Structural Basis for Suppression of a Host Antiviral Response by Influenza A Virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Das,K.; Ma, L.; Xiao, R.

2008-01-01

Influenza A viruses are responsible for seasonal epidemics and high mortality pandemics. A major function of the viral NS1A protein, a virulence factor, is the inhibition of the production of IFN-{beta}{beta} mRNA and other antiviral mRNAs. The NS1A protein of the human influenza A/Udorn/72 (Ud) virus inhibits the production of these antiviral mRNAs by binding the cellular 30-kDa subunit of the cleavage and polyadenylation specificity factor (CPSF30), which is required for the 3' end processing of all cellular pre-mRNAs. Here we report the 1.95- Angstroms resolution X-ray crystal structure of the complex formed between the second and third zinc fingermore » domain (F2F3) of CPSF30 and the C-terminal domain of the Ud NS1A protein. The complex is a tetramer, in which each of two F2F3 molecules wraps around two NS1A effector domains that interact with each other head-to-head. This structure identifies a CPSF30 binding pocket on NS1A comprised of amino acid residues that are highly conserved among human influenza A viruses. Single amino acid changes within this binding pocket eliminate CPSF30 binding, and a recombinant Ud virus expressing an NS1A protein with such a substitution is attenuated and does not inhibit IFN-{beta} pre-mRNA processing. This binding pocket is a potential target for antiviral drug development. The crystal structure also reveals that two amino acids outside of this pocket, F103 and M106, which are highly conserved (>99%) among influenza A viruses isolated from humans, participate in key hydrophobic interactions with F2F3 that stabilize the complex.« less

A Novel Antiviral Target Structure Involved in the RNA Binding, Dimerization, and Nuclear Export Functions of the Influenza A Virus Nucleoprotein

PubMed Central

Yamada, Kazunori; Kondoh, Yasumitsu; Hikono, Hirokazu; Osada, Hiroyuki; Tomii, Kentaro; Saito, Takehiko; Aida, Yoko

2015-01-01

Developing antiviral therapies for influenza A virus (IAV) infection is an ongoing process because of the rapid rate of antigenic mutation and the emergence of drug-resistant viruses. The ideal strategy is to develop drugs that target well-conserved, functionally restricted, and unique surface structures without affecting host cell function. We recently identified the antiviral compound, RK424, by screening a library of 50,000 compounds using cell-based infection assays. RK424 showed potent antiviral activity against many different subtypes of IAV in vitro and partially protected mice from a lethal dose of A/WSN/1933 (H1N1) virus in vivo. Here, we show that RK424 inhibits viral ribonucleoprotein complex (vRNP) activity, causing the viral nucleoprotein (NP) to accumulate in the cell nucleus. In silico docking analysis revealed that RK424 bound to a small pocket in the viral NP. This pocket was surrounded by three functionally important domains: the RNA binding groove, the NP dimer interface, and nuclear export signal (NES) 3, indicating that it may be involved in the RNA binding, oligomerization, and nuclear export functions of NP. The accuracy of this binding model was confirmed in a NP-RK424 binding assay incorporating photo-cross-linked RK424 affinity beads and in a plaque assay evaluating the structure-activity relationship of RK424. Surface plasmon resonance (SPR) and pull-down assays showed that RK424 inhibited both the NP-RNA and NP-NP interactions, whereas size exclusion chromatography showed that RK424 disrupted viral RNA-induced NP oligomerization. In addition, in vitro nuclear export assays confirmed that RK424 inhibited nuclear export of NP. The amino acid residues comprising the NP pocket play a crucial role in viral replication and are highly conserved in more than 7,000 NP sequences from avian, human, and swine influenza viruses. Furthermore, we found that the NP pocket has a surface structure different from that of the pocket in host molecules. Taken together, these results describe a promising new approach to developing influenza virus drugs that target a novel pocket structure within NP. PMID:26222066

Structural and Functional Analyses of a Conserved Hydrophobic Pocket of Flavivirus Methyltransferase

DOE Office of Scientific and Technical Information (OSTI.GOV)

H Dong; L Liu; G Zou

2011-12-31

The flavivirus methyltransferase (MTase) sequentially methylates the N7 and 2'-O positions of the viral RNA cap (GpppA-RNA {yields} m(7)GpppA-RNA {yields} m(7)GpppAm-RNA), using S-adenosyl-l-methionine (AdoMet) as a methyl donor. We report here that sinefungin (SIN), an AdoMet analog, inhibits several flaviviruses through suppression of viral MTase. The crystal structure of West Nile virus MTase in complex with SIN inhibitor at 2.0-{angstrom} resolution revealed a flavivirus-conserved hydrophobic pocket located next to the AdoMet-binding site. The pocket is functionally critical in the viral replication and cap methylations. In addition, the N7 methylation efficiency was found to correlate with the viral replication ability. Thus,more » SIN analogs with modifications that interact with the hydrophobic pocket are potential specific inhibitors of flavivirus MTase.« less

Structural basis for molecular recognition at serotonin receptors.

PubMed

Wang, Chong; Jiang, Yi; Ma, Jinming; Wu, Huixian; Wacker, Daniel; Katritch, Vsevolod; Han, Gye Won; Liu, Wei; Huang, Xi-Ping; Vardy, Eyal; McCorvy, John D; Gao, Xiang; Zhou, X Edward; Melcher, Karsten; Zhang, Chenghai; Bai, Fang; Yang, Huaiyu; Yang, Linlin; Jiang, Hualiang; Roth, Bryan L; Cherezov, Vadim; Stevens, Raymond C; Xu, H Eric

2013-05-03

Serotonin or 5-hydroxytryptamine (5-HT) regulates a wide spectrum of human physiology through the 5-HT receptor family. We report the crystal structures of the human 5-HT1B G protein-coupled receptor bound to the agonist antimigraine medications ergotamine and dihydroergotamine. The structures reveal similar binding modes for these ligands, which occupy the orthosteric pocket and an extended binding pocket close to the extracellular loops. The orthosteric pocket is formed by residues conserved in the 5-HT receptor family, clarifying the family-wide agonist activity of 5-HT. Compared with the structure of the 5-HT2B receptor, the 5-HT1B receptor displays a 3 angstrom outward shift at the extracellular end of helix V, resulting in a more open extended pocket that explains subtype selectivity. Together with docking and mutagenesis studies, these structures provide a comprehensive structural basis for understanding receptor-ligand interactions and designing subtype-selective serotonergic drugs.

Crystal Structure of the Marburg Virus Nucleoprotein Core Domain Chaperoned by a VP35 Peptide Reveals a Conserved Drug Target for Filovirus.

PubMed

Zhu, Tengfei; Song, Hao; Peng, Ruchao; Shi, Yi; Qi, Jianxun; Gao, George F

2017-09-15

Filovirus nucleoprotein (NP), viral protein 35 (VP35), and polymerase L are essential for viral replication and nucleocapsid formation. Here, we identify a 28-residue peptide (NP binding peptide [NPBP]) from Marburg virus (MARV) VP35 through sequence alignment with previously identified Ebola virus (EBOV) NPBP, which bound to the core region (residues 18 to 344) of the N-terminal portion of MARV NP with high affinity. The crystal structure of the MARV NP core/NPBP complex at a resolution of 2.6 Å revealed that NPBP binds to the C-terminal region of the NP core via electrostatic and nonpolar interactions. Further structural analysis revealed that the MARV and EBOV NP cores hold a conserved binding pocket for NPBP, and this pocket could serve as a promising target for the design of universal drugs against filovirus infection. In addition, cross-binding assays confirmed that the NP core of MARV or EBOV can bind the NPBP from the other virus, although with moderately reduced binding affinities that result from termini that are distinct between the MARV and EBOV NPBPs. IMPORTANCE Historically, Marburg virus (MARV) has caused severe disease with up to 90% lethality. Among the viral proteins produced by MARV, NP and VP35 are both multifunctional proteins that are essential for viral replication. In its relative, Ebola virus (EBOV), an N-terminal peptide from VP35 binds to the NP N-terminal region with high affinity. Whether this is a common mechanism among filoviruses is an unsolved question. Here, we present the crystal structure of a complex that consists of the core domain of MARV NP and the NPBP peptide from VP35. As we compared MARV NPBP with EBOV NPBP, several different features at the termini were identified. Although these differences reduce the affinity of the NP core for NPBPs across genera, a conserved pocket in the C-terminal region of the NP core makes cross-species binding possible. Our results expand our knowledge of filovirus NP-VP35 interactions and provide more details for therapeutic intervention. Copyright © 2017 American Society for Microbiology.

The Proliferating Cell Nuclear Antigen (PCNA)-interacting Protein (PIP) Motif of DNA Polymerase η Mediates Its Interaction with the C-terminal Domain of Rev1*

PubMed Central

Boehm, Elizabeth M.; Powers, Kyle T.; Kondratick, Christine M.; Spies, Maria; Houtman, Jon C. D.; Washington, M. Todd

2016-01-01

Y-family DNA polymerases, such as polymerase η, polymerase ι, and polymerase κ, catalyze the bypass of DNA damage during translesion synthesis. These enzymes are recruited to sites of DNA damage by interacting with the essential replication accessory protein proliferating cell nuclear antigen (PCNA) and the scaffold protein Rev1. In most Y-family polymerases, these interactions are mediated by one or more conserved PCNA-interacting protein (PIP) motifs that bind in a hydrophobic pocket on the front side of PCNA as well as by conserved Rev1-interacting region (RIR) motifs that bind in a hydrophobic pocket on the C-terminal domain of Rev1. Yeast polymerase η, a prototypical translesion synthesis polymerase, binds both PCNA and Rev1. It possesses a single PIP motif but not an RIR motif. Here we show that the PIP motif of yeast polymerase η mediates its interactions both with PCNA and with Rev1. Moreover, the PIP motif of polymerase η binds in the hydrophobic pocket on the Rev1 C-terminal domain. We also show that the RIR motif of human polymerase κ and the PIP motif of yeast Msh6 bind both PCNA and Rev1. Overall, these findings demonstrate that PIP motifs and RIR motifs have overlapping specificities and can interact with both PCNA and Rev1 in structurally similar ways. These findings also suggest that PIP motifs are a more versatile protein interaction motif than previously believed. PMID:26903512

A Conserved Aspartate Residue Located at the Extracellular End of the Binding Pocket Controls Cation Interactions in Brain Glutamate Transporters*

PubMed Central

Rosental, Noa; Gameiro, Armanda; Grewer, Christof; Kanner, Baruch I.

2011-01-01

In the brain, transporters of the major excitatory neurotransmitter glutamate remove their substrate from the synaptic cleft to allow optimal glutamatergic neurotransmission. Their transport cycle consists of two sequential translocation steps, namely cotransport of glutamic acid with three Na+ ions, followed by countertransport of K+. Recent studies, based on several crystal structures of the archeal homologue GltPh, indicate that glutamate translocation occurs by an elevator-like mechanism. The resolution of these structures was not sufficiently high to unambiguously identify the sites of Na+ binding, but functional and computational studies suggest some candidate sites. In the GltPh structure, a conserved aspartate residue (Asp-390) is located adjacent to a conserved tyrosine residue, previously shown to be a molecular determinant of ion selectivity in the brain glutamate transporter GLT-1. In this study, we characterize mutants of Asp-440 of the neuronal transporter EAAC1, which is the counterpart of Asp-390 of GltPh. Except for substitution by glutamate, this residue is functionally irreplaceable. Using biochemical and electrophysiological approaches, we conclude that although D440E is intrinsically capable of net flux, this mutant behaves as an exchanger under physiological conditions, due to increased and decreased apparent affinities for Na+ and K+, respectively. Our present and previous data are compatible with the idea that the conserved tyrosine and aspartate residues, located at the external end of the binding pocket, may serve as a transient or stable cation binding site in the glutamate transporters. PMID:21984827

A conserved aspartate residue located at the extracellular end of the binding pocket controls cation interactions in brain glutamate transporters.

PubMed

Rosental, Noa; Gameiro, Armanda; Grewer, Christof; Kanner, Baruch I

2011-12-02

In the brain, transporters of the major excitatory neurotransmitter glutamate remove their substrate from the synaptic cleft to allow optimal glutamatergic neurotransmission. Their transport cycle consists of two sequential translocation steps, namely cotransport of glutamic acid with three Na(+) ions, followed by countertransport of K(+). Recent studies, based on several crystal structures of the archeal homologue Glt(Ph), indicate that glutamate translocation occurs by an elevator-like mechanism. The resolution of these structures was not sufficiently high to unambiguously identify the sites of Na(+) binding, but functional and computational studies suggest some candidate sites. In the Glt(Ph) structure, a conserved aspartate residue (Asp-390) is located adjacent to a conserved tyrosine residue, previously shown to be a molecular determinant of ion selectivity in the brain glutamate transporter GLT-1. In this study, we characterize mutants of Asp-440 of the neuronal transporter EAAC1, which is the counterpart of Asp-390 of Glt(Ph). Except for substitution by glutamate, this residue is functionally irreplaceable. Using biochemical and electrophysiological approaches, we conclude that although D440E is intrinsically capable of net flux, this mutant behaves as an exchanger under physiological conditions, due to increased and decreased apparent affinities for Na(+) and K(+), respectively. Our present and previous data are compatible with the idea that the conserved tyrosine and aspartate residues, located at the external end of the binding pocket, may serve as a transient or stable cation binding site in the glutamate transporters.

Gating by tryptophan 73 exposes a cryptic pocket at the protein-binding interface of the oncogenic eIF4E protein.

PubMed

Lama, Dilraj; Brown, Christopher J; Lane, David P; Verma, Chandra S

2015-10-27

Targeting protein-protein interacting sites for potential therapeutic applications is a challenge in the development of inhibitors, and this becomes more difficult when these interfaces are relatively planar, as in the eukaryotic translation initiation factor 4E (eIF4E) protein. eIF4E is an oncogene that is overexpressed in numerous forms of cancer, making it a prime target as a therapeutic molecule. We report here the presence of a cryptic pocket at the protein-binding interface of eIF4E, which opens transiently during molecular dynamics simulations of the protein in solvent water and is observed to be stable when solvent water is mixed with benzene molecules. This pocket can also be seen in the ensemble of structures available from the solution-state conformations of eIF4E. The accessibility of the pocket is gated by the side-chain transitions of an evolutionarily conserved tryptophan residue. It is found to be feasible for accommodating clusters of benzene molecules, which signify the plasticity and ligandability of the pocket. We also observe that the newly formed cavity provides a favorable binding environment for interaction of a well-recognized small molecule inhibitor of eIF4E. The occurrence of this transiently accessible cavity highlights the existence of a more pronounced binding groove in a region that has traditionally been considered to be planar. Together, the data suggest that an alternate binding cavity exists on eIF4E and could be exploited for the rational design and development of a new class of lead compounds against the protein.

Structures of Saccharomyces cerevisiae D-arabinose dehydrogenase Ara1 and its complex with NADPH: implications for cofactor-assisted substrate recognition.

PubMed

Hu, Xiao-Qian; Guo, Peng-Chao; Ma, Jin-Di; Li, Wei-Fang

2013-11-01

The primary role of yeast Ara1, previously mis-annotated as a D-arabinose dehydrogenase, is to catalyze the reduction of a variety of toxic α,β-dicarbonyl compounds using NADPH as a cofactor at physiological pH levels. Here, crystal structures of Ara1 in apo and NADPH-complexed forms are presented at 2.10 and 2.00 Å resolution, respectively. Ara1 exists as a homodimer, each subunit of which adopts an (α/β)8-barrel structure and has a highly conserved cofactor-binding pocket. Structural comparison revealed that induced fit upon NADPH binding yielded an intact active-site pocket that recognizes the substrate. Moreover, the crystal structures combined with computational simulation defined an open substrate-binding site to accommodate various substrates that possess a dicarbonyl group.

Functional identification and characterization of sodium binding sites in Na symporters

PubMed Central

Loo, Donald D. F.; Jiang, Xuan; Gorraitz, Edurne; Hirayama, Bruce A.; Wright, Ernest M.

2013-01-01

Sodium cotransporters from several different gene families belong to the leucine transporter (LeuT) structural family. Although the identification of Na+ in binding sites is beyond the resolution of the structures, two Na+ binding sites (Na1 and Na2) have been proposed in LeuT. Na2 is conserved in the LeuT family but Na1 is not. A biophysical method has been used to measure sodium dissociation constants (Kd) of wild-type and mutant human sodium glucose cotransport (hSGLT1) proteins to identify the Na+ binding sites in hSGLT1. The Na1 site is formed by residues in the sugar binding pocket, and their mutation influences sodium binding to Na1 but not to Na2. For the canonical Na2 site formed by two –OH side chains, S392 and S393, and three backbone carbonyls, mutation of S392 to cysteine increased the sodium Kd by sixfold. This was accompanied by a dramatic reduction in the apparent sugar and phlorizin affinities. We suggest that mutation of S392 in the Na2 site produces a structural rearrangement of the sugar binding pocket to disrupt both the binding of the second Na+ and the binding of sugar. In contrast, the S393 mutations produce no significant changes in sodium, sugar, and phlorizin affinities. We conclude that the Na2 site is conserved in hSGLT1, the side chain of S392 and the backbone carbonyl of S393 are important in the first Na+ binding, and that Na+ binding to Na2 promotes binding to Na1 and also sugar binding. PMID:24191006

Genetic Pathway of HIV-1 Resistance to Novel Fusion Inhibitors Targeting the Gp41 Pocket

PubMed Central

Su, Yang; Chong, Huihiui; Xiong, Shengwen; Qiao, Yuanyuan; Qiu, Zonglin

2015-01-01

ABSTRACT The peptide drug enfuvirtide (T20) is the only HIV-1 fusion inhibitor in clinical use, but it easily induces drug resistance, calling for new strategies for developing effective drugs. On the basis of the M-T hook structure, we recently developed highly potent short-peptide HIV-1 fusion inhibitors (MTSC22 and HP23), which mainly target the conserved gp41 pocket and possess high genetic barriers to resistance. Here, we focused on the selection and characterization of HIV-1 escape mutants of MTSC22, which revealed new resistance pathways and mechanisms. Two mutations (E49K and L57R) located at the inhibitor-binding site and two mutations (N126K and E136G) located at the C-terminal heptad repeat region of gp41 were identified as conferring high resistance either singly or in combination. While E49K reduced the C-terminal binding of inhibitors via an electrostatic repulsion, L57R dramatically disrupted the N-terminal binding of M-T hook structure and pocket-binding domain. Unlike E49K and N126K, which enhanced the stability of the endogenous viral six-helical bundle core (6-HB), L57R and E136G conversely destabilized the 6-HB structure. We also demonstrated that both primary and secondary mutations caused the structural changes in 6-HB and severely impaired the capability for HIV-1 entry. Collectively, our data provide novel insights into the mechanisms of short-peptide fusion inhibitors targeting the gp41 pocket site and help increase our understanding of the structure and function of gp41 and HIV-1 evolution. IMPORTANCE The deep pocket on the N-trimer of HIV-1 gp41 has been considered an ideal drug target because of its high degree of conservation and essential role in viral entry. Short-peptide fusion inhibitors, which contain an M-T hook structure and mainly target the pocket site, show extremely high binding and inhibitory activities as well as high genetic barriers to resistance. In this study, the HIV-1 mutants resistant to MTSC22 were selected and characterized, which revealed that the E49K and L57R substitutions at the inhibitor-binding site and the N126K and E136G substitutions at the C-terminal heptad repeat region of gp41 critically determine the resistance phenotype. The data provide novel insights into the mechanisms of action of the M-T hook structure-based fusion inhibitors which will help further our understanding of the structure-function relationship of gp41 and molecular pathways of HIV-1 evolution and eventually facilitate the development of new anti-HIV drugs. PMID:26446597

Incorporation of Tyrosine and Glutamine Residues into the Soluble Guanylate Cyclase Heme Distal Pocket Alters NO and O2 Binding*

PubMed Central

Derbyshire, Emily R.; Deng, Sarah; Marletta, Michael A.

2010-01-01

Nitric oxide (NO) is the physiologically relevant activator of the mammalian hemoprotein soluble guanylate cyclase (sGC). The heme cofactor of α1β1 sGC has a high affinity for NO but has never been observed to form a complex with oxygen. Introduction of a key tyrosine residue in the sGC heme binding domain β1(1–385) is sufficient to produce an oxygen-binding protein, but this mutation in the full-length enzyme did not alter oxygen affinity. To evaluate ligand binding specificity in full-length sGC we mutated several conserved distal heme pocket residues (β1 Val-5, Phe-74, Ile-145, and Ile-149) to introduce a hydrogen bond donor in proximity to the heme ligand. We found that the NO coordination state, NO dissociation, and enzyme activation were significantly affected by the presence of a tyrosine in the distal heme pocket; however, the stability of the reduced porphyrin and the proteins affinity for oxygen were unaltered. Recently, an atypical sGC from Drosophila, Gyc-88E, was shown to form a stable complex with oxygen. Sequence analysis of this protein identified two residues in the predicted heme pocket (tyrosine and glutamine) that may function to stabilize oxygen binding in the atypical cyclase. The introduction of these residues into the rat β1 distal heme pocket (Ile-145 → Tyr and Ile-149 → Gln) resulted in an sGC construct that oxidized via an intermediate with an absorbance maximum at 417 nm. This absorbance maximum is consistent with globin FeII-O2 complexes and is likely the first observation of a FeII-O2 complex in the full-length α1β1 protein. Additionally, these data suggest that atypical sGCs stabilize O2 binding by a hydrogen bonding network involving tyrosine and glutamine. PMID:20231286

Structural basis for the inhibition of poly(ADP-ribose) polymerases 1 and 2 by BMN 673, a potent inhibitor derived from dihydropyridophthalazinone

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aoyagi-Scharber, Mika, E-mail: maoyagi@bmrn.com; Gardberg, Anna S.; Yip, Bryan K.

2014-08-29

BMN 673, a novel PARP1/2 inhibitor in clinical development with substantial tumor cytotoxicity, forms extensive hydrogen-bonding and π-stacking in the nicotinamide pocket, with its unique disubstituted scaffold extending towards the less conserved edges of the pocket. These interactions might provide structural insight into the ability of BMN 673 to both inhibit catalysis and affect DNA-binding activity. Poly(ADP-ribose) polymerases 1 and 2 (PARP1 and PARP2), which are involved in DNA damage response, are targets of anticancer therapeutics. BMN 673 is a novel PARP1/2 inhibitor with substantially increased PARP-mediated tumor cytotoxicity and is now in later-stage clinical development for BRCA-deficient breast cancers.more » In co-crystal structures, BMN 673 is anchored to the nicotinamide-binding pocket via an extensive network of hydrogen-bonding and π-stacking interactions, including those mediated by active-site water molecules. The novel di-branched scaffold of BMN 673 extends the binding interactions towards the outer edges of the pocket, which exhibit the least sequence homology among PARP enzymes. The crystallographic structural analyses reported here therefore not only provide critical insights into the molecular basis for the exceptionally high potency of the clinical development candidate BMN 673, but also new opportunities for increasing inhibitor selectivity.« less

The crystal structure of choline kinase reveals a eukaryotic protein kinase fold

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peisach, D.; Gee, P.; Kent, K.

2010-03-08

Choline kinase catalyzes the ATP-dependent phosphorylation of choline, the first committed step in the CDP-choline pathway for the biosynthesis of phosphatidylcholine. The 2.0 {angstrom} crystal structure of a choline kinase from C. elegans (CKA-2) reveals that the enzyme is a homodimeric protein with each monomer organized into a two-domain fold. The structure is remarkably similar to those of protein kinases and aminoglycoside phosphotransferases, despite no significant similarity in amino acid sequence. Comparisons to the structures of other kinases suggest that ATP binds to CKA-2 in a pocket formed by highly conserved and catalytically important residues. In addition, a choline bindingmore » site is proposed to be near the ATP binding pocket and formed by several structurally flexible loops.« less

Bacterial periplasmic sialic acid-binding proteins exhibit a conserved binding site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gangi Setty, Thanuja; Cho, Christine; Govindappa, Sowmya

2014-07-01

Structure–function studies of sialic acid-binding proteins from F. nucleatum, P. multocida, V. cholerae and H. influenzae reveal a conserved network of hydrogen bonds involved in conformational change on ligand binding. Sialic acids are a family of related nine-carbon sugar acids that play important roles in both eukaryotes and prokaryotes. These sialic acids are incorporated/decorated onto lipooligosaccharides as terminal sugars in multiple bacteria to evade the host immune system. Many pathogenic bacteria scavenge sialic acids from their host and use them for molecular mimicry. The first step of this process is the transport of sialic acid to the cytoplasm, which oftenmore » takes place using a tripartite ATP-independent transport system consisting of a periplasmic binding protein and a membrane transporter. In this paper, the structural characterization of periplasmic binding proteins from the pathogenic bacteria Fusobacterium nucleatum, Pasteurella multocida and Vibrio cholerae and their thermodynamic characterization are reported. The binding affinities of several mutations in the Neu5Ac binding site of the Haemophilus influenzae protein are also reported. The structure and the thermodynamics of the binding of sugars suggest that all of these proteins have a very well conserved binding pocket and similar binding affinities. A significant conformational change occurs when these proteins bind the sugar. While the C1 carboxylate has been identified as the primary binding site, a second conserved hydrogen-bonding network is involved in the initiation and stabilization of the conformational states.« less

Conserved neutralizing epitope at globular head of hemagglutinin in H3N2 influenza viruses.

PubMed

Iba, Yoshitaka; Fujii, Yoshifumi; Ohshima, Nobuko; Sumida, Tomomi; Kubota-Koketsu, Ritsuko; Ikeda, Mariko; Wakiyama, Motoaki; Shirouzu, Mikako; Okada, Jun; Okuno, Yoshinobu; Kurosawa, Yoshikazu; Yokoyama, Shigeyuki

2014-07-01

Neutralizing antibodies that target the hemagglutinin of influenza virus either inhibit binding of hemagglutinin to cellular receptors or prevent the low-pH-induced conformational change in hemagglutinin required for membrane fusion. In general, the former type of antibody binds to the globular head formed by HA1 and has narrow strain specificity, while the latter type binds to the stem mainly formed by HA2 and has broad strain specificity. In the present study, we analyzed the epitope and function of a broadly neutralizing human antibody against H3N2 viruses, F005-126. The crystal structure of F005-126 Fab in complex with hemagglutinin revealed that the antibody binds to the globular head, spans a cleft formed by two hemagglutinin monomers in a hemagglutinin trimer, and cross-links them. It recognizes two peptide portions (sites L and R) and a glycan linked to asparagine at residue 285 using three complementarity-determining regions and framework 3 in the heavy chain. Binding of the antibody to sites L (residues 171 to 173, 239, and 240) and R (residues 91, 92, 270 to 273, 284, and 285) is mediated mainly by van der Waals contacts with the main chains of the peptides in these sites and secondarily by hydrogen bonds with a few side chains of conserved sequences in HA1. Furthermore, the glycan recognized by F005-126 is conserved among H3N2 viruses. F005-126 has the ability to prevent low-pH-induced conformational changes in hemagglutinin. The newly identified conserved epitope, including the glycan, should be immunogenic in humans and may induce production of broadly neutralizing antibodies against H3 viruses. Antibodies play an important role in protection against influenza virus, and hemagglutinin is the major target for virus neutralizing antibodies. It has long been believed that all effective neutralizing antibodies bind to the surrounding regions of the sialic acid-binding pocket and inhibit the binding of hemagglutinin to the cellular receptor. Since mutations are readily introduced into such epitopes, this type of antibody shows narrow strain specificity. Recently, however, broadly neutralizing antibodies have been isolated. Most of these bind either to conserved sites in the stem region or to the sialic acid-binding pocket itself. In the present study, we identified a new neutralizing epitope in the head region recognized by a broadly neutralizing human antibody against H3N2. This epitope may be useful for design of vaccines. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Conserved Neutralizing Epitope at Globular Head of Hemagglutinin in H3N2 Influenza Viruses

PubMed Central

Iba, Yoshitaka; Fujii, Yoshifumi; Ohshima, Nobuko; Sumida, Tomomi; Kubota-Koketsu, Ritsuko; Ikeda, Mariko; Wakiyama, Motoaki; Shirouzu, Mikako; Okada, Jun; Okuno, Yoshinobu; Yokoyama, Shigeyuki

2014-01-01

ABSTRACT Neutralizing antibodies that target the hemagglutinin of influenza virus either inhibit binding of hemagglutinin to cellular receptors or prevent the low-pH-induced conformational change in hemagglutinin required for membrane fusion. In general, the former type of antibody binds to the globular head formed by HA1 and has narrow strain specificity, while the latter type binds to the stem mainly formed by HA2 and has broad strain specificity. In the present study, we analyzed the epitope and function of a broadly neutralizing human antibody against H3N2 viruses, F005-126. The crystal structure of F005-126 Fab in complex with hemagglutinin revealed that the antibody binds to the globular head, spans a cleft formed by two hemagglutinin monomers in a hemagglutinin trimer, and cross-links them. It recognizes two peptide portions (sites L and R) and a glycan linked to asparagine at residue 285 using three complementarity-determining regions and framework 3 in the heavy chain. Binding of the antibody to sites L (residues 171 to 173, 239, and 240) and R (residues 91, 92, 270 to 273, 284, and 285) is mediated mainly by van der Waals contacts with the main chains of the peptides in these sites and secondarily by hydrogen bonds with a few side chains of conserved sequences in HA1. Furthermore, the glycan recognized by F005-126 is conserved among H3N2 viruses. F005-126 has the ability to prevent low-pH-induced conformational changes in hemagglutinin. The newly identified conserved epitope, including the glycan, should be immunogenic in humans and may induce production of broadly neutralizing antibodies against H3 viruses. IMPORTANCE Antibodies play an important role in protection against influenza virus, and hemagglutinin is the major target for virus neutralizing antibodies. It has long been believed that all effective neutralizing antibodies bind to the surrounding regions of the sialic acid-binding pocket and inhibit the binding of hemagglutinin to the cellular receptor. Since mutations are readily introduced into such epitopes, this type of antibody shows narrow strain specificity. Recently, however, broadly neutralizing antibodies have been isolated. Most of these bind either to conserved sites in the stem region or to the sialic acid-binding pocket itself. In the present study, we identified a new neutralizing epitope in the head region recognized by a broadly neutralizing human antibody against H3N2. This epitope may be useful for design of vaccines. PMID:24719430

Structure determination of a sugar-binding protein from the phytopathogenic bacterium Xanthomonas citri

PubMed Central

Medrano, Francisco Javier; de Souza, Cristiane Santos; Romero, Antonio; Balan, Andrea

2014-01-01

The uptake of maltose and related sugars in Gram-negative bacteria is mediated by an ABC transporter encompassing a periplasmic component (the maltose-binding protein or MalE), a pore-forming membrane protein (MalF and MalG) and a membrane-associated ATPase (MalK). In the present study, the structure determination of the apo form of the putative maltose/trehalose-binding protein (Xac-MalE) from the citrus pathogen Xanthomonas citri in space group P6522 is described. The crystals contained two protein molecules in the asymmetric unit and diffracted to 2.8 Å resolution. Xac-MalE conserves the structural and functional features of sugar-binding proteins and a ligand-binding pocket with similar characteristics to eight different orthologues, including the residues for maltose and trehalose interaction. This is the first structure of a sugar-binding protein from a phytopathogenic bacterium, which is highly conserved in all species from the Xanthomonas genus. PMID:24817711

Cavity Versus Ligand Shape Descriptors: Application to Urokinase Binding Pockets.

PubMed

Cerisier, Natacha; Regad, Leslie; Triki, Dhoha; Camproux, Anne-Claude; Petitjean, Michel

2017-11-01

We analyzed 78 binding pockets of the human urokinase plasminogen activator (uPA) catalytic domain extracted from a data set of crystallized uPA-ligand complexes. These binding pockets were computed with an original geometric method that does NOT involve any arbitrary parameter, such as cutoff distances, angles, and so on. We measured the deviation from convexity of each pocket shape with the pocket convexity index (PCI). We defined a new pocket descriptor called distributional sphericity coefficient (DISC), which indicates to which extent the protein atoms of a given pocket lie on the surface of a sphere. The DISC values were computed with the freeware PCI. The pocket descriptors and their high correspondences with ligand descriptors are crucial for polypharmacology prediction. We found that the protein heavy atoms lining the urokinases binding pockets are either located on the surface of their convex hull or lie close to this surface. We also found that the radii of the urokinases binding pockets and the radii of their ligands are highly correlated (r = 0.9).

Investigate the Binding of Catechins to Trypsin Using Docking and Molecular Dynamics Simulation

PubMed Central

Cui, Fengchao; Yang, Kecheng; Li, Yunqi

2015-01-01

To explore the inhibitory mechanism of catechins for digestive enzymes, we investigated the binding mode of catechins to a typical digestive enzyme-trypsin and analyzed the structure-activity relationship of catechins, using an integration of molecular docking, molecular dynamics simulation and binding free energy calculation. We found that catechins with different structures bound to a conservative pocket S1 of trypsin, which is comprised of residues 189–195, 214–220 and 225–228. In the trypsin-catechin complexes, Asp189 by forming strong hydrogen bonding, and Gln192, Trp215 and Gly216 through hydrophobic interactions, all significantly contribute to the binding of catechins. The number and the position of hydroxyl and aromatic groups, the structure of stereoisomers, and the orientation of catechins in the binding pocket S1 of trypsin all affect the binding affinity. The binding affinity is in the order of Epigallocatechin gallate (EGCG) > Epicatechin gallate (ECG) > Epicatechin (EC) > Epigallocatechin (EGC), and 2R-3R EGCG shows the strongest binding affinity out of other stereoisomers. Meanwhile, the synergic conformational changes of residues and catechins were also analyzed. These findings will be helpful in understanding the knowledge of interactions between catechins and trypsin and referable for the design of novel polyphenol based functional food and nutriceutical formulas. PMID:25938485

Structures of BIR domains from human NAIP and cIAP2.

PubMed

Herman, Maria Dolores; Moche, Martin; Flodin, Susanne; Welin, Martin; Trésaugues, Lionel; Johansson, Ida; Nilsson, Martina; Nordlund, Pär; Nyman, Tomas

2009-11-01

The inhibitor of apoptosis (IAP) family of proteins contains key modulators of apoptosis and inflammation that interact with caspases through baculovirus IAP-repeat (BIR) domains. Overexpression of IAP proteins frequently occurs in cancer cells, thus counteracting the activated apoptotic program. The IAP proteins have therefore emerged as promising targets for cancer therapy. In this work, X-ray crystallography was used to determine the first structures of BIR domains from human NAIP and cIAP2. Both structures harbour an N-terminal tetrapeptide in the conserved peptide-binding groove. The structures reveal that these two proteins bind the tetrapeptides in a similar mode as do other BIR domains. Detailed interactions are described for the P1'-P4' side chains of the peptide, providing a structural basis for peptide-specific recognition. An arginine side chain in the P3' position reveals favourable interactions with its hydrophobic moiety in the binding pocket, while hydrophobic residues in the P2' and P4' pockets make similar interactions to those seen in other BIR domain-peptide complexes. The structures also reveal how a serine in the P1' position is accommodated in the binding pockets of NAIP and cIAP2. In addition to shedding light on the specificity determinants of these two proteins, the structures should now also provide a framework for future structure-based work targeting these proteins.

Structures of BIR domains from human NAIP and cIAP2

PubMed Central

Herman, Maria Dolores; Moche, Martin; Flodin, Susanne; Welin, Martin; Trésaugues, Lionel; Johansson, Ida; Nilsson, Martina; Nordlund, Pär; Nyman, Tomas

2009-01-01

The inhibitor of apoptosis (IAP) family of proteins contains key modulators of apoptosis and inflammation that interact with caspases through baculovirus IAP-repeat (BIR) domains. Overexpression of IAP proteins frequently occurs in cancer cells, thus counteracting the activated apoptotic program. The IAP proteins have therefore emerged as promising targets for cancer therapy. In this work, X-ray crystallography was used to determine the first structures of BIR domains from human NAIP and cIAP2. Both structures harbour an N-terminal tetrapeptide in the conserved peptide-binding groove. The structures reveal that these two proteins bind the tetrapeptides in a similar mode as do other BIR domains. Detailed interactions are described for the P1′–P4′ side chains of the peptide, providing a structural basis for peptide-specific recognition. An arginine side chain in the P3′ position reveals favourable interactions with its hydrophobic moiety in the binding pocket, while hydrophobic residues in the P2′ and P4′ pockets make similar interactions to those seen in other BIR domain–peptide complexes. The structures also reveal how a serine in the P1′ position is accommodated in the binding pockets of NAIP and cIAP2. In addition to shedding light on the specificity determinants of these two proteins, the structures should now also provide a framework for future structure-based work targeting these proteins. PMID:19923725

Cyclic AMP Inhibits the Activity and Promotes the Acetylation of Acetyl-CoA Synthetase through Competitive Binding to the ATP/AMP Pocket.

PubMed

Han, Xiaobiao; Shen, Liqiang; Wang, Qijun; Cen, Xufeng; Wang, Jin; Wu, Meng; Li, Peng; Zhao, Wei; Zhang, Yu; Zhao, Guoping

2017-01-27

The high-affinity biosynthetic pathway for converting acetate to acetyl-coenzyme A (acetyl-CoA) is catalyzed by the central metabolic enzyme acetyl-coenzyme A synthetase (Acs), which is finely regulated both at the transcriptional level via cyclic AMP (cAMP)-driven trans-activation and at the post-translational level via acetylation inhibition. In this study, we discovered that cAMP directly binds to Salmonella enterica Acs (SeAcs) and inhibits its activity in a substrate-competitive manner. In addition, cAMP binding increases SeAcs acetylation by simultaneously promoting Pat-dependent acetylation and inhibiting CobB-dependent deacetylation, resulting in enhanced SeAcs inhibition. A crystal structure study and site-directed mutagenesis analyses confirmed that cAMP binds to the ATP/AMP pocket of SeAcs, and restrains SeAcs in an open conformation. The cAMP contact residues are well conserved from prokaryotes to eukaryotes, suggesting a general regulatory mechanism of cAMP on Acs. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Structural basis for corepressor assembly by the orphan nuclear receptor TLX

PubMed Central

Zhou, X. Edward; He, Yuanzheng; Searose-Xu, Kelvin; Zhang, Chun-Li; Tsai, Chih-Cheng; Melcher, Karsten

2015-01-01

The orphan nuclear receptor TLX regulates neural stem cell self-renewal in the adult brain and functions primarily as a transcription repressor through recruitment of Atrophin corepressors, which bind to TLX via a conserved peptide motif termed the Atro box. Here we report crystal structures of the human and insect TLX ligand-binding domain in complex with Atro box peptides. In these structures, TLX adopts an autorepressed conformation in which its helix H12 occupies the coactivator-binding groove. Unexpectedly, H12 in this autorepressed conformation forms a novel binding pocket with residues from helix H3 that accommodates a short helix formed by the conserved ALXXLXXY motif of the Atro box. Mutations that weaken the TLX–Atrophin interaction compromise the repressive activity of TLX, demonstrating that this interaction is required for Atrophin to confer repressor activity to TLX. Moreover, the autorepressed conformation is conserved in the repressor class of orphan nuclear receptors, and mutations of corresponding residues in other members of this class of receptors diminish their repressor activities. Together, our results establish the functional conservation of the autorepressed conformation and define a key sequence motif in the Atro box that is essential for TLX-mediated repression. PMID:25691470

Cavity Versus Ligand Shape Descriptors: Application to Urokinase Binding Pockets

PubMed Central

Cerisier, Natacha; Regad, Leslie; Triki, Dhoha; Camproux, Anne-Claude

2017-01-01

Abstract We analyzed 78 binding pockets of the human urokinase plasminogen activator (uPA) catalytic domain extracted from a data set of crystallized uPA–ligand complexes. These binding pockets were computed with an original geometric method that does NOT involve any arbitrary parameter, such as cutoff distances, angles, and so on. We measured the deviation from convexity of each pocket shape with the pocket convexity index (PCI). We defined a new pocket descriptor called distributional sphericity coefficient (DISC), which indicates to which extent the protein atoms of a given pocket lie on the surface of a sphere. The DISC values were computed with the freeware PCI. The pocket descriptors and their high correspondences with ligand descriptors are crucial for polypharmacology prediction. We found that the protein heavy atoms lining the urokinases binding pockets are either located on the surface of their convex hull or lie close to this surface. We also found that the radii of the urokinases binding pockets and the radii of their ligands are highly correlated (r = 0.9). PMID:28570103

How Cations Can Assist DNase I in DNA Binding and Hydrolysis

PubMed Central

Guéroult, Marc; Picot, Daniel; Abi-Ghanem, Joséphine; Hartmann, Brigitte; Baaden, Marc

2010-01-01

DNase I requires Ca2+ and Mg2+ for hydrolyzing double-stranded DNA. However, the number and the location of DNase I ion-binding sites remain unclear, as well as the role of these counter-ions. Using molecular dynamics simulations, we show that bovine pancreatic (bp) DNase I contains four ion-binding pockets. Two of them strongly bind Ca2+ while the other two sites coordinate Mg2+. These theoretical results are strongly supported by revisiting crystallographic structures that contain bpDNase I. One Ca2+ stabilizes the functional DNase I structure. The presence of Mg2+ in close vicinity to the catalytic pocket of bpDNase I reinforces the idea of a cation-assisted hydrolytic mechanism. Importantly, Poisson-Boltzmann-type electrostatic potential calculations demonstrate that the divalent cations collectively control the electrostatic fit between bpDNase I and DNA. These results improve our understanding of the essential role of cations in the biological function of bpDNase I. The high degree of conservation of the amino acids involved in the identified cation-binding sites across DNase I and DNase I-like proteins from various species suggests that our findings generally apply to all DNase I-DNA interactions. PMID:21124947

Cofactor-binding sites in proteins of deviating sequence: comparative analysis and clustering in torsion angle, cavity, and fold space.

PubMed

Stegemann, Björn; Klebe, Gerhard

2012-02-01

Small molecules are recognized in protein-binding pockets through surface-exposed physicochemical properties. To optimize binding, they have to adopt a conformation corresponding to a local energy minimum within the formed protein-ligand complex. However, their conformational flexibility makes them competent to bind not only to homologous proteins of the same family but also to proteins of remote similarity with respect to the shape of the binding pockets and folding pattern. Considering drug action, such observations can give rise to unexpected and undesired cross reactivity. In this study, datasets of six different cofactors (ADP, ATP, NAD(P)(H), FAD, and acetyl CoA, sharing an adenosine diphosphate moiety as common substructure), observed in multiple crystal structures of protein-cofactor complexes exhibiting sequence identity below 25%, have been analyzed for the conformational properties of the bound ligands, the distribution of physicochemical properties in the accommodating protein-binding pockets, and the local folding patterns next to the cofactor-binding site. State-of-the-art clustering techniques have been applied to group the different protein-cofactor complexes in the different spaces. Interestingly, clustering in cavity (Cavbase) and fold space (DALI) reveals virtually the same data structuring. Remarkable relationships can be found among the different spaces. They provide information on how conformations are conserved across the host proteins and which distinct local cavity and fold motifs recognize the different portions of the cofactors. In those cases, where different cofactors are found to be accommodated in a similar fashion to the same fold motifs, only a commonly shared substructure of the cofactors is used for the recognition process. Copyright © 2011 Wiley Periodicals, Inc.

Druggable pockets and binding site centric chemical space: a paradigm shift in drug discovery.

PubMed

Pérot, Stéphanie; Sperandio, Olivier; Miteva, Maria A; Camproux, Anne-Claude; Villoutreix, Bruno O

2010-08-01

Detection, comparison and analyses of binding pockets are pivotal to structure-based drug design endeavors, from hit identification, screening of exosites and de-orphanization of protein functions to the anticipation of specific and non-specific binding to off- and anti-targets. Here, we analyze protein-ligand complexes and discuss methods that assist binding site identification, prediction of druggability and binding site comparison. The full potential of pockets is yet to be harnessed, and we envision that better understanding of the pocket space will have far-reaching implications in the field of drug discovery, such as the design of pocket-specific compound libraries and scoring functions.

Deciphering common recognition principles of nucleoside mono/di and tri-phosphates binding in diverse proteins via structural matching of their binding sites.

PubMed

Bhagavat, Raghu; Srinivasan, Narayanaswamy; Chandra, Nagasuma

2017-09-01

Nucleoside triphosphate (NTP) ligands are of high biological importance and are essential for all life forms. A pre-requisite for them to participate in diverse biochemical processes is their recognition by diverse proteins. It is thus of great interest to understand the basis for such recognition in different proteins. Towards this, we have used a structural bioinformatics approach and analyze structures of 4677 NTP complexes available in Protein Data Bank (PDB). Binding sites were extracted and compared exhaustively using PocketMatch, a sensitive in-house site comparison algorithm, which resulted in grouping the entire dataset into 27 site-types. Each of these site-types represent a structural motif comprised of two or more residue conservations, derived using another in-house tool for superposing binding sites, PocketAlign. The 27 site-types could be grouped further into 9 super-types by considering partial similarities in the sites, which indicated that the individual site-types comprise different combinations of one or more site features. A scan across PDB using the 27 structural motifs determined the motifs to be specific to NTP binding sites, and a computational alanine mutagenesis indicated that residues identified to be highly conserved in the motifs are also most contributing to binding. Alternate orientations of the ligand in several site-types were observed and rationalized, indicating the possibility of some residues serving as anchors for NTP recognition. The presence of multiple site-types and the grouping of multiple folds into each site-type is strongly suggestive of convergent evolution. Knowledge of determinants obtained from this study will be useful for detecting function in unknown proteins. Proteins 2017; 85:1699-1712. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Differential recognition of syk-binding sites by each of the two phosphotyrosine-binding pockets of the Vav SH2 domain.

PubMed

Chen, Chih-Hong; Piraner, Dan; Gorenstein, Nina M; Geahlen, Robert L; Beth Post, Carol

2013-11-01

The association of spleen tyrosine kinase (Syk), a central tyrosine kinase in B cell signaling, with Vav SH2 domain is controlled by phosphorylation of two closely spaced tyrosines in Syk linker B: Y342 and Y346. Previous studies established both singly phosphorylated and doubly phosphorylated forms play a role in signaling. The structure of the doubly phosphorylated form identified a new recognition of phosphotyrosine whereby two phosphotyrosines bind simultaneously to the Vav SH2 domain, one in the canonical pTyr pocket and one in the specificity pocket on the opposite side of the central β-sheet. It is unknown if the specificity pocket can bind phosphotyrosine independent of phosphotyrosine binding the pTyr pocket. To address this gap in knowledge, we determined the structure of the complex between Vav1 SH2 and a peptide (SykLB-YpY) modeling the singly phosphorylated-Y346 form of Syk with unphosphorylated Y342. The nuclear magnetic resonance (NMR) data conclusively establish that recognition of phosphotyrosine is swapped between the two pockets; phosphorylated pY346 binds the specificity pocket of Vav1 SH2, and unphosphorylated Y342 occupies what is normally the pTyr binding pocket. Nearly identical changes in chemical shifts occurred upon binding all three forms of singly and doubly phosphorylated peptides; however, somewhat smaller shift perturbations for SykLB-YpY from residues in regions of high internal mobility suggest that internal motions are coupled to binding affinity. The differential recognition that includes this swapped binding of phosphotyrosine to the specificity pocket of Vav SH2 increases the repertoire of possible phosphotyrosine binding by SH2 domains in regulating protein-protein interactions in cellular signaling. Copyright © 2013 Wiley Periodicals, Inc.

Investigating the Importance of the Pocket-estimation Method in Pocket-based Approaches: An Illustration Using Pocket-ligand Classification.

PubMed

Caumes, Géraldine; Borrel, Alexandre; Abi Hussein, Hiba; Camproux, Anne-Claude; Regad, Leslie

2017-09-01

Small molecules interact with their protein target on surface cavities known as binding pockets. Pocket-based approaches are very useful in all of the phases of drug design. Their first step is estimating the binding pocket based on protein structure. The available pocket-estimation methods produce different pockets for the same target. The aim of this work is to investigate the effects of different pocket-estimation methods on the results of pocket-based approaches. We focused on the effect of three pocket-estimation methods on a pocket-ligand (PL) classification. This pocket-based approach is useful for understanding the correspondence between the pocket and ligand spaces and to develop pharmacological profiling models. We found pocket-estimation methods yield different binding pockets in terms of boundaries and properties. These differences are responsible for the variation in the PL classification results that can have an impact on the detected correspondence between pocket and ligand profiles. Thus, we highlighted the importance of the pocket-estimation method choice in pocket-based approaches. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Detecting Local Ligand-Binding Site Similarity in Non-Homologous Proteins by Surface Patch Comparison

PubMed Central

Sael, Lee; Kihara, Daisuke

2012-01-01

Functional elucidation of proteins is one of the essential tasks in biology. Function of a protein, specifically, small ligand molecules that bind to a protein, can be predicted by finding similar local surface regions in binding sites of known proteins. Here, we developed an alignment free local surface comparison method for predicting a ligand molecule which binds to a query protein. The algorithm, named Patch-Surfer, represents a binding pocket as a combination of segmented surface patches, each of which is characterized by its geometrical shape, the electrostatic potential, the hydrophobicity, and the concaveness. Representing a pocket by a set of patches is effective to absorb difference of global pocket shape while capturing local similarity of pockets. The shape and the physicochemical properties of surface patches are represented using the 3D Zernike descriptor, which is a series expansion of mathematical 3D function. Two pockets are compared using a modified weighted bipartite matching algorithm, which matches similar patches from the two pockets. Patch-Surfer was benchmarked on three datasets, which consist in total of 390 proteins that bind to one of 21 ligands. Patch-Surfer showed superior performance to existing methods including a global pocket comparison method, Pocket-Surfer, which we have previously introduced. Particularly, as intended, the accuracy showed large improvement for flexible ligand molecules, which bind to pockets in different conformations. PMID:22275074

Detecting local ligand-binding site similarity in nonhomologous proteins by surface patch comparison.

PubMed

Sael, Lee; Kihara, Daisuke

2012-04-01

Functional elucidation of proteins is one of the essential tasks in biology. Function of a protein, specifically, small ligand molecules that bind to a protein, can be predicted by finding similar local surface regions in binding sites of known proteins. Here, we developed an alignment free local surface comparison method for predicting a ligand molecule which binds to a query protein. The algorithm, named Patch-Surfer, represents a binding pocket as a combination of segmented surface patches, each of which is characterized by its geometrical shape, the electrostatic potential, the hydrophobicity, and the concaveness. Representing a pocket by a set of patches is effective to absorb difference of global pocket shape while capturing local similarity of pockets. The shape and the physicochemical properties of surface patches are represented using the 3D Zernike descriptor, which is a series expansion of mathematical 3D function. Two pockets are compared using a modified weighted bipartite matching algorithm, which matches similar patches from the two pockets. Patch-Surfer was benchmarked on three datasets, which consist in total of 390 proteins that bind to one of 21 ligands. Patch-Surfer showed superior performance to existing methods including a global pocket comparison method, Pocket-Surfer, which we have previously introduced. Particularly, as intended, the accuracy showed large improvement for flexible ligand molecules, which bind to pockets in different conformations. Copyright © 2011 Wiley Periodicals, Inc.

Potent D-peptide inhibitors of HIV-1 entry

PubMed Central

Welch, Brett D.; VanDemark, Andrew P.; Heroux, Annie; Hill, Christopher P.; Kay, Michael S.

2007-01-01

During HIV-1 entry, the highly conserved gp41 N-trimer pocket region becomes transiently exposed and vulnerable to inhibition. Using mirror-image phage display and structure-assisted design, we have discovered protease-resistant D-amino acid peptides (D-peptides) that bind the N-trimer pocket with high affinity and potently inhibit viral entry. We also report high-resolution crystal structures of two of these D-peptides in complex with a pocket mimic that suggest sources of their high potency. A trimeric version of one of these peptides is the most potent pocket-specific entry inhibitor yet reported by three orders of magnitude (IC50 = 250 pM). These results are the first demonstration that D-peptides can form specific and high-affinity interactions with natural protein targets and strengthen their promise as therapeutic agents. The D-peptides described here address limitations associated with current L-peptide entry inhibitors and are promising leads for the prevention and treatment of HIV/AIDS. PMID:17942675

Identification of Small Molecules against Botulinum Neurotoxin B Binding to Neuronal Cells at Ganglioside GT1b Binding Site with Low to Moderate Affinity

DTIC Science & Technology

2014-10-01

BoNT serotype B (BoNT/B) for the trisaccharide GT1b were identified from the x-ray crystal structure of the BoNT/B/trisaccharide (GT1b) complex ( PDB ...trisaccharide and all the water from the structure and identified four potential binding pockets (Pocket-1, Pocket-2, and Pocket-4) as shown in...four potential binding sites or pockets on BoNT serotype B (BoNT/B) for the trisaccharide GT1b were identified from the x-ray crystal structure of the

New insight into the architecture of oxy-anion pocket in unliganded conformation of GAT domains: A MD-simulation study.

PubMed

Bairagya, Hridoy R; Bansal, Manju

2016-03-01

Human Guanine Monophosphate Synthetase (hGMPS) converts XMP to GMP, and acts as a bifunctional enzyme with N-terminal "glutaminase" (GAT) and C-terminal "synthetase" domain. The enzyme is identified as a potential target for anti-cancer and immunosuppressive therapies. GAT domain of enzyme plays central role in metabolism, and contains conserved catalytic residues Cys104, His190, and Glu192. MD simulation studies on GAT domain suggest that position of oxyanion in unliganded conformation is occupied by one conserved water molecule (W1), which also stabilizes that pocket. This position is occupied by a negatively charged atom of the substrate or ligand in ligand bound crystal structures. In fact, MD simulation study of Ser75 to Val indicates that W1 conserved water molecule is stabilized by Ser75, while Thr152, and His190 also act as anchor residues to maintain appropriate architecture of oxyanion pocket through water mediated H-bond interactions. Possibly, four conserved water molecules stabilize oxyanion hole in unliganded state, but they vacate these positions when the enzyme (hGMPS)-substrate complex is formed. Thus this study not only reveals functionally important role of conserved water molecules in GAT domain, but also highlights essential role of other non-catalytic residues such as Ser75 and Thr152 in this enzymatic domain. The results from this computational study could be of interest to experimental community and provide a testable hypothesis for experimental validation. Conserved sites of water molecules near and at oxyanion hole highlight structural importance of water molecules and suggest a rethink of the conventional definition of chemical geometry of inhibitor binding site. © 2016 Wiley Periodicals, Inc.

Conformational Changes in Small Ligands Upon Tetanus Toxin Binding

DTIC Science & Technology

2008-06-01

lectin-like N-terminal jelly -roll domain and a C-terminal P-trefoil domain;2’ see Figure 2. The ganglioside binding site has been found to occur along...C-terminal P-trefoil and N-terminal jelly -roll sub- domains.’ 0 The site has been identified as the most highly conserved pocket in the structures of...the TeNT and botulinum toxins.23 p-trefoil jelly -roll Figure 2: Crystal Structure of TetC Determined to 1.6 A Resolution. a-Helices are red, P-sheets

Structure of a short-chain dehydrogenase/reductase from Bacillus anthracis

PubMed Central

Hou, Jing; Wojciechowska, Kamila; Zheng, Heping; Chruszcz, Maksymilian; Cooper, David R.; Cymborowski, Marcin; Skarina, Tatiana; Gordon, Elena; Luo, Haibin; Savchenko, Alexei; Minor, Wladek

2012-01-01

The crystal structure of a short-chain dehydrogenase/reductase from Bacillus anthracis strain ‘Ames Ancestor’ complexed with NADP has been determined and refined to 1.87 Å resolution. The structure of the enzyme consists of a Rossmann fold composed of seven parallel β-strands sandwiched by three α-­helices on each side. An NADP molecule from an endogenous source is bound in the conserved binding pocket in the syn conformation. The loop region responsible for binding another substrate forms two perpendicular short helices connected by a sharp turn. PMID:22684058

Human Cytomegalovirus Major Immediate Early 1 Protein Targets Host Chromosomes by Docking to the Acidic Pocket on the Nucleosome Surface

PubMed Central

Mücke, Katrin; Paulus, Christina; Bernhardt, Katharina; Gerrer, Katrin; Schön, Kathrin; Fink, Alina; Sauer, Eva-Maria; Asbach-Nitzsche, Alexandra; Harwardt, Thomas; Kieninger, Bärbel; Kremer, Werner; Kalbitzer, Hans Robert

2014-01-01

The 72-kDa immediate early 1 (IE1) protein encoded by human cytomegalovirus (hCMV) is a nuclearly localized promiscuous regulator of viral and cellular transcription. IE1 has long been known to associate with host mitotic chromatin, yet the mechanisms underlying this interaction have not been specified. In this study, we identify the cellular chromosome receptor for IE1. We demonstrate that the viral protein targets human nucleosomes by directly binding to core histones in a nucleic acid-independent manner. IE1 exhibits two separable histone-interacting regions with differential binding specificities for H2A-H2B and H3-H4. The H2A-H2B binding region was mapped to an evolutionarily conserved 10-amino-acid motif within the chromatin-tethering domain (CTD) of IE1. Results from experimental approaches combined with molecular modeling indicate that the IE1 CTD adopts a β-hairpin structure, docking with the acidic pocket formed by H2A-H2B on the nucleosome surface. IE1 binds to the acidic pocket in a way similar to that of the latency-associated nuclear antigen (LANA) of the Kaposi's sarcoma-associated herpesvirus. Consequently, the IE1 and LANA CTDs compete for binding to nucleosome cores and chromatin. Our work elucidates in detail how a key viral regulator is anchored to human chromosomes and identifies the nucleosomal acidic pocket as a joint target of proteins from distantly related viruses. Based on the striking similarities between the IE1 and LANA CTDs and the fact that nucleosome targeting by IE1 is dispensable for productive replication even in “clinical” strains of hCMV, we speculate that the two viral proteins may serve analogous functions during latency of their respective viruses. PMID:24227840

Insights into an original pocket-ligand pair classification: a promising tool for ligand profile prediction.

PubMed

Pérot, Stéphanie; Regad, Leslie; Reynès, Christelle; Spérandio, Olivier; Miteva, Maria A; Villoutreix, Bruno O; Camproux, Anne-Claude

2013-01-01

Pockets are today at the cornerstones of modern drug discovery projects and at the crossroad of several research fields, from structural biology to mathematical modeling. Being able to predict if a small molecule could bind to one or more protein targets or if a protein could bind to some given ligands is very useful for drug discovery endeavors, anticipation of binding to off- and anti-targets. To date, several studies explore such questions from chemogenomic approach to reverse docking methods. Most of these studies have been performed either from the viewpoint of ligands or targets. However it seems valuable to use information from both ligands and target binding pockets. Hence, we present a multivariate approach relating ligand properties with protein pocket properties from the analysis of known ligand-protein interactions. We explored and optimized the pocket-ligand pair space by combining pocket and ligand descriptors using Principal Component Analysis and developed a classification engine on this paired space, revealing five main clusters of pocket-ligand pairs sharing specific and similar structural or physico-chemical properties. These pocket-ligand pair clusters highlight correspondences between pocket and ligand topological and physico-chemical properties and capture relevant information with respect to protein-ligand interactions. Based on these pocket-ligand correspondences, a protocol of prediction of clusters sharing similarity in terms of recognition characteristics is developed for a given pocket-ligand complex and gives high performances. It is then extended to cluster prediction for a given pocket in order to acquire knowledge about its expected ligand profile or to cluster prediction for a given ligand in order to acquire knowledge about its expected pocket profile. This prediction approach shows promising results and could contribute to predict some ligand properties critical for binding to a given pocket, and conversely, some key pocket properties for ligand binding.

Insights into an Original Pocket-Ligand Pair Classification: A Promising Tool for Ligand Profile Prediction

PubMed Central

Reynès, Christelle; Spérandio, Olivier; Miteva, Maria A.; Villoutreix, Bruno O.; Camproux, Anne-Claude

2013-01-01

Pockets are today at the cornerstones of modern drug discovery projects and at the crossroad of several research fields, from structural biology to mathematical modeling. Being able to predict if a small molecule could bind to one or more protein targets or if a protein could bind to some given ligands is very useful for drug discovery endeavors, anticipation of binding to off- and anti-targets. To date, several studies explore such questions from chemogenomic approach to reverse docking methods. Most of these studies have been performed either from the viewpoint of ligands or targets. However it seems valuable to use information from both ligands and target binding pockets. Hence, we present a multivariate approach relating ligand properties with protein pocket properties from the analysis of known ligand-protein interactions. We explored and optimized the pocket-ligand pair space by combining pocket and ligand descriptors using Principal Component Analysis and developed a classification engine on this paired space, revealing five main clusters of pocket-ligand pairs sharing specific and similar structural or physico-chemical properties. These pocket-ligand pair clusters highlight correspondences between pocket and ligand topological and physico-chemical properties and capture relevant information with respect to protein-ligand interactions. Based on these pocket-ligand correspondences, a protocol of prediction of clusters sharing similarity in terms of recognition characteristics is developed for a given pocket-ligand complex and gives high performances. It is then extended to cluster prediction for a given pocket in order to acquire knowledge about its expected ligand profile or to cluster prediction for a given ligand in order to acquire knowledge about its expected pocket profile. This prediction approach shows promising results and could contribute to predict some ligand properties critical for binding to a given pocket, and conversely, some key pocket properties for ligand binding. PMID:23840299

Structural basis for corepressor assembly by the orphan nuclear receptor TLX.

PubMed

Zhi, Xiaoyong; Zhou, X Edward; He, Yuanzheng; Searose-Xu, Kelvin; Zhang, Chun-Li; Tsai, Chih-Cheng; Melcher, Karsten; Xu, H Eric

2015-02-15

The orphan nuclear receptor TLX regulates neural stem cell self-renewal in the adult brain and functions primarily as a transcription repressor through recruitment of Atrophin corepressors, which bind to TLX via a conserved peptide motif termed the Atro box. Here we report crystal structures of the human and insect TLX ligand-binding domain in complex with Atro box peptides. In these structures, TLX adopts an autorepressed conformation in which its helix H12 occupies the coactivator-binding groove. Unexpectedly, H12 in this autorepressed conformation forms a novel binding pocket with residues from helix H3 that accommodates a short helix formed by the conserved ALXXLXXY motif of the Atro box. Mutations that weaken the TLX-Atrophin interaction compromise the repressive activity of TLX, demonstrating that this interaction is required for Atrophin to confer repressor activity to TLX. Moreover, the autorepressed conformation is conserved in the repressor class of orphan nuclear receptors, and mutations of corresponding residues in other members of this class of receptors diminish their repressor activities. Together, our results establish the functional conservation of the autorepressed conformation and define a key sequence motif in the Atro box that is essential for TLX-mediated repression. © 2015 Zhi et al.; Published by Cold Spring Harbor Laboratory Press.

Displacement of disordered water molecules from hydrophobic pocket creates enthalpic signature: binding of phosphonamidate to the S₁'-pocket of thermolysin.

PubMed

Englert, L; Biela, A; Zayed, M; Heine, A; Hangauer, D; Klebe, G

2010-11-01

Prerequisite for the design of tight binding protein inhibitors and prediction of their properties is an in-depth understanding of the structural and thermodynamic details of the binding process. A series of closely related phosphonamidates was studied to elucidate the forces underlying their binding affinity to thermolysin. The investigated inhibitors are identical except for the parts penetrating into the hydrophobic S₁'-pocket. A correlation of structural, kinetic and thermodynamic data was carried out by X-ray crystallography, kinetic inhibition assay and isothermal titration calorimetry. Binding affinity increases with larger ligand hydrophobic P₁'-moieties accommodating the S₁'-pocket. Surprisingly, larger P₁'-side chain modifications are accompanied by an increase in the enthalpic contribution to binding. In agreement with other studies, it is suggested that the release of largely disordered waters from an imperfectly hydrated pocket results in an enthalpically favourable integration of these water molecules into bulk water upon inhibitor binding. This enthalpically favourable process contributes more strongly to the binding energetics than the entropy increase resulting from the release of water molecules from the S₁'-pocket or the formation of apolar interactions between protein and inhibitor. Displacement of highly disordered water molecules from a rather imperfectly hydrated and hydrophobic specificity pocket can reveal an enthalpic signature of inhibitor binding. Copyright © 2010 Elsevier B.V. All rights reserved.

Structure of the substrate-binding b′ domain of the Protein disulfide isomerase-like protein of the testis

PubMed Central

Bastos-Aristizabal, Sara; Kozlov, Guennadi; Gehring, Kalle

2014-01-01

Protein Disulfide Isomerase-Like protein of the Testis (PDILT) is a testis-specific member of the PDI family. PDILT displays similar domain architecture to PDIA1, the founding member of this protein family, but lacks catalytic cysteines needed for oxidoreduction reactions. This suggests special importance of chaperone activity of PDILT, but how it recognizes misfolded protein substrates is unknown. Here, we report the high-resolution crystal structure of the b′ domain of human PDILT. The structure reveals a conserved hydrophobic pocket, which is likely a principal substrate-binding site in PDILT. In the crystal, this pocket is occupied by side chains of tyrosine and tryptophan residues from another PDILT molecule, suggesting a preference for binding exposed aromatic residues in protein substrates. The lack of interaction of the b′ domain with the P-domains of calreticulin-3 and calmegin hints at a novel way of interaction between testis-specific lectin chaperones and PDILT. Further studies of this recently discovered PDI member would help to understand the important role that PDILT plays in the differentiation and maturation of spermatozoids. PMID:24662985

Fluorophore Labeled Kinase Detects Ligands That Bind within the MAPK Insert of p38α Kinase

PubMed Central

Termathe, Martin; Grütter, Christian; Rabiller, Matthias; van Otterlo, Willem A. L.; Rauh, Daniel

2012-01-01

The vast majority of small molecules known to modulate kinase activity, target the highly conserved ATP-pocket. Consequently, such ligands are often less specific and in case of inhibitors, this leads to the inhibition of multiple kinases. Thus, selective modulation of kinase function remains a major hurdle. One of the next great challenges in kinase research is the identification of ligands which bind to less conserved sites and target the non-catalytic functions of protein kinases. However, approaches that allow for the unambiguous identification of molecules that bind to these less conserved sites are few in number. We have previously reported the use of fluorescent labels in kinases (FLiK) to develop direct kinase binding assays that exclusively detect ligands which stabilize inactive (DFG-out) kinase conformations. Here, we present the successful application of the FLiK approach to develop a high-throughput binding assay capable of directly monitoring ligand binding to a remote site within the MAPK insert of p38α mitogen-activated protein kinase (MAPK). Guided by the crystal structure of an initially identified hit molecule in complex with p38α, we developed a tight binding ligand which may serve as an ideal starting point for further investigations of the biological function of the MAPK insert in regulating the p38α signaling pathway. PMID:22768308

An SH2 domain model of STAT5 in complex with phospho-peptides define ``STAT5 Binding Signatures''

NASA Astrophysics Data System (ADS)

Gianti, Eleonora; Zauhar, Randy J.

2015-05-01

The signal transducer and activator of transcription 5 (STAT5) is a member of the STAT family of proteins, implicated in cell growth and differentiation. STAT activation is regulated by phosphorylation of protein monomers at conserved tyrosine residues, followed by binding to phospho-peptide pockets and subsequent dimerization. STAT5 is implicated in the development of severe pathological conditions, including many cancer forms. However, nowadays a few STAT5 inhibitors are known, and only one crystal structure of the inactive STAT5 dimer is publicly available. With a view to enabling structure-based drug design, we have: (1) analyzed phospho-peptide binding pockets on SH2 domains of STAT5, STAT1 and STAT3; (2) generated a model of STAT5 bound to phospho-peptides; (3) assessed our model by docking against a class of known STAT5 inhibitors (Müller et al. in ChemBioChem 9:723-727, 2008); (4) used molecular dynamics simulations to optimize the molecular determinants responsible for binding and (5) proposed unique "Binding Signatures" of STAT5. Our results put in place the foundations to address STAT5 as a target for rational drug design, from sequence, structural and functional perspectives.

Reduced ability of C-type natriuretic peptide (CNP) to activate natriuretic peptide receptor B (NPR-B) causes dwarfism in lbab−/− mice

PubMed Central

Yoder, Andrea R.; Kruse, Andrew C.; Earhart, Cathleen A.; Ohlendorf, Douglas H.; Potter, Lincoln R.

2015-01-01

C-type natriuretic peptide (CNP) stimulates endochondrial ossification by activating the transmembrane guanylyl cyclase, natriuretic peptide receptor-B (NPR-B). Recently, a spontaneous autosomal recessive mutation that causes severe dwarfism in mice was identified. The mutant, called long bone abnormality (lbab), contains a single point mutation that converts an arginine to a glycine in a conserved coding region of the CNP gene, but how this mutation affects CNP activity has not been reported. Here, we determined that thirty to greater than one hundred-fold more CNPlbab was required to activate NPR-B as compared to wild-type CNP in whole cell cGMP elevation and membrane guanylyl cyclase assays. The reduced ability of CNPlbab to activate NPR-B was explained, at least in part, by decreased binding since ten-fold more CNPlbab than wild-type CNP was required to compete with [125I][Tyr0]CNP for receptor binding. Molecular modeling suggested that the conserved arginine is critical for binding to an equally conserved acidic pocket in NPR-B. These results indicate that reduced binding to and activation of NPR-B causes dwarfism in lbab−/− mice. PMID:18554750

Structural basis for corepressor assembly by the orphan nuclear receptor TLX

DOE PAGES

Zhi, Xiaoyong; Zhou, X. Edward; He, Yuanzheng; ...

2015-02-15

The orphan nuclear receptor TLX regulates neural stem cell self-renewal in the adult brain and functions primarily as a transcription repressor through recruitment of Atrophin corepressors, which bind to TLX via a conserved peptide motif termed the Atro box. Here we report crystal structures of the human and insect TLX ligand-binding domain in complex with Atro box peptides. In these structures, TLX adopts an autorepressed conformation in which its helix H12 occupies the coactivator-binding groove. Unexpectedly, H12 in this autorepressed conformation forms a novel binding pocket with residues from helix H3 that accommodates a short helix formed by the conservedmore » ALXXLXXY motif of the Atro box. Mutations that weaken the TLX–Atrophin interaction compromise the repressive activity of TLX, demonstrating that this interaction is required for Atrophin to confer repressor activity to TLX. Moreover, the autorepressed conformation is conserved in the repressor class of orphan nuclear receptors, and mutations of corresponding residues in other members of this class of receptors diminish their repressor activities. Together, our results establish the functional conservation of the autorepressed conformation and define a key sequence motif in the Atro box that is essential for TLX-mediated repression.« less

An Aromatic Cap Seals the Substrate Binding Site in an ECF-Type S Subunit for Riboflavin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Karpowich, Nathan K.; Song, Jinmei; Wang, Da-Neng

2016-06-13

ECF transporters are a family of active membrane transporters for essential micronutrients, such as vitamins and trace metals. Found exclusively in archaea and bacteria, these transporters are composed of four subunits: an integral membrane substrate-binding subunit (EcfS), a transmembrane coupling subunit (EcfT), and two ATP-binding cassette ATPases (EcfA and EcfA'). We have characterized the structural basis of substrate binding by the EcfS subunit for riboflavin from Thermotoga maritima, TmRibU. TmRibU binds riboflavin with high affinity, and the protein–substrate complex is exceptionally stable in solution. The crystal structure of riboflavin-bound TmRibU reveals an electronegative binding pocket at the extracellular surface inmore » which the substrate is completely buried. Analysis of the intermolecular contacts indicates that nearly every available substrate hydrogen bond is satisfied. A conserved aromatic residue at the extracellular end of TM5, Tyr130, caps the binding site to generate a substrate-bound, occluded state, and non-conservative mutation of Tyr130 reduces the stability of this conformation. Using a novel fluorescence binding assay, we find that an aromatic residue at this position is essential for high-affinity substrate binding. Comparison with other S subunit structures suggests that TM5 and Loop5-6 contain a dynamic, conserved motif that plays a key role in gating substrate entry and release by S subunits of ECF transporters.« less

Host-Primed Ebola Virus GP Exposes a Hydrophobic NPC1 Receptor-Binding Pocket, Revealing a Target for Broadly Neutralizing Antibodies.

PubMed

Bornholdt, Zachary A; Ndungo, Esther; Fusco, Marnie L; Bale, Shridhar; Flyak, Andrew I; Crowe, James E; Chandran, Kartik; Saphire, Erica Ollmann

2016-02-23

The filovirus surface glycoprotein (GP) mediates viral entry into host cells. Following viral internalization into endosomes, GP is cleaved by host cysteine proteases to expose a receptor-binding site (RBS) that is otherwise hidden from immune surveillance. Here, we present the crystal structure of proteolytically cleaved Ebola virus GP to a resolution of 3.3 Å. We use this structure in conjunction with functional analysis of a large panel of pseudotyped viruses bearing mutant GP proteins to map the Ebola virus GP endosomal RBS at molecular resolution. Our studies indicate that binding of GP to its endosomal receptor Niemann-Pick C1 occurs in two distinct stages: the initial electrostatic interactions are followed by specific interactions with a hydrophobic trough that is exposed on the endosomally cleaved GP1 subunit. Finally, we demonstrate that monoclonal antibodies targeting the filovirus RBS neutralize all known filovirus GPs, making this conserved pocket a promising target for the development of panfilovirus therapeutics. Ebola virus uses its glycoprotein (GP) to enter new host cells. During entry, GP must be cleaved by human enzymes in order for receptor binding to occur. Here, we provide the crystal structure of the cleaved form of Ebola virus GP. We demonstrate that cleavage exposes a site at the top of GP and that this site binds the critical domain C of the receptor, termed Niemann-Pick C1 (NPC1). We perform mutagenesis to find parts of the site essential for binding NPC1 and map distinct roles for an upper, charged crest and lower, hydrophobic trough in cleaved GP. We find that this 3-dimensional site is conserved across the filovirus family and that antibody directed against this site is able to bind cleaved GP from every filovirus tested and neutralize viruses bearing those GPs. Copyright © 2016 Bornholdt et al.

Insights into the glycyl radical enzyme active site of benzylsuccinate synthase: a computational study.

PubMed

Bharadwaj, Vivek S; Dean, Anthony M; Maupin, C Mark

2013-08-21

The fumarate addition reaction, catalyzed by the enzyme benzylsuccinate synthase (BSS), is considered to be one of the most intriguing and energetically challenging reactions in biology. BSS belongs to the glycyl radical enzyme family and catalyzes the fumarate addition reaction, which enables microorganisms to utilize hydrocarbons as an energy source under anaerobic conditions. Unfortunately, the extreme sensitivity of the glycyl radical to oxygen has hampered the structural and kinetic characterization of BSS, thereby limiting our knowledge on this enzyme. To enhance our molecular-level understanding of BSS, a computational approach involving homology modeling, docking studies, and molecular dynamics (MD) simulations has been used to deduce the structure of BSS's catalytic subunit (BSSα) and illuminate the molecular basis for the fumarate addition reaction. We have identified two conserved and distinct binding pockets at the BSSα active site: a hydrophobic pocket for toluene binding and a polar pocket for fumaric acid binding. Subsequent dynamical and energetic evaluations have identified Glu509, Ser827, Leu390, and Phe384 as active site residues critical for substrate binding. The orientation of substrates at the active site observed in MD simulations is consistent with experimental observations of the syn addition of toluene to fumaric acid. It is also found that substrate binding tightens the active site and restricts the conformational flexibility of the thiyl radical, leading to hydrogen transfer distances conducive to the proposed reaction mechanism. The stability of substrates at the active site and the occurrence of feasible radical transfer distances between the thiyl radical, substrates, and the active site glycine indicate a substrate-assisted radical transfer pathway governing fumarate addition.

Structure of CC chemokine receptor 2 with orthosteric and allosteric antagonists

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zheng, Yi; Qin, Ling; Zacarías, Natalia V. Ortiz

CC chemokine receptor 2 (CCR2) is one of 19 members of the chemokine receptor subfamily of human class A G-protein-coupled receptors. CCR2 is expressed on monocytes, immature dendritic cells, and T-cell subpopulations, and mediates their migration towards endogenous CC chemokine ligands such as CCL2 (ref. 1). CCR2 and its ligands are implicated in numerous inflammatory and neurodegenerative diseases2 including atherosclerosis, multiple sclerosis, asthma, neuropathic pain, and diabetic nephropathy, as well as cancer3. These disease associations have motivated numerous preclinical studies and clinical trials4 (see http://www.clinicaltrials.gov) in search of therapies that target the CCR2–chemokine axis. To aid drug discovery efforts5, heremore » we solve a structure of CCR2 in a ternary complex with an orthosteric (BMS-681 (ref. 6)) and allosteric (CCR2-RA-[R]7) antagonist. BMS-681 inhibits chemokine binding by occupying the orthosteric pocket of the receptor in a previously unseen binding mode. CCR2-RA-[R] binds in a novel, highly druggable pocket that is the most intracellular allosteric site observed in class A G-protein-coupled receptors so far; this site spatially overlaps the G-protein-binding site in homologous receptors. CCR2-RA-[R] inhibits CCR2 non-competitively by blocking activation-associated conformational changes and formation of the G-protein-binding interface. The conformational signature of the conserved microswitch residues observed in double-antagonist-bound CCR2 resembles the most inactive G-protein-coupled receptor structures solved so far. Like other protein–protein interactions, receptor–chemokine complexes are considered challenging therapeutic targets for small molecules, and the present structure suggests diverse pocket epitopes that can be exploited to overcome obstacles in drug design.« less

Structure of CC Chemokine Receptor 2 with Orthosteric and Allosteric Antagonists

PubMed Central

Zheng, Yi; Qin, Ling; Ortiz Zacarías, Natalia V.; de Vries, Henk; Han, Gye Won; Gustavsson, Martin; Dabros, Marta; Zhao, Chunxia; Cherney, Robert J.; Carter, Percy; Stamos, Dean; Abagyan, Ruben; Cherezov, Vadim; Stevens, Raymond C.; IJzerman, Adriaan P.; Heitman, Laura H.; Tebben, Andrew; Kufareva, Irina; Handel, Tracy M.

2016-01-01

Summary CC chemokine receptor 2 (CCR2) is one of 19 members of the chemokine receptor subfamily of human Class A G protein-coupled receptors (GPCRs). CCR2 is expressed on monocytes, immature dendritic cells and T cell subpopulations, and mediates their migration towards endogenous CC chemokine ligands such as CCL21. CCR2 and its ligands are implicated in numerous inflammatory and neurodegenerative diseases2 including atherosclerosis, multiple sclerosis, asthma, neuropathic pain, and diabetic nephropathy, as well as cancer3. These disease associations have motivated numerous preclinical studies and clinical trials4 (see ClinicalTrials.gov) in search of therapies that target the CCR2:chemokine axis. To aid drug discovery efforts5, we solved a structure of CCR2 in a ternary complex with an orthosteric (BMS-6816) and allosteric (CCR2-RA-[R]7) antagonist. BMS-681 inhibits chemokine binding by occupying the orthosteric pocket of the receptor in a previously unseen binding mode. CCR2-RA-[R] binds in a novel, highly druggable pocket that is the most intracellular allosteric site observed in Class A GPCRs to date; this site spatially overlaps the G protein-binding site in homologous receptors. CCR2-RA-[R] inhibits CCR2 non-competitively by blocking activation-associated conformational changes and formation of the G protein-binding interface. The conformational signature of the conserved microswitch residues observed in double-antagonist-bound CCR2 resembles the most inactive GPCR structures solved to date. Like other protein:protein interactions, receptor:chemokine complexes are considered challenging therapeutic targets for small molecules, and the present structure suggests diverse pocket epitopes that can be exploited to overcome drug design obstacles. PMID:27926736

Characterization of the Raf kinase inhibitory protein (RKIP) binding pocket: NMR-based screening identifies small-molecule ligands.

PubMed

Shemon, Anne N; Heil, Gary L; Granovsky, Alexey E; Clark, Mathew M; McElheny, Dan; Chimon, Alexander; Rosner, Marsha R; Koide, Shohei

2010-05-05

Raf kinase inhibitory protein (RKIP), also known as phoshaptidylethanolamine binding protein (PEBP), has been shown to inhibit Raf and thereby negatively regulate growth factor signaling by the Raf/MAP kinase pathway. RKIP has also been shown to suppress metastasis. We have previously demonstrated that RKIP/Raf interaction is regulated by two mechanisms: phosphorylation of RKIP at Ser-153, and occupation of RKIP's conserved ligand binding domain with a phospholipid (2-dihexanoyl-sn-glycero-3-phosphoethanolamine; DHPE). In addition to phospholipids, other ligands have been reported to bind this domain; however their binding properties remain uncharacterized. In this study, we used high-resolution heteronuclear NMR spectroscopy to screen a chemical library and assay a number of potential RKIP ligands for binding to the protein. Surprisingly, many compounds previously postulated as RKIP ligands showed no detectable binding in near-physiological solution conditions even at millimolar concentrations. In contrast, we found three novel ligands for RKIP that specifically bind to the RKIP pocket. Interestingly, unlike the phospholipid, DHPE, these newly identified ligands did not affect RKIP binding to Raf-1 or RKIP phosphorylation. One out of the three ligands displayed off target biological effects, impairing EGF-induced MAPK and metabolic activity. This work defines the binding properties of RKIP ligands under near physiological conditions, establishing RKIP's affinity for hydrophobic ligands and the importance of bulky aliphatic chains for inhibiting its function. The common structural elements of these compounds defines a minimal requirement for RKIP binding and thus they can be used as lead compounds for future design of RKIP ligands with therapeutic potential.

Solution structure of an ATP-binding RNA aptamer reveals a novel fold.

PubMed Central

Dieckmann, T; Suzuki, E; Nakamura, G K; Feigon, J

1996-01-01

In vitro selection has been used to isolate several RNA aptamers that bind specifically to biological cofactors. A well-characterized example in the ATP-binding RNA aptamer family, which contains a conserved 11-base loop opposite a bulged G and flanked by regions of double-stranded RNA. The nucleotides in the consensus sequence provide a binding pocket for ATP (or AMP), which binds with a Kd in the micromolar range. Here we present the three-dimensional solution structure of a 36-nucleotide ATP-binding RNA aptamer complexed with AMP, determined from NMR-derived distance and dihedral angle restraints. The conserved loop and bulged G form a novel compact, folded structure around the AMP. The backbone tracing of the loop nucleotides can be described by a Greek zeta (zeta). Consecutive loop nucleotides G, A, A form a U-turn at the bottom of the zeta, and interact with the AMP to form a structure similar to a GNRA tetraloop, with AMP standing in for the final A. Two asymmetric G. G base pairs close the stems flanking the internal loop. Mutated aptamers support the existence of the tertiary interactions within the consensus nucleotides and with the AMP found in the calculated structures. PMID:8756406

Crystal structure and RNA-binding properties of an Hfq homolog from the deep-branching Aquificae: conservation of the lateral RNA-binding mode

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stanek, Kimberly A.; Patterson-West, Jennifer; Randolph, Peter S.

The host factor Hfq, as the bacterial branch of the Sm family, is an RNA-binding protein involved in the post-transcriptional regulation of mRNA expression and turnover. Hfq facilitates pairing between small regulatory RNAs (sRNAs) and their corresponding mRNA targets by binding both RNAs and bringing them into close proximity. Hfq homologs self-assemble into homo-hexameric rings with at least two distinct surfaces that bind RNA. Recently, another binding site, dubbed the `lateral rim', has been implicated in sRNA·mRNA annealing; the RNA-binding properties of this site appear to be rather subtle, and its degree of evolutionary conservation is unknown. An Hfq homologmore » has been identified in the phylogenetically deep-branching thermophileAquifex aeolicus(Aae), but little is known about the structure and function of Hfq from basal bacterial lineages such as the Aquificae. Therefore,AaeHfq was cloned, overexpressed, purified, crystallized and biochemically characterized. Structures ofAaeHfq were determined in space groupsP1 andP6, both to 1.5 Å resolution, and nanomolar-scale binding affinities for uridine- and adenosine-rich RNAs were discovered. Co-crystallization with U 6RNA reveals that the outer rim of theAaeHfq hexamer features a well defined binding pocket that is selective for uracil. ThisAaeHfq structure, combined with biochemical and biophysical characterization of the homolog, reveals deep evolutionary conservation of the lateral RNA-binding mode, and lays a foundation for further studies of Hfq-associated RNA biology in ancient bacterial phyla.« less

Computational Assessment of Potassium and Magnesium Ion Binding to a Buried Pocket in GTPase-Associating Center RNA

PubMed Central

2016-01-01

An experimentally well-studied model of RNA tertiary structures is a 58mer rRNA fragment, known as GTPase-associating center (GAC) RNA, in which a highly negative pocket walled by phosphate oxygen atoms is stabilized by a chelated cation. Although such deep pockets with more than one direct phosphate to ion chelation site normally include magnesium, as shown in one GAC crystal structure, another GAC crystal structure and solution experiments suggest potassium at this site. Both crystal structures also depict two magnesium ions directly bound to the phosphate groups comprising this controversial pocket. Here, we used classical molecular dynamics simulations as well as umbrella sampling to investigate the possibility of binding of potassium versus magnesium inside the pocket and to better characterize the chelation of one of the binding magnesium ions outside the pocket. The results support the preference of the pocket to accommodate potassium rather than magnesium and suggest that one of the closely binding magnesium ions can only bind at high magnesium concentrations, such as might be present during crystallization. This work illustrates the complementary utility of molecular modeling approaches with atomic-level detail in resolving discrepancies between conflicting experimental results. PMID:27983843

Computational Assessment of Potassium and Magnesium Ion Binding to a Buried Pocket in GTPase-Associating Center RNA.

PubMed

Hayatshahi, Hamed S; Roe, Daniel R; Galindo-Murillo, Rodrigo; Hall, Kathleen B; Cheatham, Thomas E

2017-01-26

An experimentally well-studied model of RNA tertiary structures is a 58mer rRNA fragment, known as GTPase-associating center (GAC) RNA, in which a highly negative pocket walled by phosphate oxygen atoms is stabilized by a chelated cation. Although such deep pockets with more than one direct phosphate to ion chelation site normally include magnesium, as shown in one GAC crystal structure, another GAC crystal structure and solution experiments suggest potassium at this site. Both crystal structures also depict two magnesium ions directly bound to the phosphate groups comprising this controversial pocket. Here, we used classical molecular dynamics simulations as well as umbrella sampling to investigate the possibility of binding of potassium versus magnesium inside the pocket and to better characterize the chelation of one of the binding magnesium ions outside the pocket. The results support the preference of the pocket to accommodate potassium rather than magnesium and suggest that one of the closely binding magnesium ions can only bind at high magnesium concentrations, such as might be present during crystallization. This work illustrates the complementary utility of molecular modeling approaches with atomic-level detail in resolving discrepancies between conflicting experimental results.

Raf Kinase Inhibitory Protein protects cells against locostatin-mediated inhibition of migration.

PubMed

Shemon, Anne N; Eves, Eva M; Clark, Matthew C; Heil, Gary; Granovsky, Alexey; Zeng, Lingchun; Imamoto, Akira; Koide, Shohei; Rosner, Marsha Rich

2009-06-24

Raf Kinase Inhibitory Protein (RKIP, also PEBP1), a member of the Phosphatidylethanolamine Binding Protein family, negatively regulates growth factor signaling by the Raf/MAP kinase pathway. Since an organic compound, locostatin, was reported to bind RKIP and inhibit cell migration by a Raf-dependent mechanism, we addressed the role of RKIP in locostatin function. We analyzed locostatin interaction with RKIP and examined the biological consequences of locostatin binding on RKIP function. NMR studies show that a locostatin precursor binds to the conserved phosphatidylethanolamine binding pocket of RKIP. However, drug binding to the pocket does not prevent RKIP association with its inhibitory target, Raf-1, nor affect RKIP phosphorylation by Protein Kinase C at a regulatory site. Similarly, exposure of wild type, RKIP-depleted HeLa cells or RKIP-deficient (RKIP(-/-)) mouse embryonic fibroblasts (MEFs) to locostatin has no effect on MAP kinase activation. Locostatin treatment of wild type MEFs causes inhibition of cell migration following wounding. RKIP deficiency impairs migration further, indicating that RKIP protects cells against locostatin-mediated inhibition of migration. Locostatin treatment of depleted or RKIP(-/-) MEFs reveals cytoskeletal disruption and microtubule abnormalities in the spindle. These results suggest that locostatin's effects on cytoskeletal structure and migration are caused through mechanisms independent of its binding to RKIP and Raf/MAP kinase signaling. The protective effect of RKIP against drug inhibition of migration suggests a new role for RKIP in potentially sequestering toxic compounds that may have deleterious effects on cells.

Theoretical studies on the selective mechanisms of GSK3β and CDK2 by molecular dynamics simulations and free energy calculations.

PubMed

Zhao, Sufang; Zhu, Jingyu; Xu, Lei; Jin, Jian

2017-06-01

Glycogen synthase kinase 3 (GSK3) is a serine/threonine protein kinase which is widely involved in cell signaling and controls a broad number of cellular functions. GSK3 contains α and β isoforms, and GSK3β has received more attention and becomes an attractive drug target for the treatment of several diseases. The binding pocket of cyclin-dependent kinase 2 (CDK2) shares high sequence identity to that of GSK3β, and therefore, the design of highly selective inhibitors toward GSK3β remains a big challenge. In this study, a computational strategy, which combines molecular docking, molecular dynamics simulations, free energy calculations, and umbrella sampling simulations, was employed to explore the binding mechanisms of two selective inhibitors to GSK3β and CDK2. The simulation results highlighted the key residues critical for GSK3β selectivity. It was observed that although GSK3β and CDK2 share the conserved ATP-binding pockets, some different residues have significant contributions to protein selectivity. This study provides valuable information for understanding the GSK3β-selective binding mechanisms and the rational design of selective GSK3β inhibitors. © 2016 John Wiley & Sons A/S.

Tb3+-cleavage assays reveal specific Mg2+ binding sites necessary to pre-fold the btuB riboswitch for AdoCbl binding

NASA Astrophysics Data System (ADS)

Choudhary, Pallavi K.; Gallo, Sofia; Sigel, Roland K. O.

2017-03-01

Riboswitches are RNA elements that bind specific metabolites in order to regulate the gene expression involved in controlling the cellular concentration of the respective molecule or ion. Ligand recognition is mostly facilitated by Mg2+ mediated pre-organization of the riboswitch to an active tertiary fold. To predict these specific Mg2+ induced tertiary interactions of the btuB riboswitch from E. coli, we here report Mg2+ binding pockets in its aptameric part in both, the ligand-free and the ligand-bound form. An ensemble of weak and strong metal ion binding sites distributed over the entire aptamer was detected by terbium(III) cleavage assays, Tb3+ being an established Mg2+ mimic. Interestingly many of the Mn+ (n = 2 or 3) binding sites involve conserved bases within the class of coenzyme B12-binding riboswitches. Comparison with the published crystal structure of the coenzyme B12 riboswitch of S. thermophilum aided in identifying a common set of Mn+ binding sites that might be crucial for tertiary interactions involved in the organization of the aptamer. Our results suggest that Mn+ binding at strategic locations of the btuB riboswitch indeed facilitates the assembly of the binding pocket needed for ligand recognition. Binding of the specific ligand, coenzyme B12 (AdoCbl), to the btuB aptamer does however not lead to drastic alterations of these Mn+ binding cores, indicating the lack of a major rearrangement within the three-dimensional structure of the RNA. This finding is strengthened by Tb3+ mediated footprints of the riboswitch's structure in its ligand-free and ligand-bound state indicating that AdoCbl indeed induces local changes rather than a global structural rearrangement.

Identification of protein-ligand binding sites by the level-set variational implicit-solvent approach.

PubMed

Guo, Zuojun; Li, Bo; Cheng, Li-Tien; Zhou, Shenggao; McCammon, J Andrew; Che, Jianwei

2015-02-10

Protein–ligand binding is a key biological process at the molecular level. The identification and characterization of small-molecule binding sites on therapeutically relevant proteins have tremendous implications for target evaluation and rational drug design. In this work, we used the recently developed level-set variational implicit-solvent model (VISM) with the Coulomb field approximation (CFA) to locate and characterize potential protein–small-molecule binding sites. We applied our method to a data set of 515 protein–ligand complexes and found that 96.9% of the cocrystallized ligands bind to the VISM-CFA-identified pockets and that 71.8% of the identified pockets are occupied by cocrystallized ligands. For 228 tight-binding protein–ligand complexes (i.e, complexes with experimental pKd values larger than 6), 99.1% of the cocrystallized ligands are in the VISM-CFA-identified pockets. In addition, it was found that the ligand binding orientations are consistent with the hydrophilic and hydrophobic descriptions provided by VISM. Quantitative characterization of binding pockets with topological and physicochemical parameters was used to assess the “ligandability” of the pockets. The results illustrate the key interactions between ligands and receptors and can be very informative for rational drug design.

Molecular mechanism of carbon nanotube to activate Subtilisin Carlsberg in polar and non-polar organic media

NASA Astrophysics Data System (ADS)

Zhang, Liyun; Li, Yuzhi; Yuan, Yuan; Jiang, Yuanyuan; Guo, Yanzhi; Li, Menglong; Pu, Xuemei

2016-11-01

In the work, we mainly used molecular dynamics (MD) simulation and protein structure network (PSN) to study subtilisin Carlsberg (SC) immobilized onto carbon nanotube (CNT) in water, acetonitrile and heptane solvents, in order to explore activation mechanism of enzymes in non-aqueous media. The result indicates that the affinity of SC with CNT follows the decreasing order of water > acetonitrile > heptane. The overall structure of SC and the catalytic triad display strong robustness to the change of environments, responsible for the activity retaining. However, the distances between two β-strands of substrate-binding pocket are significantly expanded by the immobilization in the increasing order of water < acetonitrile < heptane, contributing to the highest substrate-binding energy in heptane media. PSN analysis further reveals that the immobilization enhances structural communication paths to the substrate-binding pocket, leading to its larger change than the free-enzymes. Interestingly, the increase in the number of the pathways upon immobilization is not dependent on the absorbed extent but the desorbed one, indicating significant role of shifting process of experimental operations in influencing the functional region. In addition, some conserved and important hot-residues in the paths are identified, providing molecular information for functional modification.

POVME 2.0: An Enhanced Tool for Determining Pocket Shape and Volume Characteristics

PubMed Central

2015-01-01

Analysis of macromolecular/small-molecule binding pockets can provide important insights into molecular recognition and receptor dynamics. Since its release in 2011, the POVME (POcket Volume MEasurer) algorithm has been widely adopted as a simple-to-use tool for measuring and characterizing pocket volumes and shapes. We here present POVME 2.0, which is an order of magnitude faster, has improved accuracy, includes a graphical user interface, and can produce volumetric density maps for improved pocket analysis. To demonstrate the utility of the algorithm, we use it to analyze the binding pocket of RNA editing ligase 1 from the unicellular parasite Trypanosoma brucei, the etiological agent of African sleeping sickness. The POVME analysis characterizes the full dynamics of a potentially druggable transient binding pocket and so may guide future antitrypanosomal drug-discovery efforts. We are hopeful that this new version will be a useful tool for the computational- and medicinal-chemist community. PMID:25400521

Structure of the Trehalose-6-phosphate Phosphatase from Brugia malayi Reveals Key Design Principles for Anthelmintic Drugs

PubMed Central

Farelli, Jeremiah D.; Galvin, Brendan D.; Li, Zhiru; Liu, Chunliang; Aono, Miyuki; Garland, Megan; Hallett, Olivia E.; Causey, Thomas B.; Ali-Reynolds, Alana; Saltzberg, Daniel J.; Carlow, Clotilde K. S.; Dunaway-Mariano, Debra; Allen, Karen N.

2014-01-01

Parasitic nematodes are responsible for devastating illnesses that plague many of the world's poorest populations indigenous to the tropical areas of developing nations. Among these diseases is lymphatic filariasis, a major cause of permanent and long-term disability. Proteins essential to nematodes that do not have mammalian counterparts represent targets for therapeutic inhibitor discovery. One promising target is trehalose-6-phosphate phosphatase (T6PP) from Brugia malayi. In the model nematode Caenorhabditis elegans, T6PP is essential for survival due to the toxic effect(s) of the accumulation of trehalose 6-phosphate. T6PP has also been shown to be essential in Mycobacterium tuberculosis. We determined the X-ray crystal structure of T6PP from B. malayi. The protein structure revealed a stabilizing N-terminal MIT-like domain and a catalytic C-terminal C2B-type HAD phosphatase fold. Structure-guided mutagenesis, combined with kinetic analyses using a designed competitive inhibitor, trehalose 6-sulfate, identified five residues important for binding and catalysis. This structure-function analysis along with computational mapping provided the basis for the proposed model of the T6PP-trehalose 6-phosphate complex. The model indicates a substrate-binding mode wherein shape complementarity and van der Waals interactions drive recognition. The mode of binding is in sharp contrast to the homolog sucrose-6-phosphate phosphatase where extensive hydrogen-bond interactions are made to the substrate. Together these results suggest that high-affinity inhibitors will be bi-dentate, taking advantage of substrate-like binding to the phosphoryl-binding pocket while simultaneously utilizing non-native binding to the trehalose pocket. The conservation of the key residues that enforce the shape of the substrate pocket in T6PP enzymes suggest that development of broad-range anthelmintic and antibacterial therapeutics employing this platform may be possible. PMID:24992307

Designing small molecules to target cryptic pockets yields both positive and negative allosteric modulators

PubMed Central

Moeder, Katelyn E.; Ho, Chris M. W.; Zimmerman, Maxwell I.; Frederick, Thomas E.; Bowman, Gregory R.

2017-01-01

Allosteric drugs, which bind to proteins in regions other than their main ligand-binding or active sites, make it possible to target proteins considered “undruggable” and to develop new therapies that circumvent existing resistance. Despite growing interest in allosteric drug discovery, rational design is limited by a lack of sufficient structural information about alternative binding sites in proteins. Previously, we used Markov State Models (MSMs) to identify such “cryptic pockets,” and here we describe a method for identifying compounds that bind in these cryptic pockets and modulate enzyme activity. Experimental tests validate our approach by revealing both an inhibitor and two activators of TEM β-lactamase (TEM). To identify hits, a library of compounds is first virtually screened against either the crystal structure of a known cryptic pocket or an ensemble of structures containing the same cryptic pocket that is extracted from an MSM. Hit compounds are then screened experimentally and characterized kinetically in individual assays. We identify three hits, one inhibitor and two activators, demonstrating that screening for binding to allosteric sites can result in both positive and negative modulation. The hit compounds have modest effects on TEM activity, but all have higher affinities than previously identified inhibitors, which bind the same cryptic pocket but were found, by chance, via a computational screen targeting the active site. Site-directed mutagenesis of key contact residues predicted by the docking models is used to confirm that the compounds bind in the cryptic pocket as intended. Because hit compounds are identified from docking against both the crystal structure and structures from the MSM, this platform should prove suitable for many proteins, particularly targets whose crystal structures lack obvious druggable pockets, and for identifying both inhibitory and activating small-molecule modulators. PMID:28570708

Characterization of the Raf Kinase Inhibitory Protein (RKIP) Binding Pocket: NMR-Based Screening Identifies Small-Molecule Ligands

PubMed Central

Granovsky, Alexey E.; Clark, Mathew M.; McElheny, Dan; Chimon, Alexander; Rosner, Marsha R.; Koide, Shohei

2010-01-01

Background Raf kinase inhibitory protein (RKIP), also known as phoshaptidylethanolamine binding protein (PEBP), has been shown to inhibit Raf and thereby negatively regulate growth factor signaling by the Raf/MAP kinase pathway. RKIP has also been shown to suppress metastasis. We have previously demonstrated that RKIP/Raf interaction is regulated by two mechanisms: phosphorylation of RKIP at Ser-153, and occupation of RKIP's conserved ligand binding domain with a phospholipid (2-dihexanoyl-sn-glycero-3-phosphoethanolamine; DHPE). In addition to phospholipids, other ligands have been reported to bind this domain; however their binding properties remain uncharacterized. Methods/Findings In this study, we used high-resolution heteronuclear NMR spectroscopy to screen a chemical library and assay a number of potential RKIP ligands for binding to the protein. Surprisingly, many compounds previously postulated as RKIP ligands showed no detectable binding in near-physiological solution conditions even at millimolar concentrations. In contrast, we found three novel ligands for RKIP that specifically bind to the RKIP pocket. Interestingly, unlike the phospholipid, DHPE, these newly identified ligands did not affect RKIP binding to Raf-1 or RKIP phosphorylation. One out of the three ligands displayed off target biological effects, impairing EGF-induced MAPK and metabolic activity. Conclusions/Significance This work defines the binding properties of RKIP ligands under near physiological conditions, establishing RKIP's affinity for hydrophobic ligands and the importance of bulky aliphatic chains for inhibiting its function. The common structural elements of these compounds defines a minimal requirement for RKIP binding and thus they can be used as lead compounds for future design of RKIP ligands with therapeutic potential. PMID:20463977

Niemann-Pick type C disease: a QM/MM study of conformational changes in cholesterol in the NPC1(NTD) and NPC2 binding pockets.

PubMed

Elghobashi-Meinhardt, Nadia

2014-10-21

Niemann-Pick Type C disease is characterized by disrupted lipid trafficking within the late endosomal (LE)/lysosomal (Lys) cellular compartments. Cholesterol transport within the LE/Lys is believed to take place via a concerted hand-off mechanism in which a small (131aa) soluble cholesterol binding protein, NPC2, transfers cholesterol to the N-terminal domain (NTD) of a larger (1278aa) membrane-bound protein, NPC1(NTD). The transfer is thought to occur through the formation of a stable intermediate complex NPC1(NTD)-NPC2, in which the sterol apertures of the two proteins align to allow passage of the cholesterol molecule. In the working model of the NPC1(NTD)-NPC2 complex, the sterol apertures are aligned, but the binding pockets are bent with respect to one another. In order for cholesterol to slide from one binding pocket to the other, a conformational change must occur in the proteins, in the ligand, or in both. Here, we investigate the possibility that the ligand undergoes a conformational change, or isomerization, to accommodate the bent transfer pathway. To understand what structural factors influence the isomerization rate, we calculate the energy barrier to cholesterol isomerization in both the NPC1(NTD) and NPC2 binding pockets. Here, we use a combined quantum mechanical/molecular mechanical (QM/MM) energy function to calculate the isomerization barrier within the native NPC1(NTD) and NPC2 binding pockets before protein-protein docking as well as in the binding pockets of the NPC1(NTD)-NPC2 complex after docking has occurred. The results indicate that cholesterol isomerization in the NPC2 binding pocket is energetically favorable, both before and after formation of the NPC1(NTD)-NPC2 complex. The NPC1(NTD) binding pocket is energetically unfavorable to conformational rearrangement of the hydrophobic ligand because it contains more water molecules near the ligand tail and amino acids with polar side chains. For three NPC1(NTD) mutants investigated, L175Q/L176Q, L175A/L176A, and E191A/Y192A, the isomerization barriers were all found to be higher than the barrier calculated in the NPC2 binding pocket. Our results indicate that cholesterol isomerization in the NPC2 binding pocket, either before or after docking, may ensure an efficient transfer of cholesterol to NPC1(NTD).

Real-Time Ligand Binding Pocket Database Search Using Local Surface Descriptors

PubMed Central

Chikhi, Rayan; Sael, Lee; Kihara, Daisuke

2010-01-01

Due to the increasing number of structures of unknown function accumulated by ongoing structural genomics projects, there is an urgent need for computational methods for characterizing protein tertiary structures. As functions of many of these proteins are not easily predicted by conventional sequence database searches, a legitimate strategy is to utilize structure information in function characterization. Of a particular interest is prediction of ligand binding to a protein, as ligand molecule recognition is a major part of molecular function of proteins. Predicting whether a ligand molecule binds a protein is a complex problem due to the physical nature of protein-ligand interactions and the flexibility of both binding sites and ligand molecules. However, geometric and physicochemical complementarity is observed between the ligand and its binding site in many cases. Therefore, ligand molecules which bind to a local surface site in a protein can be predicted by finding similar local pockets of known binding ligands in the structure database. Here, we present two representations of ligand binding pockets and utilize them for ligand binding prediction by pocket shape comparison. These representations are based on mapping of surface properties of binding pockets, which are compactly described either by the two dimensional pseudo-Zernike moments or the 3D Zernike descriptors. These compact representations allow a fast real-time pocket searching against a database. Thorough benchmark study employing two different datasets show that our representations are competitive with the other existing methods. Limitations and potentials of the shape-based methods as well as possible improvements are discussed. PMID:20455259

Real-time ligand binding pocket database search using local surface descriptors.

PubMed

Chikhi, Rayan; Sael, Lee; Kihara, Daisuke

2010-07-01

Because of the increasing number of structures of unknown function accumulated by ongoing structural genomics projects, there is an urgent need for computational methods for characterizing protein tertiary structures. As functions of many of these proteins are not easily predicted by conventional sequence database searches, a legitimate strategy is to utilize structure information in function characterization. Of particular interest is prediction of ligand binding to a protein, as ligand molecule recognition is a major part of molecular function of proteins. Predicting whether a ligand molecule binds a protein is a complex problem due to the physical nature of protein-ligand interactions and the flexibility of both binding sites and ligand molecules. However, geometric and physicochemical complementarity is observed between the ligand and its binding site in many cases. Therefore, ligand molecules which bind to a local surface site in a protein can be predicted by finding similar local pockets of known binding ligands in the structure database. Here, we present two representations of ligand binding pockets and utilize them for ligand binding prediction by pocket shape comparison. These representations are based on mapping of surface properties of binding pockets, which are compactly described either by the two-dimensional pseudo-Zernike moments or the three-dimensional Zernike descriptors. These compact representations allow a fast real-time pocket searching against a database. Thorough benchmark studies employing two different datasets show that our representations are competitive with the other existing methods. Limitations and potentials of the shape-based methods as well as possible improvements are discussed.

Crystal structure analysis of a bacterial aryl acylamidase belonging to the amidase signature enzyme family

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Saeyoung; Park, Eun-Hye; Ko, Hyeok-Jin

2015-11-13

The atomic structure of a bacterial aryl acylamidase (EC 3.5.1.13; AAA) is reported and structural features are investigated to better understand the catalytic profile of this enzyme. Structures of AAA were determined in its native form and in complex with the analgesic acetanilide, p-acetaminophenol, at 1.70 Å and 1.73 Å resolutions, respectively. The overall structural fold of AAA was identified as an α/β fold class, exhibiting an open twisted β-sheet core surrounded by α-helices. The asymmetric unit contains one AAA molecule and the monomeric form is functionally active. The core structure enclosing the signature sequence region, including the canonical Ser-cisSer-Lys catalytic triad,more » is conserved in all members of the Amidase Signature enzyme family. The structure of AAA in a complex with its ligand reveals a unique organization in the substrate-binding pocket. The binding pocket consists of two loops (loop1 and loop2) in the amidase signature sequence and one helix (α10) in the non-amidase signature sequence. We identified two residues (Tyr{sup 136} and Thr{sup 330}) that interact with the ligand via water molecules, and a hydrogen-bonding network that explains the catalytic affinity over various aryl acyl compounds. The optimum activity of AAA at pH > 10 suggests that the reaction mechanism employs Lys{sup 84} as the catalytic base to polarize the Ser{sup 187} nucleophile in the catalytic triad. - Highlights: • We determined the first structure of a bacterial aryl acylamidase (EC 3.5.1.13). • Structure revealed spatially distinct architecture of the substrate-binding pocket. • Hydrogen-bonding with Tyr{sup 136} and Thr{sup 330} mediates ligand-binding and substrate.« less

An Augmented Pocketome: Detection and Analysis of Small-Molecule Binding Pockets in Proteins of Known 3D Structure.

PubMed

Bhagavat, Raghu; Sankar, Santhosh; Srinivasan, Narayanaswamy; Chandra, Nagasuma

2018-03-06

Protein-ligand interactions form the basis of most cellular events. Identifying ligand binding pockets in proteins will greatly facilitate rationalizing and predicting protein function. Ligand binding sites are unknown for many proteins of known three-dimensional (3D) structure, creating a gap in our understanding of protein structure-function relationships. To bridge this gap, we detect pockets in proteins of known 3D structures, using computational techniques. This augmented pocketome (PocketDB) consists of 249,096 pockets, which is about seven times larger than what is currently known. We deduce possible ligand associations for about 46% of the newly identified pockets. The augmented pocketome, when subjected to clustering based on similarities among pockets, yielded 2,161 site types, which are associated with 1,037 ligand types, together providing fold-site-type-ligand-type associations. The PocketDB resource facilitates a structure-based function annotation, delineation of the structural basis of ligand recognition, and provides functional clues for domains of unknown functions, allosteric proteins, and druggable pockets. Copyright © 2018 Elsevier Ltd. All rights reserved.

A gate-latch-lock mechanism for hormone signalling by abscisic acid receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Melcher, Karsten; Ng, Ley-Moy; Zhou, X Edward

2010-01-12

Abscisic acid (ABA) is a ubiquitous hormone that regulates plant growth, development and responses to environmental stresses. Its action is mediated by the PYR/PYL/RCAR family of START proteins, but it remains unclear how these receptors bind ABA and, in turn, how hormone binding leads to inhibition of the downstream type 2C protein phosphatase (PP2C) effectors. Here we report crystal structures of apo and ABA-bound receptors as well as a ternary PYL2-ABA-PP2C complex. The apo receptors contain an open ligand-binding pocket flanked by a gate that closes in response to ABA by way of conformational changes in two highly conserved β-loopsmore » that serve as a gate and latch. Moreover, ABA-induced closure of the gate creates a surface that enables the receptor to dock into and competitively inhibit the PP2C active site. A conserved tryptophan in the PP2C inserts directly between the gate and latch, which functions to further lock the receptor in a closed conformation. Together, our results identify a conserved gate-latch-lock mechanism underlying ABA signalling.« less

Free enthalpies of replacing water molecules in protein binding pockets.

PubMed

Riniker, Sereina; Barandun, Luzi J; Diederich, François; Krämer, Oliver; Steffen, Andreas; van Gunsteren, Wilfred F

2012-12-01

Water molecules in the binding pocket of a protein and their role in ligand binding have increasingly raised interest in recent years. Displacement of such water molecules by ligand atoms can be either favourable or unfavourable for ligand binding depending on the change in free enthalpy. In this study, we investigate the displacement of water molecules by an apolar probe in the binding pocket of two proteins, cyclin-dependent kinase 2 and tRNA-guanine transglycosylase, using the method of enveloping distribution sampling (EDS) to obtain free enthalpy differences. In both cases, a ligand core is placed inside the respective pocket and the remaining water molecules are converted to apolar probes, both individually and in pairs. The free enthalpy difference between a water molecule and a CH(3) group at the same location in the pocket in comparison to their presence in bulk solution calculated from EDS molecular dynamics simulations corresponds to the binding free enthalpy of CH(3) at this location. From the free enthalpy difference and the enthalpy difference, the entropic contribution of the displacement can be obtained too. The overlay of the resulting occupancy volumes of the water molecules with crystal structures of analogous ligands shows qualitative correlation between experimentally measured inhibition constants and the calculated free enthalpy differences. Thus, such an EDS analysis of the water molecules in the binding pocket may give valuable insight for potency optimization in drug design.

Free enthalpies of replacing water molecules in protein binding pockets

NASA Astrophysics Data System (ADS)

Riniker, Sereina; Barandun, Luzi J.; Diederich, François; Krämer, Oliver; Steffen, Andreas; van Gunsteren, Wilfred F.

2012-12-01

Water molecules in the binding pocket of a protein and their role in ligand binding have increasingly raised interest in recent years. Displacement of such water molecules by ligand atoms can be either favourable or unfavourable for ligand binding depending on the change in free enthalpy. In this study, we investigate the displacement of water molecules by an apolar probe in the binding pocket of two proteins, cyclin-dependent kinase 2 and tRNA-guanine transglycosylase, using the method of enveloping distribution sampling (EDS) to obtain free enthalpy differences. In both cases, a ligand core is placed inside the respective pocket and the remaining water molecules are converted to apolar probes, both individually and in pairs. The free enthalpy difference between a water molecule and a CH3 group at the same location in the pocket in comparison to their presence in bulk solution calculated from EDS molecular dynamics simulations corresponds to the binding free enthalpy of CH3 at this location. From the free enthalpy difference and the enthalpy difference, the entropic contribution of the displacement can be obtained too. The overlay of the resulting occupancy volumes of the water molecules with crystal structures of analogous ligands shows qualitative correlation between experimentally measured inhibition constants and the calculated free enthalpy differences. Thus, such an EDS analysis of the water molecules in the binding pocket may give valuable insight for potency optimization in drug design.

Raf Kinase Inhibitory Protein Protects Cells against Locostatin-Mediated Inhibition of Migration

PubMed Central

Shemon, Anne N.; Eves, Eva M.; Clark, Matthew C.; Heil, Gary; Granovsky, Alexey; Zeng, Lingchun; Imamoto, Akira

2009-01-01

Background Raf Kinase Inhibitory Protein (RKIP, also PEBP1), a member of the Phosphatidylethanolamine Binding Protein family, negatively regulates growth factor signaling by the Raf/MAP kinase pathway. Since an organic compound, locostatin, was reported to bind RKIP and inhibit cell migration by a Raf-dependent mechanism, we addressed the role of RKIP in locostatin function. Methods/Findings We analyzed locostatin interaction with RKIP and examined the biological consequences of locostatin binding on RKIP function. NMR studies show that a locostatin precursor binds to the conserved phosphatidylethanolamine binding pocket of RKIP. However, drug binding to the pocket does not prevent RKIP association with its inhibitory target, Raf-1, nor affect RKIP phosphorylation by Protein Kinase C at a regulatory site. Similarly, exposure of wild type, RKIP-depleted HeLa cells or RKIP-deficient (RKIP−/−) mouse embryonic fibroblasts (MEFs) to locostatin has no effect on MAP kinase activation. Locostatin treatment of wild type MEFs causes inhibition of cell migration following wounding. RKIP deficiency impairs migration further, indicating that RKIP protects cells against locostatin-mediated inhibition of migration. Locostatin treatment of depleted or RKIP−/− MEFs reveals cytoskeletal disruption and microtubule abnormalities in the spindle. Conclusions/Significance These results suggest that locostatin's effects on cytoskeletal structure and migration are caused through mechanisms independent of its binding to RKIP and Raf/MAP kinase signaling. The protective effect of RKIP against drug inhibition of migration suggests a new role for RKIP in potentially sequestering toxic compounds that may have deleterious effects on cells. PMID:19551145

GPR17: molecular modeling and dynamics studies of the 3-D structure and purinergic ligand binding features in comparison with P2Y receptors.

PubMed

Parravicini, Chiara; Ranghino, Graziella; Abbracchio, Maria P; Fantucci, Piercarlo

2008-06-04

GPR17 is a G-protein-coupled receptor located at intermediate phylogenetic position between two distinct receptor families: the P2Y and CysLT receptors for extracellular nucleotides and cysteinyl-LTs, respectively. We previously showed that GPR17 can indeed respond to both classes of endogenous ligands and to synthetic compounds active at the above receptor families, thus representing the first fully characterized non-peptide "hybrid" GPCR. In a rat brain focal ischemia model, the selective in vivo knock down of GPR17 by anti-sense technology or P2Y/CysLT antagonists reduced progression of ischemic damage, thus highlighting GPR17 as a novel therapeutic target for stroke. Elucidation of the structure of GPR17 and of ligand binding mechanisms are the necessary steps to obtain selective and potent drugs for this new potential target. On this basis, a 3-D molecular model of GPR17 embedded in a solvated phospholipid bilayer and refined by molecular dynamics simulations has been the first aim of this study. To explore the binding mode of the "purinergic" component of the receptor, the endogenous agonist UDP and two P2Y receptor antagonists demonstrated to be active on GPR17 (MRS2179 and cangrelor) were then modeled on the receptor. Molecular dynamics simulations suggest that GPR17 nucleotide binding pocket is similar to that described for the other P2Y receptors, although only one of the three basic residues that have been typically involved in ligand recognition is conserved (Arg255). The binding pocket is enclosed between the helical bundle and covered at the top by EL2. Driving interactions are H-bonds and salt bridges between the 6.55 and 6.52 residues and the phosphate moieties of the ligands. An "accessory" binding site in a region formed by the EL2, EL3 and the Nt was also found. Nucleotide binding to GPR17 occurs on the same receptor regions identified for already known P2Y receptors. Agonist/antagonist binding mode are similar, but not identical. An accessory external binding site could guide small ligands to the deeper principal binding site in a multi-step mechanism of activation. The nucleotide binding pocket appears to be unable to allocate the leukotrienic type ligands in the same effective way.

Affinity and specificity of interactions between Nedd4 isoforms and the epithelial Na+ channel.

PubMed

Henry, Pauline C; Kanelis, Voula; O'Brien, M Christine; Kim, Brian; Gautschi, Ivan; Forman-Kay, Julie; Schild, Laurent; Rotin, Daniela

2003-05-30

The epithelial Na+ channel (alphabetagammaENaC) regulates salt and fluid homeostasis and blood pressure. Each ENaC subunit contains a PY motif (PPXY) that binds to the WW domains of Nedd4, a Hect family ubiquitin ligase containing 3-4 WW domains and usually a C2 domain. It has been proposed that Nedd4-2, but not Nedd4-1, isoforms can bind to and suppress ENaC activity. Here we challenge this notion and show that, instead, the presence of a unique WW domain (WW3*) in either Nedd4-2 or Nedd4-1 determines high affinity interactions and the ability to suppress ENaC. WW3* from either Nedd4-2 or Nedd4-1 binds ENaC-PY motifs equally well (e.g. Kd approximately 10 microm for alpha- or betaENaC, 3-6-fold higher affinity than WW4), as determined by intrinsic tryptophan fluorescence. Moreover, dNedd4-1, which naturally contains a WW3* instead of WW2, is able to suppress ENaC function equally well as Nedd4-2. Homology models of the WW3*.betaENaC-PY complex revealed that a Pro and Ala conserved in all WW3*, but not other Nedd4-WW domains, help form the binding pocket for PY motif prolines. Extensive contacts are formed between the betaENaC-PY motif and the Pro in WW3*, and the small Ala creates a large pocket to accommodate the peptide. Indeed, mutating the conserved Pro and Ala in WW3* reduces binding affinity 2-3-fold. Additionally, we demonstrate that mutations in PY motif residues that form contacts with the WW domain based on our previously solved structure either abolish or severely reduce binding affinity to the WW domain and that the extent of binding correlates with the level of ENaC suppression. Independently, we show that a peptide encompassing the PY motif of sgk1, previously proposed to bind to Nedd4-2 and alter its ability to regulate ENaC, does not bind (or binds poorly) the WW domains of Nedd4-2. Collectively, these results suggest that high affinity of WW domain-PY-motif interactions rather than affiliation with Nedd4-1/Nedd-2 is critical for ENaC suppression by Nedd4 proteins.

Analysis and prediction of calcium-binding pockets from apo-protein structures exhibiting calcium-induced localized conformational changes

PubMed Central

Wang, Xue; Zhao, Kun; Kirberger, Michael; Wong, Hing; Chen, Guantao; Yang, Jenny J

2010-01-01

Calcium binding in proteins exhibits a wide range of polygonal geometries that relate directly to an equally diverse set of biological functions. The binding process stabilizes protein structures and typically results in local conformational change and/or global restructuring of the backbone. Previously, we established the MUG program, which utilized multiple geometries in the Ca2+-binding pockets of holoproteins to identify such pockets, ignoring possible Ca2+-induced conformational change. In this article, we first report our progress in the analysis of Ca2+-induced conformational changes followed by improved prediction of Ca2+-binding sites in the large group of Ca2+-binding proteins that exhibit only localized conformational changes. The MUGSR algorithm was devised to incorporate side chain torsional rotation as a predictor. The output from MUGSR presents groups of residues where each group, typically containing two to five residues, is a potential binding pocket. MUGSR was applied to both X-ray apo structures and NMR holo structures, which did not use calcium distance constraints in structure calculations. Predicted pockets were validated by comparison with homologous holo structures. Defining a “correct hit” as a group of residues containing at least two true ligand residues, the sensitivity was at least 90%; whereas for a “correct hit” defined as a group of residues containing at least three true ligand residues, the sensitivity was at least 78%. These data suggest that Ca2+-binding pockets are at least partially prepositioned to chelate the ion in the apo form of the protein. PMID:20512971

Structure of the HIV-1 reverse transcriptase Q151M mutant: insights into the inhibitor resistance of HIV-1 reverse transcriptase and the structure of the nucleotide-binding pocket of Hepatitis B virus polymerase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki, E-mail: y-yasutake@aist.go.jp

The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site,more » confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol.« less

Assessment of Drug Binding Potential of Pockets in the NS2B/NS3 Dengue Virus Protein

NASA Astrophysics Data System (ADS)

Amelia, F.; Iryani; Sari, P. Y.; Parikesit, A. A.; Bakri, R.; Toepak, E. P.; Tambunan, U. S. F.

2018-04-01

Every year an endemic dengue fever estimated to affect over 390 million cases in over 128 countries occurs. However, the antigen types which stimulate the human immune response are variable, as a result, neither effective vaccines nor antiviral treatments have been successfully developed for this disease. The NS2B/NS3 protease of the dengue virus (DENV) responsible for viral replication is a potential drug target. The ligand-enzyme binding site determination is a key role in the success of virtual screening of new inhibitors. The NS2B/NS3 protease of DENV (PDB ID: 2FOM) has two pockets consisting of 37 (Pocket 1) and 27 (Pocket 2) amino acid residues in each pocket. In this research, we characterized the amino acid residues for binding sites in NS3/NS2B based on the hydrophobicity, the percentage of charged residues, volume, depth, ΔGbinding, hydrogen bonding and bond length. The hydrophobic percentages of both pockets are high, 59 % (Pocket 1) and 41% (Pocket 2) and the percentage of charged residues in Pocket 1 and 2 are 22% and 48%, and the pocket volume is less than 700 Å3. An interaction analysis using molecular docking showed that interaction between the ligand complex and protein in Pocket 1 is more negative than Pocket 2. As a result, Pocket 1 is the better potential target for a ligand to inhibit the action of NS2B/NS3 DENV.

Jasmonate perception by inositol-phosphate-potentiated COI1-JAZ co-receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sheard, Laura B; Tan, Xu; Mao, Haibin

2011-11-07

Jasmonates are a family of plant hormones that regulate plant growth, development and responses to stress. The F-box protein CORONATINE INSENSITIVE 1 (COI1) mediates jasmonate signalling by promoting hormone-dependent ubiquitylation and degradation of transcriptional repressor JAZ proteins. Despite its importance, the mechanism of jasmonate perception remains unclear. Here we present structural and pharmacological data to show that the true Arabidopsis jasmonate receptor is a complex of both COI1 and JAZ. COI1 contains an open pocket that recognizes the bioactive hormone (3R,7S)-jasmonoyl-l-isoleucine (JA-Ile) with high specificity. High-affinity hormone binding requires a bipartite JAZ degron sequence consisting of a conserved {alpha}-helix formore » COI1 docking and a loop region to trap the hormone in its binding pocket. In addition, we identify a third critical component of the jasmonate co-receptor complex, inositol pentakisphosphate, which interacts with both COI1 and JAZ adjacent to the ligand. Our results unravel the mechanism of jasmonate perception and highlight the ability of F-box proteins to evolve as multi-component signalling hubs.« less

Binding ligand prediction for proteins using partial matching of local surface patches.

PubMed

Sael, Lee; Kihara, Daisuke

2010-01-01

Functional elucidation of uncharacterized protein structures is an important task in bioinformatics. We report our new approach for structure-based function prediction which captures local surface features of ligand binding pockets. Function of proteins, specifically, binding ligands of proteins, can be predicted by finding similar local surface regions of known proteins. To enable partial comparison of binding sites in proteins, a weighted bipartite matching algorithm is used to match pairs of surface patches. The surface patches are encoded with the 3D Zernike descriptors. Unlike the existing methods which compare global characteristics of the protein fold or the global pocket shape, the local surface patch method can find functional similarity between non-homologous proteins and binding pockets for flexible ligand molecules. The proposed method improves prediction results over global pocket shape-based method which was previously developed by our group.

Binding Ligand Prediction for Proteins Using Partial Matching of Local Surface Patches

PubMed Central

Sael, Lee; Kihara, Daisuke

2010-01-01

Functional elucidation of uncharacterized protein structures is an important task in bioinformatics. We report our new approach for structure-based function prediction which captures local surface features of ligand binding pockets. Function of proteins, specifically, binding ligands of proteins, can be predicted by finding similar local surface regions of known proteins. To enable partial comparison of binding sites in proteins, a weighted bipartite matching algorithm is used to match pairs of surface patches. The surface patches are encoded with the 3D Zernike descriptors. Unlike the existing methods which compare global characteristics of the protein fold or the global pocket shape, the local surface patch method can find functional similarity between non-homologous proteins and binding pockets for flexible ligand molecules. The proposed method improves prediction results over global pocket shape-based method which was previously developed by our group. PMID:21614188

A conserved NAD+ binding pocket that regulates protein-protein interactions during aging

PubMed Central

Li, Jun; Bonkowski, Michael S.; Moniot, Sébastien; Zhang, Dapeng; Hubbard, Basil P.; Ling, Alvin J. Y.; Rajman, Luis A.; Qin, Bo; Lou, Zhenkun; Gorbunova, Vera; Aravind, L.; Steegborn, Clemens; Sinclair, David A.

2017-01-01

DNA repair is essential for life, yet its efficiency declines with age for reasons that are unclear. Numerous proteins possess Nudix homology domains (NHDs) that have no known function. We show that NHDs are NAD+ (oxidized form of nicotinamide adenine dinucleotide) binding domains that regulate protein-protein interactions. The binding of NAD+ to the NHD domain of DBC1 (deleted in breast cancer 1) prevents it from inhibiting PARP1 [poly(adenosine diphosphate–ribose) polymerase], a critical DNA repair protein. As mice age and NAD+ concentrations decline, DBC1 is increasingly bound to PARP1, causing DNA damage to accumulate, a process rapidly reversed by restoring the abundance of NAD+. Thus, NAD+ directly regulates protein-protein interactions, the modulation of which may protect against cancer, radiation, and aging. PMID:28336669

Molecular modeling of ligand-receptor interactions in the OR5 olfactory receptor.

PubMed

Singer, M S; Shepherd, G M

1994-06-02

Olfactory receptors belong to the superfamily of seven transmembrane domain, G protein-coupled receptors. In order to begin analysis of mechanisms of receptor activation, a computer model of the OR5 olfactory receptor has been constructed and compared with other members of this superfamily. We have tested docking of the odor molecule lyral, which is known to activate the OR5 receptor. The results point to specific ligand-binding residues on helices III through VII that form a binding pocket in the receptor. Some of these residues occupy sequence positions identical to ligand-binding residues conserved among other superfamily members. The results provide new insights into possible molecular mechanisms of odor recognition and suggest hypotheses to guide future experimental studies using site-directed mutagenesis.

MSPocket: an orientation-independent algorithm for the detection of ligand binding pockets.

PubMed

Zhu, Hongbo; Pisabarro, M Teresa

2011-02-01

Identification of ligand binding pockets on proteins is crucial for the characterization of protein functions. It provides valuable information for protein-ligand docking and rational engineering of small molecules that regulate protein functions. A major number of current prediction algorithms of ligand binding pockets are based on cubic grid representation of proteins and, thus, the results are often protein orientation dependent. We present the MSPocket program for detecting pockets on the solvent excluded surface of proteins. The core algorithm of the MSPocket approach does not use any cubic grid system to represent proteins and is therefore independent of protein orientations. We demonstrate that MSPocket is able to achieve an accuracy of 75% in predicting ligand binding pockets on a test dataset used for evaluating several existing methods. The accuracy is 92% if the top three predictions are considered. Comparison to one of the recently published best performing methods shows that MSPocket reaches similar performance with the additional feature of being protein orientation independent. Interestingly, some of the predictions are different, meaning that the two methods can be considered complementary and combined to achieve better prediction accuracy. MSPocket also provides a graphical user interface for interactive investigation of the predicted ligand binding pockets. In addition, we show that overlap criterion is a better strategy for the evaluation of predicted ligand binding pockets than the single point distance criterion. The MSPocket source code can be downloaded from http://appserver.biotec.tu-dresden.de/MSPocket/. MSPocket is also available as a PyMOL plugin with a graphical user interface.

Crystal Structure of the Leishmania Major Phosphodiesterase LmjPDEB1 and Insight into the Design of hte Parasite-Selective Inhibitors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang,H.; Yan, Z.; Geng, J.

2007-01-01

Human leishmaniasis is a major public health problem in many countries, but chemotherapy is in an unsatisfactory state. Leishmania major phosphodiesterases (LmjPDEs) have been shown to play important roles in cell proliferation and apoptosis of the parasite. Thus LmjPDE inhibitors may potentially represent a novel class of drugs for the treatment of leishmaniasis. Reported here are the kinetic characterization of the LmjPDEB1 catalytic domain and its crystal structure as a complex with 3-isobutyl-1-methylxanthine (IBMX) at 1.55 Angstroms resolution. The structure of LmjPDEB1 is similar to that of human PDEs. IBMX stacks against the conserved phenylalanine and forms a hydrogen bondmore » with the invariant glutamine, in a pattern common to most inhibitors bound to human PDEs. However, an extensive structural comparison reveals subtle, but significant differences between the active sites of LmjPDEB1 and human PDEs. In addition, a pocket next to the inhibitor binding site is found to be unique to LmjPDEB1. This pocket is isolated by two gating residues in human PDE families, but constitutes a natural expansion of the inhibitor binding pocket in LmjPDEB1. The structure particularity might be useful for the development of parasite-selective inhibitors for the treatment of leishmaniasis.« less

Exploration of the effect of sequence variations located inside the binding pocket of HIV-1 and HIV-2 proteases.

PubMed

Triki, Dhoha; Billot, Telli; Visseaux, Benoit; Descamps, Diane; Flatters, Delphine; Camproux, Anne-Claude; Regad, Leslie

2018-04-10

HIV-2 protease (PR2) is naturally resistant to most FDA (Food and Drug Administration)-approved HIV-1 protease inhibitors (PIs), a major antiretroviral class. In this study, we compared the PR1 and PR2 binding pockets extracted from structures complexed with 12 ligands. The comparison of PR1 and PR2 pocket properties showed that bound PR2 pockets were more hydrophobic with more oxygen atoms and fewer nitrogen atoms than PR1 pockets. The structural comparison of PR1 and PR2 pockets highlighted structural changes induced by their sequence variations and that were consistent with these property changes. Specifically, substitutions at residues 31, 46, and 82 induced structural changes in their main-chain atoms that could affect PI binding in PR2. In addition, the modelling of PR1 mutant structures containing V32I and L76M substitutions revealed a cooperative mechanism leading to structural deformation of flap-residue 45 that could modify PR2 flexibility. Our results suggest that substitutions in the PR1 and PR2 pockets can modify PI binding and flap flexibility, which could underlie PR2 resistance against PIs. These results provide new insights concerning the structural changes induced by PR1 and PR2 pocket variation changes, improving the understanding of the atomic mechanism of PR2 resistance to PIs.

Structural and functional insights into the HIV-1 maturation inhibitor binding pocket.

PubMed

Waki, Kayoko; Durell, Stewart R; Soheilian, Ferri; Nagashima, Kunio; Butler, Scott L; Freed, Eric O

2012-01-01

Processing of the Gag precursor protein by the viral protease during particle release triggers virion maturation, an essential step in the virus replication cycle. The first-in-class HIV-1 maturation inhibitor dimethylsuccinyl betulinic acid [PA-457 or bevirimat (BVM)] blocks HIV-1 maturation by inhibiting the cleavage of the capsid-spacer peptide 1 (CA-SP1) intermediate to mature CA. A structurally distinct molecule, PF-46396, was recently reported to have a similar mode of action to that of BVM. Because of the structural dissimilarity between BVM and PF-46396, we hypothesized that the two compounds might interact differentially with the putative maturation inhibitor-binding pocket in Gag. To test this hypothesis, PF-46396 resistance was selected for in vitro. Resistance mutations were identified in three regions of Gag: around the CA-SP1 cleavage site where BVM resistance maps, at CA amino acid 201, and in the CA major homology region (MHR). The MHR mutants are profoundly PF-46396-dependent in Gag assembly and release and virus replication. The severe defect exhibited by the inhibitor-dependent MHR mutants in the absence of the compound is also corrected by a second-site compensatory change far downstream in SP1, suggesting structural and functional cross-talk between the HIV-1 CA MHR and SP1. When PF-46396 and BVM were both present in infected cells they exhibited mutually antagonistic behavior. Together, these results identify Gag residues that line the maturation inhibitor-binding pocket and suggest that BVM and PF-46396 interact differentially with this putative pocket. These findings provide novel insights into the structure-function relationship between the CA MHR and SP1, two domains of Gag that are critical to both assembly and maturation. The highly conserved nature of the MHR across all orthoretroviridae suggests that these findings will be broadly relevant to retroviral assembly. Finally, the results presented here provide a framework for increased structural understanding of HIV-1 maturation inhibitor activity.

Broad-spectrum non-nucleoside inhibitors for caliciviruses.

PubMed

Netzler, Natalie E; Enosi Tuipulotu, Daniel; Eltahla, Auda A; Lun, Jennifer H; Ferla, Salvatore; Brancale, Andrea; Urakova, Nadya; Frese, Michael; Strive, Tanja; Mackenzie, Jason M; White, Peter A

2017-10-01

Viruses of the Caliciviridae cause significant and sometimes lethal diseases, however despite substantial research efforts, specific antivirals are lacking. Broad-spectrum antivirals could combat multiple viral pathogens, offering a rapid solution when no therapies exist. The RNA-dependent RNA polymerase (RdRp) is an attractive antiviral target as it is essential for viral replication and lacks mammalian homologs. To focus the search for pan-Caliciviridae antivirals, the RdRp was probed with non-nucleoside inhibitors (NNIs) developed against hepatitis C virus (HCV) to reveal both allosteric ligands for structure-activity relationship enhancement, and highly-conserved RdRp pockets for antiviral targeting. The ability of HCV NNIs to inhibit calicivirus RdRp activities was assessed using in vitro enzyme and murine norovirus cell culture assays. Results revealed that three NNIs which bound the HCV RdRp Thumb I (TI) site also inhibited transcriptional activities of six RdRps spanning the Norovirus, Sapovirus and Lagovirus genera of the Caliciviridae. These NNIs included JTK-109 (RdRp inhibition range: IC 50 4.3-16.6 μM), TMC-647055 (IC 50 range: 18.8-45.4 μM) and Beclabuvir (IC 50 range: 23.8->100 μM). In silico studies and site-directed mutagenesis indicated the JTK-109 binding site was within the calicivirus RdRp thumb domain, in a pocket termed Site-B, which is highly-conserved within all calicivirus RdRps. Additionally, RdRp inhibition assays revealed that JTK-109 was antagonistic with the previously reported RdRp inhibitor pyridoxal-5'-phosphate-6-(2'-naphthylazo-6'-nitro-4',8'-disulfonate) tetrasodium salt (PPNDS), that also binds to Site-B. Moreover, like JTK-109, PPNDS was also a potent inhibitor of polymerases from six viruses spanning the three Caliciviridae genera tested (IC 50 range: 0.1-2.3 μM). Together, this study demonstrates the potential for de novo development of broad-spectrum antivirals that target the highly-conserved RdRp thumb pocket, Site-B. We also revealed three broad-spectrum HCV NNIs that could be used as antiviral scaffolds for further development against caliciviruses and other viruses. Copyright © 2017 Elsevier B.V. All rights reserved.

An allosteric conduit facilitates dynamic multisite substrate recognition by the SCFCdc4 ubiquitin ligase

NASA Astrophysics Data System (ADS)

Csizmok, Veronika; Orlicky, Stephen; Cheng, Jing; Song, Jianhui; Bah, Alaji; Delgoshaie, Neda; Lin, Hong; Mittag, Tanja; Sicheri, Frank; Chan, Hue Sun; Tyers, Mike; Forman-Kay, Julie D.

2017-01-01

The ubiquitin ligase SCFCdc4 mediates phosphorylation-dependent elimination of numerous substrates by binding one or more Cdc4 phosphodegrons (CPDs). Methyl-based NMR analysis of the Cdc4 WD40 domain demonstrates that Cyclin E, Sic1 and Ash1 degrons have variable effects on the primary Cdc4WD40 binding pocket. Unexpectedly, a Sic1-derived multi-CPD substrate (pSic1) perturbs methyls around a previously documented allosteric binding site for the chemical inhibitor SCF-I2. NMR cross-saturation experiments confirm direct contact between pSic1 and the allosteric pocket. Phosphopeptide affinity measurements reveal negative allosteric communication between the primary CPD and allosteric pockets. Mathematical modelling indicates that the allosteric pocket may enhance ultrasensitivity by tethering pSic1 to Cdc4. These results suggest negative allosteric interaction between two distinct binding pockets on the Cdc4WD40 domain may facilitate dynamic exchange of multiple CPD sites to confer ultrasensitive dependence on substrate phosphorylation.

Structural and Biochemical Studies of ALIX/AlP1 and Its Role in Retrovirus Budding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fisher,R.; Chung, H.; Zhai, Q.

2007-01-01

ALIX/AIP1 functions in enveloped virus budding, endosomal protein sorting, and many other cellular processes. Retroviruses, including HIV-1, SIV, and EIAV, bind and recruit ALIX through YPXnL late-domain motifs (X = any residue; n = 1-3). Crystal structures reveal that human ALIX is composed of an N-terminal Bro1 domain and a central domain that is composed of two extended three-helix bundles that form elongated arms that fold back into a 'V.'. The structures also reveal conformational flexibility in the arms that suggests that the V domain may act as a flexible hinge in response to ligand binding. YPXnL late domains bindmore » in a conserved hydrophobic pocket on the second arm near the apex of the V, whereas CHMP4/ESCRT-III proteins bind a conserved hydrophobic patch on the Bro1 domain, and both interactions are required for virus budding. ALIX therefore serves as a flexible, extended scaffold that connects retroviral Gag proteins to ESCRT-III and other cellular-budding machinery.« less

Structural characterization of acyl-CoA oxidases reveals a direct link between pheromone biosynthesis and metabolic state in Caenorhabditis elegans

PubMed Central

Zhang, Xinxing; Jones, Rachel A.; Bruner, Steven D.; Butcher, Rebecca A.

2016-01-01

Caenorhabditis elegans secretes ascarosides as pheromones to communicate with other worms and to coordinate the development and behavior of the population. Peroxisomal β-oxidation cycles shorten the side chains of ascaroside precursors to produce the short-chain ascaroside pheromones. Acyl-CoA oxidases, which catalyze the first step in these β-oxidation cycles, have different side chain-length specificities and enable C. elegans to regulate the production of specific ascaroside pheromones. Here, we determine the crystal structure of the acyl-CoA oxidase 1 (ACOX-1) homodimer and the ACOX-2 homodimer bound to its substrate. Our results provide a molecular basis for the substrate specificities of the acyl-CoA oxidases and reveal why some of these enzymes have a very broad substrate range, whereas others are quite specific. Our results also enable predictions to be made for the roles of uncharacterized acyl-CoA oxidases in C. elegans and in other nematode species. Remarkably, we show that most of the C. elegans acyl-CoA oxidases that participate in ascaroside biosynthesis contain a conserved ATP-binding pocket that lies at the dimer interface, and we identify key residues in this binding pocket. ATP binding induces a structural change that is associated with tighter binding of the FAD cofactor. Mutations that disrupt ATP binding reduce FAD binding and reduce enzyme activity. Thus, ATP may serve as a regulator of acyl-CoA oxidase activity, thereby directly linking ascaroside biosynthesis to ATP concentration and metabolic state. PMID:27551084

Structural basis for the Nanos-mediated recruitment of the CCR4-NOT complex and translational repression.

PubMed

Bhandari, Dipankar; Raisch, Tobias; Weichenrieder, Oliver; Jonas, Stefanie; Izaurralde, Elisa

2014-04-15

The RNA-binding proteins of the Nanos family play an essential role in germ cell development and survival in a wide range of metazoan species. They function by suppressing the expression of target mRNAs through the recruitment of effector complexes, which include the CCR4-NOT deadenylase complex. Here, we show that the three human Nanos paralogs (Nanos1-3) interact with the CNOT1 C-terminal domain and determine the structural basis for the specific molecular recognition. Nanos1-3 bind CNOT1 through a short CNOT1-interacting motif (NIM) that is conserved in all vertebrates and some invertebrate species. The crystal structure of the human Nanos1 NIM peptide bound to CNOT1 reveals that the peptide opens a conserved hydrophobic pocket on the CNOT1 surface by inserting conserved aromatic residues. The substitutions of these aromatic residues in the Nanos1-3 NIMs abolish binding to CNOT1 and abrogate the ability of the proteins to repress translation. Our findings provide the structural basis for the recruitment of the CCR4-NOT complex by vertebrate Nanos, indicate that the NIMs are the major determinants of the translational repression mediated by Nanos, and identify the CCR4-NOT complex as the main effector complex for Nanos function.

Enzyme specificity under dynamic control

NASA Astrophysics Data System (ADS)

Ota, Nobuyuki; Agard, David A.

2002-03-01

The contributions of conformational dynamics to substrate specificity have been examined by the application of principal component analysis to molecular dynamics trajectories of alpha-lytic protease. The wild-type alpha-lytic protease is highly specific for substrates with small hydrophobic side chains at the specificity pocket, while the Met190Ala binding pocket mutant has a much broader specificity, actively hydrolyzing substrates ranging from Ala to Phe. We performed a principal component analysis using 1-nanosecond molecular dynamics simulations using solvent boundary condition. We found that the walls of the wild-type substrate binding pocket move in tandem with one another, causing the pocket size to remain fixed so that only small substrates are recognized. In contrast, the M190A mutant shows uncoupled movement of the binding pocket walls, allowing the pocket to sample both smaller and larger sizes, which appears to be the cause of the observed broad specificity. The results suggest that the protein dynamics of alpha-lytic protease may play a significant role in defining the patterns of substrate specificity.

Molecular Docking Studies to Explore Potential Binding Pockets and Inhibitors for Chikungunya Virus Envelope Glycoproteins.

PubMed

Nguyen, Phuong T V; Yu, Haibo; Keller, Paul A

2017-03-11

The chikungunya virus (CHIKV) envelope glycoproteins are considered important potential targets for anti-CHIKV drug discovery due to their crucial roles in virus attachment and virus entry. In this study, using two available crystal structures of the immature and mature forms of envelope glycoproteins, virtual screenings based on blind dockings and focused dockings were carried out to identify potential binding pockets and hit compounds for the virus. The chemical library database of compounds, NCI Diversity Set II, was used in these docking studies. In addition to reproducing previously reported examples, new binding pockets were identified, e.g., Pocket 2 in the 3N40, and Pocket 2 and Pocket 3 in the 3N42. Convergences in conformational sampling in docking using AutoDock Vina were evaluated. An analysis of docking results was carried out to understand interactions of the envelope glycoproteins complexes. Some key residues for interactions, for example Gly91 and His230, are identified as possessing important roles in the fusion process.

Response of SCP-2L domain of human MFE-2 to ligand removal: binding site closure and burial of peroxisomal targeting signal.

PubMed

Lensink, M F; Haapalainen, A M; Hiltunen, J K; Glumoff, T; Juffer, A H

2002-10-11

In the study of the structure and function relationship of human MFE-2, we have investigated the dynamics of human MFE-2SCP-2L (hSCP-2L) and its response to ligand removal. A comparison was made with homologous rabbit SCP-2. Breathing and a closing motion are found, identifiable with an adjustment in size and a closing off of the binding pocket. Crucial residues for structural integrity have been identified. Particularly mobile areas of the protein are loop 1 that is connecting helices A and C in space, and helix D, next to the entrance of the pocket. In hSCP-2L, the binding pocket gets occupied by Phe93, which is making a tight hydrophobic contact with Trp36. In addition, it is found that the C-terminal peroxisomal targeting signal (PTS1) that is solvent exposed in the complexed structure becomes buried when no ligand is present. Moreover, an anti-correlation exists between burial of PTS1 and the size of the binding pocket. The results are in accordance with plant nsLTPs, where a similar accommodation of binding pocket size was found after ligand binding/removal. Furthermore, the calculations support the suggestion of a ligand-assisted targeting mechanism.

Computational Analysis of the Ligand Binding Site of the Extracellular ATP Receptor, DORN1

DOE PAGES

Nguyen, Cuong The; Tanaka, Kiwamu; Cao, Yangrong; ...

2016-09-01

DORN1 (also known as P2K1) is a plant receptor for extracellular ATP, which belongs to a large gene family of legume-type (L-type) lectin receptor kinases. Extracellular ATP binds to DORN1 with strong affinity through its lectin domain, and the binding triggers a variety of intracellular activities in response to biotic and abiotic stresses. However, information on the tertiary structure of the ligand binding site of DORN1is lacking, which hampers efforts to fully elucidate the mechanism of receptor action. Available data of the crystal structures from more than 50 L-type lectins enable us to perform an in silico study of molecularmore » interaction between DORN1 and ATP. In this study, we employed a computational approach to develop a tertiary structure model of the DORN1 lectin domain. A blind docking analysis demonstrated that ATP binds to a cavity made by four loops (defined as loops A B, C and D) of the DORN1 lectin domain with high affinity. In silico target docking of ATP to the DORN1 binding site predicted interaction with 12 residues, located on the four loops, via hydrogen bonds and hydrophobic interactions. The ATP binding pocket is structurally similar in location to the carbohydrate binding pocket of the canonical L-type lectins. However, four of the residues predicted to interact with ATP are not conserved between DORN1 and the other carbohydrate-binding lectins, suggesting that diversifying selection acting on these key residues may have led to the ATP binding activity of DORN1. Finally, the in silico model was validated by in vitro ATP binding assays using the purified extracellular lectin domain of wild-type DORN1, as well as mutated DORN1 lacking key ATP binding residues.« less

Computational Analysis of the Ligand Binding Site of the Extracellular ATP Receptor, DORN1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nguyen, Cuong The; Tanaka, Kiwamu; Cao, Yangrong

DORN1 (also known as P2K1) is a plant receptor for extracellular ATP, which belongs to a large gene family of legume-type (L-type) lectin receptor kinases. Extracellular ATP binds to DORN1 with strong affinity through its lectin domain, and the binding triggers a variety of intracellular activities in response to biotic and abiotic stresses. However, information on the tertiary structure of the ligand binding site of DORN1is lacking, which hampers efforts to fully elucidate the mechanism of receptor action. Available data of the crystal structures from more than 50 L-type lectins enable us to perform an in silico study of molecularmore » interaction between DORN1 and ATP. In this study, we employed a computational approach to develop a tertiary structure model of the DORN1 lectin domain. A blind docking analysis demonstrated that ATP binds to a cavity made by four loops (defined as loops A B, C and D) of the DORN1 lectin domain with high affinity. In silico target docking of ATP to the DORN1 binding site predicted interaction with 12 residues, located on the four loops, via hydrogen bonds and hydrophobic interactions. The ATP binding pocket is structurally similar in location to the carbohydrate binding pocket of the canonical L-type lectins. However, four of the residues predicted to interact with ATP are not conserved between DORN1 and the other carbohydrate-binding lectins, suggesting that diversifying selection acting on these key residues may have led to the ATP binding activity of DORN1. Finally, the in silico model was validated by in vitro ATP binding assays using the purified extracellular lectin domain of wild-type DORN1, as well as mutated DORN1 lacking key ATP binding residues.« less

Molecular basis for defect in Alix-binding by alternatively spliced isoform of ALG-2 (ALG-2DeltaGF122) and structural roles of F122 in target recognition.

PubMed

Inuzuka, Tatsutoshi; Suzuki, Hironori; Kawasaki, Masato; Shibata, Hideki; Wakatsuki, Soichi; Maki, Masatoshi

2010-08-06

ALG-2 (a gene product of PDCD6) belongs to the penta-EF-hand (PEF) protein family and Ca2+-dependently interacts with various intracellular proteins including mammalian Alix, an adaptor protein in the ESCRT system. Our previous X-ray crystal structural analyses revealed that binding of Ca2+ to EF3 enables the side chain of R125 to move enough to make a primary hydrophobic pocket (Pocket 1) accessible to a short fragment of Alix. The side chain of F122, facing a secondary hydrophobic pocket (Pocket 2), interacts with the Alix peptide. An alternatively spliced shorter isoform, designated ALG-2DeltaGF122, lacks Gly121Phe122 and does not bind Alix, but the structural basis of the incompetence has remained to be elucidated. We solved the X-ray crystal structure of the PEF domain of ALG-2DeltaGF122 in the Ca2+-bound form and compared it with that of ALG-2. Deletion of the two residues shortened alpha-helix 5 (alpha5) and changed the configuration of the R125 side chain so that it partially blocked Pocket 1. A wall created by the main chain of 121-GFG-123 and facing the two pockets was destroyed. Surprisingly, however, substitution of F122 with Ala or Gly, but not with Trp, increased the Alix-binding capacity in binding assays. The F122 substitutions exhibited different effects on binding of ALG-2 to other known interacting proteins, including TSG101 (Tumor susceptibility gene 101) and annexin A11. The X-ray crystal structure of the F122A mutant revealed that removal of the bulky F122 side chain not only created an additional open space in Pocket 2 but also abolished inter-helix interactions with W95 and V98 (present in alpha4) and that alpha5 inclined away from alpha4 to expand Pocket 2, suggesting acquirement of more appropriate positioning of the interacting residues to accept Alix. We found that the inability of the two-residue shorter ALG-2 isoform to bind Alix is not due to the absence of bulky side chain of F122 but due to deformation of a main-chain wall facing pockets 1 and 2. Moreover, a residue at the position of F122 contributes to target specificity and a smaller side chain is preferable for Alix binding but not favored to bind annexin A11.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fox, Jerome M.; Kang, Kyungtae; Sastry, Madhavi

In this study we use mutants of human carbonic anhydrase (HCAII) to examine how changes in the organization of water within a binding pocket can alter the thermodynamics of protein–ligand association. Results from calorimetric, crystallographic, and theoretical analyses suggest that most mutations strengthen networks of water-mediated hydrogen bonds and reduce binding affinity by increasing the enthalpic cost and, to a lesser extent, the entropic benefit of rearranging those networks during binding. The organization of water within a binding pocket can thus determine whether the hydrophobic interactions in which it engages are enthalpy-driven or entropy-driven. Our findings highlight a possible asymmetrymore » in protein–ligand association by suggesting that, within the confines of the binding pocket of HCAII, binding events associated with enthalpically favorable rearrangements of water are stronger than those associated with entropically favorable ones.« less

On the binding determinants of the glutamate agonist with the glutamate receptor ligand binding domain.

PubMed

Speranskiy, Kirill; Kurnikova, Maria

2005-08-30

Ionotropic glutamate receptors (GluRs) are ligand-gated membrane channel proteins found in the central neural system that mediate a fast excitatory response of neurons. In this paper, we report theoretical analysis of the ligand-protein interactions in the binding pocket of the S1S2 (ligand binding) domain of the GluR2 receptor in the closed conformation. By utilizing several theoretical methods ranging from continuum electrostatics to all-atom molecular dynamics simulations and quantum chemical calculations, we were able to characterize in detail glutamate agonist binding to the wild-type and E705D mutant proteins. A theoretical model of the protein-ligand interactions is validated via direct comparison of theoretical and Fourier transform infrared spectroscopy (FTIR) measured frequency shifts of the ligand's carboxylate group vibrations [Jayaraman et al. (2000) Biochemistry 39, 8693-8697; Cheng et al. (2002) Biochemistry 41, 1602-1608]. A detailed picture of the interactions in the binding site is inferred by analyzing contributions to vibrational frequencies produced by protein residues forming the ligand-binding pocket. The role of mobility and hydrogen-bonding network of water in the ligand-binding pocket and the contribution of protein residues exposed in the binding pocket to the binding and selectivity of the ligand are discussed. It is demonstrated that the molecular surface of the protein in the ligand-free state has mainly positive electrostatic potential attractive to the negatively charged ligand, and the potential produced by the protein in the ligand-binding pocket in the closed state is complementary to the distribution of the electrostatic potential produced by the ligand itself. Such charge complementarity ensures specificity to the unique charge distribution of the ligand.

The Second Transmembrane Domain of the Human Type 1 Angiotensin II Receptor Participates in the Formation of the Ligand Binding Pocket and Undergoes Integral Pivoting Movement during the Process of Receptor Activation*

PubMed Central

Domazet, Ivana; Holleran, Brian J.; Martin, Stéphane S.; Lavigne, Pierre; Leduc, Richard; Escher, Emanuel; Guillemette, Gaétan

2009-01-01

The octapeptide hormone angiotensin II (AngII) exerts a wide variety of cardiovascular effects through the activation of the angiotensin II type-1 (AT1) receptor, which belongs to the G protein-coupled receptor superfamily. Like other G protein-coupled receptors, the AT1 receptor possesses seven transmembrane domains that provide structural support for the formation of the ligand-binding pocket. In order to identify those residues in the second transmembrane domain (TMD2) that contribute to the formation of the binding pocket of the AT1 receptor, we used the substituted cysteine accessibility method. All of the residues within the Leu-70 to Trp-94 region were mutated one at a time to a cysteine, and, after expression in COS-7 cells, the mutant receptors were treated with the sulfhydryl-specific alkylating agent methanethiosulfonate-ethylammonium (MTSEA). MTSEA reacts selectively with water-accessible, free sulfhydryl groups of endogenous or introduced point mutation cysteines. If a cysteine is found in the binding pocket, the covalent modification will affect the binding kinetics of the ligand. MTSEA substantially decreased the binding affinity of D74C-AT1, L81C-AT1, A85C-AT1, T88C-AT1, and A89C-AT1 mutant receptors, which suggests that these residues orient themselves within the water-accessible binding pocket of the AT1 receptor. Interestingly, this pattern of acquired MTSEA sensitivity was altered for TMD2 reporter cysteines engineered in a constitutively active N111G-AT1 receptor background. Indeed, mutant D74C-N111G-AT1 became insensitive to MTSEA, whereas mutant L81C-N111G-AT1 lost some sensitivity and mutant V86C-N111G-AT1 became sensitive to MTSEA. Our results suggest that constitutive activation of the AT1 receptor causes TMD2 to pivot, bringing the top of TMD2 closer to the binding pocket and pushing the bottom of TMD2 away from the binding pocket. PMID:19276075

The second transmembrane domain of the human type 1 angiotensin II receptor participates in the formation of the ligand binding pocket and undergoes integral pivoting movement during the process of receptor activation.

PubMed

Domazet, Ivana; Holleran, Brian J; Martin, Stéphane S; Lavigne, Pierre; Leduc, Richard; Escher, Emanuel; Guillemette, Gaétan

2009-05-01

The octapeptide hormone angiotensin II (AngII) exerts a wide variety of cardiovascular effects through the activation of the angiotensin II type-1 (AT(1)) receptor, which belongs to the G protein-coupled receptor superfamily. Like other G protein-coupled receptors, the AT(1) receptor possesses seven transmembrane domains that provide structural support for the formation of the ligand-binding pocket. In order to identify those residues in the second transmembrane domain (TMD2) that contribute to the formation of the binding pocket of the AT(1) receptor, we used the substituted cysteine accessibility method. All of the residues within the Leu-70 to Trp-94 region were mutated one at a time to a cysteine, and, after expression in COS-7 cells, the mutant receptors were treated with the sulfhydryl-specific alkylating agent methanethiosulfonate-ethylammonium (MTSEA). MTSEA reacts selectively with water-accessible, free sulfhydryl groups of endogenous or introduced point mutation cysteines. If a cysteine is found in the binding pocket, the covalent modification will affect the binding kinetics of the ligand. MTSEA substantially decreased the binding affinity of D74C-AT(1), L81C-AT(1), A85C-AT(1), T88C-AT(1), and A89C-AT(1) mutant receptors, which suggests that these residues orient themselves within the water-accessible binding pocket of the AT(1) receptor. Interestingly, this pattern of acquired MTSEA sensitivity was altered for TMD2 reporter cysteines engineered in a constitutively active N111G-AT(1) receptor background. Indeed, mutant D74C-N111G-AT(1) became insensitive to MTSEA, whereas mutant L81C-N111G-AT(1) lost some sensitivity and mutant V86C-N111G-AT(1) became sensitive to MTSEA. Our results suggest that constitutive activation of the AT(1) receptor causes TMD2 to pivot, bringing the top of TMD2 closer to the binding pocket and pushing the bottom of TMD2 away from the binding pocket.

Thiophene antibacterials that allosterically stabilize DNA-cleavage complexes with DNA gyrase.

PubMed

Chan, Pan F; Germe, Thomas; Bax, Benjamin D; Huang, Jianzhong; Thalji, Reema K; Bacqué, Eric; Checchia, Anna; Chen, Dongzhao; Cui, Haifeng; Ding, Xiao; Ingraham, Karen; McCloskey, Lynn; Raha, Kaushik; Srikannathasan, Velupillai; Maxwell, Anthony; Stavenger, Robert A

2017-05-30

A paucity of novel acting antibacterials is in development to treat the rising threat of antimicrobial resistance, particularly in Gram-negative hospital pathogens, which has led to renewed efforts in antibiotic drug discovery. Fluoroquinolones are broad-spectrum antibacterials that target DNA gyrase by stabilizing DNA-cleavage complexes, but their clinical utility has been compromised by resistance. We have identified a class of antibacterial thiophenes that target DNA gyrase with a unique mechanism of action and have activity against a range of bacterial pathogens, including strains resistant to fluoroquinolones. Although fluoroquinolones stabilize double-stranded DNA breaks, the antibacterial thiophenes stabilize gyrase-mediated DNA-cleavage complexes in either one DNA strand or both DNA strands. X-ray crystallography of DNA gyrase-DNA complexes shows the compounds binding to a protein pocket between the winged helix domain and topoisomerase-primase domain, remote from the DNA. Mutations of conserved residues around this pocket affect activity of the thiophene inhibitors, consistent with allosteric inhibition of DNA gyrase. This druggable pocket provides potentially complementary opportunities for targeting bacterial topoisomerases for antibiotic development.

Human Anti-V3 HIV-1 Monoclonal Antibodies Encoded by the VH5-51/VL Lambda Genes Define a Conserved Antigenic Structure

PubMed Central

Gorny, Miroslaw K.; Sampson, Jared; Li, Huiguang; Jiang, Xunqing; Totrov, Maxim; Wang, Xiao-Hong; Williams, Constance; O'Neal, Timothy; Volsky, Barbara; Li, Liuzhe; Cardozo, Timothy; Nyambi, Phillipe; Zolla-Pazner, Susan; Kong, Xiang-Peng

2011-01-01

Preferential usage of immunoglobulin (Ig) genes that encode antibodies (Abs) against various pathogens is rarely observed and the nature of their dominance is unclear in the context of stochastic recombination of Ig genes. The hypothesis that restricted usage of Ig genes predetermines the antibody specificity was tested in this study of 18 human anti-V3 monoclonal Abs (mAbs) generated from unrelated individuals infected with various subtypes of HIV-1, all of which preferentially used pairing of the VH5-51 and VL lambda genes. Crystallographic analysis of five VH5-51/VL lambda-encoded Fabs complexed with various V3 peptides revealed a common three dimensional (3D) shape of the antigen-binding sites primarily determined by the four complementarity determining regions (CDR) for the heavy (H) and light (L) chains: specifically, the H1, H2, L1 and L2 domains. The CDR H3 domain did not contribute to the shape of the binding pocket, as it had different lengths, sequences and conformations for each mAb. The same shape of the binding site was further confirmed by the identical backbone conformation exhibited by V3 peptides in complex with Fabs which fully adapted to the binding pocket and the same key contact residues, mainly germline-encoded in the heavy and light chains of five Fabs. Finally, the VH5-51 anti-V3 mAbs recognized an epitope with an identical 3D structure which is mimicked by a single mimotope recognized by the majority of VH5-51-derived mAbs but not by other V3 mAbs. These data suggest that the identification of preferentially used Ig genes by neutralizing mAbs may define conserved epitopes in the diverse virus envelopes. This will be useful information for designing vaccine immunogen inducing cross-neutralizing Abs. PMID:22164215

Structural basis for subtype-specific inhibition of the P2X7 receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Karasawa, Akira; Kawate, Toshimitsu

The P2X7 receptor is a non-selective cation channel activated by extracellular adenosine triphosphate (ATP). Chronic activation of P2X7 underlies many health problems such as pathologic pain, yet we lack effective antagonists due to poorly understood mechanisms of inhibition. Here we present crystal structures of a mammalian P2X7 receptor complexed with five structurally-unrelated antagonists. Unexpectedly, these drugs all bind to an allosteric site distinct from the ATP-binding pocket in a groove formed between two neighboring subunits. This novel drug-binding pocket accommodates a diversity of small molecules mainly through hydrophobic interactions. Functional assays propose that these compounds allosterically prevent narrowing of themore » drug-binding pocket and the turret-like architecture during channel opening, which is consistent with a site of action distal to the ATP-binding pocket. These novel mechanistic insights will facilitate the development of P2X7-specific drugs for treating human diseases.« less

Modeling of Arylamide Helix Mimetics in the p53 Peptide Binding Site of hDM2 Suggests Parallel and Anti-Parallel Conformations Are Both Stable

PubMed Central

Fuller, Jonathan C.; Jackson, Richard M.; Edwards, Thomas A.; Wilson, Andrew J.; Shirts, Michael R.

2012-01-01

The design of novel α-helix mimetic inhibitors of protein-protein interactions is of interest to pharmaceuticals and chemical genetics researchers as these inhibitors provide a chemical scaffold presenting side chains in the same geometry as an α-helix. This conformational arrangement allows the design of high affinity inhibitors mimicking known peptide sequences binding specific protein substrates. We show that GAFF and AutoDock potentials do not properly capture the conformational preferences of α-helix mimetics based on arylamide oligomers and identify alternate parameters matching solution NMR data and suitable for molecular dynamics simulation of arylamide compounds. Results from both docking and molecular dynamics simulations are consistent with the arylamides binding in the p53 peptide binding pocket. Simulations of arylamides in the p53 binding pocket of hDM2 are consistent with binding, exhibiting similar structural dynamics in the pocket as simulations of known hDM2 binders Nutlin-2 and a benzodiazepinedione compound. Arylamide conformations converge towards the same region of the binding pocket on the 20 ns time scale, and most, though not all dihedrals in the binding pocket are well sampled on this timescale. We show that there are two putative classes of binding modes for arylamide compounds supported equally by the modeling evidence. In the first, the arylamide compound lies parallel to the observed p53 helix. In the second class, not previously identified or proposed, the arylamide compound lies anti-parallel to the p53 helix. PMID:22916232

Pharmacophore screening of the protein data bank for specific binding site chemistry.

PubMed

Campagna-Slater, Valérie; Arrowsmith, Andrew G; Zhao, Yong; Schapira, Matthieu

2010-03-22

A simple computational approach was developed to screen the Protein Data Bank (PDB) for putative pockets possessing a specific binding site chemistry and geometry. The method employs two commonly used 3D screening technologies, namely identification of cavities in protein structures and pharmacophore screening of chemical libraries. For each protein structure, a pocket finding algorithm is used to extract potential binding sites containing the correct types of residues, which are then stored in a large SDF-formatted virtual library; pharmacophore filters describing the desired binding site chemistry and geometry are then applied to screen this virtual library and identify pockets matching the specified structural chemistry. As an example, this approach was used to screen all human protein structures in the PDB and identify sites having chemistry similar to that of known methyl-lysine binding domains that recognize chromatin methylation marks. The selected genes include known readers of the histone code as well as novel binding pockets that may be involved in epigenetic signaling. Putative allosteric sites were identified on the structures of TP53BP1, L3MBTL3, CHEK1, KDM4A, and CREBBP.

Generating "fragment-based virtual library" using pocket similarity search of ligand-receptor complexes.

PubMed

Khashan, Raed S

2015-01-01

As the number of available ligand-receptor complexes is increasing, researchers are becoming more dedicated to mine these complexes to aid in the drug design and development process. We present free software which is developed as a tool for performing similarity search across ligand-receptor complexes for identifying binding pockets which are similar to that of a target receptor. The search is based on 3D-geometric and chemical similarity of the atoms forming the binding pocket. For each match identified, the ligand's fragment(s) corresponding to that binding pocket are extracted, thus forming a virtual library of fragments (FragVLib) that is useful for structure-based drug design. The program provides a very useful tool to explore available databases.

A conserved NAD+ binding pocket that regulates protein-protein interactions during aging.

PubMed

Li, Jun; Bonkowski, Michael S; Moniot, Sébastien; Zhang, Dapeng; Hubbard, Basil P; Ling, Alvin J Y; Rajman, Luis A; Qin, Bo; Lou, Zhenkun; Gorbunova, Vera; Aravind, L; Steegborn, Clemens; Sinclair, David A

2017-03-24

DNA repair is essential for life, yet its efficiency declines with age for reasons that are unclear. Numerous proteins possess Nudix homology domains (NHDs) that have no known function. We show that NHDs are NAD + (oxidized form of nicotinamide adenine dinucleotide) binding domains that regulate protein-protein interactions. The binding of NAD + to the NHD domain of DBC1 (deleted in breast cancer 1) prevents it from inhibiting PARP1 [poly(adenosine diphosphate-ribose) polymerase], a critical DNA repair protein. As mice age and NAD + concentrations decline, DBC1 is increasingly bound to PARP1, causing DNA damage to accumulate, a process rapidly reversed by restoring the abundance of NAD + Thus, NAD + directly regulates protein-protein interactions, the modulation of which may protect against cancer, radiation, and aging. Copyright © 2017, American Association for the Advancement of Science.

PatchSurfers: Two methods for local molecular property-based binding ligand prediction.

PubMed

Shin, Woong-Hee; Bures, Mark Gregory; Kihara, Daisuke

2016-01-15

Protein function prediction is an active area of research in computational biology. Function prediction can help biologists make hypotheses for characterization of genes and help interpret biological assays, and thus is a productive area for collaboration between experimental and computational biologists. Among various function prediction methods, predicting binding ligand molecules for a target protein is an important class because ligand binding events for a protein are usually closely intertwined with the proteins' biological function, and also because predicted binding ligands can often be directly tested by biochemical assays. Binding ligand prediction methods can be classified into two types: those which are based on protein-protein (or pocket-pocket) comparison, and those that compare a target pocket directly to ligands. Recently, our group proposed two computational binding ligand prediction methods, Patch-Surfer, which is a pocket-pocket comparison method, and PL-PatchSurfer, which compares a pocket to ligand molecules. The two programs apply surface patch-based descriptions to calculate similarity or complementarity between molecules. A surface patch is characterized by physicochemical properties such as shape, hydrophobicity, and electrostatic potentials. These properties on the surface are represented using three-dimensional Zernike descriptors (3DZD), which are based on a series expansion of a 3 dimensional function. Utilizing 3DZD for describing the physicochemical properties has two main advantages: (1) rotational invariance and (2) fast comparison. Here, we introduce Patch-Surfer and PL-PatchSurfer with an emphasis on PL-PatchSurfer, which is more recently developed. Illustrative examples of PL-PatchSurfer performance on binding ligand prediction as well as virtual drug screening are also provided. Copyright © 2015 Elsevier Inc. All rights reserved.

Identification of distant drug off-targets by direct superposition of binding pocket surfaces.

PubMed

Schumann, Marcel; Armen, Roger S

2013-01-01

Correctly predicting off-targets for a given molecular structure, which would have the ability to bind a large range of ligands, is both particularly difficult and important if they share no significant sequence or fold similarity with the respective molecular target ("distant off-targets"). A novel approach for identification of off-targets by direct superposition of protein binding pocket surfaces is presented and applied to a set of well-studied and highly relevant drug targets, including representative kinases and nuclear hormone receptors. The entire Protein Data Bank is searched for similar binding pockets and convincing distant off-target candidates were identified that share no significant sequence or fold similarity with the respective target structure. These putative target off-target pairs are further supported by the existence of compounds that bind strongly to both with high topological similarity, and in some cases, literature examples of individual compounds that bind to both. Also, our results clearly show that it is possible for binding pockets to exhibit a striking surface similarity, while the respective off-target shares neither significant sequence nor significant fold similarity with the respective molecular target ("distant off-target").

Identification of Distant Drug Off-Targets by Direct Superposition of Binding Pocket Surfaces

PubMed Central

Schumann, Marcel; Armen, Roger S.

2013-01-01

Correctly predicting off-targets for a given molecular structure, which would have the ability to bind a large range of ligands, is both particularly difficult and important if they share no significant sequence or fold similarity with the respective molecular target (“distant off-targets”). A novel approach for identification of off-targets by direct superposition of protein binding pocket surfaces is presented and applied to a set of well-studied and highly relevant drug targets, including representative kinases and nuclear hormone receptors. The entire Protein Data Bank is searched for similar binding pockets and convincing distant off-target candidates were identified that share no significant sequence or fold similarity with the respective target structure. These putative target off-target pairs are further supported by the existence of compounds that bind strongly to both with high topological similarity, and in some cases, literature examples of individual compounds that bind to both. Also, our results clearly show that it is possible for binding pockets to exhibit a striking surface similarity, while the respective off-target shares neither significant sequence nor significant fold similarity with the respective molecular target (“distant off-target”). PMID:24391782

Large-scale binding ligand prediction by improved patch-based method Patch-Surfer2.0

PubMed Central

Zhu, Xiaolei; Xiong, Yi; Kihara, Daisuke

2015-01-01

Motivation: Ligand binding is a key aspect of the function of many proteins. Thus, binding ligand prediction provides important insight in understanding the biological function of proteins. Binding ligand prediction is also useful for drug design and examining potential drug side effects. Results: We present a computational method named Patch-Surfer2.0, which predicts binding ligands for a protein pocket. By representing and comparing pockets at the level of small local surface patches that characterize physicochemical properties of the local regions, the method can identify binding pockets of the same ligand even if they do not share globally similar shapes. Properties of local patches are represented by an efficient mathematical representation, 3D Zernike Descriptor. Patch-Surfer2.0 has significant technical improvements over our previous prototype, which includes a new feature that captures approximate patch position with a geodesic distance histogram. Moreover, we constructed a large comprehensive database of ligand binding pockets that will be searched against by a query. The benchmark shows better performance of Patch-Surfer2.0 over existing methods. Availability and implementation: http://kiharalab.org/patchsurfer2.0/ Contact: dkihara@purdue.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25359888

Water-Restructuring Mutations Can Reverse the Thermodynamic Signature of Ligand Binding to Human Carbonic Anhydrase

DOE PAGES

Fox, Jerome M.; Kang, Kyungtae; Sastry, Madhavi; ...

2017-03-02

In this study we use mutants of human carbonic anhydrase (HCAII) to examine how changes in the organization of water within a binding pocket can alter the thermodynamics of protein–ligand association. Results from calorimetric, crystallographic, and theoretical analyses suggest that most mutations strengthen networks of water-mediated hydrogen bonds and reduce binding affinity by increasing the enthalpic cost and, to a lesser extent, the entropic benefit of rearranging those networks during binding. The organization of water within a binding pocket can thus determine whether the hydrophobic interactions in which it engages are enthalpy-driven or entropy-driven. Our findings highlight a possible asymmetrymore » in protein–ligand association by suggesting that, within the confines of the binding pocket of HCAII, binding events associated with enthalpically favorable rearrangements of water are stronger than those associated with entropically favorable ones.« less

Statistical Profiling of One Promiscuous Protein Binding Site: Illustrated by Urokinase Catalytic Domain.

PubMed

Cerisier, Natacha; Regad, Leslie; Triki, Dhoha; Petitjean, Michel; Flatters, Delphine; Camproux, Anne-Claude

2017-10-01

While recent literature focuses on drug promiscuity, the characterization of promiscuous binding sites (ability to bind several ligands) remains to be explored. Here, we present a proteochemometric modeling approach to analyze diverse ligands and corresponding multiple binding sub-pockets associated with one promiscuous binding site to characterize protein-ligand recognition. We analyze both geometrical and physicochemical profile correspondences. This approach was applied to examine the well-studied druggable urokinase catalytic domain inhibitor binding site, which results in a large number of complex structures bound to various ligands. This approach emphasizes the importance of jointly characterizing pocket and ligand spaces to explore the impact of ligand diversity on sub-pocket properties and to establish their main profile correspondences. This work supports an interest in mining available 3D holo structures associated with a promiscuous binding site to explore its main protein-ligand recognition tendency. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Druggable Pocketome of Corynebacterium diphtheriae: A New Approach for in silico Putative Druggable Targets

PubMed Central

Hassan, Syed S.; Jamal, Syed B.; Radusky, Leandro G.; Tiwari, Sandeep; Ullah, Asad; Ali, Javed; Behramand; de Carvalho, Paulo V. S. D.; Shams, Rida; Khan, Sabir; Figueiredo, Henrique C. P.; Barh, Debmalya; Ghosh, Preetam; Silva, Artur; Baumbach, Jan; Röttger, Richard; Turjanski, Adrián G.; Azevedo, Vasco A. C.

2018-01-01

Diphtheria is an acute and highly infectious disease, previously regarded as endemic in nature but vaccine-preventable, is caused by Corynebacterium diphtheriae (Cd). In this work, we used an in silico approach along the 13 complete genome sequences of C. diphtheriae followed by a computational assessment of structural information of the binding sites to characterize the “pocketome druggability.” To this end, we first computed the “modelome” (3D structures of a complete genome) of a randomly selected reference strain Cd NCTC13129; that had 13,763 open reading frames (ORFs) and resulted in 1,253 (∼9%) structure models. The amino acid sequences of these modeled structures were compared with the remaining 12 genomes and consequently, 438 conserved protein sequences were obtained. The RCSB-PDB database was consulted to check the template structures for these conserved proteins and as a result, 401 adequate 3D models were obtained. We subsequently predicted the protein pockets for the obtained set of models and kept only the conserved pockets that had highly druggable (HD) values (137 across all strains). Later, an off-target host homology analyses was performed considering the human proteome using NCBI database. Furthermore, the gene essentiality analysis was carried out that gave a final set of 10-conserved targets possessing highly druggable protein pockets. To check the target identification robustness of the pipeline used in this work, we crosschecked the final target list with another in-house target identification approach for C. diphtheriae thereby obtaining three common targets, these were; hisE-phosphoribosyl-ATP pyrophosphatase, glpX-fructose 1,6-bisphosphatase II, and rpsH-30S ribosomal protein S8. Our predicted results suggest that the in silico approach used could potentially aid in experimental polypharmacological target determination in C. diphtheriae and other pathogens, thereby, might complement the existing and new drug-discovery pipelines. PMID:29487617

Exploring Strategies for Labeling Viruses with Gold Nanoclusters through Non-equilibrium Molecular Dynamics Simulations.

PubMed

Pohjolainen, Emmi; Malola, Sami; Groenhof, Gerrit; Häkkinen, Hannu

2017-09-20

Biocompatible gold nanoclusters can be utilized as contrast agents in virus imaging. The labeling of viruses can be achieved noncovalently but site-specifically by linking the cluster to the hydrophobic pocket of a virus via a lipid-like pocket factor. We have estimated the binding affinities of three different pocket factors of echovirus 1 (EV1) in molecular dynamics simulations combined with non-equilibrium free-energy calculations. We have also studied the effects on binding affinities with a pocket factor linked to the Au 102 pMBA 44 nanocluster in different protonation states. Although the absolute binding affinities are over-estimated for all the systems, the trend is in agreement with recent experiments.3 Our results suggest that the natural pocket factor (palmitic acid) can be replaced by molecules pleconaril (drug) and its derivative Kirtan1 that have higher estimated binding affinities. Our results also suggest that including the gold nanocluster does not decrease the affinity of the pocket factor to the virus, but the affinity is sensitive to the protonation state of the nanocluster, i.e., to pH conditions. The methodology introduced in this work helps in the design of optimal strategies for gold-virus bioconjugation for virus detection and manipulation.

Volatile anesthetic binding to proteins is influenced by solvent and aliphatic residues.

PubMed

Streiff, John H; Jones, Keith A

2008-10-01

The main objective of this work was to characterize VA binding sites in multiple anesthetic target proteins. A computational algorithm was used to quantify the solvent exclusion and aliphatic character of amphiphilic pockets in the structures of VA binding proteins. VA binding sites in the protein structures were defined as the pockets with solvent exclusion and aliphatic character that exceeded minimum values observed in the VA binding sites of serum albumin, firefly luciferase, and apoferritin. We found that the structures of VA binding proteins are enriched in these pockets and that the predicted binding sites were consistent with experimental determined binding locations in several proteins. Autodock3 was used to dock the simulated molecules of 1,1,1,2,2-pentafluoroethane, difluoromethyl 1,1,1,2-tetrafluoroethyl ether, and sevoflurane and the isomers of halothane and isoflurane into these potential binding sites. We found that the binding of the various VA molecules to the amphiphilic pockets is driven primarily by VDW interactions and to a lesser extent by weak hydrogen bonding and electrostatic interactions. In addition, the trend in Delta G binding values follows the Meyer-Overton rule. These results suggest that VA potencies are related to the VDW interactions between the VA ligand and protein target. It is likely that VA bind to sites with a high degree of solvent exclusion and aliphatic character because aliphatic residues provide favorable VDW contacts and weak hydrogen bond donors. Water molecules occupying these sites maintain pocket integrity, associate with the VA ligand, and diminish the unfavorable solvation enthalpy of the VA. Water molecules displaced into the bulk by the VA ligand may provide an additional favorable enthalpic contribution to VA binding. Anesthesia is a component of many health related procedures, the outcomes of which could be improved with a better understanding of the molecular targets and mechanisms of anesthetic action.

Molecular recognition of the Tes LIM2-3 domains by the actin-related protein Arp7A.

PubMed

Boëda, Batiste; Knowles, Phillip P; Briggs, David C; Murray-Rust, Judith; Soriano, Erika; Garvalov, Boyan K; McDonald, Neil Q; Way, Michael

2011-04-01

Actin-related proteins (Arps) are a highly conserved family of proteins that have extensive sequence and structural similarity to actin. All characterized Arps are components of large multimeric complexes associated with chromatin or the cytoskeleton. In addition, the human genome encodes five conserved but largely uncharacterized "orphan" Arps, which appear to be mostly testis-specific. Here we show that Arp7A, which has 43% sequence identity with β-actin, forms a complex with the cytoskeletal proteins Tes and Mena in the subacrosomal layer of round spermatids. The N-terminal 65-residue extension to the actin-like fold of Arp7A interacts directly with Tes. The crystal structure of the 1-65(Arp7A)·LIM2-3(Tes)·EVH1(Mena) complex reveals that residues 28-49 of Arp7A contact the LIM2-3 domains of Tes. Two alanine residues from Arp7A that occupy equivalent apolar pockets in both LIM domains as well as an intervening GPAK linker that binds the LIM2-3 junction are critical for the Arp7A-Tes interaction. Equivalent occupied apolar pockets are also seen in the tandem LIM domain structures of LMO4 and Lhx3 bound to unrelated ligands. Our results indicate that apolar pocket interactions are a common feature of tandem LIM domain interactions, but ligand specificity is principally determined by the linker sequence.

Rupture of DNA aptamer: New insights from simulations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mishra, Rakesh Kumar; Nath, Shesh; Kumar, Sanjay

2015-10-28

Base-pockets (non-complementary base-pairs) in a double-stranded DNA play a crucial role in biological processes. Because of thermal fluctuations, it can lower the stability of DNA, whereas, in case of DNA aptamer, small molecules, e.g., adenosinemonophosphate and adenosinetriphosphate, form additional hydrogen bonds with base-pockets termed as “binding-pockets,” which enhance the stability. Using the Langevin dynamics simulations of coarse grained model of DNA followed by atomistic simulations, we investigated the influence of base-pocket and binding-pocket on the stability of DNA aptamer. Striking differences have been reported here for the separation induced by temperature and force, which require further investigation by single moleculemore » experiments.« less

Toward a New Chemotherapy for Breast Cancer: Structural and Functional Mechanism of the Retinoid Receptors Addressed by a Novel Computer Approach

DTIC Science & Technology

2002-01-01

the surface of the receptor. This pocket is the target for several known and unknown coactivator proteins, which bind the LBD through a conserved LxxLL...was and to Not se FLKAILN) and the LBDs of several receptors (TRo was used as an example in prisingly, the LBD of TR13 was also found to interact with...receptors. 541 ATTCCTTAAAGCCATTTTAAACTGAGGCATTAAGAAGAAATGCACTCACCATGAGCACCA The LBDs of several nuclear receptors were examined for FL. K. A • 1,...N

Searching for protein binding sites from Molecular Dynamics simulations and paramagnetic fragment-based NMR studies.

PubMed

Bernini, Andrea; Henrici De Angelis, Lucia; Morandi, Edoardo; Spiga, Ottavia; Santucci, Annalisa; Assfalg, Michael; Molinari, Henriette; Pillozzi, Serena; Arcangeli, Annarosa; Niccolai, Neri

2014-03-01

Hotspot delineation on protein surfaces represents a fundamental step for targeting protein-protein interfaces. Disruptors of protein-protein interactions can be designed provided that the sterical features of binding pockets, including the transient ones, can be defined. Molecular Dynamics, MD, simulations have been used as a reliable framework for identifying transient pocket openings on the protein surface. Accessible surface area and intramolecular H-bond involvement of protein backbone amides are proposed as descriptors for characterizing binding pocket occurrence and evolution along MD trajectories. TEMPOL induced paramagnetic perturbations on (1)H-(15)N HSQC signals of protein backbone amides have been analyzed as a fragment-based search for surface hotspots, in order to validate MD predicted pockets. This procedure has been applied to CXCL12, a small chemokine responsible for tumor progression and proliferation. From combined analysis of MD data and paramagnetic profiles, two CXCL12 sites suitable for the binding of small molecules were identified. One of these sites is the already well characterized CXCL12 region involved in the binding to CXCR4 receptor. The other one is a transient pocket predicted by Molecular Dynamics simulations, which could not be observed from static analysis of CXCL12 PDB structures. The present results indicate how TEMPOL, instrumental in identifying this transient pocket, can be a powerful tool to delineate minor conformations which can be highly relevant in dynamic discovery of antitumoral drugs. Copyright © 2013 Elsevier B.V. All rights reserved.

Unexpected fold in the circumsporozoite protein target of malaria vaccines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Doud, Michael B.; Koksal, Adem C.; Mi, Li-Zhi

Circumsporozoite (CS) protein is the major surface component of Plasmodium falciparum sporozoites and is essential for host cell invasion. A vaccine containing tandem repeats, region III, and thrombospondin type-I repeat (TSR) of CS is efficacious in phase III trials but gives only a 35% reduction in severe malaria in the first year postimmunization. We solved crystal structures showing that region III and TSR fold into a single unit, an '{alpha}TSR' domain. The {alpha}TSR domain possesses a hydrophobic pocket and core, missing in TSR domains. CS binds heparin, but {alpha}TSR does not. Interestingly, polymorphic T-cell epitopes map to specialized {alpha}TSR regions.more » The N and C termini are unexpectedly close, providing clues for sporozoite sheath organization. Elucidation of a unique structure of a domain within CS enables rational design of next-generation subunit vaccines and functional and medicinal chemical investigation of the conserved hydrophobic pocket.« less

Distinct requirements within the Msh3 nucleotide binding pocket for mismatch and double-strand break repair.

PubMed

Kumar, Charanya; Williams, Gregory M; Havens, Brett; Dinicola, Michelle K; Surtees, Jennifer A

2013-06-12

In Saccharomyces cerevisiae, repair of insertion/deletion loops is carried out by Msh2-Msh3-mediated mismatch repair (MMR). Msh2-Msh3 is also required for 3' non-homologous tail removal (3' NHTR) in double-strand break repair. In both pathways, Msh2-Msh3 binds double-strand/single-strand junctions and initiates repair in an ATP-dependent manner. However, the kinetics of the two processes appear different; MMR is likely rapid in order to coordinate with the replication fork, whereas 3' NHTR has been shown to be a slower process. To understand the molecular requirements in both repair pathways, we performed an in vivo analysis of well-conserved residues in Msh3 that are hypothesized to be required for MMR and/or 3' NHTR. These residues are predicted to be involved in either communication between the DNA-binding and ATPase domains within the complex or nucleotide binding and/or exchange within Msh2-Msh3. We identified a set of aromatic residues within the FLY motif of the predicted Msh3 nucleotide binding pocket that are essential for Msh2-Msh3-mediated MMR but are largely dispensable for 3' NHTR. In contrast, mutations in other regions gave similar phenotypes in both assays. Based on these results, we suggest that the two pathways have distinct requirements with respect to the position of the bound ATP within Msh3. We propose that the differences are related, at least in part, to the kinetics of each pathway. Proper binding and positioning of ATP is required to induce rapid conformational changes at the replication fork, but is less important when more time is available for repair, as in 3' NHTR. Copyright © 2013 Elsevier Ltd. All rights reserved.

Distinct requirements within the Msh3 nucleotide binding pocket for mismatch and double-strand break repair

PubMed Central

Kumar, Charanya; Williams, Gregory M.; Havens, Brett; Dinicola, Michelle; Surtees, Jennifer A.

2013-01-01

In Saccharomyces cerevisiae, repair of insertion/deletion loops is carried out by Msh2-Msh3-mediated mismatch repair (MMR). Msh2-Msh3 is also required for 3’ non-homologous tail removal (3’NHTR) in double-strand break repair. In both pathways, Msh2-Msh3 binds double-strand/single-strand junctions and initiates repair in an ATP-dependent manner. However, the kinetics of the two processes appear different; MMR is likely rapid in order to coordinate with the replication fork, whereas 3’ NHTR has been shown to be a slower process. To understand the molecular requirements in both repair pathways, we performed an in vivo analysis of well conserved residues in Msh3 that are hypothesized to be required for MMR and/or 3’NHTR. These residues are predicted to be involved in either communication between the DNA-binding and ATPase domains within the complex or nucleotide binding and/or exchange within Msh2-Msh3. We identified a set of aromatic residues within the FLY motif of the predicted Msh3 nucleotide binding pocket that are essential for Msh2-Msh3-mediated MMR but are largely dispensable for 3’NHTR. In contrast, mutations in other regions gave similar phenotypes in both assays. Based on these results, we suggest the two pathways have distinct requirements with respect to the position of the bound ATP within Msh3. We propose that the differences are related, at least in part, to the kinetics of each pathway. Proper binding and positioning of ATP is required to induce rapid conformational changes at the replication fork, but is less important when more time is available for repair, as in 3’ NHTR. PMID:23458407

A potent transrepression domain in the retinoblastoma protein induces a cell cycle arrest when bound to E2F sites.

PubMed Central

Sellers, W R; Rodgers, J W; Kaelin, W G

1995-01-01

An intact T/E1A-binding domain (the pocket) is necessary, but not sufficient, for the retinoblastoma protein (RB) to bind to DNA-protein complexes containing E2F and for RB to induce a G1/S block. Indirect evidence suggests that the binding of RB to E2F may, in addition to inhibiting E2F transactivation function, generate a complex capable of functioning as a transrepressor. Here we show that a chimera in which the E2F1 transactivation domain was replaced with the RB pocket could, in a DNA-binding and pocket-dependent manner, mimic the ability of RB to repress transcription and induce a cell cycle arrest. In contrast, a transdominant negative E2F1 mutant that is capable of blocking E2F-dependent transactivation did not. Fusion of the RB pocket to a heterologous DNA-binding domain unrelated to E2F likewise generated a transrepressor protein when scored against a suitable reporter. These results suggest that growth suppression by RB is due, at least in part, to transrepression mediated by the pocket domain bound to certain promoters via E2F. Images Fig. 4 Fig. 5 PMID:8524800

Structure-based nuclear import mechanism of histones H3 and H4 mediated by Kap123

DOE Office of Scientific and Technical Information (OSTI.GOV)

An, Sojin; Yoon, Jungmin; Kim, Hanseong

Kap123, a major karyopherin protein of budding yeast, recognizes the nuclear localization signals (NLSs) of cytoplasmic histones H3 and H4 and translocates them into the nucleus during DNA replication. Mechanistic questions include H3- and H4-NLS redundancy toward Kap123 and the role of the conserved diacetylation of cytoplasmic H4 (K5ac and K12ac) in Kap123-mediated histone nuclear translocation. Here, we report crystal structures of full-length Kluyveromyces lactis Kap123 alone and in complex with H3- and H4-NLSs. Structures reveal the unique feature of Kap123 that possesses two discrete lysine-binding pockets for NLS recognition. Structural comparison illustrates that H3- and H4-NLSs share at leastmore » one of two lysine-binding pockets, suggesting that H3- and H4-NLSs are mutually exclusive. Additionally, acetylation of key lysine residues at NLS, particularly H4-NLS diacetylation, weakens the interaction with Kap123. These data support that cytoplasmic histone H4 diacetylation weakens the Kap123-H4-NLS interaction thereby facilitating histone Kap123-H3-dependent H3:H4/Asf1 complex nuclear translocation.« less

Inhibition of Mycobacterium tuberculosis Methionine Aminopeptidases by Bengamide Derivatives

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, Jing-Ping; Yuan, Xiu-Hua; Yuan, Hai

Methionine aminopeptidase (MetAP) carries out an essential function of protein N-terminal processing in many bacteria and is a promising target for the development of novel antitubercular agents. Natural bengamides potently inhibit the proliferation of mammalian cells by targeting MetAP enzymes, and the X-ray crystal structure of human type 2 MetAP in complex with a bengamide derivative reveals the key interactions at the active site. By preserving the interactions with the conserved residues inside the binding pocket while exploring the differences between bacterial and human MetAPs around the binding pocket, seven bengamide derivatives were synthesized and evaluated for inhibition of MtMetAP1amore » and MtMetAP1c in different metalloforms, inhibition of M. tuberculosis growth in replicating and non-replicating states, and inhibition of human K562 cell growth. Potent inhibition of MtMetAP1a and MtMetAP1c and modest growth inhibition of M. tuberculosis were observed for some of these derivatives. Crystal structures of MtMetAP1c in complex with two of the derivatives provided valuable structural information for improvement of these inhibitors for potency and selectivity.« less

Structure of 5-hydroxymethylcytosine-specific restriction enzyme, AbaSI, in complex with DNA.

PubMed

Horton, John R; Borgaro, Janine G; Griggs, Rose M; Quimby, Aine; Guan, Shengxi; Zhang, Xing; Wilson, Geoffrey G; Zheng, Yu; Zhu, Zhenyu; Cheng, Xiaodong

2014-07-01

AbaSI, a member of the PvuRts1I-family of modification-dependent restriction endonucleases, cleaves deoxyribonucleic acid (DNA) containing 5-hydroxymethylctosine (5hmC) and glucosylated 5hmC (g5hmC), but not DNA containing unmodified cytosine. AbaSI has been used as a tool for mapping the genomic locations of 5hmC, an important epigenetic modification in the DNA of higher organisms. Here we report the crystal structures of AbaSI in the presence and absence of DNA. These structures provide considerable, although incomplete, insight into how this enzyme acts. AbaSI appears to be mainly a homodimer in solution, but interacts with DNA in our structures as a homotetramer. Each AbaSI subunit comprises an N-terminal, Vsr-like, cleavage domain containing a single catalytic site, and a C-terminal, SRA-like, 5hmC-binding domain. Two N-terminal helices mediate most of the homodimer interface. Dimerization brings together the two catalytic sites required for double-strand cleavage, and separates the 5hmC binding-domains by ∼70 Å, consistent with the known activity of AbaSI which cleaves DNA optimally between symmetrically modified cytosines ∼22 bp apart. The eukaryotic SET and RING-associated (SRA) domains bind to DNA containing 5-methylcytosine (5mC) in the hemi-methylated CpG sequence. They make contacts in both the major and minor DNA grooves, and flip the modified cytosine out of the helix into a conserved binding pocket. In contrast, the SRA-like domain of AbaSI, which has no sequence specificity, contacts only the minor DNA groove, and in our current structures the 5hmC remains intra-helical. A conserved, binding pocket is nevertheless present in this domain, suitable for accommodating 5hmC and g5hmC. We consider it likely, therefore, that base-flipping is part of the recognition and cleavage mechanism of AbaSI, but that our structures represent an earlier, pre-flipped stage, prior to actual recognition. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Structure of 5-hydroxymethylcytosine-specific restriction enzyme, AbaSI, in complex with DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Horton, John R.; Borgaro, Janine G.; Griggs, Rose M.

2014-07-03

AbaSI, a member of the PvuRts1I-family of modification-dependent restriction endonucleases, cleaves DNA containing 5-hydroxymethylctosine (5hmC) and glucosylated 5hmC (g5hmC), but not DNA containing unmodified cytosine. AbaSI has been used as a tool for mapping the genomic locations of 5hmC, an important epigenetic modification in the DNA of higher organisms. Here we report the crystal structures of AbaSI in the presence and absence of DNA. These structures provide considerable, although incomplete, insight into how this enzyme acts. AbaSI appears to be mainly a homodimer in solution, but interacts with DNA in our structures as a homotetramer. Each AbaSI subunit comprises anmore » N-terminal, Vsr-like, cleavage domain containing a single catalytic site, and a C-terminal, SRA-like, 5hmC-binding domain. Two N-terminal helices mediate most of the homodimer interface. Dimerization brings together the two catalytic sites required for double-strand cleavage, and separates the 5hmC binding-domains by ~ 70 Å, consistent with the known activity of AbaSI which cleaves DNA optimally between symmetrically modified cytosines ~ 22 bp apart. The eukaryotic SET and RING-associated (SRA) domains bind to DNA containing 5-methylcytosine (5mC) in the hemi-methylated CpG sequence. They make contacts in both the major and minor DNA grooves, and flip the modified cytosine out of the helix into a conserved binding pocket. In contrast, the SRA-like domain of AbaSI, which has no sequence specificity, contacts only the minor DNA groove, and in our current structures the 5hmC remains intra-helical. A conserved, binding pocket is nevertheless present in this domain, suitable for accommodating 5hmC and g5hmC. We consider it likely, therefore, that base-flipping is part of the recognition and cleavage mechanism of AbaSI, but that our structures represent an earlier, pre-flipped stage, prior to actual recognition.« less

PockDrug-Server: a new web server for predicting pocket druggability on holo and apo proteins

PubMed Central

Hussein, Hiba Abi; Borrel, Alexandre; Geneix, Colette; Petitjean, Michel; Regad, Leslie; Camproux, Anne-Claude

2015-01-01

Predicting protein pocket's ability to bind drug-like molecules with high affinity, i.e. druggability, is of major interest in the target identification phase of drug discovery. Therefore, pocket druggability investigations represent a key step of compound clinical progression projects. Currently computational druggability prediction models are attached to one unique pocket estimation method despite pocket estimation uncertainties. In this paper, we propose ‘PockDrug-Server’ to predict pocket druggability, efficient on both (i) estimated pockets guided by the ligand proximity (extracted by proximity to a ligand from a holo protein structure) and (ii) estimated pockets based solely on protein structure information (based on amino atoms that form the surface of potential binding cavities). PockDrug-Server provides consistent druggability results using different pocket estimation methods. It is robust with respect to pocket boundary and estimation uncertainties, thus efficient using apo pockets that are challenging to estimate. It clearly distinguishes druggable from less druggable pockets using different estimation methods and outperformed recent druggability models for apo pockets. It can be carried out from one or a set of apo/holo proteins using different pocket estimation methods proposed by our web server or from any pocket previously estimated by the user. PockDrug-Server is publicly available at: http://pockdrug.rpbs.univ-paris-diderot.fr. PMID:25956651

PockDrug-Server: a new web server for predicting pocket druggability on holo and apo proteins.

PubMed

Hussein, Hiba Abi; Borrel, Alexandre; Geneix, Colette; Petitjean, Michel; Regad, Leslie; Camproux, Anne-Claude

2015-07-01

Predicting protein pocket's ability to bind drug-like molecules with high affinity, i.e. druggability, is of major interest in the target identification phase of drug discovery. Therefore, pocket druggability investigations represent a key step of compound clinical progression projects. Currently computational druggability prediction models are attached to one unique pocket estimation method despite pocket estimation uncertainties. In this paper, we propose 'PockDrug-Server' to predict pocket druggability, efficient on both (i) estimated pockets guided by the ligand proximity (extracted by proximity to a ligand from a holo protein structure) and (ii) estimated pockets based solely on protein structure information (based on amino atoms that form the surface of potential binding cavities). PockDrug-Server provides consistent druggability results using different pocket estimation methods. It is robust with respect to pocket boundary and estimation uncertainties, thus efficient using apo pockets that are challenging to estimate. It clearly distinguishes druggable from less druggable pockets using different estimation methods and outperformed recent druggability models for apo pockets. It can be carried out from one or a set of apo/holo proteins using different pocket estimation methods proposed by our web server or from any pocket previously estimated by the user. PockDrug-Server is publicly available at: http://pockdrug.rpbs.univ-paris-diderot.fr. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

In silico simulations of STAT1 and STAT3 inhibitors predict SH2 domain cross-binding specificity.

PubMed

Szelag, Malgorzata; Sikorski, Krzysztof; Czerwoniec, Anna; Szatkowska, Katarzyna; Wesoly, Joanna; Bluyssen, Hans A R

2013-11-15

Signal transducers and activators of transcription (STATs) comprise a family of transcription factors that are structurally related and which participate in signaling pathways activated by cytokines, growth factors and pathogens. Activation of STAT proteins is mediated by the highly conserved Src homology 2 (SH2) domain, which interacts with phosphotyrosine motifs for specific contacts between STATs and receptors and for STAT dimerization. By generating new models for human (h)STAT1, hSTAT2 and hSTAT3 we applied comparative in silico docking to determine SH2-binding specificity of the STAT3 inhibitor stattic, and of fludarabine (STAT1 inhibitor). Thus, we provide evidence that by primarily targeting the highly conserved phosphotyrosine (pY+0) SH2 binding pocket stattic is not a specific hSTAT3 inhibitor, but is equally effective towards hSTAT1 and hSTAT2. This was confirmed in Human Micro-vascular Endothelial Cells (HMECs) in vitro, in which stattic inhibited interferon-α-induced phosphorylation of all three STATs. Likewise, fludarabine inhibits both hSTAT1 and hSTAT3 phosphorylation, but not hSTAT2, by competing with the highly conserved pY+0 and pY-X binding sites, which are less well-preserved in hSTAT2. Moreover we observed that in HMECs in vitro fludarabine inhibits cytokine and lipopolysaccharide-induced phosphorylation of hSTAT1 and hSTAT3 but does not affect hSTAT2. Finally, multiple sequence alignment of STAT-SH2 domain sequences confirmed high conservation between hSTAT1 and hSTAT3, but not hSTAT2, with respect to stattic and fludarabine binding sites. Together our data offer a molecular basis that explains STAT cross-binding specificity of stattic and fludarabine, thereby questioning the present selection strategies of SH2 domain-based competitive small inhibitors. © 2013 Elsevier B.V. All rights reserved.

Crystal Structure of the FGFR4/LY2874455 Complex Reveals Insights into the Pan-FGFR Selectivity of LY2874455.

PubMed

Wu, Daichao; Guo, Ming; Philips, Michael A; Qu, Lingzhi; Jiang, Longying; Li, Jun; Chen, Xiaojuan; Chen, Zhuchu; Chen, Lin; Chen, Yongheng

2016-01-01

Aberrant FGFR4 signaling has been documented abundantly in various human cancers. The majority of FGFR inhibitors display significantly reduced potency toward FGFR4 compared to FGFR1-3. However, LY2874455 has similar inhibition potency for FGFR1-4 with IC50 less than 6.4 nM. To date, there is no published crystal structure of LY2874455 in complex with any kinase. To better understand the pan-FGFR selectivity of LY2874455, we have determined the crystal structure of the FGFR4 kinase domain bound to LY2874455 at a resolution of 2.35 Å. LY2874455, a type I inhibitor for FGFR4, binds to the ATP-binding pocket of FGFR4 in a DFG-in active conformation with three hydrogen bonds and a number of van der Waals contacts. After alignment of the kinase domain sequence of 4 FGFRs, and superposition of the ATP binding pocket of 4 FGFRs, our structural analyses reveal that the interactions of LY2874455 to FGFR4 are largely conserved in 4 FGFRs, explaining at least partly, the broad inhibitory activity of LY2874455 toward 4 FGFRs. Consequently, our studies reveal new insights into the pan-FGFR selectivity of LY2874455 and provide a structural basis for developing novel FGFR inhibitors that target FGFR1-4 broadly.

Second-generation CK2α inhibitors targeting the αD pocket† †Electronic supplementary information (ESI) available: All experimental details, crystallographic data collection and refinement statistics, details of chemical synthesis, additional figures and tables. See DOI: 10.1039/c7sc05122k

PubMed Central

Iegre, Jessica; Brear, Paul; De Fusco, Claudia; Yoshida, Masao; Mitchell, Sophie L.; Rossmann, Maxim; Carro, Laura; Sore, Hannah F.

2018-01-01

CK2 is a critical cell cycle regulator that also promotes various anti-apoptotic mechanisms. Development of ATP-non-competitive inhibitors of CK2 is a very attractive strategy considering that the ATP binding site is highly conserved among other kinases. We have previously utilised a pocket outside the active site to develop a novel CK2 inhibitor, CAM4066. Whilst CAM4066 bound to this new pocket it was also interacting with the ATP site: herein, we describe an example of a CK2α inhibitor that binds completely outside the active site. This second generation αD-site binding inhibitor, compound CAM4712 (IC50 = 7 μM, GI50 = 10.0 ± 3.6 μM), has numerous advantages over the previously reported CAM4066, including a reduction in the number of rotatable bonds, the absence of amide groups susceptible to the action of proteases and improved cellular permeability. Unlike with CAM4066, there was no need to facilitate cellular uptake by making a prodrug. Moreover, CAM4712 displayed no drop off between its ability to inhibit the kinase in vitro (IC50) and the ability to inhibit cell proliferation (GI50). PMID:29732088

Understanding the physical and chemical nature of the warfarin drug binding site in human serum albumin: experimental and theoretical studies.

PubMed

Abou-Zied, Osama K

2015-01-01

Human serum albumin (HSA) is one of the major carrier proteins in the body and constitutes approximately half of the protein found in blood plasma. It plays an important role in lipid metabolism, and its ability to reversibly bind a large variety of pharmaceutical compounds makes it a crucial determinant of drug pharmacokinetics and pharmacodynamics. This review deals with one of the protein's major binding sites "Sudlow I" which includes a binding pocket for the drug warfarin (WAR). The binding nature of this important site can be characterized by measuring the spectroscopic changes when a ligand is bound. Using several drugs, including WAR, and other drug-like molecules as ligands, the results emphasize the nature of Sudlow I as a flexible binding site, capable of binding a variety of ligands by adapting its binding pockets. The high affinity of the WAR pocket for binding versatile molecular structures stems from the flexibility of the amino acids forming the pocket. The binding site is shown to have an ionization ability which is important to consider when using drugs that are known to bind in Sudlow I. Several studies point to the important role of water molecules trapped inside the binding site in molecular recognition and ligand binding. Water inside the protein's cavity is crucial in maintaining the balance between the hydrophobic and hydrophilic nature of the binding site. Upon the unfolding and refolding of HSA, more water molecules are trapped inside the binding site which cause some swelling that prevents a full recovery from the denatured state. Better understanding of the mechanism of binding in macromolecules such as HSA and other proteins can be achieved by combining experimental and theoretical studies which produce significant synergies in studying complex biochemical phenomena.

Large-scale binding ligand prediction by improved patch-based method Patch-Surfer2.0.

PubMed

Zhu, Xiaolei; Xiong, Yi; Kihara, Daisuke

2015-03-01

Ligand binding is a key aspect of the function of many proteins. Thus, binding ligand prediction provides important insight in understanding the biological function of proteins. Binding ligand prediction is also useful for drug design and examining potential drug side effects. We present a computational method named Patch-Surfer2.0, which predicts binding ligands for a protein pocket. By representing and comparing pockets at the level of small local surface patches that characterize physicochemical properties of the local regions, the method can identify binding pockets of the same ligand even if they do not share globally similar shapes. Properties of local patches are represented by an efficient mathematical representation, 3D Zernike Descriptor. Patch-Surfer2.0 has significant technical improvements over our previous prototype, which includes a new feature that captures approximate patch position with a geodesic distance histogram. Moreover, we constructed a large comprehensive database of ligand binding pockets that will be searched against by a query. The benchmark shows better performance of Patch-Surfer2.0 over existing methods. http://kiharalab.org/patchsurfer2.0/ CONTACT: dkihara@purdue.edu Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Molecular Architecture and Functional Analysis of NetB, a Pore-forming Toxin from Clostridium perfringens*

PubMed Central

Savva, Christos G.; Fernandes da Costa, Sérgio P.; Bokori-Brown, Monika; Naylor, Claire E.; Cole, Ambrose R.; Moss, David S.; Titball, Richard W.; Basak, Ajit K.

2013-01-01

NetB is a pore-forming toxin produced by Clostridium perfringens and has been reported to play a major role in the pathogenesis of avian necrotic enteritis, a disease that has emerged due to the removal of antibiotics in animal feedstuffs. Here we present the crystal structure of the pore form of NetB solved to 3.9 Å. The heptameric assembly shares structural homology to the staphylococcal α-hemolysin. However, the rim domain, a region that is thought to interact with the target cell membrane, shows sequence and structural divergence leading to the alteration of a phosphocholine binding pocket found in the staphylococcal toxins. Consistent with the structure we show that NetB does not bind phosphocholine efficiently but instead interacts directly with cholesterol leading to enhanced oligomerization and pore formation. Finally we have identified conserved and non-conserved amino acid positions within the rim loops that significantly affect binding and toxicity of NetB. These findings present new insights into the mode of action of these pore-forming toxins, enabling the design of more effective control measures against necrotic enteritis and providing potential new tools to the field of bionanotechnology. PMID:23239883

Selective mode of action of guanidine-containing non-peptides at human NPFF receptors.

PubMed

Findeisen, Maria; Würker, Cäcilia; Rathmann, Daniel; Meier, René; Meiler, Jens; Olsson, Roger; Beck-Sickinger, Annette G

2012-07-12

The binding pocket of both NPFF receptors was investigated, focusing on subtype-selective behavior. By use of four nonpeptidic compounds and the peptide mimetics RF9 and BIBP3226, agonistic and antagonistic properties were characterized. A set of Ala receptor mutants was generated. The binding pocket was narrowed down to the upper part of transmembrane helices V, VI, VII and the extracellular loop 2. Positions 5.27 and 6.59 have been shown to have a strong impact on receptor activation and were suggested to form an acidic, negatively charged binding pocket in both NPFF receptor subtypes. Additionally, position 7.35 was identified to play an important role in functional selectivity. According to docking experiments, the aryl group of AC-216 interacts with position 7.35 in the NPFF(1) but not in the NPFF(2) receptor. These results provide distinct insights into the receptor specific binding pockets, which is necessary for the development of drugs to address the NPFF system.

Selective mode of action of guanidine-containing non-peptides at human NPFF receptors

PubMed Central

Findeisen, Maria; Würker, Cäcilia; Rathmann, Daniel; Meier, René; Meiler, Jens; Olsson, Roger; Beck-Sickinger, Annette G.

2012-01-01

The binding pocket of both NPFF receptors was investigated, focusing on subtype-selective behavior. By using four non-peptidic compounds and the peptide mimetics RF9 and BIBP3226 agonistic and antagonistic properties were characterized. A set of Ala receptor mutants was generated, the binding pocket was narrowed down to the upper part of transmembrane helices V, VI, VII, and the extracellular loop 2. Positions 5.27 and 6.59 have been shown to have a strong impact on receptor activation and were suggested to form an acidic, negatively charged binding pocket in both NPFF receptor subtypes. Additionally, position 7.35 was identified to play an important role in functional selectivity. According to docking experiments, the aryl group of AC-216 interacts with position 7.35 in the NPFF1 but not in the NPFF2 receptor. These results provide distinct insights into the receptor specific binding pockets, which is necessary for the development of drugs to address the NPFF system. PMID:22708927

Structural basis for the Nanos-mediated recruitment of the CCR4–NOT complex and translational repression

PubMed Central

Bhandari, Dipankar; Raisch, Tobias; Weichenrieder, Oliver; Jonas, Stefanie; Izaurralde, Elisa

2014-01-01

The RNA-binding proteins of the Nanos family play an essential role in germ cell development and survival in a wide range of metazoan species. They function by suppressing the expression of target mRNAs through the recruitment of effector complexes, which include the CCR4–NOT deadenylase complex. Here, we show that the three human Nanos paralogs (Nanos1–3) interact with the CNOT1 C-terminal domain and determine the structural basis for the specific molecular recognition. Nanos1–3 bind CNOT1 through a short CNOT1-interacting motif (NIM) that is conserved in all vertebrates and some invertebrate species. The crystal structure of the human Nanos1 NIM peptide bound to CNOT1 reveals that the peptide opens a conserved hydrophobic pocket on the CNOT1 surface by inserting conserved aromatic residues. The substitutions of these aromatic residues in the Nanos1–3 NIMs abolish binding to CNOT1 and abrogate the ability of the proteins to repress translation. Our findings provide the structural basis for the recruitment of the CCR4–NOT complex by vertebrate Nanos, indicate that the NIMs are the major determinants of the translational repression mediated by Nanos, and identify the CCR4–NOT complex as the main effector complex for Nanos function. PMID:24736845

Exploration of the conformational landscape in pregnane X receptor reveals a new binding pocket

PubMed Central

Chandran, Aneesh

2016-01-01

Abstract Ligand‐regulated pregnane X receptor (PXR), a member of the nuclear receptor superfamily, plays a central role in xenobiotic metabolism. Despite its critical role in drug metabolism, PXR activation can lead to adverse drug‐drug interactions and early stage metabolism of drugs. Activated PXR can induce cancer drug resistance and enhance the onset of malignancy. Since promiscuity in ligand binding makes it difficult to develop competitive inhibitors targeting PXR ligand binding pocket (LBP), it is essential to identify allosteric sites for effective PXR antagonism. Here, molecular dynamics (MD) simulation studies unravelled the existence of two different conformational states, namely “expanded” and “contracted”, in apo PXR ligand binding domain (LBD). Ligand binding events shifted this conformational equilibrium and locked the LBD in a single “ligand‐adaptable” conformational state. Ensemble‐based computational solvent mapping identified a transiently open potential small molecule binding pocket between α5 and α8 helices, named “α8 pocket”, whose opening‐closing mechanism directly correlated with the conformational shift in LBD. A virtual hit identified through structure‐based virtual screening against α8 pocket locks the pocket in its open conformation. MD simulations further revealed that the presence of small molecule at allosteric site disrupts the LBD dynamics and locks the LBD in a “tightly‐contracted” conformation. The molecular details provided here could guide new structural studies to understand PXR activation and antagonism. PMID:27515410

A combination of 19F NMR and surface plasmon resonance for site-specific hit selection and validation of fragment molecules that bind to the ATP-binding site of a kinase.

PubMed

Nagatoishi, Satoru; Yamaguchi, Sou; Katoh, Etsuko; Kajita, Keita; Yokotagawa, Takane; Kanai, Satoru; Furuya, Toshio; Tsumoto, Kouhei

2018-05-01

19 F NMR has recently emerged as an efficient, sensitive tool for analyzing protein binding to small molecules, and surface plasmon resonance (SPR) is also a popular tool for this purpose. Herein a combination of 19 F NMR and SPR was used to find novel binders to the ATP-binding pocket of MAP kinase extracellular regulated kinase 2 (ERK2) by fragment screening with an original fluorinated-fragment library. The 19 F NMR screening yielded a high primary hit rate of binders to the ERK2 ATP-binding pocket compared with the rate for the SPR screening. Hit compounds were evaluated and categorized according to their ability to bind to different binding sites in the ATP-binding pocket. The binding manner was characterized by using isothermal titration calorimetry and docking simulation. Combining 19 F NMR with other biophysical methods allows the identification of multiple types of hit compounds, thereby increasing opportunities for drug design using preferred fragments. Copyright © 2018 Elsevier Ltd. All rights reserved.

Reversal of the Drug Binding Pocket Defects of the AcrB Multidrug Efflux Pump Protein of Escherichia coli

PubMed Central

Soparkar, Ketaki; Kinana, Alfred D.; Weeks, Jon W.; Morrison, Keith D.; Nikaido, Hiroshi

2015-01-01

ABSTRACT The AcrB protein of Escherichia coli, together with TolC and AcrA, forms a contiguous envelope conduit for the capture and extrusion of diverse antibiotics and cellular metabolites. In this study, we sought to expand our knowledge of AcrB by conducting genetic and functional analyses. We began with an AcrB mutant bearing an F610A substitution in the drug binding pocket and obtained second-site substitutions that overcame the antibiotic hypersusceptibility phenotype conferred by the F610A mutation. Five of the seven unique single amino acid substitutions—Y49S, V127A, V127G, D153E, and G288C—mapped in the periplasmic porter domain of AcrB, with the D153E and G288C mutations mapping near and at the distal drug binding pocket, respectively. The other two substitutions—F453C and L486W—were mapped to transmembrane (TM) helices 5 and 6, respectively. The nitrocefin efflux kinetics data suggested that all periplasmic suppressors significantly restored nitrocefin binding affinity impaired by the F610A mutation. Surprisingly, despite increasing MICs of tested antibiotics and the efflux of N-phenyl-1-naphthylamine, the TM suppressors did not improve the nitrocefin efflux kinetics. These data suggest that the periplasmic substitutions act by influencing drug binding affinities for the distal binding pocket, whereas the TM substitutions may indirectly affect the conformational dynamics of the drug binding domain. IMPORTANCE The AcrB protein and its homologues confer multidrug resistance in many important human bacterial pathogens. A greater understanding of how these efflux pump proteins function will lead to the development of effective inhibitors against them. The research presented in this paper investigates drug binding pocket mutants of AcrB through the isolation and characterization of intragenic suppressor mutations that overcome the drug susceptibility phenotype of mutations affecting the drug binding pocket. The data reveal a remarkable structure-function plasticity of the AcrB protein pertaining to its drug efflux activity. PMID:26240069

Allelic variation in key peptide-binding pockets discriminates between closely related diabetes-protective and diabetes-susceptible HLA-DQB1*06 alleles.

PubMed

Ettinger, Ruth A; Papadopoulos, George K; Moustakas, Antonis K; Nepom, Gerald T; Kwok, William W

2006-02-01

HLA-DQA1*0102-DQB1*0602 is associated with protection against type 1 diabetes (T1D). A similar allele, HLA-DQA1*0102-DQB1*0604, contributes to T1D susceptibility in certain populations but differs only at seven amino acids from HLA-DQA1*0102-DQB1*0602. Five of these polymorphisms are found within the peptide-binding groove, suggesting that differences in peptide binding contribute to the mechanism of their association with T1D. In this study, we determine the peptide-binding motif for HLA-DQA1*0102-DQB1*0604 allelic protein (DQ0604) in comparison to the established HLA-DQA1*0102-DQB1*0602 (DQ0602) motif using binding assays with model peptides from T1D autoantigens and homology modeling using the coordinates of the DQ0602-hypocretin 1-13 crystal structure. The peptide binding preferences were deduced with a peptide from insulin that bound both with a 2- to 3-fold difference in avidity using the same amino acids in the peptide as anchors. Peptide binding differences directly influenced by the polymorphisms in or nearby pockets 1, 6, and 9 were observed. In pocket 1, DQ0604 was better able to accommodate aromatic residues due to the beta86 and beta87 polymorphisms. A negatively charged amino acid was preferred by DQ0604 in pocket 6 due to the positively charged beta30His. In pocket 9, DQ0604 preferred aromatic amino acids due to the beta9 and beta30 polymorphisms and had low tolerance of acidic residues. beta57Val in DQ0604 functions differently than beta57Ala, in that it pushes alpha76Arg outside of the pocket, preventing the formation of a salt bridge with an acidic amino acid in the peptide. This study furthers our understanding of the structure-function relationships of MHC class II polymorphisms.

Cytidine derivatives as IspF inhibitors of Burkolderia pseudomallei

PubMed Central

Zhang, Zheng; Jakkaraju, Sriram; Blain, Joy; Gogol, Kenneth; Zhao, Lei; Hartley, Robert C.; Karlsson, Courtney A.; Staker, Bart L.; Stewart, Lance J.; Myler, Peter J.; Clare, Michael; Begley, Darren W.; Horn, James R.; Hagen, Timothy J

2013-01-01

Published biological data suggest that the methyl erythritol phosphate (MEP) pathway, a non-mevalonate isoprenoid biosynthetic pathway, is essential for certain bacteria and other infectious disease organisms. One highly conserved enzyme in the MEP pathway is 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (IspF). Fragment-bound complexes of IspF from Burkholderia pseudomallei were used to design and synthesize a series of molecules linking the cytidine moiety to different zinc pocket fragment binders. Testing by surface plasmon resonance (SPR) found one molecule in the series to possess binding affinity equal to that of cytidine diphosphate, despite lacking any metal-coordinating phosphate groups. Close inspection of the SPR data suggest different binding stoichiometries between IspF and test compounds. Crystallographic analysis shows important variations between the binding mode of one synthesized compound and the pose of the bound fragment from which it was designed. The binding modes of these molecules add to our structural knowledge base for IspF and suggest future refinements in this compound series. PMID:24157367

Tyrosine Phosphorylation of the Lyn Src Homology 2 (SH2) Domain Modulates Its Binding Affinity and Specificity*

PubMed Central

Jin, Lily L.; Wybenga-Groot, Leanne E.; Tong, Jiefei; Taylor, Paul; Minden, Mark D.; Trudel, Suzanne; McGlade, C. Jane; Moran, Michael F.

2015-01-01

Src homology 2 (SH2) domains are modular protein structures that bind phosphotyrosine (pY)-containing polypeptides and regulate cellular functions through protein-protein interactions. Proteomics analysis showed that the SH2 domains of Src family kinases are themselves tyrosine phosphorylated in blood system cancers, including acute myeloid leukemia, chronic lymphocytic leukemia, and multiple myeloma. Using the Src family kinase Lyn SH2 domain as a model, we found that phosphorylation at the conserved SH2 domain residue Y194 impacts the affinity and specificity of SH2 domain binding to pY-containing peptides and proteins. Analysis of the Lyn SH2 domain crystal structure supports a model wherein phosphorylation of Y194 on the EF loop modulates the binding pocket that engages amino acid side chains at the pY+2/+3 position. These data indicate another level of regulation wherein SH2-mediated protein-protein interactions are modulated by SH2 kinases and phosphatases. PMID:25587033

Probing the nucleotide binding domain of the osmoregulator EnvZ using fluorescent nucleotide derivatives.

PubMed

Plesniak, Leigh; Horiuchi, Yuki; Sem, Daniel; Meinenger, David; Stiles, Linda; Shaffer, Jennifer; Jennings, Patricia A; Adams, Joseph A

2002-11-26

EnvZ is a histidine protein kinase important for osmoregulation in bacteria. While structural data are available for this enzyme, the nucleotide binding pocket is not well characterized. The ATP binding domain (EnvZB) was expressed, and its ability to bind nucleotide derivatives was assessed using equilbrium and stopped-flow fluorescence spectroscopy. The fluorescence emission of the trinitrophenyl derivatives, TNP-ATP and TNP-ADP, increase upon binding to EnvZB. The fluorescence enhancements were quantitatively abolished in the presence of excess ADP, indicating that the fluorescent probes occupy the nucleotide binding pocket. Both TNP-ATP and TNP-ADP bind to EnvZB with high affinity (K(d) = 2-3 microM). The TNP moiety attached to the ribose ring does not impede access of the fluorescent nucleotide into the binding pocket. The association rate constant for TNP-ADP is 7 microM(-1) s(-1), a value consistent with those for natural nucleotides and the eucaryotic protein kinases. Using competition experiments, it was found that ATP and ADP bind 30- and 150-fold more poorly, respectively, than the corresponding TNP-derivatized forms. Surprisingly, the physiological metal Mg(2+) is not required for ADP binding and only enhances ATP affinity by 3-fold. Although portions of the nucleotide pocket are disordered, the recombinant enzyme is highly stable, unfolding only at temperatures in excess of 70 degrees C. The unusually high affinity of the TNP derivatives compared to the natural nucleotides suggests that hydrophobic substitutions on the ribose ring enforce an altered binding mode that may be exploited for drug design strategies.

What induces pocket openings on protein surface patches involved in protein-protein interactions?

PubMed

Eyrisch, Susanne; Helms, Volkhard

2009-02-01

We previously showed for the proteins BCL-X(L), IL-2, and MDM2 that transient pockets at their protein-protein binding interfaces can be identified by applying the PASS algorithm to molecular dynamics (MD) snapshots. We now investigated which aspects of the natural conformational dynamics of proteins induce the formation of such pockets. The pocket detection protocol was applied to three different conformational ensembles for the same proteins that were extracted from MD simulations of the inhibitor bound crystal conformation in water and the free crystal/NMR structure in water and in methanol. Additional MD simulations studied the impact of backbone mobility. The more efficient CONCOORD or normal mode analysis (NMA) techniques gave significantly smaller pockets than MD simulations, whereas tCONCOORD generated pockets comparable to those observed in MD simulations for two of the three systems. Our findings emphasize the influence of solvent polarity and backbone rearrangements on the formation of pockets on protein surfaces and should be helpful in future generation of transient pockets as putative ligand binding sites at protein-protein interfaces.

What induces pocket openings on protein surface patches involved in protein-protein interactions?

NASA Astrophysics Data System (ADS)

Eyrisch, Susanne; Helms, Volkhard

2009-02-01

We previously showed for the proteins BCL-XL, IL-2, and MDM2 that transient pockets at their protein-protein binding interfaces can be identified by applying the PASS algorithm to molecular dynamics (MD) snapshots. We now investigated which aspects of the natural conformational dynamics of proteins induce the formation of such pockets. The pocket detection protocol was applied to three different conformational ensembles for the same proteins that were extracted from MD simulations of the inhibitor bound crystal conformation in water and the free crystal/NMR structure in water and in methanol. Additional MD simulations studied the impact of backbone mobility. The more efficient CONCOORD or normal mode analysis (NMA) techniques gave significantly smaller pockets than MD simulations, whereas tCONCOORD generated pockets comparable to those observed in MD simulations for two of the three systems. Our findings emphasize the influence of solvent polarity and backbone rearrangements on the formation of pockets on protein surfaces and should be helpful in future generation of transient pockets as putative ligand binding sites at protein-protein interfaces.

Characterization of a Bacillus subtilis transporter for petrobactin, an anthrax stealth siderophore

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zawadzka, A. M.; Kim, Y.; Maltseva, N

2009-12-22

Iron deprivation activates the expression of components of the siderophore-mediated iron acquisition systems in Bacillus subtilis, including not only the synthesis and uptake of its siderophore bacillibactin but also expression of multiple ABC transporters for iron scavenging using xenosiderophores. The yclNOPQ operon is shown to encode the complete transporter for petrobactin (PB), a photoreactive 3,4-catecholate siderophore produced by many members of the B. cereus group, including B. anthracis. Isogenic disruption mutants in the yclNOPQ transporter, including permease YclN, ATPase YclP, and a substrate-binding protein YclQ, are unable to use either PB or the photoproduct of FePB (FePB{sup {nu}}) for ironmore » delivery and growth, in contrast to the wild-type B. subtilis. Complementation of the mutations with the copies of the respective genes restores this capability. The YclQ receptor binds selectively iron-free and ferric PB, the PB precursor, 3,4-dihydroxybenzoic acid (3,4-DHB), and FePB{sup {nu}} with high affinity; the ferric complexes are seen in ESI-MS, implying strong electrostatic interaction between the protein-binding pocket and siderophore. The first structure of a Gram-positive siderophore receptor is presented. The 1.75-{angstrom} crystal structure of YclQ reveals a bilobal periplasmic binding protein (PBP) fold consisting of two {alpha}/{beta}/{alpha} sandwich domains connected by a long {alpha}-helix with the binding pocket containing conserved positively charged and aromatic residues and large enough to accommodate FePB. Orthologs of the B. subtilis PB-transporter YclNOPQ in PB-producing Bacilli are likely contributors to the pathogenicity of these species and provide a potential target for antibacterial strategies.« less

Analysis of NFU-1 metallocofactor binding-site substitutions-impacts on iron-sulfur cluster coordination and protein structure and function.

PubMed

Wesley, Nathaniel A; Wachnowsky, Christine; Fidai, Insiya; Cowan, J A

2017-11-01

Iron-sulfur (Fe/S) clusters are ancient prosthetic groups found in numerous metalloproteins and are conserved across all kingdoms of life due to their diverse, yet essential functional roles. Genetic mutations to a specific subset of mitochondrial Fe/S cluster delivery proteins are broadly categorized as disease-related under multiple mitochondrial dysfunction syndrome (MMDS), with symptoms indicative of a general failure of the metabolic system. Multiple mitochondrial dysfunction syndrome 1 (MMDS1) arises as a result of the missense mutation in NFU1, an Fe/S cluster scaffold protein, which substitutes a glycine near the Fe/S cluster-binding pocket to a cysteine (p.Gly208Cys). This substitution has been shown to promote protein dimerization such that cluster delivery to NFU1 is blocked, preventing downstream cluster trafficking. However, the possibility of this additional cysteine, located adjacent to the cluster-binding site, serving as an Fe/S cluster ligand has not yet been explored. To fully understand the consequences of this Gly208Cys replacement, complementary substitutions at the Fe/S cluster-binding pocket for native and Gly208Cys NFU1 were made, along with six other variants. Herein, we report the results of an investigation on the effect of these substitutions on both cluster coordination and NFU1 structure and function. The data suggest that the G208C substitution does not contribute to cluster binding. Rather, replacement of the glycine at position 208 changes the oligomerization state as a result of global structural alterations that result in the downstream effects manifest as MMDS1, but does not perturb the coordination chemistry of the Fe-S cluster. © 2017 Federation of European Biochemical Societies.

Molecular adaptability of nucleoside diphosphate kinase b from trypanosomatid parasites: stability, oligomerization and structural determinants of nucleotide binding.

PubMed

Souza, Tatiana A C B; Trindade, Daniel M; Tonoli, Celisa C C; Santos, Camila R; Ward, Richard J; Arni, Raghuvir K; Oliveira, Arthur H C; Murakami, Mário T

2011-07-01

Nucleoside diphosphate kinases play a crucial role in the purine-salvage pathway of trypanosomatid protozoa and have been found in the secretome of Leishmania sp., suggesting a function related to host-cell integrity for the benefit of the parasite. Due to their importance for housekeeping functions in the parasite and by prolonging the life of host cells in infection, they become an attractive target for drug discovery and design. In this work, we describe the first structural characterization of nucleoside diphosphate kinases b from trypanosomatid parasites (tNDKbs) providing insights into their oligomerization, stability and structural determinants for nucleotide binding. Crystallographic studies of LmNDKb when complexed with phosphate, AMP and ADP showed that the crucial hydrogen-bonding residues involved in the nucleotide interaction are fully conserved in tNDKbs. Depending on the nature of the ligand, the nucleotide-binding pocket undergoes conformational changes, which leads to different cavity volumes. SAXS experiments showed that tNDKbs, like other eukaryotic NDKs, form a hexamer in solution and their oligomeric state does not rely on the presence of nucleotides or mimetics. Fluorescence-based thermal-shift assays demonstrated slightly higher stability of tNDKbs compared to human NDKb (HsNDKb), which is in agreement with the fact that tNDKbs are secreted and subjected to variations of temperature in the host cells during infection and disease development. Moreover, tNDKbs were stabilized upon nucleotide binding, whereas HsNDKb was not influenced. Contrasts on the surface electrostatic potential around the nucleotide-binding pocket might be a determinant for nucleotide affinity and protein stability differentiation. All these together demonstrated the molecular adaptation of parasite NDKbs in order to exert their biological functions intra-parasite and when secreted by regulating ATP levels of host cells.

Characterization of a novel domain ‘GATE’ in the ABC protein DrrA and its role in drug efflux by the DrrAB complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Han; Rahman, Sadia; Li, Wen

2015-03-27

A novel domain, GATE (Glycine-loop And Transducer Element), is identified in the ABC protein DrrA. This domain shows sequence and structural conservation among close homologs of DrrA as well as distantly-related ABC proteins. Among the highly conserved residues in this domain are three glycines, G215, G221 and G231, of which G215 was found to be critical for stable expression of the DrrAB complex. Other conserved residues, including E201, G221, K227 and G231, were found to be critical for the catalytic and transport functions of the DrrAB transporter. Structural analysis of both the previously published crystal structure of the DrrA homologmore » MalK and the modeled structure of DrrA showed that G215 makes close contacts with residues in and around the Walker A motif, suggesting that these interactions may be critical for maintaining the integrity of the ATP binding pocket as well as the complex. It is also shown that G215A or K227R mutation diminishes some of the atomic interactions essential for ATP catalysis and overall transport function. Therefore, based on both the biochemical and structural analyses, it is proposed that the GATE domain, located outside of the previously identified ATP binding and hydrolysis motifs, is an additional element involved in ATP catalysis. - Highlights: • A novel domain ‘GATE’ is identified in the ABC protein DrrA. • GATE shows high sequence and structural conservation among diverse ABC proteins. • GATE is located outside of the previously studied ATP binding and hydrolysis motifs. • Conserved GATE residues are critical for stability of DrrAB and for ATP catalysis.« less

Role of Desolvation in Thermodynamics and Kinetics of Ligand Binding to a Kinase

PubMed Central

2015-01-01

Computer simulations are used to determine the free energy landscape for the binding of the anticancer drug Dasatinib to its src kinase receptor and show that before settling into a free energy basin the ligand must surmount a free energy barrier. An analysis based on using both the ligand-pocket separation and the pocket-water occupancy as reaction coordinates shows that the free energy barrier is a result of the free energy cost for almost complete desolvation of the binding pocket. The simulations further show that the barrier is not a result of the reorganization free energy of the binding pocket. Although a continuum solvent model gives the location of free energy minima, it is not able to reproduce the intermediate free energy barrier. Finally, it is shown that a kinetic model for the on rate constant in which the ligand diffuses up to a doorway state and then surmounts the desolvation free energy barrier is consistent with published microsecond time-scale simulations of the ligand binding kinetics for this system [Shaw, D. E. et al. J. Am. Chem. Soc.2011, 133, 9181−918321545110]. PMID:25516727

Common Anesthetic-binding Site for Inhibition of Pentameric Ligand-gated Ion Channels.

PubMed

Kinde, Monica N; Bu, Weiming; Chen, Qiang; Xu, Yan; Eckenhoff, Roderic G; Tang, Pei

2016-03-01

Identifying functionally relevant anesthetic-binding sites in pentameric ligand-gated ion channels (pLGICs) is an important step toward understanding the molecular mechanisms underlying anesthetic action. The anesthetic propofol is known to inhibit cation-conducting pLGICs, including a prokaryotic pLGIC from Erwinia chrysanthemi (ELIC), but the sites responsible for functional inhibition remain undetermined. We photolabeled ELIC with a light-activated derivative of propofol (AziPm) and performed fluorine-19 nuclear magnetic resonance experiments to support propofol binding to a transmembrane domain (TMD) intrasubunit pocket. To differentiate sites responsible for propofol inhibition from those that are functionally irrelevant, we made an ELIC-γ-aminobutyric acid receptor (GABAAR) chimera that replaced the ELIC-TMD with the α1β3GABAAR-TMD and compared functional responses of ELIC-GABAAR and ELIC with propofol modulations. Photolabeling showed multiple AziPm-binding sites in the extracellular domain (ECD) but only one site in the TMD with labeled residues M265 and F308 in the resting state of ELIC. Notably, this TMD site is an intrasubunit pocket that overlaps with binding sites for anesthetics, including propofol, found previously in other pLGICs. Fluorine-19 nuclear magnetic resonance experiments supported propofol binding to this TMD intrasubunit pocket only in the absence of agonist. Functional measurements of ELIC-GABAAR showed propofol potentiation of the agonist-elicited current instead of inhibition observed on ELIC. The distinctly different responses of ELIC and ELIC-GABAAR to propofol support the functional relevance of propofol binding to the TMD. Combining the newly identified TMD intrasubunit pocket in ELIC with equivalent TMD anesthetic sites found previously in other cationic pLGICs, we propose this TMD pocket as a common site for anesthetic inhibition of pLGICs.

PARS: a web server for the prediction of Protein Allosteric and Regulatory Sites.

PubMed

Panjkovich, Alejandro; Daura, Xavier

2014-05-01

The regulation of protein activity is a key aspect of life at the molecular level. Unveiling its details is thus crucial to understanding signalling and metabolic pathways. The most common and powerful mechanism of protein-function regulation is allostery, which has been increasingly calling the attention of medicinal chemists due to its potential for the discovery of novel therapeutics. In this context, PARS is a simple and fast method that queries protein dynamics and structural conservation to identify pockets on a protein structure that may exert a regulatory effect on the binding of a small-molecule ligand.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ren, Chunyan; Morohashi, Keita; Plotnikov, Alexander N.

Chromobox homolog 7 (CBX7) plays an important role in gene transcription in a wide array of cellular processes, ranging from stem cell self-renewal and differentiation to tumor progression. CBX7 functions through its N-terminal chromodomain (ChD), which recognizes tri-methylated lysine 27 of histone 3 (H3K27me3), a conserved epigenetic mark that signifies gene transcriptional repression. Here in this study, we report discovery of small molecules that inhibit CBX7ChD binding to H3K27me3. Our crystal structures reveal the binding modes of these molecules that compete against H3K27me3 binding through interactions with key residues in the methyl-lysine binding pocket of CBX7ChD. We further show thatmore » a lead compound MS37452, derepresses transcription of Polycomb repressive complex target gene p16/CDKN2A by displacing CBX7 binding to the INK4A/ARF locus in prostate cancer cells. Ultimately, these small molecules have the potential to be developed into high-potency chemical modulators that target CBX7 functions in gene transcription in different disease pathways.« less

Structures of BmrR-Drug Complexes Reveal a Rigid Multidrug Binding Pocket And Transcription Activation Through Tyrosine Expulsion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Newberry, K.J.; Huffman, J.L.; Miller, M.C.

2009-05-22

BmrR is a member of the MerR family and a multidrug binding transcription factor that up-regulates the expression of the bmr multidrug efflux transporter gene in response to myriad lipophilic cationic compounds. The structural mechanism by which BmrR binds these chemically and structurally different drugs and subsequently activates transcription is poorly understood. Here, we describe the crystal structures of BmrR bound to rhodamine 6G (R6G) or berberine (Ber) and cognate DNA. These structures reveal each drug stacks against multiple aromatic residues with their positive charges most proximal to the carboxylate group of Glu-253 and that, unlike other multidrug binding pockets,more » that of BmrR is rigid. Substitution of Glu-253 with either alanine (E253A) or glutamine (E253Q) results in unpredictable binding affinities for R6G, Ber, and tetraphenylphosphonium. Moreover, these drug binding studies reveal that the negative charge of Glu-253 is not important for high affinity binding to Ber and tetraphenylphosphonium but plays a more significant, but unpredictable, role in R6G binding. In vitro transcription data show that E253A and E253Q are constitutively active, and structures of the drug-free E253A-DNA and E253Q-DNA complexes support a transcription activation mechanism requiring the expulsion of Tyr-152 from the multidrug binding pocket. In sum, these data delineate the mechanism by which BmrR binds lipophilic, monovalent cationic compounds and suggest the importance of the redundant negative electrostatic nature of this rigid drug binding pocket that can be used to discriminate against molecules that are not substrates of the Bmr multidrug efflux pump.« less

Structural Analysis of the Complex between Penta-EF-Hand ALG-2 Protein and Sec31A Peptide Reveals a Novel Target Recognition Mechanism of ALG-2

PubMed Central

Takahashi, Takeshi; Kojima, Kyosuke; Zhang, Wei; Sasaki, Kanae; Ito, Masaru; Suzuki, Hironori; Kawasaki, Masato; Wakatsuki, Soichi; Takahara, Terunao; Shibata, Hideki; Maki, Masatoshi

2015-01-01

ALG-2, a 22-kDa penta-EF-hand protein, is involved in cell death, signal transduction, membrane trafficking, etc., by interacting with various proteins in mammalian cells in a Ca2+-dependent manner. Most known ALG-2-interacting proteins contain proline-rich regions in which either PPYPXnYP (type 1 motif) or PXPGF (type 2 motif) is commonly found. Previous X-ray crystal structural analysis of the complex between ALG-2 and an ALIX peptide revealed that the peptide binds to the two hydrophobic pockets. In the present study, we resolved the crystal structure of the complex between ALG-2 and a peptide of Sec31A (outer shell component of coat complex II, COPII; containing the type 2 motif) and found that the peptide binds to the third hydrophobic pocket (Pocket 3). While amino acid substitution of Phe85, a Pocket 3 residue, with Ala abrogated the interaction with Sec31A, it did not affect the interaction with ALIX. On the other hand, amino acid substitution of Tyr180, a Pocket 1 residue, with Ala caused loss of binding to ALIX, but maintained binding to Sec31A. We conclude that ALG-2 recognizes two types of motifs at different hydrophobic surfaces. Furthermore, based on the results of serial mutational analysis of the ALG-2-binding sites in Sec31A, the type 2 motif was newly defined. PMID:25667979

Assessing the binding of cholinesterase inhibitors by docking and molecular dynamics studies.

PubMed

Ali, M Rejwan; Sadoqi, Mostafa; Møller, Simon G; Boutajangout, Allal; Mezei, Mihaly

2017-09-01

In this report we assessed by docking and molecular dynamics the binding mechanisms of three FDA-approved Alzheimer drugs, inhibitors of the enzyme acetylcholinesterase (AChE): donepezil, galantamine and rivastigmine. Dockings by the softwares Autodock-Vina, PatchDock and Plant reproduced the docked conformations of the inhibitor-enzyme complexes within 2Å of RMSD of the X-ray structure. Free-energy scores show strong affinity of the inhibitors for the enzyme binding pocket. Three independent Molecular Dynamics simulation runs indicated general stability of donepezil, galantamine and rivastigmine in their respective enzyme binding pocket (also referred to as gorge) as well as the tendency to form hydrogen bonds with the water molecules. The binding of rivastigmine in the Torpedo California AChE binding pocket is interesting as it eventually undergoes carbamylation and breaks apart according to the X-ray structure of the complex. Similarity search in the ZINC database and targeted docking on the gorge region of the AChE enzyme gave new putative inhibitor molecules with high predicted binding affinity, suitable for potential biophysical and biological assessments. Copyright © 2017 Elsevier Inc. All rights reserved.

Structure and dynamics of a constitutively active neurotensin receptor

DOE PAGES

Krumm, Brian E.; Lee, Sangbae; Bhattacharya, Supriyo; ...

2016-12-07

Many G protein-coupled receptors show constitutive activity, resulting in the production of a second messenger in the absence of an agonist; and naturally occurring constitutively active mutations in receptors have been implicated in diseases. To gain insight into mechanistic aspects of constitutive activity, we report here the 3.3 Å crystal structure of a constitutively active, agonist-bound neurotensin receptor (NTSR1) and molecular dynamics simulations of agonist-occupied and ligand-free receptor. Comparison with the structure of a NTSR1 variant that has little constitutive activity reveals uncoupling of the ligand-binding domain from conserved connector residues, that effect conformational changes during GPCR activation. Furthermore, molecularmore » dynamics simulations show strong contacts between connector residue side chains and increased flexibility at the intracellular receptor face as features that coincide with robust signalling in cells. In conclusion, the loss of correlation between the binding pocket and conserved connector residues, combined with altered receptor dynamics, possibly explains the reduced neurotensin efficacy in the constitutively active NTSR1 and a facilitated initial engagement with G protein in the absence of agonist.« less

Insights into substrate binding and catalysis in bacterial type I dehydroquinase.

PubMed

Maneiro, María; Peón, Antonio; Lence, Emilio; Otero, José M; Van Raaij, Mark J; Thompson, Paul; Hawkins, Alastair R; González-Bello, Concepción

2014-09-15

Structural, biochemical and computational studies to study substrate binding and the role of the conserved residues of the DHQ1 (type I dehydroquinase) enzyme active site are reported in the present paper. The crystal structure of DHQ1 from Salmonella typhi in complex with (2R)-2-methyl-3-dehydroquinic acid, a substrate analogue, was solved at 1.5 Å. The present study reveals a previously unknown key role for conserved Glu46, Phe145 and Met205 and Gln236, Pro234 and Ala233 residues, with the latter three being located in the flexible substrate-covering loop. Gln236 was shown to be responsible for the folding of this loop and for the dramatic reduction of its flexibility, which triggers active site closure. Glu46 was found to be key in bringing the substrate close to the lysine/histidine catalytic pocket to initiate catalysis. The present study could be useful in the rational design of inhibitors of this challenging and recognized target for the development of novel herbicides and antimicrobial agents.

Structure and dynamics of a constitutively active neurotensin receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krumm, Brian E.; Lee, Sangbae; Bhattacharya, Supriyo

Many G protein-coupled receptors show constitutive activity, resulting in the production of a second messenger in the absence of an agonist; and naturally occurring constitutively active mutations in receptors have been implicated in diseases. To gain insight into mechanistic aspects of constitutive activity, we report here the 3.3 Å crystal structure of a constitutively active, agonist-bound neurotensin receptor (NTSR1) and molecular dynamics simulations of agonist-occupied and ligand-free receptor. Comparison with the structure of a NTSR1 variant that has little constitutive activity reveals uncoupling of the ligand-binding domain from conserved connector residues, that effect conformational changes during GPCR activation. Furthermore, molecularmore » dynamics simulations show strong contacts between connector residue side chains and increased flexibility at the intracellular receptor face as features that coincide with robust signalling in cells. In conclusion, the loss of correlation between the binding pocket and conserved connector residues, combined with altered receptor dynamics, possibly explains the reduced neurotensin efficacy in the constitutively active NTSR1 and a facilitated initial engagement with G protein in the absence of agonist.« less

Structure and dynamics of a constitutively active neurotensin receptor

PubMed Central

Krumm, Brian E.; Lee, Sangbae; Bhattacharya, Supriyo; Botos, Istvan; White, Courtney F.; Du, Haijuan; Vaidehi, Nagarajan; Grisshammer, Reinhard

2016-01-01

Many G protein-coupled receptors show constitutive activity, resulting in the production of a second messenger in the absence of an agonist; and naturally occurring constitutively active mutations in receptors have been implicated in diseases. To gain insight into mechanistic aspects of constitutive activity, we report here the 3.3 Å crystal structure of a constitutively active, agonist-bound neurotensin receptor (NTSR1) and molecular dynamics simulations of agonist-occupied and ligand-free receptor. Comparison with the structure of a NTSR1 variant that has little constitutive activity reveals uncoupling of the ligand-binding domain from conserved connector residues, that effect conformational changes during GPCR activation. Furthermore, molecular dynamics simulations show strong contacts between connector residue side chains and increased flexibility at the intracellular receptor face as features that coincide with robust signalling in cells. The loss of correlation between the binding pocket and conserved connector residues, combined with altered receptor dynamics, possibly explains the reduced neurotensin efficacy in the constitutively active NTSR1 and a facilitated initial engagement with G protein in the absence of agonist. PMID:27924846

Adaptive evolution and elucidating the potential inhibitor against schizophrenia to target DAOA (G72) isoforms.

PubMed

Sehgal, Sheikh Arslan; Mannan, Shazia; Kanwal, Sumaira; Naveed, Ishrat; Mir, Asif

2015-01-01

Schizophrenia (SZ), a chronic mental and heritable disorder characterized by neurophysiological impairment and neuropsychological abnormalities, is strongly associated with D-amino acid oxidase activator (DAOA, G72). Research studies emphasized that overexpression of DAOA may be responsible for improper functioning of neurotransmitters, resulting in neurological disorders like SZ. In the present study, a hybrid approach of comparative modeling and molecular docking followed by inhibitor identification and structure modeling was employed. Screening was performed by two-dimensional similarity search against selected inhibitor, keeping in view the physiochemical properties of the inhibitor. Here, we report an inhibitor compound which showed maximum binding affinity against four selected isoforms of DAOA. Docking studies revealed that Glu-53, Thr-54, Lys-58, Val-85, Ser-86, Tyr-87, Leu-88, Glu-90, Leu-95, Val-98, Ser-100, Glu-112, Tyr-116, Lys-120, Asp-121, and Arg-122 are critical residues for receptor-ligand interaction. The C-terminal of selected isoforms is conserved, and binding was observed on the conserved region of isoforms. We propose that selected inhibitor might be more potent on the basis of binding energy values. Further analysis of this inhibitor through site-directed mutagenesis could be helpful for exploring the details of ligand-binding pockets. Overall, the findings of this study may be helpful in designing novel therapeutic targets to cure SZ.

Adaptive evolution and elucidating the potential inhibitor against schizophrenia to target DAOA (G72) isoforms

PubMed Central

Sehgal, Sheikh Arslan; Mannan, Shazia; Kanwal, Sumaira; Naveed, Ishrat; Mir, Asif

2015-01-01

Schizophrenia (SZ), a chronic mental and heritable disorder characterized by neurophysiological impairment and neuropsychological abnormalities, is strongly associated with D-amino acid oxidase activator (DAOA, G72). Research studies emphasized that overexpression of DAOA may be responsible for improper functioning of neurotransmitters, resulting in neurological disorders like SZ. In the present study, a hybrid approach of comparative modeling and molecular docking followed by inhibitor identification and structure modeling was employed. Screening was performed by two-dimensional similarity search against selected inhibitor, keeping in view the physiochemical properties of the inhibitor. Here, we report an inhibitor compound which showed maximum binding affinity against four selected isoforms of DAOA. Docking studies revealed that Glu-53, Thr-54, Lys-58, Val-85, Ser-86, Tyr-87, Leu-88, Glu-90, Leu-95, Val-98, Ser-100, Glu-112, Tyr-116, Lys-120, Asp-121, and Arg-122 are critical residues for receptor–ligand interaction. The C-terminal of selected isoforms is conserved, and binding was observed on the conserved region of isoforms. We propose that selected inhibitor might be more potent on the basis of binding energy values. Further analysis of this inhibitor through site-directed mutagenesis could be helpful for exploring the details of ligand-binding pockets. Overall, the findings of this study may be helpful in designing novel therapeutic targets to cure SZ. PMID:26170631

A unique GCN5-related glucosamine N-acetyltransferase region exist in the fungal multi-domain glycoside hydrolase family 3 β-N-acetylglucosaminidase

PubMed Central

Qin, Zhen; Xiao, Yibei; Yang, Xinbin; Mesters, Jeroen R.; Yang, Shaoqing; Jiang, Zhengqiang

2015-01-01

Glycoside hydrolase (GH) family 3 β-N-acetylglucosaminidases widely exist in the filamentous fungi, which may play a key role in chitin metabolism of fungi. A multi-domain GH family 3 β-N-acetylglucosaminidase from Rhizomucor miehei (RmNag), exhibiting a potential N-acetyltransferase region, has been recently reported to show great potential in industrial applications. In this study, the crystal structure of RmNag was determined at 2.80 Å resolution. The three-dimensional structure of RmNag showed four distinctive domains, which belong to two distinguishable functional regions — a GH family 3 β-N-acetylglucosaminidase region (N-terminal) and a N-acetyltransferase region (C-terminal). From structural and functional analysis, the C-terminal region of RmNag was identified as a unique tandem array linking general control non-derepressible 5 (GCN5)-related N-acetyltransferase (GNAT), which displayed glucosamine N-acetyltransferase activity. Structural analysis of this glucosamine N-acetyltransferase region revealed that a unique glucosamine binding pocket is located in the pantetheine arm binding terminal region of the conserved CoA binding pocket, which is different from all known GNAT members. This is the first structural report of a glucosamine N-acetyltransferase, which provides novel structural information about substrate specificity of GNATs. The structural and functional features of this multi-domain β-N-acetylglucosaminidase could be useful in studying the catalytic mechanism of GH family 3 proteins. PMID:26669854

A unique GCN5-related glucosamine N-acetyltransferase region exist in the fungal multi-domain glycoside hydrolase family 3 β-N-acetylglucosaminidase.

PubMed

Qin, Zhen; Xiao, Yibei; Yang, Xinbin; Mesters, Jeroen R; Yang, Shaoqing; Jiang, Zhengqiang

2015-12-16

Glycoside hydrolase (GH) family 3 β-N-acetylglucosaminidases widely exist in the filamentous fungi, which may play a key role in chitin metabolism of fungi. A multi-domain GH family 3 β-N-acetylglucosaminidase from Rhizomucor miehei (RmNag), exhibiting a potential N-acetyltransferase region, has been recently reported to show great potential in industrial applications. In this study, the crystal structure of RmNag was determined at 2.80 Å resolution. The three-dimensional structure of RmNag showed four distinctive domains, which belong to two distinguishable functional regions--a GH family 3 β-N-acetylglucosaminidase region (N-terminal) and a N-acetyltransferase region (C-terminal). From structural and functional analysis, the C-terminal region of RmNag was identified as a unique tandem array linking general control non-derepressible 5 (GCN5)-related N-acetyltransferase (GNAT), which displayed glucosamine N-acetyltransferase activity. Structural analysis of this glucosamine N-acetyltransferase region revealed that a unique glucosamine binding pocket is located in the pantetheine arm binding terminal region of the conserved CoA binding pocket, which is different from all known GNAT members. This is the first structural report of a glucosamine N-acetyltransferase, which provides novel structural information about substrate specificity of GNATs. The structural and functional features of this multi-domain β-N-acetylglucosaminidase could be useful in studying the catalytic mechanism of GH family 3 proteins.

Genetic and biochemical analysis of the interaction of Bacillus subtilis CodY with branched-chain amino acids.

PubMed

Villapakkam, Anuradha C; Handke, Luke D; Belitsky, Boris R; Levdikov, Vladimir M; Wilkinson, Anthony J; Sonenshein, Abraham L

2009-11-01

Bacillus subtilis CodY protein is a DNA-binding global transcriptional regulator that responds to branched-chain amino acids (isoleucine, leucine, and valine) and GTP. Crystal structure studies have shown that the N-terminal region of the protein includes a GAF domain that contains a hydrophobic pocket within which isoleucine and valine bind. This region is well conserved in CodY homologs. Site-directed mutagenesis was employed to understand the roles of some of the residues in the GAF domain and hydrophobic pocket in interaction with isoleucine and GTP. The F40A, F71E, and F98A forms of CodY were inactive in vivo. They were activatable by GTP but to a much lesser extent by branched-chain amino acids in vitro. The CodY mutant R61A retained partial repression of target promoters in vivo and was able to respond to GTP in vitro but also responded poorly to branched-chain amino acids in vitro unless GTP was simultaneously present. Thus, the GAF domain includes residues essential for full activation of CodY by branched-chain amino acids, but these residues are not critical for activation by GTP. Binding studies with branched-chain amino acids and their analogs revealed that an amino group at position 2 and a methyl group at position 3 of valine are critical components of the recognition of the amino acids by CodY.

X-ray crystal structure and small-angle X-ray scattering of sheep liver sorbitol dehydrogenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yennawar, Hemant; Møller, Magda; University of Copenhagen, DK-2100 Copenhagen

The X-ray crystal structure and a small-angle X-ray scattering solution structure of sheep liver sorbitol dehydrogenase have been determined. The details of the interactions that enable the tetramer scaffold to be the functional biological unit have been analyzed. The X-ray crystal structure of sheep liver sorbitol dehydrogenase (slSDH) has been determined using the crystal structure of human sorbitol dehydrogenase (hSDH) as a molecular-replacement model. slSDH crystallized in space group I222 with one monomer in the asymmetric unit. A conserved tetramer that superposes well with that seen in hSDH (despite belonging to a different space group) and obeying the 222 crystalmore » symmetry is seen in slSDH. An acetate molecule is bound in the active site, coordinating to the active-site zinc through a water molecule. Glycerol, a substrate of slSDH, also occupies the substrate-binding pocket together with the acetate designed by nature to fit large polyol substrates. The substrate-binding pocket is seen to be in close proximity to the tetramer interface, which explains the need for the structural integrity of the tetramer for enzyme activity. Small-angle X-ray scattering was also used to identify the quaternary structure of the tetramer of slSDH in solution.« less

Tertiary structure prediction and identification of druggable pocket in the cancer biomarker – Osteopontin-c

PubMed Central

2014-01-01

Background Osteopontin (Eta, secreted sialoprotein 1, opn) is secreted from different cell types including cancer cells. Three splice variant forms namely osteopontin-a, osteopontin-b and osteopontin-c have been identified. The main astonishing feature is that osteopontin-c is found to be elevated in almost all types of cancer cells. This was the vital point to consider it for sequence analysis and structure predictions which provide ample chances for prognostic, therapeutic and preventive cancer research. Methods Osteopontin-c gene sequence was determined from Breast Cancer sample and was translated to protein sequence. It was then analyzed using various software and web tools for binding pockets, docking and druggability analysis. Due to the lack of homological templates, tertiary structure was predicted using ab-initio method server – I-TASSER and was evaluated after refinement using web tools. Refined structure was compared with known bone sialoprotein electron microscopic structure and docked with CD44 for binding analysis and binding pockets were identified for drug designing. Results Signal sequence of about sixteen amino acid residues was identified using signal sequence prediction servers. Due to the absence of known structures of similar proteins, three dimensional structure of osteopontin-c was predicted using I-TASSER server. The predicted structure was refined with the help of SUMMA server and was validated using SAVES server. Molecular dynamic analysis was carried out using GROMACS software. The final model was built and was used for docking with CD44. Druggable pockets were identified using pocket energies. Conclusions The tertiary structure of osteopontin-c was predicted successfully using the ab-initio method and the predictions showed that osteopontin-c is of fibrous nature comparable to firbronectin. Docking studies showed the significant similarities of QSAET motif in the interaction of CD44 and osteopontins between the normal and splice variant forms of osteopontins and binding pockets analyses revealed several pockets which paved the way to the identification of a druggable pocket. PMID:24401206

A small-molecule fragment that emulates binding of receptor and broadly neutralizing antibodies to influenza A hemagglutinin.

PubMed

Kadam, Rameshwar U; Wilson, Ian A

2018-04-17

The influenza virus hemagglutinin (HA) glycoprotein mediates receptor binding and membrane fusion during viral entry in host cells. Blocking these key steps in viral infection has applications for development of novel antiinfluenza therapeutics as well as vaccines. However, the lack of structural information on how small molecules can gain a foothold in the small, shallow receptor-binding site (RBS) has hindered drug design against this important target on the viral pathogen. Here, we report on the serendipitous crystallization-based discovery of a small-molecule N -cyclohexyltaurine, commonly known as the buffering agent CHES, that is able to bind to both group-1 and group-2 HAs of influenza A viruses. X-ray structural characterization of group-1 H5N1 A/Vietnam/1203/2004 (H5/Viet) and group-2 H3N2 A/Hong Kong/1/1968 (H3/HK68) HAs at 2.0-Å and 2.57-Å resolution, respectively, revealed that N -cyclohexyltaurine binds to the heart of the conserved HA RBS. N -cyclohexyltaurine mimics the binding mode of the natural receptor sialic acid and RBS-targeting bnAbs through formation of similar hydrogen bonds and CH-π interactions with the HA. In H3/HK68, N -cyclohexyltaurine also binds to a conserved pocket in the stem region, thereby exhibiting a dual-binding mode in group-2 HAs. These long-awaited structural insights into RBS recognition by a noncarbohydrate-based small molecule enhance our knowledge of how to target this important functional site and can serve as a template to guide the development of novel broad-spectrum small-molecule therapeutics against influenza virus.

The ARTT motif and a unified structural understanding of substraterecognition in ADP ribosylating bacterial toxins and eukaryotic ADPribosyltransferases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Han, S.; Tainer, J.A.

2001-08-01

ADP-ribosylation is a widely occurring and biologically critical covalent chemical modification process in pathogenic mechanisms, intracellular signaling systems, DNA repair, and cell division. The reaction is catalyzed by ADP-ribosyltransferases, which transfer the ADP-ribose moiety of NAD to a target protein with nicotinamide release. A family of bacterial toxins and eukaryotic enzymes has been termed the mono-ADP-ribosyltransferases, in distinction to the poly-ADP-ribosyltransferases, which catalyze the addition of multiple ADP-ribose groups to the carboxyl terminus of eukaryotic nucleoproteins. Despite the limited primary sequence homology among the different ADP-ribosyltransferases, a central cleft bearing NAD-binding pocket formed by the two perpendicular b-sheet core hasmore » been remarkably conserved between bacterial toxins and eukaryotic mono- and poly-ADP-ribosyltransferases. The majority of bacterial toxins and eukaryotic mono-ADP-ribosyltransferases are characterized by conserved His and catalytic Glu residues. In contrast, Diphtheria toxin, Pseudomonas exotoxin A, and eukaryotic poly-ADP-ribosyltransferases are characterized by conserved Arg and catalytic Glu residues. The NAD-binding core of a binary toxin and a C3-like toxin family identified an ARTT motif (ADP-ribosylating turn-turn motif) that is implicated in substrate specificity and recognition by structural and mutagenic studies. Here we apply structure-based sequence alignment and comparative structural analyses of all known structures of ADP-ribosyltransfeases to suggest that this ARTT motif is functionally important in many ADP-ribosylating enzymes that bear a NAD binding cleft as characterized by conserved Arg and catalytic Glu residues. Overall, structure-based sequence analysis reveals common core structures and conserved active sites of ADP-ribosyltransferases to support similar NAD binding mechanisms but differing mechanisms of target protein binding via sequence variations within the ARTT motif structural framework. Thus, we propose here that the ARTT motif represents an experimentally testable general recognition motif region for many ADP-ribosyltransferases and thereby potentially provides a unified structural understanding of substrate recognition in ADP-ribosylation processes.« less

Active sites prediction and binding analysis E1-E2 protein human papillomavirus with biphenylsulfonacetic acid

NASA Astrophysics Data System (ADS)

Iryani, I.; Amelia, F.; Iswendi, I.

2018-04-01

Cervix cancer triggered by Human papillomavirus infection is the second cause to woman death in worldwide. The binding site of E1-E2 protein of HPV 16 is not known from a 3-D structure yet, so in this study we address this issue to study the structure of E1-E2 protein from Human papillomavirus type 16 and to find its potential binding sites using biphenylsulfonacetic acid as inhibitor. Swiss model was used for 3D structure prediction and PDB: 2V9P (E1 protein) and 2NNU (E2 protein) having 52.32% and 100% identity respectively was selected as a template. The 3D model structure developed of E1 and E2 in the core and allowed regions were 99.2% and 99.5%. The ligand binding sites were predicted using online server meta pocket 2.0 and MOE 2009.10 was used for docking. E1-and E2 protein of HPV-16 has three potential binding site that can interact with the inhibitors. The Docking biphenylsulfonacetic acid using these binding sites shows that ligand interact with the protein through hydrogen bonds on Lys 403, Arg 410, His 551 in the first pocket, on Tyr 32, Leu 99 in the second pocket, and Lys 558m Lys 517 in the third pocket.

Light-up fluorescent probes utilizing binding behavior of perylenediimide derivatives to a hydrophobic pocket within DNA.

PubMed

Takada, Tadao; Yamaguchi, Kosato; Tsukamoto, Suguru; Nakamura, Mitsunobu; Yamana, Kazushige

2014-08-21

Here we study the binding behavior of perylenediimide () derivatives to a hydrophobic pocket created inside DNA and their photochemical properties capable of designing a light-up fluorescent sensor for short single-stranded DNA or RNA. The perylenediimide derivative with alkoxy groups () suppressing electron transfer quenching was examined. The bound randomly to DNA showed negligible fluorescence due to the aggregation-induced quenching, whereas the bound to the pocket as a monomeric form showed more than 100-fold fluorescence enhancement. Switching the binding states of the corresponded to a change in the fluorescence response for the hybridization event, which allowed us to design a fluorescent sensor of nucleic acids with a nanomolar detection limit.

Near-Atomic Resolution Structure of a Plant Geminivirus Determined by Electron Cryomicroscopy.

PubMed

Hipp, Katharina; Grimm, Clemens; Jeske, Holger; Böttcher, Bettina

2017-08-01

African cassava mosaic virus is a whitefly-transmitted geminivirus which forms unique twin particles of incomplete icosahedra that are joined at five-fold vertices, building an unusual waist. How its 22 capsomers interact within a half-capsid or across the waist is unknown thus far. Using electron cryo-microscopy and image processing, we determined the virion structure with a resolution of 4.2 Å and built an atomic model for its capsid protein. The inter-capsomer contacts mediated by the flexible N termini and loop regions differed within the half-capsids and at the waist, explaining partly the unusual twin structure. The tip of the pentameric capsomer is sealed by a plug formed by a turn region harboring the evolutionary conserved residue Y193. Basic amino acid residues inside the capsid form a positively charged pocket next to the five-fold axis of the capsomer suitable for binding DNA. Within this pocket, density most likely corresponding to DNA was resolved. Copyright © 2017 Elsevier Ltd. All rights reserved.

A potent peptidomimetic inhibitor of botulinum neurotoxin serotype A has a very different conformation than SNAP-25 substrate.

PubMed

Zuniga, Jorge E; Schmidt, James J; Fenn, Timothy; Burnett, James C; Araç, Demet; Gussio, Rick; Stafford, Robert G; Badie, Shirin S; Bavari, Sina; Brunger, Axel T

2008-10-08

Botulinum neurotoxin serotype A is the most lethal of all known toxins. Here, we report the crystal structure, along with SAR data, of the zinc metalloprotease domain of BoNT/A bound to a potent peptidomimetic inhibitor (K(i)=41 nM) that resembles the local sequence of the SNAP-25 substrate. Surprisingly, the inhibitor adopts a helical conformation around the cleavage site, in contrast to the extended conformation of the native substrate. The backbone of the inhibitor's P1 residue displaces the putative catalytic water molecule and concomitantly interacts with the "proton shuttle" E224. This mechanism of inhibition is aided by residue contacts in the conserved S1' pocket of the substrate binding cleft and by the induction of new hydrophobic pockets, which are not present in the apo form, especially for the P2' residue of the inhibitor. Our inhibitor is specific for BoNT/A as it does not inhibit other BoNT serotypes or thermolysin.

Determinants of the heme-CO vibrational modes in the H-NOX family.

PubMed

Tran, Rosalie; Weinert, Emily E; Boon, Elizabeth M; Mathies, Richard A; Marletta, Michael A

2011-08-02

The Heme Nitric oxide/OXygen binding (H-NOX) family of proteins have important functions in gaseous ligand signaling in organisms from bacteria to humans, including nitric oxide (NO) sensing in mammals, and provide a model system for probing ligand selectivity in hemoproteins. A unique vibrational feature that is ubiquitous throughout the H-NOX family is the presence of a high C-O stretching frequency. To investigate the cause of this spectroscopic characteristic, the Fe-CO and C-O stretching frequencies were probed in the H-NOX domain from Thermoanaerobacter tengcongensis (Tt H-NOX) using resonance Raman (RR) spectroscopy. Four classes of heme pocket mutants were generated to assess the changes in stretching frequency: (i) the distal H-bonding network, (ii) the proximal histidine ligand, (iii) modulation of the heme conformation via Ile-5 and Pro-115, and (iv) the conserved Tyr-Ser-Arg (YxSxR) motif. These mutations revealed important electrostatic interactions that dampen the back-donation of the Fe(II) d(π) electrons into the CO π* orbitals. The most significant change occurred upon disruption of the H-bonds between the strictly conserved YxSxR motif and the heme propionate groups, producing two dominant CO-bound heme conformations. One conformer was structurally similar to Tt H-NOX WT, whereas the other displayed a decrease in ν(C-O) of up to ∼70 cm(-1) relative to the WT protein, with minimal changes in ν(Fe-CO). Taken together, these results show that the electrostatic interactions in the Tt H-NOX binding pocket are primarily responsible for the high ν(C-O) by decreasing the Fe d(π) → CO π* back-donation and suggest that the dominant mechanism by which this family modulates the Fe(II)-CO bond likely involves the YxSxR motif.

Characterization of the interaction between the small RNA-encoded peptide SR1P and GapA from Bacillus subtilis.

PubMed

Gimpel, Matthias; Maiwald, Caroline; Wiedemann, Christoph; Görlach, Matthias; Brantl, Sabine

2017-08-01

Small regulatory RNAs (sRNAs) are the most prominent post-transcriptional regulators in all kingdoms of life. A few of them, e.g. SR1 from Bacillus subtilis, are dual-function sRNAs. SR1 acts as a base-pairing sRNA in arginine catabolism and as an mRNA encoding the small peptide SR1P in RNA degradation. Both functions of SR1 are highly conserved among 23 species of Bacillales. Here, we investigate the interaction between SR1P and GapA by a combination of in vivo and in vitro methods. De novo prediction of the structure of SR1P yielded five models, one of which was consistent with experimental circular dichroism spectroscopy data of a purified, synthetic peptide. Based on this model structure and a comparison between the 23 SR1P homologues, a series of SR1P mutants was constructed and analysed by Northern blotting and co-elution experiments. The known crystal structure of Geobacillus stearothermophilus GapA was used to model SR1P onto this structure. The hypothetical SR1P binding pocket, composed of two α-helices at both termini of GapA, was investigated by constructing and assaying a number of GapA mutants in the presence and absence of wild-type or mutated SR1P. Almost all residues of SR1P located in the two highly conserved motifs are implicated in the interaction with GapA. A critical lysine residue (K332) in the C-terminal α-helix 14 of GapA corroborated the predicted binding pocket.

pocketZebra: a web-server for automated selection and classification of subfamily-specific binding sites by bioinformatic analysis of diverse protein families

PubMed Central

Suplatov, Dmitry; Kirilin, Eugeny; Arbatsky, Mikhail; Takhaveev, Vakil; Švedas, Vytas

2014-01-01

The new web-server pocketZebra implements the power of bioinformatics and geometry-based structural approaches to identify and rank subfamily-specific binding sites in proteins by functional significance, and select particular positions in the structure that determine selective accommodation of ligands. A new scoring function has been developed to annotate binding sites by the presence of the subfamily-specific positions in diverse protein families. pocketZebra web-server has multiple input modes to meet the needs of users with different experience in bioinformatics. The server provides on-site visualization of the results as well as off-line version of the output in annotated text format and as PyMol sessions ready for structural analysis. pocketZebra can be used to study structure–function relationship and regulation in large protein superfamilies, classify functionally important binding sites and annotate proteins with unknown function. The server can be used to engineer ligand-binding sites and allosteric regulation of enzymes, or implemented in a drug discovery process to search for potential molecular targets and novel selective inhibitors/effectors. The server, documentation and examples are freely available at http://biokinet.belozersky.msu.ru/pocketzebra and there are no login requirements. PMID:24852248

Biochemical Regulatory Features of Activation-Induced Cytidine Deaminase Remain Conserved from Lampreys to Humans

PubMed Central

King, Justin J.; Amemiya, Chris T.; Hsu, Ellen

2017-01-01

ABSTRACT Activation-induced cytidine deaminase (AID) is a genome-mutating enzyme that initiates class switch recombination and somatic hypermutation of antibodies in jawed vertebrates. We previously described the biochemical properties of human AID and found that it is an unusual enzyme in that it exhibits binding affinities for its substrate DNA and catalytic rates several orders of magnitude higher and lower, respectively, than a typical enzyme. Recently, we solved the functional structure of AID and demonstrated that these properties are due to nonspecific DNA binding on its surface, along with a catalytic pocket that predominantly assumes a closed conformation. Here we investigated the biochemical properties of AID from a sea lamprey, nurse shark, tetraodon, and coelacanth: representative species chosen because their lineages diverged at the earliest critical junctures in evolution of adaptive immunity. We found that these earliest-diverged AID orthologs are active cytidine deaminases that exhibit unique substrate specificities and thermosensitivities. Significant amino acid sequence divergence among these AID orthologs is predicted to manifest as notable structural differences. However, despite major differences in sequence specificities, thermosensitivities, and structural features, all orthologs share the unusually high DNA binding affinities and low catalytic rates. This absolute conservation is evidence for biological significance of these unique biochemical properties. PMID:28716949

Structural, Functional, and Genetic Analysis of Sorangicin Inhibition of Bacterial RNA Polymerase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Campbell,E.; Pavlova, O.; Zenkin, N.

2005-01-01

A combined structural, functional, and genetic approach was used to investigate inhibition of bacterial RNA polymerase (RNAP) by sorangicin (Sor), a macrolide polyether antibiotic. Sor lacks chemical and structural similarity to the ansamycin rifampicin (Rif), an RNAP inhibitor widely used to treat tuberculosis. Nevertheless, structural analysis revealed Sor binds in the same RNAP {beta} subunit pocket as Rif, with almost complete overlap of RNAP binding determinants, and functional analysis revealed that both antibiotics inhibit transcription by directly blocking the path of the elongating transcript at a length of 2-3 nucleotides. Genetic analysis indicates that Rif binding is extremely sensitive tomore » mutations expected to change the shape of the antibiotic binding pocket, while Sor is not. We suggest that conformational flexibility of Sor, in contrast to the rigid conformation of Rif, allows Sor to adapt to changes in the binding pocket. This has important implications for drug design against rapidly mutating targets.« less

Riboswitches: emerging themes in RNA structure and function.

PubMed

Montange, Rebecca K; Batey, Robert T

2008-01-01

Riboswitches are RNAs capable of binding cellular metabolites using a diverse array of secondary and tertiary structures to modulate gene expression. The recent determination of the three-dimensional structures of parts of six different riboswitches illuminates common features that allow riboswitches to be grouped into one of two types. Type I riboswitches, as exemplified by the purine riboswitch, are characterized by a single, localized binding pocket supported by a largely pre-established global fold. This arrangement limits ligand-induced conformational changes in the RNA to a small region. In contrast, Type II riboswitches, such as the thiamine pyrophosphate riboswitch, contain binding pockets split into at least two spatially distinct sites. As a result, binding induces both local changes to the binding pocket and global architecture. Similar organizational themes are found in other noncoding RNAs, making it possible to begin to build a hierarchical classification of RNA structure based on the spatial organization of their active sites and associated secondary structural elements.

Structural basis of unique ligand specificity of KAI2-like protein from parasitic weed Striga hermonthica.

PubMed

Xu, Yuqun; Miyakawa, Takuya; Nakamura, Hidemitsu; Nakamura, Akira; Imamura, Yusaku; Asami, Tadao; Tanokura, Masaru

2016-08-10

The perception of two plant germination inducers, karrikins and strigolactones, are mediated by the proteins KAI2 and D14. Recently, KAI2-type proteins from parasitic weeds, which are possibly related to seed germination induced by strigolactone, have been classified into three clades characterized by different responses to karrikin/strigolactone. Here we characterized a karrikin-binding protein in Striga (ShKAI2iB) that belongs to intermediate-evolving KAI2 and provided the structural bases for its karrikin-binding specificity. Binding assays showed that ShKAI2iB bound karrikins but not strigolactone, differing from other KAI2 and D14. The crystal structures of ShKAI2iB and ShKAI2iB-karrikin complex revealed obvious structural differences in a helix located at the entry of its ligand-binding cavity. This results in a smaller closed pocket, which is also the major cause of ShKAI2iB's specificity of binding karrikin. Our structural study also revealed that a few non-conserved amino acids led to the distinct ligand-binding profile of ShKAI2iB, suggesting that the evolution of KAI2 resulted in its diverse functions.

Small-Molecule Modulators of Methyl-Lysine Binding for the CBX7 Chromodomain

DOE PAGES

Ren, Chunyan; Morohashi, Keita; Plotnikov, Alexander N.; ...

2015-02-05

Chromobox homolog 7 (CBX7) plays an important role in gene transcription in a wide array of cellular processes, ranging from stem cell self-renewal and differentiation to tumor progression. CBX7 functions through its N-terminal chromodomain (ChD), which recognizes tri-methylated lysine 27 of histone 3 (H3K27me3), a conserved epigenetic mark that signifies gene transcriptional repression. Here in this study, we report discovery of small molecules that inhibit CBX7ChD binding to H3K27me3. Our crystal structures reveal the binding modes of these molecules that compete against H3K27me3 binding through interactions with key residues in the methyl-lysine binding pocket of CBX7ChD. We further show thatmore » a lead compound MS37452, derepresses transcription of Polycomb repressive complex target gene p16/CDKN2A by displacing CBX7 binding to the INK4A/ARF locus in prostate cancer cells. Ultimately, these small molecules have the potential to be developed into high-potency chemical modulators that target CBX7 functions in gene transcription in different disease pathways.« less

Deciphering Cryptic Binding Sites on Proteins by Mixed-Solvent Molecular Dynamics.

PubMed

Kimura, S Roy; Hu, Hai Peng; Ruvinsky, Anatoly M; Sherman, Woody; Favia, Angelo D

2017-06-26

In recent years, molecular dynamics simulations of proteins in explicit mixed solvents have been applied to various problems in protein biophysics and drug discovery, including protein folding, protein surface characterization, fragment screening, allostery, and druggability assessment. In this study, we perform a systematic study on how mixtures of organic solvent probes in water can reveal cryptic ligand binding pockets that are not evident in crystal structures of apo proteins. We examine a diverse set of eight PDB proteins that show pocket opening induced by ligand binding and investigate whether solvent MD simulations on the apo structures can induce the binding site observed in the holo structures. The cosolvent simulations were found to induce conformational changes on the protein surface, which were characterized and compared with the holo structures. Analyses of the biological systems, choice of probes and concentrations, druggability of the resulting induced pockets, and application to drug discovery are discussed here.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu Wei; Leal, Walter S.

Pheromone-binding proteins (PBPs) are involved in the uptake of pheromones from pores on the antennae, transport through an aqueous environment surrounding the olfactory receptor neurons, and fast delivery to pheromone receptors. We tested the hypothesis that a C-terminal segment and a flexible loop are involved in the release of pheromones to membrane-bound receptors. We expressed in Escherichia coli 11 mutants of the PBP from the silkworm moth, BmorPBP, taking into consideration structural differences between the forms with high and low binding affinity. The N-terminus was truncated and His-69, His-70 and His-95 at the base of a flexible loop, and amore » cluster of acidic residues at the C-terminus were mutated. Binding assays and circular dichroism analyses support a mechanism involving protonation of acidic residues Asp-132 and Glu-141 at the C-terminus and histidines, His-70 and His-95, in the base of a loop covering the binding pocket. The former leads to the formation of a new {alpha}-helix, which competes with pheromone for the binding pocket, whereas positive charge repulsion of the histidines opens the opposite side of the binding pocket.« less

A molecular dynamics simulation study of the association of 1,1";-binaphthyl-2,2";-diyl hydrogenphosphate enantiomers with a chiral molecular micelle

NASA Astrophysics Data System (ADS)

Morris, Kevin F.; Billiot, Eugene J.; Billiot, Fereshteh H.; Gladis, Ashley A.; Lipkowitz, Kenny B.; Southerland, William M.; Fang, Yayin

2014-08-01

Molecular dynamics (MD) simulations were used to investigate the binding of 1,1";-binaphthyl-2,2";-diyl hydrogenphosphate (BNP) enantiomers to the molecular micelle poly-(sodium undecyl-(L,L)-leucine-valine) (poly(SULV)). Poly(SULV) is used as a chiral selector in capillary electrophoresis separations. Four poly(SULV) binding pockets were identified and either (R)-BNP or (S)-BNP were docked into each pocket. MD simulations were then used to identify the preferred BNP binding site. Within the preferred site, both enantiomers formed hydrogen bonds with poly(SULV) and penetrated into the poly(SULV) core. Comparisons of BNP enantiomer binding to the preferred poly(SULV) pocket showed that (S)-BNP formed stronger hydrogen bonds, moved deeper into the binding site, and had a lower poly(SULV) binding free energy than the (R) enantiomer. Finally, MD simulation results were in agreement with capillary electrophoresis and NMR experiments. Each technique showed (S)-BNP interacted more strongly with poly(SULV) than (R)-BNP and that the site of chiral recognition was near the poly(SULV) leucine chiral center.

Concurrent Cooperativity and Substrate Inhibition in the Epoxidation of Carbamazepine by Cytochrome P450 3A4 Active Site Mutants Inspired by Molecular Dynamics Simulations

PubMed Central

2015-01-01

Cytochrome P450 3A4 (CYP3A4) is the major human P450 responsible for the metabolism of carbamazepine (CBZ). To explore the mechanisms of interactions of CYP3A4 with this anticonvulsive drug, we carried out multiple molecular dynamics (MD) simulations, starting with the complex of CYP3A4 manually docked with CBZ. On the basis of these simulations, we engineered CYP3A4 mutants I369F, I369L, A370V, and A370L, in which the productive binding orientation was expected to be stabilized, thus leading to increased turnover of CBZ to the 10,11-epoxide product. In addition, we generated CYP3A4 mutant S119A as a control construct with putative destabilization of the productive binding pose. Evaluation of the kinetics profiles of CBZ epoxidation demonstrate that CYP3A4-containing bacterial membranes (bactosomes) as well as purified CYP3A4 (wild-type and mutants I369L/F) exhibit substrate inhibition in reconstituted systems. In contrast, mutants S119A and A370V/L exhibit S-shaped profiles that are indicative of homotropic cooperativity. MD simulations with two to four CBZ molecules provide evidence that the substrate-binding pocket of CYP3A4 can accommodate more than one molecule of CBZ. Analysis of the kinetics profiles of CBZ metabolism with a model that combines the formalism of the Hill equation with an allowance for substrate inhibition demonstrates that the mechanism of interactions of CBZ with CYP3A4 involves multiple substrate-binding events (most likely three). Despite the retention of the multisite binding mechanism in the mutants, functional manifestations reveal an exquisite sensitivity to even minor structural changes in the binding pocket that are introduced by conservative substitutions such as I369F, I369L, and A370V. PMID:25545162

Concurrent cooperativity and substrate inhibition in the epoxidation of carbamazepine by cytochrome P450 3A4 active site mutants inspired by molecular dynamics simulations.

PubMed

Müller, Christian S; Knehans, Tim; Davydov, Dmitri R; Bounds, Patricia L; von Mandach, Ursula; Halpert, James R; Caflisch, Amedeo; Koppenol, Willem H

2015-01-27

Cytochrome P450 3A4 (CYP3A4) is the major human P450 responsible for the metabolism of carbamazepine (CBZ). To explore the mechanisms of interactions of CYP3A4 with this anticonvulsive drug, we carried out multiple molecular dynamics (MD) simulations, starting with the complex of CYP3A4 manually docked with CBZ. On the basis of these simulations, we engineered CYP3A4 mutants I369F, I369L, A370V, and A370L, in which the productive binding orientation was expected to be stabilized, thus leading to increased turnover of CBZ to the 10,11-epoxide product. In addition, we generated CYP3A4 mutant S119A as a control construct with putative destabilization of the productive binding pose. Evaluation of the kinetics profiles of CBZ epoxidation demonstrate that CYP3A4-containing bacterial membranes (bactosomes) as well as purified CYP3A4 (wild-type and mutants I369L/F) exhibit substrate inhibition in reconstituted systems. In contrast, mutants S119A and A370V/L exhibit S-shaped profiles that are indicative of homotropic cooperativity. MD simulations with two to four CBZ molecules provide evidence that the substrate-binding pocket of CYP3A4 can accommodate more than one molecule of CBZ. Analysis of the kinetics profiles of CBZ metabolism with a model that combines the formalism of the Hill equation with an allowance for substrate inhibition demonstrates that the mechanism of interactions of CBZ with CYP3A4 involves multiple substrate-binding events (most likely three). Despite the retention of the multisite binding mechanism in the mutants, functional manifestations reveal an exquisite sensitivity to even minor structural changes in the binding pocket that are introduced by conservative substitutions such as I369F, I369L, and A370V.

Structural and functional analysis of the YAP-binding domain of human TEAD2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tian, Wei; Yu, Jianzhong; Tomchick, Diana R.

2010-06-15

The Hippo pathway controls organ size and suppresses tumorigenesis in metazoans by blocking cell proliferation and promoting apoptosis. The TEAD1-4 proteins (which contain a DNA-binding domain but lack an activation domain) interact with YAP (which lacks a DNA-binding domain but contains an activation domain) to form functional heterodimeric transcription factors that activate proliferative and prosurvival gene expression programs. The Hippo pathway inhibits the YAP-TEAD hybrid transcription factors by phosphorylating and promoting cytoplasmic retention of YAP. Here we report the crystal structure of the YAP-binding domain (YBD) of human TEAD2. TEAD2 YBD adopts an immunoglobulin-like {beta}-sandwich fold with two extra helix-turn-helixmore » inserts. NMR studies reveal that the TEAD-binding domain of YAP is natively unfolded and that TEAD binding causes localized conformational changes in YAP. In vitro binding and in vivo functional assays define an extensive conserved surface of TEAD2 YBD as the YAP-binding site. Therefore, our studies suggest that a short segment of YAP adopts an extended conformation and forms extensive contacts with a rigid surface of TEAD. Targeting a surface-exposed pocket of TEAD might be an effective strategy to disrupt the YAP-TEAD interaction and to reduce the oncogenic potential of YAP.« less

A conserved phenylalanine as a relay between the α5 helix and the GDP binding region of heterotrimeric Gi protein α subunit.

PubMed

Kaya, Ali I; Lokits, Alyssa D; Gilbert, James A; Iverson, Tina M; Meiler, Jens; Hamm, Heidi E

2014-08-29

G protein activation by G protein-coupled receptors is one of the critical steps for many cellular signal transduction pathways. Previously, we and other groups reported that the α5 helix in the G protein α subunit plays a major role during this activation process. However, the precise signaling pathway between the α5 helix and the guanosine diphosphate (GDP) binding pocket remains elusive. Here, using structural, biochemical, and computational techniques, we probed different residues around the α5 helix for their role in signaling. Our data showed that perturbing the Phe-336 residue disturbs hydrophobic interactions with the β2-β3 strands and α1 helix, leading to high basal nucleotide exchange. However, mutations in β strands β5 and β6 do not perturb G protein activation. We have highlighted critical residues that leverage Phe-336 as a relay. Conformational changes are transmitted starting from Phe-336 via β2-β3/α1 to Switch I and the phosphate binding loop, decreasing the stability of the GDP binding pocket and triggering nucleotide release. When the α1 and α5 helices were cross-linked, inhibiting the receptor-mediated displacement of the C-terminal α5 helix, mutation of Phe-336 still leads to high basal exchange rates. This suggests that unlike receptor-mediated activation, helix 5 rotation and translocation are not necessary for GDP release from the α subunit. Rather, destabilization of the backdoor region of the Gα subunit is sufficient for triggering the activation process. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Targeting YAP/TAZ-TEAD protein-protein interactions using fragment-based and computational modeling approaches

PubMed Central

Verma, Chandra

2017-01-01

The Hippo signaling pathway, which is implicated in the regulation of organ size, has emerged as a potential target for the development of cancer therapeutics. YAP, TAZ (transcription co-activators) and TEAD (transcription factor) are the downstream transcriptional machinery and effectors of the pathway. Formation of the YAP/TAZ-TEAD complex leads to transcription of growth-promoting genes. Conversely, disrupting the interactions of the complex decreases cell proliferation. Herein, we screened a 1000-member fragment library using Thermal Shift Assay and identified a hit fragment. We confirmed its binding at the YAP/TAZ-TEAD interface by X-ray crystallography, and showed that it occupies the same hydrophobic pocket as a conserved phenylalanine of YAP/TAZ. This hit fragment serves as a scaffold for the development of compounds that have the potential to disrupt YAP/TAZ-TEAD interactions. Structure-activity relationship studies and computational modeling were also carried out to identify more potent compounds that may bind at this validated druggable binding site. PMID:28570566

Evolutionary plasticity of the NHL domain underlies distinct solutions to RNA recognition.

PubMed

Kumari, Pooja; Aeschimann, Florian; Gaidatzis, Dimos; Keusch, Jeremy J; Ghosh, Pritha; Neagu, Anca; Pachulska-Wieczorek, Katarzyna; Bujnicki, Janusz M; Gut, Heinz; Großhans, Helge; Ciosk, Rafal

2018-04-19

RNA-binding proteins regulate all aspects of RNA metabolism. Their association with RNA is mediated by RNA-binding domains, of which many remain uncharacterized. A recently reported example is the NHL domain, found in prominent regulators of cellular plasticity like the C. elegans LIN-41. Here we employ an integrative approach to dissect the RNA specificity of LIN-41. Using computational analysis, structural biology, and in vivo studies in worms and human cells, we find that a positively charged pocket, specific to the NHL domain of LIN-41 and its homologs (collectively LIN41), recognizes a stem-loop RNA element, whose shape determines the binding specificity. Surprisingly, the mechanism of RNA recognition by LIN41 is drastically different from that of its more distant relative, the fly Brat. Our phylogenetic analysis suggests that this reflects a rapid evolution of the domain, presenting an interesting example of a conserved protein fold that acquired completely different solutions to RNA recognition.

Asymmetric interactions in the adenosine-binding pockets of the MS2 coat protein dimer

PubMed Central

Powell, Amy J; Peabody, David S

2001-01-01

Background The X-ray structure of the MS2 coat protein-operator RNA complex reveals the existence of quasi-synmetric interactions of adenosines -4 and -10 in pockets formed on different subunits of the coat protein dimer. Both pockets utilize the same five amino acid residues, namely Val29, Thr45, Ser47, Thr59, and Lys61. We call these sites the adenosine-binding pockets. Results We present here a heterodimer complementation analysis of the contributions of individual A-pocket amino acids to the binding of A-4 and A-10 in different halves of the dimer. Various substitutions of A-pocket residues were introduced into one half of single-chain coat protein heterodimers where they were tested for their abilities to complement Y85H or T91I substitutions (defects in the A-4 and A-10 half-sites, respectively) present in the other dimer half. Conclusions These experiments provide functional tests of interactions predicted from structural analyses, demonstrating the importance of certain amino acid-nucleotide contacts observed in the crystal structure, and showing that others make little or no contribution to the stability of the complex. In summary, Val29 and Lys61 form important stabilizing interactions with both A-4 and A-10. Meanwhile, Ser47 and Thr59 interact primarily with A-10. The important interactions with Thr45 are restricted to A-4. PMID:11504563

Spatial Analysis and Quantification of the Thermodynamic Driving Forces in Protein-Ligand Binding: Binding Site Variability

PubMed Central

Raman, E. Prabhu; MacKerell, Alexander D.

2015-01-01

The thermodynamic driving forces behind small molecule-protein binding are still not well understood, including the variability of those forces associated with different types of ligands in different binding pockets. To better understand these phenomena we calculate spatially resolved thermodynamic contributions of the different molecular degrees of freedom for the binding of propane and methanol to multiple pockets on the proteins Factor Xa and p38 MAP kinase. Binding thermodynamics are computed using a statistical thermodynamics based end-point method applied on a canonical ensemble comprising the protein-ligand complexes and the corresponding free states in an explicit solvent environment. Energetic and entropic contributions of water and ligand degrees of freedom computed from the configurational ensemble provides an unprecedented level of detail into the mechanisms of binding. Direct protein-ligand interaction energies play a significant role in both non-polar and polar binding, which is comparable to water reorganization energy. Loss of interactions with water upon binding strongly compensates these contributions leading to relatively small binding enthalpies. For both solutes, the entropy of water reorganization is found to favor binding in agreement with the classical view of the “hydrophobic effect”. Depending on the specifics of the binding pocket, both energy-entropy compensation and reinforcement mechanisms are observed. Notable is the ability to visualize the spatial distribution of the thermodynamic contributions to binding at atomic resolution showing significant differences in the thermodynamic contributions of water to the binding of propane versus methanol. PMID:25625202

Tyrosine phosphorylation of the Lyn Src homology 2 (SH2) domain modulates its binding affinity and specificity.

PubMed

Jin, Lily L; Wybenga-Groot, Leanne E; Tong, Jiefei; Taylor, Paul; Minden, Mark D; Trudel, Suzanne; McGlade, C Jane; Moran, Michael F

2015-03-01

Src homology 2 (SH2) domains are modular protein structures that bind phosphotyrosine (pY)-containing polypeptides and regulate cellular functions through protein-protein interactions. Proteomics analysis showed that the SH2 domains of Src family kinases are themselves tyrosine phosphorylated in blood system cancers, including acute myeloid leukemia, chronic lymphocytic leukemia, and multiple myeloma. Using the Src family kinase Lyn SH2 domain as a model, we found that phosphorylation at the conserved SH2 domain residue Y(194) impacts the affinity and specificity of SH2 domain binding to pY-containing peptides and proteins. Analysis of the Lyn SH2 domain crystal structure supports a model wherein phosphorylation of Y(194) on the EF loop modulates the binding pocket that engages amino acid side chains at the pY+2/+3 position. These data indicate another level of regulation wherein SH2-mediated protein-protein interactions are modulated by SH2 kinases and phosphatases. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Chlorophyll-Derivative Modulation of Rhodopsin Signaling Properties through Evolutionarily Conserved Interaction Pathways

PubMed Central

Woods, Kristina N.; Pfeffer, Jürgen; Klein-Seetharaman, Judith

2017-01-01

Retinal is the light-absorbing chromophore that is responsible for the activation of visual pigments and light-driven ion pumps. Evolutionary changes in the intermolecular interactions of the retinal with specific amino acids allow for adaptation of the spectral characteristics, referred to as spectral tuning. However, it has been proposed that a specific species of dragon fish has bypassed the adaptive evolutionary process of spectral tuning and replaced it with a single evolutionary event: photosensitization of rhodopsin by chlorophyll derivatives. Here, by using a combination of experimental measurements and computational modeling to probe retinal-receptor interactions in rhodopsin, we show how the binding of the chlorophyll derivative, chlorin-e6 (Ce6) in the intracellular domain (ICD) of the receptor allosterically excites G-protein coupled receptor class A (GPCR-A) conserved long-range correlated fluctuations that connect distant parts of the receptor. These long-range correlated motions are associated with regulating the dynamics and intermolecular interactions of specific amino acids in the retinal ligand-binding pocket that have been associated with shifts in the absorbance peak maximum (λmax) and hence, spectral sensitivity of the visual system. Moreover, the binding of Ce6 affects the overall global properties of the receptor. Specifically, we find that Ce6-induced dynamics alter the thermal stability of rhodopsin by adjusting hydrogen-bonding interactions near the receptor active-site that consequently also influences the intrinsic conformational equilibrium of the receptor. Due to the conservation of the ICD residues amongst different receptors in this class and the fact that all GPCR-A receptors share a common mechanism of activation, it is possible that the allosteric associations excited in rhodopsin with Ce6 binding are a common feature in all class A GPCRs. PMID:29312953

Interaction of human synovial phospholipase A2 with mixed lipid bilayers: a coarse-grain and all-atom molecular dynamics simulation study.

PubMed

Qin, Shan-Shan; Yu, Yang-Xin; Li, Qi-Kai; Yu, Zhi-Wu

2013-02-26

Human secreted phospholipase A2s have been shown to promote inflammation in mammals by catalyzing the first step of the arachidonic acid pathway by breaking down phospholipids, producing fatty acids, including arachidonic acid. They bind to the membrane water interface to access their phospholipid substrates from the membrane. Their binding modes on membrane surfaces are regulated by diverse factors, including membrane charge, fluidity, and heterogeneity. The influence of these factors on the binding modes of the enzymes is not well understood. Here we have studied several human synovial phospholipase A2 (hs-PLA2)/mixed bilayer systems through a combined coarse-grain and all-atom molecular dynamics simulation. It was found that hydrophobic residues Leu2, Val3, Ala18, Leu19, Phe23, Gly30, and Phe63 that form the edge of the entrance of the hydrophobic binding pocket in hs-PLA2 tend to penetrate into the hydrophobic area of lipid bilayers, and more than half of the total amino acid residues make contact with the lipid headgroups. Each enzyme molecule forms 19-38 hydrogen bonds with the bilayer to which it binds, most of which are with the phosphate groups. Analysis of the root-mean-square deviation (rmsd) shows that residues Val30-Thr40, Tyr66-Gln80, and Lys107-Arg118 have relatively large rmsds during all-atom molecular dynamics simulations, in accordance with the observation of an enlarged entrance region of the hydrophobic binding pocket. The amino acid sequences forming the entrance of the binding pocket prefer to interact with lipid molecules that are more fluid or negatively charged, and the opening of the binding pocket would be larger when the lipid components are more fluid.

A Computational Analysis of ATP Binding of SV40 Large Tumor Antigen Helicase Motor

PubMed Central

Shi, Yemin; Liu, Hanbin; Gai, Dahai; Ma, Jianpeng; Chen, Xiaojiang S.

2009-01-01

Simian Virus 40 Large Tumor Antigen (LTag) is an efficient helicase motor that unwinds and translocates DNA. The DNA unwinding and translocation of LTag is powered by ATP binding and hydrolysis at the nucleotide pocket between two adjacent subunits of an LTag hexamer. Based on the set of high-resolution hexameric structures of LTag helicase in different nucleotide binding states, we simulated a conformational transition pathway of the ATP binding process using the targeted molecular dynamics method and calculated the corresponding energy profile using the linear response approximation (LRA) version of the semi-macroscopic Protein Dipoles Langevin Dipoles method (PDLD/S). The simulation results suggest a three-step process for the ATP binding from the initial interaction to the final tight binding at the nucleotide pocket, in which ATP is eventually “locked” by three pairs of charge-charge interactions across the pocket. Such a “cross-locking” ATP binding process is similar to the binding zipper model reported for the F1-ATPase hexameric motor. The simulation also shows a transition mechanism of Mg2+ coordination to form the Mg-ATP complex during ATP binding, which is accompanied by the large conformational changes of LTag. This simulation study of the ATP binding process to an LTag and the accompanying conformational changes in the context of a hexamer leads to a refined cooperative iris model that has been proposed previously. PMID:19779548

pocketZebra: a web-server for automated selection and classification of subfamily-specific binding sites by bioinformatic analysis of diverse protein families.

PubMed

Suplatov, Dmitry; Kirilin, Eugeny; Arbatsky, Mikhail; Takhaveev, Vakil; Svedas, Vytas

2014-07-01

The new web-server pocketZebra implements the power of bioinformatics and geometry-based structural approaches to identify and rank subfamily-specific binding sites in proteins by functional significance, and select particular positions in the structure that determine selective accommodation of ligands. A new scoring function has been developed to annotate binding sites by the presence of the subfamily-specific positions in diverse protein families. pocketZebra web-server has multiple input modes to meet the needs of users with different experience in bioinformatics. The server provides on-site visualization of the results as well as off-line version of the output in annotated text format and as PyMol sessions ready for structural analysis. pocketZebra can be used to study structure-function relationship and regulation in large protein superfamilies, classify functionally important binding sites and annotate proteins with unknown function. The server can be used to engineer ligand-binding sites and allosteric regulation of enzymes, or implemented in a drug discovery process to search for potential molecular targets and novel selective inhibitors/effectors. The server, documentation and examples are freely available at http://biokinet.belozersky.msu.ru/pocketzebra and there are no login requirements. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

PoSSuM v.2.0: data update and a new function for investigating ligand analogs and target proteins of small-molecule drugs.

PubMed

Ito, Jun-ichi; Ikeda, Kazuyoshi; Yamada, Kazunori; Mizuguchi, Kenji; Tomii, Kentaro

2015-01-01

PoSSuM (http://possum.cbrc.jp/PoSSuM/) is a database for detecting similar small-molecule binding sites on proteins. Since its initial release in 2011, PoSSuM has grown to provide information related to 49 million pairs of similar binding sites discovered among 5.5 million known and putative binding sites. This enlargement of the database is expected to enhance opportunities for biological and pharmaceutical applications, such as predictions of new functions and drug discovery. In this release, we have provided a new service named PoSSuM drug search (PoSSuMds) at http://possum.cbrc.jp/PoSSuM/drug_search/, in which we selected 194 approved drug compounds retrieved from ChEMBL, and detected their known binding pockets and pockets that are similar to them. Users can access and download all of the search results via a new web interface, which is useful for finding ligand analogs as well as potential target proteins. Furthermore, PoSSuMds enables users to explore the binding pocket universe within PoSSuM. Additionally, we have improved the web interface with new functions, including sortable tables and a viewer for visualizing and downloading superimposed pockets. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Hydration structure of the α-chymotrypsin substrate binding pocket: the impact of constrained geometry

NASA Astrophysics Data System (ADS)

Carey, Christina; Cheng, Yuen-Kit; Rossky, Peter J.

2000-08-01

The concave substrate binding pocket of α-chymotrypsin binds specifically hydrophobic side chains. In order to understand the hydration structure present in the absence of substrate, and elucidate the character of the solvent displaced on binding, molecular dynamics computer simulation of the solvent in a fully hydrated protein has been carried out and analyzed. The pocket is found to be characterized in terms of a mixed polar and apolar macromolecular surface. It is shown that the simulated solvent structure within it is spatially consistent with that seen via crystallography. The solvent structure is energetically characterized by large losses in hydrogen bonding among solvent molecules except at the mouth of the pocket where exposure to bulk-like solvent is possible. The loss in hydrogen bonding is attributed to the highly constrained geometry available to the solvent, preventing formation of a hydrogen bonding network, with only partial compensation by interactions with the macromolecular surface. The solvent displacement concomitant with substrate binding will therefore be associated with a large enthalpic driving force. This result is at the extreme of a continuum of variable cases of "hydrophobic" hydration, which differ most basically in surface curvature. These range from convex solute surfaces, inducing clathrate-like structures, with negligible hydrogen bond loss, to flat surfaces with significant interfacial loss, to the present concave case with hydrogen bonding losses exceeding 50%.

The role of spartin and its novel ubiquitin binding region in DALIS occurrence

PubMed Central

Karlsson, Amelia B.; Washington, Jacqueline; Dimitrova, Valentina; Hooper, Christopher; Shekhtman, Alexander; Bakowska, Joanna C.

2014-01-01

Troyer syndrome is an autosomal recessive hereditary spastic paraplegia (HSP) caused by frameshift mutations in the SPG20 gene that results in a lack of expression of the truncated protein. Spartin is a multifunctional protein, yet only two conserved domains—a microtubule-interacting and trafficking domain and a plant-related senescence domain involved in cytokinesis and mitochondrial physiology, respectively—have been defined. We have shown that overexpressed spartin binds to the Ile44 hydrophobic pocket of ubiquitin, suggesting spartin might contain a ubiquitin-binding domain. In the present study, we demonstrate that spartin contributes to the formation of dendritic aggresome-like induced structures (DALIS) through a unique ubiquitin-binding region (UBR). Using short hairpin RNA, we knocked down spartin in RAW264.7 cells and found that DALIS frequency decreased; conversely, overexpression of spartin increased the percentage of cells containing DALIS. Using nuclear magnetic resonance spectroscopy, we characterized spartin's UBR and defined the UBR's amino acids that are key for ubiquitin binding. We also found that spartin, via the UBR, binds Lys-63–linked ubiquitin chains but does not bind Lys-48–linked ubiquitin chains. Finally, we demonstrate that spartin's role in DALIS formation depends on key residues within its UBR. PMID:24523286

Mitochondrial Hsp90 is a ligand-activated molecular chaperone coupling ATP binding to dimer closure through a coiled-coil intermediate

PubMed Central

Sung, Nuri; Lee, Jungsoon; Kim, Ji-Hyun; Chang, Changsoo; Joachimiak, Andrzej; Lee, Sukyeong; Tsai, Francis T. F.

2016-01-01

Heat-shock protein of 90 kDa (Hsp90) is an essential molecular chaperone that adopts different 3D structures associated with distinct nucleotide states: a wide-open, V-shaped dimer in the apo state and a twisted, N-terminally closed dimer with ATP. Although the N domain is known to mediate ATP binding, how Hsp90 senses the bound nucleotide and facilitates dimer closure remains unclear. Here we present atomic structures of human mitochondrial Hsp90N (TRAP1N) and a composite model of intact TRAP1 revealing a previously unobserved coiled-coil dimer conformation that may precede dimer closure and is conserved in intact TRAP1 in solution. Our structure suggests that TRAP1 normally exists in an autoinhibited state with the ATP lid bound to the nucleotide-binding pocket. ATP binding displaces the ATP lid that signals the cis-bound ATP status to the neighboring subunit in a highly cooperative manner compatible with the coiled-coil intermediate state. We propose that TRAP1 is a ligand-activated molecular chaperone, which couples ATP binding to dramatic changes in local structure required for protein folding. PMID:26929380

Heparin octasaccharide decoy liposomes inhibit replication of multiple viruses

PubMed Central

Hendricks, Gabriel L.; Velazquez, Lourdes; Pham, Serena; Qaisar, Natasha; Delaney, James C.; Viswanathan, Karthik; Albers, Leila; Comolli, James C.; Shriver, Zachary; Knipe, David M.; Kurt-Jones, Evelyn A.; Fygenson, Deborah K.; Trevejo, Jose M.

2016-01-01

Heparan sulfate (HS) is a ubiquitous glycosaminoglycan that serves as a cellular attachment site for a number of significant human pathogens, including respiratory syncytial virus (RSV), human parainfluenza virus 3 (hPIV3), and herpes simplex virus (HSV). Decoy receptors can target pathogens by binding to the receptor pocket on viral attachment proteins, acting as ‘molecular sinks’ and preventing the pathogen from binding to susceptible host cells. Decoy receptors functionalized with HS could bind to pathogens and prevent infection, so we generated decoy liposomes displaying HS-octasaccharide (HS-octa). These decoy liposomes significantly inhibited RSV, hPIV3, and HSV infectivity in vitro to a greater degree than the original HS-octa building block. The degree of inhibition correlated with the density of HS-octa displayed on the liposome surface. Decoy liposomes with HS-octa inhibited infection of viruses to a greater extent than either full-length heparin or HS-octa alone. Decoy liposomes were effective when added prior to infection or following the initial infection of cells in vitro. By targeting the well-conserved receptor-binding sites of HS-binding viruses, decoy liposomes functionalized with HS-octa are a promising therapeutic antiviral agent and illustrate the utility of the liposome delivery platform. PMID:25637710

Molecular Chaperone Hsp70/Hsp90 Prepares the Mitochondrial Outer Membrane Translocon Receptor Tom71 for Preprotein Loading

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Jingzhi; Qian, Xinguo; Hu, Junbin

2010-11-03

The preproteins targeted to the mitochondria are transported through the translocase of the outer membrane complex. Tom70/Tom71 is a major surface receptor of the translocase of the outer membrane complex for mitochondrial preproteins. The preproteins are escorted to Tom70/Tom71 by molecular chaperones Hsp70 and Hsp90. Here we present the high resolution crystal structures of Tom71 and the protein complexes between Tom71 and the Hsp70/Hsp90 C terminus. The crystal structures indicate that Tom70/Tom71 may exhibit two distinct states. In the closed state, the N-terminal domain of Tom70/Tom71 partially blocks the preprotein-binding pocket. In the open state, the N-terminal domain moves away,more » and the preprotein-binding pocket is fully exposed. The complex formation between the C-terminal EEVD motif of Hsp70/Hsp90 and Tom71 could lock Tom71 in the open state where the preprotein-binding pocket of Tom71 is ready to receive preproteins. The interactions between Hsp70/Hsp90 and Tom71 N-terminal domain generate conformational changes that may increase the volume of the preprotein-binding pocket. The complex formation of Hsp70/Hsp90 and Tom71 also generates significant domain rearrangement within Tom71, which may position the preprotein-binding pocket closer to Hsp70/Hsp90 to facilitate the preprotein transfer from the molecular chaperone to Tom71. Therefore, molecular chaperone Hsp70/Hsp90 may function to prepare the mitochondrial outer membrane receptor Tom71 for preprotein loading.« less

Discovery of small molecule inhibitors of ubiquitin-like poxvirus proteinase I7L using homology modeling and covalent docking approaches

NASA Astrophysics Data System (ADS)

Katritch, Vsevolod; Byrd, Chelsea M.; Tseitin, Vladimir; Dai, Dongcheng; Raush, Eugene; Totrov, Maxim; Abagyan, Ruben; Jordan, Robert; Hruby, Dennis E.

2007-10-01

Essential for viral replication and highly conserved among poxviridae, the vaccinia virus I7L ubiquitin-like proteinase (ULP) is an attractive target for development of smallpox antiviral drugs. At the same time, the I7L proteinase exemplifies several interesting challenges from the rational drug design perspective. In the absence of a published I7L X-ray structure, we have built a detailed 3D model of the I7L ligand binding site (S2-S2' pocket) based on exceptionally high structural conservation of this site in proteases of the ULP family. The accuracy and limitations of this model were assessed through comparative analysis of available X-ray structures of ULPs, as well as energy based conformational modeling. The 3D model of the I7L ligand binding site was used to perform covalent docking and VLS of a comprehensive library of about 230,000 available ketone and aldehyde compounds. Out of 456 predicted ligands, 97 inhibitors of I7L proteinase activity were confirmed in biochemical assays (˜20% overall hit rate). These experimental results both validate our I7L ligand binding model and provide initial leads for rational optimization of poxvirus I7L proteinase inhibitors. Thus, fragments predicted to bind in the prime portion of the active site can be combined with fragments on non-prime side to yield compounds with improved activity and specificity.

The MPS1 family of protein kinases.

PubMed

Liu, Xuedong; Winey, Mark

2012-01-01

MPS1 protein kinases are found widely, but not ubiquitously, in eukaryotes. This family of potentially dual-specific protein kinases is among several that regulate a number of steps of mitosis. The most widely conserved MPS1 kinase functions involve activities at the kinetochore in both the chromosome attachment and the spindle checkpoint. MPS1 kinases also function at centrosomes. Beyond mitosis, MPS1 kinases have been implicated in development, cytokinesis, and several different signaling pathways. Family members are identified by virtue of a conserved C-terminal kinase domain, though the N-terminal domain is quite divergent. The kinase domain of the human enzyme has been crystallized, revealing an unusual ATP-binding pocket. The activity, level, and subcellular localization of Mps1 family members are tightly regulated during cell-cycle progression. The mitotic functions of Mps1 kinases and their overexpression in some tumors have prompted the identification of Mps1 inhibitors and their active development as anticancer drugs.

Structural Insights into the Ligand Binding and Releasing Mechanism of Antheraea polyphemus PBP1: Role of the C-terminal Tail

PubMed Central

Katre, Uma V.; Mazumder, Suman; Mohanty, Smita

2013-01-01

Pheromone-binding proteins (PBPs) in lepidopteran moths selectively transport the hydrophobic pheromone molecules across the sensillar lymph to trigger the neuronal response. Moth PBPs are known to bind ligand at physiological pH and release it at acidic pH while undergoing a conformational change. Two molecular switches are considered to play a role in this mechanism: (i) Protonation of His70 and His95 situated at one end of binding pocket, and (ii) Switch of the unstructured C-terminus at the other end of the binding pocket to a helix that enters the pocket. We have reported previously the role of the histidine-driven switch in ligand release for Antheraea polyphemus PBP1 (ApolPBP1). Here we show that the C-terminus plays a role in ligand release and binding mechanism of ApolPBP1. The C-terminus truncated mutants of ApolPBP1 (ApolPBP1ΔP129-V142 and ApolPBP1H70A/H95AΔP129-V142) exist only in the bound conformation at all pH levels, and they fail to undergo pH- or ligand- dependent conformational switch. Although these proteins could bind ligands even at acidic pH unlike the wild-type ApolPBP1, they had ~4 fold reduced affinity towards the ligand at both acidic and physiological pH than that of ApolPBP1wt and ApolPBP1H70A/H95A. Thus, apart from helping in the ligand-release at acidic pH, the C-terminus in ApolPBP1 also plays an important role in ligand binding and/or locking the ligand in the binding pocket. Our results are in stark contrast to those reported for BmorPBP and AtraPBP, where C-terminus truncated proteins had similar or increased pheromone-binding affinity at any pH. PMID:23327454

Enhanced fluorescence norfloxacin substituted naphthalimide derivatives: Molecular docking and antibacterial activity

NASA Astrophysics Data System (ADS)

Kumar, Santosh; Kumar, Gaurav; Tripathi, Amit Kumar; Seena, Sahadevan; Koh, Joonseok

2018-04-01

Hybrid derivatives are a fascinating and challenging process in the area of drug discovery. Naphthalimide derivatives with modified norfloxacin moiety were designed and synthesized. Docking simulations were done to assess the interactions of the derivatives with the E. coli type II topoisomerases Gyrase B and ParE ATP-binding pocket by taking novobiocin as a standard molecule. Results suggested that the norfloxacin substituted naphthalimide derivatives indicate red-shift emission maxima when compared to 4-bromo 1,8-naphthalic anhydride. The molecular docking simulation study revealed that the derivatives have similar interaction but a different mode of binding with the gyrase B ATP-binding pocket as compare to novobiocin. However, they bound to ParE ATP-binding pocket similarly to novobiocin. The antibacterial property was confirmed with disc diffusion method. Our study indicated that the norfloxacin substituted naphthalimide novel derivatives have pronounced fluorescence, anti-topoisomerase activity, and antibacterial properties; therefore, they could be developed into new drug candidates.

Identification of the functional binding pocket for compounds targeting small-conductance Ca2+-activated potassium channels

PubMed Central

Zhang, Miao; Pascal, John M.; Schumann, Marcel; Armen, Roger S.; Zhang, Ji-fang

2012-01-01

Small- and intermediate-conductance Ca2+-activated potassium channels, activated by Ca2+-bound calmodulin, play an important role in regulating membrane excitability. These channels are also linked to clinical abnormalities. A tremendous amount of effort has been devoted to developing small molecule compounds targeting these channels. However, these compounds often suffer from low potency and lack of selectivity, hindering their potentials for clinical use. A key contributing factor is the lack of knowledge of the binding site(s) for these compounds. Here we demonstrate by X-ray crystallography that the binding pocket for the compounds of the 1-EBIO class is located at the calmodulin-channel interface. We show that, based on structure data and molecular docking, mutations of the channel can effectively change the potency of these compounds. Our results provide insight into the molecular nature of the binding pocket and its contribution to the potency and selectivity of the compounds of the 1-EBIO class. PMID:22929778

Identification of the functional binding pocket for compounds targeting small-conductance Ca²⁺-activated potassium channels.

PubMed

Zhang, Miao; Pascal, John M; Schumann, Marcel; Armen, Roger S; Zhang, Ji-Fang

2012-01-01

Small- and intermediate-conductance Ca(2+)-activated potassium channels, activated by Ca(2+)-bound calmodulin, have an important role in regulating membrane excitability. These channels are also linked to clinical abnormalities. A tremendous amount of effort has been devoted to developing small molecule compounds targeting these channels. However, these compounds often suffer from low potency and lack of selectivity, hindering their potential for clinical use. A key contributing factor is the lack of knowledge of the binding site(s) for these compounds. Here we demonstrate by X-ray crystallography that the binding pocket for the compounds of the 1-ethyl-2-benzimidazolinone (1-EBIO) class is located at the calmodulin-channel interface. We show that, based on structure data and molecular docking, mutations of the channel can effectively change the potency of these compounds. Our results provide insight into the molecular nature of the binding pocket and its contribution to the potency and selectivity of the compounds of the 1-EBIO class.

Notum deacylates Wnts to suppress signalling activity

PubMed Central

Howell, Steve; Chang, Tao-Hsin; Liu, Yan; Feizi, Ten; Bineva, Ganka; O’Reilly, Nicola; Snijders, Ambrosius P.; Jones, E. Yvonne; Vincent, Jean-Paul

2015-01-01

Signalling by Wnts is finely balanced to ensure normal development and tissue homeostasis while avoiding diseases such as cancer. This is achieved in part by Notum, a highly conserved secreted feedback antagonist. Notum has been thought to act as a phospholipase, shedding glypicans and associated Wnts from the cell surface. However, this view fails to explain specificity since glypicans bind many extracellular ligands. Here we provide genetic evidence in Drosophila that Notum requires glypicans to suppress Wnt signalling, but does not cleave their glycophosphatidylinositol anchor. Structural analyses reveal glycosaminoglycan binding sites on Notum, which likely help Notum colocalise with Wnts. They also identify, at the active site of human and Drosophila Notum, a large hydrophobic pocket that accommodates palmitoleate. Kinetic and mass spectrometric analyses of human proteins show that Notum is a carboxylesterase that removes an essential palmitoleate moiety from Wnts and thus constitutes the first known extracellular protein deacylase. PMID:25731175

A salt bridge turns off the foot-pocket in class-II HDACs.

PubMed

Zhou, Jingwei; Yang, Zuolong; Zhang, Fan; Luo, Hai-Bin; Li, Min; Wu, Ruibo

2016-08-21

Histone Deacetylases (HDACs) are promising anticancer targets and several selective inhibitors have been created based on the architectural differences of foot-pockets among HDACs. However, the "gate-keeper" of foot-pockets is still controversial. Herein, it is for the first time revealed that a conserved R-E salt bridge plays a critical role in keeping foot-pockets closed in class-II HDACs by computational simulations. This finding is further substantiated by our mutagenesis experiments.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Granier, Sébastien; Manglik, Aashish; Kruse, Andrew C.

The opioid receptor family comprises three members, the {mu}-, {delta}- and {kappa}-opioid receptors, which respond to classical opioid alkaloids such as morphine and heroin as well as to endogenous peptide ligands like endorphins. They belong to the G-protein-coupled receptor (GPCR) superfamily, and are excellent therapeutic targets for pain control. The {delta}-opioid receptor ({delta}-OR) has a role in analgesia, as well as in other neurological functions that remain poorly understood. The structures of the {mu}-OR and {kappa}-OR have recently been solved. Here we report the crystal structure of the mouse {delta}-OR, bound to the subtype-selective antagonist naltrindole. Together with the structuresmore » of the {mu}-OR and {kappa}-OR, the {delta}-OR structure provides insights into conserved elements of opioid ligand recognition while also revealing structural features associated with ligand-subtype selectivity. The binding pocket of opioid receptors can be divided into two distinct regions. Whereas the lower part of this pocket is highly conserved among opioid receptors, the upper part contains divergent residues that confer subtype selectivity. This provides a structural explanation and validation for the 'message-address' model of opioid receptor pharmacology, in which distinct 'message' (efficacy) and 'address' (selectivity) determinants are contained within a single ligand. Comparison of the address region of the {delta}-OR with other GPCRs reveals that this structural organization may be a more general phenomenon, extending to other GPCR families as well.« less

Structural Evidence for a Sequential Release Mechanism for Activation of Heterotrimeric G Proteins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kapoor, Neeraj; Menon, Santosh T.; Chauhan, Radha

2010-01-12

Heptahelical G-protein (heterotrimeric guanine nucleotide-binding protein)-coupled receptors couple to heterotrimeric G proteins to relay extracellular signals to intracellular signaling networks, but the molecular mechanism underlying guanosine 5'-diphosphate (GDP) release by the G protein {alpha}-subunit is not well understood. Amino acid substitutions in the conserved {alpha}5 helix of Gi, which extends from the C-terminal region to the nucleotide-binding pocket, cause dramatic increases in basal (receptor-independent) GDP release rates. For example, mutant G{alpha}{sub i1}-T329A shows an 18-fold increase in basal GDP release rate and, when expressed in culture, it causes a significant decrease in forskolin-stimulated cAMP accumulation. The crystal structure of G{alpha}{submore » i1}-T329A {center_dot} GDP shows substantial conformational rearrangement of the switch I region and additional striking alterations of side chains lining the catalytic pocket that disrupt the Mg{sup +2} coordination sphere and dislodge bound Mg{sup +2}. We propose a 'sequential release' mechanism whereby a transient conformational change in the {alpha}5 helix alters switch I to induce GDP release. Interestingly, this mechanistic model for heterotrimeric G protein activation is similar to that suggested for the activation of the plant small G protein Rop4 by RopGEF8.« less

A cell wall-degrading esterase of Xanthomonas oryzae requires a unique substrate recognition module for pathogenesis on rice.

PubMed

Aparna, Gudlur; Chatterjee, Avradip; Sonti, Ramesh V; Sankaranarayanan, Rajan

2009-06-01

Xanthomonas oryzae pv oryzae (Xoo) causes bacterial blight, a serious disease of rice (Oryza sativa). LipA is a secretory virulence factor of Xoo, implicated in degradation of rice cell walls and the concomitant elicitation of innate immune responses, such as callose deposition and programmed cell death. Here, we present the high-resolution structural characterization of LipA that reveals an all-helical ligand binding module as a distinct functional attachment to the canonical hydrolase catalytic domain. We demonstrate that the enzyme binds to a glycoside ligand through a rigid pocket comprising distinct carbohydrate-specific and acyl chain recognition sites where the catalytic triad is situated 15 A from the anchored carbohydrate. Point mutations disrupting the carbohydrate anchor site or blocking the pocket, even at a considerable distance from the enzyme active site, can abrogate in planta LipA function, exemplified by loss of both virulence and the ability to elicit host defense responses. A high conservation of the module across genus Xanthomonas emphasizes the significance of this unique plant cell wall-degrading function for this important group of plant pathogenic bacteria. A comparison with the related structural families illustrates how a typical lipase is recruited to act on plant cell walls to promote virulence, thus providing a remarkable example of the emergence of novel functions around existing scaffolds for increased proficiency of pathogenesis during pathogen-plant coevolution.

Apolar Distal Pocket Mutants of Yeast Cytochrome c Peroxidase: Hydrogen Peroxide Reactivity and Cyanide Binding of the TriAla, TriVal, and TriLeu Variants

PubMed Central

Bidwai, Anil K.; Meyen, Cassandra; Kilheeney, Heather; Wroblewski, Damian; Vitello, Lidia B.; Erman, James E.

2012-01-01

Three yeast cytochrome c peroxidase (CcP) variants with apolar distal heme pockets have been constructed. The CcP variants have Arg48, Trp51, and His52 mutated to either all alanines, CcP(triAla), all valines, CcP(triVal), or all leucines, CcP(triLeu). The triple mutants have detectable enzymatic activity at pH 6 but the activity is less than 0.02% that of wild-type CcP. The activity loss is primarily due to the decreased rate of reaction between the triple mutants and H2O2 compared to wild-type CcP. Spectroscopic properties and cyanide binding characteristics of the triple mutants have been investigated over the pH stability region of CcP, pH 4 to 8. The absorption spectra indicate that the CcP triple mutants have hemes that are predominantly five-coordinate, high-spin at pH 5 and six-coordinate, low-spin at pH 8. Cyanide binding to the triple mutants is biphasic indicating that the triple mutants have two slowly-exchanging conformational states with different cyanide affinities. The binding affinity for cyanide is reduced at least two orders of magnitude in the triple mutants compared to wild-type CcP and the rate of cyanide binding is reduced by four to five orders of magnitude. Correlation of the reaction rates of CcP and 12 distal pocket mutants with H2O2 and HCN suggests that both reactions require ionization of the reactants within the distal heme pocket allowing the anion to bind the heme iron. Distal pocket features that promote substrate ionization (basic residues involved in base-catalyzed substrate ionization or polar residues that can stabilize substrate anions) increase the overall rate of reaction with H2O2 and HCN while features that inhibit substrate ionization slow the reactions. PMID:23022490

G protein-coupled receptor transmembrane binding pockets and their applications in GPCR research and drug discovery: a survey.

PubMed

Kratochwil, Nicole A; Gatti-McArthur, Silvia; Hoener, Marius C; Lindemann, Lothar; Christ, Andreas D; Green, Luke G; Guba, Wolfgang; Martin, Rainer E; Malherbe, Pari; Porter, Richard H P; Slack, Jay P; Winnig, Marcel; Dehmlow, Henrietta; Grether, Uwe; Hertel, Cornelia; Narquizian, Robert; Panousis, Constantinos G; Kolczewski, Sabine; Steward, Lucinda

2011-01-01

G protein-coupled receptors (GPCRs) share a common architecture consisting of seven transmembrane (TM) domains. Various lines of evidence suggest that this fold provides a generic binding pocket within the TM region for hosting agonists, antagonists, and allosteric modulators. Hence, an automated method was developed that allows a fast analysis and comparison of these generic ligand binding pockets across the entire GPCR family by providing the relevant information for all GPCRs in the same format. This methodology compiles amino acids lining the TM binding pocket including parts of the ECL2 loop in a so-called 1D ligand binding pocket vector and translates these 1D vectors in a second step into 3D receptor pharmacophore models. It aims to support various aspects of GPCR drug discovery in the pharmaceutical industry. Applications of pharmacophore similarity analysis of these 1D LPVs include definition of receptor subfamilies, prediction of species differences within subfamilies in regard to in vitro pharmacology and identification of nearest neighbors for GPCRs of interest to generate starting points for GPCR lead identification programs. These aspects of GPCR research are exemplified in the field of melanopsins, trace amine-associated receptors and somatostatin receptor subtype 5. In addition, it is demonstrated how 3D pharmacophore models of the LPVs can support the prediction of amino acids involved in ligand recognition, the understanding of mutational data in a 3D context and the elucidation of binding modes for GPCR ligands and their evaluation. Furthermore, guidance through 3D receptor pharmacophore modeling for the synthesis of subtype-specific GPCR ligands will be reported. Illustrative examples are taken from the GPCR family class C, metabotropic glutamate receptors 1 and 5 and sweet taste receptors, and from the GPCR class A, e.g. nicotinic acid and 5-hydroxytryptamine 5A receptor. © 2011 Bentham Science Publishers

Ondansetron and granisetron binding orientation in the 5-HT(3) receptor determined by unnatural amino acid mutagenesis.

PubMed

Duffy, Noah H; Lester, Henry A; Dougherty, Dennis A

2012-10-19

The serotonin type 3 receptor (5-HT(3)R) is a ligand-gated ion channel found in the central and peripheral nervous systems. The 5-HT(3)R is a therapeutic target, and the clinically available drugs ondansetron and granisetron inhibit receptor activity. Their inhibitory action is through competitive binding to the native ligand binding site, although the binding orientation of the drugs at the receptor has been a matter of debate. Here we heterologously express mouse 5-HT(3)A receptors in Xenopus oocytes and use unnatural amino acid mutagenesis to establish a cation-π interaction for both ondansetron and granisetron to tryptophan 183 in the ligand binding pocket. This cation-π interaction establishes a binding orientation for both ondansetron and granisetron within the binding pocket.

Ondansetron and Granisetron Binding Orientation in the 5-HT3 Receptor Determined by Unnatural Amino Acid Mutagenesis

PubMed Central

Duffy, Noah H.; Lester, Henry A.; Dougherty, Dennis A.

2012-01-01

The serotonin type 3 receptor (5-HT3R) is a ligand-gated ion channel that mediates fast synaptic transmission in the central and peripheral nervous systems. The 5-HT3R is a therapeutic target, and the clinically available drugs ondansetron and granisetron inhibit receptor activity. Their inhibitory action is through competitive binding to the native ligand binding site, although the binding orientation of the drugs at the receptor has been a matter of debate. Here we heterologously express mouse 5-HT3A receptors in Xenopus oocytes and use unnatural amino acid mutagenesis to establish a cation-π interaction for both ondansetron and granisetron to tryptophan 183 in the ligand binding pocket. This cation-π interaction establishes a binding orientation for both ondansetron and granisetron within the binding pocket. PMID:22873819

Interactions between Hofmeister anions and the binding pocket of a protein.

PubMed

Fox, Jerome M; Kang, Kyungtae; Sherman, Woody; Héroux, Annie; Sastry, G Madhavi; Baghbanzadeh, Mostafa; Lockett, Matthew R; Whitesides, George M

2015-03-25

This paper uses the binding pocket of human carbonic anhydrase II (HCAII, EC 4.2.1.1) as a tool to examine the properties of Hofmeister anions that determine (i) where, and how strongly, they associate with concavities on the surfaces of proteins and (ii) how, upon binding, they alter the structure of water within those concavities. Results from X-ray crystallography and isothermal titration calorimetry show that most anions associate with the binding pocket of HCAII by forming inner-sphere ion pairs with the Zn(2+) cofactor. In these ion pairs, the free energy of anion-Zn(2+) association is inversely proportional to the free energetic cost of anion dehydration; this relationship is consistent with the mechanism of ion pair formation suggested by the "law of matching water affinities". Iodide and bromide anions also associate with a hydrophobic declivity in the wall of the binding pocket. Molecular dynamics simulations suggest that anions, upon associating with Zn(2+), trigger rearrangements of water that extend up to 8 Å away from their surfaces. These findings expand the range of interactions previously thought to occur between ions and proteins by suggesting that (i) weakly hydrated anions can bind complementarily shaped hydrophobic declivities, and that (ii) ion-induced rearrangements of water within protein concavities can (in contrast with similar rearrangements in bulk water) extend well beyond the first hydration shells of the ions that trigger them. This study paints a picture of Hofmeister anions as a set of structurally varied ligands that differ in size, shape, and affinity for water and, thus, in their ability to bind to—and to alter the charge and hydration structure of—polar, nonpolar, and topographically complex concavities on the surfaces of proteins.

Characterization of the Sterol and Phosphatidylinositol 4-Phosphate Binding Properties of Golgi-Associated OSBP-Related Protein 9 (ORP9)

PubMed Central

Liu, Xinwei; Ridgway, Neale D.

2014-01-01

Oxysterol binding protein (OSBP) and OSBP-related proteins (ORPS) have a conserved lipid-binding fold that accommodates cholesterol, oxysterols and/or phospholipids. The diversity of OSBP/ORPs and their potential ligands has complicated the analysis of transfer and signalling properties of this mammalian gene family. In this study we explored the use of the fluorescent sterol cholestatrienol (CTL) to measure sterol binding by ORP9 and competition by other putative ligands. Relative to cholesterol, CTL and dehydroergosterol (DHE) were poor ligands for OSBP. In contrast, both long (ORP9L) and short (ORP9S) variants of ORP9 rapidly extracted CTL, and to a lesser extent DHE, from liposomes. ORP9L and ORP9S also extracted [32P]phosphatidylinositol 4-phosphate (PI-4P) from liposomes, which was inhibited by mutating two conserved histidine residues (HH488,489AA) at the entrance to the binding pocket but not by a mutation in the lid region that inhibited cholesterol binding. Results of direct binding and competition assays showed that phosphatidylserine was poorly extracted from liposomes by ORP9 compared to CTL and PI-4P. ORP9L and PI-4P did not co-localize in the trans-Golgi/TGN of HeLa cells, and siRNA silencing of ORP9L expression did not affect PI-4P distribution in the Golgi apparatus. However, transient overexpression of ORP9L or ORP9S in CHO cells, but not the corresponding PI-4P binding mutants, prevented immunostaining of Golgi-associated PI-4P. The apparent sequestration of Golgi PI-4P by ORP9S was identified as a possible mechanism for its growth inhibitory effects. These studies identify ORP9 as a dual sterol/PI-4P binding protein that could regulate PI-4P in the Golgi apparatus. PMID:25255026

Characterization of the sterol and phosphatidylinositol 4-phosphate binding properties of Golgi-associated OSBP-related protein 9 (ORP9).

PubMed

Liu, Xinwei; Ridgway, Neale D

2014-01-01

Oxysterol binding protein (OSBP) and OSBP-related proteins (ORPS) have a conserved lipid-binding fold that accommodates cholesterol, oxysterols and/or phospholipids. The diversity of OSBP/ORPs and their potential ligands has complicated the analysis of transfer and signalling properties of this mammalian gene family. In this study we explored the use of the fluorescent sterol cholestatrienol (CTL) to measure sterol binding by ORP9 and competition by other putative ligands. Relative to cholesterol, CTL and dehydroergosterol (DHE) were poor ligands for OSBP. In contrast, both long (ORP9L) and short (ORP9S) variants of ORP9 rapidly extracted CTL, and to a lesser extent DHE, from liposomes. ORP9L and ORP9S also extracted [32P]phosphatidylinositol 4-phosphate (PI-4P) from liposomes, which was inhibited by mutating two conserved histidine residues (HH488,489AA) at the entrance to the binding pocket but not by a mutation in the lid region that inhibited cholesterol binding. Results of direct binding and competition assays showed that phosphatidylserine was poorly extracted from liposomes by ORP9 compared to CTL and PI-4P. ORP9L and PI-4P did not co-localize in the trans-Golgi/TGN of HeLa cells, and siRNA silencing of ORP9L expression did not affect PI-4P distribution in the Golgi apparatus. However, transient overexpression of ORP9L or ORP9S in CHO cells, but not the corresponding PI-4P binding mutants, prevented immunostaining of Golgi-associated PI-4P. The apparent sequestration of Golgi PI-4P by ORP9S was identified as a possible mechanism for its growth inhibitory effects. These studies identify ORP9 as a dual sterol/PI-4P binding protein that could regulate PI-4P in the Golgi apparatus.

An alternate binding site for PPARγ ligands

PubMed Central

Hughes, Travis S.; Giri, Pankaj Kumar; de Vera, Ian Mitchelle S.; Marciano, David P.; Kuruvilla, Dana S.; Shin, Youseung; Blayo, Anne-Laure; Kamenecka, Theodore M.; Burris, Thomas P.; Griffin, Patrick R.; Kojetin, Douglas J.

2014-01-01

PPARγ is a target for insulin sensitizing drugs such as glitazones, which improve plasma glucose maintenance in patients with diabetes. Synthetic ligands have been designed to mimic endogenous ligand binding to a canonical ligand-binding pocket to hyperactivate PPARγ. Here we reveal that synthetic PPARγ ligands also bind to an alternate site, leading to unique receptor conformational changes that impact coregulator binding, transactivation and target gene expression. Using structure-function studies we show that alternate site binding occurs at pharmacologically relevant ligand concentrations, and is neither blocked by covalently bound synthetic antagonists nor by endogenous ligands indicating non-overlapping binding with the canonical pocket. Alternate site binding likely contributes to PPARγ hyperactivation in vivo, perhaps explaining why PPARγ full and partial or weak agonists display similar adverse effects. These findings expand our understanding of PPARγ activation by ligands and suggest that allosteric modulators could be designed to fine tune PPARγ activity without competing with endogenous ligands. PMID:24705063

T-Epitope Designer: A HLA-peptide binding prediction server.

PubMed

Kangueane, Pandjassarame; Sakharkar, Meena Kishore

2005-05-15

The current challenge in synthetic vaccine design is the development of a methodology to identify and test short antigen peptides as potential T-cell epitopes. Recently, we described a HLA-peptide binding model (using structural properties) capable of predicting peptides binding to any HLA allele. Consequently, we have developed a web server named T-EPITOPE DESIGNER to facilitate HLA-peptide binding prediction. The prediction server is based on a model that defines peptide binding pockets using information gleaned from X-ray crystal structures of HLA-peptide complexes, followed by the estimation of peptide binding to binding pockets. Thus, the prediction server enables the calculation of peptide binding to HLA alleles. This model is superior to many existing methods because of its potential application to any given HLA allele whose sequence is clearly defined. The web server finds potential application in T cell epitope vaccine design. http://www.bioinformation.net/ted/

Structural basis of unique ligand specificity of KAI2-like protein from parasitic weed Striga hermonthica

PubMed Central

Xu, Yuqun; Miyakawa, Takuya; Nakamura, Hidemitsu; Nakamura, Akira; Imamura, Yusaku; Asami, Tadao; Tanokura, Masaru

2016-01-01

The perception of two plant germination inducers, karrikins and strigolactones, are mediated by the proteins KAI2 and D14. Recently, KAI2-type proteins from parasitic weeds, which are possibly related to seed germination induced by strigolactone, have been classified into three clades characterized by different responses to karrikin/strigolactone. Here we characterized a karrikin-binding protein in Striga (ShKAI2iB) that belongs to intermediate-evolving KAI2 and provided the structural bases for its karrikin-binding specificity. Binding assays showed that ShKAI2iB bound karrikins but not strigolactone, differing from other KAI2 and D14. The crystal structures of ShKAI2iB and ShKAI2iB-karrikin complex revealed obvious structural differences in a helix located at the entry of its ligand-binding cavity. This results in a smaller closed pocket, which is also the major cause of ShKAI2iB’s specificity of binding karrikin. Our structural study also revealed that a few non-conserved amino acids led to the distinct ligand-binding profile of ShKAI2iB, suggesting that the evolution of KAI2 resulted in its diverse functions. PMID:27507097

Glycine activated ion channel subunits encoded by ctenophore glutamate receptor genes

DOE PAGES

Alberstein, Robert; Grey, Richard; Zimmet, Austin; ...

2015-10-12

Recent genome projects for ctenophores have revealed the presence of numerous ionotropic glutamate receptors (iGluRs) in Mnemiopsis leidyi and Pleurobrachia bachei, among our earliest metazoan ancestors. Sequence alignments and phylogenetic analysis show that these form a distinct clade from the well-characterized AMPA, kainate, and NMDA iGluR subtypes found in vertebrates. Although annotated as glutamate and kainate receptors, crystal structures of the ML032222a and PbiGluR3 ligand-binding domains (LBDs) reveal endogenous glycine in the binding pocket, whereas ligand-binding assays show that glycine binds with nanomolar affinity; biochemical assays and structural analysis establish that glutamate is occluded from the binding cavity. Further analysismore » reveals ctenophore-specific features, such as an interdomain Arg-Glu salt bridge, present only in subunits that bind glycine, but also a conserved disulfide in loop 1 of the LBD that is found in all vertebrate NMDA but not AMPA or kainate receptors. In this paper, we hypothesize that ctenophore iGluRs are related to an early ancestor of NMDA receptors, suggesting a common evolutionary path for ctenophores and bilaterian species, and finally suggest that future work should consider both glycine and glutamate as candidate neurotransmitters in ctenophore species.« less

Disruption of key NADH-binding pocket residues of the Mycobacterium tuberculosis InhA affects DD-CoA binding ability.

PubMed

Shaw, Daniel J; Robb, Kirsty; Vetter, Beatrice V; Tong, Madeline; Molle, Virginie; Hunt, Neil T; Hoskisson, Paul A

2017-07-05

Tuberculosis (TB) is a global health problem that affects over 10 million people. There is an urgent need to develop novel antimicrobial therapies to combat TB. To achieve this, a thorough understanding of key validated drug targets is required. The enoyl reductase InhA, responsible for synthesis of essential mycolic acids in the mycobacterial cell wall, is the target for the frontline anti-TB drug isoniazid. To better understand the activity of this protein a series of mutants, targeted to the NADH co-factor binding pocket were created. Residues P193 and W222 comprise a series of hydrophobic residues surrounding the cofactor binding site and mutation of both residues negatively affect InhA function. Construction of an M155A mutant of InhA results in increased affinity for NADH and DD-CoA turnover but with a reduction in V max for DD-CoA, impairing overall activity. This suggests that NADH-binding geometry of InhA likely permits long-range interactions between residues in the NADH-binding pocket to facilitate substrate turnover in the DD-CoA binding region of the protein. Understanding the precise details of substrate binding and turnover in InhA and how this may affect protein-protein interactions may facilitate the development of improved inhibitors enabling the development of novel anti-TB drugs.

Phosphate-binding pocket in Dicer-2 PAZ domain for high-fidelity siRNA production

PubMed Central

Kandasamy, Suresh K.

2016-01-01

The enzyme Dicer produces small silencing RNAs such as micro-RNAs (miRNAs) and small interfering RNAs (siRNAs). In Drosophila, Dicer-1 produces ∼22–24-nt miRNAs from pre-miRNAs, whereas Dicer-2 makes 21-nt siRNAs from long double-stranded RNAs (dsRNAs). How Dicer-2 precisely makes 21-nt siRNAs with a remarkably high fidelity is unknown. Here we report that recognition of the 5′-monophosphate of a long dsRNA substrate by a phosphate-binding pocket in the Dicer-2 PAZ (Piwi, Argonaute, and Zwille/Pinhead) domain is crucial for the length fidelity, but not the efficiency, in 21-nt siRNA production. Loss of the length fidelity, meaning increased length heterogeneity of siRNAs, caused by point mutations in the phosphate-binding pocket of the Dicer-2 PAZ domain decreased RNA silencing activity in vivo, showing the importance of the high fidelity to make 21-nt siRNAs. We propose that the 5′-monophosphate of a long dsRNA substrate is anchored by the phosphate-binding pocket in the Dicer-2 PAZ domain and the distance between the pocket and the RNA cleavage active site in the RNaseIII domain corresponds to the 21-nt pitch in the A-form duplex of a long dsRNA substrate, resulting in high-fidelity 21-nt siRNA production. This study sheds light on the molecular mechanism by which Dicer-2 produces 21-nt siRNAs with a remarkably high fidelity for efficient RNA silencing. PMID:27872309

Tetanus Neurotoxin Neutralizing Antibodies Screened from a Human Immune scFv Antibody Phage Display Library.

PubMed

Wang, Han; Yu, Rui; Fang, Ting; Yu, Ting; Chi, Xiangyang; Zhang, Xiaopeng; Liu, Shuling; Fu, Ling; Yu, Changming; Chen, Wei

2016-09-11

Tetanus neurotoxin (TeNT) produced by Clostridium tetani is one of the most poisonous protein substances. Neutralizing antibodies against TeNT can effectively prevent and cure toxicosis. Using purified Hc fragments of TeNT (TeNT-Hc) as an antigen, three specific neutralizing antibody clones recognizing different epitopes were selected from a human immune scFv antibody phage display library. The three antibodies (2-7G, 2-2D, and S-4-7H) can effectively inhibit the binding between TeNT-Hc and differentiated PC-12 cells in vitro. Moreover, 2-7G inhibited TeNT-Hc binding to the receptor via carbohydrate-binding sites of the W pocket while 2-2D and S-4-7H inhibited binding of the R pocket. Although no single mAb completely protected mice from the toxin, they could both prolong survival when challenged with 20 LD50s (50% of the lethal dose) of TeNT. When used together, the mAbs completely neutralized 1000 LD50s/mg Ab, indicating their high neutralizing potency in vivo. Antibodies recognizing different carbohydrate-binding pockets could have higher synergistic toxin neutralization activities than those that recognize the same pockets. These results could lead to further production of neutralizing antibody drugs against TeNT and indicate that using TeNT-Hc as an antigen for screening human antibodies for TeNT intoxication therapy from human immune antibody library was convenient and effective.

Structure–kinetic relationship study of CDK8/CycC specific compounds

PubMed Central

Schneider, Elisabeth V.; Böttcher, Jark; Huber, Robert; Maskos, Klaus; Neumann, Lars

2013-01-01

In contrast with the very well explored concept of structure–activity relationship, similar studies are missing for the dependency between binding kinetics and compound structure of a protein ligand complex, the structure–kinetic relationship. Here, we present a structure–kinetic relationship study of the cyclin-dependent kinase 8 (CDK8)/cyclin C (CycC) complex. The scaffold moiety of the compounds is anchored in the kinase deep pocket and extended with diverse functional groups toward the hinge region and the front pocket. These variations can cause the compounds to change from fast to slow binding kinetics, resulting in an improved residence time. The flip of the DFG motif (“DMG” in CDK8) to the inactive DFG-out conformation appears to have relatively little influence on the velocity of binding. Hydrogen bonding with the kinase hinge region contributes to the residence time but has less impact than hydrophobic complementarities within the kinase front pocket. PMID:23630251

Development of purely structure-based pharmacophores for the topoisomerase I-DNA-ligand binding pocket

NASA Astrophysics Data System (ADS)

Drwal, Malgorzata N.; Agama, Keli; Pommier, Yves; Griffith, Renate

2013-12-01

Purely structure-based pharmacophores (SBPs) are an alternative method to ligand-based approaches and have the advantage of describing the entire interaction capability of a binding pocket. Here, we present the development of SBPs for topoisomerase I, an anticancer target with an unusual ligand binding pocket consisting of protein and DNA atoms. Different approaches to cluster and select pharmacophore features are investigated, including hierarchical clustering and energy calculations. In addition, the performance of SBPs is evaluated retrospectively and compared to the performance of ligand- and complex-based pharmacophores. SBPs emerge as a valid method in virtual screening and a complementary approach to ligand-focussed methods. The study further reveals that the choice of pharmacophore feature clustering and selection methods has a large impact on the virtual screening hit lists. A prospective application of the SBPs in virtual screening reveals that they can be used successfully to identify novel topoisomerase inhibitors.

Pheromone Recognition and Selectivity by ComR Proteins among Streptococcus Species

PubMed Central

Morrison, Donald A.; Talagas, Antoine; Nessler, Sylvie; Federle, Michael J.; Prehna, Gerd

2016-01-01

Natural transformation, or competence, is an ability inherent to bacteria for the uptake of extracellular DNA. This process is central to bacterial evolution and allows for the rapid acquirement of new traits, such as antibiotic resistance in pathogenic microorganisms. For the Gram-positive bacteria genus Streptococcus, genes required for competence are under the regulation of quorum sensing (QS) mediated by peptide pheromones. One such system, ComRS, consists of a peptide (ComS) that is processed (XIP), secreted, and later imported into the cytoplasm, where it binds and activates the transcription factor ComR. ComR then engages in a positive feedback loop for the expression of ComS and the alternative sigma-factor SigX. Although ComRS are present in the majority of Streptococcus species, the sequence of both ComS/XIP and ComR diverge significantly, suggesting a mechanism for species-specific communication. To study possible cross-talk between streptococcal species in the regulation of competence, and to explore in detail the molecular interaction between ComR and XIP we undertook an interdisciplinary approach. We developed a ‘test-bed’ assay to measure the activity of different ComR proteins in response to cognate and heterologous XIP peptides in vivo, revealing distinct ComR classes of strict, intermediate, and promiscuous specificity among species. We then solved an X-ray crystal structure of ComR from S. suis to further understand the interaction with XIP and to search for structural features in ComR proteins that may explain XIP recognition. Using the structure as a guide, we probed the apo conformation of the XIP-binding pocket by site-directed mutagenesis, both in test-bed cultures and biochemically in vitro. In alignments with ComR proteins from other species, we find that the pocket is lined by a variable and a conserved face, where residues of the conserved face contribute to ligand binding and the variable face discriminate among XIP peptides. Together, our results not only provide a model for XIP recognition and specificity, but also allow for the prediction of novel XIP peptides that induce ComR activity. PMID:27907154

QStatin, a Selective Inhibitor of Quorum Sensing in Vibrio Species.

PubMed

Kim, Byoung Sik; Jang, Song Yee; Bang, Ye-Ji; Hwang, Jungwon; Koo, Youngwon; Jang, Kyung Ku; Lim, Dongyeol; Kim, Myung Hee; Choi, Sang Ho

2018-01-30

Pathogenic Vibrio species cause diseases in diverse marine animals reared in aquaculture. Since their pathogenesis, persistence, and survival in marine environments are regulated by quorum sensing (QS), QS interference has attracted attention as a means to control these bacteria in aquatic settings. A few QS inhibitors of Vibrio species have been reported, but detailed molecular mechanisms are lacking. Here, we identified a novel, potent, and selective Vibrio QS inhibitor, named QStatin [1-(5-bromothiophene-2-sulfonyl)-1H-pyrazole], which affects Vibrio harveyi LuxR homologues, the well-conserved master transcriptional regulators for QS in Vibrio species. Crystallographic and biochemical analyses showed that QStatin binds tightly to a putative ligand-binding pocket in SmcR, the LuxR homologue in V. vulnificus , and changes the flexibility of the protein, thereby altering its transcription regulatory activity. Transcriptome analysis revealed that QStatin results in SmcR dysfunction, affecting the expression of SmcR regulon required for virulence, motility/chemotaxis, and biofilm dynamics. Notably, QStatin attenuated representative QS-regulated phenotypes in various Vibrio species, including virulence against the brine shrimp ( Artemia franciscana ). Together, these results provide molecular insights into the mechanism of action of an effective, sustainable QS inhibitor that is less susceptible to resistance than other antimicrobial agents and useful in controlling the virulence of Vibrio species in aquacultures. IMPORTANCE Yields of aquaculture, such as penaeid shrimp hatcheries, are greatly affected by vibriosis, a disease caused by pathogenic Vibrio infections. Since bacterial cell-to-cell communication, known as quorum sensing (QS), regulates pathogenesis of Vibrio species in marine environments, QS inhibitors have attracted attention as alternatives to conventional antibiotics in aquatic settings. Here, we used target-based high-throughput screening to identify QStatin, a potent and selective inhibitor of V. harveyi LuxR homologues, which are well-conserved master QS regulators in Vibrio species. Structural and biochemical analyses revealed that QStatin binds tightly to a putative ligand-binding pocket on SmcR, the LuxR homologue in V. vulnificus , and affects expression of QS-regulated genes. Remarkably, QStatin attenuated diverse QS-regulated phenotypes in various Vibrio species, including pathogenesis against brine shrimp, with no impact on bacterial viability. Taken together, the results suggest that QStatin may be a sustainable antivibriosis agent useful in aquacultures. Copyright © 2018 Kim et al.

Application of oxime-diversification to optimize ligand interactions within a cryptic pocket of the polo-like kinase 1 polo-box domain.

PubMed

Zhao, Xue Zhi; Hymel, David; Burke, Terrence R

2016-10-15

By a process involving initial screening of a set of 87 aldehydes using an oxime ligation-based strategy, we were able to achieve a several-fold affinity enhancement over one of the most potent previously known polo-like kinase 1 (Plk1) polo-box domain (PBD) binding inhibitors. This improved binding may result by accessing a newly identified auxiliary region proximal to a key hydrophobic cryptic pocket on the surface of the protein. Our findings could have general applicability to the design of PBD-binding antagonists. Published by Elsevier Ltd.

Crystal structures and biochemical analyses suggest a unique mechanism and role for human glycyl-tRNA synthetase in Ap4A homeostasis.

PubMed

Guo, Rey-Ting; Chong, Yeeting E; Guo, Min; Yang, Xiang-Lei

2009-10-16

Aminoacyl-tRNA synthetases catalyze the attachment of amino acids to their cognate tRNAs for protein synthesis. However, the aminoacylation reaction can be diverted to produce diadenosine tetraphosphate (Ap4A), a universal pleiotropic signaling molecule needed for cell regulation pathways. The only known mechanism for Ap4A production by a tRNA synthetase is through the aminoacylation reaction intermediate aminoacyl-AMP, thus making Ap4A synthesis amino acid-dependent. Here, we demonstrate a new mechanism for Ap4A synthesis. Crystal structures and biochemical analyses show that human glycyl-tRNA synthetase (GlyRS) produces Ap4A by direct condensation of two ATPs, independent of glycine concentration. Interestingly, whereas the first ATP-binding pocket is conserved for all class II tRNA synthetases, the second ATP pocket is formed by an insertion domain that is unique to GlyRS, suggesting that GlyRS is the only tRNA synthetase catalyzing direct Ap4A synthesis. A special role for GlyRS in Ap4A homeostasis is proposed.

Crystal Structures and Biochemical Analyses Suggest a Unique Mechanism and Role for Human Glycyl-tRNA Synthetase in Ap4A Homeostasis*

PubMed Central

Guo, Rey-Ting; Chong, Yeeting E.; Guo, Min; Yang, Xiang-Lei

2009-01-01

Aminoacyl-tRNA synthetases catalyze the attachment of amino acids to their cognate tRNAs for protein synthesis. However, the aminoacylation reaction can be diverted to produce diadenosine tetraphosphate (Ap4A), a universal pleiotropic signaling molecule needed for cell regulation pathways. The only known mechanism for Ap4A production by a tRNA synthetase is through the aminoacylation reaction intermediate aminoacyl-AMP, thus making Ap4A synthesis amino acid-dependent. Here, we demonstrate a new mechanism for Ap4A synthesis. Crystal structures and biochemical analyses show that human glycyl-tRNA synthetase (GlyRS) produces Ap4A by direct condensation of two ATPs, independent of glycine concentration. Interestingly, whereas the first ATP-binding pocket is conserved for all class II tRNA synthetases, the second ATP pocket is formed by an insertion domain that is unique to GlyRS, suggesting that GlyRS is the only tRNA synthetase catalyzing direct Ap4A synthesis. A special role for GlyRS in Ap4A homeostasis is proposed. PMID:19710017

Structural Insights into HIV Reverse Transcriptase Mutations Q151M and Q151M Complex That Confer Multinucleoside Drug Resistance

DOE Office of Scientific and Technical Information (OSTI.GOV)

Das, Kalyan; Martinez, Sergio E.; Arnold, Eddy

HIV-1 reverse transcriptase (RT) is targeted by multiple drugs. RT mutations that confer resistance to nucleoside RT inhibitors (NRTIs) emerge during clinical use. Q151M and four associated mutations, A62V, V75I, F77L, and F116Y, were detected in patients failing therapies with dideoxynucleosides (didanosine [ddI], zalcitabine [ddC]) and/or zidovudine (AZT). The cluster of the five mutations is referred to as the Q151M complex (Q151Mc), and an RT or virus containing Q151Mc exhibits resistance to multiple NRTIs. To understand the structural basis for Q151M and Q151Mc resistance, we systematically determined the crystal structures of the wild-type RT/double-stranded DNA (dsDNA)/dATP (complex I), wild-type RT/dsDNA/ddATPmore » (complex II), Q151M RT/dsDNA/dATP (complex III), Q151Mc RT/dsDNA/dATP (complex IV), and Q151Mc RT/dsDNA/ddATP (complex V) ternary complexes. The structures revealed that the deoxyribose rings of dATP and ddATP have 3'-endo and 3'-exo conformations, respectively. The single mutation Q151M introduces conformational perturbation at the deoxynucleoside triphosphate (dNTP)-binding pocket, and the mutated pocket may exist in multiple conformations. The compensatory set of mutations in Q151Mc, particularly F116Y, restricts the side chain flexibility of M151 and helps restore the DNA polymerization efficiency of the enzyme. The altered dNTP-binding pocket in Q151Mc RT has the Q151-R72 hydrogen bond removed and has a switched conformation for the key conserved residue R72 compared to that in wild-type RT. On the basis of a modeled structure of hepatitis B virus (HBV) polymerase, the residues R72, Y116, M151, and M184 in Q151Mc HIV-1 RT are conserved in wild-type HBV polymerase as residues R41, Y89, M171, and M204, respectively; functionally, both Q151Mc HIV-1 and wild-type HBV are resistant to dideoxynucleoside analogs.« less

Switch control pocket inhibitors of p38-MAP kinase. Durable type II inhibitors that do not require binding into the canonical ATP hinge region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ahn, Yu Mi; Clare, Michael; Ensinger, Carol L.

Switch control pocket inhibitors of p38-alpha kinase are described. Durable type II inhibitors were designed which bind to arginines (Arg67 or Arg70) that function as key residues for mediating phospho-threonine 180 dependant conformational fluxing of p38-alpha from an inactive type II state to an active type I state. Binding to Arg70 in particular led to potent inhibitors, exemplified by DP-802, which also exhibited high kinase selectivity. Binding to Arg70 obviated the requirement for binding into the ATP Hinge region. X-ray crystallography revealed that DP-802 and analogs induce an enhanced type II conformation upon binding to either the unphosphorylated or themore » doubly phosphorylated form of p38-alpha kinase.« less

Molecular characterization of the receptor binding structure-activity relationships of influenza B virus hemagglutinin.

PubMed

Carbone, V; Kim, H; Huang, J X; Baker, M A; Ong, C; Cooper, M A; Li, J; Rockman, S; Velkov, T

2013-01-01

Selectivity of α2,6-linked human-like receptors by B hemagglutinin (HA) is yet to be fully understood. This study integrates binding data with structure-recognition models to examine the impact of regional-specific sequence variations within the receptor-binding pocket on selectivity and structure activity relationships (SAR). The receptor-binding selectivity of influenza B HAs corresponding to either B/Victoria/2/1987 or the B/Yamagata/16/88 lineages was examined using surface plasmon resonance, solid-phase ELISA and gel-capture assays. Our SAR data showed that the presence of asialyl sugar units is the main determinant of receptor preference of α2,6 versus α2,3 receptor binding. Changes to the type of sialyl-glycan linkage present on receptors exhibit only a minor effect upon binding affinity. Homology-based structural models revealed that structural properties within the HA pocket, such as a glyco-conjugate at Asn194 on the 190-helix, sterically interfere with binding to avian receptor analogs by blocking the exit path of the asialyl sugars. Similarly, naturally occurring substitutions in the C-terminal region of the 190-helix and near the N-terminal end of the 140-loop narrows the horizontal borders of the binding pocket, which restricts access of the avian receptor analog LSTa. This study helps bridge the gap between ligand structure and receptor recognition for influenza B HA; and provides a consensus SAR model for the binding of human and avian receptor analogs to influenza B HA.

Revealing the favorable dissociation pathway of type II kinase inhibitors via enhanced sampling simulations and two-end-state calculations.

PubMed

Sun, Huiyong; Tian, Sheng; Zhou, Shunye; Li, Youyong; Li, Dan; Xu, Lei; Shen, Mingyun; Pan, Peichen; Hou, Tingjun

2015-02-13

How does a type II inhibitor bind to/unbind from a kinase target is still a confusing question because the small molecule occupies both the ATP pocket and the allosteric pocket of the kinase binding site. Here, by using enhanced sampling simulations (umbrella sampling, US) and two-end-state free energy calculations (MM/GSBA), we systemically studied the dissociation processes of two distinct small molecules escaping from the binding pocket of p38 MAP kinase through the allosteric channel and the ATP channel. The results show that the unbinding pathways along the allosteric channel have much lower PMF depths than those along the ATP channel, suggesting that the allosteric channel is more favorable for the dissociations of the two inhibitors and thereby supporting the general understanding that the largest channel of a target is usually the entry/exit pathway for the binding/dissociation of small molecules. Interestingly, the MM/GBSA approach yielded similar PMF profiles compared with those based on US, a much time consuming approach, indicating that for a general study, such as detecting the important transition state of a ligand binding/unbinding process, MM/GBSA may be a feasible choice.

Structure of a retro-binding peptide inhibitor complexed with human alpha-thrombin.

PubMed

Tabernero, L; Chang, C Y; Ohringer, S L; Lau, W F; Iwanowicz, E J; Han, W C; Wang, T C; Seiler, S M; Roberts, D G; Sack, J S

1995-02-10

The crystallographic structure of the ternary complex between human alpha-thrombin, hirugen and the peptidyl inhibitor Phe-alloThr-Phe-O-CH3, which is acylated at its N terminus with 4-guanidino butanoic acid (BMS-183507), has been determined at 2.6 A resolution. The structure reveals a unique "retro-binding" mode for this tripeptide active site inhibitor. The inhibitor binds with its alkyl-guanidine moiety in the primary specificity pocket and its two phenyl rings occupying the hydrophobic proximal and distal pockets of the thrombin active site. In this arrangement the backbone of the tripeptide forms a parallel beta-strand to the thrombin main-chain at the binding site. This is opposite to the orientation of the natural substrate, fibrinogen, and all the small active site-directed thrombin inhibitors whose bound structures have been previously reported. BMS-183507 is the first synthetic inhibitor proved to bind in a retro-binding fashion to thrombin, in a fashion similar to that of the N-terminal residues of the natural inhibitor hirudin. Furthermore, this new potent thrombin inhibitor (Ki = 17.2 nM) is selective for thrombin over other serine proteases tested and may be a template to be considered in designing hirudin-based thrombin inhibitors with interactions at the specificity pocket.

Conserved water-mediated recognition and dynamics of NAD+ (carboxamide group) to hIMPDH enzyme: water mimic approach toward the design of isoform-selective inhibitor.

PubMed

Bairagya, Hridoy R; Mishra, Deepak K; Mukhopadhyay, Bishnu P; Sekar, K

2014-01-01

Inosine monophosphate dehydrogenase (IMPDH) enzyme involves in GMP biosynthesis pathway. Type I hIMPDH is expressed at lower levels in all cells, whereas type II is especially observed in acute myelogenous leukemia, chronic myelogenous leukemia cancer cells, and 10 ns simulation of the IMP-NAD(+) complex structures (PDB ID. 1B3O and 1JCN) have revealed the presence of a few conserved hydrophilic centers near carboxamide group of NAD(+). Three conserved water molecules (W1, W, and W1') in di-nucleotide binding pocket of enzyme have played a significant role in the recognition of carboxamide group (of NAD(+)) to D274 and H93 residues. Based on H-bonding interaction of conserved hydrophilic (water molecular) centers within IMP-NAD(+)-enzyme complexes and their recognition to NAD(+), some covalent modification at carboxamide group of di-nucleotide (NAD(+)) has been made by substituting the -CONH2group by -CONHNH2 (carboxyl hydrazide group) using water mimic inhibitor design protocol. The modeled structure of modified ligand may, though, be useful for the development of antileukemic agent or it could be act as better inhibitor for hIMPDH-II.

Drug-like density: a method of quantifying the "bindability" of a protein target based on a very large set of pockets and drug-like ligands from the Protein Data Bank.

PubMed

Sheridan, Robert P; Maiorov, Vladimir N; Holloway, M Katharine; Cornell, Wendy D; Gao, Ying-Duo

2010-11-22

One approach to estimating the "chemical tractability" of a candidate protein target where we know the atomic resolution structure is to examine the physical properties of potential binding sites. A number of other workers have addressed this issue. We characterize ~290,000 "pockets" from ~42,000 protein crystal structures in terms of a three parameter "pocket space": volume, buriedness, and hydrophobicity. A metric DLID (drug-like density) measures how likely a pocket is to bind a drug-like molecule. This is calculated from the count of other pockets in its local neighborhood in pocket space that contain drug-like cocrystallized ligands and the count of total pockets in the neighborhood. Surprisingly, despite being defined locally, a global trend in DLID can be predicted by a simple linear regression on log(volume), buriedness, and hydrophobicity. Two levels of simplification are necessary to relate the DLID of individual pockets to "targets": taking the best DLID per Protein Data Bank (PDB) entry (because any given crystal structure can have many pockets), and taking the median DLID over all PDB entries for the same target (because different crystal structures of the same protein can vary because of artifacts and real conformational changes). We can show that median DLIDs for targets that are detectably homologous in sequence are reasonably similar and that median DLIDs correlate with the "druggability" estimate of Cheng et al. (Nature Biotechnology 2007, 25, 71-75).

Conserved ABC Transport System Regulated by the General Stress Response Pathways of Alpha- and Gammaproteobacteria.

PubMed

Herrou, Julien; Willett, Jonathan W; Czyż, Daniel M; Babnigg, Gyorgy; Kim, Youngchang; Crosson, Sean

2017-03-01

Brucella abortus σ E1 is an EcfG family sigma factor that regulates the transcription of dozens of genes in response to diverse stress conditions and is required for maintenance of chronic infection in a mouse model. A putative ATP-binding cassette transporter operon, bab1_0223-bab1_0226 , is among the most highly activated gene sets in the σ E1 regulon. The proteins encoded by the operon resemble quaternary ammonium-compatible solute importers but are most similar in sequence to the broadly conserved YehZYXW system, which remains largely uncharacterized. Transcription of yehZYXW is activated by the general stress sigma factor σ S in Enterobacteriaceae , which suggests a functional role for this transport system in bacterial stress response across the classes Alphaproteobacteria and Gammaproteobacteria We present evidence that B. abortus YehZYXW does not function as an importer of known compatible solutes under physiological conditions and does not contribute to the virulence defect of a σ E1 -null strain. The sole in vitro phenotype associated with genetic disruption of this putative transport system is reduced growth in the presence of high Li + ion concentrations. A crystal structure of B. abortus YehZ revealed a class II periplasmic binding protein fold with significant structural homology to Archaeoglobus fulgidus ProX, which binds glycine betaine. However, the structure of the YehZ ligand-binding pocket is incompatible with high-affinity binding to glycine betaine. This is consistent with weak measured binding of YehZ to glycine betaine and related compatible solutes. We conclude that YehZYXW is a conserved, stress-regulated transport system that is phylogenetically and functionally distinct from quaternary ammonium-compatible solute importers. IMPORTANCE Brucella abortus σ E1 regulates transcription in response to stressors encountered in its mammalian host and is necessary for maintenance of chronic infection in a mouse model. The functions of the majority of genes regulated by σ E1 remain undefined. We present a functional/structural analysis of a conserved putative membrane transport system (YehZYXW) whose expression is strongly activated by σ E1 Though annotated as a quaternary ammonium osmolyte uptake system, experimental physiological studies and measured ligand-binding properties of the periplasmic binding protein (PBP), YehZ, are inconsistent with this function. A crystal structure of B. abortus YehZ provides molecular insight into differences between bona fide quaternary ammonium osmolyte importers and YehZ-related proteins, which form a distinct phylogenetic and functional group of PBPs. Copyright © 2017 American Society for Microbiology.

Conserved ABC Transport System Regulated by the General Stress Response Pathways of Alpha- and Gammaproteobacteria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Herrou, Julien; Willett, Jonathan W.; Czyż, Daniel M.

ABSTRACT Brucella abortusσ E1is an EcfG family sigma factor that regulates the transcription of dozens of genes in response to diverse stress conditions and is required for maintenance of chronic infection in a mouse model. A putative ATP-binding cassette transporter operon,bab1_0223-bab1_0226, is among the most highly activated gene sets in the σ E1regulon. The proteins encoded by the operon resemble quaternary ammonium-compatible solute importers but are most similar in sequence to the broadly conserved YehZYXW system, which remains largely uncharacterized. Transcription ofyehZYXWis activated by the general stress sigma factor σ SinEnterobacteriaceae, which suggests a functional role for this transport systemmore » in bacterial stress response across the classesAlphaproteobacteriaandGammaproteobacteria. We present evidence thatB. abortusYehZYXW does not function as an importer of known compatible solutes under physiological conditions and does not contribute to the virulence defect of a σ E1-null strain. The solein vitrophenotype associated with genetic disruption of this putative transport system is reduced growth in the presence of high Li +ion concentrations. A crystal structure ofB. abortusYehZ revealed a class II periplasmic binding protein fold with significant structural homology toArchaeoglobus fulgidusProX, which binds glycine betaine. However, the structure of the YehZ ligand-binding pocket is incompatible with high-affinity binding to glycine betaine. This is consistent with weak measured binding of YehZ to glycine betaine and related compatible solutes. We conclude that YehZYXW is a conserved, stress-regulated transport system that is phylogenetically and functionally distinct from quaternary ammonium-compatible solute importers. IMPORTANCEBrucella abortusσ E1regulates transcription in response to stressors encountered in its mammalian host and is necessary for maintenance of chronic infection in a mouse model. The functions of the majority of genes regulated by σ E1remain undefined. We present a functional/structural analysis of a conserved putative membrane transport system (YehZYXW) whose expression is strongly activated by σ E1. Though annotated as a quaternary ammonium osmolyte uptake system, experimental physiological studies and measured ligand-binding properties of the periplasmic binding protein (PBP), YehZ, are inconsistent with this function. A crystal structure ofB. abortusYehZ provides molecular insight into differences between bona fide quaternary ammonium osmolyte importers and YehZ-related proteins, which form a distinct phylogenetic and functional group of PBPs.« less

Structural and Functional insights into the catalytic mechanism of the Type II NADH:quinone oxidoreductase family

PubMed Central

Marreiros, Bruno C.; Sena, Filipa V.; Sousa, Filipe M.; Oliveira, A. Sofia F.; Soares, Cláudio M.; Batista, Ana P.; Pereira, Manuela M.

2017-01-01

Type II NADH:quinone oxidoreductases (NDH-2s) are membrane proteins involved in respiratory chains. These proteins contribute indirectly to the establishment of the transmembrane difference of electrochemical potential by catalyzing the reduction of quinone by oxidation of NAD(P)H. NDH-2s are widespread enzymes being present in the three domains of life. In this work, we explored the catalytic mechanism of NDH-2 by investigating the common elements of all NDH-2s, based on the rationale that conservation of such elements reflects their structural/functional importance. We observed conserved sequence motifs and structural elements among 1762 NDH-2s. We identified two proton pathways possibly involved in the protonation of the quinone. Our results led us to propose the first catalytic mechanism for NDH-2 family, in which a conserved glutamate residue, E172 (in NDH-2 from Staphylococcus aureus) plays a key role in proton transfer to the quinone pocket. This catalytic mechanism may also be extended to the other members of the two-Dinucleotide Binding Domains Flavoprotein (tDBDF) superfamily, such as sulfide:quinone oxidoreductases. PMID:28181562

Discovering rules for protein-ligand specificity using support vector inductive logic programming.

PubMed

Kelley, Lawrence A; Shrimpton, Paul J; Muggleton, Stephen H; Sternberg, Michael J E

2009-09-01

Structural genomics initiatives are rapidly generating vast numbers of protein structures. Comparative modelling is also capable of producing accurate structural models for many protein sequences. However, for many of the known structures, functions are not yet determined, and in many modelling tasks, an accurate structural model does not necessarily tell us about function. Thus, there is a pressing need for high-throughput methods for determining function from structure. The spatial arrangement of key amino acids in a folded protein, on the surface or buried in clefts, is often the determinants of its biological function. A central aim of molecular biology is to understand the relationship between such substructures or surfaces and biological function, leading both to function prediction and to function design. We present a new general method for discovering the features of binding pockets that confer specificity for particular ligands. Using a recently developed machine-learning technique which couples the rule-discovery approach of inductive logic programming with the statistical learning power of support vector machines, we are able to discriminate, with high precision (90%) and recall (86%) between pockets that bind FAD and those that bind NAD on a large benchmark set given only the geometry and composition of the backbone of the binding pocket without the use of docking. In addition, we learn rules governing this specificity which can feed into protein functional design protocols. An analysis of the rules found suggests that key features of the binding pocket may be tied to conformational freedom in the ligand. The representation is sufficiently general to be applicable to any discriminatory binding problem. All programs and data sets are freely available to non-commercial users at http://www.sbg.bio.ic.ac.uk/svilp_ligand/.

Identification of transmembrane domain 6 & 7 residues that contribute to the binding pocket of the urotensin II receptor.

PubMed

Holleran, Brian J; Domazet, Ivana; Beaulieu, Marie-Eve; Yan, Li Ping; Guillemette, Gaétan; Lavigne, Pierre; Escher, Emanuel; Leduc, Richard

2009-04-15

Urotensin II (U-II), a cyclic undecapeptide, is the natural ligand of the urotensin II (UT) receptor, a G protein-coupled receptor. In the present study, we used the substituted-cysteine accessibility method to identify specific residues in transmembrane domains (TMDs) six and seven of the rat urotensin II receptor (rUT) that contribute to the formation of the binding pocket of the receptor. Each residue in the R256(6.32)-Q283(6.59) fragment of TMD6 and the A295(7.31)-T321(7.57) fragment of TMD7 was mutated, individually, to a cysteine. The resulting mutants were expressed in COS-7 cells, which were subsequently treated with the positively charged methanethiosulfonate-ethylammonium (MTSEA) or the negatively charged methanethiosulfonate-ethylsulfonate (MTSES) sulfhydryl-specific alkylating agents. MTSEA treatment resulted in a significant reduction in the binding of TMD6 mutants F268C(6.44) and W278C(6.54) and TMD7 mutants L298C(7.34), T302C(7.38), and T303C(7.39) to (125)I-U-II. MTSES treatment resulted in a significant reduction in the binding of two additional mutants, namely L282C(6.58) in TMD6 and Y300C(7.36) in TMD7. These results suggest that specific residues orient themselves within the water-accessible binding pocket of the rUT receptor. This approach, which allowed us to identify key determinants in TMD6 and TMD7 that contribute to the UT receptor binding pocket, enabled us to further refine our homology-based model of how U-II interacts with its cognate receptor.

The fifth transmembrane domain of angiotensin II Type 1 receptor participates in the formation of the ligand-binding pocket and undergoes a counterclockwise rotation upon receptor activation.

PubMed

Domazet, Ivana; Martin, Stéphane S; Holleran, Brian J; Morin, Marie-Eve; Lacasse, Patrick; Lavigne, Pierre; Escher, Emanuel; Leduc, Richard; Guillemette, Gaétan

2009-11-13

The octapeptide hormone angiotensin II exerts a wide variety of cardiovascular effects through the activation of the angiotensin II Type 1 (AT(1)) receptor, which belongs to the G protein-coupled receptor superfamily. Like other G protein- coupled receptors, the AT(1) receptor possesses seven transmembrane domains that provide structural support for the formation of the ligand-binding pocket. The role of the fifth transmembrane domain (TMD5) was investigated using the substituted cysteine accessibility method. All of the residues within Thr-190 to Leu-217 region were mutated one at a time to cysteine, and after expression in COS-7 cells, the mutant receptors were treated with the sulfhydryl-specific alkylating agent methanethiosulfonate-ethylammonium (MTSEA). MTSEA reacts selectively with water-accessible, free sulfhydryl groups of endogenous or introduced point mutation cysteines. If a cysteine is found in the binding pocket, the covalent modification will affect the binding kinetics of the ligand. MTSEA substantially decreased the binding affinity of L197C-AT(1), N200C-AT(1), I201C-AT(1), G203C-AT(1), and F204C-AT(1) mutant receptors, which suggests that these residues orient themselves within the water-accessible binding pocket of the AT(1) receptor. Interestingly, this pattern of acquired MTSEA sensitivity was altered for TMD5 reporter cysteines engineered in a constitutively active N111G-AT(1) receptor background. Indeed, mutant I201C-N111G-AT(1) became more sensitive to MTSEA, whereas mutant G203C-N111G-AT(1) lost some sensitivity. Our results suggest that constitutive activation of AT(1) receptor causes an apparent counterclockwise rotation of TMD5 as viewed from the extracellular side.

Structural Insights into Central Hypertension Regulation by Human Aminopeptidase A*

PubMed Central

Yang, Yang; Liu, Chang; Lin, Yi-Lun; Li, Fang

2013-01-01

Hypertension is regulated through both the central and systemic renin-angiotensin systems. In the central renin-angiotensin system, zinc-dependent aminopeptidase A (APA) up-regulates blood pressure by specifically cleaving the N-terminal aspartate, but not the adjacent arginine, from angiotensin II, a process facilitated by calcium. Here, we determined the crystal structures of human APA and its complexes with different ligands and identified a calcium-binding site in the S1 pocket of APA. Without calcium, the S1 pocket can bind both acidic and basic residues through formation of salt bridges with the charged side chains. In the presence of calcium, the binding of acidic residues is enhanced as they ligate the cation, whereas the binding of basic residues is no longer favorable due to charge repulsion. Of the peptidomimetic inhibitors of APA, amastatin has higher potency than bestatin by fitting better in the S1 pocket and interacting additionally with the S3′ subsite. These results explain the calcium-modulated substrate specificity of APA in central hypertension regulation and can guide the design and development of brain-targeting antihypertensive APA inhibitors. PMID:23888046

Differential Epitope Mapping by STD NMR Spectroscopy To Reveal the Nature of Protein-Ligand Contacts.

PubMed

Monaco, Serena; Tailford, Louise E; Juge, Nathalie; Angulo, Jesus

2017-11-27

Saturation transfer difference (STD) NMR spectroscopy is extensively used to obtain epitope maps of ligands binding to protein receptors, thereby revealing structural details of the interaction, which is key to direct lead optimization efforts in drug discovery. However, it does not give information about the nature of the amino acids surrounding the ligand in the binding pocket. Herein, we report the development of the novel method differential epitope mapping by STD NMR (DEEP-STD NMR) for identifying the type of protein residues contacting the ligand. The method produces differential epitope maps through 1) differential frequency STD NMR and/or 2) differential solvent (D 2 O/H 2 O) STD NMR experiments. The two approaches provide different complementary information on the binding pocket. We demonstrate that DEEP-STD NMR can be used to readily obtain pharmacophore information on the protein. Furthermore, if the 3D structure of the protein is known, this information also helps in orienting the ligand in the binding pocket. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

Structural insights into central hypertension regulation by human aminopeptidase A.

PubMed

Yang, Yang; Liu, Chang; Lin, Yi-Lun; Li, Fang

2013-08-30

Hypertension is regulated through both the central and systemic renin-angiotensin systems. In the central renin-angiotensin system, zinc-dependent aminopeptidase A (APA) up-regulates blood pressure by specifically cleaving the N-terminal aspartate, but not the adjacent arginine, from angiotensin II, a process facilitated by calcium. Here, we determined the crystal structures of human APA and its complexes with different ligands and identified a calcium-binding site in the S1 pocket of APA. Without calcium, the S1 pocket can bind both acidic and basic residues through formation of salt bridges with the charged side chains. In the presence of calcium, the binding of acidic residues is enhanced as they ligate the cation, whereas the binding of basic residues is no longer favorable due to charge repulsion. Of the peptidomimetic inhibitors of APA, amastatin has higher potency than bestatin by fitting better in the S1 pocket and interacting additionally with the S3' subsite. These results explain the calcium-modulated substrate specificity of APA in central hypertension regulation and can guide the design and development of brain-targeting antihypertensive APA inhibitors.

Switch II Mutants Reveal Coupling between the Nucleotide- and Actin-Binding Regions in Myosin V

PubMed Central

Trivedi, Darshan V.; David, Charles; Jacobs, Donald J.; Yengo, Christopher M.

2012-01-01

Conserved active-site elements in myosins and other P-loop NTPases play critical roles in nucleotide binding and hydrolysis; however, the mechanisms of allosteric communication among these mechanoenzymes remain unresolved. In this work we introduced the E442A mutation, which abrogates a salt-bridge between switch I and switch II, and the G440A mutation, which abolishes a main-chain hydrogen bond associated with the interaction of switch II with the γ phosphate of ATP, into myosin V. We used fluorescence resonance energy transfer between mant-labeled nucleotides or IAEDANS-labeled actin and FlAsH-labeled myosin V to examine the conformation of the nucleotide- and actin-binding regions, respectively. We demonstrate that in the absence of actin, both the G440A and E442A mutants bind ATP with similar affinity and result in only minor alterations in the conformation of the nucleotide-binding pocket (NBP). In the presence of ADP and actin, both switch II mutants disrupt the formation of a closed NBP actomyosin.ADP state. The G440A mutant also prevents ATP-induced opening of the actin-binding cleft. Our results indicate that the switch II region is critical for stabilizing the closed NBP conformation in the presence of actin, and is essential for communication between the active site and actin-binding region. PMID:22713570

Crystal Structure of Cockroach Allergen Bla g 2, an Unusual Zinc Binding Aspartic Protease with a Novel Mode of Self-inhibition

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gustchina, Alla; Li, Mi; Wunschmann, Sabina

2010-07-19

The crystal structure of Bla g 2 was solved in order to investigate the structural basis for the allergenic properties of this unusual protein. This is the first structure of an aspartic protease in which conserved glycine residues, in two canonical DTG triads, are substituted by different amino acid residues. Another unprecedented feature revealed by the structure is the single phenylalanine residue insertion on the tip of the flap, with the side-chain occupying the S1 binding pocket. This and other important amino acid substitutions in the active site region of Bla g 2 modify the interactions in the vicinity ofmore » the catalytic aspartate residues, increasing the distance between them to {approx}4 {angstrom} and establishing unique direct contacts between the flap and the catalytic residues. We attribute the absence of substantial catalytic activity in Bla g 2 to these unusual features of the active site. Five disulfide bridges and a Zn-binding site confer stability to the protein, which may contribute to sensitization at lower levels of exposure than other allergens.« less

Flavonol Activation Defines an Unanticipated Ligand-Binding Site in the Kinase-RNase Domain of IRE1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiseman, R. Luke; Zhang, Yuhong; Lee, Kenneth P.K.

2010-08-18

Signaling in the most conserved branch of the endoplasmic reticulum (ER) unfolded protein response (UPR) is initiated by sequence-specific cleavage of the HAC1/XBP1 mRNA by the ER stress-induced kinase-endonuclease IRE1. We have discovered that the flavonol quercetin activates yeast IRE1's RNase and potentiates activation by ADP, a natural activating ligand that engages the IRE1 nucleotide-binding cleft. Enzyme kinetics and the structure of a cocrystal of IRE1 complexed with ADP and quercetin reveal engagement by quercetin of an unanticipated ligand-binding pocket at the dimer interface of IRE1's kinase extension nuclease (KEN) domain. Analytical ultracentrifugation and crosslinking studies support the preeminence ofmore » enhanced dimer formation in quercetin's mechanism of action. These findings hint at the existence of endogenous cytoplasmic ligands that may function alongside stress signals from the ER lumen to modulate IRE1 activity and at the potential for the development of drugs that modify UPR signaling from this unanticipated site.« less

Identification of YTH Domain-Containing Proteins as the Readers for N1-Methyladenosine in RNA.

PubMed

Dai, Xiaoxia; Wang, Tianlu; Gonzalez, Gwendolyn; Wang, Yinsheng

2018-06-05

N1-methyladenosine (m 1 A) is an important post-transcriptional modification in RNA; however, the exact biological role of m 1 A remains to be determined. By employing a quantitative proteomics method, we identified multiple putative protein readers of m 1 A in RNA, including several YTH domain family proteins. We showed that YTHDF1-3 and YTHDC1, but not YTHDC2, could bind directly to m 1 A in RNA. We also found that Trp 432 in YTHDF2, a conserved residue in the hydrophobic pocket of the YTH domain that is necessary for its binding to N 6 -methyladenosine (m 6 A), is required for its recognition of m 1 A. An analysis of previously published data revealed transcriptome-wide colocalization of YTH domain-containing proteins and m 1 A sites in HeLa cells, suggesting that YTH domain-containing proteins can bind to m 1 A in cells. Together, our results uncovered YTH domain-containing proteins as readers for m 1 A in RNA and provided new insight into the functions of m 1 A in RNA biology.

The substrate binding domains of human SIAH E3 ubiquitin ligases are now crystal clear

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Qi; Wang, Zhongduo; Hou, Feng

2017-01-01

Seven in absentia homologs (SIAHs) comprise a family of highly conserved E3 ubiquitin ligases that play an important role in regulating signalling pathways in tumorigenesis, including the DNA damage repair and hypoxia response pathways. SIAH1 and SIAH2 have been found to function as a tumour repressor and a proto-oncogene, respectively, despite the high sequence identity of their substrate binding domains (SBDs). Ubiquitin-specific protease USP19 is a deubiquitinase that forms a complex with SIAHs and counteracts the ligase function. Much effort has been made to find selective inhibitors of the SIAHs E3 ligases. Menadione was reported to inhibit SIAH2 specifically. Wemore » used X-ray crystallography, peptide array, bioinformatic analysis, and biophysical techniques to characterize the structure and interaction of SIAHs with deubiquitinases and literature reported compounds. We solved the crystal structures of SIAH1 in complex with a USP19 peptide and of the apo form SIAH2. Phylogenetic analysis revealed the SIAH/USP19 complex is conserved in evolution. We demonstrated that menadione destabilizes both SIAH1 and SIAH2 non-specifically through covalent modification. The SBDs of SIAH E3 ligases are structurally similar with a subtle stability difference. USP19 is the only deubiquitinase that directly binds to SIAHs through the substrate binding pocket. Menadione is not a specific inhibitor for SIAH2. The crystallographic models provide structural insights into the substrate binding of the SIAH family E3 ubiquitin ligases that are critically involved in regulating cancer-related pathways. Our results suggest caution should be taken when using menadione as a specific SIAH2 inhibitor.« less

Molecular basis for the recognition of cyclic-di-AMP by PstA, a PII-like signal transduction protein.

PubMed

Choi, Philip H; Sureka, Kamakshi; Woodward, Joshua J; Tong, Liang

2015-06-01

Cyclic-di-AMP (c-di-AMP) is a broadly conserved bacterial second messenger that is of importance in bacterial physiology. The molecular receptors mediating the cellular responses to the c-di-AMP signal are just beginning to be discovered. PstA is a previously uncharacterized PII -like protein which has been identified as a c-di-AMP receptor. PstA is widely distributed and conserved among Gram-positive bacteria in the phylum Firmicutes. Here, we report the biochemical, structural, and functional characterization of PstA from Listeria monocytogenes. We have determined the crystal structures of PstA in the c-di-AMP-bound and apo forms at 1.6 and 2.9 Å resolution, respectively, which provide the molecular basis for its specific recognition of c-di-AMP. PstA forms a homotrimer structure that has overall similarity to the PII protein family which binds ATP. However, PstA is markedly different from PII proteins in the loop regions, and these structural differences mediate the specific recognition of their respective nucleotide ligand. The residues composing the c-di-AMP binding pocket are conserved, suggesting that c-di-AMP recognition by PstA is of functional importance. Disruption of pstA in L. monocytogenes affected c-di-AMP-mediated alterations in bacterial growth and lysis. Overall, we have defined the PstA family as a conserved and specific c-di-AMP receptor in bacteria. © 2015 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

Sialylneolacto-N-tetraose c (LSTc)-bearing Liposomal Decoys Capture Influenza A Virus*

PubMed Central

Hendricks, Gabriel L.; Weirich, Kim L.; Viswanathan, Karthik; Li, Jing; Shriver, Zachary H.; Ashour, Joseph; Ploegh, Hidde L.; Kurt-Jones, Evelyn A.; Fygenson, Deborah K.; Finberg, Robert W.; Comolli, James C.; Wang, Jennifer P.

2013-01-01

Influenza is a severe disease in humans and animals with few effective therapies available. All strains of influenza virus are prone to developing drug resistance due to the high mutation rate in the viral genome. A therapeutic agent that targets a highly conserved region of the virus could bypass resistance and also be effective against multiple strains of influenza. Influenza uses many individually weak ligand binding interactions for a high avidity multivalent attachment to sialic acid-bearing cells. Polymerized sialic acid analogs can form multivalent interactions with influenza but are not ideal therapeutics due to solubility and toxicity issues. We used liposomes as a novel means for delivery of the glycan sialylneolacto-N-tetraose c (LSTc). LSTc-bearing decoy liposomes form multivalent, polymer-like interactions with influenza virus. Decoy liposomes competitively bind influenza virus in hemagglutination inhibition assays and inhibit infection of target cells in a dose-dependent manner. Inhibition is specific for influenza virus, as inhibition of Sendai virus and respiratory syncytial virus is not observed. In contrast, monovalent LSTc does not bind influenza virus or inhibit infectivity. LSTc decoy liposomes prevent the spread of influenza virus during multiple rounds of replication in vitro and extend survival of mice challenged with a lethal dose of virus. LSTc decoy liposomes co-localize with fluorescently tagged influenza virus, whereas control liposomes do not. Considering the conservation of the hemagglutinin binding pocket and the ability of decoy liposomes to form high avidity interactions with influenza hemagglutinin, our decoy liposomes have potential as a new therapeutic agent against emerging influenza strains. PMID:23362274

Molecular simulation to investigate the cofactor specificity for pichia stipitis Xylose reductase.

PubMed

Xia, Xiao-Le; Cong, Shan; Weng, Xiao-Rong; Chen, Jin-Hua; Wang, Jing-Fang; Chou, Kuo-Chen

2013-11-01

Xylose is one of the most abundant carbohydrates in nature, and widely used to produce bioethanol via fermentation in industry. Xylulose can produce two key enzymes: xylose reductase and xylitol dehydrogenase. Owing to the disparate cofactor specificities of xylose reductase and xylitol dehydrogenase, intracellular redox imbalance is detected during the xylose fermentation, resulting in low ethanol yields. To overcome this barrier, a common strategy is applied to artificially modify the cofactor specificity of xylose reductase. In this study, we utilized molecular simulation approaches to construct a 3D (three-dimensional) structural model for the NADP-dependent Pichia stipitis xylose reductase (PsXR). Based on the 3D model, the favourable binding modes for both cofactors NAD and NADP were obtained using the flexible docking procedure and molecular dynamics simulation. Structural analysis of the favourable binding modes showed that the cofactor binding site of PsXR was composed of 3 major components: a hydrophilic pocket, a hydrophobic pocket as well as a linker channel between the aforementioned two pockets. The hydrophilic pocket could recognize the nicotinamide moiety of the cofactors by hydrogen bonding networks, while the hydrophobic pocket functioned to position the adenine moiety of the cofactors by hydrophobic and Π-Π stacking interactions. The linker channel contained some key residues for ligand-binding; their mutation could have impact to the specificity of PsXR. Finally, it was found that any of the two single mutations, K21A and K270N, might reverse the cofactor specificity of PsXR from major NADP- to NADdependent, which was further confirmed by the additional experiments. Our findings may provide useful insights into the cofactor specificity of PsXR, stimulating new strategies for better designing xylose reductase and improving ethanol production in industry.

Key role of hydrazine to the interaction between oxaloacetic against phosphoenolpyruvic carboxykinase (PEPCK): ONIOM calculations.

PubMed

Prajongtat, Pongthep; Phromyothin, Darinee Sae-Tang; Hannongbua, Supa

2013-08-01

The interactions between oxaloacetic (OAA) and phosphoenolpyruvic carboxykinase (PEPCK) binding pocket in the presence and absence of hydrazine were carried out using quantum chemical calculations, based on the two-layered ONIOM (ONIOM2) approach. The complexes were partially optimized by ONIOM2 (B3LYP/6-31G(d):PM6) method while the interaction energies between OAA and individual residues surrounding the pocket were performed at the MP2/6-31G(d,p) level of theory. The calculated interaction energies (INT) indicated that Arg87, Gly237, Ser286, and Arg405 are key residues for binding to OAA with the INT values of -1.93, -2.06, -2.47, and -3.16 kcal mol(-1), respectively. The interactions are mainly due to the formation of hydrogen bonding interactions with OAA. Moreover, using ONIOM2 (B3LYP/6-31G(d):PM6) applied on the PEPCKHS complex, two proton transfers were observed; first, the proton was transferred from the carboxylic group of OAA to hydrazine while the second one was from Asp311 to Lys244. Such reactions cause the generation of binding strength of OAA to the pocket via electrostatic interaction. The orientations of Lys243, Lys244, His264, Asp311, Phe333, and Arg405 were greatly deviated after hydrazine incorporation. These indicate that hydrazine plays an important role in terms of not only changing the conformation of the binding pocket, but is also tightly bound to OAA resulting in its conformation change in the pocket. The understanding of such interaction can be useful for the design of hydrazine-based inhibitor for antichachexia agents.

Mechanistic Characterization and Molecular Modeling of Hepatitis B Virus Polymerase Resistance to Entecavir

PubMed Central

Walsh, Ann W.; Langley, David R.; Colonno, Richard J.; Tenney, Daniel J.

2010-01-01

Background Entecavir (ETV) is a deoxyguanosine analog competitive inhibitor of hepatitis B virus (HBV) polymerase that exhibits delayed chain termination of HBV DNA. A high barrier to entecavir-resistance (ETVr) is observed clinically, likely due to its potency and a requirement for multiple resistance changes to overcome suppression. Changes in the HBV polymerase reverse-transcriptase (RT) domain involve lamivudine-resistance (LVDr) substitutions in the conserved YMDD motif (M204V/I ± L180M), plus an additional ETV-specific change at residues T184, S202 or M250. These substitutions surround the putative dNTP binding site or primer grip regions of the HBV RT. Methods/Principal Findings To determine the mechanistic basis for ETVr, wildtype, lamivudine-resistant (M204V, L180M) and ETVr HBVs were studied using in vitro RT enzyme and cell culture assays, as well as molecular modeling. Resistance substitutions significantly reduced ETV incorporation and chain termination in HBV DNA and increased the ETV-TP inhibition constant (Ki) for HBV RT. Resistant HBVs exhibited impaired replication in culture and reduced enzyme activity (kcat) in vitro. Molecular modeling of the HBV RT suggested that ETVr residue T184 was adjacent to and stabilized S202 within the LVDr YMDD loop. ETVr arose through steric changes at T184 or S202 or by disruption of hydrogen-bonding between the two, both of which repositioned the loop and reduced the ETV-triphosphate (ETV-TP) binding pocket. In contrast to T184 and S202 changes, ETVr at primer grip residue M250 was observed during RNA-directed DNA synthesis only. Experimentally, M250 changes also impacted the dNTP-binding site. Modeling suggested a novel mechanism for M250 resistance, whereby repositioning of the primer-template component of the dNTP-binding site shifted the ETV-TP binding pocket. No structural data are available to confirm the HBV RT modeling, however, results were consistent with phenotypic analysis of comprehensive substitutions of each ETVr position. Conclusions Altogether, ETVr occurred through exclusion of ETV-TP from the dNTP-binding site, through different, novel mechanisms that involved lamivudine-resistance, ETV-specific substitutions, and the primer-template. PMID:20169198

Mechanistic characterization and molecular modeling of hepatitis B virus polymerase resistance to entecavir.

PubMed

Walsh, Ann W; Langley, David R; Colonno, Richard J; Tenney, Daniel J

2010-02-12

Entecavir (ETV) is a deoxyguanosine analog competitive inhibitor of hepatitis B virus (HBV) polymerase that exhibits delayed chain termination of HBV DNA. A high barrier to entecavir-resistance (ETVr) is observed clinically, likely due to its potency and a requirement for multiple resistance changes to overcome suppression. Changes in the HBV polymerase reverse-transcriptase (RT) domain involve lamivudine-resistance (LVDr) substitutions in the conserved YMDD motif (M204V/I +/- L180M), plus an additional ETV-specific change at residues T184, S202 or M250. These substitutions surround the putative dNTP binding site or primer grip regions of the HBV RT. To determine the mechanistic basis for ETVr, wildtype, lamivudine-resistant (M204V, L180M) and ETVr HBVs were studied using in vitro RT enzyme and cell culture assays, as well as molecular modeling. Resistance substitutions significantly reduced ETV incorporation and chain termination in HBV DNA and increased the ETV-TP inhibition constant (K(i)) for HBV RT. Resistant HBVs exhibited impaired replication in culture and reduced enzyme activity (k(cat)) in vitro. Molecular modeling of the HBV RT suggested that ETVr residue T184 was adjacent to and stabilized S202 within the LVDr YMDD loop. ETVr arose through steric changes at T184 or S202 or by disruption of hydrogen-bonding between the two, both of which repositioned the loop and reduced the ETV-triphosphate (ETV-TP) binding pocket. In contrast to T184 and S202 changes, ETVr at primer grip residue M250 was observed during RNA-directed DNA synthesis only. Experimentally, M250 changes also impacted the dNTP-binding site. Modeling suggested a novel mechanism for M250 resistance, whereby repositioning of the primer-template component of the dNTP-binding site shifted the ETV-TP binding pocket. No structural data are available to confirm the HBV RT modeling, however, results were consistent with phenotypic analysis of comprehensive substitutions of each ETVr position. Altogether, ETVr occurred through exclusion of ETV-TP from the dNTP-binding site, through different, novel mechanisms that involved lamivudine-resistance, ETV-specific substitutions, and the primer-template.

Structure of the Biliverdin Cofactor in the Pfr State of Bathy and Prototypical Phytochromes*

PubMed Central

Salewski, Johannes; Escobar, Francisco Velazquez; Kaminski, Steve; von Stetten, David; Keidel, Anke; Rippers, Yvonne; Michael, Norbert; Scheerer, Patrick; Piwowarski, Patrick; Bartl, Franz; Frankenberg-Dinkel, Nicole; Ringsdorf, Simone; Gärtner, Wolfgang; Lamparter, Tilman; Mroginski, Maria Andrea; Hildebrandt, Peter

2013-01-01

Phytochromes act as photoswitches between the red- and far-red absorbing parent states of phytochromes (Pr and Pfr). Plant phytochromes display an additional thermal conversion route from the physiologically active Pfr to Pr. The same reaction pattern is found in prototypical biliverdin-binding bacteriophytochromes in contrast to the reverse thermal transformation in bathy bacteriophytochromes. However, the molecular origin of the different thermal stabilities of the Pfr states in prototypical and bathy bacteriophytochromes is not known. We analyzed the structures of the chromophore binding pockets in the Pfr states of various bathy and prototypical biliverdin-binding phytochromes using a combined spectroscopic-theoretical approach. For the Pfr state of the bathy phytochrome from Pseudomonas aeruginosa, the very good agreement between calculated and experimental Raman spectra of the biliverdin cofactor is in line with important conclusions of previous crystallographic analyses, particularly the ZZEssa configuration of the chromophore and its mode of covalent attachment to the protein. The highly homogeneous chromophore conformation seems to be a unique property of the Pfr states of bathy phytochromes. This is in sharp contrast to the Pfr states of prototypical phytochromes that display conformational equilibria between two sub-states exhibiting small structural differences at the terminal methine bridges A-B and C-D. These differences may mainly root in the interactions of the cofactor with the highly conserved Asp-194 that occur via its carboxylate function in bathy phytochromes. The weaker interactions via the carbonyl function in prototypical phytochromes may lead to a higher structural flexibility of the chromophore pocket opening a reaction channel for the thermal (ZZE → ZZZ) Pfr to Pr back-conversion. PMID:23603902

Optimization of a binding fragment targeting the "enlarged methionine pocket" leads to potent Trypanosoma brucei methionyl-tRNA synthetase inhibitors.

PubMed

Huang, Wenlin; Zhang, Zhongsheng; Ranade, Ranae M; Gillespie, J Robert; Barros-Álvarez, Ximena; Creason, Sharon A; Shibata, Sayaka; Verlinde, Christophe L M J; Hol, Wim G J; Buckner, Frederick S; Fan, Erkang

2017-06-15

Potent inhibitors of Trypanosoma brucei methionyl-tRNA synthetase were previously designed using a structure-guided approach. Compounds 1 and 2 were the most active compounds in the cyclic and linear linker series, respectively. To further improve cellular potency, SAR investigation of a binding fragment targeting the "enlarged methionine pocket" (EMP) was performed. The optimization led to the identification of a 6,8-dichloro-tetrahydroquinoline ring as a favorable fragment to bind the EMP. Replacement of 3,5-dichloro-benzyl group (the EMP binding fragment) of inhibitor 2 using this tetrahydroquinoline fragment resulted in compound 13, that exhibited an EC 50 of 4nM. Copyright © 2017 Elsevier Ltd. All rights reserved.

Identification of COUP-TFII Orphan Nuclear Receptor as a Retinoic Acid-Activated Receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kruse, Schoen W; Suino-Powell, Kelly; Zhou, X Edward

2010-01-12

The chicken ovalbumin upstream promoter-transcription factors (COUP-TFI and II) make up the most conserved subfamily of nuclear receptors that play key roles in angiogenesis, neuronal development, organogenesis, cell fate determination, and metabolic homeostasis. Although the biological functions of COUP-TFs have been studied extensively, little is known of their structural features or aspects of ligand regulation. Here we report the ligand-free 1.48 {angstrom} crystal structure of the human COUP-TFII ligand-binding domain. The structure reveals an autorepressed conformation of the receptor, where helix {alpha}10 is bent into the ligand-binding pocket and the activation function-2 helix is folded into the cofactor binding site,more » thus preventing the recruitment of coactivators. In contrast, in multiple cell lines, COUP-TFII exhibits constitutive transcriptional activity, which can be further potentiated by nuclear receptor coactivators. Mutations designed to disrupt cofactor binding, dimerization, and ligand binding, substantially reduce the COUP-TFII transcriptional activity. Importantly, retinoid acids are able to promote COUP-TFII to recruit coactivators and activate a COUP-TF reporter construct. Although the concentration needed is higher than the physiological levels of retinoic acids, these findings demonstrate that COUP-TFII is a ligand-regulated nuclear receptor, in which ligands activate the receptor by releasing it from the autorepressed conformation.« less

Chlorella virus DNA ligase: nick recognition and mutational analysis.

PubMed

Sriskanda, V; Shuman, S

1998-01-15

Chlorella virus PBCV-1 DNA ligase seals nicked DNA substrates consisting of a 5'-phosphate-terminated strand and a 3'-hydroxyl-terminated strand annealed to a bridging DNA template strand. The enzyme discriminates at the DNA binding step between substrates containing a 5'-phosphate versus a 5'-hydroxyl at the nick. Mutational analysis of the active site motif KxDGxR (residues 27-32) illuminates essential roles for the conserved Lys, Asp and Arg moieties at different steps of the ligase reaction. Mutant K27A is unable to form the covalent ligase-(Lys-straightepsilonN-P)-adenylate intermediate and hence cannot activate a nicked DNA substrate via formation of the DNA-adenylate intermediate. Nonetheless, K27A catalyzes phosphodiester bond formation at a pre-adenylated nick. This shows that the active site lysine is not required for the strand closure reaction. K27A binds to nicked DNA-adenylate, but not to a standard DNA nick. This suggests that occupancy of the AMP binding pocket of DNA ligase is important for nick recognition. Mutant D29A is active in enzyme-adenylate formation and binds readily to nicked DNA, but is inert in DNA-adenylate formation. R32A is unable to catalyze any of the three reactions of the ligation pathway and does not bind to nicked DNA.

Cations Stiffen Actin Filaments by Adhering a Key Structural Element to Adjacent Subunits

PubMed Central

2016-01-01

Ions regulate the assembly and mechanical properties of actin filaments. Recent work using structural bioinformatics and site-specific mutagenesis favors the existence of two discrete and specific divalent cation binding sites on actin filaments, positioned in the long axis between actin subunits. Cation binding at one site drives polymerization, while the other modulates filament stiffness and plays a role in filament severing by the regulatory protein, cofilin. Existing structural methods have not been able to resolve filament-associated cations, and so in this work we turn to molecular dynamics simulations to suggest a candidate binding pocket geometry for each site and to elucidate the mechanism by which occupancy of the “stiffness site” affects filament mechanical properties. Incorporating a magnesium ion in the “polymerization site” does not seem to require any large-scale change to an actin subunit’s conformation. Binding of a magnesium ion in the “stiffness site” adheres the actin DNase-binding loop (D-loop) to its long-axis neighbor, which increases the filament torsional stiffness and bending persistence length. Our analysis shows that bound D-loops occupy a smaller region of accessible conformational space. Cation occupancy buries key conserved residues of the D-loop, restricting accessibility to regulatory proteins and enzymes that target these amino acids. PMID:27146246

Heparin octasaccharide decoy liposomes inhibit replication of multiple viruses.

PubMed

Hendricks, Gabriel L; Velazquez, Lourdes; Pham, Serena; Qaisar, Natasha; Delaney, James C; Viswanathan, Karthik; Albers, Leila; Comolli, James C; Shriver, Zachary; Knipe, David M; Kurt-Jones, Evelyn A; Fygenson, Deborah K; Trevejo, Jose M; Wang, Jennifer P; Finberg, Robert W

2015-04-01

Heparan sulfate (HS) is a ubiquitous glycosaminoglycan that serves as a cellular attachment site for a number of significant human pathogens, including respiratory syncytial virus (RSV), human parainfluenza virus 3 (hPIV3), and herpes simplex virus (HSV). Decoy receptors can target pathogens by binding to the receptor pocket on viral attachment proteins, acting as 'molecular sinks' and preventing the pathogen from binding to susceptible host cells. Decoy receptors functionalized with HS could bind to pathogens and prevent infection, so we generated decoy liposomes displaying HS-octasaccharide (HS-octa). These decoy liposomes significantly inhibited RSV, hPIV3, and HSV infectivity in vitro to a greater degree than the original HS-octa building block. The degree of inhibition correlated with the density of HS-octa displayed on the liposome surface. Decoy liposomes with HS-octa inhibited infection of viruses to a greater extent than either full-length heparin or HS-octa alone. Decoy liposomes were effective when added prior to infection or following the initial infection of cells in vitro. By targeting the well-conserved receptor-binding sites of HS-binding viruses, decoy liposomes functionalized with HS-octa are a promising therapeutic antiviral agent and illustrate the utility of the liposome delivery platform. Copyright © 2015 Elsevier B.V. All rights reserved.

Switch control pocket inhibitors of p38-MAP kinase. Durable type II inhibitors that do not require binding into the canonical ATP hinge region.

PubMed

Ahn, Yu Mi; Clare, Michael; Ensinger, Carol L; Hood, Molly M; Lord, John W; Lu, Wei-Ping; Miller, David F; Patt, William C; Smith, Bryan D; Vogeti, Lakshminarayana; Kaufman, Michael D; Petillo, Peter A; Wise, Scott C; Abendroth, Jan; Chun, Lawrence; Clark, Robin; Feese, Michael; Kim, Hidong; Stewart, Lance; Flynn, Daniel L

2010-10-01

Switch control pocket inhibitors of p38-alpha kinase are described. Durable type II inhibitors were designed which bind to arginines (Arg67 or Arg70) that function as key residues for mediating phospho-threonine 180 dependant conformational fluxing of p38-alpha from an inactive type II state to an active type I state. Binding to Arg70 in particular led to potent inhibitors, exemplified by DP-802, which also exhibited high kinase selectivity. Binding to Arg70 obviated the requirement for binding into the ATP Hinge region. X-ray crystallography revealed that DP-802 and analogs induce an enhanced type II conformation upon binding to either the unphosphorylated or the doubly phosphorylated form of p38-alpha kinase. Copyright © 2010 Elsevier Ltd. All rights reserved.

Determinants of the heme-CO vibrational modes in the H-NOX family†

PubMed Central

Tran, Rosalie; Weinert, Emily E.; Boon, Elizabeth M.; Mathies, Richard A.; Marletta, Michael A.

2011-01-01

The H-NOX family of proteins have important functions in gaseous ligand signaling in organisms from bacteria to humans, including nitric oxide (NO) sensing in mammals, and provide a model system for probing ligand selectivity in hemoproteins. A unique vibrational feature that is ubiquitous throughout the Heme-Nitric oxide/OXygen binding (H-NOX) family is the presence of a high C-O stretching frequency. To investigate the cause of this spectroscopic characteristic, the Fe-CO and C-O stretching frequencies were probed in the H-NOX domain from Thermoanaerobacter tengcongensis (Tt H-NOX) using resonance Raman (RR) spectroscopy. Four classes of heme pocket mutants were generated to assess the changes in stretching frequency: (i) the distal H-bonding network, (ii) the proximal histidine ligand, (iii) modulation of the heme conformation via Ile-5 and Pro-115, and (iv) the conserved Tyr-Ser-Arg (YxSxR) motif. These mutations revealed important electrostatic interactions that dampen the back-donation of the FeII dπ electrons into the CO π* orbitals. The most significant change occurred upon disruption of the H-bonds between the strictly conserved YxSxR motif and the heme propionate groups, producing two dominant CO-bound heme conformations. One conformer was structurally similar to Tt H-NOX WT; whereas the other displayed a decrease in ν(C-O) of up to ~70 cm−1 relative to the WT protein, with minimal changes in ν(Fe-CO). Taken together, these results show that the electrostatic interactions in the Tt H-NOX binding pocket are primarily responsible for the high ν(C-O) by decreasing the Fe dπ → CO π* back-donation, and suggest that the dominant mechanism by which this family modulates the FeII-CO bond likely involves the YxSxR motif. PMID:21714509

Identification of amino acid residues in protein SRP72 required for binding to a kinked 5e motif of the human signal recognition particle RNA.

PubMed

Iakhiaeva, Elena; Iakhiaev, Alexei; Zwieb, Christian

2010-11-13

Human cells depend critically on the signal recognition particle (SRP) for the sorting and delivery of their proteins. The SRP is a ribonucleoprotein complex which binds to signal sequences of secretory polypeptides as they emerge from the ribosome. Among the six proteins of the eukaryotic SRP, the largest protein, SRP72, is essential for protein targeting and possesses a poorly characterized RNA binding domain. We delineated the minimal region of SRP72 capable of forming a stable complex with an SRP RNA fragment. The region encompassed residues 545 to 585 of the full-length human SRP72 and contained a lysine-rich cluster (KKKKKKKKGK) at postions 552 to 561 as well as a conserved Pfam motif with the sequence PDPXRWLPXXER at positions 572 to 583. We demonstrated by site-directed mutagenesis that both regions participated in the formation of a complex with the RNA. In agreement with biochemical data and results from chymotryptic digestion experiments, molecular modeling of SRP72 implied that the invariant W577 was located inside the predicted structure of an RNA binding domain. The 11-nucleotide 5e motif contained within the SRP RNA fragment was shown by comparative electrophoresis on native polyacrylamide gels to conform to an RNA kink-turn. The model of the complex suggested that the conserved A240 of the K-turn, previously identified as being essential for the binding to SRP72, could protrude into a groove of the SRP72 RNA binding domain, similar but not identical to how other K-turn recognizing proteins interact with RNA. The results from the presented experiments provided insights into the molecular details of a functionally important and structurally interesting RNA-protein interaction. A model for how a ligand binding pocket of SRP72 can accommodate a new RNA K-turn in the 5e region of the eukaryotic SRP RNA is proposed.

Identification of amino acid residues in protein SRP72 required for binding to a kinked 5e motif of the human signal recognition particle RNA

PubMed Central

2010-01-01

Background Human cells depend critically on the signal recognition particle (SRP) for the sorting and delivery of their proteins. The SRP is a ribonucleoprotein complex which binds to signal sequences of secretory polypeptides as they emerge from the ribosome. Among the six proteins of the eukaryotic SRP, the largest protein, SRP72, is essential for protein targeting and possesses a poorly characterized RNA binding domain. Results We delineated the minimal region of SRP72 capable of forming a stable complex with an SRP RNA fragment. The region encompassed residues 545 to 585 of the full-length human SRP72 and contained a lysine-rich cluster (KKKKKKKKGK) at postions 552 to 561 as well as a conserved Pfam motif with the sequence PDPXRWLPXXER at positions 572 to 583. We demonstrated by site-directed mutagenesis that both regions participated in the formation of a complex with the RNA. In agreement with biochemical data and results from chymotryptic digestion experiments, molecular modeling of SRP72 implied that the invariant W577 was located inside the predicted structure of an RNA binding domain. The 11-nucleotide 5e motif contained within the SRP RNA fragment was shown by comparative electrophoresis on native polyacrylamide gels to conform to an RNA kink-turn. The model of the complex suggested that the conserved A240 of the K-turn, previously identified as being essential for the binding to SRP72, could protrude into a groove of the SRP72 RNA binding domain, similar but not identical to how other K-turn recognizing proteins interact with RNA. Conclusions The results from the presented experiments provided insights into the molecular details of a functionally important and structurally interesting RNA-protein interaction. A model for how a ligand binding pocket of SRP72 can accommodate a new RNA K-turn in the 5e region of the eukaryotic SRP RNA is proposed. PMID:21073748

Staphylococcus aureus MurC participates in L-alanine recognition via histidine 343, a conserved motif in the shallow hydrophobic pocket.

PubMed

Kurokawa, Kenji; Nishida, Satoshi; Ishibashi, Mihoko; Mizumura, Hikaru; Ueno, Kohji; Yutsudo, Takashi; Maki, Hideki; Murakami, Kazuhisa; Sekimizu, Kazuhisa

2008-03-01

UDP-N-acetylmuramic acid:L-alanine ligase that is encoded by the murC gene, is indispensable for bacterial peptidoglycan biosynthesis and an important target for the development of antibacterial agents. Structure of MurC ligase with substrates has been described, however, little validation via studying the effects of mutations on the structure of MurC has been performed. In this study, we carried out a functional in vitro and in vivo characterization of Staphylococcus aureus MurCH343Y protein that has a temperature-sensitive mutation of a conserved residue in the predicted shallow hydrophobic pocket that holds a short L-alanine side chain. Purified H343Y and wild-type MurC had K(m) values for L-alanine of 3.2 and 0.44 mM, respectively, whereas there was no significant difference in their K(m) values for ATP and UDP-N-acetylmuramic acid, suggesting the specific alteration of L-alanine recognition in MurCH343Y protein. In a synthetic medium that excluded L-alanine, S. aureus murCH343Y mutant cells showed an allele-specific slow growth phenotype that was suppressed by addition of L-alanine. These results suggest that His343 of S. aureus MurC is essential for high-affinity binding to L-alanine both in vitro and in vivo and provide experimental evidence supporting the structural information of MurC ligase.

Recognition of Nucleoside Monophosphate Substrates by Haemophilus influenzae Class C Acid Phosphatase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Harkewal; Schuermann, Jonathan P.; Reilly, Thomas J.

2010-12-08

The e (P4) phosphatase from Haemophilus influenzae functions in a vestigial NAD{sup +} utilization pathway by dephosphorylating nicotinamide mononucleotide to nicotinamide riboside. P4 is also the prototype of class C acid phosphatases (CCAPs), which are nonspecific 5{prime},3{prime}-nucleotidases localized to the bacterial outer membrane. To understand substrate recognition by P4 and other class C phosphatases, we have determined the crystal structures of a substrate-trapping mutant P4 enzyme complexed with nicotinamide mononucleotide, 5{prime}-AMP, 3{prime}-AMP, and 2{prime}-AMP. The structures reveal an anchor-shaped substrate-binding cavity comprising a conserved hydrophobic box that clamps the nucleotide base, a buried phosphoryl binding site, and three solvent-filled pocketsmore » that contact the ribose and the hydrogen-bonding edge of the base. The span between the hydrophobic box and the phosphoryl site is optimal for recognizing nucleoside monophosphates, explaining the general preference for this class of substrate. The base makes no hydrogen bonds with the enzyme, consistent with an observed lack of base specificity. Two solvent-filled pockets flanking the ribose are key to the dual recognition of 5{prime}-nucleotides and 3{prime}-nucleotides. These pockets minimize the enzyme's direct interactions with the ribose and provide sufficient space to accommodate 5{prime} substrates in an anti conformation and 3{prime} substrates in a syn conformation. Finally, the structures suggest that class B acid phosphatases and CCAPs share a common strategy for nucleotide recognition.« less

The Structural Basis of [beta]-Peptide-Specific Cleavage by the Serine Protease Cyanophycinase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Law, Adrienne M.; Lai, Sandy W.S.; Tavares, John

2010-10-01

Cyanophycin, or poly-L-Asp-multi-L-Arg, is a non-ribosomally synthesized peptidic polymer that is used for nitrogen storage by cyanobacteria and other select eubacteria. Upon synthesis, it self-associates to form insoluble granules, the degradation of which is uniquely catalyzed by a carboxy-terminal-specific protease, cyanophycinase. We have determined the structure of cyanophycinase from the freshwater cyanobacterium Synechocystis sp. PCC6803 at 1.5-{angstrom} resolution, showing that the structure is dimeric, with individual protomers resembling aspartyl dipeptidase. Kinetic characterization of the enzyme demonstrates that the enzyme displays Michaelis-Menten kinetics with a k{sub cat} of 16.5 s{sup -1} and a k{sub cat}/K{sub M} of 7.5 x 10{sup -6}more » M{sup -1} s{sup -1}. Site-directed mutagenesis experiments confirm that cyanophycinase is a serine protease and that Gln101, Asp172, Gln173, Arg178, Arg180 and Arg183, which form a conserved pocket adjacent to the catalytic Ser132, are functionally critical residues. Modeling indicates that cyanophycinase binds the {beta}-Asp-Arg dipeptide residue immediately N-terminal to the scissile bond in an extended conformation in this pocket, primarily recognizing this penultimate {beta}-Asp-Arg residue of the polymeric chain. Because binding and catalysis depend on substrate features unique to {beta}-linked aspartyl peptides, cyanophycinase is able to act within the cytosol without non-specific cleavage events disrupting essential cellular processes.« less

Crystal Structure of Silkworm Bombyx mori JHBP in Complex With 2-Methyl-2,4-Pentanediol: Plasticity of JH-Binding Pocket and Ligand-Induced Conformational Change of the Second Cavity in JHBP

PubMed Central

Fujimoto, Zui; Suzuki, Rintaro; Shiotsuki, Takahiro; Tsuchiya, Wataru; Tase, Akira; Momma, Mitsuru; Yamazaki, Toshimasa

2013-01-01

Juvenile hormones (JHs) control a diversity of crucial life events in insects. In Lepidoptera which major agricultural pests belong to, JH signaling is critically controlled by a species-specific high-affinity, low molecular weight JH-binding protein (JHBP) in hemolymph, which transports JH from the site of its synthesis to target tissues. Hence, JHBP is expected to be an excellent target for the development of novel specific insect growth regulators (IGRs) and insecticides. A better understanding of the structural biology of JHBP should pave the way for the structure-based drug design of such compounds. Here, we report the crystal structure of the silkworm Bombyx mori JHBP in complex with two molecules of 2-methyl-2,4-pentanediol (MPD), one molecule (MPD1) bound in the JH-binding pocket while the other (MPD2) in a second cavity. Detailed comparison with the apo-JHBP and JHBP-JH II complex structures previously reported by us led to a number of intriguing findings. First, the JH-binding pocket changes its size in a ligand-dependent manner due to flexibility of the gate α1 helix. Second, MPD1 mimics interactions of the epoxide moiety of JH previously observed in the JHBP-JH complex, and MPD can compete with JH in binding to the JH-binding pocket. We also confirmed that methoprene, which has an MPD-like structure, inhibits the complex formation between JHBP and JH while the unepoxydated JH III (methyl farnesoate) does not. These findings may open the door to the development of novel IGRs targeted against JHBP. Third, binding of MPD to the second cavity of JHBP induces significant conformational changes accompanied with a cavity expansion. This finding, together with MPD2-JHBP interaction mechanism identified in the JHBP-MPD complex, should provide important guidance in the search for the natural ligand of the second cavity. PMID:23437107

Crystal structure of the Candida albicans Kar3 kinesin motor domain fused to maltose-binding protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Delorme, Caroline; Joshi, Monika; Allingham, John S., E-mail: allinghj@queensu.ca

2012-11-30

Highlights: Black-Right-Pointing-Pointer The Candida albicans Kar3 motor domain structure was solved as a maltose-binding protein fusion. Black-Right-Pointing-Pointer The electrostatic surface and part of the ATPase pocket of the motor domain differs markedly from other kinesins. Black-Right-Pointing-Pointer The MBP-Kar3 interface highlights a new site for intramolecular or intermolecular interactions. -- Abstract: In the human fungal pathogen Candida albicans, the Kinesin-14 motor protein Kar3 (CaKar3) is critical for normal mitotic division, nuclear fusion during mating, and morphogenic transition from the commensal yeast form to the virulent hyphal form. As a first step towards detailed characterization of this motor of potential medical significance,more » we have crystallized and determined the X-ray structure of the motor domain of CaKar3 as a maltose-binding protein (MBP) fusion. The structure shows strong conservation of overall motor domain topology to other Kar3 kinesins, but with some prominent differences in one of the motifs that compose the nucleotide-binding pocket and the surface charge distribution. The MBP and Kar3 modules are arranged such that MBP interacts with the Kar3 motor domain core at the same site where the neck linker of conventional kinesins docks during the 'ATP state' of the mechanochemical cycle. This site differs from the Kar3 neck-core interface in the recent structure of the ScKar3Vik1 heterodimer. The position of MBP is also completely distinct from the Vik1 subunit in this complex. This may suggest that the site of MBP interaction on the CaKar3 motor domain provides an interface for the neck, or perhaps a partner subunit, at an intermediate state of its motile cycle that has not yet been observed for Kinesin-14 motors.« less

Structural and mechanistic insights into phospholipid transfer by Ups1-Mdm35 in mitochondria

NASA Astrophysics Data System (ADS)

Watanabe, Yasunori; Tamura, Yasushi; Kawano, Shin; Endo, Toshiya

2015-08-01

Eukaryotic cells are compartmentalized into membrane-bounded organelles whose functions rely on lipid trafficking to achieve membrane-specific compositions of lipids. Here we focused on the Ups1-Mdm35 system, which mediates phosphatidic acid (PA) transfer between the outer and inner mitochondrial membranes, and determined the X-ray structures of Mdm35 and Ups1-Mdm35 with and without PA. The Ups1-Mdm35 complex constitutes a single domain that has a deep pocket and flexible Ω-loop lid. Structure-based mutational analyses revealed that a basic residue at the pocket bottom and the Ω-loop lid are important for PA extraction from the membrane following Ups1 binding. Ups1 binding to the membrane is enhanced by the dissociation of Mdm35. We also show that basic residues around the pocket entrance are important for Ups1 binding to the membrane and PA extraction. These results provide a structural basis for understanding the mechanism of PA transfer between mitochondrial membranes.

Assembly-directed antivirals differentially bind quasiequivalent pockets to modify hepatitis B virus capsid tertiary and quaternary structure.

PubMed

Katen, Sarah P; Tan, Zhenning; Chirapu, Srinivas Reddy; Finn, M G; Zlotnick, Adam

2013-08-06

Hepatitis B virus (HBV) is a major cause of liver disease. Assembly of the HBV capsid is a critical step in virus production and an attractive target for new antiviral therapies. We determined the structure of HBV capsid in complex with AT-130, a member of the phenylpropenamide family of assembly effectors. AT-130 causes tertiary and quaternary structural changes but does not disrupt capsid structure. AT-130 binds a hydrophobic pocket that also accommodates the previously characterized heteroaryldihydropyrimidine compounds but favors a unique quasiequivalent location on the capsid surface. Thus, this pocket is a promiscuous drug-binding site and a likely target for different assembly effectors with a broad range of mechanisms of activity. That AT-130 successfully decreases virus production by increasing capsid assembly rate without disrupting capsid structure delineates a paradigm in antiviral design, that disrupting reaction timing is a viable strategy for assembly effectors of HBV and other viruses. Copyright © 2013 Elsevier Ltd. All rights reserved.

Docking and scoring with ICM: the benchmarking results and strategies for improvement

PubMed Central

Neves, Marco A. C.; Totrov, Maxim; Abagyan, Ruben

2012-01-01

Flexible docking and scoring using the Internal Coordinate Mechanics software (ICM) was benchmarked for ligand binding mode prediction against the 85 co-crystal structures in the modified Astex data set. The ICM virtual ligand screening was tested against the 40 DUD target benchmarks and 11-target WOMBAT sets. The self-docking accuracy was evaluated for the top 1 and top 3 scoring poses at each ligand binding site with near native conformations below 2 Å RMSD found in 91% and 95% of the predictions, respectively. The virtual ligand screening using single rigid pocket conformations provided the median area under the ROC curves equal to 69.4 with 22.0% true positives recovered at 2% false positive rate. Significant improvements up to ROC AUC= 82.2 and ROC(2%)= 45.2 were achieved following our best practices for flexible pocket refinement and out-of-pocket binding rescore. The virtual screening can be further improved by considering multiple conformations of the target. PMID:22569591

The structure of the SBP-Tag–streptavidin complex reveals a novel helical scaffold bridging binding pockets on separate subunits

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barrette-Ng, Isabelle H.; Wu, Sau-Ching; Tjia, Wai-Mui

2013-05-01

The structure of the SBP-Tag–streptavidin complex reveals a novel mode of peptide recognition in which a single peptide binds simultaneously to biotin-binding pockets from adjacent subunits of streptavidin. The molecular details of peptide recognition suggest how the SBP-Tag can be further modified to become an even more useful tag for a wider range of biotechnological applications. The 38-residue SBP-Tag binds to streptavidin more tightly (K{sub d} ≃ 2.5–4.9 nM) than most if not all other known peptide sequences. Crystallographic analysis at 1.75 Å resolution shows that the SBP-Tag binds to streptavidin in an unprecedented manner by simultaneously interacting with biotin-bindingmore » pockets from two separate subunits. An N-terminal HVV peptide sequence (residues 12–14) and a C-terminal HPQ sequence (residues 31–33) form the bulk of the direct interactions between the SBP-Tag and the two biotin-binding pockets. Surprisingly, most of the peptide spanning these two sites (residues 17–28) adopts a regular α-helical structure that projects three leucine side chains into a groove formed at the interface between two streptavidin protomers. The crystal structure shows that residues 1–10 and 35–38 of the original SBP-Tag identified through in vitro selection and deletion analysis do not appear to contact streptavidin and thus may not be important for binding. A 25-residue peptide comprising residues 11–34 (SBP-Tag2) was synthesized and shown using surface plasmon resonance to bind streptavidin with very similar affinity and kinetics when compared with the SBP-Tag. The SBP-Tag2 was also added to the C-terminus of β-lactamase and was shown to be just as effective as the full-length SBP-Tag in affinity purification. These results validate the molecular structure of the SBP-Tag–streptavidin complex and establish a minimal bivalent streptavidin-binding tag from which further rational design and optimization can proceed.« less

SVM prediction of ligand-binding sites in bacterial lipoproteins employing shape and physio-chemical descriptors.

PubMed

Kadam, Kiran; Prabhakar, Prashant; Jayaraman, V K

2012-11-01

Bacterial lipoproteins play critical roles in various physiological processes including the maintenance of pathogenicity and numbers of them are being considered as potential candidates for generating novel vaccines. In this work, we put forth an algorithm to identify and predict ligand-binding sites in bacterial lipoproteins. The method uses three types of pocket descriptors, namely fpocket descriptors, 3D Zernike descriptors and shell descriptors, and combines them with Support Vector Machine (SVM) method for the classification. The three types of descriptors represent shape-based properties of the pocket as well as its local physio-chemical features. All three types of descriptors, along with their hybrid combinations are evaluated with SVM and to improve classification performance, WEKA-InfoGain feature selection is applied. Results obtained in the study show that the classifier successfully differentiates between ligand-binding and non-binding pockets. For the combination of three types of descriptors, 10 fold cross-validation accuracy of 86.83% is obtained for training while the selected model achieved test Matthews Correlation Coefficient (MCC) of 0.534. Individually or in combination with new and existing methods, our model can be a very useful tool for the prediction of potential ligand-binding sites in bacterial lipoproteins.

Meiotic recombination protein Rec12: functional conservation, crossover homeostasis and early crossover/non-crossover decision

PubMed Central

Kan, Fengling; Davidson, Mari K.; Wahls, Wayne P.

2011-01-01

In fission yeast and other eukaryotes, Rec12 (Spo11) is thought to catalyze the formation of dsDNA breaks (DSBs) that initiate homologous recombination in meiosis. Rec12 is orthologous to the catalytic subunit of topoisomerase VI (Top6A). Guided by the crystal structure of Top6A, we engineered the rec12 locus to encode Rec12 proteins each with a single amino acid substitution in a conserved residue. Of 21 substitutions, 10 significantly reduced or abolished meiotic DSBs, gene conversion, crossover recombination and the faithful segregation of chromosomes. Critical residues map within the metal ion-binding pocket toprim (E179A, D229A, D231A), catalytic region 5Y-CAP (R94A, D95A, Y98F) and the DNA-binding interface (K201A, G202E, R209A, K242A). A subset of substitutions reduced DSBs but maintained crossovers, demonstrating crossover homeostasis. Furthermore, a strong separation of function mutation (R304A) suggests that the crossover/non-crossover decision is established early by a protein–protein interaction surface of Rec12. Fission yeast has multiple crossovers per bivalent, and chromosome segregation was robust above a threshold of about one crossover per bivalent, below which non-disjunction occurred. These results support structural and functional conservation among Rec12/Spo11/Top6A family members for the catalysis of DSBs, and they reveal how Rec12 regulates other features of meiotic chromosome dynamics. PMID:21030440

Agonist trapped in ATP-binding sites of the P2X2 receptor.

PubMed

Jiang, Ruotian; Lemoine, Damien; Martz, Adeline; Taly, Antoine; Gonin, Sophie; Prado de Carvalho, Lia; Specht, Alexandre; Grutter, Thomas

2011-05-31

ATP-gated P2X receptors are trimeric ion channels, as recently confirmed by X-ray crystallography. However, the structure was solved without ATP and even though extracellular intersubunit cavities surrounded by conserved amino acid residues previously shown to be important for ATP function were proposed to house ATP, the localization of the ATP sites remains elusive. Here we localize the ATP-binding sites by creating, through a proximity-dependent "tethering" reaction, covalent bonds between a synthesized ATP-derived thiol-reactive P2X2 agonist (NCS-ATP) and single cysteine mutants engineered in the putative binding cavities of the P2X2 receptor. By combining whole-cell and single-channel recordings, we report that NCS-ATP covalently and specifically labels two previously unidentified positions N140 and L186 from two adjacent subunits separated by about 18 Å in a P2X2 closed state homology model, suggesting the existence of at least two binding modes. Tethering reaction at both positions primes subsequent agonist binding, yet with distinct functional consequences. Labeling of one position impedes subsequent ATP function, which results in inefficient gating, whereas tethering of the other position, although failing to produce gating by itself, enhances subsequent ATP function. Our results thus define a large and dynamic intersubunit ATP-binding pocket and suggest that receptors trapped in covalently agonist-bound states differ in their ability to gate the ion channel.

Using Metadynamics to Understand the Mechanism of Calmodulin/Target Recognition at Atomic Detail

PubMed Central

Fiorin, G.; Pastore, A.; Carloni, P.; Parrinello, M.

2006-01-01

The ability of calcium-bound calmodulin (CaM) to recognize most of its target peptides is caused by its binding to two hydrophobic residues (‘anchors’). In most of the CaM complexes, the anchors pack against the hydrophobic pockets of the CaM domains and are surrounded by fully conserved Met side chains. Here, by using metadynamics simulations, we investigate quantitatively the energetics of the final step of this process using the M13 peptide, which has a high affinity and spans the sequence of the skeletal myosin light chain kinase, an important natural CaM target. We established the accuracy of our calculations by a comparison between calculated and NMR-derived structural and dynamical properties. Our calculations provide novel insights into the mechanism of protein/peptide recognition: we show that the process is associated with a free energy gain similar to that experimentally measured for the CaM complex with the homologous smooth muscle MLCK peptide (Ehrhardt et al., 1995, Biochemistry 34, 2731). We suggest that binding is dominated by the entropic effect, in agreement with previous proposals. Furthermore, we explain the role of conserved methionines by showing that the large flexibility of these side chains is a key feature of the binding mechanism. Finally, we provide a rationale for the experimental observation that in all CaM complexes the C-terminal domain seems to be hierarchically more important in establishing the interaction. PMID:16877506

Structure-based Understanding of Binding Affinity and Mode of Estrogen Receptor α Agonists and Antagonists.

EPA Science Inventory

The flexible hydrophobic ligand binding pocket (LBP) of estrogen receptor α (ERα) allows the binding of a wide variety of endocrine disruptors. Upon ligand binding, the LBP reshapes around the contours of the ligand and stabilizes the complex by complementary hydrophobic interact...

Structure-Based Understanding of Binding Affinity and Mode of Estrogen Receptor α Agonists and Antagonists

EPA Science Inventory

The flexible hydrophobic ligand binding pocket (LBP) of estrogen receptor α (ERα) allows the binding of a wide variety of endocrine disruptors. Upon ligand binding, the LBP reshapes around the contours of the ligand and stabilizes the complex by complementary hydrophobic interact...

A crystal structure of the bifunctional antibiotic simocyclinone D8, bound to DNA gyrase.

PubMed

Edwards, Marcus J; Flatman, Ruth H; Mitchenall, Lesley A; Stevenson, Clare E M; Le, Tung B K; Clarke, Thomas A; McKay, Adam R; Fiedler, Hans-Peter; Buttner, Mark J; Lawson, David M; Maxwell, Anthony

2009-12-04

Simocyclinones are bifunctional antibiotics that inhibit bacterial DNA gyrase by preventing DNA binding to the enzyme. We report the crystal structure of the complex formed between the N-terminal domain of the Escherichia coli gyrase A subunit and simocyclinone D8, revealing two binding pockets that separately accommodate the aminocoumarin and polyketide moieties of the antibiotic. These are close to, but distinct from, the quinolone-binding site, consistent with our observations that several mutations in this region confer resistance to both agents. Biochemical studies show that the individual moieties of simocyclinone D8 are comparatively weak inhibitors of gyrase relative to the parent compound, but their combination generates a more potent inhibitor. Our results should facilitate the design of drug molecules that target these unexploited binding pockets.

BI-2 destabilizes HIV-1 cores during infection and Prevents Binding of CPSF6 to the HIV-1 Capsid.

PubMed

Fricke, Thomas; Buffone, Cindy; Opp, Silvana; Valle-Casuso, Jose; Diaz-Griffero, Felipe

2014-12-11

The recently discovered small-molecule BI-2 potently blocks HIV-1 infection. BI-2 binds to the N-terminal domain of HIV-1 capsid. BI-2 utilizes the same capsid pocket used by the small molecule PF74. Although both drugs bind to the same pocket, it has been proposed that BI-2 uses a different mechanism to block HIV-1 infection when compared to PF74. This work demonstrates that BI-2 destabilizes the HIV-1 core during infection, and prevents the binding of the cellular factor CPSF6 to the HIV-1 core. Overall this short-form paper suggests that BI-2 is using a similar mechanism to the one used by PF74 to block HIV-1 infection.

Small Molecule Inhibitors That Selectively Block Dengue Virus Methyltransferase*

PubMed Central

Lim, Siew Pheng; Sonntag, Louis Sebastian; Noble, Christian; Nilar, Shahul H.; Ng, Ru Hui; Zou, Gang; Monaghan, Paul; Chung, Ka Yan; Dong, Hongping; Liu, Boping; Bodenreider, Christophe; Lee, Gladys; Ding, Mei; Chan, Wai Ling; Wang, Gang; Jian, Yap Li; Chao, Alexander Theodore; Lescar, Julien; Yin, Zheng; Vedananda, T. R.; Keller, Thomas H.; Shi, Pei-Yong

2011-01-01

Crystal structure analysis of Flavivirus methyltransferases uncovered a flavivirus-conserved cavity located next to the binding site for its cofactor, S-adenosyl-methionine (SAM). Chemical derivatization of S-adenosyl-homocysteine (SAH), the product inhibitor of the methylation reaction, with substituents that extend into the identified cavity, generated inhibitors that showed improved and selective activity against dengue virus methyltransferase (MTase), but not related human enzymes. Crystal structure of dengue virus MTase with a bound SAH derivative revealed that its N6-substituent bound in this cavity and induced conformation changes in residues lining the pocket. These findings demonstrate that one of the major hurdles for the development of methyltransferase-based therapeutics, namely selectivity for disease-related methyltransferases, can be overcome. PMID:21147775

A new mutation in MT-ND1 m.3928G>C p.V208L causes Leigh disease with infantile spasms.

PubMed

Wray, Carter D; Friederich, Marisa W; du Sart, Desiree; Pantaleo, Sarah; Smet, Joél; Kucera, Cathlin; Fenton, Laura; Scharer, Gunter; Van Coster, Rudy; Van Hove, Johan L K

2013-11-01

New mutations in mitochondrial DNA encoded genes of complex I are rarely reported. An infant developed Leigh disease with infantile spasms. Complex I enzyme activity was deficient and response to increasing coenzyme Q concentrations was reduced. Complex I assembly was intact. A new mutation in MT-ND1 m.3928G>C p.V208L, affecting a conserved amino acid in a critical domain, part of the coenzyme Q binding pocket, was present at high heteroplasmy. The unaffected mother did not carry measurable mutant mitochondrial DNA, but concern remained for gonadal mosaicism. Prenatal testing was possible for a subsequent sibling. The ND1 p.V208L mutation causes Leigh disease. © 2013.

The MPS1 Family of Protein Kinases

PubMed Central

Liu, Xuedong; Winey, Mark

2014-01-01

MPS1 protein kinases are found widely, but not ubiquitously, in eukaryotes. This family of potentially dual-specific protein kinases is among several that regulate a number of steps of mitosis. The most widely conserved MPS1 kinase functions involve activities at the kinetochore in both the chromosome attachment and the spindle checkpoint. MPS1 kinases also function at centrosomes. Beyond mitosis, MPS1 kinases have been implicated in development, cytokinesis, and several different signaling pathways. Family members are identified by virtue of a conserved C-terminal kinase domain, though the N-terminal domain is quite divergent. The kinase domain of the human enzyme has been crystallized, revealing an unusual ATP-binding pocket. The activity, level, and subcellular localization of Mps1 family members are tightly regulated during cell-cycle progression. The mitotic functions of Mps1 kinases and their overexpression in some tumors have prompted the identification of Mps1 inhibitors and their active development as anticancer drugs. PMID:22482908

Structural insights into the specific binding of huntingtin proline-rich region with the SH3 and WW domains.

PubMed

Gao, Yong-Guang; Yan, Xian-Zhong; Song, Ai-Xin; Chang, Yong-Gang; Gao, Xue-Chao; Jiang, Nan; Zhang, Qi; Hu, Hong-Yu

2006-12-01

The interactions of huntingtin (Htt) with the SH3 domain- or WW domain-containing proteins have been implicated in the pathogenesis of Huntington's disease (HD). We report the specific interactions of Htt proline-rich region (PRR) with the SH3GL3-SH3 domain and HYPA-WW1-2 domain pair by NMR. The results show that Htt PRR binds with the SH3 domain through nearly its entire chain, and that the binding region on the domain includes the canonical PxxP-binding site and the specificity pocket. The C terminus of PRR orients to the specificity pocket, whereas the N terminus orients to the PxxP-binding site. Htt PRR can also specifically bind to WW1-2; the N-terminal portion preferentially binds to WW1, while the C-terminal portion binds to WW2. This study provides structural insights into the specific interactions between Htt PRR and its binding partners as well as the alteration of these interactions that involve PRR, which may have implications for the understanding of HD.

Crystal Structure of a Phosphorylation-coupled Saccharide Transporter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Y Cao; X Jin; E Levin

Saccharides have a central role in the nutrition of all living organisms. Whereas several saccharide uptake systems are shared between the different phylogenetic kingdoms, the phosphoenolpyruvate-dependent phosphotransferase system exists almost exclusively in bacteria. This multi-component system includes an integral membrane protein EIIC that transports saccharides and assists in their phosphorylation. Here we present the crystal structure of an EIIC from Bacillus cereus that transports diacetylchitobiose. The EIIC is a homodimer, with an expansive interface formed between the amino-terminal halves of the two protomers. The carboxy-terminal half of each protomer has a large binding pocket that contains a diacetylchitobiose, which ismore » occluded from both sides of the membrane with its site of phosphorylation near the conserved His250 and Glu334 residues. The structure shows the architecture of this important class of transporters, identifies the determinants of substrate binding and phosphorylation, and provides a framework for understanding the mechanism of sugar translocation.« less

Structural studies of the nudix hydrolase DR1025 from deinococcus radiodurans and its ligand complexes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ranatunga, Wasantha; Hill, Emma E.; Mooster, Jana L.

We have determined the crystal structure, at 1.4, of the Nudix hydrolase DR1025 from the extremely radiation resistant bacterium Deinococcus radiodurans. The protein forms an intertwined homodimer by exchanging N-terminal segments between chains. We have identified additional conserved elements of the Nudix fold, including the metal-binding motif, a kinked b-strand characterized by a proline two positions upstream of the Nudix consensus sequence, and participation of the N-terminal extension in the formation of the substrate-binding pocket. Crystal structures were also solved of DR1025 crystallized in the presence of magnesium and either a GTP analog or Ap4A (both at 1.6 resolution). Inmore » the Ap4Aco-crystal, the electron density indicated that the product of asymmetric hydrolysis, ATP, was bound to the enzyme. The GTP analog bound structure showed that GTP was bound almost identically as ATP. Neither nucleoside triphosphate was further cleaved.« less

Neutron Crystal Structure of RAS GTPase Puts in Question the Protonation State of the GTP γ-Phosphate*

PubMed Central

Knihtila, Ryan; Holzapfel, Genevieve; Weiss, Kevin; Meilleur, Flora; Mattos, Carla

2015-01-01

RAS GTPase is a prototype for nucleotide-binding proteins that function by cycling between GTP and GDP, with hydrogen atoms playing an important role in the GTP hydrolysis mechanism. It is one of the most well studied proteins in the superfamily of small GTPases, which has representatives in a wide range of cellular functions. These proteins share a GTP-binding pocket with highly conserved motifs that promote hydrolysis to GDP. The neutron crystal structure of RAS presented here strongly supports a protonated γ-phosphate at physiological pH. This counters the notion that the phosphate groups of GTP are fully deprotonated at the start of the hydrolysis reaction, which has colored the interpretation of experimental and computational data in studies of the hydrolysis mechanism. The neutron crystal structure presented here puts in question our understanding of the pre-catalytic state associated with the hydrolysis reaction central to the function of RAS and other GTPases. PMID:26515069

Neutron crystal structure of RAS GTPase puts in question the protonation state of the GTP γ-phosphate

DOE PAGES

Knihtila, Ryan; Holzapfel, Genevieve; Weiss, Kevin; ...

2015-10-29

RAS GTPase is a prototype for nucleotide-binding proteins that function by cycling between GTP and GDP, with hydrogen atoms playing an important role in the GTP hydrolysis mechanism. It is one of the most well studied proteins in the superfamily of small GTPases, which has representatives in a wide range of cellular functions. These proteins share a GTP-binding pocket with highly conserved motifs that promote hydrolysis to GDP. The neutron crystal structure of RAS presented here strongly supports a protonated gamma-phosphate at physiological pH. This counters the notion that the phosphate groups of GTP are fully deprotonated at the startmore » of the hydrolysis reaction, which has colored the interpretation of experimental and computational data in studies of the hydrolysis mechanism. As a result, the neutron crystal structure presented here puts in question our understanding of the pre-catalytic state associated with the hydrolysis reaction central to the function of RAS and other GTPases.« less

Analysis of the crystal structure of an active MCM hexamer.

PubMed

Miller, Justin M; Arachea, Buenafe T; Epling, Leslie B; Enemark, Eric J

2014-09-29

In a previous Research article (Froelich et al., 2014), we suggested an MCM helicase activation mechanism, but were limited in discussing the ATPase domain because it was absent from the crystal structure. Here we present the crystal structure of a nearly full-length MCM hexamer that is helicase-active and thus has all features essential for unwinding DNA. The structure is a chimera of Sulfolobus solfataricus N-terminal domain and Pyrococcus furiosus ATPase domain. We discuss three major findings: 1) a novel conformation for the A-subdomain that could play a role in MCM regulation; 2) interaction of a universally conserved glutamine in the N-terminal Allosteric Communication Loop with the AAA+ domain helix-2-insert (h2i); and 3) a recessed binding pocket for the MCM ssDNA-binding motif influenced by the h2i. We suggest that during helicase activation, the h2i clamps down on the leading strand to facilitate strand retention and regulate ATP hydrolysis.

SERS and MD simulation studies of a kinase inhibitor demonstrate the emergence of a potential drug discovery tool.

PubMed

Karthigeyan, Dhanasekaran; Siddhanta, Soumik; Kishore, Annavarapu Hari; Perumal, Sathya S R R; Ågren, Hans; Sudevan, Surabhi; Bhat, Akshay V; Balasubramanyam, Karanam; Subbegowda, Rangappa Kanchugarakoppal; Kundu, Tapas K; Narayana, Chandrabhas

2014-07-22

We demonstrate the use of surface-enhanced Raman spectroscopy (SERS) as an excellent tool for identifying the binding site of small molecules on a therapeutically important protein. As an example, we show the specific binding of the common antihypertension drug felodipine to the oncogenic Aurora A kinase protein via hydrogen bonding interactions with Tyr-212 residue to specifically inhibit its activity. Based on SERS studies, molecular docking, molecular dynamics simulation, biochemical assays, and point mutation-based validation, we demonstrate the surface-binding mode of this molecule in two similar hydrophobic pockets in the Aurora A kinase. These binding pockets comprise the same unique hydrophobic patches that may aid in distinguishing human Aurora A versus human Aurora B kinase in vivo. The application of SERS to identify the specific interactions between small molecules and therapeutically important proteins by differentiating competitive and noncompetitive inhibition demonstrates its ability as a complementary technique. We also present felodipine as a specific inhibitor for oncogenic Aurora A kinase. Felodipine retards the rate of tumor progression in a xenografted nude mice model. This study reveals a potential surface pocket that may be useful for developing small molecules by selectively targeting the Aurora family kinases.

Relative positioning of classical benzodiazepines to the γ2-subunit of GABAA receptors.

PubMed

Middendorp, Simon J; Hurni, Evelyn; Schönberger, Matthias; Stein, Marco; Pangerl, Michael; Trauner, Dirk; Sigel, Erwin

2014-08-15

GABAA receptors are the major inhibitory neurotransmitter receptors in the brain. Benzodiazepine exert their action via a high affinity-binding site at the α/γ subunit interface on some of these receptors. Diazepam has sedative, hypnotic, anxiolytic, muscle relaxant, and anticonvulsant effects. It acts by potentiating the current evoked by the agonist GABA. Understanding specific interaction of benzodiazepines in the binding pocket of different GABAA receptor isoforms might help to separate these divergent effects. As a first step, we characterized the interaction between diazepam and the major GABAA receptor isoform α1β2γ2. We mutated several amino acid residues on the γ2-subunit assumed to be located near or in the benzodiazepine binding pocket individually to cysteine and studied the interaction with three ligands that are modified with a cysteine-reactive isothiocyanate group (-NCS). When the reactive NCS group is in apposition to the cysteine residue this leads to a covalent reaction. In this way, three amino acid residues, γ2Tyr58, γ2Asn60, and γ2Val190 were located relative to classical benzodiazepines in their binding pocket on GABAA receptors.

Investigation of the intermolecular recognition mechanism between the E3 ubiquitin ligase Keap1 and substrate based on multiple substrates analysis.

PubMed

Jiang, Zheng-Yu; Xu, Li-Li; Lu, Meng-Chen; Pan, Yang; Huang, Hao-Ze; Zhang, Xiao-Jin; Sun, Hao-Peng; You, Qi-Dong

2014-12-01

E3 ubiquitin ligases are attractive drug targets due to their specificity to the ubiquitin machinery. However, the development of E3 ligase inhibitors has proven challenging for the fact that they must disrupt protein-protein interactions (PPIs). The E3 ligase involved in interactome provide new hope for the discovery of the E3 ligase inhibitors. These currently known natural binding partners of the E3 ligase can benefit the discovery of other unknown substrates and also the E3 ligase inhibitors. Herein, we present a novel strategy that using multiple substrates to elucidate the molecular recognition mechanism of E3 ubiquitin ligase. Molecular dynamics simulation, molecular mechanics-generalized born surface area (MM-GBSA) binding energy calculation and energy decomposition scheme were incorporated to evaluate the quantitative contributions of sub-pocket and per-residue to binding. In this case, Kelch-like ECH-associated protein-1 (Keap1), a substrate adaptor component of the Cullin-RING ubiquitin ligases complex, is applied for the investigation of how it recognize its substrates, especially Nrf2, a master regulator of the antioxidant response. By analyzing multiple substrates binding determinants, we found that both the polar sub-pockets (P1 and P2) and the nonpolar sub-pockets (P4 and P5) of Keap1 can make remarkable contributions to intermolecular interactions. This finding stresses the requirement for substrates to interact with the polar and nonpolar sub-pockets simultaneously. The results discussed in this paper not only show the binding determinants of the Keap1 substrates but also provide valuable implications for both Keap1 substrate discovery and PPI inhibitor design.

Investigation of the intermolecular recognition mechanism between the E3 ubiquitin ligase Keap1 and substrate based on multiple substrates analysis

NASA Astrophysics Data System (ADS)

Jiang, Zheng-Yu; Xu, Li-Li; Lu, Meng-Chen; Pan, Yang; Huang, Hao-Ze; Zhang, Xiao-Jin; Sun, Hao-Peng; You, Qi-Dong

2014-12-01

E3 ubiquitin ligases are attractive drug targets due to their specificity to the ubiquitin machinery. However, the development of E3 ligase inhibitors has proven challenging for the fact that they must disrupt protein-protein interactions (PPIs). The E3 ligase involved in interactome provide new hope for the discovery of the E3 ligase inhibitors. These currently known natural binding partners of the E3 ligase can benefit the discovery of other unknown substrates and also the E3 ligase inhibitors. Herein, we present a novel strategy that using multiple substrates to elucidate the molecular recognition mechanism of E3 ubiquitin ligase. Molecular dynamics simulation, molecular mechanics-generalized born surface area (MM-GBSA) binding energy calculation and energy decomposition scheme were incorporated to evaluate the quantitative contributions of sub-pocket and per-residue to binding. In this case, Kelch-like ECH-associated protein-1 (Keap1), a substrate adaptor component of the Cullin-RING ubiquitin ligases complex, is applied for the investigation of how it recognize its substrates, especially Nrf2, a master regulator of the antioxidant response. By analyzing multiple substrates binding determinants, we found that both the polar sub-pockets (P1 and P2) and the nonpolar sub-pockets (P4 and P5) of Keap1 can make remarkable contributions to intermolecular interactions. This finding stresses the requirement for substrates to interact with the polar and nonpolar sub-pockets simultaneously. The results discussed in this paper not only show the binding determinants of the Keap1 substrates but also provide valuable implications for both Keap1 substrate discovery and PPI inhibitor design.

Simulation optimization of spherical non-polar guest recognition by deep-cavity cavitands

PubMed Central

Wanjari, Piyush P.; Gibb, Bruce C.; Ashbaugh, Henry S.

2013-01-01

Biomimetic deep-cavity cavitand hosts possess unique recognition and encapsulation properties that make them capable of selectively binding a range of non-polar guests within their hydrophobic pocket. Adamantane based derivatives which snuggly fit within the pocket of octa-acid deep cavity cavitands exhibit some of the strongest host binding. Here we explore the roles of guest size and attractiveness on optimizing guest binding to form 1:1 complexes with octa-acid cavitands in water. Specifically we simulate the water-mediated interactions of the cavitand with adamantane and a range of simple Lennard-Jones guests of varying diameter and attractive well-depth. Initial simulations performed with methane indicate hydrated methanes preferentially reside within the host pocket, although these guests frequently trade places with water and other methanes in bulk solution. The interaction strength of hydrophobic guests increases with increasing size from sizes slightly smaller than methane to Lennard-Jones guests comparable in size to adamantane. Over this guest size range the preferential guest binding location migrates from the bottom of the host pocket upwards. For guests larger than adamantane, however, binding becomes less favorable as the minimum in the potential-of-mean force shifts to the cavitand face around the portal. For a fixed guest diameter, the Lennard-Jones well-depth is found to systematically shift the guest-host potential-of-mean force to lower free energies, however, the optimal guest size is found to be insensitive to increasing well-depth. Ultimately our simulations show that adamantane lies within the optimal range of guest sizes with significant attractive interactions to match the most tightly bound Lennard-Jones guests studied. PMID:24359375

RNA processing: pocket guides to ribosomal RNA.

PubMed

Peculis, B

1997-08-01

The functional role of a recently identified class of small nucleolar (sno) RNAs has been elucidated: the 'box H/ACA' snoRNAs act as guide RNAs, specifying the position of evolutionarily conserved pseudouridines in ribosomal (r)RNA via an rRNA-snoRNA base-pairing interaction that forms a 'pseudouridine pocket'.

Structural basis for inhibition of TLR2 by staphylococcal superantigen-like protein 3 (SSL3)

PubMed Central

Koymans, Kirsten J.; Feitsma, Louris J.; Brondijk, T. Harma C.; Aerts, Piet C.; Lukkien, Eddie; Lössl, Philip; van Kessel, Kok P. M.; de Haas, Carla J. C.; van Strijp, Jos A. G.; Huizinga, Eric G.

2015-01-01

Toll-like receptors (TLRs) are crucial in innate recognition of invading micro-organisms and their subsequent clearance. Bacteria are not passive bystanders and have evolved complex evasion mechanisms. Staphylococcus aureus secretes a potent TLR2 antagonist, staphylococcal superantigen-like protein 3 (SSL3), which prevents receptor stimulation by pathogen-associated lipopeptides. Here, we present crystal structures of SSL3 and its complex with TLR2. The structure reveals that formation of the specific inhibitory complex is predominantly mediated by hydrophobic contacts between SSL3 and TLR2 and does not involve interaction of TLR2–glycans with the conserved LewisX binding site of SSL3. In the complex, SSL3 partially covers the entrance to the lipopeptide binding pocket in TLR2, reducing its size by ∼50%. We show that this is sufficient to inhibit binding of agonist Pam2CSK4 effectively, yet allows SSL3 to bind to an already formed TLR2–Pam2CSK4 complex. The binding site of SSL3 overlaps those of TLR2 dimerization partners TLR1 and TLR6 extensively. Combined, our data reveal a robust dual mechanism in which SSL3 interferes with TLR2 activation at two stages: by binding to TLR2, it blocks ligand binding and thus inhibits activation. Second, by interacting with an already formed TLR2–lipopeptide complex, it prevents TLR heterodimerization and downstream signaling. PMID:26283364

A Lipid Pathway for Ligand Binding Is Necessary for a Cannabinoid G Protein-coupled Receptor*

PubMed Central

Hurst, Dow P.; Grossfield, Alan; Lynch, Diane L.; Feller, Scott; Romo, Tod D.; Gawrisch, Klaus; Pitman, Michael C.; Reggio, Patricia H.

2010-01-01

Recent isothiocyanate covalent labeling studies have suggested that a classical cannabinoid, (−)-7′-isothiocyanato-11-hydroxy-1′,1′dimethylheptyl-hexahydrocannabinol (AM841), enters the cannabinoid CB2 receptor via the lipid bilayer (Pei, Y., Mercier, R. W., Anday, J. K., Thakur, G. A., Zvonok, A. M., Hurst, D., Reggio, P. H., Janero, D. R., and Makriyannis, A. (2008) Chem. Biol. 15, 1207–1219). However, the sequence of steps involved in such a lipid pathway entry has not yet been elucidated. Here, we test the hypothesis that the endogenous cannabinoid sn-2-arachidonoylglycerol (2-AG) attains access to the CB2 receptor via the lipid bilayer. To this end, we have employed microsecond time scale all-atom molecular dynamics (MD) simulations of the interaction of 2-AG with CB2 via a palmitoyl-oleoyl-phosphatidylcholine lipid bilayer. Results suggest the following: 1) 2-AG first partitions out of bulk lipid at the transmembrane α-helix (TMH) 6/7 interface; 2) 2-AG then enters the CB2 receptor binding pocket by passing between TMH6 and TMH7; 3) the entrance of the 2-AG headgroup into the CB2 binding pocket is sufficient to trigger breaking of the intracellular TMH3/6 ionic lock and the movement of the TMH6 intracellular end away from TMH3; and 4) subsequent to protonation at D3.49/D6.30, further 2-AG entry into the ligand binding pocket results in both a W6.48 toggle switch change and a large influx of water. To our knowledge, this is the first demonstration via unbiased molecular dynamics that a ligand can access the binding pocket of a class A G protein-coupled receptor via the lipid bilayer and the first demonstration via molecular dynamics of G protein-coupled receptor activation triggered by a ligand binding event. PMID:20220143

The Fifth Transmembrane Domain of Angiotensin II Type 1 Receptor Participates in the Formation of the Ligand-binding Pocket and Undergoes a Counterclockwise Rotation upon Receptor Activation*

PubMed Central

Domazet, Ivana; Martin, Stéphane S.; Holleran, Brian J.; Morin, Marie-Ève; Lacasse, Patrick; Lavigne, Pierre; Escher, Emanuel; Leduc, Richard; Guillemette, Gaétan

2009-01-01

The octapeptide hormone angiotensin II exerts a wide variety of cardiovascular effects through the activation of the angiotensin II Type 1 (AT1) receptor, which belongs to the G protein-coupled receptor superfamily. Like other G protein- coupled receptors, the AT1 receptor possesses seven transmembrane domains that provide structural support for the formation of the ligand-binding pocket. The role of the fifth transmembrane domain (TMD5) was investigated using the substituted cysteine accessibility method. All of the residues within Thr-190 to Leu-217 region were mutated one at a time to cysteine, and after expression in COS-7 cells, the mutant receptors were treated with the sulfhydryl-specific alkylating agent methanethiosulfonate-ethylammonium (MTSEA). MTSEA reacts selectively with water-accessible, free sulfhydryl groups of endogenous or introduced point mutation cysteines. If a cysteine is found in the binding pocket, the covalent modification will affect the binding kinetics of the ligand. MTSEA substantially decreased the binding affinity of L197C-AT1, N200C-AT1, I201C-AT1, G203C-AT1, and F204C-AT1 mutant receptors, which suggests that these residues orient themselves within the water-accessible binding pocket of the AT1 receptor. Interestingly, this pattern of acquired MTSEA sensitivity was altered for TMD5 reporter cysteines engineered in a constitutively active N111G-AT1 receptor background. Indeed, mutant I201C-N111G-AT1 became more sensitive to MTSEA, whereas mutant G203C-N111G-AT1 lost some sensitivity. Our results suggest that constitutive activation of AT1 receptor causes an apparent counterclockwise rotation of TMD5 as viewed from the extracellular side. PMID:19773549

Beta-propeller crystal structure of Psathyrella velutina lectin: an integrin-like fungal protein interacting with monosaccharides and calcium.

PubMed

Cioci, Gianluca; Mitchell, Edward P; Chazalet, Valerie; Debray, Henri; Oscarson, Stefan; Lahmann, Martina; Gautier, Catherine; Breton, Christelle; Perez, Serge; Imberty, Anne

2006-04-14

The lectin from the mushroom Psathyrella velutina recognises specifically N-acetylglucosamine and N-acetylneuraminic acid containing glycans. The crystal structure of the 401 amino acid residue lectin shows that it adopts a very regular seven-bladed beta-propeller fold with the N-terminal region tucked into the central cavity around the pseudo 7-fold axis. In the complex with N-acetylglucosamine, six monosaccharides are bound in pockets located between two consecutive propeller blades. Due to the repeats shown by the sequence the binding sites are very similar. Five hydrogen bonds between the protein and the sugar hydroxyl and N-acetyl groups stabilize the complex, together with the hydrophobic interactions with a conserved tyrosine and histidine. The complex with N-acetylneuraminic acid shows molecular mimicry with the same hydrogen bond network, but with different orientations of the carbohydrate ring in the binding site. The beta-hairpin loops connecting the two inner beta-strands of each blade are metal binding sites and two to three calcium ions were located in the structure. The multispecificity and high multivalency of this mushroom lectin, combined with its similarity to the extracellular domain of an important class of cell adhesion molecules, integrins, are another example of the outstanding success of beta-propeller structures as molecular binding machines in nature.

Cryptic binding sites on proteins: definition, detection, and druggability.

PubMed

Vajda, Sandor; Beglov, Dmitri; Wakefield, Amanda E; Egbert, Megan; Whitty, Adrian

2018-05-22

Many proteins in their unbound structures lack surface pockets appropriately sized for drug binding. Hence, a variety of experimental and computational tools have been developed for the identification of cryptic sites that are not evident in the unbound protein but form upon ligand binding, and can provide tractable drug target sites. The goal of this review is to discuss the definition, detection, and druggability of such sites, and their potential value for drug discovery. Novel methods based on molecular dynamics simulations are particularly promising and yield a large number of transient pockets, but it has been shown that only a minority of such sites are generally capable of binding ligands with substantial affinity. Based on recent studies, current methodology can be improved by combining molecular dynamics with fragment docking and machine learning approaches. Copyright © 2018 Elsevier Ltd. All rights reserved.

Structural basis of rifampin inactivation by rifampin phosphotransferase

PubMed Central

Qi, Xiaofeng; Lin, Wei; Ma, Miaolian; Wang, Chengyuan; He, Yang; He, Nisha; Gao, Jing; Zhou, Hu; Xiao, Youli; Wang, Yong

2016-01-01

Rifampin (RIF) is a first-line drug used for the treatment of tuberculosis and other bacterial infections. Various RIF resistance mechanisms have been reported, and recently an RIF-inactivation enzyme, RIF phosphotransferase (RPH), was reported to phosphorylate RIF at its C21 hydroxyl at the cost of ATP. However, the underlying molecular mechanism remained unknown. Here, we solve the structures of RPH from Listeria monocytogenes (LmRPH) in different conformations. LmRPH comprises three domains: an ATP-binding domain (AD), an RIF-binding domain (RD), and a catalytic His-containing domain (HD). Structural analyses reveal that the C-terminal HD can swing between the AD and RD, like a toggle switch, to transfer phosphate. In addition to its catalytic role, the HD can bind to the AD and induce conformational changes that stabilize ATP binding, and the binding of the HD to the RD is required for the formation of the RIF-binding pocket. A line of hydrophobic residues forms the RIF-binding pocket and interacts with the 1-amino, 2-naphthol, 4-sulfonic acid and naphthol moieties of RIF. The R group of RIF points toward the outside of the pocket, explaining the low substrate selectivity of RPH. Four residues near the C21 hydroxyl of RIF, His825, Arg666, Lys670, and Gln337, were found to play essential roles in the phosphorylation of RIF; among these the His825 residue may function as the phosphate acceptor and donor. Our study reveals the molecular mechanism of RIF phosphorylation catalyzed by RPH and will guide the development of a new generation of rifamycins. PMID:27001859

Rational Design of Novel Allosteric Dihydrofolate Reductase Inhibitors Showing Antibacterial Effects on Drug-Resistant Escherichia coli Escape Variants.

PubMed

Srinivasan, Bharath; Rodrigues, João V; Tonddast-Navaei, Sam; Shakhnovich, Eugene; Skolnick, Jeffrey

2017-07-21

In drug discovery, systematic variations of substituents on a common scaffold and bioisosteric replacements are often used to generate diversity and obtain molecules with better biological effects. However, this could saturate the small-molecule diversity pool resulting in drug resistance. On the other hand, conventional drug discovery relies on targeting known pockets on protein surfaces leading to drug resistance by mutations of critical pocket residues. Here, we present a two-pronged strategy of designing novel drugs that target unique pockets on a protein's surface to overcome the above problems. Dihydrofolate reductase, DHFR, is a critical enzyme involved in thymidine and purine nucleotide biosynthesis. Several classes of compounds that are structural analogues of the substrate dihydrofolate have been explored for their antifolate activity. Here, we describe 10 novel small-molecule inhibitors of Escherichia coli DHFR, EcDHFR, belonging to the stilbenoid, deoxybenzoin, and chalcone family of compounds discovered by a combination of pocket-based virtual ligand screening and systematic scaffold hopping. These inhibitors show a unique uncompetitive or noncompetitive inhibition mechanism, distinct from those reported for all known inhibitors of DHFR, indicative of binding to a unique pocket distinct from either substrate or cofactor-binding pockets. Furthermore, we demonstrate that rescue mutants of EcDHFR, with reduced affinity to all known classes of DHFR inhibitors, are inhibited at the same concentration as the wild-type. These compounds also exhibit antibacterial activity against E. coli harboring the drug-resistant variant of DHFR. This discovery is the first report on a novel class of inhibitors targeting a unique pocket on EcDHFR.

Comprehensive Structural Characterization of the Bacterial Homospermidine Synthase–an Essential Enzyme of the Polyamine Metabolism

PubMed Central

Krossa, Sebastian; Faust, Annette; Ober, Dietrich; Scheidig, Axel J.

2016-01-01

The highly conserved bacterial homospermidine synthase (HSS) is a key enzyme of the polyamine metabolism of many proteobacteria including pathogenic strains such as Legionella pneumophila and Pseudomonas aeruginosa; The unique usage of NAD(H) as a prosthetic group is a common feature of bacterial HSS, eukaryotic HSS and deoxyhypusine synthase (DHS). The structure of the bacterial enzyme does not possess a lysine residue in the active center and thus does not form an enzyme-substrate Schiff base intermediate as observed for the DHS. In contrast to the DHS the active site is not formed by the interface of two subunits but resides within one subunit of the bacterial HSS. Crystal structures of Blastochloris viridis HSS (BvHSS) reveal two distinct substrate binding sites, one of which is highly specific for putrescine. BvHSS features a side pocket in the direct vicinity of the active site formed by conserved amino acids and a potential substrate discrimination, guiding, and sensing mechanism. The proposed reaction steps for the catalysis of BvHSS emphasize cation-π interaction through a conserved Trp residue as a key stabilizer of high energetic transition states. PMID:26776105

Haem Recognition By a Staphylococcus Aureus NEAT Domain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grigg, J.C.; Vermeiren, C.; Heinrichs, D.E.

2009-06-01

Successful pathogenic organisms have developed mechanisms to thrive under extreme levels of iron restriction. Haem-iron represents the largest iron reservoir in the human body and is a significant source of iron for some bacterial pathogens. NEAT (NEAr Transporter) domains are found exclusively in a family of cell surface proteins in Gram-positive bacteria. Many NEAT domain-containing proteins, including IsdA in Staphylococcus aureus, are implicated in haem binding. Here, we show that overexpression of IsdA in S. aureus enhances growth and an inactivation mutant of IsdA has a growth defect, compared with wild type, when grown in media containing haem as themore » sole iron source. Furthermore, the haem-binding property of IsdA is contained within the NEAT domain. Crystal structures of the apo-IsdA NEAT domain and in complex with haem were solved and reveal a clathrin adapter-like beta-sandwich fold with a large hydrophobic haem-binding pocket. Haem is bound with the propionate groups directed at the molecular surface and the iron is co-ordinated solely by Tyr(166). The phenol groups of Tyr(166) and Tyr(170) form an H-bond that may function in regulating haem binding and release. An analysis of IsdA structure-sequence alignments indicate that conservation of Tyr(166) is a predictor of haem binding by NEAT domains.« less

Structural and mechanistic insights into phospholipid transfer by Ups1–Mdm35 in mitochondria

PubMed Central

Watanabe, Yasunori; Tamura, Yasushi; Kawano, Shin; Endo, Toshiya

2015-01-01

Eukaryotic cells are compartmentalized into membrane-bounded organelles whose functions rely on lipid trafficking to achieve membrane-specific compositions of lipids. Here we focused on the Ups1–Mdm35 system, which mediates phosphatidic acid (PA) transfer between the outer and inner mitochondrial membranes, and determined the X-ray structures of Mdm35 and Ups1–Mdm35 with and without PA. The Ups1–Mdm35 complex constitutes a single domain that has a deep pocket and flexible Ω-loop lid. Structure-based mutational analyses revealed that a basic residue at the pocket bottom and the Ω-loop lid are important for PA extraction from the membrane following Ups1 binding. Ups1 binding to the membrane is enhanced by the dissociation of Mdm35. We also show that basic residues around the pocket entrance are important for Ups1 binding to the membrane and PA extraction. These results provide a structural basis for understanding the mechanism of PA transfer between mitochondrial membranes. PMID:26235513

Switch loop flexibility affects substrate transport of the AcrB efflux pump

DOE PAGES

Muller, Reinke T.; Travers, Timothy; Cha, Hi-jea; ...

2017-10-05

The functionally important switch-loop of the trimeric multidrug transporter AcrB separates the access and deep drug binding pockets in every protomer. This loop, comprising 11 amino acid residues, has been shown to be crucial for substrate transport, as drugs have to travel past the loop to reach the deep binding pocket and from there are transported outside the cell via the connected AcrA and TolC channels. It contains four symmetrically arranged glycine residues suggesting that flexibility is a key feature for pump activity. Upon combinatorial substitution of these glycine residues to proline, functional and structural asymmetry was observed. Proline substitutionsmore » on the PC1 proximal side completely abolished transport and reduced backbone flexibility of the switch loop, which adopted a conformation restricting the pathway towards the deep binding pocket. Here, two phenylalanine residues located adjacent to the substitution sensitive glycine residues play a role in blocking the pathway upon rigidification of the loop, since the removal of the phenyl rings from the rigid loop restores drug transport activity.« less

Switch loop flexibility affects substrate transport of the AcrB efflux pump

DOE Office of Scientific and Technical Information (OSTI.GOV)

Muller, Reinke T.; Travers, Timothy; Cha, Hi-jea

The functionally important switch-loop of the trimeric multidrug transporter AcrB separates the access and deep drug binding pockets in every protomer. This loop, comprising 11 amino acid residues, has been shown to be crucial for substrate transport, as drugs have to travel past the loop to reach the deep binding pocket and from there are transported outside the cell via the connected AcrA and TolC channels. It contains four symmetrically arranged glycine residues suggesting that flexibility is a key feature for pump activity. Upon combinatorial substitution of these glycine residues to proline, functional and structural asymmetry was observed. Proline substitutionsmore » on the PC1 proximal side completely abolished transport and reduced backbone flexibility of the switch loop, which adopted a conformation restricting the pathway towards the deep binding pocket. Here, two phenylalanine residues located adjacent to the substitution sensitive glycine residues play a role in blocking the pathway upon rigidification of the loop, since the removal of the phenyl rings from the rigid loop restores drug transport activity.« less

F pocket flexibility influences the tapasin dependence of two differentially disease-associated MHC Class I proteins.

PubMed

Abualrous, Esam T; Fritzsche, Susanne; Hein, Zeynep; Al-Balushi, Mohammed S; Reinink, Peter; Boyle, Louise H; Wellbrock, Ursula; Antoniou, Antony N; Springer, Sebastian

2015-04-01

The human MHC class I protein HLA-B*27:05 is statistically associated with ankylosing spondylitis, unlike HLA-B*27:09, which differs in a single amino acid in the F pocket of the peptide-binding groove. To understand how this unique amino acid difference leads to a different behavior of the proteins in the cell, we have investigated the conformational stability of both proteins using a combination of in silico and experimental approaches. Here, we show that the binding site of B*27:05 is conformationally disordered in the absence of peptide due to a charge repulsion at the bottom of the F pocket. In agreement with this, B*27:05 requires the chaperone protein tapasin to a greater extent than the conformationally stable B*27:09 in order to remain structured and to bind peptide. Taken together, our data demonstrate a method to predict tapasin dependence and physiological behavior from the sequence and crystal structure of a particular class I allotype. Also watch the Video Abstract. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Enhanced SH3/Linker Interaction Overcomes Abl Kinase Activation by Gatekeeper and Myristic Acid Binding Pocket Mutations and Increases Sensitivity to Small Molecule Inhibitors*

PubMed Central

Panjarian, Shoghag; Iacob, Roxana E.; Chen, Shugui; Wales, Thomas E.; Engen, John R.; Smithgall, Thomas E.

2013-01-01

Multidomain kinases such as c-Src and c-Abl are regulated by complex allosteric interactions involving their noncatalytic SH3 and SH2 domains. Here we show that enhancing natural allosteric control of kinase activity by SH3/linker engagement has long-range suppressive effects on the kinase activity of the c-Abl core. Surprisingly, enhanced SH3/linker interaction also dramatically sensitized the Bcr-Abl tyrosine kinase associated with chronic myelogenous leukemia to small molecule inhibitors that target either the active site or the myristic acid binding pocket in the kinase domain C-lobe. Dynamics analyses using hydrogen exchange mass spectrometry revealed a remarkable allosteric network linking the SH3 domain, the myristic acid binding pocket, and the active site of the c-Abl core, providing a structural basis for the biological observations. These results suggest a rational strategy for enhanced drug targeting of Bcr-Abl and other multidomain kinase systems that use multiple small molecules to exploit natural mechanisms of kinase control. PMID:23303187

The C-terminal Helix of Pseudomonas aeruginosa Elongation Factor Ts Tunes EF-Tu Dynamics to Modulate Nucleotide Exchange.

PubMed

De Laurentiis, Evelina Ines; Mercier, Evan; Wieden, Hans-Joachim

2016-10-28

Little is known about the conservation of critical kinetic parameters and the mechanistic strategies of elongation factor (EF) Ts-catalyzed nucleotide exchange in EF-Tu in bacteria and particularly in clinically relevant pathogens. EF-Tu from the clinically relevant pathogen Pseudomonas aeruginosa shares over 84% sequence identity with the corresponding elongation factor from Escherichia coli Interestingly, the functionally closely linked EF-Ts only shares 55% sequence identity. To identify any differences in the nucleotide binding properties, as well as in the EF-Ts-mediated nucleotide exchange reaction, we performed a comparative rapid kinetics and mutagenesis analysis of the nucleotide exchange mechanism for both the E. coli and P. aeruginosa systems, identifying helix 13 of EF-Ts as a previously unnoticed regulatory element in the nucleotide exchange mechanism with species-specific elements. Our findings support the base side-first entry of the nucleotide into the binding pocket of the EF-Tu·EF-Ts binary complex, followed by displacement of helix 13 and rapid binding of the phosphate side of the nucleotide, ultimately leading to the release of EF-Ts. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Crystal structures of trypanosomal histidyl-tRNA synthetase illuminate differences between eukaryotic and prokaryotic homologs

PubMed Central

Merritt, Ethan A; Arakaki, Tracy L; Gillespie, J Robert; Larson, Eric T; Kelley, Angela; Mueller, Natascha; Napuli, Alberto J; Kim, Jessica; Zhang, Li; Verlinde, Christophe L M J; Fan, Erkang; Zucker, Frank; Buckner, Frederick S; Van Voorhis, Wesley C; Hol, Wim G J

2010-01-01

Crystal structures of histidyl-tRNA synthetase from the eukaryotic parasites Trypanosoma brucei and Trypanosoma cruzi provide a first structural view of a eukaryotic form of this enzyme, and reveal differences from bacterial homologs. Histidyl-tRNA synthetases in general contain an extra domain inserted between conserved motifs 2 and 3 of the Class II aminoacyl-tRNA synthetase catalytic core. The current structures show that the three dimensional topology of this domain is very different in bacterial and archaeal/eukaryotic forms of the enzyme. Comparison of apo and histidine-bound trypanosomal structures indicates substantial active site rearrangement upon histidine binding, but relatively little subsequent rearrangement after reaction of histidine with ATP to form the enzyme’s first reaction product, histidyladenylate. The specific residues involved in forming the binding pocket for the adenine moiety differ substantially both from the previously characterized binding site in bacterial structures and from the homologous residues in human histidyl-tRNA synthetases. The essentiality of the single histidyl-tRNA synthetase gene in T. brucei is shown by a severe depression of parasite growth rate that results from even partial suppression of expression by RNA interference. PMID:20132829

Structure of Yeast OSBP-Related Protein Osh1 Reveals Key Determinants for Lipid Transport and Protein Targeting at the Nucleus-Vacuole Junction.

PubMed

Manik, Mohammad Kawsar; Yang, Huiseon; Tong, Junsen; Im, Young Jun

2017-04-04

Yeast Osh1 belongs to the oxysterol-binding protein (OSBP) family of proteins and contains multiple targeting modules optimized for lipid transport at the nucleus-vacuole junction (NVJ). The key determinants for NVJ targeting and the role of Osh1 at NVJs have remained elusive because of unknown lipid specificities. In this study, we determined the structures of the ankyrin repeat domain (ANK), and OSBP-related domain (ORD) of Osh1, in complex with Nvj1 and ergosterol, respectively. The Osh1 ANK forms a unique bi-lobed structure that recognizes a cytosolic helical segment of Nvj1. We discovered that Osh1 ORD binds ergosterol and phosphatidylinositol 4-phosphate PI(4)P in a competitive manner, suggesting counter-transport function of the two lipids. Ergosterol is bound to the hydrophobic pocket in a head-down orientation, and the structure of the PI(4)P-binding site in Osh1 is well conserved. Our results suggest that Osh1 performs non-vesicular transport of ergosterol and PI(4)P at the NVJ. Copyright © 2017 Elsevier Ltd. All rights reserved.

Computational study of bindings of HK20 Fab and D5 Fab to HIV-1 gp41.

PubMed

Hartono, Yossa Dwi; Lazim, Raudah; Yip, Yew Mun; Zhang, Dawei

2012-02-15

Antibodies HK20 and D5 have been shown to target HIV-1 gp41, thereby inhibiting membrane fusion that facilitates viral entry. The binding picture is static, based on the X-ray crystal structures of the Fab regions and gp41 mimetic five-helix bundle. In this study, we carried out molecular dynamics simulation to provide the dynamic binding picture. Calculated binding free energies are within reasonable range of and follow the trend of the experimental values: -15.28 kcal/mol for HK20 Fab (expt. -11.60 kcal/mol) and -17.90 kcal/mol for D5 Fab (expt. -11.70 kcal/mol). Alanine scanning at protein-protein interface reveals that the highest contributors to binding for HK20 Fab are F54 and I56, both of V(H) region, as well as R30' of V(L) region; whereas for D5 Fab, F54 of V(H) region, as well as W32' and Y94' of V(L) region. HK20 F54 and I56, as well as D5 I52, F54, and T56, bind to the gp41 hydrophobic binding pocket, an important region targeted by many other fusion inhibitors. Hydrogen bonding analysis also identifies high-occupancy hydrogen bonds at the periphery of gp41 hydrophobic pocket. Considering that almost all interface residues are turn residues, further work may be directed to turn mimics. Pre-orientation by the hydrogen bonds to poise this particular turn towards the binding pocket may also be a point worth pursuing. Copyright © 2011 Elsevier Ltd. All rights reserved.

Protein-protein interface analysis and hot spots identification for chemical ligand design.

PubMed

Chen, Jing; Ma, Xiaomin; Yuan, Yaxia; Pei, Jianfeng; Lai, Luhua

2014-01-01

Rational design for chemical compounds targeting protein-protein interactions has grown from a dream to reality after a decade of efforts. There are an increasing number of successful examples, though major challenges remain in the field. In this paper, we will first give a brief review of the available methods that can be used to analyze protein-protein interface and predict hot spots for chemical ligand design. New developments of binding sites detection, ligandability and hot spots prediction from the author's group will also be described. Pocket V.3 is an improved program for identifying hot spots in protein-protein interface using only an apo protein structure. It has been developed based on Pocket V.2 that can derive receptor-based pharmacophore model for ligand binding cavity. Given similarities and differences between the essence of pharmacophore and hot spots for guiding design of chemical compounds, not only energetic but also spatial properties of protein-protein interface are used in Pocket V.3 for dealing with protein-protein interface. In order to illustrate the capability of Pocket V.3, two datasets have been used. One is taken from ASEdb and BID having experimental alanine scanning results for testing hot spots prediction. The other is taken from the 2P2I database containing complex structures of protein-ligand binding at the original protein-protein interface for testing hot spots application in ligand design.

Contributions of pocket depth and electrostatic interactions to affinity and selectivity of receptors for methylated lysine in water.

PubMed

Beaver, Joshua E; Peacor, Brendan C; Bain, Julianne V; James, Lindsey I; Waters, Marcey L

2015-03-21

Dynamic combinatorial chemistry was used to generate a set of receptors for peptides containing methylated lysine (KMen, n = 0-3) and study the contribution of electrostatic effects and pocket depth to binding affinity and selectivity. We found that changing the location of a carboxylate resulted in an increase in preference for KMe2, presumably based on ability to form a salt bridge with KMe2. The number of charged groups on either the receptor or peptide guest systematically varied the binding affinities to all guests by approximately 1-1.5 kcal mol(-1), with little influence on selectivity. Lastly, formation of a deeper pocket led to both increased affinity and selectivity for KMe3 over the lower methylation states. From these studies, we identified that the tightest binder was a receptor with greater net charge, with a Kd of 0.2 μM, and the receptor with the highest selectivity was the one with the deepest pocket, providing 14-fold selectivity between KMe3 and KMe2 and a Kd for KMe3 of 0.3 μM. This work provides key insights into approaches to improve binding affinity and selectivity in water, while also demonstrating the versatility of dynamic combinatorial chemistry for rapidly exploring the impact of subtle changes in receptor functionality on molecular recognition in water.

Structure of Epstein-Barr Virus Glycoprotein 42 Suggests a Mechanism for Triggering Receptor-Activated Virus Entry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kirschner, Austin N.; Sorem, Jessica; Longnecker, Richard

Epstein-Barr virus requires glycoproteins gH/gL, gB, and gp42 to fuse its lipid envelope with B cells. Gp42 is a type II membrane protein consisting of a flexible N-terminal region, which binds gH/gL, and a C-terminal lectin-like domain that binds to the B-cell entry receptor human leukocyte antigen (HLA) class II. Gp42 triggers membrane fusion after HLA binding, a process that requires simultaneous binding to gH/gL and a functional hydrophobic pocket in the lectin domain adjacent to the HLA binding site. Here we present the structure of gp42 in its unbound form. Comparisons to the previously determined structure of a gp42:HLAmore » complex reveals additional N-terminal residues forming part of the gH/gL binding site and structural changes in the receptor binding domain. Although the core of the lectin domain remains similar, significant shifts in two loops and an {alpha} helix bordering the essential hydrophobic pocket suggest a structural mechanism for triggering fusion.« less

X-ray structure and inhibition of 3C-like protease from porcine epidemic diarrhea virus

DOE PAGES

St. John, Sarah E.; Anson, Brandon J.; Mesecar, Andrew D.

2016-05-13

Porcine epidemic diarrhea virus (PEDV) is a coronavirus that infects pigs and can have mortality rates approaching 100% in piglets, causing serious economic impact. The 3C-like protease (3CL pro) is essential for the coronaviral life cycle and is an appealing target for the development of therapeutics. We report the expression, purification, crystallization and 2.10 angstrom X-ray structure of 3CL pro from PEDV. Analysis of the PEDV 3CL pro structure and comparison to other coronaviral 3CL pro's from the same alpha-coronavirus phylogeny shows that the overall structures and active site architectures across 3CL pro's are conserved, with the exception of amore » loop that comprises the protease S-2 pocket. We found a known inhibitor of severe acute respiratory syndrome coronavirus (SARS-CoV) 3CL pro, (R)-16, to have inhibitor activity against PEDV 3CL pro, despite that SARS-3CL pro and PEDV 3CL pro share only 45.4% sequence identity. Structural comparison reveals that the majority of residues involved in (R)-16 binding to SARS-3CL pro are conserved in PEDV-3CL pro; however, the sequence variation and positional difference in the loop forming the S-2 pocket may account for large observed difference in IC 50 values. In conclusion, this work advances our understanding of the subtle, but important, differences in coronaviral 3CL pro architecture and contributes to the broader structural knowledge of coronaviral 3CL pro's.« less

X-ray structure and inhibition of 3C-like protease from porcine epidemic diarrhea virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

St. John, Sarah E.; Anson, Brandon J.; Mesecar, Andrew D.

Porcine epidemic diarrhea virus (PEDV) is a coronavirus that infects pigs and can have mortality rates approaching 100% in piglets, causing serious economic impact. The 3C-like protease (3CL pro) is essential for the coronaviral life cycle and is an appealing target for the development of therapeutics. We report the expression, purification, crystallization and 2.10 angstrom X-ray structure of 3CL pro from PEDV. Analysis of the PEDV 3CL pro structure and comparison to other coronaviral 3CL pro's from the same alpha-coronavirus phylogeny shows that the overall structures and active site architectures across 3CL pro's are conserved, with the exception of amore » loop that comprises the protease S-2 pocket. We found a known inhibitor of severe acute respiratory syndrome coronavirus (SARS-CoV) 3CL pro, (R)-16, to have inhibitor activity against PEDV 3CL pro, despite that SARS-3CL pro and PEDV 3CL pro share only 45.4% sequence identity. Structural comparison reveals that the majority of residues involved in (R)-16 binding to SARS-3CL pro are conserved in PEDV-3CL pro; however, the sequence variation and positional difference in the loop forming the S-2 pocket may account for large observed difference in IC 50 values. In conclusion, this work advances our understanding of the subtle, but important, differences in coronaviral 3CL pro architecture and contributes to the broader structural knowledge of coronaviral 3CL pro's.« less

Avibactam and Class C β-Lactamases: Mechanism of Inhibition, Conservation of the Binding Pocket, and Implications for Resistance

PubMed Central

Johnstone, M. R.; Ross, P. L.; McLaughlin, R. E.; Olivier, N. B.

2014-01-01

Avibactam is a novel non-β-lactam β-lactamase inhibitor that inhibits a wide range of β-lactamases. These include class A, class C, and some class D enzymes, which erode the activity of β-lactam drugs in multidrug-resistant pathogens like Pseudomonas aeruginosa and Enterobacteriaceae spp. Avibactam is currently in clinical development in combination with the β-lactam antibiotics ceftazidime, ceftaroline fosamil, and aztreonam. Avibactam has the potential to be the first β-lactamase inhibitor that might provide activity against class C-mediated resistance, which represents a growing concern in both hospital- and community-acquired infections. Avibactam has an unusual mechanism of action: it is a covalent inhibitor that acts via ring opening, but in contrast to other currently used β-lactamase inhibitors, this reaction is reversible. Here, we present a high-resolution structure of avibactam bound to a class C β-lactamase, AmpC, from P. aeruginosa that provided insight into the mechanism of both acylation and recyclization in this enzyme class and highlighted the differences observed between class A and class C inhibition. Furthermore, variants resistant to avibactam that identified the residues important for inhibition were isolated. Finally, the structural information was used to predict effective inhibition by sequence analysis and functional studies of class C β-lactamases from a large and diverse set of contemporary clinical isolates (P. aeruginosa and several Enterobacteriaceae spp.) obtained from recent infections to understand any preexisting variability in the binding pocket that might affect inhibition by avibactam. PMID:25022578

Agonist trapped in ATP-binding sites of the P2X2 receptor

PubMed Central

Jiang, Ruotian; Lemoine, Damien; Martz, Adeline; Taly, Antoine; Gonin, Sophie; Prado de Carvalho, Lia; Specht, Alexandre; Grutter, Thomas

2011-01-01

ATP-gated P2X receptors are trimeric ion channels, as recently confirmed by X-ray crystallography. However, the structure was solved without ATP and even though extracellular intersubunit cavities surrounded by conserved amino acid residues previously shown to be important for ATP function were proposed to house ATP, the localization of the ATP sites remains elusive. Here we localize the ATP-binding sites by creating, through a proximity-dependent “tethering” reaction, covalent bonds between a synthesized ATP-derived thiol-reactive P2X2 agonist (NCS-ATP) and single cysteine mutants engineered in the putative binding cavities of the P2X2 receptor. By combining whole-cell and single-channel recordings, we report that NCS-ATP covalently and specifically labels two previously unidentified positions N140 and L186 from two adjacent subunits separated by about 18 Å in a P2X2 closed state homology model, suggesting the existence of at least two binding modes. Tethering reaction at both positions primes subsequent agonist binding, yet with distinct functional consequences. Labeling of one position impedes subsequent ATP function, which results in inefficient gating, whereas tethering of the other position, although failing to produce gating by itself, enhances subsequent ATP function. Our results thus define a large and dynamic intersubunit ATP-binding pocket and suggest that receptors trapped in covalently agonist-bound states differ in their ability to gate the ion channel. PMID:21576497

Crystal Structure and Size-Dependent Neutralization Properties of HK20, a Human Monoclonal Antibody Binding to the Highly Conserved Heptad Repeat 1 of gp41

PubMed Central

Seaman, Mike S.; Lutje Hulsik, David; Hinz, Andreas; Vanzetta, Fabrizia; Agatic, Gloria; Silacci, Chiara; Mainetti, Lara; Scarlatti, Gabriella; Sallusto, Federica; Weiss, Robin; Lanzavecchia, Antonio; Weissenhorn, Winfried

2010-01-01

The human monoclonal antibody (mAb) HK20 neutralizes a broad spectrum of primary HIV-1 isolates by targeting the highly conserved heptad repeat 1 (HR1) of gp41, which is transiently exposed during HIV-1 entry. Here we present the crystal structure of the HK20 Fab in complex with a gp41 mimetic 5-Helix at 2.3 Å resolution. HK20 employs its heavy chain CDR H2 and H3 loops to bind into a conserved hydrophobic HR1 pocket that is occupied by HR2 residues in the gp41 post fusion conformation. Compared to the previously described HR1-specific mAb D5, HK20 approaches its epitope with a different angle which might favor epitope access and thus contribute to its higher neutralization breadth and potency. Comparison of the neutralization activities of HK20 IgG, Fab and scFv employing both single cycle and multiple cycle neutralization assays revealed much higher potencies for the smaller Fab and scFv over IgG, implying that the target site is difficult to access for complete antibodies. Nevertheless, two thirds of sera from HIV-1 infected individuals contain significant titers of HK20-inhibiting antibodies. The breadth of neutralization of primary isolates across all clades, the higher potencies for C-clade viruses and the targeting of a distinct site as compared to the fusion inhibitor T-20 demonstrate the potential of HK20 scFv as a therapeutic tool. PMID:21124990

Crystal structure and size-dependent neutralization properties of HK20, a human monoclonal antibody binding to the highly conserved heptad repeat 1 of gp41.

PubMed

Sabin, Charles; Corti, Davide; Buzon, Victor; Seaman, Mike S; Lutje Hulsik, David; Hinz, Andreas; Vanzetta, Fabrizia; Agatic, Gloria; Silacci, Chiara; Mainetti, Lara; Scarlatti, Gabriella; Sallusto, Federica; Weiss, Robin; Lanzavecchia, Antonio; Weissenhorn, Winfried

2010-11-18

The human monoclonal antibody (mAb) HK20 neutralizes a broad spectrum of primary HIV-1 isolates by targeting the highly conserved heptad repeat 1 (HR1) of gp41, which is transiently exposed during HIV-1 entry. Here we present the crystal structure of the HK20 Fab in complex with a gp41 mimetic 5-Helix at 2.3 Å resolution. HK20 employs its heavy chain CDR H2 and H3 loops to bind into a conserved hydrophobic HR1 pocket that is occupied by HR2 residues in the gp41 post fusion conformation. Compared to the previously described HR1-specific mAb D5, HK20 approaches its epitope with a different angle which might favor epitope access and thus contribute to its higher neutralization breadth and potency. Comparison of the neutralization activities of HK20 IgG, Fab and scFv employing both single cycle and multiple cycle neutralization assays revealed much higher potencies for the smaller Fab and scFv over IgG, implying that the target site is difficult to access for complete antibodies. Nevertheless, two thirds of sera from HIV-1 infected individuals contain significant titers of HK20-inhibiting antibodies. The breadth of neutralization of primary isolates across all clades, the higher potencies for C-clade viruses and the targeting of a distinct site as compared to the fusion inhibitor T-20 demonstrate the potential of HK20 scFv as a therapeutic tool.

pKa Modulation of the Acid/Base Catalyst within GH32 and GH68: A Role in Substrate/Inhibitor Specificity?

PubMed Central

Yuan, Shuguang; Le Roy, Katrien; Venken, Tom; Lammens, Willem; Van den Ende, Wim; De Maeyer, Marc

2012-01-01

Glycoside hydrolases of families 32 (GH32) and 68 (GH68) belong to clan GH-J, containing hydrolytic enzymes (sucrose/fructans as donor substrates) and fructosyltransferases (sucrose/fructans as donor and acceptor substrates). In GH32 members, some of the sugar substrates can also function as inhibitors, this regulatory aspect further adding to the complexity in enzyme functionalities within this family. Although 3D structural information becomes increasingly available within this clan and huge progress has been made on structure-function relationships, it is not clear why some sugars bind as inhibitors without being catalyzed. Conserved aspartate and glutamate residues are well known to act as nucleophile and acid/bases within this clan. Based on the available 3D structures of enzymes and enzyme-ligand complexes as well as docking simulations, we calculated the pKa of the acid-base before and after substrate binding. The obtained results strongly suggest that most GH-J members show an acid-base catalyst that is not sufficiently protonated before ligand entrance, while the acid-base can be fully protonated when a substrate, but not an inhibitor, enters the catalytic pocket. This provides a new mechanistic insight aiming at understanding the complex substrate and inhibitor specificities observed within the GH-J clan. Moreover, besides the effect of substrate entrance on its own, we strongly suggest that a highly conserved arginine residue (in the RDP motif) rather than the previously proposed Tyr motif (not conserved) provides the proton to increase the pKa of the acid-base catalyst. PMID:22662155

DOE Office of Scientific and Technical Information (OSTI.GOV)

Herrou, Julien; Willett, Jonathan W.; Czyż, Daniel M.

ABSTRACT Brucella abortusσ E1is an EcfG family sigma factor that regulates the transcription of dozens of genes in response to diverse stress conditions and is required for maintenance of chronic infection in a mouse model. A putative ATP-binding cassette transporter operon,bab1_0223-bab1_0226, is among the most highly activated gene sets in the σ E1regulon. The proteins encoded by the operon resemble quaternary ammonium-compatible solute importers but are most similar in sequence to the broadly conserved YehZYXW system, which remains largely uncharacterized. Transcription ofyehZYXWis activated by the general stress sigma factor σ SinEnterobacteriaceae, which suggests a functional role for this transport systemmore » in bacterial stress response across the classesAlphaproteobacteriaandGammaproteobacteria. We present evidence thatB. abortusYehZYXW does not function as an importer of known compatible solutes under physiological conditions and does not contribute to the virulence defect of a σ E1-null strain. The solein vitrophenotype associated with genetic disruption of this putative transport system is reduced growth in the presence of high Li +ion concentrations. A crystal structure ofB. abortusYehZ revealed a class II periplasmic binding protein fold with significant structural homology toArchaeoglobus fulgidusProX, which binds glycine betaine. However, the structure of the YehZ ligand-binding pocket is incompatible with high-affinity binding to glycine betaine. This is consistent with weak measured binding of YehZ to glycine betaine and related compatible solutes. We conclude that YehZYXW is a conserved, stress-regulated transport system that is phylogenetically and functionally distinct from quaternary ammonium-compatible solute importers. IMPORTANCEBrucella abortusσ E1regulates transcription in response to stressors encountered in its mammalian host and is necessary for maintenance of chronic infection in a mouse model. The functions of the majority of genes regulated by σ E1remain undefined. We present a functional/structural analysis of a conserved putative membrane transport system (YehZYXW) whose expression is strongly activated by σ E1. Though annotated as a quaternary ammonium osmolyte uptake system, experimental physiological studies and measured ligand-binding properties of the periplasmic binding protein (PBP), YehZ, are inconsistent with this function. A crystal structure ofB. abortusYehZ provides molecular insight into differences between bona fide quaternary ammonium osmolyte importers and YehZ-related proteins, which form a distinct phylogenetic and functional group of PBPs.« less

A Structural Model for Binding of the Serine-Rich Repeat Adhesin GspB to Host Carbohydrate Receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pyburn, Tasia M.; Bensing, Barbara A.; Xiong, Yan Q.

2014-10-02

GspB is a serine-rich repeat (SRR) adhesin of Streptococcus gordonii that mediates binding of this organism to human platelets via its interaction with sialyl-T antigen on the receptor GPIb{alpha}. This interaction appears to be a major virulence determinant in the pathogenesis of infective endocarditis. To address the mechanism by which GspB recognizes its carbohydrate ligand, we determined the high-resolution x-ray crystal structure of the GspB binding region (GspB{sub BR}), both alone and in complex with a disaccharide precursor to sialyl-T antigen. Analysis of the GspB{sub BR} structure revealed that it is comprised of three independently folded subdomains or modules: (1)more » an Ig-fold resembling a CnaA domain from prokaryotic pathogens; (2) a second Ig-fold resembling the binding region of mammalian Siglecs; (3) a subdomain of unique fold. The disaccharide was found to bind in a pocket within the Siglec subdomain, but at a site distinct from that observed in mammalian Siglecs. Confirming the biological relevance of this binding pocket, we produced three isogenic variants of S. gordonii, each containing a single point mutation of a residue lining this binding pocket. These variants have reduced binding to carbohydrates of GPIb{alpha}. Further examination of purified GspB{sub BR}-R484E showed reduced binding to sialyl-T antigen while S. gordonii harboring this mutation did not efficiently bind platelets and showed a significant reduction in virulence, as measured by an animal model of endocarditis. Analysis of other SRR proteins revealed that the predicted binding regions of these adhesins also had a modular organization, with those known to bind carbohydrate receptors having modules homologous to the Siglec and Unique subdomains of GspBBR. This suggests that the binding specificity of the SRR family of adhesins is determined by the type and organization of discrete modules within the binding domains, which may affect the tropism of organisms for different tissues.« less

Flipped Phenyl Ring Orientations of Dopamine Binding with Human and Drosophila Dopamine Transporters: Remarkable Role of Three Nonconserved Residues.

PubMed

Yuan, Yaxia; Zhu, Jun; Zhan, Chang-Guo

2018-03-09

Molecular modeling and molecular dynamics simulations were performed in the present study to examine the modes of dopamine binding with human and Drosophila dopamine transporters (hDAT and dDAT). The computational data revealed flipped binding orientations of dopamine in hDAT and dDAT due to the major differences in three key residues (S149, G153, and A423 of hDAT vs A117, D121, and S422 of dDAT) in the binding pocket. These three residues dictate the binding orientation of dopamine in the binding pocket, as the aromatic ring of dopamine tends to take an orientation with both the para- and meta-hydroxyl groups being close to polar residues and away from nonpolar residues of the protein. The flipped binding orientations of dopamine in hDAT and dDAT clearly demonstrate a generally valuable insight concerning how the species difference could drastically affect the protein-ligand binding modes, demonstrating that the species difference, which is a factor rarely considered in early drug design stage, must be accounted for throughout the ligand/drug design and discovery processes in general.

Sampling and energy evaluation challenges in ligand binding protein design

PubMed Central

Dou, Jiayi; Doyle, Lindsey; Jr. Greisen, Per; Schena, Alberto; Park, Hahnbeom; Johnsson, Kai; Stoddard, Barry L.

2017-01-01

Abstract The steroid hormone 17α‐hydroxylprogesterone (17‐OHP) is a biomarker for congenital adrenal hyperplasia and hence there is considerable interest in development of sensors for this compound. We used computational protein design to generate protein models with binding sites for 17‐OHP containing an extended, nonpolar, shape‐complementary binding pocket for the four‐ring core of the compound, and hydrogen bonding residues at the base of the pocket to interact with carbonyl and hydroxyl groups at the more polar end of the ligand. Eight of 16 designed proteins experimentally tested bind 17‐OHP with micromolar affinity. A co‐crystal structure of one of the designs revealed that 17‐OHP is rotated 180° around a pseudo‐two‐fold axis in the compound and displays multiple binding modes within the pocket, while still interacting with all of the designed residues in the engineered site. Subsequent rounds of mutagenesis and binding selection improved the ligand affinity to nanomolar range, while appearing to constrain the ligand to a single bound conformation that maintains the same “flipped” orientation relative to the original design. We trace the discrepancy in the design calculations to two sources: first, a failure to model subtle backbone changes which alter the distribution of sidechain rotameric states and second, an underestimation of the energetic cost of desolvating the carbonyl and hydroxyl groups of the ligand. The difference between design model and crystal structure thus arises from both sampling limitations and energy function inaccuracies that are exacerbated by the near two‐fold symmetry of the molecule. PMID:28980354

Novel quinolone chalcones targeting colchicine-binding pocket kill multidrug-resistant cancer cells by inhibiting tubulin activity and MRP1 function.

PubMed

Lindamulage, I Kalhari; Vu, Hai-Yen; Karthikeyan, Chandrabose; Knockleby, James; Lee, Yi-Fang; Trivedi, Piyush; Lee, Hoyun

2017-08-31

Agents targeting colchicine-binding pocket usually show a minimal drug-resistance issue, albeit often associated with high toxicity. Chalcone-based compounds, which may bind to colchicine-binding site, are found in many edible fruits, suggesting that they can be effective drugs with less toxicity. Therefore, we synthesized and examined 24 quinolone chalcone compounds, from which we identified ((E)-3-(3-(2-Methoxyphenyl)-3-oxoprop-1-enyl) quinolin-2(1H)-one) (CTR-17) and ((E)-6-Methoxy-3-(3-(2-methoxyphenyl)-3-oxoprop-1-enyl) quinolin-2(1H)-one) (CTR-20) as promising leads. In particular, CTR-20 was effective against 65 different cancer cell lines originated from 12 different tissues, largely in a cancer cell-specific manner. We found that both CTR-17 and CTR-20 reversibly bind to the colchicine-binding pocket on β-tubulin. Interestingly however, both the CTRs were highly effective against multidrug-resistant cancer cells while colchicine, paclitaxel and vinblastine were not. Our study with CTR-20 showed that it overcomes multidrug-resistance through its ability to impede MRP1 function while maintaining strong inhibition against microtubule activity. Data from mice engrafted with the MDA-MB-231 triple-negative breast cancer cells showed that both CTR-17 and CTR-20 possess strong anticancer activity, alone or in combination with paclitaxel, without causing any notable side effects. Together, our data demonstrates that both the CTRs can be effective and safe drugs against many different cancers, especially against multidrug-resistant tumors.

Twisting a β-Carotene, an Adaptive Trick from Nature for Dissipating Energy during Photoprotection*

PubMed Central

Sobotka, Roman; Kish, Elizabeth; Shukla, Mahendra Kumar; Pascal, Andrew A.; Polívka, Tomáš; Robert, Bruno

2017-01-01

Cyanobacteria possess a family of one-helix high light-inducible proteins (Hlips) that are homologous to light-harvesting antenna of plants and algae. An Hlip protein, high light-inducible protein D (HliD) purified as a small complex with the Ycf39 protein is evaluated using resonance Raman spectroscopy. We show that the HliD binds two different β-carotenes, each present in two non-equivalent binding pockets with different conformations, having their (0,0) absorption maxima at 489 and 522 nm, respectively. Both populations of β-carotene molecules were in all-trans configuration and the absorption position of the farthest blue-shifted β-carotene was attributed entirely to the polarizability of the environment in its binding pocket. In contrast, the absorption maximum of the red-shifted β-carotene was attributed to two different factors: the polarizability of the environment in its binding pocket and, more importantly, to the conformation of its β-rings. This second β-carotene has highly twisted β-rings adopting a flat conformation, which implies that the effective conjugation length N is extended up to 10.5 modifying the energetic levels. This increase in N will also result in a lower S1 energy state, which may provide a permanent energy dissipation channel. Analysis of the carbonyl stretching region for chlorophyll a excitations indicates that the HliD binds six chlorophyll a molecules in five non-equivalent binding sites, with at least one chlorophyll a presenting a slight distortion to its macrocycle. The binding modes and conformations of HliD-bound pigments are discussed with respect to the known structures of LHCII and CP29. PMID:27994060

Allosteric Fine-Tuning of the Binding Pocket Dynamics in the ITK SH2 Domain by a Distal Molecular Switch: An Atomistic Perspective.

PubMed

Momin, Mohamed; Xin, Yao; Hamelberg, Donald

2017-06-29

Although the regulation of function of proteins by allosteric interactions has been identified in many subcellular processes, molecular switches are also known to induce long-range conformational changes in proteins. A less well understood molecular switch involving cis-trans isomerization of a peptidyl-prolyl bond could induce a conformational change directly to the backbone that is propagated to other parts of the protein. However, these switches are elusive and hard to identify because they are intrinsic to biomolecules that are inherently dynamic. Here, we explore the conformational dynamics and free energy landscape of the SH2 domain of interleukin-2-inducible T-cell or tyrosine kinase (ITK) to fully understand the conformational coupling between the distal cis-trans molecular switch and its binding pocket of the phosphotyrosine motif. We use multiple microsecond-long all-atom molecular dynamics simulations in explicit water for over a total of 60 μs. We show that cis-trans isomerization of the Asn286-Pro287 peptidyl-prolyl bond is directly coupled to the dynamics of the binding pocket of the phosphotyrosine motif, in agreement with previous NMR experiments. Unlike the cis state that is localized and less dynamic in a single free energy basin, the trans state samples two distinct conformations of the binding pocket-one that recognizes the phosphotyrosine motif and the other that is somewhat similar to that of the cis state. The results provide an atomic-level description of a less well understood allosteric regulation by a peptidyl-prolyl cis-trans molecular switch that could aid in the understanding of normal and aberrant subcellular processes and the identification of these elusive molecular switches in other proteins.

Influence of GTP/GDP and magnesium ion on the solvated structure of the protein FtsZ: a molecular dynamics study.

PubMed

Jamous, Carla; Basdevant, Nathalie; Ha-Duong, Tap

2014-01-01

We present here a structural analysis of ten extensive all-atom molecular dynamics simulations of the monomeric protein FtsZ in various binding states. Since the polymerization and GTPase activities of FtsZ depend on the nature of a bound nucleotide as well as on the presence of a magnesium ion, we studied the structural differences between the average conformations of the following five systems: FtsZ-Apo, FtsZ-GTP, FtsZ-GDP, FtsZ-GTP-Mg, and FtsZ-GDP-Mg. The in silico solvated average structure of FtsZ-Apo significantly differs from the crystallographic structure 1W59 of FtsZ which was crystallized in a dimeric form without nucleotide and magnesium. The simulated Apo form of the protein also clearly differs from the FtsZ structures when it is bound to its ligand, the most important discrepancies being located in the loops surrounding the nucleotide binding pocket. The three average structures of FtsZ-GTP, FtsZ-GDP, and FtsZ-GTP-Mg are overall similar, except for the loop T7 located at the opposite side of the binding pocket and whose conformation in FtsZ-GDP notably differs from the one in FtsZ-GTP and FtsZ-GTP-Mg. The presence of a magnesium ion in the binding pocket has no impact on the FtsZ conformation when it is bound to GTP. In contrast, when the protein is bound to GDP, the divalent cation causes a translation of the nucleotide outwards the pocket, inducing a significant conformational change of the loop H6-H7 and the top of helix H7.

4′-O-substitutions determine selectivity of aminoglycoside antibiotics

PubMed Central

Perez-Fernandez, Déborah; Shcherbakov, Dmitri; Matt, Tanja; Leong, Ng Chyan; Kudyba, Iwona; Duscha, Stefan; Boukari, Heithem; Patak, Rashmi; Dubbaka, Srinivas Reddy; Lang, Kathrin; Meyer, Martin; Akbergenov, Rashid; Freihofer, Pietro; Vaddi, Swapna; Thommes, Pia; Ramakrishnan, V.; Vasella, Andrea; Böttger, Erik C.

2014-01-01

Clinical use of 2-deoxystreptamine aminoglycoside antibiotics, which target the bacterial ribosome, is compromised by adverse effects related to limited drug selectivity. Here we present a series of 4′,6′-O-acetal and 4′-O-ether modifications on glucopyranosyl ring I of aminoglycosides. Chemical modifications were guided by measuring interactions between the compounds synthesized and ribosomes harbouring single point mutations in the drug-binding site, resulting in aminoglycosides that interact poorly with the drug-binding pocket of eukaryotic mitochondrial or cytosolic ribosomes. Yet, these compounds largely retain their inhibitory activity for bacterial ribosomes and show antibacterial activity. Our data indicate that 4′-O-substituted aminoglycosides possess increased selectivity towards bacterial ribosomes and little activity for any of the human drug-binding pockets. PMID:24473108

Identification of STAT1 and STAT3 Specific Inhibitors Using Comparative Virtual Screening and Docking Validation

PubMed Central

Szelag, Malgorzata; Czerwoniec, Anna; Wesoly, Joanna; Bluyssen, Hans A. R.

2015-01-01

Signal transducers and activators of transcription (STATs) facilitate action of cytokines, growth factors and pathogens. STAT activation is mediated by a highly conserved SH2 domain, which interacts with phosphotyrosine motifs for specific STAT-receptor contacts and STAT dimerization. The active dimers induce gene transcription in the nucleus by binding to a specific DNA-response element in the promoter of target genes. Abnormal activation of STAT signaling pathways is implicated in many human diseases, like cancer, inflammation and auto-immunity. Searches for STAT-targeting compounds, exploring the phosphotyrosine (pTyr)-SH2 interaction site, yielded many small molecules for STAT3 but sparsely for other STATs. However, many of these inhibitors seem not STAT3-specific, thereby questioning the present modeling and selection strategies of SH2 domain-based STAT inhibitors. We generated new 3D structure models for all human (h)STATs and developed a comparative in silico docking strategy to obtain further insight into STAT-SH2 cross-binding specificity of a selection of previously identified STAT3 inhibitors. Indeed, by primarily targeting the highly conserved pTyr-SH2 binding pocket the majority of these compounds exhibited similar binding affinity and tendency scores for all STATs. By comparative screening of a natural product library we provided initial proof for the possibility to identify STAT1 as well as STAT3-specific inhibitors, introducing the ‘STAT-comparative binding affinity value’ and ‘ligand binding pose variation’ as selection criteria. In silico screening of a multi-million clean leads (CL) compound library for binding of all STATs, likewise identified potential specific inhibitors for STAT1 and STAT3 after docking validation. Based on comparative virtual screening and docking validation, we developed a novel STAT inhibitor screening tool that allows identification of specific STAT1 and STAT3 inhibitory compounds. This could increase our understanding of the functional role of these STATs in different diseases and benefit the clinical need for more drugable STAT inhibitors with high specificity, potency and excellent bioavailability. PMID:25710482

Structures of holo wild-type human cellular retinol-binding protein II (hCRBPII) bound to retinol and retinal

PubMed Central

Nossoni, Zahra; Assar, Zahra; Yapici, Ipek; Nosrati, Meisam; Wang, Wenjing; Berbasova, Tetyana; Vasileiou, Chrysoula; Borhan, Babak; Geiger, James

2014-01-01

Cellular retinol-binding proteins (CRBPs) I and II, which are members of the intracellular lipid-binding protein (iLBP) family, are retinoid chaperones that are responsible for the intracellular transport and delivery of both retinol and retinal. Although structures of retinol-bound CRBPI and CRBPII are known, no structure of a retinal-bound CRBP has been reported. In addition, the retinol-bound human CRBPII (hCRBPII) structure shows partial occupancy of a non­canonical conformation of retinol in the binding pocket. Here, the structure of retinal-bound hCRBPII and the structure of retinol-bound hCRBPII with retinol fully occupying the binding pocket are reported. It is further shown that the retinoid derivative seen in both the zebrafish CRBP and the hCRBPII structures is likely to be the product of flux-dependent and wavelength-dependent X-ray damage during data collection. The structures of retinoid-bound CRBPs are compared and contrasted, and rationales for the differences in binding affinities for retinal and retinol are provided. PMID:25478840

Structures of holo wild-type human cellular retinol-binding protein II (hCRBPII) bound to retinol and retinal.

PubMed

Nossoni, Zahra; Assar, Zahra; Yapici, Ipek; Nosrati, Meisam; Wang, Wenjing; Berbasova, Tetyana; Vasileiou, Chrysoula; Borhan, Babak; Geiger, James

2014-12-01

Cellular retinol-binding proteins (CRBPs) I and II, which are members of the intracellular lipid-binding protein (iLBP) family, are retinoid chaperones that are responsible for the intracellular transport and delivery of both retinol and retinal. Although structures of retinol-bound CRBPI and CRBPII are known, no structure of a retinal-bound CRBP has been reported. In addition, the retinol-bound human CRBPII (hCRBPII) structure shows partial occupancy of a noncanonical conformation of retinol in the binding pocket. Here, the structure of retinal-bound hCRBPII and the structure of retinol-bound hCRBPII with retinol fully occupying the binding pocket are reported. It is further shown that the retinoid derivative seen in both the zebrafish CRBP and the hCRBPII structures is likely to be the product of flux-dependent and wavelength-dependent X-ray damage during data collection. The structures of retinoid-bound CRBPs are compared and contrasted, and rationales for the differences in binding affinities for retinal and retinol are provided.

Alkylated hydroxylamine derivatives eliminate peripheral retinylidene Schiff bases but cannot enter the retinal binding pocket of light-activated rhodopsin.

PubMed

Piechnick, Ronny; Heck, Martin; Sommer, Martha E

2011-08-23

Besides Lys-296 in the binding pocket of opsin, all-trans-retinal forms adducts with peripheral lysine residues and phospholipids, thereby mimicking the spectral and chemical properties of metarhodopsin species. These pseudophotoproducts composed of nonspecific retinylidene Schiff bases have long plagued the investigation of rhodopsin deactivation and identification of decay products. We discovered that, while hydroxylamine can enter the retinal binding pocket of light-activated rhodopsin, the modified hydroxylamine compounds o-methylhydroxylamine (mHA), o-ethylhydroxylamine (eHA), o-tert-butylhydroxylamine (t-bHA), and o-(carboxymethyl)hydroxylamine (cmHA) are excluded. However, the alkylated hydroxylamines react quickly and efficiently with exposed retinylidene Schiff bases to form their respective retinal oximes. We further investigated how t-bHA affects light-activated rhodopsin and its interaction with binding partners. We found that both metarhodopsin II (Meta II) and Meta III are resistant to t-bHA, and neither arrestin nor transducin binding is affected by t-bHA. This discovery suggests that the hypothetical solvent channel that opens in light-activated rhodopsin is extremely stringent with regard to size and/or polarity. We believe that alkylated hydroxylamines will prove to be extremely useful reagents for the investigation of rhodopsin activation and decay mechanisms. Furthermore, the use of alkylated hydroxylamines should not be limited to in vitro studies and could help elucidate visual signal transduction mechanisms in the living cells of the retina. © 2011 American Chemical Society

Binding Specificity Determines the Cytochrome P450 3A4 Mediated Enantioselective Metabolism of Metconazole.

PubMed

Zhuang, Shulin; Zhang, Leili; Zhan, Tingjie; Lu, Liping; Zhao, Lu; Wang, Haifei; Morrone, Joseph A; Liu, Weiping; Zhou, Ruhong

2018-01-25

Cytochrome P450 3A4 (CYP3A4) is a promiscuous enzyme, mediating the biotransformations of ∼50% of clinically used drugs, many of which are chiral molecules. Probing the interactions between CYP3A4 and chiral chemicals is thus essential for the elucidation of molecular mechanisms of enantioselective metabolism. We developed a stepwise-restrained-molecular-dynamics (MD) method to model human CYP3A4 in a complex with cis-metconazole (MEZ) isomers and performed conventional MD simulations with a total simulation time of 2.2 μs to probe the molecular interactions. Our current study, which employs a combined experimental and theoretical approach, reports for the first time on the distinct conformational changes of CYP3A4 that are induced by the enantioselective binding of cis-MEZ enantiomers. CYP3A4 preferably metabolizes cis-RS MEZ over the cis-SR isomer, with the resultant enantiomer fraction for cis-MEZ increasing rapidly from 0.5 to 0.82. cis-RS MEZ adopts a more extended structure in the active pocket with its Cl atom exposed to the solvent, whereas cis-SR MEZ sits within the hydrophobic core of the active pocket. Free-energy-perturbation calculations indicate that unfavorable van der Waals interactions between the cis-MEZ isomers and the CYP3A4 binding pocket predominantly contribute to their binding-affinity differences. These results demonstrate that binding specificity determines the cytochrome P450 3A4 mediated enantioselective metabolism of cis-MEZ.

Structural snapshots along the reaction pathway of Yersinia pestis RipA, a putative butyryl-CoA transferase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Torres, Rodrigo; Lan, Benson; Latif, Yama

2014-04-01

The crystal structures of Y. pestis RipA mutants were determined to provide insights into the CoA transferase reaction pathway. Yersinia pestis, the causative agent of bubonic plague, is able to survive in both extracellular and intracellular environments within the human host, although its intracellular survival within macrophages is poorly understood. A novel Y. pestis three-gene rip (required for intracellular proliferation) operon, and in particular ripA, has been shown to be essential for survival and replication in interferon γ-induced macrophages. RipA was previously characterized as a putative butyryl-CoA transferase proposed to yield butyrate, a known anti-inflammatory shown to lower macrophage-produced NOmore » levels. RipA belongs to the family I CoA transferases, which share structural homology, a conserved catalytic glutamate which forms a covalent CoA-thioester intermediate and a flexible loop adjacent to the active site known as the G(V/I)G loop. Here, functional and structural analyses of several RipA mutants are presented in an effort to dissect the CoA transferase mechanism of RipA. In particular, E61V, M31G and F60M RipA mutants show increased butyryl-CoA transferase activities when compared with wild-type RipA. Furthermore, the X-ray crystal structures of E61V, M31G and F60M RipA mutants, when compared with the wild-type RipA structure, reveal important conformational changes orchestrated by a conserved acyl-group binding-pocket phenylalanine, Phe85, and the G(V/I)G loop. Binary structures of M31G RipA and F60M RipA with two distinct CoA substrate conformations are also presented. Taken together, these data provide CoA transferase reaction snapshots of an open apo RipA, a closed glutamyl-anhydride intermediate and an open CoA-thioester intermediate. Furthermore, biochemical analyses support essential roles for both the catalytic glutamate and the flexible G(V/I)G loop along the reaction pathway, although further research is required to fully understand the function of the acyl-group binding pocket in substrate specificity.« less

Spatial Decomposition of Translational Water–Water Correlation Entropy in Binding Pockets

PubMed Central

2015-01-01

A number of computational tools available today compute the thermodynamic properties of water at surfaces and in binding pockets by using inhomogeneous solvation theory (IST) to analyze explicit-solvent simulations. Such methods enable qualitative spatial mappings of both energy and entropy around a solute of interest and can also be applied quantitatively. However, the entropy estimates of existing methods have, to date, been almost entirely limited to the first-order terms in the IST’s entropy expansion. These first-order terms account for localization and orientation of water molecules in the field of the solute but not for the modification of water–water correlations by the solute. Here, we present an extension of the Grid Inhomogeneous Solvation Theory (GIST) approach which accounts for water–water translational correlations. The method involves rewriting the two-point density of water in terms of a conditional density and utilizes the efficient nearest-neighbor entropy estimation approach. Spatial maps of this second order term, for water in and around the synthetic host cucurbit[7]uril and in the binding pocket of the enzyme Factor Xa, reveal mainly negative contributions, indicating solute-induced water–water correlations relative to bulk water; particularly strong signals are obtained for sites at the entrances of cavities or pockets. This second-order term thus enters with the same, negative, sign as the first order translational and orientational terms. Numerical and convergence properties of the methodology are examined. PMID:26636620

Understanding Cryptic Pocket Formation in Protein Targets by Enhanced Sampling Simulations.

PubMed

Oleinikovas, Vladimiras; Saladino, Giorgio; Cossins, Benjamin P; Gervasio, Francesco L

2016-11-02

Cryptic pockets, that is, sites on protein targets that only become apparent when drugs bind, provide a promising alternative to classical binding sites for drug development. Here, we investigate the nature and dynamical properties of cryptic sites in four pharmacologically relevant targets, while comparing the efficacy of various simulation-based approaches in discovering them. We find that the studied cryptic sites do not correspond to local minima in the computed conformational free energy landscape of the unliganded proteins. They thus promptly close in all of the molecular dynamics simulations performed, irrespective of the force-field used. Temperature-based enhanced sampling approaches, such as Parallel Tempering, do not improve the situation, as the entropic term does not help in the opening of the sites. The use of fragment probes helps, as in long simulations occasionally it leads to the opening and binding to the cryptic sites. Our observed mechanism of cryptic site formation is suggestive of an interplay between two classical mechanisms: induced-fit and conformational selection. Employing this insight, we developed a novel Hamiltonian Replica Exchange-based method "SWISH" (Sampling Water Interfaces through Scaled Hamiltonians), which combined with probes resulted in a promising general approach for cryptic site discovery. We also addressed the issue of "false-positives" and propose a simple approach to distinguish them from druggable cryptic pockets. Our simulations, whose cumulative sampling time was more than 200 μs, help in clarifying the molecular mechanism of pocket formation, providing a solid basis for the choice of an efficient computational method.

What regulates the catalytic activities in AGE catalysis? An answer from quantum mechanics/molecular mechanics simulations.

PubMed

Zhang, Yulai; Zhang, Hongxing; Zheng, Qingchuan

2017-12-06

The AGE superfamily (AGEs) is made up of kinds of isomerase which are very important both physiologically and industrially. One of the most intriguing aspects of AGEs has to do with the mechanism that regulates their activities in single conserved active pocket. In order to clarify the relationship among single conserved active pocket and two activities in AGEs, results for the epimerization activity catalyzed by RaCE and the isomerization activity catalyzed by SeYihS were obtained by using QM/MM umbrella sampling simulations and 2D-FES calculations. Our results show that both of them have similar enzyme-substrate combination mode for inner pyranose ring in single conserved active pocket even though they have different substrate specificity. This means that the pathways of ring opening catalyzed by them are similar. However, one non-conserved residue (Leu183 in RaCE, Met175 in SeYihS) in the active site, which has different steric hindrance, causes a small but effective change in the direction of ring opening in stage 1. And then this change will induce a fundamentally different catalytic activity for RaCE and SeYihS in stage 2. Our results give a novel viewpoint about the regulatory mechanism between CE and YihS in AGEs, and may be helpful for further experiments of rational enzyme design based on the (α/α) 6 -barrel basic scaffold.

Mechanism of the G-protein mimetic nanobody binding to a muscarinic G-protein-coupled receptor.

PubMed

Miao, Yinglong; McCammon, J Andrew

2018-03-20

Protein-protein binding is key in cellular signaling processes. Molecular dynamics (MD) simulations of protein-protein binding, however, are challenging due to limited timescales. In particular, binding of the medically important G-protein-coupled receptors (GPCRs) with intracellular signaling proteins has not been simulated with MD to date. Here, we report a successful simulation of the binding of a G-protein mimetic nanobody to the M 2 muscarinic GPCR using the robust Gaussian accelerated MD (GaMD) method. Through long-timescale GaMD simulations over 4,500 ns, the nanobody was observed to bind the receptor intracellular G-protein-coupling site, with a minimum rmsd of 2.48 Å in the nanobody core domain compared with the X-ray structure. Binding of the nanobody allosterically closed the orthosteric ligand-binding pocket, being consistent with the recent experimental finding. In the absence of nanobody binding, the receptor orthosteric pocket sampled open and fully open conformations. The GaMD simulations revealed two low-energy intermediate states during nanobody binding to the M 2 receptor. The flexible receptor intracellular loops contribute remarkable electrostatic, polar, and hydrophobic residue interactions in recognition and binding of the nanobody. These simulations provided important insights into the mechanism of GPCR-nanobody binding and demonstrated the applicability of GaMD in modeling dynamic protein-protein interactions.

Function and dynamics of aptamers: A case study on the malachite green aptamer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Tianjiao

Aptamers are short single-stranded nucleic acids that can bind to their targets with high specificity and high affinity. To study aptamer function and dynamics, the malachite green aptamer was chosen as a model. Malachite green (MG) bleaching, in which an OH- attacks the central carbon (C1) of MG, was inhibited in the presence of the malachite green aptamer (MGA). The inhibition of MG bleaching by MGA could be reversed by an antisense oligonucleotide (AS) complementary to the MGA binding pocket. Computational cavity analysis of the NMR structure of the MGA-MG complex predicted that the OH - is sterically excluded frommore » the C1 of MG. The prediction was confirmed experimentally using variants of the MGA with changes in the MG binding pocket. This work shows that molecular reactivity can be reversibly regulated by an aptamer-AS pair based on steric hindrance. In addition to demonstrate that aptamers could control molecular reactivity, aptamer dynamics was studied with a strategy combining molecular dynamics (MD) simulation and experimental verification. MD simulation predicted that the MG binding pocket of the MGA is largely pre-organized and that binding of MG involves reorganization of the pocket and a simultaneous twisting of the MGA terminal stems around the pocket. MD simulation also provided a 3D-structure model of unoccupied MGA that has not yet been obtained by biophysical measurements. These predictions were consistent with biochemical and biophysical measurements of the MGA-MG interaction including RNase I footprinting, melting curves, thermodynamic and kinetic constants measurement. This work shows that MD simulation can be used to extend our understanding of the dynamics of aptamer-target interaction which is not evident from static 3D-structures. To conclude, I have developed a novel concept to control molecular reactivity by an aptamer based on steric protection and a strategy to study the dynamics of aptamer-target interaction by combining MD simulation and experimental verification. The former has potential application in controlling metabolic reactions and protein modifications by small reactants and the latter may serve as a general approach to study the dynamics of aptamer-target interaction for new insights into mechanisms of aptamer-target recognition.« less

Biochemical analyses and molecular modeling explain the functional loss of 17β-hydroxysteroid dehydrogenase 3 mutant G133R in three Tunisian patients with 46, XY Disorders of Sex Development.

PubMed

Engeli, Roger T; Rhouma, Bochra Ben; Sager, Christoph P; Tsachaki, Maria; Birk, Julia; Fakhfakh, Faiza; Keskes, Leila; Belguith, Neila; Odermatt, Alex

2016-01-01

Mutations in the HSD17B3 gene resulting in 17β-hydroxysteroid dehydrogenase type 3 (17β-HSD3) deficiency cause 46, XY Disorders of Sex Development (46, XY DSD). Approximately 40 different mutations in HSD17B3 have been reported; only few mutant enzymes have been mechanistically investigated. Here, we report novel compound heterozygous mutations in HSD17B3, composed of the nonsense mutation C206X and the missense mutation G133R, in three Tunisian patients from two non-consanguineous families. Mutants C206X and G133R were constructed by site-directed mutagenesis and expressed in HEK-293 cells. The truncated C206X enzyme, lacking part of the substrate binding pocket, was moderately expressed and completely lost its enzymatic activity. Wild-type 17β-HSD3 and mutant G133R showed comparable expression levels and intracellular localization. The conversion of Δ4-androstene-3,17-dione (androstenedione) to testosterone was almost completely abolished for mutant G133R compared with wild-type 17β-HSD3. To obtain further mechanistic insight, G133 was mutated to alanine, phenylalanine and glutamine. G133Q and G133F were almost completely inactive, whereas G133A displayed about 70% of wild-type activity. Sequence analysis revealed that G133 on 17β-HSD3 is located in a motif highly conserved in 17β-HSDs and other short-chain dehydrogenase/reductase (SDR) enzymes. A homology model of 17β-HSD3 predicted that arginine or any other bulky residue at position 133 causes steric hindrance of cofactor NADPH binding, whereas substrate binding seems to be unaffected. The results indicate an essential role of G133 in the arrangement of the cofactor binding pocket, thus explaining the loss-of-function of 17β-HSD3 mutant G133R in the patients investigated. Copyright © 2015 Elsevier Ltd. All rights reserved.

Structural prerequisites for G-protein activation by the neurotensin receptor

PubMed Central

Krumm, Brian E.; White, Jim F.; Shah, Priyanka; Grisshammer, Reinhard

2015-01-01

We previously determined the structure of neurotensin receptor NTSR1 in an active-like conformation with six thermostabilizing mutations bound to the peptide agonist neurotensin. This receptor was unable to activate G proteins, indicating that the mutations restricted NTSR1 to relate agonist binding to G-protein activation. Here we analyse the effect of three of those mutations (E166A3.49, L310A6.37, F358A7.42) and present two structures of NTSR1 able to catalyse nucleotide exchange at Gα. The presence of F3587.42 causes the conserved W3216.48 to adopt a side chain orientation parallel to the lipid bilayer sealing the collapsed Na+ ion pocket and linking the agonist with residues in the lower receptor part implicated in GPCR activation. In the intracellular receptor half, the bulkier L3106.37 side chain dictates the position of R1673.50 of the highly conserved D/ERY motif. These residues, together with the presence of E1663.49 provide determinants for G-protein activation by NTSR1. PMID:26205105

An in silico algorithm for identifying stabilizing pockets in proteins: test case, the Y220C mutant of the p53 tumor suppressor protein

PubMed Central

Bromley, Dennis; Bauer, Matthias R.; Fersht, Alan R.; Daggett, Valerie

2016-01-01

The p53 tumor suppressor protein performs a critical role in stimulating apoptosis and cell cycle arrest in response to oncogenic stress. The function of p53 can be compromised by mutation, leading to increased risk of cancer; approximately 50% of cancers are associated with mutations in the p53 gene, the majority of which are in the core DNA-binding domain. The Y220C mutation of p53, for example, destabilizes the core domain by 4 kcal/mol, leading to rapid denaturation and aggregation. The associated loss of tumor suppressor functionality is associated with approximately 75 000 new cancer cases every year. Destabilized p53 mutants can be ‘rescued’ and their function restored; binding of a small molecule into a pocket on the surface of mutant p53 can stabilize its wild-type structure and restore its function. Here, we describe an in silico algorithm for identifying potential rescue pockets, including the algorithm's integration with the Dynameomics molecular dynamics data warehouse and the DIVE visual analytics engine. We discuss the results of the application of the method to the Y220C p53 mutant, entailing finding a putative rescue pocket through MD simulations followed by an in silico search for stabilizing ligands that dock into the putative rescue pocket. The top three compounds from this search were tested experimentally and one of them bound in the pocket, as shown by nuclear magnetic resonance, and weakly stabilized the mutant. PMID:27503952

Modeling, molecular docking, probing catalytic binding mode of acetyl-CoA malate synthase G in Brucella melitensis 16M.

PubMed

Adi, Pradeepkiran Jangampalli; Yellapu, Nanda Kumar; Matcha, Bhaskar

2016-12-01

There are enormous evidences and previous reports standpoint that the enzyme of glyoxylate pathway malate synthase G (MSG) is a potential virulence factor in several pathogenic organisms, including Brucella melitensis 16M. Where the lack of crystal structures for best candidate proteins like MSG of B. melitensis 16M creates big lacuna to understand the molecular pathogenesis of brucellosis. In the present study, we have constructed a 3-D structure of MSG of Brucella melitensis 16M in MODELLER with the help of crystal structure of Mycobacterium tuberculosis malate synthase (PDB ID: 2GQ3) as template. The stereo chemical quality of the restrained model was evaluated by SAVES server; remarkably we identified the catalytic functional core domain located at 4 th cleft with conserved catalytic amino acids, start at ILE 59 to VAL 586 manifest the function of the protein. Furthermore, virtual screening and docking results reveals that best leadmolecules binds at the core domain pocket of MSG catalytic residues and these ligand leads could be the best prospective inhibitors to treat brucellosis.

Molecular mechanism for the subversion of the retromer coat by the Legionella effector RidL

PubMed Central

Romano-Moreno, Miguel; Rojas, Adriana L.; Williamson, Chad D.; Lucas, María; Isupov, Michail N.; Bonifacino, Juan S.; Machner, Matthias P.; Hierro, Aitor

2017-01-01

Microbial pathogens employ sophisticated virulence strategies to cause infections in humans. The intracellular pathogen Legionella pneumophila encodes RidL to hijack the host scaffold protein VPS29, a component of retromer and retriever complexes critical for endosomal cargo recycling. Here, we determined the crystal structure of L. pneumophila RidL in complex with the human VPS29–VPS35 retromer subcomplex. A hairpin loop protruding from RidL inserts into a conserved pocket on VPS29 that is also used by cellular ligands, such as Tre-2/Bub2/Cdc16 domain family member 5 (TBC1D5) and VPS9-ankyrin repeat protein for VPS29 binding. Consistent with the idea of molecular mimicry in protein interactions, RidL outcompeted TBC1D5 for binding to VPS29. Furthermore, the interaction of RidL with retromer did not interfere with retromer dimerization but was essential for association of RidL with retromer-coated vacuolar and tubular endosomes. Our work thus provides structural and mechanistic evidence into how RidL is targeted to endosomal membranes. PMID:29229824

Structural basis for sorting mechanism of p62 in selective autophagy.

PubMed

Ichimura, Yoshinobu; Kumanomidou, Taichi; Sou, Yu-shin; Mizushima, Tsunehiro; Ezaki, Junji; Ueno, Takashi; Kominami, Eiki; Yamane, Takashi; Tanaka, Keiji; Komatsu, Masaaki

2008-08-15

Impairment of autophagic degradation of the ubiquitin- and LC3-binding protein "p62" leads to the formation of cytoplasmic inclusion bodies. However, little is known about the sorting mechanism of p62 to autophagic degradation. Here we identified a motif of murine p62 consisting of 11 amino acids (Ser334-Ser344) containing conserved acidic and hydrophobic residues across species, as an LC3 recognition sequence (LRS). The crystal structure of the LC3-LRS complex at 1.56 angstroms resolution revealed interaction of Trp340 and Leu343 of p62 with different hydrophobic pockets on the ubiquitin fold of LC3. In vivo analyses demonstrated that p62 mutants lacking LC3 binding ability accumulated without entrapping into autophagosomes in the cytoplasm and subsequently formed ubiquitin-positive inclusion bodies as in autophagy-deficient cells. These results demonstrate that the intracellular level of p62 is tightly regulated by autophagy through the direct interaction of LC3 with p62 and reveal that selective turnover of p62 via autophagy controls inclusion body formation.

Crystal structures of the M 1 and M 4 muscarinic acetylcholine receptors

DOE PAGES

Thal, David M.; Sun, Bingfa; Feng, Dan; ...

2016-03-09

Muscarinic M1–M5 acetylcholine receptors are G-protein-coupled receptors that regulate many vital functions of the central and peripheral nervous systems. In particular, the M1 and M4 receptor subtypes have emerged as attractive drug targets for treatments of neurological disorders, such as Alzheimer’s disease and schizophrenia, but the high conservation of the acetylcholine-binding pocket has spurred current research into targeting allosteric sites on these receptors. In this paper, we report the crystal structures of the M1 and M4 muscarinic receptors bound to the inverse agonist, tiotropium. Comparison of these structures with each other, as well as with the previously reported M2 andmore » M3 receptor structures, reveals differences in the orthosteric and allosteric binding sites that contribute to a role in drug selectivity at this important receptor family. Finally, we also report identification of a cluster of residues that form a network linking the orthosteric and allosteric sites of the M4 receptor, which provides new insight into how allosteric modulation may be transmitted between the two spatially distinct domains.« less

Crystal structures of the M 1 and M 4 muscarinic acetylcholine receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thal, David M.; Sun, Bingfa; Feng, Dan

Muscarinic M1–M5 acetylcholine receptors are G-protein-coupled receptors that regulate many vital functions of the central and peripheral nervous systems. In particular, the M1 and M4 receptor subtypes have emerged as attractive drug targets for treatments of neurological disorders, such as Alzheimer’s disease and schizophrenia, but the high conservation of the acetylcholine-binding pocket has spurred current research into targeting allosteric sites on these receptors. In this paper, we report the crystal structures of the M1 and M4 muscarinic receptors bound to the inverse agonist, tiotropium. Comparison of these structures with each other, as well as with the previously reported M2 andmore » M3 receptor structures, reveals differences in the orthosteric and allosteric binding sites that contribute to a role in drug selectivity at this important receptor family. Finally, we also report identification of a cluster of residues that form a network linking the orthosteric and allosteric sites of the M4 receptor, which provides new insight into how allosteric modulation may be transmitted between the two spatially distinct domains.« less

Nucleotides Adjacent to the Ligand-Binding Pocket are Linked to Activity Tuning in the Purine Riboswitch

PubMed Central

Stoddard, Colby D.; Widmann, Jeremy; Trausch, Jeremiah J.; Marcano-Velázquez, Joan G.; Knight, Rob; Batey, Robert T.

2013-01-01

Direct sensing of intracellular metabolite concentrations by riboswitch RNAs provides an economical and rapid means to maintain metabolic homeostasis. Since many organisms employ the same class of riboswitch to control different genes or transcription units, it is likely that functional variation exists in riboswitches such that activity is tuned to meet cellular needs. Using a bioinformatic approach, we have identified a region of the purine riboswitch aptamer domain that displays conservation patterns linked to riboswitch activity. Aptamer domain compositions within this region can be divided into nine classes that display a spectrum of activities. Naturally occurring compositions in this region favor rapid association rate constants and slow dissociation rate constants for ligand binding. Using X-ray crystallography and chemical probing, we demonstrate that both the free and bound states are influenced by the composition of this region and that modest sequence alterations have a dramatic impact on activity. The introduction of non-natural compositions result in the inability to regulate gene expression in vivo, suggesting that aptamer domain activity is highly plastic and thus readily tunable to meet cellular needs. PMID:23485418

Studies of the Interaction of Influenza Virus RNA Polymerase PAN with Endonuclease Inhibitors.

PubMed

Dong, Li-Hua; Cao, Xiao-Rong

2018-06-01

Influenza virus is a major causative agent of respiratory viral infections, and RNA polymerase catalyzes its replication and transcription activities in infected cell nuclei. Since it is highly conserved in all virus strains, RNA polymerase becomes a key target of anti-influenza virus agents. Although experimental studies have revealed the good inhibitory activity of endonuclease inhibitors to RNA polymerase, the mechanism is still unclear. In this study, the docking and molecular dynamics simulations have been performed to explore the interaction of three kinds of endonuclease inhibitors with the subunit (PA N ) of RNA polymerase. Our calculations indicate that all these endonuclease inhibitors can bind to the binding pocket of PA N , in which the electronegative oxygen atoms of the inhibitors form a chelated structure with the two Mn 2+ cations of the active center. The most important interaction between these inhibitors and PA N is electrostatic interaction. The electron density of the chelate oxygen atoms determines the magnitude of the electrostatic energy, and the chelated structure and orientation of inhibitors depend largely on the distance between the chelate oxygen atoms.

[Substrate specificities of bile salt hydrolase 1 and its mutants from Lactobacillus salivarius].

PubMed

Bi, Jie; Fang, Fang; Qiu, Yuying; Yang, Qingli; Chen, Jian

2014-03-01

In order to analyze the correlation between critical residues in the catalytic centre of BSH and the enzyme substrate specificity, seven mutants of Lactobacillus salivarius bile salt hydrolase (BSH1) were constructed by using the Escherichia coli pET-20b(+) gene expression system, rational design and site-directed mutagenesis. These BSH1 mutants exhibited different hydrolytic activities against various conjugated bile salts through substrate specificities comparison. Among the residues being tested, Cys2 and Thr264 were deduced as key sites for BSH1 to catalyze taurocholic acid and glycocholic acid, respectively. Moreover, Cys2 and Thr264 were important for keeping the catalytic activity of BSH1. The high conservative Cys2 was not the only active site, other mutant amino acid sites were possibly involved in substrate binding. These mutant residues might influence the space and shape of the substrate-binding pockets or the channel size for substrate passing through and entering active site of BSH1, thus, the hydrolytic activity of BSH1 was changed to different conjugated bile salt.

Potent Allosteric Dengue Virus NS5 Polymerase Inhibitors: Mechanism of Action and Resistance Profiling

PubMed Central

Lim, Siew Pheng; Noble, Christian Guy; Seh, Cheah Chen; Soh, Tingjin Sherryl; El Sahili, Abbas; Chan, Grace Kar Yarn; Lescar, Julien; Arora, Rishi; Benson, Timothy; Nilar, Shahul; Manjunatha, Ujjini; Wan, Kah Fei; Dong, Hongping; Xie, Xuping; Yokokawa, Fumiaki

2016-01-01

Flaviviruses comprise major emerging pathogens such as dengue virus (DENV) or Zika virus (ZIKV). The flavivirus RNA genome is replicated by the RNA-dependent-RNA polymerase (RdRp) domain of non-structural protein 5 (NS5). This essential enzymatic activity renders the RdRp attractive for antiviral therapy. NS5 synthesizes viral RNA via a “de novo” initiation mechanism. Crystal structures of the flavivirus RdRp revealed a “closed” conformation reminiscent of a pre-initiation state, with a well ordered priming loop that extrudes from the thumb subdomain into the dsRNA exit tunnel, close to the “GDD” active site. To-date, no allosteric pockets have been identified for the RdRp, and compound screening campaigns did not yield suitable drug candidates. Using fragment-based screening via X-ray crystallography, we found a fragment that bound to a pocket of the apo-DENV RdRp close to its active site (termed “N pocket”). Structure-guided improvements yielded DENV pan-serotype inhibitors of the RdRp de novo initiation activity with nano-molar potency that also impeded elongation activity at micro-molar concentrations. Inhibitors exhibited mixed inhibition kinetics with respect to competition with the RNA or GTP substrate. The best compounds have EC50 values of 1–2 μM against all four DENV serotypes in cell culture assays. Genome-sequencing of compound-resistant DENV replicons, identified amino acid changes that mapped to the N pocket. Since inhibitors bind at the thumb/palm interface of the RdRp, this class of compounds is proposed to hinder RdRp conformational changes during its transition from initiation to elongation. This is the first report of a class of pan-serotype and cell-active DENV RdRp inhibitors. Given the evolutionary conservation of residues lining the N pocket, these molecules offer insights to treat other serious conditions caused by flaviviruses. PMID:27500641

A Novel Cofactor-binding Mode in Bacterial IMP Dehydrogenases Explains Inhibitor Selectivity*

PubMed Central

Makowska-Grzyska, Magdalena; Kim, Youngchang; Maltseva, Natalia; Osipiuk, Jerzy; Gu, Minyi; Zhang, Minjia; Mandapati, Kavitha; Gollapalli, Deviprasad R.; Gorla, Suresh Kumar; Hedstrom, Lizbeth; Joachimiak, Andrzej

2015-01-01

The steadily rising frequency of emerging diseases and antibiotic resistance creates an urgent need for new drugs and targets. Inosine 5′-monophosphate dehydrogenase (IMP dehydrogenase or IMPDH) is a promising target for the development of new antimicrobial agents. IMPDH catalyzes the oxidation of IMP to XMP with the concomitant reduction of NAD+, which is the pivotal step in the biosynthesis of guanine nucleotides. Potent inhibitors of bacterial IMPDHs have been identified that bind in a structurally distinct pocket that is absent in eukaryotic IMPDHs. The physiological role of this pocket was not understood. Here, we report the structures of complexes with different classes of inhibitors of Bacillus anthracis, Campylobacter jejuni, and Clostridium perfringens IMPDHs. These structures in combination with inhibition studies provide important insights into the interactions that modulate selectivity and potency. We also present two structures of the Vibrio cholerae IMPDH in complex with IMP/NAD+ and XMP/NAD+. In both structures, the cofactor assumes a dramatically different conformation than reported previously for eukaryotic IMPDHs and other dehydrogenases, with the major change observed for the position of the NAD+ adenosine moiety. More importantly, this new NAD+-binding site involves the same pocket that is utilized by the inhibitors. Thus, the bacterial IMPDH-specific NAD+-binding mode helps to rationalize the conformation adopted by several classes of prokaryotic IMPDH inhibitors. These findings offer a potential strategy for further ligand optimization. PMID:25572472

A molecular description of ligand binding to the two overlapping binding pockets of the nuclear vitamin D receptor (VDR): structure-function implications

PubMed Central

Mizwicki, Mathew T.; Menegaz, Danusa; Yaghmaei, Sepideh; Henry, Helen L.; Norman, Anthony W.

2010-01-01

Molecular modeling results indicate that the VDR contains two overlapping ligand binding pockets (LBP). Differential ligand stability and fractional occupancy of the two LBP has been physiochemically linked to the regulation of VDR-dependent genomic and non-genomic cellular responses. The purpose of this report is to develop an unbiased molecular modeling protocol that serves as a good starting point in simulating the dynamic interaction between 1α,25(OH)2-vitamin D3 (1,25D3) and the VDR LBP. To accomplish this goal, the flexible docking protocol developed allowed for flexibility in the VDR ligand and the VDR atoms that form the surfaces of the VDR LBP. This approach blindly replicated the 1,25D3 conformation and side-chain dynamics observed in the VDR x-ray structure. The results are also consistent with the previously published tenants of the vitamin D sterol (VDS)-VDR conformational ensemble model. Furthermore, we used flexible docking in combination with whole cell patch clamp electrophysiology and steroid competition assays to demonstrate that a) new non-vitamin D VDR ligands show a different pocket selectivity when compared to 1,25D3 that is qualitatively consistent with their ability to stimulate chloride channels and b) a new route of ligand binding provides a novel hypothesis describing the structural nuances that underlie hypercalceamia. PMID:20398762

Factorization of the association rate coefficient in ligand rebinding to heme proteins

NASA Astrophysics Data System (ADS)

Young, Robert D.

1984-01-01

A stochastic theory of ligand migration in biomolecules is used to analyze the recombination of small ligands to heme proteins after flash photolysis. The stochastic theory is based on a generalized sequential barrier model in which a ligand binds by overcoming a series of barriers formed by the solvent protein interface, the protein matrix, and the heme distal histidine system. The stochastic theory shows that the association rate coefficient λon factorizes into three terms λon =γ12Nout, where γ12 is the rate coefficient from the heme pocket to the heme binding site, is the equilibrium pocket occupation factor, and Nout is the fraction of heme proteins which do not undergo geminate recombination of a flashed-off ligand. The factorization of λon holds for any number of barriers and with no assumptions regarding the various rate coefficients so long as the exponential solvent process occurs. Transitions of a single ligand are allowed between any two sites with two crucial exceptions: (i) the heme binding site acts as a trap so that thermal dissociation of a bound ligand does not occur within the time of the measurement; (ii) the final step in the rebinding process always has a ligand in the heme pocket from where the ligand binds to the heme iron.

Conservation of structure, signaling and pharmacology between two serotonin receptor subtypes from decapod crustaceans, Panulirus interruptus and Procambarus clarkii.

PubMed

Spitzer, Nadja; Edwards, Donald H; Baro, Deborah J

2008-01-01

Serotonin (5-HT) plays important roles in the maintenance and modulation of neural systems throughout the animal kingdom. The actions of 5-HT have been well characterized for several crustacean model circuits; however, a dissection of the serotonergic transduction cascades operating in these models has been hampered by the lack of pharmacological tools for invertebrate receptors. Here we provide pharmacological profiles for two 5-HT receptors from the swamp crayfish, Procambarus clarkii: 5-HT(2beta) and 5-HT(1alpha). In so doing, we also report the first functional expression of a crustacean 5-HT(1) receptor, and show that it inhibits accumulation of cAMP. The drugs mCPP and quipazine are 5-HT(1alpha) agonists and are ineffective at 5-HT(2beta). Conversely, methiothepin and cinanserin are antagonists of 5-HT(2beta) but do not block 5-HT(1alpha). A comparison of these two receptors with their orthologs from the California spiny lobster, Panulirus interruptus, indicates conservation of protein structure, signaling and pharmacology. This conservation extends beyond crustacean infraorders. The signature residues that form the ligand-binding pocket in mammalian 5-HT receptors are found in the crustacean receptors. Similarly, the protein domains involved in G protein coupling are conserved between the two crustacean receptors and other characterized arthropod and mammalian 5-HT receptors. Considering the apparent conservation of pharmacological properties between crustacean 5-HT receptors, these tools could be applicable to related crustacean physiological preparations.

Ligand-specific regulation of the extracellular surface of a G-protein-coupled receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bokoch, Michael P.; Zou, Yaozhong; Rasmussen, Søren G.F.

G-protein-coupled receptors (GPCRs) are seven-transmembrane proteins that mediate most cellular responses to hormones and neurotransmitters. They are the largest group of therapeutic targets for a broad spectrum of diseases. Recent crystal structures of GPCRs have revealed structural conservation extending from the orthosteric ligand-binding site in the transmembrane core to the cytoplasmic G-protein-coupling domains. In contrast, the extracellular surface (ECS) of GPCRs is remarkably diverse and is therefore an ideal target for the discovery of subtype-selective drugs. However, little is known about the functional role of the ECS in receptor activation, or about conformational coupling of this surface to the nativemore » ligand-binding pocket. Here we use NMR spectroscopy to investigate ligand-specific conformational changes around a central structural feature in the ECS of the {beta}{sub 2} adrenergic receptor: a salt bridge linking extracellular loops 2 and 3. Small-molecule drugs that bind within the transmembrane core and exhibit different efficacies towards G-protein activation (agonist, neutral antagonist and inverse agonist) also stabilize distinct conformations of the ECS. We thereby demonstrate conformational coupling between the ECS and the orthosteric binding site, showing that drugs targeting this diverse surface could function as allosteric modulators with high subtype selectivity. Moreover, these studies provide a new insight into the dynamic behaviour of GPCRs not addressable by static, inactive-state crystal structures.« less

Structural basis for different phosphoinositide specificities of the PX domains of sorting nexins regulating G-protein signaling.

PubMed

Mas, Caroline; Norwood, Suzanne J; Bugarcic, Andrea; Kinna, Genevieve; Leneva, Natalya; Kovtun, Oleksiy; Ghai, Rajesh; Ona Yanez, Lorena E; Davis, Jasmine L; Teasdale, Rohan D; Collins, Brett M

2014-10-10

Sorting nexins (SNXs) or phox homology (PX) domain containing proteins are central regulators of cell trafficking and signaling. A subfamily of PX domain proteins possesses two unique PX-associated domains, as well as a regulator of G protein-coupled receptor signaling (RGS) domain that attenuates Gαs-coupled G protein-coupled receptor signaling. Here we delineate the structural organization of these RGS-PX proteins, revealing a protein family with a modular architecture that is conserved in all eukaryotes. The one exception to this is mammalian SNX19, which lacks the typical RGS structure but preserves all other domains. The PX domain is a sensor of membrane phosphoinositide lipids and we find that specific sequence alterations in the PX domains of the mammalian RGS-PX proteins, SNX13, SNX14, SNX19, and SNX25, confer differential phosphoinositide binding preferences. Although SNX13 and SNX19 PX domains bind the early endosomal lipid phosphatidylinositol 3-phosphate, SNX14 shows no membrane binding at all. Crystal structures of the SNX19 and SNX14 PX domains reveal key differences, with alterations in SNX14 leading to closure of the binding pocket to prevent phosphoinositide association. Our findings suggest a role for alternative membrane interactions in spatial control of RGS-PX proteins in cell signaling and trafficking. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jha, Ramesh K.; Kern, Teresa L.; Kim, Youngchang

A whole-cell biosensor utilizing a transcription factor (TF) is an effective tool for sensitive and selective detection of specialty chemicals or anthropogenic molecules, but requires access to an expanded repertoire of TFs. Using homology modeling and ligand docking for binding pocket identification, assisted by conservative mutations in the pocket, we engineered a novel specificity in an Acinetobacter TF, PobR, to ‘sense’ a chemical p-nitrophenol (pNP) and measured the response via a fluorescent protein reporter expressed from a PobR promoter. Out of 107 variants of PobR, four were active when dosed with pNP, with two mutants showing a specificity switch frommore » the native effector 4-hydroxybenzoate (4HB). One of the mutants, pNPmut1 was then used to create a smart microbial cell responding to pNP production from hydrolysis of an insecticide, paraoxon, in a coupled assay involving phosphotriesterase (PTE) enzyme expressed from a separate promoter. We show the fluorescence of the cells correlated with the catalytic efficiency of the PTE variant expressed in each cell. High selectivity between similar molecules (4HB versus pNP), high sensitivity for pNP detection (~2 μM) and agreement of apo- and holo-structures of PobR scaffold with predetermined computational models are other significant results presented in this work.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jha, Ramesh K.; Kern, Theresa L.; Kim, Youngchang

A whole-cell biosensor utilizing a transcription factor (TF) is an effective tool for sensitive and selective detection of specialty chemicals or anthropogenic molecules, but requires an access to an expanded repertoire of TFs. Using ligand docked homology models for binding pocket identification, assisted by conservative mutations in the pocket, we engineered a novel specificity in an Acinetobacter TF, PobR, to ‘sense’ a chemical p-nitrophenol (pNP) and measured the response via a fluorescent protein reporter expressed from a PobR promoter. Out of 10 7 variants of PobR, four were active when pNP was added as an inducer, with two mutants showingmore » a specificity switch from the native effector 4-hydroxybenzoate (4HB). One of the mutants, pNPmut1 was then used to create a smart microbial cell responding to pNP production and detect hydrolysis of an insecticide, paraoxon, in a coupled assay involving phosphotriesterase (PTE) enzyme expressed from a separate promoter. We show that the fluorescence of the cells correlated with the catalytic efficiency of PTE variants, each cell expressed. High selectivity for similar molecules (4HB vs pNP), high sensitivity for pNP detection (~2 μM) and agreement of apo- and holo- structures of PobR scaffold with computational models are notable successes presented in this work.« less

Molecular actions of two synthetic brassinosteroids, iso-carbaBL and 6-deoxoBL, which cause altered physiological activities between Arabidopsis and rice.

PubMed

Nakamura, Ayako; Tochio, Naoya; Fujioka, Shozo; Ito, Shinsaku; Kigawa, Takanori; Shimada, Yukihisa; Matsuoka, Makoto; Yoshida, Shigeo; Kinoshita, Toshinori; Asami, Tadao; Seto, Hideharu; Nakano, Takeshi

2017-01-01

Brassinosteroid (BR) is an important plant hormone that is perceived by the BRASSINOSTEROID INSENSITIVE 1 (BRI1) receptor. BRI1 is conserved among dicot and monocot species; however, the molecular mechanism underlying BR perception in monocots is not fully understood. We synthesised two BRs, iso-carbabrassinolide (iso-carbaBL) and 6-deoxoBL, which have different BR activities in Arabidopsis thaliana (Arabidopsis) and rice. Our bioassay indicated that iso-carbaBL has relatively strong BR activity in Arabidopsis, but is inactive in rice and competitively inhibits BR activity. The bioactivity of 6-deoxoBL was similar to that of BL in Arabidopsis, but was much lower in rice. Binding experiments using recombinant Arabidopsis and rice BRI1 protein fragments suggested that iso-carbaBL and 6-deoxoBL bind to both receptors. These results showed that iso-carbaBL and 6-deoxoBL act as an antagonist and agonist, respectively, of BRs in rice. A docking simulation analysis suggested that iso-carbaBL fits deeper in the binding pocket to block the binding of active BR to rice BRI1. The simulated binding energy of 6-deoxoBL with rice BRI1 is much lower than that with Arabidopsis BRI1. The possible structural characteristics of rice BRI1 were determined based on the difference in the BR activities of iso-carbaBL and 6-deoxoBL in Arabidopsis and rice.

Molecular actions of two synthetic brassinosteroids, iso-carbaBL and 6-deoxoBL, which cause altered physiological activities between Arabidopsis and rice

PubMed Central

Fujioka, Shozo; Ito, Shinsaku; Kigawa, Takanori; Shimada, Yukihisa; Matsuoka, Makoto; Yoshida, Shigeo; Kinoshita, Toshinori; Asami, Tadao; Seto, Hideharu; Nakano, Takeshi

2017-01-01

Brassinosteroid (BR) is an important plant hormone that is perceived by the BRASSINOSTEROID INSENSITIVE 1 (BRI1) receptor. BRI1 is conserved among dicot and monocot species; however, the molecular mechanism underlying BR perception in monocots is not fully understood. We synthesised two BRs, iso-carbabrassinolide (iso-carbaBL) and 6-deoxoBL, which have different BR activities in Arabidopsis thaliana (Arabidopsis) and rice. Our bioassay indicated that iso-carbaBL has relatively strong BR activity in Arabidopsis, but is inactive in rice and competitively inhibits BR activity. The bioactivity of 6-deoxoBL was similar to that of BL in Arabidopsis, but was much lower in rice. Binding experiments using recombinant Arabidopsis and rice BRI1 protein fragments suggested that iso-carbaBL and 6-deoxoBL bind to both receptors. These results showed that iso-carbaBL and 6-deoxoBL act as an antagonist and agonist, respectively, of BRs in rice. A docking simulation analysis suggested that iso-carbaBL fits deeper in the binding pocket to block the binding of active BR to rice BRI1. The simulated binding energy of 6-deoxoBL with rice BRI1 is much lower than that with Arabidopsis BRI1. The possible structural characteristics of rice BRI1 were determined based on the difference in the BR activities of iso-carbaBL and 6-deoxoBL in Arabidopsis and rice. PMID:28369122

Complex between α-bungarotoxin and an α7 nicotinic receptor ligand-binding domain chimaera

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Sun; Li, Shu-Xing; Bren, Nina

2013-09-01

To identify high-affinity interactions between long-chain α-neurotoxins and nicotinic receptors, we determined the crystal structure of the complex between α-btx (α-bungarotoxin) and a pentameric ligand-binding domain constructed from the human α7 AChR (acetylcholine receptor) and AChBP (acetylcholine-binding protein). The complex buries ~2000 Å 2 (1 Å=0.1 nm) of surface area, within which Arg 36 and Phe 32 from finger II of α-btx form a π-cation stack that aligns edge-to-face with the conserved Tyr 184 from loop-C of α7, while Asp 30 of α-btx forms a hydrogen bond with the hydroxy group of Tyr 184. These inter-residue interactions diverge from thosemore » in a 4.2 Å structure of α-ctx (α-cobratoxin) bound to AChBP, but are similar to those in a 1.94 Å structure of α-btx bound to the monomeric α1 extracellular domain, although compared with the monomer-bound complex, the α-btx backbone exhibits a large shift relative to the protein surface. Mutational analyses show that replacing Tyr 184 with a threonine residue abolishes high-affinity α-btx binding, whereas replacing with a phenylalanine residue maintains high affinity. Comparison of the α-btx complex with that coupled to the agonist epibatidine reveals structural rearrangements within the binding pocket and throughout each subunit. The overall findings highlight structural principles by which α-neurotoxins interact with nicotinic receptors.« less

The Tip of the Four N-Terminal α-Helices of Clostridium sordellii Lethal Toxin Contains the Interaction Site with Membrane Phosphatidylserine Facilitating Small GTPases Glucosylation

PubMed Central

Varela Chavez, Carolina; Haustant, Georges Michel; Baron, Bruno; England, Patrick; Chenal, Alexandre; Pauillac, Serge; Blondel, Arnaud; Popoff, Michel-Robert

2016-01-01

Clostridium sordellii lethal toxin (TcsL) is a powerful virulence factor responsible for severe toxic shock in man and animals. TcsL belongs to the large clostridial glucosylating toxin (LCGT) family which inactivates small GTPases by glucosylation with uridine-diphosphate (UDP)-glucose as a cofactor. Notably, TcsL modifies Rac and Ras GTPases, leading to drastic alteration of the actin cytoskeleton and cell viability. TcsL enters cells via receptor-mediated endocytosis and delivers the N-terminal glucosylating domain (TcsL-cat) into the cytosol. TcsL-cat was found to preferentially bind to phosphatidylserine (PS)-containing membranes and to increase the glucosylation of Rac anchored to the lipid membrane. We have previously reported that the N-terminal four helical bundle structure (1–93 domain) recognizes a broad range of lipids, but that TcsL-cat specifically binds to PS and phosphatidic acid. Here, we show using mutagenesis that the PS binding site is localized on the tip of the four-helix bundle which is rich in positively-charged amino acids. Residues Y14, V15, F17, and R18 on loop 1, between helices 1 and 2, in coordination with R68 from loop 3, between helices 3 and 4, form a pocket which accommodates L-serine. The functional PS-binding site is required for TcsL-cat binding to the plasma membrane and subsequent cytotoxicity. TcsL-cat binding to PS facilitates a high enzymatic activity towards membrane-anchored Ras by about three orders of magnitude as compared to Ras in solution. The PS-binding site is conserved in LCGTs, which likely retain a common mechanism of binding to the membrane for their full activity towards membrane-bound GTPases. PMID:27023605

A fragment-based approach leading to the discovery of a novel binding site and the selective CK2 inhibitor CAM4066.

PubMed

De Fusco, Claudia; Brear, Paul; Iegre, Jessica; Georgiou, Kathy Hadje; Sore, Hannah F; Hyvönen, Marko; Spring, David R

2017-07-01

Recently we reported the discovery of a potent and selective CK2α inhibitor CAM4066. This compound inhibits CK2 activity by exploiting a pocket located outside the ATP binding site (αD pocket). Here we describe in detail the journey that led to the discovery of CAM4066 using the challenging fragment linking strategy. Specifically, we aimed to develop inhibitors by linking a high-affinity fragment anchored in the αD site to a weakly binding warhead fragment occupying the ATP site. Moreover, we describe the remarkable impact that molecular modelling had on the development of this novel chemical tool. The work described herein shows potential for the development of a novel class of CK2 inhibitors. Copyright © 2017. Published by Elsevier Ltd.

Sampling and energy evaluation challenges in ligand binding protein design.

PubMed

Dou, Jiayi; Doyle, Lindsey; Jr Greisen, Per; Schena, Alberto; Park, Hahnbeom; Johnsson, Kai; Stoddard, Barry L; Baker, David

2017-12-01

The steroid hormone 17α-hydroxylprogesterone (17-OHP) is a biomarker for congenital adrenal hyperplasia and hence there is considerable interest in development of sensors for this compound. We used computational protein design to generate protein models with binding sites for 17-OHP containing an extended, nonpolar, shape-complementary binding pocket for the four-ring core of the compound, and hydrogen bonding residues at the base of the pocket to interact with carbonyl and hydroxyl groups at the more polar end of the ligand. Eight of 16 designed proteins experimentally tested bind 17-OHP with micromolar affinity. A co-crystal structure of one of the designs revealed that 17-OHP is rotated 180° around a pseudo-two-fold axis in the compound and displays multiple binding modes within the pocket, while still interacting with all of the designed residues in the engineered site. Subsequent rounds of mutagenesis and binding selection improved the ligand affinity to nanomolar range, while appearing to constrain the ligand to a single bound conformation that maintains the same "flipped" orientation relative to the original design. We trace the discrepancy in the design calculations to two sources: first, a failure to model subtle backbone changes which alter the distribution of sidechain rotameric states and second, an underestimation of the energetic cost of desolvating the carbonyl and hydroxyl groups of the ligand. The difference between design model and crystal structure thus arises from both sampling limitations and energy function inaccuracies that are exacerbated by the near two-fold symmetry of the molecule. © 2017 The Authors Protein Science published by Wiley Periodicals, Inc. on behalf of The Protein Society.

Design, synthesis and biological evaluation of (S)-valine thiazole-derived cyclic and non-cyclic peptidomimetic oligomers as modulators of human P-glycoprotein (ABCB1)

PubMed Central

Singh, Satyakam; Prasad, Nagarajan Rajendra; Kapoor, Khyati; Chufan, Eduardo E.; Patel, Bhargav A.; Ambudkar, Suresh V.; Talele, Tanaji T.

2014-01-01

Multidrug resistance (MDR) caused by ATP-binding cassette (ABC) transporter P-glycoprotein (P-gp) through extrusion of anticancer drugs from the cells is a major cause of failure to cancer chemotherapy. Previously, selenazole containing cyclic peptides were reported as P-gp inhibitors and these were also used for co-crystallization with mouse P-gp, which has 87% homology to human P-gp. It has been reported that human P-gp, can simultaneously accommodate 2-3 moderate size molecules at the drug binding pocket. Our in-silico analysis based on the homology model of human P-gp spurred our efforts to investigate the optimal size of (S)-valine-derived thiazole units that can be accommodated at drug-binding pocket. Towards this goal, we synthesized varying lengths of linear and cyclic derivatives of (S)-valine-derived thiazole units to investigate the optimal size, lipophilicity and the structural form (linear and cyclic) of valine-derived thiazole peptides that can accommodate well in the P-gp binding pocket and affects its activity, previously an unexplored concept. Among these oligomers, lipophilic linear- (13) and cyclic-trimer (17) derivatives of QZ59S-SSS were found to be the most and equally potent inhibitors of human P-gp (IC50 = 1.5 μM). Cyclic trimer and linear trimer being equipotent, future studies can be focused on non-cyclic counterparts of cyclic peptides maintaining linear trimer length. Binding model of the linear trimer (13) within the drug-binding site on the homology model of human P-gp represents an opportunity for future optimization, specifically replacing valine and thiazole groups in the non-cyclic form. PMID:24288265

Design, synthesis, and biological evaluation of (S)-valine thiazole-derived cyclic and noncyclic peptidomimetic oligomers as modulators of human P-glycoprotein (ABCB1).

PubMed

Singh, Satyakam; Prasad, Nagarajan Rajendra; Kapoor, Khyati; Chufan, Eduardo E; Patel, Bhargav A; Ambudkar, Suresh V; Talele, Tanaji T

2014-01-03

Multidrug resistance caused by ATP binding cassette transporter P-glycoprotein (P-gp) through extrusion of anticancer drugs from the cells is a major cause of failure in cancer chemotherapy. Previously, selenazole-containing cyclic peptides were reported as P-gp inhibitors and were also used for co-crystallization with mouse P-gp, which has 87 % homology to human P-gp. It has been reported that human P-gp can simultaneously accommodate two to three moderately sized molecules at the drug binding pocket. Our in silico analysis, based on the homology model of human P-gp, spurred our efforts to investigate the optimal size of (S)-valine-derived thiazole units that can be accommodated at the drug binding pocket. Towards this goal, we synthesized varying lengths of linear and cyclic derivatives of (S)-valine-derived thiazole units to investigate the optimal size, lipophilicity, and structural form (linear or cyclic) of valine-derived thiazole peptides that can be accommodated in the P-gp binding pocket and affects its activity, previously an unexplored concept. Among these oligomers, lipophilic linear (13) and cyclic trimer (17) derivatives of QZ59S-SSS were found to be the most and equally potent inhibitors of human P-gp (IC50 =1.5 μM). As the cyclic trimer and linear trimer compounds are equipotent, future studies should focus on noncyclic counterparts of cyclic peptides maintaining linear trimer length. A binding model of the linear trimer 13 within the drug binding site on the homology model of human P-gp represents an opportunity for future optimization, specifically replacing valine and thiazole groups in the noncyclic form. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Structural basis of RND-type multidrug exporters

PubMed Central

Yamaguchi, Akihito; Nakashima, Ryosuke; Sakurai, Keisuke

2015-01-01

Bacterial multidrug exporters are intrinsic membrane transporters that act as cellular self-defense mechanism. The most notable characteristics of multidrug exporters is that they export a wide range of drugs and toxic compounds. The overexpression of these exporters causes multidrug resistance. Multidrug-resistant pathogens have become a serious problem in modern chemotherapy. Over the past decade, investigations into the structure of bacterial multidrug exporters have revealed the multidrug recognition and export mechanisms. In this review, we primarily discuss RND-type multidrug exporters particularly AcrAB-TolC, major drug exporter in Gram-negative bacteria. RND-type drug exporters are tripartite complexes comprising a cell membrane transporter, an outer membrane channel and an adaptor protein. Cell membrane transporters and outer membrane channels are homo-trimers; however, there is no consensus on the number of adaptor proteins in these tripartite complexes. The three monomers of a cell membrane transporter have varying conformations (access, binding, and extrusion) during transport. Drugs are exported following an ordered conformational change in these three monomers, through a functional rotation mechanism coupled with the proton relay cycle in ion pairs, which is driven by proton translocation. Multidrug recognition is based on a multisite drug-binding mechanism, in which two voluminous multidrug-binding pockets in cell membrane exporters recognize a wide range of substrates as a result of permutations at numerous binding sites that are specific for the partial structures of substrate molecules. The voluminous multidrug-binding pocket may have numerous binding sites even for a single substrate, suggesting that substrates may move between binding sites during transport, an idea named as multisite-drug-oscillation hypothesis. This hypothesis is consistent with the apparently broad substrate specificity of cell membrane exporters and their highly efficient ejection of drugs from the cell. Substrates are transported through dual multidrug-binding pockets via the peristaltic motion of the substrate translocation channel. Although there are no clinically available inhibitors of bacterial multidrug exporters, efforts to develop inhibitors based on structural information are underway. PMID:25941524

Structural basis of RND-type multidrug exporters.

PubMed

Yamaguchi, Akihito; Nakashima, Ryosuke; Sakurai, Keisuke

2015-01-01

Bacterial multidrug exporters are intrinsic membrane transporters that act as cellular self-defense mechanism. The most notable characteristics of multidrug exporters is that they export a wide range of drugs and toxic compounds. The overexpression of these exporters causes multidrug resistance. Multidrug-resistant pathogens have become a serious problem in modern chemotherapy. Over the past decade, investigations into the structure of bacterial multidrug exporters have revealed the multidrug recognition and export mechanisms. In this review, we primarily discuss RND-type multidrug exporters particularly AcrAB-TolC, major drug exporter in Gram-negative bacteria. RND-type drug exporters are tripartite complexes comprising a cell membrane transporter, an outer membrane channel and an adaptor protein. Cell membrane transporters and outer membrane channels are homo-trimers; however, there is no consensus on the number of adaptor proteins in these tripartite complexes. The three monomers of a cell membrane transporter have varying conformations (access, binding, and extrusion) during transport. Drugs are exported following an ordered conformational change in these three monomers, through a functional rotation mechanism coupled with the proton relay cycle in ion pairs, which is driven by proton translocation. Multidrug recognition is based on a multisite drug-binding mechanism, in which two voluminous multidrug-binding pockets in cell membrane exporters recognize a wide range of substrates as a result of permutations at numerous binding sites that are specific for the partial structures of substrate molecules. The voluminous multidrug-binding pocket may have numerous binding sites even for a single substrate, suggesting that substrates may move between binding sites during transport, an idea named as multisite-drug-oscillation hypothesis. This hypothesis is consistent with the apparently broad substrate specificity of cell membrane exporters and their highly efficient ejection of drugs from the cell. Substrates are transported through dual multidrug-binding pockets via the peristaltic motion of the substrate translocation channel. Although there are no clinically available inhibitors of bacterial multidrug exporters, efforts to develop inhibitors based on structural information are underway.

Effect of the Flexible Regions of the Oncoprotein Mouse Double Minute X on Inhibitor Binding Affinity.

PubMed

Qin, Lingyun; Liu, Huili; Chen, Rong; Zhou, Jingjing; Cheng, Xiyao; Chen, Yao; Huang, Yongqi; Su, Zhengding

2017-11-07

The oncoprotein MdmX (mouse double minute X) is highly homologous to Mdm2 (mouse double minute 2) in terms of their amino acid sequences and three-dimensional conformations, but Mdm2 inhibitors exhibit very weak affinity for MdmX, providing an excellent model for exploring how protein conformation distinguishes and alters inhibitor binding. The intrinsic conformation flexibility of proteins plays pivotal roles in determining and predicting the binding properties and the design of inhibitors. Although the molecular dynamics simulation approach enables us to understand protein-ligand interactions, the mechanism underlying how a flexible binding pocket adapts an inhibitor has been less explored experimentally. In this work, we have investigated how the intrinsic flexible regions of the N-terminal domain of MdmX (N-MdmX) affect the affinity of the Mdm2 inhibitor nutlin-3a using protein engineering. Guided by heteronuclear nuclear Overhauser effect measurements, we identified the flexible regions that affect inhibitor binding affinity around the ligand-binding pocket on N-MdmX. A disulfide engineering mutant, N-MdmX C25-C110/C76-C88 , which incorporated two staples to rigidify the ligand-binding pocket, allowed an affinity for nutlin-3a higher than that of wild-type N-MdmX (K d ∼ 0.48 vs K d ∼ 20.3 μM). Therefore, this mutant provides not only an effective protein model for screening and designing of MdmX inhibitors but also a valuable clue for enhancing the intermolecular interactions of the pharmacophores of a ligand with pronounced flexible regions. In addition, our results revealed an allosteric ligand-binding mechanism of N-MdmX in which the ligand initially interacts with a compact core, followed by augmenting intermolecular interactions with intrinsic flexible regions. This strategy should also be applicable to many other protein targets to accelerate drug discovery.

The GAP arginine finger movement into the catalytic site of Ras increases the activation entropy

PubMed Central

Kötting, Carsten; Kallenbach, Angela; Suveyzdis, Yan; Wittinghofer, Alfred; Gerwert, Klaus

2008-01-01

Members of the Ras superfamily of small G proteins play key roles in signal transduction pathways, which they control by GTP hydrolysis. They are regulated by GTPase activating proteins (GAPs). Mutations that prevent hydrolysis cause severe diseases including cancer. A highly conserved “arginine finger” of GAP is a key residue. Here, we monitor the GTPase reaction of the Ras·RasGAP complex at high temporal and spatial resolution by time-resolved FTIR spectroscopy at 260 K. After triggering the reaction, we observe as the first step a movement of the switch-I region of Ras from the nonsignaling “off” to the signaling “on” state with a rate of 3 s−1. The next step is the movement of the “arginine finger” into the active site of Ras with a rate of k2 = 0.8 s−1. Once the arginine points into the binding pocket, cleavage of GTP is fast and the protein-bound Pi intermediate forms. The switch-I reversal to the “off” state, the release of Pi, and the movement of arginine back into an aqueous environment is observed simultaneously with k3 = 0.1 s−1, the rate-limiting step. Arrhenius plots for the partial reactions show that the activation energy for the cleavage reaction is lowered by favorable positive activation entropy. This seems to indicate that protein-bound structured water molecules are pushed by the “arginine finger” movement out of the binding pocket into the bulk water. The proposed mechanism shows how the high activation barrier for phosphoryl transfer can be reduced by splitting into partial reactions separated by a Pi-intermediate. PMID:18434546

Tryptophan 80 and leucine 143 are critical for the hydride transfer step of thymidylate synthase by controlling active site access.

PubMed

Fritz, Timothy A; Liu, Lu; Finer-Moore, Janet S; Stroud, Robert M

2002-06-04

Mutant forms of thymidylate synthase (TS) with substitutions at the conserved active site residue, Trp 80, are deficient in the hydride transfer step of the TS reaction. These mutants produce a beta-mercaptoethanol (beta-ME) adduct of the 2'-deoxyuridine-5'-monophosphate (dUMP) exocyclic methylene intermediate. Trp 80 has been proposed to assist hydride transfer by stabilizing a 5,6,7,8-tetrahydrofolate (THF) radical cation intermediate [Barrett, J. E., Lucero, C. M., and Schultz, P. G. (1999) J. Am. Chem. Soc. 121, 7965-7966.] formed after THF changes its binding from the cofactor pocket to a putative alternate site. To understand the molecular basis of hydride transfer deficiency in a mutant in which Trp 80 was changed to Gly, we determined the X-ray structures of this mutant Escherichia coli TS complexed with dUMP and the folate analogue 10-propargyl-5,8-dideazafolate (CB3717) and of the wild-type enzyme complexed with dUMP and THF. The mutant enzyme has a cavity in the active site continuous with bulk solvent. This cavity, sealed from bulk solvent in wild-type TS by Leu 143, would allow nucleophilic attack of beta-ME on the dUMP C5 exocyclic methylene. The structure of the wild-type enzyme/dUMP/THF complex shows that THF is bound in the cofactor binding pocket and is well positioned to transfer hydride to the dUMP exocyclic methylene. Together, these results suggest that THF does not reorient during hydride transfer and indicate that the role of Trp 80 may be to orient Leu 143 to shield the active site from bulk solvent and to optimally position the cofactor for hydride transfer.

On an early gene for membrane-integral inorganic pyrophosphatase in the genome of an apparently pre-luca extremophile, the archaeon Candidatus Korarchaeum cryptofilum.

PubMed

Baltscheffsky, Herrick; Persson, Bengt

2014-02-01

A gene for membrane-integral inorganic pyrophosphatase (miPPase) was found in the composite genome of the extremophile archaeon Candidatus Korarchaeum cryptofilum (CKc). This korarchaeal genome shows unusual partial similarity to both major archaeal phyla Crenarchaeota and Euryarchaeota. Thus this Korarchaeote might have retained features that represent an ancestral archaeal form, existing before the occurrence of the evolutionary bifurcation into Crenarchaeota and Euryarchaeota. In addition, CKc lacks five genes that are common to early genomes at the LUCA border. These two properties independently suggest a pre-LUCA evolutionary position of this extremophile. Our finding of the miPPase gene in the CKc genome points to a role for the enzyme in the energy conversion of this very early archaeon. The structural features of its miPPase indicate that it can pump protons through membranes. An miPPase from the extremophile bacterium Caldicellulosiruptor saccharolyticus also has a sequence indicating a proton pump. Recent analysis of the three-dimensional structure of the miPPase from Vigna radiata has resulted in the recognition of a strongly acidic substrate (orthophosphate: Pi, pyrophosphate: PPi) binding pocket, containing 11 Asp and one Glu residues. Asp (aspartic acid) is an evolutionarily very early proteinaceous amino acid as compared to the later appearing Glu (glutamic acid). All the Asp residues are conserved in the miPPase of CKc, V. radiata and other miPPases. The high proportion of Asp, as compared to Glu, seems to strengthen our argument that biological energy conversion with binding and activities of orthophosphate (Pi) and energy-rich pyrophosphate (PPi) in connection with the origin and early evolution of life may have started with similar or even more primitive acidic peptide funnels and/or pockets.

Botulinum neurotoxin serotype D attacks neurons via two carbohydrate-binding sites in a ganglioside-dependent manner.

PubMed

Strotmeier, Jasmin; Lee, Kwangkook; Völker, Anne K; Mahrhold, Stefan; Zong, Yinong; Zeiser, Johannes; Zhou, Jie; Pich, Andreas; Bigalke, Hans; Binz, Thomas; Rummel, Andreas; Jin, Rongsheng

2010-10-15

The extraordinarily high toxicity of botulinum neurotoxins primarily results from their specific binding and uptake into neurons. At motor neurons, the seven BoNT (botulinum neurotoxin) serotypes A-G inhibit acetylcholine release leading to flaccid paralysis. Uptake of BoNT/A, B, E, F and G requires a dual interaction with gangliosides and the synaptic vesicle proteins synaptotagmin or SV2 (synaptic vesicle glycoprotein 2), whereas little is known about the cell entry mechanisms of the serotypes C and D, which display the lowest amino acid sequence identity compared with the other five serotypes. In the present study we demonstrate that the neurotoxicity of BoNT/D depends on the presence of gangliosides by employing phrenic nerve hemidiaphragm preparations derived from mice expressing the gangliosides GM3, GM2, GM1 and GD1a, or only GM3 [a description of our use of ganglioside nomenclature is given in Svennerholm (1994) Prog. Brain Res. 101, XI-XIV]. High-resolution crystal structures of the 50 kDa cell-binding domain of BoNT/D alone and in complex with sialic acid, as well as biological analyses of single-site BoNT/D mutants identified two carbohydrate-binding sites. One site is located at a position previously identified in BoNT/A, B, E, F and G, but is lacking the conserved SXWY motif. The other site, co-ordinating one molecule of sialic acid, resembles the second ganglioside-binding pocket (the sialic-acid-binding site) of TeNT (tetanus neurotoxin).

Reverse chemical ecology: Olfactory proteins from the giant panda and their interactions with putative pheromones and bamboo volatiles

PubMed Central

Zhu, Jiao; Arena, Simona; Spinelli, Silvia; Zhang, Guiquan; Wei, Rongping; Cambillau, Christian; Scaloni, Andrea; Wang, Guirong; Pelosi, Paolo

2017-01-01

The giant panda Ailuropoda melanoleuca belongs to the family of Ursidae; however, it is not carnivorous, feeding almost exclusively on bamboo. Being equipped with a typical carnivorous digestive apparatus, the giant panda cannot get enough energy for an active life and spends most of its time digesting food or sleeping. Feeding and mating are both regulated by odors and pheromones; therefore, a better knowledge of olfaction at the molecular level can help in designing strategies for the conservation of this species. In this context, we have identified the odorant-binding protein (OBP) repertoire of the giant panda and mapped the protein expression in nasal mucus and saliva through proteomics. Four OBPs have been identified in nasal mucus, while the other two were not detected in the samples examined. In particular, AimelOBP3 is similar to a subset of OBPs reported as pheromone carriers in the urine of rodents, saliva of the boar, and seminal fluid of the rabbit. We expressed this protein, mapped its binding specificity, and determined its crystal structure. Structural data guided the design and preparation of three protein mutants bearing single-amino acid replacements in the ligand-binding pocket, for which the corresponding binding affinity spectra were measured. We also expressed AimelOBP5, which is markedly different from AimelOBP3 and complementary in its binding spectrum. By comparing our binding data with the structures of bamboo volatiles and those of typical mammalian pheromones, we formulate hypotheses on which may be the most relevant semiochemicals for the giant panda. PMID:29078359

Reverse chemical ecology: Olfactory proteins from the giant panda and their interactions with putative pheromones and bamboo volatiles.

PubMed

Zhu, Jiao; Arena, Simona; Spinelli, Silvia; Liu, Dingzhen; Zhang, Guiquan; Wei, Rongping; Cambillau, Christian; Scaloni, Andrea; Wang, Guirong; Pelosi, Paolo

2017-11-14

The giant panda Ailuropoda melanoleuca belongs to the family of Ursidae; however, it is not carnivorous, feeding almost exclusively on bamboo. Being equipped with a typical carnivorous digestive apparatus, the giant panda cannot get enough energy for an active life and spends most of its time digesting food or sleeping. Feeding and mating are both regulated by odors and pheromones; therefore, a better knowledge of olfaction at the molecular level can help in designing strategies for the conservation of this species. In this context, we have identified the odorant-binding protein (OBP) repertoire of the giant panda and mapped the protein expression in nasal mucus and saliva through proteomics. Four OBPs have been identified in nasal mucus, while the other two were not detected in the samples examined. In particular, AimelOBP3 is similar to a subset of OBPs reported as pheromone carriers in the urine of rodents, saliva of the boar, and seminal fluid of the rabbit. We expressed this protein, mapped its binding specificity, and determined its crystal structure. Structural data guided the design and preparation of three protein mutants bearing single-amino acid replacements in the ligand-binding pocket, for which the corresponding binding affinity spectra were measured. We also expressed AimelOBP5, which is markedly different from AimelOBP3 and complementary in its binding spectrum. By comparing our binding data with the structures of bamboo volatiles and those of typical mammalian pheromones, we formulate hypotheses on which may be the most relevant semiochemicals for the giant panda.

The structures of non-CG-repeat Z-DNAs co-crystallized with the Z-DNA-binding domain, hZ alpha(ADAR1).

PubMed

Ha, Sung Chul; Choi, Jongkeun; Hwang, Hye-Yeon; Rich, Alexander; Kim, Yang-Gyun; Kim, Kyeong Kyu

2009-02-01

The Z-DNA conformation preferentially occurs at alternating purine-pyrimidine repeats, and is specifically recognized by Z alpha domains identified in several Z-DNA-binding proteins. The binding of Z alpha to foreign or chromosomal DNA in various sequence contexts is known to influence various biological functions, including the DNA-mediated innate immune response and transcriptional modulation of gene expression. For these reasons, understanding its binding mode and the conformational diversity of Z alpha bound Z-DNAs is of considerable importance. However, structural studies of Z alpha bound Z-DNA have been mostly limited to standard CG-repeat DNAs. Here, we have solved the crystal structures of three representative non-CG repeat DNAs, d(CACGTG)(2), d(CGTACG)(2) and d(CGGCCG)(2) complexed to hZ alpha(ADAR1) and compared those structures with that of hZ alpha(ADAR1)/d(CGCGCG)(2) and the Z alpha-free Z-DNAs. hZ alpha(ADAR1) bound to each of the three Z-DNAs showed a well conserved binding mode with very limited structural deviation irrespective of the DNA sequence, although varying numbers of residues were in contact with Z-DNA. Z-DNAs display less structural alterations in the Z alpha-bound state than in their free form, thereby suggesting that conformational diversities of Z-DNAs are restrained by the binding pocket of Z alpha. These data suggest that Z-DNAs are recognized by Z alpha through common conformational features regardless of the sequence and structural alterations.

STARD4 Membrane Interactions and Sterol Binding

PubMed Central

2016-01-01

The steroidogenic acute regulatory protein-related lipid transfer (START) domain family is defined by a conserved 210-amino acid sequence that folds into an α/β helix-grip structure. Members of this protein family bind a variety of ligands, including cholesterol, phospholipids, sphingolipids, and bile acids, with putative roles in nonvesicular lipid transport, metabolism, and cell signaling. Among the soluble START proteins, STARD4 is expressed in most tissues and has previously been shown to transfer sterol, but the molecular mechanisms of membrane interaction and sterol binding remain unclear. In this work, we use biochemical techniques to characterize regions of STARD4 and determine their role in membrane interaction and sterol binding. Our results show that STARD4 interacts with anionic membranes through a surface-exposed basic patch and that introducing a mutation (L124D) into the Omega-1 (Ω1) loop, which covers the sterol binding pocket, attenuates sterol transfer activity. To gain insight into the attenuating mechanism of the L124D mutation, we conducted structural and biophysical studies of wild-type and L124D STARD4. These studies show that the L124D mutation reduces the conformational flexibility of the protein, resulting in a diminished level of membrane interaction and sterol transfer. These studies also reveal that the C-terminal α-helix, and not the Ω1 loop, partitions into the membrane bilayer. On the basis of these observations, we propose a model of STARD4 membrane interaction and sterol binding and release that requires dynamic movement of both the Ω1 loop and membrane insertion of the C-terminal α-helix. PMID:26168008

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ye, Qiaozhen; Krug, Robert M.; Tao, Yizhi Jane

Influenza A viruses pose a serious threat to world public health, particularly the currently circulating avian H5N1 viruses. The influenza viral nucleoprotein forms the protein scaffold of the helical genomic ribonucleoprotein complexes, and has a critical role in viral RNA replication. Here we report a 3.2 Angstrom crystal structure of this nucleoprotein, the overall shape of which resembles a crescent with a head and a body domain, with a protein fold different compared with that of the rhabdovirus nucleoprotein. Oligomerization of the influenza virus nucleoprotein is mediated by a flexible tail loop that is inserted inside a neighboring molecule. Thismore » flexibility in the tail loop enables the nucleoprotein to form loose polymers as well as rigid helices, both of which are important for nucleoprotein functions. Single residue mutations in the tail loop result in the complete loss of nucleoprotein oligomerization. An RNA-binding groove, which is found between the head and body domains at the exterior of the nucleoprotein oligomer, is lined with highly conserved basic residues widely distributed in the primary sequence. The nucleoprotein structure shows that only one of two proposed nuclear localization signals are accessible, and suggests that the body domain of nucleoprotein contains the binding site for the viral polymerase. Our results identify the tail loop binding pocket as a potential target for antiviral development.« less

The structure and inhibition of human diamine oxidase†,‡

PubMed Central

McGrath, Aaron P; Hilmer, Kimberly M; Collyer, Charles A; Shepard, Eric M; Elmore, Bradley O.; Brown, Doreen E; Dooley, David M; Guss, J Mitchell

2009-01-01

Humans have three functioning genes that code for copper-containing amine oxidases. The product of the AOC1 gene is a so-called diamine oxidase (hDAO), named for its substrate preference for diamines, particularly histamine. hDAO has been cloned and expressed in insect cells and the structure of the native enzyme determined by X-ray crystallography to a resolution of 1.8 Å. The homodimeric structure has the archetypal amine oxidase fold. Two active sites, one in each subunit, are characterized by the presence of a copper ion and a topaquinone residue formed by the post-translational modification of a tyrosine. Although hDAO shares 37.9 % sequence identity with another human copper amine oxidase, semicarbazide sensitive amine oxidase or vascular adhesion protein-1, its substrate binding pocket and entry channel are distinctly different in accord with the different substrate specificities. The structures of two inhibitor complexes of hDAO, berenil and pentamidine, have been refined to resolutions of 2.1 Å and 2.2 Å, respectively. They bind non-covalently in the active site channel. The inhibitor binding suggests that an aspartic acid residue, conserved in all diamine oxidases but absent from other amine oxidases, is responsible for the diamine specificity by interacting with the second amino group of preferred diamine substrates. PMID:19764817

Selective activators of protein phosphatase 5 target the auto-inhibitory mechanism.

PubMed

Haslbeck, Veronika; Drazic, Adrian; Eckl, Julia M; Alte, Ferdinand; Helmuth, Martin; Popowicz, Grzegorz; Schmidt, Werner; Braun, Frank; Weiwad, Matthias; Fischer, Gunter; Gemmecker, Gerd; Sattler, Michael; Striggow, Frank; Groll, Michael; Richter, Klaus

2015-04-20

Protein phosphatase 5 (PP5) is an evolutionary conserved serine/threonine phosphatase. Its dephosphorylation activity modulates a diverse set of cellular factors including protein kinases and the microtubule-associated tau protein involved in neurodegenerative disorders. It is auto-regulated by its heat-shock protein (Hsp90)-interacting tetratricopeptide repeat (TPR) domain and its C-terminal α-helix. In the present study, we report the identification of five specific PP5 activators [PP5 small-molecule activators (P5SAs)] that enhance the phosphatase activity up to 8-fold. The compounds are allosteric modulators accelerating efficiently the turnover rate of PP5, but do barely affect substrate binding or the interaction between PP5 and the chaperone Hsp90. Enzymatic studies imply that the compounds bind to the phosphatase domain of PP5. For the most promising compound crystallographic comparisons of the apo PP5 and the PP5-P5SA-2 complex indicate a relaxation of the auto-inhibited state of PP5. Residual electron density and mutation analyses in PP5 suggest activator binding to a pocket in the phosphatase/TPR domain interface, which may exert regulatory functions. These compounds thus may expose regulatory mechanisms in the PP5 enzyme and serve to develop optimized activators based on these scaffolds. © 2015 Authors.

Structures of Trypanosome Vacuolar Soluble Pyrophosphatases: Anti-Parasitic Drug Targets

PubMed Central

Yang, Yunyun; Ko, Tzu-Ping; Chen, Chun-Chi; Huang, Guozhong; Zheng, Yingying; Liu, Weidong; Wang, Iren; Ho, Meng-Ru; Danny Hsu, Shang-Te; O’Dowd, Bing; Huff, Hannah C.; Huang, Chun-Hsiang; Docampo, Roberto; Oldfield, Eric; Guo, Rey-Ting

2016-01-01

Trypanosomatid parasites are the causative agents of many neglected tropical diseases including the leishmaniases, Chagas disease, and human African trypanosomiasis. They exploit unusual vacuolar soluble pyrophosphatases (VSPs), absent in humans, for cell growth and virulence and as such, are drug targets. Here, we report the crystal structures of VSP1s from Trypanosoma cruzi and T. brucei, together with that of the T. cruzi protein bound to a bisphosphonate inhibitor. Both VSP1s form a hybrid structure containing an (N-terminal) EF-hand domain fused to a (C-terminal) pyrophosphatase domain. The two domains are connected via an extended loop of about 17 residues. Crystallographic analysis and size exclusion chromatography indicate that the VSP1s form tetramers containing head-to-tail dimers. Phosphate and diphosphate ligands bind in the PPase substrate-binding pocket and interact with several conserved residues, and a bisphosphonate inhibitor (BPH-1260) binds to the same site. Based on Cytoscape and other bioinformatics analyses it is apparent that similar folds will be found in most if not all trypanosomatid VSP1s, including those found in insects (Angomonas deanei, Strigomonas culicis), plant pathogens (Phytomonas spp.) and Leishmania spp. Overall, the results are of general interest since they open the way to structure-based drug design for many of the neglected tropical diseases. PMID:26907161

Effect of the R119G mutation on human P5CR structure and its interactions with NAD: Insights derived from molecular dynamics simulation and free energy analysis.

PubMed

Sang, Peng; Xie, Yue-Hui; Li, Lin-Hua; Ye, Yu-Jia; Hu, Wei; Wang, Jing; Wan, Wen; Li, Rui; Li, Long-Jun; Ma, Lin-Ling; Li, Zhi; Liu, Shu-Qun; Meng, Zhao-Hui

2017-04-01

Pyrroline-5-carboxylate reductase (P5CR), an enzyme with conserved housekeeping roles, is involved in the etiology of cutis laxa. While previous work has shown that the R119G point mutation in the P5CR protein is involved, the structural mechanism behind the pathology remains to be elucidated. In order to probe the role of the R119G mutation in cutis laxa, we performed molecular dynamics (MD) simulations, essential dynamics (ED) analysis, and Molecular mechanics Poisson-Boltzmann surface area (MM-PBSA) binding free energy calculations on wild type (WT) and mutant P5CR-NAD complex. These MD simulations and ED analyses suggest that the R119G mutation decreases the flexibility of P5CR, specifically in the substrate binding pocket, which could decrease the kinetics of the cofactor entrance and egress. Furthermore, the MM-PBSA calculations suggest the R119G mutant has a lower cofactor binding affinity for NAD than WT. Our study provides insight into the possible role of the R119G mutation during interactions between P5CR and NAD, thus bettering our understanding of how the mutation promotes cutis laxa. Copyright © 2017 Elsevier Ltd. All rights reserved.

The ebola virus interferon antagonist VP24 directly binds STAT1 and has a novel, pyramidal fold.

PubMed

Zhang, Adrianna P P; Bornholdt, Zachary A; Liu, Tong; Abelson, Dafna M; Lee, David E; Li, Sheng; Woods, Virgil L; Saphire, Erica Ollmann

2012-02-01

Ebolaviruses cause hemorrhagic fever with up to 90% lethality and in fatal cases, are characterized by early suppression of the host innate immune system. One of the proteins likely responsible for this effect is VP24. VP24 is known to antagonize interferon signaling by binding host karyopherin α proteins, thereby preventing them from transporting the tyrosine-phosphorylated transcription factor STAT1 to the nucleus. Here, we report that VP24 binds STAT1 directly, suggesting that VP24 can suppress at least two distinct branches of the interferon pathway. Here, we also report the first crystal structures of VP24, derived from different species of ebolavirus that are pathogenic (Sudan) and nonpathogenic to humans (Reston). These structures reveal that VP24 has a novel, pyramidal fold. A site on a particular face of the pyramid exhibits reduced solvent exchange when in complex with STAT1. This site is above two highly conserved pockets in VP24 that contain key residues previously implicated in virulence. These crystal structures and accompanying biochemical analysis map differences between pathogenic and nonpathogenic viruses, offer templates for drug design, and provide the three-dimensional framework necessary for biological dissection of the many functions of VP24 in the virus life cycle.

Studies on the contributions of steric and polarity effects to the H2S-binding properties of Vitreoscilla hemoglobin

NASA Astrophysics Data System (ADS)

Wang, Dandan; Wang, Hui; Li, Haichao; Liu, Li; Li, Zhengqiang

2017-01-01

We have reported recently that Vitreoscilla hemoglobin (VHb) is a potential H2S receptor and storage molecule in bacterial metabolism. In this study, molecular cloning and site-directed mutagenesis were employed to investigate the structural basis for H2S binding. Association and dissociation rate constants (kon and koff) were determined using stopped-flow rapid-scanning spectrophotometry and compared with those for wild type VHb. Several unanticipated factors were found to govern H2S binding properties, due to the distinct structure of VHb. The results presented in this paper show that: i) bulkier residues at positions E7 and E11 decrease H2S binding accessibility, while the residue located at position B10 blocks bound H2S from escaping. ii) hydroxyl sidechains within the distal heme pocket reduce H2S reactivity to VHb; iii) Pro(E8) is involved in moving the E7-E10 loop region to trigger opening of the distal heme pocket to facilitate H2S binding.

Water Mediated Ligand Functional Group Cooperativity: The Contribution of a Methyl Group to Binding Affinity is Enhanced by a COO− Group Through Changes in the Structure and Thermo dynamics of the Hydration Waters of Ligand-Thermolysin Complexes

PubMed Central

Nasief, Nader N; Tan, Hongwei; Kong, Jing; Hangauer, David

2012-01-01

Ligand functional groups can modulate the contributions of one another to the ligand-protein binding thermodynamics, producing either positive or negative cooperativity. Data presented for four thermolysin phosphonamidate inhibitors demonstrate that the differential binding free energy and enthalpy caused by replacement of a H with a Me group, which binds in the well-hydrated S2′ pocket, are more favorable in presence of a ligand carboxylate. The differential entropy is however less favorable. Dissection of these differential thermodynamic parameters, X-ray crystallography, and density-functional theory calculations suggest that these cooperativities are caused by variations in the thermodynamics of the complex hydration shell changes accompanying the H→Me replacement. Specifically, the COO− reduces both the enthalpic penalty and the entropic advantage of displacing water molecules from the S2′ pocket, and causes a subsequent acquisition of a more enthalpically, less entropically, favorable water network. This study contributes to understanding the important role water plays in ligand-protein binding. PMID:22894131

Exploiting conformational dynamics in drug discovery: design of C-terminal inhibitors of Hsp90 with improved activities

PubMed Central

Moroni, Elisabetta; Zhao, Huiping; Blagg, Brian S.J.; Colombo, Giorgio

2014-01-01

The interaction that occurs between molecules is a dynamic process that impacts both structural and conformational properties of the ligand and the ligand binding site. Herein, we investigate the dynamic cross-talk between a protein and the ligand as a source for new opportunities in ligand design. Analysis of the formation/disappearance of protein pockets produced in response to a first-generation inhibitor assisted in the identification of functional groups that could be introduced onto scaffolds to facilitate optimal binding, which allowed for increased binding with previously uncharacterized regions. MD simulations were used to elucidate primary changes that occur in the Hsp90 C-terminal binding pocket in the presence of first-generation ligands. This data was then used to design ligands that adapt to these receptor conformations, which provides access to an energy landscape that is not visible in a static model. The newly synthesized compounds demonstrated anti-proliferative activity at ~150 nanomolar concentration. The method identified herein may be used to design chemical probes that provide additional information on structural variations of Hsp90 C-terminal binding site. PMID:24397468

Engineering vanilloid-sensitivity into the rat TRPV2 channel

PubMed Central

Zhang, Feng; Hanson, Sonya M; Jara-Oseguera, Andres; Krepkiy, Dmitriy; Bae, Chanhyung; Pearce, Larry V; Blumberg, Peter M; Newstead, Simon; Swartz, Kenton J

2016-01-01

The TRPV1 channel is a detector of noxious stimuli, including heat, acidosis, vanilloid compounds and lipids. The gating mechanisms of the related TRPV2 channel are poorly understood because selective high affinity ligands are not available, and the threshold for heat activation is extremely high (>50°C). Cryo-EM structures of TRPV1 and TRPV2 reveal that they adopt similar structures, and identify a putative vanilloid binding pocket near the internal side of TRPV1. Here we use biochemical and electrophysiological approaches to investigate the resiniferatoxin(RTx) binding site in TRPV1 and to explore the functional relationships between TRPV1 and TRPV2. Collectively, our results support the interaction of vanilloids with the proposed RTx binding pocket, and demonstrate an allosteric influence of a tarantula toxin on vanilloid binding. Moreover, we show that sensitivity to RTx can be engineered into TRPV2, demonstrating that the gating and permeation properties of this channel are similar to TRPV1. DOI: http://dx.doi.org/10.7554/eLife.16409.001 PMID:27177419

Engineering vanilloid-sensitivity into the rat TRPV2 channel.

PubMed

Zhang, Feng; Hanson, Sonya M; Jara-Oseguera, Andres; Krepkiy, Dmitriy; Bae, Chanhyung; Pearce, Larry V; Blumberg, Peter M; Newstead, Simon; Swartz, Kenton J

2016-05-13

The TRPV1 channel is a detector of noxious stimuli, including heat, acidosis, vanilloid compounds and lipids. The gating mechanisms of the related TRPV2 channel are poorly understood because selective high affinity ligands are not available, and the threshold for heat activation is extremely high (>50°C). Cryo-EM structures of TRPV1 and TRPV2 reveal that they adopt similar structures, and identify a putative vanilloid binding pocket near the internal side of TRPV1. Here we use biochemical and electrophysiological approaches to investigate the resiniferatoxin(RTx) binding site in TRPV1 and to explore the functional relationships between TRPV1 and TRPV2. Collectively, our results support the interaction of vanilloids with the proposed RTx binding pocket, and demonstrate an allosteric influence of a tarantula toxin on vanilloid binding. Moreover, we show that sensitivity to RTx can be engineered into TRPV2, demonstrating that the gating and permeation properties of this channel are similar to TRPV1.

Calculation of Free Energy Landscape in Multi-Dimensions with Hamiltonian-Exchange Umbrella Sampling on Petascale Supercomputer.

PubMed

Jiang, Wei; Luo, Yun; Maragliano, Luca; Roux, Benoît

2012-11-13

An extremely scalable computational strategy is described for calculations of the potential of mean force (PMF) in multidimensions on massively distributed supercomputers. The approach involves coupling thousands of umbrella sampling (US) simulation windows distributed to cover the space of order parameters with a Hamiltonian molecular dynamics replica-exchange (H-REMD) algorithm to enhance the sampling of each simulation. In the present application, US/H-REMD is carried out in a two-dimensional (2D) space and exchanges are attempted alternatively along the two axes corresponding to the two order parameters. The US/H-REMD strategy is implemented on the basis of parallel/parallel multiple copy protocol at the MPI level, and therefore can fully exploit computing power of large-scale supercomputers. Here the novel technique is illustrated using the leadership supercomputer IBM Blue Gene/P with an application to a typical biomolecular calculation of general interest, namely the binding of calcium ions to the small protein Calbindin D9k. The free energy landscape associated with two order parameters, the distance between the ion and its binding pocket and the root-mean-square deviation (rmsd) of the binding pocket relative the crystal structure, was calculated using the US/H-REMD method. The results are then used to estimate the absolute binding free energy of calcium ion to Calbindin D9k. The tests demonstrate that the 2D US/H-REMD scheme greatly accelerates the configurational sampling of the binding pocket, thereby improving the convergence of the potential of mean force calculation.

DRoP: a water analysis program identifies Ras-GTP-specific pathway of communication between membrane-interacting regions and the active site.

PubMed

Kearney, Bradley M; Johnson, Christian W; Roberts, Daniel M; Swartz, Paul; Mattos, Carla

2014-02-06

Ras GTPase mediates several cellular signal transduction pathways and is found mutated in a large number of cancers. It is active in the GTP-bound state, where it interacts with effector proteins, and at rest in the GDP-bound state. The catalytic domain is tethered to the membrane, with which it interacts in a nucleotide-dependent manner. Here we present the program Detection of Related Solvent Positions (DRoP) for crystallographic water analysis on protein surfaces and use it to study Ras. DRoP reads and superimposes multiple Protein Data Bank coordinates, transfers symmetry-related water molecules to the position closest to the protein surface, and ranks the waters according to how well conserved and tightly clustered they are in the set of structures. Coloring according to this rank allows visualization of the results. The effector-binding region of Ras is hydrated with highly conserved water molecules at the interface between the P-loop, switch I, and switch II, as well as at the Raf-RBD binding pocket. Furthermore, we discovered a new conserved water-mediated H-bonding network present in Ras-GTP, but not in Ras-GDP, that links the nucleotide sensor residues R161 and R164 on helix 5 to the active site. The double mutant RasN85A/N86A, where the final link between helix 5 and the nucleotide is not possible, is a severely impaired enzyme, while the single mutant RasN86A, with partial connection to the active site, has a wild-type hydrolysis rate. DRoP was instrumental in determining the water-mediated connectivity networks that link two lobes of the catalytic domain in Ras. Copyright © 2013 Elsevier Ltd. All rights reserved.

Relocating the Active-Site Lysine in Rhodopsin: 2. Evolutionary Intermediates.

PubMed

Devine, Erin L; Theobald, Douglas L; Oprian, Daniel D

2016-08-30

The visual pigment rhodopsin is a G protein-coupled receptor that covalently binds its retinal chromophore via a Schiff base linkage to an active-site Lys residue in the seventh transmembrane helix. Although this residue is strictly conserved among all type II retinylidene proteins, we found previously that the active-site Lys in bovine rhodopsin (Lys296) can be moved to three other locations (G90K, T94K, S186K) while retaining the ability to form a pigment with retinal and to activate transducin in a light-dependent manner [ Devine et al. ( 2013 ) Proc. Natl. Acad. Sci. USA 110 , 13351 - 13355 ]. Because the active-site Lys is not functionally constrained to be in helix seven, it is possible that it could relocate within the protein, most likely via an evolutionary intermediate with two active-site Lys. Therefore, in this study we characterized potential evolutionary intermediates with two Lys in the active site. Four mutant rhodopsins were prepared in which the original Lys296 was left untouched and a second Lys residue was substituted for G90K, T94K, S186K, or F293K. All four constructs covalently bind 11-cis-retinal, form a pigment, and activate transducin in a light-dependent manner. These results demonstrate that rhodopsin can tolerate a second Lys in the retinal binding pocket and suggest that an evolutionary intermediate with two Lys could allow migration of the Schiff base Lys to a position other than the observed, highly conserved location in the seventh TM helix. From sequence-based searches, we identified two groups of natural opsins, insect UV cones and neuropsins, that contain Lys residues at two positions in their active sites and also have intriguing spectral similarities to the mutant rhodopsins studied here.

Structural basis of sterol recognition and nonvesicular transport by lipid transfer proteins anchored at membrane contact sites.

PubMed

Tong, Junsen; Manik, Mohammad Kawsar; Im, Young Jun

2018-01-30

Membrane contact sites (MCSs) in eukaryotic cells are hotspots for lipid exchange, which is essential for many biological functions, including regulation of membrane properties and protein trafficking. Lipid transfer proteins anchored at membrane contact sites (LAMs) contain sterol-specific lipid transfer domains [StARkin domain (SD)] and multiple targeting modules to specific membrane organelles. Elucidating the structural mechanisms of targeting and ligand recognition by LAMs is important for understanding the interorganelle communication and exchange at MCSs. Here, we determined the crystal structures of the yeast Lam6 pleckstrin homology (PH)-like domain and the SDs of Lam2 and Lam4 in the apo form and in complex with ergosterol. The Lam6 PH-like domain displays a unique PH domain fold with a conserved N-terminal α-helix. The Lam6 PH-like domain lacks the basic surface for phosphoinositide binding, but contains hydrophobic patches on its surface, which are critical for targeting to endoplasmic reticulum (ER)-mitochondrial contacts. Structures of the LAM SDs display a helix-grip fold with a hydrophobic cavity and a flexible Ω1-loop as a lid. Ergosterol is bound to the pocket in a head-down orientation, with its hydrophobic acyl group located in the tunnel entrance. The Ω1-loop in an open conformation is essential for ergosterol binding by direct hydrophobic interaction. Structural comparison suggested that the sterol binding mode of the Lam2 SD2 is likely conserved among the sterol transfer proteins of the StARkin superfamily. Structural models of full-length Lam2 correlated with the sterol transport function at the membrane contact sites.

Identification and Characterization of Botulinum Neurotoxin A Substrate Binding Pockets and Their Re-Engineering for Human SNAP-23.

PubMed

Sikorra, Stefan; Litschko, Christa; Müller, Carina; Thiel, Nadine; Galli, Thierry; Eichner, Timo; Binz, Thomas

2016-01-29

Botulinum neurotoxins (BoNTs) are highly potent bacterial proteins that block neurotransmitter release at the neuromuscular junction by cleaving SNAREs (soluble N-ethyl maleimide sensitive factor attachment protein receptors). However, their serotype A (BoNT/A) that cleaves SNAP-25 (synaptosomal-associated protein of 25 kDa) has also been an established pharmaceutical for treatment of medical conditions that rely on hyperactivity of cholinergic nerve terminals for 25 years. The expansion of its use to a variety of further medical conditions associated with hypersecretion components is prevented partly because the involved SNARE isoforms are not cleaved. Therefore, we examined by mutational analyses the reason for the resistance of human SNAP-23, an isoform of SNAP-25. We show that replacement of 10 SNAP-23 residues with their SNAP-25 counterparts effects SNAP-25-like cleavability. Conversely, transfer of each of the replaced SNAP-23 residues to SNAP-25 drastically decreased the cleavability of SNAP-25. By means of the existing SNAP-25-toxin co-crystal structure, molecular dynamics simulations, and corroborative mutagenesis studies, the appropriate binding pockets for these residues in BoNT/A were characterized. Systematic mutagenesis of two major BoNT/A binding pockets was conducted in order to adapt these pockets to corresponding amino acids of human SNAP-23. Human SNAP-23 cleaving mutants were isolated using a newly established yeast-based screening system. This method may be useful for engineering novel BoNT/A pharmaceuticals for the treatment of diseases that rely on SNAP-23-mediated hypersecretion. Copyright © 2015 Elsevier Ltd. All rights reserved.

A Hemoglobin Variant Associated with Neonatal Cyanosis and Anemia

PubMed Central

Crowley, Moira A.; Mollan, Todd L.; Abdulmalik, Osheisa Y.; Butler, Andrew D.; Goodwin, Emily F.; Sarkar, Arindam; Stolle, Catherine A.; Gow, Andrew J.; Olson, John S.; Weiss, Mitchell J.

2013-01-01

SUMMARY Globin-gene mutations are a rare but important cause of cyanosis. We identified a missense mutation in the fetal G γ-globin gene (HBG2) in a father and daughter with transient neonatal cyanosis and anemia. This new mutation modifies the ligand-binding pocket of fetal hemoglobin by means of two mechanisms. First, the relatively large side chain of methionine decreases both the affinity of oxygen for binding to the mutant hemoglobin subunit and the rate at which it does so. Second, the mutant methionine is converted to aspartic acid post-translationally, probably through oxidative mechanisms. The presence of this polar amino acid in the heme pocket is predicted to enhance hemoglobin denaturation, causing anemia. PMID:21561349

PoLi: A Virtual Screening Pipeline Based On Template Pocket And Ligand Similarity

PubMed Central

Roy, Ambrish; Srinivasan, Bharath; Skolnick, Jeffrey

2015-01-01

Often in pharmaceutical research, the goal is to identify small molecules that can interact with and appropriately modify the biological behavior of a new protein target. Unfortunately, most proteins lack both known structures and small molecule binders, prerequisites of many virtual screening, VS, approaches. For such proteins, ligand homology modeling, LHM, that copies ligands from homologous and perhaps evolutionarily distant template proteins, has been shown to be a powerful VS approach to identify possible binding ligands. However, if we want to target a specific pocket for which there is no homologous holo template protein structure, then LHM will not work. To address this issue, in a new pocket based approach, PoLi, we generalize LHM by exploiting the fact that the number of distinct small molecule ligand binding pockets in proteins is small. PoLi identifies similar ligand binding pockets in a holo-template protein library, selectively copies relevant parts of template ligands and uses them for VS. In practice, PoLi is a hybrid structure and ligand based VS algorithm that integrates 2D fingerprint-based and 3D shape-based similarity metrics for improved virtual screening performance. On standard DUD and DUD-E benchmark databases, using modeled receptor structures, PoLi achieves an average enrichment factor of 13.4 and 9.6 respectively, in the top 1% of the screened library. In contrast, traditional docking based VS using AutoDock Vina and homology-based VS using FINDSITEfilt have an average enrichment of 1.6 (3.0) and 9.0 (7.9) on the DUD (DUD-E) sets respectively. Experimental validation of PoLi predictions on dihydrofolate reductase, DHFR, using differential scanning fluorimetry, DSF, identifies multiple ligands with diverse molecular scaffolds, thus demonstrating the advantage of PoLi over current state-of-the-art VS methods. PMID:26225536

Classification of small molecule protein kinase inhibitors based upon the structures of their drug-enzyme complexes.

PubMed

Roskoski, Robert

2016-01-01

Because dysregulation and mutations of protein kinases play causal roles in human disease, this family of enzymes has become one of the most important drug targets over the past two decades. The X-ray crystal structures of 21 of the 27 FDA-approved small molecule inhibitors bound to their target protein kinases are depicted in this paper. The structure of the enzyme-bound antagonist complex is used in the classification of these inhibitors. Type I inhibitors bind to the active protein kinase conformation (DFG-Asp in, αC-helix in). Type I½ inhibitors bind to a DFG-Asp in inactive conformation while Type II inhibitors bind to a DFG-Asp out inactive conformation. Type I, I½, and type II inhibitors occupy part of the adenine binding pocket and form hydrogen bonds with the hinge region connecting the small and large lobes of the enzyme. Type III inhibitors bind next to the ATP-binding pocket and type IV inhibitors do not bind to the ATP or peptide substrate binding sites. Type III and IV inhibitors are allosteric in nature. Type V inhibitors bind to two different regions of the protein kinase domain and are therefore bivalent inhibitors. The type I-V inhibitors are reversible. In contrast, type VI inhibitors bind covalently to their target enzyme. Type I, I½, and II inhibitors are divided into A and B subtypes. The type A inhibitors bind in the front cleft, the back cleft, and near the gatekeeper residue, all of which occur within the region separating the small and large lobes of the protein kinase. The type B inhibitors bind in the front cleft and gate area but do not extend into the back cleft. An analysis of the limited available data indicates that type A inhibitors have a long residence time (minutes to hours) while the type B inhibitors have a short residence time (seconds to minutes). The catalytic spine includes residues from the small and large lobes and interacts with the adenine ring of ATP. Nearly all of the approved protein kinase inhibitors occupy the adenine-binding pocket; thus it is not surprising that these inhibitors interact with nearby catalytic spine (CS) residues. Moreover, a significant number of approved drugs also interact with regulatory spine (RS) residues. Copyright © 2015 Elsevier Ltd. All rights reserved.

ATP interacts with the CPVT mutation-associated central domain of the cardiac ryanodine receptor.

PubMed

Blayney, Lynda; Beck, Konrad; MacDonald, Ewan; D'Cruz, Leon; Nomikos, Michail; Griffiths, Julia; Thanassoulas, Angelos; Nounesis, George; Lai, F Anthony

2013-10-01

This study was designed to determine whether the cardiac ryanodine receptor (RyR2) central domain, a region associated with catecholamine polymorphic ventricular tachycardia (CPVT) mutations, interacts with the RyR2 regulators, ATP and the FK506-binding protein 12.6 (FKBP12.6). Wild-type (WT) RyR2 central domain constructs (G(2236)to G(2491)) and those containing the CPVT mutations P2328S and N2386I, were expressed as recombinant proteins. Folding and stability of the proteins were examined by circular dichroism (CD) spectroscopy and guanidine hydrochloride chemical denaturation. The far-UV CD spectra showed a soluble stably-folded protein with WT and mutant proteins exhibiting a similar secondary structure. Chemical denaturation analysis also confirmed a stable protein for both WT and mutant constructs with similar two-state unfolding. ATP and caffeine binding was measured by fluorescence spectroscopy. Both ATP and caffeine bound with an EC50 of ~200-400μM, and the affinity was the same for WT and mutant constructs. Sequence alignment with other ATP binding proteins indicated the RyR2 central domain contains the signature of an ATP binding pocket. Interaction of the central domain with FKBP12.6 was tested by glutaraldehyde cross-linking and no association was found. The RyR2 central domain, expressed as a 'correctly' folded recombinant protein, bound ATP in accord with bioinformatics evidence of conserved ATP binding sequence motifs. An interaction with FKBP12.6 was not evident. CPVT mutations did not disrupt the secondary structure nor binding to ATP. Part of the RyR2 central domain CPVT mutation cluster, can be expressed independently with retention of ATP binding. Copyright © 2013 Elsevier B.V. All rights reserved.

Recognition of U-rich RNA by Hfq from the Gram-positive pathogen Listeria monocytogenes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kovach, Alexander R.; Hoff, Kirsten E.; Canty, John T.

Hfq is a post-transcriptional regulator that binds U- and A-rich regions of sRNAs and their target mRNAs to stimulate their annealing in order to effect translation regulation and, often, to alter their stability. The functional importance of Hfq and its RNA-binding properties are relatively well understood in Gram-negative bacteria, whereas less is known about the RNAbinding properties of this riboregulator in Gram-positive species. Here, we describe the structure of Hfq from the Grampositive pathogen Listeria monocytogenes in its RNA-free form and in complex with a U 6 oligoribonucleotide. As expected, the protein takes the canonical hexameric toroidal shape of allmore » other known Hfq structures. The U 6 RNA binds on the “proximal face” in a pocket formed by conserved residues Q9, N42, F43, and K58. Additionally residues G5 and Q6 are involved in protein-nucleic and inter-subunit contacts that promote uracil specificity. Unlike Staphylococcus aureus (Sa) Hfq, Lm Hfq requires magnesium to bind U 6 with high affinity. In contrast, the longer oligo-uridine, U 16, binds Lm Hfq tightly in the presence or absence of magnesium, thereby suggesting the importance of additional residues on the proximal face and possibly the lateral rim in RNA interaction. Lastly, intrinsic tryptophan fluorescence quenching (TFQ) studies reveal, surprisingly, that Lm Hfq can bind (GU) 3G and U6 on its proximal and distal faces, indicating a less stringent adenine-nucleotide specificity site on the distal face as compared to the Gram-positive Hfq proteins from Sa and Bacillus subtilis and suggesting as yet uncharacterized RNA-binding modes on both faces.« less

Recognition of U-rich RNA by Hfq from the Gram-positive pathogen Listeria monocytogenes

DOE PAGES

Kovach, Alexander R.; Hoff, Kirsten E.; Canty, John T.; ...

2014-08-22

Hfq is a post-transcriptional regulator that binds U- and A-rich regions of sRNAs and their target mRNAs to stimulate their annealing in order to effect translation regulation and, often, to alter their stability. The functional importance of Hfq and its RNA-binding properties are relatively well understood in Gram-negative bacteria, whereas less is known about the RNAbinding properties of this riboregulator in Gram-positive species. Here, we describe the structure of Hfq from the Grampositive pathogen Listeria monocytogenes in its RNA-free form and in complex with a U 6 oligoribonucleotide. As expected, the protein takes the canonical hexameric toroidal shape of allmore » other known Hfq structures. The U 6 RNA binds on the “proximal face” in a pocket formed by conserved residues Q9, N42, F43, and K58. Additionally residues G5 and Q6 are involved in protein-nucleic and inter-subunit contacts that promote uracil specificity. Unlike Staphylococcus aureus (Sa) Hfq, Lm Hfq requires magnesium to bind U 6 with high affinity. In contrast, the longer oligo-uridine, U 16, binds Lm Hfq tightly in the presence or absence of magnesium, thereby suggesting the importance of additional residues on the proximal face and possibly the lateral rim in RNA interaction. Lastly, intrinsic tryptophan fluorescence quenching (TFQ) studies reveal, surprisingly, that Lm Hfq can bind (GU) 3G and U6 on its proximal and distal faces, indicating a less stringent adenine-nucleotide specificity site on the distal face as compared to the Gram-positive Hfq proteins from Sa and Bacillus subtilis and suggesting as yet uncharacterized RNA-binding modes on both faces.« less

Artificial hydrogenases based on cobaloximes and heme oxygenase

DOE PAGES

Bacchi, Marine; Veinberg, Elias; Field, Martin J.; ...

2016-06-06

The insertion of cobaloxime catalysts in the heme-binding pocket of heme oxygenase (HO) yields artificial hydrogenases active for H 2 evolution in neutral aqueous solutions. These novel biohybrids have been purified and characterized by using UV/visible and EPR spectroscopy. These analyses revealed the presence of two distinct binding conformations, thereby providing the cobaloxime with hydrophobic and hydrophilic environments, respectively. Quantum chemical/molecular mechanical docking calculations found open and closed conformations of the binding pocket owing to mobile amino acid residues. HO-based biohybrids incorporating a {Co(dmgH) 2} (dmgH 2 = dimethylglyoxime) catalytic center displayed up to threefold increased turnover numbers with respectmore » to the cobaloxime alone or to analogous sperm whale myoglobin adducts. Here, this study thus provides a strong basis for further improvement of such biohybrids, using well-designed modifications of the second and outer coordination spheres, through site-directed mutagenesis of the host protein.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chien, Ellen Y.T.; Liu, Wei; Zhao, Qiang

Dopamine modulates movement, cognition, and emotion through activation of dopamine G protein-coupled receptors in the brain. The crystal structure of the human dopamine D3 receptor (D3R) in complex with the small molecule D2R/D3R-specific antagonist eticlopride reveals important features of the ligand binding pocket and extracellular loops. On the intracellular side of the receptor, a locked conformation of the ionic lock and two distinctly different conformations of intracellular loop 2 are observed. Docking of R-22, a D3R-selective antagonist, reveals an extracellular extension of the eticlopride binding site that comprises a second binding pocket for the aryl amide of R-22, which differsmore » between the highly homologous D2R and D3R. This difference provides direction to the design of D3R-selective agents for treating drug abuse and other neuropsychiatric indications.« less

Artificial hydrogenases based on cobaloximes and heme oxygenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bacchi, Marine; Veinberg, Elias; Field, Martin J.

The insertion of cobaloxime catalysts in the heme-binding pocket of heme oxygenase (HO) yields artificial hydrogenases active for H 2 evolution in neutral aqueous solutions. These novel biohybrids have been purified and characterized by using UV/visible and EPR spectroscopy. These analyses revealed the presence of two distinct binding conformations, thereby providing the cobaloxime with hydrophobic and hydrophilic environments, respectively. Quantum chemical/molecular mechanical docking calculations found open and closed conformations of the binding pocket owing to mobile amino acid residues. HO-based biohybrids incorporating a {Co(dmgH) 2} (dmgH 2 = dimethylglyoxime) catalytic center displayed up to threefold increased turnover numbers with respectmore » to the cobaloxime alone or to analogous sperm whale myoglobin adducts. Here, this study thus provides a strong basis for further improvement of such biohybrids, using well-designed modifications of the second and outer coordination spheres, through site-directed mutagenesis of the host protein.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Manglik, Aashish; Kruse, Andrew C.; Kobilka, Tong Sun

Opium is one of the world's oldest drugs, and its derivatives morphine and codeine are among the most used clinical drugs to relieve severe pain. These prototypical opioids produce analgesia as well as many undesirable side effects (sedation, apnoea and dependence) by binding to and activating the G-protein-coupled {mu}-opioid receptor ({mu}-OR) in the central nervous system. Here we describe the 2.8 {angstrom} crystal structure of the mouse {mu}-OR in complex with an irreversible morphinan antagonist. Compared to the buried binding pocket observed in most G-protein-coupled receptors published so far, the morphinan ligand binds deeply within a large solvent-exposed pocket. Ofmore » particular interest, the {mu}-OR crystallizes as a two-fold symmetrical dimer through a four-helix bundle motif formed by transmembrane segments 5 and 6. These high-resolution insights into opioid receptor structure will enable the application of structure-based approaches to develop better drugs for the management of pain and addiction.« less

Effect of Rap1 binding on DNA distortion and potassium permanganate hypersensitivity.

PubMed

Le Bihan, Yann-Vaï; Matot, Béatrice; Pietrement, Olivier; Giraud-Panis, Marie-Josèphe; Gasparini, Sylvaine; Le Cam, Eric; Gilson, Eric; Sclavi, Bianca; Miron, Simona; Le Du, Marie-Hélène

2013-03-01

Repressor activator protein 1 (Rap1) is an essential factor involved in transcription and telomere stability in the budding yeast Saccharomyces cerevisiae. Its interaction with DNA causes hypersensitivity to potassium permanganate, suggesting local DNA melting and/or distortion. In this study, various Rap1-DNA crystal forms were obtained using specifically designed crystal screens. Analysis of the DNA conformation showed that its distortion was not sufficient to explain the permanganate reactivity. However, anomalous data collected at the Mn edge using a Rap1-DNA crystal soaked in potassium permanganate solution indicated that the DNA conformation in the crystal was compatible with interaction with permanganate ions. Sequence-conservation analysis revealed that double-Myb-containing Rap1 proteins all carry a fully conserved Arg580 at a position that may favour interaction with permanganate ions, although it is not involved in the hypersensitive cytosine distortion. Permanganate reactivity assays with wild-type Rap1 and the Rap1[R580A] mutant demonstrated that Arg580 is essential for hypersensitivity. AFM experiments showed that wild-type Rap1 and the Rap1[R580A] mutant interact with DNA over 16 successive binding sites, leading to local DNA stiffening but not to accumulation of the observed local distortion. Therefore, Rap1 may cause permanganate hypersensitivity of DNA by forming a pocket between the reactive cytosine and Arg580, driving the permanganate ion towards the C5-C6 bond of the cytosine.

The structure of apo and holo forms of xylose reductase, a dimeric aldo-keto reductase from Candida tenuis.

PubMed

Kavanagh, Kathryn L; Klimacek, Mario; Nidetzky, Bernd; Wilson, David K

2002-07-16

Xylose reductase is a homodimeric oxidoreductase dependent on NADPH or NADH and belongs to the largely monomeric aldo-keto reductase superfamily of proteins. It catalyzes the first step in the assimilation of xylose, an aldose found to be a major constituent monosaccharide of renewable plant hemicellulosic material, into yeast metabolic pathways. It does this by reducing open chain xylose to xylitol, which is reoxidized to xylulose by xylitol dehydrogenase and metabolically integrated via the pentose phosphate pathway. No structure has yet been determined for a xylose reductase, a dimeric aldo-keto reductase or a family 2 aldo-keto reductase. The structures of the Candida tenuis xylose reductase apo- and holoenzyme, which crystallize in spacegroup C2 with different unit cells, have been determined to 2.2 A resolution and an R-factor of 17.9 and 20.8%, respectively. Residues responsible for mediating the novel dimeric interface include Asp-178, Arg-181, Lys-202, Phe-206, Trp-313, and Pro-319. Alignments with other superfamily members indicate that these interactions are conserved in other dimeric xylose reductases but not throughout the remainder of the oligomeric aldo-keto reductases, predicting alternate modes of oligomerization for other families. An arrangement of side chains in a catalytic triad shows that Tyr-52 has a conserved function as a general acid. The loop that folds over the NAD(P)H cosubstrate is disordered in the apo form but becomes ordered upon cosubstrate binding. A slow conformational isomerization of this loop probably accounts for the observed rate-limiting step involving release of cosubstrate. Xylose binding (K(m) = 87 mM) is mediated by interactions with a binding pocket that is more polar than a typical aldo-keto reductase. Modeling of xylose into the active site of the holoenzyme using ordered waters as a guide for sugar hydroxyls suggests a convincing mode of substrate binding.

Impaired helix 12 dynamics due to proline 892 substitutions in the androgen receptor are associated with complete androgen insensitivity.

PubMed

Elhaji, Youssef A; Stoica, Ileana; Dennis, Sheldon; Purisima, Enrico O; Lumbroso, Rose; Beitel, Lenore K; Trifiro, Mark A

2006-03-15

Structural studies of the ligand-binding domain (LBD) of several steroid receptors have revealed that the dynamic properties of the C-terminal helix 12 (H12) are the major determinant of the activation mode of these receptors. H12 exhibits high mobility and different conformations in the absence of ligand. Upon ligand binding, H12 is stabilized in a precise position to seal the ligand-binding pocket and finalize the assembly of the activation function (AF-2) domain. In this study, we investigated the role of the conserved proline 892 of the androgen receptor (AR) in directing the dynamic location and orientation of the AR-H12. We used a combined approach including kinetic and biochemical assays with molecular dynamic simulations to analyze two substitutions (P892A and P892L) identified in individuals with complete androgen insensitivity syndrome. Our analyses revealed distinct mechanisms by which these substitutions impair H12 function resulting in severely defective receptors. The AR-P892A receptor exhibited reduced ligand binding and transactivational potential because of an increased flexibility in H12. The AR-P892L substitution renders the receptor inactive due to a distorted, unstructured and misplaced H12. To confirm the mutants' inability to stabilize H12 in an active position, we have developed a novel in vivo assay to evaluate the accessibility of the H12-docking site on the AR-LBD surface. An extrinsic AR-H12 peptide was able to interact with wild-type and mutant LBDs in the absence of ligand. Ligand-induced proper positioning of the intrinsic H12 of wild-type AR prevented these interactions, whereas the misplacement of the mutants' H12 did not. Proline at this position may be critical for H12 dynamics not only in the AR, but also in other nuclear receptors where this proline is conserved.

Characterization of Molecular Determinants of the Conformational Stability of Macrophage Migration Inhibitory Factor: Leucine 46 Hydrophobic Pocket

PubMed Central

El-Turk, Farah; Fauvet, Bruno; Ashrafi, Amer; Ouertatani-Sakouhi, Hajer; Cho, Min-Kyu; Neri, Marilisa; Cascella, Michele; Rothlisberger, Ursula; Pojer, Florence; Zweckstetter, Markus; Lashuel, Hilal

2012-01-01

Macrophage Migration Inhibitory Factor (MIF) is a key mediator of inflammatory responses and innate immunity and has been implicated in the pathogenesis of several inflammatory and autoimmune diseases. The oligomerization of MIF, more specifically trimer formation, is essential for its keto-enol tautomerase activity and probably mediates several of its interactions and biological activities, including its binding to its receptor CD74 and activation of certain signaling pathways. Therefore, understanding the molecular factors governing the oligomerization of MIF and the role of quaternary structure in modulating its structural stability and multifunctional properties is crucial for understanding the function of MIF in health and disease. Herein, we describe highly conserved intersubunit interactions involving the hydrophobic packing of the side chain of Leu46 onto the β-strand β3 of one monomer within a hydrophobic pocket from the adjacent monomer constituted by residues Arg11, Val14, Phe18, Leu19, Val39, His40, Val41, Val42, and Pro43. To elucidate the structural significance of these intersubunit interactions and their relative contribution to MIF’s trimerization, structural stability and catalytic activity, we generated three point mutations where Leu46 was replaced by glycine (L46G), alanine (L46A) and phenylalanine (L46F), and their structural properties, stability, oligomerization state, and catalytic activity were characterized using a battery of biophysical methods and X-ray crystallography. Our findings provide new insights into the role of the Leu46 hydrophobic pocket in stabilizing the conformational state of MIF in solution. Disrupting the Leu46 hydrophobic interaction perturbs the secondary and tertiary structure of the protein but has no effect on its oligomerization state. PMID:23028743

Characterization of molecular determinants of the conformational stability of macrophage migration inhibitory factor: leucine 46 hydrophobic pocket.

PubMed

El-Turk, Farah; Fauvet, Bruno; Ashrafi, Amer; Ouertatani-Sakouhi, Hajer; Cho, Min-Kyu; Neri, Marilisa; Cascella, Michele; Rothlisberger, Ursula; Pojer, Florence; Zweckstetter, Markus; Lashuel, Hilal

2012-01-01

Macrophage Migration Inhibitory Factor (MIF) is a key mediator of inflammatory responses and innate immunity and has been implicated in the pathogenesis of several inflammatory and autoimmune diseases. The oligomerization of MIF, more specifically trimer formation, is essential for its keto-enol tautomerase activity and probably mediates several of its interactions and biological activities, including its binding to its receptor CD74 and activation of certain signaling pathways. Therefore, understanding the molecular factors governing the oligomerization of MIF and the role of quaternary structure in modulating its structural stability and multifunctional properties is crucial for understanding the function of MIF in health and disease. Herein, we describe highly conserved intersubunit interactions involving the hydrophobic packing of the side chain of Leu46 onto the β-strand β3 of one monomer within a hydrophobic pocket from the adjacent monomer constituted by residues Arg11, Val14, Phe18, Leu19, Val39, His40, Val41, Val42, and Pro43. To elucidate the structural significance of these intersubunit interactions and their relative contribution to MIF's trimerization, structural stability and catalytic activity, we generated three point mutations where Leu46 was replaced by glycine (L46G), alanine (L46A) and phenylalanine (L46F), and their structural properties, stability, oligomerization state, and catalytic activity were characterized using a battery of biophysical methods and X-ray crystallography. Our findings provide new insights into the role of the Leu46 hydrophobic pocket in stabilizing the conformational state of MIF in solution. Disrupting the Leu46 hydrophobic interaction perturbs the secondary and tertiary structure of the protein but has no effect on its oligomerization state.

Structure of EvaA: a paradigm for sugar 2,3-dehydratases.

PubMed

Kubiak, Rachel L; Thoden, James B; Holden, Hazel M

2013-03-26

Unusual deoxysugars found appended to natural products often provide or enhance the pharmacokinetic activities of the parent compound. The preferred carbohydrate donors for the biosynthesis of such glycosylated natural products are the dTDP-linked sugars. Many of the biologically relevant dTDP-deoxysugars are constructed around the 2,6-dideoxyhexoses or the 2,3(4),6-trideoxyhexoses. A key step in the biosynthesis of these sugars is the removal of the hexose C-2' hydroxyl group and the oxidation of the C-3' hydroxyl group to a carbonyl moiety. Enzymes that catalyze these reactions are referred to as 2,3-dehydratases and have been, for the most part, largely uncharacterized. Here we report the first structural analysis of a sugar 2,3-dehydratase. For this investigation, the enzyme, EvaA, was cloned from Amycolatopsis orientalis, and the structure was solved and refined to a nominal resolution of 1.7 Å. On the basis of the resulting model, it is clear that EvaA belongs to the large Nudix hydrolase superfamily and is most similar to GDP-mannose hydrolase. Each subunit of the EvaA dimer folds into two domains that clearly arose via gene duplication. Two dTDP-sugar binding pockets, A and B, are present in each EvaA subunit. On the basis of site-directed mutagenesis experiments and activity assays, it appears that pocket A functions as the active site and pocket B is simply a remnant left behind from the gene duplication event. As 2,3-dehydration is crucial for the biosynthesis of many unusual deoxysugars, this investigation provides key structural insight into this widely conserved reaction.

Structural basis of intramitochondrial phosphatidic acid transport mediated by Ups1-Mdm35 complex.

PubMed

Yu, Fang; He, Fangyuan; Yao, Hongyan; Wang, Chengyuan; Wang, Jianchuan; Li, Jianxu; Qi, Xiaofeng; Xue, Hongwei; Ding, Jianping; Zhang, Peng

2015-07-01

Ups1 forms a complex with Mdm35 and is critical for the transport of phosphatidic acid (PA) from the mitochondrial outer membrane to the inner membrane. We report the crystal structure of the Ups1-Mdm35-PA complex and the functional characterization of Ups1-Mdm35 in PA binding and transfer. Ups1 features a barrel-like structure consisting of an antiparallel β-sheet and three α-helices. Mdm35 adopts a three-helical clamp-like structure to wrap around Ups1 to form a stable complex. The β-sheet and α-helices of Ups1 form a long tunnel-like pocket to accommodate the substrate PA, and a short helix α2 acts as a lid to cover the pocket. The hydrophobic residues lining the pocket and helix α2 are critical for PA binding and transfer. In addition, a hydrophilic patch on the surface of Ups1 near the PA phosphate-binding site also plays an important role in the function of Ups1-Mdm35. Our study reveals the molecular basis of the function of Ups1-Mdm35 and sheds new light on the mechanism of intramitochondrial phospholipid transport by the MSF1/PRELI family proteins. © 2015 The Authors.

Energetics of subdomain movements and fluorescence probe solvation environment change in ATP-bound myosin.

PubMed

Harris, Michael J; Woo, Hyung-June

2008-11-01

Energetics of conformational changes experienced by an ATP-bound myosin head detached from actin was studied by all-atom explicit water umbrella sampling simulations. The statistics of coupling between large scale domain movements and smaller scale structural features were examined, including the closing of the ATP binding pocket, and a number of key hydrogen bond formations shown to play roles in structural and biochemical studies. The statistics for the ATP binding pocket open/close transition show an evolution of the relative stability from the open state in the early stages of the recovery stroke to the stable closed state after the stroke. The change in solvation environment of the fluorescence probe Trp507 (scallop numbering; 501 in Dictyostelium discoideum) indicates that the probe faithfully reflects the closing of the binding pocket as previously shown in experimental studies, while being directly coupled to roughly the early half of the overall large scale conformational change of the converter domain rotation. The free energy change of this solvation environment change, in particular, is -1.3 kcal/mol, in close agreement with experimental estimates. In addition, our results provide direct molecular level data allowing for interpretations of the fluorescence experiments of myosin conformational change in terms of the de-solvation of Trp side chain.

The crystal structure of human soluble CD14 reveals a bent solenoid with a hydrophobic amino-terminal pocket1

PubMed Central

Kelley, Stacy L.; Lukk, Tiit; Nair, Satish K.; Tapping, Richard I.

2012-01-01

Human monocyte differentiation antigen CD14 is a pattern recognition receptor that enhances innate immune responses to infection by sensitizing host cells to bacterial lipopolysaccharide (LPS; endotoxin), lipoproteins, lipoteichoic acid and other acylated microbial products. CD14 physically delivers these lipidated microbial products to various Toll-like receptor signaling complexes that subsequently induce intracellular proinflammatory signaling cascades upon ligand binding. The ensuing cellular responses are usually protective to the host, but can also result in host fatality through sepsis. In this work, we have determined the X-ray crystal structure of human CD14. The structure reveals a bent solenoid typical of leucine rich repeat proteins with an amino terminal pocket that presumably binds acylated ligands including LPS. Comparison of human and mouse CD14 structures show great similarity in overall protein fold. However, compared to mouse CD14, human CD14 contains an expanded pocket and alternative rim residues that are likely to be important for LPS binding and cell activation. The X-ray crystal structure of human CD14 presented herein may foster additional ligand bound structural studies, virtual docking studies, and drug design efforts to mitigate LPS induced sepsis and other inflammatory diseases. PMID:23264655

Formation of a repressive complex in the mammalian circadian clock is mediated by the secondary pocket of CRY1

DOE PAGES

Michael, Alicia K.; Fribourgh, Jennifer L.; Chelliah, Yogarany; ...

2017-01-31

The basic helix-loop-helix PAS domain (bHLH-PAS) transcription factor CLOCK:BMAL1 (brain and muscle Arnt-like protein 1) sits at the core of the mammalian circadian transcription/translation feedback loop. Precise control of CLOCK:BMAL1 activity by coactivators and repressors establishes the ~24-h periodicity of gene expression. Formation of a repressive complex, defined by the core clock proteins cryptochrome 1 (CRY1):CLOCK:BMAL1, plays an important role controlling the switch from repression to activation each day. Here in this paper, we show that CRY1 binds directly to the PAS domain core of CLOCK: BMAL1, driven primarily by interaction with the CLOCK PAS-B domain. Integrative modeling and solutionmore » X-ray scattering studies unambiguously position a key loop of the CLOCK PAS-B domain in the secondary pocket of CRY1, analogous to the antenna chromophore-binding pocket of photolyase. CRY1 docks onto the transcription factor alongside the PAS domains, extending above the DNA-binding bHLH domain. Single point mutations at the interface on either CRY1 or CLOCK disrupt formation of the ternary complex, highlighting the importance of this interface for direct regulation of CLOCK:BMAL1 activity by CRY1.« less

Approach for targeting Ras with small molecules that activate SOS-mediated nucleotide exchange.

PubMed

Burns, Michael C; Sun, Qi; Daniels, R Nathan; Camper, DeMarco; Kennedy, J Phillip; Phan, Jason; Olejniczak, Edward T; Lee, Taekyu; Waterson, Alex G; Rossanese, Olivia W; Fesik, Stephen W

2014-03-04

Aberrant activation of the small GTPase Ras by oncogenic mutation or constitutively active upstream receptor tyrosine kinases results in the deregulation of cellular signals governing growth and survival in ∼30% of all human cancers. However, the discovery of potent inhibitors of Ras has been difficult to achieve. Here, we report the identification of small molecules that bind to a unique pocket on the Ras:Son of Sevenless (SOS):Ras complex, increase the rate of SOS-catalyzed nucleotide exchange in vitro, and modulate Ras signaling pathways in cells. X-ray crystallography of Ras:SOS:Ras in complex with these molecules reveals that the compounds bind in a hydrophobic pocket in the CDC25 domain of SOS adjacent to the Switch II region of Ras. The structure-activity relationships exhibited by these compounds can be rationalized on the basis of multiple X-ray cocrystal structures. Mutational analyses confirmed the functional relevance of this binding site and showed it to be essential for compound activity. These molecules increase Ras-GTP levels and disrupt MAPK and PI3K signaling in cells at low micromolar concentrations. These small molecules represent tools to study the acute activation of Ras and highlight a pocket on SOS that may be exploited to modulate Ras signaling.

Functional Loop Dynamics of the Streptavidin-Biotin Complex

PubMed Central

Song, Jianing; Li, Yongle; Ji, Changge; Zhang, John Z. H.

2015-01-01

Accelerated molecular dynamics (aMD) simulation is employed to study the functional dynamics of the flexible loop3-4 in the strong-binding streptavidin-biotin complex system. Conventional molecular (cMD) simulation is also performed for comparison. The present study reveals the following important properties of the loop dynamics: (1) The transition of loop3-4 from open to closed state is observed in 200 ns aMD simulation. (2) In the absence of biotin binding, the open-state streptavidin is more stable, which is consistent with experimental evidences. The free energy (ΔG) difference is about 5 kcal/mol between two states. But with biotin binding, the closed state is more stable due to electrostatic and hydrophobic interactions between the loop3-4 and biotin. (3) The closure of loop3-4 is concerted to the stable binding of biotin to streptavidin. When the loop3-4 is in its open-state, biotin moves out of the binding pocket, indicating that the interactions between the loop3-4 and biotin are essential in trapping biotin in the binding pocket. (4) In the tetrameric streptavidin system, the conformational change of the loop3-4 in each monomer is independent of each other. That is, there is no cooperative binding for biotin bound to the four subunits of the tetramer. PMID:25601277

A novel cofactor-binding mode in bacterial IMP dehydrogenases explains inhibitor selectivity

DOE PAGES

Makowska-Grzyska, Magdalena; Kim, Youngchang; Maltseva, Natalia; ...

2015-01-09

The steadily rising frequency of emerging diseases and antibiotic resistance creates an urgent need for new drugs and targets. Inosine 5'-monophosphate dehydrogenase (IMP dehydrogenase or IMPDH) is a promising target for the development of new antimicrobial agents. IMPDH catalyzes the oxidation of IMP to XMP with the concomitant reduction of NAD +, which is the pivotal step in the biosynthesis of guanine nucleotides. Potent inhibitors of bacterial IMPDHs have been identified that bind in a structurally distinct pocket that is absent in eukaryotic IMPDHs. The physiological role of this pocket was not understood. Here, we report the structures of complexesmore » with different classes of inhibitors of Bacillus anthracis, Campylobacter jejuni, and Clostridium perfringens IMPDHs. These structures in combination with inhibition studies provide important insights into the interactions that modulate selectivity and potency. We also present two structures of the Vibrio cholerae IMPDH in complex with IMP/NAD + and XMP/NAD +. In both structures, the cofactor assumes a dramatically different conformation than reported previously for eukaryotic IMPDHs and other dehydrogenases, with the major change observed for the position of the NAD+ adenosine moiety. More importantly, this new NAD +-binding site involves the same pocket that is utilized by the inhibitors. Thus, the bacterial IMPDH-specific NAD +-binding mode helps to rationalize the conformation adopted by several classes of prokaryotic IMPDH inhibitors. As a result, these findings offer a potential strategy for further ligand optimization.« less

New insights into the structural and functional involvement of the gate loop in AcrB export activity.

PubMed

Ababou, Abdessamad

2018-02-01

AcrB is a major multidrug exporter in Escherichia coli and other Gram-negative bacteria. Its gate loop, located between the proximal and the distal pockets, have been reported to play important role in the export of many antibiotics. This loop location, rigidity and interactions with substrates have led recent reports to suggest that AcrB export mechanism operates in a sequential manner. First the substrate binds the proximal pocket in the access monomer, then it moves to bind the distal pocket in the binding monomer and subsequently it is extruded in the extrusion monomer. Recently, we have demonstrated that the gate loop is not required for the binding of Erythromycin but the integrity of this loop is important for an efficient export of this substrate. However, here we show that the antibiotic susceptibilities of the same AcrB gate loop mutants for Doxorubicin were unaffected, suggesting that this loop is not required for its export, and we demonstrate that this substrate may use principally the tunnel-1, located between transmembranes 8 and 9, more often than previously reported. To further explain our findings, here we address the gate loop mutations effects on AcrB solution energetics (fold, stability, molecular dynamics) and on the in vivo efflux of Erythromycin and Doxorubicin. Finally, we discuss the efflux and the discrepancy between the structural and the functional experiments for Erythromycin in these gate loop mutants. Copyright © 2017 Elsevier B.V. All rights reserved.

A novel cofactor-binding mode in bacterial IMP dehydrogenases explains inhibitor selectivity.

PubMed

Makowska-Grzyska, Magdalena; Kim, Youngchang; Maltseva, Natalia; Osipiuk, Jerzy; Gu, Minyi; Zhang, Minjia; Mandapati, Kavitha; Gollapalli, Deviprasad R; Gorla, Suresh Kumar; Hedstrom, Lizbeth; Joachimiak, Andrzej

2015-02-27

The steadily rising frequency of emerging diseases and antibiotic resistance creates an urgent need for new drugs and targets. Inosine 5'-monophosphate dehydrogenase (IMP dehydrogenase or IMPDH) is a promising target for the development of new antimicrobial agents. IMPDH catalyzes the oxidation of IMP to XMP with the concomitant reduction of NAD(+), which is the pivotal step in the biosynthesis of guanine nucleotides. Potent inhibitors of bacterial IMPDHs have been identified that bind in a structurally distinct pocket that is absent in eukaryotic IMPDHs. The physiological role of this pocket was not understood. Here, we report the structures of complexes with different classes of inhibitors of Bacillus anthracis, Campylobacter jejuni, and Clostridium perfringens IMPDHs. These structures in combination with inhibition studies provide important insights into the interactions that modulate selectivity and potency. We also present two structures of the Vibrio cholerae IMPDH in complex with IMP/NAD(+) and XMP/NAD(+). In both structures, the cofactor assumes a dramatically different conformation than reported previously for eukaryotic IMPDHs and other dehydrogenases, with the major change observed for the position of the NAD(+) adenosine moiety. More importantly, this new NAD(+)-binding site involves the same pocket that is utilized by the inhibitors. Thus, the bacterial IMPDH-specific NAD(+)-binding mode helps to rationalize the conformation adopted by several classes of prokaryotic IMPDH inhibitors. These findings offer a potential strategy for further ligand optimization. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

A Novel, “Double-Clamp” Binding Mode for Human Heme Oxygenase-1 Inhibition

PubMed Central

Rahman, Mona N.; Vlahakis, Jason Z.; Vukomanovic, Dragic; Lee, Wallace; Szarek, Walter A.; Nakatsu, Kanji; Jia, Zongchao

2012-01-01

The development of heme oxygenase (HO) inhibitors is critical in dissecting and understanding the HO system and for potential therapeutic applications. We have established a program to design and optimize HO inhibitors using structure-activity relationships in conjunction with X-ray crystallographic analyses. One of our previous complex crystal structures revealed a putative secondary hydrophobic binding pocket which could be exploited for a new design strategy by introducing a functional group that would fit into this potential site. To test this hypothesis and gain further insights into the structural basis of inhibitor binding, we have synthesized and characterized 1-(1H-imidazol-1-yl)-4,4-diphenyl-2-butanone (QC-308). Using a carbon monoxide (CO) formation assay on rat spleen microsomes, the compound was found to be ∼15 times more potent (IC50 = 0.27±0.07 µM) than its monophenyl analogue, which is already a potent compound in its own right (QC-65; IC50 = 4.0±1.8 µM). The crystal structure of hHO-1 with QC-308 revealed that the second phenyl group in the western region of the compound is indeed accommodated by a definitive secondary proximal hydrophobic pocket. Thus, the two phenyl moieties are each stabilized by distinct hydrophobic pockets. This “double-clamp” binding offers additional inhibitor stabilization and provides a new route for improvement of human heme oxygenase inhibitors. PMID:22276118

A novel, "double-clamp" binding mode for human heme oxygenase-1 inhibition.

PubMed

Rahman, Mona N; Vlahakis, Jason Z; Vukomanovic, Dragic; Lee, Wallace; Szarek, Walter A; Nakatsu, Kanji; Jia, Zongchao

2012-01-01

The development of heme oxygenase (HO) inhibitors is critical in dissecting and understanding the HO system and for potential therapeutic applications. We have established a program to design and optimize HO inhibitors using structure-activity relationships in conjunction with X-ray crystallographic analyses. One of our previous complex crystal structures revealed a putative secondary hydrophobic binding pocket which could be exploited for a new design strategy by introducing a functional group that would fit into this potential site. To test this hypothesis and gain further insights into the structural basis of inhibitor binding, we have synthesized and characterized 1-(1H-imidazol-1-yl)-4,4-diphenyl-2-butanone (QC-308). Using a carbon monoxide (CO) formation assay on rat spleen microsomes, the compound was found to be ∼15 times more potent (IC(50) = 0.27±0.07 µM) than its monophenyl analogue, which is already a potent compound in its own right (QC-65; IC(50) = 4.0±1.8 µM). The crystal structure of hHO-1 with QC-308 revealed that the second phenyl group in the western region of the compound is indeed accommodated by a definitive secondary proximal hydrophobic pocket. Thus, the two phenyl moieties are each stabilized by distinct hydrophobic pockets. This "double-clamp" binding offers additional inhibitor stabilization and provides a new route for improvement of human heme oxygenase inhibitors.

PL-PatchSurfer: a novel molecular local surface-based method for exploring protein-ligand interactions.

PubMed

Hu, Bingjie; Zhu, Xiaolei; Monroe, Lyman; Bures, Mark G; Kihara, Daisuke

2014-08-27

Structure-based computational methods have been widely used in exploring protein-ligand interactions, including predicting the binding ligands of a given protein based on their structural complementarity. Compared to other protein and ligand representations, the advantages of a surface representation include reduced sensitivity to subtle changes in the pocket and ligand conformation and fast search speed. Here we developed a novel method named PL-PatchSurfer (Protein-Ligand PatchSurfer). PL-PatchSurfer represents the protein binding pocket and the ligand molecular surface as a combination of segmented surface patches. Each patch is characterized by its geometrical shape and the electrostatic potential, which are represented using the 3D Zernike descriptor (3DZD). We first tested PL-PatchSurfer on binding ligand prediction and found it outperformed the pocket-similarity based ligand prediction program. We then optimized the search algorithm of PL-PatchSurfer using the PDBbind dataset. Finally, we explored the utility of applying PL-PatchSurfer to a larger and more diverse dataset and showed that PL-PatchSurfer was able to provide a high early enrichment for most of the targets. To the best of our knowledge, PL-PatchSurfer is the first surface patch-based method that treats ligand complementarity at protein binding sites. We believe that using a surface patch approach to better understand protein-ligand interactions has the potential to significantly enhance the design of new ligands for a wide array of drug-targets.

PL-PatchSurfer: A Novel Molecular Local Surface-Based Method for Exploring Protein-Ligand Interactions

PubMed Central

Hu, Bingjie; Zhu, Xiaolei; Monroe, Lyman; Bures, Mark G.; Kihara, Daisuke

2014-01-01

Structure-based computational methods have been widely used in exploring protein-ligand interactions, including predicting the binding ligands of a given protein based on their structural complementarity. Compared to other protein and ligand representations, the advantages of a surface representation include reduced sensitivity to subtle changes in the pocket and ligand conformation and fast search speed. Here we developed a novel method named PL-PatchSurfer (Protein-Ligand PatchSurfer). PL-PatchSurfer represents the protein binding pocket and the ligand molecular surface as a combination of segmented surface patches. Each patch is characterized by its geometrical shape and the electrostatic potential, which are represented using the 3D Zernike descriptor (3DZD). We first tested PL-PatchSurfer on binding ligand prediction and found it outperformed the pocket-similarity based ligand prediction program. We then optimized the search algorithm of PL-PatchSurfer using the PDBbind dataset. Finally, we explored the utility of applying PL-PatchSurfer to a larger and more diverse dataset and showed that PL-PatchSurfer was able to provide a high early enrichment for most of the targets. To the best of our knowledge, PL-PatchSurfer is the first surface patch-based method that treats ligand complementarity at protein binding sites. We believe that using a surface patch approach to better understand protein-ligand interactions has the potential to significantly enhance the design of new ligands for a wide array of drug-targets. PMID:25167137

The biological activity of botulinum neurotoxin type C is dependent upon novel types of ganglioside binding sites.

PubMed

Strotmeier, Jasmin; Gu, Shenyan; Jutzi, Stephan; Mahrhold, Stefan; Zhou, Jie; Pich, Andreas; Eichner, Timo; Bigalke, Hans; Rummel, Andreas; Jin, Rongsheng; Binz, Thomas

2011-07-01

The seven botulinum neurotoxins (BoNT) cause muscle paralysis by selectively cleaving core components of the vesicular fusion machinery. Their extraordinary activity primarily relies on highly specific entry into neurons. Data on BoNT/A, B, E, F and G suggest that entry follows a dual receptor interaction with complex gangliosides via an established ganglioside binding region and a synaptic vesicle protein. Here, we report high resolution crystal structures of the BoNT/C cell binding fragment alone and in complex with sialic acid. The WY-motif characteristic of the established ganglioside binding region was located on an exposed loop. Sialic acid was co-ordinated at a novel position neighbouring the binding pocket for synaptotagmin in BoNT/B and G and the sialic acid binding site in BoNT/D and TeNT respectively. Employing synaptosomes and immobilized gangliosides binding studies with BoNT/C mutants showed that the ganglioside binding WY-loop, the newly identified sialic acid-co-ordinating pocket and the area corresponding to the established ganglioside binding region of other BoNTs are involved in ganglioside interaction. Phrenic nerve hemidiaphragm activity tests employing ganglioside deficient mice furthermore evidenced that the biological activity of BoNT/C depends on ganglioside interaction with at least two binding sites. These data suggest a unique cell binding and entry mechanism for BoNT/C among clostridial neurotoxins. © 2011 Blackwell Publishing Ltd.

Missing Fragments: Detecting Cooperative Binding in Fragment-Based Drug Design

PubMed Central

2012-01-01

The aim of fragment-based drug design (FBDD) is to identify molecular fragments that bind to alternate subsites within a given binding pocket leading to cooperative binding when linked. In this study, the binding of fragments to human phenylethanolamine N-methyltransferase is used to illustrate how (a) current protocols may fail to detect fragments that bind cooperatively, (b) theoretical approaches can be used to validate potential hits, and (c) apparent false positives obtained when screening against cocktails of fragments may in fact indicate promising leads. PMID:24900472

Unique Structure and Dynamics of the EphA5 Ligand Binding Domain Mediate Its Binding Specificity as Revealed by X-ray Crystallography, NMR and MD Simulations

PubMed Central

Mitra, Sayantan; Zhu, Wanlong; Qin, Haina; Pasquale, Elena B.; Song, Jianxing

2013-01-01

The 16 EphA and EphB receptors represent the largest family of receptor tyrosine kinases, and their interactions with 9 ephrin-A and ephrin-B ligands initiate bidirectional signals controlling many physiological and pathological processes. Most interactions occur between receptor and ephrins of the same class, and only EphA4 can bind all A and B ephrins. To understand the structural and dynamic principles that enable Eph receptors to utilize the same jellyroll β-sandwich fold to bind ephrins, the VAPB-MSP domain, peptides and small molecules, we have used crystallography, NMR and molecular dynamics (MD) simulations to determine the first structure and dynamics of the EphA5 ligand-binding domain (LBD), which only binds ephrin-A ligands. Unexpectedly, despite being unbound, the high affinity ephrin-binding pocket of EphA5 resembles that of other Eph receptors bound to ephrins, with a helical conformation over the J–K loop and an open pocket. The openness of the pocket is further supported by NMR hydrogen/deuterium exchange data and MD simulations. Additionally, the EphA5 LBD undergoes significant picosecond-nanosecond conformational exchanges over the loops, as revealed by NMR and MD simulations, but lacks global conformational exchanges on the microsecond-millisecond time scale. This is markedly different from the EphA4 LBD, which shares 74% sequence identity and 87% homology. Consequently, the unbound EphA5 LBD appears to comprise an ensemble of open conformations that have only small variations over the loops and appear ready to bind ephrin-A ligands. These findings show how two proteins with high sequence homology and structural similarity are still able to achieve distinctive binding specificities through different dynamics, which may represent a general mechanism whereby the same protein fold can serve for different functions. Our findings also suggest that a promising strategy to design agonists/antagonists with high affinity and selectivity might be to target specific dynamic states of the Eph receptor LBDs. PMID:24086308

Molecular modeling studies of HIV-1 reverse transcriptase nonnucleoside inhibitors: total energy of complexation as a predictor of drug placement and activity.

PubMed Central

Kroeger Smith, M. B.; Rouzer, C. A.; Taneyhill, L. A.; Smith, N. A.; Hughes, S. H.; Boyer, P. L.; Janssen, P. A.; Moereels, H.; Koymans, L.; Arnold, E.

1995-01-01

Computer modeling studies have been carried out on three nonnucleoside inhibitors complexed with human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT), using crystal coordinate data from a subset of the protein surrounding the binding pocket region. Results from the minimizations of solvated complexes of 2-cyclopropyl-4-methyl-5,11-dihydro-5H-dipyrido[3,2-b :2',3'-e][1,4] diazepin-6-one (nevirapine), alpha-anilino-2, 6-dibromophenylacetamide (alpha-APA), and 8-chloro-tetrahydro-imidazo(4,5,1-jk)(1,4)-benzodiazepin-2(1H)-thi one (TIBO) show that all three inhibitors maintain a very similar conformational shape, roughly overlay each other in the binding pocket, and appear to function as pi-electron donors to aromatic side-chain residues surrounding the pocket. However, side-chain residues adapt to each bound inhibitor in a highly specific manner, closing down around the surface of the drug to make tight van der Waals contacts. Consequently, the results from the calculated minimizations reveal that only when the inhibitors are modeled in a site constructed from coordinate data obtained from their particular RT complex can the calculated binding energies be relied upon to predict the correct orientation of the drug in the pocket. In the correct site, these binding energies correlate with EC50 values determined for all three inhibitors in our laboratory. Analysis of the components of the binding energy reveals that, for all three inhibitors, solvation of the drug is endothermic, but solvation of the protein is exothermic, and the sum favors complex formation. In general, the protein is energetically more stable and the drug less stable in their complexes as compared to the reactant conformations. For all three inhibitors, interaction with the protein in the complex is highly favorable. Interactions of the inhibitors with individual residues correlate with crystallographic and site-specific mutational data. pi-Stacking interactions are important in binding and correlate with drug HOMO RHF/6-31G* energies. Modeling results are discussed with respect to the mechanism of complex formation and the design of nonnucleoside inhibitors that will be more effective against mutants of HIV-1 RT that are resistant to the currently available drugs. PMID:8535257

Solution and fluorescence properties of symmetric dipicolylamine-containing dichlorofluorescein-based Zn2+ sensors.

PubMed

Wong, Brian A; Friedle, Simone; Lippard, Stephen J

2009-05-27

The mechanism by which dipicolylamine (DPA) chelate-appended fluorophores respond to zinc was investigated by the synthesis and study of five new analogues of the 2',7'-dichlorofluorescein-based Zn(2+) sensor Zinpyr-1 (ZP1). With the use of absorption and emission spectroscopy in combination with potentiometric titrations, a detailed molecular picture has emerged of the Zn(2+) and H(+) binding properties of the ZP1 family of sensors. The two separate N(3)O donor atom sets on ZP1 converge to form binding pockets in which all four heteroatoms participate in coordination to either Zn(2+) or protons. The position of the pyridyl group nitrogen atom, 2-pyridyl or 4-pyridyl, has a large impact on the fluorescence response of the dyes to protons despite relatively small changes in pK(a) values. The fluorescence quenching effects of such multifunctional electron-donating units are often taken as a whole. Despite the structural complexity of ZP1, however, we provide evidence that the pyridyl arms of the DPA appendages participate in the quenching process, in addition to the contribution from the tertiary nitrogen amine atom. Potentiometric titrations reveal ZP1 dissociation constants (K(d)) for Zn(2+) of 0.04 pM and 1.2 nM for binding to the first and second binding pockets of the ligand, respectively, the second of which correlates with the value observed by fluorescence titration. This result demonstrates that both binding pockets of this symmetric, ditopic sensor need to be occupied in order for full fluorescence turn-on to be achieved. These results have significant implications for the design and implementation of fluorescent sensors for studies of mobile zinc ions in biology.

The same pocket in menin binds both MLL and JUND but has opposite effects on transcription

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Jing; Gurung, Buddha; Wan, Bingbing

2013-04-08

Menin is a tumour suppressor protein whose loss or inactivation causes multiple endocrine neoplasia 1 (MEN1), a hereditary autosomal dominant tumour syndrome that is characterized by tumorigenesis in multiple endocrine organs. Menin interacts with many proteins and is involved in a variety of cellular processes. Menin binds the JUN family transcription factor JUND and inhibits its transcriptional activity. Several MEN1 missense mutations disrupt the menin-JUND interaction, suggesting a correlation between the tumour-suppressor function of menin and its suppression of JUND-activated transcription. Menin also interacts with mixed lineage leukaemia protein 1 (MLL1), a histone H3 lysine 4 methyltransferase, and functions asmore » an oncogenic cofactor to upregulate gene transcription and promote MLL1-fusion-protein-induced leukaemogenesis. A recent report on the tethering of MLL1 to chromatin binding factor lens epithelium-derived growth factor (LEDGF) by menin indicates that menin is a molecular adaptor coordinating the functions of multiple proteins. Despite its importance, how menin interacts with many distinct partners and regulates their functions remains poorly understood. Here we present the crystal structures of human menin in its free form and in complexes with MLL1 or with JUND, or with an MLL1-LEDGF heterodimer. These structures show that menin contains a deep pocket that binds short peptides of MLL1 or JUND in the same manner, but that it can have opposite effects on transcription. The menin-JUND interaction blocks JUN N-terminal kinase (JNK)-mediated JUND phosphorylation and suppresses JUND-induced transcription. In contrast, menin promotes gene transcription by binding the transcription activator MLL1 through the peptide pocket while still interacting with the chromatin-anchoring protein LEDGF at a distinct surface formed by both menin and MLL1.« less

The molecular basis of resilience to the effect of the Lys103Asn mutation in non-nucleoside HIV-1 reverse transcriptase inhibitors studied by targeted molecular dynamics simulations.

PubMed

Rodríguez-Barrios, Fátima; Balzarini, Jan; Gago, Federico

2005-05-25

A series of targeted molecular dynamics simulations have been carried out in an attempt to assess the effect that the common Lys103Asn mutation in HIV-1 reverse transcriptase (RT) has on the binding of three representative non-nucleoside RT inhibitors (NNRTI), nevirapine, efavirenz, and etravirine. We have shown previously that, in the absence of an incoming inhibitor, creation of the NNRTI binding pocket is hampered due to the existence of a hydrogen bond between the side chains of Asn103 and Tyr188 for which no equivalent exists in the wild-type enzyme. As an extension of this work, we now apply the same methodology to drive the enzyme's conformation from the unbound state to the drug-bound state in the presence of the NNRTI. The location of each drug outside the binding pocket was determined by an automated docking program, and steering into the binding pocket followed a route that is likely to represent the actual entrance pathway. The additional hurdle to inhibitor entry imposed by the extra Asn103-Tyr188 hydrogen bond is seen to affect each NNRTI differently, with the ability to disrupt this interaction increasing in the order etravirine > efavirenz > or = nevirapine, in good accord with the experimental findings. This coherent picture strongly suggests that attempts to overcome resistance through structure-based drug design may be considerably more successful if dynamic structural aspects of the type studied here are considered, particularly in cases where binding energy-based structure-activity relationship methods are unable to provide the required information.

Computational analysis of protein-protein interfaces involving an alpha helix: insights for terphenyl-like molecules binding.

PubMed

Isvoran, Adriana; Craciun, Dana; Martiny, Virginie; Sperandio, Olivier; Miteva, Maria A

2013-06-14

Protein-Protein Interactions (PPIs) are key for many cellular processes. The characterization of PPI interfaces and the prediction of putative ligand binding sites and hot spot residues are essential to design efficient small-molecule modulators of PPI. Terphenyl and its derivatives are small organic molecules known to mimic one face of protein-binding alpha-helical peptides. In this work we focus on several PPIs mediated by alpha-helical peptides. We performed computational sequence- and structure-based analyses in order to evaluate several key physicochemical and surface properties of proteins known to interact with alpha-helical peptides and/or terphenyl and its derivatives. Sequence-based analysis revealed low sequence identity between some of the analyzed proteins binding alpha-helical peptides. Structure-based analysis was performed to calculate the volume, the fractal dimension roughness and the hydrophobicity of the binding regions. Besides the overall hydrophobic character of the binding pockets, some specificities were detected. We showed that the hydrophobicity is not uniformly distributed in different alpha-helix binding pockets that can help to identify key hydrophobic hot spots. The presence of hydrophobic cavities at the protein surface with a more complex shape than the entire protein surface seems to be an important property related to the ability of proteins to bind alpha-helical peptides and low molecular weight mimetics. Characterization of similarities and specificities of PPI binding sites can be helpful for further development of small molecules targeting alpha-helix binding proteins.

Ancient Regulatory Role of Lysine Acetylation in Central Metabolism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakayasu, Ernesto S.; Burnet, Meagan C.; Walukiewicz, Hanna E.

ABSTRACT Lysine acetylation is a common protein post-translational modification in bacteria and eukaryotes. Unlike phosphorylation, whose functional role in signaling has been established, it is unclear what regulatory mechanism acetylation plays and whether it is conserved across evolution. By performing a proteomic analysis of 48 phylogenetically distant bacteria, we discovered conserved acetylation sites on catalytically essential lysine residues that are invariant throughout evolution. Lysine acetylation removes the residue’s charge and changes the shape of the pocket required for substrate or cofactor binding. Two-thirds of glycolytic and tricarboxylic acid (TCA) cycle enzymes are acetylated at these critical sites. Our data suggestmore » that acetylation may play a direct role in metabolic regulation by switching off enzyme activity. We propose that protein acetylation is an ancient and widespread mechanism of protein activity regulation. IMPORTANCEPost-translational modifications can regulate the activity and localization of proteins inside the cell. Similar to phosphorylation, lysine acetylation is present in both eukaryotes and prokaryotes and modifies hundreds to thousands of proteins in cells. However, how lysine acetylation regulates protein function and whether such a mechanism is evolutionarily conserved is still poorly understood. Here, we investigated evolutionary and functional aspects of lysine acetylation by searching for acetylated lysines in a comprehensive proteomic data set from 48 phylogenetically distant bacteria. We found that lysine acetylation occurs in evolutionarily conserved lysine residues in catalytic sites of enzymes involved in central carbon metabolism. Moreover, this modification inhibits enzymatic activity. Our observations suggest that lysine acetylation is an evolutionarily conserved mechanism of controlling central metabolic activity by directly blocking enzyme active sites.« less

Ancient Regulatory Role of Lysine Acetylation in Central Metabolism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakayasu, Ernesto S.; Burnet, Meagan C.; Walukiewicz, Hanna E.

ABSTRACT Lysine acetylation is a common protein post-translational modification in bacteria and eukaryotes. Unlike phosphorylation, whose functional role in signaling has been established, it is unclear what regulatory mechanism acetylation plays and whether it is conserved across evolution. By performing a proteomic analysis of 48 phylogenetically distant bacteria, we discovered conserved acetylation sites on catalytically essential lysine residues that are invariant throughout evolution. Lysine acetylation removes the residue’s charge and changes the shape of the pocket required for substrate or cofactor binding. Two-thirds of glycolytic and tricarboxylic acid (TCA) cycle enzymes are acetylated at these critical sites. Our data suggestmore » that acetylation may play a direct role in metabolic regulation by switching off enzyme activity. We propose that protein acetylation is an ancient and widespread mechanism of protein activity regulation. IMPORTANCE Post-translational modifications can regulate the activity and localization of proteins inside the cell. Similar to phosphorylation, lysine acetylation is present in both eukaryotes and prokaryotes and modifies hundreds to thousands of proteins in cells. However, how lysine acetylation regulates protein function and whether such a mechanism is evolutionarily conserved is still poorly understood. Here, we investigated evolutionary and functional aspects of lysine acetylation by searching for acetylated lysines in a comprehensive proteomic data set from 48 phylogenetically distant bacteria. We found that lysine acetylation occurs in evolutionarily conserved lysine residues in catalytic sites of enzymes involved in central carbon metabolism. Moreover, this modification inhibits enzymatic activity. Our observations suggest that lysine acetylation is an evolutionarily conserved mechanism of controlling central metabolic activity by directly blocking enzyme active sites.« less

Ancient Regulatory Role of Lysine Acetylation in Central Metabolism

DOE PAGES

Nakayasu, Ernesto S.; Burnet, Meagan C.; Walukiewicz, Hanna E.; ...

2017-11-28

ABSTRACT Lysine acetylation is a common protein post-translational modification in bacteria and eukaryotes. Unlike phosphorylation, whose functional role in signaling has been established, it is unclear what regulatory mechanism acetylation plays and whether it is conserved across evolution. By performing a proteomic analysis of 48 phylogenetically distant bacteria, we discovered conserved acetylation sites on catalytically essential lysine residues that are invariant throughout evolution. Lysine acetylation removes the residue’s charge and changes the shape of the pocket required for substrate or cofactor binding. Two-thirds of glycolytic and tricarboxylic acid (TCA) cycle enzymes are acetylated at these critical sites. Our data suggestmore » that acetylation may play a direct role in metabolic regulation by switching off enzyme activity. We propose that protein acetylation is an ancient and widespread mechanism of protein activity regulation. IMPORTANCE Post-translational modifications can regulate the activity and localization of proteins inside the cell. Similar to phosphorylation, lysine acetylation is present in both eukaryotes and prokaryotes and modifies hundreds to thousands of proteins in cells. However, how lysine acetylation regulates protein function and whether such a mechanism is evolutionarily conserved is still poorly understood. Here, we investigated evolutionary and functional aspects of lysine acetylation by searching for acetylated lysines in a comprehensive proteomic data set from 48 phylogenetically distant bacteria. We found that lysine acetylation occurs in evolutionarily conserved lysine residues in catalytic sites of enzymes involved in central carbon metabolism. Moreover, this modification inhibits enzymatic activity. Our observations suggest that lysine acetylation is an evolutionarily conserved mechanism of controlling central metabolic activity by directly blocking enzyme active sites.« less

Different inhibitory potency of febuxostat towards mammalian and bacterial xanthine oxidoreductases: insight from molecular dynamics

PubMed Central

Kikuchi, Hiroto; Fujisaki, Hiroshi; Furuta, Tadaomi; Okamoto, Ken; Leimkühler, Silke; Nishino, Takeshi

2012-01-01

Febuxostat, a drug recently approved in the US, European Union and Japan for treatment of gout, inhibits xanthine oxidoreductase (XOR)-mediated generation of uric acid during purine catabolism. It inhibits bovine milk XOR with a Ki in the picomolar-order, but we found that it is a much weaker inhibitor of Rhodobacter capsulatus XOR, even though the substrate-binding pockets of mammalian and bacterial XOR are well-conserved as regards to catalytically important residues and three-dimensional structure, and both permit the inhibitor to be accommodated in the active site, as indicated by computational docking studies. To clarify the reason for the difference of inhibitory potency towards the two XORs, we performed molecular dynamics simulations. The results indicate that differences in mobility of hydrophobic residues that do not directly interact with the substrate account for the difference in inhibitory potency. PMID:22448318

Augmenting β-augmentation: structural basis of how BamB binds BamA and may support folding of outer membrane proteins.

PubMed

Heuck, Alexander; Schleiffer, Alexander; Clausen, Tim

2011-03-11

β-Barrel proteins are frequently found in the outer membrane of mitochondria, chloroplasts and Gram-negative bacteria. In Escherichia coli, these proteins are inserted in the outer membrane by the Bam (β-barrel assembly machinery) complex, a multiprotein machinery formed by the β-barrel protein BamA and the four peripheral membrane proteins BamB, BamC, BamD and BamE. The periplasmic part of BamA binds prefolded β-barrel proteins by a β-augmentation mechanism, thereby stabilizing the precursors prior to their membrane insertion. However, the role of the associated proteins within the Bam complex remains unknown. Here, we describe the crystal structure of BamB, a nonessential component of the Bam complex. The structure shows a typical eight-bladed β-propeller fold. Two sequence stretches of BamB were previously identified to be important for interaction with BamA. In our structure, both motifs are located in close proximity to each other and contribute to a conserved region forming a narrow groove on the top of the propeller. Moreover, crystal contacts reveal two interaction modes of how BamB might bind unfolded β-barrel proteins. In the crystal lattice, BamB binds to exposed β-strands by β-augmentation, whereas peptide stretches rich in aromatic residues can be accommodated in hydrophobic pockets located at the bottom of the propeller. Thus, BamB could simultaneously bind to BamA and prefolded β-barrel proteins, thereby enhancing the folding and membrane insertion capability of the Bam complex. Copyright © 2011 Elsevier Ltd. All rights reserved.

X-ray crystal structures of the pheromone-binding domains of two quorum-hindered transcription factors, YenR of Yersinia enterocolitica and CepR2 of Burkholderia cenocepacia: KIM et al.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Youngchang; Chhor, Gekleng; Tsai, Ching-Sung

The ability of LuxR-type proteins to regulate transcription is controlled by bacterial pheromones, N-acylhomoserine lactones (AHLs). Most LuxR-family proteins require their cognate AHLs for activity, and some of them require AHLs for folding and stability, and for protease-resistance. However, a few members of this family are able to fold, dimerize, bind DNA, and regulate transcription in the absence of AHLs; moreover, these proteins are antagonized by their cognate AHLs. One such protein is YenR of Yersinia enterocolitica, which is antagonized by N-3-oxohexanoyl-l-homoserine lactone (OHHL). This pheromone is produced by the OHHL synthase, a product of the adjacent yenI gene. Anothermore » example is CepR2 of Burkholderia cenocepacia, which is antagonized by N-octanoyl-l-homoserine lactone (OHL), whose synthesis is directed by the cepI gene of the same bacterium. Here, we describe the high-resolution crystal structures of the AHL binding domains of YenR and CepR2. YenR was crystallized in the presence and absence of OHHL. While this ligand does not cause large scale changes in the YenR structure, it does alter the orientation of several highly conserved YenR residues within and near the pheromone-binding pocket, which in turn caused a significant movement of a surface-exposed loop.« less

Replacing Arginine 33 for Alanine in the Hemophore HasA from Pseudomonas aeruginosa Causes Closure of the H32 Loop in the Apo-Protein

PubMed Central

Kumar, Ritesh; Qi, Yifei; Matsumura, Hirotoshi; Lovell, Scott; Yao, Huili; Battaile, Kevin P.; Im, Wonpil; Moënne-Loccoz, Pierre; Rivera, Mario

2017-01-01

Previous characterization of hemophores from Serratia marcescens (HasAs), Pseudomonas aeruginosa (HasAp) and Yersinia pestis (HasAyp) showed that hemin binds between two loops, where it is axially coordinated by H32 and Y75. The Y75 loop is structurally conserved in all three hemophores and harbors conserved ligand Y75. The other loop contains H32 in HasAs and HasAp, but a noncoordinating Q32 in HasAyp. The H32 loop in apo-HasAs and apo-HasAp is in an open conformation, which places H32 about 30 Å from the hemin-binding site. Hence, hemin binding onto the Y75 loop of HasAs or HasAp triggers a large relocation of the H32 loop from an open- to a closed-loop conformation and enables coordination of the hemin-iron by H32. In comparison, the Q32 loop in apo-HasAyp is in the closed conformation and hemin binding occurs with minimal reorganization and without coordinative interactions with the Q32 loop. Studies in crystallo and in solution have established that the open H32 loop in apo-HasAp and apo-HasAs is well structured and minimally affected by conformational dynamics. In this study we address the intriguing issue of the stability of the H32 loop in apo-HasAp and how hemin binding triggers its relocation. We address this question with a combination of NMR spectroscopy, X-ray crystallography, and molecular dynamics simulations and find that R33 is critical to the stability of the open H32 loop. Replacing R33 with A causes the H32 loop in R33A apo-HasAp to adopt a conformation similar to that of holo-HasAp. Finally, stopped-flow absorption and resonance Raman analyses of hemin binding to apo-R33A HasAp indicates that the closed H32 loop slows down the insertion of the heme inside the binding pocket, presumably as it obstructs access to the hydrophobic platform on the Y75 loop, but accelerate the completion of the heme iron coordination. PMID:27074415

In silico studies and fluorescence binding assays of potential anti-prion compounds reveal an important binding site for prion inhibition from PrP(C) to PrP(Sc).

PubMed

Pagadala, Nataraj S; Perez-Pineiro, Rolando; Wishart, David S; Tuszynski, Jack A

2015-02-16

To understand the pharmacophore properties of 2-aminothiazoles and design novel inhibitors against the prion protein, a highly predictive 3D quantitative structure-activity relationship (QSAR) has been developed by performing comparative molecular field analysis (CoMFA) and comparative similarity analysis (CoMSIA). Both CoMFA and CoMSIA maps reveal the presence of the oxymethyl groups in meta and para positions on the phenyl ring of compound 17 (N-[4-(3,4-dimethoxyphenyl)-1,3-thiazol-2-yl]quinolin-2-amine), is necessary for activity while electro-negative nitrogen of quinoline is highly favorable to enhance activity. The blind docking results for these compounds show that the compound with quinoline binds with higher affinity than isoquinoline and naphthalene groups. Out of 150 novel compounds retrieved using finger print analysis by pharmacophoric model predicted based on five test sets of compounds, five compounds with diverse scaffolds were selected for biological evaluation as possible PrP inhibitors. Molecular docking combined with fluorescence quenching studies show that these compounds bind to pocket-D of SHaPrP near Trp145. The new antiprion compounds 3 and 6, which bind with the interaction energies of -12.1 and -13.2 kcal/mol, respectively, show fluorescence quenching with binding constant (Kd) values of 15.5 and 44.14 μM, respectively. Further fluorescence binding assays with compound 5, which is similar to 2-aminothiazole as a positive control, also show that the molecule binds to the pocket-D with the binding constant (Kd) value of 84.7 μM. Finally, both molecular docking and a fluorescence binding assay of noscapine as a negative control reveals the same binding site on the surface of pocket-A near a rigid loop between β2 and α2 interacting with Arg164. This high level of correlation between molecular docking and fluorescence quenching studies confirm that these five compounds are likely to act as inhibitors for prion propagation while noscapine might act as a prion accelerator from PrP(C) to PrP(Sc). Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Fragment-based lead generation: identification of seed fragments by a highly efficient fragment screening technology

NASA Astrophysics Data System (ADS)

Neumann, Lars; Ritscher, Allegra; Müller, Gerhard; Hafenbradl, Doris

2009-08-01

For the detection of the precise and unambiguous binding of fragments to a specific binding site on the target protein, we have developed a novel reporter displacement binding assay technology. The application of this technology for the fragment screening as well as the fragment evolution process with a specific modelling based design strategy is demonstrated for inhibitors of the protein kinase p38alpha. In a fragment screening approach seed fragments were identified which were then used to build compounds from the deep-pocket towards the hinge binding area of the protein kinase p38alpha based on a modelling approach. BIRB796 was used as a blueprint for the alignment of the fragments. The fragment evolution of these deep-pocket binding fragments towards the fully optimized inhibitor BIRB796 included the modulation of the residence time as well as the affinity. The goal of our study was to evaluate the robustness and efficiency of our novel fragment screening technology at high fragment concentrations, compare the screening data with biochemical activity data and to demonstrate the evolution of the hit fragments with fast kinetics, into slow kinetic inhibitors in an in silico approach.

ATRX ADD domain links an atypical histone methylation recognition mechanism to human mental-retardation syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Iwase, Shigeki; Xiang, Bin; Ghosh, Sharmistha

ATR-X (alpha-thalassemia/mental retardation, X-linked) syndrome is a human congenital disorder that causes severe intellectual disabilities. Mutations in the ATRX gene, which encodes an ATP-dependent chromatin-remodeler, are responsible for the syndrome. Approximately 50% of the missense mutations in affected persons are clustered in a cysteine-rich domain termed ADD (ATRX-DNMT3-DNMT3L, ADD{sub ATRX}), whose function has remained elusive. Here we identify ADD{sub ATRX} as a previously unknown histone H3-binding module, whose binding is promoted by lysine 9 trimethylation (H3K9me3) but inhibited by lysine 4 trimethylation (H3K4me3). The cocrystal structure of ADD{sub ATRX} bound to H3{sub 1-15}K9me3 peptide reveals an atypical composite H3K9me3-binding pocket,more » which is distinct from the conventional trimethyllysine-binding aromatic cage. Notably, H3K9me3-pocket mutants and ATR-X syndrome mutants are defective in both H3K9me3 binding and localization at pericentromeric heterochromatin; thus, we have discovered a unique histone-recognition mechanism underlying the ATR-X etiology.« less

ATRX ADD Domain Links an Atypical Histone Methylation Recognition Mechanism to Human Mental-Retardation Syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

S Iwase; B Xiang; S Ghosh

ATR-X (alpha-thalassemia/mental retardation, X-linked) syndrome is a human congenital disorder that causes severe intellectual disabilities. Mutations in the ATRX gene, which encodes an ATP-dependent chromatin-remodeler, are responsible for the syndrome. Approximately 50% of the missense mutations in affected persons are clustered in a cysteine-rich domain termed ADD (ATRX-DNMT3-DNMT3L, ADD{sub ATRX}), whose function has remained elusive. Here we identify ADD{sub ATRX} as a previously unknown histone H3-binding module, whose binding is promoted by lysine 9 trimethylation (H3K9me3) but inhibited by lysine 4 trimethylation (H3K4me3). The cocrystal structure of ADD{sub ATRX} bound to H3{sub 1-15}K9me3 peptide reveals an atypical composite H3K9me3-binding pocket,more » which is distinct from the conventional trimethyllysine-binding aromatic cage. Notably, H3K9me3-pocket mutants and ATR-X syndrome mutants are defective in both H3K9me3 binding and localization at pericentromeric heterochromatin; thus, we have discovered a unique histone-recognition mechanism underlying the ATR-X etiology.« less

Structural Transformation Detection Contributes to Screening of Behaviorally Active Compounds: Dynamic Binding Process Analysis of DhelOBP21 from Dastarcus helophoroides.

PubMed

Yang, Rui-Nan; Li, Dong-Zhen; Yu, Guangqiang; Yi, Shan-Cheng; Zhang, Yinan; Kong, De-Xin; Wang, Man-Qun

2017-12-01

In light of reverse chemical ecology, the fluorescence competitive binding assays of functional odorant binding proteins (OBPs) is a recent advanced approach for screening behaviorally active compounds of insects. Previous research on Dastareus helophoroides identified a minus-C OBP, DhelOBP21, which preferably binds to several ligands. In this study, only (+)-β-pinene proved attractive to unmated adult beetles. To obtain a more in-depth explanation of the lack of behavioral activity of other ligands we selected compounds with high (camphor) and low (β-caryophyllene) binding affinities. The structural transformation of OBPs was investigated using well-established approaches for studying binding processes, such as fluorescent quenching assays, circular dichroism, and molecular dynamics. The dynamic binding process revealed that the flexibility of DhelOBP21 seems conducive to binding specific ligands, as opposed to broad substrate binding. The compound (+)-β-pinene and DhelOBP21 formed a stable complex through a secondary structural transformation of DhelOBP21, in which its amino-terminus transformed from random coil to an α-helix to cover the binding pocket. On the other hand, camphor could not efficiently induce a stable structural transformation, and its high binding affinities were due to strong hydrogen-bonding, compromising the structure of the protein. The other compound, β-caryophyllene, only collided with DhelOBP21 and could not be positioned in the binding pocket. Studying structural transformation of these proteins through examining the dynamic binding process rather than using approaches that just measure binding affinities such as fluorescence competitive binding assays can provide a more efficient and reliable approach for screening behaviorally active compounds.

The CD1 family: serving lipid antigens to T cells since the Mesozoic era.

PubMed

Zajonc, Dirk M

2016-08-01

Class I-like CD1 molecules are in a family of antigen-presenting molecules that bind lipids and lipopeptides, rather than peptides for immune surveillance by T cells. Since CD1 lacks the high degree of polymorphism found in their major histocompatibility complex (MHC) class I molecules, different species express different numbers of CD1 isotypes, likely to be able to present structurally diverse classes of lipid antigens. In this review, we will present a historical overview of the structures of the different human CD1 isotypes and also discuss species-specific adaptations of the lipid-binding groove. We will discuss how single amino acid changes alter the shape and volume of the CD1 binding groove, how these minor changes can give rise to different numbers of binding pockets, and how these pockets affect the lipid repertoire that can be presented by any given CD1 protein. We will compare the structures of various lipid antigens and finally, we will discuss recognition of CD1-presented lipid antigens by antigen receptors on T cells (TCRs).

Kuwanon-L as a New Allosteric HIV-1 Integrase Inhibitor: Molecular Modeling and Biological Evaluation.

PubMed

Esposito, Francesca; Tintori, Cristina; Martini, Riccardo; Christ, Frauke; Debyser, Zeger; Ferrarese, Roberto; Cabiddu, Gianluigi; Corona, Angela; Ceresola, Elisa Rita; Calcaterra, Andrea; Iovine, Valentina; Botta, Bruno; Clementi, Massimo; Canducci, Filippo; Botta, Maurizio; Tramontano, Enzo

2015-11-01

HIV-1 integrase (IN) active site inhibitors are the latest class of drugs approved for HIV treatment. The selection of IN strand-transfer drug-resistant HIV strains in patients supports the development of new agents that are active as allosteric IN inhibitors. Here, a docking-based virtual screening has been applied to a small library of natural ligands to identify new allosteric IN inhibitors that target the sucrose binding pocket. From theoretical studies, kuwanon-L emerged as the most promising binder and was thus selected for biological studies. Biochemical studies showed that kuwanon-L is able to inhibit the HIV-1 IN catalytic activity in the absence and in the presence of LEDGF/p75 protein, the IN dimerization, and the IN/LEDGF binding. Kuwanon-L also inhibited HIV-1 replication in cell cultures. Overall, docking and biochemical results suggest that kuwanon-L binds to an allosteric binding pocket and can be considered an attractive lead for the development of new allosteric IN antiviral agents. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The CD1 family: serving lipid antigens to T cells since the Mesozoic era

PubMed Central

Zajonc, Dirk M.

2016-01-01

Class I-like CD1 molecules are in a family of antigen-presenting molecules that bind lipids and lipopeptides, rather than peptides for immune surveillance by T cells. Since CD1 lacks the high degree of polymorphism found in their major histocompatibility complex (MHC) class I molecules, different species express different numbers of CD1 isotypes, likely to be able to present structurally diverse classes of lipid antigens. In this review, we will present a historical overview of the structures of the different human CD1 isotypes and also discuss species-specific adaptations of the lipid-binding groove. We will discuss how single amino acid changes alter the shape and volume of the CD1 binding groove, how these minor changes can give rise to different numbers of binding pockets, and how these pockets affect the lipid repertoire that can be presented by any given CD1 protein. We will compare the structures of various lipid antigens and finally, we will discuss recognition of CD1-presented lipid antigens by antigen receptors on T cells (TCRs). PMID:27368414

Structural Basis for Specific Inhibition of tRNA Synthetase by an ATP Competitive Inhibitor.

PubMed

Fang, Pengfei; Han, Hongyan; Wang, Jing; Chen, Kaige; Chen, Xin; Guo, Min

2015-06-18

Pharmaceutical inhibitors of aminoacyl-tRNA synthetases demand high species and family specificity. The antimalarial ATP-mimetic cladosporin selectively inhibits Plasmodium falciparum LysRS (PfLysRS). How the binding to a universal ATP site achieves the specificity is unknown. Here we report three crystal structures of cladosporin with human LysRS, PfLysRS, and a Pf-like human LysRS mutant. In all three structures, cladosporin occupies the class defining ATP-binding pocket, replacing the adenosine portion of ATP. Three residues holding the methyltetrahydropyran moiety of cladosporin are critical for the specificity of cladosporin against LysRS over other class II tRNA synthetase families. The species-exclusive inhibition of PfLysRS is linked to a structural divergence beyond the active site that mounts a lysine-specific stabilizing response to binding cladosporin. These analyses reveal that inherent divergence of tRNA synthetase structural assembly may allow for highly specific inhibition even through the otherwise universal substrate binding pocket and highlight the potential for structure-driven drug development. Copyright © 2015 Elsevier Ltd. All rights reserved.

Identification and Structure-Activity Relationship of HDAC6 Zinc-Finger Ubiquitin Binding Domain Inhibitors.

PubMed

Ferreira de Freitas, Renato; Harding, Rachel J; Franzoni, Ivan; Ravichandran, Mani; Mann, Mandeep K; Ouyang, Hui; Lautens, Mark; Santhakumar, Vijayaratnam; Arrowsmith, Cheryl H; Schapira, Matthieu

2018-05-24

HDAC6 plays a central role in the recruitment of protein aggregates for lysosomal degradation and is a promising target for combination therapy with proteasome inhibitors in multiple myeloma. Pharmacologically displacing ubiquitin from the zinc-finger ubiquitin-binding domain (ZnF-UBD) of HDAC6 is an underexplored alternative to catalytic inhibition. Here, we present the discovery of an HDAC6 ZnF-UBD-focused chemical series and its progression from virtual screening hits to low micromolar inhibitors. A carboxylate mimicking the C-terminal extremity of ubiquitin, and an extended aromatic system stacking with W1182 and R1155, are necessary for activity. One of the compounds induced a conformational remodeling of the binding site where the primary binding pocket opens up onto a ligand-able secondary pocket that may be exploited to increase potency. The preliminary structure-activity relationship accompanied by nine crystal structures should enable further optimization into a chemical probe to investigate the merit of targeting the ZnF-UBD of HDAC6 in multiple myeloma and other diseases.

Crystallographic Study of a Novel Sub-Nanomolar Inhibitor Provides Insight on the Binding Interactions of Alkenyldiarylmethanes with Human Immunodeficiency Virus-1 (HIV-1) Reverse Transcriptase†

PubMed Central

Cullen, Matthew D.; Ho, William C.; Bauman, Joseph D.; Das, Kalyan; Arnold, Eddy; Hartman, Tracy L.; Watson, Karen M.; Buckheit, Robert W.; Pannecouque, Christophe; De Clercq, Erik; Cushman, Mark

2009-01-01

Two crystal structures have been solved for separate complexes of alkenyldiarylmethane (ADAM) non-nucleoside reverse transcriptase inhibitors (NNRTI) 3 and 4 with HIV-1 reverse transcriptase (RT). The structures reveal inhibitor binding is exclusively hydrophobic in nature and the shape of the inhibitor-bound NNRTI binding pocket is unique among other reported inhibitor-RT crystal structures. Primarily, ADAMs 3 and 4 protrude from a large gap in the backside of the binding pocket, placing portions of the inhibitors unusually close to the polymerase active site and allowing 3 to form a weak hydrogen bond with Lys223. The lack of additional stabilizing interactions, beyond the observed hydrophobic surface contacts, between 4 and RT is quite perplexing given the extreme potency of the compound (IC50 ≤ nM). ADAM 4 was designed to be hydrolytically stable in blood plasma, and an investigation of its hydrolysis in rat plasma demonstrated it has a significantly prolonged half-life in comparison to ADAM lead compounds 1 and 2. PMID:19775161

Unbinding Pathways of an Agonist and an Antagonist from the 5-HT3 Receptor

PubMed Central

Thompson, A. J.; Chau, P.-L.; Chan, S. L.; Lummis, S. C. R.

2006-01-01

The binding sites of 5-HT3 and other Cys-loop receptors have been extensively studied, but there are no data on the entry and exit routes of ligands for these sites. Here we have used molecular dynamics simulations to predict the pathway for agonists and antagonists exiting from the 5-HT3 receptor binding site. The data suggest that the unbinding pathway follows a tunnel at the interface of two subunits, which is ∼8 Å long and terminates ∼20 Å above the membrane. The exit routes for an agonist (5-HT) and an antagonist (granisetron) were similar, with trajectories toward the membrane and outward from the ligand binding site. 5-HT appears to form many hydrogen bonds with residues in the unbinding pathway, and experiments show that mutating these residues significantly affects function. The location of the pathway is also supported by docking studies of granisetron, which show a potential binding site for granisetron on the unbinding route. We propose that leaving the binding pocket along this tunnel places the ligands close to the membrane and prevents their immediate reentry into the binding pocket. We anticipate similar exit pathways for other members of the Cys-loop receptor family. PMID:16387779

Steric and thermodynamic limits of design for the incorporation of large unnatural amino acids in aminoacyl-tRNA synthetase enzymes.

PubMed

Armen, Roger S; Schiller, Stefan M; Brooks, Charles L

2010-06-01

Orthogonal aminoacyl-tRNA synthetase/tRNA pairs from archaea have been evolved to facilitate site specific in vivo incorporation of unnatural amino acids into proteins in Escherichia coli. Using this approach, unnatural amino acids have been successfully incorporated with high translational efficiency and fidelity. In this study, CHARMM-based molecular docking and free energy calculations were used to evaluate rational design of specific protein-ligand interactions for aminoacyl-tRNA synthetases. A series of novel unnatural amino acid ligands were docked into the p-benzoyl-L-phenylalanine tRNA synthetase, which revealed that the binding pocket of the enzyme does not provide sufficient space for significantly larger ligands. Specific binding site residues were mutated to alanine to create additional space to accommodate larger target ligands, and then mutations were introduced to improve binding free energy. This approach was used to redesign binding sites for several different target ligands, which were then tested against the standard 20 amino acids to verify target specificity. Only the synthetase designed to bind Man-alpha-O-Tyr was predicted to be sufficiently selective for the target ligand and also thermodynamically stable. Our study suggests that extensive redesign of the tRNA synthatase binding pocket for large bulky ligands may be quite thermodynamically unfavorable.

Theoretical studies on beta and delta isoform-specific binding mechanisms of phosphoinositide 3-kinase inhibitors.

PubMed

Zhu, Jingyu; Pan, Peichen; Li, Youyong; Wang, Man; Li, Dan; Cao, Biyin; Mao, Xinliang; Hou, Tingjun

2014-03-04

Phosphoinositide 3-kinase (PI3K) is known to be closely related to tumorigenesis and cell proliferation, and controls a variety of cellular processes, including proliferation, growth, apoptosis, migration, metabolism, etc. The PI3K family comprises eight catalytic isoforms, which are subdivided into three classes. Recently, the discovery of inhibitors that block a single isoform of PI3K has continued to attract special attention because they may have higher selectivity for certain tumors and less toxicity for healthy cells. The PI3Kβ and PI3Kδ share fewer studies than α/γ, and therefore, in this work, the combination of molecular dynamics simulations and free energy calculations was employed to explore the binding of three isoform-specific PI3K inhibitors (COM8, IC87114, and GDC-0941) to PI3Kβ or PI3Kδ. The isoform specificities of the studied inhibitors derived from the predicted binding free energies are in good agreement with the experimental data. In addition, the key residues critical for PI3Kβ or PI3Kδ selectivity were highlighted by decomposing the binding free energies into the contributions from individual residues. It was observed that although PI3Kβ and PI3Kδ share the conserved ATP-binding pockets, individual residues do behave differently, particularly the residues critical for PI3Kβ or PI3Kδ selectivity. It can be concluded that the inhibitor specificity between PI3Kβ and PI3Kδ is determined by the additive contributions from multiple residues, not just a single one. This study provides valuable information for understanding the isoform-specific binding mechanisms of PI3K inhibitors, and should be useful for the rational design of novel and selective PI3K inhibitors.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adhikary, Suraj; Eichman, Brandt F.

DNA glycosylases specialized for the repair of alkylation damage must identify, with fine specificity, a diverse array of subtle modifications within DNA. The current mechanism involves damage sensing through interrogation of the DNA duplex, followed by more specific recognition of the target base inside the active site pocket. To better understand the physical basis for alkylpurine detection, we determined the crystal structure of Schizosaccharomyces pombe Mag1 (spMag1) in complex with DNA and performed a mutational analysis of spMag1 and the close homologue from Saccharomyces cerevisiae (scMag). Despite strong homology, spMag1 and scMag differ in substrate specificity and cellular alkylation sensitivity,more » although the enzymological basis for their functional differences is unknown. We show that Mag preference for 1,N{sup 6}-ethenoadenine ({var_epsilon}A) is influenced by a minor groove-interrogating residue more than the composition of the nucleobase-binding pocket. Exchanging this residue between Mag proteins swapped their {var_epsilon}A activities, providing evidence that residues outside the extrahelical base-binding pocket have a role in identification of a particular modification in addition to sensing damage.« less

A microbial sensor for organophosphate hydrolysis exploiting an engineered specificity switch in a transcription factor

DOE PAGES

Jha, Ramesh K.; Kern, Theresa L.; Kim, Youngchang; ...

2016-08-30

A whole-cell biosensor utilizing a transcription factor (TF) is an effective tool for sensitive and selective detection of specialty chemicals or anthropogenic molecules, but requires an access to an expanded repertoire of TFs. Using ligand docked homology models for binding pocket identification, assisted by conservative mutations in the pocket, we engineered a novel specificity in an Acinetobacter TF, PobR, to ‘sense’ a chemical p-nitrophenol (pNP) and measured the response via a fluorescent protein reporter expressed from a PobR promoter. Out of 10 7 variants of PobR, four were active when pNP was added as an inducer, with two mutants showingmore » a specificity switch from the native effector 4-hydroxybenzoate (4HB). One of the mutants, pNPmut1 was then used to create a smart microbial cell responding to pNP production and detect hydrolysis of an insecticide, paraoxon, in a coupled assay involving phosphotriesterase (PTE) enzyme expressed from a separate promoter. We show that the fluorescence of the cells correlated with the catalytic efficiency of PTE variants, each cell expressed. High selectivity for similar molecules (4HB vs pNP), high sensitivity for pNP detection (~2 μM) and agreement of apo- and holo- structures of PobR scaffold with computational models are notable successes presented in this work.« less

Evidence that Chemical Chaperone 4-Phenylbutyric Acid Binds to Human Serum Albumin at Fatty Acid Binding Sites

PubMed Central

James, Joel; Shihabudeen, Mohamed Sham; Kulshrestha, Shweta; Goel, Varun; Thirumurugan, Kavitha

2015-01-01

Endoplasmic reticulum stress elicits unfolded protein response to counteract the accumulating unfolded protein load inside a cell. The chemical chaperone, 4-Phenylbutyric acid (4-PBA) is a FDA approved drug that alleviates endoplasmic reticulum stress by assisting protein folding. It is found efficacious to augment pathological conditions like type 2 diabetes, obesity and neurodegeneration. This study explores the binding nature of 4-PBA with human serum albumin (HSA) through spectroscopic and molecular dynamics approaches, and the results show that 4-PBA has high binding specificity to Sudlow Site II (Fatty acid binding site 3, subdomain IIIA). Ligand displacement studies, RMSD stabilization profiles and MM-PBSA binding free energy calculation confirm the same. The binding constant as calculated from fluorescence spectroscopic studies was found to be kPBA = 2.69 x 105 M-1. Like long chain fatty acids, 4-PBA induces conformational changes on HSA as shown by circular dichroism, and it elicits stable binding at Sudlow Site II (fatty acid binding site 3) by forming strong hydrogen bonding and a salt bridge between domain II and III of HSA. This minimizes the fluctuation of HSA backbone as shown by limited conformational space occupancy in the principal component analysis. The overall hydrophobicity of W214 pocket (located at subdomain IIA), increases upon occupancy of 4-PBA at any FA site. Descriptors of this pocket formed by residues from other subdomains largely play a role in compensating the dynamic movement of W214. PMID:26181488

Structure-Guided Design of a High-Affinity Platelet Integrin αIIbβ3 Receptor Antagonist That Disrupts Mg2+ Binding to the MIDAS | Center for Cancer Research

Cancer.gov

A Better Fit. An improved anticoagulant drug called RUC-2 (ball and stick structure) fits snugly into its binding pocket on integrin (blue), a protein found on the surface of platelets. RUC-2 binds both subunits of integrin, inhibiting the excessive blood coagulation that can lead to strokes and heart attacks. Unlike similar drugs that alter integrin's structure when they bind

Grounds Conservation Management Plan (1982-1991), Fish and Wildlife Management Plan (1982-1991), Forest Resource Management Plan (1979-1988).

DTIC Science & Technology

1985-06-01

necessary for complete control. The third weed group includes purslane , spotted spurge and knotweed. These weeds may be controlled with dicamba. [j 4...of marsh communities varies with salinity gradients fron brackish to fresh waters. Hideaway Pond has a completely fresh water marsh (no tidal...or pocket marshes convolute the shoreline of Tetotum Flats along Upper Machodoc Creek. Species composition varies with salinity and those pockets

Evolutionary history of versatile-lipases from Agaricales through reconstruction of ancestral structures.

PubMed

Barriuso, Jorge; Martínez, María Jesús

2017-01-03

Fungal "Versatile carboxylic ester hydrolases" are enzymes with great biotechnological interest. Here we carried out a bioinformatic screening to find these proteins in genomes from Agaricales, by means of searching for conserved motifs, sequence and phylogenetic analysis, and three-dimensional modeling. Moreover, we reconstructed the molecular evolution of these enzymes along the time by inferring and analyzing the sequence of ancestral intermediate forms. The properties of the ancestral candidates are discussed on the basis of their three-dimensional structural models, the hydrophobicity of the lid, and the substrate binding intramolecular tunnel, revealing all of them featured properties of these enzymes. The evolutionary history of the putative lipases revealed an increase on the length and hydrophobicity of the lid region, as well as in the size of the substrate binding pocket, during evolution time. These facts suggest the enzymes' specialization towards certain substrates and their subsequent loss of promiscuity. These results bring to light the presence of different pools of lipases in fungi with different habitats and life styles. Despite the consistency of the data gathered from reconstruction of ancestral sequences, the heterologous expression of some of these candidates would be essential to corroborate enzymes' activities.