Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)
Das, Sourav; Kokardekar, Arshad
2009-01-01
Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089
Evolutionary and biophysical relationships among the papillomavirus E2 proteins.
Blakaj, Dukagjin M; Fernandez-Fuentes, Narcis; Chen, Zigui; Hegde, Rashmi; Fiser, Andras; Burk, Robert D; Brenowitz, Michael
2009-01-01
Infection by human papillomavirus (HPV) may result in clinical conditions ranging from benign warts to invasive cancer. The HPV E2 protein represses oncoprotein transcription and is required for viral replication. HPV E2 binds to palindromic DNA sequences of highly conserved four base pair sequences flanking an identical length variable 'spacer'. E2 proteins directly contact the conserved but not the spacer DNA. Variation in naturally occurring spacer sequences results in differential protein affinity that is dependent on their sensitivity to the spacer DNA's unique conformational and/or dynamic properties. This article explores the biophysical character of this core viral protein with the goal of identifying characteristics that associated with risk of virally caused malignancy. The amino acid sequence, 3d structure and electrostatic features of the E2 protein DNA binding domain are highly conserved; specific interactions with DNA binding sites have also been conserved. In contrast, the E2 protein's transactivation domain does not have extensive surfaces of highly conserved residues. Rather, regions of high conservation are localized to small surface patches. Implications to cancer biology are discussed.
Mapping Interaction Sites on Human Chemokine Receptors by Deep Mutational Scanning.
Heredia, Jeremiah D; Park, Jihye; Brubaker, Riley J; Szymanski, Steven K; Gill, Kevin S; Procko, Erik
2018-06-01
Chemokine receptors CXCR4 and CCR5 regulate WBC trafficking and are engaged by the HIV-1 envelope glycoprotein gp120 during infection. We combine a selection of human CXCR4 and CCR5 libraries comprising nearly all of ∼7000 single amino acid substitutions with deep sequencing to define sequence-activity landscapes for surface expression and ligand interactions. After consideration of sequence constraints for surface expression, known interaction sites with HIV-1-blocking Abs were appropriately identified as conserved residues following library sorting for Ab binding, validating the use of deep mutational scanning to map functional interaction sites in G protein-coupled receptors. Chemokine CXCL12 was found to interact with residues extending asymmetrically into the CXCR4 ligand-binding cavity, similar to the binding surface of CXCR4 recognized by an antagonistic viral chemokine previously observed crystallographically. CXCR4 mutations distal from the chemokine binding site were identified that enhance chemokine recognition. This included disruptive mutations in the G protein-coupling site that diminished calcium mobilization, as well as conservative mutations to a membrane-exposed site (CXCR4 residues H79 2.45 and W161 4.50 ) that increased ligand binding without loss of signaling. Compared with CXCR4-CXCL12 interactions, CCR5 residues conserved for gp120 (HIV-1 BaL strain) interactions map to a more expansive surface, mimicking how the cognate chemokine CCL5 makes contacts across the entire CCR5 binding cavity. Acidic substitutions in the CCR5 N terminus and extracellular loops enhanced gp120 binding. This study demonstrates how comprehensive mutational scanning can define functional interaction sites on receptors, and novel mutations that enhance receptor activities can be found simultaneously. Copyright © 2018 by The American Association of Immunologists, Inc.
Fadda, Elisa; Woods, Robert J
2011-10-11
The ability of ligands to displace conserved water molecules in protein binding sites is of significant interest in drug design and is particularly pertinent in the case of glycomimetic drugs. This concept was explored in previous work [ Clarke et al. J. Am. Chem. Soc. 2001 , 123 , 12238 - 12247 and Kadirvelraj et al. J. Am. Chem. Soc. 2008 , 130 , 16933 - 16942 ] for a highly conserved water molecule located in the binding site of the prototypic carbohydrate-binding protein Concanavalin A (Con A). A synthetic ligand was designed with the aim of displacing such water. While the synthetic ligand bound to Con A in an analogous manner to that of the natural ligand, crystallographic analysis demonstrated that it did not displace the conserved water. In order to quantify the affinity of this particular water for the Con A surface, we report here the calculated standard binding free energy for this water in both ligand-bound and free Con A, employing three popular water models: TIP3P, TIP4P, and TIP5P. Although each model was developed to perform well in simulations of bulk-phase water, the computed binding energies for the isolated water molecule displayed a high sensitivity to the model. Both molecular dynamics simulation and free energy results indicate that the choice of water model may greatly influence the characterization of surface water molecules as conserved (TIP5P) or not (TIP3P) in protein binding sites, an observation of considerable significance to rational drug design. Structural and theoretical aspects at the basis of the different behaviors are identified and discussed.
Conservation of myeloid surface antigens on primate granulocytes.
Letvin, N L; Todd, R F; Palley, L S; Schlossman, S F; Griffin, J D
1983-02-01
Monoclonal antibodies reactive with myeloid cell surface antigens were used to study evolutionary changes in granulocyte surface antigens from primate species. Certain of these granulocyte membrane antigens are conserved in phylogenetically distant species, indicating the potential functional importance of these structures. The degree of conservation of these antigens reflects the phylogenetic relationship between primate species. Furthermore, species of the same genus show similar patterns of binding to this panel of anti-human myeloid antibodies. This finding of conserved granulocyte surface antigens suggests that non-human primates may provide a model system for exploring uses of monoclonal antibodies in the treatment of human myeloid disorders.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Germane, Katherine L.; Spiller, Benjamin W.
2011-09-20
Bacterial pathogens secrete effectors into their hosts that subvert host defenses and redirect host processes. EspG is a type three secretion effector with a disputed function that is found in enteropathogenic Escherichia coli. Here we show that EspG is structurally similar to VirA, a Shigella virulence factor; EspG has a large, conserved pocket on its surface; EspG binds directly to the amino-terminal inhibitory domain of human p21-activated kinase (PAK); and mutations to conserved residues in the surface pocket disrupt the interaction with PAK.
Predicting Displaceable Water Sites Using Mixed-Solvent Molecular Dynamics.
Graham, Sarah E; Smith, Richard D; Carlson, Heather A
2018-02-26
Water molecules are an important factor in protein-ligand binding. Upon binding of a ligand with a protein's surface, waters can either be displaced by the ligand or may be conserved and possibly bridge interactions between the protein and ligand. Depending on the specific interactions made by the ligand, displacing waters can yield a gain in binding affinity. The extent to which binding affinity may increase is difficult to predict, as the favorable displacement of a water molecule is dependent on the site-specific interactions made by the water and the potential ligand. Several methods have been developed to predict the location of water sites on a protein's surface, but the majority of methods are not able to take into account both protein dynamics and the interactions made by specific functional groups. Mixed-solvent molecular dynamics (MixMD) is a cosolvent simulation technique that explicitly accounts for the interaction of both water and small molecule probes with a protein's surface, allowing for their direct competition. This method has previously been shown to identify both active and allosteric sites on a protein's surface. Using a test set of eight systems, we have developed a method using MixMD to identify conserved and displaceable water sites. Conserved sites can be determined by an occupancy-based metric to identify sites which are consistently occupied by water even in the presence of probe molecules. Conversely, displaceable water sites can be found by considering the sites which preferentially bind probe molecules. Furthermore, the inclusion of six probe types allows the MixMD method to predict which functional groups are capable of displacing which water sites. The MixMD method consistently identifies sites which are likely to be nondisplaceable and predicts the favorable displacement of water sites that are known to be displaced upon ligand binding.
Wang, Hao-Ching; Ko, Tzu-Ping; Wu, Mao-Lun; Ku, Shan-Chi; Wu, Hsing-Ju; Wang, Andrew H.-J.
2012-01-01
DNA mimic proteins occupy the DNA binding sites of DNA-binding proteins, and prevent these sites from being accessed by DNA. We show here that the Neisseria conserved hypothetical protein DMP19 acts as a DNA mimic. The crystal structure of DMP19 shows a dsDNA-like negative charge distribution on the surface, suggesting that this protein should be added to the short list of known DNA mimic proteins. The crystal structure of another related protein, NHTF (Neisseria hypothetical transcription factor), provides evidence that it is a member of the xenobiotic-response element (XRE) family of transcriptional factors. NHTF binds to a palindromic DNA sequence containing a 5′-TGTNAN11TNACA-3′ recognition box that controls the expression of an NHTF-related operon in which the conserved nitrogen-response protein [i.e. (Protein-PII) uridylyltransferase] is encoded. The complementary surface charges between DMP19 and NHTF suggest specific charge–charge interaction. In a DNA-binding assay, we found that DMP19 can prevent NHTF from binding to its DNA-binding sites. Finally, we used an in situ gene regulation assay to provide evidence that NHTF is a repressor of its down-stream genes and that DMP19 can neutralize this effect. We therefore conclude that the interaction of DMP19 and NHTF provides a novel gene regulation mechanism in Neisseria spps. PMID:22373915
Glycosylation at Asn91 of H1N1 haemagglutinin affects binding to glycan receptors
Jayaraman, Akila; Koh, Xiaoying; Li, Jing; Raman, Rahul; Viswanathan, Karthik; Shriver, Zachary; Sasisekharan, Ram
2012-01-01
The glycoprotein HA (haemagglutinin) on the surface of influenza A virus plays a central role in recognition and binding to specific host cell-surface glycan receptors and in fusion of viral membrane to the host nuclear membrane during viral replication. Given the abundance of HA on the viral surface, this protein is also the primary target for host innate and adaptive immune responses. Although addition of glycosylation sites on HA are a part of viral evolution to evade the host immune responses, there are specific glycosylation sites that are conserved during most of the evolution of the virus. In the present study, it was demonstrated that one such conserved glycosylation site at Asn91 in H1N1 HA critically governs the glycan receptor-binding specificity and hence would potentially impinge on the host adaptation of the virus. PMID:22642577
Glycosylation at Asn91 of H1N1 haemagglutinin affects binding to glycan receptors.
Jayaraman, Akila; Koh, Xiaoying; Li, Jing; Raman, Rahul; Viswanathan, Karthik; Shriver, Zachary; Sasisekharan, Ram
2012-06-15
The glycoprotein HA (haemagglutinin) on the surface of influenza A virus plays a central role in recognition and binding to specific host cell-surface glycan receptors and in fusion of viral membrane to the host nuclear membrane during viral replication. Given the abundance of HA on the viral surface, this protein is also the primary target for host innate and adaptive immune responses. Although addition of glycosylation sites on HA are a part of viral evolution to evade the host immune responses, there are specific glycosylation sites that are conserved during most of the evolution of the virus. In the present study, it was demonstrated that one such conserved glycosylation site at Asn(91) in H1N1 HA critically governs the glycan receptor-binding specificity and hence would potentially impinge on the host adaptation of the virus.
Probing binding hot spots at protein-RNA recognition sites.
Barik, Amita; Nithin, Chandran; Karampudi, Naga Bhushana Rao; Mukherjee, Sunandan; Bahadur, Ranjit Prasad
2016-01-29
We use evolutionary conservation derived from structure alignment of polypeptide sequences along with structural and physicochemical attributes of protein-RNA interfaces to probe the binding hot spots at protein-RNA recognition sites. We find that the degree of conservation varies across the RNA binding proteins; some evolve rapidly compared to others. Additionally, irrespective of the structural class of the complexes, residues at the RNA binding sites are evolutionary better conserved than those at the solvent exposed surfaces. For recognitions involving duplex RNA, residues interacting with the major groove are better conserved than those interacting with the minor groove. We identify multi-interface residues participating simultaneously in protein-protein and protein-RNA interfaces in complexes where more than one polypeptide is involved in RNA recognition, and show that they are better conserved compared to any other RNA binding residues. We find that the residues at water preservation site are better conserved than those at hydrated or at dehydrated sites. Finally, we develop a Random Forests model using structural and physicochemical attributes for predicting binding hot spots. The model accurately predicts 80% of the instances of experimental ΔΔG values in a particular class, and provides a stepping-stone towards the engineering of protein-RNA recognition sites with desired affinity. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ecale Zhou, C L; Zemla, A T; Roe, D
2005-01-29
Specific and sensitive ligand-based protein detection assays that employ antibodies or small molecules such as peptides, aptamers, or other small molecules require that the corresponding surface region of the protein be accessible and that there be minimal cross-reactivity with non-target proteins. To reduce the time and cost of laboratory screening efforts for diagnostic reagents, we developed new methods for evaluating and selecting protein surface regions for ligand targeting. We devised combined structure- and sequence-based methods for identifying 3D epitopes and binding pockets on the surface of the A chain of ricin that are conserved with respect to a set ofmore » ricin A chains and unique with respect to other proteins. We (1) used structure alignment software to detect structural deviations and extracted from this analysis the residue-residue correspondence, (2) devised a method to compare corresponding residues across sets of ricin structures and structures of closely related proteins, (3) devised a sequence-based approach to determine residue infrequency in local sequence context, and (4) modified a pocket-finding algorithm to identify surface crevices in close proximity to residues determined to be conserved/unique based on our structure- and sequence-based methods. In applying this combined informatics approach to ricin A we identified a conserved/unique pocket in close proximity (but not overlapping) the active site that is suitable for bi-dentate ligand development. These methods are generally applicable to identification of surface epitopes and binding pockets for development of diagnostic reagents, therapeutics, and vaccines.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stenmark, Pål; Dong, Min; Dupuy, Jérôme
2011-11-02
Botulinum neurotoxins (BoNTs) typically bind the neuronal cell surface via dual interactions with both protein receptors and gangliosides. We present here the 1.9-{angstrom} X-ray structure of the BoNT serotype G (BoNT/G) receptor binding domain (residues 868-1297) and a detailed view of protein receptor and ganglioside binding regions. The ganglioside binding motif (SxWY) has a conserved structure compared to the corresponding regions in BoNT serotype A and BoNT serotype B (BoNT/B), but several features of interactions with the hydrophilic face of the ganglioside are absent at the opposite side of the motif in the BoNT/G ganglioside binding cleft. This may significantlymore » reduce the affinity between BoNT/G and gangliosides. BoNT/G and BoNT/B share the protein receptor synaptotagmin (Syt) I/II. The Syt binding site has a conserved hydrophobic plateau located centrally in the proposed protein receptor binding interface (Tyr1189, Phe1202, Ala1204, Pro1205, and Phe1212). Interestingly, only 5 of 14 residues that are important for binding between Syt-II and BoNT/B are conserved in BoNT/G, suggesting that the means by which BoNT/G and BoNT/B bind Syt diverges more than previously appreciated. Indeed, substitution of Syt-II Phe47 and Phe55 with alanine residues had little effect on the binding of BoNT/G, but strongly reduced the binding of BoNT/B. Furthermore, an extended solvent-exposed hydrophobic loop, located between the Syt binding site and the ganglioside binding cleft, may serve as a third membrane association and binding element to contribute to high-affinity binding to the neuronal membrane. While BoNT/G and BoNT/B are homologous to each other and both utilize Syt-I/Syt-II as their protein receptor, the precise means by which these two toxin serotypes bind to Syt appears surprisingly divergent.« less
Stenmark, Pål; Dong, Min; Dupuy, Jérôme; Chapman, Edwin R; Stevens, Raymond C
2010-04-16
Botulinum neurotoxins (BoNTs) typically bind the neuronal cell surface via dual interactions with both protein receptors and gangliosides. We present here the 1.9-A X-ray structure of the BoNT serotype G (BoNT/G) receptor binding domain (residues 868-1297) and a detailed view of protein receptor and ganglioside binding regions. The ganglioside binding motif (SxWY) has a conserved structure compared to the corresponding regions in BoNT serotype A and BoNT serotype B (BoNT/B), but several features of interactions with the hydrophilic face of the ganglioside are absent at the opposite side of the motif in the BoNT/G ganglioside binding cleft. This may significantly reduce the affinity between BoNT/G and gangliosides. BoNT/G and BoNT/B share the protein receptor synaptotagmin (Syt) I/II. The Syt binding site has a conserved hydrophobic plateau located centrally in the proposed protein receptor binding interface (Tyr1189, Phe1202, Ala1204, Pro1205, and Phe1212). Interestingly, only 5 of 14 residues that are important for binding between Syt-II and BoNT/B are conserved in BoNT/G, suggesting that the means by which BoNT/G and BoNT/B bind Syt diverges more than previously appreciated. Indeed, substitution of Syt-II Phe47 and Phe55 with alanine residues had little effect on the binding of BoNT/G, but strongly reduced the binding of BoNT/B. Furthermore, an extended solvent-exposed hydrophobic loop, located between the Syt binding site and the ganglioside binding cleft, may serve as a third membrane association and binding element to contribute to high-affinity binding to the neuronal membrane. While BoNT/G and BoNT/B are homologous to each other and both utilize Syt-I/Syt-II as their protein receptor, the precise means by which these two toxin serotypes bind to Syt appears surprisingly divergent. Copyright (c) 2010. Published by Elsevier Ltd.
Crystal Structure of VC0702 at 2.0 angstrom: A Conserved Hypothetical Protein from Vibrio Cholerae
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ni, Shuisong; Forouhar, Farhad; Bussiere, Dirksen E.
2006-06-01
VC0702, a conserved hypothetical protein of unknown function from Vibrio cholerae, resides in a putative three-gene operon containing the MbaA gene, which is involved in regulating formation of the extracellular matrix of biofilms in Vibrio cholerae. The VC0702 crystal structure has been determined at 2.0? and refined to Rwork=22.8% and Rfree=26.3%. VC0702 crystallized in an orthorhombic crystal lattice in the C2221 space group with dimensions of a=66.61 ?, b=88.118 ?, and c=118.35 ? with a homodimer in the asymmetric unit. VC0702 belongs to the Pfam DUF84 and COG1986 family of proteins. Sequence conservation within the DUF84 and COG1986 families wasmore » used to identify a conserved patch of surface residues that define a cleft and potential substrate-binding site in VC0702. The three-dimensional structure of VC0702 is similar to that of Mj0226 from Methanococcus janeshii, which has been identified as a novel NTPase. The NTP-binding site in Mj0226 is similarly located in comparison to the conserved patch of surface residues in VC0702. Furthermore, the NTP binds to MJ0226 in a cleft and deep cavity, features that are present in the VC0702 structure as well, suggesting that VC0702 may have a biochemical function involving NTP binding that is associated with a cellular function of regulating biofilm formation in Vibrio cholerae.« less
2003-03-14
streptococcal superantigen binding to MHCII on the surface of cells (7–9), suggesting an essential role in both MHCII molecular recognition and TCR-mediated...extent, mutations of side chains found in a second conserved MHCII alpha-chain-binding site consisting of a hydrophobic surface loop decreased T-cell...fraction of dimer is present at T-cell stimulatory concentrations of Spe-C following mutation of the unpaired side chain of cys- teine at residue 27 to
Zheng, Heping; Mandal, Arabinda; Shumilin, Igor A.; Chordia, Mahendra D.; Panneerdoss, Subbarayalu; Herr, John C.; Minor, Wladek
2016-01-01
Sperm Lysozyme-Like Protein 1 (SLLP1) is one of the lysozyme-like proteins predominantly expressed in mammalian testes that lacks bacteriolytic activity, localizes in the sperm acrosome, and exhibits high affinity for an oolemmal receptor, SAS1B. The crystal structure of mouse SLLP1 (mSLLP1) was determined at 2.15Å resolution. mSLLP1 monomer adopts a structural fold similar to that of chicken/mouse lysozymes retaining all four canonical disulfide bonds. mSLLP1 is distinct from c-lysozyme by substituting two essential catalytic residues (E35T/D52N), exhibiting different surface charge distribution, and by forming helical filaments approximately 75Å in diameter with a 25Å central pore comprised of six monomers per helix turn repeating every 33Å. Cross-species alignment of all reported SLLP1 sequences revealed a set of invariant surface regions comprising a characteristic fingerprint uniquely identifying SLLP1 from other c-lysozyme family members. The fingerprint surface regions reside around the lips of the putative glycan binding groove including three polar residues (Y33/E46/H113). A flexible salt bridge (E46-R61) was observed covering the glycan binding groove. The conservation of these regions may be linked to their involvement in oolemmal protein binding. Interaction between SLLP1 monomer and its oolemmal receptor SAS1B was modeled using protein-protein docking algorithms, utilizing the SLLP1 fingerprint regions along with the SAS1B conserved surface regions. This computational model revealed complementarity between the conserved SLLP1/SAS1B interacting surfaces supporting the experimentally-observed SLLP1/SAS1B interaction involved in fertilization. PMID:26198801
Zheng, H; Mandal, A; Shumilin, I A; Chordia, M D; Panneerdoss, S; Herr, J C; Minor, W
2015-07-01
Sperm lysozyme-like protein 1 (SLLP1) is one of the lysozyme-like proteins predominantly expressed in mammalian testes that lacks bacteriolytic activity, localizes in the sperm acrosome, and exhibits high affinity for an oolemmal receptor, SAS1B. The crystal structure of mouse SLLP1 (mSLLP1) was determined at 2.15 Å resolution. mSLLP1 monomer adopts a structural fold similar to that of chicken/mouse lysozymes retaining all four canonical disulfide bonds. mSLLP1 is distinct from c-lysozyme by substituting two essential catalytic residues (E35T/D52N), exhibiting different surface charge distribution, and by forming helical filaments approximately 75 Å in diameter with a 25 Å central pore comprised of six monomers per helix turn repeating every 33 Å. Cross-species alignment of all reported SLLP1 sequences revealed a set of invariant surface regions comprising a characteristic fingerprint uniquely identifying SLLP1 from other c-lysozyme family members. The fingerprint surface regions reside around the lips of the putative glycan-binding groove including three polar residues (Y33/E46/H113). A flexible salt bridge (E46-R61) was observed covering the glycan-binding groove. The conservation of these regions may be linked to their involvement in oolemmal protein binding. Interaction between SLLP1 monomer and its oolemmal receptor SAS1B was modeled using protein-protein docking algorithms, utilizing the SLLP1 fingerprint regions along with the SAS1B conserved surface regions. This computational model revealed complementarity between the conserved SLLP1/SAS1B interacting surfaces supporting the experimentally observed SLLP1/SAS1B interaction involved in fertilization. © 2015 American Society of Andrology and European Academy of Andrology.
The human fatty acid-binding protein family: Evolutionary divergences and functions
2011-01-01
Fatty acid-binding proteins (FABPs) are members of the intracellular lipid-binding protein (iLBP) family and are involved in reversibly binding intracellular hydrophobic ligands and trafficking them throughout cellular compartments, including the peroxisomes, mitochondria, endoplasmic reticulum and nucleus. FABPs are small, structurally conserved cytosolic proteins consisting of a water-filled, interior-binding pocket surrounded by ten anti-parallel beta sheets, forming a beta barrel. At the superior surface, two alpha-helices cap the pocket and are thought to regulate binding. FABPs have broad specificity, including the ability to bind long-chain (C16-C20) fatty acids, eicosanoids, bile salts and peroxisome proliferators. FABPs demonstrate strong evolutionary conservation and are present in a spectrum of species including Drosophila melanogaster, Caenorhabditis elegans, mouse and human. The human genome consists of nine putatively functional protein-coding FABP genes. The most recently identified family member, FABP12, has been less studied. PMID:21504868
Myosin MyTH4-FERM structures highlight important principles of convergent evolution.
Planelles-Herrero, Vicente José; Blanc, Florian; Sirigu, Serena; Sirkia, Helena; Clause, Jeffrey; Sourigues, Yannick; Johnsrud, Daniel O; Amigues, Beatrice; Cecchini, Marco; Gilbert, Susan P; Houdusse, Anne; Titus, Margaret A
2016-05-24
Myosins containing MyTH4-FERM (myosin tail homology 4-band 4.1, ezrin, radixin, moesin, or MF) domains in their tails are found in a wide range of phylogenetically divergent organisms, such as humans and the social amoeba Dictyostelium (Dd). Interestingly, evolutionarily distant MF myosins have similar roles in the extension of actin-filled membrane protrusions such as filopodia and bind to microtubules (MT), suggesting that the core functions of these MF myosins have been highly conserved over evolution. The structures of two DdMyo7 signature MF domains have been determined and comparison with mammalian MF structures reveals that characteristic features of MF domains are conserved. However, across millions of years of evolution conserved class-specific insertions are seen to alter the surfaces and the orientation of subdomains with respect to each other, likely resulting in new sites for binding partners. The MyTH4 domains of Myo10 and DdMyo7 bind to MT with micromolar affinity but, surprisingly, their MT binding sites are on opposite surfaces of the MyTH4 domain. The structural analysis in combination with comparison of diverse MF myosin sequences provides evidence that myosin tail domain features can be maintained without strict conservation of motifs. The results illustrate how tuning of existing features can give rise to new structures while preserving the general properties necessary for myosin tails. Thus, tinkering with the MF domain enables it to serve as a multifunctional platform for cooperative recruitment of various partners, allowing common properties such as autoinhibition of the motor and microtubule binding to arise through convergent evolution.
Shompole, Sankale; Rurangirwa, Fred R.; Wambugu, Anderson; Sitienei, John; Mwangi, Duncan M.; Musoke, Anthony J.; Mahan, Suman; Wells, Clive W.; McGuire, Travis C.
2000-01-01
Monoclonal antibodies (MAb) binding to Cowdria ruminantium elementary bodies (EB) were identified by enzyme-linked immunosorbent assay, and surface binding of one MAb (446.15) to intact EB was determined by immunofluorescence, immunogold labeling, and transmission electron microscopy. MAb 446.15 bound an antigen of approximately 43 kDa in immunoblots of eight geographically distinct strains. The MAb did not react with Ehrlichia canis antigens or uninfected bovine endothelial cell lysate and may be useful in diagnostic assays and vaccine development. PMID:11063511
Structural analysis of a functional DIAP1 fragment bound to grim and hid peptides.
Wu, J W; Cocina, A E; Chai, J; Hay, B A; Shi, Y
2001-07-01
The inhibitor of apoptosis protein DIAP1 suppresses apoptosis in Drosophila, with the second BIR domain (BIR2) playing an important role. Three proteins, Hid, Grim, and Reaper, promote apoptosis, in part by binding to DIAP1 through their conserved N-terminal sequences. The crystal structures of DIAP1-BIR2 by itself and in complex with the N-terminal peptides from Hid and Grim reveal that these peptides bind a surface groove on DIAP1, with the first four amino acids mimicking the binding of the Smac tetrapeptide to XIAP. The next 3 residues also contribute to binding through hydrophobic interactions. Interestingly, peptide binding induces the formation of an additional alpha helix in DIAP1. Our study reveals the structural conservation and diversity necessary for the binding of IAPs by the Drosophila Hid/Grim/Reaper and the mammalian Smac proteins.
NASA Astrophysics Data System (ADS)
Liu, Chia-Lin; Hung, Hui-Chen; Lo, Shou-Chen; Chiang, Ching-Hui; Chen, I.-Jung; Hsu, John T.-A.; Hou, Ming-Hon
2016-02-01
Nucleoprotein (NP) is the most abundant type of RNA-binding viral protein in influenza A virus-infected cells and is necessary for viral RNA transcription and replication. Recent studies demonstrated that influenza NP is a valid target for antiviral drug development. The surface of the groove, covered with numerous conserved residues between the head and body domains of influenza A NP, plays a crucial role in RNA binding. To explore the mechanism by which NP binds RNA, we performed a series of site-directed mutagenesis in the RNA-binding groove, followed by surface plasmon resonance (SPR), to characterize the interactions between RNA and NP. Furthermore, a role of Y148 in NP stability and NP-RNA binding was evaluated. The aromatic residue of Y148 was found to stack with a nucleotide base. By interrupting the stacking interaction between Y148 and an RNA base, we identified an influenza virus NP inhibitor, (E, E)-1,7-bis(4-hydroxy-3-methoxyphenyl) -1,6-heptadiene-3,5-dione; this inhibitor reduced the NP’s RNA-binding affinity and hindered viral replication. Our findings will be useful for the development of new drugs that disrupt the interaction between RNA and viral NP in the influenza virus.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Goetz, R.; Dover, K; Laezza, F
2009-01-01
Voltage-gated sodium channels (Nav) produce sodium currents that underlie the initiation and propagation of action potentials in nerve and muscle cells. Fibroblast growth factor homologous factors (FHFs) bind to the intracellular C-terminal region of the Nav alpha subunit to modulate fast inactivation of the channel. In this study we solved the crystal structure of a 149-residue-long fragment of human FHF2A which unveils the structural features of the homology core domain of all 10 human FHF isoforms. Through analysis of crystal packing contacts and site-directed mutagenesis experiments we identified a conserved surface on the FHF core domain that mediates channel bindingmore » in vitro and in vivo. Mutations at this channel binding surface impaired the ability of FHFs to co-localize with Navs at the axon initial segment of hippocampal neurons. The mutations also disabled FHF modulation of voltage-dependent fast inactivation of sodium channels in neuronal cells. Based on our data, we propose that FHFs constitute auxiliary subunits for Navs.« less
Kastritis, Panagiotis L; Rodrigues, João P G L M; Folkers, Gert E; Boelens, Rolf; Bonvin, Alexandre M J J
2014-07-15
Protein-protein complexes orchestrate most cellular processes such as transcription, signal transduction and apoptosis. The factors governing their affinity remain elusive however, especially when it comes to describing dissociation rates (koff). Here we demonstrate that, next to direct contributions from the interface, the non-interacting surface (NIS) also plays an important role in binding affinity, especially polar and charged residues. Their percentage on the NIS is conserved over orthologous complexes indicating an evolutionary selection pressure. Their effect on binding affinity can be explained by long-range electrostatic contributions and surface-solvent interactions that are known to determine the local frustration of the protein complex surface. Including these in a simple model significantly improves the affinity prediction of protein complexes from structural models. The impact of mutations outside the interacting surface on binding affinity is supported by experimental alanine scanning mutagenesis data. These results enable the development of more sophisticated and integrated biophysical models of binding affinity and open new directions in experimental control and modulation of biomolecular interactions. Copyright © 2014. Published by Elsevier Ltd.
Ligand deconstruction: Why some fragment binding positions are conserved and others are not.
Kozakov, Dima; Hall, David R; Jehle, Stefan; Jehle, Sefan; Luo, Lingqi; Ochiana, Stefan O; Jones, Elizabeth V; Pollastri, Michael; Allen, Karen N; Whitty, Adrian; Vajda, Sandor
2015-05-19
Fragment-based drug discovery (FBDD) relies on the premise that the fragment binding mode will be conserved on subsequent expansion to a larger ligand. However, no general condition has been established to explain when fragment binding modes will be conserved. We show that a remarkably simple condition can be developed in terms of how fragments coincide with binding energy hot spots--regions of the protein where interactions with a ligand contribute substantial binding free energy--the locations of which can easily be determined computationally. Because a substantial fraction of the free energy of ligand binding comes from interacting with the residues in the energetically most important hot spot, a ligand moiety that sufficiently overlaps with this region will retain its location even when other parts of the ligand are removed. This hypothesis is supported by eight case studies. The condition helps identify whether a protein is suitable for FBDD, predicts the size of fragments required for screening, and determines whether a fragment hit can be extended into a higher affinity ligand. Our results show that ligand binding sites can usefully be thought of in terms of an anchor site, which is the top-ranked hot spot and dominates the free energy of binding, surrounded by a number of weaker satellite sites that confer improved affinity and selectivity for a particular ligand and that it is the intrinsic binding potential of the protein surface that determines whether it can serve as a robust binding site for a suitably optimized ligand.
A low-complexity region in the YTH domain protein Mmi1 enhances RNA binding.
Stowell, James A W; Wagstaff, Jane L; Hill, Chris H; Yu, Minmin; McLaughlin, Stephen H; Freund, Stefan M V; Passmore, Lori A
2018-06-15
Mmi1 is an essential RNA-binding protein in the fission yeast Schizosaccharomyces pombe that eliminates meiotic transcripts during normal vegetative growth. Mmi1 contains a YTH domain that binds specific RNA sequences, targeting mRNAs for degradation. The YTH domain of Mmi1 uses a noncanonical RNA-binding surface that includes contacts outside the conserved fold. Here, we report that an N-terminal extension that is proximal to the YTH domain enhances RNA binding. Using X-ray crystallography, NMR, and biophysical methods, we show that this low-complexity region becomes more ordered upon RNA binding. This enhances the affinity of the interaction of the Mmi1 YTH domain with specific RNAs by reducing the dissociation rate of the Mmi1-RNA complex. We propose that the low-complexity region influences RNA binding indirectly by reducing dynamic motions of the RNA-binding groove and stabilizing a conformation of the YTH domain that binds to RNA with high affinity. Taken together, our work reveals how a low-complexity region proximal to a conserved folded domain can adopt an ordered structure to aid nucleic acid binding. © 2018 Stowell et al.
An Aromatic Cap Seals the Substrate Binding Site in an ECF-Type S Subunit for Riboflavin
DOE Office of Scientific and Technical Information (OSTI.GOV)
Karpowich, Nathan K.; Song, Jinmei; Wang, Da-Neng
2016-06-13
ECF transporters are a family of active membrane transporters for essential micronutrients, such as vitamins and trace metals. Found exclusively in archaea and bacteria, these transporters are composed of four subunits: an integral membrane substrate-binding subunit (EcfS), a transmembrane coupling subunit (EcfT), and two ATP-binding cassette ATPases (EcfA and EcfA'). We have characterized the structural basis of substrate binding by the EcfS subunit for riboflavin from Thermotoga maritima, TmRibU. TmRibU binds riboflavin with high affinity, and the protein–substrate complex is exceptionally stable in solution. The crystal structure of riboflavin-bound TmRibU reveals an electronegative binding pocket at the extracellular surface inmore » which the substrate is completely buried. Analysis of the intermolecular contacts indicates that nearly every available substrate hydrogen bond is satisfied. A conserved aromatic residue at the extracellular end of TM5, Tyr130, caps the binding site to generate a substrate-bound, occluded state, and non-conservative mutation of Tyr130 reduces the stability of this conformation. Using a novel fluorescence binding assay, we find that an aromatic residue at this position is essential for high-affinity substrate binding. Comparison with other S subunit structures suggests that TM5 and Loop5-6 contain a dynamic, conserved motif that plays a key role in gating substrate entry and release by S subunits of ECF transporters.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Y Ren; H Seo; G Blobel
The export of mRNAs is a multistep process, involving the packaging of mRNAs into messenger ribonucleoprotein particles (mRNPs), their transport through nuclear pore complexes, and mRNP remodeling events prior to translation. Ribonucleic acid export 1 (Rae1) and Nup98 are evolutionarily conserved mRNA export factors that are targeted by the vesicular stomatitis virus matrix protein to inhibit host cell nuclear export. Here, we present the crystal structure of human Rae1 in complex with the Gle2-binding sequence (GLEBS) of Nup98 at 1.65 {angstrom} resolution. Rae1 forms a seven-bladed {beta}-propeller with several extensive surface loops. The Nup98 GLEBS motif forms an {approx}50-{angstrom}-long hairpinmore » that binds with its C-terminal arm to an essentially invariant hydrophobic surface that extends over the entire top face of the Rae1 {beta}-propeller. The C-terminal arm of the GLEBS hairpin is necessary and sufficient for Rae1 binding, and we identify a tandem glutamate element in this arm as critical for complex formation. The Rae1 {center_dot} Nup98{sup GLEBS} surface features an additional conserved patch with a positive electrostatic potential, and we demonstrate that the complex possesses single-stranded RNA-binding capability. Together, these data suggest that the Rae1 {center_dot} Nup98 complex directly binds to the mRNP at several stages of the mRNA export pathway.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Helander, Sara; Montecchio, Meri; Lemak, Alexander
Highlights: • We describe the structure of a novel fold in FKBP25 and HectD. • The new fold is named the Basic Tilted Helix Bundle (BTHB) domain. • A conserved basic surface patch is presented, suggesting a functional role. - Abstract: In this paper, we describe the structure of a N-terminal domain motif in nuclear-localized FKBP25{sub 1–73}, a member of the FKBP family, together with the structure of a sequence-related subdomain of the E3 ubiquitin ligase HectD1 that we show belongs to the same fold. This motif adopts a compact 5-helix bundle which we name the Basic Tilted Helix Bundlemore » (BTHB) domain. A positively charged surface patch, structurally centered around the tilted helix H4, is present in both FKBP25 and HectD1 and is conserved in both proteins, suggesting a conserved functional role. We provide detailed comparative analysis of the structures of the two proteins and their sequence similarities, and analysis of the interaction of the proposed FKBP25 binding protein YY1. We suggest that the basic motif in BTHB is involved in the observed DNA binding of FKBP25, and that the function of this domain can be affected by regulatory YY1 binding and/or interactions with adjacent domains.« less
Prigozhin, Daniil M.; Krieger, Inna V.; Huizar, John P.; ...
2014-12-31
Beta-lactam antibiotics target penicillin-binding proteins including several enzyme classes essential for bacterial cell-wall homeostasis. To better understand the functional and inhibitor-binding specificities of penicillin-binding proteins from the pathogen, Mycobacterium tuberculosis, we carried out structural and phylogenetic analysis of two predicted D,D-carboxypeptidases, Rv2911 and Rv3330. Optimization of Rv2911 for crystallization using directed evolution and the GFP folding reporter method yielded a soluble quadruple mutant. Structures of optimized Rv2911 bound to phenylmethylsulfonyl fluoride and Rv3330 bound to meropenem show that, in contrast to the nonspecific inhibitor, meropenem forms an extended interaction with the enzyme along a conserved surface. Phylogenetic analysis shows thatmore » Rv2911 and Rv3330 belong to different clades that emerged in Actinobacteria and are not represented in model organisms such as Escherichia coli and Bacillus subtilis. Clade-specific adaptations allow these enzymes to fulfill distinct physiological roles despite strict conservation of core catalytic residues. The characteristic differences include potential protein-protein interaction surfaces and specificity-determining residues surrounding the catalytic site. Overall, these structural insights lay the groundwork to develop improved beta-lactam therapeutics for tuberculosis.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Prigozhin, Daniil M.; Krieger, Inna V.; Huizar, John P.
Beta-lactam antibiotics target penicillin-binding proteins including several enzyme classes essential for bacterial cell-wall homeostasis. To better understand the functional and inhibitor-binding specificities of penicillin-binding proteins from the pathogen, Mycobacterium tuberculosis, we carried out structural and phylogenetic analysis of two predicted D,D-carboxypeptidases, Rv2911 and Rv3330. Optimization of Rv2911 for crystallization using directed evolution and the GFP folding reporter method yielded a soluble quadruple mutant. Structures of optimized Rv2911 bound to phenylmethylsulfonyl fluoride and Rv3330 bound to meropenem show that, in contrast to the nonspecific inhibitor, meropenem forms an extended interaction with the enzyme along a conserved surface. Phylogenetic analysis shows thatmore » Rv2911 and Rv3330 belong to different clades that emerged in Actinobacteria and are not represented in model organisms such as Escherichia coli and Bacillus subtilis. Clade-specific adaptations allow these enzymes to fulfill distinct physiological roles despite strict conservation of core catalytic residues. The characteristic differences include potential protein-protein interaction surfaces and specificity-determining residues surrounding the catalytic site. Overall, these structural insights lay the groundwork to develop improved beta-lactam therapeutics for tuberculosis.« less
Point mutations abolishing the mannose-binding capability of boar spermadhesin AQN-1.
Ekhlasi-Hundrieser, Mahnaz; Calvete, Juan J; Von Rad, Bettina; Hettel, Christiane; Nimtz, Manfred; Töpfer-Petersen, Edda
2008-05-01
The mannose-binding capability of recombinant wild-type boar spermadhesin AQN-1 and of its site-directed mutants in the highly-conserved region around of the single glycosylation site (asparagine 50) of some spermadhesins, where the carbohydrate binding site has been proposed to be located, was checked using a solid-phase assay and a biotinylated mannose ligand. Substitution of glycine 54 by amino acids bearing an unipolar side chain did not cause significant decrease in the mannose-binding activity. However, amino acids with uncharged polar side chains or having a charged polar side chain abolished the binding of biotinylated mannose to the corresponding AQN-1 mutants. The results suggest that the higher surface accessibility of amino acids possessing polar side chains compared to those bearing nonpolar groups may sterically interfere with monosaccharide binding. The location of the mannose-binding site in AQN-1 appears to be topologically conserved in other heparin-binding boar spermadhesins, i.e., AQN-3 and AWN, but departs from the location of the mannose-6-phosphate-recognition site of PSP-II. This indicates that different spermadhesin molecules have evolved non-equivalent carbohydrate-binding capabilities, which may underlie their distinct patterns of biological activities.
Prigozhin, Daniil M; Papavinasasundaram, Kadamba G; Baer, Christina E; Murphy, Kenan C; Moskaleva, Alisa; Chen, Tony Y; Alber, Tom; Sassetti, Christopher M
2016-10-28
Monitoring the environment with serine/threonine protein kinases is critical for growth and survival of Mycobacterium tuberculosis, a devastating human pathogen. Protein kinase B (PknB) is a transmembrane serine/threonine protein kinase that acts as an essential regulator of mycobacterial growth and division. The PknB extracellular domain (ECD) consists of four repeats homologous to penicillin-binding protein and serine/threonine kinase associated (PASTA) domains, and binds fragments of peptidoglycan. These properties suggest that PknB activity is modulated by ECD binding to peptidoglycan substructures, however, the molecular mechanisms underpinning PknB regulation remain unclear. In this study, we report structural and genetic characterization of the PknB ECD. We determined the crystal structures of overlapping ECD fragments at near atomic resolution, built a model of the full ECD, and discovered a region on the C-terminal PASTA domain that has the properties of a ligand-binding site. Hydrophobic interaction between this surface and a bound molecule of citrate was observed in a crystal structure. Our genetic analyses in M. tuberculosis showed that nonfunctional alleles were produced either by deletion of any of single PASTA domain or by mutation of individual conserved residues lining the putative ligand-binding surface of the C-terminal PASTA repeat. These results define two distinct structural features necessary for PknB signal transduction, a fully extended ECD and a conserved, membrane-distal putative ligand-binding site. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Ligand deconstruction: Why some fragment binding positions are conserved and others are not
Kozakov, Dima; Hall, David R.; Jehle, Stefan; Luo, Lingqi; Ochiana, Stefan O.; Jones, Elizabeth V.; Pollastri, Michael; Allen, Karen N.; Whitty, Adrian; Vajda, Sandor
2015-01-01
Fragment-based drug discovery (FBDD) relies on the premise that the fragment binding mode will be conserved on subsequent expansion to a larger ligand. However, no general condition has been established to explain when fragment binding modes will be conserved. We show that a remarkably simple condition can be developed in terms of how fragments coincide with binding energy hot spots—regions of the protein where interactions with a ligand contribute substantial binding free energy—the locations of which can easily be determined computationally. Because a substantial fraction of the free energy of ligand binding comes from interacting with the residues in the energetically most important hot spot, a ligand moiety that sufficiently overlaps with this region will retain its location even when other parts of the ligand are removed. This hypothesis is supported by eight case studies. The condition helps identify whether a protein is suitable for FBDD, predicts the size of fragments required for screening, and determines whether a fragment hit can be extended into a higher affinity ligand. Our results show that ligand binding sites can usefully be thought of in terms of an anchor site, which is the top-ranked hot spot and dominates the free energy of binding, surrounded by a number of weaker satellite sites that confer improved affinity and selectivity for a particular ligand and that it is the intrinsic binding potential of the protein surface that determines whether it can serve as a robust binding site for a suitably optimized ligand. PMID:25918377
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stanek, Kimberly A.; Patterson-West, Jennifer; Randolph, Peter S.
The host factor Hfq, as the bacterial branch of the Sm family, is an RNA-binding protein involved in the post-transcriptional regulation of mRNA expression and turnover. Hfq facilitates pairing between small regulatory RNAs (sRNAs) and their corresponding mRNA targets by binding both RNAs and bringing them into close proximity. Hfq homologs self-assemble into homo-hexameric rings with at least two distinct surfaces that bind RNA. Recently, another binding site, dubbed the `lateral rim', has been implicated in sRNA·mRNA annealing; the RNA-binding properties of this site appear to be rather subtle, and its degree of evolutionary conservation is unknown. An Hfq homologmore » has been identified in the phylogenetically deep-branching thermophileAquifex aeolicus(Aae), but little is known about the structure and function of Hfq from basal bacterial lineages such as the Aquificae. Therefore,AaeHfq was cloned, overexpressed, purified, crystallized and biochemically characterized. Structures ofAaeHfq were determined in space groupsP1 andP6, both to 1.5 Å resolution, and nanomolar-scale binding affinities for uridine- and adenosine-rich RNAs were discovered. Co-crystallization with U 6RNA reveals that the outer rim of theAaeHfq hexamer features a well defined binding pocket that is selective for uracil. ThisAaeHfq structure, combined with biochemical and biophysical characterization of the homolog, reveals deep evolutionary conservation of the lateral RNA-binding mode, and lays a foundation for further studies of Hfq-associated RNA biology in ancient bacterial phyla.« less
Laine, Elodie; Carbone, Alessandra
2015-01-01
Protein-protein interactions (PPIs) are essential to all biological processes and they represent increasingly important therapeutic targets. Here, we present a new method for accurately predicting protein-protein interfaces, understanding their properties, origins and binding to multiple partners. Contrary to machine learning approaches, our method combines in a rational and very straightforward way three sequence- and structure-based descriptors of protein residues: evolutionary conservation, physico-chemical properties and local geometry. The implemented strategy yields very precise predictions for a wide range of protein-protein interfaces and discriminates them from small-molecule binding sites. Beyond its predictive power, the approach permits to dissect interaction surfaces and unravel their complexity. We show how the analysis of the predicted patches can foster new strategies for PPIs modulation and interaction surface redesign. The approach is implemented in JET2, an automated tool based on the Joint Evolutionary Trees (JET) method for sequence-based protein interface prediction. JET2 is freely available at www.lcqb.upmc.fr/JET2. PMID:26690684
Montanuy, Imma; Alejo, Ali; Alcami, Antonio
2011-01-01
Eradication of smallpox was accomplished 30 yr ago, but poxviral infections still represent a public health concern due to the potential release of variola virus or the emergence of zoonotic poxviruses, such as monkeypox virus. A critical determinant of poxvirus virulence is the inhibition of interferons (IFNs) by the virus-encoded type I IFN-binding protein (IFNα/βBP). This immunomodulatory protein is secreted and has the unique property of interacting with the cell surface in order to prevent IFN-mediated antiviral responses. However, the mechanism of its attachment to the cell surface remains unknown. Using surface plasmon resonance and cell-binding assays, we report that the IFNα/βBP from vaccinia virus, the smallpox vaccine, interacts with cell surface glycosaminoglycans (GAGs). Analysis of the contribution of different regions of the protein to cell surface binding demonstrated that clusters of basic residues in the first immunoglobulin domain mediate GAG interactions. Furthermore, mutation of the GAG-interaction motifs does not affect its IFN-binding and -blocking capacity. Functional conservation of GAG-binding sites is demonstrated for the IFNα/βBP from variola and monkeypox viruses, extending our understanding of immune modulation by the most virulent human poxviruses. These results are relevant for the design of improved vaccines and intervention strategies.—Montanuy, I., Alejo, A., Alcami, A. Glycosaminoglycans mediate retention of the poxvirus type I interferon binding protein at the cell surface to locally block interferon antiviral responses. PMID:21372110
Patikoglou, Georgia A; Westblade, Lars F; Campbell, Elizabeth A; Lamour, Valérie; Lane, William J; Darst, Seth A
2007-09-21
The Escherichia coli Rsd protein binds tightly and specifically to the RNA polymerase (RNAP) sigma(70) factor. Rsd plays a role in alternative sigma factor-dependent transcription by biasing the competition between sigma(70) and alternative sigma factors for the available core RNAP. Here, we determined the 2.6 A-resolution X-ray crystal structure of Rsd bound to sigma(70) domain 4 (sigma(70)(4)), the primary determinant for Rsd binding within sigma(70). The structure reveals that Rsd binding interferes with the two primary functions of sigma(70)(4), core RNAP binding and promoter -35 element binding. Interestingly, the most highly conserved Rsd residues form a network of interactions through the middle of the Rsd structure that connect the sigma(70)(4)-binding surface with three cavities exposed on distant surfaces of Rsd, suggesting functional coupling between sigma(70)(4) binding and other binding surfaces of Rsd, either for other proteins or for as yet unknown small molecule effectors. These results provide a structural basis for understanding the role of Rsd, as well as its ortholog, AlgQ, a positive regulator of Pseudomonas aeruginosa virulence, in transcription regulation.
Crystal structure of the Escherichia coli regulator of σ70, Rsd, in complex with σ70 domain 4
Patikoglou, Georgia A.; Westblade, Lars F.; Campbell, Elizabeth A.; Lamour, Valérie; Lane, William J.; Darst, Seth A.
2007-01-01
Summary The Escherichia coli Rsd protein binds tightly and specifically to the RNA polymerase (RNAP) σ70 factor. Rsd plays a role in alternative σ factor-dependent transcription by biasing the competition between σ70 and alternative σ factors for the available core RNAP. Here, we determined the 2.6 Å-resolution X-ray crystal structure of Rsd bound to σ70 domain 4 (σ704), the primary determinant for Rsd binding within σ70. The structure reveals that Rsd binding interferes with the two primary functions of σ704, core RNAP binding and promoter –35 element binding. Interestingly, the most highly conserved Rsd residues form a network of interactions through the middle of the Rsd structure that connect the σ704-binding surface with three cavities exposed on distant surfaces of Rsd, suggesting functional coupling between σ704 binding and other binding surfaces of Rsd, either for other proteins or for as yet unknown small molecule effectors. These results provide a structural basis for understanding the role of Rsd, as well as its ortholog, AlgQ, a positive regulator of Pseudomonas aeruginosa virulence, in transcription regulation. PMID:17681541
Gonadotropin-Releasing Hormone (GnRH) Receptor Structure and GnRH Binding
Flanagan, Colleen A.; Manilall, Ashmeetha
2017-01-01
Gonadotropin-releasing hormone (GnRH) regulates reproduction. The human GnRH receptor lacks a cytoplasmic carboxy-terminal tail but has amino acid sequence motifs characteristic of rhodopsin-like, class A, G protein-coupled receptors (GPCRs). This review will consider how recent descriptions of X-ray crystallographic structures of GPCRs in inactive and active conformations may contribute to understanding GnRH receptor structure, mechanism of activation and ligand binding. The structures confirmed that ligands bind to variable extracellular surfaces, whereas the seven membrane-spanning α-helices convey the activation signal to the cytoplasmic receptor surface, which binds and activates heterotrimeric G proteins. Forty non-covalent interactions that bridge topologically equivalent residues in different transmembrane (TM) helices are conserved in class A GPCR structures, regardless of activation state. Conformation-independent interhelical contacts account for a conserved receptor protein structure and their importance in the GnRH receptor structure is supported by decreased expression of receptors with mutations of residues in the network. Many of the GnRH receptor mutations associated with congenital hypogonadotropic hypogonadism, including the Glu2.53(90) Lys mutation, involve amino acids that constitute the conserved network. Half of the ~250 intramolecular interactions in GPCRs differ between inactive and active structures. Conformation-specific interhelical contacts depend on amino acids changing partners during activation. Conserved inactive conformation-specific contacts prevent receptor activation by stabilizing proximity of TM helices 3 and 6 and a closed G protein-binding site. Mutations of GnRH receptor residues involved in these interactions, such as Arg3.50(139) of the DRY/S motif or Tyr7.53(323) of the N/DPxxY motif, increase or decrease receptor expression and efficiency of receptor coupling to G protein signaling, consistent with the native residues stabilizing the inactive GnRH receptor structure. Active conformation-specific interhelical contacts stabilize an open G protein-binding site. Progress in defining the GnRH-binding site has recently slowed, with evidence that Tyr6.58(290) contacts Tyr5 of GnRH, whereas other residues affect recognition of Trp3 and Gly10NH2. The surprisingly consistent observations that GnRH receptor mutations that disrupt GnRH binding have less effect on “conformationally constrained” GnRH peptides may now be explained by crystal structures of agonist-bound peptide receptors. Analysis of GPCR structures provides insight into GnRH receptor function. PMID:29123501
2014-01-01
Background The positive transcription elongation factor b (P-TEFb) plays an essential role in activating HIV genome transcription. It is recruited to the HIV LTR promoter through an interaction between the Tat viral protein and its Cyclin T1 subunit. P-TEFb activity is inhibited by direct binding of its subunit Cyclin T (1 or 2) with Hexim (1 or 2), a cellular protein, bound to the 7SK small nuclear RNA. Hexim1 competes with Tat for P-TEFb binding. Results Mutations that impair human Cyclin T1/Hexim1 interaction were searched using systematic mutagenesis of these proteins coupled with a yeast two-hybrid screen for loss of protein interaction. Evolutionary conserved Hexim1 residues belonging to an unstructured peptide located N-terminal of the dimerization domain, were found to be critical for P-TEFb binding. Random mutagenesis of the N-terminal region of Cyclin T1 provided identification of single amino-acid mutations that impair Hexim1 binding in human cells. Furthermore, conservation of critical residues supported the existence of a functional Hexim1 homologue in nematodes. Conclusions Single Cyclin T1 amino-acid mutations that impair Hexim1 binding are located on a groove between the two cyclin folds and define a surface overlapping the HIV-1 Tat protein binding surface. One residue, Y175, in the centre of this groove was identified as essential for both Hexim1 and Tat binding to P-TEFb as well as for HIV transcription. PMID:24985203
DOE Office of Scientific and Technical Information (OSTI.GOV)
Valley, Cary T.; Porter, Douglas F.; Qiu, Chen
2012-06-28
mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less
Xu, Qingping; Traag, Bjørn A; Willemse, Joost; McMullan, Daniel; Miller, Mitchell D; Elsliger, Marc-André; Abdubek, Polat; Astakhova, Tamara; Axelrod, Herbert L; Bakolitsa, Constantina; Carlton, Dennis; Chen, Connie; Chiu, Hsiu-Ju; Chruszcz, Maksymilian; Clayton, Thomas; Das, Debanu; Deller, Marc C; Duan, Lian; Ellrott, Kyle; Ernst, Dustin; Farr, Carol L; Feuerhelm, Julie; Grant, Joanna C; Grzechnik, Anna; Grzechnik, Slawomir K; Han, Gye Won; Jaroszewski, Lukasz; Jin, Kevin K; Klock, Heath E; Knuth, Mark W; Kozbial, Piotr; Krishna, S Sri; Kumar, Abhinav; Marciano, David; Minor, Wladek; Mommaas, A Mieke; Morse, Andrew T; Nigoghossian, Edward; Nopakun, Amanda; Okach, Linda; Oommachen, Silvya; Paulsen, Jessica; Puckett, Christina; Reyes, Ron; Rife, Christopher L; Sefcovic, Natasha; Tien, Henry J; Trame, Christine B; van den Bedem, Henry; Wang, Shuren; Weekes, Dana; Hodgson, Keith O; Wooley, John; Deacon, Ashley M; Godzik, Adam; Lesley, Scott A; Wilson, Ian A; van Wezel, Gilles P
2009-09-11
SsgA-like proteins (SALPs) are a family of homologous cell division-related proteins that occur exclusively in morphologically complex actinomycetes. We show that SsgB, a subfamily of SALPs, is the archetypal SALP that is functionally conserved in all sporulating actinomycetes. Sporulation-specific cell division of Streptomyces coelicolor ssgB mutants is restored by introduction of distant ssgB orthologues from other actinomycetes. Interestingly, the number of septa (and spores) of the complemented null mutants is dictated by the specific ssgB orthologue that is expressed. The crystal structure of the SsgB from Thermobifida fusca was determined at 2.6 A resolution and represents the first structure for this family. The structure revealed similarities to a class of eukaryotic "whirly" single-stranded DNA/RNA-binding proteins. However, the electro-negative surface of the SALPs suggests that neither SsgB nor any of the other SALPs are likely to interact with nucleotide substrates. Instead, we show that a conserved hydrophobic surface is likely to be important for SALP function and suggest that proteins are the likely binding partners.
Khadka, Bijendra; Gupta, Radhey S
2017-08-01
Homologs of the phosphatidylinositol-4-phosphate-5-kinase (PIP5K), which controls a multitude of essential cellular functions, contain a 8 aa insert in a conserved region that is specific for the Saccharomycetaceae family of fungi. Using structures of human PIP4K proteins as templates, structural models were generated of the Saccharomyces cerevisiae and human PIP5K proteins. In the modeled S. cerevisiae PIP5K, the 8 aa insert forms a surface exposed loop, present on the same face of the protein as the activation loop of the kinase domain. Electrostatic potential analysis indicates that the residues from 8 aa conserved loop form a highly positively charged surface patch, which through electrostatic interaction with the anionic portions of phospholipid head groups, is expected to play a role in the membrane interaction of the yeast PIP5K. To unravel this prediction, molecular dynamics (MD) simulations were carried out to examine the binding interaction of PIP5K, either containing or lacking the conserved signature insert, with two different membrane lipid bilayers. The results from MD studies provide insights concerning the mechanistic of interaction of PIP5K with lipid bilayer, and support the contention that the identified 8 aa conserved insert in fungal PIP5K plays an important role in the binding of this protein with membrane surface. Proteins 2017; 85:1454-1467. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
A Surface Groove Essential for Viral Bcl-2 Function During Chronic Infection In Vivo
Petros, Andrew M; Nettesheim, David; van Dyk, Linda F.; Labrada, Lucia; Speck, Samuel H; Levine, Beth
2005-01-01
Antiapoptotic Bcl-2 family proteins inhibit apoptosis in cultured cells by binding BH3 domains of proapoptotic Bcl-2 family members via a hydrophobic BH3 binding groove on the protein surface. We investigated the physiological importance of the BH3 binding groove of an antiapoptotic Bcl-2 protein in mammals in vivo by analyzing a viral Bcl-2 family protein. We show that the γ-herpesvirus 68 (γHV68) Bcl-2 family protein (γHV68 v-Bcl-2), which is known to inhibit apoptosis in cultured cells, inhibits both apoptosis in primary lymphocytes and Bax toxicity in yeast. Nuclear magnetic resonance determination of the γHV68 v-Bcl-2 structure revealed a BH3 binding groove that binds BH3 domain peptides from proapoptotic Bcl-2 family members Bax and Bak via a molecular mechanism shared with host Bcl-2 family proteins, involving a conserved arginine in the BH3 peptide binding groove. Mutations of this conserved arginine and two adjacent amino acids to alanine (SGR to AAA) within the BH3 binding groove resulted in a properly folded protein that lacked the capacity of the wild-type γHV68 v-Bcl-2 to bind Bax BH3 peptide and to block Bax toxicity in yeast. We tested the physiological importance of this v-Bcl-2 domain during viral infection by engineering viral mutants encoding a v-Bcl-2 containing the SGR to AAA mutation. This mutation resulted in a virus defective for both efficient reactivation of γHV68 from latency and efficient persistent γHV68 replication. These studies demonstrate an essential functional role for amino acids in the BH3 peptide binding groove of a viral Bcl-2 family member during chronic infection. PMID:16201011
Solution structure of the core SMN–Gemin2 complex
Sarachan, Kathryn L.; Valentine, Kathleen G.; Gupta, Kushol; Moorman, Veronica R.; Gledhill, John M.; Bernens, Matthew; Tommos, Cecilia; Wand, A. Joshua; Van Duyne, Gregory D.
2012-01-01
In humans, assembly of spliceosomal snRNPs (small nuclear ribonucleoproteins) begins in the cytoplasm where the multi-protein SMN (survival of motor neuron) complex mediates the formation of a seven-membered ring of Sm proteins on to a conserved site of the snRNA (small nuclear RNA). The SMN complex contains the SMN protein Gemin2 and several additional Gemins that participate in snRNP biosynthesis. SMN was first identified as the product of a gene found to be deleted or mutated in patients with the neurodegenerative disease SMA (spinal muscular atrophy), the leading genetic cause of infant mortality. In the present study, we report the solution structure of Gemin2 bound to the Gemin2-binding domain of SMN determined by NMR spectroscopy. This complex reveals the structure of Gemin2, how Gemin2 binds to SMN and the roles of conserved SMN residues near the binding interface. Surprisingly, several conserved SMN residues, including the sites of two SMA patient mutations, are not required for binding to Gemin2. Instead, they form a conserved SMN/Gemin2 surface that may be functionally important for snRNP assembly. The SMN–Gemin2 structure explains how Gemin2 is stabilized by SMN and establishes a framework for structure–function studies to investigate snRNP biogenesis as well as biological processes involving Gemin2 that do not involve snRNP assembly. PMID:22607171
Unique carbohydrate binding platforms employed by the glucan phosphatases
MEEKINS, David A.; GENTRY, Matthew S.
2016-01-01
Glucan phosphatases are a family of enzymes that are functionally conserved at the enzymatic level in animals and plants. These enzymes bind and dephosphorylate glycogen in animals and starch in plants. While the enzymatic function is conserved, the glucan phosphatases employ distinct mechanisms to bind and dephosphorylate glycogen or starch. The founding member of the family is a bimodular human protein called laforin that is comprised of a carbohydrate binding module 20 (CBM20) followed by a dual specificity phosphatase domain. Plants contain two glucan phosphatases: Starch EXcess4 (SEX4) and Like Sex Four2 (LSF2). SEX4 contains a chloroplast targeting peptide, dual specificity phosphatase (DSP) domain, a CBM45, and a carboxy-terminal motif. LSF2 is comprised of simply a chloroplast targeting peptide, DSP domain, and carboxy-terminal motif. SEX4 employs an integrated DSP-CBM glucan-binding platform to engage and dephosphorylate starch. LSF2 lacks a CBM and instead utilizes two surface binding sites to bind and dephosphorylate starch. Laforin is a dimeric protein in solution and it utilizes a tetramodular architecture and cooperativity to bind and dephosphorylate glycogen. This chapter describes the biological role of glucan phosphatases in glycogen and starch metabolism and compares and contrasts their ability to bind and dephosphorylate glucans. PMID:27147465
Huang, Ying; Bayfield, Mark A; Intine, Robert V; Maraia, Richard J
2006-07-01
By sequence-specific binding to 3' UUU-OH, the La protein shields precursor (pre)-RNAs from 3' end digestion and is required to protect defective pre-transfer RNAs from decay. Although La is comprised of a La motif and an RNA-recognition motif (RRM), a recent structure indicates that the RRM beta-sheet surface is not involved in UUU-OH recognition, raising questions as to its function. Progressively defective suppressor tRNAs in Schizosaccharomyces pombe reveal differential sensitivities to La and Rrp6p, a 3' exonuclease component of pre-tRNA decay. 3' end protection is compromised by mutations to the La motif but not the RRM surface. The most defective pre-tRNAs require a second activity of La, in addition to 3' protection, that requires an intact RRM surface. The two activities of La in tRNA maturation map to its two conserved RNA-binding surfaces and suggest a modular model that has implications for its other ligands.
Mustafaoglu, Nur; Alves, Nathan J; Bilgicer, Basar
2015-07-01
The nucleotide binding site (NBS) is a highly conserved region between the variable light and heavy chains at the Fab domains of all antibodies, and a small molecule that we identified, indole-3-butyric acid (IBA), binds specifically to this site. Fab fragment, with its small size and simple production methods compared to intact antibody, is good candidate for use in miniaturized diagnostic devices and targeted therapeutic applications. However, commonly used modification techniques are not well suited for Fab fragments as they are often more delicate than intact antibodies. Fab fragments are of particular interest for sensor surface functionalization but immobilization results in damage to the antigen binding site and greatly reduced activity due to their truncated size that allows only a small area that can bind to surfaces without impeding antigen binding. In this study, we describe an NBS-UV photocrosslinking functionalization method (UV-NBS(Biotin) in which a Fab fragment is site-specifically biotinylated with an IBA-EG11-Biotin linker via UV energy exposure (1 J/cm(2)) without affecting its antigen binding activity. This study demonstrates successful immobilization of biotinylated Ebola detecting Fab fragment (KZ52 Fab fragment) via the UV-NBS(Biotin) method yielding 1031-fold and 2-fold better antigen detection sensitivity compared to commonly used immobilization methods: direct physical adsorption and NHS-Biotin functionalization, respectively. Utilization of the UV-NBS(Biotin) method for site-specific conjugation to Fab fragment represents a proof of concept use of Fab fragment for various diagnostic and therapeutic applications with numerous fluorescent probes, affinity molecules and peptides. © 2015 Wiley Periodicals, Inc.
ABC Transporters Involved in Export of Cell Surface Glycoconjugates
Cuthbertson, Leslie; Kos, Veronica; Whitfield, Chris
2010-01-01
Summary: Complex glycoconjugates play critical roles in the biology of microorganisms. Despite the remarkable diversity in glycan structures and the bacteria that produce them, conserved themes are evident in the biosynthesis-export pathways. One of the primary pathways involves representatives of the ATP-binding cassette (ABC) transporter superfamily. These proteins are responsible for the export of a wide variety of cell surface oligo- and polysaccharides in both Gram-positive and Gram-negative bacteria. Recent investigations of the structure and function of ABC transporters involved in the export of lipopolysaccharide O antigens have revealed two fundamentally different strategies for coupling glycan polymerization to export. These mechanisms are distinguished by the presence (or absence) of characteristic nonreducing terminal modifications on the export substrates, which serve as chain termination and/or export signals, and by the presence (or absence) of a discrete substrate-binding domain in the nucleotide-binding domain polypeptide of the ABC transporter. A bioinformatic survey examining ABC exporters from known oligo- and polysaccharide biosynthesis loci identifies conserved nucleotide-binding domain protein families that correlate well with themes in the structures and assembly of glycans. The familial relationships among the ABC exporters generate hypotheses concerning the biosynthesis of structurally diverse oligo- and polysaccharides, which play important roles in the biology of bacteria with different lifestyles. PMID:20805402
Doxey, Andrew C; Cheng, Zhenyu; Moffatt, Barbara A; McConkey, Brendan J
2010-08-03
Aromatic amino acids play a critical role in protein-glycan interactions. Clusters of surface aromatic residues and their features may therefore be useful in distinguishing glycan-binding sites as well as predicting novel glycan-binding proteins. In this work, a structural bioinformatics approach was used to screen the Protein Data Bank (PDB) for coplanar aromatic motifs similar to those found in known glycan-binding proteins. The proteins identified in the screen were significantly associated with carbohydrate-related functions according to gene ontology (GO) enrichment analysis, and predicted motifs were found frequently within novel folds and glycan-binding sites not included in the training set. In addition to numerous binding sites predicted in structural genomics proteins of unknown function, one novel prediction was a surface motif (W34/W36/W192) in the tobacco pathogenesis-related protein, PR-5d. Phylogenetic analysis revealed that the surface motif is exclusive to a subfamily of PR-5 proteins from the Solanaceae family of plants, and is absent completely in more distant homologs. To confirm PR-5d's insoluble-polysaccharide binding activity, a cellulose-pulldown assay of tobacco proteins was performed and PR-5d was identified in the cellulose-binding fraction by mass spectrometry. Based on the combined results, we propose that the putative binding site in PR-5d may be an evolutionary adaptation of Solanaceae plants including potato, tomato, and tobacco, towards defense against cellulose-containing pathogens such as species of the deadly oomycete genus, Phytophthora. More generally, the results demonstrate that coplanar aromatic clusters on protein surfaces are a structural signature of glycan-binding proteins, and can be used to computationally predict novel glycan-binding proteins from 3 D structure.
Structural and functional analysis of the YAP-binding domain of human TEAD2
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tian, Wei; Yu, Jianzhong; Tomchick, Diana R.
2010-06-15
The Hippo pathway controls organ size and suppresses tumorigenesis in metazoans by blocking cell proliferation and promoting apoptosis. The TEAD1-4 proteins (which contain a DNA-binding domain but lack an activation domain) interact with YAP (which lacks a DNA-binding domain but contains an activation domain) to form functional heterodimeric transcription factors that activate proliferative and prosurvival gene expression programs. The Hippo pathway inhibits the YAP-TEAD hybrid transcription factors by phosphorylating and promoting cytoplasmic retention of YAP. Here we report the crystal structure of the YAP-binding domain (YBD) of human TEAD2. TEAD2 YBD adopts an immunoglobulin-like {beta}-sandwich fold with two extra helix-turn-helixmore » inserts. NMR studies reveal that the TEAD-binding domain of YAP is natively unfolded and that TEAD binding causes localized conformational changes in YAP. In vitro binding and in vivo functional assays define an extensive conserved surface of TEAD2 YBD as the YAP-binding site. Therefore, our studies suggest that a short segment of YAP adopts an extended conformation and forms extensive contacts with a rigid surface of TEAD. Targeting a surface-exposed pocket of TEAD might be an effective strategy to disrupt the YAP-TEAD interaction and to reduce the oncogenic potential of YAP.« less
Positive selection in octopus haemocyanin indicates functional links to temperature adaptation.
Oellermann, Michael; Strugnell, Jan M; Lieb, Bernhard; Mark, Felix C
2015-07-05
Octopods have successfully colonised the world's oceans from the tropics to the poles. Yet, successful persistence in these habitats has required adaptations of their advanced physiological apparatus to compensate impaired oxygen supply. Their oxygen transporter haemocyanin plays a major role in cold tolerance and accordingly has undergone functional modifications to sustain oxygen release at sub-zero temperatures. However, it remains unknown how molecular properties evolved to explain the observed functional adaptations. We thus aimed to assess whether natural selection affected molecular and structural properties of haemocyanin that explains temperature adaptation in octopods. Analysis of 239 partial sequences of the haemocyanin functional units (FU) f and g of 28 octopod species of polar, temperate, subtropical and tropical origin revealed natural selection was acting primarily on charge properties of surface residues. Polar octopods contained haemocyanins with higher net surface charge due to decreased glutamic acid content and higher numbers of basic amino acids. Within the analysed partial sequences, positive selection was present at site 2545, positioned between the active copper binding centre and the FU g surface. At this site, methionine was the dominant amino acid in polar octopods and leucine was dominant in tropical octopods. Sites directly involved in oxygen binding or quaternary interactions were highly conserved within the analysed sequence. This study has provided the first insight into molecular and structural mechanisms that have enabled octopods to sustain oxygen supply from polar to tropical conditions. Our findings imply modulation of oxygen binding via charge-charge interaction at the protein surface, which stabilize quaternary interactions among functional units to reduce detrimental effects of high pH on venous oxygen release. Of the observed partial haemocyanin sequence, residue 2545 formed a close link between the FU g surface and the active centre, suggesting a role as allosteric binding site. The prevalence of methionine at this site in polar octopods, implies regulation of oxygen affinity via increased sensitivity to allosteric metal binding. High sequence conservation of sites directly involved in oxygen binding indicates that functional modifications of octopod haemocyanin rather occur via more subtle mechanisms, as observed in this study.
USDA-ARS?s Scientific Manuscript database
Lmof2365_2117 is a Listeria monocytogenes putative cell wall surface anchor protein with a conserved domain found in collagen binding proteins. We constructed a deletion mutation in lmof2365_2117 in serotype 4b strain F2365, evaluated its virulence, and determined its ability to adhere and invade co...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Leger, M.; Morvan, J.M.; Thibaut, M.
Restoration of a geologic structure at earlier times is a good means to criticize, and next to improve, its interpretation. Restoration softwares already exist in 2D, but a lot of work remains to be done in 3D. The authors focus on the interbedding slip phenomenon, with bed-length and volume conservation. They unfold a (geometrical) foliation by optimizing following least-squares criteria: horizontalness, bed-length and volume conservation, under equality constraints related to the position of the ``binding`` or ``pin-surface``
Vasta, Gerardo R.; Ahmed, Hafiz; Nita-Lazar, Mihai; Banerjee, Aditi; Pasek, Marta; Shridhar, Surekha; Guha, Prasun; Fernández-Robledo, José A.
2012-01-01
Galectins are characterized by their binding affinity for β-galactosides, a unique binding site sequence motif, and wide taxonomic distribution and structural conservation in vertebrates, invertebrates, protista, and fungi. Since their initial description, galectins were considered to bind endogenous (“self”) glycans and mediate developmental processes and cancer. In the past few years, however, numerous studies have described the diverse effects of galectins on cells involved in both innate and adaptive immune responses, and the mechanistic aspects of their regulatory roles in immune homeostasis. More recently, however, evidence has accumulated to suggest that galectins also bind exogenous (“non-self”) glycans on the surface of potentially pathogenic microbes, parasites, and fungi, suggesting that galectins can function as pattern recognition receptors (PRRs) in innate immunity. Thus, a perplexing paradox arises by the fact that galectins also recognize lactosamine-containing glycans on the host cell surface during developmental processes and regulation of immune responses. According to the currently accepted model for non-self recognition, PRRs recognize pathogens via highly conserved microbial surface molecules of wide distribution such as LPS or peptidoglycan (pathogen-associated molecular patterns; PAMPs), which are absent in the host. Hence, this would not apply to galectins, which apparently bind similar self/non-self molecular patterns on host and microbial cells. This paradox underscores first, an oversimplification in the use of the PRR/PAMP terminology. Second, and most importantly, it reveals significant gaps in our knowledge about the diversity of the host galectin repertoire, and the subcellular targeting, localization, and secretion. Furthermore, our knowledge about the structural and biophysical aspects of their interactions with the host and microbial carbohydrate moieties is fragmentary, and warrants further investigation. PMID:22811679
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hua, Q. X. H.; Dementieva, I. S. D.; Walsh, M. A. W.
2001-02-23
A homologue of the Escherichia coli GroEL apical domain was obtained from thermophilic eubacterium Thermus thermophilus. The domains share 70 % sequence identity (101 out of 145 residues). The thermal stability of the T. thermophilus apical domain (T{sub m}>100{sup o}C as evaluated by circular dichroism) is at least 35{sup o}C greater than that of the E. coli apical domain (T{sub m}=65{sup o}C). The crystal structure of a selenomethione-substituted apical domain from T. thermophilus was determined to a resolution of 1.78 {angstrom} using multiwavelength-anomalous-diffraction phasing. The structure is similar to that of the E. coli apical domain (root-mean-square deviation 0.45 {angstrom}more » based on main-chain atoms). The thermophilic structure contains seven additional salt bridges of which four contain charge-stabilized hydrogen bonds. Only one of the additional salt bridges would face the 'Anfinsen cage' in GroEL. High temperatures were exploited to map sites of interactions between the apical domain and molten globules. NMR footprints of apical domain-protein complexes were obtained at elevated temperature using {sup 15}N-{sup 1}H correlation spectra of {sup 15}N-labeled apical domain. Footprints employing two polypeptides unrelated in sequence or structure (an insulin monomer and the SRY high-mobility-group box, each partially unfolded at 50{sup o}C) are essentially the same and consistent with the peptide-binding surface previously defined in E. coli GroEL and its apical domain-peptide complexes. An additional part of this surface comprising a short N-terminal {alpha}-helix is observed. The extended footprint rationalizes mutagenesis studies of intact GroEL in which point mutations affecting substrate binding were found outside the 'classical' peptide-binding site. Our results demonstrate structural conservation of the apical domain among GroEL homologues and conservation of an extended non-polar surface recognizing diverse polypeptides.« less
Xu, Qingping; Traag, Bjørn A.; Willemse, Joost; McMullan, Daniel; Miller, Mitchell D.; Elsliger, Marc-André; Abdubek, Polat; Astakhova, Tamara; Axelrod, Herbert L.; Bakolitsa, Constantina; Carlton, Dennis; Chen, Connie; Chiu, Hsiu-Ju; Chruszcz, Maksymilian; Clayton, Thomas; Das, Debanu; Deller, Marc C.; Duan, Lian; Ellrott, Kyle; Ernst, Dustin; Farr, Carol L.; Feuerhelm, Julie; Grant, Joanna C.; Grzechnik, Anna; Grzechnik, Slawomir K.; Han, Gye Won; Jaroszewski, Lukasz; Jin, Kevin K.; Klock, Heath E.; Knuth, Mark W.; Kozbial, Piotr; Krishna, S. Sri; Kumar, Abhinav; Marciano, David; Minor, Wladek; Mommaas, A. Mieke; Morse, Andrew T.; Nigoghossian, Edward; Nopakun, Amanda; Okach, Linda; Oommachen, Silvya; Paulsen, Jessica; Puckett, Christina; Reyes, Ron; Rife, Christopher L.; Sefcovic, Natasha; Tien, Henry J.; Trame, Christine B.; van den Bedem, Henry; Wang, Shuren; Weekes, Dana; Hodgson, Keith O.; Wooley, John; Deacon, Ashley M.; Godzik, Adam; Lesley, Scott A.; Wilson, Ian A.; van Wezel, Gilles P.
2009-01-01
SsgA-like proteins (SALPs) are a family of homologous cell division-related proteins that occur exclusively in morphologically complex actinomycetes. We show that SsgB, a subfamily of SALPs, is the archetypal SALP that is functionally conserved in all sporulating actinomycetes. Sporulation-specific cell division of Streptomyces coelicolor ssgB mutants is restored by introduction of distant ssgB orthologues from other actinomycetes. Interestingly, the number of septa (and spores) of the complemented null mutants is dictated by the specific ssgB orthologue that is expressed. The crystal structure of the SsgB from Thermobifida fusca was determined at 2.6 Å resolution and represents the first structure for this family. The structure revealed similarities to a class of eukaryotic “whirly” single-stranded DNA/RNA-binding proteins. However, the electro-negative surface of the SALPs suggests that neither SsgB nor any of the other SALPs are likely to interact with nucleotide substrates. Instead, we show that a conserved hydrophobic surface is likely to be important for SALP function and suggest that proteins are the likely binding partners. PMID:19567872
Functions of galectins as 'self/non-self'-recognition and effector factors.
Vasta, Gerardo R; Feng, Chiguang; González-Montalbán, Nuria; Mancini, Justin; Yang, Lishi; Abernathy, Kelsey; Frost, Graeme; Palm, Cheyenne
2017-07-31
Carbohydrate structures on the cell surface encode complex information that through specific recognition by carbohydrate-binding proteins (lectins) modulates interactions between cells, cells and the extracellular matrix, or mediates recognition of potential microbial pathogens. Galectins are a family of ß-galactoside-binding lectins, which are evolutionary conserved and have been identified in most organisms, from fungi to invertebrates and vertebrates, including mammals. Since their discovery in the 1970s, their biological roles, initially understood as limited to recognition of endogenous carbohydrate ligands in embryogenesis and development, have expanded in recent years by the discovery of their roles in tissue repair and regulation of immune homeostasis. More recently, evidence has accumulated to support the notion that galectins can also bind glycans on the surface of potentially pathogenic microbes, and function as recognition and effector factors in innate immunity, thus establishing a new paradigm. Furthermore, some parasites 'subvert' the recognition roles of the vector/host galectins for successful attachment or invasion. These recent findings have revealed a striking functional diversification in this structurally conserved lectin family. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Barre, Annick; Sordet, Camille; Culerrier, Raphaël; Rancé, Fabienne; Didier, Alain; Rougé, Pierre
2008-03-01
Surface-exposed IgE-binding epitopes of close overall conformation were characterized on the molecular surface of three-dimensional models built for the vicilin allergens of peanut (Ara h 1), walnut (Jug r 2), hazelnut (Cor a 11) and cashew nut (Ana o 1). They correspond to linear stretches of conserved amino acid sequences mainly located along the C-terminus of the polypeptide chains. A glyco-epitope corresponding to an exposed N-glycosylation site could also interfere with the IgE-binding epitopes. All these epitopic regions should participate in the IgE-binding cross-reactivity commonly reported between tree nuts or between peanut and some tree nuts in sensitized individuals. Owing to this epitopic community which constitutes a risk of cross-sensitization, the avoidance or a restricted consumption of other tree nuts should be recommended to peanut-sensitized individuals.
A Shared Docking Motif in TRF1 and TRF2 Used for Differential Recruitment of Telomeric Proteins
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Yong; Yang, Yuting; van Overbeek, Megan
2008-05-01
Mammalian telomeres are protected by a six-protein complex: shelterin. Shelterin contains two closely related proteins (TRF1 and TRF2), which recruit various proteins to telomeres. We dissect the interactions of TRF1 and TRF2 with their shared binding partner (TIN2) and other shelterin accessory factors. TRF1 recognizes TIN2 using a conserved molecular surface in its TRF homology (TRFH) domain. However, this same surface does not act as a TIN2 binding site in TRF2, and TIN2 binding to TRF2 is mediated by a region outside the TRFH domain. Instead, the TRFH docking site of TRF2 binds a shelterin accessory factor (Apollo), which doesmore » not interact with the TRFH domain of TRF1. Conversely, the TRFH domain of TRF1, but not of TRF2, interacts with another shelterin-associated factor: PinX1.« less
Allosteric Signaling Is Bidirectional in an Outer-Membrane Transport Protein.
Sikora, Arthur; Joseph, Benesh; Matson, Morgan; Staley, Jacob R; Cafiso, David S
2016-11-01
In BtuB, the Escherichia coli TonB-dependent transporter for vitamin B 12 , substrate binding to the extracellular surface unfolds a conserved energy coupling motif termed the Ton box into the periplasm. This transmembrane signaling event facilitates an interaction between BtuB and the inner-membrane protein TonB. In this study, continuous-wave and pulse electron paramagnetic resonance in a native outer-membrane preparation demonstrate that signaling also occurs from the periplasmic to the extracellular surface in BtuB. The binding of a TonB fragment to the periplasmic interface alters the configuration of the second extracellular loop and partially dissociates a spin-labeled substrate analog. Moreover, mutants in the periplasmic Ton box that are transport-defective alter the binding site for vitamin B 12 in BtuB. This work demonstrates that the Ton box and the extracellular substrate binding site are allosterically coupled in BtuB, and that TonB binding may initiate a partial round of transport. Copyright © 2016 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Zhang, Xiaoxiao; Farah, Nadya; Rolston, Laura; Ericsson, Daniel J; Catanzariti, Ann-Maree; Bernoux, Maud; Ve, Thomas; Bendak, Katerina; Chen, Chunhong; Mackay, Joel P; Lawrence, Gregory J; Hardham, Adrienne; Ellis, Jeffrey G; Williams, Simon J; Dodds, Peter N; Jones, David A; Kobe, Bostjan
2018-05-01
The effector protein AvrP is secreted by the flax rust fungal pathogen (Melampsora lini) and recognized specifically by the flax (Linum usitatissimum) P disease resistance protein, leading to effector-triggered immunity. To investigate the biological function of this effector and the mechanisms of specific recognition by the P resistance protein, we determined the crystal structure of AvrP. The structure reveals an elongated zinc-finger-like structure with a novel interleaved zinc-binding topology. The residues responsible for zinc binding are conserved in AvrP effector variants and mutations of these motifs result in a loss of P-mediated recognition. The first zinc-coordinating region of the structure displays a positively charged surface and shows some limited similarities to nucleic acid-binding and chromatin-associated proteins. We show that the majority of the AvrP protein accumulates in the plant nucleus when transiently expressed in Nicotiana benthamiana cells, suggesting a nuclear pathogenic function. Polymorphic residues in AvrP and its allelic variants map to the protein surface and could be associated with differences in recognition specificity. Several point mutations of residues on the non-conserved surface patch result in a loss of recognition by P, suggesting that these residues are required for recognition. © 2017 BSPP AND JOHN WILEY & SONS LTD.
The PD-1/PD-L1 complex resembles the antigen-binding Fv domains of antibodies and T cell receptors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lin, David Yin-wei; Tanaka, Yoshimasa; Iwasaki, Masashi
2008-07-29
Signaling through the programmed death 1 (PD-1) inhibitory receptor upon binding its ligand, PD-L1, suppresses immune responses against autoantigens and tumors and plays an important role in the maintenance of peripheral immune tolerance. Release from PD-1 inhibitory signaling revives 'exhausted' virus-specific T cells in chronic viral infections. Here we present the crystal structure of murine PD-1 in complex with human PD-L1. PD-1 and PD-L1 interact through the conserved front and side of their Ig variable (IgV) domains, as do the IgV domains of antibodies and T cell receptors. This places the loops at the ends of the IgV domains onmore » the same side of the PD-1/PD-L1 complex, forming a surface that is similar to the antigen-binding surface of antibodies and T cell receptors. Mapping conserved residues allowed the identification of residues that are important in forming the PD-1/PD-L1 interface. Based on the structure, we show that some reported loss-of-binding mutations involve the PD-1/PD-L1 interaction but that others compromise protein folding. The PD-1/PD-L1 interaction described here may be blocked by antibodies or by designed small-molecule drugs to lower inhibitory signaling that results in a stronger immune response. The immune receptor-like loops offer a new surface for further study and potentially the design of molecules that would affect PD-1/PD-L1 complex formation and thereby modulate the immune response.« less
Rosenbaum, Sabrina; Kreft, Sandra; Etich, Julia; Frie, Christian; Stermann, Jacek; Grskovic, Ivan; Frey, Benjamin; Mielenz, Dirk; Pöschl, Ernst; Gaipl, Udo; Paulsson, Mats; Brachvogel, Bent
2011-02-18
Identification and clearance of apoptotic cells prevents the release of harmful cell contents thereby suppressing inflammation and autoimmune reactions. Highly conserved annexins may modulate the phagocytic cell removal by acting as bridging molecules to phosphatidylserine, a characteristic phagocytosis signal of dying cells. In this study five members of the structurally and functionally related annexin family were characterized for their capacity to interact with phosphatidylserine and dying cells. The results showed that AnxA3, AnxA4, AnxA13, and the already described interaction partner AnxA5 can bind to phosphatidylserine and apoptotic cells, whereas AnxA8 lacks this ability. Sequence alignment experiments located the essential amino residues for the recognition of surface exposed phosphatidylserine within the calcium binding motifs common to all annexins. These amino acid residues were missing in the evolutionary young AnxA8 and when they were reintroduced by site directed mutagenesis AnxA8 gains the capability to interact with phosphatidylserine containing liposomes and apoptotic cells. By defining the evolutionary conserved amino acid residues mediating phosphatidylserine binding of annexins we show that the recognition of dying cells represent a common feature of most annexins. Hence, the individual annexin repertoire bound to the cell surface of dying cells may fulfil opsonin-like function in cell death recognition.
Allosteric mechanism controls traffic in the chaperone/usher pathway.
Di Yu, Xiao; Dubnovitsky, Anatoly; Pudney, Alex F; Macintyre, Sheila; Knight, Stefan D; Zavialov, Anton V
2012-11-07
Many virulence organelles of Gram-negative bacterial pathogens are assembled via the chaperone/usher pathway. The chaperone transports organelle subunits across the periplasm to the outer membrane usher, where they are released and incorporated into growing fibers. Here, we elucidate the mechanism of the usher-targeting step in assembly of the Yersinia pestis F1 capsule at the atomic level. The usher interacts almost exclusively with the chaperone in the chaperone:subunit complex. In free chaperone, a pair of conserved proline residues at the beginning of the subunit-binding loop form a "proline lock" that occludes the usher-binding surface and blocks usher binding. Binding of the subunit to the chaperone rotates the proline lock away from the usher-binding surface, allowing the chaperone-subunit complex to bind to the usher. We show that the proline lock exists in other chaperone/usher systems and represents a general allosteric mechanism for selective targeting of chaperone:subunit complexes to the usher and for release and recycling of the free chaperone. Copyright © 2012 Elsevier Ltd. All rights reserved.
Campos-Olivas, R; Hörr, I; Bormann, C; Jung, G; Gronenborn, A M
2001-05-11
AFP1 is a recently discovered anti-fungal, chitin-binding protein from Streptomyces tendae Tü901. Mature AFP1 comprises 86 residues and exhibits limited sequence similarity to the cellulose-binding domains of bacterial cellulases and xylanases. No similarity to the Cys and Gly-rich domains of plant chitin-binding proteins (e.g. agglutinins, lectins, hevein) is observed. AFP1 is the first chitin-binding protein from a bacterium for which anti-fungal activity was shown. Here, we report the three-dimensional solution structure of AFP1, determined by nuclear magnetic resonance spectroscopy. The protein contains two antiparallel beta-sheets (five and four beta-strands each), that pack against each other in a parallel beta-sandwich. This type of architecture is conserved in the functionally related family II of cellulose-binding domains, albeit with different connectivity. A similar fold is also observed in other unrelated proteins (spore coat protein from Myxococcus xanthus, beta-B2 and gamma-B crystallins from Bos taurus, canavalin from Jack bean). AFP1 is therefore classified as a new member of the betagamma-crystallin superfamily. The dynamics of the protein was characterized by NMR using amide 15N relaxation and solvent exchange data. We demonstrate that the protein exhibits an axially symmetric (oblate-like) rotational diffusion tensor whose principal axis coincides to within 15 degrees with that of the inertial tensor. After completion of the present structure of AFP1, an identical fold was reported for a Streptomyces killer toxin-like protein. Based on sequence comparisons and clustering of conserved residues on the protein surface for different cellulose and chitin-binding proteins, we postulate a putative sugar-binding site for AFP1. The inability of the protein to bind short chitin fragments suggests that certain particular architectural features of the solid chitin surface are crucial for the interaction. Copyright 2001 Academic Press.
Electrostatic steering and ionic tethering in enzyme-ligand binding: insights from simulations.
Wade, R C; Gabdoulline, R R; Lüdemann, S K; Lounnas, V
1998-05-26
To bind at an enzyme's active site, a ligand must diffuse or be transported to the enzyme's surface, and, if the binding site is buried, the ligand must diffuse through the protein to reach it. Although the driving force for ligand binding is often ascribed to the hydrophobic effect, electrostatic interactions also influence the binding process of both charged and nonpolar ligands. First, electrostatic steering of charged substrates into enzyme active sites is discussed. This is of particular relevance for diffusion-influenced enzymes. By comparing the results of Brownian dynamics simulations and electrostatic potential similarity analysis for triose-phosphate isomerases, superoxide dismutases, and beta-lactamases from different species, we identify the conserved features responsible for the electrostatic substrate-steering fields. The conserved potentials are localized at the active sites and are the primary determinants of the bimolecular association rates. Then we focus on a more subtle effect, which we will refer to as "ionic tethering." We explore, by means of molecular and Brownian dynamics simulations and electrostatic continuum calculations, how salt links can act as tethers between structural elements of an enzyme that undergo conformational change upon substrate binding, and thereby regulate or modulate substrate binding. This is illustrated for the lipase and cytochrome P450 enzymes. Ionic tethering can provide a control mechanism for substrate binding that is sensitive to the electrostatic properties of the enzyme's surroundings even when the substrate is nonpolar.
Conservation of transcription factor binding events predicts gene expression across species
Hemberg, Martin; Kreiman, Gabriel
2011-01-01
Recent technological advances have made it possible to determine the genome-wide binding sites of transcription factors (TFs). Comparisons across species have suggested a relatively low degree of evolutionary conservation of experimentally defined TF binding events (TFBEs). Using binding data for six different TFs in hepatocytes and embryonic stem cells from human and mouse, we demonstrate that evolutionary conservation of TFBEs within orthologous proximal promoters is closely linked to function, defined as expression of the target genes. We show that (i) there is a significantly higher degree of conservation of TFBEs when the target gene is expressed in both species; (ii) there is increased conservation of binding events for groups of TFs compared to individual TFs; and (iii) conserved TFBEs have a greater impact on the expression of their target genes than non-conserved ones. These results link conservation of structural elements (TFBEs) to conservation of function (gene expression) and suggest a higher degree of functional conservation than implied by previous studies. PMID:21622661
DOE Office of Scientific and Technical Information (OSTI.GOV)
Marcianò, G.; Huang, D. T., E-mail: d.huang@beatson.gla.ac.uk
The Spt16–SSRP1 heterodimer is a histone chaperone that plays an important role in regulating chromatin assembly. Here, a crystal structure of the N-terminal domain of human Spt16 is presented and it is shown that this domain may contribute to histone binding. The histone chaperone FACT plays an important role in facilitating nucleosome assembly and disassembly during transcription. FACT is a heterodimeric complex consisting of Spt16 and SSRP1. The N-terminal domain of Spt16 resembles an inactive aminopeptidase. How this domain contributes to the histone chaperone activity of FACT remains elusive. Here, the crystal structure of the N-terminal domain (NTD) of humanmore » Spt16 is reported at a resolution of 1.84 Å. The structure adopts an aminopeptidase-like fold similar to those of the Saccharomyces cerevisiae and Schizosaccharomyces pombe Spt16 NTDs. Isothermal titration calorimetry analyses show that human Spt16 NTD binds histones H3/H4 with low-micromolar affinity, suggesting that Spt16 NTD may contribute to histone binding in the FACT complex. Surface-residue conservation and electrostatic analysis reveal a conserved acidic patch that may be involved in histone binding.« less
Lahr, Roni M; Mack, Seshat M; Héroux, Annie; Blagden, Sarah P; Bousquet-Antonelli, Cécile; Deragon, Jean-Marc; Berman, Andrea J
2015-09-18
La-related protein 1 (LARP1) regulates the stability of many mRNAs. These include 5'TOPs, mTOR-kinase responsive mRNAs with pyrimidine-rich 5' UTRs, which encode ribosomal proteins and translation factors. We determined that the highly conserved LARP1-specific C-terminal DM15 region of human LARP1 directly binds a 5'TOP sequence. The crystal structure of this DM15 region refined to 1.86 Å resolution has three structurally related and evolutionarily conserved helix-turn-helix modules within each monomer. These motifs resemble HEAT repeats, ubiquitous helical protein-binding structures, but their sequences are inconsistent with consensus sequences of known HEAT modules, suggesting this structure has been repurposed for RNA interactions. A putative mTORC1-recognition sequence sits within a flexible loop C-terminal to these repeats. We also present modelling of pyrimidine-rich single-stranded RNA onto the highly conserved surface of the DM15 region. These studies lay the foundation necessary for proceeding toward a structural mechanism by which LARP1 links mTOR signalling to ribosome biogenesis. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Lahr, Roni M.; Mack, Seshat M.; Heroux, Annie; ...
2015-07-22
La-related protein 1 (LARP1) regulates the stability of many mRNAs. These include 5'TOPs, mTOR-kinase responsive mRNAs with pyrimidine-rich 5' UTRs, which encode ribosomal proteins and translation factors. We determined that the highly conserved LARP1-specific C-terminal DM15 region of human LARP1 directly binds a 5'TOP sequence. The crystal structure of this DM15 region refined to 1.86 Å resolution has three structurally related and evolutionarily conserved helix-turn-helix modules within each monomer. These motifs resemble HEAT repeats, ubiquitous helical protein-binding structures, but their sequences are inconsistent with consensus sequences of known HEAT modules, suggesting this structure has been repurposed for RNA interactions. Amore » putative mTORC1-recognition sequence sits within a flexible loop C-terminal to these repeats. We also present modelling of pyrimidine-rich single-stranded RNA onto the highly conserved surface of the DM15 region. Ultimately, these studies lay the foundation necessary for proceeding toward a structural mechanism by which LARP1 links mTOR signalling to ribosome biogenesis.« less
A gate-latch-lock mechanism for hormone signalling by abscisic acid receptors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Melcher, Karsten; Ng, Ley-Moy; Zhou, X Edward
2010-01-12
Abscisic acid (ABA) is a ubiquitous hormone that regulates plant growth, development and responses to environmental stresses. Its action is mediated by the PYR/PYL/RCAR family of START proteins, but it remains unclear how these receptors bind ABA and, in turn, how hormone binding leads to inhibition of the downstream type 2C protein phosphatase (PP2C) effectors. Here we report crystal structures of apo and ABA-bound receptors as well as a ternary PYL2-ABA-PP2C complex. The apo receptors contain an open ligand-binding pocket flanked by a gate that closes in response to ABA by way of conformational changes in two highly conserved β-loopsmore » that serve as a gate and latch. Moreover, ABA-induced closure of the gate creates a surface that enables the receptor to dock into and competitively inhibit the PP2C active site. A conserved tryptophan in the PP2C inserts directly between the gate and latch, which functions to further lock the receptor in a closed conformation. Together, our results identify a conserved gate-latch-lock mechanism underlying ABA signalling.« less
The Vibrio cholerae VprA-VprB Two-Component System Controls Virulence Through Endotoxin Modification
2014-12-23
antimicrobial peptides of the innate immune system bind to the membrane of Gram-negative pathogens via conserved, surface-exposed lipopolysaccharide (LPS... antimicrobial peptide polymyxin. However, the regulatory mechanisms of lipid A modification in V. 1. REPORT DATE (DD-MM-YYYY) 4. TITLE AND SUBTITLE...12211 Research Triangle Park, NC 27709-2211 bacterial cell surface, host immune system, cationic antimicrobial peptides , lipid A, LPS REPORT
NASA Astrophysics Data System (ADS)
Poornima, C. S.; Dean, P. M.
1995-12-01
Water molecules are known to play an important rôle in mediating protein-ligand interactions. If water molecules are conserved at the ligand-binding sites of homologous proteins, such a finding may suggest the structural importance of water molecules in ligand binding. Structurally conserved water molecules change the conventional definition of `binding sites' by changing the shape and complementarity of these sites. Such conserved water molecules can be important for site-directed ligand/drug design. Therefore, five different sets of homologous protein/protein-ligand complexes have been examined to identify the conserved water molecules at the ligand-binding sites. Our analysis reveals that there are as many as 16 conserved water molecules at the FAD binding site of glutathione reductase between the crystal structures obtained from human and E. coli. In the remaining four sets of high-resolution crystal structures, 2-4 water molecules have been found to be conserved at the ligand-binding sites. The majority of these conserved water molecules are either bound in deep grooves at the protein-ligand interface or completely buried in cavities between the protein and the ligand. All these water molecules, conserved between the protein/protein-ligand complexes from different species, have identical or similar apolar and polar interactions in a given set. The site residues interacting with the conserved water molecules at the ligand-binding sites have been found to be highly conserved among proteins from different species; they are more conserved compared to the other site residues interacting with the ligand. These water molecules, in general, make multiple polar contacts with protein-site residues.
Ramey, Jordan D.; Villareal, Valerie A.; Ng, Charles; Ward, Sabrina; Xiong, Jian-Ping; Clubb, Robert T.; Bradley, Kenneth A.
2010-01-01
Anthrax toxin receptor 1 (ANTXR1) / tumor endothelial marker 8 (TEM8) is one of two known proteinaceous cell surface anthrax toxin receptors. A metal ion dependent adhesion site (MIDAS) present in the integrin-like inserted (I) domain of ANTXR1 mediates the binding of the anthrax toxin subunit, protective antigen (PA). Here we provide evidence that single point mutations in the I domain can override regulation of ANTXR1 ligand-binding activity mediated by intracellular signals. A previously reported MIDAS-mutant of ANTXR1 (T118A) was found to retain normal metal ion binding and secondary structure but failed to bind PA, consistent with a locked inactive state. Conversely, mutation of a conserved I domain phenylalanine residue to a tryptophan (F205W) increased the proportion of cell-surface ANTXR1 that bound PA, consistent with a locked active state. Interestingly, the KD and total amount of PA bound by the isolated ANTXR1 I domain was not affected by the F205W mutation, indicating that ANTXR1 is preferentially found in the active state in the absence of inside-out signaling. Circular dichroism (CD) spectroscopy and 1H-15N heteronuclear single quantum coherence (HSQC) nuclear magnetic resonance (NMR) revealed that structural changes between T118A, F205W and WT I domains were minor despite a greater than 103-fold difference in their abilities to bind toxin. Regulation of toxin binding has important implications for the design of toxin inhibitors and for the targeting of ANTXR1 for anti-tumor therapies. PMID:20690680
Forsell, Mattias N E; Dey, Barna; Mörner, Andreas; Svehla, Krisha; O'dell, Sijy; Högerkorp, Carl-Magnus; Voss, Gerald; Thorstensson, Rigmor; Shaw, George M; Mascola, John R; Karlsson Hedestam, Gunilla B; Wyatt, Richard T
2008-10-03
The surface HIV-1 exterior envelope glycoprotein, gp120, binds to CD4 on the target cell surface to induce the co-receptor binding site on gp120 as the initial step in the entry process. The binding site is comprised of a highly conserved region on the gp120 core, as well as elements of the third variable region (V3). Antibodies against the co-receptor binding site are abundantly elicited during natural infection of humans, but the mechanism of elicitation has remained undefined. In this study, we investigate the requirements for elicitation of co-receptor binding site antibodies by inoculating rabbits, monkeys and human-CD4 transgenic (huCD4) rabbits with envelope glycoprotein (Env) trimers possessing high affinity for primate CD4. A cross-species comparison of the antibody responses showed that similar HIV-1 neutralization breadth was elicited by Env trimers in monkeys relative to wild-type (WT) rabbits. In contrast, antibodies against the co-receptor site on gp120 were elicited only in monkeys and huCD4 rabbits, but not in the WT rabbits. This was supported by the detection of high-titer co-receptor antibodies in all sera from a set derived from human volunteers inoculated with recombinant gp120. These findings strongly suggest that complexes between Env and (high-affinity) primate CD4 formed in vivo are responsible for the elicitation of the co-receptor-site-directed antibodies. They also imply that the naïve B cell receptor repertoire does not recognize the gp120 co-receptor site in the absence of CD4 and illustrate that conformational stabilization, imparted by primary receptor interaction, can alter the immunogenicity of a type 1 viral membrane protein.
Lsa63, a newly identified surface protein of Leptospira interrogans binds laminin and collagen IV.
Vieira, Monica L; de Morais, Zenaide M; Gonçales, Amane P; Romero, Eliete C; Vasconcellos, Silvio A; Nascimento, Ana L T O
2010-01-01
Leptospira interrogans is the etiological agent of leptospirosis, a zoonotic disease that affects populations worldwide. We have identified in proteomic studies a protein that is encoded by the gene LIC10314 and expressed in virulent strain of L. interrogans serovar Pomona. This protein was predicted to be surface exposed by PSORT program and contains a p83/100 domain identified by BLAST analysis that is conserved in protein antigens of several strains of Borrelia and Treponema spp. The proteins containing this domain have been claimed antigen candidates for serodiagnosis of Lyme borreliosis. Thus, we have cloned the LIC10314 and expressed the protein in Escherichia coli BL21-SI strain by using the expression vector pAE. The recombinant protein tagged with N-terminal hexahistidine was purified by metal-charged chromatography and characterized by circular dichroism spectroscopy. This protein is conserved among several species of pathogenic Leptospira and absent in the saprophytic strain L. biflexa. We confirm by liquid-phase immunofluorescence assays with living organisms that this protein is most likely a new surface leptospiral protein. The ability of the protein to mediate attachment to ECM components was evaluated by binding assays. The leptospiral protein encoded by LIC10314, named Lsa63 (Leptospiral surface adhesin of 63kDa), binds strongly to laminin and collagen IV in a dose-dependent and saturable fashion. In addition, Lsa63 is probably expressed during infection since it was recognized by antibodies of serum samples of confirmed-leptospirosis patients in convalescent phase of the disease. Altogether, the data suggests that this novel identified surface protein may be involved in leptospiral pathogenesis. 2009 The British Infection Society. Published by Elsevier Ltd. All rights reserved.
Wang, Lan; Ren, Shifang; Zhu, Haiyan; Zhang, Dongmei; Hao, Yuqing; Ruan, Yuanyuan; Zhou, Lei; Lee, Chiayu; Qiu, Lin; Yun, Xiaojing; Xie, Jianhui
2012-08-01
CLEC-2 was first identified by sequence similarity to C-type lectin-like molecules with immune functions and has been reported as a receptor for the platelet-aggregating snake venom toxin rhodocytin and the endogenous sialoglycoprotein podoplanin. Recent researches indicate that CLEC-2-deficient mice were lethal at the embryonic stage associated with disorganized and blood-filled lymphatic vessels and severe edema. In view of a necessary role of CLEC-2 in the individual development, it is of interest to investigate its phylogenetic homology and highly conserved functional regions. In this work, we reported that CLEC-2 from different species holds with an extraordinary conservation by sequence alignment and phylogenetic tree analysis. The functional structures including N-linked oligosaccharide sites and ligand-binding domain implement a structural and functional conservation in a variety of species. The glycosylation sites (N120 and N134) are necessary for the surface expression CLEC-2. CLEC-2 from different species possesses the binding activity of mouse podoplanin. Nevertheless, the expression of CLEC-2 is regulated with a species-specific manner. The alternative splicing of pre-mRNA, a regulatory mechanism of gene expression, and the binding sites on promoter for several key transcription factors vary between different species. Therefore, CLEC-2 shares high sequence homology and functional identity. However the transcript expression might be tightly regulated by different mechanisms in evolution.
SCM, the M Protein of Streptococcus canis Binds Immunoglobulin G
Bergmann, Simone; Eichhorn, Inga; Kohler, Thomas P.; Hammerschmidt, Sven; Goldmann, Oliver; Rohde, Manfred; Fulde, Marcus
2017-01-01
The M protein of Streptococcus canis (SCM) is a virulence factor and serves as a surface-associated receptor with a particular affinity for mini-plasminogen, a cleavage product of the broad-spectrum serine protease plasmin. Here, we report that SCM has an additional high-affinity immunoglobulin G (IgG) binding activity. The ability of a particular S. canis isolate to bind to IgG significantly correlates with a scm-positive phenotype, suggesting a dominant role of SCM as an IgG receptor. Subsequent heterologous expression of SCM in non-IgG binding S. gordonii and Western Blot analysis with purified recombinant SCM proteins confirmed its IgG receptor function. As expected for a zoonotic agent, the SCM-IgG interaction is species-unspecific, with a particular affinity of SCM for IgGs derived from human, cats, dogs, horses, mice, and rabbits, but not from cows and goats. Similar to other streptococcal IgG-binding proteins, the interaction between SCM and IgG occurs via the conserved Fc domain and is, therefore, non-opsonic. Interestingly, the interaction between SCM and IgG-Fc on the bacterial surface specifically prevents opsonization by C1q, which might constitute another anti-phagocytic mechanism of SCM. Extensive binding analyses with a variety of different truncated SCM fragments defined a region of 52 amino acids located in the central part of the mature SCM protein which is important for IgG binding. This binding region is highly conserved among SCM proteins derived from different S. canis isolates but differs significantly from IgG-Fc receptors of S. pyogenes and S. dysgalactiae sub. equisimilis, respectively. In summary, we present an additional role of SCM in the pathogen-host interaction of S. canis. The detailed analysis of the SCM-IgG interaction should contribute to a better understanding of the complex roles of M proteins in streptococcal pathogenesis. PMID:28401063
DOE Office of Scientific and Technical Information (OSTI.GOV)
Comess, Kenneth M.; Sun, Chaohong; Abad-Zapatero, Cele
Inhibition of protein kinases has validated therapeutic utility for cancer, with at least seven kinase inhibitor drugs on the market. Protein kinase inhibition also has significant potential for a variety of other diseases, including diabetes, pain, cognition, and chronic inflammatory and immunologic diseases. However, as the vast majority of current approaches to kinase inhibition target the highly conserved ATP-binding site, the use of kinase inhibitors in treating nononcology diseases may require great selectivity for the target kinase. As protein kinases are signal transducers that are involved in binding to a variety of other proteins, targeting alternative, less conserved sites onmore » the protein may provide an avenue for greater selectivity. Here we report an affinity-based, high-throughput screening technique that allows nonbiased interrogation of small molecule libraries for binding to all exposed sites on a protein surface. This approach was used to screen both the c-Jun N-terminal protein kinase Jnk-1 (involved in insulin signaling) and p38{alpha} (involved in the formation of TNF{alpha} and other cytokines). In addition to canonical ATP-site ligands, compounds were identified that bind to novel allosteric sites. The nature, biological relevance, and mode of binding of these ligands were extensively characterized using two-dimensional {sup 1}H/{sup 13}C NMR spectroscopy, protein X-ray crystallography, surface plasmon resonance, and direct enzymatic activity and activation cascade assays. Jnk-1 and p38{alpha} both belong to the MAP kinase family, and the allosteric ligands for both targets bind similarly on a ledge of the protein surface exposed by the MAP insertion present in the CMGC family of protein kinases and distant from the active site. Medicinal chemistry studies resulted in an improved Jnk-1 ligand able to increase adiponectin secretion in human adipocytes and increase insulin-induced protein kinase PKB phosphorylation in human hepatocytes, in similar fashion to Jnk-1 siRNA and to rosiglitazone treatment. Together, the data suggest that these new ligand series bind to a novel, allosteric, and physiologically relevant site and therefore represent a unique approach to identify kinase inhibitors.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.
2004-10-28
We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.
When galectins recognize glycans: from biochemistry to physiology and back again.
Di Lella, Santiago; Sundblad, Victoria; Cerliani, Juan P; Guardia, Carlos M; Estrin, Dario A; Vasta, Gerardo R; Rabinovich, Gabriel A
2011-09-20
In the past decade, increasing efforts have been devoted to the study of galectins, a family of evolutionarily conserved glycan-binding proteins with multifunctional properties. Galectins function, either intracellularly or extracellularly, as key biological mediators capable of monitoring changes occurring on the cell surface during fundamental biological processes such as cellular communication, inflammation, development, and differentiation. Their highly conserved structures, exquisite carbohydrate specificity, and ability to modulate a broad spectrum of biological processes have captivated a wide range of scientists from a wide spectrum of disciplines, including biochemistry, biophysics, cell biology, and physiology. However, in spite of enormous efforts to dissect the functions and properties of these glycan-binding proteins, limited information about how structural and biochemical aspects of these proteins can influence biological functions is available. In this review, we aim to integrate structural, biochemical, and functional aspects of this bewildering and ancient family of glycan-binding proteins and discuss their implications in physiologic and pathologic settings. © 2011 American Chemical Society
Structure-function Analysis of Receptor-binding in Adeno-Associated Virus Serotype 6 (AAV-6)
Xie, Qing; Lerch, Thomas F.; Meyer, Nancy L.; Chapman, Michael S.
2011-01-01
Crystal structures of the AAV-6 capsid at 3 Å reveal a subunit fold homologous to other parvoviruses with greatest differences in two external loops. The electrostatic potential suggests that receptor-attachment is mediated by four residues: Arg576, Lys493, Lys459 and Lys531, defining a positively charged region curving up from the valley between adjacent spikes. It overlaps only partially with the receptor-binding site of AAV-2, and the residues endowing the electrostatic character are not homologous. Mutational substitution of each residue decreases heparin affinity, particularly Lys531 and Lys459. Neither is conserved among heparin-binding serotypes, indicating that diverse modes of receptor attachment have been selected in different serotypes. Surface topology and charge are also distinct at the shoulder of the spike, where linear epitopes for AAV-2’s neutralizing monoclonal antibody A20 come together. Evolutionarily, selection of changed side-chain charge may have offered a conservative means to evade immune neutralization while preserving other essential functionality. PMID:21917284
Functional Divergence of FimX in PilZ Binding and Type IV Pilus Regulation
Qi, Yaning; Xu, Linghui; Dong, Xueming; Yau, Yin Hoe; Ho, Chun Loong; Koh, Siew Lee; Shochat, Susana Geifman; Chou, Shan-Ho; Tang, Kai
2012-01-01
Type IV pili (T4P) are polar surface structures that play important roles in bacterial motility, biofilm formation, and pathogenicity. The protein FimX and its orthologs are known to mediate T4P formation in the human pathogen Pseudomonas aeruginosa and some other bacterial species. It was reported recently that FimXXAC2398 from Xanthomonas axonopodis pv. citri interacts with PilZXAC1133 directly through the nonenzymatic EAL domain of FimXXAC2398. Here we present experimental data to reveal that the strong interaction between FimXXAC2398 and PilZXAC1133 is not conserved in P. aeruginosa and likely other Pseudomonas species. In vitro and in vivo binding experiments showed that the interaction between FimX and PilZ in P. aeruginosa is below the measurable limit. Surface plasmon resonance assays further confirmed that the interaction between the P. aeruginosa proteins is at least more than 3 orders of magnitude weaker than that between the X. axonopodis pv. citri pair. The N-terminal lobe region of FimXXAC2398 was identified as the binding surface for PilZXAC1133 by amide hydrogen-deuterium exchange and site-directed mutagenesis studies. Lack of several key residues in the N-terminal lobe region of the EAL domain of FimX is likely to account for the greatly reduced binding affinity between FimX and PilZ in P. aeruginosa. All together, the results suggest that the interaction between PilZ and FimX in Xanthomonas species is not conserved in P. aeruginosa due to the evolutionary divergence among the FimX orthologs. The precise roles of FimX and PilZ in bacterial motility and T4P biogenesis are likely to vary among bacterial species. PMID:22942245
Solution structure and DNA-binding properties of the C-terminal domain of UvrC from E.coli
Singh, S.; Folkers, G.E.; Bonvin, A.M.J.J.; Boelens, R.; Wechselberger, R.; Niztayev, A.; Kaptein, R.
2002-01-01
The C-terminal domain of the UvrC protein (UvrC CTD) is essential for 5′ incision in the prokaryotic nucleotide excision repair process. We have determined the three-dimensional structure of the UvrC CTD using heteronuclear NMR techniques. The structure shows two helix–hairpin–helix (HhH) motifs connected by a small connector helix. The UvrC CTD is shown to mediate structure-specific DNA binding. The domain binds to a single-stranded–double-stranded junction DNA, with a strong specificity towards looped duplex DNA that contains at least six unpaired bases per loop (‘bubble DNA’). Using chemical shift perturbation experiments, the DNA-binding surface is mapped to the first hairpin region encompassing the conserved glycine–valine–glycine residues followed by lysine–arginine–arginine, a positively charged surface patch and the second hairpin region consisting of glycine–isoleucine–serine. A model for the protein– DNA complex is proposed that accounts for this specificity. PMID:12426397
DOE Office of Scientific and Technical Information (OSTI.GOV)
Light, Samuel H.; Minasov, George; Shuvalova, Ludmilla
2012-04-18
Dehydroquinate dehydratase (DHQD) catalyzes the third step in the biosynthetic shikimate pathway. We present three crystal structures of the Salmonella enterica type I DHQD that address the functionality of a surface loop that is observed to close over the active site following substrate binding. Two wild-type structures with differing loop conformations and kinetic and structural studies of a mutant provide evidence of both direct and indirect mechanisms of involvement of the loop in substrate binding. In addition to allowing amino acid side chains to establish a direct interaction with the substrate, closure of the loop necessitates a conformational change ofmore » a key active site arginine, which in turn positions the substrate productively. The absence of DHQD in humans and its essentiality in many pathogenic bacteria make the enzyme a target for the development of nontoxic antimicrobials. The structures and ligand binding insights presented here may inform the design of novel type I DHQD inhibiting molecules.« less
High-resolution structure of TBP with TAF1 reveals anchoring patterns in transcriptional regulation
Anandapadamanaban, Madhanagopal; Andresen, Cecilia; Helander, Sara; Ohyama, Yoshifumi; Siponen, Marina I.; Lundström, Patrik; Kokubo, Tetsuro; Ikura, Mitsuhiko; Moche, Martin; Sunnerhagen, Maria
2016-01-01
The general transcription factor TFIID provides a regulatory platform for transcription initiation. Here we present the crystal structure (1.97 Å) and NMR analysis of yeast TAF1 N-terminal domains TAND1 and TAND2 when bound to yeast TBP, together with mutational data. The yTAF1-TAND1, which in itself acts as a transcriptional activator, binds into the DNA-binding TBP concave surface by presenting similar anchor residues to TBP as E. coli Mot1 but from a distinct structural scaffold. Furthermore, we show how yTAF1-TAND2 employs an aromatic and acidic anchoring pattern to bind a conserved yTBP surface groove traversing the basic helix region, and we find highly similar TBP-binding motifs also presented by the structurally distinct TFIIA, Mot1 and Brf1 proteins. Our identification of these anchoring patterns, which can be easily disrupted or enhanced, provides compelling insight into the competitive multiprotein TBP interplay critical to transcriptional regulation. PMID:23851461
High-resolution structure of TBP with TAF1 reveals anchoring patterns in transcriptional regulation.
Anandapadamanaban, Madhanagopal; Andresen, Cecilia; Helander, Sara; Ohyama, Yoshifumi; Siponen, Marina I; Lundström, Patrik; Kokubo, Tetsuro; Ikura, Mitsuhiko; Moche, Martin; Sunnerhagen, Maria
2013-08-01
The general transcription factor TFIID provides a regulatory platform for transcription initiation. Here we present the crystal structure (1.97 Å) and NMR analysis of yeast TAF1 N-terminal domains TAND1 and TAND2 bound to yeast TBP, together with mutational data. We find that yeast TAF1-TAND1, which in itself acts as a transcriptional activator, binds TBP's concave DNA-binding surface by presenting similar anchor residues to TBP as does Mot1 but from a distinct structural scaffold. Furthermore, we show how TAF1-TAND2 uses an aromatic and acidic anchoring pattern to bind a conserved TBP surface groove traversing the basic helix region, and we find highly similar TBP-binding motifs also presented by the structurally distinct TFIIA, Mot1 and Brf1 proteins. Our identification of these anchoring patterns, which can be easily disrupted or enhanced, provides insight into the competitive multiprotein TBP interplay critical to transcriptional regulation.
Crystal Structure of the Heterotrimeric Integrin-Binding Region of Laminin-111.
Pulido, David; Hussain, Sadaf-Ahmahni; Hohenester, Erhard
2017-03-07
Laminins are cell-adhesive glycoproteins that are essential for basement membrane assembly and function. Integrins are important laminin receptors, but their binding site on the heterotrimeric laminins is poorly defined structurally. We report the crystal structure at 2.13 Å resolution of a minimal integrin-binding fragment of mouse laminin-111, consisting of ∼50 residues of α1β1γ1 coiled coil and the first three laminin G-like (LG) domains of the α1 chain. The LG domains adopt a triangular arrangement, with the C terminus of the coiled coil situated between LG1 and LG2. The critical integrin-binding glutamic acid residue in the γ1 chain tail is surface exposed and predicted to bind to the metal ion-dependent adhesion site in the integrin β1 subunit. Additional contacts to the integrin are likely to be made by the LG1 and LG2 surfaces adjacent to the γ1 chain tail, which are notably conserved and free of obstructing glycans. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Metrick, Claire M.; Heldwein, Ekaterina E.; Sandri-Goldin, R. M.
Proteins forming the tegument layers of herpesviral virions mediate many essential processes in the viral replication cycle, yet few have been characterized in detail. UL21 is one such multifunctional tegument protein and is conserved among alphaherpesviruses. While UL21 has been implicated in many processes in viral replication, ranging from nuclear egress to virion morphogenesis to cell-cell spread, its precise roles remain unclear. Here we report the 2.7-Å crystal structure of the C-terminal domain of herpes simplex virus 1 (HSV-1) UL21 (UL21C), which has a unique α-helical fold resembling a dragonfly. Analysis of evolutionary conservation patterns and surface electrostatics pinpointed fourmore » regions of potential functional importance on the surface of UL21C to be pursued by mutagenesis. In combination with the previously determined structure of the N-terminal domain of UL21, the structure of UL21C provides a 3-dimensional framework for targeted exploration of the multiple roles of UL21 in the replication and pathogenesis of alphaherpesviruses. Additionally, we describe an unanticipated ability of UL21 to bind RNA, which may hint at a yet unexplored function. IMPORTANCEDue to the limited genomic coding capacity of viruses, viral proteins are often multifunctional, which makes them attractive antiviral targets. Such multifunctionality, however, complicates their study, which often involves constructing and characterizing null mutant viruses. Systematic exploration of these multifunctional proteins requires detailed road maps in the form of 3-dimensional structures. In this work, we determined the crystal structure of the C-terminal domain of UL21, a multifunctional tegument protein that is conserved among alphaherpesviruses. Structural analysis pinpointed surface areas of potential functional importance that provide a starting point for mutagenesis. In addition, the unexpected RNA-binding ability of UL21 may expand its functional repertoire. The structure of UL21C and the observation of its RNA-binding ability are the latest additions to the navigational chart that can guide the exploration of the multiple functions of UL21.« less
Electrostatic steering and ionic tethering in enzyme–ligand binding: Insights from simulations
Wade, Rebecca C.; Gabdoulline, Razif R.; Lüdemann, Susanna K.; Lounnas, Valère
1998-01-01
To bind at an enzyme’s active site, a ligand must diffuse or be transported to the enzyme’s surface, and, if the binding site is buried, the ligand must diffuse through the protein to reach it. Although the driving force for ligand binding is often ascribed to the hydrophobic effect, electrostatic interactions also influence the binding process of both charged and nonpolar ligands. First, electrostatic steering of charged substrates into enzyme active sites is discussed. This is of particular relevance for diffusion-influenced enzymes. By comparing the results of Brownian dynamics simulations and electrostatic potential similarity analysis for triose-phosphate isomerases, superoxide dismutases, and β-lactamases from different species, we identify the conserved features responsible for the electrostatic substrate-steering fields. The conserved potentials are localized at the active sites and are the primary determinants of the bimolecular association rates. Then we focus on a more subtle effect, which we will refer to as “ionic tethering.” We explore, by means of molecular and Brownian dynamics simulations and electrostatic continuum calculations, how salt links can act as tethers between structural elements of an enzyme that undergo conformational change upon substrate binding, and thereby regulate or modulate substrate binding. This is illustrated for the lipase and cytochrome P450 enzymes. Ionic tethering can provide a control mechanism for substrate binding that is sensitive to the electrostatic properties of the enzyme’s surroundings even when the substrate is nonpolar. PMID:9600896
Machupo Virus Glycoprotein Determinants for Human Transferrin Receptor 1 Binding and Cell Entry
2011-07-01
conserved residues mapping to the surface of the determined MACV GP1 crystal structure (DNAStar Lasergene Software ). We identified ten residues of...2010) http://www3.niaid.nih.gov/topics/ BiodefenseRelated/Biodefense/research/CatA.htm. 8. Peters CJ, Kuehne RW, Mercado RR, Le Bow RH, Spertzel RO, et
Cohen-Khait, Ruth; Schreiber, Gideon
2016-01-01
Protein–protein interactions occur via well-defined interfaces on the protein surface. Whereas the location of homologous interfaces is conserved, their composition varies, suggesting that multiple solutions may support high-affinity binding. In this study, we examined the plasticity of the interface of TEM1 β-lactamase with its protein inhibitor BLIP by low-stringency selection of a random TEM1 library using yeast surface display. Our results show that most interfacial residues could be mutated without a loss in binding affinity, protein stability, or enzymatic activity, suggesting plasticity in the interface composition supporting high-affinity binding. Interestingly, many of the selected mutations promoted faster association. Further selection for faster binders was achieved by drastically decreasing the library–ligand incubation time to 30 s. Preequilibrium selection as suggested here is a novel methodology for specifically selecting faster-associating protein complexes. PMID:27956635
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Yue; Sheng, Ju; Baggen, Jim
Human enterovirus D68 (EV-D68) is a causative agent of childhood respiratory diseases and has now emerged as a global public health threat. Nevertheless, knowledge of the tissue tropism and pathogenesis of EV-D68 has been hindered by a lack of studies on the receptor-mediated EV-D68 entry into host cells. Here we demonstrate that cell surface sialic acid is essential for EV-D68 to bind to and infect susceptible cells. Crystal structures of EV-D68 in complex with sialylated glycan receptor analogues show that they bind into the ‘canyon’ on the virus surface. The sialic acid receptor induces a cascade of conformational changes inmore » the virus to eject a fatty-acid-like molecule that regulates the stability of the virus. Furthermore, virus binding to a sialic acid receptor and to immunoglobulin-like receptors used by most other enteroviruses share a conserved mechanism for priming viral uncoating and facilitating cell entry.« less
Higgins, Matthew K; Carrington, Mark
2014-01-01
Trypanosoma and Plasmodium species are unicellular, eukaryotic pathogens that have evolved the capacity to survive and proliferate within a human host, causing sleeping sickness and malaria, respectively. They have very different survival strategies. African trypanosomes divide in blood and extracellular spaces, whereas Plasmodium species invade and proliferate within host cells. Interaction with host macromolecules is central to establishment and maintenance of an infection by both parasites. Proteins that mediate these interactions are under selection pressure to bind host ligands without compromising immune avoidance strategies. In both parasites, the expansion of genes encoding a small number of protein folds has established large protein families. This has permitted both diversification to form novel ligand binding sites and variation in sequence that contributes to avoidance of immune recognition. In this review we consider two such parasite surface protein families, one from each species. In each case, known structures demonstrate how extensive sequence variation around a conserved molecular architecture provides an adaptable protein scaffold that the parasites can mobilise to mediate interactions with their hosts. PMID:24442723
Boj, Sylvia F.; Servitja, Joan Marc; Martin, David; Rios, Martin; Talianidis, Iannis; Guigo, Roderic; Ferrer, Jorge
2009-01-01
OBJECTIVE The evolutionary conservation of transcriptional mechanisms has been widely exploited to understand human biology and disease. Recent findings, however, unexpectedly showed that the transcriptional regulators hepatocyte nuclear factor (HNF)-1α and -4α rarely bind to the same genes in mice and humans, leading to the proposal that tissue-specific transcriptional regulation has undergone extensive divergence in the two species. Such observations have major implications for the use of mouse models to understand HNF-1α– and HNF-4α–deficient diabetes. However, the significance of studies that assess binding without considering regulatory function is poorly understood. RESEARCH DESIGN AND METHODS We compared previously reported mouse and human HNF-1α and HNF-4α binding studies with independent binding experiments. We also integrated binding studies with mouse and human loss-of-function gene expression datasets. RESULTS First, we confirmed the existence of species-specific HNF-1α and -4α binding, yet observed incomplete detection of binding in the different datasets, causing an underestimation of binding conservation. Second, only a minor fraction of HNF-1α– and HNF-4α–bound genes were downregulated in the absence of these regulators. This subset of functional targets did not show evidence for evolutionary divergence of binding or binding sequence motifs. Finally, we observed differences between conserved and species-specific binding properties. For example, conserved binding was more frequently located near transcriptional start sites and was more likely to involve multiple binding events in the same gene. CONCLUSIONS Despite evolutionary changes in binding, essential direct transcriptional functions of HNF-1α and -4α are largely conserved between mice and humans. PMID:19188435
Bhandari, Dipankar; Raisch, Tobias; Weichenrieder, Oliver; Jonas, Stefanie; Izaurralde, Elisa
2014-04-15
The RNA-binding proteins of the Nanos family play an essential role in germ cell development and survival in a wide range of metazoan species. They function by suppressing the expression of target mRNAs through the recruitment of effector complexes, which include the CCR4-NOT deadenylase complex. Here, we show that the three human Nanos paralogs (Nanos1-3) interact with the CNOT1 C-terminal domain and determine the structural basis for the specific molecular recognition. Nanos1-3 bind CNOT1 through a short CNOT1-interacting motif (NIM) that is conserved in all vertebrates and some invertebrate species. The crystal structure of the human Nanos1 NIM peptide bound to CNOT1 reveals that the peptide opens a conserved hydrophobic pocket on the CNOT1 surface by inserting conserved aromatic residues. The substitutions of these aromatic residues in the Nanos1-3 NIMs abolish binding to CNOT1 and abrogate the ability of the proteins to repress translation. Our findings provide the structural basis for the recruitment of the CCR4-NOT complex by vertebrate Nanos, indicate that the NIMs are the major determinants of the translational repression mediated by Nanos, and identify the CCR4-NOT complex as the main effector complex for Nanos function.
iDBPs: a web server for the identification of DNA binding proteins.
Nimrod, Guy; Schushan, Maya; Szilágyi, András; Leslie, Christina; Ben-Tal, Nir
2010-03-01
The iDBPs server uses the three-dimensional (3D) structure of a query protein to predict whether it binds DNA. First, the algorithm predicts the functional region of the protein based on its evolutionary profile; the assumption is that large clusters of conserved residues are good markers of functional regions. Next, various characteristics of the predicted functional region as well as global features of the protein are calculated, such as the average surface electrostatic potential, the dipole moment and cluster-based amino acid conservation patterns. Finally, a random forests classifier is used to predict whether the query protein is likely to bind DNA and to estimate the prediction confidence. We have trained and tested the classifier on various datasets and shown that it outperformed related methods. On a dataset that reflects the fraction of DNA binding proteins (DBPs) in a proteome, the area under the ROC curve was 0.90. The application of the server to an updated version of the N-Func database, which contains proteins of unknown function with solved 3D-structure, suggested new putative DBPs for experimental studies. http://idbps.tau.ac.il/
Kohout, Susy C.; Corbalán-García, Senena; Gómez-Fernández, Juan C.; Falke, Joseph J.
2013-01-01
The C2 domain is a conserved signaling motif that triggers membrane docking in a Ca2+-dependent manner, but the membrane docking surfaces of many C2 domains have not yet been identified. Two extreme models can be proposed for the docking of the protein kinase Cα (PKCα) C2 domain to membranes. In the parallel model, the membrane-docking surface includes the Ca2+ binding loops and an anion binding site on β-strands 3–4, such that the β-strands are oriented parallel to the membrane. In the perpendicular model, the docking surface is localized to the Ca2+ binding loops and the β-strands are oriented perpendicular to the membrane surface. The present study utilizes site-directed fluorescence and spin-labeling to map out the membrane docking surface of the PKCα C2 domain. Single cysteine residues were engineered into 18 locations scattered over all regions of the protein surface, and were used as attachment sites for spectroscopic probes. The environmentally sensitive fluorescein probe identified positions where Ca2+ activation or membrane docking trigger measurable fluorescence changes. Ca2+ binding was found to initiate a global conformational change, while membrane docking triggered the largest fluorescein environmental changes at labeling positions on the three Ca2+ binding loops (CBL), thereby localizing these loops to the membrane docking surface. Complementary EPR power saturation measurements were carried out using a nitroxide spin probe to determine a membrane depth parameter, Φ, for each spin-labeled mutant. Positive membrane depth parameters indicative of membrane insertion were found for three positions, all located on the Ca2+ binding loops: N189 on CBL 1, and both R249 and R252 on CBL 3. In addition, EPR power saturation revealed that five positions near the anion binding site are partially protected from collisions with an aqueous paramagnetic probe, indicating that the anion binding site lies at or near the surface of the headgroup layer. Together, the fluorescence and EPR results indicate that the Ca2+ first and third Ca2+ binding loops insert directly into the lipid headgroup region of the membrane, and that the anion binding site on β-strands 3–4 lies near the headgroups. The data support a model in which the β-strands are tilted toward the parallel orientation relative to the membrane surface. PMID:12564928
DOE Office of Scientific and Technical Information (OSTI.GOV)
Strauch, Eva-Maria; Bernard, Steffen M.; La, David
Many viral surface glycoproteins and cell surface receptors are homo-oligomers1, 2, 3, 4, and thus can potentially be targeted by geometrically matched homo-oligomers that engage all subunits simultaneously to attain high avidity and/or lock subunits together. The adaptive immune system cannot generally employ this strategy since the individual antibody binding sites are not arranged with appropriate geometry to simultaneously engage multiple sites in a single target homo-oligomer. We describe a general strategy for the computational design of homo-oligomeric protein assemblies with binding functionality precisely matched to homo-oligomeric target sites5, 6, 7, 8. In the first step, a small protein ismore » designed that binds a single site on the target. In the second step, the designed protein is assembled into a homo-oligomer such that the designed binding sites are aligned with the target sites. We use this approach to design high-avidity trimeric proteins that bind influenza A hemagglutinin (HA) at its conserved receptor binding site. The designed trimers can both capture and detect HA in a paper-based diagnostic format, neutralizes influenza in cell culture, and completely protects mice when given as a single dose 24 h before or after challenge with influenza.« less
Raman, Rajeev; Rajanikanth, V; Palaniappan, Raghavan U M; Lin, Yi-Pin; He, Hongxuan; McDonough, Sean P; Sharma, Yogendra; Chang, Yung-Fu
2010-12-29
Many bacterial surface exposed proteins mediate the host-pathogen interaction more effectively in the presence of Ca²+. Leptospiral immunoglobulin-like (Lig) proteins, LigA and LigB, are surface exposed proteins containing Bacterial immunoglobulin like (Big) domains. The function of proteins which contain Big fold is not known. Based on the possible similarities of immunoglobulin and βγ-crystallin folds, we here explore the important question whether Ca²+ binds to a Big domains, which would provide a novel functional role of the proteins containing Big fold. We selected six individual Big domains for this study (three from the conserved part of LigA and LigB, denoted as Lig A3, Lig A4, and LigBCon5; two from the variable region of LigA, i.e., 9(th) (Lig A9) and 10(th) repeats (Lig A10); and one from the variable region of LigB, i.e., LigBCen2. We have also studied the conserved region covering the three and six repeats (LigBCon1-3 and LigCon). All these proteins bind the calcium-mimic dye Stains-all. All the selected four domains bind Ca²+ with dissociation constants of 2-4 µM. Lig A9 and Lig A10 domains fold well with moderate thermal stability, have β-sheet conformation and form homodimers. Fluorescence spectra of Big domains show a specific doublet (at 317 and 330 nm), probably due to Trp interaction with a Phe residue. Equilibrium unfolding of selected Big domains is similar and follows a two-state model, suggesting the similarity in their fold. We demonstrate that the Lig are Ca²+-binding proteins, with Big domains harbouring the binding motif. We conclude that despite differences in sequence, a Big motif binds Ca²+. This work thus sets up a strong possibility for classifying the proteins containing Big domains as a novel family of Ca²+-binding proteins. Since Big domain is a part of many proteins in bacterial kingdom, we suggest a possible function these proteins via Ca²+ binding.
Palaniappan, Raghavan U. M.; Lin, Yi-Pin; He, Hongxuan; McDonough, Sean P.; Sharma, Yogendra; Chang, Yung-Fu
2010-01-01
Background Many bacterial surface exposed proteins mediate the host-pathogen interaction more effectively in the presence of Ca2+. Leptospiral immunoglobulin-like (Lig) proteins, LigA and LigB, are surface exposed proteins containing Bacterial immunoglobulin like (Big) domains. The function of proteins which contain Big fold is not known. Based on the possible similarities of immunoglobulin and βγ-crystallin folds, we here explore the important question whether Ca2+ binds to a Big domains, which would provide a novel functional role of the proteins containing Big fold. Principal Findings We selected six individual Big domains for this study (three from the conserved part of LigA and LigB, denoted as Lig A3, Lig A4, and LigBCon5; two from the variable region of LigA, i.e., 9th (Lig A9) and 10th repeats (Lig A10); and one from the variable region of LigB, i.e., LigBCen2. We have also studied the conserved region covering the three and six repeats (LigBCon1-3 and LigCon). All these proteins bind the calcium-mimic dye Stains-all. All the selected four domains bind Ca2+ with dissociation constants of 2–4 µM. Lig A9 and Lig A10 domains fold well with moderate thermal stability, have β-sheet conformation and form homodimers. Fluorescence spectra of Big domains show a specific doublet (at 317 and 330 nm), probably due to Trp interaction with a Phe residue. Equilibrium unfolding of selected Big domains is similar and follows a two-state model, suggesting the similarity in their fold. Conclusions We demonstrate that the Lig are Ca2+-binding proteins, with Big domains harbouring the binding motif. We conclude that despite differences in sequence, a Big motif binds Ca2+. This work thus sets up a strong possibility for classifying the proteins containing Big domains as a novel family of Ca2+-binding proteins. Since Big domain is a part of many proteins in bacterial kingdom, we suggest a possible function these proteins via Ca2+ binding. PMID:21206924
Binding of undamaged double stranded DNA to vaccinia virus uracil-DNA glycosylase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schormann, Norbert; Banerjee, Surajit; Ricciardi, Robert
Background: Uracil-DNA glycosylases are evolutionarily conserved DNA repair enzymes. However, vaccinia virus uracil-DNA glycosylase (known as D4), also serves as an intrinsic and essential component of the processive DNA polymerase complex during DNA replication. In this complex D4 binds to a unique poxvirus specific protein A20 which tethers it to the DNA polymerase. At the replication fork the DNA scanning and repair function of D4 is coupled with DNA replication. So far, DNA-binding to D4 has not been structurally characterized. Results: This manuscript describes the first structure of a DNA-complex of a uracil-DNA glycosylase from the poxvirus family. This alsomore » represents the first structure of a uracil DNA glycosylase in complex with an undamaged DNA. In the asymmetric unit two D4 subunits bind simultaneously to complementary strands of the DNA double helix. Each D4 subunit interacts mainly with the central region of one strand. DNA binds to the opposite side of the A20-binding surface on D4. In comparison of the present structure with the structure of uracil-containing DNA-bound human uracil-DNA glycosylase suggests that for DNA binding and uracil removal D4 employs a unique set of residues and motifs that are highly conserved within the poxvirus family but different in other organisms. Conclusion: The first structure of D4 bound to a truly non-specific undamaged double-stranded DNA suggests that initial binding of DNA may involve multiple non-specific interactions between the protein and the phosphate backbone.« less
Binding of undamaged double stranded DNA to vaccinia virus uracil-DNA glycosylase
Schormann, Norbert; Banerjee, Surajit; Ricciardi, Robert; ...
2015-06-02
Background: Uracil-DNA glycosylases are evolutionarily conserved DNA repair enzymes. However, vaccinia virus uracil-DNA glycosylase (known as D4), also serves as an intrinsic and essential component of the processive DNA polymerase complex during DNA replication. In this complex D4 binds to a unique poxvirus specific protein A20 which tethers it to the DNA polymerase. At the replication fork the DNA scanning and repair function of D4 is coupled with DNA replication. So far, DNA-binding to D4 has not been structurally characterized. Results: This manuscript describes the first structure of a DNA-complex of a uracil-DNA glycosylase from the poxvirus family. This alsomore » represents the first structure of a uracil DNA glycosylase in complex with an undamaged DNA. In the asymmetric unit two D4 subunits bind simultaneously to complementary strands of the DNA double helix. Each D4 subunit interacts mainly with the central region of one strand. DNA binds to the opposite side of the A20-binding surface on D4. In comparison of the present structure with the structure of uracil-containing DNA-bound human uracil-DNA glycosylase suggests that for DNA binding and uracil removal D4 employs a unique set of residues and motifs that are highly conserved within the poxvirus family but different in other organisms. Conclusion: The first structure of D4 bound to a truly non-specific undamaged double-stranded DNA suggests that initial binding of DNA may involve multiple non-specific interactions between the protein and the phosphate backbone.« less
Niu, Qian; Ybe, Joel A.
2008-01-01
Summary Huntington’s disease is a genetic neurological disorder that is triggered by the dissociation of the huntingtin protein (htt) from its obligate interaction partner Huntingtin-interacting protein 1 (HIP1). The release of htt permits HIP-protein interactor (HIPPI) to bind to its recognition site on HIP1 to form a HIPPI/HIP1 complex that recruits Procaspase-8 to begin the process of apoptosis. The interaction module between HIPPI and HIP1 was predicted to resemble a death-effector domain (DED). Our 2.8 Å crystal structure of the HIP1 371-481 sub-fragment that includes F432 and K474 important for HIPPI binding is not a DED, but is a partially opened coiled-coil. The HIP1 371-481 model reveals a basic surface we hypothesize is suitable for binding HIPPI. There is an opened region next to the putative HIPPI site that is highly negatively charged. The acidic residues in this region are highly conserved in HIP1 and a related protein, HIP1R from different organisms, but are not conserved in the yeast homolog of HIP1, sla2p. We have modeled ∼85% of the coiled-coil domain by joining our new HIP1 371-481 structure to the HIP1 482-586 model (PDB code: 2NO2). Finally, the middle of this coiled-coil domain may be intrinsically flexible and suggests a new interaction model where HIPPI binds to a “U” shaped HIP1 molecule. PMID:18155047
Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L
2013-07-01
The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.
Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.
2013-01-01
The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967
Basic Tilted Helix Bundle - a new protein fold in human FKBP25/FKBP3 and HectD1.
Helander, Sara; Montecchio, Meri; Lemak, Alexander; Farès, Christophe; Almlöf, Jonas; Yi, Yanjun; Yee, Adelinda; Arrowsmith, Cheryl; DhePaganon, Sirano; Sunnerhagen, Maria
2014-04-25
In this paper, we describe the structure of a N-terminal domain motif in nuclear-localized FKBP251-73, a member of the FKBP family, together with the structure of a sequence-related subdomain of the E3 ubiquitin ligase HectD1 that we show belongs to the same fold. This motif adopts a compact 5-helix bundle which we name the Basic Tilted Helix Bundle (BTHB) domain. A positively charged surface patch, structurally centered around the tilted helix H4, is present in both FKBP25 and HectD1 and is conserved in both proteins, suggesting a conserved functional role. We provide detailed comparative analysis of the structures of the two proteins and their sequence similarities, and analysis of the interaction of the proposed FKBP25 binding protein YY1. We suggest that the basic motif in BTHB is involved in the observed DNA binding of FKBP25, and that the function of this domain can be affected by regulatory YY1 binding and/or interactions with adjacent domains. Copyright © 2014 Elsevier Inc. All rights reserved.
Crystal structure of bacterial cell-surface alginate-binding protein with an M75 peptidase motif
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maruyama, Yukie; Ochiai, Akihito; Mikami, Bunzo
Research highlights: {yields} Bacterial alginate-binding Algp7 is similar to component EfeO of Fe{sup 2+} transporter. {yields} We determined the crystal structure of Algp7 with a metal-binding motif. {yields} Algp7 consists of two helical bundles formed through duplication of a single bundle. {yields} A deep cleft involved in alginate binding locates around the metal-binding site. {yields} Algp7 may function as a Fe{sup 2+}-chelated alginate-binding protein. -- Abstract: A gram-negative Sphingomonas sp. A1 directly incorporates alginate polysaccharide into the cytoplasm via the cell-surface pit and ABC transporter. A cell-surface alginate-binding protein, Algp7, functions as a concentrator of the polysaccharide in the pit.more » Based on the primary structure and genetic organization in the bacterial genome, Algp7 was found to be homologous to an M75 peptidase motif-containing EfeO, a component of a ferrous ion transporter. Despite the presence of an M75 peptidase motif with high similarity, the Algp7 protein purified from recombinant Escherichia coli cells was inert on insulin B chain and N-benzoyl-Phe-Val-Arg-p-nitroanilide, both of which are substrates for a typical M75 peptidase, imelysin, from Pseudomonas aeruginosa. The X-ray crystallographic structure of Algp7 was determined at 2.10 A resolution by single-wavelength anomalous diffraction. Although a metal-binding motif, HxxE, conserved in zinc ion-dependent M75 peptidases is also found in Algp7, the crystal structure of Algp7 contains no metal even at the motif. The protein consists of two structurally similar up-and-down helical bundles as the basic scaffold. A deep cleft between the bundles is sufficiently large to accommodate macromolecules such as alginate polysaccharide. This is the first structural report on a bacterial cell-surface alginate-binding protein with an M75 peptidase motif.« less
LiCata, V J; Bernlohr, D A
1998-12-01
Adipocyte lipid-binding protein (ALBP) is one of a family of intracellular lipid-binding proteins (iLBPs) that bind fatty acids, retinoids, and other hydrophobic ligands. The different members of this family exhibit a highly conserved three-dimensional structure; and where structures have been determined both with (holo) and without (apo) bound lipid, observed conformational changes are extremely small (Banaszak, et al., 1994, Adv. Prot. Chem. 45, 89; Bernlohr, et al., 1997, Annu. Rev. Nutr. 17, 277). We have examined the electrostatic, hydrophobic, and water accessible surfaces of ALBP in the apo form and of holo forms with a variety of bound ligands. These calculations reveal a number of previously unrecognized changes between apo and holo ALBP, including: 1) an increase in the overall protein surface area when ligand binds, 2) expansion of the binding cavity when ligand is bound, 3) clustering of individual residue exposure increases in the area surrounding the proposed ligand entry portal, and 4) ligand-binding dependent variation in the topology of the electrostatic potential in the area surrounding the ligand entry portal. These focused analyses of the crystallographic structures thus reveal a number of subtle but consistent conformational and surface changes that might serve as markers for differential targeting of protein-lipid complexes within the cell. Most changes are consistent from ligand to ligand, however there are some ligand-specific changes. Comparable calculations with intestinal fatty-acid-binding protein and other vertebrate iLBPs show differences in the electrostatic topology, hydrophobic topology, and in localized changes in solvent exposure near the ligand entry portal. These results provide a basis toward understanding the functional and mechanistic differences among these highly structurally homologous proteins. Further, they suggest that iLBPs from different tissues exhibit one of two predominant end-state structural distributions of the ligand entry portal.
Walker, David M; Wang, Ruifei; Webb, Lauren J
2014-10-07
Vibrational Stark effect (VSE) spectroscopy was used to measure the electrostatic fields present at the interface of the human guanosine triphosphatase (GTPase) Ras docked with the Ras binding domain (RBD) of the protein kinase Raf. Nine amino acids located on the surface of Raf were selected for labeling with a nitrile vibrational probe. Eight of the probe locations were situated along the interface of Ras and Raf, and one probe was 2 nm away on the opposite side of Raf. Vibrational frequencies of the nine Raf nitrile probes were compared both in the monomeric, solvated protein and when docked with wild-type (WT) Ras to construct a comprehensive VSE map of the Ras-Raf interface. Molecular dynamics (MD) simulations employing an umbrella sampling strategy were used to generate a Boltzmann-weighted ensemble of nitrile positions in both the monomeric and docked complexes to determine the effect that docking has on probe location and orientation and to aid in the interpretation of VSE results. These results were compared to an identical study that was previously conducted on nine nitrile probes on the RBD of Ral guanidine dissociation stimulator (RalGDS) to make comparisons between the docked complexes formed when either of the two effectors bind to WT Ras. This comparison finds that there are three regions of conserved electrostatic fields that are formed upon docking of WT Ras with both downstream effectors. Conservation of this pattern in the docked complex then results in different binding orientations observed in otherwise structurally similar proteins. This work supports an electrostatic cause of the known binding tilt angle between the Ras-Raf and Ras-RalGDS complexes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kruus, K.; Wu, J.H.D.; Lua, A.C.
1995-09-26
Enzymatic cellulose degradation is a heterogeneous reaction requiring binding of soluble cellulase molecules to the solid substrate. Based on our studies of the cellulase complex of Clostridium thermocellum (the cellulosome), we have previously proposed that such binding can be brought about by a special {open_quotes}anchorage subunit.{close_quotes} In this {open_quotes}anchor-enzyme{close_quotes} model, CipA (a major subunit of the cellulosome) enhances the activity of CelS (the most abundant catalytic subunit of the cellulosome) by anchoring it to the cellulose surface. We have subsequently reported that CelS contains a conserved duplicated sequence at its C terminus and the CipA contains nine repeated sequences withmore » a cellulose binding domain (CBD) in between the second and third repeats. In this work, we reexamined the anchor-enzyme mechanism by using recombinant CelS (rCelS) and various CipA domains, CBD, R3 (the repeat next to CBD), and CBD/R3, expressed in Escherichia coli. As analyzed by non-denaturing gel electrophoresis, rCelS, through its conserved duplicated sequence, formed a stable complex with R3 or CBD/R3 but not with CBD. Although R3 or CBD alone did not affect the binding of rCelS to cellulose, such binding was dependent on CBD/R3, indicating the anchorage role of CBD/R3. Such anchorage apparently increased the rCelS activity toward crystalline cellulose. These results substantiate the proposed anchor-enzyme model and the expected roles of individual CipA domains and the conserved duplicated sequence of CelS.« less
Ligand-specific regulation of the extracellular surface of a G-protein-coupled receptor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bokoch, Michael P.; Zou, Yaozhong; Rasmussen, Søren G.F.
G-protein-coupled receptors (GPCRs) are seven-transmembrane proteins that mediate most cellular responses to hormones and neurotransmitters. They are the largest group of therapeutic targets for a broad spectrum of diseases. Recent crystal structures of GPCRs have revealed structural conservation extending from the orthosteric ligand-binding site in the transmembrane core to the cytoplasmic G-protein-coupling domains. In contrast, the extracellular surface (ECS) of GPCRs is remarkably diverse and is therefore an ideal target for the discovery of subtype-selective drugs. However, little is known about the functional role of the ECS in receptor activation, or about conformational coupling of this surface to the nativemore » ligand-binding pocket. Here we use NMR spectroscopy to investigate ligand-specific conformational changes around a central structural feature in the ECS of the {beta}{sub 2} adrenergic receptor: a salt bridge linking extracellular loops 2 and 3. Small-molecule drugs that bind within the transmembrane core and exhibit different efficacies towards G-protein activation (agonist, neutral antagonist and inverse agonist) also stabilize distinct conformations of the ECS. We thereby demonstrate conformational coupling between the ECS and the orthosteric binding site, showing that drugs targeting this diverse surface could function as allosteric modulators with high subtype selectivity. Moreover, these studies provide a new insight into the dynamic behaviour of GPCRs not addressable by static, inactive-state crystal structures.« less
Streptococcus oralis Neuraminidase Modulates Adherence to Multiple Carbohydrates on Platelets.
Singh, Anirudh K; Woodiga, Shireen A; Grau, Margaret A; King, Samantha J
2017-03-01
Adherence to host surfaces is often mediated by bacterial binding to surface carbohydrates. Although it is widely appreciated that some bacterial species express glycosidases, previous studies have not considered whether bacteria bind to multiple carbohydrates within host glycans as they are modified by bacterial glycosidases. Streptococcus oralis is a leading cause of subacute infective endocarditis. Binding to platelets is a critical step in disease; however, the mechanisms utilized by S. oralis remain largely undefined. Studies revealed that S. oralis , like Streptococcus gordonii and Streptococcus sanguinis , binds platelets via terminal sialic acid. However, unlike those organisms, S. oralis produces a neuraminidase, NanA, which cleaves terminal sialic acid. Further studies revealed that following NanA-dependent removal of terminal sialic acid, S. oralis bound exposed β-1,4-linked galactose. Adherence to both these carbohydrates required Fap1, the S. oralis member of the serine-rich repeat protein (SRRP) family of adhesins. Mutation of a conserved residue required for sialic acid binding by other SRRPs significantly reduced platelet binding, supporting the hypothesis that Fap1 binds this carbohydrate. The mechanism by which Fap1 contributes to β-1,4-linked galactose binding remains to be defined; however, binding may occur via additional domains of unknown function within the nonrepeat region, one of which shares some similarity with a carbohydrate binding module. This study is the first demonstration that an SRRP is required to bind β-1,4-linked galactose and the first time that one of these adhesins has been shown to be required for binding of multiple glycan receptors. Copyright © 2017 American Society for Microbiology.
On the nature of the {SO2-4}/{Ag(111) } and {SO2-4}/{Au(111) } surface bonding
NASA Astrophysics Data System (ADS)
Patrito, E. M.; Olivera, P. Paredes; Sellers, Harrell
1997-05-01
The nature of sulfate-Ag(111) and sulfate-Au(111) surface bonding has been investigated at the SCF + MP2 level of theory. Convergence of binding energy with cluster size is investigated and, unlike neutral adsorbates, large clusters are required in order to obtain reliable binding energies. In the most stable adsorption mode, sulfate binds to the surface via three oxygen atoms (C 3v symmetry) with a binding energy of 159.3 kcal/mol on Ag(111) and 143.9 kcal/mol on Au(111). The geometry of adsorbed sulfate was optimized at the SCF level. While the bond length between sulfur and the oxygens coordinated to the surface increases, the sulfur-uncoordinated oxygen bond length decreases. This weakening and strengthening of the bonds, respectively, is consistent with bond order conservation in adsorbates on metal surfaces. Although a charge transfer of 0.4 electrons towards the metal is observed, the adsorbate remains very much sulfate-like. The molecular orbital analysis indicates that there is also some charge back-donation towards unoccupied orbitals of sulfate. This results in an increased electron density around sulfur as revealed in the electron density difference maps. Analysis of the Laplacian of the charge density of free sulfate provides a suitable framework to understand the nature of the different charge transfer processes and allows us to establish some similarities with the CO- and SO 2-metal bondings.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lu, Jinghua; Marnell, Lorraine L.; Marjon, Kristopher D.
Pentraxins are a family of ancient innate immune mediators conserved throughout evolution. The classical pentraxins include serum amyloid P component (SAP) and C-reactive protein, which are two of the acute-phase proteins synthesized in response to infection. Both recognize microbial pathogens and activate the classical complement pathway through C1q. More recently, members of the pentraxin family were found to interact with cell-surface Fc{gamma} receptors (Fc{gamma}R) and activate leukocyte-mediated phagocytosis. Here we describe the structural mechanism for pentraxin's binding to Fc{gamma}R and its functional activation of Fc{gamma}R-mediated phagocytosis and cytokine secretion. The complex structure between human SAP and Fc{gamma}RIIa reveals a diagonallymore » bound receptor on each SAP pentamer with both D1 and D2 domains of the receptor contacting the ridge helices from two SAP subunits. The 1:1 stoichiometry between SAP and Fc{gamma}RIIa infers the requirement for multivalent pathogen binding for receptor aggregation. Mutational and binding studies show that pentraxins are diverse in their binding specificity for Fc{gamma}R isoforms but conserved in their recognition structure. The shared binding site for SAP and IgG results in competition for Fc{gamma}R binding and the inhibition of immune-complex-mediated phagocytosis by soluble pentraxins. These results establish antibody-like functions for pentraxins in the Fc{gamma}R pathway, suggest an evolutionary overlap between the innate and adaptive immune systems, and have new therapeutic implications for autoimmune diseases.« less
Identification of DNA-Binding Proteins Using Structural, Electrostatic and Evolutionary Features
Nimrod, Guy; Szilágyi, András; Leslie, Christina; Ben-Tal, Nir
2009-01-01
Summary DNA binding proteins (DBPs) often take part in various crucial processes of the cell's life cycle. Therefore, the identification and characterization of these proteins are of great importance. We present here a random forests classifier for identifying DBPs among proteins with known three-dimensional structures. First, clusters of evolutionarily conserved regions (patches) on the protein's surface are detected using the PatchFinder algorithm; previous studies showed that these regions are typically the proteins' functionally important regions. Next, we train a classifier using features like the electrostatic potential, cluster-based amino acid conservation patterns and the secondary structure content of the patches, as well as features of the whole protein including its dipole moment. Using 10-fold cross validation on a dataset of 138 DNA-binding proteins and 110 proteins which do not bind DNA, the classifier achieved a sensitivity and a specificity of 0.90, which is overall better than the performance of previously published methods. Furthermore, when we tested 5 different methods on 11 new DBPs which did not appear in the original dataset, only our method annotated all correctly. The resulting classifier was applied to a collection of 757 proteins of known structure and unknown function. Of these proteins, 218 were predicted to bind DNA, and we anticipate that some of them interact with DNA using new structural motifs. The use of complementary computational tools supports the notion that at least some of them do bind DNA. PMID:19233205
Cléry, Antoine; Allain, Frédéric H-T
2017-01-01
Abstract RNA recognition motifs (RRMs) are structurally versatile domains important in regulation of alternative splicing. Structural mechanisms of sequence-specific recognition of single-stranded RNAs (ssRNAs) by RRMs are well understood. The thermodynamic strategies are however unclear. Therefore, we utilized microcalorimetry and semi-empirical analyses to comparatively analyze the cognate ssRNA binding thermodynamics of four different RRM domains, each with a different RNA binding mode. The different binding modes are: canonical binding to the β-sheet surface; canonical binding with involvement of N- and C-termini; binding to conserved loops; and binding to an α-helix. Our results identify enthalpy as the sole and general force driving association at physiological temperatures. Also, networks of weak interactions are a general feature regulating stability of the different RRM–ssRNA complexes. In agreement, non-polyelectrolyte effects contributed between ∼75 and 90% of the overall free energy of binding in the considered complexes. The various RNA binding modes also displayed enormous heat capacity differences, that upon dissection revealed large differential changes in hydration, conformations and dynamics upon binding RNA. Altogether, different modes employed by RRMs to bind cognate ssRNAs utilize various thermodynamics strategies during the association process. PMID:28334819
Wienk, Hans; Slootweg, Jack C.; Speerstra, Sietske; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.
2013-01-01
To maintain the integrity of the genome, multiple DNA repair systems exist to repair damaged DNA. Recognition of altered DNA, including bulky adducts, pyrimidine dimers and interstrand crosslinks (ICL), partially depends on proteins containing helix-hairpin-helix (HhH) domains. To understand how ICL is specifically recognized by the Fanconi anemia proteins FANCM and FAAP24, we determined the structure of the HhH domain of FAAP24. Although it resembles other HhH domains, the FAAP24 domain contains a canonical hairpin motif followed by distorted motif. The HhH domain can bind various DNA substrates; using nuclear magnetic resonance titration experiments, we demonstrate that the canonical HhH motif is required for double-stranded DNA (dsDNA) binding, whereas the unstructured N-terminus can interact with single-stranded DNA. Both DNA binding surfaces are used for binding to ICL-like single/double-strand junction-containing DNA substrates. A structural model for FAAP24 bound to dsDNA has been made based on homology with the translesion polymerase iota. Site-directed mutagenesis, sequence conservation and charge distribution support the dsDNA-binding model. Analogous to other HhH domain-containing proteins, we suggest that multiple FAAP24 regions together contribute to binding to single/double-strand junction, which could contribute to specificity in ICL DNA recognition. PMID:23661679
Bhandari, Dipankar; Raisch, Tobias; Weichenrieder, Oliver; Jonas, Stefanie; Izaurralde, Elisa
2014-01-01
The RNA-binding proteins of the Nanos family play an essential role in germ cell development and survival in a wide range of metazoan species. They function by suppressing the expression of target mRNAs through the recruitment of effector complexes, which include the CCR4–NOT deadenylase complex. Here, we show that the three human Nanos paralogs (Nanos1–3) interact with the CNOT1 C-terminal domain and determine the structural basis for the specific molecular recognition. Nanos1–3 bind CNOT1 through a short CNOT1-interacting motif (NIM) that is conserved in all vertebrates and some invertebrate species. The crystal structure of the human Nanos1 NIM peptide bound to CNOT1 reveals that the peptide opens a conserved hydrophobic pocket on the CNOT1 surface by inserting conserved aromatic residues. The substitutions of these aromatic residues in the Nanos1–3 NIMs abolish binding to CNOT1 and abrogate the ability of the proteins to repress translation. Our findings provide the structural basis for the recruitment of the CCR4–NOT complex by vertebrate Nanos, indicate that the NIMs are the major determinants of the translational repression mediated by Nanos, and identify the CCR4–NOT complex as the main effector complex for Nanos function. PMID:24736845
Bode, Manuela; Woellhaf, Michael W.; Bohnert, Maria; van der Laan, Martin; Sommer, Frederik; Jung, Martin; Zimmermann, Richard; Schroda, Michael; Herrmann, Johannes M.
2015-01-01
Members of the twin Cx9C protein family constitute the largest group of proteins in the intermembrane space (IMS) of mitochondria. Despite their conserved nature and their essential role in the biogenesis of the respiratory chain, the molecular function of twin Cx9C proteins is largely unknown. We performed a SILAC-based quantitative proteomic analysis to identify interaction partners of the conserved twin Cx9C protein Cox19. We found that Cox19 interacts in a dynamic manner with Cox11, a copper transfer protein that facilitates metalation of the Cu(B) center of subunit 1 of cytochrome c oxidase. The interaction with Cox11 is critical for the stable accumulation of Cox19 in mitochondria. Cox19 consists of a helical hairpin structure that forms a hydrophobic surface characterized by two highly conserved tyrosine-leucine dipeptides. These residues are essential for Cox19 function and its specific binding to a cysteine-containing sequence in Cox11. Our observations suggest that an oxidative modification of this cysteine residue of Cox11 stimulates Cox19 binding, pointing to a redox-regulated interplay of Cox19 and Cox11 that is critical for copper transfer in the IMS and thus for biogenesis of cytochrome c oxidase. PMID:25926683
Davis, J Q; Bennett, V
1994-11-04
Neurofascin, L1, NrCAM, NgCAM, and neuroglian are membrane-spanning cell adhesion molecules with conserved cytoplasmic domains that are believed to play important roles in development of the nervous system. This report presents biochemical evidence that the cytoplasmic domains of these molecules associate directly with ankyrins, a family of spectrin-binding proteins located on the cytoplasmic surface of specialized plasma membrane domains. Rat neurofascin and NrCAM together comprise over 0.5% of the membrane protein in adult brain tissue. Linkage of these ankyrin-binding cell adhesion molecules to spectrin-based structures may provide a major class of membrane-cytoskeletal connections in adult brain as well as earlier stages of development.
Sialic acid-dependent cell entry of human enterovirus D68
Liu, Yue; Sheng, Ju; Baggen, Jim; ...
2015-11-13
Human enterovirus D68 (EV-D68) is a causative agent of childhood respiratory diseases and has now emerged as a global public health threat. Nevertheless, knowledge of the tissue tropism and pathogenesis of EV-D68 has been hindered by a lack of studies on the receptor-mediated EV-D68 entry into host cells. Here we demonstrate that cell surface sialic acid is essential for EV-D68 to bind to and infect susceptible cells. Crystal structures of EV-D68 in complex with sialylated glycan receptor analogues show that they bind into the ‘canyon’ on the virus surface. The sialic acid receptor induces a cascade of conformational changes inmore » the virus to eject a fatty-acid-like molecule that regulates the stability of the virus. Furthermore, virus binding to a sialic acid receptor and to immunoglobulin-like receptors used by most other enteroviruses share a conserved mechanism for priming viral uncoating and facilitating cell entry.« less
Sialic acid-dependent cell entry of human enterovirus D68
Liu, Yue; Sheng, Ju; Baggen, Jim; Meng, Geng; Xiao, Chuan; Thibaut, Hendrik J.; van Kuppeveld, Frank J. M.; Rossmann, Michael G.
2015-01-01
Human enterovirus D68 (EV-D68) is a causative agent of childhood respiratory diseases and has now emerged as a global public health threat. Nevertheless, knowledge of the tissue tropism and pathogenesis of EV-D68 has been hindered by a lack of studies on the receptor-mediated EV-D68 entry into host cells. Here we demonstrate that cell surface sialic acid is essential for EV-D68 to bind to and infect susceptible cells. Crystal structures of EV-D68 in complex with sialylated glycan receptor analogues show that they bind into the ‘canyon' on the virus surface. The sialic acid receptor induces a cascade of conformational changes in the virus to eject a fatty-acid-like molecule that regulates the stability of the virus. Thus, virus binding to a sialic acid receptor and to immunoglobulin-like receptors used by most other enteroviruses share a conserved mechanism for priming viral uncoating and facilitating cell entry. PMID:26563423
iDBPs: a web server for the identification of DNA binding proteins
Nimrod, Guy; Schushan, Maya; Szilágyi, András; Leslie, Christina; Ben-Tal, Nir
2010-01-01
Summary: The iDBPs server uses the three-dimensional (3D) structure of a query protein to predict whether it binds DNA. First, the algorithm predicts the functional region of the protein based on its evolutionary profile; the assumption is that large clusters of conserved residues are good markers of functional regions. Next, various characteristics of the predicted functional region as well as global features of the protein are calculated, such as the average surface electrostatic potential, the dipole moment and cluster-based amino acid conservation patterns. Finally, a random forests classifier is used to predict whether the query protein is likely to bind DNA and to estimate the prediction confidence. We have trained and tested the classifier on various datasets and shown that it outperformed related methods. On a dataset that reflects the fraction of DNA binding proteins (DBPs) in a proteome, the area under the ROC curve was 0.90. The application of the server to an updated version of the N-Func database, which contains proteins of unknown function with solved 3D-structure, suggested new putative DBPs for experimental studies. Availability: http://idbps.tau.ac.il/ Contact: NirB@tauex.tau.ac.il Supplementary information: Supplementary data are available at Bioinformatics online. PMID:20089514
Capture and quality control mechanisms for ATP binding
Li, Li; Martinis, Susan A.
2013-01-01
The catalytic events in members of the nucleotidylyl transferase superfamily are initiated by a millisecond binding of ATP in the active site. Through metadynamics simulations on a class I aminoacyl-tRNA synthetase (aaRSs), the largest group in the superfamily, we calculate the free energy landscape of ATP selection and binding. Mutagenesis studies and fluorescence spectroscopy validated the identification of the most populated intermediate states. The rapid first binding step involves formation of encounter complexes captured through a fly-casting mechanism that acts up on the triphosphate moiety of ATP. In the slower nucleoside binding step, a conserved histidine in the HxxH motif orients the incoming ATP through base-stacking interactions resulting in a deep minimum in the free energy surface. Mutation of this histidine significantly decreases the binding affinity measured experimentally and computationally. The metadynamics simulations further reveal an intermediate quality control state that the synthetases and most likely other members of the superfamily use to select ATP over other nucleoside triphosphates. PMID:23276298
Intrinsic disorder mediates the diverse regulatory functions of the Cdk inhibitor p21
Wang, Yuefeng; Fisher, John C.; Mathew, Rose; Ou, Li; Otieno, Steve; Sublett, Jack; Xiao, Limin; Chen, Jianhan; Roussel, Martine F.; Kriwacki, Richard W.
2011-01-01
Traditionally, well-defined three-dimensional structure was thought to be essential for protein function. However, myriad biological functions are performed by highly dynamic, intrinsically disordered proteins (IDPs). IDPs often fold upon binding their biological targets and frequently exhibit “binding diversity” by targeting multiple ligands. We sought to understand the physical basis of IDP binding diversity and herein report that the cyclin-dependent kinase (Cdk) inhibitor, p21Cip1, adaptively binds to and inhibits the various Cdk/cyclin complexes that regulate eukaryotic cell division. Based on results from NMR spectroscopy, and biochemical and cellular assays, we show that structural adaptability of a helical sub-domain within p21 termed LH enables two other sub-domains termed D1 and D2 to specifically bind conserved surface features of the cyclin and Cdk subunits, respectively, within otherwise structurally distinct Cdk/cyclin complexes. Adaptive folding upon binding is likely to mediate the diverse biological functions of the thousands of IDPs present in eukaryotes. PMID:21358637
Capture and quality control mechanisms for adenosine-5'-triphosphate binding.
Li, Li; Martinis, Susan A; Luthey-Schulten, Zaida
2013-04-24
The catalytic events in members of the nucleotidylyl transferase superfamily are initiated by a millisecond binding of ATP in the active site. Through metadynamics simulations on a class I aminoacyl-tRNA synthetase (aaRSs), the largest group in the superfamily, we calculate the free energy landscape of ATP selection and binding. Mutagenesis studies and fluorescence spectroscopy validated the identification of the most populated intermediate states. The rapid first binding step involves formation of encounter complexes captured through a fly casting mechanism that acts upon the triphosphate moiety of ATP. In the slower nucleoside binding step, a conserved histidine in the HxxH motif orients the incoming ATP through base-stacking interactions resulting in a deep minimum in the free energy surface. Mutation of this histidine significantly decreases the binding affinity measured experimentally and computationally. The metadynamics simulations further reveal an intermediate quality control state that the synthetases and most likely other members of the superfamily use to select ATP over other nucleoside triphosphates.
Hestand, Matthew S; van Galen, Michiel; Villerius, Michel P; van Ommen, Gert-Jan B; den Dunnen, Johan T; 't Hoen, Peter AC
2008-01-01
Background The identification of transcription factor binding sites is difficult since they are only a small number of nucleotides in size, resulting in large numbers of false positives and false negatives in current approaches. Computational methods to reduce false positives are to look for over-representation of transcription factor binding sites in a set of similarly regulated promoters or to look for conservation in orthologous promoter alignments. Results We have developed a novel tool, "CORE_TF" (Conserved and Over-REpresented Transcription Factor binding sites) that identifies common transcription factor binding sites in promoters of co-regulated genes. To improve upon existing binding site predictions, the tool searches for position weight matrices from the TRANSFACR database that are over-represented in an experimental set compared to a random set of promoters and identifies cross-species conservation of the predicted transcription factor binding sites. The algorithm has been evaluated with expression and chromatin-immunoprecipitation on microarray data. We also implement and demonstrate the importance of matching the random set of promoters to the experimental promoters by GC content, which is a unique feature of our tool. Conclusion The program CORE_TF is accessible in a user friendly web interface at . It provides a table of over-represented transcription factor binding sites in the users input genes' promoters and a graphical view of evolutionary conserved transcription factor binding sites. In our test data sets it successfully predicts target transcription factors and their binding sites. PMID:19036135
Yamada, Kazunori; Kondoh, Yasumitsu; Hikono, Hirokazu; Osada, Hiroyuki; Tomii, Kentaro; Saito, Takehiko; Aida, Yoko
2015-01-01
Developing antiviral therapies for influenza A virus (IAV) infection is an ongoing process because of the rapid rate of antigenic mutation and the emergence of drug-resistant viruses. The ideal strategy is to develop drugs that target well-conserved, functionally restricted, and unique surface structures without affecting host cell function. We recently identified the antiviral compound, RK424, by screening a library of 50,000 compounds using cell-based infection assays. RK424 showed potent antiviral activity against many different subtypes of IAV in vitro and partially protected mice from a lethal dose of A/WSN/1933 (H1N1) virus in vivo. Here, we show that RK424 inhibits viral ribonucleoprotein complex (vRNP) activity, causing the viral nucleoprotein (NP) to accumulate in the cell nucleus. In silico docking analysis revealed that RK424 bound to a small pocket in the viral NP. This pocket was surrounded by three functionally important domains: the RNA binding groove, the NP dimer interface, and nuclear export signal (NES) 3, indicating that it may be involved in the RNA binding, oligomerization, and nuclear export functions of NP. The accuracy of this binding model was confirmed in a NP-RK424 binding assay incorporating photo-cross-linked RK424 affinity beads and in a plaque assay evaluating the structure-activity relationship of RK424. Surface plasmon resonance (SPR) and pull-down assays showed that RK424 inhibited both the NP-RNA and NP-NP interactions, whereas size exclusion chromatography showed that RK424 disrupted viral RNA-induced NP oligomerization. In addition, in vitro nuclear export assays confirmed that RK424 inhibited nuclear export of NP. The amino acid residues comprising the NP pocket play a crucial role in viral replication and are highly conserved in more than 7,000 NP sequences from avian, human, and swine influenza viruses. Furthermore, we found that the NP pocket has a surface structure different from that of the pocket in host molecules. Taken together, these results describe a promising new approach to developing influenza virus drugs that target a novel pocket structure within NP. PMID:26222066
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Yue; Zhao, Yuting; Su, Minfei
Mammalian Golgi-associated plant pathogenesis-related protein 1 (GAPR-1) is a negative autophagy regulator that binds Beclin 1, a key component of the autophagosome nucleation complex. Beclin 1 residues 267–284 are required for binding GAPR-1. Here, sequence analyses, structural modeling, mutagenesis combined with pull-down assays, X-ray crystal structure determination and small-angle X-ray scattering were used to investigate the Beclin 1–GAPR-1 interaction. Five conserved residues line an equatorial GAPR-1 surface groove that is large enough to bind a peptide. A model of a peptide comprising Beclin 1 residues 267–284 docked onto GAPR-1, built using theCABS-dockserver, indicates that this peptide binds to this GAPR-1more » groove. Mutation of the five conserved residues lining this groove, H54A/E86A/G102K/H103A/N138G, abrogates Beclin 1 binding. The 1.27 Å resolution X-ray crystal structure of this pentad mutant GAPR-1 was determined. Comparison with the wild-type (WT) GAPR-1 structure shows that the equatorial groove of the pentad mutant is shallower and more positively charged, and therefore may not efficiently bind Beclin 1 residues 267–284, which include many hydrophobic residues. Both WT and pentad mutant GAPR-1 crystallize as dimers, and in each case the equatorial groove of one subunit is partially occluded by the other subunit, indicating that dimeric GAPR-1 is unlikely to bind Beclin 1. SAXS analysis of WT and pentad mutant GAPR-1 indicates that in solution the WT forms monomers, while the pentad mutant is primarily dimeric. Thus, changes in the structure of the equatorial groove combined with the improved dimerization of pentad mutant GAPR-1 are likely to abrogate binding to Beclin 1.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chruszcz, Maksymilian; Chapman, Martin D.; Vailes, Lisa D.
2009-12-01
The Group 1 mite allergens, Der f 1 and Der p 1, are potent allergens excreted by Dermatophagoides farinae and Dermatophagoides pteronyssinus, respectively. The human IgE antibody responses to the Group 1 allergens show more cross-reactivity than the murine IgG antibody responses which are largely species-specific. Here, we report the crystal structure of the mature form of Der f 1, which was isolated from its natural source, and a new, high-resolution structure of mature recombinant Der p 1. Unlike Der p 1, Der f 1 is monomeric both in the crystalline state and in solution. Moreover, no metal binding ismore » observed in the structure of Der f 1, despite the fact that all amino acids involved in Ca{sup 2+} binding in Der p 1 are completely conserved in Der f 1. Although Der p 1 and Der f 1 share extensive sequence identity, comparison of the crystal structures of both allergens revealed structural features which could explain the differences in murine and human IgE antibody responses to these allergens. There are structural differences between Der f 1 and Der p 1 which are unevenly distributed on the allergens' surfaces. This uneven spatial arrangement of conserved versus altered residues could explain both the specificity and cross-reactivity of antibodies against Der f 1 and Der p 1.« less
Niu, Qian; Ybe, Joel A
2008-02-01
Huntington's disease is a genetic neurological disorder that is triggered by the dissociation of the huntingtin protein (htt) from its obligate interaction partner Huntingtin-interacting protein 1 (HIP1). The release of the huntingtin protein permits HIP1 protein interactor (HIPPI) to bind to its recognition site on HIP1 to form a HIPPI/HIP1 complex that recruits procaspase-8 to begin the process of apoptosis. The interaction module between HIPPI and HIP1 was predicted to resemble a death-effector domain. Our 2.8-A crystal structure of the HIP1 371-481 subfragment that includes F432 and K474, which is important for HIPPI binding, is not a death-effector domain but is a partially opened coiled coil. The HIP1 371-481 model reveals a basic surface that we hypothesize to be suitable for binding HIPPI. There is an opened region next to the putative HIPPI site that is highly negatively charged. The acidic residues in this region are highly conserved in HIP1 and a related protein, HIP1R, from different organisms but are not conserved in the yeast homologue of HIP1, sla2p. We have modeled approximately 85% of the coiled-coil domain by joining our new HIP1 371-481 structure to the HIP1 482-586 model (Protein Data Bank code: 2NO2). Finally, the middle of this coiled-coil domain may be intrinsically flexible and suggests a new interaction model where HIPPI binds to a U-shaped HIP1 molecule.
Chung, Connie; Wu, Wei-Hua; Chen, Bo-Shiun
2015-01-01
The 14-3-3 family of proteins is widely distributed in the CNS where they are major regulators of essential neuronal functions. There are seven known mammalian 14-3-3 isoforms (ζ,, τ, ϵ, η, β, and σ), which generally function as adaptor proteins. Previously, we have demonstrated that 14-3-3ϵ isoform dynamically regulates forward trafficking of GluN2C-containing NMDA receptors (NMDARs) in cerebellar granule neurons, that when expressed on the surface, promotes neuronal survival following NMDA-induced excitotoxicity. Here, we report 14-3-3 isoform-specific binding and functional regulation of GluN2C. In particular, we show that GluN2C C-terminal domain (CTD) binds to all 14-3-3 isoforms except 14-3-3σ, and binding is dependent on GluN2C serine 1096 phosphorylation. Co-expression of 14-3-3 (ζ and ϵ) and GluN1/GluN2C promotes the forward delivery of receptors to the cell surface. We further identify novel residues serine 145, tyrosine 178, and cysteine 189 on α-helices 6, 7, and 8, respectively, within ζ-isoform as part of the GluN2C binding motif and independent of the canonical peptide binding groove. Mutation of these conserved residues abolishes GluN2C binding and has no functional effect on GluN2C trafficking. Reciprocal mutation of alanine 145, histidine 180, and isoleucine 191 on 14-3-3σ isoform promotes GluN2C binding and surface expression. Moreover, inhibiting endogenous 14-3-3 using a high-affinity peptide inhibitor, difopein, greatly diminishes GluN2C surface expression. Together, these findings highlight the isoform-specific structural and functional differences within the 14-3-3 family of proteins, which determine GluN2C binding and its essential role in targeting the receptor to the cell surface to facilitate glutamatergic neurotransmission. PMID:26229101
Denys, A; Allain, F; Carpentier, M; Spik, G
1998-12-15
Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway, and is released in biological fluids. We recently reported that CyPB specifically binds to T-lymphocytes and promotes enhanced incorporation of CsA. The interactions with cellular binding sites involved, at least in part, the specific N-terminal extension of the protein. In this study, we intended to specify further the nature of the CyPB-binding sites on peripheral blood T-lymphocytes. We first provide evidence that the CyPB binding to heparin-Sepharose is prevented by soluble sulphated glycosaminoglycans (GAG), raising the interesting possibility that such interactions may occur on the T-cell surface. We then characterized CyPB binding to T-cell surface GAG and found that these interactions involved the N-terminal extension of CyPB, but not its conserved CsA-binding domain. In addition, we determined the presence of a second CyPB binding site, which we termed a type I site, in contrast with type II for GAG interactions. The two binding sites exhibit a similar affinity but the expression of the type I site was 3-fold lower. The conclusion that CyPB binding to the type I site is distinct from the interactions with GAG was based on the findings that it was (1) resistant to NaCl wash and GAG-degrading enzyme treatments, (2) reduced in the presence of CsA or cyclophilin C, and (3) unmodified in the presence of either the N-terminal peptide of CyPB or protamine. Finally, we showed that the type I binding sites were involved in an endocytosis process, supporting the hypothesis that they may correspond to a functional receptor for CyPB.
Andersen, O M; Petersen, H H; Jacobsen, C; Moestrup, S K; Etzerodt, M; Andreasen, P A; Thøgersen, H C
2001-07-01
The low-density-lipoprotein-receptor (LDLR)-related protein (LRP) is composed of several classes of domains, including complement-type repeats (CR), which occur in clusters that contain binding sites for a multitude of different ligands. Each approximately 40-residue CR domain contains three conserved disulphide linkages and an octahedral Ca(2+) cage. LRP is a scavenging receptor for ligands from extracellular fluids, e.g. alpha(2)-macroglobulin (alpha(2)M)-proteinase complexes, lipoprotein-containing particles and serine proteinase-inhibitor complexes, like the complex between urokinase-type plasminogen activator (uPA) and the plasminogen activator inhibitor-1 (PAI-1). In the present study we analysed the interaction of the uPA-PAI-1 complex with an ensemble of fragments representing a complete overlapping set of two-domain fragments accounting for the ligand-binding cluster II (CR3-CR10) of LRP. By ligand blotting, solid-state competition analysis and surface-plasmon-resonance analysis, we demonstrate binding to multiple CR domains, but show a preferential interaction between the uPA-PAI-1 complex and a two-domain fragment comprising CR domains 5 and 6 of LRP. We demonstrate that surface-exposed aspartic acid and tryptophan residues at identical positions in the two homologous domains, CR5 and CR6 (Asp(958,CR5), Asp(999,CR6), Trp(953,CR5) and Trp(994,CR6)), are critical for the binding of the complex as well as for the binding of the receptor-associated protein (RAP) - the folding chaperone/escort protein required for transport of LRP to the cell surface. Accordingly, the present work provides (1) an identification of a preferred binding site within LRP CR cluster II; (2) evidence that the uPA-PAI-1 binding site involves residues from two adjacent protein domains; and (3) direct evidence identifying specific residues as important for the binding of uPA-PAI-1 as well as for the binding of RAP.
Gu, Qinyong; Zhang, Zeli; Gertzen, Christoph G W; Häussinger, Dieter; Gohlke, Holger; Münk, Carsten
2018-03-15
Members of the apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like (APOBEC3 [A3]) family of DNA cytidine deaminases are intrinsic restriction factors against retroviruses. In felids such as the domestic cat ( Felis catus ), the A3 genes encode the A3Z2, A3Z3, and A3Z2Z3 antiviral cytidine deaminases. Only A3Z3 and A3Z2Z3 inhibit viral infectivity factor (Vif)-deficient feline immunodeficiency virus (FIV). The FIV Vif protein interacts with Cullin (CUL), Elongin B (ELOB), and Elongin C (ELOC) to form an E3 ubiquitination complex to induce the degradation of feline A3s. However, the functional domains in FIV Vif for the interaction with Cullin are poorly understood. Here, we found that the expression of dominant negative CUL5 prevented the degradation of feline A3s by FIV Vif, while dominant negative CUL2 had no influence on the degradation of A3. In coimmunoprecipitation assays, FIV Vif bound to CUL5 but not CUL2. To identify the CUL5 interaction site in FIV Vif, the conserved amino acids from positions 47 to 160 of FIV Vif were mutated, but these mutations did not impair the binding of Vif to CUL5. By focusing on a potential zinc-binding motif (K175-C161-C184-C187) of FIV Vif, we found a conserved hydrophobic region (174IR175) that is important for the CUL5 interaction. Mutation of this region also impaired the FIV Vif-induced degradation of feline A3s. Based on a structural model of the FIV Vif-CUL5 interaction, the 52LW53 region in CUL5 was identified as mediating binding to FIV Vif. By comparing our results to the human immunodeficiency virus type 1 (HIV-1) Vif-CUL5 interaction surface (120IR121, a hydrophobic region that is localized in the zinc-binding motif), we suggest that the CUL5 interaction surface in the diverse HIV-1 and FIV Vifs is evolutionarily conserved, indicating a strong structural constraint. However, the FIV Vif-CUL5 interaction is zinc independent, which contrasts with the zinc dependence of HIV-1 Vif. IMPORTANCE Feline immunodeficiency virus (FIV), which is similar to human immunodeficiency virus type 1 (HIV-1), replicates in its natural host in T cells and macrophages that express the antiviral restriction factor APOBEC3 (A3). To escape A3s, FIV and HIV induce the degradation of these proteins by building a ubiquitin ligase complex using the viral protein Vif to connect to cellular proteins, including Cullin 5. Here, we identified the protein residues that regulate this interaction in FIV Vif and Cullin 5. While our structural model suggests that the diverse FIV and HIV-1 Vifs use conserved residues for Cullin 5 binding, FIV Vif binds Cullin 5 independently of zinc, in contrast to HIV-1 Vif. Copyright © 2018 American Society for Microbiology.
Campbell, Jacquelyn A.; Schelling, Pierre; Wetzel, J. Denise; Johnson, Elizabeth M.; Forrest, J. Craig; Wilson, Greame A. R.; Aurrand-Lions, Michel; Imhof, Beat A.; Stehle, Thilo; Dermody, Terence S.
2005-01-01
Reovirus infections are initiated by the binding of viral attachment protein σ1 to receptors on the surface of host cells. The σ1 protein is an elongated fiber comprised of an N-terminal tail that inserts into the virion and a C-terminal head that extends from the virion surface. The prototype reovirus strains type 1 Lang/53 (T1L/53) and type 3 Dearing/55 (T3D/55) use junctional adhesion molecule A (JAM-A) as a receptor. The C-terminal half of the T3D/55 σ1 protein interacts directly with JAM-A, but the determinants of receptor-binding specificity have not been identified. In this study, we investigated whether JAM-A also mediates the attachment of the prototype reovirus strain type 2 Jones/55 (T2J/55) and a panel of field-isolate strains representing each of the three serotypes. Antibodies specific for JAM-A were capable of inhibiting infections of HeLa cells by T1L/53, T2J/55, and T3D/55, demonstrating that strains of all three serotypes use JAM-A as a receptor. To corroborate these findings, we introduced JAM-A or the structurally related JAM family members JAM-B and JAM-C into Chinese hamster ovary cells, which are poorly permissive for reovirus infection. Both prototype and field-isolate reovirus strains were capable of infecting cells transfected with JAM-A but not those transfected with JAM-B or JAM-C. A sequence analysis of the σ1-encoding S1 gene segment of the strains chosen for study revealed little conservation in the deduced σ1 amino acid sequences among the three serotypes. This contrasts markedly with the observed sequence variability within each serotype, which is confined to a small number of amino acids. Mapping of these residues onto the crystal structure of σ1 identified regions of conservation and variability, suggesting a likely mode of JAM-A binding via a conserved surface at the base of the σ1 head domain. PMID:15956543
Lee, Yong-Jik; Lee, Sang-Jae; Kim, Seong-Bo; Lee, Sang Jun; Lee, Sung Haeng; Lee, Dong-Woo
2014-03-18
Structural genomics demonstrates that despite low levels of structural similarity of proteins comprising a metabolic pathway, their substrate binding regions are likely to be conserved. Herein based on the 3D-structures of the α/β-fold proteins involved in the ara operon, we attempted to predict the substrate binding residues of thermophilic Geobacillus stearothermophilus L-arabinose isomerase (GSAI) with no 3D-structure available. Comparison of the structures of L-arabinose catabolic enzymes revealed a conserved feature to form the substrate-binding modules, which can be extended to predict the substrate binding site of GSAI (i.e., D195, E261 and E333). Moreover, these data implicated that proteins in the l-arabinose metabolic pathway might retain their substrate binding niches as the modular structure through conserved molecular evolution even with totally different structural scaffolds. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Nikolaienko, Roman M.; Hammel, Michal; Dubreuil, Véronique; ...
2016-08-18
Protein-tyrosine phosphatase receptor type G (RPTPγ/PTPRG) interacts in vitro with contactin-3-6 (CNTN3-6), a group of glycophosphatidylinositol-anchored cell adhesion molecules involved in the wiring of the nervous system. In addition to PTPRG, CNTNs associate with multiple transmembrane proteins and signal inside the cell via cis-binding partners to alleviate the absence of an intracellular region. Here, we use comprehensive biochemical and structural analyses to demonstrate that PTPRG·CNTN3-6 complexes share similar binding affinities and a conserved arrangement. Furthermore, as a first step to identifying PTPRG·CNTN complexes in vivo, we found that PTPRG and CNTN3 associate in the outer segments of mouse rod photoreceptormore » cells. In particular, PTPRG and CNTN3 form cis-complexes at the surface of photoreceptors yet interact in trans when expressed on the surfaces of apposing cells. Further structural analyses suggest that all CNTN ectodomains adopt a bent conformation and might lie parallel to the cell surface to accommodate these cis and trans binding modes. Taken together, these studies identify a PTPRG·CNTN complex in vivo and provide novel insights into PTPRG- and CNTN-mediated signaling.« less
Conserved Structural Elements in the V3 Crown of HIV-1 gp120
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jiang, X.; Burke, V; Totrov, M
2010-01-01
Binding of the third variable region (V3) of the HIV-1 envelope glycoprotein gp120 to the cell-surface coreceptors CCR5 or CXCR4 during viral entry suggests that there are conserved structural elements in this sequence-variable region. These conserved elements could serve as epitopes to be targeted by a vaccine against HIV-1. Here we perform a systematic structural analysis of representative human anti-V3 monoclonal antibodies in complex with V3 peptides, revealing that the crown of V3 has four conserved structural elements: an arch, a band, a hydrophobic core and the peptide backbone. These are either unaffected by or are subject to minimal sequencemore » variation. As these regions are targeted by cross-clade neutralizing human antibodies, they provide a blueprint for the design of vaccine immunogens that could elicit broadly cross-reactive protective antibodies.« less
Barbosa, Angela S.; Monaris, Denize; Silva, Ludmila B.; Morais, Zenaide M.; Vasconcellos, Sílvio A.; Cianciarullo, Aurora M.; Isaac, Lourdes; Abreu, Patricia A. E.
2010-01-01
We have previously shown that pathogenic leptospiral strains are able to bind C4b binding protein (C4BP). Surface-bound C4BP retains its cofactor activity, indicating that acquisition of this complement regulator may contribute to leptospiral serum resistance. In the present study, the abilities of seven recombinant putative leptospiral outer membrane proteins to interact with C4BP were evaluated. The protein encoded by LIC11947 interacted with this human complement regulator in a dose-dependent manner. The cofactor activity of C4BP bound to immobilized recombinant LIC11947 (rLIC11947) was confirmed by detecting factor I-mediated cleavage of C4b. rLIC11947 was therefore named LcpA (for leptospiral complement regulator-acquiring protein A). LcpA was shown to be an outer membrane protein by using immunoelectron microscopy, cell surface proteolysis, and Triton X-114 fractionation. The gene coding for LcpA is conserved among pathogenic leptospiral strains. This is the first characterization of a Leptospira surface protein that binds to the human complement regulator C4BP in a manner that allows this important regulator to control complement system activation mediated either by the classical pathway or by the lectin pathway. This newly identified protein may play a role in immune evasion by Leptospira spp. and may therefore represent a target for the development of a human vaccine against leptospirosis. PMID:20404075
Bacterial periplasmic sialic acid-binding proteins exhibit a conserved binding site
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gangi Setty, Thanuja; Cho, Christine; Govindappa, Sowmya
2014-07-01
Structure–function studies of sialic acid-binding proteins from F. nucleatum, P. multocida, V. cholerae and H. influenzae reveal a conserved network of hydrogen bonds involved in conformational change on ligand binding. Sialic acids are a family of related nine-carbon sugar acids that play important roles in both eukaryotes and prokaryotes. These sialic acids are incorporated/decorated onto lipooligosaccharides as terminal sugars in multiple bacteria to evade the host immune system. Many pathogenic bacteria scavenge sialic acids from their host and use them for molecular mimicry. The first step of this process is the transport of sialic acid to the cytoplasm, which oftenmore » takes place using a tripartite ATP-independent transport system consisting of a periplasmic binding protein and a membrane transporter. In this paper, the structural characterization of periplasmic binding proteins from the pathogenic bacteria Fusobacterium nucleatum, Pasteurella multocida and Vibrio cholerae and their thermodynamic characterization are reported. The binding affinities of several mutations in the Neu5Ac binding site of the Haemophilus influenzae protein are also reported. The structure and the thermodynamics of the binding of sugars suggest that all of these proteins have a very well conserved binding pocket and similar binding affinities. A significant conformational change occurs when these proteins bind the sugar. While the C1 carboxylate has been identified as the primary binding site, a second conserved hydrogen-bonding network is involved in the initiation and stabilization of the conformational states.« less
Oligomycin frames a common drug-binding site in the ATP synthase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Symersky, Jindrich; Osowski, Daniel; Walters, D. Eric
We report the high-resolution (1.9 {angstrom}) crystal structure of oligomycin bound to the subunit c10 ring of the yeast mitochondrial ATP synthase. Oligomycin binds to the surface of the c10 ring making contact with two neighboring molecules at a position that explains the inhibitory effect on ATP synthesis. The carboxyl side chain of Glu59, which is essential for proton translocation, forms an H-bond with oligomycin via a bridging water molecule but is otherwise shielded from the aqueous environment. The remaining contacts between oligomycin and subunit c are primarily hydrophobic. The amino acid residues that form the oligomycin-binding site are 100%more » conserved between human and yeast but are widely different from those in bacterial homologs, thus explaining the differential sensitivity to oligomycin. Prior genetics studies suggest that the oligomycin-binding site overlaps with the binding site of other antibiotics, including those effective against Mycobacterium tuberculosis, and thereby frames a common 'drug-binding site.' We anticipate that this drug-binding site will serve as an effective target for new antibiotics developed by rational design.« less
Schneider, T D
2001-12-01
The sequence logo for DNA binding sites of the bacteriophage P1 replication protein RepA shows unusually high sequence conservation ( approximately 2 bits) at a minor groove that faces RepA. However, B-form DNA can support only 1 bit of sequence conservation via contacts into the minor groove. The high conservation in RepA sites therefore implies a distorted DNA helix with direct or indirect contacts to the protein. Here I show that a high minor groove conservation signature also appears in sequence logos of sites for other replication origin binding proteins (Rts1, DnaA, P4 alpha, EBNA1, ORC) and promoter binding proteins (sigma(70), sigma(D) factors). This finding implies that DNA binding proteins generally use non-B-form DNA distortion such as base flipping to initiate replication and transcription.
Wu, Jia Wei; Krawitz, Ariel R; Chai, Jijie; Li, Wenyu; Zhang, Fangjiu; Luo, Kunxin; Shi, Yigong
2002-11-01
The Ski family of nuclear oncoproteins represses TGF-beta signaling through interactions with the Smad proteins. The crystal structure of the Smad4 binding domain of human c-Ski in complex with the MH2 domain of Smad4 reveals specific recognition of the Smad4 L3 loop region by a highly conserved interaction loop (I loop) from Ski. The Ski binding surface on Smad4 significantly overlaps with that required for binding of the R-Smads. Indeed, Ski disrupts the formation of a functional complex between the Co- and R-Smads, explaining how it could lead to repression of TGF-beta, activin, and BMP responses. Intriguingly, the structure of the Ski fragment, stabilized by a bound zinc atom, resembles the SAND domain, in which the corresponding I loop is responsible for DNA binding.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Osipiuk, J.; Gornicki, P.; Maj, L.
The structure of the YlxR protein of unknown function from Streptococcus pneumonia was determined to 1.35 Angstroms. YlxR is expressed from the nusA/infB operon in bacteria and belongs to a small protein family (COG2740) that shares a conserved sequence motif GRGA(Y/W). The family shows no significant amino-acid sequence similarity with other proteins. Three-wavelength diffraction MAD data were collected to 1.7 Angstroms from orthorhombic crystals using synchrotron radiation and the structure was determined using a semi-automated approach. The YlxR structure resembles a two-layer {alpha}/{beta} sandwich with the overall shape of a cylinder and shows no structural homology to proteins of knownmore » structure. Structural analysis revealed that the YlxR structure represents a new protein fold that belongs to the {alpha}-{beta} plait superfamily. The distribution of the electrostatic surface potential shows a large positively charged patch on one side of the protein, a feature often found in nucleic acid-binding proteins. Three sulfate ions bind to this positively charged surface. Analysis of potential binding sites uncovered several substantial clefts, with the largest spanning 3/4 of the protein. A similar distribution of binding sites and a large sharply bent cleft are observed in RNA-binding proteins that are unrelated in sequence and structure. It is proposed that YlxR is an RNA-binding protein.« less
Streptococcus pneumonia YlxR at 1.35 A shows a putative new fold.
Osipiuk, J; Górnicki, P; Maj, L; Dementieva, I; Laskowski, R; Joachimiak, A
2001-11-01
The structure of the YlxR protein of unknown function from Streptococcus pneumonia was determined to 1.35 A. YlxR is expressed from the nusA/infB operon in bacteria and belongs to a small protein family (COG2740) that shares a conserved sequence motif GRGA(Y/W). The family shows no significant amino-acid sequence similarity with other proteins. Three-wavelength diffraction MAD data were collected to 1.7 A from orthorhombic crystals using synchrotron radiation and the structure was determined using a semi-automated approach. The YlxR structure resembles a two-layer alpha/beta sandwich with the overall shape of a cylinder and shows no structural homology to proteins of known structure. Structural analysis revealed that the YlxR structure represents a new protein fold that belongs to the alpha-beta plait superfamily. The distribution of the electrostatic surface potential shows a large positively charged patch on one side of the protein, a feature often found in nucleic acid-binding proteins. Three sulfate ions bind to this positively charged surface. Analysis of potential binding sites uncovered several substantial clefts, with the largest spanning 3/4 of the protein. A similar distribution of binding sites and a large sharply bent cleft are observed in RNA-binding proteins that are unrelated in sequence and structure. It is proposed that YlxR is an RNA-binding protein.
Ntumngia, Francis B; Pires, Camilla V; Barnes, Samantha J; George, Miriam T; Thomson-Luque, Richard; Kano, Flora S; Alves, Jessica R S; Urusova, Darya; Pereira, Dhelio B; Tolia, Niraj H; King, Christopher L; Carvalho, Luzia H; Adams, John H
2017-10-23
Plasmodium vivax invasion into human reticulocytes is a complex process. The Duffy binding protein (DBP) dimerization with its cognate receptor is vital for junction formation in the invasion process. Due to its functional importance, DBP is considered a prime vaccine candidate, but variation in B-cell epitopes at the dimer interface of DBP leads to induction of strain-limited immunity. We believe that the polymorphic residues tend to divert immune responses away from functionally conserved epitopes important for receptor binding or DBP dimerization. As a proof of concept, we engineered the vaccine DEKnull to ablate the dominant Bc epitope to partially overcome strain-specific immune antibody responses. Additional surface engineering on the next generation immunogen, DEKnull-2, provides an immunogenicity breakthrough to conserved protective epitopes. DEKnull-2 elicits a stronger broadly neutralizing response and reactivity with long-term persistent antibody responses of acquired natural immunity. By using novel engineered DBP immunogens, we validate that the prime targets of protective immunity are conformational epitopes at the dimer interface. These successful results indicate a potential approach that can be used generally to improve efficacy of other malaria vaccine candidates.
Structure of the Ebola VP35 interferon inhibitory domain.
Leung, Daisy W; Ginder, Nathaniel D; Fulton, D Bruce; Nix, Jay; Basler, Christopher F; Honzatko, Richard B; Amarasinghe, Gaya K
2009-01-13
Ebola viruses (EBOVs) cause rare but highly fatal outbreaks of viral hemorrhagic fever in humans, and approved treatments for these infections are currently lacking. The Ebola VP35 protein is multifunctional, acting as a component of the viral RNA polymerase complex, a viral assembly factor, and an inhibitor of host interferon (IFN) production. Mutation of select basic residues within the C-terminal half of VP35 abrogates its dsRNA-binding activity, impairs VP35-mediated IFN antagonism, and attenuates EBOV growth in vitro and in vivo. Because VP35 contributes to viral escape from host innate immunity and is required for EBOV virulence, understanding the structural basis for VP35 dsRNA binding, which correlates with suppression of IFN activity, is of high importance. Here, we report the structure of the C-terminal VP35 IFN inhibitory domain (IID) solved to a resolution of 1.4 A and show that VP35 IID forms a unique fold. In the structure, we identify 2 basic residue clusters, one of which is important for dsRNA binding. The dsRNA binding cluster is centered on Arg-312, a highly conserved residue required for IFN inhibition. Mutation of residues within this cluster significantly changes the surface electrostatic potential and diminishes dsRNA binding activity. The high-resolution structure and the identification of the conserved dsRNA binding residue cluster provide opportunities for antiviral therapeutic design. Our results suggest a structure-based model for dsRNA-mediated innate immune antagonism by Ebola VP35 and other similarly constructed viral antagonists.
The Rickettsia Surface Cell Antigen 4 Applies Mimicry to Bind to and Activate Vinculin*
Park, HaJeung; Lee, Jun Hyuck; Gouin, Edith; Cossart, Pascale; Izard, Tina
2011-01-01
Pathogenic Rickettsia species cause high morbidity and mortality, especially R. prowazekii, the causative agent of typhus. Like many intracellular pathogens, Rickettsia exploit the cytoskeleton to enter and spread within the host cell. Here we report that the cell surface antigen sca4 of Rickettsia co-localizes with vinculin in cells at sites of focal adhesions in sca4-transfected cells and that sca4 binds to and activates vinculin through two vinculin binding sites (VBSs) that are conserved across all Rickettsia. Remarkably, this occurs through molecular mimicry of the vinculin-talin interaction that is also seen with the IpaA invasin of the intracellular pathogen Shigella, where binding of these VBSs to the vinculin seven-helix bundle head domain (Vh1) displaces intramolecular interactions with the vinculin tail domain that normally clamp vinculin in an inactive state. Finally, the vinculin·sca4-VBS crystal structures reveal that vinculin adopts a new conformation when bound to the C-terminal VBS of sca4. Collectively, our data define the mechanism by which sca4 activates vinculin and interacts with the actin cytoskeleton, and they suggest important roles for vinculin in Rickettsia pathogenesis. PMID:21841197
Membrane and Integrative Nuclear Fibroblastic Growth Factor Receptor (FGFR) Regulation of FGF-23*
Han, Xiaobin; Xiao, Zhousheng; Quarles, L. Darryl
2015-01-01
Fibroblastic growth factor receptor 1 (FGFR1) signaling pathways are implicated in the regulation of FGF-23 gene transcription, but the molecular pathways remain poorly defined. We used low molecular weight (LMW, 18 kDa) FGF-2 and high molecular weight (HMW) FGF-2 isoforms, which, respectively, activate cell surface FGF receptors and intranuclear FGFR1, to determine the roles of membrane FGFRs and integrative nuclear FGFR1 signaling (INFS) in the regulation of FGF-23 gene transcription in osteoblasts. We found that LMW-FGF-2 induced NFAT and Ets1 binding to conserved cis-elements in the proximal FGF-23 promoter and stimulated FGF-23 promoter activity through PLCγ/calcineurin/NFAT and MAPK pathways in SaOS-2 and MC3T3-E1 osteoblasts. In contrast, HMW-FGF-2 stimulated FGF-23 promoter activity in osteoblasts through a cAMP-dependent binding of FGFR1 and cAMP-response element-binding protein (CREB) to a conserved cAMP response element (CRE) contiguous with the NFAT binding site in the FGF-23 promoter. Mutagenesis of the NFAT and CRE binding sites, respectively, inhibited the effects of LMW-FGF-2 and HMW-FGF-23 to stimulate FGF-23 promoter activity. FGF-2 activation of both membrane FGFRs and INFS-dependent FGFR1 pathways may provide a means to integrate systemic and local regulation of FGF-23 transcription under diverse physiological and pathological conditions. PMID:25752607
Identification of DNA-binding proteins using structural, electrostatic and evolutionary features.
Nimrod, Guy; Szilágyi, András; Leslie, Christina; Ben-Tal, Nir
2009-04-10
DNA-binding proteins (DBPs) participate in various crucial processes in the life-cycle of the cells, and the identification and characterization of these proteins is of great importance. We present here a random forests classifier for identifying DBPs among proteins with known 3D structures. First, clusters of evolutionarily conserved regions (patches) on the surface of proteins were detected using the PatchFinder algorithm; earlier studies showed that these regions are typically the functionally important regions of proteins. Next, we trained a classifier using features like the electrostatic potential, cluster-based amino acid conservation patterns and the secondary structure content of the patches, as well as features of the whole protein, including its dipole moment. Using 10-fold cross-validation on a dataset of 138 DBPs and 110 proteins that do not bind DNA, the classifier achieved a sensitivity and a specificity of 0.90, which is overall better than the performance of published methods. Furthermore, when we tested five different methods on 11 new DBPs that did not appear in the original dataset, only our method annotated all correctly. The resulting classifier was applied to a collection of 757 proteins of known structure and unknown function. Of these proteins, 218 were predicted to bind DNA, and we anticipate that some of them interact with DNA using new structural motifs. The use of complementary computational tools supports the notion that at least some of them do bind DNA.
Low capping group surface density on zinc oxide nanocrystals.
Valdez, Carolyn N; Schimpf, Alina M; Gamelin, Daniel R; Mayer, James M
2014-09-23
The ligand shell of colloidal nanocrystals can dramatically affect their stability and reaction chemistry. We present a methodology to quantify the dodecylamine (DDA) capping shell of colloidal zinc oxide nanocrystals in a nonpolar solvent. Using NMR spectroscopy, three different binding regimes are observed: strongly bound, weakly associated, and free in solution. The surface density of bound DDA is constant over a range of nanocrystal sizes, and is low compared to both predictions of the number of surface cations and maximum coverages of self-assembled monolayers. The density of strongly bound DDA ligands on the as-prepared ZnO NCs is 25% of the most conservative estimate of the maximum surface DDA density. Thus, these NCs do not resemble the common picture of a densely capped surface ligand layer. Annealing the ZnO NCs in molten DDA for 12 h at 160 °C, which is thought to remove surface hydroxide groups, resulted in a decrease of the weakly associated DDA and an increase in the density of strongly bound DDA, to ca. 80% of the estimated density of a self-assembled monolayer on a flat ZnO surface. These findings suggest that as-prepared nanocrystal surfaces contain hydroxide groups (protons on the ZnO surfaces) that inhibit strong binding of DDA.
Chirgadze, Y N; Boshkova, E A; Polozov, R V; Sivozhelezov, V S; Dzyabchenko, A V; Kuzminsky, M B; Stepanenko, V A; Ivanov, V V
2018-01-07
The mouse factor Zif268, known also as early growth response protein EGR-1, is a classical representative for the Cys2His2 transcription factor family. It is required for binding the RNA polymerase with operator dsDNA to initialize the transcription process. We have shown that only in this family of total six Zn-finger protein families the Zn complex plays a significant role in the protein-DNA binding. Electrostatic feature of this complex in the binding of factor Zif268 from Mus musculus with operator DNA has been considered. The factor consists of three similar Zn-finger units which bind with triplets of coding DNA. Essential contacts of the factor with the DNA phosphates are formed by three conservative His residues, one in each finger. We describe here the results of calculations of the electrostatic potentials for the Zn-Cys2His2 complex, Zn-finger unit 1, and the whole transcription factor. The potential of Zif268 has a positive area on the factor surface, and it corresponds exactly to the binding sites of each of Zn-finger units. The main part of these areas is determined by conservative His residues, which form contacts with the DNA phosphate groups. Our result shows that the electrostatic positive potential of this histidine residue is enhanced due to the Zn complex. The other contacts of the Zn-finger with DNA are related to nucleotide bases, and they are responsible for the sequence-specific binding with DNA. This result may be extended to all other members of the Cys2His2 transcription factor family.
Monomeric Yeast Frataxin is an Iron-Binding Protein
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cook,J.; Bencze, K.; Jankovic, A.
Friedreich's ataxia, an autosomal cardio- and neurodegenerative disorder that affects 1 in 50 000 humans, is caused by decreased levels of the protein frataxin. Although frataxin is nuclear-encoded, it is targeted to the mitochondrial matrix and necessary for proper regulation of cellular iron homeostasis. Frataxin is required for the cellular production of both heme and iron-sulfur (Fe-S) clusters. Monomeric frataxin binds with high affinity to ferrochelatase, the enzyme involved in iron insertion into porphyrin during heme production. Monomeric frataxin also binds to Isu, the scaffold protein required for assembly of Fe-S cluster intermediates. These processes (heme and Fe-S cluster assembly)more » share requirements for iron, suggesting that monomeric frataxin might function as the common iron donor. To provide a molecular basis to better understand frataxin's function, we have characterized the binding properties and metal-site structure of ferrous iron bound to monomeric yeast frataxin. Yeast frataxin is stable as an iron-loaded monomer, and the protein can bind two ferrous iron atoms with micromolar binding affinity. Frataxin amino acids affected by the presence of iron are localized within conserved acidic patches located on the surfaces of both helix-1 and strand-1. Under anaerobic conditions, bound metal is stable in the high-spin ferrous state. The metal-ligand coordination geometry of both metal-binding sites is consistent with a six-coordinate iron-(oxygen/nitrogen) based ligand geometry, surely constructed in part from carboxylate and possibly imidazole side chains coming from residues within these conserved acidic patches on the protein. On the basis of our results, we have developed a model for how we believe yeast frataxin interacts with iron.« less
Monomeric Yeast Frataxin is an Iron Binding Protein†
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cook, J.; Bencze, K; Jankovic, A
Friedreich's ataxia, an autosomal cardio- and neurodegenerative disorder that affects 1 in 50000 humans, is caused by decreased levels of the protein frataxin. Although frataxin is nuclear-encoded, it is targeted to the mitochondrial matrix and necessary for proper regulation of cellular iron homeostasis. Frataxin is required for the cellular production of both heme and iron-sulfur (Fe-S) clusters. Monomeric frataxin binds with high affinity to ferrochelatase, the enzyme involved in iron insertion into porphyrin during heme production. Monomeric frataxin also binds to Isu, the scaffold protein required for assembly of Fe-S cluster intermediates. These processes (heme and Fe-S cluster assembly) sharemore » requirements for iron, suggesting that monomeric frataxin might function as the common iron donor. To provide a molecular basis to better understand frataxin's function, we have characterized the binding properties and metal-site structure of ferrous iron bound to monomeric yeast frataxin. Yeast frataxin is stable as an iron-loaded monomer, and the protein can bind two ferrous iron atoms with micromolar binding affinity. Frataxin amino acids affected by the presence of iron are localized within conserved acidic patches located on the surfaces of both helix-1 and strand-1. Under anaerobic conditions, bound metal is stable in the high-spin ferrous state. The metal-ligand coordination geometry of both metal-binding sites is consistent with a six-coordinate iron-(oxygen/nitrogen) based ligand geometry, surely constructed in part from carboxylate and possibly imidazole side chains coming from residues within these conserved acidic patches on the protein. On the basis of our results, we have developed a model for how we believe yeast frataxin interacts with iron.« less
Structures of Human Pumilio with Noncognate RNAs Reveal Molecular Mechanisms for Binding Promiscuity
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gupta,Y.; Nair, D.; Wharton, R.
2008-01-01
Pumilio is a founder member of the evolutionarily conserved Puf family of RNA-binding proteins that control a number of physiological processes in eukaryotes. A structure of human Pumilio (hPum) Puf domain bound to a Drosophila regulatory sequence showed that each Puf repeat recognizes a single nucleotide. Puf domains in general bind promiscuously to a large set of degenerate sequences, but the structural basis for this promiscuity has been unclear. Here, we describe the structures of hPum Puf domain complexed to two noncognate RNAs, CycBreverse and Puf5. In each complex, one of the nucleotides is ejected from the binding surface, inmore » effect, acting as a 'spacer.' The complexes also reveal the plasticity of several Puf repeats, which recognize noncanonical nucleotides. Together, these complexes provide a molecular basis for recognition of degenerate binding sites, which significantly increases the number of mRNAs targeted for regulation by Puf proteins in vivo.« less
Structural basis for DNA binding by replication initiator Mcm10
DOE Office of Scientific and Technical Information (OSTI.GOV)
Warren, Eric M.; Vaithiyalingam, Sivaraja; Haworth, Justin
2009-06-30
Mcm10 is an essential eukaryotic DNA replication protein required for assembly and progression of the replication fork. The highly conserved internal domain (Mcm10-ID) has been shown to physically interact with single-stranded (ss) DNA, DNA polymerase alpha, and proliferating cell nuclear antigen (PCNA). The crystal structure of Xenopus laevis Mcm10-ID presented here reveals a DNA binding architecture composed of an oligonucleotide/oligosaccharide-fold followed in tandem by a variant and highly basic zinc finger. NMR chemical shift perturbation and mutational studies of DNA binding activity in vitro reveal how Mcm10 uses this unique surface to engage ssDNA. Corresponding mutations in Saccharomyces cerevisiae resultmore » in increased sensitivity to replication stress, demonstrating the functional importance of DNA binding by this region of Mcm10 to replication. In addition, mapping Mcm10 mutations known to disrupt PCNA, polymerase alpha, and DNA interactions onto the crystal structure provides insight into how Mcm10 might coordinate protein and DNA binding within the replisome.« less
Dahlström, Käthe M; Salminen, Tiina A
2015-12-07
Cancerous Inhibitor of Protein Phosphatase 2A (CIP2A) is a human oncoprotein, which exerts its cancer-promoting function through interaction with other proteins, for example Protein Phosphatase 2A (PP2A) and MYC. The lack of structural information for CIP2A significantly prevents the design of anti-cancer therapeutics targeting this protein. In an attempt to counteract this fact, we modeled the three-dimensional structure of the N-terminal domain (CIP2A-ArmRP), analyzed key areas and amino acids, and coupled the results to the existing literature. The model reliably shows a stable armadillo repeat fold with a positively charged groove. The fact that this conserved groove highly likely binds peptides is corroborated by the presence of a conserved polar ladder, which is essential for the proper peptide-binding mode of armadillo repeat proteins and, according to our results, several known CIP2A interaction partners appropriately possess an ArmRP-binding consensus motif. Moreover, we show that Arg229Gln, which has been linked to the development of cancer, causes a significant change in charge and surface properties of CIP2A-ArmRP. In conclusion, our results reveal that CIP2A-ArmRP shares the typical fold, protein-protein interaction site and interaction patterns with other natural armadillo proteins and that, presumably, several interaction partners bind into the central groove of the modeled CIP2A-ArmRP. By providing essential structural characteristics of CIP2A, the present study significantly increases our knowledge on how CIP2A interacts with other proteins in cancer progression and how to develop new therapeutics targeting CIP2A. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.
Jiang, Ling; Kosenko, Anastasia; Yu, Clinton; Huang, Lan; Li, Xuejun; Hoshi, Naoto
2015-11-15
Neuronal excitability is strictly regulated by various mechanisms, including modulation of ion channel activity and trafficking. Stimulation of m1 muscarinic acetylcholine receptor (also known as CHRM1) increases neuronal excitability by suppressing the M-current generated by the Kv7/KCNQ channel family. We found that m1 muscarinic acetylcholine receptor stimulation also triggers surface transport of KCNQ subunits. This receptor-induced surface transport was observed with KCNQ2 as well as KCNQ3 homomeric channels, but not with Kv3.1 channels. Deletion analyses identified that a conserved domain in a proximal region of the N-terminal tail of KCNQ protein is crucial for this surface transport--the translocation domain. Proteins that bind to this domain were identified as α- and β-tubulin and collapsin response mediator protein 2 (CRMP-2; also known as DPYSL2). An inhibitor of casein kinase 2 (CK2) reduced tubulin binding to the translocation domain, whereas an inhibitor of glycogen synthase kinase 3 (GSK3) facilitated CRMP-2 binding to the translocation domain. Consistently, treatment with the GSK3 inhibitor enhanced receptor-induced KCNQ2 surface transport. M-current recordings from neurons showed that treatment with a GSK3 inhibitor shortened the duration of muscarinic suppression and led to over-recovery of the M-current. These results suggest that m1 muscarinic acetylcholine receptor stimulates surface transport of KCNQ channels through a CRMP-2-mediated pathway. © 2015. Published by The Company of Biologists Ltd.
Conserved regulation of mesenchymal gene expression by Fgf-8 in face and limb development.
Tucker, A S; Al Khamis, A; Ferguson, C A; Bach, I; Rosenfeld, M G; Sharpe, P T
1999-01-01
Clim-2 (NLI, Lbd1) is one of two related mouse proteins that interact with Lim-domain homeoproteins. In the mouse, embryonic expression of Clim-2 is particularly pronounced in facial ectomesenchyme and limb bud mesenchyme in association with Lim genes, Lhx-6 and Lmx-1 respectively. We show that in common with both these Lim genes, Clim-2 expression is regulated by signals from overlying epithelium. In both the developing face and the limb buds we identify Fgf-8 as the likely candidate signalling molecule that regulates Clim-2 expression. We show that in the mandibular arch, as in the limb, Fgf-8 functions in combination with CD44, a cell surface binding protein, and that blocking CD44 binding results in inhibition of Fgf8-induced expression of Clim-2 and Lhx-6. Regulation of gene expression by Fgf8 in association with CD44 is thus conserved between limb and mandibular arch development.
Rose, Patrick P; Hanna, Sheri L; Spiridigliozzi, Anna; Wannissorn, Nattha; Beiting, Daniel P; Ross, Susan R; Hardy, Richard W; Bambina, Shelly A; Heise, Mark T; Cherry, Sara
2011-08-18
Alphaviruses, including several emerging human pathogens, are a large family of mosquito-borne viruses with Sindbis virus being a prototypical member of the genus. The host factor requirements and receptors for entry of this class of viruses remain obscure. Using a Drosophila system, we identified the divalent metal ion transporter natural resistance-associated macrophage protein (NRAMP) as a host cell surface molecule required for Sindbis virus binding and entry into Drosophila cells. Consequently, flies mutant for dNRAMP were protected from virus infection. NRAMP2, the ubiquitously expressed vertebrate homolog, mediated binding and infection of Sindbis virus into mammalian cells, and murine cells deficient for NRAMP2 were nonpermissive to infection. Alphavirus glycoprotein chimeras demonstrated that the requirement for NRAMP2 is at the level of Sindbis virus entry. Given the conserved structure of alphavirus glycoproteins, and the widespread use of transporters for viral entry, other alphaviruses may use conserved multipass membrane proteins for infection. Copyright © 2011 Elsevier Inc. All rights reserved.
Kim, Byunghyuk; Emmons, Scott W
2017-09-13
Nervous system function relies on precise synaptic connections. A number of widely-conserved cell adhesion proteins are implicated in cell recognition between synaptic partners, but how these proteins act as a group to specify a complex neural network is poorly understood. Taking advantage of known connectivity in C. elegans , we identified and studied cell adhesion genes expressed in three interacting neurons in the mating circuits of the adult male. Two interacting pairs of cell surface proteins independently promote fasciculation between sensory neuron HOA and its postsynaptic target interneuron AVG: BAM-2/neurexin-related in HOA binds to CASY-1/calsyntenin in AVG; SAX-7/L1CAM in sensory neuron PHC binds to RIG-6/contactin in AVG. A third, basal pathway results in considerable HOA-AVG fasciculation and synapse formation in the absence of the other two. The features of this multiplexed mechanism help to explain how complex connectivity is encoded and robustly established during nervous system development.
Jeske, Mandy; Müller, Christoph W.; Ephrussi, Anne
2017-01-01
DEAD-box RNA helicases play important roles in a wide range of metabolic processes. Regulatory proteins can stimulate or block the activity of DEAD-box helicases. Here, we show that LOTUS (Limkain, Oskar, and Tudor containing proteins 5 and 7) domains present in the germline proteins Oskar, TDRD5 (Tudor domain-containing 5), and TDRD7 bind and stimulate the germline-specific DEAD-box RNA helicase Vasa. Our crystal structure of the LOTUS domain of Oskar in complex with the C-terminal RecA-like domain of Vasa reveals that the LOTUS domain occupies a surface on a DEAD-box helicase not implicated previously in the regulation of the enzyme's activity. We show that, in vivo, the localization of Drosophila Vasa to the nuage and germ plasm depends on its interaction with LOTUS domain proteins. The binding and stimulation of Vasa DEAD-box helicases by LOTUS domains are widely conserved. PMID:28536148
DOE Office of Scientific and Technical Information (OSTI.GOV)
Buffalo, Cosmo Z.; Bahn-Suh, Adrian J.; Hirakis, Sophia P.
No vaccine exists against group A Streptococcus (GAS), a leading cause of worldwide morbidity and mortality. A severe hurdle is the hypervariability of its major antigen, the M protein, with >200 different M types known. Neutralizing antibodies typically recognize M protein hypervariable regions (HVRs) and confer narrow protection. In stark contrast, human C4b-binding protein (C4BP), which is recruited to the GAS surface to block phagocytic killing, interacts with a remarkably large number of M protein HVRs (apparently ~90%). Such broad recognition is rare, and we discovered a unique mechanism for this through the structure determination of four sequence-diverse M proteinsmore » in complexes with C4BP. The structures revealed a uniform and tolerant ‘reading head’ in C4BP, which detected conserved sequence patterns hidden within hypervariability. Our results open up possibilities for rational therapies that target the M–C4BP interaction, and also inform a path towards vaccine design.« less
Mehdi, Haider; Naqvi, Asma; Kamboh, M. lIyas
2008-01-01
Human β2-glycoprotein I (β2GPI) binds to recombinant hepatitis B surface antigen (rHBsAg), but the location of the binding domain on β2GPI is unknown. It has been suggested that the lipid rather than the protein moiety of rHBsAg binds to β2GPI. Since β2 GPI binds to anionic phospholipids (PL) through its lipid binding region in the fifth domain of β2GPI, we predicted that this lipid binding region may also be involved in binding rHBsAg. In this study, we examined rHBsAg binding to two naturally occurring mutants of β2GPI, Cys306Gly and Trp316Ser, or evolutionarily conserved hydrophobic amino acid sequence, Leu313-Ala314-Phe315 in the fifth domain of β2GPI. The two naturally occurring mutations and two mutagenized amino acids, Leu313Gly or Phe315Ser, disrupted the binding of recombinant β2GPI (rβ2GPI) to both rHBsAg and cardiolipin (CL), an anionic PL. These results suggest that rHBsAg and CL share the same region in the fifth domain of β2GPI. Credence to this conclusion was further provided by competitive ELISA, where CL-bound rβ2GPI was incubated with increasing amounts of rHBsAg. As expected, pre-incubation of rβ2GPI with CL precluded binding to rHBsAg, indicating that CL and rHBsAg bind to the same region on β2GPI. Our data provide evidence that the lipid (PL) rather than the protein moiety of rHBsAg binds to β2GPI and that this binding region is located in the fifth domain of β2GPI, which also binds to anionic PL. PMID:18230366
Richard, Jonathan; Pacheco, Beatriz; Gohain, Neelakshi; Veillette, Maxime; Ding, Shilei; Alsahafi, Nirmin; Tolbert, William D; Prévost, Jérémie; Chapleau, Jean-Philippe; Coutu, Mathieu; Jia, Manxue; Brassard, Nathalie; Park, Jongwoo; Courter, Joel R; Melillo, Bruno; Martin, Loïc; Tremblay, Cécile; Hahn, Beatrice H; Kaufmann, Daniel E; Wu, Xueling; Smith, Amos B; Sodroski, Joseph; Pazgier, Marzena; Finzi, Andrés
2016-10-01
Human immunodeficiency virus type 1 (HIV-1) has evolved a sophisticated strategy to conceal conserved epitopes of its envelope glycoproteins (Env) recognized by antibody-dependent cellular cytotoxicity (ADCC)-mediating antibodies. These antibodies, which are present in the sera of most HIV-1-infected individuals, preferentially recognize Env in its CD4-bound conformation. Accordingly, recent studies showed that small CD4-mimetics (CD4mc) able to "push" Env into this conformation sensitize HIV-1-infected cells to ADCC mediated by HIV+ sera. Here we test whether CD4mc also expose epitopes recognized by anti-cluster A monoclonal antibodies such as A32, thought to be responsible for the majority of ADCC activity present in HIV+ sera and linked to decreased HIV-1 transmission in the RV144 trial. We made the surprising observation that CD4mc are unable to enhance recognition of HIV-1-infected cells by this family of antibodies in the absence of antibodies such as 17b, which binds a highly conserved CD4-induced epitope overlapping the co-receptor binding site (CoRBS). Our results indicate that CD4mc initially open the trimeric Env enough to allow the binding of CoRBS antibodies but not anti-cluster A antibodies. CoRBS antibody binding further opens the trimeric Env, allowing anti-cluster A antibody interaction and sensitization of infected cells to ADCC. Therefore, ADCC responses mediated by cluster A antibodies in HIV-positive sera involve a sequential opening of the Env trimer on the surface of HIV-1-infected cells. The understanding of the conformational changes required to expose these vulnerable Env epitopes might be important in the design of new strategies aimed at fighting HIV-1. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Drobni, Mirva; Hallberg, Kristina; Öhman, Ulla; Birve, Anna; Persson, Karina; Johansson, Ingegerd; Strömberg, Nicklas
2006-01-01
Background Actinomyces naeslundii genospecies 1 and 2 express type-2 fimbriae (FimA subunit polymers) with variant Galβ binding specificities and Actinomyces odontolyticus a sialic acid specificity to colonize different oral surfaces. However, the fimbrial nature of the sialic acid binding property and sequence information about FimA proteins from multiple strains are lacking. Results Here we have sequenced fimA genes from strains of A.naeslundii genospecies 1 (n = 4) and genospecies 2 (n = 4), both of which harboured variant Galβ-dependent hemagglutination (HA) types, and from A.odontolyticus PK984 with a sialic acid-dependent HA pattern. Three unique subtypes of FimA proteins with 63.8–66.4% sequence identity were present in strains of A. naeslundii genospecies 1 and 2 and A. odontolyticus. The generally high FimA sequence identity (>97.2%) within a genospecies revealed species specific sequences or segments that coincided with binding specificity. All three FimA protein variants contained a signal peptide, pilin motif, E box, proline-rich segment and an LPXTG sorting motif among other conserved segments for secretion, assembly and sorting of fimbrial proteins. The highly conserved pilin, E box and LPXTG motifs are present in fimbriae proteins from other Gram-positive bacteria. Moreover, only strains of genospecies 1 were agglutinated with type-2 fimbriae antisera derived from A. naeslundii genospecies 1 strain 12104, emphasizing that the overall folding of FimA may generate different functionalities. Western blot analyses with FimA antisera revealed monomers and oligomers of FimA in whole cell protein extracts and a purified recombinant FimA preparation, indicating a sortase-independent oligomerization of FimA. Conclusion The genus Actinomyces involves a diversity of unique FimA proteins with conserved pilin, E box and LPXTG motifs, depending on subspecies and associated binding specificity. In addition, a sortase independent oligomerization of FimA subunit proteins in solution was indicated. PMID:16686953
Morando, Maria Agnese; Saladino, Giorgio; D’Amelio, Nicola; Pucheta-Martinez, Encarna; Lovera, Silvia; Lelli, Moreno; López-Méndez, Blanca; Marenchino, Marco; Campos-Olivas, Ramón; Gervasio, Francesco Luigi
2016-01-01
Understanding the conformational changes associated with the binding of small ligands to their biological targets is a fascinating and meaningful question in chemistry, biology and drug discovery. One of the most studied and important is the so-called “DFG-flip” of tyrosine kinases. The conserved three amino-acid DFG motif undergoes an “in to out” movement resulting in a particular inactive conformation to which “type II” kinase inhibitors, such as the anti-cancer drug Imatinib, bind. Despite many studies, the details of this prototypical conformational change are still debated. Here we combine various NMR experiments and surface plasmon resonance with enhanced sampling molecular dynamics simulations to shed light into the conformational dynamics associated with the binding of Imatinib to the proto-oncogene c-Src. We find that both conformational selection and induced fit play a role in the binding mechanism, reconciling opposing views held in the literature. Moreover, an external binding pose and local unfolding (cracking) of the aG helix are observed. PMID:27087366
NASA Astrophysics Data System (ADS)
Morando, Maria Agnese; Saladino, Giorgio; D'Amelio, Nicola; Pucheta-Martinez, Encarna; Lovera, Silvia; Lelli, Moreno; López-Méndez, Blanca; Marenchino, Marco; Campos-Olivas, Ramón; Gervasio, Francesco Luigi
2016-04-01
Understanding the conformational changes associated with the binding of small ligands to their biological targets is a fascinating and meaningful question in chemistry, biology and drug discovery. One of the most studied and important is the so-called “DFG-flip” of tyrosine kinases. The conserved three amino-acid DFG motif undergoes an “in to out” movement resulting in a particular inactive conformation to which “type II” kinase inhibitors, such as the anti-cancer drug Imatinib, bind. Despite many studies, the details of this prototypical conformational change are still debated. Here we combine various NMR experiments and surface plasmon resonance with enhanced sampling molecular dynamics simulations to shed light into the conformational dynamics associated with the binding of Imatinib to the proto-oncogene c-Src. We find that both conformational selection and induced fit play a role in the binding mechanism, reconciling opposing views held in the literature. Moreover, an external binding pose and local unfolding (cracking) of the aG helix are observed.
Ringwald, M; Schuh, R; Vestweber, D; Eistetter, H; Lottspeich, F; Engel, J; Dölz, R; Jähnig, F; Epplen, J; Mayer, S
1987-01-01
We have determined the amino acid sequence of the Ca2+-dependent cell adhesion molecule uvomorulin as it appears on the cell surface. The extracellular part of the molecule exhibits three internally repeated domains of 112 residues which are most likely generated by gene duplication. Each of the repeated domains contains two highly conserved units which could represent putative Ca2+-binding sites. Secondary structure predictions suggest that the putative Ca2+-binding units are located in external loops at the surface of the protein. The protein sequence exhibits a single membrane-spanning region and a cytoplasmic domain. Sequence comparison reveals extensive homology to the chicken L-CAM. Both uvomorulin and L-CAM are identical in 65% of their entire amino acid sequence suggesting a common origin for both CAMs. Images Fig. 1. Fig. 4. Fig. 7. PMID:3501370
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nemčovičová, Ivana; Slovak Academy of Sciences, Dúbravská cesta 9, SK 84505 Bratislava; Zajonc, Dirk M., E-mail: dzajonc@liai.org
2014-03-01
The crystal structure of Human cytomegalovirus immune modulator UL141 was solved at 3.25 Å resolution. Here, a detailed analysis of its intimate dimerization interface and the biophysical properties of its receptor (TRAIL-R2 and CD155) binding interactions are presented. Natural killer (NK) cells are critical components of the innate immune system as they rapidly detect and destroy infected cells. To avoid immune recognition and to allow long-term persistence in the host, Human cytomegalovirus (HCMV) has evolved a number of genes to evade or inhibit immune effector pathways. In particular, UL141 can inhibit cell-surface expression of both the NK cell-activating ligand CD155more » as well as the TRAIL death receptors (TRAIL-R1 and TRAIL-R2). The crystal structure of unliganded HCMV UL141 refined to 3.25 Å resolution allowed analysis of its head-to-tail dimerization interface. A ‘dimerization-deficient’ mutant of UL141 (ddUL141) was further designed, which retained the ability to bind to TRAIL-R2 or CD155 while losing the ability to cross-link two receptor monomers. Structural comparison of unliganded UL141 with UL141 bound to TRAIL-R2 further identified a mobile loop that makes intimate contacts with TRAIL-R2 upon receptor engagement. Superposition of the Ig-like domain of UL141 on the CD155 ligand T-cell immunoreceptor with Ig and ITIM domains (TIGIT) revealed that UL141 can potentially engage CD155 similar to TIGIT by using the C′C′′ and GF loops. Further mutations in the TIGIT binding site of CD155 (Q63R and F128R) abrogated UL141 binding, suggesting that the Ig-like domain of UL141 is a viral mimic of TIGIT, as it targets the same binding site on CD155 using similar ‘lock-and-key’ interactions. Sequence alignment of the UL141 gene and its orthologues also showed conservation in this highly hydrophobic (L/A)X{sub 6}G ‘lock’ motif for CD155 binding as well as conservation of the TRAIL-R2 binding patches, suggesting that these host–receptor interactions are evolutionary conserved.« less
Functional Advantages of Conserved Intrinsic Disorder in RNA-Binding Proteins.
Varadi, Mihaly; Zsolyomi, Fruzsina; Guharoy, Mainak; Tompa, Peter
2015-01-01
Proteins form large macromolecular assemblies with RNA that govern essential molecular processes. RNA-binding proteins have often been associated with conformational flexibility, yet the extent and functional implications of their intrinsic disorder have never been fully assessed. Here, through large-scale analysis of comprehensive protein sequence and structure datasets we demonstrate the prevalence of intrinsic structural disorder in RNA-binding proteins and domains. We addressed their functionality through a quantitative description of the evolutionary conservation of disordered segments involved in binding, and investigated the structural implications of flexibility in terms of conformational stability and interface formation. We conclude that the functional role of intrinsically disordered protein segments in RNA-binding is two-fold: first, these regions establish extended, conserved electrostatic interfaces with RNAs via induced fit. Second, conformational flexibility enables them to target different RNA partners, providing multi-functionality, while also ensuring specificity. These findings emphasize the functional importance of intrinsically disordered regions in RNA-binding proteins.
Identification and therapeutic potential of a vitronectin binding region of meningococcal msf.
Hill, Darryl J; Griffiths, Natalie J; Borodina, Elena; Andreae, Clio A; Sessions, Richard B; Virji, Mumtaz
2015-01-01
The human pathogen Neisseria meningitides (Nm) attains serum resistance via a number of mechanisms, one of which involves binding to the host complement regulator protein vitronectin. We have shown previously that the Meningococcal surface fibril (Msf), a trimeric autotransporter, binds to the activated form of vitronectin (aVn) to increase Nm survival in human serum. In this study, we aimed to identify the aVn-binding region of Msf to assess its potential as an antigen which can elicit antibodies that block aVn binding and/or possess bactericidal properties. Using several recombinant Msf fragments spanning its surface-exposed region, the smallest aVn-binding recombinants were found to span residues 1-86 and 39-124. The use of further deletion constructs and overlapping recombinant Msf fragments suggested that a region of Msf comprising residues 39-82 may be primarily important for aVn binding and that other regions may also be involved but to a lesser extent. Molecular modelling implicated K66 and K68, conserved in all available Msf sequences, to be involved in the interaction. Recombinant fragments which bound to aVn were able to reduce the survival advantage conveyed by aVn-interaction in serum bactericidal assays. Antibodies raised against one such fragment inhibited aVn binding to Msf. In addition, the antibodies enhanced specific killing of Msf-expressing Nm in a dose-dependent manner. Overall, this study identifies an aVn-binding region of Msf, an adhesin known to impart serum resistance properties to the pathogen; and shows that this region of Msf can elicit antibodies with dual properties which reduce pathogen survival within the host and thus has potential as a vaccine antigen.
Identification and Therapeutic Potential of a Vitronectin Binding Region of Meningococcal Msf
Hill, Darryl J.; Griffiths, Natalie J.; Borodina, Elena; Andreae, Clio A.; Sessions, Richard B.; Virji, Mumtaz
2015-01-01
The human pathogen Neisseria meningitides (Nm) attains serum resistance via a number of mechanisms, one of which involves binding to the host complement regulator protein vitronectin. We have shown previously that the Meningococcal surface fibril (Msf), a trimeric autotransporter, binds to the activated form of vitronectin (aVn) to increase Nm survival in human serum. In this study, we aimed to identify the aVn-binding region of Msf to assess its potential as an antigen which can elicit antibodies that block aVn binding and/or possess bactericidal properties. Using several recombinant Msf fragments spanning its surface-exposed region, the smallest aVn-binding recombinants were found to span residues 1-86 and 39-124. The use of further deletion constructs and overlapping recombinant Msf fragments suggested that a region of Msf comprising residues 39-82 may be primarily important for aVn binding and that other regions may also be involved but to a lesser extent. Molecular modelling implicated K66 and K68, conserved in all available Msf sequences, to be involved in the interaction. Recombinant fragments which bound to aVn were able to reduce the survival advantage conveyed by aVn-interaction in serum bactericidal assays. Antibodies raised against one such fragment inhibited aVn binding to Msf. In addition, the antibodies enhanced specific killing of Msf-expressing Nm in a dose-dependent manner. Overall, this study identifies an aVn-binding region of Msf, an adhesin known to impart serum resistance properties to the pathogen; and shows that this region of Msf can elicit antibodies with dual properties which reduce pathogen survival within the host and thus has potential as a vaccine antigen. PMID:25826209
Stenmark, Pål; Dupuy, Jérôme; Imamura, Akihiro; Kiso, Makoto; Stevens, Raymond C
2008-08-15
Botulinum neurotoxins have a very high affinity and specificity for their target cells requiring two different co-receptors located on the neuronal cell surface. Different toxin serotypes have different protein receptors; yet, most share a common ganglioside co-receptor, GT1b. We determined the crystal structure of the botulinum neurotoxin serotype A binding domain (residues 873-1297) alone and in complex with a GT1b analog at 1.7 A and 1.6 A, respectively. The ganglioside GT1b forms several key hydrogen bonds to conserved residues and binds in a shallow groove lined by Tryptophan 1266. GT1b binding does not induce any large structural changes in the toxin; therefore, it is unlikely that allosteric effects play a major role in the dual receptor recognition. Together with the previously published structures of botulinum neurotoxin serotype B in complex with its protein co-receptor, we can now generate a detailed model of botulinum neurotoxin's interaction with the neuronal cell surface. The two branches of the GT1b polysaccharide, together with the protein receptor site, impose strict geometric constraints on the mode of interaction with the membrane surface and strongly support a model where one end of the 100 A long translocation domain helix bundle swing into contact with the membrane, initiating the membrane anchoring event.
Molecular recognition of pyr mRNA by the Bacillus subtilis attenuation regulatory protein PyrR
Bonner, Eric R.; D’Elia, John N.; Billips, Benjamin K.; Switzer, Robert L.
2001-01-01
The pyrimidine nucleotide biosynthesis (pyr) operon in Bacillus subtilis is regulated by transcriptional attenuation. The PyrR protein binds in a uridine nucleotide-dependent manner to three attenuation sites at the 5′-end of pyr mRNA. PyrR binds an RNA-binding loop, allowing a terminator hairpin to form and repressing the downstream genes. The binding of PyrR to defined RNA molecules was characterized by a gel mobility shift assay. Titration indicated that PyrR binds RNA in an equimolar ratio. PyrR bound more tightly to the binding loops from the second (BL2 RNA) and third (BL3 RNA) attenuation sites than to the binding loop from the first (BL1 RNA) attenuation site. PyrR bound BL2 RNA 4–5-fold tighter in the presence of saturating UMP or UDP and 150- fold tighter with saturating UTP, suggesting that UTP is the more important co-regulator. The minimal RNA that bound tightly to PyrR was 28 nt long. Thirty-one structural variants of BL2 RNA were tested for PyrR binding affinity. Two highly conserved regions of the RNA, the terminal loop and top of the upper stem and a purine-rich internal bulge and the base pairs below it, were crucial for tight binding. Conserved elements of RNA secondary structure were also required for tight binding. PyrR protected conserved areas of the binding loop in hydroxyl radical footprinting experiments. PyrR likely recognizes conserved RNA sequences, but only if they are properly positioned in the correct secondary structure. PMID:11726695
Ashford, Paul; Moss, David S; Alex, Alexander; Yeap, Siew K; Povia, Alice; Nobeli, Irene; Williams, Mark A
2012-03-14
Protein structures provide a valuable resource for rational drug design. For a protein with no known ligand, computational tools can predict surface pockets that are of suitable size and shape to accommodate a complementary small-molecule drug. However, pocket prediction against single static structures may miss features of pockets that arise from proteins' dynamic behaviour. In particular, ligand-binding conformations can be observed as transiently populated states of the apo protein, so it is possible to gain insight into ligand-bound forms by considering conformational variation in apo proteins. This variation can be explored by considering sets of related structures: computationally generated conformers, solution NMR ensembles, multiple crystal structures, homologues or homology models. It is non-trivial to compare pockets, either from different programs or across sets of structures. For a single structure, difficulties arise in defining particular pocket's boundaries. For a set of conformationally distinct structures the challenge is how to make reasonable comparisons between them given that a perfect structural alignment is not possible. We have developed a computational method, Provar, that provides a consistent representation of predicted binding pockets across sets of related protein structures. The outputs are probabilities that each atom or residue of the protein borders a predicted pocket. These probabilities can be readily visualised on a protein using existing molecular graphics software. We show how Provar simplifies comparison of the outputs of different pocket prediction algorithms, of pockets across multiple simulated conformations and between homologous structures. We demonstrate the benefits of use of multiple structures for protein-ligand and protein-protein interface analysis on a set of complexes and consider three case studies in detail: i) analysis of a kinase superfamily highlights the conserved occurrence of surface pockets at the active and regulatory sites; ii) a simulated ensemble of unliganded Bcl2 structures reveals extensions of a known ligand-binding pocket not apparent in the apo crystal structure; iii) visualisations of interleukin-2 and its homologues highlight conserved pockets at the known receptor interfaces and regions whose conformation is known to change on inhibitor binding. Through post-processing of the output of a variety of pocket prediction software, Provar provides a flexible approach to the analysis and visualization of the persistence or variability of pockets in sets of related protein structures.
Chandler, Jennifer C; Gandhi, Neha S; Mancera, Ricardo L; Smith, Greg; Elizur, Abigail; Ventura, Tomer
2017-08-23
The insulin signalling system is one of the most conserved endocrine systems of Animalia from mollusc to man. In decapod Crustacea , such as the Eastern spiny lobster, Sagmariasus verreauxi (Sv) and the red-claw crayfish, Cherax quadricarinatus (Cq), insulin endocrinology governs male sexual differentiation through the action of a male-specific, insulin-like androgenic gland peptide (IAG). To understand the bioactivity of IAG it is necessary to consider its bio-regulators such as the insulin-like growth factor binding protein (IGFBP). This work has employed various molecular modelling approaches to represent S. verreauxi IGFBP and IAG, along with additional Sv-ILP ligands, in order to characterise their binding interactions. Firstly, we present Sv- and Cq-ILP2: neuroendocrine factors that share closest homology with Drosophila ILP8 (Dilp8). We then describe the binding interaction of the N-terminal domain of Sv-IGFBP and each ILP through a synergy of computational analyses. In-depth interaction mapping and computational alanine scanning of IGFBP_N' highlight the conserved involvement of the hotspot residues Q 67 , G 70 , D 71 , S 72 , G 91 , G 92 , T 93 and D 94 . The significance of the negatively charged residues D 71 and D 94 was then further exemplified by structural electrostatics. The functional importance of the negative surface charge of IGFBP is exemplified in the complementary electropositive charge on the reciprocal binding interface of all three ILP ligands. When examined, this electrostatic complementarity is the inverse of vertebrate homologues; such physicochemical divergences elucidate towards ligand-binding specificity between Phyla.
Structural Characterization of Phosducin and Its Complex with the 14-3-3 Protein*
Kacirova, Miroslava; Kosek, Dalibor; Kadek, Alan; Man, Petr; Vecer, Jaroslav; Herman, Petr; Obsilova, Veronika; Obsil, Tomas
2015-01-01
Phosducin (Pdc), a highly conserved phosphoprotein involved in the regulation of retinal phototransduction cascade, transcriptional control, and modulation of blood pressure, is controlled in a phosphorylation-dependent manner, including the binding to the 14-3-3 protein. However, the molecular mechanism of this regulation is largely unknown. Here, the solution structure of Pdc and its interaction with the 14-3-3 protein were investigated using small angle x-ray scattering, time-resolved fluorescence spectroscopy, and hydrogen-deuterium exchange coupled to mass spectrometry. The 14-3-3 protein dimer interacts with Pdc using surfaces both inside and outside its central channel. The N-terminal domain of Pdc, where both phosphorylation sites and the 14-3-3-binding motifs are located, is an intrinsically disordered protein that reduces its flexibility in several regions without undergoing dramatic disorder-to-order transition upon binding to 14-3-3. Our data also indicate that the C-terminal domain of Pdc interacts with the outside surface of the 14-3-3 dimer through the region involved in Gtβγ binding. In conclusion, we show that the 14-3-3 protein interacts with and sterically occludes both the N- and C-terminal Gtβγ binding interfaces of phosphorylated Pdc, thus providing a mechanistic explanation for the 14-3-3-dependent inhibition of Pdc function. PMID:25971962
Haem Recognition By a Staphylococcus Aureus NEAT Domain
DOE Office of Scientific and Technical Information (OSTI.GOV)
Grigg, J.C.; Vermeiren, C.; Heinrichs, D.E.
2009-06-01
Successful pathogenic organisms have developed mechanisms to thrive under extreme levels of iron restriction. Haem-iron represents the largest iron reservoir in the human body and is a significant source of iron for some bacterial pathogens. NEAT (NEAr Transporter) domains are found exclusively in a family of cell surface proteins in Gram-positive bacteria. Many NEAT domain-containing proteins, including IsdA in Staphylococcus aureus, are implicated in haem binding. Here, we show that overexpression of IsdA in S. aureus enhances growth and an inactivation mutant of IsdA has a growth defect, compared with wild type, when grown in media containing haem as themore » sole iron source. Furthermore, the haem-binding property of IsdA is contained within the NEAT domain. Crystal structures of the apo-IsdA NEAT domain and in complex with haem were solved and reveal a clathrin adapter-like beta-sandwich fold with a large hydrophobic haem-binding pocket. Haem is bound with the propionate groups directed at the molecular surface and the iron is co-ordinated solely by Tyr(166). The phenol groups of Tyr(166) and Tyr(170) form an H-bond that may function in regulating haem binding and release. An analysis of IsdA structure-sequence alignments indicate that conservation of Tyr(166) is a predictor of haem binding by NEAT domains.« less
Participation of cysteine-rich secretory proteins (CRISP) in mammalian sperm-egg interaction.
Cohen, Débora J; Busso, Dolores; Da Ros, Vanina; Ellerman, Diego A; Maldera, Julieta A; Goldweic, Nadia; Cuasnicu, Patricia S
2008-01-01
Mammalian fertilization is a complex multi-step process mediated by different molecules present on both gametes. CRISP1 (cysteine-rich secretory protein 1) is an epididymal protein thought to participate in gamete fusion through its binding to egg-complementary sites. Structure-function studies using recombinant fragments of CRISP1 as well as synthetic peptides reveal that its egg-binding ability resides in a 12 amino acid region corresponding to an evolutionary conserved motif of the CRISP family, named Signature 2 (S2). Further experiments analyzing both the ability of other CRISP proteins to bind to the rat egg and the amino acid sequence of their S2 regions show that the amino acid sequence of the S2 is needed for CRISP1 to interact with the egg. CRISP1 appears to be involved in the first step of sperm binding to the zona pellucida, identifying a novel role for this protein in fertilization. The observation that sperm testicular CRISP2 is also able to bind to the egg surface suggests a role for this protein in gamete fusion. Subsequent experiments confirmed the participation of CRISP2 in this step of fertilization and revealed that CRISP1 and CRISP2 interact with common egg surface binding sites. Together, these results suggest a functional cooperation between CRISP1 and CRISP2 to ensure the success of fertilization. These observations contribute to a better understanding of the molecular mechanisms underlying mammalian fertilization.
Nikolaienko, Roman M; Hammel, Michal; Dubreuil, Véronique; Zalmai, Rana; Hall, David R; Mehzabeen, Nurjahan; Karuppan, Sebastian J; Harroch, Sheila; Stella, Salvatore L; Bouyain, Samuel
2016-10-07
Protein-tyrosine phosphatase receptor type G (RPTPγ/PTPRG) interacts in vitro with contactin-3-6 (CNTN3-6), a group of glycophosphatidylinositol-anchored cell adhesion molecules involved in the wiring of the nervous system. In addition to PTPRG, CNTNs associate with multiple transmembrane proteins and signal inside the cell via cis-binding partners to alleviate the absence of an intracellular region. Here, we use comprehensive biochemical and structural analyses to demonstrate that PTPRG·CNTN3-6 complexes share similar binding affinities and a conserved arrangement. Furthermore, as a first step to identifying PTPRG·CNTN complexes in vivo, we found that PTPRG and CNTN3 associate in the outer segments of mouse rod photoreceptor cells. In particular, PTPRG and CNTN3 form cis-complexes at the surface of photoreceptors yet interact in trans when expressed on the surfaces of apposing cells. Further structural analyses suggest that all CNTN ectodomains adopt a bent conformation and might lie parallel to the cell surface to accommodate these cis and trans binding modes. Taken together, these studies identify a PTPRG·CNTN complex in vivo and provide novel insights into PTPRG- and CNTN-mediated signaling. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Lohman, Danielle C.; Forouhar, Farhad; Beebe, Emily T.; Stefely, Matthew S.; Minogue, Catherine E.; Ulbrich, Arne; Stefely, Jonathan A.; Sukumar, Shravan; Luna-Sánchez, Marta; Jochem, Adam; Lew, Scott; Seetharaman, Jayaraman; Xiao, Rong; Wang, Huang; Westphall, Michael S.; Wrobel, Russell L.; Everett, John K.; Mitchell, Julie C.; López, Luis C.; Coon, Joshua J.; Tong, Liang; Pagliarini, David J.
2014-01-01
Coenzyme Q (CoQ) is an isoprenylated quinone that is essential for cellular respiration and is synthesized in mitochondria by the combined action of at least nine proteins (COQ1–9). Although most COQ proteins are known to catalyze modifications to CoQ precursors, the biochemical role of COQ9 remains unclear. Here, we report that a disease-related COQ9 mutation leads to extensive disruption of the CoQ protein biosynthetic complex in a mouse model, and that COQ9 specifically interacts with COQ7 through a series of conserved residues. Toward understanding how COQ9 can perform these functions, we solved the crystal structure of Homo sapiens COQ9 at 2.4 Å. Unexpectedly, our structure reveals that COQ9 has structural homology to the TFR family of bacterial transcriptional regulators, but that it adopts an atypical TFR dimer orientation and is not predicted to bind DNA. Our structure also reveals a lipid-binding site, and mass spectrometry-based analyses of purified COQ9 demonstrate that it associates with multiple lipid species, including CoQ itself. The conserved COQ9 residues necessary for its interaction with COQ7 comprise a surface patch around the lipid-binding site, suggesting that COQ9 might serve to present its bound lipid to COQ7. Collectively, our data define COQ9 as the first, to our knowledge, mammalian TFR structural homolog and suggest that its lipid-binding capacity and association with COQ7 are key features for enabling CoQ biosynthesis. PMID:25339443
Mustafaoglu, Nur; Alves, Nathan J; Bilgicer, Basar
2015-09-08
Oriented immobilization of antibodies and antibody fragments has become increasingly important as a result of the efforts to reduce the size of diagnostic and sensor devices to miniaturized dimensions for improved accessibility to the end-user. Reduced dimensions of sensor devices necessitate the immobilized antibodies to conserve their antigen binding activity for proper operation. Fab fragments are becoming more commonly used in small-scaled diagnostic devices due to their small size and ease of manufacture. In this study, we used the previously described UV-NBS(Biotin) method to functionalize Fab fragments with IBA-EG11-Biotin linker utilizing UV energy to initiate a photo-cross-linking reaction between the nucleotide binding site (NBS) on the Fab fragment and IBA-Biotin molecule. Our results demonstrate that immobilization of biotinylated Fab fragments via UV-NBS(Biotin) method generated the highest level of immobilized Fab on surfaces when compared to other typical immobilization methods while preserving antigen binding activity. UV-NBS(Biotin) method provided 432-fold, 114-fold, and 29-fold improved antigen detection sensitivity than physical adsorption, NHS-Biotin, and ε-NH3(+), methods, respectively. Additionally, the limit of detection (LOD) for PSA utilizing Fab fragments immobilized via UV-NBS(Biotin) method was significantly lower than that of the other immobilization methods, with an LOD of 0.4 pM PSA. In summary, site-specific biotinylation of Fab fragments without structural damage or loss in antigen binding activity provides a wide range of application potential for UV-NBS immobilization technique across numerous diagnostic devices and nanotechnologies.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dahms, Sven O., E-mail: sdahms@fli-leibniz.de; Mayer, Magnus C.; Miltenyi Biotec GmbH, Robert-Koch-Strasse 1, 17166 Teterow
2015-03-01
Two X-ray structures of APLP1 E2 with and without a heparin dodecasaccharide are presented, revealing two distinct binding modes of the protein to heparan sulfate. The data provide a mechanistic explanation of how APP-like proteins bind to heparan sulfates and how they specifically recognize nonreducing structures of heparan sulfates. Beyond the pathology of Alzheimer’s disease, the members of the amyloid precursor protein (APP) family are essential for neuronal development and cell homeostasis in mammals. APP and its paralogues APP-like protein 1 (APLP1) and APP-like protein 2 (APLP2) contain the highly conserved heparan sulfate (HS) binding domain E2, which effects variousmore » (patho)physiological functions. Here, two crystal structures of the E2 domain of APLP1 are presented in the apo form and in complex with a heparin dodecasaccharide at 2.5 Å resolution. The apo structure of APLP1 E2 revealed an unfolded and hence flexible N-terminal helix αA. The (APLP1 E2){sub 2}–(heparin){sub 2} complex structure revealed two distinct binding modes, with APLP1 E2 explicitly recognizing the heparin terminus but also interacting with a continuous heparin chain. The latter only requires a certain register of the sugar moieties that fits to a positively charged surface patch and contributes to the general heparin-binding capability of APP-family proteins. Terminal binding of APLP1 E2 to heparin specifically involves a structure of the nonreducing end that is very similar to heparanase-processed HS chains. These data reveal a conserved mechanism for the binding of APP-family proteins to HS and imply a specific regulatory role of HS modifications in the biology of APP and APP-like proteins.« less
Autoinhibition of ETV6 DNA Binding Is Established by the Stability of Its Inhibitory Helix
De, Soumya; Okon, Mark; Graves, Barbara J.; McIntosh, Lawrence P.
2017-01-01
The ETS transcriptional repressor ETV6 (or TEL) is autoinhibited by an α-helix that sterically blocks its DNA-binding ETS domain. The inhibitory helix is marginally stable and unfolds when ETV6 binds to either specific or non-specific DNA. Using NMR spectroscopy, we show that folding of the inhibitory helix requires a buried charge–dipole interaction with helix H1 of the ETS domain. This interaction also contributes directly to autoinhibition by precluding a highly conserved dipole-enhanced hydrogen bond between the phosphodiester backbone of bound DNA and the N terminus of helix H1. To probe further the thermodynamic basis of autoinhibition, ETV6 variants were generated with amino acid substitutions introduced along the solvent exposed surface of the inhibitory helix. These changes were designed to increase the intrinsic helical propensity of the inhibitory helix without perturbing its packing interactions with the ETS domain. NMR-monitored amide hydrogen exchange measurements confirmed that the stability of the folded inhibitory helix increases progressively with added helix-promoting substitutions. This also results in progressively reinforced autoinhibition and decreased DNA-binding affinity. Surprisingly, locking the inhibitory helix onto the ETS domain by a disulfide bridge severely impairs, but does not abolish DNA binding. Weak interactions still occur via an interface displaced from the canonical ETS domain DNA-binding surface. Collectively, these studies establish a direct thermodynamic linkage between inhibitory helix stability and ETV6 autoinhibition, and demonstrate that helix unfolding does not strictly precede DNA binding. Modulating inhibitory helix stability provides a potential route for the in vivo regulation of ETV6 activity. PMID:26920109
Contribution of TyrB26 to the Function and Stability of Insulin
Pandyarajan, Vijay; Phillips, Nelson B.; Rege, Nischay; Lawrence, Michael C.; Whittaker, Jonathan; Weiss, Michael A.
2016-01-01
Crystallographic studies of insulin bound to receptor domains have defined the primary hormone-receptor interface. We investigated the role of TyrB26, a conserved aromatic residue at this interface. To probe the evolutionary basis for such conservation, we constructed 18 variants at B26. Surprisingly, non-aromatic polar or charged side chains (such as Glu, Ser, or ornithine (Orn)) conferred high activity, whereas the weakest-binding analogs contained Val, Ile, and Leu substitutions. Modeling of variant complexes suggested that the B26 side chains pack within a shallow depression at the solvent-exposed periphery of the interface. This interface would disfavor large aliphatic side chains. The analogs with highest activity exhibited reduced thermodynamic stability and heightened susceptibility to fibrillation. Perturbed self-assembly was also demonstrated in studies of the charged variants (Orn and Glu); indeed, the GluB26 analog exhibited aberrant aggregation in either the presence or absence of zinc ions. Thus, although TyrB26 is part of insulin's receptor-binding surface, our results suggest that its conservation has been enjoined by the aromatic ring's contributions to native stability and self-assembly. We envisage that such classical structural relationships reflect the implicit threat of toxic misfolding (rather than hormonal function at the receptor level) as a general evolutionary determinant of extant protein sequences. PMID:27129279
Naschberger, Andreas; Fürnrohr, Barbara G; Lenac Rovis, Tihana; Malic, Suzana; Scheffzek, Klaus; Dieplinger, Hans; Rupp, Bernhard
2016-12-01
The monoclonal antibody N14 is used as a detection antibody in ELISA kits for the human glycoprotein afamin, a member of the albumin family, which has recently gained interest in the capture and stabilization of Wnt signalling proteins, and for its role in metabolic syndrome and papillary thyroid carcinoma. As a rare occurrence, the N14 Fab is N-glycosylated at Asn26L at the onset of the V L 1 antigen-binding loop, with the α-1-6 core fucosylated complex glycan facing out of the L1 complementarity-determining region. The crystal structures of two non-apparent (pseudo) isomorphous crystals of the N14 Fab were analyzed, which differ significantly in the elbow angles, thereby cautioning against the overinterpretation of domain movements upon antigen binding. In addition, the map quality at 1.9 Å resolution was sufficient to crystallographically re-sequence the variable V L and V H domains and to detect discrepancies in the hybridoma-derived sequence. Finally, a conservatively refined parsimonious model is presented and its statistics are compared with those from a less conservatively built model that has been modelled more enthusiastically. Improvements to the PDB validation reports affecting ligands, clashscore and buried surface calculations are suggested.
Bochkov, Yury A; Watters, Kelly; Ashraf, Shamaila; Griggs, Theodor F; Devries, Mark K; Jackson, Daniel J; Palmenberg, Ann C; Gern, James E
2015-04-28
Members of rhinovirus C (RV-C) species are more likely to cause wheezing illnesses and asthma exacerbations compared with other rhinoviruses. The cellular receptor for these viruses was heretofore unknown. We report here that expression of human cadherin-related family member 3 (CDHR3) enables the cells normally unsusceptible to RV-C infection to support both virus binding and replication. A coding single nucleotide polymorphism (rs6967330, C529Y) was previously linked to greater cell-surface expression of CDHR3 protein, and an increased risk of wheezing illnesses and hospitalizations for childhood asthma. Compared with wild-type CDHR3, cells transfected with the CDHR3-Y529 variant had about 10-fold increases in RV-C binding and progeny yields. We developed a transduced HeLa cell line (HeLa-E8) stably expressing CDHR3-Y529 that supports RV-C propagation in vitro. Modeling of CDHR3 structure identified potential binding sites that could impact the virus surface in regions that are highly conserved among all RV-C types. Our findings identify that the asthma susceptibility gene product CDHR3 mediates RV-C entry into host cells, and suggest that rs6967330 mutation could be a risk factor for RV-C wheezing illnesses.
Clarke, Matthew W.; Boddington, Kelly F.; Warnica, Josephine M.; Atkinson, John; McKenna, Sarah; Madge, Jeffrey; Barker, Christine H.; Graether, Steffen P.
2015-01-01
Dehydration can be due to desiccation caused by a lack of environmental water or to freezing caused by a lack of liquid water. Plants have evolved a large family of proteins called LEA (late embryogenesis abundant) proteins, which include the intrinsically disordered dehydrin (dehydration protein) family, to combat these abiotic stresses. Although transcription and translation studies have shown a correlation between dehydration stress and the presence of dehydrins, the biochemical mechanisms have remained somewhat elusive. We examine here the effect and structure of a small model dehydrin (Vitis riparia K2) on the protection of membranes from freeze-thaw stress. This protein is able to bind to liposomes containing phosphatidic acid and protect the liposomes from fusing after freeze-thaw treatment. The presence of K2 did not measurably affect liposome surface accessibility or lipid mobility but did lower its membrane transition temperature by 3 °C. Using sodium dodecyl sulfate as a membrane model, we examined the NMR structure of K2 in the presence and absence of the micelle. Biochemical and NMR experiments show that the conserved, lysine-rich segments are involved in the binding of the dehydrin to a membrane, whereas the poorly conserved φ segments play no role in binding or protection. PMID:26370084
King, Justin J.; Amemiya, Chris T.; Hsu, Ellen
2017-01-01
ABSTRACT Activation-induced cytidine deaminase (AID) is a genome-mutating enzyme that initiates class switch recombination and somatic hypermutation of antibodies in jawed vertebrates. We previously described the biochemical properties of human AID and found that it is an unusual enzyme in that it exhibits binding affinities for its substrate DNA and catalytic rates several orders of magnitude higher and lower, respectively, than a typical enzyme. Recently, we solved the functional structure of AID and demonstrated that these properties are due to nonspecific DNA binding on its surface, along with a catalytic pocket that predominantly assumes a closed conformation. Here we investigated the biochemical properties of AID from a sea lamprey, nurse shark, tetraodon, and coelacanth: representative species chosen because their lineages diverged at the earliest critical junctures in evolution of adaptive immunity. We found that these earliest-diverged AID orthologs are active cytidine deaminases that exhibit unique substrate specificities and thermosensitivities. Significant amino acid sequence divergence among these AID orthologs is predicted to manifest as notable structural differences. However, despite major differences in sequence specificities, thermosensitivities, and structural features, all orthologs share the unusually high DNA binding affinities and low catalytic rates. This absolute conservation is evidence for biological significance of these unique biochemical properties. PMID:28716949
Huber, Roland G.; Bond, Peter J.
2017-01-01
An improved knowledge of protein-protein interactions is essential for better understanding of metabolic and signaling networks, and cellular function. Progress tends to be based on structure determination and predictions using known structures, along with computational methods based on evolutionary information or detailed atomistic descriptions. We hypothesized that for the case of interactions across a common interface, between proteins from a pair of paralogue families or within a family of paralogues, a relatively simple interface description could distinguish between binding and non-binding pairs. Using binding data for several systems, and large-scale comparative modeling based on known template complex structures, it is found that charge-charge interactions (for groups bearing net charge) are generally a better discriminant than buried non-polar surface. This is particularly the case for paralogue families that are less divergent, with more reliable comparative modeling. We suggest that electrostatic interactions are major determinants of specificity in such systems, an observation that could be used to predict binding partners. PMID:29016650
A Potent and Broad Neutralizing Antibody Recognizes and Penetrates the HIV Glycan Shield
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pejchal, Robert; Doores, Katie J.; Walker, Laura M.
The HIV envelope (Env) protein gp120 is protected from antibody recognition by a dense glycan shield. However, several of the recently identified PGT broadly neutralizing antibodies appear to interact directly with the HIV glycan coat. Crystal structures of antigen-binding fragments (Fabs) PGT 127 and 128 with Man{sub 9} at 1.65 and 1.29 angstrom resolution, respectively, and glycan binding data delineate a specific high mannose-binding site. Fab PGT 128 complexed with a fully glycosylated gp120 outer domain at 3.25 angstroms reveals that the antibody penetrates the glycan shield and recognizes two conserved glycans as well as a short {beta}-strand segment ofmore » the gp120 V3 loop, accounting for its high binding affinity and broad specificify. Furthermore, our data suggest that the high neutralization potency of PGT 127 and 128 immunoglobulin Gs may be mediated by cross-linking Env trimers on the viral surface.« less
Ivanov, Stefan M; Cawley, Andrew; Huber, Roland G; Bond, Peter J; Warwicker, Jim
2017-01-01
An improved knowledge of protein-protein interactions is essential for better understanding of metabolic and signaling networks, and cellular function. Progress tends to be based on structure determination and predictions using known structures, along with computational methods based on evolutionary information or detailed atomistic descriptions. We hypothesized that for the case of interactions across a common interface, between proteins from a pair of paralogue families or within a family of paralogues, a relatively simple interface description could distinguish between binding and non-binding pairs. Using binding data for several systems, and large-scale comparative modeling based on known template complex structures, it is found that charge-charge interactions (for groups bearing net charge) are generally a better discriminant than buried non-polar surface. This is particularly the case for paralogue families that are less divergent, with more reliable comparative modeling. We suggest that electrostatic interactions are major determinants of specificity in such systems, an observation that could be used to predict binding partners.
Cytidine derivatives as IspF inhibitors of Burkolderia pseudomallei
Zhang, Zheng; Jakkaraju, Sriram; Blain, Joy; Gogol, Kenneth; Zhao, Lei; Hartley, Robert C.; Karlsson, Courtney A.; Staker, Bart L.; Stewart, Lance J.; Myler, Peter J.; Clare, Michael; Begley, Darren W.; Horn, James R.; Hagen, Timothy J
2013-01-01
Published biological data suggest that the methyl erythritol phosphate (MEP) pathway, a non-mevalonate isoprenoid biosynthetic pathway, is essential for certain bacteria and other infectious disease organisms. One highly conserved enzyme in the MEP pathway is 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (IspF). Fragment-bound complexes of IspF from Burkholderia pseudomallei were used to design and synthesize a series of molecules linking the cytidine moiety to different zinc pocket fragment binders. Testing by surface plasmon resonance (SPR) found one molecule in the series to possess binding affinity equal to that of cytidine diphosphate, despite lacking any metal-coordinating phosphate groups. Close inspection of the SPR data suggest different binding stoichiometries between IspF and test compounds. Crystallographic analysis shows important variations between the binding mode of one synthesized compound and the pose of the bound fragment from which it was designed. The binding modes of these molecules add to our structural knowledge base for IspF and suggest future refinements in this compound series. PMID:24157367
Salazar, Luz Mary; Bermúdez, Adriana; Patarroyo, Manuel E
2008-07-18
SERA protein is a leading candidate molecule to be included in an antimalarial vaccine. Conserved high activity binding peptides (HABP) binding to red blood cells (RBC) have been identified in this protein. One of them (6762) localising in the 18-kDa C-terminal fragment was used to induce protective immunity with negative result. Critical RBC binding residues (assessed by glycine-analogue scanning) were replaced by others having the same mass, volume and surface but different polarity, rendering some of them immunogenic as assessed by antibody production against the parasite or its proteins and protection-inducing against challenge with a highly infectious Aotus monkey-adapted Plasmodium falciparum strain. A shift in binding to purified HLA-DR allelic molecules from the same haplotype and in their reading register was found, suggesting that modified molecules had adopted a different (1)H NMR 3D structure allowing a better fit into the MHCII-pept-TCR complex, thereby representing a new mechanism for inducing immune protection.
Du, Juan; Wang, Xue; Dong, Chun-Hai; Yang, Jian Ming; Yao, Xiao Jun
2016-01-01
Actin is a highly conserved protein. It plays important roles in cellular function and exists either in the monomeric (G-actin) or polymeric form (F-actin). Members of the actin-depolymerizing factor (ADF)/cofilin protein family bind to both G-actin and F-actin and play vital roles in actin dynamics by manipulating the rates of filament polymerization and depolymerization. It has been reported that the S6D and R98A/K100A mutants of actin-depolymerizing factor 1 (ADF1) in Arabidopsis thaliana decreased the binding affinity of ADF for the actin monomer. To investigate the binding mechanism and dynamic behavior of the ADF1-actin complex, we constructed a homology model of the AtADF1-actin complex based on the crystal structure of AtADF1 and the twinfilin C-terminal ADF-H domain in a complex with a mouse actin monomer. The model was then refined for subsequent molecular dynamics simulations. Increased binding energy of the mutated system was observed using the Molecular Mechanics Generalized Born Surface Area and Poisson-Boltzmann Surface Area (MM-GB/PBSA) methods. To determine the residues that make decisive contributions to the ADF1 actin-binding affinity, per-residue decomposition and computational alanine scanning analyses were performed, which provided more detailed information on the binding mechanism. Root-mean-square fluctuation and principal component analyses confirmed that the S6D and R98A/K100A mutants induced an increased conformational flexibility. The comprehensive molecular insight gained from this study is of great importance for understanding the binding mechanism of ADF1 and G-actin.
Wang, Xue; Dong, Chun-Hai; Yang, Jian Ming; Yao, Xiao Jun
2016-01-01
Actin is a highly conserved protein. It plays important roles in cellular function and exists either in the monomeric (G-actin) or polymeric form (F-actin). Members of the actin-depolymerizing factor (ADF)/cofilin protein family bind to both G-actin and F-actin and play vital roles in actin dynamics by manipulating the rates of filament polymerization and depolymerization. It has been reported that the S6D and R98A/K100A mutants of actin-depolymerizing factor 1 (ADF1) in Arabidopsis thaliana decreased the binding affinity of ADF for the actin monomer. To investigate the binding mechanism and dynamic behavior of the ADF1–actin complex, we constructed a homology model of the AtADF1–actin complex based on the crystal structure of AtADF1 and the twinfilin C-terminal ADF-H domain in a complex with a mouse actin monomer. The model was then refined for subsequent molecular dynamics simulations. Increased binding energy of the mutated system was observed using the Molecular Mechanics Generalized Born Surface Area and Poisson–Boltzmann Surface Area (MM-GB/PBSA) methods. To determine the residues that make decisive contributions to the ADF1 actin-binding affinity, per-residue decomposition and computational alanine scanning analyses were performed, which provided more detailed information on the binding mechanism. Root-mean-square fluctuation and principal component analyses confirmed that the S6D and R98A/K100A mutants induced an increased conformational flexibility. The comprehensive molecular insight gained from this study is of great importance for understanding the binding mechanism of ADF1 and G-actin. PMID:27414648
ERp57 interacts with conserved cysteine residues in the MHC class I peptide-binding groove.
Antoniou, Antony N; Santos, Susana G; Campbell, Elaine C; Lynch, Sarah; Arosa, Fernando A; Powis, Simon J
2007-05-15
The oxidoreductase ERp57 is a component of the major histocompatibility complex (MHC) class I peptide-loading complex. ERp57 can interact directly with MHC class I molecules, however, little is known about which of the cysteine residues within the MHC class I molecule are relevant to this interaction. MHC class I molecules possess conserved disulfide bonds between cysteines 101-164, and 203-259 in the peptide-binding and alpha3 domain, respectively. By studying a series of mutants of these conserved residues, we demonstrate that ERp57 predominantly associates with cysteine residues in the peptide-binding domain, thus indicating ERp57 has direct access to the peptide-binding groove of MHC class I molecules during assembly.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Berman, Benjamin P.; Pfeiffer, Barret D.; Laverty, Todd R.
2004-08-06
The identification of sequences that control transcription in metazoans is a major goal of genome analysis. In a previous study, we demonstrated that searching for clusters of predicted transcription factor binding sites could discover active regulatory sequences, and identified 37 regions of the Drosophila melanogaster genome with high densities of predicted binding sites for five transcription factors involved in anterior-posterior embryonic patterning. Nine of these clusters overlapped known enhancers. Here, we report the results of in vivo functional analysis of 27 remaining clusters. We generated transgenic flies carrying each cluster attached to a basal promoter and reporter gene, and assayedmore » embryos for reporter gene expression. Six clusters are enhancers of adjacent genes: giant, fushi tarazu, odd-skipped, nubbin, squeeze and pdm2; three drive expression in patterns unrelated to those of neighboring genes; the remaining 18 do not appear to have enhancer activity. We used the Drosophila pseudoobscura genome to compare patterns of evolution in and around the 15 positive and 18 false-positive predictions. Although conservation of primary sequence cannot distinguish true from false positives, conservation of binding-site clustering accurately discriminates functional binding-site clusters from those with no function. We incorporated conservation of binding-site clustering into a new genome-wide enhancer screen, and predict several hundred new regulatory sequences, including 85 adjacent to genes with embryonic patterns. Measuring conservation of sequence features closely linked to function--such as binding-site clustering--makes better use of comparative sequence data than commonly used methods that examine only sequence identity.« less
Barnett, Michael D; Öz, Haluk C M; Marsden, Arthur D
2018-05-01
Previous research has linked conservative political ideology with homophobia. Political ideology has also been linked to differences in moral decision-making, with research suggesting that conservatives and liberals may use different values in their moral decision-making processes. Moral foundations theory is a model of moral decision-making that proposes that individuals emphasize different domains in moral decision-making. Conservatives tend to emphasize binding foundations, while liberals tend to emphasize individualizing foundations. Utilizing large, ethnically diverse college samples, the purpose of these two cross-sectional studies (Study 1 N = 492; Study 2 N = 861) was to explore whether moral foundations mediate the relationship between political ideology and homophobia. These studies explored economic and social political ideology separately and utilized a two-factor model of moral foundations theory (individualizing and binding foundations). Results of both studies found that conservative economic and social political ideology was positively associated with homophobia. Study 1 found that both conservative economic and social political ideology had an indirect effect on homophobia through binding foundations. Study 2 found that both economic and social political ideology had an indirect effect on homophobia through both binding and individualizing foundations. Overall, the results were consistent with the notion that moral foundations may explain the relationship between political ideology and homophobia.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Moravcevic, Katarina; Mendrola, Jeannine M.; Schmitz, Karl R.
Phospholipid-binding modules such as PH, C1, and C2 domains play crucial roles in location-dependent regulation of many protein kinases. Here, we identify the KA1 domain (kinase associated-1 domain), found at the C terminus of yeast septin-associated kinases (Kcc4p, Gin4p, and Hsl1p) and human MARK/PAR1 kinases, as a membrane association domain that binds acidic phospholipids. Membrane localization of isolated KA1 domains depends on phosphatidylserine. Using X-ray crystallography, we identified a structurally conserved binding site for anionic phospholipids in KA1 domains from Kcc4p and MARK1. Mutating this site impairs membrane association of both KA1 domains and intact proteins and reveals the importancemore » of phosphatidylserine for bud neck localization of yeast Kcc4p. Our data suggest that KA1 domains contribute to coincidence detection, allowing kinases to bind other regulators (such as septins) only at the membrane surface. These findings have important implications for understanding MARK/PAR1 kinases, which are implicated in Alzheimer's disease, cancer, and autism.« less
The tall letters represent the highly conserved bases in DNA binding sites of several prokaryotic repressors and activators. Conservation is strongest where major grooves of the double helical DNA (represented by crests of a cosine wave) face the protein. This shows that conservation analysis alone can be used to predict the face of DNA that contacts the proteins.
Hüntelmann, Bettina; Staab, Julia; Herrmann-Lingen, Christoph; Meyer, Thomas
2014-01-01
Binding to specific palindromic sequences termed gamma-activated sites (GAS) is a hallmark of gene activation by members of the STAT (signal transducer and activator of transcription) family of cytokine-inducible transcription factors. However, the precise molecular mechanisms involved in the signal-dependent finding of target genes by STAT dimers have not yet been very well studied. In this study, we have characterized a sequence motif in the STAT1 linker domain which is highly conserved among the seven human STAT proteins and includes surface-exposed residues in close proximity to the bound DNA. Using site-directed mutagenesis, we have demonstrated that a lysine residue in position 567 of the full-length molecule is required for GAS recognition. The substitution of alanine for this residue completely abolished both binding to high-affinity GAS elements and transcriptional activation of endogenous target genes in cells stimulated with interferon-γ (IFNγ), while the time course of transient nuclear accumulation and tyrosine phosphorylation were virtually unchanged. In contrast, two glutamic acid residues (E559 and E563) on each monomer are important for the dissociation of dimeric STAT1 from DNA and, when mutated to alanine, result in elevated levels of tyrosine-phosphorylated STAT1 as well as prolonged IFNγ-stimulated nuclear accumulation. In conclusion, our data indicate that the kinetics of signal-dependent GAS binding is determined by an array of glutamic acid residues located at the interior surface of the STAT1 dimer. These negatively charged residues appear to align the long axis of the STAT1 dimer in a position perpendicular to the DNA, thereby facilitating the interaction between lysine 567 and the phosphodiester backbone of a bound GAS element, which is a prerequisite for transient gene induction.
Structural basis of molecular recognition of helical histone H3 tail by PHD finger domains.
Bortoluzzi, Alessio; Amato, Anastasia; Lucas, Xavier; Blank, Manuel; Ciulli, Alessio
2017-05-04
The plant homeodomain (PHD) fingers are among the largest family of epigenetic domains, first characterized as readers of methylated H3K4. Readout of histone post-translational modifications by PHDs has been the subject of intense investigation; however, less is known about the recognition of secondary structure features within the histone tail itself. We solved the crystal structure of the PHD finger of the bromodomain adjacent to zinc finger 2A [BAZ2A, also known as TIP5 (TTF-I/interacting protein 5)] in complex with unmodified N-terminal histone H3 tail. The peptide is bound in a helical folded-back conformation after K4, induced by an acidic patch on the protein surface that prevents peptide binding in an extended conformation. Structural bioinformatics analyses identify a conserved Asp/Glu residue that we name 'acidic wall', found to be mutually exclusive with the conserved Trp for K4Me recognition. Neutralization or inversion of the charges at the acidic wall patch in BAZ2A, and homologous BAZ2B, weakened H3 binding. We identify simple mutations on H3 that strikingly enhance or reduce binding, as a result of their stabilization or destabilization of H3 helicity. Our work unravels the structural basis for binding of the helical H3 tail by PHD fingers and suggests that molecular recognition of secondary structure motifs within histone tails could represent an additional layer of regulation in epigenetic processes. © 2017 The Author(s).
Solution structure of the chick TGFbeta type II receptor ligand-binding domain.
Marlow, Michael S; Brown, Christopher B; Barnett, Joey V; Krezel, Andrzej M
2003-02-28
The transforming growth factor beta (TGFbeta) signaling pathway influences cell proliferation, immune responses, and extracellular matrix reorganization throughout the vertebrate life cycle. The signaling cascade is initiated by ligand-binding to its cognate type II receptor. Here, we present the structure of the chick type II TGFbeta receptor determined by solution NMR methods. Distance and angular constraints were derived from 15N and 13C edited NMR experiments. Torsion angle dynamics was used throughout the structure calculations and refinement. The 20 final structures were energy minimized using the generalized Born solvent model. For these 20 structures, the average backbone root-mean-square distance from the average structure is below 0.6A. The overall fold of this 109-residue domain is conserved within the superfamily of these receptors. Chick receptors fully recognize and respond to human TGFbeta ligands despite only 60% identity at the sequence level. Comparison with the human TGFbeta receptor determined by X-ray crystallography reveals different conformations in several regions. Sequence divergence and crystal packing interactions under low pH conditions are likely causes. This solution structure identifies regions were structural changes, however subtle, may occur upon ligand-binding. We also identified two very well conserved molecular surfaces. One was found to bind ligand in the crystallized human TGFbeta3:TGFbeta type II receptor complex. The other, newly identified area can be the interaction site with type I and/or type III receptors of the TGFbeta signaling complex.
Structure-Templated Predictions of Novel Protein Interactions from Sequence Information
Betel, Doron; Breitkreuz, Kevin E; Isserlin, Ruth; Dewar-Darch, Danielle; Tyers, Mike; Hogue, Christopher W. V
2007-01-01
The multitude of functions performed in the cell are largely controlled by a set of carefully orchestrated protein interactions often facilitated by specific binding of conserved domains in the interacting proteins. Interacting domains commonly exhibit distinct binding specificity to short and conserved recognition peptides called binding profiles. Although many conserved domains are known in nature, only a few have well-characterized binding profiles. Here, we describe a novel predictive method known as domain–motif interactions from structural topology (D-MIST) for elucidating the binding profiles of interacting domains. A set of domains and their corresponding binding profiles were derived from extant protein structures and protein interaction data and then used to predict novel protein interactions in yeast. A number of the predicted interactions were verified experimentally, including new interactions of the mitotic exit network, RNA polymerases, nucleotide metabolism enzymes, and the chaperone complex. These results demonstrate that new protein interactions can be predicted exclusively from sequence information. PMID:17892321
Principles of regulatory information conservation between mouse and human.
Cheng, Yong; Ma, Zhihai; Kim, Bong-Hyun; Wu, Weisheng; Cayting, Philip; Boyle, Alan P; Sundaram, Vasavi; Xing, Xiaoyun; Dogan, Nergiz; Li, Jingjing; Euskirchen, Ghia; Lin, Shin; Lin, Yiing; Visel, Axel; Kawli, Trupti; Yang, Xinqiong; Patacsil, Dorrelyn; Keller, Cheryl A; Giardine, Belinda; Kundaje, Anshul; Wang, Ting; Pennacchio, Len A; Weng, Zhiping; Hardison, Ross C; Snyder, Michael P
2014-11-20
To broaden our understanding of the evolution of gene regulation mechanisms, we generated occupancy profiles for 34 orthologous transcription factors (TFs) in human-mouse erythroid progenitor, lymphoblast and embryonic stem-cell lines. By combining the genome-wide transcription factor occupancy repertoires, associated epigenetic signals, and co-association patterns, here we deduce several evolutionary principles of gene regulatory features operating since the mouse and human lineages diverged. The genomic distribution profiles, primary binding motifs, chromatin states, and DNA methylation preferences are well conserved for TF-occupied sequences. However, the extent to which orthologous DNA segments are bound by orthologous TFs varies both among TFs and with genomic location: binding at promoters is more highly conserved than binding at distal elements. Notably, occupancy-conserved TF-occupied sequences tend to be pleiotropic; they function in several tissues and also co-associate with many TFs. Single nucleotide variants at sites with potential regulatory functions are enriched in occupancy-conserved TF-occupied sequences.
Nandy, Suman Kumar; Seal, Alpana
2016-01-01
Cystatin superfamily is a large group of evolutionarily related proteins involved in numerous physiological activities through their inhibitory activity towards cysteine proteases. Despite sharing the same cystatin fold, and inhibiting cysteine proteases through the same tripartite edge involving highly conserved N-terminal region, L1 and L2 loop; cystatins differ widely in their inhibitory affinity towards C1 family of cysteine proteases and molecular details of these interactions are still elusive. In this study, inhibitory interactions of human family 1 & 2 cystatins with cathepsin L1 are predicted and their stability and viability are verified through protein docking & comparative molecular dynamics. An overall stabilization effect is observed in all cystatins on complex formation. Complexes are mostly dominated by van der Waals interaction but the relative participation of the conserved regions varied extensively. While van der Waals contacts prevail in L1 and L2 loop, N-terminal segment chiefly acts as electrostatic interaction site. In fact the comparative dynamics study points towards the instrumental role of L1 loop in directing the total interaction profile of the complex either towards electrostatic or van der Waals contacts. The key amino acid residues surfaced via interaction energy, hydrogen bonding and solvent accessible surface area analysis for each cystatin-cathepsin L1 complex influence the mode of binding and thus control the diverse inhibitory affinity of cystatins towards cysteine proteases.
Scorsato, Valéria; Lima, Tatiani B.; Righetto, Germanna L.; Zanchin, Nilson I. T.; Brandão-Neto, José; Sandy, James; Pereira, Humberto D’Muniz; Ferrari, Állan J. R.; Gozzo, Fabio C.; Smetana, Juliana H. C.; Aparicio, Ricardo
2016-01-01
TOR signaling pathway regulator-like (TIPRL) is a regulatory protein which inhibits the catalytic subunits of Type 2A phosphatases. Several cellular contexts have been proposed for TIPRL, such as regulation of mTOR signaling, inhibition of apoptosis and biogenesis and recycling of PP2A, however, the underlying molecular mechanism is still poorly understood. We have solved the crystal structure of human TIPRL at 2.15 Å resolution. The structure is a novel fold organized around a central core of antiparallel beta-sheet, showing an N-terminal α/β region at one of its surfaces and a conserved cleft at the opposite surface. Inside this cleft, we found a peptide derived from TEV-mediated cleavage of the affinity tag. We show by mutagenesis, pulldown and hydrogen/deuterium exchange mass spectrometry that this peptide is a mimic for the conserved C-terminal tail of PP2A, an important region of the phosphatase which regulates holoenzyme assembly, and TIPRL preferentially binds the unmodified version of the PP2A-tail mimetic peptide DYFL compared to its tyrosine-phosphorylated version. A docking model of the TIPRL-PP2Ac complex suggests that TIPRL blocks the phosphatase’s active site, providing a structural framework for the function of TIPRL in PP2A inhibition. PMID:27489114
NASA Astrophysics Data System (ADS)
Scorsato, Valéria; Lima, Tatiani B.; Righetto, Germanna L.; Zanchin, Nilson I. T.; Brandão-Neto, José; Sandy, James; Pereira, Humberto D.'Muniz; Ferrari, Állan J. R.; Gozzo, Fabio C.; Smetana, Juliana H. C.; Aparicio, Ricardo
2016-08-01
TOR signaling pathway regulator-like (TIPRL) is a regulatory protein which inhibits the catalytic subunits of Type 2A phosphatases. Several cellular contexts have been proposed for TIPRL, such as regulation of mTOR signaling, inhibition of apoptosis and biogenesis and recycling of PP2A, however, the underlying molecular mechanism is still poorly understood. We have solved the crystal structure of human TIPRL at 2.15 Å resolution. The structure is a novel fold organized around a central core of antiparallel beta-sheet, showing an N-terminal α/β region at one of its surfaces and a conserved cleft at the opposite surface. Inside this cleft, we found a peptide derived from TEV-mediated cleavage of the affinity tag. We show by mutagenesis, pulldown and hydrogen/deuterium exchange mass spectrometry that this peptide is a mimic for the conserved C-terminal tail of PP2A, an important region of the phosphatase which regulates holoenzyme assembly, and TIPRL preferentially binds the unmodified version of the PP2A-tail mimetic peptide DYFL compared to its tyrosine-phosphorylated version. A docking model of the TIPRL-PP2Ac complex suggests that TIPRL blocks the phosphatase’s active site, providing a structural framework for the function of TIPRL in PP2A inhibition.
Clark, Lars E; Mahmutovic, Selma; Raymond, Donald D; Dilanyan, Taleen; Koma, Takaaki; Manning, John T; Shankar, Sundaresh; Levis, Silvana C; Briggiler, Ana M; Enria, Delia A; Wucherpfennig, Kai W; Paessler, Slobodan; Abraham, Jonathan
2018-05-14
While five arenaviruses cause human hemorrhagic fevers in the Western Hemisphere, only Junin virus (JUNV) has a vaccine. The GP1 subunit of their envelope glycoprotein binds transferrin receptor 1 (TfR1) using a surface that substantially varies in sequence among the viruses. As such, receptor-mimicking antibodies described to date are type-specific and lack the usual breadth associated with this mode of neutralization. Here we isolate, from the blood of a recipient of the live attenuated JUNV vaccine, two antibodies that cross-neutralize Machupo virus with varying efficiency. Structures of GP1-Fab complexes explain the basis for efficient cross-neutralization, which involves avoiding receptor mimicry and targeting a conserved epitope within the receptor-binding site (RBS). The viral RBS, despite its extensive sequence diversity, is therefore a target for cross-reactive antibodies with activity against New World arenaviruses of public health concern.
Perfect transmission at oblique incidence by trigonal warping in graphene P-N junctions
NASA Astrophysics Data System (ADS)
Zhang, Shu-Hui; Yang, Wen
2018-01-01
We develop an analytical mode-matching technique for the tight-binding model to describe electron transport across graphene P-N junctions. This method shares the simplicity of the conventional mode-matching technique for the low-energy continuum model and the accuracy of the tight-binding model over a wide range of energies. It further reveals an interesting phenomenon on a sharp P-N junction: the disappearance of the well-known Klein tunneling (i.e., perfect transmission) at normal incidence and the appearance of perfect transmission at oblique incidence due to trigonal warping at energies beyond the linear Dirac regime. We show that this phenomenon arises from the conservation of a generalized pseudospin in the tight-binding model. We expect this effect to be experimentally observable in graphene and other Dirac fermions systems, such as the surface of three-dimensional topological insulators.
Qian, Xiaoxiao; Matthews, Laura; Lightman, Stafford; Ray, David; Norman, Michael
2015-01-01
Alternative splicing events from tandem donor sites result in mRNA variants coding for additional amino acids in the DNA binding domain of both the glucocorticoid (GR) and mineralocorticoid (MR) receptors. We now show that expression of both splice variants is extensively conserved in mammalian species, providing strong evidence for their functional significance. An exception to the conservation of the MR tandem splice site (an A at position +5 of the MR+12 donor site in the mouse) was predicted to decrease U1 small nuclear RNA binding. In accord with this prediction, we were unable to detect the MR+12 variant in this species. The one exception to the conservation of the GR tandem splice site, an A at position +3 of the platypus GRγ donor site that was predicted to enhance binding of U1 snRNA, was unexpectedly associated with decreased expression of the variant from the endogenous gene as well as a minigene. An intronic pyrimidine motif present in both GR and MR genes was found to be critical for usage of the downstream donor site, and overexpression of TIA1/TIAL1 RNA binding proteins, which are known to bind such motifs, led to a marked increase in the proportion of GRγ and MR+12. These results provide striking evidence for conservation of a complex splicing mechanism that involves processes other than stochastic spliceosome binding and identify a mechanism that would allow regulation of variant expression. PMID:19819975
Kearney, Bradley M; Johnson, Christian W; Roberts, Daniel M; Swartz, Paul; Mattos, Carla
2014-02-06
Ras GTPase mediates several cellular signal transduction pathways and is found mutated in a large number of cancers. It is active in the GTP-bound state, where it interacts with effector proteins, and at rest in the GDP-bound state. The catalytic domain is tethered to the membrane, with which it interacts in a nucleotide-dependent manner. Here we present the program Detection of Related Solvent Positions (DRoP) for crystallographic water analysis on protein surfaces and use it to study Ras. DRoP reads and superimposes multiple Protein Data Bank coordinates, transfers symmetry-related water molecules to the position closest to the protein surface, and ranks the waters according to how well conserved and tightly clustered they are in the set of structures. Coloring according to this rank allows visualization of the results. The effector-binding region of Ras is hydrated with highly conserved water molecules at the interface between the P-loop, switch I, and switch II, as well as at the Raf-RBD binding pocket. Furthermore, we discovered a new conserved water-mediated H-bonding network present in Ras-GTP, but not in Ras-GDP, that links the nucleotide sensor residues R161 and R164 on helix 5 to the active site. The double mutant RasN85A/N86A, where the final link between helix 5 and the nucleotide is not possible, is a severely impaired enzyme, while the single mutant RasN86A, with partial connection to the active site, has a wild-type hydrolysis rate. DRoP was instrumental in determining the water-mediated connectivity networks that link two lobes of the catalytic domain in Ras. Copyright © 2013 Elsevier Ltd. All rights reserved.
Tong, Junsen; Manik, Mohammad Kawsar; Im, Young Jun
2018-01-30
Membrane contact sites (MCSs) in eukaryotic cells are hotspots for lipid exchange, which is essential for many biological functions, including regulation of membrane properties and protein trafficking. Lipid transfer proteins anchored at membrane contact sites (LAMs) contain sterol-specific lipid transfer domains [StARkin domain (SD)] and multiple targeting modules to specific membrane organelles. Elucidating the structural mechanisms of targeting and ligand recognition by LAMs is important for understanding the interorganelle communication and exchange at MCSs. Here, we determined the crystal structures of the yeast Lam6 pleckstrin homology (PH)-like domain and the SDs of Lam2 and Lam4 in the apo form and in complex with ergosterol. The Lam6 PH-like domain displays a unique PH domain fold with a conserved N-terminal α-helix. The Lam6 PH-like domain lacks the basic surface for phosphoinositide binding, but contains hydrophobic patches on its surface, which are critical for targeting to endoplasmic reticulum (ER)-mitochondrial contacts. Structures of the LAM SDs display a helix-grip fold with a hydrophobic cavity and a flexible Ω1-loop as a lid. Ergosterol is bound to the pocket in a head-down orientation, with its hydrophobic acyl group located in the tunnel entrance. The Ω1-loop in an open conformation is essential for ergosterol binding by direct hydrophobic interaction. Structural comparison suggested that the sterol binding mode of the Lam2 SD2 is likely conserved among the sterol transfer proteins of the StARkin superfamily. Structural models of full-length Lam2 correlated with the sterol transport function at the membrane contact sites.
The cyanobacterial cytochrome b6f subunit PetP adopts an SH3 fold in solution.
Veit, Sebastian; Nagadoi, Aritaka; Rögner, Matthias; Rexroth, Sascha; Stoll, Raphael; Ikegami, Takahisa
2016-06-01
PetP is a peripheral subunit of the cytochrome b(6)f complex (b(6)f) present in both, cyanobacteria and red algae. It is bound to the cytoplasmic surface of this membrane protein complex where it greatly affects the efficiency of the linear photosynthetic electron flow although it is not directly involved in the electron transfer reactions. Despite the crystal structures of the b(6)f core complex, structural information for the transient regulatory b(6)f subunits is still missing. Here we present the first structure of PetP at atomic resolution as determined by solution NMR. The protein adopts an SH3 fold, which is a common protein motif in eukaryotes but comparatively rare in prokaryotes. The structure of PetP enabled the identification of the potential interaction site for b(6)f binding by conservation mapping. The interaction surface is mainly formed by two large loop regions and one short 310 helix which also exhibit an increased flexibility as indicated by heteronuclear steady-state {(1)H}-(15)N NOE and random coil index parameters. The properties of this potential b(6)f binding site greatly differ from the canonical peptide binding site which is highly conserved in eukaryotic SH3 domains. Interestingly, three other proteins of the photosynthetic electron transport chain share this SH3 fold with PetP: NdhS of the photosynthetic NADH dehydrogenase-like complex (NDH-1), PsaE of the photosystem 1 and subunit α of the ferredoxin-thioredoxin reductase have, similar to PetP, a great impact on the photosynthetic electron transport. Finally, a model is presented to illustrate how SH3 domains modulate the photosynthetic electron transport processes in cyanobacteria. Copyright © 2016 Elsevier B.V. All rights reserved.
Mizutani, Kenji; Machida, Yoshitaka; Unzai, Satoru; Park, Sam-Yong; Tame, Jeremy R H
2004-04-20
The most frequent modification of RNA, the conversion of uridine bases to pseudouridines, is found in all living organisms and often in highly conserved locations in ribosomal and transfer RNA. RluC and RluD are homologous enzymes which each convert three specific uridine bases in Escherichia coli ribosomal 23S RNA to pseudouridine: bases 955, 2504, and 2580 in the case of RluC and 1911, 1915, and 1917 in the case of RluD. Both have an N-terminal S4 RNA binding domain. While the loss of RluC has little phenotypic effect, loss of RluD results in a much reduced growth rate. We have determined the crystal structures of the catalytic domain of RluC, and full-length RluD. The S4 domain of RluD appears to be highly flexible or unfolded and is completely invisible in the electron density map. Despite the conserved topology shared by the two proteins, the surface shape and charge distribution are very different. The models suggest significant differences in substrate binding by different pseudouridine synthases.
Xu, Jin-Gen; Huang, Chunfeng; Yang, Zhengfeng; Jin, Mengmeng; Fu, Panhan; Zhang, Ni; Luo, Jian; Li, Dali; Liu, Mingyao; Zhou, Yan; Zhu, Yongqun
2015-01-23
Leucine-rich repeat G-protein-coupled receptors (LGRs) are a unique class of G-protein-coupled receptors characterized by a large extracellular domain to recognize ligands and regulate many important developmental processes. Among the three groups of LGRs, group B members (LGR4-6) recognize R-spondin family proteins (Rspo1-4) to stimulate Wnt signaling. In this study, we successfully utilized the "hybrid leucine-rich repeat technique," which fused LGR4 with the hagfish VLR protein, to obtain two recombinant human LGR4 proteins, LGR415 and LGR49. We determined the crystal structures of ligand-free LGR415 and the LGR49-Rspo1 complex. LGR4 exhibits a twisted horseshoe-like structure. Rspo1 adopts a flat and β-fold architecture and is bound in the concave surface of LGR4 in the complex through electrostatic and hydrophobic interactions. All the Rspo1-binding residues are conserved in LGR4-6, suggesting that LGR4-6 bind R-spondins through an identical surface. Structural analysis of our LGR4-Rspo1 complex with the previously determined LGR4 and LGR5 structures revealed that the concave surface of LGR4 is the sole binding site for R-spondins, suggesting a one-site binding model of LGR4-6 in ligand recognition. The molecular mechanism of LGR4-6 is distinct from the two-step mechanism of group A receptors LGR1-3 and the multiple-interface binding model of group C receptors LGR7-8, suggesting LGRs utilize the divergent mechanisms for ligand recognition. Our structures, together with previous reports, provide a comprehensive understanding of the ligand recognition by LGRs. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Bornholdt, Zachary A; Ndungo, Esther; Fusco, Marnie L; Bale, Shridhar; Flyak, Andrew I; Crowe, James E; Chandran, Kartik; Saphire, Erica Ollmann
2016-02-23
The filovirus surface glycoprotein (GP) mediates viral entry into host cells. Following viral internalization into endosomes, GP is cleaved by host cysteine proteases to expose a receptor-binding site (RBS) that is otherwise hidden from immune surveillance. Here, we present the crystal structure of proteolytically cleaved Ebola virus GP to a resolution of 3.3 Å. We use this structure in conjunction with functional analysis of a large panel of pseudotyped viruses bearing mutant GP proteins to map the Ebola virus GP endosomal RBS at molecular resolution. Our studies indicate that binding of GP to its endosomal receptor Niemann-Pick C1 occurs in two distinct stages: the initial electrostatic interactions are followed by specific interactions with a hydrophobic trough that is exposed on the endosomally cleaved GP1 subunit. Finally, we demonstrate that monoclonal antibodies targeting the filovirus RBS neutralize all known filovirus GPs, making this conserved pocket a promising target for the development of panfilovirus therapeutics. Ebola virus uses its glycoprotein (GP) to enter new host cells. During entry, GP must be cleaved by human enzymes in order for receptor binding to occur. Here, we provide the crystal structure of the cleaved form of Ebola virus GP. We demonstrate that cleavage exposes a site at the top of GP and that this site binds the critical domain C of the receptor, termed Niemann-Pick C1 (NPC1). We perform mutagenesis to find parts of the site essential for binding NPC1 and map distinct roles for an upper, charged crest and lower, hydrophobic trough in cleaved GP. We find that this 3-dimensional site is conserved across the filovirus family and that antibody directed against this site is able to bind cleaved GP from every filovirus tested and neutralize viruses bearing those GPs. Copyright © 2016 Bornholdt et al.
Zubieta, Chloe; Krishna, S Sri; Kapoor, Mili; Kozbial, Piotr; McMullan, Daniel; Axelrod, Herbert L; Miller, Mitchell D; Abdubek, Polat; Ambing, Eileen; Astakhova, Tamara; Carlton, Dennis; Chiu, Hsiu-Ju; Clayton, Thomas; Deller, Marc C; Duan, Lian; Elsliger, Marc-André; Feuerhelm, Julie; Grzechnik, Slawomir K; Hale, Joanna; Hampton, Eric; Han, Gye Won; Jaroszewski, Lukasz; Jin, Kevin K; Klock, Heath E; Knuth, Mark W; Kumar, Abhinav; Marciano, David; Morse, Andrew T; Nigoghossian, Edward; Okach, Linda; Oommachen, Silvya; Reyes, Ron; Rife, Christopher L; Schimmel, Paul; van den Bedem, Henry; Weekes, Dana; White, Aprilfawn; Xu, Qingping; Hodgson, Keith O; Wooley, John; Deacon, Ashley M; Godzik, Adam; Lesley, Scott A; Wilson, Ian A
2007-11-01
BtDyP from Bacteroides thetaiotaomicron (strain VPI-5482) and TyrA from Shewanella oneidensis are dye-decolorizing peroxidases (DyPs), members of a new family of heme-dependent peroxidases recently identified in fungi and bacteria. Here, we report the crystal structures of BtDyP and TyrA at 1.6 and 2.7 A, respectively. BtDyP assembles into a hexamer, while TyrA assembles into a dimer; the dimerization interface is conserved between the two proteins. Each monomer exhibits a two-domain, alpha+beta ferredoxin-like fold. A site for heme binding was identified computationally, and modeling of a heme into the proposed active site allowed for identification of residues likely to be functionally important. Structural and sequence comparisons with other DyPs demonstrate a conservation of putative heme-binding residues, including an absolutely conserved histidine. Isothermal titration calorimetry experiments confirm heme binding, but with a stoichiometry of 0.3:1 (heme:protein). (c) 2007 Wiley-Liss, Inc.
Vaccine approaches conferring cross-protection against influenza viruses
Vemula, Sai V.; Sayedahmed, Ekramy E; Sambhara, Suryaprakash; Mittal, Suresh K.
2018-01-01
Introduction Annual vaccination is one of the most efficient and cost-effective strategies to prevent and control influenza epidemics. Most of currently available influenza vaccines are strong inducer of antibody responses against viral surface proteins, hemagglutinin (HA) and neuraminidase (NA), but are poor inducers of cell-mediated immune responses against conserved internal proteins. Moreover, due to the high variability of viral surface proteins because of antigenic drift or antigenic shift, many of the currently licensed vaccines confer little or no protection against drift or shift variants. Areas covered Next generation influenza vaccines that can induce humoral immune responses to receptor-binding epitopes as well as broadly neutralizing conserved epitopes, and cell-mediated immune responses against highly conserved internal proteins would be effective against variant viruses as well as a novel pandemic influenza until circulating strain-specific vaccines become available. Here we discuss vaccine approaches that have potential to provide broad spectrum protection against influenza viruses. Expert opinion Based on current progress in defining cross-protective influenza immunity, it seems that the development of a universal influenza vaccine is feasible. It would revolutionize the strategy for influenza pandemic preparedness, and significantly impact the shelf-life and protection efficacy of seasonal influenza vaccines. PMID:28925296
Hijacking Complement Regulatory Proteins for Bacterial Immune Evasion.
Hovingh, Elise S; van den Broek, Bryan; Jongerius, Ilse
2016-01-01
The human complement system plays an important role in the defense against invading pathogens, inflammation and homeostasis. Invading microbes, such as bacteria, directly activate the complement system resulting in the formation of chemoattractants and in effective labeling of the bacteria for phagocytosis. In addition, formation of the membrane attack complex is responsible for direct killing of Gram-negative bacteria. In turn, bacteria have evolved several ways to evade complement activation on their surface in order to be able to colonize and invade the human host. One important mechanism of bacterial escape is attraction of complement regulatory proteins to the microbial surface. These molecules are present in the human body for tight regulation of the complement system to prevent damage to host self-surfaces. Therefore, recruitment of complement regulatory proteins to the bacterial surface results in decreased complement activation on the microbial surface which favors bacterial survival. This review will discuss recent advances in understanding the binding of complement regulatory proteins to the bacterial surface at the molecular level. This includes, new insights that have become available concerning specific conserved motives on complement regulatory proteins that are favorable for microbial binding. Finally, complement evasion molecules are of high importance for vaccine development due to their dominant role in bacterial survival, high immunogenicity and homology as well as their presence on the bacterial surface. Here, the use of complement evasion molecules for vaccine development will be discussed.
Hijacking Complement Regulatory Proteins for Bacterial Immune Evasion
Hovingh, Elise S.; van den Broek, Bryan; Jongerius, Ilse
2016-01-01
The human complement system plays an important role in the defense against invading pathogens, inflammation and homeostasis. Invading microbes, such as bacteria, directly activate the complement system resulting in the formation of chemoattractants and in effective labeling of the bacteria for phagocytosis. In addition, formation of the membrane attack complex is responsible for direct killing of Gram-negative bacteria. In turn, bacteria have evolved several ways to evade complement activation on their surface in order to be able to colonize and invade the human host. One important mechanism of bacterial escape is attraction of complement regulatory proteins to the microbial surface. These molecules are present in the human body for tight regulation of the complement system to prevent damage to host self-surfaces. Therefore, recruitment of complement regulatory proteins to the bacterial surface results in decreased complement activation on the microbial surface which favors bacterial survival. This review will discuss recent advances in understanding the binding of complement regulatory proteins to the bacterial surface at the molecular level. This includes, new insights that have become available concerning specific conserved motives on complement regulatory proteins that are favorable for microbial binding. Finally, complement evasion molecules are of high importance for vaccine development due to their dominant role in bacterial survival, high immunogenicity and homology as well as their presence on the bacterial surface. Here, the use of complement evasion molecules for vaccine development will be discussed. PMID:28066340
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stenmark, P.; Dupuy, J.; Inamura, A.
2009-05-26
Botulinum neurotoxins have a very high affinity and specificity for their target cells requiring two different co-receptors located on the neuronal cell surface. Different toxin serotypes have different protein receptors; yet, most share a common ganglioside co-receptor, GT1b. We determined the crystal structure of the botulinum neurotoxin serotype A binding domain (residues 873-1297) alone and in complex with a GT1b analog at 1.7 A and 1.6 A, respectively. The ganglioside GT1b forms several key hydrogen bonds to conserved residues and binds in a shallow groove lined by Tryptophan 1266. GT1b binding does not induce any large structural changes in themore » toxin; therefore, it is unlikely that allosteric effects play a major role in the dual receptor recognition. Together with the previously published structures of botulinum neurotoxin serotype B in complex with its protein co-receptor, we can now generate a detailed model of botulinum neurotoxin's interaction with the neuronal cell surface. The two branches of the GT1b polysaccharide, together with the protein receptor site, impose strict geometric constraints on the mode of interaction with the membrane surface and strongly support a model where one end of the 100 A long translocation domain helix bundle swing into contact with the membrane, initiating the membrane anchoring event.« less
Collins, Brett M.; Davis, Melissa J.; Hancock, John F.; Parton, Robert G.
2012-01-01
Summary Caveolin proteins drive formation of caveolae, specialized cell-surface microdomains that influence cell signaling. Signaling proteins are proposed to use conserved caveolin-binding motifs (CBMs) to associate with caveolae via the caveolin scaffolding domain (CSD). However, structural and bioinformatic analyses argue against such direct physical interactions: In the majority of signaling proteins, the CBM is buried and inaccessible. Putative CBMs do not form a common structure for caveolin recognition, are not enriched amongst caveolin-binding proteins, and are even more common in yeast, which lack caveolae. We propose that CBM/CSD-dependent interactions are unlikely to mediate caveolar signaling, and the basis for signaling effects should therefore be reassessed. PMID:22814599
Baumstummler, A; Lehmann, D; Janjic, N; Ochsner, UA
2014-01-01
Slow off-rate modified aptamer (SOMAmer) reagents were generated to several Staphylococcus aureus cell surface-associated proteins via SELEX with multiple modified DNA libraries using purified recombinant or native proteins. High-affinity binding agents with sub-nanomolar Kd's were obtained for staphylococcal protein A (SpA), clumping factors (ClfA, ClfB), fibronectin-binding proteins (FnbA, FnbB) and iron-regulated surface determinants (Isd). Further screening revealed several SOMAmers that specifically bound to Staph. aureus cells from all strains that were tested, but not to other staphylococci or other bacteria. SpA and ClfA SOMAmers proved useful for the selective capture and enrichment of Staph. aureus cells, as shown by culture and PCR, leading to improved limits of detection and efficient removal of PCR inhibitors. Detection of Staph. aureus cells was enhanced by several orders of magnitude when the bacterial cell surface was coated with SOMAmers followed by qPCR of the SOMAmers. Furthermore, fluorescence-labelled SpA SOMAmers demonstrated their utility as direct detection agents in flow cytometry. Significance and Impact of the Study Monitoring for microbial contamination of food, water, nonsterile products or the environment is typically based on culture, PCR or antibodies. Aptamers that bind with high specificity and affinity to well-conserved cell surface epitopes represent a promising novel type of reagents to detect bacterial cells without the need for culture or cell lysis, including for the capture and enrichment of bacteria present at low cell densities and for the direct detection via qPCR or fluorescent staining. PMID:24935714
Ohno, Shinji; Sakai, Kouji; Ito, Yuri; Fukuhara, Hideo; Komase, Katsuhiro; Brindley, Melinda A.; Rota, Paul A.; Plemper, Richard K.; Maenaka, Katsumi; Takeda, Makoto
2013-01-01
Here, we provide direct evidence that the receptor-binding site of measles virus (MV) hemagglutinin protein itself forms an effective conserved neutralizing epitope (CNE). Several receptor-interacting residues constitute the CNE. Thus, viral escape from neutralization has to be associated with loss of receptor-binding activity. Since interactions with both the signaling lymphocyte activation molecule (SLAM) and nectin4 are critical for MV pathogenesis, its escape, which results from loss of receptor-binding activity, should not occur in nature. PMID:23283964
DOE Office of Scientific and Technical Information (OSTI.GOV)
Berman, Benjamin P.; Pfeiffer, Barret D.; Laverty, Todd R.
2004-08-06
Background The identification of sequences that control transcription in metazoans is a major goal of genome analysis. In a previous study, we demonstrated that searching for clusters of predicted transcription factor binding sites could discover active regulatory sequences, and identified 37 regions of the Drosophila melanogaster genome with high densities of predicted binding sites for five transcription factors involved in anterior-posterior embryonic patterning. Nine of these clusters overlapped known enhancers. Here, we report the results of in vivo functional analysis of 27 remaining clusters. Results We generated transgenic flies carrying each cluster attached to a basal promoter and reporter gene,more » and assayed embryos for reporter gene expression. Six clusters are enhancers of adjacent genes: giant, fushi tarazu, odd-skipped, nubbin, squeeze and pdm2; three drive expression in patterns unrelated to those of neighboring genes; the remaining 18 do not appear to have enhancer activity. We used the Drosophila pseudoobscura genome to compare patterns of evolution in and around the 15 positive and 18 false-positive predictions. Although conservation of primary sequence cannot distinguish true from false positives, conservation of binding-site clustering accurately discriminates functional binding-site clusters from those with no function. We incorporated conservation of binding-site clustering into a new genome-wide enhancer screen, and predict several hundred new regulatory sequences, including 85 adjacent to genes with embryonic patterns. Conclusions Measuring conservation of sequence features closely linked to function - such as binding-site clustering - makes better use of comparative sequence data than commonly used methods that examine only sequence identity.« less
Complex between α-bungarotoxin and an α7 nicotinic receptor ligand-binding domain chimaera
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huang, Sun; Li, Shu-Xing; Bren, Nina
2013-09-01
To identify high-affinity interactions between long-chain α-neurotoxins and nicotinic receptors, we determined the crystal structure of the complex between α-btx (α-bungarotoxin) and a pentameric ligand-binding domain constructed from the human α7 AChR (acetylcholine receptor) and AChBP (acetylcholine-binding protein). The complex buries ~2000 Å 2 (1 Å=0.1 nm) of surface area, within which Arg 36 and Phe 32 from finger II of α-btx form a π-cation stack that aligns edge-to-face with the conserved Tyr 184 from loop-C of α7, while Asp 30 of α-btx forms a hydrogen bond with the hydroxy group of Tyr 184. These inter-residue interactions diverge from thosemore » in a 4.2 Å structure of α-ctx (α-cobratoxin) bound to AChBP, but are similar to those in a 1.94 Å structure of α-btx bound to the monomeric α1 extracellular domain, although compared with the monomer-bound complex, the α-btx backbone exhibits a large shift relative to the protein surface. Mutational analyses show that replacing Tyr 184 with a threonine residue abolishes high-affinity α-btx binding, whereas replacing with a phenylalanine residue maintains high affinity. Comparison of the α-btx complex with that coupled to the agonist epibatidine reveals structural rearrangements within the binding pocket and throughout each subunit. The overall findings highlight structural principles by which α-neurotoxins interact with nicotinic receptors.« less
Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I
2001-05-01
Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding.
Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I
2001-01-01
Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding. PMID:11350033
Gruschus, James M.; Greene, Lois E.; Eisenberg, Evan; Ferretti, James A.
2004-01-01
A model structure of the Hsc70/auxilin complex has been constructed to gain insight into interprotein substrate transfer and ATP hydrolysis induced conformational changes in the multidomain Hsc70 structure. The Hsc70/auxilin system, which is a member of the Hsp70/Hsp40 chaperone system family, uncoats clathrin-coated vesicles in an ATP hydrolysis-driven process. Incorporating previous results from NMR and mutant binding studies, the auxilin J-domain was docked into the Hsc70 ATPase domain lower cleft using rigid backbone/flexible side chain molecular dynamics, and the Hsc70 substrate binding domain was docked by a similar procedure. For comparison, J-domain and substrate binding domain docking sites were obtained by the rigid-body docking programs DOT and ZDOCK, filtered and ranked by the program ClusPro, and relaxed using the same rigid backbone/flexible side chain dynamics. The substrate binding domain sites were assessed in terms of conserved surface complementarity and feasibility in the context of substrate transfer, both for auxilin and another Hsp40 protein, Hsc20. This assessment favors placement of the substrate binding domain near D152 on the ATPase domain surface adjacent to the J-domain invariant HPD segment, with the Hsc70 interdomain linker in the lower cleft. Examining Hsc70 interdomain energetics, we propose that long-range electrostatic interactions, perhaps due to a difference in the pKa values of bound ATP and ADP, could play a major role in the structural change induced by ATP hydrolysis. Interdomain electrostatic interactions also appear to play a role in stimulation of ATPase activity due to J-domain binding and substrate binding by Hsc70. PMID:15273304
Saleem, Muhammad; Prince, Stephen M.; Rigby, Stephen E. J.; Imran, Muhammad; Patel, Hema; Chan, Hannah; Sanders, Holly; Maiden, Martin C. J.; Feavers, Ian M.; Derrick, Jeremy P.
2013-01-01
FrpB is an outer membrane transporter from Neisseria meningitidis, the causative agent of meningococcal meningitis. It is a member of the TonB-dependent transporter (TBDT) family and is responsible for iron uptake into the periplasm. FrpB is subject to a high degree of antigenic variation, principally through a region of hypervariable sequence exposed at the cell surface. From the crystal structures of two FrpB antigenic variants, we identify a bound ferric ion within the structure which induces structural changes on binding which are consistent with it being the transported substrate. Binding experiments, followed by elemental analysis, verified that FrpB binds Fe3+ with high affinity. EPR spectra of the bound Fe3+ ion confirmed that its chemical environment was consistent with that observed in the crystal structure. Fe3+ binding was reduced or abolished on mutation of the Fe3+-chelating residues. FrpB orthologs were identified in other Gram-negative bacteria which showed absolute conservation of the coordinating residues, suggesting the existence of a specific TBDT sub-family dedicated to the transport of Fe3+. The region of antigenic hypervariability lies in a separate, external sub-domain, whose structure is conserved in both the F3-3 and F5-1 variants, despite their sequence divergence. We conclude that the antigenic sub-domain has arisen separately as a result of immune selection pressure to distract the immune response from the primary transport function. This would enable FrpB to function as a transporter independently of antibody binding, by using the antigenic sub-domain as a ‘molecular decoy’ to distract immune surveillance. PMID:23457610
Saleem, Muhammad; Prince, Stephen M; Rigby, Stephen E J; Imran, Muhammad; Patel, Hema; Chan, Hannah; Sanders, Holly; Maiden, Martin C J; Feavers, Ian M; Derrick, Jeremy P
2013-01-01
FrpB is an outer membrane transporter from Neisseria meningitidis, the causative agent of meningococcal meningitis. It is a member of the TonB-dependent transporter (TBDT) family and is responsible for iron uptake into the periplasm. FrpB is subject to a high degree of antigenic variation, principally through a region of hypervariable sequence exposed at the cell surface. From the crystal structures of two FrpB antigenic variants, we identify a bound ferric ion within the structure which induces structural changes on binding which are consistent with it being the transported substrate. Binding experiments, followed by elemental analysis, verified that FrpB binds Fe(3+) with high affinity. EPR spectra of the bound Fe(3+) ion confirmed that its chemical environment was consistent with that observed in the crystal structure. Fe(3+) binding was reduced or abolished on mutation of the Fe(3+)-chelating residues. FrpB orthologs were identified in other Gram-negative bacteria which showed absolute conservation of the coordinating residues, suggesting the existence of a specific TBDT sub-family dedicated to the transport of Fe(3+). The region of antigenic hypervariability lies in a separate, external sub-domain, whose structure is conserved in both the F3-3 and F5-1 variants, despite their sequence divergence. We conclude that the antigenic sub-domain has arisen separately as a result of immune selection pressure to distract the immune response from the primary transport function. This would enable FrpB to function as a transporter independently of antibody binding, by using the antigenic sub-domain as a 'molecular decoy' to distract immune surveillance.
Li, Xin-Cang; Zhang, Xiao-Wen; Zhou, Jun-Fang; Ma, Hong-Yu; Liu, Zhi-Dong; Zhu, Lei; Yao, Xiao-Juan; Li, Lin-Gui; Fang, Wen-Hong
2013-01-01
Tube and Pelle are essential components in Drosophila Toll signaling pathway. In this study, we characterized a pair of crustacean homologs of Tube and Pelle in Scylla paramamosain, namely, SpTube and SpPelle, and analyzed their immune functions. The full-length cDNA of SpTube had 2052 bp with a 1578 bp open reading frame (ORF) encoding a protein with 525 aa. A death domain (DD) and a kinase domain were predicted in the deduced protein. The full-length cDNA of SpPelle had 3825 bp with a 3420 bp ORF encoding a protein with 1140 aa. The protein contained a DD and a kinase domain. Two conserved repeat motifs previously called Tube repeat motifs present only in insect Tube or Tube-like sequences were found between these two domains. Alignments and structure predictions demonstrated that SpTubeDD and SpPelleDD significantly differed in sequence and 3D structure. Similar to TubeDD, SpTubeDD contained three common conserved residues (R, K, and R) on one surface that may mediate SpMyD88 binding and two common residues (A and A) on the other surface that may contribute to Pelle binding. By contrast, SpPelleDD lacked similar conservative residues. SpTube, insect Tube-like kinases, and human IRAK4 were found to be RD kinases with an RD dipeptide in the kinase domain. SpPelle, Pelle, insect Pelle-like kinases, and human IRAK1 were found to be non-RD kinases lacking an RD dipeptide. Both SpTube and SpPelle were highly expressed in hemocytes, gills, and hepatopancreas. Upon challenge, SpTube and SpPele were significantly increased in hemocytes by Gram-negative or Gram-positive bacteria, whereas only SpPelle was elevated by White Spot Syndrome Virus. The pull-down assay showed that SpTube can bind to both SpMyD88 and SpPelle. These results suggest that SpTube, SpPelle, and SpMyD88 may form a trimeric complex involved in the immunity of mud crabs against both Gram-negative and Gram-positive bacteria.
Zhou, Jun-Fang; Ma, Hong-Yu; Liu, Zhi-Dong; Zhu, Lei; Yao, Xiao-Juan; Li, Lin-Gui; Fang, Wen-Hong
2013-01-01
Tube and Pelle are essential components in Drosophila Toll signaling pathway. In this study, we characterized a pair of crustacean homologs of Tube and Pelle in Scylla paramamosain, namely, SpTube and SpPelle, and analyzed their immune functions. The full-length cDNA of SpTube had 2052 bp with a 1578 bp open reading frame (ORF) encoding a protein with 525 aa. A death domain (DD) and a kinase domain were predicted in the deduced protein. The full-length cDNA of SpPelle had 3825 bp with a 3420 bp ORF encoding a protein with 1140 aa. The protein contained a DD and a kinase domain. Two conserved repeat motifs previously called Tube repeat motifs present only in insect Tube or Tube-like sequences were found between these two domains. Alignments and structure predictions demonstrated that SpTubeDD and SpPelleDD significantly differed in sequence and 3D structure. Similar to TubeDD, SpTubeDD contained three common conserved residues (R, K, and R) on one surface that may mediate SpMyD88 binding and two common residues (A and A) on the other surface that may contribute to Pelle binding. By contrast, SpPelleDD lacked similar conservative residues. SpTube, insect Tube-like kinases, and human IRAK4 were found to be RD kinases with an RD dipeptide in the kinase domain. SpPelle, Pelle, insect Pelle-like kinases, and human IRAK1 were found to be non-RD kinases lacking an RD dipeptide. Both SpTube and SpPelle were highly expressed in hemocytes, gills, and hepatopancreas. Upon challenge, SpTube and SpPele were significantly increased in hemocytes by Gram-negative or Gram-positive bacteria, whereas only SpPelle was elevated by White Spot Syndrome Virus. The pull-down assay showed that SpTube can bind to both SpMyD88 and SpPelle. These results suggest that SpTube, SpPelle, and SpMyD88 may form a trimeric complex involved in the immunity of mud crabs against both Gram-negative and Gram-positive bacteria. PMID:24116143
Wang, Aibing; Zhang, Lijie; Khayat, Reza
2016-01-01
Outbreaks of porcine circovirus (PCV) type 2 (PCV2)-associated diseases have caused substantial economic losses worldwide in the last 20 years. The PCV capsid protein (Cap) is the sole structural protein and main antigenic determinant of this virus. In this study, not only were phylogenetic trees reconstructed, but variations of surface structure of the PCV capsid were analysed in the course of evolution. Unique surface patterns of the icosahedral fivefold axes of the PCV2 capsid were identified and characterized, all of which were absent in PCV type 1 (PCV1). Icosahedral fivefold axes, decorated with Loops BC, HI and DE, were distinctly different between PCV2 and PCV1. Loops BC, determining the outermost surface around the fivefold axes of PCV capsids, had limited homology between Caps of PCV1 and PCV2. A conserved tyrosine phosphorylation motif in Loop HI that might be recognized by non-receptor tyrosine kinase(s) in vivo was present only in PCV2. Particularly, the concurrent presence of 60 pairs of the conserved tyrosine and a canonical PXXP motif on the PCV2 capsid surface could be a mechanism for PXXP motif binding to and activation of an SH3-domain-containing tyrosine kinase in host cells. Additionally, a conserved cysteine in Loop DE of the PCV2 Cap was substituted by an arginine in PCV1, indicating potentially distinct assembly mechanisms of the capsid in vitro between PCV1 and PCV2. Therefore, these unique patterns on the PCV2 capsid surface, absent in PCV1 isolates, might be related to cell entry, virus function and pathogenesis. PMID:27902320
Wang, Naidong; Zhan, Yang; Wang, Aibing; Zhang, Lijie; Khayat, Reza; Yang, Yi
2016-12-01
Outbreaks of porcine circovirus (PCV) type 2 (PCV2)-associated diseases have caused substantial economic losses worldwide in the last 20 years. The PCV capsid protein (Cap) is the sole structural protein and main antigenic determinant of this virus. In this study, not only were phylogenetic trees reconstructed, but variations of surface structure of the PCV capsid were analysed in the course of evolution. Unique surface patterns of the icosahedral fivefold axes of the PCV2 capsid were identified and characterized, all of which were absent in PCV type 1 (PCV1). Icosahedral fivefold axes, decorated with Loops BC, HI and DE, were distinctly different between PCV2 and PCV1. Loops BC, determining the outermost surface around the fivefold axes of PCV capsids, had limited homology between Caps of PCV1 and PCV2. A conserved tyrosine phosphorylation motif in Loop HI that might be recognized by non-receptor tyrosine kinase(s) in vivo was present only in PCV2. Particularly, the concurrent presence of 60 pairs of the conserved tyrosine and a canonical PXXP motif on the PCV2 capsid surface could be a mechanism for PXXP motif binding to and activation of an SH3-domain-containing tyrosine kinase in host cells. Additionally, a conserved cysteine in Loop DE of the PCV2 Cap was substituted by an arginine in PCV1, indicating potentially distinct assembly mechanisms of the capsid in vitro between PCV1 and PCV2. Therefore, these unique patterns on the PCV2 capsid surface, absent in PCV1 isolates, might be related to cell entry, virus function and pathogenesis.
2013-01-01
ATP-binding cassette transporter G1 (ABCG1) mediates cholesterol and oxysterol efflux onto lipidated lipoproteins and plays an important role in macrophage reverse cholesterol transport. Here, we identified a highly conserved sequence present in the five ABCG transporter family members. The conserved sequence is located between the nucleotide binding domain and the transmembrane domain and contains five amino acid residues from Asn at position 316 to Phe at position 320 in ABCG1 (NPADF). We found that cells expressing mutant ABCG1, in which Asn316, Pro317, Asp319, and Phe320 in the conserved sequence were replaced with Ala simultaneously, showed impaired cholesterol efflux activity compared with wild type ABCG1-expressing cells. A more detailed mutagenesis study revealed that mutation of Asn316 or Phe 320 to Ala significantly reduced cellular cholesterol and 7-ketocholesterol efflux conferred by ABCG1, whereas replacement of Pro317 or Asp319 with Ala had no detectable effect. To confirm the important role of Asn316 and Phe320, we mutated Asn316 to Asp (N316D) and Gln (N316Q), and Phe320 to Ile (F320I) and Tyr (F320Y). The mutant F320Y showed the same phenotype as wild type ABCG1. However, the efflux of cholesterol and 7-ketocholesterol was reduced in cells expressing ABCG1 mutant N316D, N316Q, or F320I compared with wild type ABCG1. Further, mutations N316Q and F320I impaired ABCG1 trafficking while having no marked effect on the stability and oligomerization of ABCG1. The mutant N316Q and F320I could not be transported to the cell surface efficiently. Instead, the mutant proteins were mainly localized intracellularly. Thus, these findings indicate that the two highly conserved amino acid residues, Asn and Phe, play an important role in ABCG1-dependent export of cellular cholesterol, mainly through the regulation of ABCG1 trafficking. PMID:24320932
Panayotatos, N; Radziejewska, E; Acheson, A; Somogyi, R; Thadani, A; Hendrickson, W A; McDonald, N Q
1995-06-09
By rational mutagenesis, receptor-specific functional analysis, and visualization of complex formation in solution, we identified individual amino acid side chains involved specifically in the interaction of ciliary neurotrophic factor (CNTF) with CNTFR alpha and not with the beta-components, gp130 and LIFR. In the crystal structure, the side chains of these residues, which are located in helix A, the AB loop, helix B, and helix D, are surface accessible and are clustered in space, thus constituting an epitope for CNTFR alpha. By the same analysis, a partial epitope for gp130 was also identified on the surface of helix A that faces away from the alpha-epitope. Superposition of the CNTF and growth hormone structures showed that the location of these epitopes on CNTF is analogous to the location of the first and second receptor epitopes on the surface of growth hormone. Further comparison with proposed binding sites for alpha- and beta-receptors on interleukin-6 and leukemia inhibitory factor indicated that this epitope topology is conserved among helical cytokines. In each case, epitope I is utilized by the specificity-conferring component, whereas epitopes II and III are used by accessory components. Thus, in addition to a common fold, helical cytokines share a conserved order of receptor epitopes that is function related.
Long-range coupling between ATP-binding and lever-arm regions in myosin via dielectric allostery
NASA Astrophysics Data System (ADS)
Sato, Takato; Ohnuki, Jun; Takano, Mitsunori
2017-12-01
A protein molecule is a dielectric substance, so the binding of a ligand is expected to induce dielectric response in the protein molecule, considering that ligands are charged or polar in general. We previously reported that binding of adenosine triphosphate (ATP) to molecular motor myosin actually induces such a dielectric response in myosin due to the net negative charge of ATP. By this dielectric response, referred to as "dielectric allostery," spatially separated two regions in myosin, the ATP-binding region and the actin-binding region, are allosterically coupled. In this study, from the statistically stringent analyses of the extensive molecular dynamics simulation data obtained in the ATP-free and the ATP-bound states, we show that there exists the dielectric allostery that transmits the signal of ATP binding toward the distant lever-arm region. The ATP-binding-induced electrostatic potential change observed on the surface of the main domain induced a movement of the converter subdomain from which the lever arm extends. The dielectric response was found to be caused by an underlying large-scale concerted rearrangement of the electrostatic bond network, in which highly conserved charged/polar residues are involved. Our study suggests the importance of the dielectric property for molecular machines in exerting their function.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vasan, Neil; Hutagalung, Alex; Novick, Peter
2010-08-13
The Golgi-associated retrograde protein (GARP) complex is a membrane-tethering complex that functions in traffic from endosomes to the trans-Golgi network. Here we present the structure of a C-terminal fragment of the Vps53 subunit, important for binding endosome-derived vesicles, at a resolution of 2.9 {angstrom}. We show that the C terminus consists of two {alpha}-helical bundles arranged in tandem, and we identify a highly conserved surface patch, which may play a role in vesicle recognition. Mutations of the surface result in defects in membrane traffic. The fold of the Vps53 C terminus is strongly reminiscent of proteins that belong to threemore » other tethering complexes - Dsl1, conserved oligomeric Golgi, and the exocyst - thought to share a common evolutionary origin. Thus, the structure of the Vps53 C terminus suggests that GARP belongs to this family of complexes.« less
Chappell, Paul E; Meziane, El Kahina; Harrison, Michael; Magiera, Łukasz; Hermann, Clemens; Mears, Laura; Wrobel, Antoni G; Durant, Charlotte; Nielsen, Lise Lotte; Buus, Søren; Ternette, Nicola; Mwangi, William; Butter, Colin; Nair, Venugopal; Ahyee, Trudy; Duggleby, Richard; Madrigal, Alejandro; Roversi, Pietro; Lea, Susan M; Kaufman, Jim
2015-01-01
Highly polymorphic major histocompatibility complex (MHC) molecules are at the heart of adaptive immune responses, playing crucial roles in many kinds of disease and in vaccination. We report that breadth of peptide presentation and level of cell surface expression of class I molecules are inversely correlated in both chickens and humans. This relationship correlates with protective responses against infectious pathogens including Marek's disease virus leading to lethal tumours in chickens and human immunodeficiency virus infection progressing to AIDS in humans. We propose that differences in peptide binding repertoire define two groups of MHC class I molecules strategically evolved as generalists and specialists for different modes of pathogen resistance. We suggest that differences in cell surface expression level ensure the development of optimal peripheral T cell responses. The inverse relationship of peptide repertoire and expression is evidently a fundamental property of MHC molecules, with ramifications extending beyond immunology and medicine to evolutionary biology and conservation. DOI: http://dx.doi.org/10.7554/eLife.05345.001 PMID:25860507
DOE Office of Scientific and Technical Information (OSTI.GOV)
Orans, Jillian; Johnson, Michael D.L.; Coggan, Kimberly A.
Several bacterial pathogens require the 'twitching' motility produced by filamentous type IV pili (T4P) to establish and maintain human infections. Two cytoplasmic ATPases function as an oscillatory motor that powers twitching motility via cycles of pilus extension and retraction. The regulation of this motor, however, has remained a mystery. We present the 2.1 {angstrom} resolution crystal structure of the Pseudomonas aeruginosa pilus-biogenesis factor PilY1, and identify a single site on this protein required for bacterial translocation. The structure reveals a modified {beta}-propeller fold and a distinct EF-hand-like calcium-binding site conserved in pathogens with retractile T4P. We show that preventing calciummore » binding by PilY1 using either an exogenous calcium chelator or mutation of a single residue disrupts Pseudomonas twitching motility by eliminating surface pili. In contrast, placing a lysine in this site to mimic the charge of a bound calcium interferes with motility in the opposite manner - by producing an abundance of nonfunctional surface pili. Our data indicate that calcium binding and release by the unique loop identified in the PilY1 crystal structure controls the opposing forces of pilus extension and retraction. Thus, PilY1 is an essential, calcium-dependent regulator of bacterial twitching motility.« less
A conserved mechanism for replication origin recognition and binding in archaea.
Majerník, Alan I; Chong, James P J
2008-01-15
To date, methanogens are the only group within the archaea where firing DNA replication origins have not been demonstrated in vivo. In the present study we show that a previously identified cluster of ORB (origin recognition box) sequences do indeed function as an origin of replication in vivo in the archaeon Methanothermobacter thermautotrophicus. Although the consensus sequence of ORBs in M. thermautotrophicus is somewhat conserved when compared with ORB sequences in other archaea, the Cdc6-1 protein from M. thermautotrophicus (termed MthCdc6-1) displays sequence-specific binding that is selective for the MthORB sequence and does not recognize ORBs from other archaeal species. Stabilization of in vitro MthORB DNA binding by MthCdc6-1 requires additional conserved sequences 3' to those originally described for M. thermautotrophicus. By testing synthetic sequences bearing mutations in the MthORB consensus sequence, we show that Cdc6/ORB binding is critically dependent on the presence of an invariant guanine found in all archaeal ORB sequences. Mutation of a universally conserved arginine residue in the recognition helix of the winged helix domain of archaeal Cdc6-1 shows that specific origin sequence recognition is dependent on the interaction of this arginine residue with the invariant guanine. Recognition of a mutated origin sequence can be achieved by mutation of the conserved arginine residue to a lysine or glutamine residue. Thus despite a number of differences in protein and DNA sequences between species, the mechanism of origin recognition and binding appears to be conserved throughout the archaea.
Ve, Thomas; Williams, Simon J; Catanzariti, Ann-Maree; Rafiqi, Maryam; Rahman, Motiur; Ellis, Jeffrey G; Hardham, Adrienne R; Jones, David A; Anderson, Peter A; Dodds, Peter N; Kobe, Bostjan
2013-10-22
Fungal and oomycete pathogens cause some of the most devastating diseases in crop plants, and facilitate infection by delivering a large number of effector molecules into the plant cell. AvrM is a secreted effector protein from flax rust (Melampsora lini) that can internalize into plant cells in the absence of the pathogen, binds to phosphoinositides (PIPs), and is recognized directly by the resistance protein M in flax (Linum usitatissimum), resulting in effector-triggered immunity. We determined the crystal structures of two naturally occurring variants of AvrM, AvrM-A and avrM, and both reveal an L-shaped fold consisting of a tandem duplicated four-helix motif, which displays similarity to the WY domain core in oomycete effectors. In the crystals, both AvrM variants form a dimer with an unusual nonglobular shape. Our functional analysis of AvrM reveals that a hydrophobic surface patch conserved between both variants is required for internalization into plant cells, whereas the C-terminal coiled-coil domain mediates interaction with M. AvrM binding to PIPs is dependent on positive surface charges, and mutations that abrogate PIP binding have no significant effect on internalization, suggesting that AvrM binding to PIPs is not essential for transport of AvrM across the plant membrane. The structure of AvrM and the identification of functionally important surface regions advance our understanding of the molecular mechanisms underlying how effectors enter plant cells and how they are detected by the plant immune system.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Boudreaux, David A.; Maiti, Tushar K.; Davies, Christopher W.
Ubiquitin carboxy-terminal hydrolase L1 (UCHL1) is a Parkinson disease-associated, putative cysteine protease found abundantly and selectively expressed in neurons. The crystal structure of apo UCHL1 showed that the active-site residues are not aligned in a canonical form, with the nucleophilic cysteine being 7.7 {angstrom} from the general base histidine, an arrangement consistent with an inactive form of the enzyme. Here we report the crystal structures of the wild type and two Parkinson disease-associated variants of the enzyme, S18Y and I93M, bound to a ubiquitin-based suicide substrate, ubiquitin vinyl methyl ester. These structures reveal that ubiquitin vinyl methyl ester binds primarilymore » at two sites on the enzyme, with its carboxy terminus at the active site and with its amino-terminal {beta}-hairpin at the distal site - a surface-exposed hydrophobic crevice 17 {angstrom} away from the active site. Binding at the distal site initiates a cascade of side-chain movements in the enzyme that starts at a highly conserved, surface-exposed phenylalanine and is relayed to the active site resulting in the reorientation and proximal placement of the general base within 4 {angstrom} of the catalytic cysteine, an arrangement found in productive cysteine proteases. Mutation of the distal-site, surface-exposed phenylalanine to alanine reduces ubiquitin binding and severely impairs the catalytic activity of the enzyme. These results suggest that the activity of UCHL1 may be regulated by its own substrate.« less
The E2 Domains of APP and APLP1 Share a Conserved Mode of Dimerization
DOE Office of Scientific and Technical Information (OSTI.GOV)
S Lee; Y Xue; J Hulbert
2011-12-31
Amyloid precursor protein (APP) is genetically linked to Alzheimer's disease. APP is a type I membrane protein, and its oligomeric structure is potentially important because this property may play a role in its function or affect the processing of the precursor by the secretases to generate amyloid {beta}-peptide. Several independent studies have shown that APP can form dimers in the cell, but how it dimerizes remains controversial. At least three regions of the precursor, including a centrally located and conserved domain called E2, have been proposed to contribute to dimerization. Here we report two new crystal structures of E2, onemore » from APP and the other from APLP1, a mammalian APP homologue. Comparison with an earlier APP structure, which was determined in a different space group, shows that the E2 domains share a conserved and antiparallel mode of dimerization. Biophysical measurements in solution show that heparin binding induces E2 dimerization. The 2.1 {angstrom} resolution electron density map also reveals phosphate ions that are bound to the protein surface. Mutational analysis shows that protein residues interacting with the phosphate ions are also involved in heparin binding. The locations of two of these residues, Arg-369 and His-433, at the dimeric interface suggest a mechanism for heparin-induced protein dimerization.« less
Principles of regulatory information conservation between mouse and human
Cheng, Yong; Ma, Zhihai; Kim, Bong-Hyun; ...
2014-11-19
To broaden our understanding of the evolution of gene regulation mechanisms, we generated occupancy profiles for 34 orthologous transcription factors (TFs) in human–mouse erythroid progenitor, lymphoblast and embryonic stem-cell lines. By combining the genome-wide transcription factor occupancy repertoires, associated epigenetic signals, and co-association patterns, here we deduce several evolutionary principles of gene regulatory features operating since the mouse and human lineages diverged. The genomic distribution profiles, primary binding motifs, chromatin states, and DNA methylation preferences are well conserved for TF-occupied sequences. However, the extent to which orthologous DNA segments are bound by orthologous TFs varies both among TFs and withmore » genomic location: binding at promoters is more highly conserved than binding at distal elements. Notably, occupancy-conserved TF-occupied sequences tend to be pleiotropic; they function in several tissues and also co-associate with many TFs. Lastly, single nucleotide variants at sites with potential regulatory functions are enriched in occupancy-conserved TF-occupied sequences.« less
Bosselut, R; Levin, J; Adjadj, E; Ghysdael, J
1993-11-11
Ets proteins form a family of sequence specific DNA binding proteins which bind DNA through a 85 aminoacids conserved domain, the Ets domain, whose sequence is unrelated to any other characterized DNA binding domain. Unlike all other known Ets proteins, which bind specific DNA sequences centered over either GGAA or GGAT core motifs, E74 and Elf1 selectively bind to GGAA corecontaining sites. Elf1 and E74 differ from other Ets proteins in three residues located in an otherwise highly conserved region of the Ets domain, referred to as conserved region III (CRIII). We show that a restricted selectivity for GGAA core-containing sites could be conferred to Ets1 upon changing a single lysine residue within CRIII to the threonine found in Elf1 and E74 at this position. Conversely, the reciprocal mutation in Elf1 confers to this protein the ability to bind to GGAT core containing EBS. This, together with the fact that mutation of two invariant arginine residues in CRIII abolishes DNA binding, indicates that CRIII plays a key role in Ets domain recognition of the GGAA/T core motif and lead us to discuss a model of Ets proteins--core motif interaction.
Xia, Zhen; Huynh, Tien; Kang, Seung-gu; Zhou, Ruhong
2012-03-21
Antibodies binding to conserved epitopes can provide a broad range of neutralization to existing influenza subtypes and may also prevent the propagation of potential pandemic viruses by fighting against emerging strands. Here we propose a computational framework to study structural binding patterns and detailed molecular mechanisms of viral surface glycoprotein hemagglutinin (HA) binding with a broad spectrum of neutralizing monoclonal antibody fragments (Fab). We used rigorous free-energy perturbation (FEP) methods to calculate the antigen-antibody binding affinities, with an aggregate underlying molecular-dynamics simulation time of several microseconds (∼2 μs) using all-atom, explicit-solvent models. We achieved a high accuracy in the validation of our FEP protocol against a series of known binding affinities for this complex system, with <0.5 kcal/mol errors on average. We then introduced what to our knowledge are novel mutations into the interfacial region to further study the binding mechanism. We found that the stacking interaction between Trp-21 in HA2 and Phe-55 in the CDR-H2 of Fab is crucial to the antibody-antigen association. A single mutation of either W21A or F55A can cause a binding affinity decrease of ΔΔG > 4.0 kcal/mol (equivalent to an ∼1000-fold increase in the dissociation constant K(d)). Moreover, for group 1 HA subtypes (which include both the H1N1 swine flu and the H5N1 bird flu), the relative binding affinities change only slightly (< ±1 kcal/mol) when nonpolar residues at the αA helix of HA mutate to conservative amino acids of similar size, which explains the broad neutralization capability of antibodies such as F10 and CR6261. Finally, we found that the hydrogen-bonding network between His-38 (in HA1) and Ser-30/Gln-64 (in Fab) is important for preserving the strong binding of Fab against group 1 HAs, whereas the lack of such hydrogen bonds with Asn-38 in most group 2 HAs may be responsible for the escape of antibody neutralization. These large-scale simulations may provide new insight into the antigen-antibody binding mechanism at the atomic level, which could be essential for designing more-effective vaccines for influenza. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.
A Crayfish Insulin-like-binding Protein
Rosen, Ohad; Weil, Simy; Manor, Rivka; Roth, Ziv; Khalaila, Isam; Sagi, Amir
2013-01-01
Across the animal kingdom, the involvement of insulin-like peptide (ILP) signaling in sex-related differentiation processes is attracting increasing attention. Recently, a gender-specific ILP was identified as the androgenic sex hormone in Crustacea. However, moieties modulating the actions of this androgenic insulin-like growth factor were yet to be revealed. Through molecular screening of an androgenic gland (AG) cDNA library prepared from the crayfish Cherax quadricarinatus, we have identified a novel insulin-like growth factor-binding protein (IGFBP) termed Cq-IGFBP. Based on bioinformatics analyses, the deduced Cq-IGFBP was shown to share high sequence homology with IGFBP family members from both invertebrates and vertebrates. The protein also includes a sequence determinant proven crucial for ligand binding, which according to three-dimensional modeling is assigned to the exposed outer surface of the protein. Recombinant Cq-IGFBP (rCq-IGFBP) protein was produced and, using a “pulldown” methodology, was shown to specifically interact with the insulin-like AG hormone of the crayfish (Cq-IAG). Particularly, using both mass spectral analysis and an immunological tool, rCq-IGFBP was shown to bind the Cq-IAG prohormone. Furthermore, a peptide corresponding to residues 23–38 of the Cq-IAG A-chain was found sufficient for in vitro recognition by rCq-IGFBP. Cq-IGFBP is the first IGFBP family member shown to specifically interact with a gender-specific ILP. Unlike their ILP ligands, IGFBPs are highly conserved across evolution, from ancient arthropods, like crustaceans, to humans. Such conservation places ILP signaling at the center of sex-related phenomena in early animal development. PMID:23775079
Cyclophilin B binding to platelets supports calcium-dependent adhesion to collagen.
Allain, F; Durieux, S; Denys, A; Carpentier, M; Spik, G
1999-08-01
We have recently reported that cyclophilin B (CyPB), a secreted cyclosporine-binding protein, could bind to T lymphocytes through interactions with two types of binding sites. The first ones, referred to as type I, involve interactions with the conserved domain of CyPB and promote the endocytosis of surface-bound ligand, while the second type of binding sites, termed type II, are represented by glycosaminoglycans (GAG). Here, we further investigated the interactions of CyPB with blood cell populations. In addition to lymphocytes, CyPB was found to interact mainly with platelets. The binding is specific, with a dissociation constant (kd) of 9 +/- 3 nmol/L and the number of sites estimated at 960 +/- 60 per cell. Platelet glycosaminoglycans are not required for the interactions, but the binding is dramatically reduced by active cyclosporine derivatives. We then analyzed the biologic effects of CyPB and found a significant increase in platelet adhesion to collagen. Concurrently, CyPB initiates a transmembranous influx of Ca(2+) and induces the phosphorylation of the P-20 light chains of myosin. Taken together, the present results demonstrate for the first time that extracellular CyPB specifically interacts with platelets through a functional receptor related to the lymphocyte type I binding sites and might act by regulating the activity of a receptor-operated membrane Ca(2+) channel.
Heparin octasaccharide decoy liposomes inhibit replication of multiple viruses
Hendricks, Gabriel L.; Velazquez, Lourdes; Pham, Serena; Qaisar, Natasha; Delaney, James C.; Viswanathan, Karthik; Albers, Leila; Comolli, James C.; Shriver, Zachary; Knipe, David M.; Kurt-Jones, Evelyn A.; Fygenson, Deborah K.; Trevejo, Jose M.
2016-01-01
Heparan sulfate (HS) is a ubiquitous glycosaminoglycan that serves as a cellular attachment site for a number of significant human pathogens, including respiratory syncytial virus (RSV), human parainfluenza virus 3 (hPIV3), and herpes simplex virus (HSV). Decoy receptors can target pathogens by binding to the receptor pocket on viral attachment proteins, acting as ‘molecular sinks’ and preventing the pathogen from binding to susceptible host cells. Decoy receptors functionalized with HS could bind to pathogens and prevent infection, so we generated decoy liposomes displaying HS-octasaccharide (HS-octa). These decoy liposomes significantly inhibited RSV, hPIV3, and HSV infectivity in vitro to a greater degree than the original HS-octa building block. The degree of inhibition correlated with the density of HS-octa displayed on the liposome surface. Decoy liposomes with HS-octa inhibited infection of viruses to a greater extent than either full-length heparin or HS-octa alone. Decoy liposomes were effective when added prior to infection or following the initial infection of cells in vitro. By targeting the well-conserved receptor-binding sites of HS-binding viruses, decoy liposomes functionalized with HS-octa are a promising therapeutic antiviral agent and illustrate the utility of the liposome delivery platform. PMID:25637710
Chen, Jianzhong; Yang, Maoyou; Hu, Guodong; Shi, Shuhua; Yi, Changhong; Zhang, Qinggang
2009-10-01
The molecular mechanics Poisson-Boltzmann surface area (MM-PBSA) method combined with molecular dynamics (MD) simulations were used to investigate the functional role of protonation in human immunodeficiency virus type 1 (HIV-1) protease complexed with the inhibitor BEA369. Our results demonstrate that protonation of two aspartic acids (Asp25/Asp25') has a strong influence on the dynamics behavior of the complex, the binding free energy of BEA369, and inhibitor-residue interactions. Relative binding free energies calculated using the MM-PBSA method show that protonation of Asp25 results in the strongest binding of BEA369 to HIV-1 protease. Inhibitor-residue interactions computed by the theory of free energy decomposition also indicate that protonation of Asp25 has the most favorable effect on binding of BEA369. In addition, hydrogen-bond analysis based on the trajectories of the MD simulations shows that protonation of Asp25 strongly influences the water-mediated link of a conserved water molecule, Wat301. We expect that the results of this study will contribute significantly to binding calculations for BEA369, and to the design of high affinity inhibitors.
Keck, P C; Huston, J S
1996-01-01
Molecular modeling studies on antibody Fv regions have been pursued to design a second antigen-binding site (chi-site) in a chimeric single-chain Fv (chi sFv) species of about 30 kDa. This analysis has uncovered an architectural basis common to many Fv regions that permits grafting a chi-site onto the Fv surface that diametrically opposes the normal combining site. By using molecular graphics analysis, chimeric complementarity-determining regions (chi CDRs) were defined that comprised most of the CDRs from an antibody binding site of interest. The chain directionality of chi CDRs was consistent with that of specific bottom loops of the sFv, which allowed for grafting of chi CDRs with an overall geometry approximating CDRs in the parent combining site. Analysis of 10 different Fv crystal structures indicates that the positions for inserting chi CDRs are very highly conserved, as are the corresponding chi CDR boundaries in the parent binding site. The results of this investigation suggest that it should be possible to generally apply this approach to the development of chimeric bispecific antibody binding site (chi BABS) proteins. Images FIGURE 2 FIGURE 3 PMID:8889174
Duda, David M.; van Waardenburg, Robert C. A. M.; Borg, Laura A.; McGarity, Sierra; Nourse, Amanda; Waddell, M. Brett; Bjornsti, Mary-Ann; Schulman, Brenda A.
2007-01-01
Summary The SUMO ubiquitin-like proteins play regulatory roles in cell division, transcription, DNA repair, and protein subcellular localization. Paralleling other ubiquitin-like proteins, SUMO proteins are proteolytically processed to maturity, conjugated to targets by E1-E2-E3 cascades, and subsequently recognized by specific downstream effectors containing a SUMO-binding motif (SBM). SUMO and its E2 from the budding yeast S. cerevisiae, Smt3p and Ubc9p, are encoded by essential genes. Here we describe the 1.9 Å resolution crystal structure of a noncovalent Smt3p–Ubc9p complex. Unexpectedly, a heterologous portion of the crystallized complex derived from the expression construct mimics an SBM, and binds Smt3p in a manner resembling SBM binding to human SUMO family members. In the complex, Smt3p binds a surface distal from Ubc9's catalytic cysteine. The structure implies that a single molecule of Smt3p cannot bind concurrently to both the noncovalent binding site and the catalytic cysteine of a single Ubc9p molecule. However, formation of higher-order complexes can occur, where a single Smt3p covalently linked to one Ubc9p's catalytic cysteine also binds noncovalently to another molecule of Ubc9p. Comparison with other structures from the SUMO pathway suggests that formation of the noncovalent Smt3p–Ubc9p complex occurs mutually exclusively with many other Smt3p and Ubc9p interactions in the conjugation cascade. By contrast, high-resolution insights into how Smt3p–Ubc9p can also interact with downstream recognition machineries come from contacts with the SBM mimic. Interestingly, the overall architecture of the Smt3p–Ubc9p complex is strikingly similar to recent structures from the ubiquitin pathway. The results imply that noncovalent ubiquitin-like protein–E2 complexes are conserved platforms, which function as parts of larger assemblies involved many protein post-translational regulatory pathways. PMID:17475278
Gupta, Kapil; Watson, Aleksandra A; Baptista, Tiago; Scheer, Elisabeth; Chambers, Anna L; Koehler, Christine; Zou, Juan; Obong-Ebong, Ima; Kandiah, Eaazhisai; Temblador, Arturo; Round, Adam; Forest, Eric; Man, Petr; Bieniossek, Christoph; Laue, Ernest D; Lemke, Edward A; Rappsilber, Juri; Robinson, Carol V; Devys, Didier
2017-01-01
General transcription factor TFIID is a key component of RNA polymerase II transcription initiation. Human TFIID is a megadalton-sized complex comprising TATA-binding protein (TBP) and 13 TBP-associated factors (TAFs). TBP binds to core promoter DNA, recognizing the TATA-box. We identified a ternary complex formed by TBP and the histone fold (HF) domain-containing TFIID subunits TAF11 and TAF13. We demonstrate that TAF11/TAF13 competes for TBP binding with TATA-box DNA, and also with the N-terminal domain of TAF1 previously implicated in TATA-box mimicry. In an integrative approach combining crystal coordinates, biochemical analyses and data from cross-linking mass-spectrometry (CLMS), we determine the architecture of the TAF11/TAF13/TBP complex, revealing TAF11/TAF13 interaction with the DNA binding surface of TBP. We identify a highly conserved C-terminal TBP-interaction domain (CTID) in TAF13, which is essential for supporting cell growth. Our results thus have implications for cellular TFIID assembly and suggest a novel regulatory state for TFIID function. PMID:29111974
Kwong, Peter D.; Wyatt, Richard; Robinson, James; Sweet, Raymond W.; Sodroski, Joseph; Hendrickson, Wayne A.
2017-01-01
The entry of human immunodeficiency virus (HIV) into cells requires the sequential interaction of the viral exterior envelope glycoprotein, gp120, with the CD4 glycoprotein and a chemokine receptor on the cell surface. These interactions initiate a fusion of the viral and cellular membranes. Although gpl20 can elicit virus-neutralizing antibodies, HIV eludes the immune system. We have solved the X-ray crystal structure at 2.5 Å resolution of an HIV-1 gp120 core complexed with a two-domain fragment of human CD4 and an antigen-binding fragment of a neutralizing antibody that blocks chemokine-receptor binding. The structure reveals a cavity-laden CD4-gp120 interface, a conserved binding site for the chemokine receptor, evidence for a conformational change upon CD4 binding, the nature of a CD4-induced antibody epitope, and specific mechanisms for immune evasion. Our results provide a framework for understanding the complex biology of HIV entry into cells and should guide efforts to intervene. PMID:9641677
Determinants of BH3 Binding Specificity for Mcl-1 versus Bcl-x[subscript L
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dutta, Sanjib; Gullá, Stefano; Chen, T. Scott
2010-06-25
Interactions among Bcl-2 family proteins are important for regulating apoptosis. Prosurvival members of the family interact with proapoptotic BH3 (Bcl-2-homology-3)-only members, inhibiting execution of cell death through the mitochondrial pathway. Structurally, this interaction is mediated by binding of the {alpha}-helical BH3 region of the proapoptotic proteins to a conserved hydrophobic groove on the prosurvival proteins. Native BH3-only proteins exhibit selectivity in binding prosurvival members, as do small molecules that block these interactions. Understanding the sequence and structural basis of interaction specificity in this family is important, as it may allow the prediction of new Bcl-2 family associations and/or the designmore » of new classes of selective inhibitors to serve as reagents or therapeutics. In this work, we used two complementary techniques - yeast surface display screening from combinatorial peptide libraries and SPOT peptide array analysis - to elucidate specificity determinants for binding to Bcl-x{sub L} versus Mcl-1, two prominent prosurvival proteins. We screened a randomized library and identified BH3 peptides that bound to either Mcl-1 or Bcl-x{sub L} selectively or to both with high affinity. The peptides competed with native ligands for binding into the conserved hydrophobic groove, as illustrated in detail by a crystal structure of a specific peptide bound to Mcl-1. Mcl-1-selective peptides from the screen were highly specific for binding Mcl-1 in preference to Bcl-x{sub L}, Bcl-2, Bcl-w, and Bfl-1, whereas Bcl-x{sub L}-selective peptides showed some cross-interaction with related proteins Bcl-2 and Bcl-w. Mutational analyses using SPOT arrays revealed the effects of 170 point mutations made in the background of a peptide derived from the BH3 region of Bim, and a simple predictive model constructed using these data explained much of the specificity observed in our Mcl-1 versus Bcl-x{sub L} binders.« less
Determinants of BH3 binding specificity for Mcl-1 vs. Bcl-xL
Dutta, Sanjib; Gullá, Stefano; Chen, T. Scott; Fire, Emiko; Grant, Robert A.; Keating, Amy E.
2010-01-01
Interactions among Bcl-2 family proteins are important for regulating apoptosis. Pro-survival members of the family interact with pro-apoptotic BH3-only members, inhibiting execution of cell death through the mitochondrial pathway. Structurally, this interaction is mediated by binding of the alpha-helical BH3 region of the pro-apoptotic proteins to a conserved hydrophobic groove on the pro-survival proteins. Native BH3-only proteins exhibit selectivity in binding pro-survival members, as do small molecules that block these interactions. Understanding the sequence and structural basis of interaction specificity in this family is important, as it may allow the prediction of new Bcl-2 family associations and/or the design of new classes of selective inhibitors to serve as reagents or therapeutics. In this work we used two complementary techniques, yeast surface display screening from combinatorial peptide libraries and SPOT peptide array analysis, to elucidate specificity determinants for binding to Bcl-xL vs. Mcl-1, two prominent pro-survival proteins. We screened a randomized library and identified BH3 peptides that bound to either Mcl-1 or Bcl-xL selectively, or to both with high affinity. The peptides competed with native ligands for binding into the conserved hydrophobic groove, as illustrated in detail by a crystal structure of a specific peptide bound to Mcl-1. Mcl-1 selective peptides from the screen were highly specific for binding Mcl-1 in preference to Bcl-xL, Bcl-2, Bcl-w and Bfl-1, whereas Bcl-xL selective peptides showed some cross-interaction with related proteins Bcl-2 and Bcl-w. Mutational analyses using SPOT arrays revealed the effects of 170 point mutations made in the background of a peptide derived from the BH3 region of Bim, and a simple predictive model constructed using these data explained much of the specificity observed in our Mcl-1 vs. Bcl-xL binders. PMID:20363230
Identification of functional domains in Arabidopsis thaliana mRNA decapping enzyme (AtDcp2)
Gunawardana, Dilantha; Cheng, Heung-Chin; Gayler, Kenwyn R.
2008-01-01
The Arabidopsis thaliana decapping enzyme (AtDcp2) was characterized by bioinformatics analysis and by biochemical studies of the enzyme and mutants produced by recombinant expression. Three functionally significant regions were detected: (i) a highly disordered C-terminal region with a putative PSD-95, Discs-large, ZO-1 (PDZ) domain-binding motif, (ii) a conserved Nudix box constituting the putative active site and (iii) a putative RNA binding domain consisting of the conserved Box B and a preceding loop region. Mutation of the putative PDZ domain-binding motif improved the stability of recombinant AtDcp2 and secondary mutants expressed in Escherichia coli. Such recombinant AtDcp2 specifically hydrolysed capped mRNA to produce 7-methyl GDP and decapped RNA. AtDcp2 activity was Mn2+- or Mg2+-dependent and was inhibited by the product 7-methyl GDP. Mutation of the conserved glutamate-154 and glutamate-158 in the Nudix box reduced AtDcp2 activity up to 400-fold and showed that AtDcp2 employs the catalytic mechanism conserved amongst Nudix hydrolases. Unlike many Nudix hydrolases, AtDcp2 is refractory to inhibition by fluoride ions. Decapping was dependent on binding to the mRNA moiety rather than to the 7-methyl diguanosine triphosphate cap of the substrate. Mutational analysis of the putative RNA-binding domain confirmed the functional significance of an 11-residue loop region and the conserved Box B. PMID:18025047
The hypothetical protein Atu4866 from Agrobacterium tumefaciens adopts a streptavidin-like fold
Ai, Xuanjun; Semesi, Anthony; Yee, Adelinda; Arrowsmith, Cheryl H.; Choy, Wing-Yiu; Li, Shawn S.C.
2008-01-01
Atu4866 is a 79-residue conserved hypothetical protein of unknown function from Agrobacterium tumefaciens. Protein sequence alignments show that it shares ≥60% sequence identity with 20 other hypothetical proteins of bacterial origin. However, the structures and functions of these proteins remain unknown so far. To gain insight into the function of this family of proteins, we have determined the structure of Atu4866 as a target of a structural genomics project using solution NMR spectroscopy. Our results reveal that Atu4866 adopts a streptavidin-like fold featuring a β-barrel/sandwich formed by eight antiparallel β-strands. Further structural analysis identified a continuous patch of conserved residues on the surface of Atu4866 that may constitute a potential ligand-binding site. PMID:18042676
Tung, Ying-Tsen; Hsu, Wen-Ming; Lee, Hsinyu; Huang, Wei-Pang; Liao, Yung-Feng
2010-07-01
Mammalian p62/sequestosome-1 protein binds to both LC3, the mammalian homologue of yeast Atg8, and polyubiquitinated cargo proteins destined to undergo autophagy-mediated degradation. We previously identified a cargo receptor-binding domain in Atg8 that is essential for its interaction with the cargo receptor Atg19 in selective autophagic processes in yeast. We, thus, sought to determine whether this interaction is evolutionally conserved from yeast to mammals. Using an amino acid replacement approach, we demonstrate that cells expressing mutant LC3 (LC3-K30D, LC3-K51A, or LC3-L53A) all exhibit defective lipidation of LC3, a disrupted LC3-p62 interaction, and impaired autophagic degradation of p62, suggesting that the p62-binding site of LC3 is localized within an evolutionarily conserved domain. Importantly, whereas cells expressing these LC3 mutants exhibited similar overall autophagic activity comparable to that of cells expressing wild-type LC3, autophagy-mediated clearance of the aggregation-prone mutant Huntingtin was defective in the mutant-expressing cells. Together, these results suggest that p62 directly binds to the evolutionarily conserved cargo receptor-binding domain of Atg8/LC3 and selectively mediates the clearance of mutant Huntingtin.
Role of conserved cysteine residues in Herbaspirillum seropedicae NifA activity.
Oliveira, Marco A S; Baura, Valter A; Aquino, Bruno; Huergo, Luciano F; Kadowaki, Marco A S; Chubatsu, Leda S; Souza, Emanuel M; Dixon, Ray; Pedrosa, Fábio O; Wassem, Roseli; Monteiro, Rose A
2009-01-01
Herbaspirillum seropedicae is an endophytic diazotrophic bacterium that associates with economically important crops. NifA protein, the transcriptional activator of nif genes in H. seropedicae, binds to nif promoters and, together with RNA polymerase-sigma(54) holoenzyme, catalyzes the formation of open complexes to allow transcription initiation. The activity of H. seropedicae NifA is controlled by ammonium and oxygen levels, but the mechanisms of such control are unknown. Oxygen sensitivity is attributed to a conserved motif of cysteine residues in NifA that spans the central AAA+ domain and the interdomain linker that connects the AAA+ domain to the C-terminal DNA binding domain. Here we mutagenized this conserved motif of cysteines and assayed the activity of mutant proteins in vivo. We also purified the mutant variants of NifA and tested their capacity to bind to the nifB promoter region. Chimeric proteins between H. seropedicae NifA, an oxygen-sensitive protein, and Azotobacter vinelandii NifA, an oxygen-tolerant protein, were constructed and showed that the oxygen response is conferred by the central AAA+ and C-terminal DNA binding domains of H. seropedicae NifA. We conclude that the conserved cysteine motif is essential for NifA activity, although single cysteine-to-serine mutants are still competent at binding DNA.
Alternative C-Terminal Helix Orientation Alters Chemokine Function
Kuo, Je-Hung; Chen, Ya-Ping; Liu, Jai-Shin; Dubrac, Alexandre; Quemener, Cathy; Prats, Hervé; Bikfalvi, Andreas; Wu, Wen-guey; Sue, Shih-Che
2013-01-01
Chemokines, a subfamily of cytokines, are small, secreted proteins that mediate a variety of biological processes. Various chemokines adopt remarkable conserved tertiary structure comprising an anti-parallel β-sheet core domain followed by a C-terminal helix that packs onto the β-sheet. The conserved structural feature has been considered critical for chemokine function, including binding to cell surface receptor. The recently isolated variant, CXCL4L1, is a homologue of CXCL4 chemokine (or platelet factor 4) with potent anti-angiogenic activity and differed only in three amino acid residues of P58L, K66E, and L67H. In this study we show by x-ray structural determination that CXCL4L1 adopts a previously unrecognized structure at its C terminus. The orientation of the C-terminal helix protrudes into the aqueous space to expose the entire helix. The alternative helix orientation modifies the overall chemokine shape and surface properties. The L67H mutation is mainly responsible for the swing-out effect of the helix, whereas mutations of P58L and K66E only act secondarily. This is the first observation that reports an open conformation of the C-terminal helix in a chemokine. This change leads to a decrease of its glycosaminoglycan binding properties and to an enhancement of its anti-angiogenic and anti-tumor effects. This unique structure is recent in evolution and has allowed CXCL4L1 to gain novel functional properties. PMID:23536183
Nandy, Suman Kumar; Seal, Alpana
2016-01-01
Cystatin superfamily is a large group of evolutionarily related proteins involved in numerous physiological activities through their inhibitory activity towards cysteine proteases. Despite sharing the same cystatin fold, and inhibiting cysteine proteases through the same tripartite edge involving highly conserved N-terminal region, L1 and L2 loop; cystatins differ widely in their inhibitory affinity towards C1 family of cysteine proteases and molecular details of these interactions are still elusive. In this study, inhibitory interactions of human family 1 & 2 cystatins with cathepsin L1 are predicted and their stability and viability are verified through protein docking & comparative molecular dynamics. An overall stabilization effect is observed in all cystatins on complex formation. Complexes are mostly dominated by van der Waals interaction but the relative participation of the conserved regions varied extensively. While van der Waals contacts prevail in L1 and L2 loop, N-terminal segment chiefly acts as electrostatic interaction site. In fact the comparative dynamics study points towards the instrumental role of L1 loop in directing the total interaction profile of the complex either towards electrostatic or van der Waals contacts. The key amino acid residues surfaced via interaction energy, hydrogen bonding and solvent accessible surface area analysis for each cystatin-cathepsin L1 complex influence the mode of binding and thus control the diverse inhibitory affinity of cystatins towards cysteine proteases. PMID:27764212
Baumstummler, A; Lehmann, D; Janjic, N; Ochsner, U A
2014-10-01
Slow off-rate modified aptamer (SOMAmer) reagents were generated to several Staphylococcus aureus cell surface-associated proteins via SELEX with multiple modified DNA libraries using purified recombinant or native proteins. High-affinity binding agents with sub-nanomolar Kd 's were obtained for staphylococcal protein A (SpA), clumping factors (ClfA, ClfB), fibronectin-binding proteins (FnbA, FnbB) and iron-regulated surface determinants (Isd). Further screening revealed several SOMAmers that specifically bound to Staph. aureus cells from all strains that were tested, but not to other staphylococci or other bacteria. SpA and ClfA SOMAmers proved useful for the selective capture and enrichment of Staph. aureus cells, as shown by culture and PCR, leading to improved limits of detection and efficient removal of PCR inhibitors. Detection of Staph. aureus cells was enhanced by several orders of magnitude when the bacterial cell surface was coated with SOMAmers followed by qPCR of the SOMAmers. Furthermore, fluorescence-labelled SpA SOMAmers demonstrated their utility as direct detection agents in flow cytometry. Significance and impact of the study: Monitoring for microbial contamination of food, water, nonsterile products or the environment is typically based on culture, PCR or antibodies. Aptamers that bind with high specificity and affinity to well-conserved cell surface epitopes represent a promising novel type of reagents to detect bacterial cells without the need for culture or cell lysis, including for the capture and enrichment of bacteria present at low cell densities and for the direct detection via qPCR or fluorescent staining. © 2014 Soma Logic, Inc. published by John Wiley & Sons Ltd On behalf of the society for Applied Microbiology.
Ogawa, Haruo; Qiu, Yue; Philo, John S; Arakawa, Tsutomu; Ogata, Craig M; Misono, Kunio S
2010-03-01
The binding of atrial natriuretic peptide (ANP) to its receptor requires chloride, and it is chloride concentration dependent. The extracellular domain (ECD) of the ANP receptor (ANPR) contains a chloride near the ANP-binding site, suggesting a possible regulatory role. The bound chloride, however, is completely buried in the polypeptide fold, and its functional role has remained unclear. Here, we have confirmed that chloride is necessary for ANP binding to the recombinant ECD or the full-length ANPR expressed in CHO cells. ECD without chloride (ECD(-)) did not bind ANP. Its binding activity was fully restored by bromide or chloride addition. A new X-ray structure of the bromide-bound ECD is essentially identical to that of the chloride-bound ECD. Furthermore, bromide atoms are localized at the same positions as chloride atoms both in the apo and in the ANP-bound structures, indicating exchangeable and reversible halide binding. Far-UV CD and thermal unfolding data show that ECD(-) largely retains the native structure. Sedimentation equilibrium in the absence of chloride shows that ECD(-) forms a strongly associated dimer, possibly preventing the structural rearrangement of the two monomers that is necessary for ANP binding. The primary and tertiary structures of the chloride-binding site in ANPR are highly conserved among receptor-guanylate cyclases and metabotropic glutamate receptors. The chloride-dependent ANP binding, reversible chloride binding, and the highly conserved chloride-binding site motif suggest a regulatory role for the receptor bound chloride. Chloride-dependent regulation of ANPR may operate in the kidney, modulating ANP-induced natriuresis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ogawa, H.; Qiu, Y; Philo, J
2010-01-01
The binding of atrial natriuretic peptide (ANP) to its receptor requires chloride, and it is chloride concentration dependent. The extracellular domain (ECD) of the ANP receptor (ANPR) contains a chloride near the ANP-binding site, suggesting a possible regulatory role. The bound chloride, however, is completely buried in the polypeptide fold, and its functional role has remained unclear. Here, we have confirmed that chloride is necessary for ANP binding to the recombinant ECD or the full-length ANPR expressed in CHO cells. ECD without chloride (ECD(-)) did not bind ANP. Its binding activity was fully restored by bromide or chloride addition. Amore » new X-ray structure of the bromide-bound ECD is essentially identical to that of the chloride-bound ECD. Furthermore, bromide atoms are localized at the same positions as chloride atoms both in the apo and in the ANP-bound structures, indicating exchangeable and reversible halide binding. Far-UV CD and thermal unfolding data show that ECD(-) largely retains the native structure. Sedimentation equilibrium in the absence of chloride shows that ECD(-) forms a strongly associated dimer, possibly preventing the structural rearrangement of the two monomers that is necessary for ANP binding. The primary and tertiary structures of the chloride-binding site in ANPR are highly conserved among receptor-guanylate cyclases and metabotropic glutamate receptors. The chloride-dependent ANP binding, reversible chloride binding, and the highly conserved chloride-binding site motif suggest a regulatory role for the receptor bound chloride. Chloride-dependent regulation of ANPR may operate in the kidney, modulating ANP-induced natriuresis.« less
Ogawa, Haruo; Qiu, Yue; Philo, John S; Arakawa, Tsutomu; Ogata, Craig M; Misono, Kunio S
2010-01-01
The binding of atrial natriuretic peptide (ANP) to its receptor requires chloride, and it is chloride concentration dependent. The extracellular domain (ECD) of the ANP receptor (ANPR) contains a chloride near the ANP-binding site, suggesting a possible regulatory role. The bound chloride, however, is completely buried in the polypeptide fold, and its functional role has remained unclear. Here, we have confirmed that chloride is necessary for ANP binding to the recombinant ECD or the full-length ANPR expressed in CHO cells. ECD without chloride (ECD(−)) did not bind ANP. Its binding activity was fully restored by bromide or chloride addition. A new X-ray structure of the bromide-bound ECD is essentially identical to that of the chloride-bound ECD. Furthermore, bromide atoms are localized at the same positions as chloride atoms both in the apo and in the ANP-bound structures, indicating exchangeable and reversible halide binding. Far-UV CD and thermal unfolding data show that ECD(−) largely retains the native structure. Sedimentation equilibrium in the absence of chloride shows that ECD(−) forms a strongly associated dimer, possibly preventing the structural rearrangement of the two monomers that is necessary for ANP binding. The primary and tertiary structures of the chloride-binding site in ANPR are highly conserved among receptor-guanylate cyclases and metabotropic glutamate receptors. The chloride-dependent ANP binding, reversible chloride binding, and the highly conserved chloride-binding site motif suggest a regulatory role for the receptor bound chloride. Chloride-dependent regulation of ANPR may operate in the kidney, modulating ANP-induced natriuresis. PMID:20066666
Avilés-Reyes, A.; Miller, J.H.; Simpson-Haidaris, P.J.; Lemos, J.A.; Abranches, J.
2014-01-01
SUMMARY Cnm, a collagen- and laminin-binding protein present in a subset of Streptococcus mutans strains, mediates binding to extracellular matrices (ECM), intracellular invasion and virulence in the Galleria mellonella model. Antibodies raised against Cnm were used to confirm expression and the cell surface localization of Cnm in the highly invasive OMZ175 strain. Sequence analysis identified two additional genes (cnaB and cbpA) encoding putative surface proteins immediately upstream of cnm. Inactivation of cnaB and cbpA in OMZ175, individually or in combination, did not decrease the ability of this highly invasive and virulent strain to bind to different ECM proteins, invade human coronary artery endothelial cells (HCAEC), or kill G. mellonella. Similarly, expression of cnaB and cbpA in the cnm− strain UA159 revealed that these genes did not enhance Cnmrelated phenotypes. However, integration of cnm in the chromosome of UA159 significantly increased its ability to bind to collagen and laminin, invade HCAEC, and kill G. mellonella. Moreover, the presence of antibodies against Cnm nearly abolished the ability of OMZ175 to bind to collagen and laminin and invade HCAEC, and significantly protected G. mellonella against OMZ175 infection. We concluded that neither CnaB nor CbpA is necessary for the expression of Cnm-related traits. We also provided definitive evidence that Cnm is an important virulence factor and a suitable target for the development of novel preventive and therapeutic strategies to combat invasive S. mutans strains. PMID:24103776
Diehl, Adam G
2018-01-01
Abstract The mouse is widely used as system to study human genetic mechanisms. However, extensive rewiring of transcriptional regulatory networks often confounds translation of findings between human and mouse. Site-specific gain and loss of individual transcription factor binding sites (TFBS) has caused functional divergence of orthologous regulatory loci, and so we must look beyond this positional conservation to understand common themes of regulatory control. Fortunately, transcription factor co-binding patterns shared across species often perform conserved regulatory functions. These can be compared to ‘regulatory sentences’ that retain the same meanings regardless of sequence and species context. By analyzing TFBS co-occupancy patterns observed in four human and mouse cell types, we learned a regulatory grammar: the rules by which TFBS are combined into meaningful regulatory sentences. Different parts of this grammar associate with specific sets of functional annotations regardless of sequence conservation and predict functional signatures more accurately than positional conservation. We further show that both species-specific and conserved portions of this grammar are involved in gene expression divergence and human disease risk. These findings expand our understanding of transcriptional regulatory mechanisms, suggesting that phenotypic divergence and disease risk are driven by a complex interplay between deeply conserved and species-specific transcriptional regulatory pathways. PMID:29361190
Structural basis for the antibody neutralization of Herpes simplex virus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Cheng-Chung; Lin, Li-Ling; Academia Sinica, Taipei 115, Taiwan
2013-10-01
The gD–E317-Fab complex crystal revealed the conformational epitope of human mAb E317 on HSV gD, providing a molecular basis for understanding the viral neutralization mechanism. Glycoprotein D (gD) of Herpes simplex virus (HSV) binds to a host cell surface receptor, which is required to trigger membrane fusion for virion entry into the host cell. gD has become a validated anti-HSV target for therapeutic antibody development. The highly inhibitory human monoclonal antibody E317 (mAb E317) was previously raised against HSV gD for viral neutralization. To understand the structural basis of antibody neutralization, crystals of the gD ectodomain bound to the E317more » Fab domain were obtained. The structure of the complex reveals that E317 interacts with gD mainly through the heavy chain, which covers a large area for epitope recognition on gD, with a flexible N-terminal and C-terminal conformation. The epitope core structure maps to the external surface of gD, corresponding to the binding sites of two receptors, herpesvirus entry mediator (HVEM) and nectin-1, which mediate HSV infection. E317 directly recognizes the gD–nectin-1 interface and occludes the HVEM contact site of gD to block its binding to either receptor. The binding of E317 to gD also prohibits the formation of the N-terminal hairpin of gD for HVEM recognition. The major E317-binding site on gD overlaps with either the nectin-1-binding residues or the neutralizing antigenic sites identified thus far (Tyr38, Asp215, Arg222 and Phe223). The epitopes of gD for E317 binding are highly conserved between two types of human herpesvirus (HSV-1 and HSV-2). This study enables the virus-neutralizing epitopes to be correlated with the receptor-binding regions. The results further strengthen the previously demonstrated therapeutic and diagnostic potential of the E317 antibody.« less
No significant regulation of bicoid mRNA by Pumilio or Nanos in the early Drosophila embryo.
Wharton, Tammy H; Nomie, Krystle J; Wharton, Robin P
2018-01-01
Drosophila Pumilio (Pum) is a founding member of the conserved Puf domain class of RNA-binding translational regulators. Pum binds with high specificity, contacting eight nucleotides, one with each of the repeats in its RNA-binding domain. In general, Pum is thought to block translation in collaboration with Nanos (Nos), which exhibits no binding specificity in isolation but is recruited jointly to regulatory sequences containing a Pum binding site in the 3'-UTRs of target mRNAs. Unlike Pum, which is ubiquitous in the early embryo, Nos is tightly restricted to the posterior, ensuring that repression of its best-characterized target, maternal hunchback (hb) mRNA, takes place exclusively in the posterior. An exceptional case of Nos-independent regulation by Pum has been described-repression of maternal bicoid (bcd) mRNA at the anterior pole of the early embryo, dependent on both Pum and conserved Pum binding sites in the 3'-UTR of the mRNA. We have re-investigated regulation of bcd in the early embryo; our experiments reveal no evidence of a role for Pum or its conserved binding sites in regulation of the perdurance of bcd mRNA or protein. Instead, we find that Pum and Nos control the accumulation of bcd mRNA in testes.
The Prp19 WD40 Domain Contains a Conserved Protein Interaction Region Essential for its Function
Vander Kooi, Craig W.; Ren, Liping; Xu, Ping; Ohi, Melanie D.; Gould, Kathleen L.; Chazin, Walter J.
2010-01-01
Summary Prp19 is a member of the WD40-repeat family of E3 ubiquitin ligases and a conserved eukaryotic RNA splicing factor essential for activation and stabilization of the spliceosome. To understand the role of the WD40 repeat domain of Prp19 we have determined its structure using X-ray crystallography. The domain has a distorted seven bladed WD40 architecture with significant asymmetry due to irregular packing of blades one and seven into the core of the WD40 domain. Structure-based mutagenesis identified a highly conserved surface centered around blade five that is required for the physical interaction between Prp19 and Cwc2, another essential splicing factor. This region is found to be required for Prp19 function and yeast viability. Experiments in vitro and in vivo demonstrate that two molecules of Cwc2 bind to the Prp19 tetramer. These coupled structural and functional studies provide a model for the functional architecture of Prp19. PMID:20462492
Baines, Anthony J
2003-01-01
The spectrin superfamily (spectrin, alpha-actinin, utrophin and dystrophin) has in common a triple helical repeating unit of ~106 amino acid residues. In spectrin, alpha and beta chains contain multiple copies of this repeat. beta-spectrin chains contain the majority of binding activities in spectrin and are essential for animal life. Canonical beta-spectrins have 17 repeats; beta-heavy spectrins have 30. Here, the repeats of five human beta-spectrins, plus beta-spectrins from several other vertebrates and invertebrates, have been analysed. Repeats 1, 2, 14 and 17 in canonical beta are highly conserved between invertebrates and vertebrates, and repeat 8 in some isoforms. This is consistent with conservation of critical functions, since repeats 1, 2 and 17 bind alpha-spectrin. Repeats 1 of beta-spectrins are not always detected by SMART or Pfam tools. A profile hidden Markov model of beta-spectrin repeat 1 detects alpha-actinins, but not utrophin or dystrophin. Novel examples of repeat 1 were detected in the spectraplakins MACF1, BPAG1 and plectin close to the actin-binding domain. Ankyrin binds to the C-terminal portion of repeat 14; the high conservation of this entire repeat may point to additional, undiscovered ligand-binding activities. This analysis indicates that the basic triple helical repeat pattern was adapted early in the evolution of the spectrin superfamily to encompass essential binding activities, which characterise individual repeats in proteins extant today.
Ostberg, Karen L.; DeRocco, Amanda J.; Mistry, Shreni D.; Dickinson, Mary Kathryne
2013-01-01
The transferrin-binding proteins TbpA and TbpB enable Neisseria gonorrhoeae to obtain iron from human transferrin. The lipoprotein TbpB facilitates, but is not strictly required for, TbpA-mediated iron acquisition. The goal of the current study was to determine the contribution of two conserved regions within TbpB to the function of this protein. Using site-directed mutagenesis, the first mutation we constructed replaced the lipobox (LSAC) of TbpB with a signal I peptidase cleavage site (LAAA), while the second mutation deleted a conserved stretch of glycine residues immediately downstream of the lipobox. We then evaluated the resulting mutants for effects on TbpB expression, surface exposure, and transferrin iron utilization. Western blot analysis and palmitate labeling indicated that the lipobox, but not the glycine-rich motif, is required for lipidation of TbpB and tethering to the outer membrane. TbpB was released into the supernatant by the mutant that produces TbpB LSAC. Neither mutation disrupted the transport of TbpB across the bacterial cell envelope. When these mutant TbpB proteins were produced in a strain expressing a form of TbpA that requires TbpB for iron acquisition, growth on transferrin was either abrogated or dramatically diminished. We conclude that surface tethering of TbpB is required for optimal performance of the transferrin iron acquisition system, while the presence of the polyglycine stretch near the amino terminus of TbpB contributes significantly to transferrin iron transport function. Overall, these results provide important insights into the functional roles of two conserved motifs of TbpB, enhancing our understanding of this critical iron uptake system. PMID:23836816
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zalewski, Jenna K.; Mo, Joshua H.; Heber, Simone
Shroom-mediated remodeling of the actomyosin cytoskeleton is a critical driver of cellular shape and tissue morphology that underlies the development of many tissues including the neural tube, eye, intestines, and vasculature. Shroom uses a conserved SD2 domain to direct the subcellular localization of Rho-associated kinase (Rock), which in turn drives changes in the cytoskeleton and cellular morphology through its ability to phosphorylate and activate non-muscle myosin II. Here in this paper, we present the structure of the human Shroom-Rock binding module, revealing an unexpected stoichiometry for Shroom in which two Shroom SD2 domains bind independent surfaces on Rock. Mutation ofmore » interfacial residues impaired Shroom-Rock binding in vitro and resulted in altered remodeling of the cytoskeleton and loss of Shroom-mediated changes in cellular morphology. In addition, we provide the first direct evidence that Shroom can function as a Rock activator. These data provide molecular insight into the Shroom-Rock interface and demonstrate that Shroom directly participates in regulating cytoskeletal dynamics, adding to its known role in Rock localization.« less
Structure and Self-Assembly of the Calcium Binding Matrix Protein of Human Metapneumovirus
Leyrat, Cedric; Renner, Max; Harlos, Karl; Huiskonen, Juha T.; Grimes, Jonathan M.
2014-01-01
Summary The matrix protein (M) of paramyxoviruses plays a key role in determining virion morphology by directing viral assembly and budding. Here, we report the crystal structure of the human metapneumovirus M at 2.8 Å resolution in its native dimeric state. The structure reveals the presence of a high-affinity Ca2+ binding site. Molecular dynamics simulations (MDS) predict a secondary lower-affinity site that correlates well with data from fluorescence-based thermal shift assays. By combining small-angle X-ray scattering with MDS and ensemble analysis, we captured the structure and dynamics of M in solution. Our analysis reveals a large positively charged patch on the protein surface that is involved in membrane interaction. Structural analysis of DOPC-induced polymerization of M into helical filaments using electron microscopy leads to a model of M self-assembly. The conservation of the Ca2+ binding sites suggests a role for calcium in the replication and morphogenesis of pneumoviruses. PMID:24316400
Structure and mechanism of the UvrA-UvrB DNA damage sensor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pakotiprapha, Danaya; Samuels, Martin; Shen, Koning
2012-04-17
Nucleotide excision repair (NER) is used by all organisms to eliminate DNA lesions. We determined the structure of the Geobacillus stearothermophilus UvrA-UvrB complex, the damage-sensor in bacterial NER and a new structure of UvrA. We observe that the DNA binding surface of UvrA, previously found in an open shape that binds damaged DNA, also exists in a closed groove shape compatible with native DNA only. The sensor contains two UvrB molecules that flank the UvrA dimer along the predicted path for DNA, ~80 Å from the lesion. We show that the conserved signature domain II of UvrA mediates a nexusmore » of contacts among UvrA, UvrB and DNA. Further, in our new structure of UvrA, this domain adopts an altered conformation while an adjacent nucleotide binding site is vacant. Our findings raise unanticipated questions about NER and also suggest a revised picture of its early stages.« less
Oligosaccharide Binding in Escherichia coli Glycogen Synthase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sheng, Fang; Yep, Alejandra; Feng, Lei
2010-11-17
Glycogen/starch synthase elongates glucan chains and is the key enzyme in the synthesis of glycogen in bacteria and starch in plants. Cocrystallization of Escherichia coli wild-type glycogen synthase (GS) with substrate ADPGlc and the glucan acceptor mimic HEPPSO produced a closed form of GS and suggests that domain-domain closure accompanies glycogen synthesis. Cocrystallization of the inactive GS mutant E377A with substrate ADPGlc and oligosaccharide results in the first oligosaccharide-bound glycogen synthase structure. Four bound oligosaccharides are observed, one in the interdomain cleft (G6a) and three on the N-terminal domain surface (G6b, G6c, and G6d). Extending from the center of themore » enzyme to the interdomain cleft opening, G6a mostly interacts with the highly conserved N-terminal domain residues lining the cleft of GS. The surface-bound oligosaccharides G6c and G6d have less interaction with enzyme and exhibit a more curled, helixlike structural arrangement. The observation that oligosaccharides bind only to the N-terminal domain of GS suggests that glycogen in vivo probably binds to only one side of the enzyme to ensure unencumbered interdomain movement, which is required for efficient, continuous glucan-chain synthesis.« less
Crystal Structure of the N-terminal Domain of the Group B Streptococcus Alpha C Protein
DOE Office of Scientific and Technical Information (OSTI.GOV)
Auperin,T.; Bolduc, G.; Baron, M.
Group B Streptococcus (GBS) is the leading cause of bacterial pneumonia, sepsis, and meningitis among neonates and an important cause of morbidity among pregnant women and immunocompromised adults. Invasive diseases due to GBS are attributed to the ability of the pathogen to translocate across human epithelial surfaces. The alpha C protein (ACP) has been identified as an invasin that plays a role in internalization and translocation of GBS across epithelial cells. The soluble N-terminal domain of ACP (NtACP) blocks the internalization of GBS. We determined the 1.86-{angstrom} resolution crystal structure of NtACP comprising residues Ser{sup 52} through Leu{sup 225} ofmore » the full-length ACP. NtACP has two domains, an N-terminal {beta}-sandwich and a C-terminal three-helix bundle. Structural and topological alignments reveal that the {beta}-sandwich shares structural elements with the type III fibronectin fold (FnIII), but includes structural elaborations that make it unique. We have identified a potential integrin-binding motif consisting of Lys-Thr-Asp{sup 146}, Arg{sup 110}, and Asp{sup 118}. A similar arrangement of charged residues has been described in other invasins. ACP shows a heparin binding activity that requires NtACP. We propose a possible heparin-binding site, including one surface of the three-helix bundle, and nearby portions of the sandwich and repeat domains. We have validated this prediction using assays of the heparin binding and cell-adhesion properties of engineered fragments of ACP. This is the first crystal structure of a member of the highly conserved Gram-positive surface alpha-like protein family, and it will enable the internalization mechanism of GBS to be dissected at the atomic level.« less
Exhaustive comparison and classification of ligand-binding surfaces in proteins
Murakami, Yoichi; Kinoshita, Kengo; Kinjo, Akira R; Nakamura, Haruki
2013-01-01
Many proteins function by interacting with other small molecules (ligands). Identification of ligand-binding sites (LBS) in proteins can therefore help to infer their molecular functions. A comprehensive comparison among local structures of LBSs was previously performed, in order to understand their relationships and to classify their structural motifs. However, similar exhaustive comparison among local surfaces of LBSs (patches) has never been performed, due to computational complexity. To enhance our understanding of LBSs, it is worth performing such comparisons among patches and classifying them based on similarities of their surface configurations and electrostatic potentials. In this study, we first developed a rapid method to compare two patches. We then clustered patches corresponding to the same PDB chemical component identifier for a ligand, and selected a representative patch from each cluster. We subsequently exhaustively as compared the representative patches and clustered them using similarity score, PatSim. Finally, the resultant PatSim scores were compared with similarities of atomic structures of the LBSs and those of the ligand-binding protein sequences and functions. Consequently, we classified the patches into ∼2000 well-characterized clusters. We found that about 63% of these clusters are used in identical protein folds, although about 25% of the clusters are conserved in distantly related proteins and even in proteins with cross-fold similarity. Furthermore, we showed that patches with higher PatSim score have potential to be involved in similar biological processes. PMID:23934772
Incorporating evolution of transcription factor binding sites into annotated alignments.
Bais, Abha S; Grossmann, Stefen; Vingron, Martin
2007-08-01
Identifying transcription factor binding sites (TFBSs) is essential to elucidate putative regulatory mechanisms. A common strategy is to combine cross-species conservation with single sequence TFBS annotation to yield "conserved TFBSs". Most current methods in this field adopt a multi-step approach that segregates the two aspects. Again, it is widely accepted that the evolutionary dynamics of binding sites differ from those of the surrounding sequence. Hence, it is desirable to have an approach that explicitly takes this factor into account. Although a plethora of approaches have been proposed for the prediction of conserved TFBSs, very few explicitly model TFBS evolutionary properties, while additionally being multi-step. Recently, we introduced a novel approach to simultaneously align and annotate conserved TFBSs in a pair of sequences. Building upon the standard Smith-Waterman algorithm for local alignments, SimAnn introduces additional states for profiles to output extended alignments or annotated alignments. That is, alignments with parts annotated as gaplessly aligned TFBSs (pair-profile hits)are generated. Moreover,the pair- profile related parameters are derived in a sound statistical framework. In this article, we extend this approach to explicitly incorporate evolution of binding sites in the SimAnn framework. We demonstrate the extension in the theoretical derivations through two position-specific evolutionary models, previously used for modelling TFBS evolution. In a simulated setting, we provide a proof of concept that the approach works given the underlying assumptions,as compared to the original work. Finally, using a real dataset of experimentally verified binding sites in human-mouse sequence pairs,we compare the new approach (eSimAnn) to an existing multi-step tool that also considers TFBS evolution. Although it is widely accepted that binding sites evolve differently from the surrounding sequences, most comparative TFBS identification methods do not explicitly consider this.Additionally, prediction of conserved binding sites is carried out in a multi-step approach that segregates alignment from TFBS annotation. In this paper, we demonstrate how the simultaneous alignment and annotation approach of SimAnn can be further extended to incorporate TFBS evolutionary relationships. We study how alignments and binding site predictions interplay at varying evolutionary distances and for various profile qualities.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Dong-Hwa; Ha, Ji-Hyang; Kim, Yul
Highlights: {yields} Identification of a conserved BH3 motif in C-terminal coiled coil region of nCLU. {yields} The nCLU BH3 domain binds to BH3 peptide-binding grooves in both Bcl-X{sub L} and Bcl-2. {yields} A conserved binding mechanism of nCLU BH3 and the other pro-apoptotic BH3 peptides with Bcl-X{sub L}. {yields} The absolutely conserved Leu323 and Asp328 of nCLU BH3 domain are critical for binding to Bcl-X{sub L.} {yields} Molecular understanding of the pro-apoptotic function of nCLU as a novel BH3-only protein. -- Abstract: Clusterin (CLU) is a multifunctional glycoprotein that is overexpressed in prostate and breast cancers. Although CLU is knownmore » to be involved in the regulation of apoptosis and cell survival, the precise molecular mechanism underlying the pro-apoptotic function of nuclear CLU (nCLU) remains unclear. In this study, we identified a conserved BH3 motif in C-terminal coiled coil (CC2) region of nCLU by sequence analysis and characterized the molecular interaction of the putative nCLU BH3 domain with anti-apoptotic Bcl-2 family proteins by nuclear magnetic resonance (NMR) spectroscopy. The chemical shift perturbation data demonstrated that the nCLU BH3 domain binds to pro-apoptotic BH3 peptide-binding grooves in both Bcl-X{sub L} and Bcl-2. A structural model of the Bcl-X{sub L}/nCLU BH3 peptide complex reveals that the binding mode is remarkably similar to those of other Bcl-X{sub L}/BH3 peptide complexes. In addition, mutational analysis confirmed that Leu323 and Asp328 of nCLU BH3 domain, absolutely conserved in the BH3 motifs of BH3-only protein family, are critical for binding to Bcl-X{sub L}. Taken altogether, our results suggest a molecular basis for the pro-apoptotic function of nCLU by elucidating the residue specific interactions of the BH3 motif in nCLU with anti-apoptotic Bcl-2 family proteins.« less
Siddiqui, Asim A.; Xainli, Jia; Schloegel, Jesse; Carias, Lenore; Ntumngia, Francis; Shoham, Menachem; Casey, Joanne L.; Foley, Michael; Adams, John H.
2012-01-01
Plasmodium vivax invasion of human erythrocytes requires interaction of the P. vivax Duffy binding protein (PvDBP) with its host receptor, the Duffy antigen (Fy) on the erythrocyte surface. Consequently, PvDBP is a leading vaccine candidate. The binding domain of PvDBP lies in a cysteine-rich portion of the molecule called region II (PvDBPII). PvDBPII contains three distinct subdomains based upon intramolecular disulfide bonding patterns. Subdomain 2 (SD2) is highly polymorphic and is thought to contain many key residues for binding to Fy, while SD1 and SD3 are comparatively conserved and their role in Fy binding is not well understood. To examine the relative contributions of the different subdomains to binding to Fy and their abilities to elicit strain-transcending binding-inhibitory antibodies, we evaluated recombinant proteins from SD1+2, SD2, SD3, and SD3+, which includes 24 residues of SD2. All of the recombinant subdomains, except for SD2, bound variably to human erythrocytes, with constructs containing SD3 showing the best binding. Antisera raised in laboratory animals against SD3, SD3+, and SD2+3 inhibited the binding of full-length PvDBPII, which is strain transcending, whereas antisera generated to SD1+2 and SD2 failed to generate blocking antibodies. All of the murine monoclonal antibodies generated to full-length PvDBPII that had significant binding-inhibitory activity recognized only SD3. Thus, SD3 binds Fy and elicits blocking antibodies, indicating that it contains residues critical to Fy binding that could be the basis of a strain-transcending candidate vaccine against P. vivax. PMID:22615246
Siddiqui, Asim A; Xainli, Jia; Schloegel, Jesse; Carias, Lenore; Ntumngia, Francis; Shoham, Menachem; Casey, Joanne L; Foley, Michael; Adams, John H; King, Christopher L
2012-08-01
Plasmodium vivax invasion of human erythrocytes requires interaction of the P. vivax Duffy binding protein (PvDBP) with its host receptor, the Duffy antigen (Fy) on the erythrocyte surface. Consequently, PvDBP is a leading vaccine candidate. The binding domain of PvDBP lies in a cysteine-rich portion of the molecule called region II (PvDBPII). PvDBPII contains three distinct subdomains based upon intramolecular disulfide bonding patterns. Subdomain 2 (SD2) is highly polymorphic and is thought to contain many key residues for binding to Fy, while SD1 and SD3 are comparatively conserved and their role in Fy binding is not well understood. To examine the relative contributions of the different subdomains to binding to Fy and their abilities to elicit strain-transcending binding-inhibitory antibodies, we evaluated recombinant proteins from SD1+2, SD2, SD3, and SD3+, which includes 24 residues of SD2. All of the recombinant subdomains, except for SD2, bound variably to human erythrocytes, with constructs containing SD3 showing the best binding. Antisera raised in laboratory animals against SD3, SD3+, and SD2+3 inhibited the binding of full-length PvDBPII, which is strain transcending, whereas antisera generated to SD1+2 and SD2 failed to generate blocking antibodies. All of the murine monoclonal antibodies generated to full-length PvDBPII that had significant binding-inhibitory activity recognized only SD3. Thus, SD3 binds Fy and elicits blocking antibodies, indicating that it contains residues critical to Fy binding that could be the basis of a strain-transcending candidate vaccine against P. vivax.
Raman, Rajeev; Ptak, Christopher P; Hsieh, Ching-Lin; Oswald, Robert E; Chang, Yung-Fu; Sharma, Yogendra
2013-07-09
Many host-parasite interactions are mediated via surface-exposed proteins containing bacterial immunoglobulin-like (Big) domains. Here, we utilize the spectral properties of a conserved Trp to provide evidence that, along with a Phe, these residues are positioned within the hydrophobic core of a subset of Big_2 domains. The mutation of the Phe to Ala decreases Big_2 domain stability and impairs the ability of LigBCen2 to bind to the host protein, fibronectin.
2002-01-01
the surface of the receptor. This pocket is the target for several known and unknown coactivator proteins, which bind the LBD through a conserved LxxLL...was and to Not se FLKAILN) and the LBDs of several receptors (TRo was used as an example in prisingly, the LBD of TR13 was also found to interact with...receptors. 541 ATTCCTTAAAGCCATTTTAAACTGAGGCATTAAGAAGAAATGCACTCACCATGAGCACCA The LBDs of several nuclear receptors were examined for FL. K. A • 1,...N
Structural basis for corepressor assembly by the orphan nuclear receptor TLX
Zhou, X. Edward; He, Yuanzheng; Searose-Xu, Kelvin; Zhang, Chun-Li; Tsai, Chih-Cheng; Melcher, Karsten
2015-01-01
The orphan nuclear receptor TLX regulates neural stem cell self-renewal in the adult brain and functions primarily as a transcription repressor through recruitment of Atrophin corepressors, which bind to TLX via a conserved peptide motif termed the Atro box. Here we report crystal structures of the human and insect TLX ligand-binding domain in complex with Atro box peptides. In these structures, TLX adopts an autorepressed conformation in which its helix H12 occupies the coactivator-binding groove. Unexpectedly, H12 in this autorepressed conformation forms a novel binding pocket with residues from helix H3 that accommodates a short helix formed by the conserved ALXXLXXY motif of the Atro box. Mutations that weaken the TLX–Atrophin interaction compromise the repressive activity of TLX, demonstrating that this interaction is required for Atrophin to confer repressor activity to TLX. Moreover, the autorepressed conformation is conserved in the repressor class of orphan nuclear receptors, and mutations of corresponding residues in other members of this class of receptors diminish their repressor activities. Together, our results establish the functional conservation of the autorepressed conformation and define a key sequence motif in the Atro box that is essential for TLX-mediated repression. PMID:25691470
Biological role and structural mechanism of twinfilin–capping protein interaction
Falck, Sandra; Paavilainen, Ville O; Wear, Martin A; Grossmann, J Günter; Cooper, John A; Lappalainen, Pekka
2004-01-01
Twinfilin and capping protein (CP) are highly conserved actin-binding proteins that regulate cytoskeletal dynamics in organisms from yeast to mammals. Twinfilin binds actin monomer, while CP binds the barbed end of the actin filament. Remarkably, twinfilin and CP also bind directly to each other, but the mechanism and role of this interaction in actin dynamics are not defined. Here, we found that the binding of twinfilin to CP does not affect the binding of either protein to actin. Furthermore, site-directed mutagenesis studies revealed that the CP-binding site resides in the conserved C-terminal tail region of twinfilin. The solution structure of the twinfilin–CP complex supports these conclusions. In vivo, twinfilin's binding to both CP and actin monomer was found to be necessary for twinfilin's role in actin assembly dynamics, based on genetic studies with mutants that have defined biochemical functions. Our results support a novel model for how sequential interactions between actin monomers, twinfilin, CP, and actin filaments promote cytoskeletal dynamics. PMID:15282541
Da Ros, V; Busso, D; Cohen, D J; Maldera, J; Goldweic, N; Cuasnicu, P S
2007-01-01
Epididymal protein DE and testicular protein Tpx-1 are two cysteine-rich secretory proteins also known as CRISP-1 and CRISP-2, respectively. DE/ CRISP-1 is localised on the equatorial segment of acrosome-reacted sperm and participates in rat gamete fusion through its binding to egg-complementary sites. Recent results using bacterially-expressed recombinant fragments of DE as well as synthetic peptides revealed that the ability of DE to bind to the egg surface and inhibit gamete fusion resides in a region of 12 amino acids corresponding to an evolutionary conserved motif of the CRISP family (Signature 2). Given the high degree of homology between DE/CRISP-1 and Tpx-1/CRISP-2, we also explored the potential participation of the testicular intra-acrosomal protein in gamete fusion. Results showing the ability of recombinant Tpx-1 to bind to the surface of rat eggs (evaluated by indirect immunofluorescence) and to significantly inhibit zona-free egg penetration, support the participation of this protein in gamete fusion through its interaction with egg-binding sites. Interestingly, rat Tpx-1 exhibits only two substitutions in Signature 2 when compared to this region in DE. Together, these results provide evidence for the involvement of both epididymal DE/CRISP-1 and testicular Tpx-1/CRISP-2 in gamete fusion suggesting the existence of a functional cooperation between homologue molecules as a mechanism to ensure the success of fertilisation.
Naz, Sadia; Ngo, Tony; Farooq, Umar
2017-01-01
Background The rapid increase in antibiotic resistance by various bacterial pathogens underlies the significance of developing new therapies and exploring different drug targets. A fraction of bacterial pathogens abbreviated as ESKAPE by the European Center for Disease Prevention and Control have been considered a major threat due to the rise in nosocomial infections. Here, we compared putative drug binding pockets of twelve essential and mostly conserved metabolic enzymes in numerous bacterial pathogens including those of the ESKAPE group and Mycobacterium tuberculosis. The comparative analysis will provide guidelines for the likelihood of transferability of the inhibitors from one species to another. Methods Nine bacterial species including six ESKAPE pathogens, Mycobacterium tuberculosis along with Mycobacterium smegmatis and Eschershia coli, two non-pathogenic bacteria, have been selected for drug binding pocket analysis of twelve essential enzymes. The amino acid sequences were obtained from Uniprot, aligned using ICM v3.8-4a and matched against the Pocketome encyclopedia. We used known co-crystal structures of selected target enzyme orthologs to evaluate the location of their active sites and binding pockets and to calculate a matrix of pairwise sequence identities across each target enzyme across the different species. This was used to generate sequence maps. Results High sequence identity of enzyme binding pockets, derived from experimentally determined co-crystallized structures, was observed among various species. Comparison at both full sequence level and for drug binding pockets of key metabolic enzymes showed that binding pockets are highly conserved (sequence similarity up to 100%) among various ESKAPE pathogens as well as Mycobacterium tuberculosis. Enzymes orthologs having conserved binding sites may have potential to interact with inhibitors in similar way and might be helpful for design of similar class of inhibitors for a particular species. The derived pocket alignments and distance-based maps provide guidelines for drug discovery and repurposing. In addition they also provide recommendations for the relevant model bacteria that may be used for initial drug testing. Discussion Comparing ligand binding sites through sequence identity calculation could be an effective approach to identify conserved orthologs as drug binding pockets have shown higher level of conservation among various species. By using this approach we could avoid the problems associated with full sequence comparison. We identified essential metabolic enzymes among ESKAPE pathogens that share high sequence identity in their putative drug binding pockets (up to 100%), of which known inhibitors can potentially antagonize these identical pockets in the various species in a similar manner. PMID:28948099
Naz, Sadia; Ngo, Tony; Farooq, Umar; Abagyan, Ruben
2017-01-01
The rapid increase in antibiotic resistance by various bacterial pathogens underlies the significance of developing new therapies and exploring different drug targets. A fraction of bacterial pathogens abbreviated as ESKAPE by the European Center for Disease Prevention and Control have been considered a major threat due to the rise in nosocomial infections. Here, we compared putative drug binding pockets of twelve essential and mostly conserved metabolic enzymes in numerous bacterial pathogens including those of the ESKAPE group and Mycobacterium tuberculosis . The comparative analysis will provide guidelines for the likelihood of transferability of the inhibitors from one species to another. Nine bacterial species including six ESKAPE pathogens, Mycobacterium tuberculosis along with Mycobacterium smegmatis and Eschershia coli , two non-pathogenic bacteria, have been selected for drug binding pocket analysis of twelve essential enzymes. The amino acid sequences were obtained from Uniprot, aligned using ICM v3.8-4a and matched against the Pocketome encyclopedia. We used known co-crystal structures of selected target enzyme orthologs to evaluate the location of their active sites and binding pockets and to calculate a matrix of pairwise sequence identities across each target enzyme across the different species. This was used to generate sequence maps. High sequence identity of enzyme binding pockets, derived from experimentally determined co-crystallized structures, was observed among various species. Comparison at both full sequence level and for drug binding pockets of key metabolic enzymes showed that binding pockets are highly conserved (sequence similarity up to 100%) among various ESKAPE pathogens as well as Mycobacterium tuberculosis . Enzymes orthologs having conserved binding sites may have potential to interact with inhibitors in similar way and might be helpful for design of similar class of inhibitors for a particular species. The derived pocket alignments and distance-based maps provide guidelines for drug discovery and repurposing. In addition they also provide recommendations for the relevant model bacteria that may be used for initial drug testing. Comparing ligand binding sites through sequence identity calculation could be an effective approach to identify conserved orthologs as drug binding pockets have shown higher level of conservation among various species. By using this approach we could avoid the problems associated with full sequence comparison. We identified essential metabolic enzymes among ESKAPE pathogens that share high sequence identity in their putative drug binding pockets (up to 100%), of which known inhibitors can potentially antagonize these identical pockets in the various species in a similar manner.
Functional and Structural Analysis of the Conserved EFhd2 Protein
Acosta, Yancy Ferrer; Rodríguez Cruz, Eva N.; Vaquer, Ana del C.; Vega, Irving E.
2013-01-01
EFhd2 is a novel protein conserved from C. elegans to H. sapiens. This novel protein was originally identified in cells of the immune and central nervous systems. However, it is most abundant in the central nervous system, where it has been found associated with pathological forms of the microtubule-associated protein tau. The physiological or pathological roles of EFhd2 are poorly understood. In this study, a functional and structural analysis was carried to characterize the molecular requirements for EFhd2’s calcium binding activity. The results showed that mutations of a conserved aspartate on either EF-hand motif disrupted the calcium binding activity, indicating that these motifs work in pair as a functional calcium binding domain. Furthermore, characterization of an identified single-nucleotide polymorphisms (SNP) that introduced a missense mutation indicates the importance of a conserved phenylalanine on EFhd2 calcium binding activity. Structural analysis revealed that EFhd2 is predominantly composed of alpha helix and random coil structures and that this novel protein is thermostable. EFhd2’s thermo stability depends on its N-terminus. In the absence of the N-terminus, calcium binding restored EFhd2’s thermal stability. Overall, these studies contribute to our understanding on EFhd2 functional and structural properties, and introduce it into the family of canonical EF-hand domain containing proteins. PMID:22973849
2012-01-01
Background To discover a compound inhibiting multiple proteins (i.e. polypharmacological targets) is a new paradigm for the complex diseases (e.g. cancers and diabetes). In general, the polypharmacological proteins often share similar local binding environments and motifs. As the exponential growth of the number of protein structures, to find the similar structural binding motifs (pharma-motifs) is an emergency task for drug discovery (e.g. side effects and new uses for old drugs) and protein functions. Results We have developed a Space-Related Pharmamotifs (called SRPmotif) method to recognize the binding motifs by searching against protein structure database. SRPmotif is able to recognize conserved binding environments containing spatially discontinuous pharma-motifs which are often short conserved peptides with specific physico-chemical properties for protein functions. Among 356 pharma-motifs, 56.5% interacting residues are highly conserved. Experimental results indicate that 81.1% and 92.7% polypharmacological targets of each protein-ligand complex are annotated with same biological process (BP) and molecular function (MF) terms, respectively, based on Gene Ontology (GO). Our experimental results show that the identified pharma-motifs often consist of key residues in functional (active) sites and play the key roles for protein functions. The SRPmotif is available at http://gemdock.life.nctu.edu.tw/SRP/. Conclusions SRPmotif is able to identify similar pharma-interfaces and pharma-motifs sharing similar binding environments for polypharmacological targets by rapidly searching against the protein structure database. Pharma-motifs describe the conservations of binding environments for drug discovery and protein functions. Additionally, these pharma-motifs provide the clues for discovering new sequence-based motifs to predict protein functions from protein sequence databases. We believe that SRPmotif is useful for elucidating protein functions and drug discovery. PMID:23281852
Chiu, Yi-Yuan; Lin, Chun-Yu; Lin, Chih-Ta; Hsu, Kai-Cheng; Chang, Li-Zen; Yang, Jinn-Moon
2012-01-01
To discover a compound inhibiting multiple proteins (i.e. polypharmacological targets) is a new paradigm for the complex diseases (e.g. cancers and diabetes). In general, the polypharmacological proteins often share similar local binding environments and motifs. As the exponential growth of the number of protein structures, to find the similar structural binding motifs (pharma-motifs) is an emergency task for drug discovery (e.g. side effects and new uses for old drugs) and protein functions. We have developed a Space-Related Pharmamotifs (called SRPmotif) method to recognize the binding motifs by searching against protein structure database. SRPmotif is able to recognize conserved binding environments containing spatially discontinuous pharma-motifs which are often short conserved peptides with specific physico-chemical properties for protein functions. Among 356 pharma-motifs, 56.5% interacting residues are highly conserved. Experimental results indicate that 81.1% and 92.7% polypharmacological targets of each protein-ligand complex are annotated with same biological process (BP) and molecular function (MF) terms, respectively, based on Gene Ontology (GO). Our experimental results show that the identified pharma-motifs often consist of key residues in functional (active) sites and play the key roles for protein functions. The SRPmotif is available at http://gemdock.life.nctu.edu.tw/SRP/. SRPmotif is able to identify similar pharma-interfaces and pharma-motifs sharing similar binding environments for polypharmacological targets by rapidly searching against the protein structure database. Pharma-motifs describe the conservations of binding environments for drug discovery and protein functions. Additionally, these pharma-motifs provide the clues for discovering new sequence-based motifs to predict protein functions from protein sequence databases. We believe that SRPmotif is useful for elucidating protein functions and drug discovery.
Identical phosphatase mechanisms achieved through distinct modes of binding phosphoprotein substrate
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pazy, Y.; Motaleb, M.A.; Guarnieri, M.T.
2010-04-05
Two-component signal transduction systems are widespread in prokaryotes and control numerous cellular processes. Extensive investigation of sensor kinase and response regulator proteins from many two-component systems has established conserved sequence, structural, and mechanistic features within each family. In contrast, the phosphatases which catalyze hydrolysis of the response regulator phosphoryl group to terminate signal transduction are poorly understood. Here we present structural and functional characterization of a representative of the CheC/CheX/FliY phosphatase family. The X-ray crystal structure of Borrelia burgdorferi CheX complexed with its CheY3 substrate and the phosphoryl analogue BeF{sub 3}{sup -} reveals a binding orientation between a response regulatormore » and an auxiliary protein different from that shared by every previously characterized example. The surface of CheY3 containing the phosphoryl group interacts directly with a long helix of CheX which bears the conserved (E - X{sub 2} - N) motif. Conserved CheX residues Glu96 and Asn99, separated by a single helical turn, insert into the CheY3 active site. Structural and functional data indicate that CheX Asn99 and CheY3 Thr81 orient a water molecule for hydrolytic attack. The catalytic residues of the CheX-CheY3 complex are virtually superimposable on those of the Escherichia coli CheZ phosphatase complexed with CheY, even though the active site helices of CheX and CheZ are oriented nearly perpendicular to one other. Thus, evolution has found two structural solutions to achieve the same catalytic mechanism through different helical spacing and side chain lengths of the conserved acid/amide residues in CheX and CheZ.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bauer, Ryan; Janowska, Katarzyna; Taylor, Kelly
Clostridium histolyticumcollagenases ColG and ColH are segmental enzymes that are thought to be activated by Ca 2+-triggered domain reorientation to cause extensive tissue destruction. The collagenases consist of a collagenase module (s1), a variable number of polycystic kidney disease-like (PKD-like) domains (s2a and s2b in ColH and s2 in ColG) and a variable number of collagen-binding domains (s3 in ColH and s3a and s3b in ColG). The X-ray crystal structures of Ca 2+-bound holo s2b (1.4 Å resolution,R= 15.0%,R free= 19.1%) and holo s2a (1.9 Å resolution,R= 16.3%,R free= 20.7%), as well as of Ca 2+-free apo s2a (1.8 Åmore » resolution,R= 20.7%,R free= 27.2%) and two new forms of N-terminally truncated apo s2 (1.4 Å resolution,R= 16.9%,R free= 21.2%; 1.6 Å resolution,R= 16.2%,R free= 19.2%), are reported. The structurally similar PKD-like domains resemble the V-set Ig fold. In addition to a conserved β-bulge, the PKD-like domains feature a second bulge that also changes the allegiance of the subsequent β-strand. This β-bulge and the genesis of a Ca 2+pocket in the archaeal PKD-like domain suggest a close kinship between bacterial and archaeal PKD-like domains. Different surface properties and indications of different dynamics suggest unique roles for the PKD-like domains in ColG and in ColH. Surface aromatic residues found on ColH s2a-s2b, but not on ColG s2, may provide the weak interaction in the biphasic collagen-binding mode previously found in s2b-s3.B-factor analyses suggest that in the presence of Ca 2+the midsection of s2 becomes more flexible but the midsections of s2a and s2b stay rigid. The different surface properties and dynamics of the domains suggest that the PKD-like domains of M9B bacterial collagenase can be grouped into either a ColG subset or a ColH subset. The conserved properties of PKD-like domains in ColG and in ColH include Ca 2+binding. Conserved residues not only interact with Ca 2+, but also position the Ca 2+-interacting water molecule. Ca 2+aligns the N-terminal linker approximately parallel to the major axis of the domain. Ca 2+binding also increases stability against heat and guanidine hydrochloride, and may improve the longevity in the extracellular matrix. The results of this study will further assist in developing collagen-targeting vehicles for various signal molecules.« less
Bauer, Ryan; Janowska, Katarzyna; Taylor, Kelly; ...
2015-03-01
Clostridium histolyticumcollagenases ColG and ColH are segmental enzymes that are thought to be activated by Ca 2+-triggered domain reorientation to cause extensive tissue destruction. The collagenases consist of a collagenase module (s1), a variable number of polycystic kidney disease-like (PKD-like) domains (s2a and s2b in ColH and s2 in ColG) and a variable number of collagen-binding domains (s3 in ColH and s3a and s3b in ColG). The X-ray crystal structures of Ca 2+-bound holo s2b (1.4 Å resolution,R= 15.0%,R free= 19.1%) and holo s2a (1.9 Å resolution,R= 16.3%,R free= 20.7%), as well as of Ca 2+-free apo s2a (1.8 Åmore » resolution,R= 20.7%,R free= 27.2%) and two new forms of N-terminally truncated apo s2 (1.4 Å resolution,R= 16.9%,R free= 21.2%; 1.6 Å resolution,R= 16.2%,R free= 19.2%), are reported. The structurally similar PKD-like domains resemble the V-set Ig fold. In addition to a conserved β-bulge, the PKD-like domains feature a second bulge that also changes the allegiance of the subsequent β-strand. This β-bulge and the genesis of a Ca 2+pocket in the archaeal PKD-like domain suggest a close kinship between bacterial and archaeal PKD-like domains. Different surface properties and indications of different dynamics suggest unique roles for the PKD-like domains in ColG and in ColH. Surface aromatic residues found on ColH s2a-s2b, but not on ColG s2, may provide the weak interaction in the biphasic collagen-binding mode previously found in s2b-s3.B-factor analyses suggest that in the presence of Ca 2+the midsection of s2 becomes more flexible but the midsections of s2a and s2b stay rigid. The different surface properties and dynamics of the domains suggest that the PKD-like domains of M9B bacterial collagenase can be grouped into either a ColG subset or a ColH subset. The conserved properties of PKD-like domains in ColG and in ColH include Ca 2+binding. Conserved residues not only interact with Ca 2+, but also position the Ca 2+-interacting water molecule. Ca 2+aligns the N-terminal linker approximately parallel to the major axis of the domain. Ca 2+binding also increases stability against heat and guanidine hydrochloride, and may improve the longevity in the extracellular matrix. The results of this study will further assist in developing collagen-targeting vehicles for various signal molecules.« less
Cortez, Cristian; Yoshida, Nobuko; Bahia, Diana; Sobreira, Tiago J.P.
2012-01-01
Host cell invasion and dissemination within the host are hallmarks of virulence for many pathogenic microorganisms. As concerns Trypanosoma cruzi, which causes Chagas disease, the insect vector-derived metacyclic trypomastigotes (MT) initiate infection by invading host cells, and later blood trypomastigotes disseminate to diverse organs and tissues. Studies with MT generated in vitro and tissue culture-derived trypomastigotes (TCT), as counterparts of insect-borne and bloodstream parasites, have implicated members of the gp85/trans-sialidase superfamily, MT gp82 and TCT Tc85-11, in cell invasion and interaction with host factors. Here we analyzed the gp82 structure/function characteristics and compared them with those previously reported for Tc85-11. One of the gp82 sequences identified as a cell binding site consisted of an α-helix, which connects the N-terminal β-propeller domain to the C-terminal β-sandwich domain where the second binding site is nested. In the gp82 structure model, both sites were exposed at the surface. Unlike gp82, the Tc85-11 cell adhesion sites are located in the N-terminal β-propeller region. The gp82 sequence corresponding to the epitope for a monoclonal antibody that inhibits MT entry into target cells was exposed on the surface, upstream and contiguous to the α-helix. Located downstream and close to the α-helix was the gp82 gastric mucin binding site, which plays a central role in oral T. cruzi infection. The sequences equivalent to Tc85-11 laminin-binding sites, which have been associated with the parasite ability to overcome extracellular matrices and basal laminae, was poorly conserved in gp82, compatible with its reduced capacity to bind laminin. Our study indicates that gp82 is structurally suited for MT to initiate infection by the oral route, whereas Tc85-11, with its affinity for laminin, would facilitate the parasite dissemination through diverse organs and tissues. PMID:22860068
Kan, Fengling; Davidson, Mari K.; Wahls, Wayne P.
2011-01-01
In fission yeast and other eukaryotes, Rec12 (Spo11) is thought to catalyze the formation of dsDNA breaks (DSBs) that initiate homologous recombination in meiosis. Rec12 is orthologous to the catalytic subunit of topoisomerase VI (Top6A). Guided by the crystal structure of Top6A, we engineered the rec12 locus to encode Rec12 proteins each with a single amino acid substitution in a conserved residue. Of 21 substitutions, 10 significantly reduced or abolished meiotic DSBs, gene conversion, crossover recombination and the faithful segregation of chromosomes. Critical residues map within the metal ion-binding pocket toprim (E179A, D229A, D231A), catalytic region 5Y-CAP (R94A, D95A, Y98F) and the DNA-binding interface (K201A, G202E, R209A, K242A). A subset of substitutions reduced DSBs but maintained crossovers, demonstrating crossover homeostasis. Furthermore, a strong separation of function mutation (R304A) suggests that the crossover/non-crossover decision is established early by a protein–protein interaction surface of Rec12. Fission yeast has multiple crossovers per bivalent, and chromosome segregation was robust above a threshold of about one crossover per bivalent, below which non-disjunction occurred. These results support structural and functional conservation among Rec12/Spo11/Top6A family members for the catalysis of DSBs, and they reveal how Rec12 regulates other features of meiotic chromosome dynamics. PMID:21030440
Gurung, Arun Bahadur; Das, Amit Kumar; Bhattacharjee, Atanu
2017-04-01
Mycobacterium tuberculosis has distinctive ability to detoxify various microbicidal superoxides and hydroperoxides via a redox catalytic cycle involving thiol reductants of peroxiredoxin (Prx) and thioredoxin (Trx) systems which has conferred on it resistance against oxidative killing and survivability within host. We have used computational approach to disrupt catalytic functions of Prx-Trx complex which can possibly render the pathogen vulnerable to oxidative killing in the host. Using protein-protein docking method, we have successfully constructed the Prx-Trx complex. Statistics of interface region revealed contact area of each monomer less than 1500Å 2 and enriched in polar amino acids indicating transient interaction between Prx and Trx. We have identified ZINC40139449 as a potent interface binding molecule through virtual screening of drug-like compounds from ZINC database. Molecular dynamics (MD) simulation studies showed differences in structural properties of Prx-Trx complex both in apo and ligand bound states with regard to root mean square deviation (RMSD), radius of gyration (Rg), root mean square fluctuations (RMSF), solvent accessible surface area (SASA) and number of hydrogen bonds (NHBs). Interestingly, we found stability of two conserved catalytic residues Cys61 and Cys174 of Prx and conserved catalytic motif, WCXXC of Trx upon binding of ZINC40139449. The time dependent displacement study reveals that the compound is quite stable in the interface binding region till 30ns of MD simulation. The structural properties were further validated by principal component analysis (PCA). We report ZINC40139449 as promising lead which can be further evaluated by in vitro or in vivo enzyme inhibition assays. Copyright © 2016 Elsevier Ltd. All rights reserved.
Wang, Jiafu; Meng, Jianghui; Nugent, Marc; Tang, Minhong; Dolly, J. Oliver
2017-01-01
Botulinum neurotoxins (BoNTs) are the most toxic proteins known, due to inhibiting the neuronal release of acetylcholine and causing flaccid paralysis. Most BoNT serotypes target neurons by binding to synaptic vesicle proteins and gangliosides via a C-terminal binding sub-domain (HCC). However, the role of their conserved N-terminal sub-domain (HCN) has not been established. Herein, we created a mutant form of recombinant BoNT/A lacking HCN (rAΔHCN) and showed that the lethality of this mutant is reduced 3.3 × 104-fold compared to wild-type BoNT/A. Accordingly, low concentrations of rAΔHCN failed to bind either synaptic vesicle protein 2C or neurons, unlike the high-affinity neuronal binding obtained with 125I-BoNT/A (Kd = 0.46 nM). At a higher concentration, rAΔHCN did bind to cultured sensory neurons and cluster on the surface, even after 24 h exposure. In contrast, BoNT/A became internalised and its light chain appeared associated with the plasmalemma, and partially co-localised with vesicle-associated membrane protein 2 in some vesicular compartments. We further found that a point mutation (W985L) within HCN reduced the toxicity over 10-fold, while this mutant maintained the same level of binding to neurons as wild type BoNT/A, suggesting that HCN makes additional contributions to productive internalization/translocation steps beyond binding to neurons. PMID:28295026
Spencer, J Vaughn; Arndt, Karen M
2002-12-01
The TATA-binding protein (TBP) nucleates the assembly and determines the position of the preinitiation complex at RNA polymerase II-transcribed genes. We investigated the importance of two conserved residues on the DNA binding surface of Saccharomyces cerevisiae TBP to DNA binding and sequence discrimination. Because they define a significant break in the twofold symmetry of the TBP-TATA interface, Ala100 and Pro191 have been proposed to be key determinants of TBP binding orientation and transcription directionality. In contrast to previous predictions, we found that substitution of an alanine for Pro191 did not allow recognition of a reversed TATA box in vivo; however, the reciprocal change, Ala100 to proline, resulted in efficient utilization of this and other variant TATA sequences. In vitro assays demonstrated that TBP mutants with the A100P and P191A substitutions have increased and decreased affinity for DNA, respectively. The TATA binding defect of TBP with the P191A mutation could be intragenically suppressed by the A100P substitution. Our results suggest that Ala100 and Pro191 are important for DNA binding and sequence recognition by TBP, that the naturally occurring asymmetry of Ala100 and Pro191 is not essential for function, and that a single amino acid change in TBP can lead to elevated DNA binding affinity and recognition of a reversed TATA sequence.
González, Silvia A; Affranchino, José L
2016-07-01
The process of feline immunodeficiency virus (FIV) entry into its target cells is initiated by the association of the surface (SU) subunit of the viral envelope glycoprotein (Env) with the cellular receptors CD134 and CXCR4. This event is followed by the fusion of the viral and cellular membranes, which is mediated by the transmembrane (TM) subunit of Env. We and others have previously demonstrated that the V3 domain of the SU subunit of Env is essential for CXCR4 binding. Of note, there are two contiguous and highly conserved potential N-glycosylation sites ((418)NST(420) and (422)NLT(424)) located at the C-terminal side of the V3 domain. We therefore decided to study the relevance for Env functions of these N-glycosylation motifs and found that disruption of both of them by introducing the N418Q/N422Q double amino acid substitution drastically impairs Env processing into the SU and TM subunits. Moreover, the simultaneous mutation of these N-glycosylation sites prevents Env incorporation into virions and Env-mediated cell-to-cell fusion. Notably, a recombinant soluble version of the SU glycoprotein carrying the double amino acid replacement N418Q/N422Q at the V3 C-terminal side binds to CXCR4 with an efficiency similar to that of wild-type SU.
Structure of deformed wing virus, a major honey bee pathogen.
Škubník, Karel; Nováček, Jiří; Füzik, Tibor; Přidal, Antonín; Paxton, Robert J; Plevka, Pavel
2017-03-21
The worldwide population of western honey bees ( Apis mellifera ) is under pressure from habitat loss, environmental stress, and pathogens, particularly viruses that cause lethal epidemics. Deformed wing virus (DWV) from the family Iflaviridae , together with its vector, the mite Varroa destructor , is likely the major threat to the world's honey bees. However, lack of knowledge of the atomic structures of iflaviruses has hindered the development of effective treatments against them. Here, we present the virion structures of DWV determined to a resolution of 3.1 Å using cryo-electron microscopy and 3.8 Å by X-ray crystallography. The C-terminal extension of capsid protein VP3 folds into a globular protruding (P) domain, exposed on the virion surface. The P domain contains an Asp-His-Ser catalytic triad that is, together with five residues that are spatially close, conserved among iflaviruses. These residues may participate in receptor binding or provide the protease, lipase, or esterase activity required for entry of the virus into a host cell. Furthermore, nucleotides of the DWV RNA genome interact with VP3 subunits. The capsid protein residues involved in the RNA binding are conserved among honey bee iflaviruses, suggesting a putative role of the genome in stabilizing the virion or facilitating capsid assembly. Identifying the RNA-binding and putative catalytic sites within the DWV virion structure enables future analyses of how DWV and other iflaviruses infect insect cells and also opens up possibilities for the development of antiviral treatments.
A proposed OB-fold with a protein-interaction surface in Candida albicans telomerase protein Est3
Yu, Eun Young; Wang, Feng; Lei, Ming; Lue, Neal F
2008-01-01
Ever shorter telomeres 3 (Est3) is an essential telomerase regulatory subunit thought to be unique to budding yeasts. Here we use multiple sequence alignment and hidden Markov model–hidden Markov model (HMM-HMM) comparison to uncover potential similarities between Est3 and the mammalian telomeric protein Tpp1. Analysis of site-specific mutants of Candida albicans Est3 revealed functional distinctions between residues that are conserved between Est3 and Tpp1 and those that are unique to Est3. Although both types of residues are important for telomere maintenance in vivo, only the former contributes to telomerase activity in vitro and facilitates the association of Est3 with telomerase core components. Consistent with a function in protein-protein interaction, the residues common to Est3 and Tpp1 map to one face of an OB-fold model structure, away from the canonical nucleic acid binding surface. We propose that Est3 and the OB-fold domain of Tpp1 mediate a conserved function in telomerase regulation. PMID:19172753
The distinct proteome of placental malaria parasites.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fried, Michal; Hixson, Kim K.; Anderson, Lori
Malaria proteins expressed on the surface of Plasmodium falciparum infected erythrocytes (IE) mediate adhesion and are targeted by protective immune responses. During pregnancy, IE sequester in the placenta. Placental IE bind to the molecule chondroitin sulfate A (CSA) and preferentially transcribe the gene that encodes VAR2CSA, a member of the PfEMP1 variant surface antigen family. Over successive pregnancies women develop specific immunity to CSA-binding IE and antibodies to VAR2CSA. We used tandem mass spectrometry together with accurate mass and time tag technology to study IE membrane fractions of placental parasites. VAR2CSA peptides were detected in placental IE and in IEmore » from children, but the MC variant of VAR2CSA was specifically associated with placental IE. We identified six conserved hypothetical proteins with putative TM or signal peptides that were exclusively expressed by the placental IE, and 11 such proteins that were significantly more abundant in placental IE. One of these hypothetical proteins, PFI1785w, is a 42kDa molecule detected by Western blot in parasites infecting pregnant women but not those infecting children.« less
Munde, Manoj; Poon, Gregory M. K.; Wilson, W. David
2013-01-01
Members of the ETS family of transcription factors regulate a functionally diverse array of genes. All ETS proteins share a structurally-conserved but sequence-divergent DNA-binding domain, known as the ETS domain. Although the structure and thermodynamics of the ETS-DNA complexes are well known, little is known about the kinetics of sequence recognition, a facet that offers potential insight into its molecular mechanism. We have characterized DNA binding by the ETS domain of PU.1 by biosensor-surface plasmon resonance (SPR). SPR analysis revealed a striking kinetic profile for DNA binding by the PU.1 ETS domain. At low salt concentrations, it binds high-affinity cognate DNA with a very slow association rate constant (≤105 M−1 s−1), compensated by a correspondingly small dissociation rate constant. The kinetics are strongly salt-dependent but mutually balance to produce a relatively weak dependence in the equilibrium constant. This profile contrasts sharply with reported data for other ETS domains (e.g., Ets-1, TEL) for which high-affinity binding is driven by rapid association (>107 M−1 s−1). We interpret this difference in terms of the hydration properties of ETS-DNA binding and propose that at least two mechanisms of sequence recognition are employed by this family of DNA-binding domain. Additionally, we use SPR to demonstrate the potential for pharmacological inhibition of sequence-specific ETS-DNA binding, using the minor groove-binding distamycin as a model compound. Our work establishes SPR as a valuable technique for extending our understanding of the molecular mechanisms of ETS-DNA interactions as well as developing potential small-molecule agents for biotechnological and therapeutic purposes. PMID:23416556
Alontaga, Aileen Y.; Fenton, Aron W.
2011-01-01
The binding site for allosteric inhibitor (amino acid) is highly conserved between human liver pyruvate kinase (hL-PYK) and the rabbit muscle isozyme (rM1-PYK). To detail similarities/differences in the allosteric function of these two homologs, we quantified the binding of 45 amino acid analogues to hL-PYK and their allosteric impact on affinity for the substrate, phosphoenolpyruvate (PEP). This complements a similar study previously completed for rM1-PYK. In hL-PYK, the minimum chemical requirements for effector binding are the same as those identified for rM1-PYK (i.e. the L-2-aminopropanaldehyde substructure of the effector is primarily responsible for binding). However different regions of the effector determine the magnitude of the allosteric response in hL-PYK vs. rM1-PYK. This finding is inconsistent with the idea that allosteric pathways are conserved between homologs of a protein family. PMID:21261284
Guillaume, Vanessa; Aslan, Hamide; Ainouze, Michelle; Guerbois, Mathilde; Wild, T Fabian; Buckland, Robin; Langedijk, Johannes P M
2006-08-01
As a preliminary to the localization of the receptor-binding site(s) on the Nipah virus (NiV) glycoprotein (NiV-G), we have undertaken the identification of NiV-G residues that play a role in fusion promotion. To achieve this, we have used two strategies. First, as NiV and Hendra virus (HeV) share a common receptor and their cellular tropism is similar, we hypothesized that residues functioning in receptor attachment could be conserved between their respective G proteins. Our initial strategy was to target charged residues (which can be expected to be at the surface of the protein) conserved between the NiV-G and HeV-G globular heads. Second, we generated NiV variants that escaped neutralization by anti-NiV-G monoclonal antibodies (MAbs) that neutralize NiV both in vitro and in vivo, likely by blocking receptor attachment. The sequencing of such "escape mutants" identified NiV-G residues present in the epitopes to which the neutralizing MAbs are directed. Residues identified via these two strategies whose mutation had an effect on fusion promotion were localized on a new structural model for the NiV-G protein. Our results suggest that seven NiV-G residues, including one (E533) that was identified using both strategies, form a contiguous site on the top of the globular head that is implicated in ephrinB2 binding. This site commences near the shallow depression in the center of the top surface of the globular head and extends to the rim of the barrel-like structure on the top loops of beta-sheet 5. The topology of this site is strikingly similar to that proposed to form the SLAM receptor site on another paramyxovirus attachment protein, that of the measles virus hemagglutinin.
Guillaume, Vanessa; Aslan, Hamide; Ainouze, Michelle; Guerbois, Mathilde; Fabian Wild, T.; Buckland, Robin; Langedijk, Johannes P. M.
2006-01-01
As a preliminary to the localization of the receptor-binding site(s) on the Nipah virus (NiV) glycoprotein (NiV-G), we have undertaken the identification of NiV-G residues that play a role in fusion promotion. To achieve this, we have used two strategies. First, as NiV and Hendra virus (HeV) share a common receptor and their cellular tropism is similar, we hypothesized that residues functioning in receptor attachment could be conserved between their respective G proteins. Our initial strategy was to target charged residues (which can be expected to be at the surface of the protein) conserved between the NiV-G and HeV-G globular heads. Second, we generated NiV variants that escaped neutralization by anti-NiV-G monoclonal antibodies (MAbs) that neutralize NiV both in vitro and in vivo, likely by blocking receptor attachment. The sequencing of such “escape mutants” identified NiV-G residues present in the epitopes to which the neutralizing MAbs are directed. Residues identified via these two strategies whose mutation had an effect on fusion promotion were localized on a new structural model for the NiV-G protein. Our results suggest that seven NiV-G residues, including one (E533) that was identified using both strategies, form a contiguous site on the top of the globular head that is implicated in ephrinB2 binding. This site commences near the shallow depression in the center of the top surface of the globular head and extends to the rim of the barrel-like structure on the top loops of β-sheet 5. The topology of this site is strikingly similar to that proposed to form the SLAM receptor site on another paramyxovirus attachment protein, that of the measles virus hemagglutinin. PMID:16840334
Hammond, John A.; Hauton, Chris; Bennett, Kimberley A.; Hall, Ailsa J.
2012-01-01
The cytokine hormone leptin is a key signalling molecule in many pathways that control physiological functions. Although leptin demonstrates structural conservation in mammals, there is evidence of positive selection in primates, lagomorphs and chiropterans. We previously reported that the leptin genes of the grey and harbour seals (phocids) have significantly diverged from other mammals. Therefore we further investigated the diversification of leptin in phocids, other marine mammals and terrestrial taxa by sequencing the leptin genes of representative species. Phylogenetic reconstruction revealed that leptin diversification was pronounced within the phocid seals with a high dN/dS ratio of 2.8, indicating positive selection. We found significant evidence of positive selection along the branch leading to the phocids, within the phocid clade, but not over the dataset as a whole. Structural predictions indicate that the individual residues under selection are away from the leptin receptor (LEPR) binding site. Predictions of the surface electrostatic potential indicate that phocid seal leptin is notably different to other mammalian leptins, including the otariids. Cloning the grey seal leptin binding domain of LEPR confirmed that this was structurally conserved. These data, viewed in toto, support a hypothesis that phocid leptin divergence is unlikely to have arisen by random mutation. Based upon these phylogenetic and structural assessments, and considering the comparative physiology and varying life histories among species, we postulate that the unique phocid diving behaviour has produced this selection pressure. The Phocidae includes some of the deepest diving species, yet have the least modified lung structure to cope with pressure and volume changes experienced at depth. Therefore, greater surfactant production is required to facilitate rapid lung re-inflation upon surfacing, while maintaining patent airways. We suggest that this additional surfactant requirement is met by the leptin pulmonary surfactant production pathway which normally appears only to function in the mammalian foetus. PMID:22536379
Fluorophore Labeled Kinase Detects Ligands That Bind within the MAPK Insert of p38α Kinase
Termathe, Martin; Grütter, Christian; Rabiller, Matthias; van Otterlo, Willem A. L.; Rauh, Daniel
2012-01-01
The vast majority of small molecules known to modulate kinase activity, target the highly conserved ATP-pocket. Consequently, such ligands are often less specific and in case of inhibitors, this leads to the inhibition of multiple kinases. Thus, selective modulation of kinase function remains a major hurdle. One of the next great challenges in kinase research is the identification of ligands which bind to less conserved sites and target the non-catalytic functions of protein kinases. However, approaches that allow for the unambiguous identification of molecules that bind to these less conserved sites are few in number. We have previously reported the use of fluorescent labels in kinases (FLiK) to develop direct kinase binding assays that exclusively detect ligands which stabilize inactive (DFG-out) kinase conformations. Here, we present the successful application of the FLiK approach to develop a high-throughput binding assay capable of directly monitoring ligand binding to a remote site within the MAPK insert of p38α mitogen-activated protein kinase (MAPK). Guided by the crystal structure of an initially identified hit molecule in complex with p38α, we developed a tight binding ligand which may serve as an ideal starting point for further investigations of the biological function of the MAPK insert in regulating the p38α signaling pathway. PMID:22768308
Moravcevic, Katarina; Alvarado, Diego; Schmitz, Karl R.; Kenniston, Jon A.; Mendrola, Jeannine M.; Ferguson, Kathryn M.; Lemmon, Mark A.
2015-01-01
SUMMARY F-BAR domains control membrane interactions in endocytosis, cytokinesis, and cell signaling. Although generally thought to bind curved membranes containing negatively charged phospholipids, numerous functional studies argue that differences in lipid-binding selectivities of F-BAR domains are functionally important. Here, we compare membrane-binding properties of the S. cerevisiae F-BAR domains in vitro and in vivo. Whereas some F-BAR domains (such as Bzz1p and Hof1p F-BARs) bind equally well to all phospholipids, the F-BAR domain from the RhoGAP Rgd1p preferentially binds phosphoinositides. We determined X-ray crystal structures of F-BAR domains from Hof1p and Rgd1p, the latter bound to an inositol phosphate. The structures explain phospholipid-binding selectivity differences, and reveal an F-BAR phosphoinositide binding site that is fully conserved in a mammalian RhoGAP called Gmip, and is partly retained in certain other F-BAR domains. Our findings reveal previously unappreciated determinants of F-BAR domain lipid-binding specificity, and provide a basis for its prediction from sequence. PMID:25620000
Marques, Alexandra T; Antunes, Agostinho; Fernandes, Pedro A; Ramos, Maria J
2006-01-01
Background The Aβ-binding alcohol dehydrogenase/17β-hydroxysteroid dehydrogenase type 10 (ABAD/HSD10) is an enzyme involved in pivotal metabolic processes and in the mitochondrial dysfunction seen in the Alzheimer's disease. Here we use comparative genomic analyses to study the evolution of the HADH2 gene encoding ABAD/HSD10 across several eukaryotic species. Results Both vertebrate and nematode HADH2 genes showed a six-exon/five-intron organization while those of the insects had a reduced and varied number of exons (two to three). Eutherian mammal HADH2 genes revealed some highly conserved noncoding regions, which may indicate the presence of functional elements, namely in the upstream region about 1 kb of the transcription start site and in the first part of intron 1. These regions were also conserved between Tetraodon and Fugu fishes. We identified a conserved alternative splicing event between human and dog, which have a nine amino acid deletion, causing the removal of the strand βF. This strand is one of the seven strands that compose the core β-sheet of the Rossman fold dinucleotide-binding motif characteristic of the short chain dehydrogenase/reductase (SDR) family members. However, the fact that the substrate binding cleft residues are retained and the existence of a shared variant between human and dog suggest that it might be functional. Molecular adaptation analyses across eutherian mammal orthologues revealed the existence of sites under positive selection, some of which being localized in the substrate-binding cleft and in the insertion 1 region on loop D (an important region for the Aβ-binding to the enzyme). Interestingly, a higher than expected number of nonsynonymous substitutions were observed between human/chimpanzee and orangutan, with six out of the seven amino acid replacements being under molecular adaptation (including three in loop D and one in the substrate binding loop). Conclusion Our study revealed that HADH2 genes maintained a reasonable conserved organization across a large evolutionary distance. The conserved noncoding regions identified among mammals and between pufferfishes, the evidence of an alternative splicing variant conserved between human and dog, and the detection of positive selection across eutherian mammals, may be of importance for further research on ABAD/HSD10 function and its implication in the Alzheimer's disease. PMID:16899120
Amaral, Paulo P; Leonardi, Tommaso; Han, Namshik; Viré, Emmanuelle; Gascoigne, Dennis K; Arias-Carrasco, Raúl; Büscher, Magdalena; Pandolfini, Luca; Zhang, Anda; Pluchino, Stefano; Maracaja-Coutinho, Vinicius; Nakaya, Helder I; Hemberg, Martin; Shiekhattar, Ramin; Enright, Anton J; Kouzarides, Tony
2018-03-15
The mammalian genome is transcribed into large numbers of long noncoding RNAs (lncRNAs), but the definition of functional lncRNA groups has proven difficult, partly due to their low sequence conservation and lack of identified shared properties. Here we consider promoter conservation and positional conservation as indicators of functional commonality. We identify 665 conserved lncRNA promoters in mouse and human that are preserved in genomic position relative to orthologous coding genes. These positionally conserved lncRNA genes are primarily associated with developmental transcription factor loci with which they are coexpressed in a tissue-specific manner. Over half of positionally conserved RNAs in this set are linked to chromatin organization structures, overlapping binding sites for the CTCF chromatin organiser and located at chromatin loop anchor points and borders of topologically associating domains (TADs). We define these RNAs as topological anchor point RNAs (tapRNAs). Characterization of these noncoding RNAs and their associated coding genes shows that they are functionally connected: they regulate each other's expression and influence the metastatic phenotype of cancer cells in vitro in a similar fashion. Furthermore, we find that tapRNAs contain conserved sequence domains that are enriched in motifs for zinc finger domain-containing RNA-binding proteins and transcription factors, whose binding sites are found mutated in cancers. This work leverages positional conservation to identify lncRNAs with potential importance in genome organization, development and disease. The evidence that many developmental transcription factors are physically and functionally connected to lncRNAs represents an exciting stepping-stone to further our understanding of genome regulation.
Jones, Harrison G; Ritschel, Tina; Pascual, Gabriel; Brakenhoff, Just P J; Keogh, Elissa; Furmanova-Hollenstein, Polina; Lanckacker, Ellen; Wadia, Jehangir S; Gilman, Morgan S A; Williamson, R Anthony; Roymans, Dirk; van 't Wout, Angélique B; Langedijk, Johannes P; McLellan, Jason S
2018-03-01
Respiratory syncytial virus (RSV) is a major cause of severe lower respiratory tract infections in infants and the elderly, and yet there remains no effective treatment or vaccine. The surface of the virion is decorated with the fusion glycoprotein (RSV F) and the attachment glycoprotein (RSV G), which binds to CX3CR1 on human airway epithelial cells to mediate viral attachment and subsequent infection. RSV G is a major target of the humoral immune response, and antibodies that target the central conserved region of G have been shown to neutralize both subtypes of RSV and to protect against severe RSV disease in animal models. However, the molecular underpinnings for antibody recognition of this region have remained unknown. Therefore, we isolated two human antibodies directed against the central conserved region of RSV G and demonstrated that they neutralize RSV infection of human bronchial epithelial cell cultures in the absence of complement. Moreover, the antibodies protected cotton rats from severe RSV disease. Both antibodies bound with high affinity to a secreted form of RSV G as well as to a peptide corresponding to the unglycosylated central conserved region. High-resolution crystal structures of each antibody in complex with the G peptide revealed two distinct conformational epitopes that require proper folding of the cystine noose located in the C-terminal part of the central conserved region. Comparison of these structures with the structure of fractalkine (CX3CL1) alone or in complex with a viral homolog of CX3CR1 (US28) suggests that RSV G would bind to CX3CR1 in a mode that is distinct from that of fractalkine. Collectively, these results build on recent studies demonstrating the importance of RSV G in antibody-mediated protection from severe RSV disease, and the structural information presented here should guide the development of new vaccines and antibody-based therapies for RSV.
Jones, Harrison G.; Brakenhoff, Just P. J.; Furmanova-Hollenstein, Polina; Wadia, Jehangir S.; Gilman, Morgan S. A.; Roymans, Dirk
2018-01-01
Respiratory syncytial virus (RSV) is a major cause of severe lower respiratory tract infections in infants and the elderly, and yet there remains no effective treatment or vaccine. The surface of the virion is decorated with the fusion glycoprotein (RSV F) and the attachment glycoprotein (RSV G), which binds to CX3CR1 on human airway epithelial cells to mediate viral attachment and subsequent infection. RSV G is a major target of the humoral immune response, and antibodies that target the central conserved region of G have been shown to neutralize both subtypes of RSV and to protect against severe RSV disease in animal models. However, the molecular underpinnings for antibody recognition of this region have remained unknown. Therefore, we isolated two human antibodies directed against the central conserved region of RSV G and demonstrated that they neutralize RSV infection of human bronchial epithelial cell cultures in the absence of complement. Moreover, the antibodies protected cotton rats from severe RSV disease. Both antibodies bound with high affinity to a secreted form of RSV G as well as to a peptide corresponding to the unglycosylated central conserved region. High-resolution crystal structures of each antibody in complex with the G peptide revealed two distinct conformational epitopes that require proper folding of the cystine noose located in the C-terminal part of the central conserved region. Comparison of these structures with the structure of fractalkine (CX3CL1) alone or in complex with a viral homolog of CX3CR1 (US28) suggests that RSV G would bind to CX3CR1 in a mode that is distinct from that of fractalkine. Collectively, these results build on recent studies demonstrating the importance of RSV G in antibody-mediated protection from severe RSV disease, and the structural information presented here should guide the development of new vaccines and antibody-based therapies for RSV. PMID:29509814
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu, Rui; McBride, Ryan; Paulson, James C.
2010-03-04
The hemagglutinin (HA) envelope protein of influenza viruses mediates essential viral functions, including receptor binding and membrane fusion, and is the major viral antigen for antibody neutralization. The 1957 H2N2 subtype (Asian flu) was one of the three great influenza pandemics of the last century and caused 1 million deaths globally from 1957 to 1968. Three crystal structures of 1957 H2 HAs have been determined at 1.60 to 1.75 {angstrom} resolutions to investigate the structural basis for their antigenicity and evolution from avian to human binding specificity that contributed to its introduction into the human population. These structures, which representmore » the highest resolutions yet recorded for a complete ectodomain of a glycosylated viral surface antigen, along with the results of glycan microarray binding analysis, suggest that a hydrophobicity switch at residue 226 and elongation of receptor-binding sites were both critical for avian H2 HA to acquire human receptor specificity. H2 influenza viruses continue to circulate in birds and pigs and, therefore, remain a substantial threat for transmission to humans. The H2 HA structure also reveals a highly conserved epitope that could be harnessed in the design of a broader and more universal influenza A virus vaccine.« less
Wieczorek, Anna; McHenry, Charles S
2006-05-05
The alpha subunit of the replicase of all bacteria contains a php domain, initially identified by its similarity to histidinol phosphatase but of otherwise unknown function (Aravind, L., and Koonin, E. V. (1998) Nucleic Acids Res. 26, 3746-3752). Deletion of 60 residues from the NH2 terminus of the alpha php domain destroys epsilon binding. The minimal 255-residue php domain, estimated by sequence alignment with homolog YcdX, is insufficient for epsilon binding. However, a 320-residue segment including sequences that immediately precede the polymerase domain binds epsilon with the same affinity as the 1160-residue full-length alpha subunit. A subset of mutations of a conserved acidic residue (Asp43 in Escherichia coli alpha) present in the php domain of all bacterial replicases resulted in defects in epsilon binding. Using sequence alignments, we show that the prototypical gram+ Pol C, which contains the polymerase and proofreading activities within the same polypeptide chain, has an epsilon-like sequence inserted in a surface loop near the center of the homologous YcdX protein. These findings suggest that the php domain serves as a platform to enable coordination of proofreading and polymerase activities during chromosomal replication.
Structural basis for the recognition of Asef by adenomatous polyposis coli
Zhang, Zhenyi; Chen, Leyi; Gao, Lei; Lin, Kui; Zhu, Liang; Lu, Yang; Shi, Xiaoshan; Gao, Yuan; Zhou, Jing; Xu, Ping; Zhang, Jian; Wu, Geng
2012-01-01
Adenomatous polyposis coli (APC) regulates cell-cell adhesion and cell migration through activating the APC-stimulated guanine nucleotide-exchange factor (GEF; Asef), which is usually autoinhibited through the binding between its Src homology 3 (SH3) and Dbl homology (DH) domains. The APC-activated Asef stimulates the small GTPase Cdc42, which leads to decreased cell-cell adherence and enhanced cell migration. In colorectal cancers, truncated APC constitutively activates Asef and promotes cancer cell migration and angiogenesis. Here, we report crystal structures of the human APC/Asef complex. We find that the armadillo repeat domain of APC uses a highly conserved surface groove to recognize the APC-binding region (ABR) of Asef, conformation of which changes dramatically upon binding to APC. Key residues on APC and Asef for the complex formation were mutated and their importance was demonstrated by binding and activity assays. Structural superimposition of the APC/Asef complex with autoinhibited Asef suggests that the binding between APC and Asef might create a steric clash between Asef-DH domain and APC, which possibly leads to a conformational change in Asef that stimulates its GEF activity. Our structures thus elucidate the molecular mechanism of Asef recognition by APC, as well as provide a potential target for pharmaceutical intervention against cancers. PMID:21788986
Heparin octasaccharide decoy liposomes inhibit replication of multiple viruses.
Hendricks, Gabriel L; Velazquez, Lourdes; Pham, Serena; Qaisar, Natasha; Delaney, James C; Viswanathan, Karthik; Albers, Leila; Comolli, James C; Shriver, Zachary; Knipe, David M; Kurt-Jones, Evelyn A; Fygenson, Deborah K; Trevejo, Jose M; Wang, Jennifer P; Finberg, Robert W
2015-04-01
Heparan sulfate (HS) is a ubiquitous glycosaminoglycan that serves as a cellular attachment site for a number of significant human pathogens, including respiratory syncytial virus (RSV), human parainfluenza virus 3 (hPIV3), and herpes simplex virus (HSV). Decoy receptors can target pathogens by binding to the receptor pocket on viral attachment proteins, acting as 'molecular sinks' and preventing the pathogen from binding to susceptible host cells. Decoy receptors functionalized with HS could bind to pathogens and prevent infection, so we generated decoy liposomes displaying HS-octasaccharide (HS-octa). These decoy liposomes significantly inhibited RSV, hPIV3, and HSV infectivity in vitro to a greater degree than the original HS-octa building block. The degree of inhibition correlated with the density of HS-octa displayed on the liposome surface. Decoy liposomes with HS-octa inhibited infection of viruses to a greater extent than either full-length heparin or HS-octa alone. Decoy liposomes were effective when added prior to infection or following the initial infection of cells in vitro. By targeting the well-conserved receptor-binding sites of HS-binding viruses, decoy liposomes functionalized with HS-octa are a promising therapeutic antiviral agent and illustrate the utility of the liposome delivery platform. Copyright © 2015 Elsevier B.V. All rights reserved.
Chen, Lin; Zheng, Qing-Chuan; Zhang, Hong-Xing
2015-02-28
A novel, highly conserved chromatin protein, Cren7 is involved in regulating essential cellular processes such as transcription, replication and repair. Although mutations in the DNA-binding loop of Cren7 destabilize the structure and reduce DNA-binding activity, the details are not very clear. Focusing on the specific Cren7-dsDNA complex (PDB code ), we applied molecular dynamics (MD) simulations and the molecular mechanics Poisson-Boltzmann surface area (MM-PBSA) free energy calculations to explore the structural and dynamic effects of W26A, L28A, and K53A mutations in comparison to the wild-type protein. The energetic analysis indicated that the intermolecular van der Waals interaction and nonpolar solvation energy play an important role in the binding process of Cren7 and dsDNA. Compared with the wild type Cren7, all the studied mutants W26A, L28A, and K53A have obviously reduced binding free energies with dsDNA in the reduction of the polar and/or nonpolar interactions. These results further elucidated the previous experiments to understand the Cren7-DNA interaction comprehensively. Our work also would provide support for an understanding of the interactions of proteins with nucleic acids.
Evolutionarily conserved structural and functional roles of the FYVE domain.
Hayakawa, Akira; Hayes, Susan; Leonard, Deborah; Lambright, David; Corvera, Silvia
2007-01-01
The FYVE domain is an approx. 80 amino acid motif that binds to the phosphoinositide PtdIns3P with high specificity and affinity. It is present in 38 predicted gene products within the human genome, but only in 12-13 in Caenorhabditis elegans and Drosophila melanogaster. Eight of these are highly conserved in all three organisms, and they include proteins that have not been characterized in any species. One of these, WDFY2, appears to play an important role in early endocytosis and was revealed in a RNAi (RNA interference) screen in C. elegans. Interestingly, some proteins contain FYVE-like domains in C. elegans and D. melanogaster, but have lost this domain during evolution. One of these is the homologue of Rabatin-5, a protein that, in mammalian cells, binds both Rab5 and Rabex-5, a guanine-nucleotide exchange factor for Rab5. Thus the Rabatin-5 homologue suggests that mechanisms to link PtdIns3P and Rab5 activation developed in evolution. In mammalian cells, these mechanisms are apparent in the existence of proteins that bind PtdIns3P and Rab GTPases, such as EEA1, Rabenosyn-5 and Rabip4'. Despite the comparable ability to bind to PtdIns3P in vitro, FYVE domains display widely variable abilities to interact with endosomes in intact cells. This variation is due to three distinct properties of FYVE domains conferred by residues that are not involved in PtdIns3P head group recognition: These properties are: (i) the propensity to oligomerize, (ii) the ability to insert into the membrane bilayer, and (iii) differing electrostatic interactions with the bilayer surface. The different binding properties are likely to regulate the extent and duration of the interaction of specific FYVE domain-containing proteins with early endosomes, and thereby their biological function.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Li; DeRider, Michele; McCornack, Milissa A.
Chemokines (chemotactic cytokines) comprise a large family of proteins that recruit and activate leukocytes, giving chemokines a major role in both the immune response and inflammation-related diseases. The poxvirus-encoded viral CC chemokine inhibitor (vCCI) binds to many CC chemokines with high affinity, acting as a potent inhibitor of chemokine action. We have used heteronuclear multidimensional NMR to determine the first structure of an orthopoxvirus vCCI in complex with a human CC chemokine MIP-1β. vCCI binds to the chemokine with 1:1 stoichiometry, using residues from its β-sheet II to interact with the a surface of MIP-1β that includes the N-terminus, themore » following residues in the so-called N-loop20’s region, and the 40’s loop. This structure reveals a general strategy of vCCI for selective chemokine binding, as vCCI appears to interact most stronglyinteracts most directly with residues that are conserved among a subset of CC chemokines, but are not conservednot among the other chemokine subfamilies. This structure reveals a general strategy of vCCI for selective chemokine binding. Chemokines play critical roles in the immune system, causing chemotaxis of a variety of cells to sites of infection and inflammation, as well as mediating cell homing and immune system development 1(Baggiolini 2001). To date, about 50 chemokines have been identified, and these small proteins (7-14 kDa) are believed to function by binding with endothelial or matrix glycosaminoglycans to form a concentration gradient that is then sensed by high affinity, 7-transmembrane domain G-protein coupled chemokine receptors on the surface of immune cells surface. The chemokine system is critical for host defense in healthy individuals, butand can also lead to diseases including asthma, arthritis, and atherosclerosis in the case of malfunction, often due to inappropriate inflammation and subsequent tissue damage 2(Gerard and Rollins 2001). There are four subfamilies of chemokines, CC, CXC, C, and CX3C, named for the position of conserved N-terminal cysteine residues. Members of the same subfamily often have overlapping receptor binding and cell activation ability while different subfamilies tend to functionwork on different cell subsets1{Baggiolini, 2001 #472} (REF). For example, CC chemokines mostly interact with monocytes, macrophages, T cells and eosinophils, while CXC chemokines mainly interact with neutrophils. Structures of chemokines from different subfamilies have been solved by NMR and X-ray crystallography (XXX Include Fernandez and Lolis review) 3-9{Clore, 1990 #91;Skelton, 1995 #97;Handel, 1996 #93;Crump, 1997 #92;Crump, 1998 #248;Meunier, 1997 #96;Fernandez, 2002 #496}(Clore 1990; Skelton 1995; Handel and Domaille 1996; Crump, Gong et al. 1997; Meunier 1997; Crump, Rajarathnam et al. 1998)(Clore 1990; Skelton 1995; Handel and Domaille 1996; Crump et al. 1997; Meunier 1997; Crump et al. 1998).« less
Stereophysicochemical variability plots highlight conserved antigenic areas in Flaviviruses
Schein, Catherine H; Zhou, Bin; Braun, Werner
2005-01-01
Background Flaviviruses, which include Dengue (DV) and West Nile (WN), mutate in response to immune system pressure. Identifying escape mutants, variant progeny that replicate in the presence of neutralizing antibodies, is a common way to identify functionally important residues of viral proteins. However, the mutations typically occur at variable positions on the viral surface that are not essential for viral replication. Methods are needed to determine the true targets of the neutralizing antibodies. Results Stereophysicochemical variability plots (SVPs), 3-D images of protein structures colored according to variability, as determined by our PCPMer program, were used to visualize residues conserved in their physical chemical properties (PCPs) near escape mutant positions. The analysis showed 1) that escape mutations in the flavivirus envelope protein are variable residues by our criteria and 2) two escape mutants found at the same position in many flaviviruses sit above clusters of conserved residues from different regions of the linear sequence. Conservation patterns in T-cell epitopes in the NS3- protease suggest a similar mechanism of immune system evasion. Conclusion The SVPs add another dimension to structurally defining the binding sites of neutralizing antibodies. They provide a useful aid for determining antigenically important regions and designing vaccines. PMID:15845145
Prokop, Jeremy W.; Santos, Robson A. S.; Milsted, Amy
2013-01-01
The renin-angiotensin system is involved in multiple conditions ranging from cardiovascular disorders to cancer. Components of the pathway, including ACE, renin and angiotensin receptors are targets for disease treatment. This study addresses three receptors of the pathway: AT1, AT2, and MAS and how the receptors are similar and differ in activation by angiotensin peptides. Combining biochemical and amino acid variation data with multiple species sequence alignments, structural models, and docking site predictions allows for visualization of how angiotensin peptides may bind and activate the receptors; allowing identification of conserved and variant mechanisms in the receptors. MAS differs from AT1 favoring Ang-(1–7) and not Ang II binding, while AT2 recently has been suggested to preferentially bind Ang III. A new model of Ang peptide binding to AT1 and AT2 is proposed that correlates data from site directed mutagenesis and photolabled experiments that were previously considered conflicting. Ang II binds AT1 and AT2 through a conserved initial binding mode involving amino acids 111 (consensus 325) of AT1 (Asn) interacting with Tyr (4) of Ang II and 199 and 256 (consensus 512 and 621, a Lys and His respectively) interacting with Phe (8) of Ang II. In MAS these sites are not conserved, leading to differential binding and activation by Ang-(1–7). In both AT1 and AT2, the Ang II peptide may internalize through Phe (8) of Ang II propagating through the receptors’ conserved aromatic amino acids to the final photolabled positioning relative to either AT1 (amino acid 294, Asn, consensus 725) or AT2 (138, Leu, consensus 336). Understanding receptor activation provides valuable information for drug design and identification of other receptors that can potentially bind Ang peptides. PMID:23755216
Surface salt bridges modulate DNA wrapping by the type II DNA-binding protein TF1.
Grove, Anne
2003-07-29
The histone-like protein HU is involved in compaction of the bacterial genome. Up to 37 bp of DNA may be wrapped about some HU homologues in a process that has been proposed to depend on a linked disruption of surface salt bridges that liberates cationic side chains for interaction with the DNA. Despite significant sequence conservation between HU homologues, binding sites from 9 to 37 bp have been reported. TF1, an HU homologue that is encoded by Bacillus subtilis bacteriophage SPO1, has nM affinity for 37 bp preferred sites in DNA with 5-hydroxymethyluracil (hmU) in place of thymine. On the basis of electrophoretic mobility shift assays, we show that TF1-DNA complex formation is associated with a net release of only approximately 0.5 cations. The structure of TF1 suggests that Asp13 can form a dehydrated surface salt bridge with Lys23; substitution of Asp13 with Ala increases the net release of cations to approximately 1. These data are consistent with complex formation linked to disruption of surface salt bridges. Substitution of Glu90 with Ala, which would expose Lys87 predicted to contact DNA immediately distal to a proline-mediated DNA kink, causes an increase in affinity and an abrogation of the preference for hmU-containing DNA. We propose that hmU preference is due to finely tuned interactions at the sites of kinking that expose a differential flexibility of hmU- and T-containing DNA. Our data further suggest that the difference in binding site size for HU homologues is based on a differential ability to stabilize the DNA kinks.
El-Diwany, Ramy; Cohen, Valerie J; Mankowski, Madeleine C; Wasilewski, Lisa N; Brady, Jillian K; Snider, Anna E; Osburn, William O; Murrell, Ben; Ray, Stuart C; Bailey, Justin R
2017-02-01
Broadly-neutralizing monoclonal antibodies (bNAbs) may guide vaccine development for highly variable viruses including hepatitis C virus (HCV), since they target conserved viral epitopes that could serve as vaccine antigens. However, HCV resistance to bNAbs could reduce the efficacy of a vaccine. HC33.4 and AR4A are two of the most potent anti-HCV human bNAbs characterized to date, binding to highly conserved epitopes near the amino- and carboxy-terminus of HCV envelope (E2) protein, respectively. Given their distinct epitopes, it was surprising that these bNAbs showed similar neutralization profiles across a panel of natural HCV isolates, suggesting that some viral polymorphisms may confer resistance to both bNAbs. To investigate this resistance, we developed a large, diverse panel of natural HCV envelope variants and a novel computational method to identify bNAb resistance polymorphisms in envelope proteins (E1 and E2). By measuring neutralization of a panel of HCV pseudoparticles by 10 μg/mL of each bNAb, we identified E1E2 variants with resistance to one or both bNAbs, despite 100% conservation of the AR4A binding epitope across the panel. We discovered polymorphisms outside of either binding epitope that modulate resistance to both bNAbs by altering E2 binding to the HCV co-receptor, scavenger receptor B1 (SR-B1). This study is focused on a mode of neutralization escape not addressed by conventional analysis of epitope conservation, highlighting the contribution of extra-epitopic polymorphisms to bNAb resistance and presenting a novel mechanism by which HCV might persist even in the face of an antibody response targeting multiple conserved epitopes.
The dark side of the ring: role of the DNA sliding surface of PCNA.
De March, Matteo; De Biasio, Alfredo
2017-12-01
The proliferating cell nuclear antigen (PCNA) sliding clamp lies at the heart of the accurate duplication of eukaryotic genomes. While the outer surface of the PCNA ring interacts with polymerases and other factors, the role of the inner wall facing the DNA is elusive. Recent evidence shows that conserved basic residues in the PCNA central channel create a specific surface that recognizes the DNA backbone and enables the clamp to slide by rotationally tracking the DNA helix. The sliding surface can be modulated (i) through lysine acetylation, which triggers PCNA degradation during nucleotide excision repair (NER) and stimulates repair by homologous recombination (HR) or (ii) through binding of the protein factor p15 PAF , which turns off DNA lesion bypass. Thus, the inner surface of PCNA is unexpectedly highly regulated to control resistance to DNA damage. From a structural viewpoint, we reflect on these findings that open a new perspective on PCNA function and offer opportunities to develop tools to manipulate the DNA damage response in cancer treatment.
2010-01-01
Background The Botrytis cinerea xylanase Xyn11A has been previously shown to be required for full virulence of this organism despite its poor contribution to the secreted xylanase activity and the low xylan content of B. cinerea hosts. Intriguingly, xylanases from other fungi have been shown to have the property, independent of the xylan degrading activity, to induce necrosis when applied to plant tissues, so we decided to test the hypothesis that secreted Xyn11A contributes to virulence by promoting the necrosis of the plant tissue surrounding the infection, therefore facilitating the growth of this necrotroph. Results We show here that Xyn11A has necrotizing activity on plants and that this capacity is conserved in site-directed mutants of the protein lacking the catalytic activity. Besides, Xyn11A contributes to the infection process with the necrotizing and not with the xylan hydrolyzing activity, as the catalytically-impaired Xyn11A variants were able to complement the lower virulence of the xyn11A mutant. The necrotizing activity was mapped to a 30-amino acids peptide in the protein surface, and this region was also shown to mediate binding to tobacco spheroplasts by itself. Conclusions The main contribution of the xylanase Xyn11A to the infection process of B. cinerea is to induce necrosis of the infected plant tissue. A conserved 30-amino acids region on the enzyme surface, away from the xylanase active site, is responsible for this effect and mediates binding to plant cells. PMID:20184750
Eriksson, Sylvia K.; Kutzer, Michael; Procek, Jan; Gröbner, Gerhard; Harryson, Pia
2011-01-01
Dehydrins are intrinsically disordered plant proteins whose expression is upregulated under conditions of desiccation and cold stress. Their molecular function in ensuring plant survival is not yet known, but several studies suggest their involvement in membrane stabilization. The dehydrins are characterized by a broad repertoire of conserved and repetitive sequences, out of which the archetypical K-segment has been implicated in membrane binding. To elucidate the molecular mechanism of these K-segments, we examined the interaction between lipid membranes and a dehydrin with a basic functional sequence composition: Lti30, comprising only K-segments. Our results show that Lti30 interacts electrostatically with vesicles of both zwitterionic (phosphatidyl choline) and negatively charged phospholipids (phosphatidyl glycerol, phosphatidyl serine, and phosphatidic acid) with a stronger binding to membranes with high negative surface potential. The membrane interaction lowers the temperature of the main lipid phase transition, consistent with Lti30’s proposed role in cold tolerance. Moreover, the membrane binding promotes the assembly of lipid vesicles into large and easily distinguishable aggregates. Using these aggregates as binding markers, we identify three factors that regulate the lipid interaction of Lti30 in vitro: (1) a pH dependent His on/off switch, (2) phosphorylation by protein kinase C, and (3) reversal of membrane binding by proteolytic digest. PMID:21665998
Conserved neutralizing epitope at globular head of hemagglutinin in H3N2 influenza viruses.
Iba, Yoshitaka; Fujii, Yoshifumi; Ohshima, Nobuko; Sumida, Tomomi; Kubota-Koketsu, Ritsuko; Ikeda, Mariko; Wakiyama, Motoaki; Shirouzu, Mikako; Okada, Jun; Okuno, Yoshinobu; Kurosawa, Yoshikazu; Yokoyama, Shigeyuki
2014-07-01
Neutralizing antibodies that target the hemagglutinin of influenza virus either inhibit binding of hemagglutinin to cellular receptors or prevent the low-pH-induced conformational change in hemagglutinin required for membrane fusion. In general, the former type of antibody binds to the globular head formed by HA1 and has narrow strain specificity, while the latter type binds to the stem mainly formed by HA2 and has broad strain specificity. In the present study, we analyzed the epitope and function of a broadly neutralizing human antibody against H3N2 viruses, F005-126. The crystal structure of F005-126 Fab in complex with hemagglutinin revealed that the antibody binds to the globular head, spans a cleft formed by two hemagglutinin monomers in a hemagglutinin trimer, and cross-links them. It recognizes two peptide portions (sites L and R) and a glycan linked to asparagine at residue 285 using three complementarity-determining regions and framework 3 in the heavy chain. Binding of the antibody to sites L (residues 171 to 173, 239, and 240) and R (residues 91, 92, 270 to 273, 284, and 285) is mediated mainly by van der Waals contacts with the main chains of the peptides in these sites and secondarily by hydrogen bonds with a few side chains of conserved sequences in HA1. Furthermore, the glycan recognized by F005-126 is conserved among H3N2 viruses. F005-126 has the ability to prevent low-pH-induced conformational changes in hemagglutinin. The newly identified conserved epitope, including the glycan, should be immunogenic in humans and may induce production of broadly neutralizing antibodies against H3 viruses. Antibodies play an important role in protection against influenza virus, and hemagglutinin is the major target for virus neutralizing antibodies. It has long been believed that all effective neutralizing antibodies bind to the surrounding regions of the sialic acid-binding pocket and inhibit the binding of hemagglutinin to the cellular receptor. Since mutations are readily introduced into such epitopes, this type of antibody shows narrow strain specificity. Recently, however, broadly neutralizing antibodies have been isolated. Most of these bind either to conserved sites in the stem region or to the sialic acid-binding pocket itself. In the present study, we identified a new neutralizing epitope in the head region recognized by a broadly neutralizing human antibody against H3N2. This epitope may be useful for design of vaccines. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Conserved Neutralizing Epitope at Globular Head of Hemagglutinin in H3N2 Influenza Viruses
Iba, Yoshitaka; Fujii, Yoshifumi; Ohshima, Nobuko; Sumida, Tomomi; Kubota-Koketsu, Ritsuko; Ikeda, Mariko; Wakiyama, Motoaki; Shirouzu, Mikako; Okada, Jun; Okuno, Yoshinobu; Yokoyama, Shigeyuki
2014-01-01
ABSTRACT Neutralizing antibodies that target the hemagglutinin of influenza virus either inhibit binding of hemagglutinin to cellular receptors or prevent the low-pH-induced conformational change in hemagglutinin required for membrane fusion. In general, the former type of antibody binds to the globular head formed by HA1 and has narrow strain specificity, while the latter type binds to the stem mainly formed by HA2 and has broad strain specificity. In the present study, we analyzed the epitope and function of a broadly neutralizing human antibody against H3N2 viruses, F005-126. The crystal structure of F005-126 Fab in complex with hemagglutinin revealed that the antibody binds to the globular head, spans a cleft formed by two hemagglutinin monomers in a hemagglutinin trimer, and cross-links them. It recognizes two peptide portions (sites L and R) and a glycan linked to asparagine at residue 285 using three complementarity-determining regions and framework 3 in the heavy chain. Binding of the antibody to sites L (residues 171 to 173, 239, and 240) and R (residues 91, 92, 270 to 273, 284, and 285) is mediated mainly by van der Waals contacts with the main chains of the peptides in these sites and secondarily by hydrogen bonds with a few side chains of conserved sequences in HA1. Furthermore, the glycan recognized by F005-126 is conserved among H3N2 viruses. F005-126 has the ability to prevent low-pH-induced conformational changes in hemagglutinin. The newly identified conserved epitope, including the glycan, should be immunogenic in humans and may induce production of broadly neutralizing antibodies against H3 viruses. IMPORTANCE Antibodies play an important role in protection against influenza virus, and hemagglutinin is the major target for virus neutralizing antibodies. It has long been believed that all effective neutralizing antibodies bind to the surrounding regions of the sialic acid-binding pocket and inhibit the binding of hemagglutinin to the cellular receptor. Since mutations are readily introduced into such epitopes, this type of antibody shows narrow strain specificity. Recently, however, broadly neutralizing antibodies have been isolated. Most of these bind either to conserved sites in the stem region or to the sialic acid-binding pocket itself. In the present study, we identified a new neutralizing epitope in the head region recognized by a broadly neutralizing human antibody against H3N2. This epitope may be useful for design of vaccines. PMID:24719430
Zalewski, Jenna K.; Mo, Joshua H.; Heber, Simone; ...
2016-10-10
Shroom-mediated remodeling of the actomyosin cytoskeleton is a critical driver of cellular shape and tissue morphology that underlies the development of many tissues including the neural tube, eye, intestines, and vasculature. Shroom uses a conserved SD2 domain to direct the subcellular localization of Rho-associated kinase (Rock), which in turn drives changes in the cytoskeleton and cellular morphology through its ability to phosphorylate and activate non-muscle myosin II. Here in this paper, we present the structure of the human Shroom-Rock binding module, revealing an unexpected stoichiometry for Shroom in which two Shroom SD2 domains bind independent surfaces on Rock. Mutation ofmore » interfacial residues impaired Shroom-Rock binding in vitro and resulted in altered remodeling of the cytoskeleton and loss of Shroom-mediated changes in cellular morphology. In addition, we provide the first direct evidence that Shroom can function as a Rock activator. These data provide molecular insight into the Shroom-Rock interface and demonstrate that Shroom directly participates in regulating cytoskeletal dynamics, adding to its known role in Rock localization.« less
Michelow, Ian C; Dong, Mingdong; Mungall, Bruce A; Yantosca, L Michael; Lear, Calli; Ji, Xin; Karpel, Marshall; Rootes, Christina L; Brudner, Matthew; Houen, Gunnar; Eisen, Damon P; Kinane, T Bernard; Takahashi, Kazue; Stahl, Gregory L; Olinger, Gene G; Spear, Gregory T; Ezekowitz, R Alan B; Schmidt, Emmett V
2010-08-06
Ebola viruses constitute a newly emerging public threat because they cause rapidly fatal hemorrhagic fevers for which no treatment exists, and they can be manipulated as bioweapons. We targeted conserved N-glycosylated carbohydrate ligands on viral envelope surfaces using novel immune therapies. Mannose-binding lectin (MBL) and L-ficolin (L-FCN) were selected because they function as opsonins and activate complement. Given that MBL has a complex quaternary structure unsuitable for large scale cost-effective production, we sought to develop a less complex chimeric fusion protein with similar ligand recognition and enhanced effector functions. We tested recombinant human MBL and three L-FCN/MBL variants that contained the MBL carbohydrate recognition domain and varying lengths of the L-FCN collagenous domain. Non-reduced chimeric proteins formed predominantly nona- and dodecameric oligomers, whereas recombinant human MBL formed octadecameric and larger oligomers. Surface plasmon resonance revealed that L-FCN/MBL76 had the highest binding affinities for N-acetylglucosamine-bovine serum albumin and mannan. The same chimeric protein displayed superior complement C4 cleavage and binding to calreticulin (cC1qR), a putative receptor for MBL. L-FCN/MBL76 reduced infection by wild type Ebola virus Zaire significantly greater than the other molecules. Tapping mode atomic force microscopy revealed that L-FCN/MBL76 was significantly less tall than the other molecules despite similar polypeptide lengths. We propose that alterations in the quaternary structure of L-FCN/MBL76 resulted in greater flexibility in the collagenous or neck region. Similarly, a more pliable molecule might enhance cooperativity between the carbohydrate recognition domains and their cognate ligands, complement activation, and calreticulin binding dynamics. L-FCN/MBL chimeric proteins should be considered as potential novel therapeutics.
Zhou, Jia; Sears, Renee L; Xing, Xiaoyun; Zhang, Bo; Li, Daofeng; Rockweiler, Nicole B; Jang, Hyo Sik; Choudhary, Mayank N K; Lee, Hyung Joo; Lowdon, Rebecca F; Arand, Jason; Tabers, Brianne; Gu, C Charles; Cicero, Theodore J; Wang, Ting
2017-09-12
Uncovering mechanisms of epigenome evolution is an essential step towards understanding the evolution of different cellular phenotypes. While studies have confirmed DNA methylation as a conserved epigenetic mechanism in mammalian development, little is known about the conservation of tissue-specific genome-wide DNA methylation patterns. Using a comparative epigenomics approach, we identified and compared the tissue-specific DNA methylation patterns of rat against those of mouse and human across three shared tissue types. We confirmed that tissue-specific differentially methylated regions are strongly associated with tissue-specific regulatory elements. Comparisons between species revealed that at a minimum 11-37% of tissue-specific DNA methylation patterns are conserved, a phenomenon that we define as epigenetic conservation. Conserved DNA methylation is accompanied by conservation of other epigenetic marks including histone modifications. Although a significant amount of locus-specific methylation is epigenetically conserved, the majority of tissue-specific DNA methylation is not conserved across the species and tissue types that we investigated. Examination of the genetic underpinning of epigenetic conservation suggests that primary sequence conservation is a driving force behind epigenetic conservation. In contrast, evolutionary dynamics of tissue-specific DNA methylation are best explained by the maintenance or turnover of binding sites for important transcription factors. Our study extends the limited literature of comparative epigenomics and suggests a new paradigm for epigenetic conservation without genetic conservation through analysis of transcription factor binding sites.
Role of Conserved Glycine in Zinc-dependent Medium Chain Dehydrogenase/Reductase Superfamily*
Tiwari, Manish Kumar; Singh, Raushan Kumar; Singh, Ranjitha; Jeya, Marimuthu; Zhao, Huimin; Lee, Jung-Kul
2012-01-01
The medium-chain dehydrogenase/reductase (MDR) superfamily consists of a large group of enzymes with a broad range of activities. Members of this superfamily are currently the subject of intensive investigation, but many aspects, including the zinc dependence of MDR superfamily proteins, have not yet have been adequately investigated. Using a density functional theory-based screening strategy, we have identified a strictly conserved glycine residue (Gly) in the zinc-dependent MDR superfamily. To elucidate the role of this conserved Gly in MDR, we carried out a comprehensive structural, functional, and computational analysis of four MDR enzymes through a series of studies including site-directed mutagenesis, isothermal titration calorimetry, electron paramagnetic resonance (EPR), quantum mechanics, and molecular mechanics analysis. Gly substitution by other amino acids posed a significant threat to the metal binding affinity and activity of MDR superfamily enzymes. Mutagenesis at the conserved Gly resulted in alterations in the coordination of the catalytic zinc ion, with concomitant changes in metal-ligand bond length, bond angle, and the affinity (Kd) toward the zinc ion. The Gly mutants also showed different spectroscopic properties in EPR compared with those of the wild type, indicating that the binding geometries of the zinc to the zinc binding ligands were changed by the mutation. The present results demonstrate that the conserved Gly in the GHE motif plays a role in maintaining the metal binding affinity and the electronic state of the catalytic zinc ion during catalysis of the MDR superfamily enzymes. PMID:22500022
Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav
2002-12-01
The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.
Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav
2002-01-01
The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit. PMID:12515387
Structural basis for corepressor assembly by the orphan nuclear receptor TLX.
Zhi, Xiaoyong; Zhou, X Edward; He, Yuanzheng; Searose-Xu, Kelvin; Zhang, Chun-Li; Tsai, Chih-Cheng; Melcher, Karsten; Xu, H Eric
2015-02-15
The orphan nuclear receptor TLX regulates neural stem cell self-renewal in the adult brain and functions primarily as a transcription repressor through recruitment of Atrophin corepressors, which bind to TLX via a conserved peptide motif termed the Atro box. Here we report crystal structures of the human and insect TLX ligand-binding domain in complex with Atro box peptides. In these structures, TLX adopts an autorepressed conformation in which its helix H12 occupies the coactivator-binding groove. Unexpectedly, H12 in this autorepressed conformation forms a novel binding pocket with residues from helix H3 that accommodates a short helix formed by the conserved ALXXLXXY motif of the Atro box. Mutations that weaken the TLX-Atrophin interaction compromise the repressive activity of TLX, demonstrating that this interaction is required for Atrophin to confer repressor activity to TLX. Moreover, the autorepressed conformation is conserved in the repressor class of orphan nuclear receptors, and mutations of corresponding residues in other members of this class of receptors diminish their repressor activities. Together, our results establish the functional conservation of the autorepressed conformation and define a key sequence motif in the Atro box that is essential for TLX-mediated repression. © 2015 Zhi et al.; Published by Cold Spring Harbor Laboratory Press.
A Conserved Mode of Protein Recognition and Binding in a ParD−ParE Toxin−Antitoxin Complex
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dalton, Kevin M.; Crosson, Sean
2010-05-06
Toxin-antitoxin (TA) systems form a ubiquitous class of prokaryotic proteins with functional roles in plasmid inheritance, environmental stress response, and cell development. ParDE family TA systems are broadly conserved on plasmids and bacterial chromosomes and have been well characterized as genetic elements that promote stable plasmid inheritance. We present a crystal structure of a chromosomally encoded ParD-ParE complex from Caulobacter crescentus at 2.6 {angstrom} resolution. This TA system forms an {alpha}{sub 2}{beta}{sub 2} heterotetramer in the crystal and in solution. The toxin-antitoxin binding interface reveals extensive polar and hydrophobic contacts of ParD antitoxin helices with a conserved recognition and bindingmore » groove on the ParE toxin. A cross-species comparison of this complex structure with related toxin structures identified an antitoxin recognition and binding subdomain that is conserved between distantly related members of the RelE/ParE toxin superfamily despite a low level of overall primary sequence identity. We further demonstrate that ParD antitoxin is dimeric, stably folded, and largely helical when not bound to ParE toxin. Thus, the paradigmatic model in which antitoxin undergoes a disorder-to-order transition upon toxin binding does not apply to this chromosomal ParD-ParE TA system.« less
Hübner, Sebastian; Declerck, Nathalie; Diethmaier, Christine; Le Coq, Dominique; Aymerich, Stephane; Stülke, Jörg
2011-01-01
Each family of signal transduction systems requires specificity determinants that link individual signals to the correct regulatory output. In Bacillus subtilis, a family of four anti-terminator proteins controls the expression of genes for the utilisation of alternative sugars. These regulatory systems contain the anti-terminator proteins and a RNA structure, the RNA anti-terminator (RAT) that is bound by the anti-terminator proteins. We have studied three of these proteins (SacT, SacY, and LicT) to understand how they can transmit a specific signal in spite of their strong structural homology. A screen for random mutations that render SacT capable to bind a RNA structure recognized by LicT only revealed a substitution (P26S) at one of the few non-conserved residues that are in contact with the RNA. We have randomly modified this position in SacT together with another non-conserved RNA-contacting residue (Q31). Surprisingly, the mutant proteins could bind all RAT structures that are present in B. subtilis. In a complementary approach, reciprocal amino acid exchanges have been introduced in LicT and SacY at non-conserved positions of the RNA-binding site. This analysis revealed the key role of an arginine side-chain for both the high affinity and specificity of LicT for its cognate RAT. Introduction of this Arg at the equivalent position of SacY (A26) increased the RNA binding in vitro but also resulted in a relaxed specificity. Altogether our results suggest that this family of anti-termination proteins has evolved to reach a compromise between RNA binding efficacy and specific interaction with individual target sequences. PMID:21278164
Wei, Shipeng; Roessler, Bryan C.; Chauvet, Sylvain; Guo, Jingyu; Hartman, John L.; Kirk, Kevin L.
2014-01-01
ATP-binding cassette (ABC) transporters are an ancient family of transmembrane proteins that utilize ATPase activity to move substrates across cell membranes. The ABCC subfamily of the ABC transporters includes active drug exporters (the multidrug resistance proteins (MRPs)) and a unique ATP-gated ion channel (cystic fibrosis transmembrane conductance regulator (CFTR)). The CFTR channel shares gating principles with conventional ligand-gated ion channels, but the allosteric network that couples ATP binding at its nucleotide binding domains (NBDs) with conformational changes in its transmembrane helices (TMs) is poorly defined. It is also unclear whether the mechanisms that govern CFTR gating are conserved with the thermodynamically distinct MRPs. Here we report a new class of gain of function (GOF) mutation of a conserved proline at the base of the pore-lining TM6. Multiple substitutions of this proline promoted ATP-free CFTR activity and activation by the weak agonist, 5′-adenylyl-β,γ-imidodiphosphate (AMP-PNP). TM6 proline mutations exhibited additive GOF effects when combined with a previously reported GOF mutation located in an outer collar of TMs that surrounds the pore-lining TMs. Each TM substitution allosterically rescued the ATP sensitivity of CFTR gating when introduced into an NBD mutant with defective ATP binding. Both classes of GOF mutations also rescued defective drug export by a yeast MRP (Yor1p) with ATP binding defects in its NBDs. We conclude that the conserved TM6 proline helps set the energy barrier to both CFTR channel opening and MRP-mediated drug efflux and that CFTR channels and MRP pumps utilize similar allosteric mechanisms for coupling conformational changes in their translocation pathways to ATP binding at their NBDs. PMID:24876383
Wei, Shipeng; Roessler, Bryan C; Chauvet, Sylvain; Guo, Jingyu; Hartman, John L; Kirk, Kevin L
2014-07-18
ATP-binding cassette (ABC) transporters are an ancient family of transmembrane proteins that utilize ATPase activity to move substrates across cell membranes. The ABCC subfamily of the ABC transporters includes active drug exporters (the multidrug resistance proteins (MRPs)) and a unique ATP-gated ion channel (cystic fibrosis transmembrane conductance regulator (CFTR)). The CFTR channel shares gating principles with conventional ligand-gated ion channels, but the allosteric network that couples ATP binding at its nucleotide binding domains (NBDs) with conformational changes in its transmembrane helices (TMs) is poorly defined. It is also unclear whether the mechanisms that govern CFTR gating are conserved with the thermodynamically distinct MRPs. Here we report a new class of gain of function (GOF) mutation of a conserved proline at the base of the pore-lining TM6. Multiple substitutions of this proline promoted ATP-free CFTR activity and activation by the weak agonist, 5'-adenylyl-β,γ-imidodiphosphate (AMP-PNP). TM6 proline mutations exhibited additive GOF effects when combined with a previously reported GOF mutation located in an outer collar of TMs that surrounds the pore-lining TMs. Each TM substitution allosterically rescued the ATP sensitivity of CFTR gating when introduced into an NBD mutant with defective ATP binding. Both classes of GOF mutations also rescued defective drug export by a yeast MRP (Yor1p) with ATP binding defects in its NBDs. We conclude that the conserved TM6 proline helps set the energy barrier to both CFTR channel opening and MRP-mediated drug efflux and that CFTR channels and MRP pumps utilize similar allosteric mechanisms for coupling conformational changes in their translocation pathways to ATP binding at their NBDs. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Crystal Structure of the N-Terminal Half of the Traffic Controller UL37 from Herpes Simplex Virus 1
DOE Office of Scientific and Technical Information (OSTI.GOV)
Koenigsberg, Andrea L.; Heldwein, Ekaterina E.; Sandri-Goldin, Rozanne M.
Inner tegument protein UL37 is conserved among all three subfamilies of herpesviruses. Studies of UL37 homologs from two alphaherpesviruses, herpes simplex virus 1 (HSV-1) and pseudorabies virus (PRV), have suggested that UL37 plays an essential albeit poorly defined role in intracellular capsid trafficking. At the same time, HSV and PRV homologs cannot be swapped, which suggests that in addition to a conserved function, UL37 homologs also have divergent virus-specific functions. Accurate dissection of UL37 functions requires detailed maps in the form of atomic-resolution structures. Previously, we reported the crystal structure of the N-terminal half of UL37 (UL37N) from PRV. Here,more » we report the crystal structure of HSV-1 UL37N. Comparison of the two structures reveals that UL37 homologs differ in their overall shapes, distributions of surface charges, and locations of projecting loops. In contrast, the previously identified R2 surface region is structurally conserved. We propose that within the N-terminal half of UL37, functional conservation is centered within the R2 surface region, whereas divergent structural elements pinpoint regions mediating virus-specific functions and may engage different binding partners. Together, the two structures can now serve as templates for a structure-guided exploration of both conserved and virus-specific functions of UL37. IMPORTANCEThe ability to move efficiently within host cell cytoplasm is essential for replication in all viruses. It is especially important in the neuroinvasive alphaherpesviruses, such as human herpes simplex virus 1 (HSV-1), HSV-2, and veterinarian pseudorabies virus (PRV), that infect the peripheral nervous system and have to travel long distances along axons. Capsid movement in these viruses is controlled by capsid-associated tegument proteins, yet their specific roles have not yet been defined. Systematic exploration of the roles of tegument proteins in capsid trafficking requires detailed navigational charts in the form of their three-dimensional structures. Here, we determined the crystal structure of the N-terminal half of a conserved tegument protein, UL37, from HSV-1. This structure, along with our previously reported structure of the UL37 homolog from PRV, provides a much needed 3-dimensional template for the dissection of both conserved and virus-specific functions of UL37 in intracellular capsid trafficking.« less
Kadamur, Ganesh; Ross, Elliott M
2016-05-20
Mammalian phospholipase C-β (PLC-β) isoforms are stimulated by heterotrimeric G protein subunits and members of the Rho GTPase family of small G proteins. Although recent structural studies showed how Gαq and Rac1 bind PLC-β, there is a lack of consensus regarding the Gβγ binding site in PLC-β. Using FRET between cerulean fluorescent protein-labeled Gβγ and the Alexa Fluor 594-labeled PLC-β pleckstrin homology (PH) domain, we demonstrate that the PH domain is the minimal Gβγ binding region in PLC-β3. We show that the isolated PH domain can compete with full-length PLC-β3 for binding Gβγ but not Gαq, Using sequence conservation, structural analyses, and mutagenesis, we identify a hydrophobic face of the PLC-β PH domain as the Gβγ binding interface. This PH domain surface is not solvent-exposed in crystal structures of PLC-β, necessitating conformational rearrangement to allow Gβγ binding. Blocking PH domain motion in PLC-β by cross-linking it to the EF hand domain inhibits stimulation by Gβγ without altering basal activity or Gαq response. The fraction of PLC-β cross-linked is proportional to the fractional loss of Gβγ response. Cross-linked PLC-β does not bind Gβγ in a FRET-based Gβγ-PLC-β binding assay. We propose that unliganded PLC-β exists in equilibrium between a closed conformation observed in crystal structures and an open conformation where the PH domain moves away from the EF hands. Therefore, intrinsic movement of the PH domain in PLC-β modulates Gβγ access to its binding site. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Kadamur, Ganesh
2016-01-01
Mammalian phospholipase C-β (PLC-β) isoforms are stimulated by heterotrimeric G protein subunits and members of the Rho GTPase family of small G proteins. Although recent structural studies showed how Gαq and Rac1 bind PLC-β, there is a lack of consensus regarding the Gβγ binding site in PLC-β. Using FRET between cerulean fluorescent protein-labeled Gβγ and the Alexa Fluor 594-labeled PLC-β pleckstrin homology (PH) domain, we demonstrate that the PH domain is the minimal Gβγ binding region in PLC-β3. We show that the isolated PH domain can compete with full-length PLC-β3 for binding Gβγ but not Gαq, Using sequence conservation, structural analyses, and mutagenesis, we identify a hydrophobic face of the PLC-β PH domain as the Gβγ binding interface. This PH domain surface is not solvent-exposed in crystal structures of PLC-β, necessitating conformational rearrangement to allow Gβγ binding. Blocking PH domain motion in PLC-β by cross-linking it to the EF hand domain inhibits stimulation by Gβγ without altering basal activity or Gαq response. The fraction of PLC-β cross-linked is proportional to the fractional loss of Gβγ response. Cross-linked PLC-β does not bind Gβγ in a FRET-based Gβγ-PLC-β binding assay. We propose that unliganded PLC-β exists in equilibrium between a closed conformation observed in crystal structures and an open conformation where the PH domain moves away from the EF hands. Therefore, intrinsic movement of the PH domain in PLC-β modulates Gβγ access to its binding site. PMID:27002154
Agwa, Akello J; Peigneur, Steve; Chow, Chun Yuen; Lawrence, Nicole; Craik, David J; Tytgat, Jan; King, Glenn F; Henriques, Sonia Troeira; Schroeder, Christina I
2018-04-27
Gating modifier toxins (GMTs) are venom-derived peptides isolated from spiders and other venomous creatures that modulate activity of disease-relevant voltage-gated ion channels and are therefore being pursued as therapeutic leads. The amphipathic surface profile of GMTs has prompted the proposal that some GMTs simultaneously bind to the cell membrane and voltage-gated ion channels in a trimolecular complex. Here we examined whether there is a relationship among spider GMT amphipathicity, membrane binding and potency or selectivity for voltage-gated sodium (NaV) channels. We used NMR spectroscopy and in silico calculations to examine the structures and physicochemical properties of a panel of nine GMTs and deployed surface plasmon resonance to measure GMT affinity for lipids putatively found in proximity to NaV channels. Electrophysiology was used to quantify GMT activity on NaV1.7, an ion channel linked to chronic pain. Selectivity of the peptides was further examined against a panel of NaV channel subtypes. We show that GMTs adsorb to the outer leaflet of anionic lipid bilayers through electrostatic interactions. We did not observe a direct correlation between GMT amphipathicity and affinity for lipid bilayers. Furthermore, GMT-lipid bilayer interactions did not correlate with potency or selectivity for NaVs. We therefore propose that increased membrane binding is unlikely to improve subtype selectivity and that the conserved amphipathic GMT surface profile is an adaptation that facilitates simultaneous modulation of multiple NaVs. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.
Nishimichi, Norihisa; Kawashima, Nagako; Yokosaki, Yasuyuki
2015-01-01
Identification of epitopes for integrin-blocking monoclonal antibodies (mAbs) has aided our understanding of structure-function relationship of integrins. We mapped epitopes of chicken anti-integrin-α8-subunit-blocking mAbs by mutational analyses, examining regions that harboured all mapped epitopes recognized by mAbs against other α-subunits in the RGD-binding-integrin subfamily. Six mAbs exhibited blocking function, and these mAbs recognized residues on the same W2:41-loop on the top-face of the β-propeller. Loop-tips sufficiently close to W2:41 (<25 Å) contained within a footprint of the mAbs were mutated, and the loop W3:34 on the bottom face was identified as an additional component of the epitope of one antibody, clone YZ5. Binding sequences on the two loops were conserved in virtually all mammals, and that on W3:34 was also conserved in chickens. These indicate 1) YZ5 binds both top and bottom loops, and the binding to W3:34 is by interactions to conserved residues between immunogen and host species, 2) five other blocking mAbs solely bind to W2:41 and 3) the α8 mAbs would cross-react with most mammals. Comparing with the mAbs against the other α-subunits of RGD-integrins, two classes were delineated; those binding to “W3:34 and an top-loop”, and “solely W2:41”, accounting for 82% of published RGD-integrin-mAbs. PMID:26349930
Nishimichi, Norihisa; Kawashima, Nagako; Yokosaki, Yasuyuki
2015-09-09
Identification of epitopes for integrin-blocking monoclonal antibodies (mAbs) has aided our understanding of structure-function relationship of integrins. We mapped epitopes of chicken anti-integrin-α8-subunit-blocking mAbs by mutational analyses, examining regions that harboured all mapped epitopes recognized by mAbs against other α-subunits in the RGD-binding-integrin subfamily. Six mAbs exhibited blocking function, and these mAbs recognized residues on the same W2:41-loop on the top-face of the β-propeller. Loop-tips sufficiently close to W2:41 (<25 Å) contained within a footprint of the mAbs were mutated, and the loop W3:34 on the bottom face was identified as an additional component of the epitope of one antibody, clone YZ5. Binding sequences on the two loops were conserved in virtually all mammals, and that on W3:34 was also conserved in chickens. These indicate 1) YZ5 binds both top and bottom loops, and the binding to W3:34 is by interactions to conserved residues between immunogen and host species, 2) five other blocking mAbs solely bind to W2:41 and 3) the α8 mAbs would cross-react with most mammals. Comparing with the mAbs against the other α-subunits of RGD-integrins, two classes were delineated; those binding to "W3:34 and an top-loop", and "solely W2:41", accounting for 82% of published RGD-integrin-mAbs.
Endosomal sorting of GLUT4 and Gap1 is conserved between yeast and insulin-sensitive cells
Shewan, Annette M.; McCann, Rebecca K.; Lamb, Christopher A.; Stirrat, Laura; Kioumourtzoglou, Dimitrios; Adamson, Iain S.; Verma, Suzie; James, David E.; Bryant, Nia J.
2013-01-01
Summary The insulin-regulated trafficking of the facilitative glucose transporter GLUT4 in human fat and muscle cells and the nitrogen-regulated trafficking of the general amino acid permease Gap1 in the yeast Saccharomyces cerevisiae share several common features: Both Gap1 and GLUT4 are nutrient transporters that are mobilised to the cell surface from an intracellular store in response to an environmental cue; both are polytopic membrane proteins harbouring amino acid targeting motifs in their C-terminal tails that are required for their regulated trafficking; ubiquitylation of both Gap1 and GLUT4 plays an important role in their regulated trafficking, as do the ubiquitin-binding GGA (Golgi-localised, γ-ear-containing, ARF-binding) adaptor proteins. Here, we find that when expressed heterologously in yeast, human GLUT4 is subject to nitrogen-regulated trafficking in an ubiquitin-dependent manner similar to Gap1. In addition, by expressing a GLUT4/Gap1 chimeric protein in adipocytes we show that the carboxy-tail of Gap1 directs intracellular sequestration and insulin-regulated trafficking in adipocytes. These findings demonstrate that the trafficking signals and their cognate molecular regulatory machinery that mediate regulated exocytosis of membrane proteins are conserved across evolution. PMID:23424197
Snapp, Karen R.; Craig, Ron; Herron, Michael; Nelson, Robert D.; Stoolman, Lloyd M.; Kansas, Geoffrey S.
1998-01-01
Interactions between P-selectin, expressed on endothelial cells and activated platelets, and its leukocyte ligand, a homodimer termed P-selectin glycoprotein ligand-1 (PSGL-1), mediate the earliest adhesive events during an inflammatory response. To investigate whether dimerization of PSGL-1 is essential for functional interactions with P-selectin, a mutant form of PSGL-1 was generated in which the conserved membrane proximal cysteine was mutated to alanine (designated C320A). Western blotting under both denaturing and native conditions of the C320A PSGL-1 mutant isolated from stably transfected cells revealed expression of only a monomeric form of PSGL-1. In contrast to cells cotransfected with α1-3 fucosyltransferase-VII (FucT-VII) plus PSGL-1, K562 cells expressing FucT-VII plus C320A failed to bind COS cells transfected with P-selectin in a low shear adhesion assay, or to roll on CHO cells transfected with P-selectin under conditions of physiologic flow. In addition, C320A transfectants failed to bind chimeric P-selectin fusion proteins. Both PSGL-1 and C320A were uniformly distributed on the surface of transfected K562 cells. Thus, dimerization of PSGL-1 through the single, conserved, extracellular cysteine is essential for functional recognition of P-selectin. PMID:9660879
Xu, Emma-Ruoqi; Blythe, Emily E; Fischer, Gerhard; Hyvönen, Marko
2017-07-28
Bone morphogenetic proteins (BMPs) are secreted growth factors that promote differentiation processes in embryogenesis and tissue development. Regulation of BMP signaling involves binding to a variety of extracellular proteins, among which are many von Willebrand factor C (vWC) domain-containing proteins. Although the crystal structure of the complex of crossveinless-2 (CV-2) vWC1 and BMP-2 previously revealed one mode of the vWC/BMP-binding mechanism, other vWC domains may bind to BMP differently. Here, using X-ray crystallography, we present for the first time structures of the vWC domains of two proteins thought to interact with BMP-2: collagen IIA and matricellular protein CCN3. We found that these two vWC domains share a similar N-terminal fold that differs greatly from that in CV-2 vWC, which comprises its BMP-2-binding site. We analyzed the ability of these vWC domains to directly bind to BMP-2 and detected an interaction only between the collagen IIa vWC and BMP-2. Guided by the collagen IIa vWC domain crystal structure and conservation of surface residues among orthologous domains, we mapped the BMP-binding epitope on the subdomain 1 of the vWC domain. This binding site is different from that previously observed in the complex between CV-2 vWC and BMP-2, revealing an alternative mode of interaction between vWC domains and BMPs. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Sinha, Sangita; Rappu, Pekka; Lange, S. C.; Mäntsälä, Pekka; Zalkin, Howard; Smith, Janet L.
1999-01-01
The yabJ gene in Bacillus subtilis is required for adenine-mediated repression of purine biosynthetic genes in vivo and codes for an acid-soluble, 14-kDa protein. The molecular mechanism of YabJ is unknown. YabJ is a member of a large, widely distributed family of proteins of unknown biochemical function. The 1.7-Å crystal structure of YabJ reveals a trimeric organization with extensive buried hydrophobic surface and an internal water-filled cavity. The most important finding in the structure is a deep, narrow cleft between subunits lined with nine side chains that are invariant among the 25 most similar homologs. This conserved site is proposed to be a binding or catalytic site for a ligand or substrate that is common to YabJ and other members of the YER057c/YjgF/UK114 family of proteins. PMID:10557275
A "Trojan horse" bispecific-antibody strategy for broad protection against ebolaviruses.
Wec, Anna Z; Nyakatura, Elisabeth K; Herbert, Andrew S; Howell, Katie A; Holtsberg, Frederick W; Bakken, Russell R; Mittler, Eva; Christin, John R; Shulenin, Sergey; Jangra, Rohit K; Bharrhan, Sushma; Kuehne, Ana I; Bornholdt, Zachary A; Flyak, Andrew I; Saphire, Erica Ollmann; Crowe, James E; Aman, M Javad; Dye, John M; Lai, Jonathan R; Chandran, Kartik
2016-10-21
There is an urgent need for monoclonal antibody (mAb) therapies that broadly protect against Ebola virus and other filoviruses. The conserved, essential interaction between the filovirus glycoprotein, GP, and its entry receptor Niemann-Pick C1 (NPC1) provides an attractive target for such mAbs but is shielded by multiple mechanisms, including physical sequestration in late endosomes. Here, we describe a bispecific-antibody strategy to target this interaction, in which mAbs specific for NPC1 or the GP receptor-binding site are coupled to a mAb against a conserved, surface-exposed GP epitope. Bispecific antibodies, but not parent mAbs, neutralized all known ebolaviruses by coopting viral particles themselves for endosomal delivery and conferred postexposure protection against multiple ebolaviruses in mice. Such "Trojan horse" bispecific antibodies have potential as broad antifilovirus immunotherapeutics. Copyright © 2016, American Association for the Advancement of Science.
Regions of extreme synonymous codon selection in mammalian genes
Schattner, Peter; Diekhans, Mark
2006-01-01
Recently there has been increasing evidence that purifying selection occurs among synonymous codons in mammalian genes. This selection appears to be a consequence of either cis-regulatory motifs, such as exonic splicing enhancers (ESEs), or mRNA secondary structures, being superimposed on the coding sequence of the gene. We have developed a program to identify regions likely to be enriched for such motifs by searching for extended regions of extreme codon conservation between homologous genes of related species. Here we present the results of applying this approach to five mammalian species (human, chimpanzee, mouse, rat and dog). Even with very conservative selection criteria, we find over 200 regions of extreme codon conservation, ranging in length from 60 to 178 codons. The regions are often found within genes involved in DNA-binding, RNA-binding or zinc-ion-binding. They are highly depleted for synonymous single nucleotide polymorphisms (SNPs) but not for non-synonymous SNPs, further indicating that the observed codon conservation is being driven by negative selection. Forty-three percent of the regions overlap conserved alternative transcript isoforms and are enriched for known ESEs. Other regions are enriched for TpA dinucleotides and may contain conserved motifs/structures relating to mRNA stability and/or degradation. We anticipate that this tool will be useful for detecting regions enriched in other classes of coding-sequence motifs and structures as well. PMID:16556911
Casals, Cristina; Johansson, Hanna; Saenz, Alejandra; Gustafsson, Magnus; Alfonso, Carlos; Nordling, Kerstin; Johansson, Jan
2008-02-01
Surfactant protein C (SP-C) constitutes the transmembrane part of prosurfactant protein C (proSP-C) and is alpha-helical in its native state. The C-terminal part of proSP-C (CTC) is localized in the endoplasmic reticulum lumen and binds to misfolded (beta-strand) SP-C, thereby preventing its aggregation and amyloid fibril formation. In this study, we investigated the structure of recombinant human CTC and the effects of CTC-membrane interaction on protein structure. CTC forms noncovalent trimers and supratrimeric oligomers. It contains two intrachain disulfide bridges, and its secondary structure is significantly affected by urea or heat only after disulfide reduction. The postulated Brichos domain of CTC, with homologs found in proteins associated with amyloid and proliferative disease, is up to 1000-fold more protected from limited proteolysis than the rest of CTC. The protein exposes hydrophobic surfaces, as determined by CTC binding to the environment-sensitive fluorescent probe 1,1'-bis(4-anilino-5,5'-naphthalenesulfonate). Fluorescence energy transfer experiments further reveal close proximity between bound 1,1'-bis(4-anilino-5,5'-naphthalenesulfonate) and tyrosine residues in CTC, some of which are conserved in all Brichos domains. CTC binds to unilamellar phospholipid vesicles with low micromolar dissociation constants, and differential scanning calorimetry and CD analyses indicate that membrane-bound CTC is less structurally ordered than the unbound protein. The exposed hydrophobic surfaces and the structural disordering that result from interactions with phospholipid membranes suggest a mechanism whereby CTC binds to misfolded SP-C in the endoplasmic reticulum membrane.
Phosphatidylserine colocalizes with epichromatin in interphase nuclei and mitotic chromosomes
Prudovsky, Igor; Vary, Calvin P.H.; Markaki, Yolanda; Olins, Ada L.; Olins, Donald E.
2012-01-01
Cycling eukaryotic cells rapidly re-establish the nuclear envelope and internal architecture following mitosis. Studies with a specific anti-nucleosome antibody recently demonstrated that the surface (“epichromatin”) of interphase and mitotic chromatin possesses a unique and conserved conformation, suggesting a role in postmitotic nuclear reformation. Here we present evidence showing that the anionic glycerophospholipid phosphatidylserine is specifically located in epichromatin throughout the cell cycle and is associated with nucleosome core histones. This suggests that chromatin bound phosphatidylserine may function as a nucleation site for the binding of ER and re-establishment of the nuclear envelope. PMID:22555604
In vivo functional mapping of the conserved protein domains within murine Themis1.
Zvezdova, Ekaterina; Lee, Jan; El-Khoury, Dalal; Barr, Valarie; Akpan, Itoro; Samelson, Lawrence; Love, Paul E
2014-09-01
Thymocyte development requires the coordinated input of signals that originate from numerous cell surface molecules. Although the majority of thymocyte signal-initiating receptors are lineage-specific, most trigger 'ubiquitous' downstream signaling pathways. T-lineage-specific receptors are coupled to these signaling pathways by lymphocyte-restricted adapter molecules. We and others recently identified a new putative adapter protein, Themis1, whose expression is largely restricted to the T lineage. Mice lacking Themis1 exhibit a severe block in thymocyte development and a striking paucity of mature T cells revealing a critical role for Themis1 in T-cell maturation. Themis1 orthologs contain three conserved domains: a proline-rich region (PRR) that binds to the ubiquitous cytosolic adapter Grb2, a nuclear localization sequence (NLS), and two copies of a novel cysteine-containing globular (CABIT) domain. In the present study, we evaluated the functional importance of each of these motifs by retroviral reconstitution of Themis1(-/-) progenitor cells. The results demonstrate an essential requirement for the PRR and NLS motifs but not the conserved CABIT cysteines for Themis1 function.
Moravcevic, Katarina; Alvarado, Diego; Schmitz, Karl R; Kenniston, Jon A; Mendrola, Jeannine M; Ferguson, Kathryn M; Lemmon, Mark A
2015-02-03
F-BAR domains control membrane interactions in endocytosis, cytokinesis, and cell signaling. Although they are generally thought to bind curved membranes containing negatively charged phospholipids, numerous functional studies argue that differences in lipid-binding selectivities of F-BAR domains are functionally important. Here, we compare membrane-binding properties of the Saccharomyces cerevisiae F-BAR domains in vitro and in vivo. Whereas some F-BAR domains (such as Bzz1p and Hof1p F-BARs) bind equally well to all phospholipids, the F-BAR domain from the RhoGAP Rgd1p preferentially binds phosphoinositides. We determined X-ray crystal structures of F-BAR domains from Hof1p and Rgd1p, the latter bound to an inositol phosphate. The structures explain phospholipid-binding selectivity differences and reveal an F-BAR phosphoinositide binding site that is fully conserved in a mammalian RhoGAP called Gmip and is partly retained in certain other F-BAR domains. Our findings reveal previously unappreciated determinants of F-BAR domain lipid-binding specificity and provide a basis for its prediction from sequence. Copyright © 2015 Elsevier Ltd. All rights reserved.
Moravcevic, Katarina; Alvarado, Diego; Schmitz, Karl R.; ...
2015-01-22
F-BAR domains control membrane interactions in endocytosis, cytokinesis, and cell signaling. Although they are generally thought to bind curved membranes containing negatively charged phospholipids, numerous functional studies argue that differences in lipid-binding selectivities of F-BAR domains are functionally important. Here in this paper, we compare membrane-binding properties of the Saccharomyces cerevisiae F-BAR domains in vitro and in vivo. Whereas some F-BAR domains (such as Bzz1p and Hof1p F-BARs) bind equally well to all phospholipids, the F-BAR domain from the RhoGAP Rgd1p preferentially binds phosphoinositides. We determined X-ray crystal structures of F-BAR domains from Hof1p and Rgd1p, the latter bound tomore » an inositol phosphate. The structures explain phospholipid-binding selectivity differences and reveal an F-BAR phosphoinositide binding site that is fully conserved in a mammalian RhoGAP called Gmip and is partly retained in certain other F-BAR domains. In conclusion, our findings reveal previously unappreciated determinants of F-BAR domain lipid-binding specificity and provide a basis for its prediction from sequence.« less
Broadly neutralizing epitopes in the Plasmodium vivax vaccine candidate Duffy Binding Protein
Chen, Edwin; Salinas, Nichole D.; Huang, Yining; ...
2016-05-18
Plasmodium vivax Duffy Binding Protein (PvDBP) is the most promising vaccine candidate for P. vivax malaria. The polymorphic nature of PvDBP induces strain-specific immune responses, however, and the epitopes of broadly neutralizing antibodies are unknown. These features hamper the rational design of potent DBP-based vaccines and necessitate the identification of globally conserved epitopes. Using X-ray crystallography, small-angle X-ray scattering, hydrogen-deuterium exchange mass spectrometry, and mutational mapping, we have defined epitopes for three inhibitory mAbs (mAbs 2D10, 2H2, and 2C6) and one noninhibitory mAb (3D10) that engage DBP. These studies expand the currently known inhibitory epitope repertoire by establishing protective motifsmore » in subdomain three outside the receptor-binding and dimerization residues of DBP, and introduce globally conserved protective targets. All of the epitopes are highly conserved among DBP alleles. In conclusion, the identification of broadly conserved epitopes of inhibitory antibodies provides critical motifs that should be retained in the next generation of potent vaccines for P. vivax malaria.« less
Broadly neutralizing epitopes in the Plasmodium vivax vaccine candidate Duffy Binding Protein
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Edwin; Salinas, Nichole D.; Huang, Yining
Plasmodium vivax Duffy Binding Protein (PvDBP) is the most promising vaccine candidate for P. vivax malaria. The polymorphic nature of PvDBP induces strain-specific immune responses, however, and the epitopes of broadly neutralizing antibodies are unknown. These features hamper the rational design of potent DBP-based vaccines and necessitate the identification of globally conserved epitopes. Using X-ray crystallography, small-angle X-ray scattering, hydrogen-deuterium exchange mass spectrometry, and mutational mapping, we have defined epitopes for three inhibitory mAbs (mAbs 2D10, 2H2, and 2C6) and one noninhibitory mAb (3D10) that engage DBP. These studies expand the currently known inhibitory epitope repertoire by establishing protective motifsmore » in subdomain three outside the receptor-binding and dimerization residues of DBP, and introduce globally conserved protective targets. All of the epitopes are highly conserved among DBP alleles. In conclusion, the identification of broadly conserved epitopes of inhibitory antibodies provides critical motifs that should be retained in the next generation of potent vaccines for P. vivax malaria.« less
Moran, Yehu; Cohen, Lior; Kahn, Roy; Karbat, Izhar; Gordon, Dalia; Gurevitz, Michael
2006-07-25
Type I sea anemone toxins are highly potent modulators of voltage-gated Na-channels (Na(v)s) and compete with the structurally dissimilar scorpion alpha-toxins on binding to receptor site-3. Although these features provide two structurally different probes for studying receptor site-3 and channel fast inactivation, the bioactive surface of sea anemone toxins has not been fully resolved. We established an efficient expression system for Av2 (known as ATX II), a highly insecticidal sea anemone toxin from Anemonia viridis (previously named A. sulcata), and mutagenized it throughout. Each toxin mutant was analyzed in toxicity and binding assays as well as by circular dichroism spectroscopy to discern the effects derived from structural perturbation from those related to bioactivity. Six residues were found to constitute the anti-insect bioactive surface of Av2 (Val-2, Leu-5, Asn-16, Leu-18, and Ile-41). Further analysis of nine Av2 mutants on the human heart channel Na(v)1.5 expressed in Xenopus oocytes indicated that the bioactive surfaces toward insects and mammals practically coincide but differ from the bioactive surface of a structurally similar sea anemone toxin, Anthopleurin B, from Anthopleura xanthogrammica. Hence, our results not only demonstrate clear differences in the bioactive surfaces of Av2 and scorpion alpha-toxins but also indicate that despite the general conservation in structure and importance of the Arg-14 loop and its flanking residues Gly-10 and Gly-20 for function, the surface of interaction between different sea anemone toxins and Na(v)s varies.
Nevil, Markus; Bondra, Eliana R.; Schulz, Katharine N.; Kaplan, Tommy; Harrison, Melissa M.
2017-01-01
It has been suggested that transcription factor binding is temporally dynamic, and that changes in binding determine transcriptional output. Nonetheless, this model is based on relatively few examples in which transcription factor binding has been assayed at multiple developmental stages. The essential transcription factor Grainy head (Grh) is conserved from fungi to humans, and controls epithelial development and barrier formation in numerous tissues. Drosophila melanogaster, which possess a single grainy head (grh) gene, provide an excellent system to study this conserved factor. To determine whether temporally distinct binding events allow Grh to control cell fate specification in different tissue types, we used a combination of ChIP-seq and RNA-seq to elucidate the gene regulatory network controlled by Grh during four stages of embryonic development (spanning stages 5–17) and in larval tissue. Contrary to expectations, we discovered that Grh remains bound to at least 1146 genomic loci over days of development. In contrast to this stable DNA occupancy, the subset of genes whose expression is regulated by Grh varies. Grh transitions from functioning primarily as a transcriptional repressor early in development to functioning predominantly as an activator later. Our data reveal that Grh binds to target genes well before the Grh-dependent transcriptional program commences, suggesting it sets the stage for subsequent recruitment of additional factors that execute stage-specific Grh functions. PMID:28007888
Pedersen, Kim Brint; Chodavarapu, Harshita
2017-01-01
Angiotensin-converting enzyme 2 (ACE2) has protective effects on a wide range of morbidities associated with elevated angiotensin-II signaling. Most tissues, including pancreatic islets, express ACE2 mainly from the proximal promoter region. We previously found that hepatocyte nuclear factors 1α and 1β stimulate ACE2 expression from three highly conserved hepatocyte nuclear factor 1 binding motifs in the proximal promoter region. We hypothesized that other highly conserved motifs would also affect ACE2 expression. By systematic mutation of conserved elements, we identified five regions affecting ACE2 expression, of which two regions bound transcriptional activators. One of these is a functional FOXA binding motif. We further identified the main protein binding the FOXA motif in 832/13 insulinoma cells as well as in mouse pancreatic islets as FOXA2. PMID:29082356
Ribosome-Inactivating Proteins: From Plant Defense to Tumor Attack
de Virgilio, Maddalena; Lombardi, Alessio; Caliandro, Rocco; Fabbrini, Maria Serena
2010-01-01
Ribosome-inactivating proteins (RIPs) are EC3.2.32.22 N-glycosidases that recognize a universally conserved stem-loop structure in 23S/25S/28S rRNA, depurinating a single adenine (A4324 in rat) and irreversibly blocking protein translation, leading finally to cell death of intoxicated mammalian cells. Ricin, the plant RIP prototype that comprises a catalytic A subunit linked to a galactose-binding lectin B subunit to allow cell surface binding and toxin entry in most mammalian cells, shows a potency in the picomolar range. The most promising way to exploit plant RIPs as weapons against cancer cells is either by designing molecules in which the toxic domains are linked to selective tumor targeting domains or directly delivered as suicide genes for cancer gene therapy. Here, we will provide a comprehensive picture of plant RIPs and discuss successful designs and features of chimeric molecules having therapeutic potential. PMID:22069572
Notum deacylates Wnts to suppress signalling activity
Howell, Steve; Chang, Tao-Hsin; Liu, Yan; Feizi, Ten; Bineva, Ganka; O’Reilly, Nicola; Snijders, Ambrosius P.; Jones, E. Yvonne; Vincent, Jean-Paul
2015-01-01
Signalling by Wnts is finely balanced to ensure normal development and tissue homeostasis while avoiding diseases such as cancer. This is achieved in part by Notum, a highly conserved secreted feedback antagonist. Notum has been thought to act as a phospholipase, shedding glypicans and associated Wnts from the cell surface. However, this view fails to explain specificity since glypicans bind many extracellular ligands. Here we provide genetic evidence in Drosophila that Notum requires glypicans to suppress Wnt signalling, but does not cleave their glycophosphatidylinositol anchor. Structural analyses reveal glycosaminoglycan binding sites on Notum, which likely help Notum colocalise with Wnts. They also identify, at the active site of human and Drosophila Notum, a large hydrophobic pocket that accommodates palmitoleate. Kinetic and mass spectrometric analyses of human proteins show that Notum is a carboxylesterase that removes an essential palmitoleate moiety from Wnts and thus constitutes the first known extracellular protein deacylase. PMID:25731175
Selection of the simplest RNA that binds isoleucine
LOZUPONE, CATHERINE; CHANGAYIL, SHANKAR; MAJERFELD, IRENE; YARUS, MICHAEL
2003-01-01
We have identified the simplest RNA binding site for isoleucine using selection-amplification (SELEX), by shrinking the size of the randomized region until affinity selection is extinguished. Such a protocol can be useful because selection does not necessarily make the simplest active motif most prominent, as is often assumed. We find an isoleucine binding site that behaves exactly as predicted for the site that requires fewest nucleotides. This UAUU motif (16 highly conserved positions; 27 total), is also the most abundant site in successful selections on short random tracts. The UAUU site, now isolated independently at least 63 times, is a small asymmetric internal loop. Conserved loop sequences include isoleucine codon and anticodon triplets, whose nucleotides are required for amino acid binding. This reproducible association between isoleucine and its coding sequences supports the idea that the genetic code is, at least in part, a stereochemical residue of the most easily isolated RNA–amino acid binding structures. PMID:14561881
Structural basis for specific recognition of multiple mRNA targets by a PUF regulatory protein
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Yeming; Opperman, Laura; Wickens, Marvin
2011-11-02
Caenorhabditis elegans fem-3 binding factor (FBF) is a founding member of the PUMILIO/FBF (PUF) family of mRNA regulatory proteins. It regulates multiple mRNAs critical for stem cell maintenance and germline development. Here, we report crystal structures of FBF in complex with 6 different 9-nt RNA sequences, including elements from 4 natural mRNAs. These structures reveal that FBF binds to conserved bases at positions 1-3 and 7-8. The key specificity determinant of FBF vs. other PUF proteins lies in positions 4-6. In FBF/RNA complexes, these bases stack directly with one another and turn away from the RNA-binding surface. A short regionmore » of FBF is sufficient to impart its unique specificity and lies directly opposite the flipped bases. We suggest that this region imposes a flattened curvature on the protein; hence, the requirement for the additional nucleotide. The principles of FBF/RNA recognition suggest a general mechanism by which PUF proteins recognize distinct families of RNAs yet exploit very nearly identical atomic contacts in doing so.« less
Structural basis for specific recognition of multiple mRNA targets by a PUF regulatory protein
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Yeming; Opperman, Laura; Wickens, Marvin
2010-08-19
Caenorhabditis elegans fem-3 binding factor (FBF) is a founding member of the PUMILIO/FBF (PUF) family of mRNA regulatory proteins. It regulates multiple mRNAs critical for stem cell maintenance and germline development. Here, we report crystal structures of FBF in complex with 6 different 9-nt RNA sequences, including elements from 4 natural mRNAs. These structures reveal that FBF binds to conserved bases at positions 1-3 and 7-8. The key specificity determinant of FBF vs. other PUF proteins lies in positions 4-6. In FBF/RNA complexes, these bases stack directly with one another and turn away from the RNA-binding surface. A short regionmore » of FBF is sufficient to impart its unique specificity and lies directly opposite the flipped bases. We suggest that this region imposes a flattened curvature on the protein; hence, the requirement for the additional nucleotide. The principles of FBF/RNA recognition suggest a general mechanism by which PUF proteins recognize distinct families of RNAs yet exploit very nearly identical atomic contacts in doing so.« less
Antibodies to a conformational epitope on gp41 neutralize HIV-1 by destabilizing the Env spike
Lee, Jeong Hyun; Leaman, Daniel P.; Kim, Arthur S.; Torrents de la Peña, Alba; Sliepen, Kwinten; Yasmeen, Anila; Derking, Ronald; Ramos, Alejandra; de Taeye, Steven W.; Ozorowski, Gabriel; Klein, Florian; Burton, Dennis R.; Nussenzweig, Michel C.; Poignard, Pascal; Moore, John P.; Klasse, Per Johan; Sanders, Rogier W.; Zwick, Michael B.; Wilson, Ian A.; Ward, Andrew B.
2015-01-01
The recent identification of three broadly neutralizing antibodies (bnAbs) against gp120–gp41 interface epitopes has expanded the targetable surface on the HIV-1 envelope glycoprotein (Env) trimer. By using biochemical, biophysical and computational methods, we map the previously unknown trimer epitopes of two related antibodies, 3BC315 and 3BC176. A cryo-EM reconstruction of a soluble Env trimer bound to 3BC315 Fab at 9.3 Å resolution reveals that the antibody binds between two gp41 protomers, and neutralizes the virus by accelerating trimer decay. In contrast, bnAb 35O22 binding to a partially overlapping quaternary epitope at the gp120–gp41 interface does not induce decay. A conserved gp41-proximal glycan at N88 was also shown to play a role in the binding kinetics of 3BC176 and 3BC315. Finally, our data suggest that the dynamic structure of the Env trimer influences exposure of bnAb epitopes. PMID:26404402
Structure and self-assembly of the calcium binding matrix protein of human metapneumovirus.
Leyrat, Cedric; Renner, Max; Harlos, Karl; Huiskonen, Juha T; Grimes, Jonathan M
2014-01-07
The matrix protein (M) of paramyxoviruses plays a key role in determining virion morphology by directing viral assembly and budding. Here, we report the crystal structure of the human metapneumovirus M at 2.8 Å resolution in its native dimeric state. The structure reveals the presence of a high-affinity Ca²⁺ binding site. Molecular dynamics simulations (MDS) predict a secondary lower-affinity site that correlates well with data from fluorescence-based thermal shift assays. By combining small-angle X-ray scattering with MDS and ensemble analysis, we captured the structure and dynamics of M in solution. Our analysis reveals a large positively charged patch on the protein surface that is involved in membrane interaction. Structural analysis of DOPC-induced polymerization of M into helical filaments using electron microscopy leads to a model of M self-assembly. The conservation of the Ca²⁺ binding sites suggests a role for calcium in the replication and morphogenesis of pneumoviruses. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
Conformational dynamics underlie the activity of the auxin-binding protein, Nt-abp1.
David, K; Carnero-Diaz, E; Leblanc, N; Monestiez, M; Grosclaude, J; Perrot-Rechenmann, C
2001-09-14
The auxin-binding protein 1 (ABP1) has been proposed to be involved in the perception of the phytohormone at the plasma membrane. Site-directed mutagenesis was performed on highly conserved residues at the C terminus of ABP1 to investigate their relative importance in protein folding and activation of a functional response at the plasma membrane. Detailed analysis of the dynamic interaction of the wild-type ABP1 and mutated proteins with three distinct monoclonal antibodies recognizing conformation-dependent epitopes was performed by surface plasmon resonance. The influence of auxin on these interactions was also investigated. The Cys(177) as well as Asp(175) and Glu(176) were identified as critical residues for ABP1 folding and action at the plasma membrane. On the contrary, the C-terminal KDEL sequence was demonstrated not to be essential for auxin binding, interaction with the plasma membrane, or activation of the transduction cascade although it does appear to be involved in the stability of ABP1. Taken together, the results confirmed that ABP1 conformational change is the critical step for initiating the signal from the plasma membrane.
Cryptic glucocorticoid receptor-binding sites pervade genomic NF-κB response elements.
Hudson, William H; Vera, Ian Mitchelle S de; Nwachukwu, Jerome C; Weikum, Emily R; Herbst, Austin G; Yang, Qin; Bain, David L; Nettles, Kendall W; Kojetin, Douglas J; Ortlund, Eric A
2018-04-06
Glucocorticoids (GCs) are potent repressors of NF-κB activity, making them a preferred choice for treatment of inflammation-driven conditions. Despite the widespread use of GCs in the clinic, current models are inadequate to explain the role of the glucocorticoid receptor (GR) within this critical signaling pathway. GR binding directly to NF-κB itself-tethering in a DNA binding-independent manner-represents the standing model of how GCs inhibit NF-κB-driven transcription. We demonstrate that direct binding of GR to genomic NF-κB response elements (κBREs) mediates GR-driven repression of inflammatory gene expression. We report five crystal structures and solution NMR data of GR DBD-κBRE complexes, which reveal that GR recognizes a cryptic response element between the binding footprints of NF-κB subunits within κBREs. These cryptic sequences exhibit high sequence and functional conservation, suggesting that GR binding to κBREs is an evolutionarily conserved mechanism of controlling the inflammatory response.
Petrov, Artem; Arzhanik, Vladimir; Makarov, Gennady; Koliasnikov, Oleg
2016-08-01
Antibodies are the family of proteins, which are responsible for antigen recognition. The computational modeling of interaction between an antigen and an antibody is very important when crystallographic structure is unavailable. In this research, we have discovered the correlation between the amino acid sequence of antibody and its specific binding characteristics on the example of the novel conservative binding motif, which consists of four residues: Arg H52, Tyr H33, Thr H59, and Glu H61. These residues are specifically oriented in the binding site and interact with each other in a specific manner. The residues of the binding motif are involved in interaction strictly with negatively charged groups of antigens, and form a binding complex. Mechanism of interaction and characteristics of the complex were also discovered. The results of this research can be used to increase the accuracy of computational antibody-antigen interaction modeling and for post-modeling quality control of the modeled structures.
Medrano, Francisco Javier; de Souza, Cristiane Santos; Romero, Antonio; Balan, Andrea
2014-01-01
The uptake of maltose and related sugars in Gram-negative bacteria is mediated by an ABC transporter encompassing a periplasmic component (the maltose-binding protein or MalE), a pore-forming membrane protein (MalF and MalG) and a membrane-associated ATPase (MalK). In the present study, the structure determination of the apo form of the putative maltose/trehalose-binding protein (Xac-MalE) from the citrus pathogen Xanthomonas citri in space group P6522 is described. The crystals contained two protein molecules in the asymmetric unit and diffracted to 2.8 Å resolution. Xac-MalE conserves the structural and functional features of sugar-binding proteins and a ligand-binding pocket with similar characteristics to eight different orthologues, including the residues for maltose and trehalose interaction. This is the first structure of a sugar-binding protein from a phytopathogenic bacterium, which is highly conserved in all species from the Xanthomonas genus. PMID:24817711
Villa, Riccardo; Martorana, Alessandra M; Okuda, Suguru; Gourlay, Louise J; Nardini, Marco; Sperandeo, Paola; Dehò, Gianni; Bolognesi, Martino; Kahne, Daniel; Polissi, Alessandra
2013-03-01
Lipopolysaccharide is a major glycolipid component in the outer leaflet of the outer membrane (OM), a peculiar permeability barrier of Gram-negative bacteria that prevents many toxic compounds from entering the cell. Lipopolysaccharide transport (Lpt) across the periplasmic space and its assembly at the Escherichia coli cell surface are carried out by a transenvelope complex of seven essential Lpt proteins spanning the inner membrane (LptBCFG), the periplasm (LptA), and the OM (LptDE), which appears to operate as a unique machinery. LptC is an essential inner membrane-anchored protein with a large periplasm-protruding domain. LptC binds the inner membrane LptBFG ABC transporter and interacts with the periplasmic protein LptA. However, its role in lipopolysaccharide transport is unclear. Here we show that LptC lacking the transmembrane region is viable and can bind the LptBFG inner membrane complex; thus, the essential LptC functions are located in the periplasmic domain. In addition, we characterize two previously described inactive single mutations at two conserved glycines (G56V and G153R, respectively) of the LptC periplasmic domain, showing that neither mutant is able to assemble the transenvelope machinery. However, while LptCG56V failed to copurify any Lpt component, LptCG153R was able to interact with the inner membrane protein complex LptBFG. Overall, our data further support the model whereby the bridge connecting the inner and outer membranes would be based on the conserved structurally homologous jellyroll domain shared by five out of the seven Lpt components.
Villa, Riccardo; Martorana, Alessandra M.; Okuda, Suguru; Gourlay, Louise J.; Nardini, Marco; Sperandeo, Paola; Dehò, Gianni; Bolognesi, Martino; Kahne, Daniel
2013-01-01
Lipopolysaccharide is a major glycolipid component in the outer leaflet of the outer membrane (OM), a peculiar permeability barrier of Gram-negative bacteria that prevents many toxic compounds from entering the cell. Lipopolysaccharide transport (Lpt) across the periplasmic space and its assembly at the Escherichia coli cell surface are carried out by a transenvelope complex of seven essential Lpt proteins spanning the inner membrane (LptBCFG), the periplasm (LptA), and the OM (LptDE), which appears to operate as a unique machinery. LptC is an essential inner membrane-anchored protein with a large periplasm-protruding domain. LptC binds the inner membrane LptBFG ABC transporter and interacts with the periplasmic protein LptA. However, its role in lipopolysaccharide transport is unclear. Here we show that LptC lacking the transmembrane region is viable and can bind the LptBFG inner membrane complex; thus, the essential LptC functions are located in the periplasmic domain. In addition, we characterize two previously described inactive single mutations at two conserved glycines (G56V and G153R, respectively) of the LptC periplasmic domain, showing that neither mutant is able to assemble the transenvelope machinery. However, while LptCG56V failed to copurify any Lpt component, LptCG153R was able to interact with the inner membrane protein complex LptBFG. Overall, our data further support the model whereby the bridge connecting the inner and outer membranes would be based on the conserved structurally homologous jellyroll domain shared by five out of the seven Lpt components. PMID:23292770
Structure-Function Relationships in Human Testis-determining Factor SRY
Racca, Joseph D.; Chen, Yen-Shan; Maloy, James D.; Wickramasinghe, Nalinda; Phillips, Nelson B.; Weiss, Michael A.
2014-01-01
Human testis determination is initiated by SRY, a Y-encoded architectural transcription factor. Mutations in SRY cause 46 XY gonadal dysgenesis with female somatic phenotype (Swyer syndrome) and confer a high risk of malignancy (gonadoblastoma). Such mutations cluster in the SRY high mobility group (HMG) box, a conserved motif of specific DNA binding and bending. To explore structure-function relationships, we constructed all possible substitutions at a site of clinical mutation (W70L). Our studies thus focused on a core aromatic residue (position 15 of the consensus HMG box) that is invariant among SRY-related HMG box transcription factors (the SOX family) and conserved as aromatic (Phe or Tyr) among other sequence-specific boxes. In a yeast one-hybrid system sensitive to specific SRY-DNA binding, the variant domains exhibited reduced (Phe and Tyr) or absent activity (the remaining 17 substitutions). Representative nonpolar variants with partial or absent activity (Tyr, Phe, Leu, and Ala in order of decreasing side-chain volume) were chosen for study in vitro and in mammalian cell culture. The clinical mutation (Leu) was found to markedly impair multiple biochemical and cellular activities as respectively probed through the following: (i) in vitro assays of specific DNA binding and protein stability, and (ii) cell culture-based assays of proteosomal degradation, nuclear import, enhancer DNA occupancy, and SRY-dependent transcriptional activation. Surprisingly, however, DNA bending is robust to this or the related Ala substitution that profoundly impairs box stability. Together, our findings demonstrate that the folding, trafficking, and gene-regulatory function of SRY requires an invariant aromatic “buttress” beneath its specific DNA-bending surface. PMID:25258310
Multiple solvent crystal structures of ribonuclease A: An assessment of the method
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dechene, Michelle; Wink, Glenna; Smith, Mychal
2010-11-12
The multiple solvent crystal structures (MSCS) method uses organic solvents to map the surfaces of proteins. It identifies binding sites and allows for a more thorough examination of protein plasticity and hydration than could be achieved by a single structure. The crystal structures of bovine pancreatic ribonuclease A (RNAse A) soaked in the following organic solvents are presented: 50% dioxane, 50% dimethylformamide, 70% dimethylsulfoxide, 70% 1,6-hexanediol, 70% isopropanol, 50% R,S,R-bisfuran alcohol, 70% t-butanol, 50% trifluoroethanol, or 1.0M trimethylamine-N-oxide. This set of structures is compared with four sets of crystal structures of RNAse A from the protein data bank (PDB) andmore » with the solution NMR structure to assess the validity of previously untested assumptions associated with MSCS analysis. Plasticity from MSCS is the same as from PDB structures obtained in the same crystal form and deviates only at crystal contacts when compared to structures from a diverse set of crystal environments. Furthermore, there is a good correlation between plasticity as observed by MSCS and the dynamic regions seen by NMR. Conserved water binding sites are identified by MSCS to be those that are conserved in the sets of structures taken from the PDB. Comparison of the MSCS structures with inhibitor-bound crystal structures of RNAse A reveals that the organic solvent molecules identify key interactions made by inhibitor molecules, highlighting ligand binding hot-spots in the active site. The present work firmly establishes the relevance of information obtained by MSCS.« less
Wang, Shengjun; Mao, Yang; Narimatsu, Yoshiki; Ye, Zilu; Tian, Weihua; Goth, Christoffer K; Lira-Navarrete, Erandi; Pedersen, Nis B; Benito-Vicente, Asier; Martin, Cesar; Uribe, Kepa B; Hurtado-Guerrero, Ramon; Christoffersen, Christina; Seidah, Nabil G; Nielsen, Rikke; Christensen, Erik I; Hansen, Lars; Bennett, Eric P; Vakhrushev, Sergey Y; Schjoldager, Katrine T; Clausen, Henrik
2018-05-11
The low-density lipoprotein receptor (LDLR) and related receptors are important for the transport of diverse biomolecules across cell membranes and barriers. Their functions are especially relevant for cholesterol homeostasis and diseases, including neurodegenerative and kidney disorders. Members of the LDLR-related protein family share LDLR class A (LA) repeats providing binding properties for lipoproteins and other biomolecules. We previously demonstrated that short linker regions between these LA repeats contain conserved O -glycan sites. Moreover, we found that O -glycan modifications at these sites are selectively controlled by the GalNAc-transferase isoform, GalNAc-T11. However, the effects of GalNAc-T11-mediated O -glycosylation on LDLR and related receptor localization and function are unknown. Here, we characterized O -glycosylation of LDLR-related proteins and identified conserved O -glycosylation sites in the LA linker regions of VLDLR, LRP1, and LRP2 (Megalin) from both cell lines and rat organs. Using a panel of gene-edited isogenic cell line models, we demonstrate that GalNAc-T11-mediated LDLR and VLDLR O -glycosylation is not required for transport and cell-surface expression and stability of these receptors but markedly enhances LDL and VLDL binding and uptake. Direct ELISA-based binding assays with truncated LDLR constructs revealed that O -glycosylation increased affinity for LDL by ∼5-fold. The molecular basis for this observation is currently unknown, but these findings open up new avenues for exploring the roles of LDLR-related proteins in disease. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Peng, Tao; Free, Paul; Fernig, David G.; Lim, Sierin; Tomczak, Nikodem
2016-01-01
Porous protein cages are supramolecular protein self-assemblies presenting pores that allow the access of surrounding molecules and ions into their core in order to store and transport them in biological environments. Protein cages’ pores are attractive channels for the internalisation of inorganic nanoparticles and an alternative for the preparation of hybrid bioinspired nanoparticles. However, strategies based on nanoparticle transport through the pores are largely unexplored, due to the difficulty of tailoring nanoparticles that have diameters commensurate with the pores size and simultaneously displaying specific affinity to the cages’ core and low non-specific binding to the cages’ outer surface. We evaluated the specific internalisation of single small gold nanoparticles, 3.9 nm in diameter, into porous protein cages via affinity binding. The E2 protein cage derived from the Geobacillus stearothermophilus presents 12 pores, 6 nm in diameter, and an empty core of 13 nm in diameter. We engineered the E2 protein by site-directed mutagenesis with oligohistidine sequences exposing them into the cage’s core. Dynamic light scattering and electron microscopy analysis show that the structures of E2 protein cages mutated with bis- or penta-histidine sequences are well conserved. The surface of the gold nanoparticles was passivated with a self-assembled monolayer made of a mixture of short peptidols and thiolated alkane ethylene glycol ligands. Such monolayers are found to provide thin coatings preventing non-specific binding to proteins. Further functionalisation of the peptide coated gold nanoparticles with Ni2+ nitrilotriacetic moieties enabled the specific binding to oligohistidine tagged cages. The internalisation via affinity binding was evaluated by electron microscopy analysis. From the various mutations tested, only the penta-histidine mutated E2 protein cage showed repeatable and stable internalisation. The present work overcomes the limitations of currently available approaches and provides a new route to design tailored and well-controlled hybrid nanoparticles. PMID:27622533
Conserved noncoding sequences (CNSs) in higher plants.
Freeling, Michael; Subramaniam, Shabarinath
2009-04-01
Plant conserved noncoding sequences (CNSs)--a specific category of phylogenetic footprint--have been shown experimentally to function. No plant CNS is conserved to the extent that ultraconserved noncoding sequences are conserved in vertebrates. Plant CNSs are enriched in known transcription factor or other cis-acting binding sites, and are usually clustered around genes. Genes that encode transcription factors and/or those that respond to stimuli are particularly CNS-rich. Only rarely could this function involve small RNA binding. Some transcribed CNSs encode short translation products as a form of negative control. Approximately 4% of Arabidopsis gene content is estimated to be both CNS-rich and occupies a relatively long stretch of chromosome: Bigfoot genes (long phylogenetic footprints). We discuss a 'DNA-templated protein assembly' idea that might help explain Bigfoot gene CNSs.
Understanding the Role of Dispositional and Situational Threat Sensitivity in Our Moral Judgments
ERIC Educational Resources Information Center
Wright, Jennifer Cole; Baril, Galen L.
2013-01-01
Previous research has identified different moral judgments in liberals and conservatives. While both care about harm/fairness ("individualizing" foundations), conservatives emphasize in-group/authority/purity ("binding" foundations) more than liberals. Thus, some argue that conservatives have a more complex morality. We suggest…
DNA-binding proteins from marine bacteria expand the known sequence diversity of TALE-like repeats
de Lange, Orlando; Wolf, Christina; Thiel, Philipp; Krüger, Jens; Kleusch, Christian; Kohlbacher, Oliver; Lahaye, Thomas
2015-01-01
Transcription Activator-Like Effectors (TALEs) of Xanthomonas bacteria are programmable DNA binding proteins with unprecedented target specificity. Comparative studies into TALE repeat structure and function are hindered by the limited sequence variation among TALE repeats. More sequence-diverse TALE-like proteins are known from Ralstonia solanacearum (RipTALs) and Burkholderia rhizoxinica (Bats), but RipTAL and Bat repeats are conserved with those of TALEs around the DNA-binding residue. We study two novel marine-organism TALE-like proteins (MOrTL1 and MOrTL2), the first to date of non-terrestrial origin. We have assessed their DNA-binding properties and modelled repeat structures. We found that repeats from these proteins mediate sequence specific DNA binding conforming to the TALE code, despite low sequence similarity to TALE repeats, and with novel residues around the BSR. However, MOrTL1 repeats show greater sequence discriminating power than MOrTL2 repeats. Sequence alignments show that there are only three residues conserved between repeats of all TALE-like proteins including the two new additions. This conserved motif could prove useful as an identifier for future TALE-likes. Additionally, comparing MOrTL repeats with those of other TALE-likes suggests a common evolutionary origin for the TALEs, RipTALs and Bats. PMID:26481363
Interactions of RadB, a DNA repair protein in archaea, with DNA and ATP.
Guy, Colin P; Haldenby, Sam; Brindley, Amanda; Walsh, David A; Briggs, Geoffrey S; Warren, Martin J; Allers, Thorsten; Bolt, Edward L
2006-04-21
The RecA family of recombinases (RecA, Rad51, RadA and UvsX) catalyse strand-exchange between homologous DNA molecules by utilising conserved DNA-binding modules and a common core ATPase domain. RadB was identified in archaea as a Rad51-like protein on the basis of conserved ATPase sequences. However, RadB does not catalyse strand exchange and does not turn over ATP efficiently. RadB does bind DNA, and here we report a triplet of residues (Lys-His-Arg) that is highly conserved at the RadB C terminus, and is crucial for DNA binding. This is consistent with the motif forming a "basic patch" of highly conserved residues identified in an atomic structure of RadB from Thermococcus kodakaraensis. As the triplet motif is conserved at the C terminus of XRCC2 also, a mammalian Rad51-paralogue, we present a phylogenetic analysis that clarifies the relationship between RadB, Rad51-paralogues and recombinases. We investigate interactions between RadB and ATP using genetics and biochemistry; ATP binding by RadB is needed to promote survival of Haloferax volcanii after UV irradiation, and ATP, but not other NTPs, induces pronounced conformational change in RadB. This is the first genetic analysis of radB, and establishes its importance for maintaining genome stability in archaea. ATP-induced conformational change in RadB may explain previous reports that RadB controls Holliday junction resolution by Hjc, depending on the presence or the absence of ATP.
Atomic structure of the murine norovirus protruding domain and sCD300lf receptor complex.
Kilic, Turgay; Koromyslova, Anna; Malak, Virginie; Hansman, Grant S
2018-03-21
Human noroviruses are the leading cause of acute gastroenteritis in human. Noroviruses also infect animals such as cow, mice, cat, and dog. How noroviruses bind and enter host cells is still incompletely understood. Recently, the type I transmembrane protein CD300lf was recently identified as the murine norovirus receptor, yet it is unclear how the virus capsid and receptor interact at the molecular level. In this study, we determined the X-ray crystal structure of the soluble CD300lf (sCD300lf) and murine norovirus capsid-protruding domain complex at 2.05 Å resolution. We found that the sCD300lf binding site is located on the topside of the protruding domain and involves a network of hydrophilic and hydrophobic interactions. The sCD300lf locked nicely into a complementary cavity on the protruding domain that is additionally coordinated with a positive surface charge on the sCD300lf and a negative surface charge on the protruding domain. Five of six protruding domain residues interacting with sCD300lf were maintained between different murine norovirus strains, suggesting that the sCD300lf was capable of binding to a highly conserved pocket. Moreover, a sequence alignment with other CD300 paralogs showed that the sCD300lf interacting residues were partially conserved in CD300ld, but variable in other CD300 family members, consistent with previously reported infection selectivity. Overall, these data provide insights into how a norovirus engages a protein receptor and will be important for a better understanding of selective recognition and norovirus attachment and entry mechanisms. IMPORTANCE Noroviruses exhibit exquisite host-range specificity due to species-specific interactions between the norovirus capsid protein and host molecules. Given this strict host-range restriction it has been unclear how the viruses are maintained within a species between relatively sporadic epidemics. While much data demonstrates that noroviruses can interact with carbohydrates, recent work has shown that expression of the protein CD300lf is both necessary and sufficient for murine norovirus infection of mice and binding of the virus to permissive cells. Importantly, the expression of this murine protein by human cells renders them fully permissive for murine norovirus infection, indicating that at least in this case host-range restriction is determined by molecular events that control receptor binding and entry. Defining the atomic-resolution interactions between the norovirus capsid protein and its cognate receptor is essential for a molecular understanding of host-range restriction and norovirus tropism. Copyright © 2018 American Society for Microbiology.
Alternative dimerization interfaces in the glucocorticoid receptor-α ligand binding domain.
Bianchetti, Laurent; Wassmer, Bianca; Defosset, Audrey; Smertina, Anna; Tiberti, Marion L; Stote, Roland H; Dejaegere, Annick
2018-04-30
Nuclear hormone receptors (NRs) constitute a large family of multi-domain ligand-activated transcription factors. Dimerization is essential for their regulation, and both DNA binding domain (DBD) and ligand binding domain (LBD) are implicated in dimerization. Intriguingly, the glucocorticoid receptor-α (GRα) presents a DBD dimeric architecture similar to that of the homologous estrogen receptor-α (ERα), but an atypical dimeric architecture for the LBD. The physiological relevance of the proposed GRα LBD dimer is a subject of debate. We analyzed all GRα LBD homodimers observed in crystals using an energetic analysis based on the PISA and on the MM/PBSA methods and a sequence conservation analysis, using the ERα LBD dimer as a reference point. Several dimeric assemblies were observed for GRα LBD. The assembly generally taken to be physiologically relevant showed weak binding free energy and no significant residue conservation at the contact interface, while an alternative homodimer mediated by both helix 9 and C-terminal residues showed significant binding free energy and residue conservation. However, none of the GRα LBD assemblies found in crystals are as stable or conserved as the canonical ERα LBD dimer. GRα C-terminal sequence (F-domain) forms a steric obstacle to the canonical dimer assembly in all available structures. Our analysis calls for a re-examination of the currently accepted GRα homodimer structure and experimental investigations of the alternative architectures. This work questions the validity of the currently accepted architecture. This has implications for interpreting physiological data and for therapeutic design pertaining to glucocorticoid research. Copyright © 2018. Published by Elsevier B.V.
Surface conservation laws at microscopically diffuse interfaces.
Chu, Kevin T; Bazant, Martin Z
2007-11-01
In studies of interfaces with dynamic chemical composition, bulk and interfacial quantities are often coupled via surface conservation laws of excess surface quantities. While this approach is easily justified for microscopically sharp interfaces, its applicability in the context of microscopically diffuse interfaces is less theoretically well-established. Furthermore, surface conservation laws (and interfacial models in general) are often derived phenomenologically rather than systematically. In this article, we first provide a mathematically rigorous justification for surface conservation laws at diffuse interfaces based on an asymptotic analysis of transport processes in the boundary layer and derive general formulae for the surface and normal fluxes that appear in surface conservation laws. Next, we use nonequilibrium thermodynamics to formulate surface conservation laws in terms of chemical potentials and provide a method for systematically deriving the structure of the interfacial layer. Finally, we derive surface conservation laws for a few examples from diffusive and electrochemical transport.
Taha; Siddiqui, K S; Campanaro, S; Najnin, T; Deshpande, N; Williams, T J; Aldrich-Wright, J; Wilkins, M; Curmi, P M G; Cavicchioli, R
2016-09-01
TRAM domain proteins present in Archaea and Bacteria have a β-barrel shape with anti-parallel β-sheets that form a nucleic acid binding surface; a structure also present in cold shock proteins (Csps). Aside from protein structures, experimental data defining the function of TRAM domains is lacking. Here, we explore the possible functional properties of a single TRAM domain protein, Ctr3 (cold-responsive TRAM domain protein 3) from the Antarctic archaeon Methanococcoides burtonii that has increased abundance during low temperature growth. Ribonucleic acid (RNA) bound by Ctr3 in vitro was determined using RNA-seq. Ctr3-bound M. burtonii RNA with a preference for transfer (t)RNA and 5S ribosomal RNA, and a potential binding motif was identified. In tRNA, the motif represented the C loop; a region that is conserved in tRNA from all domains of life and appears to be solvent exposed, potentially providing access for Ctr3 to bind. Ctr3 and Csps are structurally similar and are both inferred to function in low temperature translation. The broad representation of single TRAM domain proteins within Archaea compared with their apparent absence in Bacteria, and scarcity of Csps in Archaea but prevalence in Bacteria, suggests they represent distinct evolutionary lineages of functionally equivalent RNA-binding proteins. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.
Zhou, Yan; Dong, Na; Hu, Liyan; Shao, Feng
2013-01-01
The genus Shigella infects human gut epithelial cells to cause diarrhea and gastrointestinal disorders. Like many other Gram-negative bacterial pathogens, the virulence of Shigella spp. relies on a conserved type three secretion system that delivers a handful of effector proteins into host cells to manipulate various host cell physiology. However, many of the Shigella type III effectors remain functionally uncharacterized. Here we observe that OspG, one of the Shigella effectors, interacted with ubiquitin conjugates and poly-ubiquitin chains of either K48 or K63 linkage in eukaryotic host cells. Purified OspG protein formed a stable complex with ubiquitin but showed no interactions with other ubiquitin-like proteins. OspG binding to ubiquitin required the carboxyl terminal helical region in OspG and the canonical I44-centered hydrophobic surface in ubiquitin. OspG and OspG-homologous effectors, NleH1/2 from enteropathogenic E coli (EPEC), contain sub-domains I-VII of eukaryotic serine/threonine kinase. GST-tagged OspG and NleH1/2 could undergo autophosphorylation, the former of which was significantly stimulated by ubiquitin binding. Ubiquitin binding was also required for OspG functioning in attenuating host NF-κB signaling. Our data illustrate a new mechanism that bacterial pathogen like Shigella exploits ubiquitin binding to activate its secreted virulence effector for its functioning in host eukaryotic cells. PMID:23469023
Identification of Conserved Water Sites in Protein Structures for Drug Design.
Jukič, Marko; Konc, Janez; Gobec, Stanislav; Janežič, Dušanka
2017-12-26
Identification of conserved waters in protein structures is a challenging task with applications in molecular docking and protein stability prediction. As an alternative to computationally demanding simulations of proteins in water, experimental cocrystallized waters in the Protein Data Bank (PDB) in combination with a local structure alignment algorithm can be used for reliable prediction of conserved water sites. We developed the ProBiS H2O approach based on the previously developed ProBiS algorithm, which enables identification of conserved water sites in proteins using experimental protein structures from the PDB or a set of custom protein structures available to the user. With a protein structure, a binding site, or an individual water molecule as a query, ProBiS H2O collects similar proteins from the PDB and performs local or binding site-specific superimpositions of the query structure with similar proteins using the ProBiS algorithm. It collects the experimental water molecules from the similar proteins and transposes them to the query protein. Transposed waters are clustered by their mutual proximity, which enables identification of discrete sites in the query protein with high water conservation. ProBiS H2O is a robust and fast new approach that uses existing experimental structural data to identify conserved water sites on the interfaces of protein complexes, for example protein-small molecule interfaces, and elsewhere on the protein structures. It has been successfully validated in several reported proteins in which conserved water molecules were found to play an important role in ligand binding with applications in drug design.
Matthews, Lindsay A.; Selvaratnam, Rajeevan; Jones, Darryl R.; Akimoto, Madoka; McConkey, Brendan J.; Melacini, Giuseppe; Duncker, Bernard P.; Guarné, Alba
2014-01-01
Forkhead-associated (FHA) and BRCA1 C-terminal (BRCT) domains are overrepresented in DNA damage and replication stress response proteins. They function primarily as phosphoepitope recognition modules but can also mediate non-canonical interactions. The latter are rare, and only a few have been studied at a molecular level. We have identified a crucial non-canonical interaction between the N-terminal FHA1 domain of the checkpoint effector kinase Rad53 and the BRCT domain of the regulatory subunit of the Dbf4-dependent kinase that is critical to suppress late origin firing and to stabilize stalled forks during replication stress. The Rad53-Dbf4 interaction is phosphorylation-independent and involves a novel non-canonical interface on the FHA1 domain. Mutations within this surface result in hypersensitivity to genotoxic stress. Importantly, this surface is not conserved in the FHA2 domain of Rad53, suggesting that the FHA domains of Rad53 gain specificity by engaging additional interaction interfaces beyond their phosphoepitope-binding site. In general, our results point to FHA domains functioning as complex logic gates rather than mere phosphoepitope-targeting modules. PMID:24285546
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gromowski, Gregory D.; Barrett, Alan D.T.
2007-09-30
The surface of the mature dengue virus (DENV) particle consists of 90 envelope (E) protein dimers that mediate both receptor binding and fusion. The E protein ectodomain can be divided into three structural domains designated ED1, ED2, and ED3, of which ED3 contains the critical and dominant virus-specific neutralization sites. In this study the ED3 epitopes recognized by seven, murine, IgG1 DENV-2 type-specific, monoclonal antibodies (MAbs) were determined using site-directed mutagenesis of a recombinant DENV-2 ED3 (rED3) protein. A total of 41 single amino acid substitutions were introduced into the rED3 at 30 different surface accessible residues. The affinity ofmore » each MAb with the mutant rED3s was assessed by indirect ELISA and the results indicate that all seven MAbs recognize overlapping epitopes with residues K305 and P384 critical for binding. These residues are conserved among DENV-2 strains and cluster together on the upper lateral face of ED3. A linear relationship was observed between relative occupancy of ED3 on the virion by MAb and neutralization of the majority of virus infectivity ({approx} 90%) for all seven MAbs. Depending on the MAb, it is predicted that between 10% and 50% relative occupancy of ED3 on the virion is necessary for virus neutralization and for all seven MAbs occupancy levels approaching saturation were required for 100% neutralization of virus infectivity. Overall, the conserved antigenic site recognized by all seven MAbs is likely to be a dominant DENV-2 type-specific, neutralization determinant.« less
Zheng, Xiangdong; Gooi, Li Ming; Wason, Arpit; Gabriel, Elke; Mehrjardi, Narges Zare; Yang, Qian; Zhang, Xingrun; Debec, Alain; Basiri, Marcus L.; Avidor-Reiss, Tomer; Pozniakovsky, Andrei; Poser, Ina; Šarić, Tomo; Hyman, Anthony A.; Li, Haitao; Gopalakrishnan, Jay
2014-01-01
Pericentriolar material (PCM) recruitment to centrioles forms a key step in centrosome biogenesis. Deregulation of this process leads to centrosome aberrations causing disorders, one of which is autosomal recessive primary microcephaly (MCPH), a neurodevelopmental disorder where brain size is reduced. During PCM recruitment, the conserved centrosomal protein Sas-4/CPAP/MCPH6, known to play a role in centriole formation, acts as a scaffold for cytoplasmic PCM complexes to bind and then tethers them to centrioles to form functional centrosomes. To understand Sas-4’s tethering role, we determined the crystal structure of its T complex protein 10 (TCP) domain displaying a solvent-exposed single-layer of β-sheets fold. This unique feature of the TCP domain suggests that it could provide an “extended surface-like” platform to tether the Sas-4–PCM scaffold to a centriole. Functional studies in Drosophila, human cells, and human induced pluripotent stem cell-derived neural progenitor cells were used to test this hypothesis, where point mutations within the 9–10th β-strands (β9–10 mutants including a MCPH-associated mutation) perturbed PCM tethering while allowing Sas-4/CPAP to scaffold cytoplasmic PCM complexes. Specifically, the Sas-4 β9–10 mutants displayed perturbed interactions with Ana2, a centrosome duplication factor, and Bld-10, a centriole microtubule-binding protein, suggesting a role for the β9–10 surface in mediating protein–protein interactions for efficient Sas-4–PCM scaffold centriole tethering. Hence, we provide possible insights into how centrosomal protein defects result in human MCPH and how Sas-4 proteins act as a vehicle to tether PCM complexes to centrioles independent of its well-known role in centriole duplication. PMID:24385583
Lucky, Amuza Byaruhanga; Sakaguchi, Miako; Katakai, Yuko; Kawai, Satoru; Yahata, Kazuhide; Templeton, Thomas J; Kaneko, Osamu
2016-01-01
The malaria parasite, Plasmodium, exports protein products to the infected erythrocyte to introduce modifications necessary for the establishment of nutrient acquisition and surface display of host interaction ligands. Erythrocyte remodeling impacts parasite virulence and disease pathology and is well documented for the human malaria parasite Plasmodium falciparum, but has been less described for other Plasmodium species. For P. falciparum, the exported protein skeleton-binding protein 1 (PfSBP1) is involved in the trafficking of erythrocyte surface ligands and localized to membranous structures within the infected erythrocyte, termed Maurer's clefts. In this study, we analyzed SBP1 orthologs across the Plasmodium genus by BLAST analysis and conserved gene synteny, which were also recently described by de Niz et al. (2016). To evaluate the localization of an SBP1 ortholog, we utilized the zoonotic malaria parasite, Plasmodium knowlesi. Immunofluorescence assay of transgenic P. knowlesi parasites expressing epitope-tagged recombinant PkSBP1 revealed a punctate staining pattern reminiscent of Maurer's clefts, following infection of either monkey or human erythrocytes. The recombinant PkSBP1-positive puncta co-localized with Giemsa-stained structures, known as 'Sinton and Mulligan' stipplings. Immunoelectron microscopy also showed that recombinant PkSBP1 localizes within or on the membranous structures akin to the Maurer's clefts. The recombinant PkSBP1 expressed in P. falciparum-infected erythrocytes co-localized with PfSBP1 at the Maurer's clefts, indicating an analogous trafficking pattern. A member of the P. knowlesi 2TM protein family was also expressed and localized to membranous structures in infected monkey erythrocytes. These results suggest that the trafficking machinery and induced erythrocyte cellular structures of P. knowlesi are similar following infection of both monkey and human erythrocytes, and are conserved with P. falciparum.
Bähring, R; Dannenberg, J; Peters, H C; Leicher, T; Pongs, O; Isbrandt, D
2001-06-29
Association of Kv channel-interacting proteins (KChIPs) with Kv4 channels leads to modulation of these A-type potassium channels (An, W. F., Bowlby, M. R., Betty, M., Cao, J., Ling, H. P., Mendoza, G., Hinson, J. W., Mattsson, K. I., Strassle, B. W., Trimmer, J. S., and Rhodes, K. J. (2000) Nature 403, 553-556). We cloned a KChIP2 splice variant (KChIP2.2) from human ventricle. In comparison with KChIP2.1, coexpression of KChIP2.2 with human Kv4 channels in mammalian cells slowed the onset of Kv4 current inactivation (2-3-fold), accelerated the recovery from inactivation (5-7-fold), and shifted Kv4 steady-state inactivation curves by 8-29 mV to more positive potentials. The features of Kv4.2/KChIP2.2 currents closely resemble those of cardiac rapidly inactivating transient outward currents. KChIP2.2 stimulated the Kv4 current density in Chinese hamster ovary cells by approximately 55-fold. This correlated with a redistribution of immunoreactivity from perinuclear areas to the plasma membrane. Increased Kv4 cell-surface expression and current density were also obtained in the absence of KChIP2.2 when the highly conserved proximal Kv4 N terminus was deleted. The same domain is required for association of KChIP2.2 with Kv4 alpha-subunits. We propose that an efficient transport of Kv4 channels to the cell surface depends on KChIP binding to the Kv4 N-terminal domain. Our data suggest that the binding is necessary, but not sufficient, for the functional activity of KChIPs.
Bryant, Kevin F; Yan, Zhipeng; Dreyfus, David H; Knipe, David M
2012-06-01
Herpes simplex virus 1 (HSV-1) ICP8 is a single-stranded DNA-binding protein that is necessary for viral DNA replication and exhibits recombinase activity in vitro. Alignment of the HSV-1 ICP8 amino acid sequence with ICP8 homologs from other herpesviruses revealed conserved aspartic acid (D) and glutamic acid (E) residues. Amino acid residue D1087 was conserved in every ICP8 homolog analyzed, indicating that it is likely critical for ICP8 function. We took a genetic approach to investigate the functions of the conserved ICP8 D and E residues in HSV-1 replication. The E1086A D1087A mutant form of ICP8 failed to support the replication of an ICP8 mutant virus in a complementation assay. E1086A D1087A mutant ICP8 bound DNA, albeit with reduced affinity, demonstrating that the protein is not globally misfolded. This mutant form of ICP8 was also recognized by a conformation-specific antibody, further indicating that its overall structure was intact. A recombinant virus expressing E1086A D1087A mutant ICP8 was defective in viral replication, viral DNA synthesis, and late gene expression in Vero cells. A class of enzymes called DDE recombinases utilize conserved D and E residues to coordinate divalent metal cations in their active sites. We investigated whether the conserved D and E residues in ICP8 were also required for binding metal cations and found that the E1086A D1087A mutant form of ICP8 exhibited altered divalent metal binding in an in vitro iron-induced cleavage assay. These results identify a novel divalent metal cation-binding site in ICP8 that is required for ICP8 functions during viral replication.
Miller, Michelle C; Klyosov, Anatole; Mayo, Kevin H
2009-01-01
Galectins are a sub-family of lectins, defined by their highly conserved β-sandwich structures and ability to bind to β-galactosides, like Gal β1-4 Glc (lactose). Here, we used 15N-1H HSQC and pulse field gradient (PFG) NMR spectroscopy to demonstrate that galectin-1 (gal-1) binds to the relatively large galactomannan Davanat, whose backbone is composed of β1-4-linked d-mannopyranosyl units to which single d-galactopyranosyl residues are periodically attached via α1-6 linkage (weight-average MW of 59 kDa). The Davanat binding domain covers a relatively large area on the surface of gal-1 that runs across the dimer interface primarily on that side of the protein opposite to the lactose binding site. Our data show that gal-1 binds Davanat with an apparent equilibrium dissociation constant (Kd) of 10 × 10−6 M, compared to 260 × 10−6 M for lactose, and a stiochiometry of about 3 to 6 gal-1 molecules per Davanat molecule. Mannan also interacts at the same galactomannan binding domain on gal-1, but with at least 10-fold lower avidity, supporting the role of galactose units in Davanat for relatively strong binding to gal-1. We also found that the β-galactoside binding domain remains accessible in the gal-1/Davanat complex, as lactose can still bind with no apparent loss in affinity. In addition, gal-1 binding to Davanat also modifies the supermolecular structure of the galactomannan and appears to reduce its hydrodynamic radius and disrupt inter-glycan interactions thereby reducing glycan-mediated solution viscosity. Overall, our findings contribute to understanding gal-1–carbohydrate interactions and provide insight into gal-1 function with potentially significant biological consequences. PMID:19541770
Bakó, László; Umeda, Masaaki; Tiburcio, Antonio F.; Schell, Jeff; Koncz, Csaba
2003-01-01
The bacterial virulence protein VirD2 plays an important role in nuclear import and chromosomal integration of Agrobacterium-transferred DNA in fungal, plant, animal, and human cells. Here we show that in nuclei of alfalfa cells, VirD2 interacts with and is phosphorylated by CAK2Ms, a conserved plant ortholog of cyclin-dependent kinase-activating kinases. CAK2Ms binds to and phosphorylates the C-terminal regulatory domain of RNA polymerase II largest subunit, which can recruit the TATA box-binding protein. VirD2 is found in tight association with the TATA box-binding protein in vivo. These results indicate that recognition of VirD2 is mediated by widely conserved nuclear factors in eukaryotes. PMID:12900506
Nagy, Andrea; Kénesi, Erzsébet; Rentsendorj, Otgonchimeg; Molnár, Annamária; Szénási, Tibor; Sinkó, Ildikó; Zvara, Ágnes; Thottathil Oommen, Sajit; Barta, Endre; Puskás, László G.; Lefebvre, Veronique; Kiss, Ibolya
2011-01-01
To help uncover the mechanisms underlying the staggered expression of cartilage-specific genes in the growth plate, we dissected the transcriptional mechanisms driving expression of the matrilin-1 gene (Matn1). We show that a unique assembly of evolutionarily conserved cis-acting elements in the Matn1 proximal promoter restricts expression to the proliferative and prehypertrophic zones of the growth plate. These elements functionally interact with distal elements and likewise are capable of restricting the domain of activity of a pancartilaginous Col2a1 enhancer. The proximal elements include a Pe1 element binding the chondrogenic L-Sox5, Sox6, and Sox9 proteins, a SI element binding Nfi proteins, and an initiator Ine element binding the Sox trio and other factors. Sox9 binding to Pe1 is indispensable for functional interaction with the distal promoter. Binding of L-Sox5/Sox6 to Ine and Nfib to SI modulates Sox9 transactivation in a protein dose-dependent manner, possibly to enhance Sox9 activity in early stages of chondrogenesis and repress it at later stages. Hence, our data suggest a novel model whereby Sox and Nfi proteins bind to conserved Matn1 proximal elements and functionally interact with each other to finely tune gene expression in specific zones of the cartilage growth plate. PMID:21173167
Mieher, Joshua L; Larson, Matthew R; Schormann, Norbert; Purushotham, Sangeetha; Wu, Ren; Rajashankar, Kanagalaghatta R; Wu, Hui; Deivanayagam, Champion
2018-07-01
The high-resolution structure of glucan binding protein C (GbpC) at 1.14 Å, a sucrose-dependent virulence factor of the dental caries pathogen Streptococcus mutans , has been determined. GbpC shares not only structural similarities with the V regions of AgI/II and SspB but also functional adherence to salivary agglutinin (SAG) and its scavenger receptor cysteine-rich domains (SRCRs). This is not only a newly identified function for GbpC but also an additional fail-safe binding mechanism for S. mutans Despite the structural similarities with S. mutans antigen I/II (AgI/II) and SspB of Streptococcus gordonii , GbpC remains unique among these surface proteins in its propensity to adhere to dextran/glucans. The complex crystal structure of GbpC with dextrose (β-d-glucose; Protein Data Bank ligand BGC) highlights exclusive structural features that facilitate this interaction with dextran. Targeted deletion mutant studies on GbpC's divergent loop region in the vicinity of a highly conserved calcium binding site confirm its role in biofilm formation. Finally, we present a model for adherence to dextran. The structure of GbpC highlights how artfully microbes have engineered the lectin-like folds to broaden their functional adherence repertoire. Copyright © 2018 American Society for Microbiology.
Membrane and Protein Interactions of the Pleckstrin Homology Domain Superfamily
Lenoir, Marc; Kufareva, Irina; Abagyan, Ruben; Overduin, Michael
2015-01-01
The human genome encodes about 285 proteins that contain at least one annotated pleckstrin homology (PH) domain. As the first phosphoinositide binding module domain to be discovered, the PH domain recruits diverse protein architectures to cellular membranes. PH domains constitute one of the largest protein superfamilies, and have diverged to regulate many different signaling proteins and modules such as Dbl homology (DH) and Tec homology (TH) domains. The ligands of approximately 70 PH domains have been validated by binding assays and complexed structures, allowing meaningful extrapolation across the entire superfamily. Here the Membrane Optimal Docking Area (MODA) program is used at a genome-wide level to identify all membrane docking PH structures and map their lipid-binding determinants. In addition to the linear sequence motifs which are employed for phosphoinositide recognition, the three dimensional structural features that allow peripheral membrane domains to approach and insert into the bilayer are pinpointed and can be predicted ab initio. The analysis shows that conserved structural surfaces distinguish which PH domains associate with membrane from those that do not. Moreover, the results indicate that lipid-binding PH domains can be classified into different functional subgroups based on the type of membrane insertion elements they project towards the bilayer. PMID:26512702
Caldas, Cristina; Coelho, Verônica; Kalil, Jorge; Moro, Ana Maria; Maranhão, Andrea Q; Brígido, Marcelo M
2003-05-01
Humanization of monoclonal antibodies by complementary determinant region (CDR)-grafting has become a standard procedure to improve the clinical usage of animal antibodies. However, antibody humanization may result in loss of activity that has been attributed to structural constraints in the framework structure. In this paper, we report the complete humanization of the 6.7 anti-human CD18 monoclonal antibody in a scFv form. We used a germline-based approach to design a humanized VL gene fragment and expressed it together with a previously described humanized VH. The designed humanized VL has only 14 mutations compared to the closest human germline sequence. The resulting humanized scFv maintained the binding capacity and specificity to human CD18 expressed on the cell surface of peripheral blood mononuclear cells (PBMC), and showed the same pattern of staining T-lymphocytes sub-populations, in comparison to the original monoclonal antibody. We observed an unexpected effect of a conserved mouse-human framework position (L37) that hinders the binding of the humanized scFv to antigen. This paper reveals a new framework residue that interferes with paratope and antigen binding and also reinforces the germline approach as a successful strategy to humanize antibodies.
A Comparison of Two Single-Stranded DNA Binding Models by Mutational Analysis of APOBEC3G
Shindo, Keisuke; Li, Ming; Gross, Phillip J.; Brown, William L.; Harjes, Elena; Lu, Yongjian; Matsuo, Hiroshi; Harris, Reuben S.
2012-01-01
APOBEC3G is the best known of several DNA cytosine deaminases that function to inhibit the replication of parasitic genetic elements including the lentivirus HIV. Several high-resolution structures of the APOBEC3G catalytic domain have been generated, but none reveal how this enzyme binds to substrate single-stranded DNA. Here, we constructed a panel of APOBEC3G amino acid substitution mutants and performed a series of biochemical, genetic, and structural assays to distinguish between “Brim” and “Kink” models for single-strand DNA binding. Each model predicts distinct sets of interactions between surface arginines and negatively charged phosphates in the DNA backbone. Concordant with both models, changing the conserved arginine at position 313 to glutamate abolished both catalytic and restriction activities. In support of the Brim model, arginine to glutamate substitutions at positions 213, 215, and 320 also compromised these APOBEC3G activities. Arginine to glutamate substitutions at Kink model residues 374 and 376 had smaller effects. These observations were supported by A3G catalytic domain-ssDNA chemical shift perturbation experiments. The overall data set is most consistent with the Brim model for single-stranded DNA binding by APOBEC3G. PMID:24832226
Gonçalves, Ana Maria D; Silva, Catarina S; Madeira, Tânia I; Coelho, Ricardo; de Sanctis, Daniele; San Romão, Maria Vitória; Bento, Isabel
2012-11-01
The crystal structure of wild-type endo-β-D-1,4-mannanase (EC 3.2.1.78) from the ascomycete Chrysonilia sitophila (CsMan5) has been solved at 1.40 Å resolution. The enzyme isolated directly from the source shows mixed activity as both an endo-glucanase and an endo-mannanase. CsMan5 adopts the (β/α)(8)-barrel fold that is well conserved within the GH5 family and has highest sequence and structural homology to the GH5 endo-mannanases. Superimposition with proteins of this family shows a unique structural arrangement of three surface loops of CsMan5 that stretch over the active centre, promoting an altered topography of the binding cleft. The most relevant feature results from the repositioning of a long loop at the extremity of the binding cleft, resulting in a shortened glycone-binding region with two subsites. The other two extended loops flanking the binding groove produce a narrower cleft compared with the wide architecture observed in GH5 homologues. Two aglycone subsites (+1 and +2) are identified and a nonconserved tryptophan (Trp271) at the +1 subsite may offer steric hindrance. Taken together, these findings suggest that the discrimination of mannan substrates is achieved through modified loop length and structure.
Structural analysis of Bacillus pumilus phenolic acid decarboxylase, a lipocalin-fold enzyme
DOE Office of Scientific and Technical Information (OSTI.GOV)
Matte, Allan; Grosse, Stephan; Bergeron, Hélène
The decarboxylation of phenolic acids, including ferulic and p-coumaric acids, to their corresponding vinyl derivatives is of importance in the flavoring and polymer industries. Here, the crystal structure of phenolic acid decarboxylase (PAD) from Bacillus pumilus strain UI-670 is reported. The enzyme is a 161-residue polypeptide that forms dimers both in the crystal and in solution. The structure of PAD as determined by X-ray crystallography revealed a -barrel structure and two -helices, with a cleft formed at one edge of the barrel. The PAD structure resembles those of the lipocalin-fold proteins, which often bind hydrophobic ligands. Superposition of structurally relatedmore » proteins bound to their cognate ligands shows that they and PAD bind their ligands in a conserved location within the -barrel. Analysis of the residue-conservation pattern for PAD-related sequences mapped onto the PAD structure reveals that the conservation mainly includes residues found within the hydrophobic core of the protein, defining a common lipocalin-like fold for this enzyme family. A narrow cleft containing several conserved amino acids was observed as a structural feature and a potential ligand-binding site.« less
Ntumngia, Francis B.; Schloegel, Jesse; Barnes, Samantha J.; McHenry, Amy M.; Singh, Sanjay; King, Christopher L.
2012-01-01
The Duffy binding protein (DBP) is a vital ligand for Plasmodium vivax blood-stage merozoite invasion, making the molecule an attractive vaccine candidate against vivax malaria. Similar to other blood-stage vaccine candidates, DBP allelic variation eliciting a strain-specific immunity may be a major challenge for development of a broadly effective vaccine against vivax malaria. To understand whether conserved epitopes can be the target of neutralizing anti-DBP inhibition, we generated a set of monoclonal antibodies to DBP and functionally analyzed their reactivity to a panel of allelic variants. Quantitative analysis by enzyme-linked immunosorbent assay (ELISA) determined that some monoclonal antibodies reacted strongly with epitopes conserved on all DBP variants tested, while reactivity of others was allele specific. Qualitative analysis characterized by anti-DBP functional inhibition using an in vitro erythrocyte binding inhibition assay indicated that there was no consistent correlation between the endpoint titers and functional inhibition. Some monoclonal antibodies were broadly inhibitory while inhibition of others varied significantly by target allele. These data demonstrate a potential for vaccine-elicited immunization to target conserved epitopes but optimization of DBP epitope target specificity and immunogenicity may be necessary for protection against diverse P. vivax strains. PMID:22215740
Ntumngia, Francis B; Schloegel, Jesse; Barnes, Samantha J; McHenry, Amy M; Singh, Sanjay; King, Christopher L; Adams, John H
2012-03-01
The Duffy binding protein (DBP) is a vital ligand for Plasmodium vivax blood-stage merozoite invasion, making the molecule an attractive vaccine candidate against vivax malaria. Similar to other blood-stage vaccine candidates, DBP allelic variation eliciting a strain-specific immunity may be a major challenge for development of a broadly effective vaccine against vivax malaria. To understand whether conserved epitopes can be the target of neutralizing anti-DBP inhibition, we generated a set of monoclonal antibodies to DBP and functionally analyzed their reactivity to a panel of allelic variants. Quantitative analysis by enzyme-linked immunosorbent assay (ELISA) determined that some monoclonal antibodies reacted strongly with epitopes conserved on all DBP variants tested, while reactivity of others was allele specific. Qualitative analysis characterized by anti-DBP functional inhibition using an in vitro erythrocyte binding inhibition assay indicated that there was no consistent correlation between the endpoint titers and functional inhibition. Some monoclonal antibodies were broadly inhibitory while inhibition of others varied significantly by target allele. These data demonstrate a potential for vaccine-elicited immunization to target conserved epitopes but optimization of DBP epitope target specificity and immunogenicity may be necessary for protection against diverse P. vivax strains.
Yoder, Andrea R.; Kruse, Andrew C.; Earhart, Cathleen A.; Ohlendorf, Douglas H.; Potter, Lincoln R.
2015-01-01
C-type natriuretic peptide (CNP) stimulates endochondrial ossification by activating the transmembrane guanylyl cyclase, natriuretic peptide receptor-B (NPR-B). Recently, a spontaneous autosomal recessive mutation that causes severe dwarfism in mice was identified. The mutant, called long bone abnormality (lbab), contains a single point mutation that converts an arginine to a glycine in a conserved coding region of the CNP gene, but how this mutation affects CNP activity has not been reported. Here, we determined that thirty to greater than one hundred-fold more CNPlbab was required to activate NPR-B as compared to wild-type CNP in whole cell cGMP elevation and membrane guanylyl cyclase assays. The reduced ability of CNPlbab to activate NPR-B was explained, at least in part, by decreased binding since ten-fold more CNPlbab than wild-type CNP was required to compete with [125I][Tyr0]CNP for receptor binding. Molecular modeling suggested that the conserved arginine is critical for binding to an equally conserved acidic pocket in NPR-B. These results indicate that reduced binding to and activation of NPR-B causes dwarfism in lbab−/− mice. PMID:18554750
Jaendling, Alessa; Ramayah, Soshila; Pryce, David W; McFarlane, Ramsay J
2008-02-01
Translin is a conserved protein which associates with the breakpoint junctions of chromosomal translocations linked with the development of some human cancers. It binds to both DNA and RNA and has been implicated in mRNA metabolism and regulation of genome stability. It has a binding partner, translin-associated protein X (TRAX), levels of which are regulated by the translin protein in higher eukaryotes. In this study we find that this regulatory function is conserved in the lower eukaryotes, suggesting that translin and TRAX have important functions which provide a selective advantage to both unicellular and multi-cellular eukaryotes, indicating that this function may not be tissue-specific in nature. However, to date, the biological importance of translin and TRAX remains unclear. Here we systematically investigate proposals that suggest translin and TRAX play roles in controlling mitotic cell proliferation, DNA damage responses, genome stability, meiotic/mitotic recombination and stability of GT-rich repeat sequences. We find no evidence for translin and/or TRAX primary function in these pathways, indicating that the conserved biochemical function of translin is not implicated in primary pathways for regulating genome stability and/or segregation.
Structural basis for corepressor assembly by the orphan nuclear receptor TLX
Zhi, Xiaoyong; Zhou, X. Edward; He, Yuanzheng; ...
2015-02-15
The orphan nuclear receptor TLX regulates neural stem cell self-renewal in the adult brain and functions primarily as a transcription repressor through recruitment of Atrophin corepressors, which bind to TLX via a conserved peptide motif termed the Atro box. Here we report crystal structures of the human and insect TLX ligand-binding domain in complex with Atro box peptides. In these structures, TLX adopts an autorepressed conformation in which its helix H12 occupies the coactivator-binding groove. Unexpectedly, H12 in this autorepressed conformation forms a novel binding pocket with residues from helix H3 that accommodates a short helix formed by the conservedmore » ALXXLXXY motif of the Atro box. Mutations that weaken the TLX–Atrophin interaction compromise the repressive activity of TLX, demonstrating that this interaction is required for Atrophin to confer repressor activity to TLX. Moreover, the autorepressed conformation is conserved in the repressor class of orphan nuclear receptors, and mutations of corresponding residues in other members of this class of receptors diminish their repressor activities. Together, our results establish the functional conservation of the autorepressed conformation and define a key sequence motif in the Atro box that is essential for TLX-mediated repression.« less
Klingl, Stefan; Sandmann, Achim; Taccardi, Nicola; Sticht, Heinrich; Muller, Yves A.; Hensel, Michael
2017-01-01
The giant non-fimbrial adhesin SiiE of Salmonella enterica mediates the first contact to the apical site of epithelial cells and enables subsequent invasion. SiiE is a 595 kDa protein composed of 53 repetitive bacterial immunoglobulin (BIg) domains and the only known substrate of the SPI4-encoded type 1 secretion system (T1SS). The crystal structure of BIg50-52 of SiiE revealed two distinct Ca2+-binding sites per BIg domain formed by conserved aspartate or glutamate residues. In a mutational analysis Ca2+-binding sites were disrupted by aspartate to serine exchange at various positions in the BIg domains of SiiE. Amounts of secreted SiiE diminish with a decreasing number of intact Ca2+-binding sites. BIg domains of SiiE contain distinct Ca2+-binding sites, with type I sites being similar to other T1SS-secreted proteins and type II sites newly identified in SiiE. We functionally and structurally dissected the roles of type I and type II Ca2+-binding sites in SiiE, as well as the importance of Ca2+-binding sites in various positions of SiiE. Type I Ca2+-binding sites were critical for efficient secretion of SiiE and a decreasing number of type I sites correlated with reduced secretion. Type II sites were less important for secretion, stability and surface expression of SiiE, however integrity of type II sites in the C-terminal portion was required for the function of SiiE in mediating adhesion and invasion. PMID:28558023
Thompson, Joanne; Fernandez-Reyes, Delmiro; Sharling, Lisa; Moore, Sally G; Eling, Wijnand M; Kyes, Sue A; Newbold, Christopher I; Kafatos, Fotis C; Janse, Chris J; Waters, Andrew P
2007-06-01
The Cysteine Repeat Modular Proteins (PCRMP1-4) of Plasmodium, are encoded by a small gene family that is conserved in malaria and other Apicomplexan parasites. They are very large, predicted surface proteins with multipass transmembrane domains containing motifs that are conserved within families of cysteine-rich, predicted surface proteins in a range of unicellular eukaryotes, and a unique combination of protein-binding motifs, including a >100 kDa cysteine-rich modular region, an epidermal growth factor-like domain and a Kringle domain. PCRMP1 and 2 are expressed in life cycle stages in both the mosquito and vertebrate. They colocalize with PfEMP1 (P. falciparum Erythrocyte Membrane Antigen-1) during its export from P. falciparum blood-stage parasites and are exposed on the surface of haemolymph- and salivary gland-sporozoites in the mosquito, consistent with a role in host tissue targeting and invasion. Gene disruption of pcrmp1 and 2 in the rodent malaria model, P. berghei, demonstrated that both are essential for transmission of the parasite from the mosquito to the mouse and has established their discrete and important roles in sporozoite targeting to the mosquito salivary gland. The unprecedented expression pattern and structural features of the PCRMPs thus suggest a variety of roles mediating host-parasite interactions throughout the parasite life cycle.
2011-01-01
Background The two homologous iron-binding lobes of transferrins are thought to have evolved by gene duplication of an ancestral monolobal form, but any conserved synteny between bilobal and monolobal transferrin loci remains unexplored. The important role played by transferrin in the resistance to invading pathogens makes this polymorphic gene a highly valuable candidate for studying adaptive divergence among local populations. Results The Atlantic cod genome was shown to harbour two tandem duplicated serum transferrin genes (Tf1, Tf2), a melanotransferrin gene (MTf), and a monolobal transferrin gene (Omp). Whereas Tf1 and Tf2 were differentially expressed in liver and brain, the Omp transcript was restricted to the otoliths. Fish, chicken and mammals showed highly conserved syntenic regions in which monolobal and bilobal transferrins reside, but contrasting with tetrapods, the fish transferrin genes are positioned on three different linkage groups. Sequence alignment of cod Tf1 cDNAs from Northeast (NE) and Northwest (NW) Atlantic populations revealed 22 single nucleotide polymorphisms (SNP) causing the replacement of 16 amino acids, including eight surface residues revealed by the modelled 3D-structures, that might influence the binding of pathogens for removal of iron. SNP analysis of a total of 375 individuals from 14 trans-Atlantic populations showed that the Tf1-NE variant was almost fixed in the Baltic cod and predominated in the other NE Atlantic populations, whereas the NW Atlantic populations were more heterozygous and showed high frequencies of the Tf-NW SNP alleles. Conclusions The highly conserved synteny between fish and tetrapod transferrin loci infers that the fusion of tandem duplicated Omp-like genes gave rise to the modern transferrins. The multiple nonsynonymous substitutions in cod Tf1 with putative structural effects, together with highly divergent allele frequencies among different cod populations, strongly suggest evidence for positive selection and local adaptation in trans-Atlantic cod populations. PMID:21612617
Andersen, Øivind; De Rosa, Maria Cristina; Pirolli, Davide; Tooming-Klunderud, Ave; Petersen, Petra E; André, Carl
2011-05-25
The two homologous iron-binding lobes of transferrins are thought to have evolved by gene duplication of an ancestral monolobal form, but any conserved synteny between bilobal and monolobal transferrin loci remains unexplored. The important role played by transferrin in the resistance to invading pathogens makes this polymorphic gene a highly valuable candidate for studying adaptive divergence among local populations. The Atlantic cod genome was shown to harbour two tandem duplicated serum transferrin genes (Tf1, Tf2), a melanotransferrin gene (MTf), and a monolobal transferrin gene (Omp). Whereas Tf1 and Tf2 were differentially expressed in liver and brain, the Omp transcript was restricted to the otoliths. Fish, chicken and mammals showed highly conserved syntenic regions in which monolobal and bilobal transferrins reside, but contrasting with tetrapods, the fish transferrin genes are positioned on three different linkage groups. Sequence alignment of cod Tf1 cDNAs from Northeast (NE) and Northwest (NW) Atlantic populations revealed 22 single nucleotide polymorphisms (SNP) causing the replacement of 16 amino acids, including eight surface residues revealed by the modelled 3D-structures, that might influence the binding of pathogens for removal of iron. SNP analysis of a total of 375 individuals from 14 trans-Atlantic populations showed that the Tf1-NE variant was almost fixed in the Baltic cod and predominated in the other NE Atlantic populations, whereas the NW Atlantic populations were more heterozygous and showed high frequencies of the Tf-NW SNP alleles. The highly conserved synteny between fish and tetrapod transferrin loci infers that the fusion of tandem duplicated Omp-like genes gave rise to the modern transferrins. The multiple nonsynonymous substitutions in cod Tf1 with putative structural effects, together with highly divergent allele frequencies among different cod populations, strongly suggest evidence for positive selection and local adaptation in trans-Atlantic cod populations.
Kozakova, Lucie; Liao, Chunyan; Guerineau, Marc; Colnaghi, Rita; Vidot, Susanne; Marek, Jaromir; Bathula, Sreenivas R.; Lehmann, Alan R.; Palecek, Jan
2011-01-01
Background The SMC5-6 protein complex is involved in the cellular response to DNA damage. It is composed of 6–8 polypeptides, of which Nse1, Nse3 and Nse4 form a tight sub-complex. MAGEG1, the mammalian ortholog of Nse3, is the founding member of the MAGE (melanoma-associated antigen) protein family and Nse4 is related to the EID (E1A-like inhibitor of differentiation) family of transcriptional repressors. Methodology/Principal Findings Using site-directed mutagenesis, protein-protein interaction analyses and molecular modelling, we have identified a conserved hydrophobic surface on the C-terminal domain of Nse3 that interacts with Nse4 and identified residues in its N-terminal domain that are essential for interaction with Nse1. We show that these interactions are conserved in the human orthologs. Furthermore, interaction of MAGEG1, the mammalian ortholog of Nse3, with NSE4b, one of the mammalian orthologs of Nse4, results in transcriptional co-activation of the nuclear receptor, steroidogenic factor 1 (SF1). In an examination of the evolutionary conservation of the Nse3-Nse4 interactions, we find that several MAGE proteins can interact with at least one of the NSE4/EID proteins. Conclusions/Significance We have found that, despite the evolutionary diversification of the MAGE family, the characteristic hydrophobic surface shared by all MAGE proteins from yeast to humans mediates its binding to NSE4/EID proteins. Our work provides new insights into the interactions, evolution and functions of the enigmatic MAGE proteins. PMID:21364888
Elhaji, Youssef A; Stoica, Ileana; Dennis, Sheldon; Purisima, Enrico O; Lumbroso, Rose; Beitel, Lenore K; Trifiro, Mark A
2006-03-15
Structural studies of the ligand-binding domain (LBD) of several steroid receptors have revealed that the dynamic properties of the C-terminal helix 12 (H12) are the major determinant of the activation mode of these receptors. H12 exhibits high mobility and different conformations in the absence of ligand. Upon ligand binding, H12 is stabilized in a precise position to seal the ligand-binding pocket and finalize the assembly of the activation function (AF-2) domain. In this study, we investigated the role of the conserved proline 892 of the androgen receptor (AR) in directing the dynamic location and orientation of the AR-H12. We used a combined approach including kinetic and biochemical assays with molecular dynamic simulations to analyze two substitutions (P892A and P892L) identified in individuals with complete androgen insensitivity syndrome. Our analyses revealed distinct mechanisms by which these substitutions impair H12 function resulting in severely defective receptors. The AR-P892A receptor exhibited reduced ligand binding and transactivational potential because of an increased flexibility in H12. The AR-P892L substitution renders the receptor inactive due to a distorted, unstructured and misplaced H12. To confirm the mutants' inability to stabilize H12 in an active position, we have developed a novel in vivo assay to evaluate the accessibility of the H12-docking site on the AR-LBD surface. An extrinsic AR-H12 peptide was able to interact with wild-type and mutant LBDs in the absence of ligand. Ligand-induced proper positioning of the intrinsic H12 of wild-type AR prevented these interactions, whereas the misplacement of the mutants' H12 did not. Proline at this position may be critical for H12 dynamics not only in the AR, but also in other nuclear receptors where this proline is conserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Xiuhua; Yuan, Zenglin; Wang, Jiaxu
YfeX from Escherichia coli O157 is a bacterial dye-decolorizing peroxidase that represents both dye-decoloring activity and typical peroxidase activity. We reported the crystal structure of YfeX bound to heme at 2.09 Å resolution. The YfeX monomer resembles a ferredoxin-like fold and contains two domains. The three conserved residues surrounding the heme group are His{sup 215}, Asp{sup 143} and Arg{sup 232}. His{sup 215} functions as the proximal axial ligand of the heme iron atom. Biochemical data show that the catalytic significance of the conserved Asp{sup 143} and Arg{sup 232} depends on the substrate types and that YfeX may adopt various catalytic mechanismsmore » toward divergent substrates. In addition, it is observed that an access tunnel spans from the protein molecular surface to the heme distal region, it serves as the passageway for the entrance and binding of the H{sub 2}O{sub 2}. - Highlights: • We determined the crystal structure of YfeX bound to heme at 2.09 Å resolution. • The conserved Asp{sup 143} and Arg{sup 232} play different roles toward divergent substrates. • The H{sub 2}O{sub 2} access tunnel spans from the protein molecular surface to the heme distal region.« less
Burgess, Diane; Freeling, Michael
2014-01-01
In vertebrates, conserved noncoding elements (CNEs) are functionally constrained sequences that can show striking conservation over >400 million years of evolutionary distance and frequently are located megabases away from target developmental genes. Conserved noncoding sequences (CNSs) in plants are much shorter, and it has been difficult to detect conservation among distantly related genomes. In this article, we show not only that CNS sequences can be detected throughout the eudicot clade of flowering plants, but also that a subset of 37 CNSs can be found in all flowering plants (diverging ∼170 million years ago). These CNSs are functionally similar to vertebrate CNEs, being highly associated with transcription factor and development genes and enriched in transcription factor binding sites. Some of the most highly conserved sequences occur in genes encoding RNA binding proteins, particularly the RNA splicing–associated SR genes. Differences in sequence conservation between plants and animals are likely to reflect differences in the biology of the organisms, with plants being much more able to tolerate genomic deletions and whole-genome duplication events due, in part, to their far greater fecundity compared with vertebrates. PMID:24681619
Ion-binding properties of the ClC chloride selectivity filter
Lobet, Séverine; Dutzler, Raimund
2006-01-01
The ClC channels are members of a large protein family of chloride (Cl−) channels and secondary active Cl− transporters. Despite their diverse functions, the transmembrane architecture within the family is conserved. Here we present a crystallographic study on the ion-binding properties of the ClC selectivity filter in the close homolog from Escherichia coli (EcClC). The ClC selectivity filter contains three ion-binding sites that bridge the extra- and intracellular solutions. The sites bind Cl− ions with mM affinity. Despite their close proximity within the filter, the three sites can be occupied simultaneously. The ion-binding properties are found conserved from the bacterial transporter EcClC to the human Cl− channel ClC-1, suggesting a close functional link between ion permeation in the channels and active transport in the transporters. In resemblance to K+ channels, ions permeate the ClC channel in a single file, with mutual repulsion between the ions fostering rapid conduction. PMID:16341087
Structural basis of Bloom syndrome (BS) causing mutations in the BLM helicase domain.
Rong, S. B.; Väliaho, J.; Vihinen, M.
2000-01-01
BACKGROUND: Bloom syndrome (BS) is characterized by mutations within the BLM gene. The Bloom syndrome protein (BLM) has similarity to the RecQ subfamily of DNA helicases, which contain seven conserved helicase domains and share significant sequence and structural similarity with the Rep and PcrA DNA helicases. We modeled the three-dimensional structure of the BLM helicase domain to analyze the structural basis of BS-causing mutations. MATERIALS AND METHODS: The sequence alignment was performed for RecQ DNA helicases and Rep and PcrA helicases. The crystal structure of PcrA helicase (PDB entry 3PJR) was used as the template for modeling the BLM helicase domain. The model was used to infer the function of BLM and to analyze the effect of the mutations. RESULTS: The structural model with good stereochemistry of the BLM helicase domain contains two subdomains, 1A and 2A. The electrostatic potential of the model is highly negative over most of the surface, except for the cleft between subdomains 1A and 2A which is similar to the template protein. The ATP-binding site is located inside the model between subdomains 1A and 2A; whereas, the DNA-binding region is situated at the surface cleft, with positive potential between 1A and 2A. CONCLUSIONS: The three-dimensional structure of the BLM helicase domain was modeled and applied to interpret BS-causing mutations. The mutation I841T is likely to weaken DNA binding, while the mutations C891R, C901Y, and Q672R presumably disturb the ATP binding. In addition, other critical positions are discussed. PMID:10965492
Butler-Cole, Christine; Wagner, Mary J; Da Silva, Melissa; Brown, Gordon D; Burke, Robert D; Upton, Chris
2007-07-24
Profilins are critical to cytoskeletal dynamics in eukaryotes; however, little is known about their viral counterparts. In this study, a poxviral profilin homolog, ectromelia virus strain Moscow gene 141 (ECTV-PH), was investigated by a variety of experimental and bioinformatics techniques to characterize its interactions with cellular and viral proteins. Profilin-like proteins are encoded by all orthopoxviruses sequenced to date, and share over 90% amino acid (aa) identity. Sequence comparisons show highest similarity to mammalian type 1 profilins; however, a conserved 3 aa deletion in mammalian type 3 and poxviral profilins suggests that these homologs may be more closely related. Structural analysis shows that ECTV-PH can be successfully modelled onto both the profilin 1 crystal structure and profilin 3 homology model, though few of the surface residues thought to be required for binding actin, poly(L-proline), and PIP2 are conserved. Immunoprecipitation and mass spectrometry identified two proteins that interact with ECTV-PH within infected cells: alpha-tropomyosin, a 38 kDa cellular actin-binding protein, and the 84 kDa product of vaccinia virus strain Western Reserve (VACV-WR) 148, which is the truncated VACV counterpart of the orthopoxvirus A-type inclusion (ATI) protein. Western and far-western blots demonstrated that the interaction with alpha-tropomyosin is direct, and immunofluorescence experiments suggest that ECTV-PH and alpha-tropomyosin may colocalize to structures that resemble actin tails and cellular protrusions. Sequence comparisons of the poxviral ATI proteins show that although full-length orthologs are only present in cowpox and ectromelia viruses, an ~ 700 aa truncated ATI protein is conserved in over 90% of sequenced orthopoxviruses. Immunofluorescence studies indicate that ECTV-PH localizes to cytoplasmic inclusion bodies formed by both truncated and full-length versions of the viral ATI protein. Furthermore, colocalization of ECTV-PH and truncated ATI protein to protrusions from the cell surface was observed. These results suggest a role for ECTV-PH in intracellular transport of viral proteins or intercellular spread of the virus. Broader implications include better understanding of the virus-host relationship and mechanisms by which cells organize and control the actin cytoskeleton.
In silico simulations of STAT1 and STAT3 inhibitors predict SH2 domain cross-binding specificity.
Szelag, Malgorzata; Sikorski, Krzysztof; Czerwoniec, Anna; Szatkowska, Katarzyna; Wesoly, Joanna; Bluyssen, Hans A R
2013-11-15
Signal transducers and activators of transcription (STATs) comprise a family of transcription factors that are structurally related and which participate in signaling pathways activated by cytokines, growth factors and pathogens. Activation of STAT proteins is mediated by the highly conserved Src homology 2 (SH2) domain, which interacts with phosphotyrosine motifs for specific contacts between STATs and receptors and for STAT dimerization. By generating new models for human (h)STAT1, hSTAT2 and hSTAT3 we applied comparative in silico docking to determine SH2-binding specificity of the STAT3 inhibitor stattic, and of fludarabine (STAT1 inhibitor). Thus, we provide evidence that by primarily targeting the highly conserved phosphotyrosine (pY+0) SH2 binding pocket stattic is not a specific hSTAT3 inhibitor, but is equally effective towards hSTAT1 and hSTAT2. This was confirmed in Human Micro-vascular Endothelial Cells (HMECs) in vitro, in which stattic inhibited interferon-α-induced phosphorylation of all three STATs. Likewise, fludarabine inhibits both hSTAT1 and hSTAT3 phosphorylation, but not hSTAT2, by competing with the highly conserved pY+0 and pY-X binding sites, which are less well-preserved in hSTAT2. Moreover we observed that in HMECs in vitro fludarabine inhibits cytokine and lipopolysaccharide-induced phosphorylation of hSTAT1 and hSTAT3 but does not affect hSTAT2. Finally, multiple sequence alignment of STAT-SH2 domain sequences confirmed high conservation between hSTAT1 and hSTAT3, but not hSTAT2, with respect to stattic and fludarabine binding sites. Together our data offer a molecular basis that explains STAT cross-binding specificity of stattic and fludarabine, thereby questioning the present selection strategies of SH2 domain-based competitive small inhibitors. © 2013 Elsevier B.V. All rights reserved.
Lavillette, Dimitri; Boson, Bertrand; Russell, Stephen J.; Cosset, François-Loïc
2001-01-01
Cell entry of retroviruses is initiated by the recognition of cellular receptors and the subsequent membrane fusion between viral and cellular membranes. These two steps are mediated by the surface (SU) and transmembrane (TM) subunits of the retroviral envelope glycoprotein (Env), respectively. Determinants regulating membrane fusion have been described throughout SU and TM, but the processes coupling receptor recognition to fusion are still elusive. Here we establish that a critical interaction is formed between the receptor-binding domain (RBD) and the major disulfide loop of the carboxy-terminal domain (C domain) of the murine leukemia virus SU. Receptor binding causes an alteration of this interaction and, in turn, promotes further events of Env fusion activation. We characterize mutations which, by lowering this interaction and reducing the compatibility between the RBD and C domains of Env glycoprotein chimeras, affect both Env fusogenicity and sensitivity to receptor interference. Additionally, we demonstrate that suboptimal interactions in such mutant Env proteins can be compensated in trans by soluble RBDs in a manner that depends on their compatibility with the C domain. Our results therefore indicate that RBD/C domain interactions may occur in cis, via the proper RBD of the viral Env itself, or in trans, via a distinct RBD expressed by virion-free Env glycoproteins expressed endogenously by the infected cells or provided by neighboring Env trimers. PMID:11264358
Nakajima, Keiji; Yamashita, Atsuko; Akama, Hiroyuki; Nakatsu, Toru; Kato, Hiroaki; Hashimoto, Takashi; Oda, Jun’ichi; Yamada, Yasuyuki
1998-01-01
A pair of tropinone reductases (TRs) share 64% of the same amino acid residues and belong to the short-chain dehydrogenase/reductase family. In the synthesis of tropane alkaloids in several medicinal plants, the TRs reduce a carbonyl group of an alkaloid intermediate, tropinone, to hydroxy groups with different diastereomeric configurations. To clarify the structural basis for their different reaction stereospecificities, we determined the crystal structures of the two enzymes at 2.4- and 2.3-Å resolutions. The overall folding of the two enzymes was almost identical. The conservation was not confined within the core domains that are conserved within the protein family but extended outside the core domain where each family member has its characteristic structure. The binding sites for the cofactor and the positions of the active site residues were well conserved between the two TRs. The substrate binding site was composed mostly of hydrophobic amino acids in both TRs, but the presence of different charged residues conferred different electrostatic environments on the two enzymes. A modeling study indicated that these charged residues play a major role in controlling the binding orientation of tropinone within the substrate binding site, thereby determining the stereospecificity of the reaction product. The results obtained herein raise the possibility that in certain cases different stereospecificities can be acquired in enzymes by changing a few amino acid residues within substrate binding sites. PMID:9560196
DNA-binding proteins from marine bacteria expand the known sequence diversity of TALE-like repeats.
de Lange, Orlando; Wolf, Christina; Thiel, Philipp; Krüger, Jens; Kleusch, Christian; Kohlbacher, Oliver; Lahaye, Thomas
2015-11-16
Transcription Activator-Like Effectors (TALEs) of Xanthomonas bacteria are programmable DNA binding proteins with unprecedented target specificity. Comparative studies into TALE repeat structure and function are hindered by the limited sequence variation among TALE repeats. More sequence-diverse TALE-like proteins are known from Ralstonia solanacearum (RipTALs) and Burkholderia rhizoxinica (Bats), but RipTAL and Bat repeats are conserved with those of TALEs around the DNA-binding residue. We study two novel marine-organism TALE-like proteins (MOrTL1 and MOrTL2), the first to date of non-terrestrial origin. We have assessed their DNA-binding properties and modelled repeat structures. We found that repeats from these proteins mediate sequence specific DNA binding conforming to the TALE code, despite low sequence similarity to TALE repeats, and with novel residues around the BSR. However, MOrTL1 repeats show greater sequence discriminating power than MOrTL2 repeats. Sequence alignments show that there are only three residues conserved between repeats of all TALE-like proteins including the two new additions. This conserved motif could prove useful as an identifier for future TALE-likes. Additionally, comparing MOrTL repeats with those of other TALE-likes suggests a common evolutionary origin for the TALEs, RipTALs and Bats. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Pham-Ledard, Anne; Prochazkova-Carlotti, Martina; Deveza, Mélanie; Laforet, Marie-Pierre; Beylot-Barry, Marie; Vergier, Béatrice; Parrens, Marie; Feuillard, Jean; Merlio, Jean-Philippe; Gachard, Nathalie
2017-11-01
Immunophenotype of primary cutaneous diffuse large B-cell lymphoma, leg-type (PCLBCL-LT) suggests a germinal center-experienced B lymphocyte (BCL2+ MUM1+ BCL6+/-). As maturation history of B-cell is "imprinted" during B-cell development on the immunoglobulin gene sequence, we studied the structure and sequence of the variable part of the genes (IGHV, IGLV, IGKV), immunoglobulin surface expression and features of class switching in order to determine the PCLBCL-LT cell of origin. Clonality analysis with BIOMED2 protocol and VH leader primers was done on DNA extracted from frozen skin biopsies on retrospective samples from 14 patients. The clonal DNA IGHV sequence of the tumor was aligned and compared with the closest germline sequence and homology percentage was calculated. Superantigen binding sites were studied. Features of selection pressure were evaluated with the multinomial Lossos model. A functional monoclonal sequence was observed in 14 cases as determined for IGHV (10), IGLV (2) or IGKV (3). IGV mutation rates were high (>5%) in all cases but one (median:15.5%), with superantigen binding sites conservation. Features of selection pressure were identified in 11/12 interpretable cases, more frequently negative (75%) than positive (25%). Intraclonal variation was detected in 3 of 8 tumor specimens with a low rate of mutations. Surface immunoglobulin was an IgM in 12/12 cases. FISH analysis of IGHM locus, deleted during class switching, showed heterozygous IGHM gene deletion in half of cases. The genomic PCR analysis confirmed the deletions within the switch μ region. IGV sequences were highly mutated but functional, with negative features of selection pressure suggesting one or more germinal center passage(s) with somatic hypermutation, but superantigen (SpA) binding sites conservation. Genetic features of class switch were observed, but on the non functional allele and co-existing with primary isotype IgM expression. These data suggest that cell-of origin is germinal center experienced and superantigen driven selected B-cell, in a stage between germinal center B-cell and plasma cell. Copyright © 2017 Japanese Society for Investigative Dermatology. Published by Elsevier B.V. All rights reserved.
Nesmelova, Irina V; Ermakova, Elena; Daragan, Vladimir A; Pang, Mabel; Menéndez, Margarita; Lagartera, Laura; Solís, Dolores; Baum, Linda G; Mayo, Kevin H
2010-04-16
Galectins are a family of lectins with a conserved carbohydrate recognition domain that interacts with beta-galactosides. By binding cell surface glycoconjugates, galectin-1 (gal-1) is involved in cell adhesion and migration processes and is an important regulator of tumor angiogenesis. Here, we used heteronuclear NMR spectroscopy and molecular modeling to investigate lactose binding to gal-1 and to derive solution NMR structures of gal-1 in the lactose-bound and unbound states. Structure analysis shows that the beta-strands and loops around the lactose binding site, which are more open and dynamic in the unbound state, fold in around the bound lactose molecule, dampening internal motions at that site and increasing motions elsewhere throughout the protein to contribute entropically to the binding free energy. CD data support the view of an overall more open structure in the lactose-bound state. Analysis of heteronuclear single quantum coherence titration binding data indicates that lactose binds the two carbohydrate recognition domains of the gal-1 dimer with negative cooperativity, in that the first lactose molecule binds more strongly (K(1)=21+/-6 x 10(3) M(-1)) than the second (K(2)=4+/-2 x 10(3) M(-1)). Isothermal calorimetry data fit using a sequential binding model present a similar picture, yielding K(1)=20+/-10 x 10(3) M(-1) and K(2)=1.67+/-0.07 x 10(3) M(-1). Molecular dynamics simulations provide insight into structural dynamics of the half-loaded lactose state and, together with NMR data, suggest that lactose binding at one site transmits a signal through the beta-sandwich and loops to the second binding site. Overall, our results provide new insight into gal-1 structure-function relationships and to protein-carbohydrate interactions in general. Copyright (c) 2010. Published by Elsevier Ltd.
Impact of SPR biosensor assay configuration on antibody: Neonatal Fc receptor binding data
Wang, Xiangdan; McKay, Patrick; Dutina, George; Hass, Philip E.; Nijem, Ihsan; Allison, David; Cowan, Kyra J.; Lin, Kevin; Quarmby, Valerie; Yang, Jihong
2017-01-01
ABSTRACT Binding interactions with the neonatal Fc receptor (FcRn) are one determinant of pharmacokinetic properties of recombinant human monoclonal antibody (rhumAb) therapeutics, and a conserved binding motif in the crystallizable fragment (Fc) region of IgG molecules interacts with FcRn. Surface plasmon resonance (SPR) biosensor assays are often used to characterize interactions between FcRn and rhumAb therapeutics. In such assays, generally either the rhumAb (format 1) or the FcRn protein (format 2) is immobilized on a biosensor chip. However, because evidence suggests that, in some cases, the variable domains of a rhumAb may also affect FcRn binding, we evaluated the effect of SPR assay configuration on binding data. We sought to assess FcRn binding properties of 2 rhumAbs (rhumAb1 and rhumAb2) to FcRn proteins using these 2 biosensor assay formats. The two rhumAbs have greater than 99% sequence identity in the Fc domain but differ in their Fab regions. rhumAb2 contains a positively charged patch in the variable domain that is absent in rhumAb1. Our results showed that binding of rhumAb1 to FcRn was independent of biosensor assay configuration, while binding of rhumAb2 to FcRn was highly SPR assay configuration dependent. Further investigations revealed that the format dependency of rhumAb2-FcRn binding is linked to the basic residues that form a positively charged patch in the variable domain of rhumAb2. Our work highlights the importance of analyzing rhumAb-FcRn binding interactions using 2 alternate SPR biosensor assay configurations. This approach may also provide a simple way to identify the potential for non-Fc-driven FcRn binding interactions in otherwise typical IgGs. PMID:28001487
A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.
Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L
1997-03-11
We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Yanwu; Wang, Xiaoxia; Hawkins, Cheryl A.
The LIM-only adaptor PINCH (the particularly interesting cysteine- and histidine-rich protein) plays a pivotal role in the assembly of focal adhesions (FAs), supramolecular complexes that transmit mechanical and biochemical information between extracellular matrix and actin cytoskeleton, regulating diverse cell adhesive processes such as cell migration, cell spreading, and survival. A key step for the PINCH function is its localization to FAs, which depends critically on the tight binding of PINCH to integrin-linked kinase (ILK). Here we report the solution NMR structure of the core ILK {center_dot} PINCH complex (28 kDa, K{sub D} {approx} 68 nm) involving the N-terminal ankyrin repeatmore » domain (ARD) of ILK and the first LIM domain (LIM1) of PINCH. We show that the ILK ARD exhibits five sequentially stacked ankyrin repeat units, which provide a large concave surface to grip the two contiguous zinc fingers of the PINCH LIM1. The highly electrostatic interface is evolutionally conserved but differs drastically from those of known ARD and LIM bound to other types of protein domains. Consistently mutation of a hot spot in LIM1, which is not conserved in other LIM domains, disrupted the PINCH binding to ILK and abolished the PINCH targeting to FAs. These data provide atomic insight into a novel modular recognition and demonstrate how PINCH is specifically recruited by ILK to mediate the FA assembly and cell-extracellular matrix communication.« less
A conserved mechanism for gating in an ionotropic glutamate receptor.
Moore, Bryn S; Mirshahi, Uyenlinh L; Ebersole, Tonya L; Mirshahi, Tooraj
2013-06-28
Ionotropic glutamate receptor (iGluR) channels control synaptic activity. The crystallographic structure of GluA2, the prototypical iGluR, reveals a clamshell-like ligand-binding domain (LBD) that closes in the presence of glutamate to open a gate on the pore lining α-helix. How LBD closure leads to gate opening remains unclear. Here, we show that bending the pore helix at a highly conserved alanine residue (Ala-621) below the gate is responsible for channel opening. Substituting Ala-621 with the smaller more flexible glycine resulted in a basally active, nondesensitizing channel with ∼39-fold increase in glutamate potency without affecting surface expression or binding. On GluA2(A621G), the partial agonist kainate showed efficacy similar to a full agonist, and competitive antagonists CNQX and DNQX acted as a partial agonists. Met-629 in GluA2 sits above the gate and is critical in transmitting LBD closure to the gate. Substituting Met-629 with the flexible glycine resulted in reduced channel activity and glutamate potency. The pore regions in potassium channels are structurally similar to iGluRs. Whereas potassium channels typically use glycines as a hinge for gating, iGluRs use the less flexible alanine as a hinge at a similar position to maintain low basal activity allowing for ligand-mediated gating.
Hemmi, Hikaru; Ishibashi, Jun; Tomie, Tetsuya; Yamakawa, Minoru
2003-06-20
Scarabaecin isolated from hemolymph of the coconut rhinoceros beetle Oryctes rhinoceros is a 36-residue polypeptide that has antifungal activity. The solution structure of scarabaecin has been determined from twodimensional 1H NMR spectroscopic data and hybrid distance geometry-simulated annealing protocol calculation. Based on 492 interproton and 10 hydrogen-bonding distance restraints and 36 dihedral angle restraints, we obtained 20 structures. The average backbone root-mean-square deviation for residues 4-35 is 0.728 +/- 0.217 A from the mean structure. The solution structure consists of a two-stranded antiparallel beta-sheet connected by a type-I beta-turn after a short helical turn. All secondary structures and a conserved disulfide bond are located in the C-terminal half of the peptide, residues 18-36. Overall folding is stabilized by a combination of a disulfide bond, seven hydrogen bonds, and numerous hydrophobic interactions. The structural motif of the C-terminal half shares a significant tertiary structural similarity with chitin-binding domains of plant and invertebrate chitin-binding proteins, even though scarabaecin has no overall sequence similarity to other peptide/polypeptides including chitin-binding proteins. The length of its primary structure, the number of disulfide bonds, and the pattern of conserved functional residues binding to chitin in scarabaecin differ from those of chitin-binding proteins in other invertebrates and plants, suggesting that scarabaecin does not share a common ancestor with them. These results are thought to provide further strong experimental evidence to the hypothesis that chitin-binding proteins of invertebrates and plants are correlated by a convergent evolution process.
Effect of solid surface charge on the binding behaviour of a metal-binding peptide
Donatan, Senem; Sarikaya, Mehmet; Tamerler, Candan; Urgen, Mustafa
2012-01-01
Over the last decade, solid-binding peptides have been increasingly used as molecular building blocks coupling bio- and nanotechnology. Despite considerable research being invested in this field, the effects of many surface-related parameters that define the binding of peptide to solids are still unknown. In the quest to control biological molecules at solid interfaces and, thereby, tailoring the binding characteristics of the peptides, the use of surface charge of the solid surface may probably play an important role, which then can be used as a potential tuning parameter of peptide adsorption. Here, we report quantitative investigation on the viscoelastic properties and binding kinetics of an engineered gold-binding peptide, 3RGBP1, adsorbed onto the gold surface at different surface charge densities. The experiments were performed in aqueous solutions using an electrochemical dissipative quartz crystal microbalance system. Hydrodynamic mass, hydration state and surface coverage of the adsorbed peptide films were determined as a function of surface charge density of the gold metal substrate. Under each charged condition, binding of 3rGBP1 displayed quantitative differences in terms of adsorbed peptide amount, surface coverage ratio and hydration state. Based on the intrinsically disordered structure of the peptide, we propose a possible mechanism for binding of the peptide that can be used for tuning surface adsorption in further studies. Controlled alteration of peptide binding on solid surfaces, as shown here, may provide novel methods for surface functionalization used for bioenabled processing and fabrication of future micro- and nanodevices. PMID:22491974
Karim, Kazi Muhammad Rezaul; Husaini, Ahmad; Sing, Ngieng Ngui; Sinang, Fazia Mohd; Roslan, Hairul Azman; Hussain, Hasnain
2018-04-01
In this study, an alpha-amylase enzyme from a locally isolated Aspergillus flavus NSH9 was purified and characterized. The extracellular α-amylase was purified by ammonium sulfate precipitation and anion-exchange chromatography at a final yield of 2.55-fold and recovery of 11.73%. The molecular mass of the purified α-amylase was estimated to be 54 kDa using SDS-PAGE and the enzyme exhibited optimal catalytic activity at pH 5.0 and temperature of 50 °C. The enzyme was also thermally stable at 50 °C, with 87% residual activity after 60 min. As a metalloenzymes containing calcium, the purified α-amylase showed significantly increased enzyme activity in the presence of Ca 2+ ions. Further gene isolation and characterization shows that the α-amylase gene of A. flavus NSH9 contained eight introns and an open reading frame that encodes for 499 amino acids with the first 21 amino acids presumed to be a signal peptide. Analysis of the deduced peptide sequence showed the presence of three conserved catalytic residues of α-amylase, two Ca 2+ -binding sites, seven conserved peptide sequences, and several other properties that indicates the protein belongs to glycosyl hydrolase family 13 capable of acting on α-1,4-bonds only. Based on sequence similarity, the deduced peptide sequence of A. flavus NSH9 α-amylase was also found to carry two potential surface/secondary-binding site (SBS) residues (Trp 237 and Tyr 409) that might be playing crucial roles in both the enzyme activity and also the binding of starch granules.
Conserved mRNA-binding proteomes in eukaryotic organisms.
Matia-González, Ana M; Laing, Emma E; Gerber, André P
2015-12-01
RNA-binding proteins (RBPs) are essential for post-transcriptional regulation of gene expression. Recent high-throughput screens have dramatically increased the number of experimentally identified RBPs; however, comprehensive identification of RBPs within living organisms is elusive. Here we describe the repertoire of 765 and 594 proteins that reproducibly interact with polyadenylated mRNAs in Saccharomyces cerevisiae and Caenorhabditis elegans, respectively. Furthermore, we report the differential association of mRNA-binding proteins (mRPBs) upon induction of apoptosis in C. elegans L4-stage larvae. Strikingly, most proteins composing mRBPomes, including components of early metabolic pathways and the proteasome, are evolutionarily conserved between yeast and C. elegans. We speculate, on the basis of our evidence that glycolytic enzymes bind distinct glycolytic mRNAs, that enzyme-mRNA interactions relate to an ancient mechanism for post-transcriptional coordination of metabolic pathways that perhaps was established during the transition from the early 'RNA world' to the 'protein world'.
Impact of germline and somatic missense variations on drug binding sites.
Yan, C; Pattabiraman, N; Goecks, J; Lam, P; Nayak, A; Pan, Y; Torcivia-Rodriguez, J; Voskanian, A; Wan, Q; Mazumder, R
2017-03-01
Advancements in next-generation sequencing (NGS) technologies are generating a vast amount of data. This exacerbates the current challenge of translating NGS data into actionable clinical interpretations. We have comprehensively combined germline and somatic nonsynonymous single-nucleotide variations (nsSNVs) that affect drug binding sites in order to investigate their prevalence. The integrated data thus generated in conjunction with exome or whole-genome sequencing can be used to identify patients who may not respond to a specific drug because of alterations in drug binding efficacy due to nsSNVs in the target protein's gene. To identify the nsSNVs that may affect drug binding, protein-drug complex structures were retrieved from Protein Data Bank (PDB) followed by identification of amino acids in the protein-drug binding sites using an occluded surface method. Then, the germline and somatic mutations were mapped to these amino acids to identify which of these alter protein-drug binding sites. Using this method we identified 12 993 amino acid-drug binding sites across 253 unique proteins bound to 235 unique drugs. The integration of amino acid-drug binding sites data with both germline and somatic nsSNVs data sets revealed 3133 nsSNVs affecting amino acid-drug binding sites. In addition, a comprehensive drug target discovery was conducted based on protein structure similarity and conservation of amino acid-drug binding sites. Using this method, 81 paralogs were identified that could serve as alternative drug targets. In addition, non-human mammalian proteins bound to drugs were used to identify 142 homologs in humans that can potentially bind to drugs. In the current protein-drug pairs that contain somatic mutations within their binding site, we identified 85 proteins with significant differential gene expression changes associated with specific cancer types. Information on protein-drug binding predicted drug target proteins and prevalence of both somatic and germline nsSNVs that disrupt these binding sites can provide valuable knowledge for personalized medicine treatment. A web portal is available where nsSNVs from individual patient can be checked by scanning against DrugVar to determine whether any of the SNVs affect the binding of any drug in the database.
Social Justice and Social Order: Binding Moralities across the Political Spectrum
2016-01-01
Two studies explored the relationship between political ideology and endorsement of a range of moral principles. Political liberals and conservatives did not differ on intrapersonal or interpersonal moralities, which require self-regulation. However differences emerged on collective moralities, which involve social regulation. Contrary to Moral Foundations Theory, both liberals and conservatives endorsed a group-focused binding morality, specifically Social Justice and Social Order respectively. Libertarians were the group without a binding morality. Although Social Justice and Social Order appear conflictual, analyses based on earlier cross-cultural work on societal tightness-looseness suggest that countries actually benefit in terms of economic success and societal well-being when these group-based moralities co-exist and serve as counterweights in social regulation. PMID:27031103
Mücke, Katrin; Paulus, Christina; Bernhardt, Katharina; Gerrer, Katrin; Schön, Kathrin; Fink, Alina; Sauer, Eva-Maria; Asbach-Nitzsche, Alexandra; Harwardt, Thomas; Kieninger, Bärbel; Kremer, Werner; Kalbitzer, Hans Robert
2014-01-01
The 72-kDa immediate early 1 (IE1) protein encoded by human cytomegalovirus (hCMV) is a nuclearly localized promiscuous regulator of viral and cellular transcription. IE1 has long been known to associate with host mitotic chromatin, yet the mechanisms underlying this interaction have not been specified. In this study, we identify the cellular chromosome receptor for IE1. We demonstrate that the viral protein targets human nucleosomes by directly binding to core histones in a nucleic acid-independent manner. IE1 exhibits two separable histone-interacting regions with differential binding specificities for H2A-H2B and H3-H4. The H2A-H2B binding region was mapped to an evolutionarily conserved 10-amino-acid motif within the chromatin-tethering domain (CTD) of IE1. Results from experimental approaches combined with molecular modeling indicate that the IE1 CTD adopts a β-hairpin structure, docking with the acidic pocket formed by H2A-H2B on the nucleosome surface. IE1 binds to the acidic pocket in a way similar to that of the latency-associated nuclear antigen (LANA) of the Kaposi's sarcoma-associated herpesvirus. Consequently, the IE1 and LANA CTDs compete for binding to nucleosome cores and chromatin. Our work elucidates in detail how a key viral regulator is anchored to human chromosomes and identifies the nucleosomal acidic pocket as a joint target of proteins from distantly related viruses. Based on the striking similarities between the IE1 and LANA CTDs and the fact that nucleosome targeting by IE1 is dispensable for productive replication even in “clinical” strains of hCMV, we speculate that the two viral proteins may serve analogous functions during latency of their respective viruses. PMID:24227840
Localization of yeast RNA polymerase I core subunits by immunoelectron microscopy.
Klinger, C; Huet, J; Song, D; Petersen, G; Riva, M; Bautz, E K; Sentenac, A; Oudet, P; Schultz, P
1996-01-01
Immunoelectron microscopy was used to determine the spatial organization of the yeast RNA polymerase I core subunits on a three-dimensional model of the enzyme. Images of antibody-labeled enzymes were compared with the native enzyme to determine the localization of the antibody binding site on the surface of the model. Monoclonal antibodies were used as probes to identify the two largest subunits homologous to the bacterial beta and beta' subunits. The epitopes for the two monoclonal antibodies were mapped using subunit-specific phage display libraries, thus allowing a direct correlation of the structural data with functional information on conserved sequence elements. An epitope close to conserved region C of the beta-like subunit is located at the base of the finger-like domain, whereas a sequence between conserved regions C and D of the beta'-like subunit is located in the apical region of the enzyme. Polyclonal antibodies outlined the alpha-like subunit AC40 and subunit AC19 which were found co-localized also in the apical region of the enzyme. The spatial location of the subunits is correlated with their biological activity and the inhibitory effect of the antibodies. Images PMID:8887555
Stability of surface and subsurface hydrogen on and in Au/Ni near-surface alloys
Celik, Fuat E.; Mavrikakis, Manos
2015-01-12
Periodic, self-consistent DFT-GGA (PW91) calculations were used to study the interaction of hydrogen atoms with the (111) surfaces of substitutional near-surface alloys (NSAs) of Au and Ni with different surface layer compositions and different arrangements of Au atoms in the surface layer. The effect of hydrogen adsorption on the surface and in the first and second subsurface layers of the NSAs was studied. Increasing the Au content in the surface layer weakens hydrogen binding on the surface, but strengthens subsurface binding, suggesting that the distribution of surface and subsurface hydrogen will be different than that on pure Ni(111). While themore » metal composition of the surface layer has an effect on the binding energy of hydrogen on NSA surfaces, the local composition of the binding site has a stronger effect. For example, fcc hollow sites consisting of three Ni atoms bind H nearly as strongly as on Ni(111), and fcc sites consisting of three Au atoms bind H nearly as weakly as on Au(111). Sites with one or two Au atoms show intermediate binding energies. The preference of hydrogen for three-fold Ni hollow sites alters the relative stabilities of different surface metal atom arrangements, and may provide a driving force for adsorbate-induced surface rearrangement.« less
Stability of Surface and Subsurface Hydrogen on and in Au/Ni Near-Surface Alloys
DOE Office of Scientific and Technical Information (OSTI.GOV)
Celik, Fuat E.; Mavrikakis, Manos
2015-10-01
Periodic, self-consistent DFT-GGA (PW91) calculations were used to study the interaction of hydrogen atoms with the (111) surfaces of substitutional near-surface alloys (NSAs) of Au and Ni with different surface layer compositions and different arrangements of Au atoms in the surface layer. The effect of hydrogen adsorption on the surface and in the first and second subsurface layers of the NSAs was studied. Increasing the Au content in the surface layer weakens hydrogen binding on the surface, but strengthens subsurface binding, suggesting that the distribution of surface and subsurface hydrogen will be different than that on pure Ni(111). While themore » metal composition of the surface layer has an effect on the binding energy of hydrogen on NSA surfaces, the local composition of the binding site has a stronger effect. For example, fcc hollow sites consisting of three Ni atoms bind H nearly as strongly as on Ni(111), and fcc sites consisting of three Au atoms bind H nearly as weakly as on Au(111). Sites with one or two Au atoms show intermediate binding energies. The preference of hydrogen for three-fold Ni hollow sites alters the relative stabilities of different surface metal atom arrangements, and may provide a driving force for adsorbate-induced surface rearrangement.« less
Stability of surface and subsurface hydrogen on and in Au/Ni near-surface alloys
NASA Astrophysics Data System (ADS)
Celik, Fuat E.; Mavrikakis, Manos
2015-10-01
Periodic, self-consistent DFT-GGA (PW91) calculations were used to study the interaction of hydrogen atoms with the (111) surfaces of substitutional near-surface alloys (NSAs) of Au and Ni with different surface layer compositions and different arrangements of Au atoms in the surface layer. The effect of hydrogen adsorption on the surface and in the first and second subsurface layers of the NSAs was studied. Increasing the Au content in the surface layer weakens hydrogen binding on the surface, but strengthens subsurface binding, suggesting that the distribution of surface and subsurface hydrogen will be different than that on pure Ni(111). While the metal composition of the surface layer has an effect on the binding energy of hydrogen on NSA surfaces, the local composition of the binding site has a stronger effect. For example, fcc hollow sites consisting of three Ni atoms bind H nearly as strongly as on Ni(111), and fcc sites consisting of three Au atoms bind H nearly as weakly as on Au(111). Sites with one or two Au atoms show intermediate binding energies. The preference of hydrogen for three-fold Ni hollow sites alters the relative stabilities of different surface metal atom arrangements, and may provide a driving force for adsorbate-induced surface rearrangement.
2010-01-01
Background Puf proteins have important roles in controlling gene expression at the post-transcriptional level by promoting RNA decay and repressing translation. The Pumilio homology domain (PUM-HD) is a conserved region within Puf proteins that binds to RNA with sequence specificity. Although Puf proteins have been well characterized in animal and fungal systems, little is known about the structural and functional characteristics of Puf-like proteins in plants. Results The Arabidopsis and rice genomes code for 26 and 19 Puf-like proteins, respectively, each possessing eight or fewer Puf repeats in their PUM-HD. Key amino acids in the PUM-HD of several of these proteins are conserved with those of animal and fungal homologs, whereas other plant Puf proteins demonstrate extensive variability in these amino acids. Three-dimensional modeling revealed that the predicted structure of this domain in plant Puf proteins provides a suitable surface for binding RNA. Electrophoretic gel mobility shift experiments showed that the Arabidopsis AtPum2 PUM-HD binds with high affinity to BoxB of the Drosophila Nanos Response Element I (NRE1) RNA, whereas a point mutation in the core of the NRE1 resulted in a significant reduction in binding affinity. Transient expression of several of the Arabidopsis Puf proteins as fluorescent protein fusions revealed a dynamic, punctate cytoplasmic pattern of localization for most of these proteins. The presence of predicted nuclear export signals and accumulation of AtPuf proteins in the nucleus after treatment of cells with leptomycin B demonstrated that shuttling of these proteins between the cytosol and nucleus is common among these proteins. In addition to the cytoplasmically enriched AtPum proteins, two AtPum proteins showed nuclear targeting with enrichment in the nucleolus. Conclusions The Puf family of RNA-binding proteins in plants consists of a greater number of members than any other model species studied to date. This, along with the amino acid variability observed within their PUM-HDs, suggests that these proteins may be involved in a wide range of post-transcriptional regulatory events that are important in providing plants with the ability to respond rapidly to changes in environmental conditions and throughout development. PMID:20214804
The influence of surface integrin binding patterns on specific biomaterial-cell interactions
NASA Astrophysics Data System (ADS)
Beranek, Maggi Marie
As the future of biomaterials progresses toward bioactivity, the biomaterial surface must control non-specific protein adsorption and encourage selective protein and cell adsorption. Integrins alphavbeta3, alpha 1beta1, alpha5beta1 and alpha Mbeta2 are expressed on cells involved in endothelialization, inflammation, and intimal hyperplasia. These cellular events play a vital role in biomaterial biocompatibility, especially in the vascular environment. The overall hypothesis of these studies is that biomaterial surfaces exhibit selective integrin binding, which then specifies differential cell binding. To test this hypothesis, four specific aims were developed. The first aim was designed to determine whether metal and polymeric biomaterials exhibit selective integrin binding. The tested materials included 316L stainless steel, nitinol, gold, Elgiloy RTM, poly(D, L-lactide-co-glycolide), polycarbonate urethane and expanded polytetrafluoroethylene. Discrete integrin binding patterns were detected microscopically using integrin specific fluorescent antibodies. Stainless steel exhibited high level integrin alpha1beta 1 and low level integrin alphaMbeta2 binding pattern. This suggests that this metal surface should selectively encourage endothelial cell to inflammatory cell binding. In contrast, gold bound ten times the amount of integrin alphaMbeta2 compared to integrin alpha1beta1, which should encourage inflammatory cell adhesion. The 65/35 poly(D, L-lactide-co-glycolide) was the only polymeric biomaterial tested that had integrin binding levels comparable to metal biomaterials. Based on these observations, a combinational biomaterial with a surface pattern of 65/35 poly(D, L-lactide-co-glycolide) dots on a 316L stainless steel background was created. A pattern of high level integrin alpha1beta1 binding and low level integrin alpha Mbeta2 binding on this combinational surface indicates that this surface should selectively favor endothelial cell binding. In the second aim, the response of surface-bound integrins to flow-related shear stress was examined. Based on fluorescent analysis, total alphavbeta 3, alpha1beta1, and alpha5beta 1 appeared to increase on stainless steel after 90-minute low shear stress exposure, whereas only alpha5beta1 appeared to increase when exposed to high shear. 65/35 poly(D, L-lactide-co-glycolide) exhibited increased total binding of alpha5beta1 and alphaMbeta2, when exposed to either shear stress level. Exposure to either shear stress regimen appeared to increase binding of all integrins on the combinational surface. These responses to shear stress suggest differential integrin binding affinity compared to stainless steel. Using antibodies specific to the integrin subunits, the apparent increase in surface-bound integrins was found to be related to a surface disassociation of alpha and beta subunits. The third aim evaluated human aortic endothelial cells and acute monocytic leukemia cells (THP-1) cell binding to the tested biomaterial surfaces under both static and flow conditions. Both stainless steel and the combinational surface had increased endothelial cell binding compared to monocyte attachment. Pre-incubation of the surface with the specific integrins significantly inhibited human aortic endothelial cell binding. Aim four was designed to investigate the influence of surface bound integrins on human aortic endothelial cell migration under shear stress. If biomaterial surface integrin binding patterns are specific, then pre-bound surface integrins should competitively inhibit binding of cellular integrins to the surface. Cell migration distance on to alphavbeta3, alpha 1beta1, and alpha5beta1 pre-incubated stainless steel was decreased ten-fold, and decreased by three-fold on both 65/35 poly(D, L-lactide-coglycolide) and combinational surfaces compared to the respective bare surfaces. In contrast, migration distance on to alphaMbeta2 pre-coated stainless steel and combinational surface was decreased by only sixty percent and only fifty percent on alphaMbeta2 precoated 65/35 poly(D, L -lactide-co-glycolide). These results suggested that surface binding sites are selective and critical in governing endothelial cell migration. In conclusion, these results support the hypothesis that a surface that encourages specific integrin binding would promote differential cell binding. The novel integrin binding model used in this investigation may be a methodology that can be employed to evaluate potential vascular biomaterials.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kumaran,D.; Bonnano, J.; Burley, S.
2006-01-01
Phosphatidylglycerophosphatase (PGPase), an enzyme involved in lipid metabolism, catalyzes formation of phosphatidylglycerol from phosphatidylglycerophosphate. Phosphatidylglycerol is a multifunctional phospholipid, found in the biological membranes of many organisms. Here, we report the crystal structure of Listeria monocytogenes PGPase at 1.8 Angstroms resolution. PGPase, an all-helical molecule, forms a homotetramer. Each protomer contains an independent active site with two metal ions, Ca{sup 2+} and Mg{sup 2+}, forming a hetero-binuclear center located in a hydrophilic cavity near the surface of the molecule. The binuclear center, conserved ligands, metal-bound water molecules, and an Asp-His dyad form the active site. The catalytic mechanism of thismore » enzyme is likely to proceed via binuclear metal activated nucleophilic water. The binuclear metal-binding active-site environment of this structure should provide insights into substrate binding and metal-dependent catalysis. A long channel with inter-linked linear water chains, termed 'proton wires', is observed at the tetramer interface. Comparison of similar water chain structures in photosynthetic reaction centers (RCs), Cytochrome f, gramicidin, and bacteriorhodopsin, suggests that PGPase may conduct protons via proton wires.« less
Moffatt, Pierre; Wazen, Rima M; Dos Santos Neves, Juliana; Nanci, Antonio
2014-12-01
Functional genomic screening of the rat enamel organ (EO) has led to the identification of a number of secreted proteins expressed during the maturation stage of amelogenesis, including amelotin (AMTN) and odontogenic ameloblast-associated (ODAM). In this study, we characterise the gene, protein and pattern of expression of a related protein called secretory calcium-binding phosphoprotein-proline-glutamine-rich 1 (SCPPPQ1). The Scpppq1 gene resides within the secretory calcium-binding phosphoprotein (Scpp) cluster. SCPPPQ1 is a highly conserved, 75-residue, secreted protein rich in proline, leucine, glutamine and phenylalanine. In silico data mining has revealed no correlation to any known sequences. Northern blotting of various rat tissues suggests that the expression of Scpppq1 is restricted to tooth and associated tissues. Immunohistochemical analyses show that the protein is expressed during the late maturation stage of amelogenesis and in the junctional epithelium where it localises to an atypical basal lamina at the cell-tooth interface. This discrete localisation suggests that SCPPPQ1, together with AMTN and ODAM, participates in structuring the basal lamina and in mediating attachment of epithelia cells to mineralised tooth surfaces.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Priyadarshini, C.G. Poornima; Savithri, H.S., E-mail: bchss@biochem.iisc.ernet.i
Gemini viral assembly and transport of viral DNA into nucleus for replication, essentially involve DNA-coat protein interactions. The kinetics of interaction of Cotton Leaf Curl Kokhran Virus-Dabawali recombinant coat protein (rCP) with DNA was studied by electrophoretic mobility shift assay (EMSA) and surface plasmon resonance (SPR). The rCP interacted with ssDNA with a K{sub A}, of 2.6 +- 0.29 x 10{sup 8} M{sup -1} in a sequence non-specific manner. The CP has a conserved C2H2 type zinc finger motif composed of residues C68, C72, H81 and H85. Mutation of these residues to alanine resulted in reduced binding to DNA probes.more » The H85A mutant rCP showed the least binding with approximately 756 fold loss in the association rate and a three order magnitude decrease in the binding affinity as compared to rCP. The CP-DNA interactions via the zinc finger motif could play a crucial role in virus assembly and in nuclear transport.« less
Crystal structure of a gammadelta T-cell receptor specific for the human MHC class I homolog MICA.
Xu, Bin; Pizarro, Juan C; Holmes, Margaret A; McBeth, Christine; Groh, Veronika; Spies, Thomas; Strong, Roland K
2011-02-08
γδ T cells play important roles in bridging innate and adaptive immunity, but their recognition mechanisms remain poorly understood. Human γδ T cells of the V(δ)1 subset predominate in intestinal epithelia and respond to MICA and MICB (MHC class I chain-related, A and B; MIC) self-antigens, mediating responses to tumorigenesis or viral infection. The crystal structure of an MIC-reactive V(δ)1 γδ T-cell receptor (TCR) showed expected overall structural homology to antibodies, αβ, and other γδ TCRs, but complementary determining region conformations and conservation of V(δ)1 use revealed an uncharacteristically flat potential binding surface. MIC, likewise, serves as a ligand for the activating immunoreceptor natural killer group 2, D (NKG2D), also expressed on γδ T cells. Although MIC recognition drives both the TCR-dependent stimulatory and NKG2D-dependent costimulatory signals necessary for activation, interaction analyses showed that MIC binding by the two receptors was mutually exclusive. Analysis of relative binding kinetics suggested sequential recognition, defining constraints for the temporal organization of γδ T-cell/target cell interfaces.
Nimlos, Mark R.; Beckham, Gregg T.; Matthews, James F.; Bu, Lintao; Himmel, Michael E.; Crowley, Michael F.
2012-01-01
Cellulase enzymes often contain carbohydrate-binding modules (CBMs) for binding to cellulose. The mechanisms by which CBMs recognize specific surfaces of cellulose and aid in deconstruction are essential to understand cellulase action. The Family 1 CBM from the Trichoderma reesei Family 7 cellobiohydrolase, Cel7A, is known to selectively bind to hydrophobic surfaces of native cellulose. It is most commonly suggested that three aromatic residues identify the planar binding face of this CBM, but several recent studies have challenged this hypothesis. Here, we use molecular simulation to study the CBM binding orientation and affinity on hydrophilic and hydrophobic cellulose surfaces. Roughly 43 μs of molecular dynamics simulations were conducted, which enables statistically significant observations. We quantify the fractions of the CBMs that detach from crystal surfaces or diffuse to other surfaces, the diffusivity along the hydrophobic surface, and the overall orientation of the CBM on both hydrophobic and hydrophilic faces. The simulations demonstrate that there is a thermodynamic driving force for the Cel7A CBM to bind preferentially to the hydrophobic surface of cellulose relative to hydrophilic surfaces. In addition, the simulations demonstrate that the CBM can diffuse from hydrophilic surfaces to the hydrophobic surface, whereas the reverse transition is not observed. Lastly, our simulations suggest that the flat faces of Family 1 CBMs are the preferred binding surfaces. These results enhance our understanding of how Family 1 CBMs interact with and recognize specific cellulose surfaces and provide insights into the initial events of cellulase adsorption and diffusion on cellulose. PMID:22496371
DOE Office of Scientific and Technical Information (OSTI.GOV)
McCallum, Matthew; Tammam, Stephanie; Little, Dustin J.
Pseudomonas aeruginosa is an opportunistic bacterial pathogen that expresses type IVa pili. The pilus assembly system, which promotes surface-associated twitching motility and virulence, is composed of inner and outer membrane subcomplexes, connected by an alignment subcomplex composed of PilMNOP. PilM binds to the N terminus of PilN, and we hypothesize that this interaction causes functionally significant structural changes in PilM. To characterize this interaction, we determined the crystal structures of PilM and a PilM chimera where PilM was fused to the first 12 residues of PilN (PilM·PilN(1–12)). Structural analysis, multiangle light scattering coupled with size exclusion chromatography, and bacterial two-hybridmore » data revealed that PilM forms dimers mediated by the binding of a novel conserved motif in the N terminus of PilM, and binding PilN abrogates this binding interface, resulting in PilM monomerization. Structural comparison of PilM with PilM·PilN(1–12) revealed that upon PilN binding, there is a large domain closure in PilM that alters its ATP binding site. Using biolayer interferometry, we found that the association rate of PilN with PilM is higher in the presence of ATP compared with ADP. Bacterial two-hybrid data suggested the connectivity of the cytoplasmic and inner membrane components of the type IVa pilus machinery in P. aeruginosa, with PilM binding to PilB, PilT, and PilC in addition to PilN. Pull-down experiments demonstrated direct interactions of PilM with PilB and PilT. As a result, we propose a working model in which dynamic binding of PilN facilitates functionally relevant structural changes in PilM.« less
McCallum, Matthew; Tammam, Stephanie; Little, Dustin J.; ...
2016-03-28
Pseudomonas aeruginosa is an opportunistic bacterial pathogen that expresses type IVa pili. The pilus assembly system, which promotes surface-associated twitching motility and virulence, is composed of inner and outer membrane subcomplexes, connected by an alignment subcomplex composed of PilMNOP. PilM binds to the N terminus of PilN, and we hypothesize that this interaction causes functionally significant structural changes in PilM. To characterize this interaction, we determined the crystal structures of PilM and a PilM chimera where PilM was fused to the first 12 residues of PilN (PilM·PilN(1–12)). Structural analysis, multiangle light scattering coupled with size exclusion chromatography, and bacterial two-hybridmore » data revealed that PilM forms dimers mediated by the binding of a novel conserved motif in the N terminus of PilM, and binding PilN abrogates this binding interface, resulting in PilM monomerization. Structural comparison of PilM with PilM·PilN(1–12) revealed that upon PilN binding, there is a large domain closure in PilM that alters its ATP binding site. Using biolayer interferometry, we found that the association rate of PilN with PilM is higher in the presence of ATP compared with ADP. Bacterial two-hybrid data suggested the connectivity of the cytoplasmic and inner membrane components of the type IVa pilus machinery in P. aeruginosa, with PilM binding to PilB, PilT, and PilC in addition to PilN. Pull-down experiments demonstrated direct interactions of PilM with PilB and PilT. As a result, we propose a working model in which dynamic binding of PilN facilitates functionally relevant structural changes in PilM.« less
Ligand-independent activation of the oestrogen receptor by mutation of a conserved tyrosine.
White, R; Sjöberg, M; Kalkhoven, E; Parker, M G
1997-01-01
The oestrogen receptor is a member of the nuclear receptor family of transcription factors which, on binding the steroid hormone 17beta-oestradiol, interacts with co-activator proteins and stimulates gene expression. Replacement of a single tyrosine in the hormone-binding domain generated activated forms of the receptor which stimulated transcription in the absence of hormone. This increased activation is related to a decrease in hydrophobicity and a reduction in size of the side chain of the amino acid with which the tyrosine is replaced. Ligand-independent, in common with ligand-dependent transcriptional activation, requires an amphipathic alpha-helix at the C-terminus of the ligand-binding domain which is essential for the interaction of the receptor with a number of potential co-activator proteins. In contrast to the wild-type protein, constitutively active receptors were able to bind both the receptor-interacting protein RIP-140 and the steroid receptor co-activator SRC-1 in a ligand-independent manner, although in the case of SRC-1 this was only evident when the receptors were prebound to DNA. We propose, therefore, that this tyrosine is required to maintain the receptor in a transcriptionally inactive state in the absence of hormone. Modification of this residue may generate a conformational change in the ligand-binding domain of the receptor to form an interacting surface which allows the recruitment of co-activators independent of hormone binding. This suggests that this tyrosine may be a target for a different signalling pathway which forms an alternative mechanism of activating oestrogen receptor-mediated transcription. PMID:9135157
STARD4 Membrane Interactions and Sterol Binding
2016-01-01
The steroidogenic acute regulatory protein-related lipid transfer (START) domain family is defined by a conserved 210-amino acid sequence that folds into an α/β helix-grip structure. Members of this protein family bind a variety of ligands, including cholesterol, phospholipids, sphingolipids, and bile acids, with putative roles in nonvesicular lipid transport, metabolism, and cell signaling. Among the soluble START proteins, STARD4 is expressed in most tissues and has previously been shown to transfer sterol, but the molecular mechanisms of membrane interaction and sterol binding remain unclear. In this work, we use biochemical techniques to characterize regions of STARD4 and determine their role in membrane interaction and sterol binding. Our results show that STARD4 interacts with anionic membranes through a surface-exposed basic patch and that introducing a mutation (L124D) into the Omega-1 (Ω1) loop, which covers the sterol binding pocket, attenuates sterol transfer activity. To gain insight into the attenuating mechanism of the L124D mutation, we conducted structural and biophysical studies of wild-type and L124D STARD4. These studies show that the L124D mutation reduces the conformational flexibility of the protein, resulting in a diminished level of membrane interaction and sterol transfer. These studies also reveal that the C-terminal α-helix, and not the Ω1 loop, partitions into the membrane bilayer. On the basis of these observations, we propose a model of STARD4 membrane interaction and sterol binding and release that requires dynamic movement of both the Ω1 loop and membrane insertion of the C-terminal α-helix. PMID:26168008
Ho, Ngoc Anh Thu; Dawes, Stephanie S.; Crowe, Adam M.; Casabon, Israël; Gao, Chen; Kendall, Sharon L.; Baker, Edward N.; Eltis, Lindsay D.; Lott, J. Shaun
2016-01-01
Cholesterol can be a major carbon source for Mycobacterium tuberculosis during infection, both at an early stage in the macrophage phagosome and later within the necrotic granuloma. KstR is a highly conserved TetR family transcriptional repressor that regulates a large set of genes responsible for cholesterol catabolism. Many genes in this regulon, including kstR, are either induced during infection or are essential for survival of M. tuberculosis in vivo. In this study, we identified two ligands for KstR, both of which are CoA thioester cholesterol metabolites with four intact steroid rings. A metabolite in which one of the rings was cleaved was not a ligand. We confirmed the ligand-protein interactions using intrinsic tryptophan fluorescence and showed that ligand binding strongly inhibited KstR-DNA binding using surface plasmon resonance (IC50 for ligand = 25 nm). Crystal structures of the ligand-free form of KstR show variability in the position of the DNA-binding domain. In contrast, structures of KstR·ligand complexes are highly similar to each other and demonstrate a position of the DNA-binding domain that is unfavorable for DNA binding. Comparison of ligand-bound and ligand-free structures identifies residues involved in ligand specificity and reveals a distinctive mechanism by which the ligand-induced conformational change mediates DNA release. PMID:26858250
Leonard, D A; Rajaram, N; Kerppola, T K
1997-05-13
Interactions among transcription factors that bind to separate sequence elements require bending of the intervening DNA and juxtaposition of interacting molecular surfaces in an appropriate orientation. Here, we examine the effects of single amino acid substitutions adjacent to the basic regions of Fos and Jun as well as changes in sequences flanking the AP-1 site on DNA bending. Substitution of charged amino acid residues at positions adjacent to the basic DNA-binding domains of Fos and Jun altered DNA bending. The change in DNA bending was directly proportional to the change in net charge for all heterodimeric combinations between these proteins. Fos and Jun induced distinct DNA bends at different binding sites. Exchange of a single base pair outside of the region contacted in the x-ray crystal structure altered DNA bending. Substitution of base pairs flanking the AP-1 site had converse effects on the opposite directions of DNA bending induced by homodimers and heterodimers. These results suggest that Fos and Jun induce DNA bending in part through electrostatic interactions between amino acid residues adjacent to the basic region and base pairs flanking the AP-1 site. DNA bending by Fos and Jun at inverted binding sites indicated that heterodimers bind to the AP-1 site in a preferred orientation. Mutation of a conserved arginine within the basic regions of Fos and transversion of the central C:G base pair in the AP-1 site to G:C had complementary effects on the orientation of heterodimer binding and DNA bending. The conformational variability of the Fos-Jun-AP-1 complex may contribute to its functional versatility at different promoters.
Lejal, Nathalie; Tarus, Bogdan; Bouguyon, Edwige; Chenavas, Sylvie; Bertho, Nicolas; Delmas, Bernard; Ruigrok, Rob W. H.; Di Primo, Carmelo
2013-01-01
The nucleoprotein (NP) binds the viral RNA genome and associates with the polymerase in a ribonucleoprotein complex (RNP) required for transcription and replication of influenza A virus. NP has no cellular counterpart, and the NP sequence is highly conserved, which led to considering NP a hot target in the search for antivirals. We report here that monomeric nucleoprotein can be inhibited by a small molecule binding in its RNA binding groove, resulting in a novel antiviral against influenza A virus. We identified naproxen, an anti-inflammatory drug that targeted the nucleoprotein to inhibit NP-RNA association required for NP function, by virtual screening. Further docking and molecular dynamics (MD) simulations identified in the RNA groove two NP-naproxen complexes of similar levels of interaction energy. The predicted naproxen binding sites were tested using the Y148A, R152A, R355A, and R361A proteins carrying single-point mutations. Surface plasmon resonance, fluorescence, and other in vitro experiments supported the notion that naproxen binds at a site identified by MD simulations and showed that naproxen competed with RNA binding to wild-type (WT) NP and protected active monomers of the nucleoprotein against proteolytic cleavage. Naproxen protected Madin-Darby canine kidney (MDCK) cells against viral challenges with the H1N1 and H3N2 viral strains and was much more effective than other cyclooxygenase inhibitors in decreasing viral titers of MDCK cells. In a mouse model of intranasal infection, naproxen treatment decreased the viral titers in mice lungs. In conclusion, naproxen is a promising lead compound for novel antivirals against influenza A virus that targets the nucleoprotein in its RNA binding groove. PMID:23459490
Stegemann, Björn; Klebe, Gerhard
2012-02-01
Small molecules are recognized in protein-binding pockets through surface-exposed physicochemical properties. To optimize binding, they have to adopt a conformation corresponding to a local energy minimum within the formed protein-ligand complex. However, their conformational flexibility makes them competent to bind not only to homologous proteins of the same family but also to proteins of remote similarity with respect to the shape of the binding pockets and folding pattern. Considering drug action, such observations can give rise to unexpected and undesired cross reactivity. In this study, datasets of six different cofactors (ADP, ATP, NAD(P)(H), FAD, and acetyl CoA, sharing an adenosine diphosphate moiety as common substructure), observed in multiple crystal structures of protein-cofactor complexes exhibiting sequence identity below 25%, have been analyzed for the conformational properties of the bound ligands, the distribution of physicochemical properties in the accommodating protein-binding pockets, and the local folding patterns next to the cofactor-binding site. State-of-the-art clustering techniques have been applied to group the different protein-cofactor complexes in the different spaces. Interestingly, clustering in cavity (Cavbase) and fold space (DALI) reveals virtually the same data structuring. Remarkable relationships can be found among the different spaces. They provide information on how conformations are conserved across the host proteins and which distinct local cavity and fold motifs recognize the different portions of the cofactors. In those cases, where different cofactors are found to be accommodated in a similar fashion to the same fold motifs, only a commonly shared substructure of the cofactors is used for the recognition process. Copyright © 2011 Wiley Periodicals, Inc.
Fuentes-Pananá, Ezequiel M.; Swaminathan, Sankar; Ling, Paul D.
1999-01-01
The Epstein-Barr virus (EBV) EBNA2 protein is a transcriptional activator that controls viral latent gene expression and is essential for EBV-driven B-cell immortalization. EBNA2 is expressed from the viral C promoter (Cp) and regulates its own expression by activating Cp through interaction with the cellular DNA binding protein CBF1. Through regulation of Cp and EBNA2 expression, EBV controls the pattern of latent protein expression and the type of latency established. To gain further insight into the important regulatory elements that modulate Cp usage, we isolated and sequenced the Cp regions corresponding to nucleotides 10251 to 11479 of the EBV genome (−1079 to +144 relative to the transcription initiation site) from the EBV-like lymphocryptoviruses found in baboons (herpesvirus papio; HVP) and Rhesus macaques (RhEBV). Sequence comparison of the approximately 1,230-bp Cp regions from these primate viruses revealed that EBV and HVP Cp sequences are 64% conserved, EBV and RhEBV Cp sequences are 66% conserved, and HVP and RhEBV Cp sequences are 65% conserved relative to each other. Approximately 50% of the residues are conserved among all three sequences, yet all three viruses have retained response elements for glucocorticoids, two positionally conserved CCAAT boxes, and positionally conserved TATA boxes. The putative EBNA2 100-bp enhancers within these promoters contain 54 conserved residues, and the binding sites for CBF1 and CBF2 are well conserved. Cp usage in the HVP- and RhEBV-transformed cell lines was detected by S1 nuclease protection analysis. Transient-transfection analysis showed that promoters of both HVP and RhEBV are responsive to EBNA2 and that they bind CBF1 and CBF2 in gel mobility shift assays. These results suggest that similar mechanisms for regulation of latent gene expression are conserved among the EBV-related lymphocryptoviruses found in nonhuman primates. PMID:9847397
Fuentes-Pananá, E M; Swaminathan, S; Ling, P D
1999-01-01
The Epstein-Barr virus (EBV) EBNA2 protein is a transcriptional activator that controls viral latent gene expression and is essential for EBV-driven B-cell immortalization. EBNA2 is expressed from the viral C promoter (Cp) and regulates its own expression by activating Cp through interaction with the cellular DNA binding protein CBF1. Through regulation of Cp and EBNA2 expression, EBV controls the pattern of latent protein expression and the type of latency established. To gain further insight into the important regulatory elements that modulate Cp usage, we isolated and sequenced the Cp regions corresponding to nucleotides 10251 to 11479 of the EBV genome (-1079 to +144 relative to the transcription initiation site) from the EBV-like lymphocryptoviruses found in baboons (herpesvirus papio; HVP) and Rhesus macaques (RhEBV). Sequence comparison of the approximately 1,230-bp Cp regions from these primate viruses revealed that EBV and HVP Cp sequences are 64% conserved, EBV and RhEBV Cp sequences are 66% conserved, and HVP and RhEBV Cp sequences are 65% conserved relative to each other. Approximately 50% of the residues are conserved among all three sequences, yet all three viruses have retained response elements for glucocorticoids, two positionally conserved CCAAT boxes, and positionally conserved TATA boxes. The putative EBNA2 100-bp enhancers within these promoters contain 54 conserved residues, and the binding sites for CBF1 and CBF2 are well conserved. Cp usage in the HVP- and RhEBV-transformed cell lines was detected by S1 nuclease protection analysis. Transient-transfection analysis showed that promoters of both HVP and RhEBV are responsive to EBNA2 and that they bind CBF1 and CBF2 in gel mobility shift assays. These results suggest that similar mechanisms for regulation of latent gene expression are conserved among the EBV-related lymphocryptoviruses found in nonhuman primates.
Getting to the core of cadherin complex function in Caenorhabditis elegans.
Hardin, Jeff
2015-01-01
The classic cadherin-catenin complex (CCC) mediates cell-cell adhesion in metazoans. Although substantial insights have been gained by studying the CCC in vertebrate tissue culture, analyzing requirements for and regulation of the CCC in vertebrates remains challenging. Caenorhabditis elegans is a powerful system for connecting the molecular details of CCC function with functional requirements in a living organism. Recent data, using an "angstroms to embryos" approach, have elucidated functions for key residues, conserved across all metazoans, that mediate cadherin/β-catenin binding. Other recent work reveals a novel, potentially ancestral, role for the C. elegans p120ctn homologue in regulating polarization of blastomeres in the early embryo via Cdc42 and the partitioning-defective (PAR)/atypical protein kinase C (aPKC) complex. Finally, recent work suggests that the CCC is trafficked to the cell surface via the clathrin adaptor protein complex 1 (AP-1) in surprising ways. These studies continue to underscore the value of C. elegans as a model system for identifying conserved molecular mechanisms involving the CCC.
The Cbf5-Nop10 Complex is a Molecular Bracket that Organizes Box H/ACA RNPs
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hamma, Tomoko; Reichow, Steve L.; Varani, Gabriele
2005-12-01
Box H/ACA ribonucleoprotein particles (RNPs) catalyze RNA pseudouridylation and direct processing of ribosomal RNA, and are essential architectural components of vertebrate telomerases. H/ACA RNPs comprise four proteins and a multihelical RNA. Two proteins, Cbf5 and Nop10, suffice for basal enzymatic activity in an archaeal in vitro system. We now report their cocrystal structure at 1.95-A resolution. We find that archaeal Cbf5 can assemble with yeast Nop10 and with human telomerase RNA, consistent with the high sequence identity of the RNP componenets between archaea and eukarya. Thus, the Cbf5-Nop10 architecture is phylogenetically conserved. The structure shows how Nop10 buttresses the activemore » site of Cbf5, and it reveals two basic troughs that bidirectionally extend the active site cleft. Mutagenesis results implicate an adjacent basic patch in RNA binding. This tripartite RNA-binding surface may function as a molecular bracket that organizes the multihelical H/ACA and telomerase RNAs.« less
Structural Basis for Marburg Virus Neutralization by a Cross-Reactive Human Antibody
Hashiguchi, Takao; Fusco, Marnie L.; Bornholdt, Zachary A.; ...
2015-02-26
The filoviruses, including Marburg and Ebola, express a single glycoprotein on their surface, termed GP, which is responsible for attachment and entry of target cells. Filovirus GPs differ by up to 70% in protein sequence, and no antibodies are yet described that cross-react among them. Here, we present the 3.6 Å crystal structure of Marburg virus GP in complex with a cross-reactive antibody from a human survivor, and a lower resolution structure of the antibody bound to Ebola virus GP. The antibody, MR78, recognizes a GP1 epitope conserved across the filovirus family, which likely represents the binding site of theirmore » NPC1 receptor. Indeed, MR78 blocks binding of the essential NPC1 domain C. We find that these structures and additional small-angle X-ray scattering of mucin-containing MARV and EBOV GPs suggest why such antibodies were not previously elicited in studies of Ebola virus, and provide critical templates for development of immunotherapeutics and inhibitors of entry.« less
Wang, Junqing; Ren, Xudong; Wang, Ruiming; Su, Jing; Wang, Feng
2017-09-06
Trehalose has important applications in the food industry and pharmaceutical manufacturing. The thermostable enzyme trehalose synthase from Thermobaculum terrenum (TtTS) catalyzes the reversible interconversion of maltose and trehalose. Here, we investigated the structural characteristics of TtTS in complex with the inhibitor TriS. TtTS exhibits the typical three domain glycoside hydrolase family 13 structure. The catalytic cleft consists of Asp202-Glu244-Asp310 and various conserved substrate-binding residues. However, among trehalose synthases, TtTS demonstrates obvious thermal stability. TtTS has more polar (charged) amino acids distributed on its protein structure surface and more aromatic amino acids buried within than other mesophilic trehalose synthases. Furthermore, TtTS structural analysis revealed four potential metal ion-binding sites rather than the two in a homologous structure. These factors may render TtTS relatively more thermostable among mesophilic trehalose synthases. The detailed thermophilic enzyme structure provided herein may provide guidance for further protein engineering in the design of stabilized enzymes.
Structural basis for Marburg virus neutralization by a cross-reactive human antibody.
Hashiguchi, Takao; Fusco, Marnie L; Bornholdt, Zachary A; Lee, Jeffrey E; Flyak, Andrew I; Matsuoka, Rei; Kohda, Daisuke; Yanagi, Yusuke; Hammel, Michal; Crowe, James E; Saphire, Erica Ollmann
2015-02-26
The filoviruses, including Marburg and Ebola, express a single glycoprotein on their surface, termed GP, which is responsible for attachment and entry of target cells. Filovirus GPs differ by up to 70% in protein sequence, and no antibodies are yet described that cross-react among them. Here, we present the 3.6 Å crystal structure of Marburg virus GP in complex with a cross-reactive antibody from a human survivor, and a lower resolution structure of the antibody bound to Ebola virus GP. The antibody, MR78, recognizes a GP1 epitope conserved across the filovirus family, which likely represents the binding site of their NPC1 receptor. Indeed, MR78 blocks binding of the essential NPC1 domain C. These structures and additional small-angle X-ray scattering of mucin-containing MARV and EBOV GPs suggest why such antibodies were not previously elicited in studies of Ebola virus, and provide critical templates for development of immunotherapeutics and inhibitors of entry. Copyright © 2015 Elsevier Inc. All rights reserved.
Kim, Kye-Won; Smith, Clyde A.; Daily, Michael D.; ...
2014-11-19
Control over phenoxy radical-radical coupling reactions in vivo in vascular plants was enigmatic until our discovery of dirigent proteins (DPs, from the Latin dirigere, to guide or align). The first three-dimensional structure of a DP ((+)-pinoresinol-forming DP, 1.95 Å resolution, rhombohedral space group H32)) is reported herein. It has a tightly packed trimeric structure with an eight-stranded β-barrel topology for each DP monomer. Each putative substrate binding and orientation coupling site is located on the trimer surface but too far apart for intermolecular coupling between sites. It is proposed that each site enables stereoselective coupling (using either two coniferyl alcoholmore » radicals or a radical and a monolignol). Interestingly, there are six differentially conserved residues in DPs affording either the (+)- or (₋)-antipodes in the vicinity of the putative binding site and region known to control stereoselectivity. We find DPs are involved in lignan biosynthesis, whereas dirigent domains/sites have been implicated in lignin deposition.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Leung, Daisy W.; Borek, Dominika; Luthra, Priya
During viral RNA synthesis, Ebola virus (EBOV) nucleoprotein (NP) alternates between an RNA-template-bound form and a template-free form to provide the viral polymerase access to the RNA template. In addition, newly synthesized NP must be prevented from indiscriminately binding to noncognate RNAs. Here, we investigate the molecular bases for these critical processes. We identify an intrinsically disordered peptide derived from EBOV VP35 (NPBP, residues 20–48) that binds NP with high affinity and specificity, inhibits NP oligomerization, and releases RNA from NP-RNA complexes in vitro. The structure of the NPBP/ΔNP NTD complex, solved to 3.7 Å resolution, reveals how NPBP peptidemore » occludes a large surface area that is important for NP-NP and NP-RNA interactions and for viral RNA synthesis. Together, our results identify a highly conserved viral interface that is important for EBOV replication and can be targeted for therapeutic development.« less
Leung, Daisy W.; Borek, Dominika; Luthra, Priya; ...
2015-04-01
During viral RNA synthesis, Ebola virus (EBOV) nucleoprotein (NP) alternates between an RNA-template-bound form and a template-free form to provide the viral polymerase access to the RNA template. In addition, newly synthesized NP must be prevented from indiscriminately binding to noncognate RNAs. Here, we investigate the molecular bases for these critical processes. We identify an intrinsically disordered peptide derived from EBOV VP35 (NPBP, residues 20–48) that binds NP with high affinity and specificity, inhibits NP oligomerization, and releases RNA from NP-RNA complexes in vitro. The structure of the NPBP/ΔNP NTD complex, solved to 3.7 Å resolution, reveals how NPBP peptidemore » occludes a large surface area that is important for NP-NP and NP-RNA interactions and for viral RNA synthesis. Together, our results identify a highly conserved viral interface that is important for EBOV replication and can be targeted for therapeutic development.« less
Leung, Daisy W; Borek, Dominika; Luthra, Priya; Binning, Jennifer M; Anantpadma, Manu; Liu, Gai; Harvey, Ian B; Su, Zhaoming; Endlich-Frazier, Ariel; Pan, Juanli; Shabman, Reed S; Chiu, Wah; Davey, Robert A; Otwinowski, Zbyszek; Basler, Christopher F; Amarasinghe, Gaya K
2015-04-21
During viral RNA synthesis, Ebola virus (EBOV) nucleoprotein (NP) alternates between an RNA-template-bound form and a template-free form to provide the viral polymerase access to the RNA template. In addition, newly synthesized NP must be prevented from indiscriminately binding to noncognate RNAs. Here, we investigate the molecular bases for these critical processes. We identify an intrinsically disordered peptide derived from EBOV VP35 (NPBP, residues 20-48) that binds NP with high affinity and specificity, inhibits NP oligomerization, and releases RNA from NP-RNA complexes in vitro. The structure of the NPBP/ΔNPNTD complex, solved to 3.7 Å resolution, reveals how NPBP peptide occludes a large surface area that is important for NP-NP and NP-RNA interactions and for viral RNA synthesis. Together, our results identify a highly conserved viral interface that is important for EBOV replication and can be targeted for therapeutic development. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
2016-01-01
Color variation provides the opportunity to investigate the genetic basis of evolution and selection. Reptiles are less studied than mammals. Comparative genomics approaches allow for knowledge gained in one species to be leveraged for use in another species. We describe a comparative vertebrate analysis of conserved regulatory modules in pythons aimed at assessing bioinformatics evidence that transcription factors important in mammalian pigmentation phenotypes may also be important in python pigmentation phenotypes. We identified 23 python orthologs of mammalian genes associated with variation in coat color phenotypes for which we assessed the extent of pairwise protein sequence identity between pythons and mouse, dog, horse, cow, chicken, anole lizard, and garter snake. We next identified a set of melanocyte/pigment associated transcription factors (CREB, FOXD3, LEF-1, MITF, POU3F2, and USF-1) that exhibit relatively conserved sequence similarity within their DNA binding regions across species based on orthologous alignments across multiple species. Finally, we identified 27 evolutionarily conserved clusters of transcription factor binding sites within ~200-nucleotide intervals of the 1500-nucleotide upstream regions of AIM1, DCT, MC1R, MITF, MLANA, OA1, PMEL, RAB27A, and TYR from Python bivittatus. Our results provide insight into pigment phenotypes in pythons. PMID:27698666
Kinetic Contributions to Gating by Interactions Unique to N-methyl-d-aspartate (NMDA) Receptors*
Borschel, William F.; Cummings, Kirstie A.; Tindell, LeeAnn K.; Popescu, Gabriela K.
2015-01-01
Among glutamate-gated channels, NMDA receptors produce currents that subside with unusually slow kinetics, and this feature is essential to the physiology of central excitatory synapses. Relative to the homologous AMPA and kainate receptors, NMDA receptors have additional intersubunit contacts in the ligand binding domain that occur at both conserved and non-conserved sites. We examined GluN1/GluN2A single-channel currents with kinetic analyses and modeling to probe these class-specific intersubunit interactions for their role in glutamate binding and receptor gating. We found that substitutions that eliminate such interactions at non-conserved sites reduced stationary gating, accelerated deactivation, and imparted sensitivity to aniracetam, an AMPA receptor-selective positive modulator. Abolishing unique contacts at conserved sites also reduced stationary gating and accelerated deactivation. These results show that contacts specific to NMDA receptors, which brace the heterodimer interface within the ligand binding domain, stabilize actively gating receptor conformations and result in longer bursts and slower deactivations. They support the view that the strength of the heterodimer interface modulates gating in both NMDA and non-NMDA receptors and that unique interactions at this interface are responsible in part for basic differences between the kinetics of NMDA and non-NMDA currents at glutamatergic synapses. PMID:26370091
Irizarry, Kristopher J L; Bryden, Randall L
2016-01-01
Color variation provides the opportunity to investigate the genetic basis of evolution and selection. Reptiles are less studied than mammals. Comparative genomics approaches allow for knowledge gained in one species to be leveraged for use in another species. We describe a comparative vertebrate analysis of conserved regulatory modules in pythons aimed at assessing bioinformatics evidence that transcription factors important in mammalian pigmentation phenotypes may also be important in python pigmentation phenotypes. We identified 23 python orthologs of mammalian genes associated with variation in coat color phenotypes for which we assessed the extent of pairwise protein sequence identity between pythons and mouse, dog, horse, cow, chicken, anole lizard, and garter snake. We next identified a set of melanocyte/pigment associated transcription factors (CREB, FOXD3, LEF-1, MITF, POU3F2, and USF-1) that exhibit relatively conserved sequence similarity within their DNA binding regions across species based on orthologous alignments across multiple species. Finally, we identified 27 evolutionarily conserved clusters of transcription factor binding sites within ~200-nucleotide intervals of the 1500-nucleotide upstream regions of AIM1, DCT, MC1R, MITF, MLANA, OA1, PMEL, RAB27A, and TYR from Python bivittatus . Our results provide insight into pigment phenotypes in pythons.
Tian, Li; Liu, Shijia; Wang, Shuai; Wang, Lushan
2016-03-24
Biomass can be converted into sugars by a series of lignocellulolytic enzymes, which belong to the glycoside hydrolase (GH) families summarized in CAZy databases. Here, using a structural bioinformatics method, we analyzed the active site architecture of the main lignocellulolytic enzyme families. The aromatic amino acids Trp/Tyr and polar amino acids Glu/Asp/Asn/Gln/Arg occurred at higher frequencies in the active site architecture than in the whole enzyme structure. And the number of potential subsites was significantly different among different families. In the cellulase and xylanase families, the conserved amino acids in the active site architecture were mostly found at the -2 to +1 subsites, while in β-glucosidase they were mainly concentrated at the -1 subsite. Families with more conserved binding amino acid residues displayed strong selectivity for their ligands, while those with fewer conserved binding amino acid residues often exhibited promiscuity when recognizing ligands. Enzymes with different activities also tended to bind different hydroxyl oxygen atoms on the ligand. These results may help us to better understand the common and unique structural bases of enzyme-ligand recognition from different families and provide a theoretical basis for the functional evolution and rational design of major lignocellulolytic enzymes.
Golovenko, Dmitrij; Manakova, Elena; Zakrys, Linas; Zaremba, Mindaugas; Sasnauskas, Giedrius; Gražulis, Saulius; Siksnys, Virginijus
2014-01-01
The B3 DNA-binding domains (DBDs) of plant transcription factors (TF) and DBDs of EcoRII and BfiI restriction endonucleases (EcoRII-N and BfiI-C) share a common structural fold, classified as the DNA-binding pseudobarrel. The B3 DBDs in the plant TFs recognize a diverse set of target sequences. The only available co-crystal structure of the B3-like DBD is that of EcoRII-N (recognition sequence 5′-CCTGG-3′). In order to understand the structural and molecular mechanisms of specificity of B3 DBDs, we have solved the crystal structure of BfiI-C (recognition sequence 5′-ACTGGG-3′) complexed with 12-bp cognate oligoduplex. Structural comparison of BfiI-C–DNA and EcoRII-N–DNA complexes reveals a conserved DNA-binding mode and a conserved pattern of interactions with the phosphodiester backbone. The determinants of the target specificity are located in the loops that emanate from the conserved structural core. The BfiI-C–DNA structure presented here expands a range of templates for modeling of the DNA-bound complexes of the B3 family of plant TFs. PMID:24423868
Replication-Independent Histone Deposition by the HIR Complex and Asf1
Green, Erin M.; Antczak, Andrew J.; Bailey, Aaron O.; Franco, Alexa A.; Wu, Kevin J.; Yates, John R.; Kaufman, Paul D.
2010-01-01
Summary The orderly deposition of histones onto DNA is mediated by conserved assembly complexes, including Chromatin Assembly Factor-1 (CAF-1) and the Hir proteins [1–4]. CAF-1 and the Hir proteins operate in distinct but functionally overlapping histone deposition pathways in vivo [5, 6]. The Hir proteins and CAF-1 share a common partner, the highly conserved histone H3/H4-binding protein Asf1, which binds the middle subunit of CAF-1 as well as to Hir proteins [7–11]. Asf1 binds to newly synthesized histones H3/H4 [12] and this complex stimulates histone deposition by CAF-1 [7, 12, 13]. In yeast, Asf1 is required for the contribution of the Hir proteins to gene silencing [7, 14]. Here, we demonstrate that Hir1, Hir2, Hir3 and Hpc2 comprise the HIR complex, which co-purifies with histone deposition protein Asf1. Together, the HIR complex and Asf1 deposit histones onto DNA in a replication-independent manner. Histone deposition by the HIR complex and Asf1 is impaired by a mutation in Asf1 that inhibits HIR binding. These data indicate that the HIR complex and Asf1 proteins function together as a conserved eukaryotic pathway for histone replacement throughout the cell cycle. PMID:16303565
Evolution of the insulin molecule: insights into structure-activity and phylogenetic relationships.
Conlon, J M
2001-07-01
The conformation of insulin in the crystalline state has been known for more than 30 years but there remains uncertainty regarding the biologically active conformation and the structural features that constitute the receptor-binding domain. The primary structure of insulin has been determined for at least 100 vertebrate species. In addition to the invariant cysteines, only ten amino acids (GlyA1, IleA2, ValA3, TyrA19, LeuB6, GlyB8, LeuB11, ValB12, GlyB23 and PheB24) have been fully conserved during vertebrate evolution. This observation supports the hypothesis derived from alanine-scanning mutagenesis studies that five of these invariant residues (IleA2, ValA3, TyrA19, GlyB23, and Phe24) interact directly with the receptor and five additional conserved residues (LeuB6, GlyB8, LeuB11, GluB13 and PheB25) are important in maintaining the receptor-binding conformation. With the exception of the hagfish, only conservative substitutions are found at B13 (Glu --> Asp) and B25(Phe --> Tyr). In contrast, amino acid residues that were also considered to be important in receptor binding based upon the crystal structure of insulin (GluA4, GlnA5, AsnA21, TyrB16, TyrB26) have been much less well conserved and are probably not components of the receptor-binding domain. The hypothesis that LeuA13 and LeuB17 form part of a second receptor-binding site in the insulin molecule finds some support in terms of their conservation during vertebrate evolution, although the site is probably absent in some hystricomorph insulins. In general, the amino acid sequences of insulins are not useful in cladistic analyses especially when evolutionary distant taxa are compared but, among related species in a particular order or family, the presence of unusual structural features in the insulin molecule may permit a meaningful phylogenetic inference. For example, analysis of insulin sequences supports monophyletic status for Dipnoi, Elasmobranchii, Holocephali and Petromyzontiformes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Han, S.; Tainer, J.A.
2001-08-01
ADP-ribosylation is a widely occurring and biologically critical covalent chemical modification process in pathogenic mechanisms, intracellular signaling systems, DNA repair, and cell division. The reaction is catalyzed by ADP-ribosyltransferases, which transfer the ADP-ribose moiety of NAD to a target protein with nicotinamide release. A family of bacterial toxins and eukaryotic enzymes has been termed the mono-ADP-ribosyltransferases, in distinction to the poly-ADP-ribosyltransferases, which catalyze the addition of multiple ADP-ribose groups to the carboxyl terminus of eukaryotic nucleoproteins. Despite the limited primary sequence homology among the different ADP-ribosyltransferases, a central cleft bearing NAD-binding pocket formed by the two perpendicular b-sheet core hasmore » been remarkably conserved between bacterial toxins and eukaryotic mono- and poly-ADP-ribosyltransferases. The majority of bacterial toxins and eukaryotic mono-ADP-ribosyltransferases are characterized by conserved His and catalytic Glu residues. In contrast, Diphtheria toxin, Pseudomonas exotoxin A, and eukaryotic poly-ADP-ribosyltransferases are characterized by conserved Arg and catalytic Glu residues. The NAD-binding core of a binary toxin and a C3-like toxin family identified an ARTT motif (ADP-ribosylating turn-turn motif) that is implicated in substrate specificity and recognition by structural and mutagenic studies. Here we apply structure-based sequence alignment and comparative structural analyses of all known structures of ADP-ribosyltransfeases to suggest that this ARTT motif is functionally important in many ADP-ribosylating enzymes that bear a NAD binding cleft as characterized by conserved Arg and catalytic Glu residues. Overall, structure-based sequence analysis reveals common core structures and conserved active sites of ADP-ribosyltransferases to support similar NAD binding mechanisms but differing mechanisms of target protein binding via sequence variations within the ARTT motif structural framework. Thus, we propose here that the ARTT motif represents an experimentally testable general recognition motif region for many ADP-ribosyltransferases and thereby potentially provides a unified structural understanding of substrate recognition in ADP-ribosylation processes.« less
Chen, Chih-Ying; Brodsky, Frances M
2005-02-18
Clathrin heavy and light chains form triskelia, which assemble into polyhedral coats of membrane vesicles that mediate transport for endocytosis and organelle biogenesis. Light chain subunits regulate clathrin assembly in vitro by suppressing spontaneous self-assembly of the heavy chains. The residues that play this regulatory role are at the N terminus of a conserved 22-amino acid sequence that is shared by all vertebrate light chains. Here we show that these regulatory residues and others in the conserved sequence mediate light chain interaction with Hip1 and Hip1R. These related proteins were previously found to be enriched in clathrin-coated vesicles and to promote clathrin assembly in vitro. We demonstrate Hip1R binding preference for light chains associated with clathrin heavy chain and show that Hip1R stimulation of clathrin assembly in vitro is blocked by mutations in the conserved sequence of light chains that abolish interaction with Hip1 and Hip1R. In vivo overexpression of a fragment of clathrin light chain comprising the Hip1R-binding region affected cellular actin distribution. Together these results suggest that the roles of Hip1 and Hip1R in affecting clathrin assembly and actin distribution are mediated by their interaction with the conserved sequence of clathrin light chains.
Solution structure of an ATP-binding RNA aptamer reveals a novel fold.
Dieckmann, T; Suzuki, E; Nakamura, G K; Feigon, J
1996-01-01
In vitro selection has been used to isolate several RNA aptamers that bind specifically to biological cofactors. A well-characterized example in the ATP-binding RNA aptamer family, which contains a conserved 11-base loop opposite a bulged G and flanked by regions of double-stranded RNA. The nucleotides in the consensus sequence provide a binding pocket for ATP (or AMP), which binds with a Kd in the micromolar range. Here we present the three-dimensional solution structure of a 36-nucleotide ATP-binding RNA aptamer complexed with AMP, determined from NMR-derived distance and dihedral angle restraints. The conserved loop and bulged G form a novel compact, folded structure around the AMP. The backbone tracing of the loop nucleotides can be described by a Greek zeta (zeta). Consecutive loop nucleotides G, A, A form a U-turn at the bottom of the zeta, and interact with the AMP to form a structure similar to a GNRA tetraloop, with AMP standing in for the final A. Two asymmetric G. G base pairs close the stems flanking the internal loop. Mutated aptamers support the existence of the tertiary interactions within the consensus nucleotides and with the AMP found in the calculated structures. PMID:8756406
Palumbo, Michael J; Newberg, Lee A
2010-07-01
The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).
Evidence for Conformationa1 Heterogeneity of Fission Protein Fis1 from Saccharomyces cerevisiae†
Picton, Lora K.; Casares, Salvador; Monahan, Ann C.; Majumdar, Ananya; Hill, R. Blake
2009-01-01
Fission 1 (Fis1) is an evolutionarily conserved, type II integral membrane protein implicated in maintaining the proper morphology of mitochondria and peroxisomes. A concave surface on the cytosolic domain of Fis1 from Saccharomyces cerevisiae is implicated in binding other fission proteins, yet structural studies reveal that this surface is sterically occluded by its N-terminal arm. Here we address the question of whether the N-terminal arm of yeast Fis1 exists in a dynamic equilibrium that would allow access to this functionally important surface. NMR measurements sensitive to dynamics occurring on a wide range of time scales (picoseconds to minutes) were used to assess whether the Fis1 arm is dynamic. Hydrogen–deuterium exchange experiments revealed that the Fis1 arm, α-helix 6, and proximal loops were not protected from solvent exchange, consistent with motions on the second to minute time scale. An engineered cysteine, I85C, located on the concave surface that lies underneath the Fis1 arm, was readily modified by a fluorescent probe, revealing more solvent accessibility of this position than would be predicted from the structure. Chemical denaturation, NMR chemical shift perturbation, and residual dipolar coupling experiments support the idea that the dynamic equilibrium can be shifted on the basis of changing pH and temperature, with the changes primarily localizing to the Fis1 arm and proximal regions. The data as a whole are consistent with the Fis1 arm adopting a primarily “closed” conformational state able to undergo dynamic excursions that reveal the concave surface and therefore may be important for binding other fission factors and for Fis1 function. PMID:19522466
Kern, Valerie J.; Kern, Justin W.; Theriot, Julie A.; Schneewind, Olaf
2012-01-01
The Gram-positive pathogen Bacillus anthracis contains 24 genes whose products harbor the structurally conserved surface-layer (S-layer) homology (SLH) domain. Proteins endowed with the SLH domain associate with the secondary cell wall polysaccharide (SCWP) following secretion. Two such proteins, Sap and EA1, have the unique ability to self-assemble into a paracrystalline layer on the surface of bacilli and form S layers. Other SLH domain proteins can also be found within the S layer and have been designated Bacillus S-layer-associated protein (BSLs). While both S-layer proteins and BSLs bind the same SCWP, their deposition on the cell surface is not random. For example, BslO is targeted to septal peptidoglycan zones, where it catalyzes the separation of daughter cells. Here we show that an insertional lesion in the sap structural gene results in elongated chains of bacilli, as observed with a bslO mutant. The chain length of the sap mutant can be reduced by the addition of purified BslO in the culture medium. This complementation in trans can be explained by an increased deposition of BslO onto the surface of sap mutant bacilli that extends beyond chain septa. Using fluorescence microscopy, we observed that the Sap S layer does not overlap the EA1 S layer and slowly yields to the EA1 S layer in a growth-phase-dependent manner. Although present all over bacilli, Sap S-layer patches are not observed at septa. Thus, we propose that the dynamic Sap/EA1 S-layer coverage of the envelope restricts the deposition of BslO to the SCWP at septal rings. PMID:22609927
Conserved Regulation of MAP Kinase Expression by PUF RNA-Binding Proteins
Lee, Myon-Hee; Hook, Brad; Pan, Guangjin; Kershner, Aaron M; Merritt, Christopher; Seydoux, Geraldine; Thomson, James A; Wickens, Marvin; Kimble, Judith
2007-01-01
Mitogen-activated protein kinase (MAPK) and PUF (for Pumilio and FBF [fem-3 binding factor]) RNA-binding proteins control many cellular processes critical for animal development and tissue homeostasis. In the present work, we report that PUF proteins act directly on MAPK/ERK-encoding mRNAs to downregulate their expression in both the Caenorhabditis elegans germline and human embryonic stem cells. In C. elegans, FBF/PUF binds regulatory elements in the mpk-1 3′ untranslated region (3′ UTR) and coprecipitates with mpk-1 mRNA; moreover, mpk-1 expression increases dramatically in FBF mutants. In human embryonic stem cells, PUM2/PUF binds 3′UTR elements in both Erk2 and p38α mRNAs, and PUM2 represses reporter constructs carrying either Erk2 or p38α 3′ UTRs. Therefore, the PUF control of MAPK expression is conserved. Its biological function was explored in nematodes, where FBF promotes the self-renewal of germline stem cells, and MPK-1 promotes oocyte maturation and germ cell apoptosis. We found that FBF acts redundantly with LIP-1, the C. elegans homolog of MAPK phosphatase (MKP), to restrict MAPK activity and prevent apoptosis. In mammals, activated MAPK can promote apoptosis of cancer cells and restrict stem cell self-renewal, and MKP is upregulated in cancer cells. We propose that the dual negative regulation of MAPK by both PUF repression and MKP inhibition may be a conserved mechanism that influences both stem cell maintenance and tumor progression. PMID:18166083
Moreno, Andrew; Froehlig, John R; Bachas, Sharrol; Gunio, Drew; Alexander, Teressa; Vanya, Aaron; Wade, Herschel
2016-08-30
Multidrug resistance (MDR) refers to the acquired ability of cells to tolerate a broad range of toxic compounds. One mechanism cells employ is to increase the level of expression of efflux pumps for the expulsion of xenobiotics. A key feature uniting efflux-related mechanisms is multidrug (MD) recognition, either by efflux pumps themselves or by their transcriptional regulators. However, models describing MD binding by MDR effectors are incomplete, underscoring the importance of studies focused on the recognition elements and key motifs that dictate polyspecific binding. One such motif is the GyrI-like domain, which is found in several MDR proteins and is postulated to have been adapted for small-molecule binding and signaling. Here we report the solution binding properties and crystal structures of two proteins containing GyrI-like domains, SAV2435 and CTR107, bound to various ligands. Furthermore, we provide a comparison with deposited crystal structures of GyrI-like proteins, revealing key features of GyrI-like domains that not only support polyspecific binding but also are conserved among GyrI-like domains. Together, our studies suggest that GyrI-like domains perform evolutionarily conserved functions connected to multidrug binding and highlight the utility of these types of studies for elucidating mechanisms of MDR.
Jia, Min; Li, Jianchao; Zhu, Jinwei; Wen, Wenyu; Zhang, Mingjie; Wang, Wenning
2012-01-01
GoLoco (GL) motif-containing proteins regulate G protein signaling by binding to Gα subunit and acting as guanine nucleotide dissociation inhibitors. GLs of LGN are also known to bind the GDP form of Gαi/o during asymmetric cell division. Here, we show that the C-terminal GL domain of LGN binds four molecules of Gαi·GDP. The crystal structures of Gαi·GDP in complex with LGN GL3 and GL4, respectively, reveal distinct GL/Gαi interaction features when compared with the only high resolution structure known with GL/Gαi interaction between RGS14 and Gαi1. Only a few residues C-terminal to the conserved GL sequence are required for LGN GLs to bind to Gαi·GDP. A highly conserved “double Arg finger” sequence (RΨ(D/E)(D/E)QR) is responsible for LGN GL to bind to GDP bound to Gαi. Together with the sequence alignment, we suggest that the LGN GL/Gαi interaction represents a general binding mode between GL motifs and Gαi. We also show that LGN GLs are potent guanine nucleotide dissociation inhibitors. PMID:22952234
Methylated glycans as conserved targets of animal and fungal innate defense
Wohlschlager, Therese; Butschi, Alex; Grassi, Paola; Sutov, Grigorij; Gauss, Robert; Hauck, Dirk; Schmieder, Stefanie S.; Knobel, Martin; Titz, Alexander; Dell, Anne; Haslam, Stuart M.; Hengartner, Michael O.; Aebi, Markus; Künzler, Markus
2014-01-01
Effector proteins of innate immune systems recognize specific non-self epitopes. Tectonins are a family of β-propeller lectins conserved from bacteria to mammals that have been shown to bind bacterial lipopolysaccharide (LPS). We present experimental evidence that two Tectonins of fungal and animal origin have a specificity for O-methylated glycans. We show that Tectonin 2 of the mushroom Laccaria bicolor (Lb-Tec2) agglutinates Gram-negative bacteria and exerts toxicity toward the model nematode Caenorhabditis elegans, suggesting a role in fungal defense against bacteria and nematodes. Biochemical and genetic analysis of these interactions revealed that both bacterial agglutination and nematotoxicity of Lb-Tec2 depend on the recognition of methylated glycans, namely O-methylated mannose and fucose residues, as part of bacterial LPS and nematode cell-surface glycans. In addition, a C. elegans gene, termed samt-1, coding for a candidate membrane transport protein for the presumptive donor substrate of glycan methylation, S-adenosyl-methionine, from the cytoplasm to the Golgi was identified. Intriguingly, limulus lectin L6, a structurally related antibacterial protein of the Japanese horseshoe crab Tachypleus tridentatus, showed properties identical to the mushroom lectin. These results suggest that O-methylated glycans constitute a conserved target of the fungal and animal innate immune system. The broad phylogenetic distribution of O-methylated glycans increases the spectrum of potential antagonists recognized by Tectonins, rendering this conserved protein family a universal defense armor. PMID:24879441
Mechanistic insights into phosphoprotein-binding FHA domains.
Liang, Xiangyang; Van Doren, Steven R
2008-08-01
[Structure: see text]. FHA domains are protein modules that switch signals in diverse biological pathways by monitoring the phosphorylation of threonine residues of target proteins. As part of the effort to gain insight into cellular avoidance of cancer, FHA domains involved in the cellular response to DNA damage have been especially well-characterized. The complete protein where the FHA domain resides and the interaction partners determine the nature of the signaling. Thus, a key biochemical question is how do FHA domains pick out their partners from among thousands of alternatives in the cell? This Account discusses the structure, affinity, and specificity of FHA domains and the formation of their functional structure. Although FHA domains share sequence identity at only five loop residues, they all fold into a beta-sandwich of two beta-sheets. The conserved arginine and serine of the recognition loops recognize the phosphorylation of the threonine targeted. Side chains emanating from loops that join beta-strand 4 with 5, 6 with 7, or 10 with 11 make specific contacts with amino acids of the ligand that tailor sequence preferences. Many FHA domains choose a partner in extended conformation, somewhat according to the residue three after the phosphothreonine in sequence (pT + 3 position). One group of FHA domains chooses a short carboxylate-containing side chain at pT + 3. Another group chooses a long, branched aliphatic side chain. A third group prefers other hydrophobic or uncharged polar side chains at pT + 3. However, another FHA domain instead chooses on the basis of pT - 2, pT - 3, and pT + 1 positions. An FHA domain from a marker of human cancer instead chooses a much longer protein fragment that adds a beta-strand to its beta-sheet and that presents hydrophobic residues from a novel helix to the usual recognition surface. This novel recognition site and more remote sites for the binding of other types of protein partners were predicted for the entire family of FHA domains by a bioinformatics approach. The phosphopeptide-dependent dynamics of an FHA domain, SH2 domain, and PTB domain suggest a common theme: rigid, preformed binding surfaces support van der Waals contacts that provide favorable binding enthalpy. Despite the lack of pronounced conformational changes in FHA domains linked to binding events, more subtle adjustments may be possible. In the one FHA domain tested, phosphothreonine peptide binding is accompanied by increased flexibility just outside the binding site and increased rigidity across the beta-sandwich. The folding of the same FHA domain progresses through near-native intermediates that stabilize the recognition loops in the center of the phosphoprotein-binding surface; this may promote rigidity in the interface and affinity for targets phosphorylated on threonine.
Rosental, Noa; Gameiro, Armanda; Grewer, Christof; Kanner, Baruch I.
2011-01-01
In the brain, transporters of the major excitatory neurotransmitter glutamate remove their substrate from the synaptic cleft to allow optimal glutamatergic neurotransmission. Their transport cycle consists of two sequential translocation steps, namely cotransport of glutamic acid with three Na+ ions, followed by countertransport of K+. Recent studies, based on several crystal structures of the archeal homologue GltPh, indicate that glutamate translocation occurs by an elevator-like mechanism. The resolution of these structures was not sufficiently high to unambiguously identify the sites of Na+ binding, but functional and computational studies suggest some candidate sites. In the GltPh structure, a conserved aspartate residue (Asp-390) is located adjacent to a conserved tyrosine residue, previously shown to be a molecular determinant of ion selectivity in the brain glutamate transporter GLT-1. In this study, we characterize mutants of Asp-440 of the neuronal transporter EAAC1, which is the counterpart of Asp-390 of GltPh. Except for substitution by glutamate, this residue is functionally irreplaceable. Using biochemical and electrophysiological approaches, we conclude that although D440E is intrinsically capable of net flux, this mutant behaves as an exchanger under physiological conditions, due to increased and decreased apparent affinities for Na+ and K+, respectively. Our present and previous data are compatible with the idea that the conserved tyrosine and aspartate residues, located at the external end of the binding pocket, may serve as a transient or stable cation binding site in the glutamate transporters. PMID:21984827
Rosental, Noa; Gameiro, Armanda; Grewer, Christof; Kanner, Baruch I
2011-12-02
In the brain, transporters of the major excitatory neurotransmitter glutamate remove their substrate from the synaptic cleft to allow optimal glutamatergic neurotransmission. Their transport cycle consists of two sequential translocation steps, namely cotransport of glutamic acid with three Na(+) ions, followed by countertransport of K(+). Recent studies, based on several crystal structures of the archeal homologue Glt(Ph), indicate that glutamate translocation occurs by an elevator-like mechanism. The resolution of these structures was not sufficiently high to unambiguously identify the sites of Na(+) binding, but functional and computational studies suggest some candidate sites. In the Glt(Ph) structure, a conserved aspartate residue (Asp-390) is located adjacent to a conserved tyrosine residue, previously shown to be a molecular determinant of ion selectivity in the brain glutamate transporter GLT-1. In this study, we characterize mutants of Asp-440 of the neuronal transporter EAAC1, which is the counterpart of Asp-390 of Glt(Ph). Except for substitution by glutamate, this residue is functionally irreplaceable. Using biochemical and electrophysiological approaches, we conclude that although D440E is intrinsically capable of net flux, this mutant behaves as an exchanger under physiological conditions, due to increased and decreased apparent affinities for Na(+) and K(+), respectively. Our present and previous data are compatible with the idea that the conserved tyrosine and aspartate residues, located at the external end of the binding pocket, may serve as a transient or stable cation binding site in the glutamate transporters.