 of the 17 serotype strains and 42 clinical isolates of P. aeruginosa. Only the serotype 12 isolate and one clinical isolate showed small differences in restriction pattern. Southern probing of PstI chromosomal digests of 14 species from the family Pseudomonadaceae revealed that only the nine members of rRNA homology group I hybridized with the oprF gene. To reveal the actual extent of homology, the oprF gene and its product were characterized in Pseudomonas syringae. Nine strains of P. syringae from seven different pathovars hybridized with the P. aeruginosa gene to produce five different but related restriction maps. All produced an OprF protein in their outer membranes with the same apparent molecular weight as that of P.aeruginosa OprF. In each case the protein reacted with monoclonal antibody MA4-10 and was similarly heat and 2-mercaptoethanol modifiable. The purified OprF protein of the type strain P. syringae pv. syringae ATCC 19310 reconstituted small channels in lipid bilayer membranes. The oprF gene from this latter strain was cloned and sequenced. Despite the low level of DNA hybridization between P. aeruginosa and P. syringae DNA, the OprF gene was highly conserved between the species with 72% DNA sequence identity and 68% amino acid sequence identity overall. The carboxy terminus-encoding region of P. syringae oprF showed 85 and 33% identity, respectively, with the same regions of the P. aeruginosa oprF and Escherichia coli ompA genes. Images PMID:1898935

  16. The Moraxella catarrhalis immunoglobulin D-binding protein MID has conserved sequences and is regulated by a mechanism corresponding to phase variation.


    Möllenkvist, Andrea; Nordström, Therése; Halldén, Christer; Christensen, Jens Jørgen; Forsgren, Arne; Riesbeck, Kristian


    The prevalence of the Moraxella catarrhalis immunoglobulin D (IgD)-binding outer membrane protein MID and its gene was determined in 91 clinical isolates and in 7 culture collection strains. Eighty-four percent of the clinical Moraxella strains expressed MID-dependent IgD binding. The mid gene was detected in all strains as revealed by homology of the signal peptide sequence and a conserved area in the 3' end of the gene. When MID proteins from five different strains were compared, an identity of 65.3 to 85.0% and a similarity of 71.2 to 89.1% were detected. Gene analyses showed several amino acid repeat motifs in the open reading frames, and MID could be called a putative autotransport protein. Interestingly, homopolymeric [polyguanine [poly(G)

  17. Conservation of major and minor jelly-roll capsid proteins in Polinton (Maverick) transposons suggests that they are bona fide viruses

    PubMed Central


    Reviewers This article was reviewed by Lakshminarayan M. Iyer and I. King Jordan. For complete reviews, see the Reviewers’ Reports section. Polintons (also known as Mavericks) and Tlr elements of Tetrahymena thermophila represent two families of large DNA transposons widespread in eukaryotes. Here, we show that both Polintons and Tlr elements encode two key virion proteins, the major capsid protein with the double jelly-roll fold and the minor capsid protein, known as the penton, with the single jelly-roll topology. This observation along with the previously noted conservation of the genes for viral genome packaging ATPase and adenovirus-like protease strongly suggests that Polintons and Tlr elements combine features of bona fide viruses and transposons. We propose the name ‘Polintoviruses’ to denote these putative viruses that could have played a central role in the evolution of several groups of DNA viruses of eukaryotes. PMID:24773695

  18. The structure of avian polyomavirus reveals variably sized capsids, non-conserved inter-capsomere interactions, and a possible location of the minor capsid protein VP4

    SciTech Connect

    Shen, Peter S.; Enderlein, Dirk; Nelson, Christian D.S.; Carter, Weston S.; Kawano, Masaaki; Xing Li; Swenson, Robert D.; Olson, Norman H.; Baker, Timothy S.; Cheng, R. Holland; Atwood, Walter J.; Johne, Reimar; Belnap, David M.


    Avian polyomavirus (APV) causes a fatal, multi-organ disease among several bird species. Using cryogenic electron microscopy and other biochemical techniques, we investigated the structure of APV and compared it to that of mammalian polyomaviruses, particularly JC polyomavirus and simian virus 40. The structure of the pentameric major capsid protein (VP1) is mostly conserved; however, APV VP1 has a unique, truncated C-terminus that eliminates an intercapsomere-connecting {beta}-hairpin observed in other polyomaviruses. We postulate that the terminal {beta}-hairpin locks other polyomavirus capsids in a stable conformation and that absence of the hairpin leads to the observed capsid size variation in APV. Plug-like density features were observed at the base of the VP1 pentamers, consistent with the known location of minor capsid proteins VP2 and VP3. However, the plug density is more prominent in APV and may include VP4, a minor capsid protein unique to bird polyomaviruses.

  19. Low sequence identity but high structural and functional conservation: The case of Hsp70/Hsp90 organizing protein (Hop/Sti1) of Leishmania braziliensis.


    Batista, Fernanda A H; Seraphim, Thiago V; Santos, Clelton A; Gonzaga, Marisvanda R; Barbosa, Leandro R S; Ramos, Carlos H I; Borges, Júlio C


    Parasites belonging to the genus Leishmania are subjected to extensive environmental changes during their life cycle; molecular chaperones/co-chaperones act as protagonists in this scenario to maintain cellular homeostasis. Hop/Sti1 is a co-chaperone that connects the Hsp90 and Hsp70 systems, modulating their ATPase activities and affecting the fate of client proteins because it facilitates their transfer from the Hsp70 to the Hsp90 chaperone. Hop/Sti1 is one of the most prevalent co-chaperones, highlighting its importance despite the relatively low sequence identity among orthologue proteins. This multi-domain protein comprises three tetratricopeptides domains (TPR1, TPR2A and TPR2B) and two Asp/Pro-rich domains. Given the importance of Hop/Sti1 for the chaperone system and for Leishmania protozoa viability, the Leishmania braziliensis Hop (LbHop) and a truncated mutant (LbHop(TPR2AB)) were characterized. Structurally, both proteins are α-helix-rich and highly elongated monomeric proteins. Functionally, they inhibited the ATPase activity of Leishmania braziliensis Hsp90 (LbHsp90) to a similar extent, and the thermodynamic parameters of their interactions with LbHsp90 were similar, indicating that TPR2A-TPR2B forms the functional center for the LbHop interaction with LbHsp90. These results highlight the structural and functional similarity of Hop/Sti1 proteins, despite their low sequence conservation compared to the Hsp70 and Hsp90 systems, which are phylogenetic highly conserved. PMID:27103305

  20. The Arabidopsis Protein CONSERVED ONLY IN THE GREEN LINEAGE160 Promotes the Assembly of the Membranous Part of the Chloroplast ATP Synthase[W

    PubMed Central

    Rühle, Thilo; Razeghi, Jafar Angouri; Vamvaka, Evgenia; Viola, Stefania; Gandini, Chiara; Kleine, Tatjana; Schünemann, Danja; Barbato, Roberto; Jahns, Peter; Leister, Dario


    The chloroplast F1Fo-ATP synthase/ATPase (cpATPase) couples ATP synthesis to the light-driven electrochemical proton gradient. The cpATPase is a multiprotein complex and consists of a membrane-spanning protein channel (comprising subunit types a, b, b′, and c) and a peripheral domain (subunits α, β, γ, δ, and ε). We report the characterization of the Arabidopsis (Arabidopsis thaliana) CONSERVED ONLY IN THE GREEN LINEAGE160 (AtCGL160) protein (AtCGL160), conserved in green algae and plants. AtCGL160 is an integral thylakoid protein, and its carboxyl-terminal portion is distantly related to prokaryotic ATP SYNTHASE PROTEIN1 (Atp1/UncI) proteins that are thought to function in ATP synthase assembly. Plants without AtCGL160 display an increase in xanthophyll cycle activity and energy-dependent nonphotochemical quenching. These photosynthetic perturbations can be attributed to a severe reduction in cpATPase levels that result in increased acidification of the thylakoid lumen. AtCGL160 is not an integral cpATPase component but is specifically required for the efficient incorporation of the c-subunit into the cpATPase. AtCGL160, as well as a chimeric protein containing the amino-terminal part of AtCGL160 and Synechocystis sp. PCC6803 Atp1, physically interact with the c-subunit. We conclude that AtCGL160 and Atp1 facilitate the assembly of the membranous part of the cpATPase in their hosts, but loss of their functions provokes a unique compensatory response in each organism. PMID:24664203

  1. Cyclin-dependent kinase-like function is shared by the beta- and gamma- subset of the conserved herpesvirus protein kinases.


    Kuny, Chad V; Chinchilla, Karen; Culbertson, Michael R; Kalejta, Robert F


    The UL97 protein of human cytomegalovirus (HCMV, or HHV-5 (human herpesvirus 5)), is a kinase that phosphorylates the cellular retinoblastoma (Rb) tumor suppressor and lamin A/C proteins that are also substrates of cellular cyclin-dependent kinases (Cdks). A functional complementation assay has further shown that UL97 has authentic Cdk-like activity. The other seven human herpesviruses each encode a kinase with sequence and positional homology to UL97. These UL97-homologous proteins have been termed the conserved herpesvirus protein kinases (CHPKs) to distinguish them from other human herpesvirus-encoded kinases. To determine if the Cdk-like activities of UL97 were shared by all of the CHPKs, we individually expressed epitope-tagged alleles of each protein in human Saos-2 cells to test for Rb phosphorylation, human U-2 OS cells to monitor nuclear lamina disruption and lamin A phosphorylation, or S. cerevisiae cdc28-13 mutant cells to directly assay for Cdk function. We found that the ability to phosphorylate Rb and lamin A, and to disrupt the nuclear lamina, was shared by all CHPKs from the beta- and gamma-herpesvirus families, but not by their alpha-herpesvirus homologs. Similarly, all but one of the beta and gamma CHPKs displayed bona fide Cdk activity in S. cerevisiae, while the alpha proteins did not. Thus, we have identified novel virally-encoded Cdk-like kinases, a nomenclature we abbreviate as v-Cdks. Interestingly, we found that other, non-Cdk-related activities reported for UL97 (dispersion of promyelocytic leukemia protein nuclear bodies (PML-NBs) and disruption of cytoplasmic or nuclear aggresomes) showed weak conservation among the CHPKs that, in general, did not segregate to specific viral families. Therefore, the genomic and evolutionary conservation of these kinases has not been fully maintained at the functional level. Our data indicate that these related kinases, some of which are targets of approved or developmental antiviral drugs, are likely to

  2. NO66, a Highly Conserved Dual Location Protein in the Nucleolus and in a Special Type of Synchronously Replicating ChromatinD⃞

    PubMed Central

    Eilbracht, Jens; Reichenzeller, Michaela; Hergt, Michaela; Schnölzer, Martina; Heid, Hans; Stöhr, Michael; Franke, Werner W.; Schmidt-Zachmann, Marion S.


    It has recently become clear that the nucleolus, the most prominent nuclear subcompartment, harbors diverse functions beyond its classic role in ribosome biogenesis. To gain insight into nucleolar functions, we have purified amplified nucleoli from Xenopus laevis oocytes using a novel approach involving fluorescence-activated cell sorting techniques. The resulting protein fraction was analyzed by mass spectrometry and used for the generation of monoclonal antibodies directed against nucleolar components. Here, we report the identification and molecular characterization of a novel, ubiquitous protein, which in most cell types appears to be a constitutive nucleolar component. Immunolocalization studies have revealed that this protein, termed NO66, is highly conserved during evolution and shows in most cells analyzed a dual localization pattern, i.e., a strong enrichment in the granular part of nucleoli and in distinct nucleoplasmic entities. Colocalizations with proteins Ki-67, HP1α, and PCNA, respectively, have further shown that the staining pattern of NO66 overlaps with certain clusters of late replicating chromatin. Biochemical experiments have revealed that protein NO66 cofractionates with large preribosomal particles but is absent from cytoplasmic ribosomes. We propose that in addition to its role in ribosome biogenesis protein NO66 has functions in the replication or remodeling of certain heterochromatic regions. PMID:14742713

  3. Autoantibodies define a family of proteins with conserved double-stranded RNA-binding domains as well as DNA binding activity.


    Satoh, M; Shaheen, V M; Kao, P N; Okano, T; Shaw, M; Yoshida, H; Richards, H B; Reeves, W H


    Cellular responses to viral infection are signaled by double-stranded (ds) RNA, which is not found in substantial amounts in uninfected cells. Although cellular dsRNA-binding proteins have been described, their characterization is incomplete. We show that dsRNA-binding proteins are prominent autoantigens. Sera from B6 and B10.S mice with pristane-induced lupus and human autoimmune sera immunoprecipitated a novel set of 130-, 110-, 90-, 80-, and 45-kDa proteins. The proteins were all major cellular poly(IC)-binding factors. N-terminal amino acid sequences of p110 and p90 were identical and matched nuclear factor (NF) 90 and M phase phosphoprotein 4. p45 and p90 were identified as the NF45.NF90 complex, which binds the interleukin-2 promoter as well as certain highly structured viral RNAs. NF90.NF45 and M phase phosphoprotein 4 belong to a large group of proteins with conserved dsRNA-binding motifs. Besides binding dsRNA, NF90.NF45, p110, and p130 had single-stranded and dsDNA binding activity. Some sera contained autoantibodies whose binding was inhibited by poly(IC) but not single-stranded DNA or vice versa, suggesting that the DNA- and RNA-binding sites are different. These autoantibodies will be useful probes of the function of dsRNA-binding proteins. Their interaction with dsRNA, an immunological adjuvant, also could promote autoimmunity. PMID:10574923

  4. Conserved epitope on several human vitamin K-dependent proteins: location of the antigenic site and influence of metal ions on antibody binding

    SciTech Connect

    Church, W.R.; Messier, T.; Howard, P.R.; Amiral, J.; Meyer, D.; Mann, K.G.


    A murine monoclonal antibody (designated H-11) produced by injecting mice with purified human protein C was found to bind several human vitamin K-dependent proteins. Using a solid-phase competitive radioimmunoassay with antibody immobilized onto microtiter plates, binding of /sup 125/I-labeled protein C to the antibody was inhibited by increasing amounts of protein C, prothrombin, and Factors X and VII over a concentration range of 1 x 10/sup -8/ to 1 x 10/sup -6/ M. Chemical treatment of prothrombin with a variety of agents did not destroy the antigenic site recognized by the antibody as measured by immunoblotting of prothrombin or prothrombin derivative immobilized onto nitrocellulose. Immunoblotting of purified vitamin K-dependent polypeptides with the monoclonal antibody following sodium dodecyl sulfate-polyacrylamide gel electrophoresis and electrophoretic transfer to nitrocellulose indicated that the antigenic site was found on the light chains of protein C and Factor X. The exact location of the antigenic determinant for antibody H-11 was established using synthetic peptides. Comparison of protein sequences of bovine and human vitamin K-dependent proteins suggests that the sequence Phe-Leu-Glu-Glu-Xaa-Arg/Lys is required for antibody binding. Increasing concentrations of Ca/sup 2 +/, Mg/sup 2 +/, or Mn/sup 2 +/ partially inhibited binding of /sup 125/I-protein C to the antibody in a solid-phase assay system with half-maximal binding observed at divalent metal ion concentrations of 2, 4, and 0.6 mM, respectively. The antigenic site thus recognized by monoclonal antibody H-11 is located at the amino-terminal region in the highly conserved ..gamma..-carboxyglutamic acid-containing domains of several, but not all, vitamin K-dependent proteins.

  5. Sequence conservation in the Ancylostoma secreted protein-2 of Necator americanus (Na-ASP-2) from hookworm infected individuals in Thailand.


    Ungcharoensuk, Charoenchai; Putaporntip, Chaturong; Pattanawong, Urassaya; Jongwutiwes, Somchai


    The Ancylostoma secreted protein-2 of Necator americanus (Na-ASP-2) was one of the promising vaccine candidates against the most prevalent human hookworm species as adverse vaccine reaction has compromised further human vaccine trials. To elucidate the gene structure and the extent of sequence diversity, we determined the complete nucleotide sequence of the Na-asp-2 gene of individual larvae from 32 infected subjects living in 3 different endemic areas of Thailand. Sequence analysis revealed that the gene encoding Na-ASP-2 comprised 8 exons. Of 3 nucleotide substitutions in these exons, only one causes an amino acid change from leucine to methionine. A consensus conserved GT and AG at the 5' and the 3' boundaries of each intron was observed akin to those found in other eukaryotic genes. Introns of Na-asp-2 contained 23 nucleotide substitutions and 0-18 indels. The mean number of nucleotide substitutions per site (d) in introns was not significantly different from the mean number of synonymous substitutions per synonymous site (d(S)) in exons whereas d in introns was significantly exceeded d(N) (the mean number of nonsynonymous substitutions per nonsynonymous site) in exons (p<0.05), suggesting that introns and synonymous sites in exons may evolve at a similar rate whereas functional constraints at the amino acid could limit amino acid substitutions in Na-ASP-2. A recombination site was identified in an intron near the 3' portion of the gene. The positions of introns and the intron phases in the Na-asp-2 gene comparing with those in other pathogenesis-related-1 proteins of Loa loa, Onchocerca volvulus, Heterodera glycines, Caenorhabditis elegans and human were relatively conserved, suggesting evolutionary conservation of these genes. Sequence conservation in Na-ASP-2 may not compromise further vaccine design if adverse vaccine effects could be resolved whereas microheterogeneity in introns of this locus may be useful for population genetics analysis of N. americanus

  6. The crystal structure of human IRE1 luminal domain reveals a conserved dimerization interface required for activation of the unfolded protein response

    SciTech Connect

    Zhou, Jiahai; Liu, Chuan Yin; Back, Sung Hoon; Clark, Robert L.; Peisach, Daniel; Xu, Zhaohui; Kaufman, Randal J.


    The unfolded protein response (UPR) is an evolutionarily conserved mechanism by which all eukaryotic cells adapt to the accumulation of unfolded proteins in the endoplasmic reticulum (ER). Inositol-requiring kinase 1 (IRE1) and PKR-related ER kinase (PERK) are two type I transmembrane ER-localized protein kinase receptors that signal the UPR through a process that involves homodimerization and autophosphorylation. To elucidate the molecular basis of the ER transmembrane signaling event, we determined the x-ray crystal structure of the luminal domain of human IRE1{alpha}. The monomer of the luminal domain comprises a unique fold of a triangular assembly of {beta}-sheet clusters. Structural analysis identified an extensive dimerization interface stabilized by hydrogen bonds and hydrophobic interactions. Dimerization creates an MHC-like groove at the interface. However, because this groove is too narrow for peptide binding and the purified luminal domain forms high-affinity dimers in vitro, peptide binding to this groove is not required for dimerization. Consistent with our structural observations, mutations that disrupt the dimerization interface produced IRE1{alpha} molecules that failed to either dimerize or activate the UPR upon ER stress. In addition, mutations in a structurally homologous region within PERK also prevented dimerization. Our structural, biochemical, and functional studies in vivo altogether demonstrate that IRE1 and PERK have conserved a common molecular interface necessary and sufficient for dimerization and UPR signaling.

  7. spalt encodes an evolutionarily conserved zinc finger protein of novel structure which provides homeotic gene function in the head and tail region of the Drosophila embryo.

    PubMed Central

    Kühnlein, R P; Frommer, G; Friedrich, M; Gonzalez-Gaitan, M; Weber, A; Wagner-Bernholz, J F; Gehring, W J; Jäckle, H; Schuh, R


    The region specific homeotic gene spalt (sal) of Drosophila melanogaster promotes the specification of terminal pattern elements as opposed to segments in the trunk. Our results show that the previously reported sal transcription unit was misidentified. Based on P-element mediated germ line transformation and DNA sequence analysis of sal mutant alleles, we identified the transcription unit that carries sal function. sal is located close to the misidentified transcription unit, and it is expressed in similar temporal and spatial patterns during embryogenesis. The sal gene encodes a zinc finger protein of novel structure composed of three widely spaced 'double zinc finger' motifs of internally conserved sequences and a single zinc finger motif of different sequence. Antibodies produced against the sal protein show that sal is first expressed at the blastoderm stage and later in restricted areas of the embryonic nervous system as well as in the developing trachea. The antibodies detect sal homologous proteins in corresponding spatial and temporal patterns in the embryos of related insect species. Sequence analysis of the sal gene of Drosophila virilis, a species which is phylogenetically separated by approximately 60 million years, suggests that the sal function is conserved during evolution, consistent with its proposed role in head formation during arthropod evolution. Images PMID:7905822

  8. PhyloPro2.0: a database for the dynamic exploration of phylogenetically conserved proteins and their domain architectures across the Eukarya

    PubMed Central

    Cromar, Graham L.; Zhao, Anthony; Xiong, Xuejian; Swapna, Lakshmipuram S.; Loughran, Noeleen; Song, Hongyan; Parkinson, John


    PhyloPro is a database and accompanying web-based application for the construction and exploration of phylogenetic profiles across the Eukarya. In this update article, we present six major new developments in PhyloPro: (i) integration of Pfam-A domain predictions for all proteins; (ii) new summary heatmaps and detailed level views of domain conservation; (iii) an interactive, network-based visualization tool for exploration of domain architectures and their conservation; (iv) ability to browse based on protein functional categories (GOSlim); (v) improvements to the web interface to enhance drill down capability from the heatmap view; and (vi) improved coverage including 164 eukaryotes and 12 reference species. In addition, we provide improved support for downloading data and images in a variety of formats. Among the existing tools available for phylogenetic profiles, PhyloPro provides several innovative domain-based features including a novel domain adjacency visualization tool. These are designed to allow the user to identify and compare proteins with similar domain architectures across species and thus develop hypotheses about the evolution of lineage-specific trajectories. Database URL: PMID:26980519

  9. PhyloPro2.0: a database for the dynamic exploration of phylogenetically conserved proteins and their domain architectures across the Eukarya.


    Cromar, Graham L; Zhao, Anthony; Xiong, Xuejian; Swapna, Lakshmipuram S; Loughran, Noeleen; Song, Hongyan; Parkinson, John


    PhyloPro is a database and accompanying web-based application for the construction and exploration of phylogenetic profiles across the Eukarya. In this update article, we present six major new developments in PhyloPro: (i) integration of Pfam-A domain predictions for all proteins; (ii) new summary heatmaps and detailed level views of domain conservation; (iii) an interactive, network-based visualization tool for exploration of domain architectures and their conservation; (iv) ability to browse based on protein functional categories (GOSlim); (v) improvements to the web interface to enhance drill down capability from the heatmap view; and (vi) improved coverage including 164 eukaryotes and 12 reference species. In addition, we provide improved support for downloading data and images in a variety of formats. Among the existing tools available for phylogenetic profiles, PhyloPro provides several innovative domain-based features including a novel domain adjacency visualization tool. These are designed to allow the user to identify and compare proteins with similar domain architectures across species and thus develop hypotheses about the evolution of lineage-specific trajectories. Database URL: PMID:26980519

  10. Identification of a Conserved Linear B-Cell Epitope of Streptococcus dysgalactiae GapC Protein by Screening Phage-Displayed Random Peptide Library

    PubMed Central

    Fan, Ziyao; Zhou, Xue; Yu, Liquan; Sun, Hunan; Wu, Zhijun; Yu, Yongzhong; Song, Baifen; Ma, Jinzhu; Tong, Chunyu; Wang, Xintong; Zhu, Zhanbo; Cui, Yudong


    The GapC of Streptococcus dysgalactiae (S. dysgalactiae) is a highly conserved surface protein that can induce protective humoral immune response in animals. However, B-cell epitopes on the S. dysgalactiae GapC have not been well identified. In this study, a monoclonal antibody (mAb5B7) against the GapC1-150 protein was prepared. After passive transfer, mAb5B7 could partially protect mice against S. dysgalactiae infection. Eleven positive phage clones recognized by mAb5B7 were identified by screening phage-displayed random 12-peptide library, most of which matched the consensus motif DTTQGRFD. The motif sequence exactly matches amino acids 48-55 of the S. dysgalactiae GapC protein. In addition, the motif 48DTTQGRFD55 shows high homology among various streptococcus species. Site-directed mutagenic analysis further confirmed that residues D48, T50, Q51, G52 and F54 formed the core motif of 48DTTQGRFD55. This motif was the minimal determinant of the B-cell epitope recognized by the mAb5B7. As expected, epitope-peptide evoked protective immune response against S. dysgalactiae infection in immunized mice. Taken together, this identified conserved B-cell epitope within S. dysgalactiae GapC could provide very valuable insights for vaccine design against S. dysgalactiae infection. PMID:26121648

  11. MEPPitope: spatial, electrostatic and secondary structure perturbations in the post-fusion Dengue virus envelope protein highlights known epitopes and conserved residues in the Zika virus.


    Chakraborty, Sandeep


    The dramatic transformation of the Zika virus (ZIKV) from a relatively unknown virus to a pathogen generating global-wide panic has exposed the dearth of detailed knowledge about this virus. Decades of research in the related Dengue virus (DENV), finally culminating in a vaccine registered for use in endemic regions (CYD-TDV), provides key insights in developing strategies for tackling ZIKV. The previously established MEPP methodology compares two conformations of the same protein and identifies residues with significant spatial and electrostatic perturbations. In the current work, MEPP analyzed the pre-and post-fusion DENV type 2 envelope (E) protein, and identified several known epitopes (His317, Tyr299, Glu26, Arg188, etc.) (MEPPitope). These residues are overwhelmingly conserved in ZIKV and all DENV serotypes. Characterization of α-helices in E-proteins show that α1 is not conserved in the sequence space of ZIKV and DENV. Furthermore, perturbation of α1 in the post-fusion DENV structure includes a known epitope Asp215, a residue absent in the pre-fusion α1. A cationic β-sheet in the GAG-binding domain that is stereochemically equivalent in ZIKV and all DENV serotypes is also highlighted due to a residue pair (Arg286-Arg288) that has a significant electrostatic polarity reversal upon fusion. Finally, two highly conserved residues (Thr32 and Thr40), with little emphasis in existing literature, are found to have significant electrostatic perturbation. Thus, a combination of different computational methods enable the rapid and rational detection of critical residues that can be made the target of small drugs, or as epitopes in the search for an elusive therapy or vaccine that neutralizes multiple members of the Flaviviridae family. PMID:27540468

  12. Conservative tryptophan mutants of the protein tyrosine phosphatase YopH exhibit impaired WPD-loop function and crystallize with divanadate esters in their active sites.


    Moise, Gwendolyn; Gallup, Nathan M; Alexandrova, Anastassia N; Hengge, Alvan C; Johnson, Sean J


    Catalysis in protein tyrosine phosphatases (PTPs) involves movement of a protein loop called the WPD loop that brings a conserved aspartic acid into the active site to function as a general acid. Mutation of the tryptophan in the WPD loop of the PTP YopH to any other residue with a planar, aromatic side chain (phenylalanine, tyrosine, or histidine) disables general acid catalysis. Crystal structures reveal these conservative mutations leave this critical loop in a catalytically unproductive, quasi-open position. Although the loop positions in crystal structures are similar for all three conservative mutants, the reasons inhibiting normal loop closure differ for each mutant. In the W354F and W354Y mutants, steric clashes result from six-membered rings occupying the position of the five-membered ring of the native indole side chain. The histidine mutant dysfunction results from new hydrogen bonds stabilizing the unproductive position. The results demonstrate how even modest modifications can disrupt catalytically important protein dynamics. Crystallization of all the catalytically compromised mutants in the presence of vanadate gave rise to vanadate dimers at the active site. In W354Y and W354H, a divanadate ester with glycerol is observed. Such species have precedence in solution and are known from the small molecule crystal database. Such species have not been observed in the active site of a phosphatase, as a functional phosphatase would rapidly catalyze their decomposition. The compromised functionality of the mutants allows the trapping of species that undoubtedly form in solution and are capable of binding at the active sites of PTPs, and, presumably, other phosphatases. In addition to monomeric vanadate, such higher-order vanadium-based molecules are likely involved in the interaction of vanadate with PTPs in solution. PMID:26445170

  13. Conservative Tryptophan Mutants of the Protein Tyrosine Phosphatase YopH Exhibit Impaired WPD-Loop Function and Crystallize with Divanadate Esters in Their Active Sites

    PubMed Central

    Moise, Gwendolyn; Gallup, Nathan M.; Alexandrova, Anastassia N.; Hengge, Alvan C.; Johnson, Sean J.


    Catalysis in protein tyrosine phosphatases (PTPs) involves movement of a protein loop called the WPD loop that brings a conserved aspartic acid into the active site to function as a general acid. Mutation of the tryptophan in the WPD loop of the PTP YopH to any other residue with a planar, aromatic side chain (phenylalanine, tyrosine, or histidine) disables general acid catalysis. Crystal structures reveal these conservative mutations leave this critical loop in a catalytically unproductive, quasi-open position. Although the loop positions in crystal structures are similar for all three conservative mutants, the reasons inhibiting normal loop closure differ for each mutant. In the W354F and W354Y mutants, steric clashes result from six-membered rings occupying the position of the five-membered ring of the native indole side chain. The histidine mutant dysfunction results from new hydrogen bonds stabilizing the unproductive position. The results demonstrate how even modest modifications can disrupt catalytically important protein dynamics. Crystallization of all the catalytically compromised mutants in the presence of vanadate gave rise to vanadate dimers at the active site. In W354Y and W354H, a divanadate ester with glycerol is observed. Such species have precedence in solution and are known from the small molecule crystal database. Such species have not been observed in the active site of a phosphatase, as a functional phosphatase would rapidly catalyze their decomposition. The compromised functionality of the mutants allows the trapping of species that undoubtedly form in solution and are capable of binding at the active sites of PTPs, and, presumably, other phosphatases. In addition to monomeric vanadate, such higher-order vanadium-based molecules are likely involved in the interaction of vanadate with PTPs in solution. PMID:26445170

  14. MEPPitope: spatial, electrostatic and secondary structure perturbations in the post-fusion Dengue virus envelope protein highlights known epitopes and conserved residues in the Zika virus

    PubMed Central

    Chakraborty, Sandeep


    The dramatic transformation of the Zika virus (ZIKV) from a relatively unknown virus to a pathogen generating global-wide panic has exposed the dearth of detailed knowledge about this virus. Decades of research in the related Dengue virus (DENV), finally culminating in a vaccine registered for use in endemic regions (CYD-TDV), provides key insights in developing strategies for tackling ZIKV. The previously established MEPP methodology compares two conformations of the same protein and identifies residues with significant spatial and electrostatic perturbations. In the current work, MEPP analyzed the pre-and post-fusion DENV type 2 envelope (E) protein, and identified several known epitopes (His317, Tyr299, Glu26, Arg188, etc.) (MEPPitope). These residues are overwhelmingly conserved in ZIKV and all DENV serotypes. Characterization of α-helices in E-proteins show that α1 is not conserved in the sequence space of ZIKV and DENV. Furthermore, perturbation of α1 in the post-fusion DENV structure includes a known epitope Asp215, a residue absent in the pre-fusion α1. A cationic β-sheet in the GAG-binding domain that is stereochemically equivalent in ZIKV and all DENV serotypes is also highlighted due to a residue pair (Arg286-Arg288) that has a significant electrostatic polarity reversal upon fusion. Finally, two highly conserved residues (Thr32 and Thr40), with little emphasis in existing literature, are found to have significant electrostatic perturbation. Thus, a combination of different computational methods enable the rapid and rational detection of critical residues that can be made the target of small drugs, or as epitopes in the search for an elusive therapy or vaccine that neutralizes multiple members of the Flaviviridae family. PMID:27540468

  15. Analysis of Globodera rostochiensis effectors reveals conserved functions of SPRYSEC proteins in suppressing and eliciting plant immune responses.


    Ali, Shawkat; Magne, Maxime; Chen, Shiyan; Obradovic, Natasa; Jamshaid, Lubna; Wang, Xiaohong; Bélair, Guy; Moffett, Peter


    Potato cyst nematodes (PCNs), including Globodera rostochiensis (Woll.), are important pests of potato. Plant parasitic nematodes produce multiple effector proteins, secreted from their stylets, to successfully infect their hosts. These include proteins delivered to the apoplast and to the host cytoplasm. A number of effectors from G. rostochiensis predicted to be delivered to the host cytoplasm have been identified, including several belonging to the secreted SPRY domain (SPRYSEC) family. SPRYSEC proteins are unique to members of the genus Globodera and have been implicated in both the induction and the repression of host defense responses. We have tested the properties of six different G. rostochiensis SPRYSEC proteins by expressing them in Nicotiana benthamiana and N. tabacum. We have found that all SPRYSEC proteins tested are able to suppress defense responses induced by NB-LRR proteins as well as cell death induced by elicitors, suggesting that defense repression is a common characteristic of members of this effector protein family. At the same time, GrSPRYSEC-15 elicited a defense responses in N. tabacum, which was found to be resistant to a virus expressing GrSPRYSEC-15. These results suggest that SPRYSEC proteins may possess characteristics that allow them to be recognized by the plant immune system. PMID:26322064

  16. Analysis of Globodera rostochiensis effectors reveals conserved functions of SPRYSEC proteins in suppressing and eliciting plant immune responses

    PubMed Central

    Ali, Shawkat; Magne, Maxime; Chen, Shiyan; Obradovic, Natasa; Jamshaid, Lubna; Wang, Xiaohong; Bélair, Guy; Moffett, Peter


    Potato cyst nematodes (PCNs), including Globodera rostochiensis (Woll.), are important pests of potato. Plant parasitic nematodes produce multiple effector proteins, secreted from their stylets, to successfully infect their hosts. These include proteins delivered to the apoplast and to the host cytoplasm. A number of effectors from G. rostochiensis predicted to be delivered to the host cytoplasm have been identified, including several belonging to the secreted SPRY domain (SPRYSEC) family. SPRYSEC proteins are unique to members of the genus Globodera and have been implicated in both the induction and the repression of host defense responses. We have tested the properties of six different G. rostochiensis SPRYSEC proteins by expressing them in Nicotiana benthamiana and N. tabacum. We have found that all SPRYSEC proteins tested are able to suppress defense responses induced by NB-LRR proteins as well as cell death induced by elicitors, suggesting that defense repression is a common characteristic of members of this effector protein family. At the same time, GrSPRYSEC-15 elicited a defense responses in N. tabacum, which was found to be resistant to a virus expressing GrSPRYSEC-15. These results suggest that SPRYSEC proteins may possess characteristics that allow them to be recognized by the plant immune system. PMID:26322064

  17. Analysis of Globodera rostochiensis effectors reveals conserved functions of SPRYSEC proteins in suppressing and eliciting plant immune responses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Potato cyst nematodes (PCNs), including Globodera rostochiensis (Woll.), are important pests of potato. Plant parasitic nematodes produce multiple effector proteins, secreted from their stylets, to successfully infect their hosts. These include proteins that are delivered to the apoplast, as well as...

  18. Comparative genomic analysis of a neurotoxigenic Clostridium species using partial genome sequence: Phylogenetic analysis of a few conserved proteins involved in cellular processes and metabolism.


    Alam, Syed Imteyaz; Dixit, Aparna; Tomar, Arvind; Singh, Lokendra


    Clostridial organisms produce neurotoxins, which are generally regarded as the most potent toxic substances of biological origin and potential biological warfare agents. Clostridium tetani produces tetanus neurotoxin and is responsible for the fatal tetanus disease. In spite of the extensive immunization regimen, the disease is an important cause of death especially among neonates. Strains of C. tetani have not been genetically characterized except the complete genome sequencing of strain E88. The present study reports the genetic makeup and phylogenetic affiliations of an environmental strain of this bacterium with respect to C. tetani E88 and other clostridia. A shot gun library was constructed from the genomic DNA of C. tetani drde, isolated from decaying fish sample. Unique clones were sequenced and sequences compared with its closest relative C. tetani E88. A total of 275 clones were obtained and 32,457 bases of non-redundant sequence were generated. A total of 150 base changes were observed over the entire length of sequence obtained, including, additions, deletions and base substitutions. Of the total 120 ORFs detected, 48 exhibited closest similarity to E88 proteins of which three are hypothetical proteins. Eight of the ORFs exhibited similarity with hypothetical proteins from other organisms and 10 aligned with other proteins from unrelated organisms. There is an overall conservation of protein sequences among the two strains of C. tetani and. Selected ORFs involved in cellular processes and metabolism were subjected to phylogenetic analysis. PMID:19527791

  19. Hsp90 inhibitor 17-DMAG decreases expression of conserved herpesvirus protein kinases and reduces virus production in Epstein-Barr virus-infected cells.


    Sun, Xiaoping; Bristol, Jillian A; Iwahori, Satoko; Hagemeier, Stacy R; Meng, Qiao; Barlow, Elizabeth A; Fingeroth, Joyce D; Tarakanova, Vera L; Kalejta, Robert F; Kenney, Shannon C


    All eight human herpesviruses have a conserved herpesvirus protein kinase (CHPK) that is important for the lytic phase of the viral life cycle. In this study, we show that heat shock protein 90 (Hsp90) interacts directly with each of the eight CHPKs, and we demonstrate that an Hsp90 inhibitor drug, 17-dimethylaminoethylamino-17-demethoxygeldanamycin (17-DMAG), decreases expression of all eight CHPKs in transfected HeLa cells. 17-DMAG also decreases expression the of the endogenous Epstein-Barr virus protein kinase (EBV PK, encoded by the BGLF4 gene) in lytically infected EBV-positive cells and inhibits phosphorylation of several different known EBV PK target proteins. Furthermore, 17-DMAG treatment abrogates expression of the human cytomegalovirus (HCMV) kinase UL97 in HCMV-infected human fibroblasts. Importantly, 17-DMAG treatment decreased the EBV titer approximately 100-fold in lytically infected AGS-Akata cells without causing significant cellular toxicity during the same time frame. Increased EBV PK expression in 17-DMAG-treated AGS-Akata cells did not restore EBV titers, suggesting that 17-DMAG simultaneously targets multiple viral and/or cellular proteins required for efficient viral replication. These results suggest that Hsp90 inhibitors, including 17-DMAG, may be a promising group of drugs that could have profound antiviral effects on herpesviruses. PMID:23843639

  20. The budding yeast U5 snRNP Prp8 is a highly conserved protein which links RNA splicing with cell cycle progression.

    PubMed Central

    Shea, J E; Toyn, J H; Johnston, L H


    The dbf3 mutation was originally obtained in a screen for DNA synthesis mutants with a cell cycle phenotype in the budding yeast Saccharomyces cerevisiae. We have now isolated the DBF3 gene and found it to be an essential gene with an ORF of 7239 nucleotides, potentially encoding a large protein of 268 kDa. We also obtained an allele-specific high copy number suppressor of the dbf3-1 allele, encoded by the known SSB1 gene, a member of the Hsp70 family of heat shock proteins. The sequence of the Dbf3 protein is 58% identical over 2300 amino acid residues to a predicted protein from Caenorhabditis elegans. Furthermore, partial sequences with 61% amino acid sequence identity were deduced from two files of human cDNA in the EST nucleotide database so that Dbf3 is a highly conserved protein. The nucleotide sequence of DBF3 turned out to be identical to the yeast gene PRP8, which encodes a U5 snRNP required for pre-mRNA splicing. This surprising result led us to further characterise the phenotype of dbf3 which confirmed its role in the cell cycle and showed it to function early, around the time of S phase. This data suggests a hitherto unexpected link between pre-mRNA splicing and the cell cycle. Images PMID:7838707

  1. Akirins, highly conserved nuclear proteins, required for NF-κB dependent gene expression in Drosophila and mice

    PubMed Central

    Goto, Akira; Matsushita, Kazufumi; Gesellchen, Viola; Chamy, Laure El; Kuttenkeuler, David; Takeuchi, Osamu; Hoffmann, Jules A.; Akira, Shizuo; Boutros, Michael; Reichhart, Jean-Marc


    During a genome-wide RNAi screen, we isolated CG8580 as a gene involved in the innate immune response of Drosophila. CG8580, which we named Akirin, acts in parallel with the NF-κB transcription factor downstream of the Imd pathway and was required for defense against Gram-negative bacteria. Akirin is highly conserved and the human genome contains two homologues, one of which was able to rescue the loss of function phenotype in Drosophila cells. Akirins had a strict nuclear localization. Knockout of both Akirin homologues in mice revealed that one had an essential function downstream of Toll-like receptor, tumor necrosis factor and interleukin 1-β (IL-1β) signaling pathways leading to the production of IL-6. Thus, Akirin is a conserved nuclear factor required for innate immune responses. PMID:18066067

  2. Characterization of a Highly Conserved Histone Related Protein, Ydl156w, and Its Functional Associations Using Quantitative Proteomic Analyses*

    PubMed Central

    Gilmore, Joshua M.; Sardiu, Mihaela E.; Venkatesh, Swaminathan; Stutzman, Brent; Peak, Allison; Seidel, Chris W.; Workman, Jerry L.; Florens, Laurence; Washburn, Michael P.


    A significant challenge in biology is to functionally annotate novel and uncharacterized proteins. Several approaches are available for deducing the function of proteins in silico based upon sequence homology and physical or genetic interaction, yet this approach is limited to proteins with well-characterized domains, paralogs and/or orthologs in other species, as well as on the availability of suitable large-scale data sets. Here, we present a quantitative proteomics approach extending the protein network of core histones H2A, H2B, H3, and H4 in Saccharomyces cerevisiae, among which a novel associated protein, the previously uncharacterized Ydl156w, was identified. In order to predict the role of Ydl156w, we designed and applied integrative bioinformatics, quantitative proteomics and biochemistry approaches aiming to infer its function. Reciprocal analysis of Ydl156w protein interactions demonstrated a strong association with all four histones and also to proteins strongly associated with histones including Rim1, Rfa2 and 3, Yku70, and Yku80. Through a subsequent combination of the focused quantitative proteomics experiments with available large-scale genetic interaction data and Gene Ontology functional associations, we provided sufficient evidence to associate Ydl156w with multiple processes including chromatin remodeling, transcription and DNA repair/replication. To gain deeper insights into the role of Ydl156w in histone biology we investigated the effect of the genetic deletion of ydl156w on H4 associated proteins, which lead to a dramatic decrease in the association of H4 with RNA polymerase III proteins. The implication of a role for Ydl156w in RNA Polymerase III mediated transcription was consequently verified by RNA-Seq experiments. Finally, using these approaches we generated a refined network of Ydl156w-associated proteins. PMID:22199229

  3. The evolutionary conserved oil body associated protein OBAP1 participates in the regulation of oil body size.


    López-Ribera, Ignacio; La Paz, José Luis; Repiso, Carlos; García, Nora; Miquel, Mercè; Hernández, María Luisa; Martínez-Rivas, José Manuel; Vicient, Carlos M


    A transcriptomic approach has been used to identify genes predominantly expressed in maize (Zea mays) scutellum during maturation. One of the identified genes is oil body associated protein1 (obap1), which is transcribed during seed maturation predominantly in the scutellum, and its expression decreases rapidly after germination. Proteins similar to OBAP1 are present in all plants, including primitive plants and mosses, and in some fungi and bacteria. In plants, obap genes are divided in two subfamilies. Arabidopsis (Arabidopsis thaliana) genome contains five genes coding for OBAP proteins. Arabidopsis OBAP1a protein is accumulated during seed maturation and disappears after germination. Agroinfiltration of tobacco (Nicotiana benthamiana) epidermal leaf cells with fusions of OBAP1 to yellow fluorescent protein and immunogold labeling of embryo transmission electron microscopy sections showed that OBAP1 protein is mainly localized in the surface of the oil bodies. OBAP1 protein was detected in the oil body cellular fraction of Arabidopsis embryos. Deletion analyses demonstrate that the most hydrophilic part of the protein is responsible for the oil body localization, which suggests an indirect interaction of OBAP1 with other proteins in the oil body surface. An Arabidopsis mutant with a transfer DNA inserted in the second exon of the obap1a gene and an RNA interference line against the same gene showed a decrease in the germination rate, a decrease in seed oil content, and changes in fatty acid composition, and their embryos have few, big, and irregular oil bodies compared with the wild type. Taken together, our findings suggest that OBAP1 protein is involved in the stability of oil bodies. PMID:24406791

  4. The glove-like structure of the conserved membrane protein TatC provides insight into signal sequence recognition in twin-arginine translocation.


    Ramasamy, Sureshkumar; Abrol, Ravinder; Suloway, Christian J M; Clemons, William M


    In bacteria, two signal-sequence-dependent secretion pathways translocate proteins across the cytoplasmic membrane. Although the mechanism of the ubiquitous general secretory pathway is becoming well understood, that of the twin-arginine translocation pathway, responsible for translocation of folded proteins across the bilayer, is more mysterious. TatC, the largest and most conserved of three integral membrane components, provides the initial binding site of the signal sequence prior to pore assembly. Here, we present two crystal structures of TatC from the thermophilic bacteria Aquifex aeolicus at 4.0 Å and 6.8 Å resolution. The membrane architecture of TatC includes a glove-shaped structure with a lipid-exposed pocket predicted by molecular dynamics to distort the membrane. Correlating the biochemical literature to these results suggests that the signal sequence binds in this pocket, leading to structural changes that facilitate higher order assemblies. PMID:23583035

  5. The glove-like structure of the conserved membrane protein TatC provides insight into signal sequence recognition in twin-arginine translocation

    PubMed Central

    Ramasamy, Sureshkumar; Abrol, Ravinder; Suloway, Christian J.M.; Clemons, William M.


    SUMMARY In bacteria, two signal sequence dependent secretion pathways translocate proteins across the cytoplasmic membrane. While the mechanism of the ubiquitous general secretory pathway (SEC) is becoming well understood, that of the twin-arginine translocation pathway (TAT), responsible for translocation of folded proteins across the bilayer, is more mysterious. TatC, the largest and most conserved of three integral membrane components, provides the initial binding site of the signal sequence prior to pore assembly. Here, we present two crystal structures of TatC from the thermophilic bacteria Aquifex aeolicus at 4.0Å and 6.8Å resolution. The novel membrane architecture of TatC includes a glove-shaped structure with a lipid-exposed pocket predicted by molecular dynamics to distort the membrane. Correlating the biochemical literature to these results suggests that the signal sequence binds in this pocket leading to structural changes that facilitate higher order assemblies. PMID:23583035

  6. Membrane translocation of mitochondrially coded Cox2p: distinct requirements for export of N and C termini and dependence on the conserved protein Oxa1p.

    PubMed Central

    He, S; Fox, T D


    To study in vivo the export of mitochondrially synthesized protein from the matrix to the intermembrane space, we have fused a synthetic mitochondrial gene, ARG8m, to the Saccharomyces cerevisiae COX2 gene in mitochondrial DNA. The Arg8mp moiety was translocated through the inner membrane when fused to the Cox2p C terminus by a mechanism dependent on topogenic information at least partially contained within the exported Cox2p C-terminal tail. The pre-Cox2p leader peptide did not signal translocation. Export of the Cox2p C-terminal tail, but not the N-terminal tail, was dependent on the inner membrane potential. The mitochondrial export system does not closely resemble the bacterial Sec translocase. However, normal translocation of both exported domains of Cox2p was defective in cells lacking the widely conserved inner membrane protein Oxa1p. Images PMID:9285818

  7. Enhancing In Silico Protein-Based Vaccine Discovery for Eukaryotic Pathogens Using Predicted Peptide-MHC Binding and Peptide Conservation Scores

    PubMed Central

    Goodswen, Stephen J.; Kennedy, Paul J.; Ellis, John T.


    Given thousands of proteins constituting a eukaryotic pathogen, the principal objective for a high-throughput in silico vaccine discovery pipeline is to select those proteins worthy of laboratory validation. Accurate prediction of T-cell epitopes on protein antigens is one crucial piece of evidence that would aid in this selection. Prediction of peptides recognised by T-cell receptors have to date proved to be of insufficient accuracy. The in silico approach is consequently reliant on an indirect method, which involves the prediction of peptides binding to major histocompatibility complex (MHC) molecules. There is no guarantee nevertheless that predicted peptide-MHC complexes will be presented by antigen-presenting cells and/or recognised by cognate T-cell receptors. The aim of this study was to determine if predicted peptide-MHC binding scores could provide contributing evidence to establish a protein’s potential as a vaccine. Using T-Cell MHC class I binding prediction tools provided by the Immune Epitope Database and Analysis Resource, peptide binding affinity to 76 common MHC I alleles were predicted for 160 Toxoplasma gondii proteins: 75 taken from published studies represented proteins known or expected to induce T-cell immune responses and 85 considered less likely vaccine candidates. The results show there is no universal set of rules that can be applied directly to binding scores to distinguish a vaccine from a non-vaccine candidate. We present, however, two proposed strategies exploiting binding scores that provide supporting evidence that a protein is likely to induce a T-cell immune response–one using random forest (a machine learning algorithm) with a 72% sensitivity and 82.4% specificity and the other, using amino acid conservation scores with a 74.6% sensitivity and 70.5% specificity when applied to the 160 benchmark proteins. More importantly, the binding score strategies are valuable evidence contributors to the overall in silico vaccine

  8. Membrane bound Indian clade C HIV-1 envelope antigen induces antibodies to diverse and conserved epitopes upon DNA prime/protein boost in rabbits.


    Rangasamy, Sneha Priya; Menon, Veena; Dhopeshwarkar, Priyanka; Pal, Ranajit; Vaniambadi, Kalyanaraman S; Mahalingam, Sundarasamy


    The partial success of RV144 human clinical trial demonstrated that ALVAC prime/envelope protein boost vaccine regimen may represent a promising strategy for the development of an effective HIV-1 vaccine. Our earlier study demonstrated that a trimeric HIV-1 envelope gp145 from an Indian clade C isolate elicited cross clade neutralizing antibodies primarily towards Tier 1 isolates. In the present study, we examined the immunogenicity of DNA prime/envelope protein boost vaccine in rabbits using gp160 DNA of the Indian clade C isolate with various cytoplasmic tail truncations and trimeric gp145 protein. Cytoplasmic tail mutants of gp160 exposed epitopes that reacted strongly with a number of broadly neutralizing human monoclonal antibodies against HIV-1. Overall, envelope specific titers were found to be similar in all rabbit groups with higher pseudovirus neutralization in protein only immunized rabbits. The complete linear epitope mapping of rabbit immune sera revealed strong binding to C1, C2, V3, C3 and C4 domains of gp145. Importantly, reactivity of gp41 ecto-domain peptides was observed in DNA prime/protein boost sera but not in the sera of rabbits immunized with protein alone. Moreover, membrane anchored but not soluble envelope encoding DNA immunization elicited antibodies against linear epitopes on the conserved gp41 ecto-domain. Together, these results suggest that priming with DNA encoding cytoplasmic domains of Env alters the quality of antibodies elicited following protein boost and hence may be utilized to generate protective immunity by HIV-1 vaccine. PMID:27032514

  9. A Conserved alpha-helical motif mediates the binding of diverse nuclear proteins to the SRC1 interaction domain of CBP.


    Matsuda, Sachiko; Harries, Janet C; Viskaduraki, Maria; Troke, Philip J F; Kindle, Karin B; Ryan, Colm; Heery, David M


    CREB-binding protein (CBP) and p300 contain modular domains that mediate protein-protein interactions with a wide variety of nuclear factors. A C-terminal domain of CBP (referred to as the SID) is responsible for interaction with the alpha-helical AD1 domain of p160 coactivators such as the steroid receptor coactivator (SRC1), and also other transcriptional regulators such as E1A, Ets-2, IRF3, and p53. Here we show that the pointed (PNT) domain of Ets-2 mediates its interaction with the CBP SID, and describe the effects of mutations in the SID on binding of Ets-2, E1A, and SRC1. In vitro binding studies indicate that SRC1, Ets-2 and E1A display mutually exclusive binding to the CBP SID. Consistent with this, we observed negative cross-talk between ERalpha/SRC1, Ets-2, and E1A proteins in reporter assays in transiently transfected cells. Transcriptional inhibition of Ets-2 or GAL4-AD1 activity by E1A was rescued by co-transfection with a CBP expression plasmid, consistent with the hypothesis that the observed inhibition was due to competition for CBP in vivo. Sequence comparisons revealed that SID-binding proteins contain a leucine-rich motif similar to the alpha-helix Aalpha1 of the SRC1 AD1 domain. Deletion mutants of E1A and Ets-2 lacking the conserved motif were unable to bind the CBP SID. Moreover, a peptide corresponding to this sequence competed the binding of full-length SRC1, Ets-2, and E1A proteins to the CBP SID. Thus, a leucine-rich amphipathic alpha-helix mediates mutually exclusive interactions of functionally diverse nuclear proteins with CBP. PMID:14722092

  10. The 2.2 Å resolution crystal structure of Bacillus cereus Nif3-family protein YqfO reveals a conserved dimetal-binding motif and a regulatory domain

    PubMed Central

    Godsey, Michael H.; Minasov, George; Shuvalova, Ludmilla; Brunzelle, Joseph S.; Vorontsov, Ivan I.; Collart, Frank R.; Anderson, Wayne F.


    YqfO of Bacillus cereus is a member of the widespread Nif3 family of proteins, which has been highlighted as an important target for structural genomics. The N- and C-terminal domains are conserved across the family and contain a dimetal-binding motif in a putative active site. YqfO contains an insert in the middle of the protein, present in a minority of bacterial family members. The structure of YqfO was determined at a resolution of 2.2 Å and reveals conservation of the putative active site. It also reveals the previously unknown structure of the insert, which despite extremely limited sequence conservation, bears great similarity to PII, CutA, and a number of other trimeric regulatory proteins. Our results suggest that this domain acts as a signal sensor to regulate the still-unknown catalytic activity of the more-conserved domains. PMID:17586767

  11. Tomato Cutin Deficient 1 (CD1) and Putative Orthologs Comprise an Ancient Family of Cutin Synthase-like (CUS) Proteins that are Conserved among Land Plants

    PubMed Central

    Yeats, Trevor H.; Huang, Wenlin; Chatterjee, Subhasish; Viart, Hélène M-F.; Clausen, Mads H.; Stark, Ruth E.; Rose, Jocelyn K.C.


    Summary The aerial epidermis of all land plants is covered with a hydrophobic cuticle that provides essential protection from desiccation, and so its evolution is believed to have been prerequisite for terrestrial colonization. A major structural component of apparently all plant cuticles is cutin, a polyester of hydroxy fatty acids. However, despite its ubiquity, the details of cutin polymeric structure and the mechanisms of its formation and remodeling are not well understood. We recently reported that cutin polymerization in tomato (Solanum lycopersicum) fruit occurs via transesterification of hydroxyacylglycerol precursors, catalyzed by the GDSL-motif lipase/hydrolase family protein (GDSL) Cutin Deficient 1 (CD1). Here we present additional biochemical characterization of CD1 and putative orthologs from Arabidopsis thaliana and the moss Physcomitrella patens, which represent a distinct clade of cutin synthases within the large GDSL super-family. We demonstrate that members of this ancient and conserved family of cutin synthase-like (CUS) proteins act as polyester synthases with negligible hydrolytic activity. Moreover, solution-state NMR analysis indicates that CD1 catalyzes the formation of primarily linear cutin oligomeric products in vitro. These results reveal a conserved mechanism of cutin polyester synthesis in land plants, and suggest that elaborations of the linear polymer, such as branching or cross-linking, may require additional, as yet unknown, factors. PMID:24372802

  12. The Evolutionarily Conserved LIM Homeodomain Protein LIM-4/LHX6 Specifies the Terminal Identity of a Cholinergic and Peptidergic C. elegans Sensory/Inter/Motor Neuron-Type

    PubMed Central

    Choi, Seong-Kyoon; Huh, Yang Hoon; Fang, Zi; Park, Seo Jin; Kim, Myoung Ok; Ryoo, Zae Young; Kang, Kyeongjin; Kweon, Hee-Seok; Jeon, Won Bae; Li, Chris; Kim, Kyuhyung


    The expression of specific transcription factors determines the differentiated features of postmitotic neurons. However, the mechanism by which specific molecules determine neuronal cell fate and the extent to which the functions of transcription factors are conserved in evolution are not fully understood. In C. elegans, the cholinergic and peptidergic SMB sensory/inter/motor neurons innervate muscle quadrants in the head and control the amplitude of sinusoidal movement. Here we show that the LIM homeobox protein LIM-4 determines neuronal characteristics of the SMB neurons. In lim-4 mutant animals, expression of terminal differentiation genes, such as the cholinergic gene battery and the flp-12 neuropeptide gene, is completely abolished and thus the function of the SMB neurons is compromised. LIM-4 activity promotes SMB identity by directly regulating the expression of the SMB marker genes via a distinct cis-regulatory motif. Two human LIM-4 orthologs, LHX6 and LHX8, functionally substitute for LIM-4 in C. elegans. Furthermore, C. elegans LIM-4 or human LHX6 can induce cholinergic and peptidergic characteristics in the human neuronal cell lines. Our results indicate that the evolutionarily conserved LIM-4/LHX6 homeodomain proteins function in generation of precise neuronal subtypes. PMID:26305787

  13. A Novel Universal Neutralizing Monoclonal Antibody against Enterovirus 71 That Targets the Highly Conserved “Knob” Region of VP3 Protein

    PubMed Central

    Meng, Tao; Chow, Vincent Tak Kwong; Kwang, Jimmy


    Hand, foot and mouth disease caused by enterovirus 71(EV71) leads to the majority of neurological complications and death in young children. While putative inactivated vaccines are only now undergoing clinical trials, no specific treatment options exist yet. Ideally, EV71 specific intravenous immunoglobulins could be developed for targeted treatment of severe cases. To date, only a single universally neutralizing monoclonal antibody against a conserved linear epitope of VP1 has been identified. Other enteroviruses have been shown to possess major conformational neutralizing epitopes on both the VP2 and VP3 capsid proteins. Hence, we attempted to isolate such neutralizing antibodies against conformational epitopes for their potential in the treatment of infection as well as differential diagnosis and vaccine optimization. Here we describe a universal neutralizing monoclonal antibody that recognizes a conserved conformational epitope of EV71 which was mapped using escape mutants. Eight escape mutants from different subgenogroups (A, B2, B4, C2, C4) were rescued; they harbored three essential mutations either at amino acid positions 59, 62 or 67 of the VP3 protein which are all situated in the “knob” region. The escape mutant phenotype could be mimicked by incorporating these mutations into reverse genetically engineered viruses showing that P59L, A62D, A62P and E67D abolish both monoclonal antibody binding and neutralization activity. This is the first conformational neutralization epitope mapped on VP3 for EV71. PMID:24875055

  14. Cloning, purification and preliminary crystallographic analysis of a conserved hypothetical protein, SA0961 (YlaN), from Staphylococcus aureus

    SciTech Connect

    Xu, Ling; Sedelnikova, Svetlana E.; Baker, Patrick J.; Rice, David W.


    SA0961 is an unknown hypothetical protein from Staphylococcus aureus that can be identified in the Firmicutes division of Gram-positive bacteria. SA0961 was cloned and the protein was overexpressed in Escherichia coli, purified and subsequently crystallized. SA0961 is an unknown hypothetical protein from Staphylococcus aureus that can be identified in the Firmicutes division of Gram-positive bacteria. The gene for the homologue of SA0961 in Bacillus subtilis, ylaN, has been shown to be essential for cell survival, thus identifying the protein encoded by this gene as a potential target for the development of novel antibiotics. SA0961 was cloned and the protein was overexpressed in Escherichia coli, purified and subsequently crystallized. Crystals of selenomethionine-labelled SA0961 diffract to beyond 2.4 Å resolution and belong to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 31.5, b = 42.7, c = 62.7 Å, β = 92.4° and two molecules in the asymmetric unit. A full structure determination is under way to provide insights into the function of this protein.

  15. Comprehensive and quantitative proteomic analyses of zebrafish plasma reveals conserved protein profiles between genders and between zebrafish and human

    PubMed Central

    Li, Caixia; Tan, Xing Fei; Lim, Teck Kwang; Lin, Qingsong; Gong, Zhiyuan


    Omic approaches have been increasingly used in the zebrafish model for holistic understanding of molecular events and mechanisms of tissue functions. However, plasma is rarely used for omic profiling because of the technical challenges in collecting sufficient blood. In this study, we employed two mass spectrometric (MS) approaches for a comprehensive characterization of zebrafish plasma proteome, i.e. conventional shotgun liquid chromatography-tandem mass spectrometry (LC-MS/MS) for an overview study and quantitative SWATH (Sequential Window Acquisition of all THeoretical fragment-ion spectra) for comparison between genders. 959 proteins were identified in the shotgun profiling with estimated concentrations spanning almost five orders of magnitudes. Other than the presence of a few highly abundant female egg yolk precursor proteins (vitellogenins), the proteomic profiles of male and female plasmas were very similar in both number and abundance and there were basically no other highly gender-biased proteins. The types of plasma proteins based on IPA (Ingenuity Pathway Analysis) classification and tissue sources of production were also very similar. Furthermore, the zebrafish plasma proteome shares significant similarities with human plasma proteome, in particular in top abundant proteins including apolipoproteins and complements. Thus, the current study provided a valuable dataset for future evaluation of plasma proteins in zebrafish. PMID:27071722

  16. Comprehensive and quantitative proteomic analyses of zebrafish plasma reveals conserved protein profiles between genders and between zebrafish and human.


    Li, Caixia; Tan, Xing Fei; Lim, Teck Kwang; Lin, Qingsong; Gong, Zhiyuan


    Omic approaches have been increasingly used in the zebrafish model for holistic understanding of molecular events and mechanisms of tissue functions. However, plasma is rarely used for omic profiling because of the technical challenges in collecting sufficient blood. In this study, we employed two mass spectrometric (MS) approaches for a comprehensive characterization of zebrafish plasma proteome, i.e. conventional shotgun liquid chromatography-tandem mass spectrometry (LC-MS/MS) for an overview study and quantitative SWATH (Sequential Window Acquisition of all THeoretical fragment-ion spectra) for comparison between genders. 959 proteins were identified in the shotgun profiling with estimated concentrations spanning almost five orders of magnitudes. Other than the presence of a few highly abundant female egg yolk precursor proteins (vitellogenins), the proteomic profiles of male and female plasmas were very similar in both number and abundance and there were basically no other highly gender-biased proteins. The types of plasma proteins based on IPA (Ingenuity Pathway Analysis) classification and tissue sources of production were also very similar. Furthermore, the zebrafish plasma proteome shares significant similarities with human plasma proteome, in particular in top abundant proteins including apolipoproteins and complements. Thus, the current study provided a valuable dataset for future evaluation of plasma proteins in zebrafish. PMID:27071722

  17. Conserved Allosteric Hot Spots in the Transmembrane Domains of Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Channels and Multidrug Resistance Protein (MRP) Pumps*

    PubMed Central

    Wei, Shipeng; Roessler, Bryan C.; Chauvet, Sylvain; Guo, Jingyu; Hartman, John L.; Kirk, Kevin L.


    ATP-binding cassette (ABC) transporters are an ancient family of transmembrane proteins that utilize ATPase activity to move substrates across cell membranes. The ABCC subfamily of the ABC transporters includes active drug exporters (the multidrug resistance proteins (MRPs)) and a unique ATP-gated ion channel (cystic fibrosis transmembrane conductance regulator (CFTR)). The CFTR channel shares gating principles with conventional ligand-gated ion channels, but the allosteric network that couples ATP binding at its nucleotide binding domains (NBDs) with conformational changes in its transmembrane helices (TMs) is poorly defined. It is also unclear whether the mechanisms that govern CFTR gating are conserved with the thermodynamically distinct MRPs. Here we report a new class of gain of function (GOF) mutation of a conserved proline at the base of the pore-lining TM6. Multiple substitutions of this proline promoted ATP-free CFTR activity and activation by the weak agonist, 5′-adenylyl-β,γ-imidodiphosphate (AMP-PNP). TM6 proline mutations exhibited additive GOF effects when combined with a previously reported GOF mutation located in an outer collar of TMs that surrounds the pore-lining TMs. Each TM substitution allosterically rescued the ATP sensitivity of CFTR gating when introduced into an NBD mutant with defective ATP binding. Both classes of GOF mutations also rescued defective drug export by a yeast MRP (Yor1p) with ATP binding defects in its NBDs. We conclude that the conserved TM6 proline helps set the energy barrier to both CFTR channel opening and MRP-mediated drug efflux and that CFTR channels and MRP pumps utilize similar allosteric mechanisms for coupling conformational changes in their translocation pathways to ATP binding at their NBDs. PMID:24876383

  18. Conserved Distal Loop Residues in the Hsp104 and ClpB Middle Domain Contact Nucleotide-binding Domain 2 and Enable Hsp70-dependent Protein Disaggregation*

    PubMed Central

    DeSantis, Morgan E.; Sweeny, Elizabeth A.; Snead, David; Leung, Eunice H.; Go, Michelle S.; Gupta, Kushol; Wendler, Petra; Shorter, James


    The homologous hexameric AAA+ proteins, Hsp104 from yeast and ClpB from bacteria, collaborate with Hsp70 to dissolve disordered protein aggregates but employ distinct mechanisms of intersubunit collaboration. How Hsp104 and ClpB coordinate polypeptide handover with Hsp70 is not understood. Here, we define conserved distal loop residues between middle domain (MD) helix 1 and 2 that are unexpectedly critical for Hsp104 and ClpB collaboration with Hsp70. Surprisingly, the Hsp104 and ClpB MD distal loop does not contact Hsp70 but makes intrasubunit contacts with nucleotide-binding domain 2 (NBD2). Thus, the MD does not invariably project out into solution as in one structural model of Hsp104 and ClpB hexamers. These intrasubunit contacts as well as those between MD helix 2 and NBD1 are different in Hsp104 and ClpB. NBD2-MD contacts dampen disaggregase activity and must separate for protein disaggregation. We demonstrate that ClpB requires DnaK more stringently than Hsp104 requires Hsp70 for protein disaggregation. Thus, we reveal key differences in how Hsp104 and ClpB coordinate polypeptide handover with Hsp70, which likely reflects differential tuning for yeast and bacterial proteostasis. PMID:24280225

  19. Evolutionarily conserved multisubunit RBL2/p130 and E2F4 protein complex represses human cell cycle-dependent genes in quiescence.


    Litovchick, Larisa; Sadasivam, Subhashini; Florens, Laurence; Zhu, Xiaopeng; Swanson, Selene K; Velmurugan, Soundarapandian; Chen, Runsheng; Washburn, Michael P; Liu, X Shirley; DeCaprio, James A


    The mammalian Retinoblastoma (RB) family including pRB, p107, and p130 represses E2F target genes through mechanisms that are not fully understood. In D. melanogaster, RB-dependent repression is mediated in part by the multisubunit protein complex Drosophila RBF, E2F, and Myb (dREAM) that contains homologs of the C. elegans synthetic multivulva class B (synMuvB) gene products. Using an integrated approach combining proteomics, genomics, and bioinformatic analyses, we identified a p130 complex termed DP, RB-like, E2F, and MuvB (DREAM) that contains mammalian homologs of synMuvB proteins LIN-9, LIN-37, LIN-52, LIN-54, and LIN-53/RBBP4. DREAM bound to more than 800 human promoters in G0 and was required for repression of E2F target genes. In S phase, MuvB proteins dissociated from p130 and formed a distinct submodule that bound MYB. This work reveals an evolutionarily conserved multisubunit protein complex that contains p130 and E2F4, but not pRB, and mediates the repression of cell cycle-dependent genes in quiescence. PMID:17531812

  20. Subunit interactions in ABC transporters: a conserved sequence in hydrophobic membrane proteins of periplasmic permeases defines an important site of interaction with the ATPase subunits.


    Mourez, M; Hofnung, M; Dassa, E


    The cytoplasmic membrane proteins of bacterial binding protein-dependent transporters belong to the superfamily of ABC transporters. The hydrophobic proteins display a conserved, at least 20 amino acid EAA---G---------I-LP region exposed in the cytosol, the EAA region. We mutagenized the EAA regions of MalF and MalG proteins of the Escherichia coli maltose transport system. Substitutions at the same positions in MalF and MalG have different phenotypes, indicating that EAA regions do not act symmetrically. Mutations in malG or malF that slightly affect or do not affect transport, determine a completely defective phenotype when present together. This suggests that EAA regions of MalF and MalG may interact during transport. Maltose-negative mutants fall into two categories with respect to the cellular localization of the MalK ATPase: in the first, MalK is membrane-bound, as in wild-type strains, while in the second, it is cytosolic, as in strains deleted in the malF and malG genes. From maltose-negative mutants of the two categories, we isolated suppressor mutations within malK that restore transport. They map mainly in the putative helical domain of MalK, suggesting that EAA regions may constitute a recognition site for the ABC ATPase helical domain. PMID:9214624

  1. Fine level epitope mapping and conservation analysis of two novel linear B-cell epitopes of the avian infectious bronchitis coronavirus nucleocapsid protein.


    Han, Zongxi; Zhao, Fei; Shao, Yuhao; Liu, Xiaoli; Kong, Xiangang; Song, Yang; Liu, Shengwang


    The nucleocapsid (N) protein of the infectious bronchitis virus (IBV) may play an essential role in the replication and translation of viral RNA. The N protein can also induce high titers of cross-reactive antibodies and cell-mediated immunity, which protects chickens from acute infection. In this study, we generated two monoclonal antibodies (mAbs), designated as 6D10 and 4F10, which were directed against the N protein of IBV using the whole viral particles as immunogens. Both of the mAbs do not cross react with Newcastle disease virus (NDV), infectious laryngotracheitis virus (ILTV) and subtype H9 avian influenza virus (AIV). After screening a phage display peptide library and peptide scanning, we identified two linear B-cell epitopes that were recognized by the mAbs 6D10 and 4F10, which corresponded to the amino acid sequences (242)FGPRTK(247) and (195)DLIARAAKI(203), respectively, in the IBV N protein. Alignments of amino acid sequences from a large number of IBV isolates indicated that the two epitopes, especially (242)FGPRTK(247), were well conserved among IBV strains. This conclusion was further confirmed by the relationships of 18 heterologous sequences to the 2 mAbs. The novel mAbs and the epitopes identified will be useful for developing diagnostic assays for IBV infections. PMID:23123213

  2. Expression of human Cfdp1 gene in Drosophila reveals new insights into the function of the evolutionarily conserved BCNT protein family

    PubMed Central

    Messina, Giovanni; Atterrato, Maria Teresa; Fanti, Laura; Giordano, Ennio; Dimitri, Patrizio


    The Bucentaur (BCNT) protein family is widely distributed in eukaryotes and is characterized by a highly conserved C-terminal domain. This family was identified two decades ago in ruminants, but its role(s) remained largely unknown. Investigating cellular functions and mechanism of action of BCNT proteins is challenging, because they have been implicated in human craniofacial development. Recently, we found that YETI, the D. melanogaster BCNT, is a chromatin factor that participates to H2A.V deposition. Here we report the effects of in vivo expression of CFDP1, the human BCNT protein, in Drosophila melanogaster. We show that CFDP1, similarly to YETI, binds to chromatin and its expression results in a wide range of abnormalities highly reminiscent of those observed in Yeti null mutants. This indicates that CFDP1 expressed in flies behaves in a dominant negative fashion disrupting the YETI function. Moreover, GST pull-down provides evidence indicating that 1) both YETI and CFDP1 undergo homodimerization and 2) YETI and CFDP1 physically interact each other by forming inactive heterodimers that would trigger the observed dominant-negative effect. Overall, our findings highlight unanticipated evidences suggesting that homodimerization mediated by the BCNT domain is integral to the chromatin functions of BCNT proteins. PMID:27151176

  3. Expression of human Cfdp1 gene in Drosophila reveals new insights into the function of the evolutionarily conserved BCNT protein family.


    Messina, Giovanni; Atterrato, Maria Teresa; Fanti, Laura; Giordano, Ennio; Dimitri, Patrizio


    The Bucentaur (BCNT) protein family is widely distributed in eukaryotes and is characterized by a highly conserved C-terminal domain. This family was identified two decades ago in ruminants, but its role(s) remained largely unknown. Investigating cellular functions and mechanism of action of BCNT proteins is challenging, because they have been implicated in human craniofacial development. Recently, we found that YETI, the D. melanogaster BCNT, is a chromatin factor that participates to H2A.V deposition. Here we report the effects of in vivo expression of CFDP1, the human BCNT protein, in Drosophila melanogaster. We show that CFDP1, similarly to YETI, binds to chromatin and its expression results in a wide range of abnormalities highly reminiscent of those observed in Yeti null mutants. This indicates that CFDP1 expressed in flies behaves in a dominant negative fashion disrupting the YETI function. Moreover, GST pull-down provides evidence indicating that 1) both YETI and CFDP1 undergo homodimerization and 2) YETI and CFDP1 physically interact each other by forming inactive heterodimers that would trigger the observed dominant-negative effect. Overall, our findings highlight unanticipated evidences suggesting that homodimerization mediated by the BCNT domain is integral to the chromatin functions of BCNT proteins. PMID:27151176

  4. Chicken interferon consensus sequence-binding protein (ICSBP) and interferon regulatory factor (IRF) 1 genes reveal evolutionary conservation in the IRF gene family.

    PubMed Central

    Jungwirth, C; Rebbert, M; Ozato, K; Degen, H J; Schultz, U; Dawid, I B


    Members of the IRF family mediate transcriptional responses to interferons (IFNs) and to virus infection. So far, proteins of this family have been studied only among mammalian species. Here we report the isolation of cDNA clones encoding two members of this family from chicken, interferon consensus sequence-binding protein (ICSBP) and IRF-1. The predicted chicken ICSBP and IRF-1 proteins show high levels of sequence similarity to their corresponding human and mouse counterparts. Sequence identities in the putative DNA-binding domains of chicken and human ICSBP and IRF-1 were 97% and 89%, respectively, whereas the C-terminal regions showed identities of 64% and 51%; sequence relationships with mouse ICSBP and IRF-1 are very similar. Chicken ICSBP was found to be expressed in several embryonic tissues, and both chicken IRF-1 and ICSBP were strongly induced in chicken fibroblasts by IFN treatment, supporting the involvement of these factors in IFN-regulated gene expression. The presence of proteins homologous to mammalian IRF family members, together with earlier observations on the occurrence of functionally homologous IFN-responsive elements in chicken and mammalian genes, highlights the conservation of transcriptional mechanisms in the IFN system, a finding that contrasts with the extensive sequence and functional divergence of the IFNs. Images Fig. 3 Fig. 4 Fig. 5 PMID:7536924

  5. Three-dimensional reconstructions of the bacteriophage CUS-3 virion reveal a conserved coat protein I-domain but a distinct tailspike receptor-binding domain

    SciTech Connect

    Parent, Kristin N.; Tang, Jinghua; Cardone, Giovanni; Gilcrease, Eddie B.; Janssen, Mandy E.; Olson, Norman H.; Casjens, Sherwood R.; Baker, Timothy S.


    CUS-3 is a short-tailed, dsDNA bacteriophage that infects serotype K1 Escherichia coli. We report icosahedrally averaged and asymmetric, three-dimensional, cryo-electron microscopic reconstructions of the CUS-3 virion. Its coat protein structure adopts the “HK97-fold” shared by other tailed phages and is quite similar to that in phages P22 and Sf6 despite only weak amino acid sequence similarity. In addition, these coat proteins share a unique extra external domain (“I-domain”), suggesting that the group of P22-like phages has evolved over a very long time period without acquiring a new coat protein gene from another phage group. On the other hand, the morphology of the CUS-3 tailspike differs significantly from that of P22 or Sf6, but is similar to the tailspike of phage K1F, a member of the extremely distantly related T7 group of phages. We conclude that CUS-3 obtained its tailspike gene from a distantly related phage quite recently. - Highlights: • Asymmetric and symmetric three-dimensional reconstructions of phage CUS-3 are presented. • CUS-3 major capsid protein has a conserved I-domain, which is found in all three categories of “P22-like phage”. • CUS-3 has very different tailspike receptor binding domain from those of P22 and Sf6. • The CUS-3 tailspike likely was acquired by horizontal gene transfer.

  6. Identification of a Highly Conserved Epitope on Avian Influenza Virus Non-Structural Protein 1 Using a Peptide Microarray

    PubMed Central

    Wen, Xuexia; Bao, Hongmei; Shi, Lin; Tao, Qimeng; Jiang, Yongping; Zeng, Xianying; Xu, Xiaolong; Tian, Guobin; Zheng, Shimin; Chen, Hualan


    Avian influenza virus (AIV) non-structural protein 1 (NS1) is a multifunctional protein. It is present at high levels in infected cells and can be used for AIV detection and diagnosis. In this study, we generated monoclonal antibody (MAb) D7 against AIV NS1 protein by immunization of BALB/c mice with purified recombinant NS1 protein expressed in Escherichia coli. Isotype determination revealed that the MAb was IgG1/κ-type subclass. To identify the epitope of the MAb D7, the NS1 protein was truncated into a total of 225 15-mer peptides with 14 amino acid overlaps, which were spotted for a peptide microarray. The results revealed that the MAb D7 recognized the consensus DAPF motif. Furthermore, the AIV NS1 protein with the DAPF motif deletion was transiently expressed in 293T cells and failed to react with MAb D7. Subsequently, the DAPF motif was synthesized with an elongated GSGS linker at both the C- and N-termini. The MAb D7 reacted with the synthesized peptide both in enzyme-linked immunosorbent assay (ELISA) and dot-blot assays. From these results, we concluded that DAPF motif is the epitope of MAb D7. To our knowledge, this is the first report of a 4-mer epitope on the NS1 protein of AIV that can be recognized by MAb using a peptide microarray, which is able to simplify epitope identification, and that could serve as the basis for immune responses against avian influenza. PMID:26938453

  7. The West Nile virus assembly process evades the conserved antiviral mechanism of the interferon-induced MxA protein

    SciTech Connect

    Hoenen, Antje; Gillespie, Leah; Morgan, Garry; Heide, Peter van der; Khromykh, Alexander; Mackenzie, Jason


    Flaviviruses have evolved means to evade host innate immune responses. Recent evidence suggests this is due to prevention of interferon production and signaling in flavivirus-infected cells. Here we show that the interferon-induced MxA protein can sequester the West Nile virus strain Kunjin virus (WNV{sub KUN}) capsid protein in cytoplasmic tubular structures in an expression-replication system. This sequestering resulted in reduced titers of secreted WNV{sub KUN} particles. We show by electron microscopy, tomography and 3D modeling that these cytoplasmic tubular structures form organized bundles. Additionally we show that recombinant ER-targeted MxA can restrict production of infectious WNV{sub KUN} under conditions of virus infection. Our results indicate a co-ordinated and compartmentalized WNV{sub KUN} assembly process may prevent recognition of viral components by MxA, particularly the capsid protein. This recognition can be exploited if MxA is targeted to intracellular sites of WNV{sub KUN} assembly. This results in further understanding of the mechanisms of flavivirus evasion from the immune system. - Highlights: • We show that the ISG MxA can recognize the West Nile virus capsid protein. • Interaction between WNV C protein and MxA induces cytoplasmic fibrils. • MxA can be retargeted to the ER to restrict WNV particle release. • WNV assembly process is a strategy to avoid MxA recognition.

  8. Molecular cloning of a highly conserved mouse and human integral membrane protein (Itm1) and genetic mapping to mouse chromosome 9

    SciTech Connect

    Hong, Guizhu; Tylzanowski, P.; Deleersnijder, W.


    We have isolated and characterized a novel cDNA coding for a highly hydrophobic protein (B5) from a fetal mouse mandibular condyle cDNA library. The full-length mouse B5 cDNA is 3095 nucleotides long and contains a potential open reading frame coding for a protein of 705 amino acids with a calculated molecular weight of 80.5 kDa. The B5 mRNA is differentially polyadenylated, with the most abundant transcript having a length of 2.7 kb. The human homolog of B5 was isolated from a cDNA testis library. The predicted amino acid sequence of the human B5 is 98.5% identical to that of mouse. The most striking feature of the B5 protein is the presence of numerous (10-14) potential transmembrane domains, characteristic of an integral membrane protein. Similarity searches in public databanks reveal that B5 is 58% similar to the T12A2.2 gene of Caenorhabditis elegans and 60% similar to the STT3 gene of Saccharomyces cerevisiae. Futhermore, the report of an EST sequence (Accession No. Z13858) related to the human B5, but identical to the STT3 gene, indicates that B5 belongs to a larger gene family coding for novel putative transmembrane proteins. This family exhibits a remarkable degree of conservation in different species. The gene for B5, designated Itm1 (Integral membrane protein 1), is located on mouse chromosome 9. 28 refs., 4 figs.

  9. Conserved Cysteine Residue in the DNA-Binding Domain of the Bovine Papillomavirus Type 1 E2 Protein Confers Redox Regulation of the DNA- Binding Activity in Vitro

    NASA Astrophysics Data System (ADS)

    McBride, Alison A.; Klausner, Richard D.; Howley, Peter M.


    The bovine papillomavirus type 1 E2 open reading frame encodes three proteins involved in viral DNA replication and transcriptional regulation. These polypeptides share a carboxyl-terminal domain with a specific DNA-binding activity; through this domain the E2 polypeptides form dimers. In this study, we demonstrate the inhibition of E2 DNA binding in vitro by reagents that oxidize or otherwise chemically modify the free sulfydryl groups of reactive cysteine residues. However, these reagents had no effect on DNA-binding activity when the E2 polypeptide was first bound to DNA, suggesting that the free sulfydryl group(s) may be protected by DNA binding. Sensitivity to sulfydryl modification was mapped to a cysteine residue at position 340 in the E2 DNA-binding domain, an amino acid that is highly conserved among the E2 proteins of different papillomaviruses. Replacement of this residue with other amino acids abrogated the sensitivity to oxidation-reduction changes but did not affect the DNA-binding property of the E2 protein. These results suggest that papillomavirus DNA replication and transcriptional regulation could be modulated through the E2 proteins by changes in the intracellular redox environment. Furthermore, a motif consisting of a reactive cysteine residue carboxyl-terminal to a lysine residue in a basic region of the DNA-binding domain is a feature common to a number of transcriptional regulatory proteins that, like E2, are subject to redox regulation. Thus, posttranslational regulation of the activity of these proteins by the intracellular redox environment may be a general phenomenon.

  10. Conservation of the Host-Interacting Proteins Tp0750 and Pallilysin among Treponemes and Restriction of Proteolytic Capacity to Treponema pallidum.


    Houston, Simon; Taylor, John S; Denchev, Yavor; Hof, Rebecca; Zuerner, Richard L; Cameron, Caroline E


    The spirochete Treponema pallidum subsp. pallidum is the causative agent of syphilis, a chronic, sexually transmitted infection characterized by multiple symptomatic and asymptomatic stages. Although several other species in the genus are able to cause or contribute to disease, T. pallidum differs in that it is able to rapidly disseminate via the bloodstream to tissue sites distant from the site of initial infection. It is also the only Treponema species able to cross both the blood-brain and placental barriers. Previously, the T. pallidum proteins, Tp0750 and Tp0751 (also called pallilysin), were shown to degrade host proteins central to blood coagulation and basement membrane integrity, suggesting a role for these proteins in T. pallidum dissemination and tissue invasion. In the present study, we characterized Tp0750 and Tp0751 sequence variation in a diversity of pathogenic and nonpathogenic treponemes. We also determined the proteolytic potential of the orthologs from the less invasive species Treponema denticola and Treponema phagedenis. These analyses showed high levels of sequence similarity among Tp0750 orthologs from pathogenic species. For pallilysin, lower levels of sequence conservation were observed between this protein and orthologs from other treponemes, except for the ortholog from the highly invasive rabbit venereal syphilis-causing Treponema paraluiscuniculi. In vitro host component binding and degradation assays demonstrated that pallilysin and Tp0750 orthologs from the less invasive treponemes tested were not capable of binding or degrading host proteins. The results show that pallilysin and Tp0750 host protein binding and degradative capability is positively correlated with treponemal invasiveness. PMID:26283341

  11. Conservation of the Host-Interacting Proteins Tp0750 and Pallilysin among Treponemes and Restriction of Proteolytic Capacity to Treponema pallidum

    PubMed Central

    Houston, Simon; Taylor, John S.; Denchev, Yavor; Hof, Rebecca; Zuerner, Richard L.


    The spirochete Treponema pallidum subsp. pallidum is the causative agent of syphilis, a chronic, sexually transmitted infection characterized by multiple symptomatic and asymptomatic stages. Although several other species in the genus are able to cause or contribute to disease, T. pallidum differs in that it is able to rapidly disseminate via the bloodstream to tissue sites distant from the site of initial infection. It is also the only Treponema species able to cross both the blood-brain and placental barriers. Previously, the T. pallidum proteins, Tp0750 and Tp0751 (also called pallilysin), were shown to degrade host proteins central to blood coagulation and basement membrane integrity, suggesting a role for these proteins in T. pallidum dissemination and tissue invasion. In the present study, we characterized Tp0750 and Tp0751 sequence variation in a diversity of pathogenic and nonpathogenic treponemes. We also determined the proteolytic potential of the orthologs from the less invasive species Treponema denticola and Treponema phagedenis. These analyses showed high levels of sequence similarity among Tp0750 orthologs from pathogenic species. For pallilysin, lower levels of sequence conservation were observed between this protein and orthologs from other treponemes, except for the ortholog from the highly invasive rabbit venereal syphilis-causing Treponema paraluiscuniculi. In vitro host component binding and degradation assays demonstrated that pallilysin and Tp0750 orthologs from the less invasive treponemes tested were not capable of binding or degrading host proteins. The results show that pallilysin and Tp0750 host protein binding and degradative capability is positively correlated with treponemal invasiveness. PMID:26283341

  12. PHOTOSYSTEM II PROTEIN33, a protein conserved in the plastid lineage, is associated with the chloroplast thylakoid membrane and provides stability to photosystem II supercomplexes in Arabidopsis.


    Fristedt, Rikard; Herdean, Andrei; Blaby-Haas, Crysten E; Mamedov, Fikret; Merchant, Sabeeha S; Last, Robert L; Lundin, Björn


    Photosystem II (PSII) is a multiprotein complex that catalyzes the light-driven water-splitting reactions of oxygenic photosynthesis. Light absorption by PSII leads to the production of excited states and reactive oxygen species that can cause damage to this complex. Here, we describe Arabidopsis (Arabidopsis thaliana) At1g71500, which encodes a previously uncharacterized protein that is a PSII auxiliary core protein and hence is named PHOTOSYSTEM II PROTEIN33 (PSB33). We present evidence that PSB33 functions in the maintenance of PSII-light-harvesting complex II (LHCII) supercomplex organization. PSB33 encodes a protein with a chloroplast transit peptide and one transmembrane segment. In silico analysis of PSB33 revealed a light-harvesting complex-binding motif within the transmembrane segment and a large surface-exposed head domain. Biochemical analysis of PSII complexes further indicates that PSB33 is an integral membrane protein located in the vicinity of LHCII and the PSII CP43 reaction center protein. Phenotypic characterization of mutants lacking PSB33 revealed reduced amounts of PSII-LHCII supercomplexes, very low state transition, and a lower capacity for nonphotochemical quenching, leading to increased photosensitivity in the mutant plants under light stress. Taken together, these results suggest a role for PSB33 in regulating and optimizing photosynthesis in response to changing light levels. PMID:25511433

  13. Epstein-Barr virus infection induces expression in B lymphocytes of a novel gene encoding an evolutionarily conserved 55-kilodalton actin-bundling protein.


    Mosialos, G; Yamashiro, S; Baughman, R W; Matsudaira, P; Vara, L; Matsumura, F; Kieff, E; Birkenbach, M


    A novel human mRNA whose expression is induced over 200-fold in B lymphocytes by latent Epstein-Barr virus (EBV) infection was reverse transcribed, cloned, and sequenced. The mRNA is predicted to encode a protein containing four peptides which precisely match amino acid sequences from a previously identified 55-kDa actin-bundling protein, p55. In vitro translation of the cDNA results in a 55-kDa protein which binds to actin filaments in the presence of purified p55 from HeLa cells. The p55 mRNA is undetectable in non-EBV-infected B- and T-cell lines or in a myelomonocytic cell line (U937). Newly infected primary human B lymphocytes, EBV-transformed B-cell lines, latently infected Burkitt tumor cells expressing EBNA2 and LMP1, a chronic myelogenous leukemia cell line (K562), and an osteosarcoma cell line (TK143) contain high levels of p55 mRNA or protein. In EBV-transformed B cells, p55 localizes to perinuclear cytoplasm and to cell surface processes that resemble filopodia. The p55 mRNA is detected at high levels in spleen and brain tissues, at moderate levels in lung and placenta tissues, and at low levels in skeletal muscle, liver, and tonsil tissues and is undetectable in heart, kidney, pancreas, and bone marrow tissues. Immunohistochemical staining of human brain tissue demonstrates p55 localization to the perinuclear cytoplasm and dendritic processes of many, but not all, types of cortical or cerebellar neurons, to glial cells, and to capillary endothelial cells. In cultured primary rat neurons, p55 is distributed throughout the perinuclear cytoplasm and in subcortical filamentous structures of dendrites and growth cones. p55 is highly evolutionarily conserved since it shows 40% amino acid sequence identity to the Drosophila singed gene product and 37% identity to fascin, an echinoderm actin-bundling protein. The evolutionary conservation of p55 and its lack of extensive homology to other actin-binding proteins suggest that p55 has specific microfilament

  14. Conserved Surface Features Form the Double-stranded RNA Binding Site of Non-structural Protein 1 (NS1) from Influenza A and B Viruses

    SciTech Connect

    Yin,C.; Khan, J.; Swapna, G.; Ertekin, A.; Krug, R.; Tong, L.; Montelione, G.


    Influenza A viruses cause a highly contagious respiratory disease in humans and are responsible for periodic widespread epidemics with high mortality rates. The influenza A virus NS1 protein (NS1A) plays a key role in countering host antiviral defense and in virulence. The 73-residue N-terminal domain of NS1A (NS1A-(1-73)) forms a symmetric homodimer with a unique six-helical chain fold. It binds canonical A-form double-stranded RNA (dsRNA). Mutational inactivation of this dsRNA binding activity of NS1A highly attenuates virus replication. Here, we have characterized the unique structural features of the dsRNA binding surface of NS1A-(1-73) using NMR methods and describe the 2.1-{angstrom} x-ray crystal structure of the corresponding dsRNA binding domain from human influenza B virus NS1B-(15-93). These results identify conserved dsRNA binding surfaces on both NS1A-(1-73) and NS1B-(15-93) that are very different from those indicated in earlier 'working models' of the complex between dsRNA and NS1A-(1-73). The combined NMR and crystallographic data reveal highly conserved surface tracks of basic and hydrophilic residues that interact with dsRNA. These tracks are structurally complementary to the polyphosphate backbone conformation of A-form dsRNA and run at an {approx}45{sup o} angle relative to the axes of helices {alpha}2/{alpha}2'. At the center of this dsRNA binding epitope, and common to NS1 proteins from influenza A and B viruses, is a deep pocket that includes both hydrophilic and hydrophobic amino acids. This pocket provides a target on the surface of the NS1 protein that is potentially suitable for the development of antiviral drugs targeting both influenza A and B viruses.

  15. Conserved surface features form the double-stranded RNA binding site of non-structural protein 1 (NS1) from influenza A and B viruses.


    Yin, Cuifeng; Khan, Javed A; Swapna, G V T; Ertekin, Asli; Krug, Robert M; Tong, Liang; Montelione, Gaetano T


    Influenza A viruses cause a highly contagious respiratory disease in humans and are responsible for periodic widespread epidemics with high mortality rates. The influenza A virus NS1 protein (NS1A) plays a key role in countering host antiviral defense and in virulence. The 73-residue N-terminal domain of NS1A (NS1A-(1-73)) forms a symmetric homodimer with a unique six-helical chain fold. It binds canonical A-form double-stranded RNA (dsRNA). Mutational inactivation of this dsRNA binding activity of NS1A highly attenuates virus replication. Here, we have characterized the unique structural features of the dsRNA binding surface of NS1A-(1-73) using NMR methods and describe the 2.1-A x-ray crystal structure of the corresponding dsRNA binding domain from human influenza B virus NS1B-(15-93). These results identify conserved dsRNA binding surfaces on both NS1A-(1-73) and NS1B-(15-93) that are very different from those indicated in earlier "working models" of the complex between dsRNA and NS1A-(1-73). The combined NMR and crystallographic data reveal highly conserved surface tracks of basic and hydrophilic residues that interact with dsRNA. These tracks are structurally complementary to the polyphosphate backbone conformation of A-form dsRNA and run at an approximately 45 degrees angle relative to the axes of helices alpha2/alpha2'. At the center of this dsRNA binding epitope, and common to NS1 proteins from influenza A and B viruses, is a deep pocket that includes both hydrophilic and hydrophobic amino acids. This pocket provides a target on the surface of the NS1 protein that is potentially suitable for the development of antiviral drugs targeting both influenza A and B viruses. PMID:17475623

  16. Conserved Residues in the N Terminus of Lipin-1 Are Required for Binding to Protein Phosphatase-1c, Nuclear Translocation, and Phosphatidate Phosphatase Activity*

    PubMed Central

    Kok, Bernard P. C.; Skene-Arnold, Tamara D.; Ling, Ji; Benesch, Matthew G. K.; Dewald, Jay; Harris, Thurl E.; Holmes, Charles F. B.; Brindley, David N.


    Lipin-1 is a phosphatidate phosphatase in glycerolipid biosynthesis and signal transduction. It also serves as a transcriptional co-regulator to control lipid metabolism and adipogenesis. These functions are controlled partly by its subcellular distribution. Hyperphosphorylated lipin-1 remains sequestered in the cytosol, whereas hypophosphorylated lipin-1 translocates to the endoplasmic reticulum and nucleus. The serine/threonine protein phosphatase-1 catalytic subunit (PP-1c) is a major protein dephosphorylation enzyme. Its activity is controlled by interactions with different regulatory proteins, many of which contain conserved RVXF binding motifs. We found that lipin-1 binds to PP-1cγ through a similar HVRF binding motif. This interaction depends on Mg2+ or Mn2+ and is competitively inhibited by (R/H)VXF-containing peptides. Mutating the HVRF motif in the highly conserved N terminus of lipin-1 greatly decreases PP-1cγ interaction. Moreover, mutations of other residues in the N terminus of lipin-1 also modulate PP-1cγ binding. PP-1cγ binds poorly to a phosphomimetic mutant of lipin-1 and binds well to the non-phosphorylatable lipin-1 mutant. This indicates that lipin-1 is dephosphorylated before PP-1cγ binds to its HVRF motif. Importantly, mutating the HVRF motif also abrogates the nuclear translocation and phosphatidate phosphatase activity of lipin-1. In conclusion, we provide novel evidence of the importance of the lipin-1 N-terminal domain for its catalytic activity, nuclear localization, and binding to PP-1cγ. PMID:24558042

  17. Chimeric virus-like particles containing a conserved region of the G protein in combination with a single peptide of the M2 protein confer protection against respiratory syncytial virus infection.


    Qiao, Lei; Zhang, Yuan; Chai, Feng; Tan, Yiluo; Huo, Chunling; Pan, Zishu


    To investigate the feasibility and efficacy of a virus-like particle (VLP) vaccine composed of the conserved antigenic epitopes of respiratory syncytial virus (RSV), the chimeric RSV VLPs HBcΔ-tG and HBcΔ-tG/M282-90 were generated based on the truncated hepatitis B virus core protein (HBcΔ). HBcΔ-tG consisted of HBcΔ, the conserved region (aa 144-204) of the RSV G protein. HBcΔ-tG was combined with a single peptide (aa 82-90) of the M2 protein to generate HBcΔ-tG/M282-90. Immunization of mice with the HBcΔ-tG or HBcΔ-tG/M282-90 VLPs elicited RSV-specific IgG and neutralizing antibody production and conferred protection against RSV infection. Compared with HBcΔ-tG, HBcΔ-tG/M282-90 induced decreased Th2 cytokine production (IL-4 and IL-5), increased Th1 cytokine response (IFN-γ, TNF-α, and IL-2), and increased ratios of IgG2a/IgG1 antibodies, thereby relieving pulmonary pathology upon subsequent RSV infection. Our results demonstrated that chimeric HBcΔ-tG/M282-90 VLPs represented an effective RSV subunit vaccine candidate. PMID:27154395

  18. Structure of astrotactin-2: a conserved vertebrate-specific and perforin-like membrane protein involved in neuronal development

    PubMed Central

    Ni, Tao; Harlos, Karl; Gilbert, Robert


    The vertebrate-specific proteins astrotactin-1 and 2 (ASTN-1 and ASTN-2) are integral membrane perforin-like proteins known to play critical roles in neurodevelopment, while ASTN-2 has been linked to the planar cell polarity pathway in hair cells. Genetic variations associated with them are linked to a variety of neurodevelopmental disorders and other neurological pathologies, including an advanced onset of Alzheimer's disease. Here we present the structure of the majority endosomal region of ASTN-2, showing it to consist of a unique combination of polypeptide folds: a perforin-like domain, a minimal epidermal growth factor-like module, a unique form of fibronectin type III domain and an annexin-like domain. The perforin-like domain differs from that of other members of the membrane attack complex-perforin (MACPF) protein family in ways that suggest ASTN-2 does not form pores. Structural and biophysical data show that ASTN-2 (but not ASTN-1) binds inositol triphosphates, suggesting a mechanism for membrane recognition or secondary messenger regulation of its activity. The annexin-like domain is closest in fold to repeat three of human annexin V and similarly binds calcium, and yet shares no sequence homology with it. Overall, our structure provides the first atomic-resolution description of a MACPF protein involved in development, while highlighting distinctive features of ASTN-2 responsible for its activity. PMID:27249642

  19. Structure of astrotactin-2: a conserved vertebrate-specific and perforin-like membrane protein involved in neuronal development.


    Ni, Tao; Harlos, Karl; Gilbert, Robert


    The vertebrate-specific proteins astrotactin-1 and 2 (ASTN-1 and ASTN-2) are integral membrane perforin-like proteins known to play critical roles in neurodevelopment, while ASTN-2 has been linked to the planar cell polarity pathway in hair cells. Genetic variations associated with them are linked to a variety of neurodevelopmental disorders and other neurological pathologies, including an advanced onset of Alzheimer's disease. Here we present the structure of the majority endosomal region of ASTN-2, showing it to consist of a unique combination of polypeptide folds: a perforin-like domain, a minimal epidermal growth factor-like module, a unique form of fibronectin type III domain and an annexin-like domain. The perforin-like domain differs from that of other members of the membrane attack complex-perforin (MACPF) protein family in ways that suggest ASTN-2 does not form pores. Structural and biophysical data show that ASTN-2 (but not ASTN-1) binds inositol triphosphates, suggesting a mechanism for membrane recognition or secondary messenger regulation of its activity. The annexin-like domain is closest in fold to repeat three of human annexin V and similarly binds calcium, and yet shares no sequence homology with it. Overall, our structure provides the first atomic-resolution description of a MACPF protein involved in development, while highlighting distinctive features of ASTN-2 responsible for its activity. PMID:27249642

  20. Conserved globulin gene across eight grass genomes identify fundamental units of the loci encoding seed storage proteins

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The wheat high molecular weight (HMW)-glutenins are important seed storage proteins that determine bread-making quality in hexaploid wheat (Triticum aestivum). In this study, detailed comparative sequence analyses of large orthologous HMW-glutenin genomic regions from eight grass species, represent...

  1. Conservation of functional domains involved in RNA binding and protein-protein interactions in human and Saccharomyces cerevisiae pre-mRNA splicing factor SF1.

    PubMed Central

    Rain, J C; Rafi, Z; Rhani, Z; Legrain, P; Krämer, A


    The modular structure of splicing factor SF1 is conserved from yeast to man and SF1 acts at early stages of spliceosome assembly in both organisms. The hnRNP K homology (KH) domain of human (h) SF1 is the major determinant for RNA binding and is essential for the activity of hSF1 in spliceosome assembly, supporting the view that binding of SF1 to RNA is essential for its function. Sequences N-terminal to the KH domain mediate the interaction between hSF1 and U2AF65, which binds to the polypyrimidine tract upstream of the 3' splice site. Moreover, yeast (y) SF1 interacts with Mud2p, the presumptive U2AF65 homologue in yeast, and the interaction domain is conserved in ySF1. The C-terminal degenerate RRMs in U2AF65 and Mud2p mediate the association with hSF1 and ySF1, respectively. Analysis of chimeric constructs of hSF1 and ySF indicates that the KH domain may serve a similar function in both systems, whereas sequences C-terminal to the KH domain are not exchangeable. Thus, these results argue for hSF1 and ySF1, as well as U2AF65 and Mud2p, being functional homologues. PMID:9582097

  2. Reconstitution of Protein Translation of Mycobacterium Reveals Functional Conservation and Divergence with the Gram-Negative Bacterium Escherichia coli

    PubMed Central

    Srivastava, Aashish; Asahara, Haruichi; Zhang, Meng; Zhang, Weijia; Liu, Haiying; Cui, Sheng; Jin, Qi; Chong, Shaorong


    Protein translation is essential for all bacteria pathogens. It has also been a major focus of structural and functional studies and an important target of antibiotics. Here we report our attempts to biochemically reconstitute mycobacterial protein translation in vitro from purified components. This mycobacterial translation system consists of individually purified recombinant translation factors from Mycobacterium tuberculosis (M. tuberculosis), purified tRNAs and ribosomes from Mycobacterium smegmatis (M. smegmatis), and an aminoacyl-tRNA synthetase (AARS) mixture from the cell-extract of M. smegmatis. We demonstrate that such mycobacterial translation system was efficient in in vitro protein synthesis, and enabled functional comparisons of translational components between the gram-positive Mycobacterium and the gram-negative E. coli. Although mycobacterial translation factors and ribosomes were highly compatible with their E. coli counterparts, M. smegmatis tRNAs were not properly charged by the E. coli AARSs to allow efficient translation of a reporter. In contrast, both E. coli and M. smegmatis tRNAs exhibited similar activity with the semi-purified M. smegmatis AARSs mixture for in vitro translation. We further demonstrated the use of both mycobacterial and E. coli translation systems as comparative in vitro assays for small-molecule antibiotics that target protein translation. While mycobacterial and E. coli translation were both inhibited at the same IC50 by the antibiotic spectinomycin, mycobacterial translation was preferentially inhibited by the antibiotic tetracycline, suggesting that there may be structural differences at the antibiotic binding sites between the ribosomes of Mycobacterium and E. coli. Our results illustrate an alternative approach for antibiotic discovery and functional studies of protein translation in mycobacteria and possibly other bacterial pathogens. PMID:27564552

  3. Reconstitution of Protein Translation of Mycobacterium Reveals Functional Conservation and Divergence with the Gram-Negative Bacterium Escherichia coli.


    Srivastava, Aashish; Asahara, Haruichi; Zhang, Meng; Zhang, Weijia; Liu, Haiying; Cui, Sheng; Jin, Qi; Chong, Shaorong


    Protein translation is essential for all bacteria pathogens. It has also been a major focus of structural and functional studies and an important target of antibiotics. Here we report our attempts to biochemically reconstitute mycobacterial protein translation in vitro from purified components. This mycobacterial translation system consists of individually purified recombinant translation factors from Mycobacterium tuberculosis (M. tuberculosis), purified tRNAs and ribosomes from Mycobacterium smegmatis (M. smegmatis), and an aminoacyl-tRNA synthetase (AARS) mixture from the cell-extract of M. smegmatis. We demonstrate that such mycobacterial translation system was efficient in in vitro protein synthesis, and enabled functional comparisons of translational components between the gram-positive Mycobacterium and the gram-negative E. coli. Although mycobacterial translation factors and ribosomes were highly compatible with their E. coli counterparts, M. smegmatis tRNAs were not properly charged by the E. coli AARSs to allow efficient translation of a reporter. In contrast, both E. coli and M. smegmatis tRNAs exhibited similar activity with the semi-purified M. smegmatis AARSs mixture for in vitro translation. We further demonstrated the use of both mycobacterial and E. coli translation systems as comparative in vitro assays for small-molecule antibiotics that target protein translation. While mycobacterial and E. coli translation were both inhibited at the same IC50 by the antibiotic spectinomycin, mycobacterial translation was preferentially inhibited by the antibiotic tetracycline, suggesting that there may be structural differences at the antibiotic binding sites between the ribosomes of Mycobacterium and E. coli. Our results illustrate an alternative approach for antibiotic discovery and functional studies of protein translation in mycobacteria and possibly other bacterial pathogens. PMID:27564552

  4. DNA prime-protein boost based vaccination with a conserved region of leptospiral immunoglobulin-like A and B proteins enhances protection against leptospirosis.


    Forster, Karine M; Hartwig, Daiane D; Oliveira, Thaís L; Bacelo, Kátia L; Schuch, Rodrigo; Amaral, Marta G; Dellagostin, Odir A


    Leptospirosis is a zoonotic disease caused by pathogenic spirochetes of the Leptospira genus. Vaccination with bacterins has severe limitations. Here, we evaluated the N-terminal region of the leptospiral immunoglobulin-like B protein (LigBrep) as a vaccine candidate against leptospirosis using immunisation strategies based on DNA prime-protein boost, DNA vaccine, and subunit vaccine. Upon challenge with a virulent strain ofLeptospira interrogans, the prime-boost and DNA vaccine approaches induced significant protection in hamsters, as well as a specific IgG antibody response and sterilising immunity. Although vaccination with recombinant fragment of LigBrep also produced a strong antibody response, it was not immunoprotective. These results highlight the potential of LigBrep as a candidate antigen for an effective vaccine against leptospirosis and emphasise the use of the DNA prime-protein boost as an important strategy for vaccine development. PMID:26676320

  5. DNA prime-protein boost based vaccination with a conserved region of leptospiral immunoglobulin-like A and B proteins enhances protection against leptospirosis

    PubMed Central

    Forster, Karine M; Hartwig, Daiane D; Oliveira, Thaís L; Bacelo, Kátia L; Schuch, Rodrigo; Amaral, Marta G; Dellagostin, Odir A


    Leptospirosis is a zoonotic disease caused by pathogenic spirochetes of theLeptospira genus. Vaccination with bacterins has severe limitations. Here, we evaluated the N-terminal region of the leptospiral immunoglobulin-like B protein (LigBrep) as a vaccine candidate against leptospirosis using immunisation strategies based on DNA prime-protein boost, DNA vaccine, and subunit vaccine. Upon challenge with a virulent strain ofLeptospira interrogans, the prime-boost and DNA vaccine approaches induced significant protection in hamsters, as well as a specific IgG antibody response and sterilising immunity. Although vaccination with recombinant fragment of LigBrep also produced a strong antibody response, it was not immunoprotective. These results highlight the potential of LigBrep as a candidate antigen for an effective vaccine against leptospirosis and emphasise the use of the DNA prime-protein boost as an important strategy for vaccine development. PMID:26676320

  6. Structural mapping of the coiled-coil domain of a bacterial condensin and comparative analyses across all domains of life suggest conserved features of SMC proteins.


    Waldman, Vincent M; Stanage, Tyler H; Mims, Alexandra; Norden, Ian S; Oakley, Martha G


    The structural maintenance of chromosomes (SMC) proteins form the cores of multisubunit complexes that are required for the segregation and global organization of chromosomes in all domains of life. These proteins share a common domain structure in which N- and C- terminal regions pack against one another to form a globular ATPase domain. This "head" domain is connected to a central, globular, "hinge" or dimerization domain by a long, antiparallel coiled coil. To date, most efforts for structural characterization of SMC proteins have focused on the globular domains. Recently, however, we developed a method to map interstrand interactions in the 50-nm coiled-coil domain of MukB, the divergent SMC protein found in γ-proteobacteria. Here, we apply that technique to map the structure of the Bacillus subtilis SMC (BsSMC) coiled-coil domain. We find that, in contrast to the relatively complicated coiled-coil domain of MukB, the BsSMC domain is nearly continuous, with only two detectable coiled-coil interruptions. Near the middle of the domain is a break in coiled-coil structure in which there are three more residues on the C-terminal strand than on the N-terminal strand. Close to the head domain, there is a second break with a significantly longer insertion on the same strand. These results provide an experience base that allows an informed interpretation of the output of coiled-coil prediction algorithms for this family of proteins. A comparison of such predictions suggests that these coiled-coil deviations are highly conserved across SMC types in a wide variety of organisms, including humans. PMID:25664627

  7. Computational Modeling of Structurally Conserved Cancer Mutations in the RET and MET Kinases: The Impact on Protein Structure, Dynamics, and Stability

    PubMed Central

    Dixit, Anshuman; Torkamani, Ali; Schork, Nicholas J.; Verkhivker, Gennady


    Structural and biochemical characterization of protein kinases that confer oncogene addiction and harbor a large number of disease-associated mutations, including RET and MET kinases, have provided insights into molecular mechanisms associated with the protein kinase activation in human cancer. In this article, structural modeling, molecular dynamics, and free energy simulations of a structurally conserved mutational hotspot, shared by M918T in RET and M1250T in MET kinases, are undertaken to quantify the molecular mechanism of activation and the functional role of cancer mutations in altering protein kinase structure, dynamics, and stability. The mechanistic basis of the activating RET and MET cancer mutations may be driven by an appreciable free energy destabilization of the inactive kinase state in the mutational forms. According to our results, the locally enhanced mobility of the cancer mutants and a higher conformational entropy are counterbalanced by a larger enthalpy loss and result in the decreased thermodynamic stability. The computed protein stability differences between the wild-type and cancer kinase mutants are consistent with circular dichroism spectroscopy and differential scanning calorimetry experiments. These results support the molecular mechanism of activation, which causes a detrimental imbalance in the dynamic equilibrium shifted toward the active form of the enzyme. Furthermore, computer simulations of the inhibitor binding with the oncogenic and drug-resistant RET mutations have also provided a plausible molecular rationale for the observed differences in the inhibition profiles, which is consistent with the experimental data. Finally, structural mapping of RET and MET cancer mutations and the computed protein stability changes suggest a similar mechanism of activation, whereby the cancer mutations which display the higher oncogenic activity tend to have the greatest destabilization effect on the inactive kinase structure. PMID:19186126

  8. Linkage of TATA-binding protein and proteasome subunit C5 genes in mice and humans reveals synteny conserved between mammals and invertebrates.


    Trachtulec, Z; Hamvas, R M; Forejt, J; Lehrach, H R; Vincek, V; Klein, J


    The TATA-binding protein (TBP) is a factor required for the transcription of all classes of eukaryotic genes. Here, we demonstrate that in the mouse the TBP-encoding gene (Tbp) resides next to the proteasomal subunit C5-encoding gene (Psmb1). The genes are located on mouse chromosome 17 in the t complex within the Hybrid sterility 1 (Hst1) region. We demonstrate that the homologous human genes (TBP AND PSMB1) are tightly linked on the long arm of chromosome 6, in a region syntenic with the proximal part of mouse chromosome 17. The mouse Tbp and Psmb1 and the human TBP and PSMB1 genes are transcribed in the opposite orientation. The TATA-binding protein and proteasomal subunit C5 genes are also linked on chromosome III of Caenorhabditis elegans, and together they are linked to other genes whose homologs map to human chromosome 6 and mouse chromosome 17. In the Drosophila genome, the housekeeping TATA-binding protein gene maps close to two other genes with homologs in the mammalian major histocompatibility complex. There thus exists conserved synteny of unrelated genes between mammals and invertebrates. PMID:9286694

  9. An ancient and conserved function for Armadillo-related proteins in the control of spore and seed germination by abscisic acid.


    Moody, Laura A; Saidi, Younousse; Gibbs, Daniel J; Choudhary, Anushree; Holloway, Daniel; Vesty, Eleanor F; Bansal, Kiran Kaur; Bradshaw, Susan J; Coates, Juliet C


    Armadillo-related proteins regulate development throughout eukaryotic kingdoms. In the flowering plant Arabidopsis thaliana, Armadillo-related ARABIDILLO proteins promote multicellular root branching. ARABIDILLO homologues exist throughout land plants, including early-diverging species lacking true roots, suggesting that early-evolving ARABIDILLOs had additional biological roles. Here we investigated, using molecular genetics, the conservation and diversification of ARABIDILLO protein function in plants separated by c. 450 million years of evolution. We demonstrate that ARABIDILLO homologues in the moss Physcomitrella patens regulate a previously undiscovered inhibitory effect of abscisic acid (ABA) on spore germination. Furthermore, we show that A. thaliana ARABIDILLOs function similarly during seed germination. Early-diverging ARABIDILLO homologues from both P. patens and the lycophyte Selaginella moellendorffii can substitute for ARABIDILLO function during A. thaliana root development and seed germination. We conclude that (1) ABA was co-opted early in plant evolution to regulate functionally analogous processes in spore- and seed-producing plants and (2) plant ARABIDILLO germination functions were co-opted early into both gametophyte and sporophyte, with a specific rooting function evolving later in the land plant lineage. PMID:27040616

  10. Two-ligand priming mechanism for potentiated phosphoinositide synthesis is an evolutionarily conserved feature of Sec14-like phosphatidylinositol and phosphatidylcholine exchange proteins.


    Huang, Jin; Ghosh, Ratna; Tripathi, Ashutosh; Lönnfors, Max; Somerharju, Pentti; Bankaitis, Vytas A


    Lipid signaling, particularly phosphoinositide signaling, plays a key role in regulating the extreme polarized membrane growth that drives root hair development in plants. The Arabidopsis AtSFH1 gene encodes a two-domain protein with an amino-terminal Sec14-like phosphatidylinositol transfer protein (PITP) domain linked to a carboxy-terminal nodulin domain. AtSfh1 is critical for promoting the spatially highly organized phosphatidylinositol-4,5-bisphosphate signaling program required for establishment and maintenance of polarized root hair growth. Here we demonstrate that, like the yeast Sec14, the AtSfh1 PITP domain requires both its phosphatidylinositol (PtdIns)- and phosphatidylcholine (PtdCho)-binding properties to stimulate PtdIns-4-phosphate [PtdIns(4)P] synthesis. Moreover, we show that both phospholipid-binding activities are essential for AtSfh1 activity in supporting polarized root hair growth. Finally, we report genetic and biochemical evidence that the two-ligand mechanism for potentiation of PtdIns 4-OH kinase activity is a broadly conserved feature of plant Sec14-nodulin proteins, and that this strategy appeared only late in plant evolution. Taken together, the data indicate that the PtdIns/PtdCho-exchange mechanism for stimulated PtdIns(4)P synthesis either arose independently during evolution in yeast and in higher plants, or a suitable genetic module was introduced to higher plants from a fungal source and subsequently exploited by them. PMID:27193303

  11. Spatial control of translation repression and polarized growth by conserved NDR kinase Orb6 and RNA-binding protein Sts5.


    Nuñez, Illyce; Rodriguez Pino, Marbelys; Wiley, David J; Das, Maitreyi E; Chen, Chuan; Goshima, Tetsuya; Kume, Kazunori; Hirata, Dai; Toda, Takashi; Verde, Fulvia


    RNA-binding proteins contribute to the formation of ribonucleoprotein (RNP) granules by phase transition, but regulatory mechanisms are not fully understood. Conserved fission yeast NDR (Nuclear Dbf2-Related) kinase Orb6 governs cell morphogenesis in part by spatially controlling Cdc42 GTPase. Here we describe a novel, independent function for Orb6 kinase in negatively regulating the recruitment of RNA-binding protein Sts5 into RNPs to promote polarized cell growth. We find that Orb6 kinase inhibits Sts5 recruitment into granules, its association with processing (P) bodies, and degradation of Sts5-bound mRNAs by promoting Sts5 interaction with 14-3-3 protein Rad24. Many Sts5-bound mRNAs encode essential factors for polarized cell growth, and Orb6 kinase spatially and temporally controls the extent of Sts5 granule formation. Disruption of this control system affects cell morphology and alters the pattern of polarized cell growth, revealing a role for Orb6 kinase in the spatial control of translational repression that enables normal cell morphogenesis. PMID:27474797

  12. Discovery of an essential nucleotidylating activity associated with a newly delineated conserved domain in the RNA polymerase-containing protein of all nidoviruses

    PubMed Central

    Lehmann, Kathleen C.; Gulyaeva, Anastasia; Zevenhoven-Dobbe, Jessika C.; Janssen, George M. C.; Ruben, Mark; Overkleeft, Hermen S.; van Veelen, Peter A.; Samborskiy, Dmitry V.; Kravchenko, Alexander A.; Leontovich, Andrey M.; Sidorov, Igor A.; Snijder, Eric J.; Posthuma, Clara C.; Gorbalenya, Alexander E.


    RNA viruses encode an RNA-dependent RNA polymerase (RdRp) that catalyzes the synthesis of their RNA(s). In the case of positive-stranded RNA viruses belonging to the order Nidovirales, the RdRp resides in a replicase subunit that is unusually large. Bioinformatics analysis of this non-structural protein has now revealed a nidoviral signature domain (genetic marker) that is N-terminally adjacent to the RdRp and has no apparent homologs elsewhere. Based on its conservation profile, this domain is proposed to have nucleotidylation activity. We used recombinant non-structural protein 9 of the arterivirus equine arteritis virus (EAV) and different