Fine-tuning structural RNA alignments in the twilight zone.
Bremges, Andreas; Schirmer, Stefanie; Giegerich, Robert
2010-04-30
A widely used method to find conserved secondary structure in RNA is to first construct a multiple sequence alignment, and then fold the alignment, optimizing a score based on thermodynamics and covariance. This method works best around 75% sequence similarity. However, in a "twilight zone" below 55% similarity, the sequence alignment tends to obscure the covariance signal used in the second phase. Therefore, while the overall shape of the consensus structure may still be found, the degree of conservation cannot be estimated reliably. Based on a combination of available methods, we present a method named planACstar for improving structure conservation in structural alignments in the twilight zone. After constructing a consensus structure by alignment folding, planACstar abandons the original sequence alignment, refolds the sequences individually, but consistent with the consensus, aligns the structures, irrespective of sequence, by a pure structure alignment method, and derives an improved sequence alignment from the alignment of structures, to be re-submitted to alignment folding, etc.. This circle may be iterated as long as structural conservation improves, but normally, one step suffices. Employing the tools ClustalW, RNAalifold, and RNAforester, we find that for sequences with 30-55% sequence identity, structural conservation can be improved by 10% on average, with a large variation, measured in terms of RNAalifold's own criterion, the structure conservation index.
Palzkill, T G; Oliver, S G; Newlon, C S
1986-01-01
Four fragments of Saccharomyces cerevisiae chromosome III DNA which carry ARS elements have been sequenced. Each fragment contains multiple copies of sequences that have at least 10 out of 11 bases of homology to a previously reported 11 bp core consensus sequence. A survey of these new ARS sequences and previously reported sequences revealed the presence of an additional 11 bp conserved element located on the 3' side of the T-rich strand of the core consensus. Subcloning analysis as well as deletion and transposon insertion mutagenesis of ARS fragments support a role for 3' conserved sequence in promoting ARS activity. PMID:3529036
Fine-tuning structural RNA alignments in the twilight zone
2010-01-01
Background A widely used method to find conserved secondary structure in RNA is to first construct a multiple sequence alignment, and then fold the alignment, optimizing a score based on thermodynamics and covariance. This method works best around 75% sequence similarity. However, in a "twilight zone" below 55% similarity, the sequence alignment tends to obscure the covariance signal used in the second phase. Therefore, while the overall shape of the consensus structure may still be found, the degree of conservation cannot be estimated reliably. Results Based on a combination of available methods, we present a method named planACstar for improving structure conservation in structural alignments in the twilight zone. After constructing a consensus structure by alignment folding, planACstar abandons the original sequence alignment, refolds the sequences individually, but consistent with the consensus, aligns the structures, irrespective of sequence, by a pure structure alignment method, and derives an improved sequence alignment from the alignment of structures, to be re-submitted to alignment folding, etc.. This circle may be iterated as long as structural conservation improves, but normally, one step suffices. Conclusions Employing the tools ClustalW, RNAalifold, and RNAforester, we find that for sequences with 30-55% sequence identity, structural conservation can be improved by 10% on average, with a large variation, measured in terms of RNAalifold's own criterion, the structure conservation index. PMID:20433706
Plucienniczak, A; Schroeder, E; Zettlmeissl, G; Streeck, R E
1985-01-01
The nucleotide sequence of a 7.6 kb vaccinia DNA segment from a genomic region conserved among different orthopox virus has been determined. This segment contains a tight cluster of 12 partly overlapping open reading frames most of which can be correlated with previously identified early and late proteins and mRNAs. Regulatory signals used by vaccinia virus have been studied. Presumptive promoter regions are rich in A, T and carry the consensus sequences TATA and AATAA spaced at 20-24 base pairs. Tandem repeats of a CTATTC consensus sequence are proposed to be involved in the termination of early transcription. PMID:2987815
A conserved mechanism for replication origin recognition and binding in archaea.
Majerník, Alan I; Chong, James P J
2008-01-15
To date, methanogens are the only group within the archaea where firing DNA replication origins have not been demonstrated in vivo. In the present study we show that a previously identified cluster of ORB (origin recognition box) sequences do indeed function as an origin of replication in vivo in the archaeon Methanothermobacter thermautotrophicus. Although the consensus sequence of ORBs in M. thermautotrophicus is somewhat conserved when compared with ORB sequences in other archaea, the Cdc6-1 protein from M. thermautotrophicus (termed MthCdc6-1) displays sequence-specific binding that is selective for the MthORB sequence and does not recognize ORBs from other archaeal species. Stabilization of in vitro MthORB DNA binding by MthCdc6-1 requires additional conserved sequences 3' to those originally described for M. thermautotrophicus. By testing synthetic sequences bearing mutations in the MthORB consensus sequence, we show that Cdc6/ORB binding is critically dependent on the presence of an invariant guanine found in all archaeal ORB sequences. Mutation of a universally conserved arginine residue in the recognition helix of the winged helix domain of archaeal Cdc6-1 shows that specific origin sequence recognition is dependent on the interaction of this arginine residue with the invariant guanine. Recognition of a mutated origin sequence can be achieved by mutation of the conserved arginine residue to a lysine or glutamine residue. Thus despite a number of differences in protein and DNA sequences between species, the mechanism of origin recognition and binding appears to be conserved throughout the archaea.
Embedding strategies for effective use of information from multiple sequence alignments.
Henikoff, S.; Henikoff, J. G.
1997-01-01
We describe a new strategy for utilizing multiple sequence alignment information to detect distant relationships in searches of sequence databases. A single sequence representing a protein family is enriched by replacing conserved regions with position-specific scoring matrices (PSSMs) or consensus residues derived from multiple alignments of family members. In comprehensive tests of these and other family representations, PSSM-embedded queries produced the best results overall when used with a special version of the Smith-Waterman searching algorithm. Moreover, embedding consensus residues instead of PSSMs improved performance with readily available single sequence query searching programs, such as BLAST and FASTA. Embedding PSSMs or consensus residues into a representative sequence improves searching performance by extracting multiple alignment information from motif regions while retaining single sequence information where alignment is uncertain. PMID:9070452
CODEHOP (COnsensus-DEgenerate Hybrid Oligonucleotide Primer) PCR primer design
Rose, Timothy M.; Henikoff, Jorja G.; Henikoff, Steven
2003-01-01
We have developed a new primer design strategy for PCR amplification of distantly related gene sequences based on consensus-degenerate hybrid oligonucleotide primers (CODEHOPs). An interactive program has been written to design CODEHOP PCR primers from conserved blocks of amino acids within multiply-aligned protein sequences. Each CODEHOP consists of a pool of related primers containing all possible nucleotide sequences encoding 3–4 highly conserved amino acids within a 3′ degenerate core. A longer 5′ non-degenerate clamp region contains the most probable nucleotide predicted for each flanking codon. CODEHOPs are used in PCR amplification to isolate distantly related sequences encoding the conserved amino acid sequence. The primer design software and the CODEHOP PCR strategy have been utilized for the identification and characterization of new gene orthologs and paralogs in different plant, animal and bacterial species. In addition, this approach has been successful in identifying new pathogen species. The CODEHOP designer (http://blocks.fhcrc.org/codehop.html) is linked to BlockMaker and the Multiple Alignment Processor within the Blocks Database World Wide Web (http://blocks.fhcrc.org). PMID:12824413
2014-01-01
Background Ambiscript is a graphically-designed nucleic acid notation that uses symbol symmetries to support sequence complementation, highlight biologically-relevant palindromes, and facilitate the analysis of consensus sequences. Although the original Ambiscript notation was designed to easily represent consensus sequences for multiple sequence alignments, the notation’s black-on-white ambiguity characters are unable to reflect the statistical distribution of nucleotides found at each position. We now propose a color-augmented ambigraphic notation to encode the frequency of positional polymorphisms in these consensus sequences. Results We have implemented this color-coding approach by creating an Adobe Flash® application ( http://www.ambiscript.org) that shades and colors modified Ambiscript characters according to the prevalence of the encoded nucleotide at each position in the alignment. The resulting graphic helps viewers perceive biologically-relevant patterns in multiple sequence alignments by uniquely combining color, shading, and character symmetries to highlight palindromes and inverted repeats in conserved DNA motifs. Conclusion Juxtaposing an intuitive color scheme over the deliberate character symmetries of an ambigraphic nucleic acid notation yields a highly-functional nucleic acid notation that maximizes information content and successfully embodies key principles of graphic excellence put forth by the statistician and graphic design theorist, Edward Tufte. PMID:24447494
NASA Astrophysics Data System (ADS)
Prasetyo, Afiono Agung; Dharmawan, Ruben; Sari, Yulia; Sariyatun, Ratna
2017-02-01
Human immunodeficiency virus type 1 (HIV-1) remains a cause of global health problem. Continuous studies of HIV-1 genetic and immunological profiles are important to find strategies against the virus. This study aimed to conduct analysis of sequence conservation, HLA-E-restricted peptide, and best-defined CTL/CD8+ epitopes in p24 (capsid) of HIV-1 subtype B worldwide. The p24-coding sequences from 3,557 HIV subtype B isolates were aligned using MUSCLE and analysed. Some highly conserved regions (sequence conservation ≥95%) were observed. Two considerably long series of sequences with conservation of 100% was observed at base 349-356 and 550-557 of p24 (HXB2 numbering). The consensus from all aligned isolates was precisely the same as consensus B in the Los Alamos HIV Database. The HLA-E-restricted peptide in amino acid (aa) 14-22 of HIV-1 p24 (AISPRTLNA) was found in 55.9% (1,987/3,557) of HIV-1 subtype B worldwide. Forty-four best-defined CTL/CD8+ epitopes were observed, in which VKNWMTETL epitope (aa 181-189 of p24) restricted by B*4801 was the most frequent, as found in 94.9% of isolates. The results of this study would contribute information about HIV-1 subtype B and benefits for further works willing to develop diagnostic and therapeutic strategies against the virus.
Rogan, P K; Schneider, T D
1995-01-01
Predicting the effects of nucleotide substitutions in human splice sites has been based on analysis of consensus sequences. We used a graphic representation of sequence conservation and base frequency, the sequence logo, to demonstrate that a change in a splice acceptor of hMSH2 (a gene associated with familial nonpolyposis colon cancer) probably does not reduce splicing efficiency. This confirms a population genetic study that suggested that this substitution is a genetic polymorphism. The information theory-based sequence logo is quantitative and more sensitive than the corresponding splice acceptor consensus sequence for detection of true mutations. Information analysis may potentially be used to distinguish polymorphisms from mutations in other types of transcriptional, translational, or protein-coding motifs.
Provencher, Cathy; LaPointe, Gisèle; Sirois, Stéphane; Van Calsteren, Marie-Rose; Roy, Denis
2003-01-01
A primer design strategy named CODEHOP (consensus-degenerate hybrid oligonucleotide primer) for amplification of distantly related sequences was used to detect the priming glycosyltransferase (GT) gene in strains of the Lactobacillus casei group. Each hybrid primer consisted of a short 3′ degenerate core based on four highly conserved amino acids and a longer 5′ consensus clamp region based on six sequences of the priming GT gene products from exopolysaccharide (EPS)-producing bacteria. The hybrid primers were used to detect the priming GT gene of 44 commercial isolates and reference strains of Lactobacillus rhamnosus, L. casei, Lactobacillus zeae, and Streptococcus thermophilus. The priming GT gene was detected in the genome of both non-EPS-producing (EPS−) and EPS-producing (EPS+) strains of L. rhamnosus. The sequences of the cloned PCR products were similar to those of the priming GT gene of various gram-negative and gram-positive EPS+ bacteria. Specific primers designed from the L. rhamnosus RW-9595M GT gene were used to sequence the end of the priming GT gene in selected EPS+ strains of L. rhamnosus. Phylogenetic analysis revealed that Lactobacillus spp. form a distinctive group apart from other lactic acid bacteria for which GT genes have been characterized to date. Moreover, the sequences show a divergence existing among strains of L. rhamnosus with respect to the terminal region of the priming GT gene. Thus, the PCR approach with consensus-degenerate hybrid primers designed with CODEHOP is a practical approach for the detection of similar genes containing conserved motifs in different bacterial genomes. PMID:12788729
Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L
2013-07-01
The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.
Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.
2013-01-01
The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967
Qu, Wen; Cingolani, Pablo; Zeeberg, Barry R; Ruden, Douglas M
2017-01-01
Deep sequencing of cDNAs made from spliced mRNAs indicates that most coding genes in many animals and plants have pre-mRNA transcripts that are alternatively spliced. In pre-mRNAs, in addition to invariant exons that are present in almost all mature mRNA products, there are at least 6 additional types of exons, such as exons from alternative promoters or with alternative polyA sites, mutually exclusive exons, skipped exons, or exons with alternative 5' or 3' splice sites. Our bioinformatics-based hypothesis is that, in analogy to the genetic code, there is an "alternative-splicing code" in introns and flanking exon sequences, analogous to the genetic code, that directs alternative splicing of many of the 36 types of introns. In humans, we identified 42 different consensus sequences that are each present in at least 100 human introns. 37 of the 42 top consensus sequences are significantly enriched or depleted in at least one of the 36 types of introns. We further supported our hypothesis by showing that 96 out of 96 analyzed human disease mutations that affect RNA splicing, and change alternative splicing from one class to another, can be partially explained by a mutation altering a consensus sequence from one type of intron to that of another type of intron. Some of the alternative splicing consensus sequences, and presumably their small-RNA or protein targets, are evolutionarily conserved from 50 plant to animal species. We also noticed the set of introns within a gene usually share the same splicing codes, thus arguing that one sub-type of splicesosome might process all (or most) of the introns in a given gene. Our work sheds new light on a possible mechanism for generating the tremendous diversity in protein structure by alternative splicing of pre-mRNAs.
Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.
Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C
2018-01-10
Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing cancer cells. Copyright © 2017 Elsevier B.V. All rights reserved.
Bernardes, Juliana; Zaverucha, Gerson; Vaquero, Catherine; Carbone, Alessandra
2016-01-01
Traditional protein annotation methods describe known domains with probabilistic models representing consensus among homologous domain sequences. However, when relevant signals become too weak to be identified by a global consensus, attempts for annotation fail. Here we address the fundamental question of domain identification for highly divergent proteins. By using high performance computing, we demonstrate that the limits of state-of-the-art annotation methods can be bypassed. We design a new strategy based on the observation that many structural and functional protein constraints are not globally conserved through all species but might be locally conserved in separate clades. We propose a novel exploitation of the large amount of data available: 1. for each known protein domain, several probabilistic clade-centered models are constructed from a large and differentiated panel of homologous sequences, 2. a decision-making protocol combines outcomes obtained from multiple models, 3. a multi-criteria optimization algorithm finds the most likely protein architecture. The method is evaluated for domain and architecture prediction over several datasets and statistical testing hypotheses. Its performance is compared against HMMScan and HHblits, two widely used search methods based on sequence-profile and profile-profile comparison. Due to their closeness to actual protein sequences, clade-centered models are shown to be more specific and functionally predictive than the broadly used consensus models. Based on them, we improved annotation of Plasmodium falciparum protein sequences on a scale not previously possible. We successfully predict at least one domain for 72% of P. falciparum proteins against 63% achieved previously, corresponding to 30% of improvement over the total number of Pfam domain predictions on the whole genome. The method is applicable to any genome and opens new avenues to tackle evolutionary questions such as the reconstruction of ancient domain duplications, the reconstruction of the history of protein architectures, and the estimation of protein domain age. Website and software: http://www.lcqb.upmc.fr/CLADE. PMID:27472895
The Malarial Host-Targeting Signal Is Conserved in the Irish Potato Famine Pathogen
Liolios, Konstantinos; Win, Joe; Kanneganti, Thirumala-Devi; Young, Carolyn; Kamoun, Sophien; Haldar, Kasturi
2006-01-01
Animal and plant eukaryotic pathogens, such as the human malaria parasite Plasmodium falciparum and the potato late blight agent Phytophthora infestans, are widely divergent eukaryotic microbes. Yet they both produce secretory virulence and pathogenic proteins that alter host cell functions. In P. falciparum, export of parasite proteins to the host erythrocyte is mediated by leader sequences shown to contain a host-targeting (HT) motif centered on an RxLx (E, D, or Q) core: this motif appears to signify a major pathogenic export pathway with hundreds of putative effectors. Here we show that a secretory protein of P. infestans, which is perceived by plant disease resistance proteins and induces hypersensitive plant cell death, contains a leader sequence that is equivalent to the Plasmodium HT-leader in its ability to export fusion of green fluorescent protein (GFP) from the P. falciparum parasite to the host erythrocyte. This export is dependent on an RxLR sequence conserved in P. infestans leaders, as well as in leaders of all ten secretory oomycete proteins shown to function inside plant cells. The RxLR motif is also detected in hundreds of secretory proteins of P. infestans, Phytophthora sojae, and Phytophthora ramorum and has high value in predicting host-targeted leaders. A consensus motif further reveals E/D residues enriched within ~25 amino acids downstream of the RxLR, which are also needed for export. Together the data suggest that in these plant pathogenic oomycetes, a consensus HT motif may reside in an extended sequence of ~25–30 amino acids, rather than in a short linear sequence. Evidence is presented that although the consensus is much shorter in P. falciparum, information sufficient for vacuolar export is contained in a region of ~30 amino acids, which includes sequences flanking the HT core. Finally, positional conservation between Phytophthora RxLR and P. falciparum RxLx (E, D, Q) is consistent with the idea that the context of their presentation is constrained. These studies provide the first evidence to our knowledge that eukaryotic microbes share equivalent pathogenic HT signals and thus conserved mechanisms to access host cells across plant and animal kingdoms that may present unique targets for prophylaxis across divergent pathogens. PMID:16733545
Bioinformatics prediction of siRNAs as potential antiviral agents against dengue viruses
Villegas-Rosales, Paula M; Méndez-Tenorio, Alfonso; Ortega-Soto, Elizabeth; Barrón, Blanca L
2012-01-01
Dengue virus (DENV 1-4) represents the major emerging arthropod-borne viral infection in the world. Currently, there is neither an available vaccine nor a specific treatment. Hence, there is a need of antiviral drugs for these viral infections; we describe the prediction of short interfering RNA (siRNA) as potential therapeutic agents against the four DENV serotypes. Our strategy was to carry out a series of multiple alignments using ClustalX program to find conserved sequences among the four DENV serotype genomes to obtain a consensus sequence for siRNAs design. A highly conserved sequence among the four DENV serotypes, located in the encoding sequence for NS4B and NS5 proteins was found. A total of 2,893 complete DENV genomes were downloaded from the NCBI, and after a depuration procedure to identify identical sequences, 220 complete DENV genomes were left. They were edited to select the NS4B and NS5 sequences, which were aligned to obtain a consensus sequence. Three different servers were used for siRNA design, and the resulting siRNAs were aligned to identify the most prevalent sequences. Three siRNAs were chosen, one targeted the genome region that codifies for NS4B protein and the other two; the region for NS5 protein. Predicted secondary structure for DENV genomes was used to demonstrate that the siRNAs were able to target the viral genome forming double stranded structures, necessary to activate the RNA silencing machinery. PMID:22829722
Brylinski, Michal; Konieczny, Leszek; Kononowicz, Andrzej; Roterman, Irena
2008-03-21
The well-known procedure implemented in ClustalW oriented on the sequence comparison was applied to structure comparison. The consensus sequence as well as consensus structure has been defined for proteins belonging to serpine family. The structure of early stage intermediate was the object for similarity search. The high values of W(sequence) appeared to be accordant with high values of W(structure) making possible structure comparison using common criteria for sequence and structure comparison. Since the early stage structural form has been created according to limited conformational sub-space which does not include the beta-structure (this structure is mediated by C7eq structural form), is particularly important to see, that the C7eq structural form may be treated as the seed for beta-structure present in the final native structure of protein. The applicability of ClustalW procedure to structure comparison makes these two comparisons unified.
Chutiwitoonchai, Nopporn; Kakisaka, Michinori; Yamada, Kazunori; Aida, Yoko
2014-01-01
The assembly of influenza virus progeny virions requires machinery that exports viral genomic ribonucleoproteins from the cell nucleus. Currently, seven nuclear export signal (NES) consensus sequences have been identified in different viral proteins, including NS1, NS2, M1, and NP. The present study examined the roles of viral NES consensus sequences and their significance in terms of viral replication and nuclear export. Mutation of the NP-NES3 consensus sequence resulted in a failure to rescue viruses using a reverse genetics approach, whereas mutation of the NS2-NES1 and NS2-NES2 sequences led to a strong reduction in viral replication kinetics compared with the wild-type sequence. While the viral replication kinetics for other NES mutant viruses were also lower than those of the wild-type, the difference was not so marked. Immunofluorescence analysis after transient expression of NP-NES3, NS2-NES1, or NS2-NES2 proteins in host cells showed that they accumulated in the cell nucleus. These results suggest that the NP-NES3 consensus sequence is mostly required for viral replication. Therefore, each of the hydrophobic (Φ) residues within this NES consensus sequence (Φ1, Φ2, Φ3, or Φ4) was mutated, and its viral replication and nuclear export function were analyzed. No viruses harboring NP-NES3 Φ2 or Φ3 mutants could be rescued. Consistent with this, the NP-NES3 Φ2 and Φ3 mutants showed reduced binding affinity with CRM1 in a pull-down assay, and both accumulated in the cell nucleus. Indeed, a nuclear export assay revealed that these mutant proteins showed lower nuclear export activity than the wild-type protein. Moreover, the Φ2 and Φ3 residues (along with other Φ residues) within the NP-NES3 consensus were highly conserved among different influenza A viruses, including human, avian, and swine. Taken together, these results suggest that the Φ2 and Φ3 residues within the NP-NES3 protein are important for its nuclear export function during viral replication.
Gerencsér, Ákos; Barta, Endre; Boa, Simon; Kastanis, Petros; Bösze, Zsuzsanna; Whitelaw, C Bruce A
2002-01-01
κ-casein plays an essential role in the formation, stabilisation and aggregation of milk micelles. Control of κ-casein expression reflects this essential role, although an understanding of the mechanisms involved lags behind that of the other milk protein genes. We determined the 5'-flanking sequences for the murine, rabbit and human κ-casein genes and compared them to the published ruminant sequences. The most conserved region was not the proximal promoter region but an approximately 400 bp long region centred 800 bp upstream of the TATA box. This region contained two highly conserved MGF/STAT5 sites with common spacing relative to each other. In this region, six conserved short stretches of similarity were also found which did not correspond to known transcription factor consensus sites. On the contrary to ruminant and human 5' regulatory sequences, the rabbit and murine 5'-flanking regions did not harbour any kind of repetitive elements. We generated a phylogenetic tree of the six species based on multiple alignment of the κ-casein sequences. This study identified conserved candidate transcriptional regulatory elements within the κ-casein gene promoter. PMID:11929628
Casillas, Rosario; Tabernero, David; Gregori, Josep; Belmonte, Irene; Cortese, Maria Francesca; González, Carolina; Riveiro-Barciela, Mar; López, Rosa Maria; Quer, Josep; Esteban, Rafael; Buti, Maria; Rodríguez-Frías, Francisco
2018-01-01
AIM To determine the variability/conservation of the domain of hepatitis B virus (HBV) preS1 region that interacts with sodium-taurocholate cotransporting polypeptide (hereafter, NTCP-interacting domain) and the prevalence of the rs2296651 polymorphism (S267F, NTCP variant) in a Spanish population. METHODS Serum samples from 246 individuals were included and divided into 3 groups: patients with chronic HBV infection (CHB) (n = 41, 73% Caucasians), patients with resolved HBV infection (n = 100, 100% Caucasians) and an HBV-uninfected control group (n = 105, 100% Caucasians). Variability/conservation of the amino acid (aa) sequences of the NTCP-interacting domain, (aa 2-48 in viral genotype D) and a highly conserved preS1 domain associated with virion morphogenesis (aa 92-103 in viral genotype D) were analyzed by next-generation sequencing and compared in 18 CHB patients with viremia > 4 log IU/mL. The rs2296651 polymorphism was determined in all individuals in all 3 groups using an in-house real-time PCR melting curve analysis. RESULTS The HBV preS1 NTCP-interacting domain showed a high degree of conservation among the examined viral genomes especially between aa 9 and 21 (in the genotype D consensus sequence). As compared with the virion morphogenesis domain, the NTCP-interacting domain had a smaller proportion of HBV genotype-unrelated changes comprising > 1% of the quasispecies (25.5% vs 31.8%), but a larger proportion of genotype-associated viral polymorphisms (34% vs 27.3%), according to consensus sequences from GenBank patterns of HBV genotypes A to H. Variation/conservation in both domains depended on viral genotype, with genotype C being the most highly conserved and genotype E the most variable (limited finding, only 2 genotype E included). Of note, proline residues were highly conserved in both domains, and serine residues showed changes only to threonine or tyrosine in the virion morphogenesis domain. The rs2296651 polymorphism was not detected in any participant. CONCLUSION In our CHB population, the NTCP-interacting domain was highly conserved, particularly the proline residues and essential amino acids related with the NTCP interaction, and the prevalence of rs2296651 was low/null. PMID:29456407
Freimuth, P; Anderson, C W
1993-03-01
The sequence of a 1158-base pair fragment of the human adenovirus serotype 12 (Ad12) genome was determined. This segment encodes the precursors for virion components Mu and VI. Both Ad12 precursors contain two sequences that conform to a consensus sequence motif for cleavage by the endoproteinase of adenovirus 2 (Ad2). Analysis of the amino terminus of VI and of the peptide fragments found in Ad12 virions demonstrated that these sites are cleaved during Ad12 maturation. This observation suggests that the recognition motif for adenovirus endoproteinases is highly conserved among human serotypes. The adenovirus 2 endoproteinase polypeptide requires additional co-factors for activity (C. W. Anderson, Protein Expression Purif., 1993, 4, 8-15). Synthetic Ad12 or Ad2 pVI carboxy-terminal peptides each permitted efficient cleavage of an artificial endoproteinase substrate by recombinant Ad2 endoproteinase polypeptide.
Zhu, X; Naz, R K
1999-03-01
The deduced ZP3 amino acid (aa) sequences of 13 vertebrate species namely mouse, hamster, rabbit, pig, porcine, cow, dog, cat, human, bonnet, marmoset, carp, and frog were compared using the PILEUP and PRETTY alignment programs (GCG, Wisconsin, USA). The published aa sequences obtained from 13 vertebrate species indicated the overall evolutionarily conservation in the N-terminus, central region, and C-terminus of the ZP3 polypeptide. More variations of ZP3 polypeptide sequences were seen in the alignments of carp and frog from the 11 mammalian species making the leader sequence more prominent. The canonical furin proteolytic processing signal at the C-terminus was found in all the ZP3 polypeptide sequences except of carp and frog. In the central region, the ZP3 deduced aa sequences of all the 13 vertebrate species aligned well, and six relatively conserved sequences were found. There are 11 conserved cysteine residues in the central region across all species including carp and frog, indicating that these residues have longer evolutionary history. The ZP3 aa sequence similarities were examined using the GAP program (GCG). The highest aa similarities are observed between the members of the same order within the class mammalia, and also (95.4%) between pig (ungulata) and rabbit (lagomorpha). The deduced ZP3 aa sequences per se may not be enough to build a phylogenetic tree.
Miyazaki, Saori; Sato, Yutaka; Asano, Tomoya; Nagamura, Yoshiaki; Nonomura, Ken-Ichi
2015-10-01
Post-transcriptional gene regulation by RNA recognition motif (RRM) proteins through binding to cis-elements in the 3'-untranslated region (3'-UTR) is widely used in eukaryotes to complete various biological processes. Rice MEIOSIS ARRESTED AT LEPTOTENE2 (MEL2) is the RRM protein that functions in the transition to meiosis in proper timing. The MEL2 RRM preferentially associated with the U-rich RNA consensus, UUAGUU[U/A][U/G][A/U/G]U, dependently on sequences and proportionally to MEL2 protein amounts in vitro. The consensus sequences were located in the putative looped structures of the RNA ligand. A genome-wide survey revealed a tendency of MEL2-binding consensus appearing in 3'-UTR of rice genes. Of 249 genes that conserved the consensus in their 3'-UTR, 13 genes spatiotemporally co-expressed with MEL2 in meiotic flowers, and included several genes whose function was supposed in meiosis; such as Replication protein A and OsMADS3. The proteome analysis revealed that the amounts of small ubiquitin-related modifier-like protein and eukaryotic translation initiation factor3-like protein were dramatically altered in mel2 mutant anthers. Taken together with transcriptome and gene ontology results, we propose that the rice MEL2 is involved in the translational regulation of key meiotic genes on 3'-UTRs to achieve the faithful transition of germ cells to meiosis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Crooks, Gavin E.
WebLogo is a web based application designed to make the generation of sequence logos as easy and painless as possible. Sequesnce logos are a graphical representation of an amino acid or nucleic acid multiple sequence alignment developed by Tom Schneider and Mike Stephens. Each logo consists of stacks of symbols, one stack for each position in the sequence. The overall height of the stack indicates the sequence conservation at that position, while the height of symbols within the stack indicates the relative frequency of each amino or nucleic acid at that position. In general, a sequence logo provides a richermore » and more precise description of, for example, a binding site, than would a consensus sequence.« less
Lahr, Roni M; Mack, Seshat M; Héroux, Annie; Blagden, Sarah P; Bousquet-Antonelli, Cécile; Deragon, Jean-Marc; Berman, Andrea J
2015-09-18
La-related protein 1 (LARP1) regulates the stability of many mRNAs. These include 5'TOPs, mTOR-kinase responsive mRNAs with pyrimidine-rich 5' UTRs, which encode ribosomal proteins and translation factors. We determined that the highly conserved LARP1-specific C-terminal DM15 region of human LARP1 directly binds a 5'TOP sequence. The crystal structure of this DM15 region refined to 1.86 Å resolution has three structurally related and evolutionarily conserved helix-turn-helix modules within each monomer. These motifs resemble HEAT repeats, ubiquitous helical protein-binding structures, but their sequences are inconsistent with consensus sequences of known HEAT modules, suggesting this structure has been repurposed for RNA interactions. A putative mTORC1-recognition sequence sits within a flexible loop C-terminal to these repeats. We also present modelling of pyrimidine-rich single-stranded RNA onto the highly conserved surface of the DM15 region. These studies lay the foundation necessary for proceeding toward a structural mechanism by which LARP1 links mTOR signalling to ribosome biogenesis. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Lahr, Roni M.; Mack, Seshat M.; Heroux, Annie; ...
2015-07-22
La-related protein 1 (LARP1) regulates the stability of many mRNAs. These include 5'TOPs, mTOR-kinase responsive mRNAs with pyrimidine-rich 5' UTRs, which encode ribosomal proteins and translation factors. We determined that the highly conserved LARP1-specific C-terminal DM15 region of human LARP1 directly binds a 5'TOP sequence. The crystal structure of this DM15 region refined to 1.86 Å resolution has three structurally related and evolutionarily conserved helix-turn-helix modules within each monomer. These motifs resemble HEAT repeats, ubiquitous helical protein-binding structures, but their sequences are inconsistent with consensus sequences of known HEAT modules, suggesting this structure has been repurposed for RNA interactions. Amore » putative mTORC1-recognition sequence sits within a flexible loop C-terminal to these repeats. We also present modelling of pyrimidine-rich single-stranded RNA onto the highly conserved surface of the DM15 region. Ultimately, these studies lay the foundation necessary for proceeding toward a structural mechanism by which LARP1 links mTOR signalling to ribosome biogenesis.« less
Unusual Intron Conservation near Tissue-Regulated Exons Found by Splicing Microarrays
Sugnet, Charles W; Srinivasan, Karpagam; Clark, Tyson A; O'Brien, Georgeann; Cline, Melissa S; Wang, Hui; Williams, Alan; Kulp, David; Blume, John E; Haussler, David; Ares, Manuel
2006-01-01
Alternative splicing contributes to both gene regulation and protein diversity. To discover broad relationships between regulation of alternative splicing and sequence conservation, we applied a systems approach, using oligonucleotide microarrays designed to capture splicing information across the mouse genome. In a set of 22 adult tissues, we observe differential expression of RNA containing at least two alternative splice junctions for about 40% of the 6,216 alternative events we could detect. Statistical comparisons identify 171 cassette exons whose inclusion or skipping is different in brain relative to other tissues and another 28 exons whose splicing is different in muscle. A subset of these exons is associated with unusual blocks of intron sequence whose conservation in vertebrates rivals that of protein-coding exons. By focusing on sets of exons with similar regulatory patterns, we have identified new sequence motifs implicated in brain and muscle splicing regulation. Of note is a motif that is strikingly similar to the branchpoint consensus but is located downstream of the 5′ splice site of exons included in muscle. Analysis of three paralogous membrane-associated guanylate kinase genes reveals that each contains a paralogous tissue-regulated exon with a similar tissue inclusion pattern. While the intron sequences flanking these exons remain highly conserved among mammalian orthologs, the paralogous flanking intron sequences have diverged considerably, suggesting unusually complex evolution of the regulation of alternative splicing in multigene families. PMID:16424921
Simone, Domenico; Bay, Denice C.; Leach, Thorin; Turner, Raymond J.
2013-01-01
Background The twin-arginine translocation (Tat) protein export system enables the transport of fully folded proteins across a membrane. This system is composed of two integral membrane proteins belonging to TatA and TatC protein families and in some systems a third component, TatB, a homolog of TatA. TatC participates in substrate protein recognition through its interaction with a twin arginine leader peptide sequence. Methodology/Principal Findings The aim of this study was to explore TatC diversity, evolution and sequence conservation in bacteria to identify how TatC is evolving and diversifying in various bacterial phyla. Surveying bacterial genomes revealed that 77% of all species possess one or more tatC loci and half of these classes possessed only tatC and tatA genes. Phylogenetic analysis of diverse TatC homologues showed that they were primarily inherited but identified a small subset of taxonomically unrelated bacteria that exhibited evidence supporting lateral gene transfer within an ecological niche. Examination of bacilli tatCd/tatCy isoform operons identified a number of known and potentially new Tat substrate genes based on their frequent association to tatC loci. Evolutionary analysis of these Bacilli isoforms determined that TatCy was the progenitor of TatCd. A bacterial TatC consensus sequence was determined and highlighted conserved and variable regions within a three dimensional model of the Escherichia coli TatC protein. Comparative analysis between the TatC consensus sequence and Bacilli TatCd/y isoform consensus sequences revealed unique sites that may contribute to isoform substrate specificity or make TatA specific contacts. Synonymous to non-synonymous nucleotide substitution analyses of bacterial tatC homologues determined that tatC sequence variation differs dramatically between various classes and suggests TatC specialization in these species. Conclusions/Significance TatC proteins appear to be diversifying within particular bacterial classes and its specialization may be driven by the substrates it transports and the environment of its host. PMID:24236045
Hepatitis delta genotypes in chronic delta infection in the northeast of Spain (Catalonia).
Cotrina, M; Buti, M; Jardi, R; Quer, J; Rodriguez, F; Pascual, C; Esteban, R; Guardia, J
1998-06-01
Based on genetic analysis of variants obtained around the world, three genotypes of the hepatitis delta virus have been defined. Hepatitis delta virus variants have been associated with different disease patterns and geographic distributions. To determine the prevalence of hepatitis delta virus genotypes in the northeast of Spain (Catalonia) and the correlation with transmission routes and clinical disease, we studied the nucleotide divergence of the consensus sequence of HDV RNA obtained from 33 patients with chronic delta hepatitis (24 were intravenous drug users and nine had no risk factors), and four patients with acute self-limited delta infection. Serum HDV RNA was amplified by the polymerase chain reaction technique and a fragment of 350 nucleotides (nt 910 to 1259) was directly sequenced. Genetic analysis of the nucleotide consensus sequence obtained showed a high degree of conservation among sequences (93% of mean). Comparison of these sequences with those derived from different geographic areas and pertaining to genotypes I, II and III, showed a mean sequence identity of 92% with genotype I, 73% with genotype II and 61% with genotype III. At the amino acid level (aa 115 to 214), the mean identity was 87% with genotype I, 63% with genotype II and 56% with genotype III. Conserved regions included the RNA editing domain, the carboxyl terminal 19 amino acids of the hepatitis delta antigen and the polyadenylation signal of the viral mRNA. Hepatitis delta virus isolates in the northeast of Spain are exclusively genotype I, independently of the transmission route and the type of infection. No hepatitis delta virus subgenotypes were found, suggesting that the origin of hepatitis delta virus infection in our geographical area is homogeneous.
Structure, replication efficiency and fragility of yeast ARS elements.
Dhar, Manoj K; Sehgal, Shelly; Kaul, Sanjana
2012-05-01
DNA replication in eukaryotes initiates at specific sites known as origins of replication, or replicators. These replication origins occur throughout the genome, though the propensity of their occurrence depends on the type of organism. In eukaryotes, zones of initiation of replication spanning from about 100 to 50,000 base pairs have been reported. The characteristics of eukaryotic replication origins are best understood in the budding yeast Saccharomyces cerevisiae, where some autonomously replicating sequences, or ARS elements, confer origin activity. ARS elements are short DNA sequences of a few hundred base pairs, identified by their efficiency at initiating a replication event when cloned in a plasmid. ARS elements, although structurally diverse, maintain a basic structure composed of three domains, A, B and C. Domain A is comprised of a consensus sequence designated ACS (ARS consensus sequence), while the B domain has the DNA unwinding element and the C domain is important for DNA-protein interactions. Although there are ∼400 ARS elements in the yeast genome, not all of them are active origins of replication. Different groups within the genus Saccharomyces have ARS elements as components of replication origin. The present paper provides a comprehensive review of various aspects of ARSs, starting from their structural conservation to sequence thermodynamics. All significant and conserved functional sequence motifs within different types of ARS elements have been extensively described. Issues like silencing at ARSs, their inherent fragility and factors governing their replication efficiency have also been addressed. Progress in understanding crucial components associated with the replication machinery and timing at these ARS elements is discussed in the section entitled "The replicon revisited". Copyright © 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
WebLogo: A Sequence Logo Generator
Crooks, Gavin E.; Hon, Gary; Chandonia, John-Marc; Brenner, Steven E.
2004-01-01
WebLogo generates sequence logos, graphical representations of the patterns within a multiple sequence alignment. Sequence logos provide a richer and more precise description of sequence similarity than consensus sequences and can rapidly reveal significant features of the alignment otherwise difficult to perceive. Each logo consists of stacks of letters, one stack for each position in the sequence. The overall height of each stack indicates the sequence conservation at that position (measured in bits), whereas the height of symbols within the stack reflects the relative frequency of the corresponding amino or nucleic acid at that position. WebLogo has been enhanced recently with additional features and options, to provide a convenient and highly configurable sequence logo generator. A command line interface and the complete, open WebLogo source code are available for local installation and customization. PMID:15173120
Stevenson, Clare E. M.; Assaad, Aoun; Chandra, Govind; Le, Tung B. K.; Greive, Sandra J.; Bibb, Mervyn J.; Lawson, David M.
2013-01-01
Consistent with their complex lifestyles and rich secondary metabolite profiles, the genomes of streptomycetes encode a plethora of transcription factors, the vast majority of which are uncharacterized. Herein, we use Surface Plasmon Resonance (SPR) to identify and delineate putative operator sites for SCO3205, a MarR family transcriptional regulator from Streptomyces coelicolor that is well represented in sequenced actinomycete genomes. In particular, we use a novel SPR footprinting approach that exploits indirect ligand capture to vastly extend the lifetime of a standard streptavidin SPR chip. We define two operator sites upstream of sco3205 and a pseudopalindromic consensus sequence derived from these enables further potential operator sites to be identified in the S. coelicolor genome. We evaluate each of these through SPR and test the importance of the conserved bases within the consensus sequence. Informed by these results, we determine the crystal structure of a SCO3205-DNA complex at 2.8 Å resolution, enabling molecular level rationalization of the SPR data. Taken together, our observations support a DNA recognition mechanism involving both direct and indirect sequence readout. PMID:23748564
Li, Jie; Overall, Christopher C.; Johnson, Rudd C.; ...
2015-09-21
The alternative sigma factor σ E functions to maintain bacterial homeostasis and membrane integrity in response to extracytoplasmic stress by regulating thousands of genes both directly and indirectly. The transcriptional regulatory network governed by σ E in Salmonella and E. coli has been examined using microarray, however a genome-wide analysis of σ E–binding sites inSalmonella has not yet been reported. We infected macrophages with Salmonella Typhimurium over a select time course. Using chromatin immunoprecipitation followed by high-throughput DNA sequencing (ChIP-seq), 31 σ E–binding sites were identified. Seventeen sites were new, which included outer membrane proteins, a quorum-sensing protein, a cellmore » division factor, and a signal transduction modulator. The consensus sequence identified for σ E in vivo binding was similar to the one previously reported, except for a conserved G and A between the -35 and -10 regions. One third of the σ E–binding sites did not contain the consensus sequence, suggesting there may be alternative mechanisms by which σ E modulates transcription. By dissecting direct and indirect modes of σ E-mediated regulation, we found that σ E activates gene expression through recognition of both canonical and reversed consensus sequence. Lastly, new σ E regulated genes ( greA, luxS, ompA and ompX) are shown to be involved in heat shock and oxidative stress responses.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Jie; Overall, Christopher C.; Johnson, Rudd C.
The alternative sigma factor σ E functions to maintain bacterial homeostasis and membrane integrity in response to extracytoplasmic stress by regulating thousands of genes both directly and indirectly. The transcriptional regulatory network governed by σ E in Salmonella and E. coli has been examined using microarray, however a genome-wide analysis of σ E–binding sites inSalmonella has not yet been reported. We infected macrophages with Salmonella Typhimurium over a select time course. Using chromatin immunoprecipitation followed by high-throughput DNA sequencing (ChIP-seq), 31 σ E–binding sites were identified. Seventeen sites were new, which included outer membrane proteins, a quorum-sensing protein, a cellmore » division factor, and a signal transduction modulator. The consensus sequence identified for σ E in vivo binding was similar to the one previously reported, except for a conserved G and A between the -35 and -10 regions. One third of the σ E–binding sites did not contain the consensus sequence, suggesting there may be alternative mechanisms by which σ E modulates transcription. By dissecting direct and indirect modes of σ E-mediated regulation, we found that σ E activates gene expression through recognition of both canonical and reversed consensus sequence. Lastly, new σ E regulated genes ( greA, luxS, ompA and ompX) are shown to be involved in heat shock and oxidative stress responses.« less
Duda, Anja; Stange, Annett; Lüftenegger, Daniel; Stanke, Nicole; Westphal, Dana; Pietschmann, Thomas; Eastman, Scott W; Linial, Maxine L; Rethwilm, Axel; Lindemann, Dirk
2004-12-01
Analogous to cellular glycoproteins, viral envelope proteins contain N-terminal signal sequences responsible for targeting them to the secretory pathway. The prototype foamy virus (PFV) envelope (Env) shows a highly unusual biosynthesis. Its precursor protein has a type III membrane topology with both the N and C terminus located in the cytoplasm. Coexpression of FV glycoprotein and interaction of its leader peptide (LP) with the viral capsid is essential for viral particle budding and egress. Processing of PFV Env into the particle-associated LP, surface (SU), and transmembrane (TM) subunits occur posttranslationally during transport to the cell surface by yet-unidentified cellular proteases. Here we provide strong evidence that furin itself or a furin-like protease and not the signal peptidase complex is responsible for both processing events. N-terminal protein sequencing of the SU and TM subunits of purified PFV Env-immunoglobulin G immunoadhesin identified furin consensus sequences upstream of both cleavage sites. Mutagenesis analysis of two overlapping furin consensus sequences at the PFV LP/SU cleavage site in the wild-type protein confirmed the sequencing data and demonstrated utilization of only the first site. Fully processed SU was almost completely absent in viral particles of mutants having conserved arginine residues replaced by alanines in the first furin consensus sequence, but normal processing was observed upon mutation of the second motif. Although these mutants displayed a significant loss in infectivity as a result of reduced particle release, no correlation to processing inhibition was observed, since another mutant having normal LP/SU processing had a similar defect.
Kiryu, Hisanori; Kin, Taishin; Asai, Kiyoshi
2007-02-15
Recent transcriptomic studies have revealed the existence of a considerable number of non-protein-coding RNA transcripts in higher eukaryotic cells. To investigate the functional roles of these transcripts, it is of great interest to find conserved secondary structures from multiple alignments on a genomic scale. Since multiple alignments are often created using alignment programs that neglect the special conservation patterns of RNA secondary structures for computational efficiency, alignment failures can cause potential risks of overlooking conserved stem structures. We investigated the dependence of the accuracy of secondary structure prediction on the quality of alignments. We compared three algorithms that maximize the expected accuracy of secondary structures as well as other frequently used algorithms. We found that one of our algorithms, called McCaskill-MEA, was more robust against alignment failures than others. The McCaskill-MEA method first computes the base pairing probability matrices for all the sequences in the alignment and then obtains the base pairing probability matrix of the alignment by averaging over these matrices. The consensus secondary structure is predicted from this matrix such that the expected accuracy of the prediction is maximized. We show that the McCaskill-MEA method performs better than other methods, particularly when the alignment quality is low and when the alignment consists of many sequences. Our model has a parameter that controls the sensitivity and specificity of predictions. We discussed the uses of that parameter for multi-step screening procedures to search for conserved secondary structures and for assigning confidence values to the predicted base pairs. The C++ source code that implements the McCaskill-MEA algorithm and the test dataset used in this paper are available at http://www.ncrna.org/papers/McCaskillMEA/. Supplementary data are available at Bioinformatics online.
Prokop, Jeremy W.; Santos, Robson A. S.; Milsted, Amy
2013-01-01
The renin-angiotensin system is involved in multiple conditions ranging from cardiovascular disorders to cancer. Components of the pathway, including ACE, renin and angiotensin receptors are targets for disease treatment. This study addresses three receptors of the pathway: AT1, AT2, and MAS and how the receptors are similar and differ in activation by angiotensin peptides. Combining biochemical and amino acid variation data with multiple species sequence alignments, structural models, and docking site predictions allows for visualization of how angiotensin peptides may bind and activate the receptors; allowing identification of conserved and variant mechanisms in the receptors. MAS differs from AT1 favoring Ang-(1–7) and not Ang II binding, while AT2 recently has been suggested to preferentially bind Ang III. A new model of Ang peptide binding to AT1 and AT2 is proposed that correlates data from site directed mutagenesis and photolabled experiments that were previously considered conflicting. Ang II binds AT1 and AT2 through a conserved initial binding mode involving amino acids 111 (consensus 325) of AT1 (Asn) interacting with Tyr (4) of Ang II and 199 and 256 (consensus 512 and 621, a Lys and His respectively) interacting with Phe (8) of Ang II. In MAS these sites are not conserved, leading to differential binding and activation by Ang-(1–7). In both AT1 and AT2, the Ang II peptide may internalize through Phe (8) of Ang II propagating through the receptors’ conserved aromatic amino acids to the final photolabled positioning relative to either AT1 (amino acid 294, Asn, consensus 725) or AT2 (138, Leu, consensus 336). Understanding receptor activation provides valuable information for drug design and identification of other receptors that can potentially bind Ang peptides. PMID:23755216
Almeida, Rafael Ribeiro; Rosa, Daniela Santoro; Ribeiro, Susan Pereira; Santana, Vinicius Canato; Kallás, Esper Georges; Sidney, John; Sette, Alessandro; Kalil, Jorge; Cunha-Neto, Edecio
2012-01-01
T-cell based vaccine approaches have emerged to counteract HIV-1/AIDS. Broad, polyfunctional and cytotoxic CD4+ T-cell responses have been associated with control of HIV-1 replication, which supports the inclusion of CD4+ T-cell epitopes in vaccines. A successful HIV-1 vaccine should also be designed to overcome viral genetic diversity and be able to confer immunity in a high proportion of immunized individuals from a diverse HLA-bearing population. In this study, we rationally designed a multiepitopic DNA vaccine in order to elicit broad and cross-clade CD4+ T-cell responses against highly conserved and promiscuous peptides from the HIV-1 M-group consensus sequence. We identified 27 conserved, multiple HLA-DR-binding peptides in the HIV-1 M-group consensus sequences of Gag, Pol, Nef, Vif, Vpr, Rev and Vpu using the TEPITOPE algorithm. The peptides bound in vitro to an average of 12 out of the 17 tested HLA-DR molecules and also to several molecules such as HLA-DP, -DQ and murine IAb and IAd. Sixteen out of the 27 peptides were recognized by PBMC from patients infected with different HIV-1 variants and 72% of such patients recognized at least 1 peptide. Immunization with a DNA vaccine (HIVBr27) encoding the identified peptides elicited IFN-γ secretion against 11 out of the 27 peptides in BALB/c mice; CD4+ and CD8+ T-cell proliferation was observed against 8 and 6 peptides, respectively. HIVBr27 immunization elicited cross-clade T-cell responses against several HIV-1 peptide variants. Polyfunctional CD4+ and CD8+ T cells, able to simultaneously proliferate and produce IFN-γ and TNF-α, were also observed. This vaccine concept may cope with HIV-1 genetic diversity as well as provide increased population coverage, which are desirable features for an efficacious strategy against HIV-1/AIDS. PMID:23028895
AMS 4.0: consensus prediction of post-translational modifications in protein sequences.
Plewczynski, Dariusz; Basu, Subhadip; Saha, Indrajit
2012-08-01
We present here the 2011 update of the AutoMotif Service (AMS 4.0) that predicts the wide selection of 88 different types of the single amino acid post-translational modifications (PTM) in protein sequences. The selection of experimentally confirmed modifications is acquired from the latest UniProt and Phospho.ELM databases for training. The sequence vicinity of each modified residue is represented using amino acids physico-chemical features encoded using high quality indices (HQI) obtaining by automatic clustering of known indices extracted from AAindex database. For each type of the numerical representation, the method builds the ensemble of Multi-Layer Perceptron (MLP) pattern classifiers, each optimising different objectives during the training (for example the recall, precision or area under the ROC curve (AUC)). The consensus is built using brainstorming technology, which combines multi-objective instances of machine learning algorithm, and the data fusion of different training objects representations, in order to boost the overall prediction accuracy of conserved short sequence motifs. The performance of AMS 4.0 is compared with the accuracy of previous versions, which were constructed using single machine learning methods (artificial neural networks, support vector machine). Our software improves the average AUC score of the earlier version by close to 7 % as calculated on the test datasets of all 88 PTM types. Moreover, for the selected most-difficult sequence motifs types it is able to improve the prediction performance by almost 32 %, when compared with previously used single machine learning methods. Summarising, the brainstorming consensus meta-learning methodology on the average boosts the AUC score up to around 89 %, averaged over all 88 PTM types. Detailed results for single machine learning methods and the consensus methodology are also provided, together with the comparison to previously published methods and state-of-the-art software tools. The source code and precompiled binaries of brainstorming tool are available at http://code.google.com/p/automotifserver/ under Apache 2.0 licensing.
Conservation of CD44 exon v3 functional elements in mammals
Vela, Elena; Hilari, Josep M; Delclaux, María; Fernández-Bellon, Hugo; Isamat, Marcos
2008-01-01
Background The human CD44 gene contains 10 variable exons (v1 to v10) that can be alternatively spliced to generate hundreds of different CD44 protein isoforms. Human CD44 variable exon v3 inclusion in the final mRNA depends on a multisite bipartite splicing enhancer located within the exon itself, which we have recently described, and provides the protein domain responsible for growth factor binding to CD44. Findings We have analyzed the sequence of CD44v3 in 95 mammalian species to report high conservation levels for both its splicing regulatory elements (the 3' splice site and the exonic splicing enhancer), and the functional glycosaminglycan binding site coded by v3. We also report the functional expression of CD44v3 isoforms in peripheral blood cells of different mammalian taxa with both consensus and variant v3 sequences. Conclusion CD44v3 mammalian sequences maintain all functional splicing regulatory elements as well as the GAG binding site with the same relative positions and sequence identity previously described during alternative splicing of human CD44. The sequence within the GAG attachment site, which in turn contains the Y motif of the exonic splicing enhancer, is more conserved relative to the rest of exon. Amplification of CD44v3 sequence from mammalian species but not from birds, fish or reptiles, may lead to classify CD44v3 as an exclusive mammalian gene trait. PMID:18710510
Pasion, S G; Hines, J C; Ou, X; Mahmood, R; Ray, D S
1996-01-01
Gene expression in trypanosomatids appears to be regulated largely at the posttranscriptional level and involves maturation of mRNA precursors by trans splicing of a 39-nucleotide miniexon sequence to the 5' end of the mRNA and cleavage and polyadenylation at the 3' end of the mRNA. To initiate the identification of sequences involved in the periodic expression of DNA replication genes in trypanosomatids, we have mapped splice acceptor sites in the 5' flanking region of the TOP2 gene, which encodes the kinetoplast DNA topoisomerase, and have carried out deletion analysis of this region on a plasmid-encoded TOP2 gene. Block deletions within the 5' untranslated region (UTR) identified two regions (-608 to -388 and -387 to -186) responsible for periodic accumulation of the mRNA. Deletion of one or the other of these sequences had no effect on periodic expression of the mRNA, while deletion of both regions resulted in constitutive expression of the mRNA throughout the cell cycle. Subcloning of these sequences into the 5' UTR of a construct lacking both regions of the TOP2 5' UTR has shown that an octamer consensus sequence present in the 5' UTR of the TOP2, RPA1, and DHFR-TS mRNAs is required for normal cycling of the TOP2 mRNA. Mutation of the consensus octamer sequence in the TOP2 5' UTR in a plasmid construct containing only a single consensus octamer and that shows normal cycling of the plasmid-encoded TOP2 mRNA resulted in substantial reduction of the cycling of the mRNA level. These results imply a negative regulation of TOP2 mRNA during the cell cycle by a mechanism involving redundant elements containing one or more copies of a conserved octamer sequence within the 5' UTR of TOP2 mRNA. PMID:8943327
Pasion, S G; Hines, J C; Ou, X; Mahmood, R; Ray, D S
1996-12-01
Gene expression in trypanosomatids appears to be regulated largely at the posttranscriptional level and involves maturation of mRNA precursors by trans splicing of a 39-nucleotide miniexon sequence to the 5' end of the mRNA and cleavage and polyadenylation at the 3' end of the mRNA. To initiate the identification of sequences involved in the periodic expression of DNA replication genes in trypanosomatids, we have mapped splice acceptor sites in the 5' flanking region of the TOP2 gene, which encodes the kinetoplast DNA topoisomerase, and have carried out deletion analysis of this region on a plasmid-encoded TOP2 gene. Block deletions within the 5' untranslated region (UTR) identified two regions (-608 to -388 and -387 to -186) responsible for periodic accumulation of the mRNA. Deletion of one or the other of these sequences had no effect on periodic expression of the mRNA, while deletion of both regions resulted in constitutive expression of the mRNA throughout the cell cycle. Subcloning of these sequences into the 5' UTR of a construct lacking both regions of the TOP2 5' UTR has shown that an octamer consensus sequence present in the 5' UTR of the TOP2, RPA1, and DHFR-TS mRNAs is required for normal cycling of the TOP2 mRNA. Mutation of the consensus octamer sequence in the TOP2 5' UTR in a plasmid construct containing only a single consensus octamer and that shows normal cycling of the plasmid-encoded TOP2 mRNA resulted in substantial reduction of the cycling of the mRNA level. These results imply a negative regulation of TOP2 mRNA during the cell cycle by a mechanism involving redundant elements containing one or more copies of a conserved octamer sequence within the 5' UTR of TOP2 mRNA.
Watada, Hirotaka; Mirmira, Raghavendra G.; Kalamaras, Julie; German, Michael S.
2000-01-01
The developmentally important homeodomain transcription factors of the NK-2 class contain a highly conserved region, the NK2-specific domain (NK2-SD). The function of this domain, however, remains unknown. The primary structure of the NK2-SD suggests that it might function as an accessory DNA-binding domain or as a protein–protein interaction interface. To assess the possibility that the NK2-SD may contribute to DNA-binding specificity, we used a PCR-based approach to identify a consensus DNA-binding sequences for Nkx2.2, an NK-2 family member involved in pancreas and central nervous system development. The consensus sequence (TCTAAGTGAGCTT) is similar to the known binding sequences for other NK-2 homeodomain proteins, but we show that the NK2-SD does not contribute significantly to specific DNA binding to this sequence. To determine whether the NK2-SD contributes to transactivation, we used GAL4-Nkx2.2 fusion constructs to map a powerful transcriptional activation domain in the C-terminal region beyond the conserved NK2-SD. Interestingly, this C-terminal region functions as a transcriptional activator only in the absence of an intact NK2-SD. The NK2-SD also can mask transactivation from the paired homeodomain transcription factor Pax6, but it has no effect on transcription by itself. These results demonstrate that the NK2-SD functions as an intramolecular regulator of the C-terminal activation domain in Nkx2.2 and support a model in which interactions through the NK2-SD regulate the ability of NK-2-class proteins to activate specific genes during development. PMID:10944215
Background: Ribonuclease III belongs to the family of Mg2+-dependent endonucleases that show specificity for double-stranded RNA (dsRNA). RNase III is conserved in all known bacteria and eukaryotes and has 1–2 copies of a 9-residue consensus sequence, known as the RNase III signature motif. The bacterial RNase III proteins are the simplest, consisting of two domains: an
Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.
Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E
1996-10-03
We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.
2011-01-01
Background Big sagebrush (Artemisia tridentata) is one of the most widely distributed and ecologically important shrub species in western North America. This species serves as a critical habitat and food resource for many animals and invertebrates. Habitat loss due to a combination of disturbances followed by establishment of invasive plant species is a serious threat to big sagebrush ecosystem sustainability. Lack of genomic data has limited our understanding of the evolutionary history and ecological adaptation in this species. Here, we report on the sequencing of expressed sequence tags (ESTs) and detection of single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers in subspecies of big sagebrush. Results cDNA of A. tridentata sspp. tridentata and vaseyana were normalized and sequenced using the 454 GS FLX Titanium pyrosequencing technology. Assembly of the reads resulted in 20,357 contig consensus sequences in ssp. tridentata and 20,250 contigs in ssp. vaseyana. A BLASTx search against the non-redundant (NR) protein database using 29,541 consensus sequences obtained from a combined assembly resulted in 21,436 sequences with significant blast alignments (≤ 1e-15). A total of 20,952 SNPs and 119 polymorphic SSRs were detected between the two subspecies. SNPs were validated through various methods including sequence capture. Validation of SNPs in different individuals uncovered a high level of nucleotide variation in EST sequences. EST sequences of a third, tetraploid subspecies (ssp. wyomingensis) obtained by Illumina sequencing were mapped to the consensus sequences of the combined 454 EST assembly. Approximately one-third of the SNPs between sspp. tridentata and vaseyana identified in the combined assembly were also polymorphic within the two geographically distant ssp. wyomingensis samples. Conclusion We have produced a large EST dataset for Artemisia tridentata, which contains a large sample of the big sagebrush leaf transcriptome. SNP mapping among the three subspecies suggest the origin of ssp. wyomingensis via mixed ancestry. A large number of SNP and SSR markers provide the foundation for future research to address questions in big sagebrush evolution, ecological genetics, and conservation using genomic approaches. PMID:21767398
Bricheux, G; Brugerolle, G
1997-08-01
The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.
2010-01-01
Background Multiple sequence alignments are used to study gene or protein function, phylogenetic relations, genome evolution hypotheses and even gene polymorphisms. Virtually without exception, all available tools focus on conserved segments or residues. Small divergent regions, however, are biologically important for specific quantitative polymerase chain reaction, genotyping, molecular markers and preparation of specific antibodies, and yet have received little attention. As a consequence, they must be selected empirically by the researcher. AlignMiner has been developed to fill this gap in bioinformatic analyses. Results AlignMiner is a Web-based application for detection of conserved and divergent regions in alignments of conserved sequences, focusing particularly on divergence. It accepts alignments (protein or nucleic acid) obtained using any of a variety of algorithms, which does not appear to have a significant impact on the final results. AlignMiner uses different scoring methods for assessing conserved/divergent regions, Entropy being the method that provides the highest number of regions with the greatest length, and Weighted being the most restrictive. Conserved/divergent regions can be generated either with respect to the consensus sequence or to one master sequence. The resulting data are presented in a graphical interface developed in AJAX, which provides remarkable user interaction capabilities. Users do not need to wait until execution is complete and can.even inspect their results on a different computer. Data can be downloaded onto a user disk, in standard formats. In silico and experimental proof-of-concept cases have shown that AlignMiner can be successfully used to designing specific polymerase chain reaction primers as well as potential epitopes for antibodies. Primer design is assisted by a module that deploys several oligonucleotide parameters for designing primers "on the fly". Conclusions AlignMiner can be used to reliably detect divergent regions via several scoring methods that provide different levels of selectivity. Its predictions have been verified by experimental means. Hence, it is expected that its usage will save researchers' time and ensure an objective selection of the best-possible divergent region when closely related sequences are analysed. AlignMiner is freely available at http://www.scbi.uma.es/alignminer. PMID:20525162
Maintaining replication origins in the face of genomic change.
Di Rienzi, Sara C; Lindstrom, Kimberly C; Mann, Tobias; Noble, William S; Raghuraman, M K; Brewer, Bonita J
2012-10-01
Origins of replication present a paradox to evolutionary biologists. As a collection, they are absolutely essential genomic features, but individually are highly redundant and nonessential. It is therefore difficult to predict to what extent and in what regard origins are conserved over evolutionary time. Here, through a comparative genomic analysis of replication origins and chromosomal replication patterns in the budding yeasts Saccharomyces cerevisiae and Lachancea waltii, we assess to what extent replication origins survived genomic change produced from 150 million years of evolution. We find that L. waltii origins exhibit a core consensus sequence and nucleosome occupancy pattern highly similar to those of S. cerevisiae origins. We further observe that the overall progression of chromosomal replication is similar between L. waltii and S. cerevisiae. Nevertheless, few origins show evidence of being conserved in location between the two species. Among the conserved origins are those surrounding centromeres and adjacent to histone genes, suggesting that proximity to an origin may be important for their regulation. We conclude that, over evolutionary time, origins maintain sequence, structure, and regulation, but are continually being created and destroyed, with the result that their locations are generally not conserved.
Maintaining replication origins in the face of genomic change
Di Rienzi, Sara C.; Lindstrom, Kimberly C.; Mann, Tobias; Noble, William S.; Raghuraman, M.K.; Brewer, Bonita J.
2012-01-01
Origins of replication present a paradox to evolutionary biologists. As a collection, they are absolutely essential genomic features, but individually are highly redundant and nonessential. It is therefore difficult to predict to what extent and in what regard origins are conserved over evolutionary time. Here, through a comparative genomic analysis of replication origins and chromosomal replication patterns in the budding yeasts Saccharomyces cerevisiae and Lachancea waltii, we assess to what extent replication origins survived genomic change produced from 150 million years of evolution. We find that L. waltii origins exhibit a core consensus sequence and nucleosome occupancy pattern highly similar to those of S. cerevisiae origins. We further observe that the overall progression of chromosomal replication is similar between L. waltii and S. cerevisiae. Nevertheless, few origins show evidence of being conserved in location between the two species. Among the conserved origins are those surrounding centromeres and adjacent to histone genes, suggesting that proximity to an origin may be important for their regulation. We conclude that, over evolutionary time, origins maintain sequence, structure, and regulation, but are continually being created and destroyed, with the result that their locations are generally not conserved. PMID:22665441
Roca, Alberto I
2014-01-01
The 2013 BioVis Contest provided an opportunity to evaluate different paradigms for visualizing protein multiple sequence alignments. Such data sets are becoming extremely large and thus taxing current visualization paradigms. Sequence Logos represent consensus sequences but have limitations for protein alignments. As an alternative, ProfileGrids are a new protein sequence alignment visualization paradigm that represents an alignment as a color-coded matrix of the residue frequency occurring at every homologous position in the aligned protein family. The JProfileGrid software program was used to analyze the BioVis contest data sets to generate figures for comparison with the Sequence Logo reference images. The ProfileGrid representation allows for the clear and effective analysis of protein multiple sequence alignments. This includes both a general overview of the conservation and diversity sequence patterns as well as the interactive ability to query the details of the protein residue distributions in the alignment. The JProfileGrid software is free and available from http://www.ProfileGrid.org.
Sequence Bundles: a novel method for visualising, discovering and exploring sequence motifs
2014-01-01
Background We introduce Sequence Bundles--a novel data visualisation method for representing multiple sequence alignments (MSAs). We identify and address key limitations of the existing bioinformatics data visualisation methods (i.e. the Sequence Logo) by enabling Sequence Bundles to give salient visual expression to sequence motifs and other data features, which would otherwise remain hidden. Methods For the development of Sequence Bundles we employed research-led information design methodologies. Sequences are encoded as uninterrupted, semi-opaque lines plotted on a 2-dimensional reconfigurable grid. Each line represents a single sequence. The thickness and opacity of the stack at each residue in each position indicates the level of conservation and the lines' curved paths expose patterns in correlation and functionality. Several MSAs can be visualised in a composite image. The Sequence Bundles method is designed to favour a tangible, continuous and intuitive display of information. Results We have developed a software demonstration application for generating a Sequence Bundles visualisation of MSAs provided for the BioVis 2013 redesign contest. A subsequent exploration of the visualised line patterns allowed for the discovery of a number of interesting features in the dataset. Reported features include the extreme conservation of sequences displaying a specific residue and bifurcations of the consensus sequence. Conclusions Sequence Bundles is a novel method for visualisation of MSAs and the discovery of sequence motifs. It can aid in generating new insight and hypothesis making. Sequence Bundles is well disposed for future implementation as an interactive visual analytics software, which can complement existing visualisation tools. PMID:25237395
Rasmussen, C.; Purcell, M.K.; Gregg, J.L.; LaPatra, S.E.; Winton, J.R.; Hershberger, P.K.
2010-01-01
The mesomycetozoean parasite Ichthyophonus hoferi is most commonly associated with marine fish hosts but also occurs in some components of the freshwater rainbow trout Oncorhynchus mykiss aquaculture industry in Idaho, USA. It is not certain how the parasite was introduced into rainbow trout culture, but it might have been associated with the historical practice of feeding raw, ground common carp Cyprinus carpio that were caught by commercial fisherman. Here, we report a major genetic division between west coast freshwater and marine isolates of Ichthyophonus hoferi. Sequence differences were not detected in 2 regions of the highly conserved small subunit (18S) rDNA gene; however, nucleotide variation was seen in internal transcribed spacer loci (ITS1 and ITS2), both within and among the isolates. Intra-isolate variation ranged from 2.4 to 7.6 nucleotides over a region consisting of ~740 bp. Majority consensus sequences from marine/anadromous hosts differed in only 0 to 3 nucleotides (99.6 to 100% nucleotide identity), while those derived from freshwater rainbow trout had no nucleotide substitutions relative to each other. However, the consensus sequences between isolates from freshwater rainbow trout and those from marine/anadromous hosts differed in 13 to 16 nucleotides (97.8 to 98.2% nucleotide identity).
Characterization of kinetoplast DNA from Phytomonas serpens.
Sá-Carvalho, D; Perez-Morga, D; Traub-Cseko, Y M
1993-01-01
The restriction enzyme digestion of kinetoplast DNA from four Phytomonas serpens isolates shows an overall similar band pattern. One minicircle from isolate 30T was cloned and sequenced, showing low levels of homology but the same general features and organization as described for minicircles of other trypanosomatids. Extensive regions of the minicircle are composed by G and T on the H strand. These regions are very repetitive and similar to regions in a minicircle of Crithidia oncopelti and to telomeric sequences of Saccharomyces cerevisiae. Conserved Sequence Block 3, present in all trypanosomatids, is one nucleotide different from the consensus in P. serpens and provides a basis to differentiate P. serpens from other trypanosomatids. Electron microscopy of kinetoplast DNA evidenced a network with organization similar to other trypanosomatids and the measurement of minicircles confirmed the size of about 1.45 kb of the sequenced minicircle.
Li, S; Cullen, D; Hjort, M; Spear, R; Andrews, J H
1996-01-01
Aureobasidium pullulans, a cosmopolitan yeast-like fungus, colonizes leaf surfaces and has potential as a biocontrol agent of pathogens. To assess the feasibility of rRNA as a target for A. pullulans-specific oligonucleotide probes, we compared the nucleotide sequences of the small-subunit rRNA (18S) genes of 12 geographically diverse A. pullulans strains. Extreme sequence conservation was observed. The consensus A. pullulans sequence was compared with other fungal sequences to identify potential probes. A 21-mer probe which hybridized to the 12 A. pullulans strains but not to 98 other fungi, including 82 isolates from the phylloplane, was identified. A 17-mer highly specific for Cladosporium herbarum was also identified. These probes have potential in monitoring and quantifying fungi in leaf surface and other microbial communities. PMID:8633850
Hunt, C; Morimoto, R I
1985-01-01
We have determined the nucleotide sequence of the human hsp70 gene and 5' flanking region. The hsp70 gene is transcribed as an uninterrupted primary transcript of 2440 nucleotides composed of a 5' noncoding leader sequence of 212 nucleotides, a 3' noncoding region of 242 nucleotides, and a continuous open reading frame of 1986 nucleotides that encodes a protein with predicted molecular mass of 69,800 daltons. Upstream of the 5' terminus are the canonical TATAAA box, the sequence ATTGG that corresponds in the inverted orientation to the CCAAT motif, and the dyad sequence CTGGAAT/ATTCCCG that shares homology in 12 of 14 positions with the consensus transcription regulatory sequence common to Drosophila heat shock genes. Comparison of the predicted amino acid sequences of human hsp70 with the published sequences of Drosophila hsp70 and Escherichia coli dnaK reveals that human hsp70 is 73% identical to Drosophila hsp70 and 47% identical to E. coli dnaK. Surprisingly, the nucleotide sequences of the human and Drosophila genes are 72% identical and human and E. coli genes are 50% identical, which is more highly conserved than necessary given the degeneracy of the genetic code. The lack of accumulated silent nucleotide substitutions leads us to propose that there may be additional information in the nucleotide sequence of the hsp70 gene or the corresponding mRNA that precludes the maximum divergence allowed in the silent codon positions. PMID:3931075
2013-01-01
Background Cucumber is an important vegetable crop that is susceptible to many pathogens, but no disease resistance (R) genes have been cloned. The availability of whole genome sequences provides an excellent opportunity for systematic identification and characterization of the nucleotide binding and leucine-rich repeat (NB-LRR) type R gene homolog (RGH) sequences in the genome. Cucumber has a very narrow genetic base making it difficult to construct high-density genetic maps. Development of a consensus map by synthesizing information from multiple segregating populations is a method of choice to increase marker density. As such, the objectives of the present study were to identify and characterize NB-LRR type RGHs, and to develop a high-density, integrated cucumber genetic-physical map anchored with RGH loci. Results From the Gy14 draft genome, 70 NB-containing RGHs were identified and characterized. Most RGHs were in clusters with uneven distribution across seven chromosomes. In silico analysis indicated that all 70 RGHs had EST support for gene expression. Phylogenetic analysis classified 58 RGHs into two clades: CNL and TNL. Comparative analysis revealed high-degree sequence homology and synteny in chromosomal locations of these RGH members between the cucumber and melon genomes. Fifty-four molecular markers were developed to delimit 67 of the 70 RGHs, which were integrated into a genetic map through linkage analysis. A 1,681-locus cucumber consensus map including 10 gene loci and spanning 730.0 cM in seven linkage groups was developed by integrating three component maps with a bin-mapping strategy. Physically, 308 scaffolds with 193.2 Mbp total DNA sequences were anchored onto this consensus map that covered 52.6% of the 367 Mbp cucumber genome. Conclusions Cucumber contains relatively few NB-LRR RGHs that are clustered and unevenly distributed in the genome. All RGHs seem to be transcribed and shared significant sequence homology and synteny with the melon genome suggesting conservation of these RGHs in the Cucumis lineage. The 1,681-locus consensus genetic-physical map developed and the RGHs identified and characterized herein are valuable genomics resources that may have many applications such as quantitative trait loci identification, map-based gene cloning, association mapping, marker-assisted selection, as well as assembly of a more complete cucumber genome. PMID:23531125
Applying the Concept of Peptide Uniqueness to Anti-Polio Vaccination.
Kanduc, Darja; Fasano, Candida; Capone, Giovanni; Pesce Delfino, Antonella; Calabrò, Michele; Polimeno, Lorenzo
2015-01-01
Although rare, adverse events may associate with anti-poliovirus vaccination thus possibly hampering global polio eradication worldwide. To design peptide-based anti-polio vaccines exempt from potential cross-reactivity risks and possibly able to reduce rare potential adverse events such as the postvaccine paralytic poliomyelitis due to the tendency of the poliovirus genome to mutate. Proteins from poliovirus type 1, strain Mahoney, were analyzed for amino acid sequence identity to the human proteome at the pentapeptide level, searching for sequences that (1) have zero percent of identity to human proteins, (2) are potentially endowed with an immunologic potential, and (3) are highly conserved among poliovirus strains. Sequence analyses produced a set of consensus epitopic peptides potentially able to generate specific anti-polio immune responses exempt from cross-reactivity with the human host. Peptide sequences unique to poliovirus proteins and conserved among polio strains might help formulate a specific and universal anti-polio vaccine able to react with multiple viral strains and exempt from the burden of possible cross-reactions with human proteins. As an additional advantage, using a peptide-based vaccine instead of current anti-polio DNA vaccines would eliminate the rare post-polio poliomyelitis cases and other disabling symptoms that may appear following vaccination.
An RNAi in silico approach to find an optimal shRNA cocktail against HIV-1
2010-01-01
Background HIV-1 can be inhibited by RNA interference in vitro through the expression of short hairpin RNAs (shRNAs) that target conserved genome sequences. In silico shRNA design for HIV has lacked a detailed study of virus variability constituting a possible breaking point in a clinical setting. We designed shRNAs against HIV-1 considering the variability observed in naïve and drug-resistant isolates available at public databases. Methods A Bioperl-based algorithm was developed to automatically scan multiple sequence alignments of HIV, while evaluating the possibility of identifying dominant and subdominant viral variants that could be used as efficient silencing molecules. Student t-test and Bonferroni Dunn correction test were used to assess statistical significance of our findings. Results Our in silico approach identified the most common viral variants within highly conserved genome regions, with a calculated free energy of ≥ -6.6 kcal/mol. This is crucial for strand loading to RISC complex and for a predicted silencing efficiency score, which could be used in combination for achieving over 90% silencing. Resistant and naïve isolate variability revealed that the most frequent shRNA per region targets a maximum of 85% of viral sequences. Adding more divergent sequences maintained this percentage. Specific sequence features that have been found to be related with higher silencing efficiency were hardly accomplished in conserved regions, even when lower entropy values correlated with better scores. We identified a conserved region among most HIV-1 genomes, which meets as many sequence features for efficient silencing. Conclusions HIV-1 variability is an obstacle to achieving absolute silencing using shRNAs designed against a consensus sequence, mainly because there are many functional viral variants. Our shRNA cocktail could be truly effective at silencing dominant and subdominant naïve viral variants. Additionally, resistant isolates might be targeted under specific antiretroviral selective pressure, but in both cases these should be tested exhaustively prior to clinical use. PMID:21172023
Sebestyén, Endre; Nagy, Tibor; Suhai, Sándor; Barta, Endre
2009-01-01
Background The comparative genomic analysis of a large number of orthologous promoter regions of the chordate and plant genes from the DoOP databases shows thousands of conserved motifs. Most of these motifs differ from any known transcription factor binding site (TFBS). To identify common conserved motifs, we need a specific tool to be able to search amongst them. Since conserved motifs from the DoOP databases are linked to genes, the result of such a search can give a list of genes that are potentially regulated by the same transcription factor(s). Results We have developed a new tool called DoOPSearch for the analysis of the conserved motifs in the promoter regions of chordate or plant genes. We used the orthologous promoters of the DoOP database to extract thousands of conserved motifs from different taxonomic groups. The advantage of this approach is that different sets of conserved motifs might be found depending on how broad the taxonomic coverage of the underlying orthologous promoter sequence collection is (consider e.g. primates vs. mammals or Brassicaceae vs. Viridiplantae). The DoOPSearch tool allows the users to search these motif collections or the promoter regions of DoOP with user supplied query sequences or any of the conserved motifs from the DoOP database. To find overrepresented gene ontologies, the gene lists obtained can be analysed further using a modified version of the GeneMerge program. Conclusion We present here a comparative genomics based promoter analysis tool. Our system is based on a unique collection of conserved promoter motifs characteristic of different taxonomic groups. We offer both a command line and a web-based tool for searching in these motif collections using user specified queries. These can be either short promoter sequences or consensus sequences of known transcription factor binding sites. The GeneMerge analysis of the search results allows the user to identify statistically overrepresented Gene Ontology terms that might provide a clue on the function of the motifs and genes. PMID:19534755
Chiu, Yi-Yuan; Lin, Chih-Ta; Huang, Jhang-Wei; Hsu, Kai-Cheng; Tseng, Jen-Hu; You, Syuan-Ren; Yang, Jinn-Moon
2013-01-01
Kinases play central roles in signaling pathways and are promising therapeutic targets for many diseases. Designing selective kinase inhibitors is an emergent and challenging task, because kinases share an evolutionary conserved ATP-binding site. KIDFamMap (http://gemdock.life.nctu.edu.tw/KIDFamMap/) is the first database to explore kinase-inhibitor families (KIFs) and kinase-inhibitor-disease (KID) relationships for kinase inhibitor selectivity and mechanisms. This database includes 1208 KIFs, 962 KIDs, 55 603 kinase-inhibitor interactions (KIIs), 35 788 kinase inhibitors, 399 human protein kinases, 339 diseases and 638 disease allelic variants. Here, a KIF can be defined as follows: (i) the kinases in the KIF with significant sequence similarity, (ii) the inhibitors in the KIF with significant topology similarity and (iii) the KIIs in the KIF with significant interaction similarity. The KIIs within a KIF are often conserved on some consensus KIDFamMap anchors, which represent conserved interactions between the kinase subsites and consensus moieties of their inhibitors. Our experimental results reveal that the members of a KIF often possess similar inhibition profiles. The KIDFamMap anchors can reflect kinase conformations types, kinase functions and kinase inhibitor selectivity. We believe that KIDFamMap provides biological insights into kinase inhibitor selectivity and binding mechanisms. PMID:23193279
Consensus generation and variant detection by Celera Assembler.
Denisov, Gennady; Walenz, Brian; Halpern, Aaron L; Miller, Jason; Axelrod, Nelson; Levy, Samuel; Sutton, Granger
2008-04-15
We present an algorithm to identify allelic variation given a Whole Genome Shotgun (WGS) assembly of haploid sequences, and to produce a set of haploid consensus sequences rather than a single consensus sequence. Existing WGS assemblers take a column-by-column approach to consensus generation, and produce a single consensus sequence which can be inconsistent with the underlying haploid alleles, and inconsistent with any of the aligned sequence reads. Our new algorithm uses a dynamic windowing approach. It detects alleles by simultaneously processing the portions of aligned reads spanning a region of sequence variation, assigns reads to their respective alleles, phases adjacent variant alleles and generates a consensus sequence corresponding to each confirmed allele. This algorithm was used to produce the first diploid genome sequence of an individual human. It can also be applied to assemblies of multiple diploid individuals and hybrid assemblies of multiple haploid organisms. Being applied to the individual human genome assembly, the new algorithm detects exactly two confirmed alleles and reports two consensus sequences in 98.98% of the total number 2,033311 detected regions of sequence variation. In 33,269 out of 460,373 detected regions of size >1 bp, it fixes the constructed errors of a mosaic haploid representation of a diploid locus as produced by the original Celera Assembler consensus algorithm. Using an optimized procedure calibrated against 1 506 344 known SNPs, it detects 438 814 new heterozygous SNPs with false positive rate 12%. The open source code is available at: http://wgs-assembler.cvs.sourceforge.net/wgs-assembler/
Splicing factor SFRS1 recognizes a functionally diverse landscape of RNA transcripts.
Sanford, Jeremy R; Wang, Xin; Mort, Matthew; Vanduyn, Natalia; Cooper, David N; Mooney, Sean D; Edenberg, Howard J; Liu, Yunlong
2009-03-01
Metazoan genes are encrypted with at least two superimposed codes: the genetic code to specify the primary structure of proteins and the splicing code to expand their proteomic output via alternative splicing. Here, we define the specificity of a central regulator of pre-mRNA splicing, the conserved, essential splicing factor SFRS1. Cross-linking immunoprecipitation and high-throughput sequencing (CLIP-seq) identified 23,632 binding sites for SFRS1 in the transcriptome of cultured human embryonic kidney cells. SFRS1 was found to engage many different classes of functionally distinct transcripts including mRNA, miRNA, snoRNAs, ncRNAs, and conserved intergenic transcripts of unknown function. The majority of these diverse transcripts share a purine-rich consensus motif corresponding to the canonical SFRS1 binding site. The consensus site was not only enriched in exons cross-linked to SFRS1 in vivo, but was also enriched in close proximity to splice sites. mRNAs encoding RNA processing factors were significantly overrepresented, suggesting that SFRS1 may broadly influence the post-transcriptional control of gene expression in vivo. Finally, a search for the SFRS1 consensus motif within the Human Gene Mutation Database identified 181 mutations in 82 different genes that disrupt predicted SFRS1 binding sites. This comprehensive analysis substantially expands the known roles of human SR proteins in the regulation of a diverse array of RNA transcripts.
Vaira, A M; Accotto, G P; Costantini, A; Milne, R G
2003-06-01
A 4018 nucleotide sequence was obtained for RNA 1 of Ranunculus white mottle virus (RWMV), genus Ophiovirus, representing an incomplete ORF of 1339 aa. Amino acid sequence analysis revealed significant similarities with RNA polymerases of viruses in the family Rhabdoviridae and a conserved domain of 685 aa, corresponding to the RdRp domain of those in the order Mononegavirales. Phylogenetic analysis indicated that the genus Ophiovirus is not related to the genus Tenuivirus or the family Bunyaviridae, with which it has been linked, and probably deserves a special taxonomic position, within a new family. A pair of degenerate primers was designed from a consensus sequence obtained from a relatively conserved region in the RNA 1 of two members of the genus, Citrus psorosis virus (CPsV) and RWMV. The primers, used in RT-PCR experiments, amplified a 136 bp DNA fragment from all the three recognized members of the genus, i.e. CPsV, RWMV and Tulip mild mottle mosaic virus (TMMMV) and from two tentative ophioviruses from lettuce and freesia. The amplified DNAs were sequenced and compared with the corresponding sequences of CPsV and RWMV and phylogenetic relationships were evaluated. Assays using extracts from plants infected by viruses belonging to the genera Tospovirus, Tenuivirus, Rhabdovirus and Varicosavirus indicated that the primers are genus-specific.
Campion, S R; Ameen, A S; Lai, L; King, J M; Munzenmaier, T N
2001-08-15
This report describes the application of a simple computational tool, AAPAIR.TAB, for the systematic analysis of the cysteine-rich EGF, Sushi, and Laminin motif/sequence families at the two-amino acid level. Automated dipeptide frequency/bias analysis detects preferences in the distribution of amino acids in established protein families, by determining which "ordered dipeptides" occur most frequently in comprehensive motif-specific sequence data sets. Graphic display of the dipeptide frequency/bias data revealed family-specific preferences for certain dipeptides, but more importantly detected a shared preference for employment of the ordered dipeptides Gly-Tyr (GY) and Gly-Phe (GF) in all three protein families. The dipeptide Asn-Gly (NG) also exhibited high-frequency and bias in the EGF and Sushi motif families, whereas Asn-Thr (NT) was distinguished in the Laminin family. Evaluation of the distribution of dipeptides identified by frequency/bias analysis subsequently revealed the highly restricted localization of the G(F/Y) and N(G/T) sequence elements at two separate sites of extreme conservation in the consensus sequence of all three sequence families. The similar employment of the high-frequency/bias dipeptides in three distinct protein sequence families was further correlated with the concurrence of these shared molecular determinants at similar positions within the distinctive scaffolds of three structurally divergent, but similarly employed, motif modules.
Molecular cloning of crustins from the hemocytes of Brazilian penaeid shrimps.
Rosa, Rafael Diego; Bandeira, Paula Terra; Barracco, Margherita Anna
2007-09-01
Crustins are antimicrobial peptides initially identified in the hemocytes of the crab Carcinus maenas (11.5-kDa peptide or carcinin) and recently also recognized in penaeid shrimps and other crustacean species. The aim of this study was to identify sequences encoding for crustins from the hemocytes of four Brazilian penaeid species: Farfantepenaeus paulensis, Farfantepenaeus subtilis, Farfantepenaeus brasiliensis and Litopenaeus schmitti. Using primers based on consensus nucleotide alignment of crustins from different crustaceans, cDNA sequences coding for crustins in all indigenous penaeid species were amplified. The obtained four crustin sequences encoded for peptides containing a hydrophobic N-terminal region rich in glycine repeats and a C-terminal part with 12 cysteine residues and a conserved whey acidic protein domain. All obtained crustin sequences showed high amino acidic similarity among each other and with crustins from litopenaeid shrimps (76-98%). This is the first report of crustins in native Brazilian penaeid shrimps.
Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.
2015-01-01
This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030
2014-01-01
Background The 2013 BioVis Contest provided an opportunity to evaluate different paradigms for visualizing protein multiple sequence alignments. Such data sets are becoming extremely large and thus taxing current visualization paradigms. Sequence Logos represent consensus sequences but have limitations for protein alignments. As an alternative, ProfileGrids are a new protein sequence alignment visualization paradigm that represents an alignment as a color-coded matrix of the residue frequency occurring at every homologous position in the aligned protein family. Results The JProfileGrid software program was used to analyze the BioVis contest data sets to generate figures for comparison with the Sequence Logo reference images. Conclusions The ProfileGrid representation allows for the clear and effective analysis of protein multiple sequence alignments. This includes both a general overview of the conservation and diversity sequence patterns as well as the interactive ability to query the details of the protein residue distributions in the alignment. The JProfileGrid software is free and available from http://www.ProfileGrid.org. PMID:25237393
Tang, Rongying; Prosser, Debra O.; Love, Donald R.
2016-01-01
The increasing diagnostic use of gene sequencing has led to an expanding dataset of novel variants that lie within consensus splice junctions. The challenge for diagnostic laboratories is the evaluation of these variants in order to determine if they affect splicing or are merely benign. A common evaluation strategy is to use in silico analysis, and it is here that a number of programmes are available online; however, currently, there are no consensus guidelines on the selection of programmes or protocols to interpret the prediction results. Using a collection of 222 pathogenic mutations and 50 benign polymorphisms, we evaluated the sensitivity and specificity of four in silico programmes in predicting the effect of each variant on splicing. The programmes comprised Human Splice Finder (HSF), Max Entropy Scan (MES), NNSplice, and ASSP. The MES and ASSP programmes gave the highest performance based on Receiver Operator Curve analysis, with an optimal cut-off of score reduction of 10%. The study also showed that the sensitivity of prediction is affected by the level of conservation of individual positions, with in silico predictions for variants at positions −4 and +7 within consensus splice sites being largely uninformative. PMID:27313609
Esmagambetov, Ilias; Bagaev, Alexander; Pichugin, Alexey; Lysenko, Andrey; Shcherbinin, Dmitry; Sedova, Elena; Logunov, Denis; Shmarov, Maxim; Ataullakhanov, Ravshan; Naroditsky, Boris; Gintsburg, Alexander
2018-01-01
To avoid outbreaks of influenza virus epidemics and pandemics among human populations, modern medicine requires the development of new universal vaccines that are able to provide protection from a wide range of influenza A virus strains. In the course of development of a universal vaccine, it is necessary to consider that immunity must be generated even against viruses from different hosts because new human epidemic virus strains have their origins in viruses of birds and other animals. We have enriched conserved viral proteins–nucleoprotein (NP) and matrix protein 2 (M2)—by B and T-cell epitopes not only human origin but also swine and avian origin. For this purpose, we analyzed M2 and NP sequences with respect to changes in the sequences of known T and B-cell epitopes and chose conserved and evolutionarily significant epitopes. Eventually, we found consensus sequences of M2 and NP that have the maximum quantity of epitopes that are 100% coincident with them. Consensus epitope-enriched amino acid sequences of M2 and NP proteins were included in a recombinant adenoviral vector. Immunization with Ad5-tet-M2NP induced strong CD8 and CD4 T cells responses, specific to each of the encoded antigens, i.e. M2 and NP. Eight months after immunization with Ad5-tet-M2NP, high numbers of M2- and NP-responding “effector memory” CD44posCD62neg T cells were found in the mouse spleens, which revealed a long-term T cell immune memory conferred by the immunization. In all, the challenge experiments showed an extraordinarily wide-ranging efficacy of protection by the Ad5-tet-M2NP vaccine, covering 5 different heterosubtypes of influenza A virus (2 human, 2 avian and 1 swine). PMID:29377916
Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E
1998-06-01
Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.
Structure and stability of the ankyrin domain of the Drosophila Notch receptor.
Zweifel, Mark E; Leahy, Daniel J; Hughson, Frederick M; Barrick, Doug
2003-11-01
The Notch receptor contains a conserved ankyrin repeat domain that is required for Notch-mediated signal transduction. The ankyrin domain of Drosophila Notch contains six ankyrin sequence repeats previously identified as closely matching the ankyrin repeat consensus sequence, and a putative seventh C-terminal sequence repeat that exhibits lower similarity to the consensus sequence. To better understand the role of the Notch ankyrin domain in Notch-mediated signaling and to examine how structure is distributed among the seven ankyrin sequence repeats, we have determined the crystal structure of this domain to 2.0 angstroms resolution. The seventh, C-terminal, ankyrin sequence repeat adopts a regular ankyrin fold, but the first, N-terminal ankyrin repeat, which contains a 15-residue insertion, appears to be largely disordered. The structure reveals a substantial interface between ankyrin polypeptides, showing a high degree of shape and charge complementarity, which may be related to homotypic interactions suggested from indirect studies. However, the Notch ankyrin domain remains largely monomeric in solution, demonstrating that this interface alone is not sufficient to promote tight association. Using the structure, we have classified reported mutations within the Notch ankyrin domain that are known to disrupt signaling into those that affect buried residues and those restricted to surface residues. We show that the buried substitutions greatly decrease protein stability, whereas the surface substitutions have only a marginal affect on stability. The surface substitutions are thus likely to interfere with Notch signaling by disrupting specific Notch-effector interactions and map the sites of these interactions.
ApiEST-DB: analyzing clustered EST data of the apicomplexan parasites.
Li, Li; Crabtree, Jonathan; Fischer, Steve; Pinney, Deborah; Stoeckert, Christian J; Sibley, L David; Roos, David S
2004-01-01
ApiEST-DB (http://www.cbil.upenn.edu/paradbs-servlet/) provides integrated access to publicly available EST data from protozoan parasites in the phylum Apicomplexa. The database currently incorporates a total of nearly 100,000 ESTs from several parasite species of clinical and/or veterinary interest, including Eimeria tenella, Neospora caninum, Plasmodium falciparum, Sarcocystis neurona and Toxoplasma gondii. To facilitate analysis of these data, EST sequences were clustered and assembled to form consensus sequences for each organism, and these assemblies were then subjected to automated annotation via similarity searches against protein and domain databases. The underlying relational database infrastructure, Genomics Unified Schema (GUS), enables complex biologically based queries, facilitating validation of gene models, identification of alternative splicing, detection of single nucleotide polymorphisms, identification of stage-specific genes and recognition of phylogenetically conserved and phylogenetically restricted sequences.
Applying the Concept of Peptide Uniqueness to Anti-Polio Vaccination
Kanduc, Darja; Fasano, Candida; Capone, Giovanni; Pesce Delfino, Antonella; Calabrò, Michele; Polimeno, Lorenzo
2015-01-01
Background. Although rare, adverse events may associate with anti-poliovirus vaccination thus possibly hampering global polio eradication worldwide. Objective. To design peptide-based anti-polio vaccines exempt from potential cross-reactivity risks and possibly able to reduce rare potential adverse events such as the postvaccine paralytic poliomyelitis due to the tendency of the poliovirus genome to mutate. Methods. Proteins from poliovirus type 1, strain Mahoney, were analyzed for amino acid sequence identity to the human proteome at the pentapeptide level, searching for sequences that (1) have zero percent of identity to human proteins, (2) are potentially endowed with an immunologic potential, and (3) are highly conserved among poliovirus strains. Results. Sequence analyses produced a set of consensus epitopic peptides potentially able to generate specific anti-polio immune responses exempt from cross-reactivity with the human host. Conclusion. Peptide sequences unique to poliovirus proteins and conserved among polio strains might help formulate a specific and universal anti-polio vaccine able to react with multiple viral strains and exempt from the burden of possible cross-reactions with human proteins. As an additional advantage, using a peptide-based vaccine instead of current anti-polio DNA vaccines would eliminate the rare post-polio poliomyelitis cases and other disabling symptoms that may appear following vaccination. PMID:26568962
A novel paired domain DNA recognition motif can mediate Pax2 repression of gene transcription.
Håvik, B; Ragnhildstveit, E; Lorens, J B; Saelemyr, K; Fauske, O; Knudsen, L K; Fjose, A
1999-12-20
The paired domain (PD) is an evolutionarily conserved DNA-binding domain encoded by the Pax gene family of developmental regulators. The Pax proteins are transcription factors and are involved in a variety of processes such as brain development, patterning of the central nervous system (CNS), and B-cell development. In this report we demonstrate that the zebrafish Pax2 PD can interact with a novel type of DNA sequences in vitro, the triple-A motif, consisting of a heptameric nucleotide sequence G/CAAACA/TC with an invariant core of three adjacent adenosines. This recognition sequence was found to be conserved in known natural Pax5 repressor elements involved in controlling the expression of the p53 and J-chain genes. By identifying similar high affinity binding sites in potential target genes of the Pax2 protein, including the pax2 gene itself, we obtained further evidence that the triple-A sites are biologically significant. The putative natural target sites also provide a basis for defining an extended consensus recognition sequence. In addition, we observed in transformation assays a direct correlation between Pax2 repressor activity and the presence of triple-A sites. The results suggest that a transcriptional regulatory function of Pax proteins can be modulated by PD binding to different categories of target sequences. Copyright 1999 Academic Press.
Pettigrew, Christopher; Wayte, Nicola; Lovelock, Paul K; Tavtigian, Sean V; Chenevix-Trench, Georgia; Spurdle, Amanda B; Brown, Melissa A
2005-01-01
Introduction Aberrant pre-mRNA splicing can be more detrimental to the function of a gene than changes in the length or nature of the encoded amino acid sequence. Although predicting the effects of changes in consensus 5' and 3' splice sites near intron:exon boundaries is relatively straightforward, predicting the possible effects of changes in exonic splicing enhancers (ESEs) remains a challenge. Methods As an initial step toward determining which ESEs predicted by the web-based tool ESEfinder in the breast cancer susceptibility gene BRCA1 are likely to be functional, we have determined their evolutionary conservation and compared their location with known BRCA1 sequence variants. Results Using the default settings of ESEfinder, we initially detected 669 potential ESEs in the coding region of the BRCA1 gene. Increasing the threshold score reduced the total number to 464, while taking into consideration the proximity to splice donor and acceptor sites reduced the number to 211. Approximately 11% of these ESEs (23/211) either are identical at the nucleotide level in human, primates, mouse, cow, dog and opossum Brca1 (conserved) or are detectable by ESEfinder in the same position in the Brca1 sequence (shared). The frequency of conserved and shared predicted ESEs between human and mouse is higher in BRCA1 exons (2.8 per 100 nucleotides) than in introns (0.6 per 100 nucleotides). Of conserved or shared putative ESEs, 61% (14/23) were predicted to be affected by sequence variants reported in the Breast Cancer Information Core database. Applying the filters described above increased the colocalization of predicted ESEs with missense changes, in-frame deletions and unclassified variants predicted to be deleterious to protein function, whereas they decreased the colocalization with known polymorphisms or unclassified variants predicted to be neutral. Conclusion In this report we show that evolutionary conservation analysis may be used to improve the specificity of an ESE prediction tool. This is the first report on the prediction of the frequency and distribution of ESEs in the BRCA1 gene, and it is the first reported attempt to predict which ESEs are most likely to be functional and therefore which sequence variants in ESEs are most likely to be pathogenic. PMID:16280041
rVISTA 2.0: Evolutionary Analysis of Transcription Factor Binding Sites
DOE Office of Scientific and Technical Information (OSTI.GOV)
Loots, G G; Ovcharenko, I
2004-01-28
Identifying and characterizing the patterns of DNA cis-regulatory modules represents a challenge that has the potential to reveal the regulatory language the genome uses to dictate transcriptional dynamics. Several studies have demonstrated that regulatory modules are under positive selection and therefore are often conserved between related species. Using this evolutionary principle we have created a comparative tool, rVISTA, for analyzing the regulatory potential of noncoding sequences. The rVISTA tool combines transcription factor binding site (TFBS) predictions, sequence comparisons and cluster analysis to identify noncoding DNA regions that are highly conserved and present in a specific configuration within an alignment. Heremore » we present the newly developed version 2.0 of the rVISTA tool that can process alignments generated by both zPicture and PipMaker alignment programs or use pre-computed pairwise alignments of seven vertebrate genomes available from the ECR Browser. The rVISTA web server is closely interconnected with the TRANSFAC database, allowing users to either search for matrices present in the TRANSFAC library collection or search for user-defined consensus sequences. rVISTA tool is publicly available at http://rvista.dcode.org/.« less
Solution structure of an ATP-binding RNA aptamer reveals a novel fold.
Dieckmann, T; Suzuki, E; Nakamura, G K; Feigon, J
1996-01-01
In vitro selection has been used to isolate several RNA aptamers that bind specifically to biological cofactors. A well-characterized example in the ATP-binding RNA aptamer family, which contains a conserved 11-base loop opposite a bulged G and flanked by regions of double-stranded RNA. The nucleotides in the consensus sequence provide a binding pocket for ATP (or AMP), which binds with a Kd in the micromolar range. Here we present the three-dimensional solution structure of a 36-nucleotide ATP-binding RNA aptamer complexed with AMP, determined from NMR-derived distance and dihedral angle restraints. The conserved loop and bulged G form a novel compact, folded structure around the AMP. The backbone tracing of the loop nucleotides can be described by a Greek zeta (zeta). Consecutive loop nucleotides G, A, A form a U-turn at the bottom of the zeta, and interact with the AMP to form a structure similar to a GNRA tetraloop, with AMP standing in for the final A. Two asymmetric G. G base pairs close the stems flanking the internal loop. Mutated aptamers support the existence of the tertiary interactions within the consensus nucleotides and with the AMP found in the calculated structures. PMID:8756406
Vettore, André L.; da Silva, Felipe R.; Kemper, Edson L.; Souza, Glaucia M.; da Silva, Aline M.; Ferro, Maria Inês T.; Henrique-Silva, Flavio; Giglioti, Éder A.; Lemos, Manoel V.F.; Coutinho, Luiz L.; Nobrega, Marina P.; Carrer, Helaine; França, Suzelei C.; Bacci, Maurício; Goldman, Maria Helena S.; Gomes, Suely L.; Nunes, Luiz R.; Camargo, Luis E.A.; Siqueira, Walter J.; Van Sluys, Marie-Anne; Thiemann, Otavio H.; Kuramae, Eiko E.; Santelli, Roberto V.; Marino, Celso L.; Targon, Maria L.P.N.; Ferro, Jesus A.; Silveira, Henrique C.S.; Marini, Danyelle C.; Lemos, Eliana G.M.; Monteiro-Vitorello, Claudia B.; Tambor, José H.M.; Carraro, Dirce M.; Roberto, Patrícia G.; Martins, Vanderlei G.; Goldman, Gustavo H.; de Oliveira, Regina C.; Truffi, Daniela; Colombo, Carlos A.; Rossi, Magdalena; de Araujo, Paula G.; Sculaccio, Susana A.; Angella, Aline; Lima, Marleide M.A.; de Rosa, Vicente E.; Siviero, Fábio; Coscrato, Virginia E.; Machado, Marcos A.; Grivet, Laurent; Di Mauro, Sonia M.Z.; Nobrega, Francisco G.; Menck, Carlos F.M.; Braga, Marilia D.V.; Telles, Guilherme P.; Cara, Frank A.A.; Pedrosa, Guilherme; Meidanis, João; Arruda, Paulo
2003-01-01
To contribute to our understanding of the genome complexity of sugarcane, we undertook a large-scale expressed sequence tag (EST) program. More than 260,000 cDNA clones were partially sequenced from 26 standard cDNA libraries generated from different sugarcane tissues. After the processing of the sequences, 237,954 high-quality ESTs were identified. These ESTs were assembled into 43,141 putative transcripts. Of the assembled sequences, 35.6% presented no matches with existing sequences in public databases. A global analysis of the whole SUCEST data set indicated that 14,409 assembled sequences (33% of the total) contained at least one cDNA clone with a full-length insert. Annotation of the 43,141 assembled sequences associated almost 50% of the putative identified sugarcane genes with protein metabolism, cellular communication/signal transduction, bioenergetics, and stress responses. Inspection of the translated assembled sequences for conserved protein domains revealed 40,821 amino acid sequences with 1415 Pfam domains. Reassembling the consensus sequences of the 43,141 transcripts revealed a 22% redundancy in the first assembling. This indicated that possibly 33,620 unique genes had been identified and indicated that >90% of the sugarcane expressed genes were tagged. PMID:14613979
Proels, Reinhard K; Roitsch, Thomas
2006-03-01
Very few CACTA transposon-like sequences have been described in Solanaceae species. Sequence information has been restricted to partial transposase (TPase)-like fragments, and no target gene of CACTA-like transposon insertion has been described in tomato to date. In this manuscript, we report on a CACTA transposon-like insertion in intron I of tomato (Lycopersicon esculentum) invertase gene Lin5 and TPase-like sequences of several Solanaceae species. Consensus primers deduced from the TPase region of the tomato CACTA transposon-like element allowed the amplification of similar sequences from various Solanaceae species of different subfamilies including Solaneae (Solanum tuberosum), Cestreae (Nicotiana tabacum) and Datureae (Datura stramonium). This demonstrates the ubiquitous presence of CACTA-like elements in Solanaceae genomes. The obtained partial sequences are highly conserved, and allow further detection and detailed analysis of CACTA-like transposons throughout Solanaceae species. CACTA-like transposon sequences make possible the evaluation of their use for genome analysis, functional studies of genes and the evolutionary relationships between plant species.
The liberal illusion of uniqueness.
Stern, Chadly; West, Tessa V; Schmitt, Peter G
2014-01-01
In two studies, we demonstrated that liberals underestimate their similarity to other liberals (i.e., display truly false uniqueness), whereas moderates and conservatives overestimate their similarity to other moderates and conservatives (i.e., display truly false consensus; Studies 1 and 2). We further demonstrated that a fundamental difference between liberals and conservatives in the motivation to feel unique explains this ideological distinction in the accuracy of estimating similarity (Study 2). Implications of the accuracy of consensus estimates for mobilizing liberal and conservative political movements are discussed.
Jurka, Jerzy W.
1997-01-01
Enhanced homologous recombination is obtained by employing a consensus sequence which has been found to be associated with integration of repeat sequences, such as Alu and ID. The consensus sequence or sequence having a single transition mutation determines one site of a double break which allows for high efficiency of integration at the site. By introducing single or double stranded DNA having the consensus sequence flanking region joined to a sequence of interest, one can reproducibly direct integration of the sequence of interest at one or a limited number of sites. In this way, specific sites can be identified and homologous recombination achieved at the site by employing a second flanking sequence associated with a sequence proximal to the 3'-nick.
Badaut, Cyril; Bertin, Gwladys; Rustico, Tatiana; Fievet, Nadine; Massougbodji, Achille; Gaye, Alioune; Deloron, Philippe
2010-01-01
Background Placental malaria is a disease linked to the sequestration of Plasmodium falciparum infected red blood cells (IRBC) in the placenta, leading to reduced materno-fetal exchanges and to local inflammation. One of the virulence factors of P. falciparum involved in cytoadherence to chondroitin sulfate A, its placental receptor, is the adhesive protein VAR2CSA. Its localisation on the surface of IRBC makes it accessible to the immune system. VAR2CSA contains six DBL domains. The DBL6ε domain is the most variable. High variability constitutes a means for the parasite to evade the host immune response. The DBL6ε domain could constitute a very attractive basis for a vaccine candidate but its reported variability necessitates, for antigenic characterisations, identifying and classifying commonalities across isolates. Methodology/Principal Findings Local alignment analysis of the DBL6ε domain had revealed that it is not as variable as previously described. Variability is concentrated in seven regions present on the surface of the DBL6ε domain. The main goal of our work is to classify and group variable sequences that will simplify further research to determine dominant epitopes. Firstly, variable sequences were grouped following their average percent pairwise identity (APPI). Groups comprising many variable sequences sharing low variability were found. Secondly, ELISA experiments following the IgG recognition of a recombinant DBL6ε domain, and of peptides mimicking its seven variable blocks, allowed to determine an APPI cut-off and to isolate groups represented by a single consensus sequence. Conclusions/Significance A new sequence approach is used to compare variable regions in sequences that have extensive segmental gene relationship. Using this approach, the VAR2CSA DBL6 domain is composed of 7 variable blocks with limited polymorphism. Each variable block is composed of a limited number of consensus types. Based on peptide based ELISA, variable blocks with 85% or greater sequence identity are expected to be recognized equally well by antibody and can be considered the same consensus type. Therefore, the analysis of the antibody response against the classified small number of sequences should be helpful to determine epitopes. PMID:20585655
Guinea Pig ID-Like Families of SINEs
Kass, David H.; Schaetz, Brian A.; Beitler, Lindsey; Bonney, Kevin M.; Jamison, Nicole; Wiesner, Cathy
2009-01-01
Previous studies have indicated a paucity of SINEs within the genomes of the guinea pig and nutria, representatives of the Hystricognathi suborder of rodents. More recent work has shown that the guinea pig genome contains a large number of B1 elements, expanding to various levels among different rodents. In this work we utilized A–B PCR and screened GenBank with sequences from isolated clones to identify potentially uncharacterized SINEs within the guinea pig genome, and identified numerous sequences with a high degree of similarity (>92%) specific to the guinea pig. The presence of A-tails and flanking direct repeats associated with these sequences supported the identification of a full-length SINE, with a consensus sequence notably distinct from other rodent SINEs. Although most similar to the ID SINE, it clearly was not derived from the known ID master gene (BC1), hence we refer to this element as guinea pig ID-like (GPIDL). Using the consensus to screen the guinea pig genomic database (Assembly CavPor2) with Ensembl BlastView, we estimated at least 100,000 copies, which contrasts markedly to just over 100 copies of ID elements. Additionally we provided evidence of recent integrations of GPIDL as two of seven analyzed conserved GPIDL-containing loci demonstrated presence/absence variants in Cavia porcellus and C. aperea. Using intra-IDL PCR and sequence analyses we also provide evidence that GPIDL is derived from a hystricognath-specific SINE family. These results demonstrate that this SINE family continues to contribute to the dynamics of genomes of hystricognath rodents. PMID:19232383
Guinea pig ID-like families of SINEs.
Kass, David H; Schaetz, Brian A; Beitler, Lindsey; Bonney, Kevin M; Jamison, Nicole; Wiesner, Cathy
2009-05-01
Previous studies have indicated a paucity of SINEs within the genomes of the guinea pig and nutria, representatives of the Hystricognathi suborder of rodents. More recent work has shown that the guinea pig genome contains a large number of B1 elements, expanding to various levels among different rodents. In this work we utilized A-B PCR and screened GenBank with sequences from isolated clones to identify potentially uncharacterized SINEs within the guinea pig genome, and identified numerous sequences with a high degree of similarity (>92%) specific to the guinea pig. The presence of A-tails and flanking direct repeats associated with these sequences supported the identification of a full-length SINE, with a consensus sequence notably distinct from other rodent SINEs. Although most similar to the ID SINE, it clearly was not derived from the known ID master gene (BC1), hence we refer to this element as guinea pig ID-like (GPIDL). Using the consensus to screen the guinea pig genomic database (Assembly CavPor2) with Ensembl BlastView, we estimated at least 100,000 copies, which contrasts markedly to just over 100 copies of ID elements. Additionally we provided evidence of recent integrations of GPIDL as two of seven analyzed conserved GPIDL-containing loci demonstrated presence/absence variants in Cavia porcellus and C. aperea. Using intra-IDL PCR and sequence analyses we also provide evidence that GPIDL is derived from a hystricognath-specific SINE family. These results demonstrate that this SINE family continues to contribute to the dynamics of genomes of hystricognath rodents.
Shivange, Amol V; Hoeffken, Hans Wolfgang; Haefner, Stefan; Schwaneberg, Ulrich
2016-12-01
Protein consensus-based surface engineering (ProCoS) is a simple and efficient method for directed protein evolution combining computational analysis and molecular biology tools to engineer protein surfaces. ProCoS is based on the hypothesis that conserved residues originated from a common ancestor and that these residues are crucial for the function of a protein, whereas highly variable regions (situated on the surface of a protein) can be targeted for surface engineering to maximize performance. ProCoS comprises four main steps: ( i ) identification of conserved and highly variable regions; ( ii ) protein sequence design by substituting residues in the highly variable regions, and gene synthesis; ( iii ) in vitro DNA recombination of synthetic genes; and ( iv ) screening for active variants. ProCoS is a simple method for surface mutagenesis in which multiple sequence alignment is used for selection of surface residues based on a structural model. To demonstrate the technique's utility for directed evolution, the surface of a phytase enzyme from Yersinia mollaretii (Ymphytase) was subjected to ProCoS. Screening just 1050 clones from ProCoS engineering-guided mutant libraries yielded an enzyme with 34 amino acid substitutions. The surface-engineered Ymphytase exhibited 3.8-fold higher pH stability (at pH 2.8 for 3 h) and retained 40% of the enzyme's specific activity (400 U/mg) compared with the wild-type Ymphytase. The pH stability might be attributed to a significantly increased (20 percentage points; from 9% to 29%) number of negatively charged amino acids on the surface of the engineered phytase.
To Clone or Not To Clone: Method Analysis for Retrieving Consensus Sequences In Ancient DNA Samples
Winters, Misa; Barta, Jodi Lynn; Monroe, Cara; Kemp, Brian M.
2011-01-01
The challenges associated with the retrieval and authentication of ancient DNA (aDNA) evidence are principally due to post-mortem damage which makes ancient samples particularly prone to contamination from “modern” DNA sources. The necessity for authentication of results has led many aDNA researchers to adopt methods considered to be “gold standards” in the field, including cloning aDNA amplicons as opposed to directly sequencing them. However, no standardized protocol has emerged regarding the necessary number of clones to sequence, how a consensus sequence is most appropriately derived, or how results should be reported in the literature. In addition, there has been no systematic demonstration of the degree to which direct sequences are affected by damage or whether direct sequencing would provide disparate results from a consensus of clones. To address this issue, a comparative study was designed to examine both cloned and direct sequences amplified from ∼3,500 year-old ancient northern fur seal DNA extracts. Majority rules and the Consensus Confidence Program were used to generate consensus sequences for each individual from the cloned sequences, which exhibited damage at 31 of 139 base pairs across all clones. In no instance did the consensus of clones differ from the direct sequence. This study demonstrates that, when appropriate, cloning need not be the default method, but instead, should be used as a measure of authentication on a case-by-case basis, especially when this practice adds time and cost to studies where it may be superfluous. PMID:21738625
Rouanet, Carine; Reverchon, Sylvie; Rodionov, Dmitry A; Nasser, William
2004-07-16
In Erwinia chrysanthemi, production of pectic enzymes is modulated by a complex network involving several regulators. One of them, PecS, which belongs to the MarR family, also controls the synthesis of various other virulence factors, such as cellulases and indigoidine. Here, the PecS consensus-binding site is defined by combining a systematic evolution of ligands by an exponential enrichment approach and mutational analyses. The consensus consists of a 23-base pair palindromic-like sequence (C(-11)G(-10)A(-9)N(-8)W(-7)T(-6)C(-5)G(-4)T(-3)A(-2))T(-1)A(0)T(1)(T(2)A(3)C(4)G(5)A(6)N(7)N(8)N(9)C(10)G(11)). Mutational experiments revealed that (i) the palindromic organization is required for the binding of PecS, (ii) the very conserved part of the consensus (-6 to 6) allows for a specific interaction with PecS, but the presence of the relatively degenerated bases located apart significantly increases PecS affinity, (iii) the four bases G, A, T, and C are required for efficient binding of PecS, and (iv) the presence of several binding sites on the same promoter increases the affinity of PecS. This consensus is detected in the regions involved in PecS binding on the previously characterized target genes. This variable consensus is in agreement with the observation that the members of the MarR family are able to bind various DNA targets as dimers by means of a winged helix DNA-binding motif. Binding of PecS on a promoter region containing the defined consensus results in a repression of gene transcription in vitro. Preliminary scanning of the E. chrysanthemi genome sequence with the consensus revealed the presence of strong PecS-binding sites in the intergenic region between fliE and fliFGHIJKLMNOPQR which encode proteins involved in the biogenesis of flagellum. Accordingly, PecS directly represses fliE expression. Thus, PecS seems to control the synthesis of virulence factors required for the key steps of plant infection.
Pomerantz, Aaron; Peñafiel, Nicolás; Arteaga, Alejandro; Bustamante, Lucas; Pichardo, Frank; Coloma, Luis A; Barrio-Amorós, César L; Salazar-Valenzuela, David; Prost, Stefan
2018-04-01
Advancements in portable scientific instruments provide promising avenues to expedite field work in order to understand the diverse array of organisms that inhabit our planet. Here, we tested the feasibility for in situ molecular analyses of endemic fauna using a portable laboratory fitting within a single backpack in one of the world's most imperiled biodiversity hotspots, the Ecuadorian Chocó rainforest. We used portable equipment, including the MinION nanopore sequencer (Oxford Nanopore Technologies) and the miniPCR (miniPCR), to perform DNA extraction, polymerase chain reaction amplification, and real-time DNA barcoding of reptile specimens in the field. We demonstrate that nanopore sequencing can be implemented in a remote tropical forest to quickly and accurately identify species using DNA barcoding, as we generated consensus sequences for species resolution with an accuracy of >99% in less than 24 hours after collecting specimens. The flexibility of our mobile laboratory further allowed us to generate sequence information at the Universidad Tecnológica Indoamérica in Quito for rare, endangered, and undescribed species. This includes the recently rediscovered Jambato toad, which was thought to be extinct for 28 years. Sequences generated on the MinION required as few as 30 reads to achieve high accuracy relative to Sanger sequencing, and with further multiplexing of samples, nanopore sequencing can become a cost-effective approach for rapid and portable DNA barcoding. Overall, we establish how mobile laboratories and nanopore sequencing can help to accelerate species identification in remote areas to aid in conservation efforts and be applied to research facilities in developing countries. This opens up possibilities for biodiversity studies by promoting local research capacity building, teaching nonspecialists and students about the environment, tackling wildlife crime, and promoting conservation via research-focused ecotourism.
Vázquez, Martín; Ben-Dov, Claudia; Lorenzi, Hernan; Moore, Troy; Schijman, Alejandro; Levin, Mariano J.
2000-01-01
The short interspersed repetitive element (SIRE) of Trypanosoma cruzi was first detected when comparing the sequences of loci that encode the TcP2β genes. It is present in about 1,500–3,000 copies per genome, depending on the strain, and it is distributed in all chromosomes. An initial analysis of SIRE sequences from 21 genomic fragments allowed us to derive a consensus nucleotide sequence and structure for the element, consisting of three regions (I, II, and III) each harboring distinctive features. Analysis of 158 transcribed SIREs demonstrates that the consensus is highly conserved. The sequences of 51 cDNAs show that SIRE is included in the 3′ end of several mRNAs, always transcribed from the sense strand, contributing the polyadenylation site in 63% of the cases. This study led to the characterization of VIPER (vestigial interposed retroelement), a 2,326-bp-long unusual retroelement. VIPER's 5′ end is formed by the first 182 bp of SIRE, whereas its 3′ end is formed by the last 220 bp of the element. Both SIRE moieties are connected by a 1,924-bp-long fragment that carries a unique ORF encoding a complete reverse transcriptase-RNase H gene whose 15 C-terminal amino acids derive from codons specified by SIRE's region II. The amino acid sequence of VIPER's reverse transcriptase-RNase H shares significant homology to that of long terminal repeat retrotransposons. The fact that SIRE and VIPER sequences are found only in the T. cruzi genome may be of relevance for studies concerning the evolution and the genome flexibility of this protozoan parasite. PMID:10688909
Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén
2012-05-01
To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.
Belak, Zachery R; Ovsenek, Nicholas; Eskiw, Christopher H
2018-05-23
Yin-Yang 1 (YY1) is a highly conserved transcription factor possessing RNA-binding activity. A putative YY1 homologue was previously identified in the developmental model organism Strongylocentrotus purpuratus (the purple sea urchin) by genomic sequencing. We identified a high degree of sequence similarity with YY1 homologues of vertebrate origin which shared 100% protein sequence identity over the DNA- and RNA-binding zinc-finger region with high similarity in the N-terminal transcriptional activation domain. SpYY1 demonstrated identical DNA- and RNA-binding characteristics between Xenopus laevis and S. purpuratus indicating that it maintains similar functional and biochemical properties across widely divergent deuterostome species. SpYY1 binds to the consensus YY1 DNA element, and also to U-rich RNA sequences. Although we detected SpYY1 RNA-binding activity in ova lysates and observed cytoplasmic localization, SpYY1 was not associated with maternal mRNA in ova. SpYY1 expressed in Xenopus oocytes was excluded from the nucleus and associated with maternally expressed cytoplasmic mRNA molecules. These data demonstrate the existence of an YY1 homologue in S. purpuratus with similar structural and biochemical features to those of the well-studied vertebrate YY1; however, the data reveal major differences in the biological role of YY1 in the regulation of maternally expressed mRNA in the two species.
Fernández-Caballero Rico, Jose Ángel; Chueca Porcuna, Natalia; Álvarez Estévez, Marta; Mosquera Gutiérrez, María Del Mar; Marcos Maeso, María Ángeles; García, Federico
2018-02-01
To show how to generate a consensus sequence from the information of massive parallel sequences data obtained from routine HIV anti-retroviral resistance studies, and that may be suitable for molecular epidemiology studies. Paired Sanger (Trugene-Siemens) and next-generation sequencing (NGS) (454 GSJunior-Roche) HIV RT and protease sequences from 62 patients were studied. NGS consensus sequences were generated using Mesquite, using 10%, 15%, and 20% thresholds. Molecular evolutionary genetics analysis (MEGA) was used for phylogenetic studies. At a 10% threshold, NGS-Sanger sequences from 17/62 patients were phylogenetically related, with a median bootstrap-value of 88% (IQR83.5-95.5). Association increased to 36/62 sequences, median bootstrap 94% (IQR85.5-98)], using a 15% threshold. Maximum association was at the 20% threshold, with 61/62 sequences associated, and a median bootstrap value of 99% (IQR98-100). A safe method is presented to generate consensus sequences from HIV-NGS data at 20% threshold, which will prove useful for molecular epidemiological studies. Copyright © 2016 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lai, Xiaokuang; Davis, F.C.; Ingram, L.O.
1997-02-01
Genomic libraries from nine cellobiose-metabolizing bacteria were screened for cellobiose utilization. Positive clones were recovered from six libraries, all of which encode phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS) proteins. Clones from Bacillus subtilis, Butyrivibrio fibrisolvens, and Klebsiella oxytoca allowed the growth of recombinant Escherichia coli in cellobiose-M9 minimal medium. The K. oxytoca clone, pLOI1906, exhibited an unusually broad substrate range (cellobiose, arbutin, salicin, and methylumbelliferyl derivatives of glucose, cellobiose, mannose, and xylose) and was sequenced. The insert in this plasmid encoded the carboxy-terminal region of a putative regulatory protein, cellobiose permease (single polypeptide), and phospho-{beta}-glucosidase, which appear to form an operon (casRAB).more » Subclones allowed both casA and casB to be expressed independently, as evidenced by in vitro complementation. An analysis of the translated sequences from the EIIC domains of cellobiose, aryl-{beta}-glucoside, and other disaccharide permeases allowed the identification of a 50-amino-acid conserved region. A disaccharide consensus sequence is proposed for the most conserved segment (13 amino acids), which may represent part of the EIIC active site for binding and phosphorylation. 63 refs., 4 figs., 4 tabs.« less
Gentles, Andrew J.; Kohany, Oleksiy; Jurka, Jerzy
2005-01-01
Short interspersed elements (SINEs) make up a significant fraction of total DNA in mammalian genomes, providing a rich substrate for chromosomal rearrangements by SINE-SINE recombinations. Proliferation of mammalian SINEs is mediated primarily by LINE1 (L1) non-LTR retrotransposons that preferentially integrate at DNA sequence targets with average length ~15 bp and containing conserved endonucleolytic nicking signals at both ends. We report that sequence variations in the first of the two nicking signals, represented by a 5′TT-AAAA consensus sequence, affect the position of the second signal thus leading to target site duplications (TSDs) of different lengths. The length distribution of TSDs appears to be affected also by L1-encoded enzyme variants, since targets with the same 5′ nicking site can be of different average length in different mammalian species. Taking this into account, we re-analyzed the second nicking site and found that it is larger and includes more conserved sites than previously appreciated, with a consensus of 5′ANTNTN-AA. We also studied potential involvement of the nicking sites in stimulating recombinations between SINE elements. We determined that SINE elements retaining TSDs with perfect 5′TT-AAAA nicking sites appear to be lost relatively rapidly from the human and rat genomes, and less rapidly from dog. We speculate that the introduction of single-strand DNA breaks induced by recurring endonucleolytic attacks at these sites, combined with the ubiquitousness of SINEs, may significantly promote recombination between repetitive elements, leading to the observed losses. At the same time new L1 subfamilies may be selected for “incompatibility” with pre-existing targets. This provides a possible driving force for the continual emergence of new L1 subfamilies which, in turn, may affect selection of L1-dependent SINE subfamilies. PMID:15944437
2010-01-01
Background Epimedium sagittatum (Sieb. Et Zucc.) Maxim, a traditional Chinese medicinal plant species, has been used extensively as genuine medicinal materials. Certain Epimedium species are endangered due to commercial overexploition, while sustainable application studies, conservation genetics, systematics, and marker-assisted selection (MAS) of Epimedium is less-studied due to the lack of molecular markers. Here, we report a set of expressed sequence tags (ESTs) and simple sequence repeats (SSRs) identified in these ESTs for E. sagittatum. Results cDNAs of E. sagittatum are sequenced using 454 GS-FLX pyrosequencing technology. The raw reads are cleaned and assembled into a total of 76,459 consensus sequences comprising of 17,231 contigs and 59,228 singlets. About 38.5% (29,466) of the consensus sequences significantly match to the non-redundant protein database (E-value < 1e-10), 22,295 of which are further annotated using Gene Ontology (GO) terms. A total of 2,810 EST-SSRs is identified from the Epimedium EST dataset. Trinucleotide SSR is the dominant repeat type (55.2%) followed by dinucleotide (30.4%), tetranuleotide (7.3%), hexanucleotide (4.9%), and pentanucleotide (2.2%) SSR. The dominant repeat motif is AAG/CTT (23.6%) followed by AG/CT (19.3%), ACC/GGT (11.1%), AT/AT (7.5%), and AAC/GTT (5.9%). Thirty-two SSR-ESTs are randomly selected and primer pairs are synthesized for testing the transferability across 52 Epimedium species. Eighteen primer pairs (85.7%) could be successfully transferred to Epimedium species and sixteen of those show high genetic diversity with 0.35 of observed heterozygosity (Ho) and 0.65 of expected heterozygosity (He) and high number of alleles per locus (11.9). Conclusion A large EST dataset with a total of 76,459 consensus sequences is generated, aiming to provide sequence information for deciphering secondary metabolism, especially for flavonoid pathway in Epimedium. A total of 2,810 EST-SSRs is identified from EST dataset and ~1580 EST-SSR markers are transferable. E. sagittatum EST-SSR transferability to the major Epimedium germplasm is up to 85.7%. Therefore, this EST dataset and EST-SSRs will be a powerful resource for further studies such as taxonomy, molecular breeding, genetics, genomics, and secondary metabolism in Epimedium species. PMID:20141623
Analysis of Ribosome Inactivating Protein (RIP): A Bioinformatics Approach
NASA Astrophysics Data System (ADS)
Jothi, G. Edward Gnana; Majilla, G. Sahaya Jose; Subhashini, D.; Deivasigamani, B.
2012-10-01
In spite of the medical advances in recent years, the world is in need of different sources to encounter certain health issues.Ribosome Inactivating Proteins (RIPs) were found to be one among them. In order to get easy access about RIPs, there is a need to analyse RIPs towards constructing a database on RIPs. Also, multiple sequence alignment was done towards screening for homologues of significant RIPs from rare sources against RIPs from easily available sources in terms of similarity. Protein sequences were retrieved from SWISS-PROT and are further analysed using pair wise and multiple sequence alignment.Analysis shows that, 151 RIPs have been characterized to date. Amongst them, there are 87 type I, 37 type II, 1 type III and 25 unknown RIPs. The sequence length information of various RIPs about the availability of full or partial sequence was also found. The multiple sequence alignment of 37 type I RIP using the online server Multalin, indicates the presence of 20 conserved residues. Pairwise alignment and multiple sequence alignment of certain selected RIPs in two groups namely Group I and Group II were carried out and the consensus level was found to be 98%, 98% and 90% respectively.
Biclustering as a method for RNA local multiple sequence alignment.
Wang, Shu; Gutell, Robin R; Miranker, Daniel P
2007-12-15
Biclustering is a clustering method that simultaneously clusters both the domain and range of a relation. A challenge in multiple sequence alignment (MSA) is that the alignment of sequences is often intended to reveal groups of conserved functional subsequences. Simultaneously, the grouping of the sequences can impact the alignment; precisely the kind of dual situation biclustering is intended to address. We define a representation of the MSA problem enabling the application of biclustering algorithms. We develop a computer program for local MSA, BlockMSA, that combines biclustering with divide-and-conquer. BlockMSA simultaneously finds groups of similar sequences and locally aligns subsequences within them. Further alignment is accomplished by dividing both the set of sequences and their contents. The net result is both a multiple sequence alignment and a hierarchical clustering of the sequences. BlockMSA was tested on the subsets of the BRAliBase 2.1 benchmark suite that display high variability and on an extension to that suite to larger problem sizes. Also, alignments were evaluated of two large datasets of current biological interest, T box sequences and Group IC1 Introns. The results were compared with alignments computed by ClustalW, MAFFT, MUCLE and PROBCONS alignment programs using Sum of Pairs (SPS) and Consensus Count. Results for the benchmark suite are sensitive to problem size. On problems of 15 or greater sequences, BlockMSA is consistently the best. On none of the problems in the test suite are there appreciable differences in scores among BlockMSA, MAFFT and PROBCONS. On the T box sequences, BlockMSA does the most faithful job of reproducing known annotations. MAFFT and PROBCONS do not. On the Intron sequences, BlockMSA, MAFFT and MUSCLE are comparable at identifying conserved regions. BlockMSA is implemented in Java. Source code and supplementary datasets are available at http://aug.csres.utexas.edu/msa/
Jackson, Angelyca A; Daniels, Emily F; Hammond, John H; Willger, Sven D; Hogan, Deborah A
2014-10-01
Haemolytic phospholipase C (PlcH) is a potent virulence and colonization factor that is expressed at high levels by Pseudomonas aeruginosa within the mammalian host. The phosphorylcholine liberated from phosphatidylcholine and sphingomyelin by PlcH is further catabolized into molecules that both support growth and further induce plcH expression. We have shown previously that the catabolism of PlcH-released choline leads to increased activity of Anr, a global transcriptional regulator that promotes biofilm formation and virulence. Here, we demonstrated the presence of a negative feedback loop in which Anr repressed plcH transcription and we proposed that this regulation allowed for PlcH levels to be maintained in a way that promotes productive host-pathogen interactions. Evidence for Anr-mediated regulation of PlcH came from data showing that growth at low oxygen (1%) repressed PlcH abundance and plcH transcription in the WT, and that plcH transcription was enhanced in an Δanr mutant. The plcH promoter featured an Anr consensus sequence that was conserved across all P. aeruginosa genomes and mutation of conserved nucleotides within the Anr consensus sequence increased plcH expression under hypoxic conditions. The Anr-regulated transcription factor Dnr was not required for this effect. The loss of Anr was not sufficient to completely derepress plcH transcription as GbdR, a positive regulator of plcH, was required for expression. Overexpression of Anr was sufficient to repress plcH transcription even at 21 % oxygen. Anr repressed plcH expression and phospholipase C activity in a cell culture model for P. aeruginosa-epithelial cell interactions. The Authors.
The Importance of Consensus Information in Acceptance of Climate Change (Invited)
NASA Astrophysics Data System (ADS)
Cook, J.; Lewandowsky, S.
2013-12-01
In recent years, public perception of the scientific consensus on human-caused global warming has been disturbingly low, in contrast to the overwhelming level of agreement among climate scientists and in peer-reviewed research. The misperception is partly cultural, with a significant link between perceived consensus and political ideology, and partly informational with all cultural groups exhibiting the misperception to varying degrees. This universal 'consensus gap' is in large part due to a persistent and focused misinformation campaign casting doubt on the consensus, dating back as early as the 1980s. Opponents of climate action have long recognized that perception of scientific consensus is linked to support for climate policy, a link only acknowledged by social scientists in the last few years. How do we counter the all-too-effective misinformation campaign? Psychological research tells us that a crucial aspect of effective refutations is an alternative narrative. In this case, an important counter-narrative to the consensus story is the strategy to perpetuate the impression of ongoing scientific debate. I will also present recent research into the effect that consensus information has on climate beliefs of Australians and Americans. For both groups, the consensus message significantly increased beliefs about human-caused global warming and outperformed interventions that feature evidence or scientists' expertise. For the Australian sample, consensus information partially neutralised the biasing influence of ideology. However, for Americans, a backfire effect (reduced climate belief) was observed for a small minority holding strong conservative views. A psychological model employing Bayesian Networks indicates that a key element to the backfire effect is conspiratorial thinking, consistent with other research finding a link between rejection of climate science and conspiratorial ideation. Thus when presented to a general audience, consensus information has an overall positive effect but if presented to conservative audiences, may require framing that is consonant with conservative values.
Multiple splicing defects in an intronic false exon.
Sun, H; Chasin, L A
2000-09-01
Splice site consensus sequences alone are insufficient to dictate the recognition of real constitutive splice sites within the typically large transcripts of higher eukaryotes, and large numbers of pseudoexons flanked by pseudosplice sites with good matches to the consensus sequences can be easily designated. In an attempt to identify elements that prevent pseudoexon splicing, we have systematically altered known splicing signals, as well as immediately adjacent flanking sequences, of an arbitrarily chosen pseudoexon from intron 1 of the human hprt gene. The substitution of a 5' splice site that perfectly matches the 5' consensus combined with mutation to match the CAG/G sequence of the 3' consensus failed to get this model pseudoexon included as the central exon in a dhfr minigene context. Provision of a real 3' splice site and a consensus 5' splice site and removal of an upstream inhibitory sequence were necessary and sufficient to confer splicing on the pseudoexon. This activated context also supported the splicing of a second pseudoexon sequence containing no apparent enhancer. Thus, both the 5' splice site sequence and the polypyrimidine tract of the pseudoexon are defective despite their good agreement with the consensus. On the other hand, the pseudoexon body did not exert a negative influence on splicing. The introduction into the pseudoexon of a sequence selected for binding to ASF/SF2 or its replacement with beta-globin exon 2 only partially reversed the effect of the upstream negative element and the defective polypyrimidine tract. These results support the idea that exon-bridging enhancers are not a prerequisite for constitutive exon definition and suggest that intrinsically defective splice sites and negative elements play important roles in distinguishing the real splicing signal from the vast number of false splicing signals.
Cuypers, Lize; Li, Guangdi; Libin, Pieter; Piampongsant, Supinya; Vandamme, Anne-Mieke; Theys, Kristof
2015-09-16
Treatment with pan-genotypic direct-acting antivirals, targeting different viral proteins, is the best option for clearing hepatitis C virus (HCV) infection in chronically infected patients. However, the diversity of the HCV genome is a major obstacle for the development of antiviral drugs, vaccines, and genotyping assays. In this large-scale analysis, genome-wide diversity and selective pressure was mapped, focusing on positions important for treatment, drug resistance, and resistance testing. A dataset of 1415 full-genome sequences, including genotypes 1-6 from the Los Alamos database, was analyzed. In 44% of all full-genome positions, the consensus amino acid was different for at least one genotype. Focusing on positions sharing the same consensus amino acid in all genotypes revealed that only 15% was defined as pan-genotypic highly conserved (≥99% amino acid identity) and an additional 24% as pan-genotypic conserved (≥95%). Despite its large genetic diversity, across all genotypes, codon positions were rarely identified to be positively selected (0.23%-0.46%) and predominantly found to be under negative selective pressure, suggesting mainly neutral evolution. For NS3, NS5A, and NS5B, respectively, 40% (6/15), 33% (3/9), and 14% (2/14) of the resistance-related positions harbored as consensus the amino acid variant related to resistance, potentially impeding treatment. For example, the NS3 variant 80K, conferring resistance to simeprevir used for treatment of HCV1 infected patients, was present in 39.3% of the HCV1a strains and 0.25% of HCV1b strains. Both NS5A variants 28M and 30S, known to be associated with resistance to the pan-genotypic drug daclatasvir, were found in a significant proportion of HCV4 strains (10.7%). NS5B variant 556G, known to confer resistance to non-nucleoside inhibitor dasabuvir, was observed in 8.4% of the HCV1b strains. Given the large HCV genetic diversity, sequencing efforts for resistance testing purposes may need to be genotype-specific or geographically tailored.
Lee, J H; Maeda, S; Angelos, K L; Kamita, S G; Ramachandran, C; Walsh, D A
1992-11-03
Active gamma subunit of skeletal muscle phosphorylase kinase has been obtained by expression of the rat soleus cDNA in a baculovirus system. The protein exhibited the expected pH 6.8/8.2 activity ratio of 0.6, and its activity was insensitive to Ca2+ addition, indicating that it was free gamma subunit and not a gamma subunit-calmodulin complex. It was stimulated approximately 2-fold by Ca(2+)-calmodulin addition, demonstrating that it had retained high-affinity calmodulin binding. By site-directed mutagenesis, we have examined the role of six of the amino acids that constitute the consensus ATP binding site of the protein kinase, which in the gamma subunit is represented by the sequence 26Gly.Arg.Gly.Val.Ser.Ser.Val.Val33. Changes were evaluated by the kinetic determination of the dissociation constants of gamma-ATP, gamma-ADP, gamma-AMP.PCP, and gamma-phosphorylase and the maximum catalytic activity. The mutants Ser26-gamma, Ser29-gamma, Phe30-gamma, and Gly31-gamma each exhibited an essentially identical dissociation constant for gamma subunit phosphorylase, indicating that these mutations had not caused a global alteration in the protein structure but were limited to changes in the nucleotide binding site domain. Substitution of either Val33 (by Gly) or Gly28 (by Ser), two of the most conserved residues in all protein kinases, resulted in enzyme with marginally detectable activity. In noted contrast, the Ser26 mutant, which substituted the first glycine of the consensus glycine trio motif, and which is also very highly conserved, retained at least 25% of the enzymatic activity. The Gly31 substitution, which restored a glycine to a position characteristic for most protein kinases, had little overall effect upon the maximum rate of catalysis. Restoration of Ser30 to the more typical phenylalanine, which is present in most protein kinases, had minimal effect on catalysis. These data provide the first direct evaluation of the roles that different residues play within this consensus glycine trio/valine motif of the protein kinases, which up to now have only been surmised to be of importance because of their conservation. Two unexpected findings are that for one residue that is very conserved (Gly26) there is some flexibility of substitution not apparent from the evolutionary conservation and that a second quite conserved residue in protein kinases (equivalent to Gly at position 31) does not produce a protein optimized for nucleotide binding.
Dykeman, Eric C; Stockley, Peter G; Twarock, Reidun
2013-09-09
The current paradigm for assembly of single-stranded RNA viruses is based on a mechanism involving non-sequence-specific packaging of genomic RNA driven by electrostatic interactions. Recent experiments, however, provide compelling evidence for sequence specificity in this process both in vitro and in vivo. The existence of multiple RNA packaging signals (PSs) within viral genomes has been proposed, which facilitates assembly by binding coat proteins in such a way that they promote the protein-protein contacts needed to build the capsid. The binding energy from these interactions enables the confinement or compaction of the genomic RNAs. Identifying the nature of such PSs is crucial for a full understanding of assembly, which is an as yet untapped potential drug target for this important class of pathogens. Here, for two related bacterial viruses, we determine the sequences and locations of their PSs using Hamiltonian paths, a concept from graph theory, in combination with bioinformatics and structural studies. Their PSs have a common secondary structure motif but distinct consensus sequences and positions within the respective genomes. Despite these differences, the distributions of PSs in both viruses imply defined conformations for the packaged RNA genomes in contact with the protein shell in the capsid, consistent with a recent asymmetric structure determination of the MS2 virion. The PS distributions identified moreover imply a preferred, evolutionarily conserved assembly pathway with respect to the RNA sequence with potentially profound implications for other single-stranded RNA viruses known to have RNA PSs, including many animal and human pathogens. Copyright © 2013 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Burkhardt E.; Adham, I.M.; Brosig, B.
1994-03-01
Leydig insulin-like protein (LEY I-L) is a member of the insulin-like hormone superfamily. The LEY I-L gene (designated INSL3) is expressed exclusively in prenatal and postnatal Leydig cells. The authors report here the cloning and nucleotide sequence of porcine and human LEY I-L genes including the 5[prime] regions. Both genes consist of two exons and one intron. The organization of the LEY I-L gene is similar to that of insulin and relaxin. The transcription start site in the porcine and human LEY I-L gene is localized 13 and 14 bp upstream of the translation start site, respectively. Alignment of themore » 5[prime] flanking regions of both genes reveals that the first 107 nucleotides upstream of the transcription start site exhibit an overall sequence similarity of 80%. This conserved region contains a consensus TATAA box, a CAAT-like element (GAAT), and a consensus SP1 sequence (GGGCGG) at equivalent positions in both genes and therefore may play a role in regulation of expression of the LEY I-L gene. The porcine and human genome contains a single copy of the LEY I-L gene. By in situ hybridization, the human gene was assigned to bands p13.2-p12 of the short arm of chromosome 19. 25 refs., 6 figs.« less
Mechanisms of radiation-induced gene responses
DOE Office of Scientific and Technical Information (OSTI.GOV)
Woloschak, G.E.; Paunesku, T.
1996-10-01
In the process of identifying genes differentially expressed in cells exposed ultraviolet radiation, we have identified a transcript having a 26-bp region that is highly conserved in a variety of species including Bacillus circulans, yeast, pumpkin, Drosophila, mouse, and man. When the 5` region (flanking region or UTR) of a gene, the sequence is predominantly in +/+ orientation with respect to the coding DNA strand; while in the coding region and the 3` region (UTR), the sequence is most frequently in the +/-orientation with respect to the coding DNA strand. In two genes, the element is split into two parts;more » however, in most cases, it is found only once but with a minimum of 11 consecutive nucleotides precisely depicting the original sequence. The element is found in a large number of different genes with diverse functions (from human ras p21 to B. circulans chitonase). Gel shift assays demonstrated the presence of a protein in HeLa cell extracts that binds to the sense and antisense single-stranded consensus oligomers, as well as to the double- stranded oligonucleotide. When double-stranded oligomer was used, the size shift demonstrated as additional protein-oligomer complex larger than the one bound to either sense or antisense single-stranded consensus oligomers alone. It is speculated either that this element binds to protein(s) important in maintaining DNA is a single-stranded orientation for transcription or, alternatively that this element is important in the transcription-coupled DNA repair process.« less
Berstein, R M; Schluter, S F; Shen, S; Marchalonis, J J
1996-04-16
All immunoglobulins and T-cell receptors throughout phylogeny share regions of highly conserved amino acid sequence. To identify possible primitive immunoglobulins and immunoglobulin-like molecules, we utilized 3' RACE (rapid amplification of cDNA ends) and a highly conserved constant region consensus amino acid sequence to isolate a new immunoglobulin class from the sandbar shark Carcharhinus plumbeus. The immunoglobulin, termed IgW, in its secreted form consists of 782 amino acids and is expressed in both the thymus and the spleen. The molecule overall most closely resembles mu chains of the skate and human and a new putative antigen binding molecule isolated from the nurse shark (NAR). The full-length IgW chain has a variable region resembling human and shark heavy-chain (VH) sequences and a novel joining segment containing the WGXGT motif characteristic of H chains. However, unlike any other H-chain-type molecule, it contains six constant (C) domains. The first C domain contains the cysteine residue characteristic of C mu1 that would allow dimerization with a light (L) chain. The fourth and sixth domains also contain comparable cysteines that would enable dimerization with other H chains or homodimerization. Comparison of the sequences of IgW V and C domains shows homology greater than that found in comparisons among VH and C mu or VL, or CL thereby suggesting that IgW may retain features of the primordial immunoglobulin in evolution.
Listorti, Valeria; Laconi, Andrea; Catelli, Elena; Cecchinato, Mattia; Lupini, Caterina; Naylor, Clive J
2017-10-09
IBV genotype QX causes sufficient disease in Europe for several commercial companies to have started developing live attenuated vaccines. Here, one of those vaccines (L1148) was fully consensus sequenced alongside its progenitor field strain (1148-A) to determine vaccine markers, thereby enabling detection on farms. Twenty-eight single nucleotide substitutions were associated with the 1148-A attenuation, of which any combination can identify vaccine L1148 in the field. Sixteen substitutions resulted in amino acid coding changes of which half were in spike. One change in the 1b gene altered the normally highly conserved final 5 nucleotides of the transcription regulatory sequence of the S gene, common to all IBV QX genes. No mutations can currently be associated with the attenuation process. Field vaccination strategies would greatly benefit by such comparative sequence data being mandatorily submitted to regulators prior to vaccine release following a successful registration process. Copyright © 2017. Published by Elsevier Ltd.
Regulated expression of the Ras effector Rin1 in forebrain neurons
Dzudzor, Bartholomew; Huynh, Lucia; Thai, Minh; Bliss, Joanne M.; Nagaoka, Yoshiko; Wang, Ying; Ch'ng, Toh Hean; Jiang, Meisheng; Martin, Kelsey C.; Colicelli, John
2009-01-01
The Ras effector Rin1 is induced concomitant with synaptogenesis in forebrain neurons, where it inhibits fear conditioning and amygdala LTP. In epithelial cells, lower levels of Rin1 orchestrate receptor endocytosis. A 945bp Rin1 promoter fragment was active in hippocampal neurons and directed accurate tissue-specific and temporal expression in transgenic mice. Regulated expression in neurons and epithelial cells was mediated in part by Snail transcriptional repressors: mutation of a conserved Snail site increased expression and endogenous Snai1 was detected at the Rin1 promoter. We also describe an element closely related to, but distinct from, the consensus site for REST, a master repressor of neuronal genes. Conversion to a consensus REST sequence reduced expression in both cell types. These results provide insight into regulated expression of a neuronal Ras effector, define a promoter useful in telencephalic neuron studies, and describe a novel REST site variant directing expression to mature neurons. PMID:19837165
Yasukawa, Hiro; Kuroita, Toshihiro; Tamura, Kentaro; Yamaguchi, Kazuo
2003-07-01
Penicillin binding proteins (PBPs) are penicillin-sensitive DD-peptidases catalyzing the terminal stages of bacterial cell wall assembly. We identified a Dictyostelium discoideum gene that encodes a protein of 522 amino acids showing similarity to Escherichia coli PBP4. The D. discoideum protein conserves three consensus sequences (SXXK, SXN and KTG) that are responsible for the catalytic activities of PBPs. The gene product prepared in the cell-free translation system showed carboxypeptidase activity but the activity was not detected in the presence of penicillin G. These results demonstrate that the D. discoideum gene encodes a eukaryotic form of penicillin-sensitive carboxypeptidase.
Li, Fan; Ma, Liying; Feng, Yi; Hu, Jing; Ni, Na; Ruan, Yuhua; Shao, Yiming
2017-06-01
HIV-1 transmission in intravenous drug users (IDUs) has been characterized by high genetic multiplicity and suggests a greater challenge for HIV-1 infection blocking. We investigated a total of 749 sequences of full-length gp160 gene obtained by single genome sequencing (SGS) from 22 HIV-1 early infected IDUs in Xinjiang province, northwest China, and generated a transmitted and founder virus (T/F virus) consensus sequence (IDU.CON). The T/F virus was classified as subtype CRF07_BC and predicted to be CCR5-tropic virus. The variable region (V1, V2, and V4 loop) of IDU.CON showed length variation compared with the heterosexual T/F virus consensus sequence (HSX.CON) and homosexual T/F virus consensus sequence (MSM.CON). A total of 26 N-linked glycosylation sites were discovered in the IDU.CON sequence, which is less than that of MSM.CON and HSX.CON. Characterization of T/F virus from IDUs highlights the genetic make-up and complexity of virus near the moment of transmission or in early infection preceding systemic dissemination and is important toward the development of an effective HIV-1 preventive methods, including vaccines.
Peñafiel, Nicolás; Arteaga, Alejandro; Bustamante, Lucas; Pichardo, Frank; Coloma, Luis A; Barrio-Amorós, César L; Salazar-Valenzuela, David; Prost, Stefan
2018-01-01
Abstract Background Advancements in portable scientific instruments provide promising avenues to expedite field work in order to understand the diverse array of organisms that inhabit our planet. Here, we tested the feasibility for in situ molecular analyses of endemic fauna using a portable laboratory fitting within a single backpack in one of the world's most imperiled biodiversity hotspots, the Ecuadorian Chocó rainforest. We used portable equipment, including the MinION nanopore sequencer (Oxford Nanopore Technologies) and the miniPCR (miniPCR), to perform DNA extraction, polymerase chain reaction amplification, and real-time DNA barcoding of reptile specimens in the field. Findings We demonstrate that nanopore sequencing can be implemented in a remote tropical forest to quickly and accurately identify species using DNA barcoding, as we generated consensus sequences for species resolution with an accuracy of >99% in less than 24 hours after collecting specimens. The flexibility of our mobile laboratory further allowed us to generate sequence information at the Universidad Tecnológica Indoamérica in Quito for rare, endangered, and undescribed species. This includes the recently rediscovered Jambato toad, which was thought to be extinct for 28 years. Sequences generated on the MinION required as few as 30 reads to achieve high accuracy relative to Sanger sequencing, and with further multiplexing of samples, nanopore sequencing can become a cost-effective approach for rapid and portable DNA barcoding. Conclusions Overall, we establish how mobile laboratories and nanopore sequencing can help to accelerate species identification in remote areas to aid in conservation efforts and be applied to research facilities in developing countries. This opens up possibilities for biodiversity studies by promoting local research capacity building, teaching nonspecialists and students about the environment, tackling wildlife crime, and promoting conservation via research-focused ecotourism. PMID:29617771
Zhou, Gaofeng; Jian, Jianbo; Wang, Penghao; Li, Chengdao; Tao, Ye; Li, Xuan; Renshaw, Daniel; Clements, Jonathan; Sweetingham, Mark; Yang, Huaan
2018-01-01
An ultra-high density genetic map containing 34,574 sequence-defined markers was developed in Lupinus angustifolius. Markers closely linked to nine genes of agronomic traits were identified. A physical map was improved to cover 560.5 Mb genome sequence. Lupin (Lupinus angustifolius L.) is a recently domesticated legume grain crop. In this study, we applied the restriction-site associated DNA sequencing (RADseq) method to genotype an F 9 recombinant inbred line population derived from a wild type × domesticated cultivar (W × D) cross. A high density linkage map was developed based on the W × D population. By integrating sequence-defined DNA markers reported in previous mapping studies, we established an ultra-high density consensus genetic map, which contains 34,574 markers consisting of 3508 loci covering 2399 cM on 20 linkage groups. The largest gap in the entire consensus map was 4.73 cM. The high density W × D map and the consensus map were used to develop an improved physical map, which covered 560.5 Mb of genome sequence data. The ultra-high density consensus linkage map, the improved physical map and the markers linked to genes of breeding interest reported in this study provide a common tool for genome sequence assembly, structural genomics, comparative genomics, functional genomics, QTL mapping, and molecular plant breeding in lupin.
A tree of life based on ninety-eight expressed genes conserved across diverse eukaryotic species
Jayaswal, Pawan Kumar; Dogra, Vivek; Shanker, Asheesh; Sharma, Tilak Raj
2017-01-01
Rapid advances in DNA sequencing technologies have resulted in the accumulation of large data sets in the public domain, facilitating comparative studies to provide novel insights into the evolution of life. Phylogenetic studies across the eukaryotic taxa have been reported but on the basis of a limited number of genes. Here we present a genome-wide analysis across different plant, fungal, protist, and animal species, with reference to the 36,002 expressed genes of the rice genome. Our analysis revealed 9831 genes unique to rice and 98 genes conserved across all 49 eukaryotic species analysed. The 98 genes conserved across diverse eukaryotes mostly exhibited binding and catalytic activities and shared common sequence motifs; and hence appeared to have a common origin. The 98 conserved genes belonged to 22 functional gene families including 26S protease, actin, ADP–ribosylation factor, ATP synthase, casein kinase, DEAD-box protein, DnaK, elongation factor 2, glyceraldehyde 3-phosphate, phosphatase 2A, ras-related protein, Ser/Thr protein phosphatase family protein, tubulin, ubiquitin and others. The consensus Bayesian eukaryotic tree of life developed in this study demonstrated widely separated clades of plants, fungi, and animals. Musa acuminata provided an evolutionary link between monocotyledons and dicotyledons, and Salpingoeca rosetta provided an evolutionary link between fungi and animals, which indicating that protozoan species are close relatives of fungi and animals. The divergence times for 1176 species pairs were estimated accurately by integrating fossil information with synonymous substitution rates in the comprehensive set of 98 genes. The present study provides valuable insight into the evolution of eukaryotes. PMID:28922368
Grivas, Theodoros B; de Mauroy, Jean Claude; Négrini, Stefano; Kotwicki, Tomasz; Zaina, Fabio; Wynne, James H; Stokes, Ian A; Knott, Patrick; Pizzetti, Paolo; Rigo, Manuel; Villagrasa, Monica; Weiss, Hans Rudolf; Maruyama, Toru
2010-11-02
This report is the SOSORT Consensus Paper on Terminology for use in the treatment of conservative spinal deformities. Figures are provided and relevant literature is cited where appropriate. The Delphi method was used to reach a preliminary consensus before the meeting, where the terms that still needed further clarification were discussed. A final agreement was found for all the terms, which now constitute the base of this glossary. New terms will be added after being discussed and accepted. When only one set of terms is used for communication in a place or among a group of people, then everyone can clearly and efficiently communicate. This principle applies for any professional group. Until now, no common set of terms was available in the field of the conservative treatment of scoliosis and spinal deformities. This glossary gives a common base language to draw from to discuss data, findings and treatment.
Bisciotti, Gian Nicola; Volpi, Piero; Amato, Maurizio; Alberti, Giampietro; Allegra, Francesco; Aprato, Alessandro; Artina, Matteo; Auci, Alessio; Bait, Corrado; Bastieri, Gian Matteo; Balzarini, Luca; Belli, Andrea; Bellini, Gianandrea; Bettinsoli, Pierfrancesco; Bisciotti, Alessandro; Bisciotti, Andrea; Bona, Stefano; Brambilla, Lorenzo; Bresciani, Marco; Buffoli, Michele; Calanna, Filippo; Canata, Gian Luigi; Cardinali, Davide; Carimati, Giulia; Cassaghi, Gabriella; Cautero, Enrico; Cena, Emanuele; Corradini, Barbara; D'Agostino, Cristina; De Donato, Massimo; Delle Rose, Giacomo; Di Marzo, Francesco; Di Pietto, Francesco; Enrica, Drapchind; Eirale, Cristiano; Febbrari, Luigi; Ferrua, Paolo; Foglia, Andrea; Galbiati, Alberto; Gheza, Alberto; Giammattei, Carlo; Masia, Francesco; Melegati, Gianluca; Moretti, Biagio; Moretti, Lorenzo; Niccolai, Roberto; Orgiani, Antonio; Orizio, Claudio; Pantalone, Andrea; Parra, Federica; Patroni, Paolo; Pereira Ruiz, Maria Teresa; Perri, Marzio; Petrillo, Stefano; Pulici, Luca; Quaglia, Alessandro; Ricciotti, Luca; Rosa, Francesco; Sasso, Nicola; Sprenger, Claudio; Tarantola, Chiara; Tenconi, Fabio Gianpaolo; Tosi, Fabio; Trainini, Michele; Tucciarone, Agostino; Yekdah, Ali; Vuckovic, Zarko; Zini, Raul; Chamari, Karim
2018-01-01
Provide the state of the art concerning (1) biology and aetiology, (2) classification, (3) clinical assessment and (4) conservative treatment of lower limb muscle injuries (MI) in athletes. Seventy international experts with different medical backgrounds participated in the consensus conference. They discussed and approved a consensus composed of four sections which are presented in these documents. This paper represents a synthesis of the consensus conference, the following four sections are discussed: (i) The biology and aetiology of MIs. A definition of MI was formulated and some key points concerning physiology and pathogenesis of MIs were discussed. (ii) The MI classification. A classification of MIs was proposed. (iii) The MI clinical assessment, in which were discussed anamnesis, inspection and clinical examination and are provided the relative guidelines. (iv) The MI conservative treatment, in which are provided the guidelines for conservative treatment based on the severity of the lesion. Furthermore, instrumental therapy and pharmacological treatment were discussed. Knowledge of the aetiology and biology of MIs is an essential prerequisite in order to plan and conduct a rehabilitation plan. Another important aspect is the use of a rational MI classification on prognostic values. We propose a classification based on radiological investigations performed by ultrasonography and MRI strongly linked to prognostic factors. Furthermore, the consensus conference results will able to provide fundamental guidelines for diagnostic and rehabilitation practice, also considering instrumental therapy and pharmacological treatment of MI. Expert opinion, level IV. PMID:29862040
Zemla, Adam T; Lang, Dorothy M; Kostova, Tanya; Andino, Raul; Ecale Zhou, Carol L
2011-06-02
Most of the currently used methods for protein function prediction rely on sequence-based comparisons between a query protein and those for which a functional annotation is provided. A serious limitation of sequence similarity-based approaches for identifying residue conservation among proteins is the low confidence in assigning residue-residue correspondences among proteins when the level of sequence identity between the compared proteins is poor. Multiple sequence alignment methods are more satisfactory--still, they cannot provide reliable results at low levels of sequence identity. Our goal in the current work was to develop an algorithm that could help overcome these difficulties by facilitating the identification of structurally (and possibly functionally) relevant residue-residue correspondences between compared protein structures. Here we present StralSV (structure-alignment sequence variability), a new algorithm for detecting closely related structure fragments and quantifying residue frequency from tight local structure alignments. We apply StralSV in a study of the RNA-dependent RNA polymerase of poliovirus, and we demonstrate that the algorithm can be used to determine regions of the protein that are relatively unique, or that share structural similarity with proteins that would be considered distantly related. By quantifying residue frequencies among many residue-residue pairs extracted from local structural alignments, one can infer potential structural or functional importance of specific residues that are determined to be highly conserved or that deviate from a consensus. We further demonstrate that considerable detailed structural and phylogenetic information can be derived from StralSV analyses. StralSV is a new structure-based algorithm for identifying and aligning structure fragments that have similarity to a reference protein. StralSV analysis can be used to quantify residue-residue correspondences and identify residues that may be of particular structural or functional importance, as well as unusual or unexpected residues at a given sequence position. StralSV is provided as a web service at http://proteinmodel.org/AS2TS/STRALSV/.
Mohammad, Dara K.; Ali, Raja H.; Turunen, Janne J.; Nore, Beston F.; Smith, C. I. Edvard
2016-01-01
Protein kinase B (AKT) phosphorylates numerous substrates on the consensus motif RXRXXpS/T, a docking site for 14-3-3 interactions. To identify novel AKT-induced phosphorylation events following B cell receptor (BCR) activation, we performed proteomics, biochemical and bioinformatics analyses. Phosphorylated consensus motif-specific antibody enrichment, followed by tandem mass spectrometry, identified 446 proteins, containing 186 novel phosphorylation events. Moreover, we found 85 proteins with up regulated phosphorylation, while in 277 it was down regulated following stimulation. Up regulation was mainly in proteins involved in ribosomal and translational regulation, DNA binding and transcription regulation. Conversely, down regulation was preferentially in RNA binding, mRNA splicing and mRNP export proteins. Immunoblotting of two identified RNA regulatory proteins, RBM25 and MEF-2D, confirmed the proteomics data. Consistent with these findings, the AKT-inhibitor (MK-2206) dramatically reduced, while the mTORC-inhibitor PP242 totally blocked phosphorylation on the RXRXXpS/T motif. This demonstrates that this motif, previously suggested as an AKT target sequence, also is a substrate for mTORC1/2. Proteins with PDZ, PH and/or SH3 domains contained the consensus motif, whereas in those with an HMG-box, H15 domains and/or NF-X1-zinc-fingers, the motif was absent. Proteins carrying the consensus motif were found in all eukaryotic clades indicating that they regulate a phylogenetically conserved set of proteins. PMID:27487157
Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.
2015-03-22
Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean ( Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we usemore » site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.
Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean ( Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we usemore » site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less
Henry, Kelli F; Kawashima, Tomokazu; Goldberg, Robert B
2015-06-01
Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean (Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we use site-directed mutagenesis experiments in transgenic tobacco globular-stage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. A homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.
Fujibuchi, Wataru; Anderson, John S. J.; Landsman, David
2001-01-01
Consensus pattern and matrix-based searches designed to predict cis-acting transcriptional regulatory sequences have historically been subject to large numbers of false positives. We sought to decrease false positives by incorporating expression profile data into a consensus pattern-based search method. We have systematically analyzed the expression phenotypes of over 6000 yeast genes, across 121 expression profile experiments, and correlated them with the distribution of 14 known regulatory elements over sequences upstream of the genes. Our method is based on a metric we term probabilistic element assessment (PEA), which is a ranking of potential sites based on sequence similarity in the upstream regions of genes with similar expression phenotypes. For eight of the 14 known elements that we examined, our method had a much higher selectivity than a naïve consensus pattern search. Based on our analysis, we have developed a web-based tool called PROSPECT, which allows consensus pattern-based searching of gene clusters obtained from microarray data. PMID:11574681
Tsangaras, Kyriakos; Mayer, Jens; Alquezar-Planas, David E; Greenwood, Alex D
2015-11-24
Transcriptome analysis of polar bear (Ursus maritimus) tissues identified sequences with similarity to Porcine Endogenous Retroviruses (PERV). Based on these sequences, four proviral copies and 15 solo long terminal repeats (LTRs) of a newly described endogenous retrovirus were characterized from the polar bear draft genome sequence. Closely related sequences were identified by PCR analysis of brown bear (Ursus arctos) and black bear (Ursus americanus) but were absent in non-Ursinae bear species. The virus was therefore designated UrsusERV. Two distinct groups of LTRs were observed including a recombinant ERV that contained one LTR belonging to each group indicating that genomic invasions by at least two UrsusERV variants have recently occurred. Age estimates based on proviral LTR divergence and conservation of integration sites among ursids suggest the viral group is only a few million years old. The youngest provirus was polar bear specific, had intact open reading frames (ORFs) and could potentially encode functional proteins. Phylogenetic analyses of UrsusERV consensus protein sequences suggest that it is part of a pig, gibbon and koala retrovirus clade. The young age estimates and lineage specificity of the virus suggests UrsusERV is a recent cross species transmission from an unknown reservoir and places the viral group among the youngest of ERVs identified in mammals.
Tsangaras, Kyriakos; Mayer, Jens; Alquezar-Planas, David E.; Greenwood, Alex D.
2015-01-01
Transcriptome analysis of polar bear (Ursus maritimus) tissues identified sequences with similarity to Porcine Endogenous Retroviruses (PERV). Based on these sequences, four proviral copies and 15 solo long terminal repeats (LTRs) of a newly described endogenous retrovirus were characterized from the polar bear draft genome sequence. Closely related sequences were identified by PCR analysis of brown bear (Ursus arctos) and black bear (Ursus americanus) but were absent in non-Ursinae bear species. The virus was therefore designated UrsusERV. Two distinct groups of LTRs were observed including a recombinant ERV that contained one LTR belonging to each group indicating that genomic invasions by at least two UrsusERV variants have recently occurred. Age estimates based on proviral LTR divergence and conservation of integration sites among ursids suggest the viral group is only a few million years old. The youngest provirus was polar bear specific, had intact open reading frames (ORFs) and could potentially encode functional proteins. Phylogenetic analyses of UrsusERV consensus protein sequences suggest that it is part of a pig, gibbon and koala retrovirus clade. The young age estimates and lineage specificity of the virus suggests UrsusERV is a recent cross species transmission from an unknown reservoir and places the viral group among the youngest of ERVs identified in mammals. PMID:26610552
Liu, Yanbin; Koh, Chong Mei John; Ngoh, Si Te; Ji, Lianghui
2015-10-26
Rhodosporidium and Rhodotorula are two genera of oleaginous red yeast with great potential for industrial biotechnology. To date, there is no effective method for inducible expression of proteins and RNAs in these hosts. We have developed a luciferase gene reporter assay based on a new codon-optimized LUC2 reporter gene (RtLUC2), which is flanked with CAR2 homology arms and can be integrated into the CAR2 locus in the nuclear genome at >90 % efficiency. We characterized the upstream DNA sequence of a D-amino acid oxidase gene (DAO1) from R. toruloides ATCC 10657 by nested deletions. By comparing the upstream DNA sequences of several putative DAO1 homologs of Basidiomycetous fungi, we identified a conserved DNA motif with a consensus sequence of AGGXXGXAGX11GAXGAXGG within a 0.2 kb region from the mRNA translation initiation site. Deletion of this motif led to strong mRNA transcription under non-inducing conditions. Interestingly, DAO1 promoter activity was enhanced about fivefold when the 108 bp intron 1 was included in the reporter construct. We identified a conserved CT-rich motif in the intron with a consensus sequence of TYTCCCYCTCCYCCCCACWYCCGA, deletion or point mutations of which drastically reduced promoter strength under both inducing and non-inducing conditions. Additionally, we created a selection marker-free DAO1-null mutant (∆dao1e) which displayed greatly improved inducible gene expression, particularly when both glucose and nitrogen were present in high levels. To avoid adding unwanted peptide to proteins to be expressed, we converted the original translation initiation codon to ATC and re-created a translation initiation codon at the start of exon 2. This promoter, named P DAO1-in1m1 , showed very similar luciferase activity to the wild-type promoter upon induction with D-alanine. The inducible system was tunable by adjusting the levels of inducers, carbon source and nitrogen source. The intron 1-containing DAO1 promoters coupled with a DAO1 null mutant makes an efficient and tight D-amino acid-inducible gene expression system in Rhodosporidium and Rhodotorula genera. The system will be a valuable tool for metabolic engineering and enzyme expression in these yeast hosts.
Divergence and evolution of homologous regions of Bombyx mori nuclear polyhedrosis virus.
Majima, K; Kobara, R; Maeda, S
1993-01-01
Homologous regions (hrs) (hr1,hr2-left,hr2-right,hr3,hr4-left,hr 4-right, and hr5) similar to those found in the Autographa californica nuclear polyhedrosis virus (AcNPV) genome were found in the Bombyx mori NPV (BmNPV) genome. The BmNPV hrs contained two to eight repeats of a homologous nucleotide sequence which were on average about 75 bp long. All of these homologous sequence repeats contained a 26-bp-long palindrome motif with an EcoRI or EcoRI-like site at its core. The consensus sequence of the BmNPV hrs showed 95% conservation with respect to those found in AcNPV. Nucleotide sequence analysis indicated that hr2-left and hr2-right of BmNPV evolved from an ancestor similar to hr2 of AcNPV by inversion, cleavage, and ligation. The polarities of the BmNPV and AcNPV hrs were conserved except for that of hr4-left. Within hr4-right of BmNPV, four repeats of a previously underscribed palindrome motif were found. Bmhr5D, a BmNPV mutant which lacked hr5, replicated at a rate similar to that of wild-type BmNPV in BmN cells and silkworm larvae, indicating that hr5 was not essential for viral replication. After ten passages of Bmhr5D in BmN cells, no detectable changes in its genome were observed by restriction endonuclease analysis. The evolution and divergence of the BmNPV genome are also discussed. Images PMID:8230471
Singh, B N; Mudgil, Yashwanti; Sopory, S K; Reddy, M K
2003-07-01
We have successfully expressed enzymatically active plant topoisomerase II in Escherichia coli for the first time, which has enabled its biochemical characterization. Using a PCR-based strategy, we obtained a full-length cDNA and the corresponding genomic clone of tobacco topoisomerase II. The genomic clone has 18 exons interrupted by 17 introns. Most of the 5' and 3' splice junctions follow the typical canonical consensus dinucleotide sequence GU-AG present in other plant introns. The position of introns and phasing with respect to primary amino acid sequence in tobacco TopII and Arabidopsis TopII are highly conserved, suggesting that the two genes are evolved from the common ancestral type II topoisomerase gene. The cDNA encodes a polypeptide of 1482 amino acids. The primary amino acid sequence shows a striking sequence similarity, preserving all the structural domains that are conserved among eukaryotic type II topoisomerases in an identical spatial order. We have expressed the full-length polypeptide in E. coli and purified the recombinant protein to homogeneity. The full-length polypeptide relaxed supercoiled DNA and decatenated the catenated DNA in a Mg(2+)- and ATP-dependent manner, and this activity was inhibited by 4'-(9-acridinylamino)-3'-methoxymethanesulfonanilide (m-AMSA). The immunofluorescence and confocal microscopic studies, with antibodies developed against the N-terminal region of tobacco recombinant topoisomerase II, established the nuclear localization of topoisomerase II in tobacco BY2 cells. The regulated expression of tobacco topoisomerase II gene under the GAL1 promoter functionally complemented a temperature-sensitive TopII(ts) yeast mutant.
A genosensor for detection of consensus DNA sequence of Dengue virus using ZnO/Pt-Pd nanocomposites.
Singhal, Chaitali; Pundir, C S; Narang, Jagriti
2017-11-15
An electrochemical genosensor based on Zinc oxide/platinum-palladium (ZnO/Pt-Pd) modified fluorine doped tin oxide (FTO) glass plate was fabricated for detection of consensus DNA sequence of Dengue virus (DENV) using methylene blue (MB) as an intercalating agent. To achieve it, probe DNA (PDNA) was immobilized on the surface of ZnO/Pt-Pd nanocomposites modified FTO electrode. The synthesized nano-composites were characterized by high resolution transmission electron microscopy (HRTEM), energy dispersive X-ray analysis (EDX), atomic force microscopy (AFM), scanning electron microscopy (SEM), UV-Vis spectroscopy, X-ray diffraction (XRD) analysis and Fourier transform infra-red (FTIR) spectroscopy. This PDNA modified electrode (PDNA/ZnO/Pt-Pd/FTO) served as a signal amplification platform for the detection of the target hybridized DNA (TDNA). The hybridization between PDNA and TDNA was detected by reduction in current, generated by interaction of anionic mediator, i.e., methylene blue (MB) with free guanine (3'G) of ssDNA. The sensor showed a dynamic linear range of 1 × 10 -6 M to 100 × 10 -6 M with LOD as 4.3 × 10 -5 M and LOQ as 9.5 × 10 -5 M. Till date, majorly serotype specific biosensors for dengue detection have been developed. The genosensor reported here eliminates the possibility of false result as in case of serotype specific DNA sensor. This is the report where conserved sequences present in all the serotypes of Dengue virus has been employed for fabrication of a genosensor. Copyright © 2017 Elsevier B.V. All rights reserved.
Harrison, Robert A; Ibison, Frances; Wilbraham, Davina; Wagstaff, Simon C
2007-05-01
The immobilisation of prey by snakes is most efficiently achieved by the rapid dissemination of venom from its site of injection into the blood stream. Hyaluronidase is a common component of snake venoms and has been termed the "venom spreading factor". In the absence of nucleotide or protein sequence data to confirm the functional identity of this venom component, we interrogated a venom gland EST database for the saw-scaled viper, Echis ocellatus (Nigeria), using the gene ontology (GO) term "carbohydrate metabolism". A single hyalurononglucosaminadase-activity matching sequence (EOC00242) was found and used to design PCR primers to acquire the full-length cDNA sequence. Although very different from the bee venom and mammalian hyaluronidase sequences, the E. ocellatus sequence retained all the catalytic, positional and structural residues that characterise this class of carbohydrate metabolising hydrolases. An extraordinarily high level of sequence identity (>95%) was observed in analogous venom gland cDNA sequences isolated (by PCR) from another saw-scaled viper species, E. pyramidum leakeyi (Kenya), and from the sahara horned viper, Cerastes cerastes cerastes (Egypt) and the puff adder, Bitis arietans (Nigeria). Smaller amplicons, lacking hyaluronidase catalytic residues because of 768 bp or 855 bp central deletions, appear to encode either truncated peptides without hyaluronidase activity, or are non-translated transcripts because they lack consensus translation initiating motifs.
Integrative View of the Diversity and Evolution of SWEET and SemiSWEET Sugar Transporters
Jia, Baolei; Zhu, Xiao Feng; Pu, Zhong Ji; Duan, Yu Xi; Hao, Lu Jiang; Zhang, Jie; Chen, Li-Qing; Jeon, Che Ok; Xuan, Yuan Hu
2017-01-01
Sugars Will Eventually be Exported Transporter (SWEET) and SemiSWEET are recently characterized families of sugar transporters in eukaryotes and prokaryotes, respectively. SemiSWEETs contain 3 transmembrane helices (TMHs), while SWEETs contain 7. Here, we performed sequence-based comprehensive analyses for SWEETs and SemiSWEETs across the biosphere. In total, 3,249 proteins were identified and ≈60% proteins were found in green plants and Oomycota, which include a number of important plant pathogens. Protein sequence similarity networks indicate that proteins from different organisms are significantly clustered. Of note, SemiSWEETs with 3 or 4 TMHs that may fuse to SWEET were identified in plant genomes. 7-TMH SWEETs were found in bacteria, implying that SemiSWEET can be fused directly in prokaryote. 15-TMH extraSWEET and 25-TMH superSWEET were also observed in wild rice and oomycetes, respectively. The transporters can be classified into 4, 2, 2, and 2 clades in plants, Metazoa, unicellular eukaryotes, and prokaryotes, respectively. The consensus and coevolution of amino acids in SWEETs were identified by multiple sequence alignments. The functions of the highly conserved residues were analyzed by molecular dynamics analysis. The 19 most highly conserved residues in the SWEETs were further confirmed by point mutagenesis using SWEET1 from Arabidopsis thaliana. The results proved that the conserved residues located in the extrafacial gate (Y57, G58, G131, and P191), the substrate binding pocket (N73, N192, and W176), and the intrafacial gate (P43, Y83, F87, P145, M161, P162, and Q202) play important roles for substrate recognition and transport processes. Taken together, our analyses provide a foundation for understanding the diversity, classification, and evolution of SWEETs and SemiSWEETs using large-scale sequence analysis and further show that gene duplication and gene fusion are important factors driving the evolution of SWEETs. PMID:29326750
Integrative View of the Diversity and Evolution of SWEET and SemiSWEET Sugar Transporters.
Jia, Baolei; Zhu, Xiao Feng; Pu, Zhong Ji; Duan, Yu Xi; Hao, Lu Jiang; Zhang, Jie; Chen, Li-Qing; Jeon, Che Ok; Xuan, Yuan Hu
2017-01-01
Sugars Will Eventually be Exported Transporter (SWEET) and SemiSWEET are recently characterized families of sugar transporters in eukaryotes and prokaryotes, respectively. SemiSWEETs contain 3 transmembrane helices (TMHs), while SWEETs contain 7. Here, we performed sequence-based comprehensive analyses for SWEETs and SemiSWEETs across the biosphere. In total, 3,249 proteins were identified and ≈60% proteins were found in green plants and Oomycota, which include a number of important plant pathogens. Protein sequence similarity networks indicate that proteins from different organisms are significantly clustered. Of note, SemiSWEETs with 3 or 4 TMHs that may fuse to SWEET were identified in plant genomes. 7-TMH SWEETs were found in bacteria, implying that SemiSWEET can be fused directly in prokaryote. 15-TMH extraSWEET and 25-TMH superSWEET were also observed in wild rice and oomycetes, respectively. The transporters can be classified into 4, 2, 2, and 2 clades in plants, Metazoa, unicellular eukaryotes, and prokaryotes, respectively. The consensus and coevolution of amino acids in SWEETs were identified by multiple sequence alignments. The functions of the highly conserved residues were analyzed by molecular dynamics analysis. The 19 most highly conserved residues in the SWEETs were further confirmed by point mutagenesis using SWEET1 from Arabidopsis thaliana . The results proved that the conserved residues located in the extrafacial gate (Y57, G58, G131, and P191), the substrate binding pocket (N73, N192, and W176), and the intrafacial gate (P43, Y83, F87, P145, M161, P162, and Q202) play important roles for substrate recognition and transport processes. Taken together, our analyses provide a foundation for understanding the diversity, classification, and evolution of SWEETs and SemiSWEETs using large-scale sequence analysis and further show that gene duplication and gene fusion are important factors driving the evolution of SWEETs.
Expression of ADP-ribosylation factor (ARF)-like protein 6 during mouse embryonic development.
Takada, Tatsuyuki; Iida, Keiko; Sasaki, Hiroshi; Taira, Masanori; Kimura, Hiroshi
2005-01-01
ADP-ribosylation factor (ARF)-like protein 6 (ARL6) is a member of the ARF-like protein (ARL) subfamily of small GTPases (Moss, 1995; Chavrier, 1999). ARLs are highly conserved through evolution and most of them possess the consensus sequence required for GTP binding and hydrolysis (Pasquallato, 2002). Among ARLs, ARL6 which was initially isolated from a J2E erythroleukemic cell line is divergent in its consensus sequences and its expression has been shown to be limited to the brain and kidney in adult mouse (Ingley, 1999). Recently, it was reported that mutations of the ARL6 gene cause type 3 Bardet-Biedl syndrome in humans and that ARL6 is involved in ciliary transport in C. elegans (Chiang, 2004; Fan, 2004). Here, we investigated the expression pattern of ARL6 during early mouse development by whole-mount in situ hybridization and found that interestingly, ARL6 mRNA was localized around the node at 7.0-7.5 days post coitum (dpc) embryos, while weak expression was also found in the ectoderm. At the later stage (8.5 dpc) ARL6 was expressed in the neural plate and probably in the somites. Based on these results, a possible role of ARL6 in early development is discussed in relation to the findings in human and C. elegans (Chiang, 2004; Fan, 2004).
Comparison of MY09/11 consensus PCR and type-specific PCRs in the detection of oncogenic HPV types.
Depuydt, C E; Boulet, G A V; Horvath, C A J; Benoy, I H; Vereecken, A J; Bogers, J J
2007-01-01
The causal relationship between persistent infection with high-risk HPV and cervical cancer has resulted in the development of HPV DNA detection systems. The widely used MY09/11 consensus PCR targets a 450bp conserved sequence in the HPV L1 gene, and can therefore amplify a broad spectrum of HPV types. However, limitations of these consensus primers are evident, particularly in regard to the variability in detection sensitivity among different HPV types. This study compared MY09/11 PCR with type-specific PCRs in the detection of oncogenic HPV types. The study population comprised 15, 774 patients. Consensus PCR failed to detect 522 (10.9%) HPV infections indicated by type-specific PCRs. A significant correlation between failure of consensus PCR and HPV type was found. HPV types 51, 68 and 45 were missed most frequently. The clinical relevance of the HPV infections missed by MY09/11 PCR was reflected in the fraction of cases with cytological abnormalities and in follow-up, showing 104 (25.4%) CIN2+ cases. The MY09/11 false negativity could be the result of poor sensitivity, mismatch of MY09/11 primers or disruption of L1 target by HPV integration or DNA degradation. Furthermore, MY09/11 PCR lacked specificity for oncogenic HPVs. Diagnostic accuracy of the PCR systems, in terms of sensitivity (MY09/11 PCR: 87.9%; type-specific PCRs: 98.3%) and specificity (MY09/11 PCR: 38.7%; type-specific PCRs: 76.14%), and predictive values for histologically confirmed CIN2+, suggest that type-specific PCRs could be used in a clinical setting as a reliable screening tool.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zemla, A; Lang, D; Kostova, T
2010-11-29
Most of the currently used methods for protein function prediction rely on sequence-based comparisons between a query protein and those for which a functional annotation is provided. A serious limitation of sequence similarity-based approaches for identifying residue conservation among proteins is the low confidence in assigning residue-residue correspondences among proteins when the level of sequence identity between the compared proteins is poor. Multiple sequence alignment methods are more satisfactory - still, they cannot provide reliable results at low levels of sequence identity. Our goal in the current work was to develop an algorithm that could overcome these difficulties and facilitatemore » the identification of structurally (and possibly functionally) relevant residue-residue correspondences between compared protein structures. Here we present StralSV, a new algorithm for detecting closely related structure fragments and quantifying residue frequency from tight local structure alignments. We apply StralSV in a study of the RNA-dependent RNA polymerase of poliovirus and demonstrate that the algorithm can be used to determine regions of the protein that are relatively unique or that shared structural similarity with structures that are distantly related. By quantifying residue frequencies among many residue-residue pairs extracted from local alignments, one can infer potential structural or functional importance of specific residues that are determined to be highly conserved or that deviate from a consensus. We further demonstrate that considerable detailed structural and phylogenetic information can be derived from StralSV analyses. StralSV is a new structure-based algorithm for identifying and aligning structure fragments that have similarity to a reference protein. StralSV analysis can be used to quantify residue-residue correspondences and identify residues that may be of particular structural or functional importance, as well as unusual or unexpected residues at a given sequence position.« less
The Functional Human C-Terminome
Hedden, Michael; Lyon, Kenneth F.; Brooks, Steven B.; David, Roxanne P.; Limtong, Justin; Newsome, Jacklyn M.; Novakovic, Nemanja; Rajasekaran, Sanguthevar; Thapar, Vishal; Williams, Sean R.; Schiller, Martin R.
2016-01-01
All translated proteins end with a carboxylic acid commonly called the C-terminus. Many short functional sequences (minimotifs) are located on or immediately proximal to the C-terminus. However, information about the function of protein C-termini has not been consolidated into a single source. Here, we built a new “C-terminome” database and web system focused on human proteins. Approximately 3,600 C-termini in the human proteome have a minimotif with an established molecular function. To help evaluate the function of the remaining C-termini in the human proteome, we inferred minimotifs identified by experimentation in rodent cells, predicted minimotifs based upon consensus sequence matches, and predicted novel highly repetitive sequences in C-termini. Predictions can be ranked by enrichment scores or Gene Evolutionary Rate Profiling (GERP) scores, a measurement of evolutionary constraint. By searching for new anchored sequences on the last 10 amino acids of proteins in the human proteome with lengths between 3–10 residues and up to 5 degenerate positions in the consensus sequences, we have identified new consensus sequences that predict instances in the majority of human genes. All of this information is consolidated into a database that can be accessed through a C-terminome web system with search and browse functions for minimotifs and human proteins. A known consensus sequence-based predicted function is assigned to nearly half the proteins in the human proteome. Weblink: http://cterminome.bio-toolkit.com. PMID:27050421
Polypeptide p41 of a Norwalk-Like Virus Is a Nucleic Acid-Independent Nucleoside Triphosphatase
Pfister, Thomas; Wimmer, Eckard
2001-01-01
Southampton virus (SHV) is a member of the Norwalk-like viruses (NLVs), one of four genera of the family Caliciviridae. The genome of SHV contains three open reading frames (ORFs). ORF 1 encodes a polyprotein that is autocatalytically processed into six proteins, one of which is p41. p41 shares sequence motifs with protein 2C of picornaviruses and superfamily 3 helicases. We have expressed p41 of SHV in bacteria. Purified p41 exhibited nucleoside triphosphate (NTP)-binding and NTP hydrolysis activities. The NTPase activity was not stimulated by single-stranded nucleic acids. SHV p41 had no detectable helicase activity. Protein sequence comparison between the consensus sequences of NLV p41 and enterovirus protein 2C revealed regions of high similarity. According to secondary structure prediction, the conserved regions were located within a putative central domain of alpha helices and beta strands. This study reveals for the first time an NTPase activity associated with a calicivirus-encoded protein. Based on enzymatic properties and sequence information, a functional relationship between NLV p41 and enterovirus 2C is discussed in regard to the role of 2C-like proteins in virus replication. PMID:11160659
Genomic Structure of the Luciferase Gene from the Bioluminescent Beetle, Nyctophila cf. Caucasica
Day, John C.; Chaichi, Mohammad J.; Najafil, Iraj; Whiteley, Andrew S.
2006-01-01
The gene coding for beetle luciferase, the enzyme responsible for bioluminescence in over two thousand coleopteran species has, to date, only been characterized from one Palearctic species of Lampyridae. Here we report the characterization of the luciferase gene from a female beetle of an Iranian lampyrid species, Nyctophila cf. caucasica (Coleoptera:Lampyridae). The luciferase gene was composed of seven exons, coding for 547 amino acids, separated by six introns spanning 1976 bp of genomic DNA. The deduced amino acid sequences of the luciferase gene of N. caucasica showed 98.9% homology to that of the Palearctic species Lampyris noctiluca. Analysis of the 810 bp upstream region of the luciferase gene revealed three TATA boxes and several other consensus transcriptional factor recognition sequences presenting evidence for a putative core promoter region conserved in Lampyrinae from -190 through to -155 upstream of the luciferase start codon. Along with the core promoter region the luciferase gene was compared with orthologous sequences from other lampyrid species and found to have greatest identity to Lampyris turkistanicus and Lampyris noctiluca. The significant sequence identity to the former is discussed in relation to taxonomic issues of Iranian lampyrids. PMID:20298115
Dai, Qi; Ren, Aiming; Westholm, Jakub O; Duan, Hong; Patel, Dinshaw J; Lai, Eric C
2015-01-01
Recently, the BEN (BANP, E5R, and NAC1) domain was recognized as a new class of conserved DNA-binding domain. The fly genome encodes three proteins that bear only a single BEN domain ("BEN-solo" factors); namely, Insensitive (Insv), Bsg25A (Elba1), and CG9883 (Elba2). Insv homodimers preferentially bind CCAATTGG palindromes throughout the genome to mediate transcriptional repression, whereas Bsg25A and Elba2 heterotrimerize with their obligate adaptor, Elba3 (i.e., the ELBA complex), to recognize a CCAATAAG motif in the Fab-7 insulator. While these data suggest distinct DNA-binding properties of BEN-solo proteins, we performed reporter assays that indicate that both Bsg25A and Elba2 can individually recognize Insv consensus sites efficiently. We confirmed this by solving the structure of Bsg25A complexed to the Insv site, which showed that key aspects of the BEN:DNA recognition strategy are similar between these proteins. We next show that both Insv and ELBA proteins are competent to mediate transcriptional repression via Insv consensus sequences but that the ELBA complex appears to be selective for the ELBA site. Reciprocally, genome-wide analysis reveals that Insv exhibits significant cobinding to class I insulator elements, indicating that it may also contribute to insulator function. Indeed, we observed abundant Insv binding within the Hox complexes with substantial overlaps with class I insulators, many of which bear Insv consensus sites. Moreover, Insv coimmunoprecipitates with the class I insulator factor CP190. Finally, we observed that Insv harbors exclusive activity among fly BEN-solo factors with respect to regulation of Notch-mediated cell fate choices in the peripheral nervous system. This in vivo activity is recapitulated by BEND6, a mammalian BEN-solo factor that conserves the Notch corepressor function of Insv but not its capacity to bind Insv consensus sites. Altogether, our data define an array of common and distinct biochemical and functional properties of this new family of transcription factors. © 2015 Dai et al.; Published by Cold Spring Harbor Laboratory Press.
Dai, Qi; Ren, Aiming; Westholm, Jakub O.; Duan, Hong; Patel, Dinshaw J.
2015-01-01
Recently, the BEN (BANP, E5R, and NAC1) domain was recognized as a new class of conserved DNA-binding domain. The fly genome encodes three proteins that bear only a single BEN domain (“BEN-solo” factors); namely, Insensitive (Insv), Bsg25A (Elba1), and CG9883 (Elba2). Insv homodimers preferentially bind CCAATTGG palindromes throughout the genome to mediate transcriptional repression, whereas Bsg25A and Elba2 heterotrimerize with their obligate adaptor, Elba3 (i.e., the ELBA complex), to recognize a CCAATAAG motif in the Fab-7 insulator. While these data suggest distinct DNA-binding properties of BEN-solo proteins, we performed reporter assays that indicate that both Bsg25A and Elba2 can individually recognize Insv consensus sites efficiently. We confirmed this by solving the structure of Bsg25A complexed to the Insv site, which showed that key aspects of the BEN:DNA recognition strategy are similar between these proteins. We next show that both Insv and ELBA proteins are competent to mediate transcriptional repression via Insv consensus sequences but that the ELBA complex appears to be selective for the ELBA site. Reciprocally, genome-wide analysis reveals that Insv exhibits significant cobinding to class I insulator elements, indicating that it may also contribute to insulator function. Indeed, we observed abundant Insv binding within the Hox complexes with substantial overlaps with class I insulators, many of which bear Insv consensus sites. Moreover, Insv coimmunoprecipitates with the class I insulator factor CP190. Finally, we observed that Insv harbors exclusive activity among fly BEN-solo factors with respect to regulation of Notch-mediated cell fate choices in the peripheral nervous system. This in vivo activity is recapitulated by BEND6, a mammalian BEN-solo factor that conserves the Notch corepressor function of Insv but not its capacity to bind Insv consensus sites. Altogether, our data define an array of common and distinct biochemical and functional properties of this new family of transcription factors. PMID:25561495
Auvray, F; Coddeville, M; Ritzenthaler, P; Dupont, L
1997-01-01
Bacteriophage mv4 is a temperate phage infecting Lactobacillus delbrueckii subsp. bulgaricus. During lysogenization, the phage integrates its genome into the host chromosome at the 3' end of a tRNA(Ser) gene through a site-specific recombination process (L. Dupont et al., J. Bacteriol., 177:586-595, 1995). A nonreplicative vector (pMC1) based on the mv4 integrative elements (attP site and integrase-coding int gene) is able to integrate into the chromosome of a wide range of bacterial hosts, including Lactobacillus plantarum, Lactobacillus casei (two strains), Lactococcus lactis subsp. cremoris, Enterococcus faecalis, and Streptococcus pneumoniae. Integrative recombination of pMC1 into the chromosomes of all of these species is dependent on the int gene product and occurs specifically at the pMC1 attP site. The isolation and sequencing of pMC1 integration sites from these bacteria showed that in lactobacilli, pMC1 integrated into the conserved tRNA(Ser) gene. In the other bacterial species where this tRNA gene is less or not conserved; secondary integration sites either in potential protein-coding regions or in intergenic DNA were used. A consensus sequence was deduced from the analysis of the different integration sites. The comparison of these sequences demonstrated the flexibility of the integrase for the bacterial integration site and suggested the importance of the trinucleotide CCT at the 5' end of the core in the strand exchange reaction. PMID:9068626
Wheat CBF gene family: identification of polymorphisms in the CBF coding sequence.
Mohseni, Sara; Che, Hua; Djillali, Zakia; Dumont, Estelle; Nankeu, Joseph; Danyluk, Jean
2012-12-01
Expression of cold-regulated genes needed for protection against freezing stress is mediated, in part, by the CBF transcription factor family. Previous studies with temperate cereals suggested that the CBF gene family in wheat was large, and that CBF genes were at the base of an important low temperature tolerance trait. Therefore, the goal of our study was to identify the CBF repertoire in the freezing-tolerant hexaploid wheat cultivar Norstar, and then to examine if the coding region of CBF genes in two spring cultivars contain polymorphisms that could affect the protein sequence and structure. Our analyses reveal that hexaploid wheat contains a complex CBF family consisting of at least 65 CBF genes of which 60 are known to be expressed in the cultivar Norstar. They represent 27 paralogous genes with 1-3 homeologous copies for the A, B, and D genomes. The cultivar Norstar contains two pseudogenes and at least 24 additional proteins having sequences and (or) structures that deviate from the consensus in the conserved AP2 DNA-binding and (or) C-terminal activation-domains. This suggests that in cultivars such as Norstar, low temperature tolerance may be increased through breeding of additional optimal alleles. The examination of the CBF repertoire present in the two spring cultivars, Chinese Spring and Manitou, reveals that they have additional polymorphisms affecting conserved positions in these domains. Understanding the effects of these polymorphisms will provide additional information for the selection of optimum CBF alleles in Triticeae breeding programs.
Samal, Sweety; Kumar, Sachin; Khattar, Sunil K; Samal, Siba K
2011-10-01
A key determinant of Newcastle disease virus (NDV) virulence is the amino acid sequence at the fusion (F) protein cleavage site. The NDV F protein is synthesized as an inactive precursor, F(0), and is activated by proteolytic cleavage between amino acids 116 and 117 to produce two disulfide-linked subunits, F(1) and F(2). The consensus sequence of the F protein cleavage site of virulent [(112)(R/K)-R-Q-(R/K)-R↓F-I(118)] and avirulent [(112)(G/E)-(K/R)-Q-(G/E)-R↓L-I(118)] strains contains a conserved glutamine residue at position 114. Recently, some NDV strains from Africa and Madagascar were isolated from healthy birds and have been reported to contain five basic residues (R-R-R-K-R↓F-I/V or R-R-R-R-R↓F-I/V) at the F protein cleavage site. In this study, we have evaluated the role of this conserved glutamine residue in the replication and pathogenicity of NDV by using the moderately pathogenic Beaudette C strain and by making Q114R, K115R and I118V mutants of the F protein in this strain. Our results showed that changing the glutamine to a basic arginine residue reduced viral replication and attenuated the pathogenicity of the virus in chickens. The pathogenicity was further reduced when the isoleucine at position 118 was substituted for valine.
2010-01-01
Background This report is the SOSORT Consensus Paper on Terminology for use in the treatment of conservative spinal deformities. Figures are provided and relevant literature is cited where appropriate. Methods The Delphi method was used to reach a preliminary consensus before the meeting, where the terms that still needed further clarification were discussed. Results A final agreement was found for all the terms, which now constitute the base of this glossary. New terms will be added after being discussed and accepted. Discussion When only one set of terms is used for communication in a place or among a group of people, then everyone can clearly and efficiently communicate. This principle applies for any professional group. Until now, no common set of terms was available in the field of the conservative treatment of scoliosis and spinal deformities. This glossary gives a common base language to draw from to discuss data, findings and treatment. PMID:21044334
Duplication of the genome in normal and cancer cell cycles.
Bandura, Jennifer L; Calvi, Brian R
2002-01-01
It is critical to discover the mechanisms of normal cell cycle regulation if we are to fully understand what goes awry in cancer cells. The normal eukaryotic cell tightly regulates the activity of origins of DNA replication so that the genome is duplicated exactly once per cell cycle. Over the last ten years much has been learned concerning the cell cycle regulation of origin activity. It is now clear that the proteins and cell cycle mechanisms that control origin activity are largely conserved from yeast to humans. Despite this conservation, the composition of origins of DNA replication in higher eukaryotes remains ill defined. A DNA consensus for predicting origins has yet to emerge, and it is of some debate whether primary DNA sequence determines where replication initiates. In this review we outline what is known about origin structure and the mechanism of once per cell cycle DNA replication with an emphasis on recent advances in mammalian cells. We discuss the possible relevance of these regulatory pathways for cancer biology and therapy.
Specific DNA binding of the two chicken Deformed family homeodomain proteins, Chox-1.4 and Chox-a.
Sasaki, H; Yokoyama, E; Kuroiwa, A
1990-01-01
The cDNA clones encoding two chicken Deformed (Dfd) family homeobox containing genes Chox-1.4 and Chox-a were isolated. Comparison of their amino acid sequences with another chicken Dfd family homeodomain protein and with those of mouse homologues revealed that strong homologies are located in the amino terminal regions and around the homeodomains. Although homologies in other regions were relatively low, some short conserved sequences were also identified. E. coli-made full length proteins were purified and used for the production of specific antibodies and for DNA binding studies. The binding profiles of these proteins to the 5'-leader and 5'-upstream sequences of Chox-1.4 and Chox-a coding regions were analyzed by immunoprecipitation and DNase I footprint assays. These two Chox proteins bound to the same sites in the 5'-flanking sequences of their coding regions with various affinities and their binding affinities to each site were nearly the same. The consensus sequences of the high and low affinity binding sites were TAATGA(C/G) and CTAATTTT, respectively. A clustered binding site was identified in the 5'-upstream of the Chox-a gene, suggesting that this clustered binding site works as a cis-regulatory element for auto- and/or cross-regulation of Chox-a gene expression. Images PMID:1970866
Isolation and characterization of target sequences of the chicken CdxA homeobox gene.
Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A
1993-01-01
The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943
ERIC Educational Resources Information Center
Ivashevskii, S. L.
2011-01-01
These days politicians and scientists refer to the importance of consensus for understanding society's new ideological need, but the path to consensus is difficult. Political differences account for the wide variety of approaches to the problem. The United Russia Party supports a "conservative European" ideology, while the Communist…
Zhang, Limeng; Zhang, Hua; Fan, Ziyao; Zhou, Xue; Yu, Liquan; Sun, Hunan; Wu, Zhijun; Yu, Yongzhong; Song, Baifen; Ma, Jinzhu; Tong, Chunyu; Zhu, Zhanbo; Cui, Yudong
2015-02-01
Streptococcus dysgalactiae (S. dysgalactiae) GapC protein is a protective antigen that induces partial immunity against S. dysgalactiae infection in animals. To identify the conserved B-cell epitope of S. dysgalactiae GapC, a mouse monoclonal antibody 1E11 (mAb1E11) against GapC was generated and used to screen a phage-displayed 12-mer random peptide library (Ph.D.-12). Eleven positive clones recognized by mAb1E11 were identified, most of which matched the consensus motif TGFFAKK. Sequence of the motif exactly matched amino acids 97-103 of the S. dysgalactiae GapC. In addition, the epitope (97)TGFFAKK(103) showed high homology among different streptococcus species. Site-directed mutagenic analysis further confirmed that residues G98, F99, F100 and K103 formed the core of (97)TGFFAKK(103), and this core motif was the minimal determinant of the B-cell epitope recognized by the mAb1E11. Collectively, the identification of conserved B-cell epitope within S. dysgalactiae GapC highlights the possibility of developing the epitope-based vaccine. Copyright © 2014 Elsevier Ltd. All rights reserved.
Muchero, Wellington; Diop, Ndeye N; Bhat, Prasanna R; Fenton, Raymond D; Wanamaker, Steve; Pottorff, Marti; Hearne, Sarah; Cisse, Ndiaga; Fatokun, Christian; Ehlers, Jeffrey D; Roberts, Philip A; Close, Timothy J
2009-10-27
Consensus genetic linkage maps provide a genomic framework for quantitative trait loci identification, map-based cloning, assessment of genetic diversity, association mapping, and applied breeding in marker-assisted selection schemes. Among "orphan crops" with limited genomic resources such as cowpea [Vigna unguiculata (L.) Walp.] (2n = 2x = 22), the use of transcript-derived SNPs in genetic maps provides opportunities for automated genotyping and estimation of genome structure based on synteny analysis. Here, we report the development and validation of a high-throughput EST-derived SNP assay for cowpea, its application in consensus map building, and determination of synteny to reference genomes. SNP mining from 183,118 ESTs sequenced from 17 cDNA libraries yielded approximately 10,000 high-confidence SNPs from which an Illumina 1,536-SNP GoldenGate genotyping array was developed and applied to 741 recombinant inbred lines from six mapping populations. Approximately 90% of the SNPs were technically successful, providing 1,375 dependable markers. Of these, 928 were incorporated into a consensus genetic map spanning 680 cM with 11 linkage groups and an average marker distance of 0.73 cM. Comparison of this cowpea genetic map to reference legumes, soybean (Glycine max) and Medicago truncatula, revealed extensive macrosynteny encompassing 85 and 82%, respectively, of the cowpea map. Regions of soybean genome duplication were evident relative to the simpler diploid cowpea. Comparison with Arabidopsis revealed extensive genomic rearrangement with some conserved microsynteny. These results support evolutionary closeness between cowpea and soybean and identify regions for synteny-based functional genomics studies in legumes.
Singh, Aditya; Bhatia, Prateek
2016-12-01
Sanger sequencing platforms, such as applied biosystems instruments, generate chromatogram files. Generally, for 1 region of a sequence, we use both forward and reverse primers to sequence that area, in that way, we have 2 sequences that need to be aligned and a consensus generated before mutation detection studies. This work is cumbersome and takes time, especially if the gene is large with many exons. Hence, we devised a rapid automated command system to filter, build, and align consensus sequences and also optionally extract exonic regions, translate them in all frames, and perform an amino acid alignment starting from raw sequence data within a very short time. In full capabilities of Automated Mutation Analysis Pipeline (ASAP), it is able to read "*.ab1" chromatogram files through command line interface, convert it to the FASTQ format, trim the low-quality regions, reverse-complement the reverse sequence, create a consensus sequence, extract the exonic regions using a reference exonic sequence, translate the sequence in all frames, and align the nucleic acid and amino acid sequences to reference nucleic acid and amino acid sequences, respectively. All files are created and can be used for further analysis. ASAP is available as Python 3.x executable at https://github.com/aditya-88/ASAP. The version described in this paper is 0.28.
Conserved structure and inferred evolutionary history of long terminal repeats (LTRs)
2013-01-01
Background Long terminal repeats (LTRs, consisting of U3-R-U5 portions) are important elements of retroviruses and related retrotransposons. They are difficult to analyse due to their variability. The aim was to obtain a more comprehensive view of structure, diversity and phylogeny of LTRs than hitherto possible. Results Hidden Markov models (HMM) were created for 11 clades of LTRs belonging to Retroviridae (class III retroviruses), animal Metaviridae (Gypsy/Ty3) elements and plant Pseudoviridae (Copia/Ty1) elements, complementing our work with Orthoretrovirus HMMs. The great variation in LTR length of plant Metaviridae and the few divergent animal Pseudoviridae prevented building HMMs from both of these groups. Animal Metaviridae LTRs had the same conserved motifs as retroviral LTRs, confirming that the two groups are closely related. The conserved motifs were the short inverted repeats (SIRs), integrase recognition signals (5´TGTTRNR…YNYAACA 3´); the polyadenylation signal or AATAAA motif; a GT-rich stretch downstream of the polyadenylation signal; and a less conserved AT-rich stretch corresponding to the core promoter element, the TATA box. Plant Pseudoviridae LTRs differed slightly in having a conserved TATA-box, TATATA, but no conserved polyadenylation signal, plus a much shorter R region. The sensitivity of the HMMs for detection in genomic sequences was around 50% for most models, at a relatively high specificity, suitable for genome screening. The HMMs yielded consensus sequences, which were aligned by creating an HMM model (a ‘Superviterbi’ alignment). This yielded a phylogenetic tree that was compared with a Pol-based tree. Both LTR and Pol trees supported monophyly of retroviruses. In both, Pseudoviridae was ancestral to all other LTR retrotransposons. However, the LTR trees showed the chromovirus portion of Metaviridae clustering together with Pseudoviridae, dividing Metaviridae into two portions with distinct phylogeny. Conclusion The HMMs clearly demonstrated a unitary conserved structure of LTRs, supporting that they arose once during evolution. We attempted to follow the evolution of LTRs by tracing their functional foundations, that is, acquisition of RNAse H, a combined promoter/ polyadenylation site, integrase, hairpin priming and the primer binding site (PBS). Available information did not support a simple evolutionary chain of events. PMID:23369192
Gaynor, Kaitlyn M; Solomon, Joseph W; Siller, Stefanie; Jessell, Linnet; Duffy, J Emmett; Rubenstein, Dustin R
2017-11-01
Molecular markers are powerful tools for studying patterns of relatedness and parentage within populations and for making inferences about social evolution. However, the development of molecular markers for simultaneous study of multiple species presents challenges, particularly when species exhibit genome duplication or polyploidy. We developed microsatellite markers for Synalpheus shrimp, a genus in which species exhibit not only great variation in social organization, but also interspecific variation in genome size and partial genome duplication. From the four primary clades within Synalpheus, we identified microsatellites in the genomes of four species and in the consensus transcriptome of two species. Ultimately, we designed and tested primers for 143 microsatellite markers across 25 species. Although the majority of markers were disomic, many markers were polysomic for certain species. Surprisingly, we found no relationship between genome size and the number of polysomic markers. As expected, markers developed for a given species amplified better for closely related species than for more distant relatives. Finally, the markers developed from the transcriptome were more likely to work successfully and to be disomic than those developed from the genome, suggesting that consensus transcriptomes are likely to be conserved across species. Our findings suggest that the transcriptome, particularly consensus sequences from multiple species, can be a valuable source of molecular markers for taxa with complex, duplicated genomes. © 2017 John Wiley & Sons Ltd.
Marck, Christian; Grosjean, Henri
2002-01-01
From 50 genomes of the three domains of life (7 eukarya, 13 archaea, and 30 bacteria), we extracted, analyzed, and compared over 4,000 sequences corresponding to cytoplasmic, nonorganellar tRNAs. For each genome, the complete set of tRNAs required to read the 61 sense codons was identified, which permitted revelation of three major anticodon-sparing strategies. Other features and sequence peculiarities analyzed are the following: (1) fit to the standard cloverleaf structure, (2) characteristic consensus sequences for elongator and initiator tDNAs, (3) frequencies of bases at each sequence position, (4) type and frequencies of conserved 2D and 3D base pairs, (5) anticodon/tDNA usages and anticodon-sparing strategies, (6) identification of the tRNA-Ile with anticodon CAU reading AUA, (7) size of variable arm, (8) occurrence and location of introns, (9) occurrence of 3'-CCA and 5'-extra G encoded at the tDNA level, and (10) distribution of the tRNA genes in genomes and their mode of transcription. Among all tRNA isoacceptors, we found that initiator tDNA-iMet is the most conserved across the three domains, yet domain-specific signatures exist. Also, according to which tRNA feature is considered (5'-extra G encoded in tDNAs-His, AUA codon read by tRNA-Ile with anticodon CAU, presence of intron, absence of "two-out-of-three" reading mode and short V-arm in tDNA-Tyr) Archaea sequester either with Bacteria or Eukarya. No common features between Eukarya and Bacteria not shared with Archaea could be unveiled. Thus, from the tRNomic point of view, Archaea appears as an "intermediate domain" between Eukarya and Bacteria. PMID:12403461
Alcántara, Cristina; Sarmiento-Rubiano, Luz Adriana; Monedero, Vicente; Deutscher, Josef; Pérez-Martínez, Gaspar; Yebra, María J.
2008-01-01
Sequence analysis of the five genes (gutRMCBA) downstream from the previously described sorbitol-6-phosphate dehydrogenase-encoding Lactobacillus casei gutF gene revealed that they constitute a sorbitol (glucitol) utilization operon. The gutRM genes encode putative regulators, while the gutCBA genes encode the EIIC, EIIBC, and EIIA proteins of a phosphoenolpyruvate-dependent sorbitol phosphotransferase system (PTSGut). The gut operon is transcribed as a polycistronic gutFRMCBA messenger, the expression of which is induced by sorbitol and repressed by glucose. gutR encodes a transcriptional regulator with two PTS-regulated domains, a galactitol-specific EIIB-like domain (EIIBGat domain) and a mannitol/fructose-specific EIIA-like domain (EIIAMtl domain). Its inactivation abolished gut operon transcription and sorbitol uptake, indicating that it acts as a transcriptional activator. In contrast, cells carrying a gutB mutation expressed the gut operon constitutively, but they failed to transport sorbitol, indicating that EIIBCGut negatively regulates GutR. A footprint analysis showed that GutR binds to a 35-bp sequence upstream from the gut promoter. A sequence comparison with the presumed promoter region of gut operons from various firmicutes revealed a GutR consensus motif that includes an inverted repeat. The regulation mechanism of the L. casei gut operon is therefore likely to be operative in other firmicutes. Finally, gutM codes for a conserved protein of unknown function present in all sequenced gut operons. A gutM mutant, the first constructed in a firmicute, showed drastically reduced gut operon expression and sorbitol uptake, indicating a regulatory role also for GutM. PMID:18676710
Radulović, Željko; Porter, Lindsay M.; Kim, Tae K.; Mulenga, Albert
2015-01-01
Organic anion-transporting polypeptides (Oatps) are an integral part of the detoxification mechanism in vertebrates and invertebrates. These cell surface proteins are involved in mediating the sodium-independent uptake and/or distribution of a broad array of organic amphipathic compounds and xenobiotic drugs. This study describes bioinformatics and biological characterization of 9 Oatp sequences in the Ixodes scapularis genome. These sequences have been annotated on the basis of 12 transmembrane domains, consensus motif D-X-RW-(I,V)-GAWW-X-G-(F,L)-L, and 11 conserved cysteine amino acid residues in the large extracellular loop 5 that characterize the Oatp superfamily. Ixodes scapularis Oatps may regulate non-redundant cross-tick species conserved functions in that they did not cluster as a monolithic group on the phylogeny tree and that they have orthologs in other ticks. Phylogeny clustering patterns also suggest that some tick Oatp sequences transport substrates that are similar to those of body louse, mosquito, eye worm, and filarial worm Oatps. Semi-quantitative RT-PCR analysis demonstrated that all 9 I. scapularis Oatp sequences were expressed during tick feeding. Ixodes scapularis Oatp genes potentially regulate functions during early and/or late-stage tick feeding as revealed by normalized mRNA profiles. Normalized transcript abundance indicates that I. scapularis Oatp genes are strongly expressed in unfed ticks during the first 24 h of feeding and/or at the end of the tick feeding process. Except for 2 I. scapularis Oatps, which were expressed in the salivary glands and ovaries, all other genes were expressed in all tested organs, suggesting the significance of I. scapularis Oatps in maintaining tick homeostasis. Different I. scapularis Oatp mRNA expression patterns were detected and discussed with reference to different physiological states of unfed and feeding ticks. PMID:24582512
Knierim, Dennis; Maiss, Edgar; Kenyon, Lawrence; Winter, Stephan; Menzel, Wulf
2015-10-01
Luffa aphid-borne yellows virus (LABYV) was proposed as the name for a previously undescribed polerovirus based on partial genome sequences obtained from samples of cucurbit plants collected in Thailand between 2008 and 2013. In this study, we determined the first full-length genome sequence of LABYV. Based on phylogenetic analysis and genome properties, it is clear that this virus represents a distinct species in the genus Polerovirus. Analysis of sequences from sample TH24, which was collected in 2010 from a luffa plant in Thailand, reveals the presence of two different full-length genome consensus sequences.
Zeng, Lu; Kortschak, R Daniel; Raison, Joy M; Bertozzi, Terry; Adelson, David L
2018-01-01
Transposable Elements (TEs) are mobile DNA sequences that make up significant fractions of amniote genomes. However, they are difficult to detect and annotate ab initio because of their variable features, lengths and clade-specific variants. We have addressed this problem by refining and developing a Comprehensive ab initio Repeat Pipeline (CARP) to identify and cluster TEs and other repetitive sequences in genome assemblies. The pipeline begins with a pairwise alignment using krishna, a custom aligner. Single linkage clustering is then carried out to produce families of repetitive elements. Consensus sequences are then filtered for protein coding genes and then annotated using Repbase and a custom library of retrovirus and reverse transcriptase sequences. This process yields three types of family: fully annotated, partially annotated and unannotated. Fully annotated families reflect recently diverged/young known TEs present in Repbase. The remaining two types of families contain a mixture of novel TEs and segmental duplications. These can be resolved by aligning these consensus sequences back to the genome to assess copy number vs. length distribution. Our pipeline has three significant advantages compared to other methods for ab initio repeat identification: 1) we generate not only consensus sequences, but keep the genomic intervals for the original aligned sequences, allowing straightforward analysis of evolutionary dynamics, 2) consensus sequences represent low-divergence, recently/currently active TE families, 3) segmental duplications are annotated as a useful by-product. We have compared our ab initio repeat annotations for 7 genome assemblies to other methods and demonstrate that CARP compares favourably with RepeatModeler, the most widely used repeat annotation package.
Zeng, Lu; Kortschak, R. Daniel; Raison, Joy M.
2018-01-01
Transposable Elements (TEs) are mobile DNA sequences that make up significant fractions of amniote genomes. However, they are difficult to detect and annotate ab initio because of their variable features, lengths and clade-specific variants. We have addressed this problem by refining and developing a Comprehensive ab initio Repeat Pipeline (CARP) to identify and cluster TEs and other repetitive sequences in genome assemblies. The pipeline begins with a pairwise alignment using krishna, a custom aligner. Single linkage clustering is then carried out to produce families of repetitive elements. Consensus sequences are then filtered for protein coding genes and then annotated using Repbase and a custom library of retrovirus and reverse transcriptase sequences. This process yields three types of family: fully annotated, partially annotated and unannotated. Fully annotated families reflect recently diverged/young known TEs present in Repbase. The remaining two types of families contain a mixture of novel TEs and segmental duplications. These can be resolved by aligning these consensus sequences back to the genome to assess copy number vs. length distribution. Our pipeline has three significant advantages compared to other methods for ab initio repeat identification: 1) we generate not only consensus sequences, but keep the genomic intervals for the original aligned sequences, allowing straightforward analysis of evolutionary dynamics, 2) consensus sequences represent low-divergence, recently/currently active TE families, 3) segmental duplications are annotated as a useful by-product. We have compared our ab initio repeat annotations for 7 genome assemblies to other methods and demonstrate that CARP compares favourably with RepeatModeler, the most widely used repeat annotation package. PMID:29538441
RhoA Regulation of Cardiomyocyte Differentiation
Kaarbø, Mari; Crane, Denis I.; Murrell, Wayne G.
2013-01-01
Earlier findings from our laboratory implicated RhoA in heart developmental processes. To investigate factors that potentially regulate RhoA expression, RhoA gene organisation and promoter activity were analysed. Comparative analysis indicated strict conservation of both gene organisation and coding sequence of the chick, mouse, and human RhoA genes. Bioinformatics analysis of the derived promoter region of mouse RhoA identified putative consensus sequence binding sites for several transcription factors involved in heart formation and organogenesis generally. Using luciferase reporter assays, RhoA promoter activity was shown to increase in mouse-derived P19CL6 cells that were induced to differentiate into cardiomyocytes. Overexpression of a dominant negative mutant of mouse RhoA (mRhoAN19) blocked this cardiomyocyte differentiation of P19CL6 cells and led to the accumulation of the cardiac transcription factors SRF and GATA4 and the early cardiac marker cardiac α-actin. Taken together, these findings indicate a fundamental role for RhoA in the differentiation of cardiomyocytes. PMID:23935420
Su, B; Fu, Y; Wang, Y; Jin, L; Chakraborty, R
2001-06-01
The red panda (Ailurus fulgens) is one of the flagship species in worldwide conservation and is of special interest in evolutionary studies due to its taxonomic uniqueness. We sequenced a 236-bp fragment of the mitochondrial D-loop region in a sample of 53 red pandas from two populations in southwestern China. Seventeen polymorphic sites were found, together with a total of 25 haplotypes, indicating a high level of genetic diversity in the red panda. However, no obvious genetic divergence was detected between the Sichuan and Yunnan populations. The consensus phylogenetic tree of the 25 haplotypes was starlike. The pairwise mismatch distribution fitted into a pattern of populations undergoing expansion. Furthermore, Fu's F(S) test of neutrality was significant for the total population (F(S) = -7.573), which also suggests a recent population expansion. Interestingly, the effective population size in the Sichuan population was both larger and more stable than that in the Yunnan population, implying a southward expansion from Sichuan to Yunnan.
Bowen, David M; Lewis, Jessica A; Lu, Wenzhe; Schein, Catherine H
2012-09-14
Designing proteins that reflect the natural variability of a pathogen is essential for developing novel vaccines and drugs. Flaviviruses, including Dengue (DENV) and West Nile (WNV), evolve rapidly and can "escape" neutralizing monoclonal antibodies by mutation. Designing antigens that represent many distinct strains is important for DENV, where infection with a strain from one of the four serotypes may lead to severe hemorrhagic disease on subsequent infection with a strain from another serotype. Here, a DENV physicochemical property (PCP)-consensus sequence was derived from 671 unique sequences from the Flavitrack database. PCP-consensus proteins for domain 3 of the envelope protein (EdomIII) were expressed from synthetic genes in Escherichia coli. The ability of the purified consensus proteins to bind polyclonal antibodies generated in response to infection with strains from each of the four DENV serotypes was determined. The initial consensus protein bound antibodies from DENV-1-3 in ELISA and Western blot assays. This sequence was altered in 3 steps to incorporate regions of maximum variability, identified as significant changes in the PCPs, characteristic of DENV-4 strains. The final protein was recognized by antibodies against all four serotypes. Two amino acids essential for efficient binding to all DENV antibodies are part of a discontinuous epitope previously defined for a neutralizing monoclonal antibody. The PCP-consensus method can significantly reduce the number of experiments required to define a multivalent antigen, which is particularly important when dealing with pathogens that must be tested at higher biosafety levels. Copyright © 2012 Elsevier Ltd. All rights reserved.
Identification of B Cells as a Major Site for Cyprinid Herpesvirus 3 Latency
Reed, Aimee N.; Izume, Satoko; Dolan, Brian P.; LaPatra, Scott; Kent, Michael; Dong, Jing
2014-01-01
ABSTRACT Cyprinid herpesvirus 3 (CyHV-3), commonly known as koi herpesvirus (KHV), is a member of the Alloherpesviridae, and is a recently discovered emerging herpesvirus that is highly pathogenic for koi and common carp. Our previous study demonstrated that CyHV-3 becomes latent in peripheral white blood cells (WBC). In this study, CyHV-3 latency was further investigated in IgM+ WBC. The presence of the CyHV-3 genome in IgM+ WBC was about 20-fold greater than in IgM− WBC. To determine whether CyHV-3 expressed genes during latency, transcription from all eight open reading frames (ORFs) in the terminal repeat was investigated in IgM+ WBC from koi with latent CyHV-3 infection. Only a spliced ORF6 transcript was found to be abundantly expressed in IgM+ WBC from CyHV-3 latently infected koi. The spliced ORF6 transcript was also detected in vitro during productive infection as early as 1 day postinfection. The ORF6 transcript from in vitro infection begins at −127 bp upstream of the ATG codon and ends +188 bp downstream of the stop codon, +20 bp downstream of the polyadenylation signal. The hypothetical protein of ORF6 contains a consensus sequence with homology to a conserved domain of EBNA-3B and ICP4 from Epstein-Barr virus and herpes simplex virus 1, respectively, both members of the Herpesviridae. This is the first report of latent CyHV-3 in B cells and identification of gene transcription during latency for a member of the Alloherpesviridae. IMPORTANCE This is the first demonstration that a member of the Alloherpesviridae, cyprinid herpesvirus 3 (CyHV-3), establishes a latent infection in the B cells of its host, Cyprinus carpio. In addition, this is the first report of identification of gene transcription during latency for a member of Herpesvirales outside Herpesviridae. This is also the first report that the hypothetical protein of latent transcript of CyHV-3 contains a consensus sequence with homology to a conserved domain of EBNA-3B from Epstein-Barr virus and ICP4 from herpes simplex virus 1, which are genes important for latency. These strongly suggest that latency is evolutionally conserved across vertebrates. PMID:24899202
Identification of B cells as a major site for cyprinid herpesvirus 3 latency.
Reed, Aimee N; Izume, Satoko; Dolan, Brian P; LaPatra, Scott; Kent, Michael; Dong, Jing; Jin, Ling
2014-08-01
Cyprinid herpesvirus 3 (CyHV-3), commonly known as koi herpesvirus (KHV), is a member of the Alloherpesviridae, and is a recently discovered emerging herpesvirus that is highly pathogenic for koi and common carp. Our previous study demonstrated that CyHV-3 becomes latent in peripheral white blood cells (WBC). In this study, CyHV-3 latency was further investigated in IgM(+) WBC. The presence of the CyHV-3 genome in IgM(+) WBC was about 20-fold greater than in IgM(-) WBC. To determine whether CyHV-3 expressed genes during latency, transcription from all eight open reading frames (ORFs) in the terminal repeat was investigated in IgM(+) WBC from koi with latent CyHV-3 infection. Only a spliced ORF6 transcript was found to be abundantly expressed in IgM(+) WBC from CyHV-3 latently infected koi. The spliced ORF6 transcript was also detected in vitro during productive infection as early as 1 day postinfection. The ORF6 transcript from in vitro infection begins at -127 bp upstream of the ATG codon and ends +188 bp downstream of the stop codon, +20 bp downstream of the polyadenylation signal. The hypothetical protein of ORF6 contains a consensus sequence with homology to a conserved domain of EBNA-3B and ICP4 from Epstein-Barr virus and herpes simplex virus 1, respectively, both members of the Herpesviridae. This is the first report of latent CyHV-3 in B cells and identification of gene transcription during latency for a member of the Alloherpesviridae. This is the first demonstration that a member of the Alloherpesviridae, cyprinid herpesvirus 3 (CyHV-3), establishes a latent infection in the B cells of its host, Cyprinus carpio. In addition, this is the first report of identification of gene transcription during latency for a member of Herpesvirales outside Herpesviridae. This is also the first report that the hypothetical protein of latent transcript of CyHV-3 contains a consensus sequence with homology to a conserved domain of EBNA-3B from Epstein-Barr virus and ICP4 from herpes simplex virus 1, which are genes important for latency. These strongly suggest that latency is evolutionally conserved across vertebrates. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
The Effect of Information Provision on Public Consensus about Climate Change.
Deryugina, Tatyana; Shurchkov, Olga
2016-01-01
Despite over 20 years of research and scientific consensus on the topic, climate change continues to be a politically polarizing issue. We conducted a survey experiment to test whether providing the public with information on the exact extent of scientific agreement about the occurrence and causes of climate change affects respondents' own beliefs and bridges the divide between conservatives and liberals. First, we show that the public significantly underestimated the extent of the scientific consensus. We then find that those given concrete information about scientists' views were more likely to report believing that climate change was already underway and that it was caused by humans. However, their beliefs about the necessity of making policy decisions and their willingness to donate money to combat climate change were not affected. Information provision affected liberals, moderates, and conservatives similarly, implying that the gap in beliefs between liberals and conservatives is not likely to be bridged by information treatments similar to the one we study. Finally, we conducted a 6-month follow-up with respondents to see if the treatment effect persisted; the results were statistically inconclusive.
Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou
2011-01-01
DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738
Effects of an Environmental Education Course on Consensus Estimates for Proenvironmental Intentions
ERIC Educational Resources Information Center
Hovardas, Tasos; Korfiatis, Konstantinos
2012-01-01
An environmental education intervention in a university conservation-related course was designed to decrease students' errors in consensus estimates for proenvironmental intentions, that is, their errors in guessing their classmates' proenvironmental intentions. Before and after the course, the authors measured two intentions regarding willingness…
Ghosh, Jayadri Sekhar; Bhattacharya, Samik; Pal, Amita
2017-06-01
The unavailability of the reproductive structure and unpredictability of vegetative characters for the identification and phylogenetic study of bamboo prompted the application of molecular techniques for greater resolution and consensus. We first employed internal transcribed spacer (ITS1, 5.8S rRNA and ITS2) sequences to construct the phylogenetic tree of 21 tropical bamboo species. While the sequence alone could grossly reconstruct the traditional phylogeny amongst the 21-tropical species studied, some anomalies were encountered that prompted a further refinement of the phylogenetic analyses. Therefore, we integrated the secondary structure of the ITS sequences to derive individual sequence-structure matrix to gain more resolution on the phylogenetic reconstruction. The results showed that ITS sequence-structure is the reliable alternative to the conventional phenotypic method for the identification of bamboo species. The best-fit topology obtained by the sequence-structure based phylogeny over the sole sequence based one underscores closer clustering of all the studied Bambusa species (Sub-tribe Bambusinae), while Melocanna baccifera, which belongs to Sub-Tribe Melocanneae, disjointedly clustered as an out-group within the consensus phylogenetic tree. In this study, we demonstrated the dependability of the combined (ITS sequence+structure-based) approach over the only sequence-based analysis for phylogenetic relationship assessment of bamboo.
Agarwal, Meetu; Bhowmick, Krishanu; Shah, Kushal; Krishnamachari, Annangarachari; Dhar, Suman Kumar
2017-08-01
DNA replication is a fundamental process in genome maintenance, and initiates from several genomic sites (origins) in eukaryotes. In Saccharomyces cerevisiae, conserved sequences known as autonomously replicating sequences (ARSs) provide a landing pad for the origin recognition complex (ORC), leading to replication initiation. Although origins from higher eukaryotes share some common sequence features, the definitive genomic organization of these sites remains elusive. The human malaria parasite Plasmodium falciparum undergoes multiple rounds of DNA replication; therefore, control of initiation events is crucial to ensure proper replication. However, the sites of DNA replication initiation and the mechanism by which replication is initiated are poorly understood. Here, we have identified and characterized putative origins in P. falciparum by bioinformatics analyses and experimental approaches. An autocorrelation measure method was initially used to search for regions with marked fluctuation (dips) in the chromosome, which we hypothesized might contain potential origins. Indeed, S. cerevisiae ARS consensus sequences were found in dip regions. Several of these P. falciparum sequences were validated with chromatin immunoprecipitation-quantitative PCR, nascent strand abundance and a plasmid stability assay. Subsequently, the same sequences were used in yeast to confirm their potential as origins in vivo. Our results identify the presence of functional ARSs in P. falciparum and provide meaningful insights into replication origins in these deadly parasites. These data could be useful in designing transgenic vectors with improved stability for transfection in P. falciparum. © 2017 Federation of European Biochemical Societies.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stenger, Drake C., E-mail: drake.stenger@ars.usda.
Population structure of Homalodisca coagulata Virus-1 (HoCV-1) among and within field-collected insects sampled from a single point in space and time was examined. Polymorphism in complete consensus sequences among single-insect isolates was dominated by synonymous substitutions. The mutant spectrum of the C2 helicase region within each single-insect isolate was unique and dominated by nonsynonymous singletons. Bootstrapping was used to correct the within-isolate nonsynonymous:synonymous arithmetic ratio (N:S) for RT-PCR error, yielding an N:S value ~one log-unit greater than that of consensus sequences. Probability of all possible single-base substitutions for the C2 region predicted N:S values within 95% confidence limits of themore » corrected within-isolate N:S when the only constraint imposed was viral polymerase error bias for transitions over transversions. These results indicate that bottlenecks coupled with strong negative/purifying selection drive consensus sequences toward neutral sequence space, and that most polymorphism within single-insect isolates is composed of newly-minted mutations sampled prior to selection. -- Highlights: •Sampling protocol minimized differential selection/history among isolates. •Polymorphism among consensus sequences dominated by negative/purifying selection. •Within-isolate N:S ratio corrected for RT-PCR error by bootstrapping. •Within-isolate mutant spectrum dominated by new mutations yet to undergo selection.« less
Parfitt, David; Martyn Ainsworth, A; Simpson, Deborah; Rogers, Hilary J; Boddy, Lynne
2007-07-01
Hydnellum and Phellodon species, generally considered ectomycorrhizal partners of a range of woody angiosperms and gymnosperms particularly within Fagaceae and Pinaceae, appear to be declining in continental Europe. They are listed as priority species in the UK Biodiversity Action Plan, but their UK conservation status remains uncertain. Interpretation of species distribution data is hampered by a lack of consensus regarding some key discriminatory morphological characters and difficulties with their interpretation. DNA sequencing of the ITS1 region of the ribosomal gene cluster discriminated between the known British species of Phellodon but revealed more terminal clusters than currently recognised taxa. Although the main focus within Hydnellum was on the very similar species pair H. concrescens and H. scrobiculatum, a few samples of H. caeruleum, H. ferrugineum, H. peckii, and H. spongiosipes were included in the study for reference. DNA sequencing of material identified on spore-based criteria as H. concrescens yielded two main groups, but samples received as H. scrobiculatum were generally more variable. Of these, two were reassigned and the remaining group, with very similar spores (although shorter than in published descriptions of H. scrobiculatum), had highly variable sequence data. The results and conservation importance of these fungi highlight the need for a taxonomic reassessment of P. melaleucus, P. niger, H. concrescens, and H. scrobiculatum collections from Britain and continental Europe using a combined molecular and morphological approach. Specific PCR primers were constructed to discriminate fruit bodies, mycelium, and mycorrhizal roots of P. niger and P. confluens from each other and from other stipitate hydnoids.
Watanabe, K; Yoshioka, K; Ito, H; Ishigami, M; Takagi, K; Utsunomiya, S; Kobayashi, M; Kishimoto, H; Yano, M; Kakumu, S
1999-11-10
Hypervariable region 1 (HVR1) proteins of hepatitis C virus (HCV) have been reported to react broadly with sera of patients with HCV infection. However, the variability of the broad reactivity of individual HVR1 proteins has not been elucidated. We assessed the reactivity of 25 different HVR1 proteins (genotype 1b) with sera of 81 patients with HCV infection (genotype 1b) by Western blot. HVR1 proteins reacted with 2-60 sera. The number of sera reactive with each HVR1 protein significantly correlated with the number of amino acid residues identical to the consensus sequence defined by Puntoriero et al. (G. Puntoriero, A. Lahm, S. Zucchelli, B. B. Ercole, R. Tafi, M. Penzzanera, M. U. Mondelli, R. Cortese, A. Tramontano, G. Galfre', and A. Nicosia. 1998. EMBO J. 17, 3521-3533. ) (r = 0.561, P < 0.005). The most widely reactive HVR1 protein, 12-22, had a sequence similar to the consensus sequence. The peptide with C-terminal 13-amino-acids sequence of HVR1 protein 12-22 (NH2-CSFTSLFTPGPSQK) was injected into rabbits as an immunogen. The rabbit immune sera reacted with 9 of 25 HVR1 proteins of genotype 1b including HVR1 protein 12-22 and with 3 of 12 proteins of genotype 2a. These results indicate that the HVR1 protein broadly reactive with patients' sera has a sequence similar to the consensus sequence, can induce broadly reactive sera, and could be one of the candidate immunogens in a prophylactic vaccine against HCV. Copyright 1999 Academic Press.
The yeast genome may harbor hypoxia response elements (HRE).
Ferreira, Túlio César; Hertzberg, Libi; Gassmann, Max; Campos, Elida Geralda
2007-01-01
The hypoxia-inducible factor-1 (HIF-1) is a heterodimeric transcription factor activated when cells are submitted to hypoxia. The heterodimer is composed of two subunits, HIF-1alpha and the constitutively expressed HIF-1beta. During normoxia, HIF-1alpha is degraded by the 26S proteasome, but hypoxia causes HIF-1alpha to be stabilized, enter the nucleus and bind to HIF-1beta, thus forming the active complex. The complex then binds to the regulatory sequences of various genes involved in physiological and pathological processes. The specific regulatory sequence recognized by HIF-1 is the hypoxia response element (HRE) that has the consensus sequence 5'BRCGTGVBBB3'. Although the basic transcriptional regulation machinery is conserved between yeast and mammals, Saccharomyces cerevisiae does not express HIF-1 subunits. However, we hypothesized that baker's yeast has a protein analogous to HIF-1 which participates in the response to changes in oxygen levels by binding to HRE sequences. In this study we screened the yeast genome for HREs using probabilistic motif search tools. We described 24 yeast genes containing motifs with high probability of being HREs (p-value<0.1) and classified them according to biological function. Our results show that S. cerevisiae may harbor HREs and indicate that a transcription factor analogous to HIF-1 may exist in this organism.
The complete sequence and promoter activity of the human A-raf-1 gene (ARAF1)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, J.E.; Beck, T.W.; Brennscheidt, U.
1994-03-01
The raf proto-oncogenes encode cytoplasmic protein serine/threonine kinases, which play a critical role in cell growth and development. One of these, A-raf-1 (human gene symbol, ARAF1), which is predominantly expressed in mouse urogenital tissues, has been mapped to an evolutionarily conserved linkage group composed of ARAF1, SYN1, TIMP, and properdin located at human chromosome Xp11.2. The authors have isolated human genomic DNA clones containing the expressed gene (ARAF1) on the X chromosome and a pseudogene (ARAF2) on chromosome 7p12-q11.21. Analysis of the nucleotide sequence from the ARAF1 genomic clones demonstrated that it consists of 16 exons encoded by minimally 10,776more » nucleotides. The major transcriptional start site (+1) was determined by RNase protection and primer extension assays. Promoter activity was confirmed by functional assays using DNA fragments fused to a CAT reporter gene. The ARAF1 minimal promoter, located between nucleotides -59 and +93, has a low G + C content and lacks consensus TATA and Inr sequences but shows sequence similarity at position -1 to the E box that is known to interact with USF and TFII-I transcription factors. 65 refs., 7 figs., 1 tab.« less
Characterization of Cer-1 cis-regulatory region during early Xenopus development.
Silva, Ana Cristina; Filipe, Mário; Steinbeisser, Herbert; Belo, José António
2011-05-01
Cerberus-related molecules are well-known Wnt, Nodal, and BMP inhibitors that have been implicated in different processes including anterior–posterior patterning and left–right asymmetry. In both mouse and frog, two Cerberus-related genes have been isolated, mCer-1 and mCer-2, and Xcer and Xcoco, respectively. Until now, little is known about the mechanisms involved in their transcriptional regulation. Here, we report a heterologous analysis of the mouse Cerberus-1 gene upstream regulatory regions, responsible for its expression in the visceral endodermal cells. Our analysis showed that the consensus sequences for a TATA, CAAT, or GC boxes were absent but a TGTGG sequence was present at position -172 to -168 bp, relative to the ATG. Using a series of deletion constructs and transient expression in Xenopus embryos, we found that a fragment of 1.4 kb of Cer-1 promoter sequence could reproduce the endogenous expression pattern of Xenopus cerberus. A 0.7-kb mcer-1 upstream region was able to drive reporter expression to the involuting mesendodermal cells, while further deletions abolished reporter gene expression. Our results suggest that although no sequence similarity was found between mouse and Xenopus cerberus cis-regulatory regions, the signaling cascades regulating cerberus expression, during gastrulation, is conserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Yanfeng; Zheng, Yi; Qin, Ling
Beta-hydroxyacid dehydrogenase (β-HAD) genes have been identified in all sequenced genomes of eukaryotes and prokaryotes. Their gene products catalyze the NAD+- or NADP+-dependent oxidation of various β-hydroxy acid substrates into their corresponding semialdehyde. In many fungal and bacterial genomes, multiple β-HAD genes are observed leading to the hypothesis that these gene products may have unique, uncharacterized metabolic roles specific to their species. The genomes of Geobacter sulfurreducens and Geobacter metallireducens each contain two potential β-HAD genes. The protein sequences of one pair of these genes, Gs-βHAD (Q74DE4) and Gm-βHAD (Q39R98), have 65% sequence identity and 77% sequence similarity with eachmore » other. Both proteins reduce succinic semialdehyde, a metabolite of the GABA shunt. To further explore the structural and functional characteristics of these two β-HADs with a potentially unique substrate specificity, crystal structures for Gs-βHAD and Gm-βHAD in complex with NADP+ were determined to a resolution of 1.89 Å and 2.07 Å, respectively. The structure of both proteins are similar, composed of 14 α-helices and nine β-strands organized into two domains. Domain One (1-165) adopts a typical Rossmann fold composed of two α/β units: a six-strand parallel β-sheet surrounded by six α-helices (α1 – α6) followed by a mixed three-strand β-sheet surrounded by two α-helices (α7 and α8). Domain Two (166-287) is composed of a bundle of seven α-helices (α9 – α14). Four functional regions conserved in all β-HADs are spatially located near each other at the interdomain cleft in both Gs-βHAD and Gm-βHAD with a buried molecule of NADP+. The structural features of Gs-βHAD and Gm-βHAD are described in relation to the four conserved consensus sequences characteristic of β-HADs and the potential biochemical importance of these enzymes as an alternative pathway for the degradation of succinic semialdehyde.« less
Chen, J; Chen, J; Adams, M J
2001-01-01
A universal primer (Sprimer: 5'-GGX AAY AAY AGY GGX CAZ CC-3', X = A, G, C or T; Y = T or C; Z = A or G), designed from the consensus sequences that code for the conserved sequence GNNSGQP in the NIb region of members of the family Potyviridae, was used to amplify by RT-PCR the 3'-terminal genome regions from infected plant samples representing 21 different viruses in the family. Sequencing of some of the fragments (c. 1.7 kb) showed that the type strain (ATTC PV-107) of Oat necrotic mottle virus is not a distinct species in the genus Rymovirus, but is synonymous with Brome streak mosaic virus (genus Tritimovirus) and that Celery mosaic virus is a distinct member of the genus Potyvirus not closely related to any other sequenced species. Potyviruses infecting crops in China were also investigated, showing that viruses on cowpea and maize in Hangzhou, Zhejiang province were respectively Bean common mosaic virus and Sugarcane mosaic virus and that one on garlic in Nanjing, Jiangsu province was Onion yellow dwarf virus. Fragments were also sequenced from Chinese isolates of Lettuce mosaic virus and Soybean mosaic virus (from Hangzhou), Turnip mosaic virus (2 different isolates from Zhejiang province) and RNA1 of Wheat yellow mosaic virus (from Rongcheng, Shandong province).
An artificial intelligence approach fit for tRNA gene studies in the era of big sequence data.
Iwasaki, Yuki; Abe, Takashi; Wada, Kennosuke; Wada, Yoshiko; Ikemura, Toshimichi
2017-09-12
Unsupervised data mining capable of extracting a wide range of knowledge from big data without prior knowledge or particular models is a timely application in the era of big sequence data accumulation in genome research. By handling oligonucleotide compositions as high-dimensional data, we have previously modified the conventional self-organizing map (SOM) for genome informatics and established BLSOM, which can analyze more than ten million sequences simultaneously. Here, we develop BLSOM specialized for tRNA genes (tDNAs) that can cluster (self-organize) more than one million microbial tDNAs according to their cognate amino acid solely depending on tetra- and pentanucleotide compositions. This unsupervised clustering can reveal combinatorial oligonucleotide motifs that are responsible for the amino acid-dependent clustering, as well as other functionally and structurally important consensus motifs, which have been evolutionarily conserved. BLSOM is also useful for identifying tDNAs as phylogenetic markers for special phylotypes. When we constructed BLSOM with 'species-unknown' tDNAs from metagenomic sequences plus 'species-known' microbial tDNAs, a large portion of metagenomic tDNAs self-organized with species-known tDNAs, yielding information on microbial communities in environmental samples. BLSOM can also enhance accuracy in the tDNA database obtained from big sequence data. This unsupervised data mining should become important for studying numerous functionally unclear RNAs obtained from a wide range of organisms.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chang, Soo-Ik; Hammes, G.G.
1989-11-01
Homology analyses of the protein sequences of chicken liver and rat mammary gland fatty acid synthases were carried out. The amino acid sequences of the chicken and rat enzymes are 67% identical. If conservative substitutions are allowed, 78% of the amino acids are matched. A region of low homologies exists between the functional domains, in particular around amino acid residues 1059-1264 of the chicken enzyme. Homologies between the active sites of chicken and rat and of chicken and yeast enzymes have been analyzed by an alignment method. A high degree of homology exists between the active sites of the chickenmore » and rat enzymes. However, the chicken and yeast enzymes show a lower degree of homology. The DADPH-binding dinucleotide folds of the {beta}-ketoacyl reductase and the enoyl reductase sites were identified by comparison with a known consensus sequence for the DADP- and FAD-binding dinucleotide folds. The active sites of all of the enzymes are primarily in hydrophobic regions of the protein. This study suggests that the genes for the functional domains of fatty acid synthase were originally separated, and these genes were connected to each other by using different connecting nucleotide sequences in different species. An alternative explanation for the differences in rat and chicken is a common ancestry and mutations in the joining regions during evolution.« less
Gratias, Ariane; Lepère, Gersende; Garnier, Olivier; Rosa, Sarah; Duharcourt, Sandra; Malinsky, Sophie; Meyer, Eric; Bétermier, Mireille
2008-01-01
Somatic genome assembly in the ciliate Paramecium involves the precise excision of thousands of short internal eliminated sequences (IESs) that are scattered throughout the germline genome and often interrupt open reading frames. Excision is initiated by double-strand breaks centered on the TA dinucleotides that are conserved at each IES boundary, but the factors that drive cleavage site recognition remain unknown. A degenerate consensus was identified previously at IES ends and genetic analyses confirmed the participation of their nucleotide sequence in efficient excision. Even for wild-type IESs, however, variant excision patterns (excised or nonexcised) may be inherited maternally through sexual events, in a homology-dependent manner. We show here that this maternal epigenetic control interferes with the targeting of DNA breaks at IES ends. Furthermore, we demonstrate that a mutation in the TA at one end of an IES impairs DNA cleavage not only at the mutant end but also at the wild-type end. We conclude that crosstalk between both ends takes place prior to their cleavage and propose that the ability of an IES to adopt an excision-prone conformation depends on the combination of its nucleotide sequence and of additional determinants. PMID:18420657
Eggert, Lori S; Rasner, Caylor A; Woodruff, David S
2002-10-07
Recent genetic results support the recognition of two African elephant species: Loxodonta africana, the savannah elephant, and Loxodonta cyclotis, the forest elephant. The study, however, did not include the populations of West Africa, where the taxonomic affinities of elephants have been much debated. We examined mitochondrial cytochrome b control region sequences and four microsatellite loci to investigate the genetic differences between the forest and savannah elephants of West and Central Africa. We then combined our data with published control region sequences from across Africa to examine patterns at the continental level. Our analysis reveals several deeply divergent lineages that do not correspond with the currently recognized taxonomy: (i) the forest elephants of Central Africa; the forest and savannah elephants of West Africa; and (iii) the savannah elephants of eastern, southern and Central Africa. We propose that the complex phylogeographic patterns we detect in African elephants result from repeated continental-scale climatic changes over their five-to-six million year evolutionary history. Until there is consensus on the taxonomy, we suggest that the genetic and ecological distinctness of these lineages should be an important factor in conservation management planning.
In silico analysis of β-1,3-glucanase from a psychrophilic yeast, Glaciozyma antarctica PI12
NASA Astrophysics Data System (ADS)
Mohammadi, Salimeh; Bakar, Farah Diba Abu; Rabu, Amir; Murad, Abdul Munir Abdul
2014-09-01
1,3-beta-glucanase is an industrially important enzyme having wide range of applications especially in food industry. It is crucial to gain an understanding about the structure and functional aspects of various beta-1,3-glucanase produced from diverse sources. In this, study a cDNA encoding β-1,3-glucanase (GaExg55) was isolated from a psychrophilic yeast, Glaciozyma antarctica PI12. The cDNA sequence has been submitted to Genbank with an accession number (KJ436377). Subsequently, the perdition protein was analyzed using various bioinformatics tools to explore the properties of the protein. GaEXG55 is consisting of 1,440-bp nucleotides encoding 480 amino acid residues. Alignment of the deduced amino acid for GaExg55 with other exo-β-1,3-glucanase available at the NCBI database indicate that deduced amino acids shared a consensus motif NEP, which is signature pattern of GH5 hydrolases. Predicted molecular weight of GaExg55 is 53.66 kDa. GaExg55 sequences possesses signal peptide sequence and it is highly conserved with other fungal exo-beta-1,3 glucanase.
Structure of human POFUT2: insights into thrombospondin type 1 repeat fold and O-fucosylation
Chen, Chun-I; Keusch, Jeremy J; Klein, Dominique; Hess, Daniel; Hofsteenge, Jan; Gut, Heinz
2012-01-01
Protein O-fucosylation is a post-translational modification found on serine/threonine residues of thrombospondin type 1 repeats (TSR). The fucose transfer is catalysed by the enzyme protein O-fucosyltransferase 2 (POFUT2) and >40 human proteins contain the TSR consensus sequence for POFUT2-dependent fucosylation. To better understand O-fucosylation on TSR, we carried out a structural and functional analysis of human POFUT2 and its TSR substrate. Crystal structures of POFUT2 reveal a variation of the classical GT-B fold and identify sugar donor and TSR acceptor binding sites. Structural findings are correlated with steady-state kinetic measurements of wild-type and mutant POFUT2 and TSR and give insight into the catalytic mechanism and substrate specificity. By using an artificial mini-TSR substrate, we show that specificity is not primarily encoded in the TSR protein sequence but rather in the unusual 3D structure of a small part of the TSR. Our findings uncover that recognition of distinct conserved 3D fold motifs can be used as a mechanism to achieve substrate specificity by enzymes modifying completely folded proteins of very wide sequence diversity and biological function. PMID:22588082
Unit-length line-1 transcripts in human teratocarcinoma cells.
Skowronski, J; Fanning, T G; Singer, M F
1988-01-01
We have characterized the approximately 6.5-kilobase cytoplasmic poly(A)+ Line-1 (L1) RNA present in a human teratocarcinoma cell line, NTera2D1, by primer extension and by analysis of cloned cDNAs. The bulk of the RNA begins (5' end) at the residue previously identified as the 5' terminus of the longest known primate genomic L1 elements, presumed to represent "unit" length. Several of the cDNA clones are close to 6 kilobase pairs, that is, close to full length. The partial sequences of 18 cDNA clones and full sequence of one (5,975 base pairs) indicate that many different genomic L1 elements contribute transcripts to the 6.5-kilobase cytoplasmic poly(A)+ RNA in NTera2D1 cells because no 2 of the 19 cDNAs analyzed had identical sequences. The transcribed elements appear to represent a subset of the total genomic L1s, a subset that has a characteristic consensus sequence in the 3' noncoding region and a high degree of sequence conservation throughout. Two open reading frames (ORFs) of 1,122 (ORF1) and 3,852 (ORF2) bases, flanked by about 800 and 200 bases of sequence at the 5' and 3' ends, respectively, can be identified in the cDNAs. Both ORFs are in the same frame, and they are separated by 33 bases bracketed by two conserved in-frame stop codons. ORF 2 is interrupted by at least one randomly positioned stop codon in the majority of the cDNAs. The data support proposals suggesting that the human L1 family includes one or more functional genes as well as an extraordinarily large number of pseudogenes whose ORFs are broken by stop codons. The cDNA structures suggest that both genes and pseudogenes are transcribed. At least one of the cDNAs (cD11), which was sequenced in its entirety, could, in principle, represent an mRNA for production of the ORF1 polypeptide. The similarity of mammalian L1s to several recently described invertebrate movable elements defines a new widely distributed class of elements which we term class II retrotransposons. Images PMID:2454389
PDSM, a motif for phosphorylation-dependent SUMO modification
Hietakangas, Ville; Anckar, Julius; Blomster, Henri A.; Fujimoto, Mitsuaki; Palvimo, Jorma J.; Nakai, Akira; Sistonen, Lea
2006-01-01
SUMO (small ubiquitin-like modifier) modification regulates many cellular processes, including transcription. Although sumoylation often occurs on specific lysines within the consensus tetrapeptide ΨKxE, other modifications, such as phosphorylation, may regulate the sumoylation of a substrate. We have discovered PDSM (phosphorylation-dependent sumoylation motif), composed of a SUMO consensus site and an adjacent proline-directed phosphorylation site (ΨKxExxSP). The highly conserved motif regulates phosphorylation-dependent sumoylation of multiple substrates, such as heat-shock factors (HSFs), GATA-1, and myocyte enhancer factor 2. In fact, the majority of the PDSM-containing proteins are transcriptional regulators. Within the HSF family, PDSM is conserved between two functionally distinct members, HSF1 and HSF4b, whose transactivation capacities are repressed through the phosphorylation-dependent sumoylation. As the first recurrent sumoylation determinant beyond the consensus tetrapeptide, the PDSM provides a valuable tool in predicting new SUMO substrates. PMID:16371476
Wang, Guiqin; Yin, Renfu; Zhou, Paul; Ding, Zhuang
2017-01-01
Hemagglutinin (HA) head has long been considered to be able to elicit only a narrow, strain-specific antibody response as it undergoes rapid antigenic drift. However, we previously showed that a heterologous prime-boost strategy, in which mice were primed twice with DNA encoding HA and boosted once with virus-like particles (VLP) from an H5N1 strain A/Thailand/1(KAN)-1/2004 (noted as TH DDV), induced anti-head broad cross-H5 neutralizing antibody response. To explain why TH DDV immunization could generate such breadth, we systemically compared the neutralization breadth and potency between TH DDV sera and immune sera elicited by TH DDD (three times of DNA immunizations), TH VVV (three times of VLP immunizations), TH DV (one DNA prime plus one VLP boost) and TK DDV (plasmid DNA and VLP derived from another H5N1 strain, A/Turkey/65596/2006). Then we determined the antigenic sites (AS) on TH HA head and the key residues of the main antigenic site. Through the comparison of different regiments, we found that the combination of the immunization with the sequence close to the consensus sequence and two DNA prime plus one VLP boost caused that TH DDV immunization generate broad neutralizing antibodies. Antigenic analysis showed that TH DDV, TH DV, TH DDD and TH VVV sera recognize the common antigenic site AS1. Antibodies directed to AS1 contribute to the largest proportion of the neutralizing activity of these immune sera. Residues 188 and 193 in AS1 are the key residues which are responsible for neutralization breadth of the immune sera. Interestingly, residues 188 and 193 locate in classical antigen sites but are relatively conserved among the 16 tested strains and 1,663 HA sequences from NCBI database. Thus, our results strongly indicate that it is feasible to develop broad cross-H5 influenza vaccines against HA head. PMID:28542275
2010-01-01
Background The Eight-Twenty-One (ETO) nuclear co-repressor gene belongs to the ETO homologue family also containing Myeloid Translocation Gene on chromosome 16 (MTG16) and myeloid translocation Gene-Related protein 1 (MTGR1). By chromosomal translocations ETO and MTG16 become parts of fusion proteins characteristic of morphological variants of acute myeloid leukemia. Normal functions of ETO homologues have as yet not been examined. The goal of this work was to identify structural and functional promoter elements upstream of the coding sequence of the ETO gene in order to explore lineage-specific hematopoietic expression and get hints to function. Results A putative proximal ETO promoter was identified within 411 bp upstream of the transcription start site. Strong ETO promoter activity was specifically observed upon transfection of a promoter reporter construct into erythroid/megakaryocytic cells, which have endogeneous ETO gene activity. An evolutionary conserved region of 228 bp revealed potential cis-elements involved in transcription of ETO. Disruption of the evolutionary conserved GATA -636 consensus binding site repressed transactivation and disruption of the ETS1 -705 consensus binding site enhanced activity of the ETO promoter. The promoter was stimulated by overexpression of GATA-1 into erythroid/megakaryocytic cells. Electrophoretic mobility shift assay with erythroid/megakaryocytic cells showed specific binding of GATA-1 to the GATA -636 site. Furthermore, results from chromatin immunoprecipitation showed GATA-1 binding in vivo to the conserved region of the ETO promoter containing the -636 site. The results suggest that the GATA -636 site may have a role in activation of the ETO gene activity in cells with erythroid/megakaryocytic potential. Leukemia associated AML1-ETO strongly suppressed an ETO promoter reporter in erythroid/megakaryocytic cells. Conclusions We demonstrate that the GATA-1 transcription factor binds and transactivates the ETO proximal promoter in an erythroid/megakaryocytic-specific manner. Thus, trans-acting factors that are essential in erythroid/megakaryocytic differentiation govern ETO expression. PMID:20487545
Pfeiffer, M; Klein, A; Steinert, P; Schomburg, D
The 25 amino acid long subunit VhuU of the F420-non-reducing hydrogenase from Methanococcus voltae contains selenocysteine within the consensus sequence of known [NiFe] hydrogenases DP(C or U)CxxCxxH (U = selenocysteine). The sulfur-analogue VhuUc was chemically synthesized, purified and its metal binding capability, the catalytic properties, and structural features were investigated. The polypeptide was able to bind nickel, but did not catalyse the heterolytic activation of H2. 2D-NMR spectroscopy revealed an alpha-helical secondary structure for the 15 N-terminal amino acids in 50% TFE. Nickel only binds to the C-terminus, which contains the conserved amino acid motif. Structures derived from the NMR data are compatible with the participation of both sulfur atoms from the conserved cysteine residues in a metal ion binding. Structures obtained from the data sets for Ni.VhuUc as well as Zn.VhuUc showed no further ligands. The informational value for Ni.VhuUc was low due to paramagnetism.
Identification of a conserved B-cell epitope on the GapC protein of Streptococcus dysgalactiae.
Zhang, Limeng; Zhou, Xue; Fan, Ziyao; Tang, Wei; Chen, Liang; Dai, Jian; Wei, Yuhua; Zhang, Jianxin; Yang, Xuan; Yang, Xijing; Liu, Daolong; Yu, Liquan; Zhang, Hua; Wu, Zhijun; Yu, Yongzhong; Sun, Hunan; Cui, Yudong
2015-01-01
Streptococcus dysgalactiae (S. dysgalactia) GapC is a highly conserved surface dehydrogenase among the streptococcus spp., which is responsible for inducing protective antibody immune responses in animals. However, the B-cell epitope of S. dysgalactia GapC have not been well characterized. In this study, a monoclonal antibody 1F2 (mAb1F2) against S. dysgalactiae GapC was generated by the hybridoma technique and used to screen a phage-displayed 12-mer random peptide library (Ph.D.-12) for mapping the linear B-cell epitope. The mAb1F2 recognized phages displaying peptides with the consensus motif TRINDLT. Amino acid sequence of the motif exactly matched (30)TRINDLT(36) of the S. dysgalactia GapC. Subsequently, site-directed mutagenic analysis further demonstrated that residues R31, I32, N33, D34 and L35 formed the core of (30)TRINDLT(36), and this core motif was the minimal determinant of the B-cell epitope recognized by the mAb1F2. The epitope (30)TRINDLT(36) showed high homology among different streptococcus species. Overall, our findings characterized a conserved B-cell epitope, which will be useful for the further study of epitope-based vaccines. Copyright © 2015 Elsevier Ltd. All rights reserved.
Amexis, Georgios; Rubin, Steven; Chatterjee, Nando; Carbone, Kathryn; Chumakov, Kostantin
2003-06-01
A single clinical isolate of mumps virus designated 88-1961 was obtained from a patient hospitalized with a clinical history of upper respiratory tract infection, parotitis, severe headache, fever and lymphadenopathy. We have sequenced the full-length genome of 88-1961 and compared it against all available full-length sequences of mumps virus. Based upon its nucleotide sequence of the SH gene 88-1961 was identified as a genotype H mumps strain. The overall extent of nucleotide and amino acid differences between each individual gene and protein of 88-1961 and the full-length mumps samples showed that the missense to silent ratios were unevenly distributed. Upon evaluation of the consensus sequence of 88-1961, four positions were found to be clearly heterogeneous at the nucleotide level (NP 315C/T, NP 318C/T, F 271A/C, and HN 855C/T). Sequence analysis revealed that the amino acid sequences for the NP, M, and the L protein were the most conserved, whereas the SH protein exhibited the highest variability among the compared mumps genotypes A, B, and G. No identifying molecular patterns in the non-coding (intergenic) or coding regions of 88-1961 were found when we compared it against relatively virulent (Urabe AM9 B, Glouc1/UK96, 87-1004 and 87-1005) and non-virulent mumps strains (Jeryl Lynn and all Urabe Am9 A substrains). Copyright 2003 Wiley-Liss, Inc.
Augmenting Chinese hamster genome assembly by identifying regions of high confidence.
Vishwanathan, Nandita; Bandyopadhyay, Arpan A; Fu, Hsu-Yuan; Sharma, Mohit; Johnson, Kathryn C; Mudge, Joann; Ramaraj, Thiruvarangan; Onsongo, Getiria; Silverstein, Kevin A T; Jacob, Nitya M; Le, Huong; Karypis, George; Hu, Wei-Shou
2016-09-01
Chinese hamster Ovary (CHO) cell lines are the dominant industrial workhorses for therapeutic recombinant protein production. The availability of genome sequence of Chinese hamster and CHO cells will spur further genome and RNA sequencing of producing cell lines. However, the mammalian genomes assembled using shot-gun sequencing data still contain regions of uncertain quality due to assembly errors. Identifying high confidence regions in the assembled genome will facilitate its use for cell engineering and genome engineering. We assembled two independent drafts of Chinese hamster genome by de novo assembly from shotgun sequencing reads and by re-scaffolding and gap-filling the draft genome from NCBI for improved scaffold lengths and gap fractions. We then used the two independent assemblies to identify high confidence regions using two different approaches. First, the two independent assemblies were compared at the sequence level to identify their consensus regions as "high confidence regions" which accounts for at least 78 % of the assembled genome. Further, a genome wide comparison of the Chinese hamster scaffolds with mouse chromosomes revealed scaffolds with large blocks of collinearity, which were also compiled as high-quality scaffolds. Genome scale collinearity was complemented with EST based synteny which also revealed conserved gene order compared to mouse. As cell line sequencing becomes more commonly practiced, the approaches reported here are useful for assessing the quality of assembly and potentially facilitate the engineering of cell lines. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Hamilton, P T; Reeve, J N
1985-01-01
DNA fragments cloned from the methanogenic archaebacterium Methanobrevibacter smithii which complement mutations in the purE and proC genes of E. coli have been sequenced. Sequence analyses, transposon mutagenesis and expression in E. coli minicells indicate that purE and proC complementations result from the synthesis of M. smithii polypeptides with molecular weights of 36,697 and 27,836 respectively. The encoding genes appear to be located in operons. The M. smithii genome contains 69% A/T basepairs (bp) which is reflected in unusual codon usages and intergenic regions containing approximately 85% A/T bp. An insertion element, designated ISM1, was found within the cloned M. smithii DNA located adjacent to the proC complementing region. ISM1 is 1381 bp in length, has 29 bp terminal inverted repeat sequences and contains one major ORF encoded in 87% of the ISM1 sequence. ISM1 is mobile, present in approximately 10 copies per genome and integration duplicates 8 bp at the site of insertion. The duplicated sequences show homology with sequences within the 29 bp terminal repeat sequence of ISM1. Comparison of our data with sequences from halophilic archaebacteria suggests that 5'GAANTTTCA and 5'TTTTAATATAAA may be consensus promoter sequences for archaebacteria. These sequences closely resemble the consensus sequences which precede Drosophila heat-shock genes (Pelham 1982; Davidson et al. 1983). Methanogens appear to employ the eubacterial system of mRNA: 16SrRNA hybridization to ensure initiation of translation; the consensus ribosome binding sequence is 5'AGGTGA.
El-Assaad, Atlal; Dawy, Zaher; Nemer, Georges; Hajj, Hazem; Kobeissy, Firas H
2017-01-01
Degradomics is a novel discipline that involves determination of the proteases/substrate fragmentation profile, called the substrate degradome, and has been recently applied in different disciplines. A major application of degradomics is its utility in the field of biomarkers where the breakdown products (BDPs) of different protease have been investigated. Among the major proteases assessed, calpain and caspase proteases have been associated with the execution phases of the pro-apoptotic and pro-necrotic cell death, generating caspase/calpain-specific cleaved fragments. The distinction between calpain and caspase protein fragments has been applied to distinguish injury mechanisms. Advanced proteomics technology has been used to identify these BDPs experimentally. However, it has been a challenge to identify these BDPs with high precision and efficiency, especially if we are targeting a number of proteins at one time. In this chapter, we present a novel bioinfromatic detection method that identifies BDPs accurately and efficiently with validation against experimental data. This method aims at predicting the consensus sequence occurrences and their variants in a large set of experimentally detected protein sequences based on state-of-the-art sequence matching and alignment algorithms. After detection, the method generates all the potential cleaved fragments by a specific protease. This space and time-efficient algorithm is flexible to handle the different orientations that the consensus sequence and the protein sequence can take before cleaving. It is O(mn) in space complexity and O(Nmn) in time complexity, with N number of protein sequences, m length of the consensus sequence, and n length of each protein sequence. Ultimately, this knowledge will subsequently feed into the development of a novel tool for researchers to detect diverse types of selected BDPs as putative disease markers, contributing to the diagnosis and treatment of related disorders.
Glynn, Neil C; Comstock, Jack C; Sood, Sushma G; Dang, Phat M; Chaparro, Jose X
2008-01-01
Resistance gene analogues (RGAs) have been isolated from many crops and offer potential in breeding for disease resistance through marker-assisted selection, either as closely linked or as perfect markers. Many R-gene sequences contain kinase domains, and indeed kinase genes have been reported as being proximal to R-genes, making kinase analogues an additionally promising target. The first step towards utilizing RGAs as markers for disease resistance is isolation and characterization of the sequences. Sugarcane clone US01-1158 was identified as resistant to yellow leaf caused by the sugarcane yellow leaf virus (SCYLV) and moderately resistant to rust caused by Puccinia melanocephala Sydow & Sydow. Degenerate primers that had previously proved useful for isolating RGAs and kinase analogues in wheat and soybean were used to amplify DNA from sugarcane (Saccharum spp.) clone US-01-1158. Sequences generated from 1512 positive clones were assembled into 134 contigs of between two and 105 sequences. Comparison of the contig consensuses with the NCBI sequence database using BLASTx showed that 20 had sequence homology to nuclear binding site and leucine rich repeat (NBS-LRR) RGAs, and eight to kinase genes. Alignment of the deduced amino acid sequences with similar sequences from the NCBI database allowed the identification of several conserved domains. The alignment and resulting phenetic tree showed that many of the sequences had greater similarity to sequences from other species than to one another. The use of degenerate primers is a useful method for isolating novel sugarcane RGA and kinase gene analogues. Further studies are needed to evaluate the role of these genes in disease resistance.
Kozutsumi, Daisuke; Tsunematsu, Masako; Yamaji, Taketo; Kino, Kohsuke
2007-01-01
Cry-consensus peptide is a linearly linked peptide of T-cell epitopes for the management of Japanese cedar (JC) pollinosis and is expected to become a new drug for immunotherapy. However, the mechanism of T-cell epitopes in allergic diseases is not well understood, and thus, a simple in vitro procedure for evaluation of its biological activity is desired. Peripheral blood mononuclear cells (PBMC) were isolated from 27 JC pollinosis patients and 10 healthy subjects, and cultured in vitro for 4 days in the presence of Cry-consensus peptide and (3)H-thymidine. The relationship between growth stimulation (stimulation index; SI) and antigen-specific IgE levels in serum was also investigated in JC pollinosis patients. Moreover, to confirm the importance of the primary sequence in Cry-consensus peptide, heat-treated Cry-consensus peptide and a mixture of the amino acids of which Cry-consensus peptide is composed, and their (3)H-thymidine uptake was compared with Cry-consensus peptide. Finally, whether Cry-consensus peptide stimulates PBMCs from healthy subjects was investigated. The mean SI of JC patients showed a good correlation with Cry-consensus peptide concentration in the culture medium; however, the SI was independent of the anti-Cry j 1 IgE level. Heat-denatured Cry-consensus peptide retained a PBMC proliferation stimulatory effect comparable to the original Cry-consensus peptide, while the mixture of amino acids constituting Cry-consensus peptide did not stimulate PBMC proliferation. PBMCs from healthy subjects did not respond to Cry-consensus peptide at all. These data indicate that the PBMC response of patients suffering from JC pollinosis to Cry-consensus peptide is specific for the sequence of T cell epitopes thereof and may be useful for the evaluation of the efficacy of Cry-consensus peptide in vivo.
Sequencing Conservation Actions Through Threat Assessments in the Southeastern United States
Robert D. Sutter; Christopher C. Szell
2006-01-01
The identification of conservation priorities is one of the leading issues in conservation biology. We present a project of The Nature Conservancy, called Sequencing Conservation Actions, which prioritizes conservation areas and identifies foci for crosscutting strategies at various geographic scales. We use the term âSequencingâ to mean an ordering of actions over...
R2R--software to speed the depiction of aesthetic consensus RNA secondary structures.
Weinberg, Zasha; Breaker, Ronald R
2011-01-04
With continuing identification of novel structured noncoding RNAs, there is an increasing need to create schematic diagrams showing the consensus features of these molecules. RNA structural diagrams are typically made either with general-purpose drawing programs like Adobe Illustrator, or with automated or interactive programs specific to RNA. Unfortunately, the use of applications like Illustrator is extremely time consuming, while existing RNA-specific programs produce figures that are useful, but usually not of the same aesthetic quality as those produced at great cost in Illustrator. Additionally, most existing RNA-specific applications are designed for drawing single RNA molecules, not consensus diagrams. We created R2R, a computer program that facilitates the generation of aesthetic and readable drawings of RNA consensus diagrams in a fraction of the time required with general-purpose drawing programs. Since the inference of a consensus RNA structure typically requires a multiple-sequence alignment, the R2R user annotates the alignment with commands directing the layout and annotation of the RNA. R2R creates SVG or PDF output that can be imported into Adobe Illustrator, Inkscape or CorelDRAW. R2R can be used to create consensus sequence and secondary structure models for novel RNA structures or to revise models when new representatives for known RNA classes become available. Although R2R does not currently have a graphical user interface, it has proven useful in our efforts to create 100 schematic models of distinct noncoding RNA classes. R2R makes it possible to obtain high-quality drawings of the consensus sequence and structural models of many diverse RNA structures with a more practical amount of effort. R2R software is available at http://breaker.research.yale.edu/R2R and as an Additional file.
Gál, Zita; Hegedüs, Csilla; Szakács, Gergely; Váradi, András; Sarkadi, Balázs; Özvegy-Laczka, Csilla
2015-02-01
Human ABCG2 is a plasma membrane glycoprotein causing multidrug resistance in cancer. Membrane cholesterol and bile acids are efficient regulators of ABCG2 function, while the molecular nature of the sterol-sensing sites has not been elucidated. The cholesterol recognition amino acid consensus (CRAC, L/V-(X)(1-5)-Y-(X)(1-5)-R/K) sequence is one of the conserved motifs involved in cholesterol binding in several proteins. We have identified five potential CRAC motifs in the transmembrane domain of the human ABCG2 protein. In order to define their roles in sterol-sensing, the central tyrosines of these CRACs (Y413, 459, 469, 570 and 645) were mutated to S or F and the mutants were expressed both in insect and mammalian cells. We found that mutation in Y459 prevented protein expression; the Y469S and Y645S mutants lost their activity; while the Y570S, Y469F, and Y645F mutants retained function as well as cholesterol and bile acid sensitivity. We found that in the case of the Y413S mutant, drug transport was efficient, while modulation of the ATPase activity by cholesterol and bile acids was significantly altered. We suggest that the Y413 residue within a putative CRAC motif has a role in sterol-sensing and the ATPase/drug transport coupling in the ABCG2 multidrug transporter. Copyright © 2014. Published by Elsevier B.V.
Klein, Wolfgang; Westendorf, Carolin; Schmidt, Antje; Conill-Cortés, Mercè; Rutz, Claudia; Blohs, Marcus; Beyermann, Michael; Protze, Jonas; Krause, Gerd; Krause, Eberhard; Schülein, Ralf
2015-01-01
The cyclodepsipeptide cotransin was described to inhibit the biosynthesis of a small subset of proteins by a signal sequence-discriminatory mechanism at the Sec61 protein-conducting channel. However, it was not clear how selective cotransin is, i.e. how many proteins are sensitive. Moreover, a consensus motif in signal sequences mediating cotransin sensitivity has yet not been described. To address these questions, we performed a proteomic study using cotransin-treated human hepatocellular carcinoma cells and the stable isotope labelling by amino acids in cell culture technique in combination with quantitative mass spectrometry. We used a saturating concentration of cotransin (30 micromolar) to identify also less-sensitive proteins and to discriminate the latter from completely resistant proteins. We found that the biosynthesis of almost all secreted proteins was cotransin-sensitive under these conditions. In contrast, biosynthesis of the majority of the integral membrane proteins was cotransin-resistant. Cotransin sensitivity of signal sequences was neither related to their length nor to their hydrophobicity. Instead, in the case of signal anchor sequences, we identified for the first time a conformational consensus motif mediating cotransin sensitivity. PMID:25806945
On the relationship between residue structural environment and sequence conservation in proteins.
Liu, Jen-Wei; Lin, Jau-Ji; Cheng, Chih-Wen; Lin, Yu-Feng; Hwang, Jenn-Kang; Huang, Tsun-Tsao
2017-09-01
Residues that are crucial to protein function or structure are usually evolutionarily conserved. To identify the important residues in protein, sequence conservation is estimated, and current methods rely upon the unbiased collection of homologous sequences. Surprisingly, our previous studies have shown that the sequence conservation is closely correlated with the weighted contact number (WCN), a measure of packing density for residue's structural environment, calculated only based on the C α positions of a protein structure. Moreover, studies have shown that sequence conservation is correlated with environment-related structural properties calculated based on different protein substructures, such as a protein's all atoms, backbone atoms, side-chain atoms, or side-chain centroid. To know whether the C α atomic positions are adequate to show the relationship between residue environment and sequence conservation or not, here we compared C α atoms with other substructures in their contributions to the sequence conservation. Our results show that C α positions are substantially equivalent to the other substructures in calculations of various measures of residue environment. As a result, the overlapping contributions between C α atoms and the other substructures are high, yielding similar structure-conservation relationship. Take the WCN as an example, the average overlapping contribution to sequence conservation is 87% between C α and all-atom substructures. These results indicate that only C α atoms of a protein structure could reflect sequence conservation at the residue level. © 2017 Wiley Periodicals, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Buchman, A.R.; Kimmerly, W.J.; Rine, J.
1988-01-01
Two DNA-binding factors from Saccharomyces cerevisiae have been characterized, GRFI (general regulatory factor I) and ABFI (ARS-binding factor I), that recognize specific sequences within diverse genetic elements. GRFI bound to sequences at the negative regulatory elements (silencers) of the silent mating type loci HML E and HMR E and to the upstream activating sequence (UAS) required for transcription of the MAT ..cap alpha.. genes. A putative conserved UAS located at genes involved in translation (RPG box) was also recognized by GRFI. In addition, GRFI bound with high affinity to sequences within the (C/sub 1-3/A)-repeat region at yeast telomeres. Binding sitesmore » for GRFI with the highest affinity appeared to be of the form 5'-(A/G)(A/C)ACCCAN NCA(T/C)(T/C)-3', where N is any nucleotide. ABFI-binding sites were located next to autonomously replicating sequences (ARSs) at controlling elements of the silent mating type loci HMR E, HMR I, and HML I and were associated with ARS1, ARS2, and the 2..mu..m plasmid ARS. Two tandem ABFI binding sites were found between the HIS3 and DED1 genes, several kilobase pairs from any ARS, indicating that ABFI-binding sites are not restricted to ARSs. The sequences recognized by AFBI showed partial dyad-symmetry and appeared to be variations of the consensus 5'-TATCATTNNNNACGA-3'. GRFI and ABFI were both abundant DNA-binding factors and did not appear to be encoded by the SIR genes, whose product are required for repression of the silent mating type loci. Together, these results indicate that both GRFI and ABFI play multiple roles within the cell.« less
Croager, Emma J.; Gout, Alexander M.; Abraham, Lawrence J.
2000-01-01
CD30, as a member of the tumor necrosis factor (TNF) receptor family, is expressed on the surface of activated lymphoid cells. CD30 overexpression is a characteristic of lymphoproliferative diseases such as Hodgkin’s/non-Hodgkin’s lymphomas, embryonal carcinoma, and a number of Th2-associated diseases. The CD30 gene has been mapped to a region of the murine genome that is involved in susceptibility to systemic lupus erythematosus. Functionally, CD30 may play a role in the deletion of autoreactive T cells. We were interested in determining the molecular nature of CD30 overexpression. Sequence comparison has revealed significant identity between the TATA-less human and murine CD30 promoters; they share a number of common consensus binding motifs. Transfection assays identified three regions of transcriptional importance; the region between position −1.2 kb and −336 bp, containing a CCAT microsatellite sequence, a conserved Sp1 site at positions −43 to −38, and a downstream promoter element (DPE) at positions +24 to +29. EMSA and DNase I footprinting showed specific DNA-protein interactions of the CD30 promoter with the Sp1 site and the CCAT repeat region. The DPE element was shown to be essential for start site selection. We conclude that the conserved Sp1 site at −43 to −38 is associated with maximum reporter gene activity, the DPE element is required for start site selection, and the CCAT tetranucleotide repeats act to repress transcription. We also have shown that the microsatellite is multiallelic, when we screened a random healthy population. Further studies are required to determine whether microsatellite instability in the repressor predisposes susceptible individuals to CD30 overexpression. PMID:10793083
18 CFR 5.16 - Preliminary licensing proposal.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Preliminary licensing proposal. 5.16 Section 5.16 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION... application may be requested, based on a consensus of the participants in favor of such waiver. ...
Reconsidering School Politics: Educational Controversies in Sweden
ERIC Educational Resources Information Center
Fredholm, Axel
2017-01-01
School politics in Sweden has recently moved in a conservative direction, emphasising the importance of conventional school subjects, stronger teacher authority and more discipline in the classroom. At the same time, consensus on the utility of such measures is lacking in the school debate. The conservative approach is often criticised as…
Gonzalez, Patrice; Labarère, Jacques
1998-01-01
A comparative study of variable domains V4, V6, and V9 of the mitochondrial small-subunit (SSU) rRNA was carried out with the genus Agrocybe by PCR amplification of 42 wild isolates belonging to 10 species, Agrocybe aegerita, Agrocybe dura, Agrocybe chaxingu, Agrocybe erebia, Agrocybe firma, Agrocybe praecox, Agrocybe paludosa, Agrocybe pediades, Agrocybe alnetorum, and Agrocybe vervacti. Sequencing of the PCR products showed that the three domains in the isolates belonging to the same species were the same length and had the same sequence, while variations were found among the 10 species. Alignment of the sequences showed that nucleotide motifs encountered in the smallest sequence of each variable domain were also found in the largest sequence, indicating that the sequences evolved by insertion-deletion events. Determination of the secondary structure of each domain revealed that the insertion-deletion events commonly occurred in regions not directly involved in the secondary structure (i.e., the loops). Moreover, conserved sequences ranging from 4 to 25 nucleotides long were found at the beginning and end of each domain and could constitute genus-specific sequences. Comparisons of the V4, V6, and V9 secondary structures resulted in identification of the following four groups: (i) group I, which was characterized by the presence of additional P23-1 and P23-3 helices in the V4 domain and the lack of the P49-1 helix in V9 and included A. aegerita, A. chaxingu, and A. erebia; (ii) group II, which had the P23-3 helix in V4 and the P49-1 helix in V9 and included A. pediades; (iii) group III, which did not have additional helices in V4, had the P49-1 helix in V9 and included A. paludosa, A. firma, A. alnetorum, and A. praecox; and (iv) group IV, which lacked both the V4 additional helices and the P49-1 helix in V9 and included A. vervacti and A. dura. This grouping of species was supported by the structure of a consensus tree based on the variable domain sequences. The conservation of the sequences of the V4, V6, and V9 domains of the mitochondrial SSU rRNA within species and the high degree of interspecific variation found in the Agrocybe species studied open the way for these sequences to be used as specific molecular markers of the Basidiomycota. PMID:9797259
Gonzalez, P; Labarère, J
1998-11-01
A comparative study of variable domains V4, V6, and V9 of the mitochondrial small-subunit (SSU) rRNA was carried out with the genus Agrocybe by PCR amplification of 42 wild isolates belonging to 10 species, Agrocybe aegerita, Agrocybe dura, Agrocybe chaxingu, Agrocybe erebia, Agrocybe firma, Agrocybe praecox, Agrocybe paludosa, Agrocybe pediades, Agrocybe alnetorum, and Agrocybe vervacti. Sequencing of the PCR products showed that the three domains in the isolates belonging to the same species were the same length and had the same sequence, while variations were found among the 10 species. Alignment of the sequences showed that nucleotide motifs encountered in the smallest sequence of each variable domain were also found in the largest sequence, indicating that the sequences evolved by insertion-deletion events. Determination of the secondary structure of each domain revealed that the insertion-deletion events commonly occurred in regions not directly involved in the secondary structure (i.e., the loops). Moreover, conserved sequences ranging from 4 to 25 nucleotides long were found at the beginning and end of each domain and could constitute genus-specific sequences. Comparisons of the V4, V6, and V9 secondary structures resulted in identification of the following four groups: (i) group I, which was characterized by the presence of additional P23-1 and P23-3 helices in the V4 domain and the lack of the P49-1 helix in V9 and included A. aegerita, A. chaxingu, and A. erebia; (ii) group II, which had the P23-3 helix in V4 and the P49-1 helix in V9 and included A. pediades; (iii) group III, which did not have additional helices in V4, had the P49-1 helix in V9 and included A. paludosa, A. firma, A. alnetorum, and A. praecox; and (iv) group IV, which lacked both the V4 additional helices and the P49-1 helix in V9 and included A. vervacti and A. dura. This grouping of species was supported by the structure of a consensus tree based on the variable domain sequences. The conservation of the sequences of the V4, V6, and V9 domains of the mitochondrial SSU rRNA within species and the high degree of interspecific variation found in the Agrocybe species studied open the way for these sequences to be used as specific molecular markers of the Basidiomycota.
Elam, W Austin; Schrank, Travis P; Campagnolo, Andrew J; Hilser, Vincent J
2013-04-01
Intrinsically disordered (ID) proteins function in the absence of a unique stable structure and appear to challenge the classic structure-function paradigm. The extent to which ID proteins take advantage of subtle conformational biases to perform functions, and whether signals for such mechanism can be identified in proteome-wide studies is not well understood. Of particular interest is the polyproline II (PII) conformation, suggested to be highly populated in unfolded proteins. We experimentally determine a complete calorimetric propensity scale for the PII conformation. Projection of the scale into representative eukaryotic proteomes reveals significant PII bias in regions coding for ID proteins. Importantly, enrichment of PII in ID proteins, or protein segments, is also captured by other PII scales, indicating that this enrichment is robustly encoded and universally detectable regardless of the method of PII propensity determination. Gene ontology (GO) terms obtained using our PII scale and other scales demonstrate a consensus for molecular functions performed by high PII proteins across the proteome. Perhaps the most striking result of the GO analysis is conserved enrichment (P < 10(-8) ) of phosphorylation sites in high PII regions found by all PII scales. Subsequent conformational analysis reveals a phosphorylation-dependent modulation of PII, suggestive of a conserved "tunability" within these regions. In summary, the application of an experimentally determined polyproline II (PII) propensity scale to proteome-wide sequence analysis and gene ontology reveals an enrichment of PII bias near disordered phosphorylation sites that is conserved throughout eukaryotes. Copyright © 2013 The Protein Society.
Regional centromeres in the yeast Candida lusitaniae lack pericentromeric heterochromatin
Kapoor, Shivali; Zhu, Lisha; Froyd, Cara; Liu, Tao; Rusche, Laura N.
2015-01-01
Point centromeres are specified by a short consensus sequence that seeds kinetochore formation, whereas regional centromeres lack a conserved sequence and instead are epigenetically inherited. Regional centromeres are generally flanked by heterochromatin that ensures high levels of cohesin and promotes faithful chromosome segregation. However, it is not known whether regional centromeres require pericentromeric heterochromatin. In the yeast Candida lusitaniae, we identified a distinct type of regional centromere that lacks pericentromeric heterochromatin. Centromere locations were determined by ChIP-sequencing of two key centromere proteins, Cse4 and Mif2, and are consistent with bioinformatic predictions. The centromeric DNA sequence was unique for each chromosome and spanned 4–4.5 kbp, consistent with regional epigenetically inherited centromeres. However, unlike other regional centromeres, there was no evidence of pericentromeric heterochromatin in C. lusitaniae. In particular, flanking genes were expressed at a similar level to the rest of the genome, and a URA3 reporter inserted adjacent to a centromere was not repressed. In addition, regions flanking the centromeric core were not associated with hypoacetylated histones or a sirtuin deacetylase that generates heterochromatin in other yeast. Interestingly, the centromeric chromatin had a distinct pattern of histone modifications, being enriched for methylated H3K79 and H3R2 but lacking methylation of H3K4, which is found at other regional centromeres. Thus, not all regional centromeres require flanking heterochromatin. PMID:26371315
Hu, H M; Chuang, C K; Lee, M J; Tseng, T C; Tang, T K
2000-11-01
We previously reported two novel testis-specific serine/threonine kinases, Aie1 (mouse) and AIE2 (human), that share high amino acid identities with the kinase domains of fly aurora and yeast Ipl1. Here, we report the entire intron-exon organization of the Aie1 gene and analyze the expression patterns of Aie1 mRNA during testis development. The mouse Aie1 gene spans approximately 14 kb and contains seven exons. The sequences of the exon-intron boundaries of the Aie1 gene conform to the consensus sequences (GT/AG) of the splicing donor and acceptor sites of most eukaryotic genes. Comparative genomic sequencing revealed that the gene structure is highly conserved between mouse Aie1 and human AIE2. However, much less homology was found in the sequence outside the kinase-coding domains. The Aie1 locus was mapped to mouse chromosome 7A2-A3 by fluorescent in situ hybridization. Northern blot analysis indicates that Aie1 mRNA likely is expressed at a low level on day 14 and reaches its plateau on day 21 in the developing postnatal testis. RNA in situ hybridization indicated that the expression of the Aie1 transcript was restricted to meiotically active germ cells, with the highest levels detected in spermatocytes at the late pachytene stage. These findings suggest that Aie1 plays a role in spermatogenesis.
Foggetti, Giorgia; Raimondi, Ivan; Campomenosi, Paola; Menichini, Paola
2014-01-01
TP63 is a member of the TP53 gene family that encodes for up to ten different TA and ΔN isoforms through alternative promoter usage and alternative splicing. Besides being a master regulator of gene expression for squamous epithelial proliferation, differentiation and maintenance, P63, through differential expression of its isoforms, plays important roles in tumorigenesis. All P63 isoforms share an immunoglobulin-like folded DNA binding domain responsible for binding to sequence-specific response elements (REs), whose overall consensus sequence is similar to that of the canonical p53 RE. Using a defined assay in yeast, where P63 isoforms and RE sequences are the only variables, and gene expression assays in human cell lines, we demonstrated that human TA- and ΔN-P63α proteins exhibited differences in transactivation specificity not observed with the corresponding P73 or P53 protein isoforms. These differences 1) were dependent on specific features of the RE sequence, 2) could be related to intrinsic differences in their oligomeric state and cooperative DNA binding, and 3) appeared to be conserved in evolution. Since genotoxic stress can change relative ratio of TA- and ΔN-P63α protein levels, the different transactivation specificity of each P63 isoform could potentially influence cellular responses to specific stresses. PMID:24926492
Bo, Kari; Frawley, Helena C; Haylen, Bernard T; Abramov, Yoram; Almeida, Fernando G; Berghmans, Bary; Bortolini, Maria; Dumoulin, Chantale; Gomes, Mario; McClurg, Doreen; Meijlink, Jane; Shelly, Elizabeth; Trabuco, Emanuel; Walker, Carolina; Wells, Amanda
2017-02-01
There has been an increasing need for the terminology on the conservative management of female pelvic floor dysfunction to be collated in a clinically based consensus report. This Report combines the input of members and elected nominees of the Standardization and Terminology Committees of two International Organizations, the International Urogynecological Association (IUGA) and the International Continence Society (ICS), assisted at intervals by many external referees. An extensive process of nine rounds of internal and external review was developed to exhaustively examine each definition, with decision-making by collective opinion (consensus). Before opening up for comments on the webpages of ICS and IUGA, five experts from physiotherapy, neurology, urology, urogynecology, and nursing were invited to comment on the paper. A Terminology Report on the conservative management of female pelvic floor dysfunction, encompassing over 200 separate definitions, has been developed. It is clinically based, with the most common symptoms, signs, assessments, diagnoses, and treatments defined. Clarity and ease of use have been key aims to make it interpretable by practitioners and trainees in all the different specialty groups involved in female pelvic floor dysfunction. Ongoing review is not only anticipated, but will be required to keep the document updated and as widely acceptable as possible. A consensus-based terminology report for the conservative management of female pelvic floor dysfunction has been produced, aimed at being a significant aid to clinical practice and a stimulus for research.
Goh, C J; Park, D; Lee, J S; Sebastiani, F; Hahn, Y
2018-01-01
Amalgaviridae is a family of double-stranded, monosegmented RNA viruses that are associated with plants, fungi, microsporidians, and animals. A sequence contig derived from the transcriptome of a eudicot, Cistus incanus (the family Cistaceae; commonly known as hoary rockrose), was identified as the genome sequence of a novel plant RNA virus and named Cistus incanus RNA virus 1 (CiRV1). Sequence comparison and phylogenetic analysis indicated that CiRV1 is a novel species of the genus Amalgavirus in the family Amalgaviridae. The CiRV1 genome contig has two overlapping open reading frames (ORFs). ORF1 encodes a putative replication factory matrix-like protein, while ORF2 encodes a RNA-dependent RNA polymerase (RdRp) domain. An ORF1+2 fusion protein, which functions in viral RNA replication, is produced by a +1 programmed ribosomal frameshifting (PRF) mechanism. A +1 PRF motif UUU_CGU, which matches the conserved amalgavirus +1 PRF consensus sequence UUU_CGN, was found at the boundary of CiRV1 ORF1 and ORF2. Comparison of 25 amalgavirus ORF1+2 fusion proteins revealed that only three different positions within a 13-amino acid segment were recurrently used at the boundary, possibly being selected so as not to interfere with correct folding and function of the fusion protein. CiRV1 is the first virus found to be associated with the Cistus species and may be useful for studying amalgaviruses.
Tetraploid Wheat Landraces in the Mediterranean Basin: Taxonomy, Evolution and Genetic Diversity
Oliveira, Hugo R.; Campana, Michael G.; Jones, Huw; Hunt, Harriet V.; Leigh, Fiona; Redhouse, David I.; Lister, Diane L.; Jones, Martin K.
2012-01-01
The geographic distribution of genetic diversity and the population structure of tetraploid wheat landraces in the Mediterranean basin has received relatively little attention. This is complicated by the lack of consensus concerning the taxonomy of tetraploid wheats and by unresolved questions regarding the domestication and spread of naked wheats. These knowledge gaps hinder crop diversity conservation efforts and plant breeding programmes. We investigated genetic diversity and population structure in tetraploid wheats (wild emmer, emmer, rivet and durum) using nuclear and chloroplast simple sequence repeats, functional variations and insertion site-based polymorphisms. Emmer and wild emmer constitute a genetically distinct population from durum and rivet, the latter seeming to share a common gene pool. Our population structure and genetic diversity data suggest a dynamic history of introduction and extinction of genotypes in the Mediterranean fields. PMID:22615891
Distribution and sequence homogeneity of an abundant satellite DNA in the beetle, Tenebrio molitor.
Davis, C A; Wyatt, G R
1989-01-01
The mealworm beetle, Tenebrio molitor, contains an unusually abundant and homogeneous satellite DNA which constitutes up to 60% of its genome. The satellite DNA is shown to be present in all of the chromosomes by in situ hybridization. 18 dimers of the repeat unit were cloned and sequenced. The consensus sequence is 142 nt long and lacks any internal repeat structure. Monomers of the sequence are very similar, showing on average a 2% divergence from the calculated consensus. Variant nucleotides are scattered randomly throughout the sequence although some variants are more common than others. Neighboring repeat units are no more alike than randomly chosen ones. The results suggest that some mechanism, perhaps gene conversion, is acting to maintain the homogeneity of the satellite DNA despite its abundance and distribution on all of the chromosomes. Images PMID:2762148
Reviving the Dead: History and Reactivation of an Extinct L1
Yang, Lei; Brunsfeld, John; Scott, LuAnn; Wichman, Holly
2014-01-01
Although L1 sequences are present in the genomes of all placental mammals and marsupials examined to date, their activity was lost in the megabat family, Pteropodidae, ∼24 million years ago. To examine the characteristics of L1s prior to their extinction, we analyzed the evolutionary history of L1s in the genome of a megabat, Pteropus vampyrus, and found a pattern of periodic L1 expansion and quiescence. In contrast to the well-characterized L1s in human and mouse, megabat genomes have accommodated two or more simultaneously active L1 families throughout their evolutionary history, and major peaks of L1 deposition into the genome always involved multiple families. We compared the consensus sequences of the two major megabat L1 families at the time of their extinction to consensus L1s of a variety of mammalian species. Megabat L1s are comparable to the other mammalian L1s in terms of adenosine content and conserved amino acids in the open reading frames (ORFs). However, the intergenic region (IGR) of the reconstructed element from the more active family is dramatically longer than the IGR of well-characterized human and mouse L1s. We synthesized the reconstructed element from this L1 family and tested the ability of its components to support retrotransposition in a tissue culture assay. Both ORFs are capable of supporting retrotransposition, while the IGR is inhibitory to retrotransposition, especially when combined with either of the reconstructed ORFs. We dissected the inhibitory effect of the IGR by testing truncated and shuffled versions and found that length is a key factor, but not the only one affecting inhibition of retrotransposition. Although the IGR is inhibitory to retrotransposition, this inhibition does not account for the extinction of L1s in megabats. Overall, the evolution of the L1 sequence or the quiescence of L1 is unlikely the reason of L1 extinction. PMID:24968166
Reviving the dead: history and reactivation of an extinct l1.
Yang, Lei; Brunsfeld, John; Scott, LuAnn; Wichman, Holly
2014-06-01
Although L1 sequences are present in the genomes of all placental mammals and marsupials examined to date, their activity was lost in the megabat family, Pteropodidae, ∼24 million years ago. To examine the characteristics of L1s prior to their extinction, we analyzed the evolutionary history of L1s in the genome of a megabat, Pteropus vampyrus, and found a pattern of periodic L1 expansion and quiescence. In contrast to the well-characterized L1s in human and mouse, megabat genomes have accommodated two or more simultaneously active L1 families throughout their evolutionary history, and major peaks of L1 deposition into the genome always involved multiple families. We compared the consensus sequences of the two major megabat L1 families at the time of their extinction to consensus L1s of a variety of mammalian species. Megabat L1s are comparable to the other mammalian L1s in terms of adenosine content and conserved amino acids in the open reading frames (ORFs). However, the intergenic region (IGR) of the reconstructed element from the more active family is dramatically longer than the IGR of well-characterized human and mouse L1s. We synthesized the reconstructed element from this L1 family and tested the ability of its components to support retrotransposition in a tissue culture assay. Both ORFs are capable of supporting retrotransposition, while the IGR is inhibitory to retrotransposition, especially when combined with either of the reconstructed ORFs. We dissected the inhibitory effect of the IGR by testing truncated and shuffled versions and found that length is a key factor, but not the only one affecting inhibition of retrotransposition. Although the IGR is inhibitory to retrotransposition, this inhibition does not account for the extinction of L1s in megabats. Overall, the evolution of the L1 sequence or the quiescence of L1 is unlikely the reason of L1 extinction.
Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.
Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less
A surprisingly large RNase P RNA in Candida glabrata
KACHOURI, RYM; STRIBINSKIS, VILIUS; ZHU, YANGLONG; RAMOS, KENNETH S.; WESTHOF, ERIC; LI, YONG
2005-01-01
We have found an extremely large ribonuclease P (RNase P) RNA (RPR1) in the human pathogen Candida glabrata and verified that this molecule is expressed and present in the active enzyme complex of this hemiascomycete yeast. A structural alignment of the C. glabrata sequence with 36 other hemiascomycete RNase P RNAs (abbreviated as P RNAs) allows us to characterize the types of insertions. In addition, 15 P RNA sequences were newly characterized by searching in the recently sequenced genomes Candida albicans, C. glabrata, Debaryomyces hansenii, Eremothecium gossypii, Kluyveromyces lactis, Kluyveromyces waltii, Naumovia castellii, Saccharomyces kudriavzevii, Saccharomyces mikatae, and Yarrowia lipolytica; and by PCR amplification for other Candida species (Candida guilliermondii, Candida krusei, Candida parapsilosis, Candida stellatoidea, and Candida tropicalis). The phylogenetic comparative analysis identifies a hemiascomycete secondary structure consensus that presents a conserved core in all species with variable insertions or deletions. The most significant variability is found in C. glabrata P RNA in which three insertions exceeding in total 700 nt are present in the Specificity domain. This P RNA is more than twice the length of any other homologous P RNAs known in the three domains of life and is eight times the size of the smallest. RNase P RNA, therefore, represents one of the most diversified noncoding RNAs in terms of size variation and structural diversity. PMID:15987816
Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes
Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.; ...
2014-01-01
Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less
Genetic Diversity in Oxytocin Ligands and Receptors in New World Monkeys
Ren, Dongren; Lu, Guoqing; Moriyama, Hideaki; Mustoe, Aaryn C.; Harrison, Emily B.; French, Jeffrey A.
2015-01-01
Oxytocin (OXT) is an important neurohypophyseal hormone that influences wide spectrum of reproductive and social processes. Eutherian mammals possess a highly conserved sequence of OXT (Cys-Tyr-Ile-Gln-Asn-Cys-Pro-Leu-Gly). However, in this study, we sequenced the coding region for OXT in 22 species covering all New World monkeys (NWM) genera and clades, and characterize five OXT variants, including consensus mammalian Leu8-OXT, major variant Pro8-OXT, and three previously unreported variants: Ala8-OXT, Thr8-OXT, and Phe2-OXT. Pro8-OXT shows clear structural and physicochemical differences from Leu8-OXT. We report multiple predicted amino acid substitutions in the G protein-coupled OXT receptor (OXTR), especially in the critical N-terminus, which is crucial for OXT recognition and binding. Genera with same Pro8-OXT tend to cluster together on a phylogenetic tree based on OXTR sequence, and we demonstrate significant coevolution between OXT and OXTR. NWM species are characterized by high incidence of social monogamy, and we document an association between OXTR phylogeny and social monogamy. Our results demonstrate remarkable genetic diversity in the NWM OXT/OXTR system, which can provide a foundation for molecular, pharmacological, and behavioral studies of the role of OXT signaling in regulating complex social phenotypes. PMID:25938568
Wallis, Michael
2008-01-15
Mammalian growth hormone (GH) sequences have been shown previously to display episodic evolution: the sequence is generally strongly conserved but on at least two occasions during mammalian evolution (on lineages leading to higher primates and ruminants) bursts of rapid evolution occurred. However, the number of mammalian orders studied previously has been relatively limited, and the availability of sequence data via mammalian genome projects provides the potential for extending the range of GH gene sequences examined. Complete or nearly complete GH gene sequences for six mammalian species for which no data were previously available have been extracted from the genome databases-Dasypus novemcinctus (nine-banded armadillo), Erinaceus europaeus (western European hedgehog), Myotis lucifugus (little brown bat), Procavia capensis (cape rock hyrax), Sorex araneus (European shrew), Spermophilus tridecemlineatus (13-lined ground squirrel). In addition incomplete data for several other species have been extended. Examination of the data in detail and comparison with previously available sequences has allowed assessment of the reliability of deduced sequences. Several of the new sequences differ substantially from the consensus sequence previously determined for eutherian GHs, indicating greater variability than previously recognised, and confirming the episodic pattern of evolution. The episodic pattern is not seen for signal sequences, 5' upstream sequence or synonymous substitutions-it is specific to the mature protein sequence, suggesting that it relates to the hormonal function. The substitutions accumulated during the course of GH evolution have occurred mainly on the side of the hormone facing away from the receptor, in a non-random fashion, and it is suggested that this may reflect interaction of the receptor-bound hormone with other proteins or small ligands.
Shahin, Arwa; Smulders, Marinus J. M.; van Tuyl, Jaap M.; Arens, Paul; Bakker, Freek T.
2014-01-01
Next Generation Sequencing (NGS) may enable estimating relationships among genotypes using allelic variation of multiple nuclear genes simultaneously. We explored the potential and caveats of this strategy in four genetically distant Lilium cultivars to estimate their genetic divergence from transcriptome sequences using three approaches: POFAD (Phylogeny of Organisms from Allelic Data, uses allelic information of sequence data), RAxML (Randomized Accelerated Maximum Likelihood, tree building based on concatenated consensus sequences) and Consensus Network (constructing a network summarizing among gene tree conflicts). Twenty six gene contigs were chosen based on the presence of orthologous sequences in all cultivars, seven of which also had an orthologous sequence in Tulipa, used as out-group. The three approaches generated the same topology. Although the resolution offered by these approaches is high, in this case there was no extra benefit in using allelic information. We conclude that these 26 genes can be widely applied to construct a species tree for the genus Lilium. PMID:25368628
Conservation and diversification of Msx protein in metazoan evolution.
Takahashi, Hirokazu; Kamiya, Akiko; Ishiguro, Akira; Suzuki, Atsushi C; Saitou, Naruya; Toyoda, Atsushi; Aruga, Jun
2008-01-01
Msx (/msh) family genes encode homeodomain (HD) proteins that control ontogeny in many animal species. We compared the structures of Msx genes from a wide range of Metazoa (Porifera, Cnidaria, Nematoda, Arthropoda, Tardigrada, Platyhelminthes, Mollusca, Brachiopoda, Annelida, Echiura, Echinodermata, Hemichordata, and Chordata) to gain an understanding of the role of these genes in phylogeny. Exon-intron boundary analysis suggested that the position of the intron located N-terminally to the HDs was widely conserved in all the genes examined, including those of cnidarians. Amino acid (aa) sequence comparison revealed 3 new evolutionarily conserved domains, as well as very strong conservation of the HDs. Two of the three domains were associated with Groucho-like protein binding in both a vertebrate and a cnidarian Msx homolog, suggesting that the interaction between Groucho-like proteins and Msx proteins was established in eumetazoan ancestors. Pairwise comparison among the collected HDs and their C-flanking aa sequences revealed that the degree of sequence conservation varied depending on the animal taxa from which the sequences were derived. Highly conserved Msx genes were identified in the Vertebrata, Cephalochordata, Hemichordata, Echinodermata, Mollusca, Brachiopoda, and Anthozoa. The wide distribution of the conserved sequences in the animal phylogenetic tree suggested that metazoan ancestors had already acquired a set of conserved domains of the current Msx family genes. Interestingly, although strongly conserved sequences were recovered from the Vertebrata, Cephalochordata, and Anthozoa, the sequences from the Urochordata and Hydrozoa showed weak conservation. Because the Vertebrata-Cephalochordata-Urochordata and Anthozoa-Hydrozoa represent sister groups in the Chordata and Cnidaria, respectively, Msx sequence diversification may have occurred differentially in the course of evolution. We speculate that selective loss of the conserved domains in Msx family proteins contributed to the diversification of animal body organization.
Bhutiani, Neal; Mercer, Megan K; Bachman, Katelynn C; Heidrich, Samantha R; Martin, Robert C G; Scoggins, Charles R; McMasters, Kelly M; Ajkay, Nicolás
2018-02-09
This study sought to evaluate re-excision rates, patient satisfaction with their breasts, and healthcare costs before and after publication of 2014 Society of Surgical Oncology/American Society of Radiation Oncology consensus guideline on margins for breast conserving operation with whole-breast irradiation for stage I and II breast cancer at an academic institution. Patients with stage I and II invasive carcinomas who underwent partial mastectomy were divided into 2 groups based on whether they were treated before (PRE) or after (POST) guideline publication in March 2014. Groups were compared with respect to re-excision rates, conversion to mastectomy, specimen volumes, mean cost per patient of surgical care, and prospectively collected patient post-procedure quality of life. A total of 237 patients who underwent partial mastectomy were examined (n = 126 in the PRE group and n = 111 in the POST group). Patients in the POST group were less likely to require re-excision (9% POST vs 37% PRE; p < 0.001) and were less likely to undergo conversion to mastectomy (5% POST vs 14% PRE; p = 0.02). After consensus guideline publication, mean operative cost per patient decreased ($4,874 POST vs $5,772 PRE; p < 0.001), and patients had improved breast quality of life scores (77 out of 100 POST vs 61 out of 100 PRE; p = 0.03). On multivariable analysis, publication of the consensus statement was an independent predictor of decreased re-excision rates (odds ratio 0.17; 95% CI 0.08 to 0.38; p < 0.001) and operative cost per patient (odds ratio 0.14; 95% CI 0.78 to 0.30; p < 0.001). Widespread implementation of the consensus guideline on margins for breast conserving operation will likely lead to the intended improvements in operative and financial outcomes, as well as patient satisfaction with breast conserving operation. Copyright © 2018 American College of Surgeons. Published by Elsevier Inc. All rights reserved.
Conservative treatment for acute Achilles tendon rupture: survey of current practice.
Osarumwense, Donald; Wright, Jonathan; Gardner, Kikachukwu; James, Laurence
2013-04-01
To survey the practice of orthopaedic consultants in the Greater London area for treating Achilles tendon ruptures. 221 orthopaedic consultants working in 28 hospitals within the Greater London area were identified. A questionnaire regarding conservative treatment for acute Achilles tendon ruptures was sent. The choice of immobilisation, the period of immobilisation, the time to weight bearing, the use of heel raises, and the use of diagnostic ultrasonography were enquired about. 62 of 86 respondents treated Achilles tendon ruptures conservatively by below-knee casts (n=51), above-knee casts (n=5), or functional braces (n=6). The most common immobilisation regimen (n=7) was to keep the foot in a sequence of an equinus position, a semi-equinus position, and a neutral position (3 weeks in each position). After cast removal, 45 of respondents preferred to use a heel raise for a median duration of 4 (range, 2-36) weeks. Respectively for foot and ankle specialists (n=24) and other orthopaedic specialists (n=38), the median immobilisation period prescribed was 8 (range, 3-13) and 9 (range, 6-36) weeks, respectively (p=0.625), whereas the median time to weight bearing prescribed was 6 (range, 0-9) and 6 (range, 0-12) weeks, respectively (p=0.402). Functional bracing was not as widely used as below-knee cast immobilisation. There was no consensus on the optimal immobilisation regimen.
[SECOT consensus on medial femorotibial osteoarthritis].
Moreno, A; Silvestre, A; Carpintero, P
2013-01-01
A consensus, prepared by SECOT, is presented on the management of medial knee compartment osteoarthritis, in order to establish clinical criteria and recommendations directed at unifying the criteria in its management, dealing with the factors involved in the pathogenesis of medial femorotibial knee osteoarthritis, the usefulness of diagnostic imaging techniques, and the usefulness of arthroscopy. Conservative and surgical treatments are also analysed. The experts consulted showed a consensus (agreed or disagreed) in 65.8% of the items considered, leaving 14items where no consensus was found, which included the aetiopathogenesis of the osteoarthritis, the value of NMR in degenerative disease, the usefulness of COX-2 and the chondroprotective drugs, as well as on the ideal valgus tibial osteotomy technique. © 2013 SECOT. Published by Elsevier Espana. All rights reserved.
R2R - software to speed the depiction of aesthetic consensus RNA secondary structures
2011-01-01
Background With continuing identification of novel structured noncoding RNAs, there is an increasing need to create schematic diagrams showing the consensus features of these molecules. RNA structural diagrams are typically made either with general-purpose drawing programs like Adobe Illustrator, or with automated or interactive programs specific to RNA. Unfortunately, the use of applications like Illustrator is extremely time consuming, while existing RNA-specific programs produce figures that are useful, but usually not of the same aesthetic quality as those produced at great cost in Illustrator. Additionally, most existing RNA-specific applications are designed for drawing single RNA molecules, not consensus diagrams. Results We created R2R, a computer program that facilitates the generation of aesthetic and readable drawings of RNA consensus diagrams in a fraction of the time required with general-purpose drawing programs. Since the inference of a consensus RNA structure typically requires a multiple-sequence alignment, the R2R user annotates the alignment with commands directing the layout and annotation of the RNA. R2R creates SVG or PDF output that can be imported into Adobe Illustrator, Inkscape or CorelDRAW. R2R can be used to create consensus sequence and secondary structure models for novel RNA structures or to revise models when new representatives for known RNA classes become available. Although R2R does not currently have a graphical user interface, it has proven useful in our efforts to create 100 schematic models of distinct noncoding RNA classes. Conclusions R2R makes it possible to obtain high-quality drawings of the consensus sequence and structural models of many diverse RNA structures with a more practical amount of effort. R2R software is available at http://breaker.research.yale.edu/R2R and as an Additional file. PMID:21205310
Functionally conserved enhancers with divergent sequences in distant vertebrates
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Song; Oksenberg, Nir; Takayama, Sachiko
To examine the contributions of sequence and function conservation in the evolution of enhancers, we systematically identified enhancers whose sequences are not conserved among distant groups of vertebrate species, but have homologous function and are likely to be derived from a common ancestral sequence. In conclusion, our approach combined comparative genomics and epigenomics to identify potential enhancer sequences in the genomes of three groups of distantly related vertebrate species.
Functionally conserved enhancers with divergent sequences in distant vertebrates
Yang, Song; Oksenberg, Nir; Takayama, Sachiko; ...
2015-10-30
To examine the contributions of sequence and function conservation in the evolution of enhancers, we systematically identified enhancers whose sequences are not conserved among distant groups of vertebrate species, but have homologous function and are likely to be derived from a common ancestral sequence. In conclusion, our approach combined comparative genomics and epigenomics to identify potential enhancer sequences in the genomes of three groups of distantly related vertebrate species.
Nonhybrid, finished microbial genome assemblies from long-read SMRT sequencing data.
Chin, Chen-Shan; Alexander, David H; Marks, Patrick; Klammer, Aaron A; Drake, James; Heiner, Cheryl; Clum, Alicia; Copeland, Alex; Huddleston, John; Eichler, Evan E; Turner, Stephen W; Korlach, Jonas
2013-06-01
We present a hierarchical genome-assembly process (HGAP) for high-quality de novo microbial genome assemblies using only a single, long-insert shotgun DNA library in conjunction with Single Molecule, Real-Time (SMRT) DNA sequencing. Our method uses the longest reads as seeds to recruit all other reads for construction of highly accurate preassembled reads through a directed acyclic graph-based consensus procedure, which we follow with assembly using off-the-shelf long-read assemblers. In contrast to hybrid approaches, HGAP does not require highly accurate raw reads for error correction. We demonstrate efficient genome assembly for several microorganisms using as few as three SMRT Cell zero-mode waveguide arrays of sequencing and for BACs using just one SMRT Cell. Long repeat regions can be successfully resolved with this workflow. We also describe a consensus algorithm that incorporates SMRT sequencing primary quality values to produce de novo genome sequence exceeding 99.999% accuracy.
Variation of 45S rDNA intergenic spacers in Arabidopsis thaliana.
Havlová, Kateřina; Dvořáčková, Martina; Peiro, Ramon; Abia, David; Mozgová, Iva; Vansáčová, Lenka; Gutierrez, Crisanto; Fajkus, Jiří
2016-11-01
Approximately seven hundred 45S rRNA genes (rDNA) in the Arabidopsis thaliana genome are organised in two 4 Mbp-long arrays of tandem repeats arranged in head-to-tail fashion separated by an intergenic spacer (IGS). These arrays make up 5 % of the A. thaliana genome. IGS are rapidly evolving sequences and frequent rearrangements inside the rDNA loci have generated considerable interspecific and even intra-individual variability which allows to distinguish among otherwise highly conserved rRNA genes. The IGS has not been comprehensively described despite its potential importance in regulation of rDNA transcription and replication. Here we describe the detailed sequence variation in the complete IGS of A. thaliana WT plants and provide the reference/consensus IGS sequence, as well as genomic DNA analysis. We further investigate mutants dysfunctional in chromatin assembly factor-1 (CAF-1) (fas1 and fas2 mutants), which are known to have a reduced number of rDNA copies, and plant lines with restored CAF-1 function (segregated from a fas1xfas2 genetic background) showing major rDNA rearrangements. The systematic rDNA loss in CAF-1 mutants leads to the decreased variability of the IGS and to the occurrence of distinct IGS variants. We present for the first time a comprehensive and representative set of complete IGS sequences, obtained by conventional cloning and by Pacific Biosciences sequencing. Our data expands the knowledge of the A. thaliana IGS sequence arrangement and variability, which has not been available in full and in detail until now. This is also the first study combining IGS sequencing data with RFLP analysis of genomic DNA.
Torto-Alalibo, Trudy; Tian, Miaoying; Gajendran, Kamal; Waugh, Mark E; van West, Pieter; Kamoun, Sophien
2005-01-01
Background The oomycete Saprolegnia parasitica is one of the most economically important fish pathogens. There is a dramatic recrudescence of Saprolegnia infections in aquaculture since the use of the toxic organic dye malachite green was banned in 2002. Little is known about the molecular mechanisms underlying pathogenicity in S. parasitica and other animal pathogenic oomycetes. In this study we used a genomics approach to gain a first insight into the transcriptome of S. parasitica. Results We generated 1510 expressed sequence tags (ESTs) from a mycelial cDNA library of S. parasitica. A total of 1279 consensus sequences corresponding to 525944 base pairs were assembled. About half of the unigenes showed similarities to known protein sequences or motifs. The S. parasitica sequences tended to be relatively divergent from Phytophthora sequences. Based on the sequence alignments of 18 conserved proteins, the average amino acid identity between S. parasitica and three Phytophthora species was 77% compared to 93% within Phytophthora. Several S. parasitica cDNAs, such as those with similarity to fungal type I cellulose binding domain proteins, PAN/Apple module proteins, glycosyl hydrolases, proteases, as well as serine and cysteine protease inhibitors, were predicted to encode secreted proteins that could function in virulence. Some of these cDNAs were more similar to fungal proteins than to other eukaryotic proteins confirming that oomycetes and fungi share some virulence components despite their evolutionary distance Conclusion We provide a first glimpse into the gene content of S. parasitica, a reemerging oomycete fish pathogen. These resources will greatly accelerate research on this important pathogen. The data is available online through the Oomycete Genomics Database [1]. PMID:16076392
Wellehan, James F. X.; Johnson, April J.; Harrach, Balázs; Benkö, Mária; Pessier, Allan P.; Johnson, Calvin M.; Garner, Michael M.; Childress, April; Jacobson, Elliott R.
2004-01-01
A consensus nested-PCR method was designed for investigation of the DNA polymerase gene of adenoviruses. Gene fragments were amplified and sequenced from six novel adenoviruses from seven lizard species, including four species from which adenoviruses had not previously been reported. Host species included Gila monster, leopard gecko, fat-tail gecko, blue-tongued skink, Tokay gecko, bearded dragon, and mountain chameleon. This is the first sequence information from lizard adenoviruses. Phylogenetic analysis indicated that these viruses belong to the genus Atadenovirus, supporting the reptilian origin of atadenoviruses. This PCR method may be useful for obtaining templates for initial sequencing of novel adenoviruses. PMID:15542689
Wellehan, James F X; Johnson, April J; Harrach, Balázs; Benkö, Mária; Pessier, Allan P; Johnson, Calvin M; Garner, Michael M; Childress, April; Jacobson, Elliott R
2004-12-01
A consensus nested-PCR method was designed for investigation of the DNA polymerase gene of adenoviruses. Gene fragments were amplified and sequenced from six novel adenoviruses from seven lizard species, including four species from which adenoviruses had not previously been reported. Host species included Gila monster, leopard gecko, fat-tail gecko, blue-tongued skink, Tokay gecko, bearded dragon, and mountain chameleon. This is the first sequence information from lizard adenoviruses. Phylogenetic analysis indicated that these viruses belong to the genus Atadenovirus, supporting the reptilian origin of atadenoviruses. This PCR method may be useful for obtaining templates for initial sequencing of novel adenoviruses.
Bergman, C M; Kreitman, M
2001-08-01
Comparative genomic approaches to gene and cis-regulatory prediction are based on the principle that differential DNA sequence conservation reflects variation in functional constraint. Using this principle, we analyze noncoding sequence conservation in Drosophila for 40 loci with known or suspected cis-regulatory function encompassing >100 kb of DNA. We estimate the fraction of noncoding DNA conserved in both intergenic and intronic regions and describe the length distribution of ungapped conserved noncoding blocks. On average, 22%-26% of noncoding sequences surveyed are conserved in Drosophila, with median block length approximately 19 bp. We show that point substitution in conserved noncoding blocks exhibits transition bias as well as lineage effects in base composition, and occurs more than an order of magnitude more frequently than insertion/deletion (indel) substitution. Overall, patterns of noncoding DNA structure and evolution differ remarkably little between intergenic and intronic conserved blocks, suggesting that the effects of transcription per se contribute minimally to the constraints operating on these sequences. The results of this study have implications for the development of alignment and prediction algorithms specific to noncoding DNA, as well as for models of cis-regulatory DNA sequence evolution.
Identification and application of self-binding zipper-like sequences in SARS-CoV spike protein.
Zhang, Si Min; Liao, Ying; Neo, Tuan Ling; Lu, Yanning; Liu, Ding Xiang; Vahlne, Anders; Tam, James P
2018-05-22
Self-binding peptides containing zipper-like sequences, such as the Leu/Ile zipper sequence within the coiled coil regions of proteins and the cross-β spine steric zippers within the amyloid-like fibrils, could bind to the protein-of-origin through homophilic sequence-specific zipper motifs. These self-binding sequences represent opportunities for the development of biochemical tools and/or therapeutics. Here, we report on the identification of a putative self-binding β-zipper-forming peptide within the severe acute respiratory syndrome-associated coronavirus spike (S) protein and its application in viral detection. Peptide array scanning of overlapping peptides covering the entire length of S protein identified 34 putative self-binding peptides of six clusters, five of which contained octapeptide core consensus sequences. The Cluster I consensus octapeptide sequence GINITNFR was predicted by the Eisenberg's 3D profile method to have high amyloid-like fibrillation potential through steric β-zipper formation. Peptide C6 containing the Cluster I consensus sequence was shown to oligomerize and form amyloid-like fibrils. Taking advantage of this, C6 was further applied to detect the S protein expression in vitro by fluorescence staining. Meanwhile, the coiled-coil-forming Leu/Ile heptad repeat sequences within the S protein were under-represented during peptide array scanning, in agreement with that long peptide lengths were required to attain high helix-mediated interaction avidity. The data suggest that short β-zipper-like self-binding peptides within the S protein could be identified through combining the peptide scanning and predictive methods, and could be exploited as biochemical detection reagents for viral infection. Copyright © 2018. Published by Elsevier Ltd.
Biological function in the twilight zone of sequence conservation.
Ponting, Chris P
2017-08-16
Strong DNA conservation among divergent species is an indicator of enduring functionality. With weaker sequence conservation we enter a vast 'twilight zone' in which sequence subject to transient or lower constraint cannot be distinguished easily from neutrally evolving, non-functional sequence. Twilight zone functional sequence is illuminated instead by principles of selective constraint and positive selection using genomic data acquired from within a species' population. Application of these principles reveals that despite being biochemically active, most twilight zone sequence is not functional.
Brondani, Rosana PV; Williams, Emlyn R; Brondani, Claudio; Grattapaglia, Dario
2006-01-01
Background Eucalypts are the most widely planted hardwood trees in the world occupying globally more than 18 million hectares as an important source of carbon neutral renewable energy and raw material for pulp, paper and solid wood. Quantitative Trait Loci (QTLs) in Eucalyptus have been localized on pedigree-specific RAPD or AFLP maps seriously limiting the value of such QTL mapping efforts for molecular breeding. The availability of a genus-wide genetic map with transferable microsatellite markers has become a must for the effective advancement of genomic undertakings. This report describes the development of a novel set of 230 EMBRA microsatellites, the construction of the first comprehensive microsatellite-based consensus linkage map for Eucalyptus and the consolidation of existing linkage information for other microsatellites and candidate genes mapped in other species of the genus. Results The consensus map covers ~90% of the recombining genome of Eucalyptus, involves 234 mapped EMBRA loci on 11 linkage groups, an observed length of 1,568 cM and a mean distance between markers of 8.4 cM. A compilation of all microsatellite linkage information published in Eucalyptus allowed us to establish the homology among linkage groups between this consensus map and other maps published for E. globulus. Comparative mapping analyses also resulted in the linkage group assignment of other 41 microsatellites derived from other Eucalyptus species as well as candidate genes and QTLs for wood and flowering traits published in the literature. This report significantly increases the availability of microsatellite markers and mapping information for species of Eucalyptus and corroborates the high conservation of microsatellite flanking sequences and locus ordering between species of the genus. Conclusion This work represents an important step forward for Eucalyptus comparative genomics, opening stimulating perspectives for evolutionary studies and molecular breeding applications. The generalized use of an increasingly larger set of interspecific transferable markers and consensus mapping information, will allow faster and more detailed investigations of QTL synteny among species, validation of expression-QTL across variable genetic backgrounds and positioning of a growing number of candidate genes co-localized with QTLs, to be tested in association mapping experiments. PMID:16995939
Bo, Kari; Frawley, Helena C; Haylen, Bernard T; Abramov, Yoram; Almeida, Fernando G; Berghmans, Bary; Bortolini, Maria; Dumoulin, Chantale; Gomes, Mario; McClurg, Doreen; Meijlink, Jane; Shelly, Elizabeth; Trabuco, Emanuel; Walker, Carolina; Wells, Amanda
2017-02-01
Introduction and hypothesis There has been an increasing need for the terminology on the conservative management of female pelvic floor dysfunction to be collated in a clinically based consensus report. Methods This Report combines the input of members and elected nominees of the Standardization and Terminology Committees of two International Organizations, the International Urogynecological Association (IUGA) and the International Continence Society (ICS), assisted at intervals by many external referees. An extensive process of nine rounds of internal and external review was developed to exhaustively examine each definition, with decision-making by collective opinion (consensus). Before opening up for comments on the webpages of ICS and IUGA, five experts from physiotherapy, neurology, urology, urogynecology, and nursing were invited to comment on the paper. Results A Terminology Report on the conservative management of female pelvic floor dysfunction, encompassing over 200 separate definitions, has been developed. It is clinically based, with the most common symptoms, signs, assessments, diagnoses, and treatments defined. Clarity and ease of use have been key aims to make it interpretable by practitioners and trainees in all the different specialty groups involved in female pelvic floor dysfunction. Ongoing review is not only anticipated, but will be required to keep the document updated and as widely acceptable as possible. Conclusion A consensus-based terminology report for the conservative management of female pelvic floor dysfunction has been produced, aimed at being a significant aid to clinical practice and a stimulus for research. © 2016 Wiley Periodicals, Inc., and The International Urogynecological Association.
Federal Register 2010, 2011, 2012, 2013, 2014
2013-12-31
... Conservation Program: Proposed Determination of Set-Top Boxes and Network Equipment as a Covered Consumer... published June 15, 2011 that set-top boxes (STBs) and network equipment qualify as a covered product under... action in light of a consensus agreement entered by a broadly representative group that DOE believes has...
Nucleotide sequence of the gene encoding the nitrogenase iron protein of Thiobacillus ferrooxidans
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pretorius, I.M.; Rawlings, D.E.; O'Neill, E.G.
1987-01-01
The DNA sequence was determined for the cloned Thiobacillus ferrooxidans nifH and part of the nifD genes. The DNA chains were radiolabeled with (..cap alpha..-/sup 32/P)dCTP (3000 Ci/mmol) or (..cap alpha..-/sup 35/S)dCTP (400 Ci/mmol). A putative T. ferrooxidans nifH promoter was identified whose sequences showed perfect consensus with those of the Klebsiella pneumoniae nif promoter. Two putative consensus upstream activator sequences were also identified. The amino acid sequence was deduced from the DNA sequence. In a comparison of nifH DNA sequences from T. ferrooxidans and eight other nitrogen-fixing microbes, a Rhizobium sp. isolated from Parasponia andersonii showed the greatest homologymore » (74%) and Clostridium pasteurianum (nifH1) showed the least homology (54%). In the comparison of the amino acid sequences of the Fe proteins, the Rhizobium sp. and Rhizobium japonicum showed the greatest homology (both 86%) and C. pasteurianum (nifH1 gene product) demonstrated the least homology (56%) to the T. ferrooxidans Fe protein.« less
de la Rosa, Guillermo; Corrales-García, Ligia L; Rodriguez-Ruiz, Ximena; López-Vera, Estuardo; Corzo, Gerardo
2018-07-01
The three-fingered toxin family and more precisely short-chain α-neurotoxins (also known as Type I α-neurotoxins) are crucial in defining the elapid envenomation process, but paradoxically, they are barely neutralized by current elapid snake antivenoms. This work has been focused on the primary structural identity among Type I neurotoxins in order to create a consensus short-chain α-neurotoxin with conserved characteristics. A multiple sequence alignment considering the twelve most toxic short-chain α-neurotoxins reported from the venoms of the elapid genera Acanthophis, Oxyuranus, Walterinnesia, Naja, Dendroaspis and Micrurus led us to propose a short-chain consensus α-neurotoxin, here named ScNtx. The synthetic ScNtx gene was de novo constructed and cloned into the expression vector pQE30 containing a 6His-Tag and an FXa proteolytic cleavage region. Escherichia coli Origami cells transfected with the pQE30/ScNtx vector expressed the recombinant consensus neurotoxin in a soluble form with a yield of 1.5 mg/L of culture medium. The 60-amino acid residue ScNtx contains canonical structural motifs similar to α-neurotoxins from African elapids and its LD 50 of 3.8 µg/mice is similar to the most toxic short-chain α-neurotoxins reported from elapid venoms. Furthermore, ScNtx was also able to antagonize muscular, but not neuronal, nicotinic acetylcholine receptors (nAChR). Rabbits immunized with ScNtx were able to immune-recognize short-chain α-neurotoxins within whole elapid venoms. Type I neurotoxins are difficult to isolate and purify from natural sources; therefore, the heterologous expression of molecules such ScNtx, bearing crucial motifs and key amino acids, is a step forward to create common immunogens for developing cost-effective antivenoms with a wider spectrum of efficacy, quality and strong therapeutic value.
A strategy for detecting the conservation of folding-nucleus residues in protein superfamilies.
Michnick, S W; Shakhnovich, E
1998-01-01
Nucleation-growth theory predicts that fast-folding peptide sequences fold to their native structure via structures in a transition-state ensemble that share a small number of native contacts (the folding nucleus). Experimental and theoretical studies of proteins suggest that residues participating in folding nuclei are conserved among homologs. We attempted to determine if this is true in proteins with highly diverged sequences but identical folds (superfamilies). We describe a strategy based on comparisons of residue conservation in natural superfamily sequences with simulated sequences (generated with a Monte-Carlo sequence design strategy) for the same proteins. The basic assumptions of the strategy were that natural sequences will conserve residues needed for folding and stability plus function, the simulated sequences contain no functional conservation, and nucleus residues make native contacts with each other. Based on these assumptions, we identified seven potential nucleus residues in ubiquitin superfamily members. Non-nucleus conserved residues were also identified; these are proposed to be involved in stabilizing native interactions. We found that all superfamily members conserved the same potential nucleus residue positions, except those for which the structural topology is significantly different. Our results suggest that the conservation of the nucleus of a specific fold can be predicted by comparing designed simulated sequences with natural highly diverged sequences that fold to the same structure. We suggest that such a strategy could be used to help plan protein folding and design experiments, to identify new superfamily members, and to subdivide superfamilies further into classes having a similar folding mechanism.
Fossati, Sara Maria; Candiani, Simona; Nödl, Marie-Therese; Maragliano, Luca; Pennuto, Maria; Domingues, Pedro; Benfenati, Fabio; Pestarino, Mario; Zullo, Letizia
2015-08-01
Acetylcholinesterase (ACHE) is a glycoprotein with a key role in terminating synaptic transmission in cholinergic neurons of both vertebrates and invertebrates. ACHE is also involved in the regulation of cell growth and morphogenesis during embryogenesis and regeneration acting through its non-cholinergic sites. The mollusk Octopus vulgaris provides a powerful model for investigating the mechanisms underlying tissue morphogenesis due to its high regenerative power. Here, we performed a comparative investigation of arm morphogenesis during adult arm regeneration and embryonic arm development which may provide insights on the conserved ACHE pathways. In this study, we cloned and characterized O. vulgaris ACHE, finding a single highly conserved ACHE hydrophobic variant, characterized by prototypical catalytic sites and a putative consensus region for a glycosylphosphatidylinositol (GPI)-anchor attachment at the COOH-terminus. We then show that its expression level is correlated to the stage of morphogenesis in both adult and embryonic arm. In particular, ACHE is localized in typical neuronal sites when adult-like arm morphology is established and in differentiating cell locations during the early stages of arm morphogenesis. This possibility is also supported by the presence in the ACHE sequence and model structure of both cholinergic and non-cholinergic sites. This study provides insights into ACHE conserved roles during processes of arm morphogenesis. In addition, our modeling study offers a solid basis for predicting the interaction of the ACHE domains with pharmacological blockers for in vivo investigations. We therefore suggest ACHE as a target for the regulation of tissue morphogenesis.
A Molecular Phylogeny of Living Primates
Perelman, Polina; Johnson, Warren E.; Roos, Christian; Seuánez, Hector N.; Horvath, Julie E.; Moreira, Miguel A. M.; Kessing, Bailey; Pontius, Joan; Roelke, Melody; Rumpler, Yves; Schneider, Maria Paula C.; Silva, Artur; O'Brien, Stephen J.; Pecon-Slattery, Jill
2011-01-01
Comparative genomic analyses of primates offer considerable potential to define and understand the processes that mold, shape, and transform the human genome. However, primate taxonomy is both complex and controversial, with marginal unifying consensus of the evolutionary hierarchy of extant primate species. Here we provide new genomic sequence (∼8 Mb) from 186 primates representing 61 (∼90%) of the described genera, and we include outgroup species from Dermoptera, Scandentia, and Lagomorpha. The resultant phylogeny is exceptionally robust and illuminates events in primate evolution from ancient to recent, clarifying numerous taxonomic controversies and providing new data on human evolution. Ongoing speciation, reticulate evolution, ancient relic lineages, unequal rates of evolution, and disparate distributions of insertions/deletions among the reconstructed primate lineages are uncovered. Our resolution of the primate phylogeny provides an essential evolutionary framework with far-reaching applications including: human selection and adaptation, global emergence of zoonotic diseases, mammalian comparative genomics, primate taxonomy, and conservation of endangered species. PMID:21436896
Schwannomatosis associated with multiple meningiomas due to a familial SMARCB1 mutation.
Bacci, Costanza; Sestini, Roberta; Provenzano, Aldesia; Paganini, Irene; Mancini, Irene; Porfirio, Berardino; Vivarelli, Rossella; Genuardi, Maurizio; Papi, Laura
2010-02-01
Schwannomatosis (MIM 162091) is a condition predisposing to the development of central and peripheral schwannomas; most cases are sporadic without a clear family history but a few families with a clear autosomal dominant pattern of transmission have been described. Germline mutations in SMARCB1 are associated with schwannomatosis. We report a family with multiple schwannomas and meningiomas. A SMARCB1 germline mutation in exon 1 was identified. The mutation, c.92A>T (p.Glu31Val), occurs in a highly conserved amino acid in the SMARCB1 protein. In addition, in silico analysis demonstrated that the mutation disrupts the donor consensus sequence of exon 1. RNA studies verified the absence of mRNA transcribed by the mutant allele. This is the first report of a SMARCB1 germline mutation in a family with schwannomatosis characterized by the development of multiple meningiomas.
Reid-Bayliss, Kate S; Loeb, Lawrence A
2017-08-29
Transcriptional mutagenesis (TM) due to misincorporation during RNA transcription can result in mutant RNAs, or epimutations, that generate proteins with altered properties. TM has long been hypothesized to play a role in aging, cancer, and viral and bacterial evolution. However, inadequate methodologies have limited progress in elucidating a causal association. We present a high-throughput, highly accurate RNA sequencing method to measure epimutations with single-molecule sensitivity. Accurate RNA consensus sequencing (ARC-seq) uniquely combines RNA barcoding and generation of multiple cDNA copies per RNA molecule to eliminate errors introduced during cDNA synthesis, PCR, and sequencing. The stringency of ARC-seq can be scaled to accommodate the quality of input RNAs. We apply ARC-seq to directly assess transcriptome-wide epimutations resulting from RNA polymerase mutants and oxidative stress.
NFATc1 regulation of the human β3 integrin promoter in osteoclast differentiation
Crotti, Tania N.; Flannery, Merrilee; Walsh, Nicole C.; Fleming, Joseph D.; Goldring, Steven R.; McHugh, Kevin P.
2006-01-01
The transcription factor NFATc1 plays an essential role in transducing signals from RANKL in osteoclast differentiation. To date, however, the specific transcriptional targets of NFATc1 are unknown. Expression of the β3 integrin is required for normal osteoclast function. We therefore examined the role of NFATc1 in human β3 integrin expression in osteoclast differentiation. Analysis of the mouse and human β3 gene promoters revealed considerable sequence homology across a 1.3 kb region upstream of the transcription start site (TSS), with conserved NFAT binding elements present. The region −1242 to +29 (relative to the TSS) was cloned as a luciferase reporter construct (pB3-1.3) and a deletion construct removing to −997 (pB3-1) made. The deletion of 245 bp 5′ removed three conserved NFAT sites including a consensus NFAT:AP-1 site. The pB3-1.3 reporter construct was induced by treatment with RANKL in the range 2.5–40 ng/ml and dose-dependently induced by co-transfection with human NFATc1 in RAW264.7 cells. The pB3-1 deletion construct was minimally induced with RANKL treatment and unresponsive to co-transfected NFATc1. Direct NFAT binding to two of the consensus NFAT sites within this 245 bp 5′ region was demonstrated by EMSA and supershift with anti-NFAT antibodies. Mutation of two of the conserved NFAT sites in the −1242 to −997 fragment was required to prevent binding. The double NFAT mutant, in the context of the full-length promoter was unresponsive to RANKL treatment or co-transfected NFATc1. We generated cell-permeable TAT-dominant-negative (dn)NFATc1 fusion proteins to assess the effect of blockade of NFAT signaling. Transduction with dnNFAT inhibited RANKL induction of the human β3 integrin promoter. Involvement of the NFATc1-calcineurin pathway in regulating the human β3 integrin promoter was further confirmed using the calcineurin pathway inhibitory peptide 11R-VIVIT. Together these results establish the β3 gene as a direct target of NFATc1 in RANKL-dependent osteoclast formation. PMID:16513293
USDA-ARS?s Scientific Manuscript database
Lipase (lip) and lipase-specific foldase (lif) genes of a biodegradable polyhydroxyalkanoate- (PHA-) synthesizing Pseudomonas resinovorans NRRL B-2649 were cloned using primers based on consensus sequences, followed by PCR-based genome walking. Sequence analyses showed a putative Lip gene-product (...
BrEPS 2.0: Optimization of sequence pattern prediction for enzyme annotation.
Dudek, Christian-Alexander; Dannheim, Henning; Schomburg, Dietmar
2017-01-01
The prediction of gene functions is crucial for a large number of different life science areas. Faster high throughput sequencing techniques generate more and larger datasets. The manual annotation by classical wet-lab experiments is not suitable for these large amounts of data. We showed earlier that the automatic sequence pattern-based BrEPS protocol, based on manually curated sequences, can be used for the prediction of enzymatic functions of genes. The growing sequence databases provide the opportunity for more reliable patterns, but are also a challenge for the implementation of automatic protocols. We reimplemented and optimized the BrEPS pattern generation to be applicable for larger datasets in an acceptable timescale. Primary improvement of the new BrEPS protocol is the enhanced data selection step. Manually curated annotations from Swiss-Prot are used as reliable source for function prediction of enzymes observed on protein level. The pool of sequences is extended by highly similar sequences from TrEMBL and SwissProt. This allows us to restrict the selection of Swiss-Prot entries, without losing the diversity of sequences needed to generate significant patterns. Additionally, a supporting pattern type was introduced by extending the patterns at semi-conserved positions with highly similar amino acids. Extended patterns have an increased complexity, increasing the chance to match more sequences, without losing the essential structural information of the pattern. To enhance the usability of the database, we introduced enzyme function prediction based on consensus EC numbers and IUBMB enzyme nomenclature. BrEPS is part of the Braunschweig Enzyme Database (BRENDA) and is available on a completely redesigned website and as download. The database can be downloaded and used with the BrEPScmd command line tool for large scale sequence analysis. The BrEPS website and downloads for the database creation tool, command line tool and database are freely accessible at http://breps.tu-bs.de.
BrEPS 2.0: Optimization of sequence pattern prediction for enzyme annotation
Schomburg, Dietmar
2017-01-01
The prediction of gene functions is crucial for a large number of different life science areas. Faster high throughput sequencing techniques generate more and larger datasets. The manual annotation by classical wet-lab experiments is not suitable for these large amounts of data. We showed earlier that the automatic sequence pattern-based BrEPS protocol, based on manually curated sequences, can be used for the prediction of enzymatic functions of genes. The growing sequence databases provide the opportunity for more reliable patterns, but are also a challenge for the implementation of automatic protocols. We reimplemented and optimized the BrEPS pattern generation to be applicable for larger datasets in an acceptable timescale. Primary improvement of the new BrEPS protocol is the enhanced data selection step. Manually curated annotations from Swiss-Prot are used as reliable source for function prediction of enzymes observed on protein level. The pool of sequences is extended by highly similar sequences from TrEMBL and SwissProt. This allows us to restrict the selection of Swiss-Prot entries, without losing the diversity of sequences needed to generate significant patterns. Additionally, a supporting pattern type was introduced by extending the patterns at semi-conserved positions with highly similar amino acids. Extended patterns have an increased complexity, increasing the chance to match more sequences, without losing the essential structural information of the pattern. To enhance the usability of the database, we introduced enzyme function prediction based on consensus EC numbers and IUBMB enzyme nomenclature. BrEPS is part of the Braunschweig Enzyme Database (BRENDA) and is available on a completely redesigned website and as download. The database can be downloaded and used with the BrEPScmd command line tool for large scale sequence analysis. The BrEPS website and downloads for the database creation tool, command line tool and database are freely accessible at http://breps.tu-bs.de. PMID:28750104
Adams, C; Dowling, D N; O'Sullivan, D J; O'Gara, F
1994-06-03
An iron-regulated gene, pbsC, required for siderophore production in fluorescent Pseudomonas sp. strain M114 has been identified. A kanamycin-resistance cassette was inserted at specific restriction sites within a 7 kb genomic fragment of M114 DNA and by marker exchange two siderophore-negative mutants, designated M1 and M2, were isolated. The nucleotide sequence of approximately 4 kb of the region flanking the insertion sites was determined and a large open reading frame (ORF) extending for 2409 bp was identified. This gene was designated pbsC (pseudobactin synthesis C) and its putative protein product termed PbsC. PbsC was found to be homologous to a family of enzymes involved in the biosynthesis of secondary metabolites, including EntF of Escherichia coli. These enzymes are believed to act via ATP-dependent binding of AMP to their substrate. Several areas of high sequence homology between these proteins and PbsC were observed, including a conserved AMP-binding domain. The expression of pbsC is iron-regulated as revealed when a DNA fragment containing the upstream region was cloned in a promoter probe vector and conjugated into the wild-type strain, M114. The nucleotide sequence upstream of the putative translational start site contains a region homologous to previously defined -16 to -25 sequences of iron-regulated genes but did not contain an iron-box consensus sequence. It was noted that inactivation of the pbsC gene also affected other iron-regulated phenotypes of Pseudomonas M114.
Cofactor specificity switch in Shikimate dehydrogenase by rational design and consensus engineering.
García-Guevara, Fernando; Bravo, Iris; Martínez-Anaya, Claudia; Segovia, Lorenzo
2017-08-01
Consensus engineering has been used to design more stable variants using the most frequent amino acid at each site of a multiple sequence alignment; sometimes consensus engineering modifies function, but efforts have mainly been focused on studying stability. Here we constructed a consensus Rossmann domain for the Shikimate dehydrogenase enzyme; separately we decided to switch the cofactor specificity through rational design in the Escherichia coli Shikimate dehydrogenase enzyme and then analyzed the effect of consensus mutations on top of our design. We found that consensus mutations closest to the 2' adenine moiety increased the activity in our design. Consensus engineering has been shown to result in more stable proteins and our findings suggest it could also be used as a complementary tool for increasing or modifying enzyme activity during design. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Fast discovery and visualization of conserved regions in DNA sequences using quasi-alignment
2013-01-01
Background Next Generation Sequencing techniques are producing enormous amounts of biological sequence data and analysis becomes a major computational problem. Currently, most analysis, especially the identification of conserved regions, relies heavily on Multiple Sequence Alignment and its various heuristics such as progressive alignment, whose run time grows with the square of the number and the length of the aligned sequences and requires significant computational resources. In this work, we present a method to efficiently discover regions of high similarity across multiple sequences without performing expensive sequence alignment. The method is based on approximating edit distance between segments of sequences using p-mer frequency counts. Then, efficient high-throughput data stream clustering is used to group highly similar segments into so called quasi-alignments. Quasi-alignments have numerous applications such as identifying species and their taxonomic class from sequences, comparing sequences for similarities, and, as in this paper, discovering conserved regions across related sequences. Results In this paper, we show that quasi-alignments can be used to discover highly similar segments across multiple sequences from related or different genomes efficiently and accurately. Experiments on a large number of unaligned 16S rRNA sequences obtained from the Greengenes database show that the method is able to identify conserved regions which agree with known hypervariable regions in 16S rRNA. Furthermore, the experiments show that the proposed method scales well for large data sets with a run time that grows only linearly with the number and length of sequences, whereas for existing multiple sequence alignment heuristics the run time grows super-linearly. Conclusion Quasi-alignment-based algorithms can detect highly similar regions and conserved areas across multiple sequences. Since the run time is linear and the sequences are converted into a compact clustering model, we are able to identify conserved regions fast or even interactively using a standard PC. Our method has many potential applications such as finding characteristic signature sequences for families of organisms and studying conserved and variable regions in, for example, 16S rRNA. PMID:24564200
Fast discovery and visualization of conserved regions in DNA sequences using quasi-alignment.
Nagar, Anurag; Hahsler, Michael
2013-01-01
Next Generation Sequencing techniques are producing enormous amounts of biological sequence data and analysis becomes a major computational problem. Currently, most analysis, especially the identification of conserved regions, relies heavily on Multiple Sequence Alignment and its various heuristics such as progressive alignment, whose run time grows with the square of the number and the length of the aligned sequences and requires significant computational resources. In this work, we present a method to efficiently discover regions of high similarity across multiple sequences without performing expensive sequence alignment. The method is based on approximating edit distance between segments of sequences using p-mer frequency counts. Then, efficient high-throughput data stream clustering is used to group highly similar segments into so called quasi-alignments. Quasi-alignments have numerous applications such as identifying species and their taxonomic class from sequences, comparing sequences for similarities, and, as in this paper, discovering conserved regions across related sequences. In this paper, we show that quasi-alignments can be used to discover highly similar segments across multiple sequences from related or different genomes efficiently and accurately. Experiments on a large number of unaligned 16S rRNA sequences obtained from the Greengenes database show that the method is able to identify conserved regions which agree with known hypervariable regions in 16S rRNA. Furthermore, the experiments show that the proposed method scales well for large data sets with a run time that grows only linearly with the number and length of sequences, whereas for existing multiple sequence alignment heuristics the run time grows super-linearly. Quasi-alignment-based algorithms can detect highly similar regions and conserved areas across multiple sequences. Since the run time is linear and the sequences are converted into a compact clustering model, we are able to identify conserved regions fast or even interactively using a standard PC. Our method has many potential applications such as finding characteristic signature sequences for families of organisms and studying conserved and variable regions in, for example, 16S rRNA.
Burgess, Diane; Freeling, Michael
2014-01-01
In vertebrates, conserved noncoding elements (CNEs) are functionally constrained sequences that can show striking conservation over >400 million years of evolutionary distance and frequently are located megabases away from target developmental genes. Conserved noncoding sequences (CNSs) in plants are much shorter, and it has been difficult to detect conservation among distantly related genomes. In this article, we show not only that CNS sequences can be detected throughout the eudicot clade of flowering plants, but also that a subset of 37 CNSs can be found in all flowering plants (diverging ∼170 million years ago). These CNSs are functionally similar to vertebrate CNEs, being highly associated with transcription factor and development genes and enriched in transcription factor binding sites. Some of the most highly conserved sequences occur in genes encoding RNA binding proteins, particularly the RNA splicing–associated SR genes. Differences in sequence conservation between plants and animals are likely to reflect differences in the biology of the organisms, with plants being much more able to tolerate genomic deletions and whole-genome duplication events due, in part, to their far greater fecundity compared with vertebrates. PMID:24681619
PUTATIVE GENE PROMOTER SEQUENCES IN THE CHLORELLA VIRUSES
Fitzgerald, Lisa A.; Boucher, Philip T.; Yanai-Balser, Giane; Suhre, Karsten; Graves, Michael V.; Van Etten, James L.
2008-01-01
Three short (7 to 9 nucleotides) highly conserved nucleotide sequences were identified in the putative promoter regions (150 bp upstream and 50 bp downstream of the ATG translation start site) of three members of the genus Chlorovirus, family Phycodnaviridae. Most of these sequences occurred in similar locations within the defined promoter regions. The sequence and location of the motifs were often conserved among homologous ORFs within the Chlorovirus family. One of these conserved sequences (AATGACA) is predominately associated with genes expressed early in virus replication. PMID:18768195
Worley, K C; Wiese, B A; Smith, R F
1995-09-01
BEAUTY (BLAST enhanced alignment utility) is an enhanced version of the NCBI's BLAST data base search tool that facilitates identification of the functions of matched sequences. We have created new data bases of conserved regions and functional domains for protein sequences in NCBI's Entrez data base, and BEAUTY allows this information to be incorporated directly into BLAST search results. A Conserved Regions Data Base, containing the locations of conserved regions within Entrez protein sequences, was constructed by (1) clustering the entire data base into families, (2) aligning each family using our PIMA multiple sequence alignment program, and (3) scanning the multiple alignments to locate the conserved regions within each aligned sequence. A separate Annotated Domains Data Base was constructed by extracting the locations of all annotated domains and sites from sequences represented in the Entrez, PROSITE, BLOCKS, and PRINTS data bases. BEAUTY performs a BLAST search of those Entrez sequences with conserved regions and/or annotated domains. BEAUTY then uses the information from the Conserved Regions and Annotated Domains data bases to generate, for each matched sequence, a schematic display that allows one to directly compare the relative locations of (1) the conserved regions, (2) annotated domains and sites, and (3) the locally aligned regions matched in the BLAST search. In addition, BEAUTY search results include World-Wide Web hypertext links to a number of external data bases that provide a variety of additional types of information on the function of matched sequences. This convenient integration of protein families, conserved regions, annotated domains, alignment displays, and World-Wide Web resources greatly enhances the biological informativeness of sequence similarity searches. BEAUTY searches can be performed remotely on our system using the "BCM Search Launcher" World-Wide Web pages (URL is < http:/ /gc.bcm.tmc.edu:8088/ search-launcher/launcher.html > ).
A first report and complete genome sequence of alfalfa enamovirus from Sudan
USDA-ARS?s Scientific Manuscript database
A full genome sequence of a viral pathogen, provisionally named alfalfa enamovirus 2 (AEV-2), was reconstructed from short reads obtained by Illumina RNA sequencing of alfalfa sample originating from Sudan. Ambiguous nucleotides in the resultant consensus assembly and identity of the predicted virus...
A consensus linkage map of lentil based on DArT markers from three RIL mapping populations.
Ates, Duygu; Aldemir, Secil; Alsaleh, Ahmad; Erdogmus, Semih; Nemli, Seda; Kahriman, Abdullah; Ozkan, Hakan; Vandenberg, Albert; Tanyolac, Bahattin
2018-01-01
Lentil (Lens culinaris ssp. culinaris Medikus) is a diploid (2n = 2x = 14), self-pollinating grain legume with a haploid genome size of about 4 Gbp and is grown throughout the world with current annual production of 4.9 million tonnes. A consensus map of lentil (Lens culinaris ssp. culinaris Medikus) was constructed using three different lentils recombinant inbred line (RIL) populations, including "CDC Redberry" x "ILL7502" (LR8), "ILL8006" x "CDC Milestone" (LR11) and "PI320937" x "Eston" (LR39). The lentil consensus map was composed of 9,793 DArT markers, covered a total of 977.47 cM with an average distance of 0.10 cM between adjacent markers and constructed 7 linkage groups representing 7 chromosomes of the lentil genome. The consensus map had no gap larger than 12.67 cM and only 5 gaps were found to be between 12.67 cM and 6.0 cM (on LG3 and LG4). The localization of the SNP markers on the lentil consensus map were in general consistent with their localization on the three individual genetic linkage maps and the lentil consensus map has longer map length, higher marker density and shorter average distance between the adjacent markers compared to the component linkage maps. This high-density consensus map could provide insight into the lentil genome. The consensus map could also help to construct a physical map using a Bacterial Artificial Chromosome library and map based cloning studies. Sequence information of DArT may help localization of orientation scaffolds from Next Generation Sequencing data.
A consensus linkage map of lentil based on DArT markers from three RIL mapping populations
Ates, Duygu; Aldemir, Secil; Alsaleh, Ahmad; Erdogmus, Semih; Nemli, Seda; Kahriman, Abdullah; Ozkan, Hakan; Vandenberg, Albert
2018-01-01
Background Lentil (Lens culinaris ssp. culinaris Medikus) is a diploid (2n = 2x = 14), self-pollinating grain legume with a haploid genome size of about 4 Gbp and is grown throughout the world with current annual production of 4.9 million tonnes. Materials and methods A consensus map of lentil (Lens culinaris ssp. culinaris Medikus) was constructed using three different lentils recombinant inbred line (RIL) populations, including “CDC Redberry” x “ILL7502” (LR8), “ILL8006” x “CDC Milestone” (LR11) and “PI320937” x “Eston” (LR39). Results The lentil consensus map was composed of 9,793 DArT markers, covered a total of 977.47 cM with an average distance of 0.10 cM between adjacent markers and constructed 7 linkage groups representing 7 chromosomes of the lentil genome. The consensus map had no gap larger than 12.67 cM and only 5 gaps were found to be between 12.67 cM and 6.0 cM (on LG3 and LG4). The localization of the SNP markers on the lentil consensus map were in general consistent with their localization on the three individual genetic linkage maps and the lentil consensus map has longer map length, higher marker density and shorter average distance between the adjacent markers compared to the component linkage maps. Conclusion This high-density consensus map could provide insight into the lentil genome. The consensus map could also help to construct a physical map using a Bacterial Artificial Chromosome library and map based cloning studies. Sequence information of DArT may help localization of orientation scaffolds from Next Generation Sequencing data. PMID:29351563
Reddy, M K; Nair, S; Singh, B N; Mudgil, Y; Tewari, K K; Sopory, S K
2001-01-24
We report the cloning and sequencing of both cDNA and genomic DNA of a 33 kDa chloroplast ribonucleoprotein (33RNP) from pea. The analysis of the predicted amino acid sequence of the cDNA clone revealed that the encoded protein contains two RNA binding domains, including the conserved consensus ribonucleoprotein sequences CS-RNP1 and CS-RNP2, on the C-terminus half and the presence of a putative transit peptide sequence in the N-terminus region. The phylogenetic and multiple sequence alignment analysis of pea chloroplast RNP along with RNPs reported from the other plant sources revealed that the pea 33RNP is very closely related to Nicotiana sylvestris 31RNP and 28RNP and also to 31RNP and 28RNP of Arabidopsis and spinach, respectively. The pea 33RNP was expressed in Escherichia coli and purified to homogeneity. The in vitro import of precursor protein into chloroplasts confirmed that the N-terminus putative transit peptide is a bona fide transit peptide and 33RNP is localized in the chloroplast. The nucleic acid-binding properties of the recombinant protein, as revealed by South-Western analysis, showed that 33RNP has higher binding affinity for poly (U) and oligo dT than for ssDNA and dsDNA. The steady state transcript level was higher in leaves than in roots and the expression of this gene is light stimulated. Sequence analysis of the genomic clone revealed that the gene contains four exons and three introns. We have also isolated and analyzed the 5' flanking region of the pea 33RNP gene.
Jeong, Jae-Hee; Kim, Yi-Seul; Rojviriya, Catleya; Cha, Hyung Jin; Ha, Sung-Chul; Kim, Yeon-Gil
2013-10-01
The members of the ARM/HEAT repeat-containing protein superfamily in eukaryotes have been known to mediate protein-protein interactions by using their concave surface. However, little is known about the ARM/HEAT repeat proteins in prokaryotes. Here we report the crystal structure of TON1937, a hypothetical protein from the hyperthermophilic archaeon Thermococcus onnurineus NA1. The structure reveals a crescent-shaped molecule composed of a double layer of α-helices with seven anti-parallel α-helical repeats. A structure-based sequence alignment of the α-helical repeats identified a conserved pattern of hydrophobic or aliphatic residues reminiscent of the consensus sequence of eukaryotic HEAT repeats. The individual repeats of TON1937 also share high structural similarity with the canonical eukaryotic HEAT repeats. In addition, the concave surface of TON1937 is proposed to be its potential binding interface based on this structural comparison and its surface properties. These observations lead us to speculate that the archaeal HEAT-like repeats of TON1937 have evolved to engage in protein-protein interactions in the same manner as eukaryotic HEAT repeats. Copyright © 2013 Elsevier B.V. All rights reserved.
Eukaryotic tRNAs fingerprint invertebrates vis-à-vis vertebrates.
Mitra, Sanga; Das, Pijush; Samadder, Arpa; Das, Smarajit; Betai, Rupal; Chakrabarti, Jayprokas
2015-01-01
During translation, aminoacyl-tRNA synthetases recognize the identities of the tRNAs to charge them with their respective amino acids. The conserved identities of 58,244 eukaryotic tRNAs of 24 invertebrates and 45 vertebrates in genomic tRNA database were analyzed and their novel features extracted. The internal promoter sequences, namely, A-Box and B-Box, were investigated and evidence gathered that the intervention of optional nucleotides at 17a and 17b correlated with the optimal length of the A-Box. The presence of canonical transcription terminator sequences at the immediate vicinity of tRNA genes was ventured. Even though non-canonical introns had been reported in red alga, green alga, and nucleomorph so far, fairly motivating evidence of their existence emerged in tRNA genes of other eukaryotes. Non-canonical introns were seen to interfere with the internal promoters in two cases, questioning their transcription fidelity. In a first of its kind, phylogenetic constructs based on tRNA molecules delineated and built the trees of the vast and diverse invertebrates and vertebrates. Finally, two tRNA models representing the invertebrates and the vertebrates were drawn, by isolating the dominant consensus in the positional fluctuations of nucleotide compositions.
Modular structural elements in the replication origin region of Tetrahymena rDNA.
Du, C; Sanzgiri, R P; Shaiu, W L; Choi, J K; Hou, Z; Benbow, R M; Dobbs, D L
1995-01-01
Computer analyses of the DNA replication origin region in the amplified rRNA genes of Tetrahymena thermophila identified a potential initiation zone in the 5'NTS [Dobbs, Shaiu and Benbow (1994), Nucleic Acids Res. 22, 2479-2489]. This region consists of a putative DNA unwinding element (DUE) aligned with predicted bent DNA segments, nuclear matrix or scaffold associated region (MAR/SAR) consensus sequences, and other common modular sequence elements previously shown to be clustered in eukaryotic chromosomal origin regions. In this study, two mung bean nuclease-hypersensitive sites in super-coiled plasmid DNA were localized within the major DUE-like element predicted by thermodynamic analyses. Three restriction fragments of the 5'NTS region predicted to contain bent DNA segments exhibited anomalous migration characteristic of bent DNA during electrophoresis on polyacrylamide gels. Restriction fragments containing the 5'NTS region bound Tetrahymena nuclear matrices in an in vitro binding assay, consistent with an association of the replication origin region with the nuclear matrix in vivo. The direct demonstration in a protozoan origin region of elements previously identified in Drosophila, chick and mammalian origin regions suggests that clusters of modular structural elements may be a conserved feature of eukaryotic chromosomal origins of replication. Images PMID:7784181
Bogani, Debora; Morgan, Marc A. J.; Nelson, Andrew C.; Costello, Ita; McGouran, Joanna F.; Kessler, Benedikt M.
2013-01-01
Prdm4 is a highly conserved member of the Prdm family of PR/SET domain zinc finger proteins. Many well-studied Prdm family members play critical roles in development and display striking loss-of-function phenotypes. Prdm4 functional contributions have yet to be characterized. Here, we describe its widespread expression in the early embryo and adult tissues. We demonstrate that DNA binding is exclusively mediated by the Prdm4 zinc finger domain, and we characterize its tripartite consensus sequence via SELEX (systematic evolution of ligands by exponential enrichment) and ChIP-seq (chromatin immunoprecipitation-sequencing) experiments. In embryonic stem cells (ESCs), Prdm4 regulates key pluripotency and differentiation pathways. Two independent strategies, namely, targeted deletion of the zinc finger domain and generation of a EUCOMM LacZ reporter allele, resulted in functional null alleles. However, homozygous mutant embryos develop normally and adults are healthy and fertile. Collectively, these results strongly suggest that Prdm4 functions redundantly with other transcriptional partners to cooperatively regulate gene expression in the embryo and adult animal. PMID:23918801
Algama, Manjula; Tasker, Edward; Williams, Caitlin; Parslow, Adam C; Bryson-Richardson, Robert J; Keith, Jonathan M
2017-03-27
Computational identification of non-coding RNAs (ncRNAs) is a challenging problem. We describe a genome-wide analysis using Bayesian segmentation to identify intronic elements highly conserved between three evolutionarily distant vertebrate species: human, mouse and zebrafish. We investigate the extent to which these elements include ncRNAs (or conserved domains of ncRNAs) and regulatory sequences. We identified 655 deeply conserved intronic sequences in a genome-wide analysis. We also performed a pathway-focussed analysis on genes involved in muscle development, detecting 27 intronic elements, of which 22 were not detected in the genome-wide analysis. At least 87% of the genome-wide and 70% of the pathway-focussed elements have existing annotations indicative of conserved RNA secondary structure. The expression of 26 of the pathway-focused elements was examined using RT-PCR, providing confirmation that they include expressed ncRNAs. Consistent with previous studies, these elements are significantly over-represented in the introns of transcription factors. This study demonstrates a novel, highly effective, Bayesian approach to identifying conserved non-coding sequences. Our results complement previous findings that these sequences are enriched in transcription factors. However, in contrast to previous studies which suggest the majority of conserved sequences are regulatory factor binding sites, the majority of conserved sequences identified using our approach contain evidence of conserved RNA secondary structures, and our laboratory results suggest most are expressed. Functional roles at DNA and RNA levels are not mutually exclusive, and many of our elements possess evidence of both. Moreover, ncRNAs play roles in transcriptional and post-transcriptional regulation, and this may contribute to the over-representation of these elements in introns of transcription factors. We attribute the higher sensitivity of the pathway-focussed analysis compared to the genome-wide analysis to improved alignment quality, suggesting that enhanced genomic alignments may reveal many more conserved intronic sequences.
Veldman, G M; Klootwijk, J; van Heerikhuizen, H; Planta, R J
1981-01-01
We have determined the nucleotide sequence of part of a cloned yeast ribosomal RNA operon extending from the 5.8S RNA gene downstream into the 5' -terminal region of the 26S RNA gene. We mapped the pertinent processing sites, viz. the 5' end of 26S rRNA and the 3'ends of 5.8S rRNA and its immediate precursor, 7S RNA. At the 3' end of 7S RNA we find the sequence UCGUUU which is very similar to the type I consensus sequence UCAUUA/U present at the 3' ends of 17S, 5.8S and 26S rRNA as well as 18S precursor rRNA in yeast. At the 5' end of the 26S RNA gene we find a sequence of thirteen nucleotides which is homologous to the type II sequence present at the 5' termini of both the 17S and the 5.8S RNA gene. These findings further support the suggestion put forward earlier (G.M. Veldman et al. (1980) Nucl. Acids Res. 8, 2907-2920) that both consensus sequences are involved in the recognition of precursor rRNA by the processing nuclease(s). We discuss a model for the processing of yeast rRNA in which a processing enzyme sequentially recognizes several combinations of a type I and a type II consensus sequence. We also describe the existence of a significant base complementarity between sequences in the 5' -terminal region of 26S rRNA and the 3' -terminal region of 5.8S rRNA. We suggest that base pairing between these sequences contributes to the binding between 5.8S and 26S rRNA. Images PMID:7312619
Consensus statement: Virus taxonomy in the age of metagenomics.
Simmonds, Peter; Adams, Mike J; Benkő, Mária; Breitbart, Mya; Brister, J Rodney; Carstens, Eric B; Davison, Andrew J; Delwart, Eric; Gorbalenya, Alexander E; Harrach, Balázs; Hull, Roger; King, Andrew M Q; Koonin, Eugene V; Krupovic, Mart; Kuhn, Jens H; Lefkowitz, Elliot J; Nibert, Max L; Orton, Richard; Roossinck, Marilyn J; Sabanadzovic, Sead; Sullivan, Matthew B; Suttle, Curtis A; Tesh, Robert B; van der Vlugt, René A; Varsani, Arvind; Zerbini, F Murilo
2017-03-01
The number and diversity of viral sequences that are identified in metagenomic data far exceeds that of experimentally characterized virus isolates. In a recent workshop, a panel of experts discussed the proposal that, with appropriate quality control, viruses that are known only from metagenomic data can, and should be, incorporated into the official classification scheme of the International Committee on Taxonomy of Viruses (ICTV). Although a taxonomy that is based on metagenomic sequence data alone represents a substantial departure from the traditional reliance on phenotypic properties, the development of a robust framework for sequence-based virus taxonomy is indispensable for the comprehensive characterization of the global virome. In this Consensus Statement article, we consider the rationale for why metagenomic sequence data should, and how it can, be incorporated into the ICTV taxonomy, and present proposals that have been endorsed by the Executive Committee of the ICTV.
Ullah, Farman; Bhattarai, Dinesh; Cheng, Zhangrui; Liang, Xianwei; Deng, Tingxian; Rehman, Zia Ur; Talpur, Hira Sajjad; Worku, Tesfaye; Brohi, Rahim Dad; Safdar, Muhammad; Ahmad, Muhammad Jamil; Salim, Mohammad; Khan, Momen; Ahmad, Hafiz Ishfaq; Zhang, Shujun
2018-01-01
AKT3 gene is a constituent of the serine/threonine protein kinase family and plays a crucial role in synthesis of milk fats and cholesterol by regulating activity of the sterol regulatory element binding protein (SREBP). AKT3 is highly conserved in mammals and its expression levels during the lactation periods of cattle are markedly increased. AKT3 is highly expressed in the intestine followed by mammary gland and it is also expressed in immune cells. It is involved in the TLR pathways as effectively as proinflammatory cytokines. The aims of this study were to investigate the sequences differences between buffalo and cow. Our results showed that there were substantial differences between buffalo and cow in some exons and noteworthy differences of the gene size in different regions. We also identified the important consensus sequence motifs, variation in 2000 upstream of ATG, substantial difference in the "3'UTR" region, and miRNA association in the buffalo sequences compared with the cow. In addition, genetic analyses, such as gene structure, phylogenetic tree, position of different motifs, and functional domains, were performed to establish their correlation with other species. This may indicate that a buffalo breed has potential resistance to disease, environment changes, and airborne microorganisms and some good production and reproductive traits.
Bhattarai, Dinesh; Cheng, Zhangrui; Liang, Xianwei; Deng, Tingxian; Rehman, Zia Ur; Talpur, Hira Sajjad; Worku, Tesfaye; Brohi, Rahim Dad; Safdar, Muhammad; Ahmad, Muhammad Jamil; Salim, Mohammad; Khan, Momen; Ahmad, Hafiz Ishfaq
2018-01-01
AKT3 gene is a constituent of the serine/threonine protein kinase family and plays a crucial role in synthesis of milk fats and cholesterol by regulating activity of the sterol regulatory element binding protein (SREBP). AKT3 is highly conserved in mammals and its expression levels during the lactation periods of cattle are markedly increased. AKT3 is highly expressed in the intestine followed by mammary gland and it is also expressed in immune cells. It is involved in the TLR pathways as effectively as proinflammatory cytokines. The aims of this study were to investigate the sequences differences between buffalo and cow. Our results showed that there were substantial differences between buffalo and cow in some exons and noteworthy differences of the gene size in different regions. We also identified the important consensus sequence motifs, variation in 2000 upstream of ATG, substantial difference in the “3′UTR” region, and miRNA association in the buffalo sequences compared with the cow. In addition, genetic analyses, such as gene structure, phylogenetic tree, position of different motifs, and functional domains, were performed to establish their correlation with other species. This may indicate that a buffalo breed has potential resistance to disease, environment changes, and airborne microorganisms and some good production and reproductive traits. PMID:29862252
Salazar, L; Fsihi, H; de Rossi, E; Riccardi, G; Rios, C; Cole, S T; Takiff, H E
1996-04-01
The genus Mycobacterium is composed of species with widely differing growth rates ranging from approximately three hours in Mycobacterium smegmatis to two weeks in Mycobacterium leprae. As DNA replication is coupled to cell duplication, it may be regulated by common mechanisms. The chromosomal regions surrounding the origins of DNA replication from M. smegmatis, M. tuberculosis, and M. leprae have been sequenced, and show very few differences. The gene order, rnpA-rpmH-dnaA-dnaN-recF-orf-gyrB-gyrA, is the same as in other Gram-positive organisms. Although the general organization in M. smegmatis is very similar to that of Streptomyces spp., a closely related genus, M. tuberculosis and M. leprae differ as they lack an open reading frame, between dnaN and recF, which is similar to the gnd gene of Escherichia coli. Within the three mycobacterial species, there is extensive sequence conservation in the intergenic regions flanking dnaA, but more variation from the consensus DnaA box sequence was seen than in other bacteria. By means of subcloning experiments, the putative chromosomal origin of replication of M. smegmatis, containing the dnaA-dnaN region, was shown to promote autonomous replication in M. smegmatis, unlike the corresponding regions from M. tuberculosis or M. leprae.
Quick, Josh; Grubaugh, Nathan D; Pullan, Steven T; Claro, Ingra M; Smith, Andrew D; Gangavarapu, Karthik; Oliveira, Glenn; Robles-Sikisaka, Refugio; Rogers, Thomas F; Beutler, Nathan A; Burton, Dennis R; Lewis-Ximenez, Lia Laura; de Jesus, Jaqueline Goes; Giovanetti, Marta; Hill, Sarah; Black, Allison; Bedford, Trevor; Carroll, Miles W; Nunes, Marcio; Alcantara, Luiz Carlos; Sabino, Ester C; Baylis, Sally A; Faria, Nuno; Loose, Matthew; Simpson, Jared T; Pybus, Oliver G; Andersen, Kristian G; Loman, Nicholas J
2018-01-01
Genome sequencing has become a powerful tool for studying emerging infectious diseases; however, genome sequencing directly from clinical samples without isolation remains challenging for viruses such as Zika, where metagenomic sequencing methods may generate insufficient numbers of viral reads. Here we present a protocol for generating coding-sequence complete genomes comprising an online primer design tool, a novel multiplex PCR enrichment protocol, optimised library preparation methods for the portable MinION sequencer (Oxford Nanopore Technologies) and the Illumina range of instruments, and a bioinformatics pipeline for generating consensus sequences. The MinION protocol does not require an internet connection for analysis, making it suitable for field applications with limited connectivity. Our method relies on multiplex PCR for targeted enrichment of viral genomes from samples containing as few as 50 genome copies per reaction. Viral consensus sequences can be achieved starting with clinical samples in 1-2 days following a simple laboratory workflow. This method has been successfully used by several groups studying Zika virus evolution and is facilitating an understanding of the spread of the virus in the Americas. PMID:28538739
Fast and accurate de novo genome assembly from long uncorrected reads
Vaser, Robert; Sović, Ivan; Nagarajan, Niranjan
2017-01-01
The assembly of long reads from Pacific Biosciences and Oxford Nanopore Technologies typically requires resource-intensive error-correction and consensus-generation steps to obtain high-quality assemblies. We show that the error-correction step can be omitted and that high-quality consensus sequences can be generated efficiently with a SIMD-accelerated, partial-order alignment–based, stand-alone consensus module called Racon. Based on tests with PacBio and Oxford Nanopore data sets, we show that Racon coupled with miniasm enables consensus genomes with similar or better quality than state-of-the-art methods while being an order of magnitude faster. PMID:28100585
Sequence specificity of the human mRNA N6-adenosine methylase in vitro.
Harper, J E; Miceli, S M; Roberts, R J; Manley, J L
1990-01-01
N6-adenosine methylation is a frequent modification of mRNAs and their precursors, but little is known about the mechanism of the reaction or the function of the modification. To explore these questions, we developed conditions to examine N6-adenosine methylase activity in HeLa cell nuclear extracts. Transfer of the methyl group from S-[3H methyl]-adenosylmethionine to unlabeled random copolymer RNA substrates of varying ribonucleotide composition revealed a substrate specificity consistent with a previously deduced consensus sequence, Pu[G greater than A]AC[A/C/U]. 32-P labeled RNA substrates of defined sequence were used to examine the minimum sequence requirements for methylation. Each RNA was 20 nucleotides long, and contained either the core consensus sequence GGACU, or some variation of this sequence. RNAs containing GGACU, either in single or multiple copies, were good substrates for methylation, whereas RNAs containing single base substitutions within the GGACU sequence gave dramatically reduced methylation. These results demonstrate that the N6-adenosine methylase has a strict sequence specificity, and that there is no requirement for extended sequences or secondary structures for methylation. Recognition of this sequence does not require an RNA component, as micrococcal nuclease pretreatment of nuclear extracts actually increased methylation efficiency. Images PMID:2216767
Schneider, T D
2001-12-01
The sequence logo for DNA binding sites of the bacteriophage P1 replication protein RepA shows unusually high sequence conservation ( approximately 2 bits) at a minor groove that faces RepA. However, B-form DNA can support only 1 bit of sequence conservation via contacts into the minor groove. The high conservation in RepA sites therefore implies a distorted DNA helix with direct or indirect contacts to the protein. Here I show that a high minor groove conservation signature also appears in sequence logos of sites for other replication origin binding proteins (Rts1, DnaA, P4 alpha, EBNA1, ORC) and promoter binding proteins (sigma(70), sigma(D) factors). This finding implies that DNA binding proteins generally use non-B-form DNA distortion such as base flipping to initiate replication and transcription.
Baig, Tayyba T.; Lanchy, Jean-Marc; Lodmell, J. Stephen
2009-01-01
The packaging signal (ψ) of human immunodeficiency virus type 2 (HIV-2) is present in the 5′ noncoding region of RNA and contains a 10-nucleotide palindrome (pal; 5′-392-GGAGUGCUCC) located upstream of the dimerization signal stem-loop 1 (SL1). pal has been shown to be functionally important in vitro and in vivo. We previously showed that the 3′ side of pal (GCUCC-3′) is involved in base-pairing interactions with a sequence downstream of SL1 to make an extended SL1, which is important for replication in vivo and the regulation of dimerization in vitro. However, the role of the 5′ side of pal (5′-GGAGU) was less clear. Here, we characterized this role using an in vivo SELEX approach. We produced a population of HIV-2 DNA genomes with random sequences within the 5′ side of pal and transfected these into COS-7 cells. Viruses from COS-7 cells were used to infect C8166 permissive cells. After several weeks of serial passage in C8166 cells, surviving viruses were sequenced. On the 5′ side of pal there was a striking convergence toward a GGRGN consensus sequence. Individual clones with consensus and nonconsensus sequences were tested in infectivity and packaging assays. Analysis of individuals that diverged from the consensus sequence showed normal viral RNA and protein synthesis but had replication defects and impaired RNA packaging. These findings clearly indicate that the GGRG motif is essential for viral replication and genomic RNA packaging. PMID:18971263
Leitwein, Maeva; Guinand, Bruno; Pouzadoux, Juliette; Desmarais, Erick; Berrebi, Patrick; Gagnaire, Pierre-Alexandre
2017-01-01
High-density linkage maps are valuable tools for conservation and eco-evolutionary issues. In salmonids, a complex rediploidization process consecutive to an ancient whole genome duplication event makes linkage maps of prime importance for investigating the evolutionary history of chromosome rearrangements. Here, we developed a high-density consensus linkage map for the brown trout (Salmo trutta), a socioeconomically important species heavily impacted by human activities. A total of 3977 ddRAD markers were mapped and ordered in 40 linkage groups using sex- and lineage-averaged recombination distances obtained from two family crosses. Performing map comparison between S. trutta and its sister species, S. salar, revealed extensive chromosomal rearrangements. Strikingly, all of the fusion and fission events that occurred after the S. salar/S. trutta speciation happened in the Atlantic salmon branch, whereas the brown trout remained closer to the ancestral chromosome structure. Using the strongly conserved synteny within chromosome arms, we aligned the brown trout linkage map to the Atlantic salmon genome sequence to estimate the local recombination rate in S. trutta at 3721 loci. A significant positive correlation between recombination rate and within-population nucleotide diversity (π) was found, indicating that selection constrains variation at linked neutral sites in brown trout. This new high-density linkage map provides a useful genomic resource for future aquaculture, conservation, and eco-evolutionary studies in brown trout. PMID:28235829
CapZyme-Seq Comprehensively Defines Promoter-Sequence Determinants for RNA 5' Capping with NAD.
Vvedenskaya, Irina O; Bird, Jeremy G; Zhang, Yuanchao; Zhang, Yu; Jiao, Xinfu; Barvík, Ivan; Krásný, Libor; Kiledjian, Megerditch; Taylor, Deanne M; Ebright, Richard H; Nickels, Bryce E
2018-05-03
Nucleoside-containing metabolites such as NAD + can be incorporated as 5' caps on RNA by serving as non-canonical initiating nucleotides (NCINs) for transcription initiation by RNA polymerase (RNAP). Here, we report CapZyme-seq, a high-throughput-sequencing method that employs NCIN-decapping enzymes NudC and Rai1 to detect and quantify NCIN-capped RNA. By combining CapZyme-seq with multiplexed transcriptomics, we determine efficiencies of NAD + capping by Escherichia coli RNAP for ∼16,000 promoter sequences. The results define preferred transcription start site (TSS) positions for NAD + capping and define a consensus promoter sequence for NAD + capping: HRRASWW (TSS underlined). By applying CapZyme-seq to E. coli total cellular RNA, we establish that sequence determinants for NCIN capping in vivo match the NAD + -capping consensus defined in vitro, and we identify and quantify NCIN-capped small RNAs (sRNAs). Our findings define the promoter-sequence determinants for NCIN capping with NAD + and provide a general method for analysis of NCIN capping in vitro and in vivo. Copyright © 2018 Elsevier Inc. All rights reserved.
Kaplan, Oktay I; Berber, Burak; Hekim, Nezih; Doluca, Osman
2016-11-02
Many studies show that short non-coding sequences are widely conserved among regulatory elements. More and more conserved sequences are being discovered since the development of next generation sequencing technology. A common approach to identify conserved sequences with regulatory roles relies on topological changes such as hairpin formation at the DNA or RNA level. G-quadruplexes, non-canonical nucleic acid topologies with little established biological roles, are increasingly considered for conserved regulatory element discovery. Since the tertiary structure of G-quadruplexes is strongly dependent on the loop sequence which is disregarded by the generally accepted algorithm, we hypothesized that G-quadruplexes with similar topology and, indirectly, similar interaction patterns, can be determined using phylogenetic clustering based on differences in the loop sequences. Phylogenetic analysis of 52 G-quadruplex forming sequences in the Escherichia coli genome revealed two conserved G-quadruplex motifs with a potential regulatory role. Further analysis revealed that both motifs tend to form hairpins and G quadruplexes, as supported by circular dichroism studies. The phylogenetic analysis as described in this work can greatly improve the discovery of functional G-quadruplex structures and may explain unknown regulatory patterns. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
A Microbial Avenue to Cell Cycle Control in the Plant Superkingdom[C][W][OPEN
Tulin, Frej; Cross, Frederick R.
2014-01-01
Research in yeast and animals has resulted in a well-supported consensus model for eukaryotic cell cycle control. The fit of this model to early diverging eukaryotes, such as the plant kingdom, remains unclear. Using the green alga Chlamydomonas reinhardtii, we developed an efficient pipeline, incorporating robotics, semiautomated image analysis, and deep sequencing, to molecularly identify >50 genes, mostly conserved in higher plants, specifically required for cell division but not cell growth. Mutated genes include the cyclin-dependent kinases CDKA (resembling yeast and animal Cdk1) and the plant-specific CDKB. The Chlamydomonas cell cycle consists of a long G1 during which cells can grow >10-fold, followed by multiple rapid cycles of DNA replication and segregation. CDKA and CDKB execute nonoverlapping functions: CDKA promotes transition between G1 and entry into the division cycle, while CDKB is essential specifically for spindle formation and nuclear division, but not for DNA replication, once CDKA-dependent initiation has occurred. The anaphase-promoting complex is required for similar steps in the Chlamydomonas cell cycle as in Opisthokonts; however, the spindle assembly checkpoint, which targets the APC in Opisthokonts, appears severely attenuated in Chlamydomonas, based on analysis of mutants affecting microtubule function. This approach allows unbiased integration of the consensus cell cycle control model with innovations specific to the plant lineage. PMID:25336509
Valliere-Douglass, John F; Kodama, Paul; Mujacic, Mirna; Brady, Lowell J; Wang, Wes; Wallace, Alison; Yan, Boxu; Reddy, Pranhitha; Treuheit, Michael J; Balland, Alain
2009-11-20
We report that N-linked oligosaccharide structures can be present on an asparagine residue not adhering to the consensus site motif NX(S/T), where X is not proline, described in the literature. We have observed oligosaccharides on a non-consensus asparaginyl residue in the C(H)1 constant domain of IgG1 and IgG2 antibodies. The initial findings were obtained from characterization of charge variant populations evident in a recombinant human antibody of the IgG2 subclass. HPLC-MS results indicated that cation-exchange chromatography acidic variant populations were enriched in antibody with a second glycosylation site, in addition to the well documented canonical glycosylation site located in the C(H)2 domain. Subsequent tryptic and chymotryptic peptide map data indicated that the second glycosylation site was associated with the amino acid sequence TVSWN(162)SGAL in the C(H)1 domain of the antibody. This highly atypical modification is present at levels of 0.5-2.0% on most of the recombinant antibodies that have been tested and has also been observed in IgG1 antibodies derived from human donors. Site-directed mutagenesis of the C(H)1 domain sequence in a recombinant-human IgG1 antibody resulted in an increase in non-consensus glycosylation to 3.15%, a greater than 4-fold increase over the level observed in the wild type, by changing the -1 and +1 amino acids relative to the asparagine residue at position 162. We believe that further understanding of the phenomenon of non-consensus glycosylation can be used to gain fundamental insights into the fidelity of the cellular glycosylation machinery.
Dickinson, Louise; Ahmed, Hashim U; Allen, Clare; Barentsz, Jelle O; Carey, Brendan; Futterer, Jurgen J; Heijmink, Stijn W; Hoskin, Peter J; Kirkham, Alex; Padhani, Anwar R; Persad, Raj; Puech, Philippe; Punwani, Shonit; Sohaib, Aslam S; Tombal, Bertrand; Villers, Arnauld; van der Meulen, Jan; Emberton, Mark
2011-04-01
Multiparametric magnetic resonance imaging (mpMRI) may have a role in detecting clinically significant prostate cancer in men with raised serum prostate-specific antigen levels. Variations in technique and the interpretation of images have contributed to inconsistency in its reported performance characteristics. Our aim was to make recommendations on a standardised method for the conduct, interpretation, and reporting of prostate mpMRI for prostate cancer detection and localisation. A consensus meeting of 16 European prostate cancer experts was held that followed the UCLA-RAND Appropriateness Method and facilitated by an independent chair. Before the meeting, 520 items were scored for "appropriateness" by panel members, discussed face to face, and rescored. Agreement was reached in 67% of 260 items related to imaging sequence parameters. T2-weighted, dynamic contrast-enhanced, and diffusion-weighted MRI were the key sequences incorporated into the minimum requirements. Consensus was also reached on 54% of 260 items related to image interpretation and reporting, including features of malignancy on individual sequences. A 5-point scale was agreed on for communicating the probability of malignancy, with a minimum of 16 prostatic regions of interest, to include a pictorial representation of suspicious foci. Limitations relate to consensus methodology. Dominant personalities are known to affect the opinions of the group and were countered by a neutral chairperson. Consensus was reached on a number of areas related to the conduct, interpretation, and reporting of mpMRI for the detection, localisation, and characterisation of prostate cancer. Before optimal dissemination of this technology, these outcomes will require formal validation in prospective trials. Copyright © 2010 European Association of Urology. Published by Elsevier B.V. All rights reserved.
Singh, Savita; Zheng, Yun; Jagadeeswaran, Guru; Ebron, Jey Sabith; Sikand, Kavleen; Gupta, Sanjay; Sunker, Ramanjulu; Shukla, Girish C
2016-02-28
Complex epithelial and stromal cell interactions are required during the development and progression of prostate cancer. Regulatory small non-coding microRNAs (miRNAs) participate in the spatiotemporal regulation of messenger RNA (mRNA) and regulation of translation affecting a large number of genes involved in prostate carcinogenesis. In this study, through deep-sequencing of size fractionated small RNA libraries we profiled the miRNAs of prostate epithelial (PrEC) and stromal (PrSC) cells. Over 50 million reads were obtained for PrEC in which 860,468 were unique sequences. Similarly, nearly 76 million reads for PrSC were obtained in which over 1 million were unique reads. Expression of many miRNAs of broadly conserved and poorly conserved miRNA families were identified. Sixteen highly expressed miRNAs with significant change in expression in PrSC than PrEC were further analyzed in silico. ConsensusPathDB showed the target genes of these miRNAs were significantly involved in adherence junction, cell adhesion, EGRF, TGF-β and androgen signaling. Let-7 family of tumor-suppressor miRNAs expression was highly pervasive in both, PrEC and PrSC cells. In addition, we have also identified several miRNAs that are unique to PrEC or PrSC cells and their predicted putative targets are a group of transcription factors. This study provides perspective on the miRNA expression in PrEC and PrSC, and reveals a global trend in miRNA interactome. We conclude that the most abundant miRNAs are potential regulators of development and differentiation of the prostate gland by targeting a set of growth factors. Additionally, high level expression of the most members of let-7 family miRNAs suggests their role in the fine tuning of the growth and proliferation of prostate epithelial and stromal cells. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
A filtering method to generate high quality short reads using illumina paired-end technology.
Eren, A Murat; Vineis, Joseph H; Morrison, Hilary G; Sogin, Mitchell L
2013-01-01
Consensus between independent reads improves the accuracy of genome and transcriptome analyses, however lack of consensus between very similar sequences in metagenomic studies can and often does represent natural variation of biological significance. The common use of machine-assigned quality scores on next generation platforms does not necessarily correlate with accuracy. Here, we describe using the overlap of paired-end, short sequence reads to identify error-prone reads in marker gene analyses and their contribution to spurious OTUs following clustering analysis using QIIME. Our approach can also reduce error in shotgun sequencing data generated from libraries with small, tightly constrained insert sizes. The open-source implementation of this algorithm in Python programming language with user instructions can be obtained from https://github.com/meren/illumina-utils.
Conservation and variability of West Nile virus proteins.
Koo, Qi Ying; Khan, Asif M; Jung, Keun-Ok; Ramdas, Shweta; Miotto, Olivo; Tan, Tin Wee; Brusic, Vladimir; Salmon, Jerome; August, J Thomas
2009-01-01
West Nile virus (WNV) has emerged globally as an increasingly important pathogen for humans and domestic animals. Studies of the evolutionary diversity of the virus over its known history will help to elucidate conserved sites, and characterize their correspondence to other pathogens and their relevance to the immune system. We describe a large-scale analysis of the entire WNV proteome, aimed at identifying and characterizing evolutionarily conserved amino acid sequences. This study, which used 2,746 WNV protein sequences collected from the NCBI GenPept database, focused on analysis of peptides of length 9 amino acids or more, which are immunologically relevant as potential T-cell epitopes. Entropy-based analysis of the diversity of WNV sequences, revealed the presence of numerous evolutionarily stable nonamer positions across the proteome (entropy value of < or = 1). The representation (frequency) of nonamers variant to the predominant peptide at these stable positions was, generally, low (< or = 10% of the WNV sequences analyzed). Eighty-eight fragments of length 9-29 amino acids, representing approximately 34% of the WNV polyprotein length, were identified to be identical and evolutionarily stable in all analyzed WNV sequences. Of the 88 completely conserved sequences, 67 are also present in other flaviviruses, and several have been associated with the functional and structural properties of viral proteins. Immunoinformatic analysis revealed that the majority (78/88) of conserved sequences are potentially immunogenic, while 44 contained experimentally confirmed human T-cell epitopes. This study identified a comprehensive catalogue of completely conserved WNV sequences, many of which are shared by other flaviviruses, and majority are potential epitopes. The complete conservation of these immunologically relevant sequences through the entire recorded WNV history suggests they will be valuable as components of peptide-specific vaccines or other therapeutic applications, for sequence-specific diagnosis of a wide-range of Flavivirus infections, and for studies of homologous sequences among other flaviviruses.
A Fast Alignment-Free Approach for De Novo Detection of Protein Conserved Regions
Abnousi, Armen; Broschat, Shira L.; Kalyanaraman, Ananth
2016-01-01
Background Identifying conserved regions in protein sequences is a fundamental operation, occurring in numerous sequence-driven analysis pipelines. It is used as a way to decode domain-rich regions within proteins, to compute protein clusters, to annotate sequence function, and to compute evolutionary relationships among protein sequences. A number of approaches exist for identifying and characterizing protein families based on their domains, and because domains represent conserved portions of a protein sequence, the primary computation involved in protein family characterization is identification of such conserved regions. However, identifying conserved regions from large collections (millions) of protein sequences presents significant challenges. Methods In this paper we present a new, alignment-free method for detecting conserved regions in protein sequences called NADDA (No-Alignment Domain Detection Algorithm). Our method exploits the abundance of exact matching short subsequences (k-mers) to quickly detect conserved regions, and the power of machine learning is used to improve the prediction accuracy of detection. We present a parallel implementation of NADDA using the MapReduce framework and show that our method is highly scalable. Results We have compared NADDA with Pfam and InterPro databases. For known domains annotated by Pfam, accuracy is 83%, sensitivity 96%, and specificity 44%. For sequences with new domains not present in the training set an average accuracy of 63% is achieved when compared to Pfam. A boost in results in comparison with InterPro demonstrates the ability of NADDA to capture conserved regions beyond those present in Pfam. We have also compared NADDA with ADDA and MKDOM2, assuming Pfam as ground-truth. On average NADDA shows comparable accuracy, more balanced sensitivity and specificity, and being alignment-free, is significantly faster. Excluding the one-time cost of training, runtimes on a single processor were 49s, 10,566s, and 456s for NADDA, ADDA, and MKDOM2, respectively, for a data set comprised of approximately 2500 sequences. PMID:27552220
Krinitsyna, A A; Mel'nikova, N V; Belenikin, M S; Poltronieri, P; Santino, A; Kudriavtseva, A V; Savilova, A M; Speranskaia, A S
2013-01-01
Kunitz-type proteinase inhibitor proteins of group A (KPI-A) are involved in the protection of potato plants from pathogens and pests. Although sequences of large number of the KPI-A genes from different species of cultivated potato (Solanum tuberosum subsp. tuberosum) and a few genes from tomato (Solanum lycopersicum) are known to date, information about the allelic diversity of these genes in other species of the genus Solanum is lacking. In our work, the consensus sequences of the KPI-A genes were established in two species of subgenus Potatoe sect. Petota (Solanum tuberosum subsp. andigenum--5 genes and Solanum stoloniferum--2 genes) and in the subgenus Solanum (Solanum nigrum--5 genes) by amplification, cloning, sequencing and subsequent analysis. The determined sequences of KPI-A genes were 97-100% identical to known sequences of the cultivated potato of sect. Petota (cultivated potato Solanum tuberosum subsp. tuberosum) and sect. Etuberosum (S. palustre). The interspecific variability of these genes did not exceed the intraspecific variability for all studied species except Solanum lycopersicum. The distribution of highly variable and conserved sequences in the mature protein-encoding regions was uniform for all investigated KPI-A genes. However, our attempts to amplify the homologous genes using the same primers and the genomes of Solanum dulcamarum, Solanum lycopersicum and Mandragora officinarum resulted in no product formation. Phylogenetic analysis of KPI-A diversity showed that the sequences of the S. lycopersicum form independent cluster, whereas KPI-A of S. nigrum and species of sect. Etuberosum and sect. Petota are closely related and do not form species-specific subclasters. Although Solanum nigrum is resistant to all known races of economically one of the most important diseases of solanaceous plants oomycete Phytophthora infestans aminoacid sequences encoding by KPI-A genes from its genome have nearly or absolutely no differences to the same from genomes of cultivated potatoes involved by P. infestans.
Evidence for Horizontal Gene Transfer in Evolution of Elongation Factor Tu in Enterococci
Ke, Danbing; Boissinot, Maurice; Huletsky, Ann; Picard, François J.; Frenette, Johanne; Ouellette, Marc; Roy, Paul H.; Bergeron, Michel G.
2000-01-01
The elongation factor Tu, encoded by tuf genes, is a GTP binding protein that plays a central role in protein synthesis. One to three tuf genes per genome are present, depending on the bacterial species. Most low-G+C-content gram-positive bacteria carry only one tuf gene. We have designed degenerate PCR primers derived from consensus sequences of the tuf gene to amplify partial tuf sequences from 17 enterococcal species and other phylogenetically related species. The amplified DNA fragments were sequenced either by direct sequencing or by sequencing cloned inserts containing putative amplicons. Two different tuf genes (tufA and tufB) were found in 11 enterococcal species, including Enterococcus avium, Enterococcus casseliflavus, Enterococcus dispar, Enterococcus durans, Enterococcus faecium, Enterococcus gallinarum, Enterococcus hirae, Enterococcus malodoratus, Enterococcus mundtii, Enterococcus pseudoavium, and Enterococcus raffinosus. For the other six enterococcal species (Enterococcus cecorum, Enterococcus columbae, Enterococcus faecalis, Enterococcus sulfureus, Enterococcus saccharolyticus, and Enterococcus solitarius), only the tufA gene was present. Based on 16S rRNA gene sequence analysis, the 11 species having two tuf genes all have a common ancestor, while the six species having only one copy diverged from the enterococcal lineage before that common ancestor. The presence of one or two copies of the tuf gene in enterococci was confirmed by Southern hybridization. Phylogenetic analysis of tuf sequences demonstrated that the enterococcal tufA gene branches with the Bacillus, Listeria, and Staphylococcus genera, while the enterococcal tufB gene clusters with the genera Streptococcus and Lactococcus. Primary structure analysis showed that four amino acid residues encoded within the sequenced regions are conserved and unique to the enterococcal tufB genes and the tuf genes of streptococci and Lactococcus lactis. The data suggest that an ancestral streptococcus or a streptococcus-related species may have horizontally transferred a tuf gene to the common ancestor of the 11 enterococcal species which now carry two tuf genes. PMID:11092850
Tank, David C.
2016-01-01
Advances in high-throughput sequencing (HTS) have allowed researchers to obtain large amounts of biological sequence information at speeds and costs unimaginable only a decade ago. Phylogenetics, and the study of evolution in general, is quickly migrating towards using HTS to generate larger and more complex molecular datasets. In this paper, we present a method that utilizes microfluidic PCR and HTS to generate large amounts of sequence data suitable for phylogenetic analyses. The approach uses the Fluidigm Access Array System (Fluidigm, San Francisco, CA, USA) and two sets of PCR primers to simultaneously amplify 48 target regions across 48 samples, incorporating sample-specific barcodes and HTS adapters (2,304 unique amplicons per Access Array). The final product is a pooled set of amplicons ready to be sequenced, and thus, there is no need to construct separate, costly genomic libraries for each sample. Further, we present a bioinformatics pipeline to process the raw HTS reads to either generate consensus sequences (with or without ambiguities) for every locus in every sample or—more importantly—recover the separate alleles from heterozygous target regions in each sample. This is important because it adds allelic information that is well suited for coalescent-based phylogenetic analyses that are becoming very common in conservation and evolutionary biology. To test our approach and bioinformatics pipeline, we sequenced 576 samples across 96 target regions belonging to the South American clade of the genus Bartsia L. in the plant family Orobanchaceae. After sequencing cleanup and alignment, the experiment resulted in ~25,300bp across 486 samples for a set of 48 primer pairs targeting the plastome, and ~13,500bp for 363 samples for a set of primers targeting regions in the nuclear genome. Finally, we constructed a combined concatenated matrix from all 96 primer combinations, resulting in a combined aligned length of ~40,500bp for 349 samples. PMID:26828929
Vera-Cabrera, L; Johnson, W M; Welsh, O; Resendiz-Uresti, F L; Salinas-Carmona, M C
1999-06-01
An immunodominant protein from Nocardia brasiliensis, P61, was subjected to amino-terminal and internal sequence analysis. Three sequences of 22, 17, and 38 residues, respectively, were obtained and compared with the protein database from GenBank by using the BLAST system. The sequences showed homology to some eukaryotic catalases and to a bromoperoxidase-catalase from Streptomyces violaceus. Its identity as a catalase was confirmed by analysis of its enzymatic activity on H2O2 and by a double-staining method on a nondenaturing polyacrylamide gel with 3,3'-diaminobenzidine and ferricyanide; the result showed only catalase activity, but no peroxidase. By using one of the internal amino acid sequences and a consensus catalase motif (VGNNTP), we were able to design a PCR assay that generated a 500-bp PCR product. The amplicon was analyzed, and the nucleotide sequence was compared to the GenBank database with the observation of high homology to other bacterial and eukaryotic catalases. A PCR assay based on this target sequence was performed with primers NB10 and NB11 to confirm the presence of the NB10-NB11 gene fragment in several N. brasiliensis strains isolated from mycetoma. The same assay was used to determine whether there were homologous sequences in several type strains from the genera Nocardia, Rhodococcus, Gordona, and Streptomyces. All of the N. brasiliensis strains presented a positive result but only some of the actinomycetes species tested were positive in the PCR assay. In order to confirm these findings, genomic DNA was subjected to Southern blot analysis. A 1.7-kbp band was observed in the N. brasiliensis strains, and bands of different molecular weight were observed in cross-reacting actinomycetes. Sequence analysis of the amplicons of selected actinomycetes showed high homology in this catalase fragment, thus demonstrating that this protein is highly conserved in this group of bacteria.
Two rapidly evolving genes contribute to male fitness in Drosophila
Reinhardt, Josephine A; Jones, Corbin D
2013-01-01
Purifying selection often results in conservation of gene sequence and function. The most functionally conserved genes are also thought to be among the most biologically essential. These observations have led to the use of sequence conservation as a proxy for functional conservation. Here we describe two genes that are exceptions to this pattern. We show that lack of sequence conservation among orthologs of CG15460 and CG15323 – herein named jean-baptiste (jb) and karr respectively – does not necessarily predict lack of functional conservation. These two Drosophila melanogaster genes are among the most rapidly evolving protein-coding genes in this species, being nearly as diverged from their D. yakuba orthologs as random sequences are. jb and karr are both expressed at an elevated level in larval males and adult testes, but they are not accessory gland proteins and their loss does not affect male fertility. Instead, knockdown of these genes in D. melanogaster via RNA interference caused male-biased viability defects. These viability effects occur prior to the third instar for jb and during late pupation for karr. We show that putative orthologs to jb and karr are also expressed strongly in the testes of other Drosophila species and have similar gene structure across species despite low levels of sequence conservation. While standard molecular evolution tests could not reject neutrality, other data hint at a role for natural selection. Together these data provide a clear case where a lack of sequence conservation does not imply a lack of conservation of expression or function. PMID:24221639
Scientists' opinions on the global status and management of biological diversity.
Rudd, Murray A
2011-12-01
The large investments needed if loss of biological diversity is to be stemmed will likely lead to increased public and political scrutiny of conservation strategies and the science underlying them. It is therefore crucial to understand the degree of consensus or divergence among scientists on core scientific perceptions and strategies most likely to achieve given objectives. I developed an internet survey designed to elucidate the opinions of conservation scientists. Conservation scientists (n =583) were unanimous (99.5%) in their view that a serious loss of biological diversity is likely, very likely, or virtually certain. Scientists' agreement that serious loss is very likely or virtually certain ranged from 72.8% for Western Europe to 90.9% for Southeast Asia. Tropical coral ecosystems were perceived as the most seriously affected by loss of biological diversity; 88.0% of respondents familiar with that ecosystem type agreed that a serious loss is very likely or virtually certain. With regard to conservation strategies, scientists most often viewed understanding how people and nature interact in certain contexts and the role of biological diversity in maintaining ecosystem function as their priorities. Protection of biological diversity for its cultural and spiritual values and because of its usefulness to humans were low priorities, which suggests that many scientists do not fully support the utilitarian concept of ecosystem services. Many scientists expressed a willingness to consider conservation triage, engage in active conservation interventions, and consider reframing conservation goals and measures of success for conservation of biological diversity in an era of climate change. Although some heterogeneity of opinion is evident, results of the survey show a clear consensus within the scientific community on core issues of the extent and geographic scope of loss of biological diversity and on elements that may contribute to successful conservation strategies in the future. ©2011 Society for Conservation Biology.
Castrignanò, Tiziana; Canali, Alessandro; Grillo, Giorgio; Liuni, Sabino; Mignone, Flavio; Pesole, Graziano
2004-01-01
The identification and characterization of genome tracts that are highly conserved across species during evolution may contribute significantly to the functional annotation of whole-genome sequences. Indeed, such sequences are likely to correspond to known or unknown coding exons or regulatory motifs. Here, we present a web server implementing a previously developed algorithm that, by comparing user-submitted genome sequences, is able to identify statistically significant conserved blocks and assess their coding or noncoding nature through the measure of a coding potential score. The web tool, available at http://www.caspur.it/CSTminer/, is dynamically interconnected with the Ensembl genome resources and produces a graphical output showing a map of detected conserved sequences and annotated gene features. PMID:15215464
Hyder, S M; Stancel, G M; Nawaz, Z; McDonnell, D P; Loose-Mitchell, D S
1992-09-05
We have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyltransferase, linked to regions of mouse c-fos, to identify a specific estrogen response element (ERE) in this protooncogene. This element is located in the untranslated 3'-flanking region of the c-fos gene, 5 kilobases (kb) downstream from the c-fos promoter and 1.5 kb downstream of the poly(A) signal. This element confers estrogen responsiveness to chloramphenicol acetyltransferase reporters linked to both the herpes simplex virus thymidine kinase promoter and the homologous c-fos promoter. Deletion analysis localized the response element to a 200-base pair fragment which contains the element GGTCACCACAGCC that resembles the consensus ERE sequence GGTCACAGTGACC originally identified in Xenopus vitellogenin A2 gene. A synthetic 36-base pair oligodeoxynucleotide containing this c-fos sequence conferred estrogen inducibility to the thymidine kinase promoter. The corresponding sequence also induced reporter activity when present in the c-fos gene fragment 3 kb from the thymidine kinase promoter. Gel-shift experiments demonstrated that synthetic oligonucleotides containing either the consensus ERE or the c-fos element bind human estrogen receptor obtained from a yeast expression system. However, the mobility of the shifted band is faster for the fos-ERE-complex than the consensus ERE complex suggesting that the three-dimensional structure of the protein-DNA complexes is different or that other factors are differentially involved in the two reactions. When the 5'-GGTCA sequence present in the c-fos ERE is mutated to 5'-TTTCA, transcriptional activation and receptor binding activities are both lost. Mutation of the CAGCC-3' element corresponding to the second half-site of the c-fos sequence also led to the loss of receptor binding activity, suggesting that both half-sites of this element are involved in this function. The estrogen induction mediated by either the c-fos or the consensus ERE was blunted by the antiestrogen tamoxifen. Based on these studies, we believe the 3'-fos ERE sequence we have identified may be a major cis-acting element involved in the physiological regulation of the gene by estrogens in vivo.
CodonLogo: a sequence logo-based viewer for codon patterns.
Sharma, Virag; Murphy, David P; Provan, Gregory; Baranov, Pavel V
2012-07-15
Conserved patterns across a multiple sequence alignment can be visualized by generating sequence logos. Sequence logos show each column in the alignment as stacks of symbol(s) where the height of a stack is proportional to its informational content, whereas the height of each symbol within the stack is proportional to its frequency in the column. Sequence logos use symbols of either nucleotide or amino acid alphabets. However, certain regulatory signals in messenger RNA (mRNA) act as combinations of codons. Yet no tool is available for visualization of conserved codon patterns. We present the first application which allows visualization of conserved regions in a multiple sequence alignment in the context of codons. CodonLogo is based on WebLogo3 and uses the same heuristics but treats codons as inseparable units of a 64-letter alphabet. CodonLogo can discriminate patterns of codon conservation from patterns of nucleotide conservation that appear indistinguishable in standard sequence logos. The CodonLogo source code and its implementation (in a local version of the Galaxy Browser) are available at http://recode.ucc.ie/CodonLogo and through the Galaxy Tool Shed at http://toolshed.g2.bx.psu.edu/.
Zaforteza, Concha; Gastaldo, Denise; Moreno, Cristina; Bover, Andreu; Miró, Rosa; Miró, Margalida
2015-12-01
This study focuses on change strategies generated through a dialogical-reflexive-participatory process designed to improve the care of families of critically ill patients in an intensive care unit (ICU) using a participatory action research in a tertiary hospital in the Balearic Islands (Spain). Eleven professionals (representatives) participated in 11 discussion groups and five in-depth interviews. They represented the opinions of 49 colleagues (participants). Four main change strategies were created: (i) Institutionally supported practices were confronted to make a shift from professional-centered work to a more inclusive, patient-centered approach; (ii) traditional power relations were challenged to decrease the hierarchical power differences between physicians and nurses; (iii) consensus was built about the need to move from an individual to a collective position in relation to change; and (iv) consensus was built about the need to develop a critical attitude toward the conservative nature of the unit. The strategies proposed were both transgressive and conservative; however, when compared with the initial situation, they enhanced the care offered to patients' relatives and patient safety. Transforming conservative settings requires capacity to negotiate positions and potential outcomes. However, when individual critical capacities are articulated with a new approach to micropolitics, transformative proposals can be implemented and sustained. © 2015 John Wiley & Sons Ltd.
Sequences of Zika Virus Genomes from a Pediatric Cohort in Nicaragua.
Oldfield, Lauren M; Fedorova, Nadia; Puri, Vinita; Shrivastava, Susmita; Amedeo, Paolo; Durbin, Alan; Rocchi, Iara; Williams, Torrey; Shabman, Reed S; Tan, Gene S; Balmaseda, Angel; Kuan, Guillermina; Saborio, Saira; Gordon, Aubree; Harris, Eva; Pickett, Brett E
2018-06-14
We report here the whole-genome sequence of 11 Zika virus (ZIKV) samples from six pediatric patients in Nicaragua. Serum samples were collected, and ZIKV was isolated in tissue culture. Both serum and virus isolates were sequenced. The consensus ZIKV genomes are greater than 99% identical to each other. Copyright © 2018 Oldfield et al.
Regulation of the alpha-glucuronidase-encoding gene ( aguA) from Aspergillus niger.
de Vries, R P; van de Vondervoort, P J I; Hendriks, L; van de Belt, M; Visser, J
2002-09-01
The alpha-glucuronidase gene aguA from Aspergillus niger was cloned and characterised. Analysis of the promoter region of aguA revealed the presence of four putative binding sites for the major carbon catabolite repressor protein CREA and one putative binding site for the transcriptional activator XLNR. In addition, a sequence motif was detected which differed only in the last nucleotide from the XLNR consensus site. A construct in which part of the aguA coding region was deleted still resulted in production of a stable mRNA upon transformation of A. niger. The putative XLNR binding sites and two of the putative CREA binding sites were mutated individually in this construct and the effects on expression were examined in A. niger transformants. Northern analysis of the transformants revealed that the consensus XLNR site is not actually functional in the aguA promoter, whereas the sequence that diverges from the consensus at a single position is functional. This indicates that XLNR is also able to bind to the sequence GGCTAG, and the XLNR binding site consensus should therefore be changed to GGCTAR. Both CREA sites are functional, indicating that CREA has a strong influence on aguA expression. A detailed expression analysis of aguA in four genetic backgrounds revealed a second regulatory system involved in activation of aguA gene expression. This system responds to the presence of glucuronic and galacturonic acids, and is not dependent on XLNR.
Yuryev, A.; Corden, J. L.
1996-01-01
The largest subunit of RNA polymerase II contains a repetitive C-terminal domain (CTD) consisting of tandem repeats of the consensus sequence Tyr(1)Ser(2)Pro(3)Thr(4) Ser(5)Pro(6) Ser(7). Substitution of nonphosphorylatable amino acids at positions two or five of the Saccharomyces cerevisiae CTD is lethal. We developed a selection ssytem for isolating suppressors of this lethal phenotype and cloned a gene, SCA1 (suppressor of CTD alanine), which complements recessive suppressors of lethal multiple-substitution mutations. A partial deletion of SCA1 (sca1Δ::hisG) suppresses alanine or glutamate substitutions at position two of the consensus CTD sequence, and a lethal CTD truncation mutation, but SCA1 deletion does not suppress alanine or glutamate substitutions at position five. SCA1 is identical to SRB9, a suppressor of a cold-sensitive CTD truncation mutation. Strains carrying dominant SRB mutations have the same suppression properties as a sca1Δ::hisG strain. These results reveal a functional difference between positions two and five of the consensus CTD heptapeptide repeat. The ability of SCA1 and SRB mutant alleles to suppress CTD truncation mutations suggest that substitutions at position two, but not at position five, cause a defect in RNA polymerase II function similar to that introduced by CTD truncation. PMID:8725217
Trung, Le Quang; VAN Puyvelde, Karolien; Triest, Ludwig
2008-03-01
Consensus primers, based on exon sequences of the cyp73 gene family coding for cinnamate 4-hydroxylase (C4H) of the lignin biosynthesis pathway, were designed for the tetraploid willow species Salix alba and Salix fragilis. Diagnostic alleles at species level were observed among introns of three cyp73 genes and allowed unambiguous detection of the first generation and introgressed hybrids in populations. Progeny analysis of a female S. alba with a male introgressed hybrid confirmed the codominant inheritance of each intron. Sequences of the diagnostic alleles of both species were similar to those found in the hybrids. © 2007 The Authors.
Hulse-Kemp, Amanda M; Maheshwari, Shamoni; Stoffel, Kevin; Hill, Theresa A; Jaffe, David; Williams, Stephen R; Weisenfeld, Neil; Ramakrishnan, Srividya; Kumar, Vijay; Shah, Preyas; Schatz, Michael C; Church, Deanna M; Van Deynze, Allen
2018-01-01
Linked-Read sequencing technology has recently been employed successfully for de novo assembly of human genomes, however, the utility of this technology for complex plant genomes is unproven. We evaluated the technology for this purpose by sequencing the 3.5-gigabase (Gb) diploid pepper ( Capsicum annuum ) genome with a single Linked-Read library. Plant genomes, including pepper, are characterized by long, highly similar repetitive sequences. Accordingly, significant effort is used to ensure that the sequenced plant is highly homozygous and the resulting assembly is a haploid consensus. With a phased assembly approach, we targeted a heterozygous F 1 derived from a wide cross to assess the ability to derive both haplotypes and characterize a pungency gene with a large insertion/deletion. The Supernova software generated a highly ordered, more contiguous sequence assembly than all currently available C. annuum reference genomes. Over 83% of the final assembly was anchored and oriented using four publicly available de novo linkage maps. A comparison of the annotation of conserved eukaryotic genes indicated the completeness of assembly. The validity of the phased assembly is further demonstrated with the complete recovery of both 2.5-Kb insertion/deletion haplotypes of the PUN1 locus in the F 1 sample that represents pungent and nonpungent peppers, as well as nearly full recovery of the BUSCO2 gene set within each of the two haplotypes. The most contiguous pepper genome assembly to date has been generated which demonstrates that Linked-Read library technology provides a tool to de novo assemble complex highly repetitive heterozygous plant genomes. This technology can provide an opportunity to cost-effectively develop high-quality genome assemblies for other complex plants and compare structural and gene differences through accurate haplotype reconstruction.
Nakano, Shogo; Motoyama, Tomoharu; Miyashita, Yurina; Ishizuka, Yuki; Matsuo, Naoya; Tokiwa, Hiroaki; Shinoda, Suguru; Asano, Yasuhisa; Ito, Sohei
2018-05-22
The expansion of protein sequence databases has enabled us to design artificial proteins by sequence-based design methods, such as full consensus design (FCD) and ancestral sequence reconstruction (ASR). Artificial proteins with enhanced activity levels compared with native ones can potentially be generated by such methods, but successful design is rare because preparing a sequence library by curating the database and selecting a method is difficult. Utilizing a curated library prepared by reducing conservation energies, we successfully designed two artificial L-threonine 3-dehydrogenase (SDR-TDH) with higher activity levels than native SDR-TDH, FcTDH-N1 and AncTDH, using FCD and ASR, respectively. The artificial SDR-TDHs had excellent thermal stability and NAD+ recognition compared to native SDR-TDH from Cupriavidus necator (CnTDH): the melting temperatures of FcTDH-N1 and AncTDH were about 10 and 5°C higher than CnTDH, respectively, and the dissociation constants toward NAD+ of FcTDH-N1 and AncTDH were two- and seven-fold lower than that of CnTDH, respectively. Enzymatic efficiency of the artificial SDR-TDHs were comparable to that of CnTDH. Crystal structures of FcTDH-N1 and AncTDH were determined at 2.8 and 2.1 Å resolution, respectively. Structural and MD simulation analysis of the SDR-TDHs indicated that only the flexibility at specific regions was changed, suggesting that multiple mutations introduced in the artificial SDR-TDHs altered their flexibility and thereby affected their enzymatic properties. Benchmark analysis of the SDR-TDHs indicated that both FCD and ASR can generate highly functional proteins if a curated library is prepared appropriately.
Paldurai, Anandan; Subbiah, Madhuri; Kumar, Sachin; Collins, Peter L.; Samal, Siba K.
2009-01-01
Complete consensus genome sequences were determined for avian paramyxovirus type 8 (APMV-8) strains goose/Delaware/1053/76 (prototype strain) and pintail/Wakuya/20/78. The genome of each strain is 15,342 nucleotides (nt) long, which follows the “rule of six”. The genome consists of six genes in the order of 3′-N-P/V/W-M-F-HN-L-5′. The genes are flanked on either side by conserved transcription start and stop signals, and have intergenic regions ranging from 1 to 30 nt. The genome contains a 55 nt leader region at the 3′-end and a 171 nt trailer region at the 5′-end. Comparison of sequences of strains Delaware and Wakuya showed nucleotide identity of 96.8% at the genome level and amino acid identities of 99.3%, 96.5%, 98.6%, 99.4%, 98.6% and 99.1% for the predicted N, P, M, F, HN and L proteins, respectively. Both strains grew in embryonated chicken eggs and in primary chicken embryo kidney cells, and 293T cells. Both strains contained only a single basic residue at the cleavage activation site of the F protein and their efficiency of replication in vitro depended on and was augmented by, the presence of exogenous protease in most cell lines. Sequence alignment and phylogenic analysis of the predicted amino acid sequence of APMV-8 strain Delaware proteins with the cognate proteins of other available APMV serotypes showed that APMV-8 is more closely related to APMV-2 and -6 than to APMV-1, -3 and -4. PMID:19341613
Monin, Benoît; Norton, Michael I
2003-05-01
A 5-day field study (N = 415) during and right after a shower ban demonstrated multifaceted social projection and the tendency to draw personality inferences from simple behavior in a time of drastic consensus change. Bathers thought showering was more prevalent than did non-bathers (false consensus) and respondents consistently underestimated the prevalence of the desirable and common behavior--be it not showering during the shower ban or showering after the ban (uniqueness bias). Participants thought that bathers and non-bathers during the ban differed greatly in their general concern for the community, but self-reports demonstrated that this gap was illusory (false polarization). Finally, bathers thought other bathers cared less than they did, whereas non-bathers thought other non-bathers cared more than they did (pluralistic ignorance). The study captures the many biases at work in social perception in a time of social change.
Genetic dissection of the consensus sequence for the class 2 and class 3 flagellar promoters
Wozniak, Christopher E.; Hughes, Kelly T.
2008-01-01
Summary Computational searches for DNA binding sites often utilize consensus sequences. These search models make assumptions that the frequency of a base pair in an alignment relates to the base pair’s importance in binding and presume that base pairs contribute independently to the overall interaction with the DNA binding protein. These two assumptions have generally been found to be accurate for DNA binding sites. However, these assumptions are often not satisfied for promoters, which are involved in additional steps in transcription initiation after RNA polymerase has bound to the DNA. To test these assumptions for the flagellar regulatory hierarchy, class 2 and class 3 flagellar promoters were randomly mutagenized in Salmonella. Important positions were then saturated for mutagenesis and compared to scores calculated from the consensus sequence. Double mutants were constructed to determine how mutations combined for each promoter type. Mutations in the binding site for FlhD4C2, the activator of class 2 promoters, better satisfied the assumptions for the binding model than did mutations in the class 3 promoter, which is recognized by the σ28 transcription factor. These in vivo results indicate that the activator sites within flagellar promoters can be modeled using simple assumptions but that the DNA sequences recognized by the flagellar sigma factor require more complex models. PMID:18486950
Yamada, Kazuhiko; Kamimura, Eikichi; Kondo, Mariko; Tsuchiya, Kimiyuki; Nishida-Umehara, Chizuko; Matsuda, Yoichi
2006-02-01
We molecularly cloned new families of site-specific repetitive DNA sequences from BglII- and EcoRI-digested genomic DNA of the Syrian hamster (Mesocricetus auratus, Cricetrinae, Rodentia) and characterized them by chromosome in situ hybridization and filter hybridization. They were classified into six different types of repetitive DNA sequence families according to chromosomal distribution and genome organization. The hybridization patterns of the sequences were consistent with the distribution of C-positive bands and/or Hoechst-stained heterochromatin. The centromeric major satellite DNA and sex chromosome-specific and telomeric region-specific repetitive sequences were conserved in the same genus (Mesocricetus) but divergent in different genera. The chromosome-2-specific sequence was conserved in two genera, Mesocricetus and Cricetulus, and a low copy number of repetitive sequences on the heterochromatic chromosome arms were conserved in the subfamily Cricetinae but not in the subfamily Calomyscinae. By contrast, the other type of repetitive sequences on the heterochromatic chromosome arms, which had sequence similarities to a LINE sequence of rodents, was conserved through the three subfamilies, Cricetinae, Calomyscinae and Murinae. The nucleotide divergence of the repetitive sequences of heterochromatin was well correlated with the phylogenetic relationships of the Cricetinae species, and each sequence has been independently amplified and diverged in the same genome.
SEPT9 Mutations and a Conserved 17q25 Sequence in Sporadic and Hereditary Brachial Plexus Neuropathy
Klein, Christopher J.; Wu, Yanhong; Cunningham, Julie M.; Windebank, Anthony J.; Dyck, P. James B.; Friedenberg, Scott M.; Klein, Diane M.; Dyck, Peter J.
2009-01-01
Background The clinical characteristics of sporadic brachial plexus neuropathy (S-BPN) and hereditary brachial plexus neuropathy (H-BPN) are similar. At times of attack inflammation in brachial plexus nerves has been identified in both conditions. SEPT-9 mutations (Arg88Trp, Ser93Phe, 5UTR-131G to C) occur in some families with H-BPN. These mutations were not found in American H-BPN kindreds with a conserved 500 Kb sequence of DNA at 17q25 (the location of SEPT-9) where a founder mutation has been suggested. Objective To study 17q25 and SEPT-9 in S-BPN (56 patients) and H-BPN (13 kindreds). Methods Allele analysis at 17q25, SEPT-9 DNA sequencing and mRNA analysis from lymphoblast cultures. Results A conserved 17q25 sequence was found in 5 of 13 H-BPN kindreds and one S-BPN patient. This conserved sequence was not found in the family with a SEPT-9 mutation (Arg88Trp) or controls (182). SEPT-9 mRNA expression did not differ between forms of H-BPN and controls. No known mutations of SEPT-9 were found in S-BPN. Conclusions/Relevance Rare S-BPN patients have the same conserved 17q25 sequence found in many American H-BPN kindreds. BPN patients with this conserved sequence do not appear to have SEPT-9 mutations or alterations of its mRNA expression levels in lymphoblast cultures. BPN patients with this conserved sequence may have the most common genetic cause in the Americas by a founder effect mutation. PMID:19204161
Structure-function analysis of HKE4, a member of the new LIV-1 subfamily of zinc transporters.
Taylor, Kathryn M; Morgan, Helen E; Johnson, Andrea; Nicholson, Robert I
2004-01-01
The KE4 proteins are an emerging group of proteins with little known functional data. In the present study, we report the first characterization of the recombinant human KE4 protein in mammalian cells. The KE4 sequences are included in the subfamily of ZIP (Zrt-, Irt-like Proteins) zinc transporters, which we have termed LZT (LIV-1 subfamily of ZIP zinc Transporters). All these LZT sequences contain similarities to ZIP transporters, including the consensus sequence in transmembrane domain IV, which is essential for zinc transport. However, the new LZT subfamily can be separated from other ZIP transporters by the presence of a highly conserved potential metalloprotease motif (HEXPHEXGD) in transmembrane domain V. Here we report the location of HKE4 on intracellular membranes, including the endoplasmic reticulum, and its ability to increase the intracellular free zinc as measured with the zinc-specific fluorescent dye, Newport Green, in a time-, temperature- and concentration-dependent manner. This is in contrast with the zinc influx ability of another LZT protein, LIV-1, which was due to its plasma membrane location. Therefore we have added to the functionality of LZT proteins by reporting their ability to increase intracellular-free zinc, whether they are located on the plasma membrane or on intracellular membranes. This result, in combination with the crucial role that zinc plays in cell growth, emphasizes the importance of this new LZT subfamily, including the KE4 sequences, in the control of intracellular zinc homoeostasis, aberrations of which can lead to diseases such as cancer, immunological disorders and neurological dysfunction. PMID:14525538
Benitez-Capistros, Francisco; Hugé, Jean; Dahdouh-Guebas, Farid; Koedam, Nico
2016-10-01
Conservation discourses change rapidly both at global and local scales. To be able to capture these shifts and the relationships between humans and nature, we focused on a local and iconic conservation case: the Galapagos giant tortoises (Chelonoidis spp.). We used the Q methodology to contextualize conservation for science and decision making and to explore the multidimensionality of the conservation concept in Galapagos. The results indicate four prevailing discourses: (1) Multi-actor governance; (2) giant tortoise and ecosystems conservation; (3) community governance; and (4) market and tourism centred. These findings allow us to identify foreseeable points of disagreement, as well as areas of consensus, and to discuss the implication of the findings to address socio-ecological conservation and sustainability challenges. This can help the different involved stakeholders (managers, scientists and local communities) to the design and apply contextualized conservation actions and policies to contribute to a better sustainable management of the archipelago.
Logan, Grace; Freimanis, Graham L; King, David J; Valdazo-González, Begoña; Bachanek-Bankowska, Katarzyna; Sanderson, Nicholas D; Knowles, Nick J; King, Donald P; Cottam, Eleanor M
2014-09-30
Next-Generation Sequencing (NGS) is revolutionizing molecular epidemiology by providing new approaches to undertake whole genome sequencing (WGS) in diagnostic settings for a variety of human and veterinary pathogens. Previous sequencing protocols have been subject to biases such as those encountered during PCR amplification and cell culture, or are restricted by the need for large quantities of starting material. We describe here a simple and robust methodology for the generation of whole genome sequences on the Illumina MiSeq. This protocol is specific for foot-and-mouth disease virus (FMDV) or other polyadenylated RNA viruses and circumvents both the use of PCR and the requirement for large amounts of initial template. The protocol was successfully validated using five FMDV positive clinical samples from the 2001 epidemic in the United Kingdom, as well as a panel of representative viruses from all seven serotypes. In addition, this protocol was successfully used to recover 94% of an FMDV genome that had previously been identified as cell culture negative. Genome sequences from three other non-FMDV polyadenylated RNA viruses (EMCV, ERAV, VESV) were also obtained with minor protocol amendments. We calculated that a minimum coverage depth of 22 reads was required to produce an accurate consensus sequence for FMDV O. This was achieved in 5 FMDV/O/UKG isolates and the type O FMDV from the serotype panel with the exception of the 5' genomic termini and area immediately flanking the poly(C) region. We have developed a universal WGS method for FMDV and other polyadenylated RNA viruses. This method works successfully from a limited quantity of starting material and eliminates the requirement for genome-specific PCR amplification. This protocol has the potential to generate consensus-level sequences within a routine high-throughput diagnostic environment.
Rajaram, Vengaldas; Nepolean, Thirunavukkarasu; Senthilvel, Senapathy; Varshney, Rajeev K; Vadez, Vincent; Srivastava, Rakesh K; Shah, Trushar M; Supriya, Ambawat; Kumar, Sushil; Ramana Kumari, Basava; Bhanuprakash, Amindala; Narasu, Mangamoori Lakshmi; Riera-Lizarazu, Oscar; Hash, Charles Thomas
2013-03-09
Pearl millet [Pennisetum glaucum (L.) R. Br.] is a widely cultivated drought- and high-temperature tolerant C4 cereal grown under dryland, rainfed and irrigated conditions in drought-prone regions of the tropics and sub-tropics of Africa, South Asia and the Americas. It is considered an orphan crop with relatively few genomic and genetic resources. This study was undertaken to increase the EST-based microsatellite marker and genetic resources for this crop to facilitate marker-assisted breeding. Newly developed EST-SSR markers (99), along with previously mapped EST-SSR (17), genomic SSR (53) and STS (2) markers, were used to construct linkage maps of four F7 recombinant inbred populations (RIP) based on crosses ICMB 841-P3 × 863B-P2 (RIP A), H 77/833-2 × PRLT 2/89-33 (RIP B), 81B-P6 × ICMP 451-P8 (RIP C) and PT 732B-P2 × P1449-2-P1 (RIP D). Mapped loci numbers were greatest for RIP A (104), followed by RIP B (78), RIP C (64) and RIP D (59). Total map lengths (Haldane) were 615 cM, 690 cM, 428 cM and 276 cM, respectively. A total of 176 loci detected by 171 primer pairs were mapped among the four crosses. A consensus map of 174 loci (899 cM) detected by 169 primer pairs was constructed using MergeMap to integrate the individual linkage maps. Locus order in the consensus map was well conserved for nearly all linkage groups. Eighty-nine EST-SSR marker loci from this consensus map had significant BLAST hits (top hits with e-value ≤ 1E-10) on the genome sequences of rice, foxtail millet, sorghum, maize and Brachypodium with 35, 88, 58, 48 and 38 loci, respectively. The consensus map developed in the present study contains the largest set of mapped SSRs reported to date for pearl millet, and represents a major consolidation of existing pearl millet genetic mapping information. This study increased numbers of mapped pearl millet SSR markers by >50%, filling important gaps in previously published SSR-based linkage maps for this species and will greatly facilitate SSR-based QTL mapping and applied marker-assisted selection programs.
Nair, Divya N; Prasad, Rajesh; Singhal, Neha; Bhattacharjee, Manish; Sudhakar, Renu; Singh, Pushpa; Thanumalayan, Subramonian; Kiran, Uday; Sharma, Yogendra; Sijwali, Puran Singh
2018-06-01
Plasmodium falciparum DJ1 (PfDJ1) belongs to the DJ-1/ThiJ/PfpI superfamily whose members are present in all the kingdoms of life and exhibit diverse cellular functions and biochemical activities. The common feature of the superfamily is the class I glutamine amidotransferase domain with a conserved redox-active cysteine residue, which mediates various activities of the superfamily members, including anti-oxidative activity in PfDJ1 and human DJ1 (hDJ1). As the superfamily members represent diverse functional classes, to investigate if there is any sequence feature unique to hDJ1-like proteins, sequences of the representative proteins of different functional classes were compared and analysed. A novel motif unique to PfDJ1 and several other hDJ1-like proteins, with the consensus sequence of TSXGPX5FXLX5L, was identified that we designated as the hDJ1-subfamily motif (DJSM). Several mutations that have been associated with Parkinson's disease are also present in DJSM, suggesting its functional importance in hDJ1-like proteins. Mutations of the conserved residues of DJSM of PfDJ1 did not significantly affect overall secondary structure, but caused both a significant loss (S151A and P154A) and gain (L168A) of anti-oxidative activity. We also report that PfDJ1 has deglycase activity, which was significantly decreased in its mutants of the catalytic cysteine (C106A) and DJSM (S151A and P154A). Episomal expression of the catalytic cysteine (C106A) or DJSM (P154A) mutant decreased growth rates of parasites as compared to that of wild type parasites or parasites expressing wild type PfDJ1. S151 appears to properly position the nucleophilic elbow containing C106 and P154 forms a hydrogen bond with C106, which could be a reason for the loss of activities of PfDJ1 upon their mutations. Taken together, DJSM delineates PfDJ1 and other hDJ1-subfamily proteins from the remaining superfamily, and is critical for anti-oxidative and deglycase activities of PfDJ1. Copyright © 2018 Elsevier B.V. All rights reserved.
Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters
DOE Office of Scientific and Technical Information (OSTI.GOV)
Santini, Simona; Boore, Jeffrey L.; Meyer, Axel
2003-12-31
Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involvedmore » in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.« less
cWINNOWER algorithm for finding fuzzy dna motifs
NASA Technical Reports Server (NTRS)
Liang, S.; Samanta, M. P.; Biegel, B. A.
2004-01-01
The cWINNOWER algorithm detects fuzzy motifs in DNA sequences rich in protein-binding signals. A signal is defined as any short nucleotide pattern having up to d mutations differing from a motif of length l. The algorithm finds such motifs if a clique consisting of a sufficiently large number of mutated copies of the motif (i.e., the signals) is present in the DNA sequence. The cWINNOWER algorithm substantially improves the sensitivity of the winnower method of Pevzner and Sze by imposing a consensus constraint, enabling it to detect much weaker signals. We studied the minimum detectable clique size qc as a function of sequence length N for random sequences. We found that qc increases linearly with N for a fast version of the algorithm based on counting three-member sub-cliques. Imposing consensus constraints reduces qc by a factor of three in this case, which makes the algorithm dramatically more sensitive. Our most sensitive algorithm, which counts four-member sub-cliques, needs a minimum of only 13 signals to detect motifs in a sequence of length N = 12,000 for (l, d) = (15, 4). Copyright Imperial College Press.
cWINNOWER Algorithm for Finding Fuzzy DNA Motifs
NASA Technical Reports Server (NTRS)
Liang, Shoudan
2003-01-01
The cWINNOWER algorithm detects fuzzy motifs in DNA sequences rich in protein-binding signals. A signal is defined as any short nucleotide pattern having up to d mutations differing from a motif of length l. The algorithm finds such motifs if multiple mutated copies of the motif (i.e., the signals) are present in the DNA sequence in sufficient abundance. The cWINNOWER algorithm substantially improves the sensitivity of the winnower method of Pevzner and Sze by imposing a consensus constraint, enabling it to detect much weaker signals. We studied the minimum number of detectable motifs qc as a function of sequence length N for random sequences. We found that qc increases linearly with N for a fast version of the algorithm based on counting three-member sub-cliques. Imposing consensus constraints reduces qc, by a factor of three in this case, which makes the algorithm dramatically more sensitive. Our most sensitive algorithm, which counts four-member sub-cliques, needs a minimum of only 13 signals to detect motifs in a sequence of length N = 12000 for (l,d) = (15,4).
A conserved post-transcriptional BMP2 switch in lung cells.
Jiang, Shan; Fritz, David T; Rogers, Melissa B
2010-05-15
An ultra-conserved sequence in the bone morphogenetic protein 2 (BMP2) 3' untranslated region (UTR) markedly represses BMP2 expression in non-transformed lung cells. In contrast, the ultra-conserved sequence stimulates BMP2 expression in transformed lung cells. The ultra-conserved sequence functions as a post-transcriptional cis-regulatory switch. A common single-nucleotide polymorphism (SNP, rs15705, +A1123C), which has been shown to influence human morphology, disrupts a conserved element within the ultra-conserved sequence and altered reporter gene activity in non-transformed lung cells. This polymorphism changed the affinity of the BMP2 RNA for several proteins including nucleolin, which has an increased affinity for the C allele. Elevated BMP2 synthesis is associated with increased malignancy in mouse models of lung cancer and poor lung cancer patient prognosis. Understanding the cis- and trans-regulatory factors that control BMP2 synthesis is relevant to the initiation or progression of pathologies associated with abnormal BMP2 levels. (c) 2010 Wiley-Liss, Inc.
Mapping and Sequencing the Human Genome
DOE R&D Accomplishments Database
1988-01-01
Numerous meetings have been held and a debate has developed in the biological community over the merits of mapping and sequencing the human genome. In response a committee to examine the desirability and feasibility of mapping and sequencing the human genome was formed to suggest options for implementing the project. The committee asked many questions. Should the analysis of the human genome be left entirely to the traditionally uncoordinated, but highly successful, support systems that fund the vast majority of biomedical research. Or should a more focused and coordinated additional support system be developed that is limited to encouraging and facilitating the mapping and eventual sequencing of the human genome. If so, how can this be done without distorting the broader goals of biological research that are crucial for any understanding of the data generated in such a human genome project. As the committee became better informed on the many relevant issues, the opinions of its members coalesced, producing a shared consensus of what should be done. This report reflects that consensus.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Q Zhai; M Landesman; H Robinson
2011-12-31
Retroviral Gag proteins contain short late-domain motifs that recruit cellular ESCRT pathway proteins to facilitate virus budding. ALIX-binding late domains often contain the core consensus sequence YPX{sub n}L (where X{sub n} can vary in sequence and length). However, some simian immunodeficiency virus (SIV) Gag proteins lack this consensus sequence, yet still bind ALIX. We mapped divergent, ALIX-binding late domains within the p6{sup Gag} proteins of SIV{sub MAC239} ({sub 40}SREK{und P}YKE{und VT}ED{und L}LHLNSLF{sub 59}) and SIV{sub agmTan-1} ({sub 24}AAG{und A}YDP{und AR}KL{und L}EQYAKK{sub 41}). Crystal structures revealed that anchoring tyrosines (in lightface) and nearby hydrophobic residues (underlined) contact the ALIX V domain,more » revealing how lentiviruses employ a diverse family of late-domain sequences to bind ALIX and promote virus budding.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhai, Q.; Robinson, H.; Landesman, M. B.
2011-01-01
Retroviral Gag proteins contain short late-domain motifs that recruit cellular ESCRT pathway proteins to facilitate virus budding. ALIX-binding late domains often contain the core consensus sequence YPX{sub n}L (where X{sub n} can vary in sequence and length). However, some simian immunodeficiency virus (SIV) Gag proteins lack this consensus sequence, yet still bind ALIX. We mapped divergent, ALIX-binding late domains within the p6{sup Gag} proteins of SIV{sub mac239} ({sub 40}SREK{und P}YKE{und VT}ED{und L}LHLNSLF{sub 59}) and SIV{sub agmTan-1} ({sub 24}AAG{und A}YDP{und AR}KL{und L}EQYAKK{sub 41}). Crystal structures revealed that anchoring tyrosines (in lightface) and nearby hydrophobic residues (underlined) contact the ALIX V domain,more » revealing how lentiviruses employ a diverse family of late-domain sequences to bind ALIX and promote virus budding.« less
Lim, C K; Smith, M C; Petty, J; Baumberg, S; Wootton, J C
1989-12-01
The aphD gene of Streptomyces griseus, encoding a streptomycin 6-phosphotransferase (SPH), was sub-cloned in the pBR322-based expression vector pRK9 (which contains the Serratia marcescens trp promoter) with selection for expression of streptomycin resistance in Escherichia coli. Two hybrid plasmids, pCKL631 and pCKL711, were isolated which conferred resistance. Both contained a approximately 2 kbp fragment already suspected to include aphD. The properties of in vitro deletion derivatives of these plasmids were consistent with the presumed location of aphD. In vitro deletion of a sequence including most of the trp promoter largely, but not quite completely, abolished the ability of the plasmid to confer streptomycin resistance, confirming that expression was indeed principally from the trp promoter. A polypeptide of approximately 34.5 kDa was present in minicells containing plasmids that conferred streptomycin resistance, but was absent when the plasmids contained in vitro deletions removing streptomycin resistance. Part of the fragment was sequenced and an open reading frame corresponding to aphD identified. A computer-assisted comparison of the deduced SPH sequence with those of other antibiotic phosphotransferases suggested a common structure A-B-C-D-E, where B and D were conserved between all sequences compared while A, C and E divided between the streptomycin and hygromycin B phosphotransferases on one hand and kanamycin/neomycin ones on the other. A composite sequence data base was searched for homologues to consensus matrices constructed from five approximately 12-residue subsequences within blocks B and D. For one subsequence, corresponding to the N-terminal portion of block D, those sequences from the database that yielded the highest homology scores comprised almost entirely either antibiotic phosphotransferases or eukaryotic protein kinases. Possible evolutionary implications of this homology, previously described by other groups, are discussed.
USDA-ARS?s Scientific Manuscript database
The soybean Consensus Map 4.0 facilitated the anchoring of 95.6% of the soybean whole genome sequence developed by the Joint Genome Institute, Department of Energy but only properly oriented 66% of the sequence scaffolds. To find additional single nucleotide polymorphism (SNP) markers for additiona...
Berger, Cordula; Parson, Walther
2009-06-01
The degradation state of some biological traces recovered from the crime scene requires the amplification of very short fragments to attain a useful mitochondrial (mt)DNA sequence. We have previously introduced two mini-multiplex assays that amplify 10 overlapping control region (CR) fragments in two separate multiplex PCRs, which brought successful CR consensus sequences from even highly degraded DNA extracts. This procedure requires a total of 20 sequencing reactions per sample, which is laborious and cost intensive. For only moderately degraded samples that we encounter more frequently with typical mtDNA casework material, we developed two new multiplex assays that use a subset of the mini-amplicon primers but embrace larger fragments (midis) and require only 10 sequencing reactions to build a double-stranded CR consensus sequence. We used a preceding mtDNA quantitation step by real-time PCR with two different target fragments (143 and 283 bp) that roughly correspond to the average fragment sizes of the different multiplex approaches to estimate size-dependent mtDNA quantities and to aid the choice of the appropriate PCR multiplexes with respect to quality of the results and required costs.
Busk, Peter Kamp; Lange, Lene
2013-06-01
Functional prediction of carbohydrate-active enzymes is difficult due to low sequence identity. However, similar enzymes often share a few short motifs, e.g., around the active site, even when the overall sequences are very different. To exploit this notion for functional prediction of carbohydrate-active enzymes, we developed a simple algorithm, peptide pattern recognition (PPR), that can divide proteins into groups of sequences that share a set of short conserved sequences. When this method was used on 118 glycoside hydrolase 5 proteins with 9% average pairwise identity and representing four characterized enzymatic functions, 97% of the proteins were sorted into groups correlating with their enzymatic activity. Furthermore, we analyzed 8,138 glycoside hydrolase 13 proteins including 204 experimentally characterized enzymes with 28 different functions. There was a 91% correlation between group and enzyme activity. These results indicate that the function of carbohydrate-active enzymes can be predicted with high precision by finding short, conserved motifs in their sequences. The glycoside hydrolase 61 family is important for fungal biomass conversion, but only a few proteins of this family have been functionally characterized. Interestingly, PPR divided 743 glycoside hydrolase 61 proteins into 16 subfamilies useful for targeted investigation of the function of these proteins and pinpointed three conserved motifs with putative importance for enzyme activity. Furthermore, the conserved sequences were useful for cloning of new, subfamily-specific glycoside hydrolase 61 proteins from 14 fungi. In conclusion, identification of conserved sequence motifs is a new approach to sequence analysis that can predict carbohydrate-active enzyme functions with high precision.
2012-01-01
Background The detection of conserved residue clusters on a protein structure is one of the effective strategies for the prediction of functional protein regions. Various methods, such as Evolutionary Trace, have been developed based on this strategy. In such approaches, the conserved residues are identified through comparisons of homologous amino acid sequences. Therefore, the selection of homologous sequences is a critical step. It is empirically known that a certain degree of sequence divergence in the set of homologous sequences is required for the identification of conserved residues. However, the development of a method to select homologous sequences appropriate for the identification of conserved residues has not been sufficiently addressed. An objective and general method to select appropriate homologous sequences is desired for the efficient prediction of functional regions. Results We have developed a novel index to select the sequences appropriate for the identification of conserved residues, and implemented the index within our method to predict the functional regions of a protein. The implementation of the index improved the performance of the functional region prediction. The index represents the degree of conserved residue clustering on the tertiary structure of the protein. For this purpose, the structure and sequence information were integrated within the index by the application of spatial statistics. Spatial statistics is a field of statistics in which not only the attributes but also the geometrical coordinates of the data are considered simultaneously. Higher degrees of clustering generate larger index scores. We adopted the set of homologous sequences with the highest index score, under the assumption that the best prediction accuracy is obtained when the degree of clustering is the maximum. The set of sequences selected by the index led to higher functional region prediction performance than the sets of sequences selected by other sequence-based methods. Conclusions Appropriate homologous sequences are selected automatically and objectively by the index. Such sequence selection improved the performance of functional region prediction. As far as we know, this is the first approach in which spatial statistics have been applied to protein analyses. Such integration of structure and sequence information would be useful for other bioinformatics problems. PMID:22643026
Nanopore DNA Sequencing and Genome Assembly on the International Space Station.
Castro-Wallace, Sarah L; Chiu, Charles Y; John, Kristen K; Stahl, Sarah E; Rubins, Kathleen H; McIntyre, Alexa B R; Dworkin, Jason P; Lupisella, Mark L; Smith, David J; Botkin, Douglas J; Stephenson, Timothy A; Juul, Sissel; Turner, Daniel J; Izquierdo, Fernando; Federman, Scot; Stryke, Doug; Somasekar, Sneha; Alexander, Noah; Yu, Guixia; Mason, Christopher E; Burton, Aaron S
2017-12-21
We evaluated the performance of the MinION DNA sequencer in-flight on the International Space Station (ISS), and benchmarked its performance off-Earth against the MinION, Illumina MiSeq, and PacBio RS II sequencing platforms in terrestrial laboratories. Samples contained equimolar mixtures of genomic DNA from lambda bacteriophage, Escherichia coli (strain K12, MG1655) and Mus musculus (female BALB/c mouse). Nine sequencing runs were performed aboard the ISS over a 6-month period, yielding a total of 276,882 reads with no apparent decrease in performance over time. From sequence data collected aboard the ISS, we constructed directed assemblies of the ~4.6 Mb E. coli genome, ~48.5 kb lambda genome, and a representative M. musculus sequence (the ~16.3 kb mitochondrial genome), at 100%, 100%, and 96.7% consensus pairwise identity, respectively; de novo assembly of the E. coli genome from raw reads yielded a single contig comprising 99.9% of the genome at 98.6% consensus pairwise identity. Simulated real-time analyses of in-flight sequence data using an automated bioinformatic pipeline and laptop-based genomic assembly demonstrated the feasibility of sequencing analysis and microbial identification aboard the ISS. These findings illustrate the potential for sequencing applications including disease diagnosis, environmental monitoring, and elucidating the molecular basis for how organisms respond to spaceflight.
Stakeholder Participation in Marine Spatial Plan Making Process in Lampung Province
NASA Astrophysics Data System (ADS)
Asirin; Asbi, A. M.; Pakpahan, V. H.
2018-05-01
Lampung Province has coastal areas, seas and small islands facing conflicts of interest between tourism, conservation areas for defense, environmental conservation, and the threat of unsustainable marine resource utilization. Indonesia (including Lampung Province) has committed itself to achieving the objectives of conservation and sustainable use of oceans, seas and marine resources in view of sustainable development. One of the instruments used to achieve this goal is by using marine spatial planning (MSP). The purpose of this research was to analyse the marine spatial plan making process in Lampung Province. This research also evaluated the participation process and participation level based on plan-making process criteria and the stakeholder participation ladder. This research can be useful as a recommendation in the evaluation step to improve the plan-making process in order to address conflicts of interest between various related interest groups, so that planning can be accomplished with the involvement of all relevant parties to reach consensus on how to achieve a sustainable marine environment. This research used a qualitative research method as well as a case study approach. The scope of this study was limited by the conceptual framework of marine spatial planning and the stakeholder participation ladder. The authors recommend study of the preparation of marine spatial planning in addition to a technocratic approach considering the results of the study aspects of spatial allocation and physical aspects of marine resources, while prioritizing building consensus among various interest groups related to the utilization of marine resources. Thus, it is necessary to develop technical steps to build consensus in the marine spatial plan-making process.
NASA Astrophysics Data System (ADS)
Sui, Xin; Yang, Yongqing; Xu, Xianyun; Zhang, Shuai; Zhang, Lingzhong
2018-02-01
This paper investigates the consensus of multi-agent systems with probabilistic time-varying delays and packet losses via sampled-data control. On the one hand, a Bernoulli-distributed white sequence is employed to model random packet losses among agents. On the other hand, a switched system is used to describe packet dropouts in a deterministic way. Based on the special property of the Laplacian matrix, the consensus problem can be converted into a stabilization problem of a switched system with lower dimensions. Some mean square consensus criteria are derived in terms of constructing an appropriate Lyapunov function and using linear matrix inequalities (LMIs). Finally, two numerical examples are given to show the effectiveness of the proposed method.
Fuentes-Pananá, Ezequiel M.; Swaminathan, Sankar; Ling, Paul D.
1999-01-01
The Epstein-Barr virus (EBV) EBNA2 protein is a transcriptional activator that controls viral latent gene expression and is essential for EBV-driven B-cell immortalization. EBNA2 is expressed from the viral C promoter (Cp) and regulates its own expression by activating Cp through interaction with the cellular DNA binding protein CBF1. Through regulation of Cp and EBNA2 expression, EBV controls the pattern of latent protein expression and the type of latency established. To gain further insight into the important regulatory elements that modulate Cp usage, we isolated and sequenced the Cp regions corresponding to nucleotides 10251 to 11479 of the EBV genome (−1079 to +144 relative to the transcription initiation site) from the EBV-like lymphocryptoviruses found in baboons (herpesvirus papio; HVP) and Rhesus macaques (RhEBV). Sequence comparison of the approximately 1,230-bp Cp regions from these primate viruses revealed that EBV and HVP Cp sequences are 64% conserved, EBV and RhEBV Cp sequences are 66% conserved, and HVP and RhEBV Cp sequences are 65% conserved relative to each other. Approximately 50% of the residues are conserved among all three sequences, yet all three viruses have retained response elements for glucocorticoids, two positionally conserved CCAAT boxes, and positionally conserved TATA boxes. The putative EBNA2 100-bp enhancers within these promoters contain 54 conserved residues, and the binding sites for CBF1 and CBF2 are well conserved. Cp usage in the HVP- and RhEBV-transformed cell lines was detected by S1 nuclease protection analysis. Transient-transfection analysis showed that promoters of both HVP and RhEBV are responsive to EBNA2 and that they bind CBF1 and CBF2 in gel mobility shift assays. These results suggest that similar mechanisms for regulation of latent gene expression are conserved among the EBV-related lymphocryptoviruses found in nonhuman primates. PMID:9847397
Fuentes-Pananá, E M; Swaminathan, S; Ling, P D
1999-01-01
The Epstein-Barr virus (EBV) EBNA2 protein is a transcriptional activator that controls viral latent gene expression and is essential for EBV-driven B-cell immortalization. EBNA2 is expressed from the viral C promoter (Cp) and regulates its own expression by activating Cp through interaction with the cellular DNA binding protein CBF1. Through regulation of Cp and EBNA2 expression, EBV controls the pattern of latent protein expression and the type of latency established. To gain further insight into the important regulatory elements that modulate Cp usage, we isolated and sequenced the Cp regions corresponding to nucleotides 10251 to 11479 of the EBV genome (-1079 to +144 relative to the transcription initiation site) from the EBV-like lymphocryptoviruses found in baboons (herpesvirus papio; HVP) and Rhesus macaques (RhEBV). Sequence comparison of the approximately 1,230-bp Cp regions from these primate viruses revealed that EBV and HVP Cp sequences are 64% conserved, EBV and RhEBV Cp sequences are 66% conserved, and HVP and RhEBV Cp sequences are 65% conserved relative to each other. Approximately 50% of the residues are conserved among all three sequences, yet all three viruses have retained response elements for glucocorticoids, two positionally conserved CCAAT boxes, and positionally conserved TATA boxes. The putative EBNA2 100-bp enhancers within these promoters contain 54 conserved residues, and the binding sites for CBF1 and CBF2 are well conserved. Cp usage in the HVP- and RhEBV-transformed cell lines was detected by S1 nuclease protection analysis. Transient-transfection analysis showed that promoters of both HVP and RhEBV are responsive to EBNA2 and that they bind CBF1 and CBF2 in gel mobility shift assays. These results suggest that similar mechanisms for regulation of latent gene expression are conserved among the EBV-related lymphocryptoviruses found in nonhuman primates.
[Promising conservative treatment using dynamic mobilisation after Achilles tendon rupture].
Tengberg, Peter Toft; Barfod, Kristoffer; Krasheninnikoff, Michael; Ebskov, Lars; Troelsen, Anders
2011-10-31
There is no consensus regarding the optimal treatment of acute Achilles tendon ruptures. This review of the literature on the subject shows a significantly higher rate of reruptures (RR) in the conservatively treated group compared to the surgically treated group when the foot is immobilised in the aftertreatment. Recent studies that used early dynamic mobilisation in the conservatively treated group did not show this difference in the RR rate. The latest literature on the subject indicates that non-operative treatment, followed by dynamic aftertreatment, results in the lowest complication rate and a good functional outcome.
Dong, Zheng; Zhou, Hongyu; Tao, Peng
2018-02-01
PAS domains are widespread in archaea, bacteria, and eukaryota, and play important roles in various functions. In this study, we aim to explore functional evolutionary relationship among proteins in the PAS domain superfamily in view of the sequence-structure-dynamics-function relationship. We collected protein sequences and crystal structure data from RCSB Protein Data Bank of the PAS domain superfamily belonging to three biological functions (nucleotide binding, photoreceptor activity, and transferase activity). Protein sequences were aligned and then used to select sequence-conserved residues and build phylogenetic tree. Three-dimensional structure alignment was also applied to obtain structure-conserved residues. The protein dynamics were analyzed using elastic network model (ENM) and validated by molecular dynamics (MD) simulation. The result showed that the proteins with same function could be grouped by sequence similarity, and proteins in different functional groups displayed statistically significant difference in their vibrational patterns. Interestingly, in all three functional groups, conserved amino acid residues identified by sequence and structure conservation analysis generally have a lower fluctuation than other residues. In addition, the fluctuation of conserved residues in each biological function group was strongly correlated with the corresponding biological function. This research suggested a direct connection in which the protein sequences were related to various functions through structural dynamics. This is a new attempt to delineate functional evolution of proteins using the integrated information of sequence, structure, and dynamics. © 2017 The Protein Society.
USDA-ARS?s Scientific Manuscript database
Background: Vertebrate immune systems generate diverse repertoires of antibodies capable of mediating response to a variety of antigens. Next generation sequencing methods provide unique approaches to a number of immuno-based research areas including antibody discovery and engineering, disease surve...
Ramos, María Laura; Altieri, Emiliano; Bulos, Mariano; Sala, Carlos A
2013-01-01
Reduced height germplasm has the potential to increase stem strength, standability, and also yields potential of the sunflower crop (Helianthus annuus L. var. macrocarpus Ckll.). In this study, we report on the inheritance, mapping, phenotypic and molecular characterization of a reduced plant height trait in inbred lines derived from the source DDR. This trait is controlled by a semidominant allele, Rht1, which maps on linkage group 12 of the sunflower public consensus map. Phenotypic effects of this allele include shorter height and internode length, insensibility to exogenous gibberellin application, normal skotomorphogenetic response, and reduced seed set under self-pollination conditions. This later effect presumably is related to the reduced pollen viability observed in all DDR-derived lines studied. Rht1 completely cosegregated with a haplotype of the HaDella1 gene sequence. This haplotype consists of a point mutation converting a leucine residue in a proline within the conserved DELLA domain. Taken together, the phenotypic, genetic, and molecular results reported here indicate that Rht1 in sunflower likely encodes an altered DELLA protein. If the DELPA motif of the HaDELLA1 sequence in the Rht1-encoded protein determines by itself the observed reduction in height is a matter that remains to be investigated.
Johnson, J A; Parra, G I; Levenson, E A; Green, K Y
2017-06-01
Historical outbreaks can be an important source of information in the understanding of norovirus evolution and epidemiology. Here, we revisit an outbreak of undiagnosed gastroenteritis that occurred in Shippensburg, Pennsylvania in 1972. Nearly 5000 people fell ill over the course of 10 days. Symptoms included diarrhea, vomiting, stomach cramps, and fever, lasting for a median of 24 h. Using current techniques, including next-generation sequencing of full-length viral genomic amplicons, we identified an unusual norovirus recombinant (GII.Pg/GII.3) in nine of 15 available stool samples from the outbreak. This particular recombinant virus has not been reported in recent decades, although GII.3 and GII.Pg genotypes have been detected individually in current epidemic strains. The consensus nucleotide sequences were nearly identical among the four viral genomes analysed, although each strain had three to seven positions in the genome with heterogenous non-synonymous nucleotide subpopulations. Two of these resulting amino acid polymorphisms were conserved in frequency among all four cases, consistent with common source exposure and successful transmission of a mixed viral population. Continued investigation of variant nucleotide populations and recombination events among ancestral norovirus strains such as the Shippensburg virus may provide unique insight into the origin of contemporary strains.
In vitro mapping of Myotonic Dystrophy (DM) gene promoter
DOE Office of Scientific and Technical Information (OSTI.GOV)
Storbeck, C.J.; Sabourin, L.; Baird, S.
1994-09-01
The Myotonic Dystrophy Kinase (DMK) gene has been cloned and shared homology to serine/threonine protein kinases. Overexpression of this gene in stably transfected mouse myoblasts has been shown to inhibit fusion into myotubes while myoblasts stably transfected with an antisense construct show increased fusion potential. These experiments, along with data showing that the DM gene is highly expressed in muscle have highlighted the possibility of DMK being involved in myogenesis. The promoter region of the DM gene lacks a consensus TATA box and CAAT box, but harbours numerous transcription binding sites. Clones containing extended 5{prime} upstream sequences (UPS) of DMKmore » only weakly drive the reporter gene chloramphenicol acetyl transferase (CAT) when transfected into C2C12 mouse myoblasts. However, four E-boxes are present in the first intron of the DM gene and transient assays show increased expression of the CAT gene when the first intron is present downstream of these 5{prime} UPS in an orientation dependent manner. Comparison between mouse and human sequence reveals that the regions in the first intron where the E-boxes are located are highly conserved. The mapping of the promoter and the importance of the first intron in the control of DMK expression will be presented.« less
Quantifying the relationship between sequence and three-dimensional structure conservation in RNA
2010-01-01
Background In recent years, the number of available RNA structures has rapidly grown reflecting the increased interest on RNA biology. Similarly to the studies carried out two decades ago for proteins, which gave the fundamental grounds for developing comparative protein structure prediction methods, we are now able to quantify the relationship between sequence and structure conservation in RNA. Results Here we introduce an all-against-all sequence- and three-dimensional (3D) structure-based comparison of a representative set of RNA structures, which have allowed us to quantitatively confirm that: (i) there is a measurable relationship between sequence and structure conservation that weakens for alignments resulting in below 60% sequence identity, (ii) evolution tends to conserve more RNA structure than sequence, and (iii) there is a twilight zone for RNA homology detection. Discussion The computational analysis here presented quantitatively describes the relationship between sequence and structure for RNA molecules and defines a twilight zone region for detecting RNA homology. Our work could represent the theoretical basis and limitations for future developments in comparative RNA 3D structure prediction. PMID:20550657
Putaporntip, Chaturong; Thongaree, Siriporn; Jongwutiwes, Somchai
2013-08-01
To determine the genetic diversity and potential transmission routes of Plasmodium knowlesi, we analyzed the complete nucleotide sequence of the gene encoding the merozoite surface protein-1 of this simian malaria (Pkmsp-1), an asexual blood-stage vaccine candidate, from naturally infected humans and macaques in Thailand. Analysis of Pkmsp-1 sequences from humans (n=12) and monkeys (n=12) reveals five conserved and four variable domains. Most nucleotide substitutions in conserved domains were dimorphic whereas three of four variable domains contained complex repeats with extensive sequence and size variation. Besides purifying selection in conserved domains, evidence of intragenic recombination scattering across Pkmsp-1 was detected. The number of haplotypes, haplotype diversity, nucleotide diversity and recombination sites of human-derived sequences exceeded that of monkey-derived sequences. Phylogenetic networks based on concatenated conserved sequences of Pkmsp-1 displayed a character pattern that could have arisen from sampling process or the presence of two independent routes of P. knowlesi transmission, i.e. from macaques to human and from human to humans in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.
Schein, Catherine H; Ye, Mengyi; Paul, Aniko V; Oberste, M Steven; Chapman, Nora; van der Heden van Noort, Gerbrand J; Filippov, Dmitri V; Choi, Kyung H
2015-10-01
Enteroviruses (EV) uridylylate a peptide, VPg, as the first step in their replication. VPgpUpU, found free in infected cells, serves as the primer for RNA elongation. The abilities of four polymerases (3D(pol)), from EV-species A-C, to uridylylate VPgs that varied by up to 60% of their residues were compared. Each 3D(pol) was able to uridylylate all five VPgs using polyA RNA as template, while showing specificity for its own genome encoded peptide. All 3D(pol) uridylylated a consensus VPg representing the physical chemical properties of 31 different VPgs. Thus the residues required for uridylylation and the enzymatic mechanism must be similar in diverse EV. As VPg-binding sites differ in co-crystal structures, the reaction is probably done by a second 3D(pol) molecule. The conservation of polymerase residues whose mutation reduces uridylylation but not RNA elongation is compared. Copyright © 2015 Elsevier Inc. All rights reserved.
Structural analysis of Notch-regulating Rumi reveals basis for pathogenic mutations
Yu, Hongjun; Takeuchi, Hideyuki; Takeuchi, Megumi; ...
2016-07-18
We present Rumi O-glucosylates the EGF repeats of a growing list of proteins essential in metazoan development, including Notch. Rumi is essential for Notch signaling, and Rumi dysregulation is linked to several human diseases. Despite Rumi's critical roles, it is unknown how Rumi glucosylates a serine of many but not all EGF repeats. Here we report crystal structures of Drosophila Rumi as binary and ternary complexes with a folded EGF repeat and/or donor substrates. These structures provide insights into the catalytic mechanism and show that Rumi recognizes structural signatures of the EGF motif, the U-shaped consensus sequence, C-X-S-X-(P/A)-C and amore » conserved hydrophobic region. We found that five Rumi mutations identified in cancers and Dowling–Degos disease are clustered around the enzyme active site and adversely affect its activity. In conclusion, our study suggests that loss of Rumi activity may underlie these diseases, and the mechanistic insights may facilitate the development of modulators of Notch signaling.« less
Mbanzibwa, Deusdedith R.; Tian, Yanping; Mukasa, Settumba B.; Valkonen, Jari P. T.
2009-01-01
The complete positive-sense single-stranded RNA genome of Cassava brown streak virus (CBSV; genus Ipomovirus; Potyviridae) was found to consist of 9,069 nucleotides and predicted to produce a polyprotein of 2,902 amino acids. It was lacking helper-component proteinase but contained a single P1 serine proteinase that strongly suppressed RNA silencing. Besides the exceptional structure of the 5′-proximal part of the genome, CBSV also contained a Maf/HAM1-like sequence (678 nucleotides, 226 amino acids) recombined between the replicase and coat protein domains in the 3′-proximal part of the genome, which is highly conserved in Potyviridae. HAM1 was flanked by consensus proteolytic cleavage sites for ipomovirus NIaPro cysteine proteinase. Homology of CBSV HAM1 with cellular Maf/HAM1 pyrophosphatases suggests that it may intercept noncanonical nucleoside triphosphates to reduce mutagenesis of viral RNA. PMID:19386713
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ranatunga, Wasantha; Hill, Emma E.; Mooster, Jana L.
We have determined the crystal structure, at 1.4, of the Nudix hydrolase DR1025 from the extremely radiation resistant bacterium Deinococcus radiodurans. The protein forms an intertwined homodimer by exchanging N-terminal segments between chains. We have identified additional conserved elements of the Nudix fold, including the metal-binding motif, a kinked b-strand characterized by a proline two positions upstream of the Nudix consensus sequence, and participation of the N-terminal extension in the formation of the substrate-binding pocket. Crystal structures were also solved of DR1025 crystallized in the presence of magnesium and either a GTP analog or Ap4A (both at 1.6 resolution). Inmore » the Ap4Aco-crystal, the electron density indicated that the product of asymmetric hydrolysis, ATP, was bound to the enzyme. The GTP analog bound structure showed that GTP was bound almost identically as ATP. Neither nucleoside triphosphate was further cleaved.« less
Structural analysis of Notch-regulating Rumi reveals basis for pathogenic mutations
Yu, Hongjun; Takeuchi, Hideyuki; Takeuchi, Megumi; Liu, Qun; Kantharia, Joshua; Haltiwanger, Robert S.; Li, Huilin
2016-01-01
Rumi O-glucosylates the EGF repeats of a growing list of proteins essential in metazoan development including Notch. Rumi is essential for Notch signaling, and Rumi dysregulation is linked to several human diseases. Despite Rumi’s critical roles, it is unknown how Rumi glucosylates a serine of many but not all EGF repeats. Here we report crystal structures of Drosophila Rumi as binary or ternary complexes with a folded EGF repeat and/or donor substrates. These structures provide insights into the catalytic mechanism, and show that Rumi recognizes structural signatures of the EGF motif, the U-shaped consensus sequence, C-X-S-X-(P/A)-C and a conserved hydrophobic region. We found that five Rumi mutations identified in cancers and Dowling-Degos disease are clustered around the enzyme active site and adversely affect its activity. Our study suggests that loss of Rumi activity may underlie these diseases, and the mechanistic insights may facilitate the development of modulators of Notch signaling. PMID:27428513
Mori, Yusuke; Inoue, Yoko; Taniyama, Yuki; Tanaka, Sayori; Terada, Yasuhiko
2015-12-25
Cep169 is a centrosomal protein conserved among vertebrates. In our previous reports, we showed that mammalian Cep169 interacts and collaborates with CDK5RAP2 to regulate microtubule (MT) dynamics and stabilization. Although Cep169 is required for MT regulation, its precise cellular function remains largely elusive. Here we show that Cep169 associates with centrosomes during interphase, but dissociates from these structures from the onset of mitosis, although CDK5RAP2 (Cep215) is continuously located at the centrosomes throughout cell cycle. Interestingly, treatment with purvalanol A, a Cdk1 inhibitor, nearly completely blocked the dissociation of Cep169 from centrosomes during mitosis. In addition, mass spectrometry analyses identified 7 phosphorylated residues of Cep169 corresponding to consensus phosphorylation sequence for Cdk1. These data suggest that the dissociation of Cep169 from centrosomes is controlled by Cdk1/Cyclin B during mitosis, and that Cep169 might regulate MT dynamics of mitotic spindle. Copyright © 2015 Elsevier Inc. All rights reserved.
Structural analysis of Notch-regulating Rumi reveals basis for pathogenic mutations
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yu, Hongjun; Takeuchi, Hideyuki; Takeuchi, Megumi
We present Rumi O-glucosylates the EGF repeats of a growing list of proteins essential in metazoan development, including Notch. Rumi is essential for Notch signaling, and Rumi dysregulation is linked to several human diseases. Despite Rumi's critical roles, it is unknown how Rumi glucosylates a serine of many but not all EGF repeats. Here we report crystal structures of Drosophila Rumi as binary and ternary complexes with a folded EGF repeat and/or donor substrates. These structures provide insights into the catalytic mechanism and show that Rumi recognizes structural signatures of the EGF motif, the U-shaped consensus sequence, C-X-S-X-(P/A)-C and amore » conserved hydrophobic region. We found that five Rumi mutations identified in cancers and Dowling–Degos disease are clustered around the enzyme active site and adversely affect its activity. In conclusion, our study suggests that loss of Rumi activity may underlie these diseases, and the mechanistic insights may facilitate the development of modulators of Notch signaling.« less
Towards Tuneable Retaining Glycosidase-Inhibiting Peptides by Mimicry of a Plant Flavonol Warhead.
Yoshisada, Ryoji; van Gijzel, Lieke; Jongkees, Seino A K
2017-12-05
Retaining glycosidases are an important class of enzymes involved in glycan degradation. To study better the role of specific enzymes in deglycosylation processes, and thereby the importance of particular glycosylation patterns, a set of potent inhibitors, each specific to a particular glycosidase, would be an invaluable toolkit. Towards this goal, we detail here a more in-depth study of a prototypical macrocyclic peptide inhibitor of the model retaining glycosidase human pancreatic α-amylase (HPA). Notably, incorporation of l-DOPA into this peptide affords an inhibitor of HPA with potency that is tenfold higher (K i =480 pm) than that of the previously found consensus sequence. This represents a first successful step in converting a recently discovered natural-product-derived motif, already specific for the catalytic side-chain arrangement conserved in the active sites of retaining glycosidases, into a tuneable retaining glycosidase inhibition warhead. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Liang, Yunyun; Liu, Sanyang; Zhang, Shengli
2015-01-01
Prediction of protein structural classes for low-similarity sequences is useful for understanding fold patterns, regulation, functions, and interactions of proteins. It is well known that feature extraction is significant to prediction of protein structural class and it mainly uses protein primary sequence, predicted secondary structure sequence, and position-specific scoring matrix (PSSM). Currently, prediction solely based on the PSSM has played a key role in improving the prediction accuracy. In this paper, we propose a novel method called CSP-SegPseP-SegACP by fusing consensus sequence (CS), segmented PsePSSM, and segmented autocovariance transformation (ACT) based on PSSM. Three widely used low-similarity datasets (1189, 25PDB, and 640) are adopted in this paper. Then a 700-dimensional (700D) feature vector is constructed and the dimension is decreased to 224D by using principal component analysis (PCA). To verify the performance of our method, rigorous jackknife cross-validation tests are performed on 1189, 25PDB, and 640 datasets. Comparison of our results with the existing PSSM-based methods demonstrates that our method achieves the favorable and competitive performance. This will offer an important complementary to other PSSM-based methods for prediction of protein structural classes for low-similarity sequences.
Congenital analbuminemia caused by a novel aberrant splicing in the albumin gene.
Caridi, Gianluca; Dagnino, Monica; Erdeve, Omer; Di Duca, Marco; Yildiz, Duran; Alan, Serdar; Atasay, Begum; Arsan, Saadet; Campagnoli, Monica; Galliano, Monica; Minchiotti, Lorenzo
2014-01-01
Congenital analbuminemia is a rare autosomal recessive disorder manifested by the presence of a very low amount of circulating serum albumin. It is an allelic heterogeneous defect, caused by variety of mutations within the albumin gene in homozygous or compound heterozygous state. Herein we report the clinical and molecular characterization of a new case of congenital analbuminemia diagnosed in a female newborn of consanguineous (first degree cousins) parents from Ankara, Turkey, who presented with a low albumin concentration (< 8 g/L) and severe clinical symptoms. The albumin gene of the index case was screened by single-strand conformation polymorphism, heteroduplex analysis, and direct DNA sequencing. The effect of the splicing mutation was evaluated by examining the cDNA obtained by reverse transcriptase - polymerase chain reaction (RT-PCR) from the albumin mRNA extracted from proband's leukocytes. DNA sequencing revealed that the proband is homozygous, and both parents are heterozygous, for a novel G>A transition at position c.1652+1, the first base of intron 12, which inactivates the strongly conserved GT dinucleotide at the 5' splice site consensus sequence of this intron. The splicing defect results in the complete skipping of the preceding exon (exon 12) and in a frame-shift within exon 13 with a premature stop codon after the translation of three mutant amino acid residues. Our results confirm the clinical diagnosis of congenital analbuminemia in the proband and the inheritance of the trait and contribute to shed light on the molecular genetics of analbuminemia.
Horness, Rachel E; Basom, Edward J; Mayer, John P; Thielges, Megan C
2016-02-03
Conformational heterogeneity and dynamics are increasingly evoked in models of protein molecular recognition but are challenging to experimentally characterize. Here we combine the inherent temporal resolution of infrared (IR) spectroscopy with the spatial resolution afforded by selective incorporation of carbon-deuterium (C-D) bonds, which provide frequency-resolved absorptions within a protein IR spectrum, to characterize the molecular recognition of the Src homology 3 (SH3) domain of the yeast protein Sho1 with its cognate proline-rich (PR) sequence of Pbs2. The IR absorptions of C-D bonds introduced at residues along a peptide of the Pbs2 PR sequence report on the changes in the local environments upon binding to the SH3 domain. Interestingly, upon forming the complex the IR spectra of the peptides labeled with C-D bonds at either of the two conserved prolines of the PXXP consensus recognition sequence show more absorptions than there are C-D bonds, providing evidence for the population of multiple states. In contrast, the NMR spectra of the peptides labeled with (13)C at the same residues show only single resonances, indicating rapid interconversion on the NMR time scale. Thus, the data suggest that the SH3 domain recognizes its cognate peptide with a component of induced fit molecular recognition involving the adoption of multiples states, which have previously gone undetected due to interconversion between the populated states that is too fast to resolve using conventional methods.
Khansa, Ibrahim; Hall, Courtney; Madhoun, Lauren L; Splaingard, Mark; Baylis, Adriane; Kirschner, Richard E; Pearson, Gregory D
2017-04-01
Pierre Robin sequence is characterized by mandibular retrognathia and glossoptosis resulting in airway obstruction and feeding difficulties. When conservative management fails, mandibular distraction osteogenesis or tongue-lip adhesion may be required to avoid tracheostomy. The authors' goal was to prospectively evaluate the airway and feeding outcomes of their comprehensive approach to Pierre Robin sequence, which includes conservative management, mandibular distraction osteogenesis, and tongue-lip adhesion. A longitudinal study of newborns with Pierre Robin sequence treated at a pediatric academic medical center between 2010 and 2015 was performed. Baseline feeding and respiratory data were collected. Patients underwent conservative management if they demonstrated sustainable weight gain without tube feeds, and if their airway was stable with positioning alone. Patients who required surgery underwent tongue-lip adhesion or mandibular distraction osteogenesis based on family and surgeon preference. Postoperative airway and feeding data were collected. Twenty-eight patients with Pierre Robin sequence were followed prospectively. Thirty-two percent had a syndrome. Ten underwent mandibular distraction osteogenesis, eight underwent tongue-lip adhesion, and 10 were treated conservatively. There were no differences in days to extubation or discharge, change in weight percentile, requirement for gastrostomy tube, or residual obstructive sleep apnea between the three groups. No patients required tracheostomy. The greatest reduction in apnea-hypopnea index occurred with mandibular distraction osteogenesis, followed by tongue-lip adhesion and conservative management. Careful selection of which patients with Pierre Robin sequence need surgery, and of the most appropriate surgical procedure for each patient, can minimize the need for postprocedure tracheostomy. A comprehensive approach to Pierre Robin sequence that includes conservative management, mandibular distraction osteogenesis, and tongue-lip adhesion can result in excellent airway and feeding outcomes. Therapeutic, II.
Van Lent, Sarah; Creasy, Heather Huot; Myers, Garry S A; Vanrompay, Daisy
2016-01-01
Variation is a central trait of the polymorphic membrane protein (Pmp) family. The number of pmp coding sequences differs between Chlamydia species, but it is unknown whether the number of pmp coding sequences is constant within a Chlamydia species. The level of conservation of the Pmp proteins has previously only been determined for Chlamydia trachomatis. As different Pmp proteins might be indispensible for the pathogenesis of different Chlamydia species, this study investigated the conservation of Pmp proteins both within and across C. trachomatis,C. pneumoniae,C. abortus, and C. psittaci. The pmp coding sequences were annotated in 16 C. trachomatis, 6 C. pneumoniae, 2 C. abortus, and 16 C. psittaci genomes. The number and organization of polymorphic membrane coding sequences differed within and across the analyzed Chlamydia species. The length of coding sequences of pmpA,pmpB, and pmpH was conserved among all analyzed genomes, while the length of pmpE/F and pmpG, and remarkably also of the subtype pmpD, differed among the analyzed genomes. PmpD, PmpA, PmpH, and PmpA were the most conserved Pmp in C. trachomatis,C. pneumoniae,C. abortus, and C. psittaci, respectively. PmpB was the most conserved Pmp across the 4 analyzed Chlamydia species. © 2016 S. Karger AG, Basel.
Kim, Seongman; Dai, Gan; O’Callaghan, Dennis J.; Kim, Seong Kee
2012-01-01
The immediate-early protein (IEP), the major regulatory protein encoded by the IE gene of equine herpesvirus 1 (EHV-1), plays a crucial role as both transcription activator and repressor during a productive lytic infection. To investigate the mechanism by which the EHV-1 IEP inhibits its own promoter, IE promoter-luciferase reporter plasmids containing wild-type and mutant IEP-binding site (IEBS) were constructed and used for luciferase reporter assays. The IEP inhibited transcription from its own promoter in the presence of a consensus IEBS (5’-ATCGT-3’) located near the transcription initiation site but did not inhibit when the consensus sequence was deleted. To determine whether the distance between the TATA box and the IEBS affects transcriptional repression, the IEBS was displaced from the original site by the insertion of synthetic DNA sequences. Luciferase reporter assays revealed that the IEP is able to repress its own promoter when the IEBS is located within 26-bp from the TATA box. We also found that the proper orientation and position of the IEBS were required for the repression by the IEP. Interestingly, the level of repression was significantly reduced when a consensus TATA sequence was deleted from the promoter region, indicating that the IEP efficiently inhibits its own promoter in a TATA box-dependent manner. Taken together, these results suggest that the EHV-1 IEP delicately modulates autoregulation of its gene through the consensus IEBS that is near the transcription initiation site and the TATA box. PMID:22265772
Kim, Seongman; Dai, Gan; O'Callaghan, Dennis J; Kim, Seong Kee
2012-04-01
The immediate-early protein (IEP), the major regulatory protein encoded by the IE gene of equine herpesvirus 1 (EHV-1), plays a crucial role as both transcription activator and repressor during a productive lytic infection. To investigate the mechanism by which the EHV-1 IEP inhibits its own promoter, IE promoter-luciferase reporter plasmids containing wild-type and mutant IEP-binding site (IEBS) were constructed and used for luciferase reporter assays. The IEP inhibited transcription from its own promoter in the presence of a consensus IEBS (5'-ATCGT-3') located near the transcription initiation site but did not inhibit when the consensus sequence was deleted. To determine whether the distance between the TATA box and the IEBS affects transcriptional repression, the IEBS was displaced from the original site by the insertion of synthetic DNA sequences. Luciferase reporter assays revealed that the IEP is able to repress its own promoter when the IEBS is located within 26-bp from the TATA box. We also found that the proper orientation and position of the IEBS were required for the repression by the IEP. Interestingly, the level of repression was significantly reduced when a consensus TATA sequence was deleted from the promoter region, indicating that the IEP efficiently inhibits its own promoter in a TATA box-dependent manner. Taken together, these results suggest that the EHV-1 IEP delicately modulates autoregulation of its gene through the consensus IEBS that is near the transcription initiation site and the TATA box. Copyright © 2012. Published by Elsevier B.V.
Kortenhoeven, Cornell; Joubert, Fourie; Bastos, Armanda D S; Abolnik, Celia
2015-02-22
Extensive focus is placed on the comparative analyses of consensus genotypes in the study of West Nile virus (WNV) emergence. Few studies account for genetic change in the underlying WNV quasispecies population variants. These variants are not discernable in the consensus genome at the time of emergence, and the maintenance of mutation-selection equilibria of population variants is greatly underestimated. The emergence of lineage 1 WNV strains has been studied extensively, but recent epidemics caused by lineage 2 WNV strains in Hungary, Austria, Greece and Italy emphasizes the increasing importance of this lineage to public health. In this study we explored the quasispecies dynamics of minority variants that contribute to cell-tropism and host determination, i.e. the ability to infect different cell types or cells from different species from Next Generation Sequencing (NGS) data of a historic lineage 2 WNV strain. Minority variants contributing to host cell membrane association persist in the viral population without contributing to the genetic change in the consensus genome. Minority variants are shown to maintain a stable mutation-selection equilibrium under positive selection, particularly in the capsid gene region. This study is the first to infer positive selection and the persistence of WNV haplotype variants that contribute to viral fitness without accompanying genetic change in the consensus genotype, documented solely from NGS sequence data. The approach used in this study streamlines the experimental design seeking viral minority variants accurately from NGS data whilst minimizing the influence of associated sequence error.
Kamalakaran, Sitharthan; Radhakrishnan, Senthil K; Beck, William T
2005-06-03
We developed a pipeline to identify novel genes regulated by the steroid hormone-dependent transcription factor, estrogen receptor, through a systematic analysis of upstream regions of all human and mouse genes. We built a data base of putative promoter regions for 23,077 human and 19,984 mouse transcripts from National Center for Biotechnology Information annotation and 8793 human and 6785 mouse promoters from the Data Base of Transcriptional Start Sites. We used this data base of putative promoters to identify potential targets of estrogen receptor by identifying estrogen response elements (EREs) in their promoters. Our program correctly identified EREs in genes known to be regulated by estrogen in addition to several new genes whose putative promoters contained EREs. We validated six genes (KIAA1243, NRIP1, MADH9, NME3, TPD52L, and ABCG2) to be estrogen-responsive in MCF7 cells using reverse transcription PCR. To allow for extensibility of our program in identifying targets of other transcription factors, we have built a Web interface to access our data base and programs. Our Web-based program for Promoter Analysis of Genome, PAGen@UIC, allows a user to identify putative target genes for vertebrate transcription factors through the analysis of their upstream sequences. The interface allows the user to search the human and mouse promoter data bases for potential target genes containing one or more listed transcription factor binding sites (TFBSs) in their upstream elements, using either regular expression-based consensus or position weight matrices. The data base can also be searched for promoters harboring user-defined TFBSs given as a consensus or a position weight matrix. Furthermore, the user can retrieve putative promoter sequences for any given gene together with identified TFBSs located on its promoter. Orthologous promoters are also analyzed to determine conserved elements.
Yang, Lingna; Wang, Chongyuan; Li, Fudong; Zhang, Jiahai; Nayab, Anam; Wu, Jihui; Shi, Yunyu; Gong, Qingguo
2017-09-29
MEX-3 is a K-homology (KH) domain-containing RNA-binding protein first identified as a translational repressor in Caenorhabditis elegans , and its four orthologs (MEX-3A-D) in human and mouse were subsequently found to have E3 ubiquitin ligase activity mediated by a RING domain and critical for RNA degradation. Current evidence implicates human MEX-3C in many essential biological processes and suggests a strong connection with immune diseases and carcinogenesis. The highly conserved dual KH domains in MEX-3 proteins enable RNA binding and are essential for the recognition of the 3'-UTR and post-transcriptional regulation of MEX-3 target transcripts. However, the molecular mechanisms of translational repression and the consensus RNA sequence recognized by the MEX-3C KH domain are unknown. Here, using X-ray crystallography and isothermal titration calorimetry, we investigated the RNA-binding activity and selectivity of human MEX-3C dual KH domains. Our high-resolution crystal structures of individual KH domains complexed with a noncanonical U-rich and a GA-rich RNA sequence revealed that the KH1/2 domains of human MEX-3C bound MRE10, a 10-mer RNA (5'-CAGAGUUUAG-3') consisting of an eight-nucleotide MEX-3-recognition element (MRE) motif, with high affinity. Of note, we also identified a consensus RNA motif recognized by human MEX-3C. The potential RNA-binding sites in the 3'-UTR of the human leukocyte antigen serotype ( HLA-A2 ) mRNA were mapped with this RNA-binding motif and further confirmed by fluorescence polarization. The binding motif identified here will provide valuable information for future investigations of the functional pathways controlled by human MEX-3C and for predicting potential mRNAs regulated by this enzyme. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Burmeister, Thomas; Schwartz, Stefan; Hummel, Michael; Hoelzer, Dieter; Thiel, Eckhard
2007-01-01
Background The Deltaretrovirus genus comprises viruses that infect humans (HTLV), various simian species (STLV) and cattle (BLV). HTLV-I is the main causative agent in adult T-cell leukemia in endemic areas and some of the simian T-cell lymphotropic viruses have been implicated in the induction of malignant lymphomas in their hosts. BLV causes enzootic bovine leukosis in infected cattle or sheep. During the past few years several new Deltaretrovirus isolates have been described in various primate species. Two new HTLV-like viruses in humans have recently been identified and provisionally termed HTLV-III and HTLV-IV. In order to identify a broad spectrum of Deltaretroviruses by a single PCR approach we have established a novel consensus PCR based on nucleotide sequence data obtained from 42 complete virus isolates (HTLV-I/-II, STLV-I/-II/-III, BLV). The primer sequences were based on highly interspecies-conserved virus genome regions. We used this PCR to detect Deltaretroviruses in samples from adult patients with a variety of rare T-cell neoplasms in Germany. Results The sensitivity of the consensus PCR was at least between 10-2 and 10-3 with 100% specificity as demonstrated by serial dilutions of cell lines infected with either HTLV-I, HTLV-II or BLV. Fifty acute T-cell lymphoblastic leukemia (T-ALL) samples and 33 samples from patients with various rare mature T-cell neoplasms (T-PLL, Sézary syndrome and other T-NHL) were subsequently investigated. There were no cases with HTLV-I, HTLV-II or any other Deltaretroviruses. Conclusion The results rule out a significant involvement of HTLV-I or HTLV-II in these disease entities and show that other related Deltaretroviruses are not likely to be involved. The newly established Deltaretrovirus PCR may be a useful tool for identifying new Deltaretroviruses. PMID:17284327
Sechi, Leonardo A.; Zanetti, Stefania; Dupré, Ilaria; Delogu, Giovanni; Fadda, Giovanni
1998-01-01
The presence of enterobacterial repetitive intergenic consensus (ERIC) sequences was demonstrated for the first time in the genome of Mycobacterium tuberculosis; these sequences have been found in transcribed regions of the chromosomes of gram-negative bacteria. In this study genetic diversity among clinical isolates of M. tuberculosis was determined by PCR with ERIC primers (ERIC-PCR). The study isolates comprised 71 clinical isolates collected from Sardinia, Italy. ERIC-PCR was able to identify 59 distinct profiles. The results obtained were compared with IS6110 and PCR-GTG fingerprinting. We found that the level of differentiation obtained by ERIC-PCR is greater than that obtained by IS6110 fingerprinting and comparable to that obtained by PCR-GTG. This method of fingerprinting is rapid and sensitive and can be applied to the study of the epidemiology of M. tuberculosis infections, especially when IS6110 fingerprinting is not of any help. PMID:9431935
Paiardini, Alessandro; Bossa, Francesco; Pascarella, Stefano
2004-01-01
The wealth of biological information provided by structural and genomic projects opens new prospects of understanding life and evolution at the molecular level. In this work, it is shown how computational approaches can be exploited to pinpoint protein structural features that remain invariant upon long evolutionary periods in the fold-type I, PLP-dependent enzymes. A nonredundant set of 23 superposed crystallographic structures belonging to this superfamily was built. Members of this family typically display high-structural conservation despite low-sequence identity. For each structure, a multiple-sequence alignment of orthologous sequences was obtained, and the 23 alignments were merged using the structural information to obtain a comprehensive multiple alignment of 921 sequences of fold-type I enzymes. The structurally conserved regions (SCRs), the evolutionarily conserved residues, and the conserved hydrophobic contacts (CHCs) were extracted from this data set, using both sequence and structural information. The results of this study identified a structural pattern of hydrophobic contacts shared by all of the superfamily members of fold-type I enzymes and involved in native interactions. This profile highlights the presence of a nucleus for this fold, in which residues participating in the most conserved native interactions exhibit preferential evolutionary conservation, that correlates significantly (r = 0.70) with the extent of mean hydrophobic contact value of their apolar fraction. PMID:15498941
Ho, Cynthia K. Y.; Raghwani, Jayna; Koekkoek, Sylvie; Liang, Richard H.; Van der Meer, Jan T. M.; Van Der Valk, Marc; De Jong, Menno; Pybus, Oliver G.
2016-01-01
ABSTRACT In contrast to other available next-generation sequencing platforms, PacBio single-molecule, real-time (SMRT) sequencing has the advantage of generating long reads albeit with a relatively higher error rate in unprocessed data. Using this platform, we longitudinally sampled and sequenced the hepatitis C virus (HCV) envelope genome region (1,680 nucleotides [nt]) from individuals belonging to a cluster of sexually transmitted cases. All five subjects were coinfected with HIV-1 and a closely related strain of HCV genotype 4d. In total, 50 samples were analyzed by using SMRT sequencing. By using 7 passes of circular consensus sequencing, the error rate was reduced to 0.37%, and the median number of sequences was 612 per sample. A further reduction of insertions was achieved by alignment against a sample-specific reference sequence. However, in vitro recombination during PCR amplification could not be excluded. Phylogenetic analysis supported close relationships among HCV sequences from the four male subjects and subsequent transmission from one subject to his female partner. Transmission was characterized by a strong genetic bottleneck. Viral genetic diversity was low during acute infection and increased upon progression to chronicity but subsequently fluctuated during chronic infection, caused by the alternate detection of distinct coexisting lineages. SMRT sequencing combines long reads with sufficient depth for many phylogenetic analyses and can therefore provide insights into within-host HCV evolutionary dynamics without the need for haplotype reconstruction using statistical algorithms. IMPORTANCE Next-generation sequencing has revolutionized the study of genetically variable RNA virus populations, but for phylogenetic and evolutionary analyses, longer sequences than those generated by most available platforms, while minimizing the intrinsic error rate, are desired. Here, we demonstrate for the first time that PacBio SMRT sequencing technology can be used to generate full-length HCV envelope sequences at the single-molecule level, providing a data set with large sequencing depth for the characterization of intrahost viral dynamics. The selection of consensus reads derived from at least 7 full circular consensus sequencing rounds significantly reduced the intrinsic high error rate of this method. We used this method to genetically characterize a unique transmission cluster of sexually transmitted HCV infections, providing insight into the distinct evolutionary pathways in each patient over time and identifying the transmission-associated genetic bottleneck as well as fluctuations in viral genetic diversity over time, accompanied by dynamic shifts in viral subpopulations. PMID:28077634
USDA-ARS?s Scientific Manuscript database
Lipase gene (lip) of a biodegradable polyhydroxyalkanoate- (PHA-) synthesizing bacterium P. resinovorans NRRL B-2649 was cloned, sequenced and characterized by using consensus primers and PCR-based genome walking method. The ORF of the putative Lip (314 amino acids) and its active site (Ser111, Asp...
A FRET Biosensor for ROCK Based on a Consensus Substrate Sequence Identified by KISS Technology.
Li, Chunjie; Imanishi, Ayako; Komatsu, Naoki; Terai, Kenta; Amano, Mutsuki; Kaibuchi, Kozo; Matsuda, Michiyuki
2017-01-11
Genetically-encoded biosensors based on Förster/fluorescence resonance energy transfer (FRET) are versatile tools for studying the spatio-temporal regulation of signaling molecules within not only the cells but also tissues. Perhaps the hardest task in the development of a FRET biosensor for protein kinases is to identify the kinase-specific substrate peptide to be used in the FRET biosensor. To solve this problem, we took advantage of kinase-interacting substrate screening (KISS) technology, which deduces a consensus substrate sequence for the protein kinase of interest. Here, we show that a consensus substrate sequence for ROCK identified by KISS yielded a FRET biosensor for ROCK, named Eevee-ROCK, with high sensitivity and specificity. By treating HeLa cells with inhibitors or siRNAs against ROCK, we show that a substantial part of the basal FRET signal of Eevee-ROCK was derived from the activities of ROCK1 and ROCK2. Eevee-ROCK readily detected ROCK activation by epidermal growth factor, lysophosphatidic acid, and serum. When cells stably-expressing Eevee-ROCK were time-lapse imaged for three days, ROCK activity was found to increase after the completion of cytokinesis, concomitant with the spreading of cells. Eevee-ROCK also revealed a gradual increase in ROCK activity during apoptosis. Thus, Eevee-ROCK, which was developed from a substrate sequence predicted by the KISS technology, will pave the way to a better understanding of the function of ROCK in a physiological context.
Curran, Michael; de Souza, Danielle Maia; Antón, Assumpció; Teixeira, Ricardo F M; Michelsen, Ottar; Vidal-Legaz, Beatriz; Sala, Serenella; Milà i Canals, Llorenç
2016-03-15
The modeling of land use impacts on biodiversity is considered a priority in life cycle assessment (LCA). Many diverging approaches have been proposed in an expanding literature on the topic. The UNEP/SETAC Life Cycle Initiative is engaged in building consensus on a shared modeling framework to highlight best-practice and guide model application by practitioners. In this paper, we evaluated the performance of 31 models from both the LCA and the ecology/conservation literature (20 from LCA, 11 from non-LCA fields) according to a set of criteria reflecting (i) model completeness, (ii) biodiversity representation, (iii) impact pathway coverage, (iv) scientific quality, and (v) stakeholder acceptance. We show that LCA models tend to perform worse than those from ecology and conservation (although not significantly), implying room for improvement. We identify seven best-practice recommendations that can be implemented immediately to improve LCA models based on existing approaches in the literature. We further propose building a "consensus model" through weighted averaging of existing information, to complement future development. While our research focuses on conceptual model design, further quantitative comparison of promising models in shared case studies is an essential prerequisite for future informed model choice.
USDA-ARS?s Scientific Manuscript database
Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...
Rick Bonney; David N. Pashley; Robert J. Cooper; Larry Niles
2000-01-01
This volume represents a compilation of papers presented at the 3rd International Partners in Flight Workshop held October 1-5, 1995, at the Grand Hotel in Cape May, NJ. The title of the workshop was "Partners in Flight Conservation Plan: Building Consensus for Action." Manuscripts have been available on-line at the Cornell Laboratory of Ornithology web site...
Kantarski, Traci; Larson, Steve; Zhang, Xiaofei; DeHaan, Lee; Borevitz, Justin; Anderson, James; Poland, Jesse
2017-01-01
Development of the first consensus genetic map of intermediate wheatgrass gives insight into the genome and tools for molecular breeding. Intermediate wheatgrass (Thinopyrum intermedium) has been identified as a candidate for domestication and improvement as a perennial grain, forage, and biofuel crop and is actively being improved by several breeding programs. To accelerate this process using genomics-assisted breeding, efficient genotyping methods and genetic marker reference maps are needed. We present here the first consensus genetic map for intermediate wheatgrass (IWG), which confirms the species' allohexaploid nature (2n = 6x = 42) and homology to Triticeae genomes. Genotyping-by-sequencing was used to identify markers that fit expected segregation ratios and construct genetic maps for 13 heterogeneous parents of seven full-sib families. These maps were then integrated using a linear programming method to produce a consensus map with 21 linkage groups containing 10,029 markers, 3601 of which were present in at least two populations. Each of the 21 linkage groups contained between 237 and 683 markers, cumulatively covering 5061 cM (2891 cM--Kosambi) with an average distance of 0.5 cM between each pair of markers. Through mapping the sequence tags to the diploid (2n = 2x = 14) barley reference genome, we observed high colinearity and synteny between these genomes, with three homoeologous IWG chromosomes corresponding to each of the seven barley chromosomes, and mapped translocations that are known in the Triticeae. The consensus map is a valuable tool for wheat breeders to map important disease-resistance genes within intermediate wheatgrass. These genomic tools can help lead to rapid improvement of IWG and development of high-yielding cultivars of this perennial grain that would facilitate the sustainable intensification of agricultural systems.
Quick, Joshua; Grubaugh, Nathan D; Pullan, Steven T; Claro, Ingra M; Smith, Andrew D; Gangavarapu, Karthik; Oliveira, Glenn; Robles-Sikisaka, Refugio; Rogers, Thomas F; Beutler, Nathan A; Burton, Dennis R; Lewis-Ximenez, Lia Laura; de Jesus, Jaqueline Goes; Giovanetti, Marta; Hill, Sarah C; Black, Allison; Bedford, Trevor; Carroll, Miles W; Nunes, Marcio; Alcantara, Luiz Carlos; Sabino, Ester C; Baylis, Sally A; Faria, Nuno R; Loose, Matthew; Simpson, Jared T; Pybus, Oliver G; Andersen, Kristian G; Loman, Nicholas J
2017-06-01
Genome sequencing has become a powerful tool for studying emerging infectious diseases; however, genome sequencing directly from clinical samples (i.e., without isolation and culture) remains challenging for viruses such as Zika, for which metagenomic sequencing methods may generate insufficient numbers of viral reads. Here we present a protocol for generating coding-sequence-complete genomes, comprising an online primer design tool, a novel multiplex PCR enrichment protocol, optimized library preparation methods for the portable MinION sequencer (Oxford Nanopore Technologies) and the Illumina range of instruments, and a bioinformatics pipeline for generating consensus sequences. The MinION protocol does not require an Internet connection for analysis, making it suitable for field applications with limited connectivity. Our method relies on multiplex PCR for targeted enrichment of viral genomes from samples containing as few as 50 genome copies per reaction. Viral consensus sequences can be achieved in 1-2 d by starting with clinical samples and following a simple laboratory workflow. This method has been successfully used by several groups studying Zika virus evolution and is facilitating an understanding of the spread of the virus in the Americas. The protocol can be used to sequence other viral genomes using the online Primal Scheme primer designer software. It is suitable for sequencing either RNA or DNA viruses in the field during outbreaks or as an inexpensive, convenient method for use in the lab.
A Novel Mechanism of Latency in Matrix Metalloproteinases*
López-Pelegrín, Mar; Ksiazek, Miroslaw; Karim, Abdulkarim Y.; Guevara, Tibisay; Arolas, Joan L.; Potempa, Jan; Gomis-Rüth, F. Xavier
2015-01-01
The matrix metalloproteinases (MMPs) are a family of secreted soluble or membrane-anchored multimodular peptidases regularly found in several paralogous copies in animals and plants, where they have multiple functions. The minimal consensus domain architecture comprises a signal peptide, a 60–90-residue globular prodomain with a conserved sequence motif including a cysteine engaged in “cysteine-switch” or “Velcro” mediated latency, and a catalytic domain. Karilysin, from the human periodontopathogen Tannerella forsythia, is the only bacterial MMP to have been characterized biochemically to date. It shares with eukaryotic forms the catalytic domain but none of the flanking domains. Instead of the consensus MMP prodomain, it features a 14-residue propeptide, the shortest reported for a metallopeptidase, which lacks cysteines. Here we determined the structure of a prokarilysin fragment encompassing the propeptide and the catalytic domain, and found that the former runs across the cleft in the opposite direction to a bound substrate and inhibits the latter through an “aspartate-switch” mechanism. This finding is reminiscent of latency maintenance in the otherwise unrelated astacin and fragilysin metallopeptidase families. In addition, in vivo and biochemical assays showed that the propeptide contributes to protein folding and stability. Our analysis of prokarilysin reveals a novel mechanism of latency and activation in MMPs. Finally, our findings support the view that the karilysin catalytic domain was co-opted by competent bacteria through horizontal gene transfer from a eukaryotic source, and later evolved in a specific bacterial environment. PMID:25555916
Zhang, Zhenyi; Akyildiz, Senem; Xiao, Yafei; Gai, Zhongchao; An, Ying; Behrens, Jürgen; Wu, Geng
2015-01-01
The tumor suppressor APC employs its conserved armadillo repeat (ARM) domain to recognize many of its binding partners, including Amer1/WTX, which is mutated in Wilms' tumor and bone overgrowth syndrome. The APC–Amer1 complex has important roles in regulating Wnt signaling and cell adhesion. Three sites A1, A2, and A3 of Amer1 have been reported to mediate its interaction with APC-ARM. In this study, crystal structures of APC–ARM in complexes with Amer1-A1, -A2, and -A4, which is newly identified in this work, were determined. Combined with our GST pull-down, yeast two-hybrid, and isothermal titration calorimetry (ITC) assay results using mutants of APC and Amer1 interface residues, our structures demonstrate that Amer1-A1, -A2, and -A4, as well as other APC-binding proteins such as Asef and Sam68, all employ a common recognition pattern to associate with APC–ARM. In contrast, Amer1-A3 binds to the C-terminal side of APC–ARM through a bipartite interaction mode. Composite mutations on either APC or Amer1 disrupting all four interfaces abrogated their association in cultured cells and impaired the membrane recruitment of APC by Amer1. Our study thus comprehensively elucidated the recognition mechanism between APC and Amer1, and revealed a consensus recognition sequence employed by various APC–ARM binding partners. PMID:27462415
Zhang, Zhenyi; Akyildiz, Senem; Xiao, Yafei; Gai, Zhongchao; An, Ying; Behrens, Jürgen; Wu, Geng
2015-01-01
The tumor suppressor APC employs its conserved armadillo repeat (ARM) domain to recognize many of its binding partners, including Amer1/WTX, which is mutated in Wilms' tumor and bone overgrowth syndrome. The APC-Amer1 complex has important roles in regulating Wnt signaling and cell adhesion. Three sites A1, A2, and A3 of Amer1 have been reported to mediate its interaction with APC-ARM. In this study, crystal structures of APC-ARM in complexes with Amer1-A1, -A2, and -A4, which is newly identified in this work, were determined. Combined with our GST pull-down, yeast two-hybrid, and isothermal titration calorimetry (ITC) assay results using mutants of APC and Amer1 interface residues, our structures demonstrate that Amer1-A1, -A2, and -A4, as well as other APC-binding proteins such as Asef and Sam68, all employ a common recognition pattern to associate with APC-ARM. In contrast, Amer1-A3 binds to the C-terminal side of APC-ARM through a bipartite interaction mode. Composite mutations on either APC or Amer1 disrupting all four interfaces abrogated their association in cultured cells and impaired the membrane recruitment of APC by Amer1. Our study thus comprehensively elucidated the recognition mechanism between APC and Amer1, and revealed a consensus recognition sequence employed by various APC-ARM binding partners.
Forest, David; Nishikawa, Ryuhei; Kobayashi, Hiroshi; Parton, Angela; Bayne, Christopher J.; Barnes, David W.
2007-01-01
We have established a cartilaginous fish cell line [Squalus acanthias embryo cell line (SAE)], a mesenchymal stem cell line derived from the embryo of an elasmobranch, the spiny dogfish shark S. acanthias. Elasmobranchs (sharks and rays) first appeared >400 million years ago, and existing species provide useful models for comparative vertebrate cell biology, physiology, and genomics. Comparative vertebrate genomics among evolutionarily distant organisms can provide sequence conservation information that facilitates identification of critical coding and noncoding regions. Although these genomic analyses are informative, experimental verification of functions of genomic sequences depends heavily on cell culture approaches. Using ESTs defining mRNAs derived from the SAE cell line, we identified lengthy and highly conserved gene-specific nucleotide sequences in the noncoding 3′ UTRs of eight genes involved in the regulation of cell growth and proliferation. Conserved noncoding 3′ mRNA regions detected by using the shark nucleotide sequences as a starting point were found in a range of other vertebrate orders, including bony fish, birds, amphibians, and mammals. Nucleotide identity of shark and human in these regions was remarkably well conserved. Our results indicate that highly conserved gene sequences dating from the appearance of jawed vertebrates and representing potential cis-regulatory elements can be identified through the use of cartilaginous fish as a baseline. Because the expression of genes in the SAE cell line was prerequisite for their identification, this cartilaginous fish culture system also provides a physiologically valid tool to test functional hypotheses on the role of these ancient conserved sequences in comparative cell biology. PMID:17227856
Sequence conservation on the Y chromosome
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gibson, L.H.; Yang-Feng, L.; Lau, C.
The Y chromosome is present in all mammals and is considered to be essential to sex determination. Despite intense genomic research, only a few genes have been identified and mapped to this chromosome in humans. Several of them, such as SRY and ZFY, have been demonstrated to be conserved and Y-located in other mammals. In order to address the issue of sequence conservation on the Y chromosome, we performed fluorescence in situ hybridization (FISH) with DNA from a human Y cosmid library as a probe to study the Y chromosomes from other mammalian species. Total DNA from 3,000-4,500 cosmid poolsmore » were labeled with biotinylated-dUTP and hybridized to metaphase chromosomes. For human and primate preparations, human cot1 DNA was included in the hybridization mixture to suppress the hybridization from repeat sequences. FISH signals were detected on the Y chromosomes of human, gorilla, orangutan and baboon (Old World monkey) and were absent on those of squirrel monkey (New World monkey), Indian munjac, wood lemming, Chinese hamster, rat and mouse. Since sequence analysis suggested that specific genes, e.g. SRY and ZFY, are conserved between these two groups, the lack of detectable hybridization in the latter group implies either that conservation of the human Y sequences is limited to the Y chromosomes of the great apes and Old World monkeys, or that the size of the syntenic segment is too small to be detected under the resolution of FISH, or that homologeous sequences have undergone considerable divergence. Further studies with reduced hybridization stringency are currently being conducted. Our results provide some clues as to Y-sequence conservation across species and demonstrate the limitations of FISH across species with total DNA sequences from a particular chromosome.« less
Evolutionary and biophysical relationships among the papillomavirus E2 proteins.
Blakaj, Dukagjin M; Fernandez-Fuentes, Narcis; Chen, Zigui; Hegde, Rashmi; Fiser, Andras; Burk, Robert D; Brenowitz, Michael
2009-01-01
Infection by human papillomavirus (HPV) may result in clinical conditions ranging from benign warts to invasive cancer. The HPV E2 protein represses oncoprotein transcription and is required for viral replication. HPV E2 binds to palindromic DNA sequences of highly conserved four base pair sequences flanking an identical length variable 'spacer'. E2 proteins directly contact the conserved but not the spacer DNA. Variation in naturally occurring spacer sequences results in differential protein affinity that is dependent on their sensitivity to the spacer DNA's unique conformational and/or dynamic properties. This article explores the biophysical character of this core viral protein with the goal of identifying characteristics that associated with risk of virally caused malignancy. The amino acid sequence, 3d structure and electrostatic features of the E2 protein DNA binding domain are highly conserved; specific interactions with DNA binding sites have also been conserved. In contrast, the E2 protein's transactivation domain does not have extensive surfaces of highly conserved residues. Rather, regions of high conservation are localized to small surface patches. Implications to cancer biology are discussed.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 50 Wildlife and Fisheries 8 2010-10-01 2010-10-01 false Definitions. 600.750 Section 600.750 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND ATMOSPHERIC ADMINISTRATION.... Consensus means unanimous concurrence among the members on a Fishery Negotiation Panel established under...
Bradshaw, Charles Richard; Surendranath, Vineeth; Henschel, Robert; Mueller, Matthias Stefan; Habermann, Bianca Hermine
2011-03-10
Conserved domains in proteins are one of the major sources of functional information for experimental design and genome-level annotation. Though search tools for conserved domain databases such as Hidden Markov Models (HMMs) are sensitive in detecting conserved domains in proteins when they share sufficient sequence similarity, they tend to miss more divergent family members, as they lack a reliable statistical framework for the detection of low sequence similarity. We have developed a greatly improved HMMerThread algorithm that can detect remotely conserved domains in highly divergent sequences. HMMerThread combines relaxed conserved domain searches with fold recognition to eliminate false positive, sequence-based identifications. With an accuracy of 90%, our software is able to automatically predict highly divergent members of conserved domain families with an associated 3-dimensional structure. We give additional confidence to our predictions by validation across species. We have run HMMerThread searches on eight proteomes including human and present a rich resource of remotely conserved domains, which adds significantly to the functional annotation of entire proteomes. We find ∼4500 cross-species validated, remotely conserved domain predictions in the human proteome alone. As an example, we find a DNA-binding domain in the C-terminal part of the A-kinase anchor protein 10 (AKAP10), a PKA adaptor that has been implicated in cardiac arrhythmias and premature cardiac death, which upon stress likely translocates from mitochondria to the nucleus/nucleolus. Based on our prediction, we propose that with this HLH-domain, AKAP10 is involved in the transcriptional control of stress response. Further remotely conserved domains we discuss are examples from areas such as sporulation, chromosome segregation and signalling during immune response. The HMMerThread algorithm is able to automatically detect the presence of remotely conserved domains in proteins based on weak sequence similarity. Our predictions open up new avenues for biological and medical studies. Genome-wide HMMerThread domains are available at http://vm1-hmmerthread.age.mpg.de.
Bradshaw, Charles Richard; Surendranath, Vineeth; Henschel, Robert; Mueller, Matthias Stefan; Habermann, Bianca Hermine
2011-01-01
Conserved domains in proteins are one of the major sources of functional information for experimental design and genome-level annotation. Though search tools for conserved domain databases such as Hidden Markov Models (HMMs) are sensitive in detecting conserved domains in proteins when they share sufficient sequence similarity, they tend to miss more divergent family members, as they lack a reliable statistical framework for the detection of low sequence similarity. We have developed a greatly improved HMMerThread algorithm that can detect remotely conserved domains in highly divergent sequences. HMMerThread combines relaxed conserved domain searches with fold recognition to eliminate false positive, sequence-based identifications. With an accuracy of 90%, our software is able to automatically predict highly divergent members of conserved domain families with an associated 3-dimensional structure. We give additional confidence to our predictions by validation across species. We have run HMMerThread searches on eight proteomes including human and present a rich resource of remotely conserved domains, which adds significantly to the functional annotation of entire proteomes. We find ∼4500 cross-species validated, remotely conserved domain predictions in the human proteome alone. As an example, we find a DNA-binding domain in the C-terminal part of the A-kinase anchor protein 10 (AKAP10), a PKA adaptor that has been implicated in cardiac arrhythmias and premature cardiac death, which upon stress likely translocates from mitochondria to the nucleus/nucleolus. Based on our prediction, we propose that with this HLH-domain, AKAP10 is involved in the transcriptional control of stress response. Further remotely conserved domains we discuss are examples from areas such as sporulation, chromosome segregation and signalling during immune response. The HMMerThread algorithm is able to automatically detect the presence of remotely conserved domains in proteins based on weak sequence similarity. Our predictions open up new avenues for biological and medical studies. Genome-wide HMMerThread domains are available at http://vm1-hmmerthread.age.mpg.de. PMID:21423752
Brand, Luise H.; Fischer, Nina M.; Harter, Klaus; Kohlbacher, Oliver; Wanke, Dierk
2013-01-01
WRKY transcription factors constitute a large protein family in plants that is involved in the regulation of developmental processes and responses to biotic or abiotic stimuli. The question arises how stimulus-specific responses are mediated given that the highly conserved WRKY DNA-binding domain (DBD) exclusively recognizes the ‘TTGACY’ W-box consensus. We speculated that the W-box consensus might be more degenerate and yet undetected differences in the W-box consensus of WRKYs of different evolutionary descent exist. The phylogenetic analysis of WRKY DBDs suggests that they evolved from an ancestral group IIc-like WRKY early in the eukaryote lineage. A direct descent of group IIc WRKYs supports a monophyletic origin of all other group II and III WRKYs from group I by loss of an N-terminal DBD. Group I WRKYs are of paraphyletic descent and evolved multiple times independently. By homology modeling, molecular dynamics simulations and in vitro DNA–protein interaction-enzyme-linked immunosorbent assay with AtWRKY50 (IIc), AtWRKY33 (I) and AtWRKY11 (IId) DBDs, we revealed differences in DNA-binding specificities. Our data imply that other components are essentially required besides the W-box-specific binding to DNA to facilitate a stimulus-specific WRKY function. PMID:23975197
Expert consensus document: Advances in the evaluation of anorectal function.
Carrington, Emma V; Scott, S Mark; Bharucha, Adil; Mion, François; Remes-Troche, Jose M; Malcolm, Allison; Heinrich, Henriette; Fox, Mark; Rao, Satish S
2018-05-01
Faecal incontinence and evacuation disorders are common, impair quality of life and incur substantial economic costs worldwide. As symptoms alone are poor predictors of underlying pathophysiology and aetiology, diagnostic tests of anorectal function could facilitate patient management in those cases that are refractory to conservative therapies. In the past decade, several major technological advances have improved our understanding of anorectal structure, coordination and sensorimotor function. This Consensus Statement provides the reader with an appraisal of the current indications, study performance characteristics, clinical utility, strengths and limitations of the most widely available tests of anorectal structure (ultrasonography and MRI) and function (anorectal manometry, neurophysiological investigations, rectal distension techniques and tests of evacuation, including defecography). Additionally, this article provides our consensus on the clinical relevance of these tests.
Feltus, F A; Singh, H P; Lohithaswa, H C; Schulze, S R; Silva, T D; Paterson, A H
2006-04-01
Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species.
Feltus, F.A.; Singh, H.P.; Lohithaswa, H.C.; Schulze, S.R.; Silva, T.D.; Paterson, A.H.
2006-01-01
Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species. PMID:16607031
Rodriguez-Rivas, Juan; Marsili, Simone; Juan, David; Valencia, Alfonso
2016-01-01
Protein–protein interactions are fundamental for the proper functioning of the cell. As a result, protein interaction surfaces are subject to strong evolutionary constraints. Recent developments have shown that residue coevolution provides accurate predictions of heterodimeric protein interfaces from sequence information. So far these approaches have been limited to the analysis of families of prokaryotic complexes for which large multiple sequence alignments of homologous sequences can be compiled. We explore the hypothesis that coevolution points to structurally conserved contacts at protein–protein interfaces, which can be reliably projected to homologous complexes with distantly related sequences. We introduce a domain-centered protocol to study the interplay between residue coevolution and structural conservation of protein–protein interfaces. We show that sequence-based coevolutionary analysis systematically identifies residue contacts at prokaryotic interfaces that are structurally conserved at the interface of their eukaryotic counterparts. In turn, this allows the prediction of conserved contacts at eukaryotic protein–protein interfaces with high confidence using solely mutational patterns extracted from prokaryotic genomes. Even in the context of high divergence in sequence (the twilight zone), where standard homology modeling of protein complexes is unreliable, our approach provides sequence-based accurate information about specific details of protein interactions at the residue level. Selected examples of the application of prokaryotic coevolutionary analysis to the prediction of eukaryotic interfaces further illustrate the potential of this approach. PMID:27965389
Rodriguez-Rivas, Juan; Marsili, Simone; Juan, David; Valencia, Alfonso
2016-12-27
Protein-protein interactions are fundamental for the proper functioning of the cell. As a result, protein interaction surfaces are subject to strong evolutionary constraints. Recent developments have shown that residue coevolution provides accurate predictions of heterodimeric protein interfaces from sequence information. So far these approaches have been limited to the analysis of families of prokaryotic complexes for which large multiple sequence alignments of homologous sequences can be compiled. We explore the hypothesis that coevolution points to structurally conserved contacts at protein-protein interfaces, which can be reliably projected to homologous complexes with distantly related sequences. We introduce a domain-centered protocol to study the interplay between residue coevolution and structural conservation of protein-protein interfaces. We show that sequence-based coevolutionary analysis systematically identifies residue contacts at prokaryotic interfaces that are structurally conserved at the interface of their eukaryotic counterparts. In turn, this allows the prediction of conserved contacts at eukaryotic protein-protein interfaces with high confidence using solely mutational patterns extracted from prokaryotic genomes. Even in the context of high divergence in sequence (the twilight zone), where standard homology modeling of protein complexes is unreliable, our approach provides sequence-based accurate information about specific details of protein interactions at the residue level. Selected examples of the application of prokaryotic coevolutionary analysis to the prediction of eukaryotic interfaces further illustrate the potential of this approach.
Targeting Conserved Genes in Penicillium Species.
Peterson, Stephen W
2017-01-01
Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of dideoxynucleotide-labeled fragments or NGS. The sequences are compared to a database of validated isolates. Identification of species indicates the potential of the fungus to make particular mycotoxins.
Ali, S; Azfer, M A; Bashamboo, A; Mathur, P K; Malik, P K; Mathur, V B; Raha, A K; Ansari, S
1999-03-04
We have cloned and sequenced a 906bp EcoRI repeat DNA fraction from Rhinoceros unicornis genome. The contig pSS(R)2 is AT rich with 340 A (37.53%), 187 C (20.64%), 173 G (19.09%) and 206 T (22.74%). The sequence contains MALT box, NF-E1, Poly-A signal, lariat consensus sequences, TATA box, translational initiation sequences and several stop codons. Translation of the contig showed seven different types of protein motifs, among which, EGF-like domain cysteine pattern signatures and Bowman-Birk serine protease inhibitor family signatures were prominent. The presence of eukaryotic transcriptional elements, protein signatures and analysis of subset sequences in the 5' region from 1 to 165nt indicating coding potential (test code value=0.97) suggest possible regulatory and/or functional role(s) of these sequences in the rhino genome. Translation of the complementary strand from 906 to 706nt and 190 to 2nt showed proteins of more than 7kDa rich in non-polar residues. This suggests that pSS(R)2 is either a part of, or adjacent to, a functional gene. The contig contains mostly non-consecutive simple repeat units from 2 to 17nt with varying frequencies, of which four base motifs were found to be predominant. Zoo-blot hybridization revealed that pSS(R)2 sequences are unique to R. unicornis genome because they do not cross-hybridize, even with the genomic DNA of South African black rhino Diceros bicornis. Southern blot analysis of R. unicornis genomic DNA with pSS(R)2 and other synthetic oligo probes revealed a high level of genetic homogeneity, which was also substantiated by microsatellite associated sequence amplification (MASA). Owing to its uniqueness, the pSS(R)2 probe has a potential application in the area of conservation biology for unequivocal identification of horn or other body tissues of R. unicornis. The evolutionary aspect of this repeat fraction in the context of comparative genome analysis is discussed.
Tins, B; Cassar-Pullicino, V; Haddaway, M; Nachtrab, U
2012-01-01
Objectives The bulk of spinal imaging is still performed with conventional two-dimensional sequences. This study assesses the suitability of three-dimensional sampling perfection with application-optimised contrasts using a different flip angle evolutions (SPACE) sequence for routine spinal imaging. Methods 62 MRI examinations of the spine were evaluated by 2 examiners in consensus for the depiction of anatomy and presence of artefact. We noted pathologies that might be missed using the SPACE sequence only or the SPACE and a sagittal T1 weighted sequence. The reference standards were sagittal and axial T1 weighted and T2 weighted sequences. At a later date the evaluation was repeated by one of the original examiners and an additional examiner. Results There was good agreement of the single evaluations and consensus evaluation for the conventional sequences: κ>0.8, confidence interval (CI)>0.6–1.0. For the SPACE sequence, depiction of anatomy was very good for 84% of cases, with high interobserver agreement, but there was poor interobserver agreement for other cases. For artefact assessment of SPACE, κ=0.92, CI=0.92–1.0. The SPACE sequence was superior to conventional sequences for depiction of anatomy and artefact resistance. The SPACE sequence occasionally missed bone marrow oedema. In conjunction with sagittal T1 weighted sequences, no abnormality was missed. The isotropic SPACE sequence was superior to conventional sequences in imaging difficult anatomy such as in scoliosis and spondylolysis. Conclusion The SPACE sequence allows excellent assessment of anatomy owing to high spatial resolution and resistance to artefact. The sensitivity for bone marrow abnormalities is limited. PMID:22374284
Tins, B; Cassar-Pullicino, V; Haddaway, M; Nachtrab, U
2012-08-01
The bulk of spinal imaging is still performed with conventional two-dimensional sequences. This study assesses the suitability of three-dimensional sampling perfection with application-optimised contrasts using a different flip angle evolutions (SPACE) sequence for routine spinal imaging. 62 MRI examinations of the spine were evaluated by 2 examiners in consensus for the depiction of anatomy and presence of artefact. We noted pathologies that might be missed using the SPACE sequence only or the SPACE and a sagittal T(1) weighted sequence. The reference standards were sagittal and axial T(1) weighted and T(2) weighted sequences. At a later date the evaluation was repeated by one of the original examiners and an additional examiner. There was good agreement of the single evaluations and consensus evaluation for the conventional sequences: κ>0.8, confidence interval (CI)>0.6-1.0. For the SPACE sequence, depiction of anatomy was very good for 84% of cases, with high interobserver agreement, but there was poor interobserver agreement for other cases. For artefact assessment of SPACE, κ=0.92, CI=0.92-1.0. The SPACE sequence was superior to conventional sequences for depiction of anatomy and artefact resistance. The SPACE sequence occasionally missed bone marrow oedema. In conjunction with sagittal T(1) weighted sequences, no abnormality was missed. The isotropic SPACE sequence was superior to conventional sequences in imaging difficult anatomy such as in scoliosis and spondylolysis. The SPACE sequence allows excellent assessment of anatomy owing to high spatial resolution and resistance to artefact. The sensitivity for bone marrow abnormalities is limited.
Colinet, Anne-Sophie; Thines, Louise; Deschamps, Antoine; Flémal, Gaëlle; Demaegd, Didier; Morsomme, Pierre
2017-07-01
The UPF0016 family is a recently identified group of poorly characterized membrane proteins whose function is conserved through evolution and that are defined by the presence of 1 or 2 copies of the E-φ-G-D-[KR]-[TS] consensus motif in their transmembrane domain. We showed that 2 members of this family, the human TMEM165 and the budding yeast Gdt1p, are functionally related and are likely to form a new group of Ca 2+ transporters. Mutations in TMEM165 have been demonstrated to cause a new type of rare human genetic diseases denominated as Congenital Disorders of Glycosylation. Using site-directed mutagenesis, we generated 17 mutations in the yeast Golgi-localized Ca 2+ transporter Gdt1p. Single alanine substitutions were targeted to the highly conserved consensus motifs, 4 acidic residues localized in the central cytosolic loop, and the arginine at position 71. The mutants were screened in a yeast strain devoid of both the endogenous Gdt1p exchanger and Pmr1p, the Ca 2+ -ATPase of the Golgi apparatus. We show here that acidic and polar uncharged residues of the consensus motifs play a crucial role in calcium tolerance and calcium transport activity and are therefore likely to be architectural components of the cation binding site of Gdt1p. Importantly, we confirm the essential role of the E53 residue whose mutation in humans triggers congenital disorders of glycosylation. © 2017 John Wiley & Sons Ltd.
Nomiyama, H; Kuhara, S; Kukita, T; Otsuka, T; Sakaki, Y
1981-01-01
The 26S ribosomal RNA gene of Physarum polycephalum is interrupted by two introns, and we have previously determined the sequence of one of them (intron 1) (Nomiyama et al. Proc.Natl.Acad.Sci.USA 78, 1376-1380, 1981). In this study we sequenced the second intron (intron 2) of about 0.5 kb length and its flanking regions, and found that one nucleotide at each junction is identical in intron 1 and intron 2, though the junction regions share no other sequence homology. Comparison of the flanking exon sequences to E. coli 23S rRNA sequences shows that conserved sequences are interspersed with tracts having little homology. In particular, the region encompassing the intron 2 interruption site is highly conserved. The E. coli ribosomal protein L1 binding region is also conserved. Images PMID:6171776
Hall, L; Laird, J E; Craig, R K
1984-01-01
Nucleotide sequence analysis of cloned guinea-pig casein B cDNA sequences has identified two casein B variants related to the bovine and rat alpha s1 caseins. Amino acid homology was largely confined to the known bovine or predicted rat phosphorylation sites and within the 'signal' precursor sequence. Comparison of the deduced nucleotide sequence of the guinea-pig and rat alpha s1 casein mRNA species showed greater sequence conservation in the non-coding than in the coding regions, suggesting a functional and possibly regulatory role for the non-coding regions of casein mRNA. The results provide insight into the evolution of the casein genes, and raise questions as to the role of conserved nucleotide sequences within the non-coding regions of mRNA species. Images Fig. 1. PMID:6548375
Freudenberger, Nora; Meyer, Tina; Groitl, Peter; Dobner, Thomas; Schreiner, Sabrina
2018-02-15
Human adenoviruses (HAdV) are nonenveloped viruses containing a linear, double-stranded DNA genome surrounded by an icosahedral capsid. To allow proper viral replication, the genome is imported through the nuclear pore complex associated with viral core proteins. Until now, the role of these incoming virion proteins during the early phase of infection was poorly understood. The core protein V is speculated to bridge the core and the surrounding capsid. It binds the genome in a sequence-independent manner and localizes in the nucleus of infected cells, accumulating at nucleoli. Here, we show that protein V contains conserved SUMO conjugation motifs (SCMs). Mutation of these consensus motifs resulted in reduced SUMOylation of the protein; thus, protein V represents a novel target of the host SUMOylation machinery. To understand the role of protein V SUMO posttranslational modification during productive HAdV infection, we generated a replication-competent HAdV with SCM mutations within the protein V coding sequence. Phenotypic analyses revealed that these SCM mutations are beneficial for adenoviral replication. Blocking protein V SUMOylation at specific sites shifts the onset of viral DNA replication to earlier time points during infection and promotes viral gene expression. Simultaneously, the altered kinetics within the viral life cycle are accompanied by more efficient proteasomal degradation of host determinants and increased virus progeny production than that observed during wild-type infection. Taken together, our studies show that protein V SUMOylation reduces virus growth; hence, protein V SUMOylation represents an important novel aspect of the host antiviral strategy to limit virus replication and thereby points to potential intervention strategies. IMPORTANCE Many decades of research have revealed that HAdV structural proteins promote viral entry and mainly physical stability of the viral genome in the capsid. Our work over the last years showed that this concept needs expansion as the functions are more diverse. We showed that capsid protein VI regulates the antiviral response by modulation of the transcription factor Daxx during infection. Moreover, core protein VII interacts with SPOC1 restriction factor, which is beneficial for efficient viral gene expression. Here, we were able to show that core protein V also represents a novel substrate of the host SUMOylation machinery and contains several conserved SCMs; mutation of these consensus motifs reduced SUMOylation of the protein. Unexpectedly, we observed that introducing these mutations into HAdV promotes adenoviral replication. In conclusion, we offer novel insights into adenovirus core proteins and provide evidence that SUMOylation of HAdV factors regulates replication efficiency. Copyright © 2018 American Society for Microbiology.
Coronado, Liani; Liniger, Matthias; Muñoz-González, Sara; Postel, Alexander; Pérez, Lester Josue; Pérez-Simó, Marta; Perera, Carmen Laura; Frías-Lepoureau, Maria Teresa; Rosell, Rosa; Grundhoff, Adam; Indenbirken, Daniela; Alawi, Malik; Fischer, Nicole; Becher, Paul; Ruggli, Nicolas; Ganges, Llilianne
2017-03-01
In this study, we compared the virulence in weaner pigs of the Pinar del Rio isolate and the virulent Margarita strain. The latter caused the Cuban classical swine fever (CSF) outbreak of 1993. Our results showed that the Pinar del Rio virus isolated during an endemic phase is clearly of low virulence. We analysed the complete nucleotide sequence of the Pinar del Rio virus isolated after persistence in newborn piglets, as well as the genome sequence of the inoculum. The consensus genome sequence of the Pinar del Rio virus remained completely unchanged after 28days of persistent infection in swine. More importantly, a unique poly-uridine tract was discovered in the 3'UTR of the Pinar del Rio virus, which was not found in the Margarita virus or any other known CSFV sequences. Based on RNA secondary structure prediction, the poly-uridine tract results in a long single-stranded intervening sequence (SS) between the stem-loops I and II of the 3'UTR, without major changes in the stem- loop structures when compared to the Margarita virus. The possible implications of this novel insertion on persistence and attenuation remain to be investigated. In addition, comparison of the amino acid sequence of the viral proteins E rns , E1, E2 and p7 of the Margarita and Pinar del Rio viruses showed that all non-conservative amino acid substitutions acquired by the Pinar del Rio isolate clustered in E2, with two of them being located within the B/C domain. Immunisation and cross-neutralisation experiments in pigs and rabbits suggest differences between these two viruses, which may be attributable to the amino acid differences observed in E2. Altogether, these data provide fresh insights into viral molecular features which might be associated with the attenuation and adaptation of CSFV for persistence in the field. Copyright © 2017 Elsevier B.V. All rights reserved.
Gordon, Kacy L.; Arthur, Robert K.; Ruvinsky, Ilya
2015-01-01
Gene regulatory information guides development and shapes the course of evolution. To test conservation of gene regulation within the phylum Nematoda, we compared the functions of putative cis-regulatory sequences of four sets of orthologs (unc-47, unc-25, mec-3 and elt-2) from distantly-related nematode species. These species, Caenorhabditis elegans, its congeneric C. briggsae, and three parasitic species Meloidogyne hapla, Brugia malayi, and Trichinella spiralis, represent four of the five major clades in the phylum Nematoda. Despite the great phylogenetic distances sampled and the extensive sequence divergence of nematode genomes, all but one of the regulatory elements we tested are able to drive at least a subset of the expected gene expression patterns. We show that functionally conserved cis-regulatory elements have no more extended sequence similarity to their C. elegans orthologs than would be expected by chance, but they do harbor motifs that are important for proper expression of the C. elegans genes. These motifs are too short to be distinguished from the background level of sequence similarity, and while identical in sequence they are not conserved in orientation or position. Functional tests reveal that some of these motifs contribute to proper expression. Our results suggest that conserved regulatory circuitry can persist despite considerable turnover within cis elements. PMID:26020930
Comprehensively Surveying Structure and Function of RING Domains from Drosophila melanogaster
Wu, Yuehao; Wan, Fusheng; Huang, Chunhong; Jie, Kemin
2011-01-01
Using a complete set of RING domains from Drosophila melanogaster, all the solved RING domains and cocrystal structures of RING-containing ubiquitin-ligases (RING-E3) and ubiquitin-conjugating enzyme (E2) pairs, we analyzed RING domains structures from their primary to quarternary structures. The results showed that: i) putative orthologs of RING domains between Drosophila melanogaster and the human largely occur (118/139, 84.9%); ii) of the 118 orthologous pairs from Drosophila melanogaster and the human, 117 pairs (117/118, 99.2%) were found to retain entirely uniform domain architectures, only Iap2/Diap2 experienced evolutionary expansion of domain architecture; iii) 4 evolutionary structurally conserved regions (SCRs) are responsible for homologous folding of RING domains at the superfamily level; iv) besides the conserved Cys/His chelating zinc ions, 6 equivalent residues (4 hydrophobic and 2 polar residues) in the SCRs possess good-consensus and conservation- these 4 SCRs function in the structural positioning of 6 equivalent residues as determinants for RING-E3 catalysis; v) members of these RING proteins located nucleus, multiple subcellular compartments, membrane protein and mitochondrion are respectively 42 (42/139, 30.2%), 71 (71/139, 51.1%), 22 (22/139, 15.8%) and 4 (4/139, 2.9%); vi) CG15104 (Topors) and CG1134 (Mul1) in C3HC4, and CG3929 (Deltex) in C3H2C3 seem to display broader E2s binding profiles than other RING-E3s; vii) analyzing intermolecular interfaces of E2/RING-E3 complexes indicate that residues directly interacting with E2s are all from the SCRs in RING domains. Of the 6 residues, 2 hydrophobic ones contribute to constructing the conserved hydrophobic core, while the 2 hydrophobic and 2 polar residues directly participate in E2/RING-E3 interactions. Based on sequence and structural data, SCRs, conserved equivalent residues and features of intermolecular interfaces were extracted, highlighting the presence of a nucleus for RING domain fold and formation of catalytic core in which related residues and regions exhibit preferential evolutionary conservation. PMID:21912646
Scop3D: three-dimensional visualization of sequence conservation.
Vermeire, Tessa; Vermaere, Stijn; Schepens, Bert; Saelens, Xavier; Van Gucht, Steven; Martens, Lennart; Vandermarliere, Elien
2015-04-01
The integration of a protein's structure with its known sequence variation provides insight on how that protein evolves, for instance in terms of (changing) function or immunogenicity. Yet, collating the corresponding sequence variants into a multiple sequence alignment, calculating each position's conservation, and mapping this information back onto a relevant structure is not straightforward. We therefore built the Sequence Conservation on Protein 3D structure (scop3D) tool to perform these tasks automatically. The output consists of two modified PDB files in which the B-values for each position are replaced by the percentage sequence conservation, or the information entropy for each position, respectively. Furthermore, text files with absolute and relative amino acid occurrences for each position are also provided, along with snapshots of the protein from six distinct directions in space. The visualization provided by scop3D can for instance be used as an aid in vaccine development or to identify antigenic hotspots, which we here demonstrate based on an analysis of the fusion proteins of human respiratory syncytial virus and mumps virus. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Sequencing Needs for Viral Diagnostics
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gardner, S N; Lam, M; Mulakken, N J
2004-01-26
We built a system to guide decisions regarding the amount of genomic sequencing required to develop diagnostic DNA signatures, which are short sequences that are sufficient to uniquely identify a viral species. We used our existing DNA diagnostic signature prediction pipeline, which selects regions of a target species genome that are conserved among strains of the target (for reliability, to prevent false negatives) and unique relative to other species (for specificity, to avoid false positives). We performed simulations, based on existing sequence data, to assess the number of genome sequences of a target species and of close phylogenetic relatives (''nearmore » neighbors'') that are required to predict diagnostic signature regions that are conserved among strains of the target species and unique relative to other bacterial and viral species. For DNA viruses such as variola (smallpox), three target genomes provide sufficient guidance for selecting species-wide signatures. Three near neighbor genomes are critical for species specificity. In contrast, most RNA viruses require four target genomes and no near neighbor genomes, since lack of conservation among strains is more limiting than uniqueness. SARS and Ebola Zaire are exceptional, as additional target genomes currently do not improve predictions, but near neighbor sequences are urgently needed. Our results also indicate that double stranded DNA viruses are more conserved among strains than are RNA viruses, since in most cases there was at least one conserved signature candidate for the DNA viruses and zero conserved signature candidates for the RNA viruses.« less
Beccari, T; Hoade, J; Orlacchio, A; Stirling, J L
1992-01-01
cDNAs encoding the mouse beta-N-acetylhexosaminidase alpha-subunit were isolated from a mouse testis library. The longest of these (1.7 kb) was sequenced and showed 83% similarity with the human alpha-subunit cDNA sequence. The 5' end of the coding sequence was obtained from a genomic DNA clone. Alignment of the human and mouse sequences showed that all three putative N-glycosylation sites are conserved, but that the mouse alpha-subunit has an additional site towards the C-terminus. All eight cysteines in the human sequence are conserved in the mouse. There are an additional two cysteines in the mouse alpha-subunit signal peptide. All amino acids affected in Tay-Sachs-disease mutations are conserved in the mouse. Images Fig. 1. PMID:1379046
Rapid Multi-Locus Sequence Typing Using Microfluidic Biochips
2010-05-12
Sequence Types. The evolutionary history of all the B. cereus MLST concatenated Sequence Types (545 taxa, 2,394 nucleotide positions) was inferred using...the Neighbor-Joining method [28]. The bootstrap consensus tree inferred from 100 replicates was taken to represent the evolutionary history of the... Chlamydia (manuscript in preparation) and performed pilot studies on Staphylococcus aureus and Streptoccus pneumoniae (Data S4 and Text S2). Another potential
Kim, Bo Kyung; Lim, Seoung Ok; Park, Yun Gyu
2008-08-01
The cyclic adenosine monophosphate-response element (CRE)-transcription factor complex participates in the regulation of viral gene expression and pathologic processes caused by various viruses. The hepatitis B virus (HBV) enhancer I directs liver-specific transcription of viral genes and contains a CRE sequence (HBV-CRE); however, whether the HBV-CRE and CRE-binding protein (CREB) are required for the HBV life cycle remains to be determined. This study was designed to investigate the role of CREB in HBV replication and gene expression. Sequence-comparison analysis of 984 HBVs reported worldwide showed that the HBV-CRE sequence is highly conserved, indicating the possibility that it plays an important role in the HBV life cycle. The binding of CREB to the HBV-CRE site was markedly inhibited by oligonucleotides containing HBV-CRE and consensus CRE sequences in vitro and in vivo. The HBV promoter activity was demonstrated to be dependent upon the transactivation activity of CREB. Treatment with CRE decoy oligonucleotides reduced HBV promoter activity, and this was reversed by CREB overexpression. The levels of viral transcripts, DNA, and antigens were remarkably decreased in response to the overexpression of CREB mutants or treatment with the CRE decoy oligonucleotides, whereas enhancing CREB activity increased the levels of viral transcripts. In addition, introduction of a three-base mutation into the HBV-CRE led to a marked reduction in HBV messenger RNA synthesis. Taken together, our results demonstrate that both replication and gene expression of HBV require a functional CREB and HBV-CRE. We have also demonstrated that CRE decoy oligonucleotides and the overexpression of CREB mutants can effectively block the HBV life cycle, suggesting that interventions against CREB activity could provide a new avenue to treat HBV infection.
Guazzi, S; Pintonello, M L; Viganò, A; Boncinelli, E
1998-05-01
Vertebrate Hox and Otx genes encode homeodomain-containing transcription factors thought to transduce positional information along the body axis in the segmental portion of the trunk and in the rostral brain, respectively. Moreover, Hox and Otx2 genes show a complementary spatial regulation during embryogenesis. In this report, we show that a 1821-base pair (bp) upstream DNA fragment of the Otx2 gene is positively regulated by co-transfection with expression vectors for the human HOXB1, HOXB2, and HOXB3 proteins in an embryonal carcinoma cell line (NT2/D1) and that a shorter fragment of only 534 bp is able to drive this regulation. We also identified the HOXB1, HOXB2, and HOXB3 DNA-binding region on the 534-bp Otx2 genomic fragment using nuclear extracts from Hox-transfected COS cells and 12.5 days postcoitum mouse embryos or HOXB3 homeodomain-containing bacterial extracts. HOXB1, HOXB3, and nuclear extracts from 12.5 days postcoitum mouse embryos bind to a sequence containing two palindromic TAATTA sites, which bear four copies of the ATTA core sequence, a common feature of most HOM-C/HOX binding sites. HOXB2 protected an adjacent site containing a direct repeat of an ACTT sequence, quite divergent from the ATTA consensus. The region bound by the three homeoproteins is strikingly conserved through evolution and necessary (at least for HOXB1 and HOXB3) to mediate the up-regulation of the Otx2 transcription. Taken together, our data support the hypothesis that anteriorly expressed Hox genes might play a role in the refinement of the Otx2 early expression boundaries in vivo.
Yasmin, T; Nabi, A H M Nurun
2016-05-01
Ebola virus (EBV) has become a serious threat to public health. Different approaches were applied to predict continuous and discontinuous B cell epitopes as well as T cell epitopes from the sequence-based and available three-dimensional structural analyses of each protein of EBV. Peptides '(79) VPSATKRWGFRSGVPP(94) ' from GP1 and '(515) LHYWTTQDEGAAIGLA(530) ' from GP2 of Ebola were found to be the consensus peptidic sequences predicted as linear B cell epitope of which the latter contains a region (519) TTQDEG(524) that fulfilled all the criteria of accessibility, hydrophilicity, flexibility and beta turn region for becoming an ideal B cell epitope. Different nonamers as T cell epitopes were obtained that interacted with different numbers of MHC class I and class II alleles with a binding affinity of <100 nm. Interestingly, these alleles also bound to the MHC class I alleles mostly prevalent in African and South Asian regions. Of these, 'LANETTQAL' and 'FLYDRLAST' nonamers were predicted to be the most potent T cell epitopes and they, respectively, interacted with eight and twelve class I alleles that covered 63.79% and 54.16% of world population, respectively. These nonamers were found to be the core sequences of 15mer peptides that interacted with the most common class II allele, HLA-DRB1*01:01. They were further validated for their binding to specific class I alleles using docking technique. Thus, these predicted epitopes may be used as vaccine targets against EBV and can be validated in model hosts to verify their efficacy as vaccine. © 2016 The Foundation for the Scandinavian Journal of Immunology.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Van Coillie, E.; Fiten, P.; Van Damme, J.
1997-03-01
Monocyte chemotactic proteins (MCPs) form a subfamily of chemokines that recruit leukocytes to sites of inflammation and that may contribute to tumor-associated leukocyte infiltration and to the antiviral state against HIV infection. With the use of degenerate primers that were based on CC chemokine consensus sequences, the known MIP-1{alpha}/LD78{alpha}, MCP-1, and MCP-3 genes and the previously unidentified eotaxin and MCP-2 genes were isolated from a YAC contig from human chromosome 17q11.2. The amplified genomic MCP-2 fragment was used to isolate an MCP-2 cosmid from which the gene sequence was determined. The MCP-2 gene shares with the MCP-1 and MCP-3 genesmore » a conserved intron-exon structure and a coding nucleotide sequence homology of 77%. By Northern blot analysis the 1.0-kb MCP-2 mRNA was predominantly detectable in the small intestine, peripheral blood, heart, placenta, lung, skeletal muscle, ovary, colon, spinal cord, pancreas, and thymus. Transcripts of 1.5 and 2.4 kb were found in the testis, the small intestine, and the colon. The isolation of the MCP-2 gene from the chemokine contig localized it on YAC clones of chromosome 17q11.2, which also contain the eotaxin, MCP-1, MCP-3, and NCC-1/MCP-4 genes. The combination of using degenerate primer PCR and YACs illustrates that novel genes can efficiently be isolated from gene cluster contigs with less redundancy and effort than the isolation of novel ESTs. 42 refs., 5 figs., 2 tabs.« less
Cross-species inference of long non-coding RNAs greatly expands the ruminant transcriptome.
Bush, Stephen J; Muriuki, Charity; McCulloch, Mary E B; Farquhar, Iseabail L; Clark, Emily L; Hume, David A
2018-04-24
mRNA-like long non-coding RNAs (lncRNAs) are a significant component of mammalian transcriptomes, although most are expressed only at low levels, with high tissue-specificity and/or at specific developmental stages. Thus, in many cases lncRNA detection by RNA-sequencing (RNA-seq) is compromised by stochastic sampling. To account for this and create a catalogue of ruminant lncRNAs, we compared de novo assembled lncRNAs derived from large RNA-seq datasets in transcriptional atlas projects for sheep and goats with previous lncRNAs assembled in cattle and human. We then combined the novel lncRNAs with the sheep transcriptional atlas to identify co-regulated sets of protein-coding and non-coding loci. Few lncRNAs could be reproducibly assembled from a single dataset, even with deep sequencing of the same tissues from multiple animals. Furthermore, there was little sequence overlap between lncRNAs that were assembled from pooled RNA-seq data. We combined positional conservation (synteny) with cross-species mapping of candidate lncRNAs to identify a consensus set of ruminant lncRNAs and then used the RNA-seq data to demonstrate detectable and reproducible expression in each species. In sheep, 20 to 30% of lncRNAs were located close to protein-coding genes with which they are strongly co-expressed, which is consistent with the evolutionary origin of some ncRNAs in enhancer sequences. Nevertheless, most of the lncRNAs are not co-expressed with neighbouring protein-coding genes. Alongside substantially expanding the ruminant lncRNA repertoire, the outcomes of our analysis demonstrate that stochastic sampling can be partly overcome by combining RNA-seq datasets from related species. This has practical implications for the future discovery of lncRNAs in other species.
GeneSilico protein structure prediction meta-server.
Kurowski, Michal A; Bujnicki, Janusz M
2003-07-01
Rigorous assessments of protein structure prediction have demonstrated that fold recognition methods can identify remote similarities between proteins when standard sequence search methods fail. It has been shown that the accuracy of predictions is improved when refined multiple sequence alignments are used instead of single sequences and if different methods are combined to generate a consensus model. There are several meta-servers available that integrate protein structure predictions performed by various methods, but they do not allow for submission of user-defined multiple sequence alignments and they seldom offer confidentiality of the results. We developed a novel WWW gateway for protein structure prediction, which combines the useful features of other meta-servers available, but with much greater flexibility of the input. The user may submit an amino acid sequence or a multiple sequence alignment to a set of methods for primary, secondary and tertiary structure prediction. Fold-recognition results (target-template alignments) are converted into full-atom 3D models and the quality of these models is uniformly assessed. A consensus between different FR methods is also inferred. The results are conveniently presented on-line on a single web page over a secure, password-protected connection. The GeneSilico protein structure prediction meta-server is freely available for academic users at http://genesilico.pl/meta.
GeneSilico protein structure prediction meta-server
Kurowski, Michal A.; Bujnicki, Janusz M.
2003-01-01
Rigorous assessments of protein structure prediction have demonstrated that fold recognition methods can identify remote similarities between proteins when standard sequence search methods fail. It has been shown that the accuracy of predictions is improved when refined multiple sequence alignments are used instead of single sequences and if different methods are combined to generate a consensus model. There are several meta-servers available that integrate protein structure predictions performed by various methods, but they do not allow for submission of user-defined multiple sequence alignments and they seldom offer confidentiality of the results. We developed a novel WWW gateway for protein structure prediction, which combines the useful features of other meta-servers available, but with much greater flexibility of the input. The user may submit an amino acid sequence or a multiple sequence alignment to a set of methods for primary, secondary and tertiary structure prediction. Fold-recognition results (target-template alignments) are converted into full-atom 3D models and the quality of these models is uniformly assessed. A consensus between different FR methods is also inferred. The results are conveniently presented on-line on a single web page over a secure, password-protected connection. The GeneSilico protein structure prediction meta-server is freely available for academic users at http://genesilico.pl/meta. PMID:12824313
The sequence specificity of UV-induced DNA damage in a systematically altered DNA sequence.
Khoe, Clairine V; Chung, Long H; Murray, Vincent
2018-06-01
The sequence specificity of UV-induced DNA damage was investigated in a specifically designed DNA plasmid using two procedures: end-labelling and linear amplification. Absorption of UV photons by DNA leads to dimerisation of pyrimidine bases and produces two major photoproducts, cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). A previous study had determined that two hexanucleotide sequences, 5'-GCTC*AC and 5'-TATT*AA, were high intensity UV-induced DNA damage sites. The UV clone plasmid was constructed by systematically altering each nucleotide of these two hexanucleotide sequences. One of the main goals of this study was to determine the influence of single nucleotide alterations on the intensity of UV-induced DNA damage. The sequence 5'-GCTC*AC was designed to examine the sequence specificity of 6-4PPs and the highest intensity 6-4PP damage sites were found at 5'-GTTC*CC nucleotides. The sequence 5'-TATT*AA was devised to investigate the sequence specificity of CPDs and the highest intensity CPD damage sites were found at 5'-TTTT*CG nucleotides. It was proposed that the tetranucleotide DNA sequence, 5'-YTC*Y (where Y is T or C), was the consensus sequence for the highest intensity UV-induced 6-4PP adduct sites; while it was 5'-YTT*C for the highest intensity UV-induced CPD damage sites. These consensus tetranucleotides are composed entirely of consecutive pyrimidines and must have a DNA conformation that is highly productive for the absorption of UV photons. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.
Zhang, Fantao; Luo, Xiangdong; Zhou, Yi; Xie, Jiankun
2016-04-01
To identify drought stress-responsive conserved microRNA (miRNA) from Dongxiang wild rice (Oryza rufipogon Griff., DXWR) on a genome-wide scale, high-throughput sequencing technology was used to sequence libraries of DXWR samples, treated with and without drought stress. 505 conserved miRNAs corresponding to 215 families were identified. 17 were significantly down-regulated and 16 were up-regulated under drought stress. Stem-loop qRT-PCR revealed the same expression patterns as high-throughput sequencing, suggesting the accuracy of the sequencing result was high. Potential target genes of the drought-responsive miRNA were predicted to be involved in diverse biological processes. Furthermore, 16 miRNA families were first identified to be involved in drought stress response from plants. These results present a comprehensive view of the conserved miRNA and their expression patterns under drought stress for DXWR, which will provide valuable information and sequence resources for future basis studies.
NASA Astrophysics Data System (ADS)
Tang, Le; Zhu, Songling; Mastriani, Emilio; Fang, Xin; Zhou, Yu-Jie; Li, Yong-Guo; Johnston, Randal N.; Guo, Zheng; Liu, Gui-Rong; Liu, Shu-Lin
2017-03-01
Highly conserved short sequences help identify functional genomic regions and facilitate genomic annotation. We used Salmonella as the model to search the genome for evolutionarily conserved regions and focused on the tetranucleotide sequence CTAG for its potentially important functions. In Salmonella, CTAG is highly conserved across the lineages and large numbers of CTAG-containing short sequences fall in intergenic regions, strongly indicating their biological importance. Computer modeling demonstrated stable stem-loop structures in some of the CTAG-containing intergenic regions, and substitution of a nucleotide of the CTAG sequence would radically rearrange the free energy and disrupt the structure. The postulated degeneration of CTAG takes distinct patterns among Salmonella lineages and provides novel information about genomic divergence and evolution of these bacterial pathogens. Comparison of the vertically and horizontally transmitted genomic segments showed different CTAG distribution landscapes, with the genome amelioration process to remove CTAG taking place inward from both terminals of the horizontally acquired segment.
Laligné, C.; Klotz, C.; Garreau de Loubresse, N.; Lemullois, M.; Hori, M.; Laurent, F. X.; Papon, J. F.; Louis, B.; Cohen, J.; Koll, F.
2010-01-01
Centrioles, cilia, and flagella are ancestral conserved organelles of eukaryotic cells. Among the proteins identified in the proteomics of ciliary proteins in Paramecium, we focus here on a protein, Bug22p, previously detected by cilia and basal-body high-throughput studies but never analyzed per se. Remarkably, this protein is also present in plants, which lack centrioles and cilia. Bug22p sequence alignments revealed consensus positions that distinguish species with centrioles/cilia from plants. In Paramecium, antibody and green fluorescent protein (GFP) fusion labeling localized Bug22p in basal bodies and cilia, and electron microscopy immunolabeling refined the localization to the terminal plate of the basal bodies, the transition zone, and spots along the axoneme, preferentially between the membrane and the microtubules. RNA interference (RNAi) depletion of Bug22p provoked a strong decrease in swimming speed, followed by cell death after a few days. High-speed video microscopy and morphological analysis of Bug22p-depleted cells showed that the protein plays an important role in the efficiency of ciliary movement by participating in the stroke shape and rigidity of cilia. The defects in cell swimming and growth provoked by RNAi can be complemented by expression of human Bug22p. This is the first reported case of complementation by a human gene in a ciliate. PMID:20118210
Laligné, C; Klotz, C; de Loubresse, N Garreau; Lemullois, M; Hori, M; Laurent, F X; Papon, J F; Louis, B; Cohen, J; Koll, F
2010-04-01
Centrioles, cilia, and flagella are ancestral conserved organelles of eukaryotic cells. Among the proteins identified in the proteomics of ciliary proteins in Paramecium, we focus here on a protein, Bug22p, previously detected by cilia and basal-body high-throughput studies but never analyzed per se. Remarkably, this protein is also present in plants, which lack centrioles and cilia. Bug22p sequence alignments revealed consensus positions that distinguish species with centrioles/cilia from plants. In Paramecium, antibody and green fluorescent protein (GFP) fusion labeling localized Bug22p in basal bodies and cilia, and electron microscopy immunolabeling refined the localization to the terminal plate of the basal bodies, the transition zone, and spots along the axoneme, preferentially between the membrane and the microtubules. RNA interference (RNAi) depletion of Bug22p provoked a strong decrease in swimming speed, followed by cell death after a few days. High-speed video microscopy and morphological analysis of Bug22p-depleted cells showed that the protein plays an important role in the efficiency of ciliary movement by participating in the stroke shape and rigidity of cilia. The defects in cell swimming and growth provoked by RNAi can be complemented by expression of human Bug22p. This is the first reported case of complementation by a human gene in a ciliate.
Structural basis of gene regulation by the Grainyhead/CP2 transcription factor family
Ming, Qianqian; Roske, Yvette; Schuetz, Anja; Walentin, Katharina; Ibraimi, Ibraim; Schmidt-Ott, Kai M
2018-01-01
Abstract Grainyhead (Grh)/CP2 transcription factors are highly conserved in multicellular organisms as key regulators of epithelial differentiation, organ development and skin barrier formation. In addition, they have been implicated as being tumor suppressors in a variety of human cancers. Despite their physiological importance, little is known about their structure and DNA binding mode. Here, we report the first structural study of mammalian Grh/CP2 factors. Crystal structures of the DNA-binding domains of grainyhead-like (Grhl) 1 and Grhl2 reveal a closely similar conformation with immunoglobulin-like core. Both share a common fold with the tumor suppressor p53, but differ in important structural features. The Grhl1 DNA-binding domain binds duplex DNA containing the consensus recognition element in a dimeric arrangement, supporting parsimonious target-sequence selection through two conserved arginine residues. We elucidate the molecular basis of a cancer-related mutation in Grhl1 involving one of these arginines, which completely abrogates DNA binding in biochemical assays and transcriptional activation of a reporter gene in a human cell line. Thus, our studies establish the structural basis of DNA target-site recognition by Grh transcription factors and reveal how tumor-associated mutations inactivate Grhl proteins. They may serve as points of departure for the structure-based development of Grh/CP2 inhibitors for therapeutic applications. PMID:29309642
Structures of apo IRF-3 and IRF-7 DNA binding domains: effect of loop L1 on DNA binding
DOE Office of Scientific and Technical Information (OSTI.GOV)
De Ioannes, Pablo; Escalante, Carlos R.; Aggarwal, Aneel K.
2013-11-20
Interferon regulatory factors IRF-3 and IRF-7 are transcription factors essential in the activation of interferon-{beta} (IFN-{beta}) gene in response to viral infections. Although, both proteins recognize the same consensus IRF binding site AANNGAAA, they have distinct DNA binding preferences for sites in vivo. The X-ray structures of IRF-3 and IRF-7 DNA binding domains (DBDs) bound to IFN-{beta} promoter elements revealed flexibility in the loops (L1-L3) and the residues that make contacts with the target sequence. To characterize the conformational changes that occur on DNA binding and how they differ between IRF family members, we have solved the X-ray structures ofmore » IRF-3 and IRF-7 DBDs in the absence of DNA. We found that loop L1, carrying the conserved histidine that interacts with the DNA minor groove, is disordered in apo IRF-3 but is ordered in apo IRF-7. This is reflected in differences in DNA binding affinities when the conserved histidine in loop L1 is mutated to alanine in the two proteins. The stability of loop L1 in IRF-7 derives from a unique combination of hydrophobic residues that pack against the protein core. Together, our data show that differences in flexibility of loop L1 are an important determinant of differential IRF-DNA binding.« less
Event-triggered consensus tracking of multi-agent systems with Lur'e nonlinear dynamics
NASA Astrophysics Data System (ADS)
Huang, Na; Duan, Zhisheng; Wen, Guanghui; Zhao, Yu
2016-05-01
In this paper, distributed consensus tracking problem for networked Lur'e systems is investigated based on event-triggered information interactions. An event-triggered control algorithm is designed with the advantages of reducing controller update frequency and sensor energy consumption. By using tools of ?-procedure and Lyapunov functional method, some sufficient conditions are derived to guarantee that consensus tracking is achieved under a directed communication topology. Meanwhile, it is shown that Zeno behaviour of triggering time sequences is excluded for the proposed event-triggered rule. Finally, some numerical simulations on coupled Chua's circuits are performed to illustrate the effectiveness of the theoretical algorithms.
ERIC Educational Resources Information Center
Fyfe, Emily R.; DeCaro, Marci S.; Rittle-Johnson, Bethany
2014-01-01
Background: The sequencing of learning materials greatly influences the knowledge that learners construct. Recently, learning theorists have focused on the sequencing of instruction in relation to solving related problems. The general consensus suggests explicit instruction should be provided; however, when to provide instruction remains unclear.…
Sampled-Data Consensus of Linear Multi-agent Systems With Packet Losses.
Zhang, Wenbing; Tang, Yang; Huang, Tingwen; Kurths, Jurgen
In this paper, the consensus problem is studied for a class of multi-agent systems with sampled data and packet losses, where random and deterministic packet losses are considered, respectively. For random packet losses, a Bernoulli-distributed white sequence is used to describe packet dropouts among agents in a stochastic way. For deterministic packet losses, a switched system with stable and unstable subsystems is employed to model packet dropouts in a deterministic way. The purpose of this paper is to derive consensus criteria, such that linear multi-agent systems with sampled-data and packet losses can reach consensus. By means of the Lyapunov function approach and the decomposition method, the design problem of a distributed controller is solved in terms of convex optimization. The interplay among the allowable bound of the sampling interval, the probability of random packet losses, and the rate of deterministic packet losses are explicitly derived to characterize consensus conditions. The obtained criteria are closely related to the maximum eigenvalue of the Laplacian matrix versus the second minimum eigenvalue of the Laplacian matrix, which reveals the intrinsic effect of communication topologies on consensus performance. Finally, simulations are given to show the effectiveness of the proposed results.In this paper, the consensus problem is studied for a class of multi-agent systems with sampled data and packet losses, where random and deterministic packet losses are considered, respectively. For random packet losses, a Bernoulli-distributed white sequence is used to describe packet dropouts among agents in a stochastic way. For deterministic packet losses, a switched system with stable and unstable subsystems is employed to model packet dropouts in a deterministic way. The purpose of this paper is to derive consensus criteria, such that linear multi-agent systems with sampled-data and packet losses can reach consensus. By means of the Lyapunov function approach and the decomposition method, the design problem of a distributed controller is solved in terms of convex optimization. The interplay among the allowable bound of the sampling interval, the probability of random packet losses, and the rate of deterministic packet losses are explicitly derived to characterize consensus conditions. The obtained criteria are closely related to the maximum eigenvalue of the Laplacian matrix versus the second minimum eigenvalue of the Laplacian matrix, which reveals the intrinsic effect of communication topologies on consensus performance. Finally, simulations are given to show the effectiveness of the proposed results.
Examination of the catalytic fitness of the hammerhead ribozyme by in vitro selection.
Tang, J; Breaker, R R
1997-01-01
We have designed a self-cleaving ribozyme construct that is rendered inactive during preparative in vitro transcription by allosteric interactions with ATP. This allosteric ribozyme was constructed by joining a hammerhead domain to an ATP-binding RNA aptamer, thereby creating a ribozyme whose catalytic rate can be controlled by ATP. Upon purification by PAGE, the engineered ribozyme undergoes rapid self-cleavage when incubated in the absence of ATP. This strategy of "allosteric delay" was used to prepare intact hammerhead ribozymes that would otherwise self-destruct during transcription. Using a similar strategy, we have prepared a combinatorial pool of RNA in order to assess the catalytic fitness of ribozymes that carry the natural consensus sequence for the hammerhead. Using in vitro selection, this comprehensive RNA pool was screened for sequence variants of the hammerhead ribozyme that also display catalytic activity. We find that sequences that comprise the core of naturally occurring hammerhead dominate the population of selected RNAs, indicating that the natural consensus sequence of this ribozyme is optimal for catalytic function. PMID:9257650
Singh, Reema; Schilde, Christina; Schaap, Pauline
2016-11-17
Dictyostelia are a well-studied group of organisms with colonial multicellularity, which are members of the mostly unicellular Amoebozoa. A phylogeny based on SSU rDNA data subdivided all Dictyostelia into four major groups, but left the position of the root and of six group-intermediate taxa unresolved. Recent phylogenies inferred from 30 or 213 proteins from sequenced genomes, positioned the root between two branches, each containing two major groups, but lacked data to position the group-intermediate taxa. Since the positions of these early diverging taxa are crucial for understanding the evolution of phenotypic complexity in Dictyostelia, we sequenced six representative genomes of early diverging taxa. We retrieved orthologs of 47 housekeeping proteins with an average size of 890 amino acids from six newly sequenced and eight published genomes of Dictyostelia and unicellular Amoebozoa and inferred phylogenies from single and concatenated protein sequence alignments. Concatenated alignments of all 47 proteins, and four out of five subsets of nine concatenated proteins all produced the same consensus phylogeny with 100% statistical support. Trees inferred from just two out of the 47 proteins, individually reproduced the consensus phylogeny, highlighting that single gene phylogenies will rarely reflect correct species relationships. However, sets of two or three concatenated proteins again reproduced the consensus phylogeny, indicating that a small selection of genes suffices for low cost classification of as yet unincorporated or newly discovered dictyostelid and amoebozoan taxa by gene amplification. The multi-locus consensus phylogeny shows that groups 1 and 2 are sister clades in branch I, with the group-intermediate taxon D. polycarpum positioned as outgroup to group 2. Branch II consists of groups 3 and 4, with the group-intermediate taxon Polysphondylium violaceum positioned as sister to group 4, and the group-intermediate taxon Dictyostelium polycephalum branching at the base of that whole clade. Given the data, the approximately unbiased test rejects all alternative topologies favoured by SSU rDNA and individual proteins with high statistical support. The test also rejects monophyletic origins for the genera Acytostelium, Polysphondylium and Dictyostelium. The current position of Acytostelium ellipticum in the consensus phylogeny indicates that somatic cells were lost twice in Dictyostelia.
Edwards, W. Barry
2013-01-01
The aim of this study was to identify potential ligands of PSMA suitable for further development as novel PSMA-targeted peptides using phage display technology. The human PSMA protein was immobilized as a target followed by incubation with a 15-mer phage display random peptide library. After one round of prescreening and two rounds of screening, high-stringency screening at the third round of panning was performed to identify the highest affinity binders. Phages which had a specific binding activity to PSMA in human prostate cancer cells were isolated and the DNA corresponding to the 15-mers were sequenced to provide three consensus sequences: GDHSPFT, SHFSVGS and EVPRLSLLAVFL as well as other sequences that did not display consensus. Two of the peptide sequences deduced from DNA sequencing of binding phages, SHSFSVGSGDHSPFT and GRFLTGGTGRLLRIS were labeled with 5-carboxyfluorescein and shown to bind and co-internalize with PSMA on human prostate cancer cells by fluorescence microscopy. The high stringency requirements yielded peptides with affinities KD∼1 µM or greater which are suitable starting points for affinity maturation. While these values were less than anticipated, the high stringency did yield peptide sequences that apparently bound to different surfaces on PSMA. These peptide sequences could be the basis for further development of peptides for prostate cancer tumor imaging and therapy. PMID:23935860
Functionally conserved cis-regulatory elements of COL18A1 identified through zebrafish transgenesis.
Kague, Erika; Bessling, Seneca L; Lee, Josephine; Hu, Gui; Passos-Bueno, Maria Rita; Fisher, Shannon
2010-01-15
Type XVIII collagen is a component of basement membranes, and expressed prominently in the eye, blood vessels, liver, and the central nervous system. Homozygous mutations in COL18A1 lead to Knobloch Syndrome, characterized by ocular defects and occipital encephalocele. However, relatively little has been described on the role of type XVIII collagen in development, and nothing is known about the regulation of its tissue-specific expression pattern. We have used zebrafish transgenesis to identify and characterize cis-regulatory sequences controlling expression of the human gene. Candidate enhancers were selected from non-coding sequence associated with COL18A1 based on sequence conservation among mammals. Although these displayed no overt conservation with orthologous zebrafish sequences, four regions nonetheless acted as tissue-specific transcriptional enhancers in the zebrafish embryo, and together recapitulated the major aspects of col18a1 expression. Additional post-hoc computational analysis on positive enhancer sequences revealed alignments between mammalian and teleost sequences, which we hypothesize predict the corresponding zebrafish enhancers; for one of these, we demonstrate functional overlap with the orthologous human enhancer sequence. Our results provide important insight into the biological function and regulation of COL18A1, and point to additional sequences that may contribute to complex diseases involving COL18A1. More generally, we show that combining functional data with targeted analyses for phylogenetic conservation can reveal conserved cis-regulatory elements in the large number of cases where computational alignment alone falls short. Copyright 2009 Elsevier Inc. All rights reserved.
Sawada, Akihisa; Croom-Carter, Deborah; Kondo, Osamu; Yasui, Masahiro; Koyama-Sato, Maho; Inoue, Masami; Kawa, Keisei; Rickinson, Alan B; Tierney, Rosemary J
2011-05-01
Polymorphisms in Epstein-Barr virus (EBV) latent genes can identify virus strains from different human populations and individual strains within a population. An Asian EBV signature has been defined almost exclusively from Chinese viruses, with little information from other Asian countries. Here we sequenced polymorphic regions of the EBNA1, 2, 3A, 3B, 3C and LMP1 genes of 31 Japanese strains from control donors and EBV-associated T/NK-cell lymphoproliferative disease (T/NK-LPD) patients. Though identical to Chinese strains in their dominant EBNA1 and LMP1 alleles, Japanese viruses were subtly different at other loci. Thus, while Chinese viruses mainly fall into two families with strongly linked 'Wu' or 'Li' alleles at EBNA2 and EBNA3A/B/C, Japanese viruses all have the consensus Wu EBNA2 allele but fall into two families at EBNA3A/B/C. One family has variant Li-like sequences at EBNA3A and 3B and the consensus Li sequence at EBNA3C; the other family has variant Wu-like sequences at EBNA3A, variants of a low frequency Chinese allele 'Sp' at EBNA3B and a consensus Sp sequence at EBNA3C. Thus, EBNA3A/B/C allelotypes clearly distinguish Japanese from Chinese strains. Interestingly, most Japanese viruses also lack those immune-escape mutations in the HLA-A11 epitope-encoding region of EBNA3B that are so characteristic of viruses from the highly A11-positive Chinese population. Control donor-derived and T/NK-LPD-derived strains were similarly distributed across allelotypes and, by using allelic polymorphisms to track virus strains in patients pre- and post-haematopoietic stem-cell transplant, we show that a single strain can induce both T/NK-LPD and B-cell-lymphoproliferative disease in the same patient.
Coiled-coil length: Size does matter.
Surkont, Jaroslaw; Diekmann, Yoan; Ryder, Pearl V; Pereira-Leal, Jose B
2015-12-01
Protein evolution is governed by processes that alter primary sequence but also the length of proteins. Protein length may change in different ways, but insertions, deletions and duplications are the most common. An optimal protein size is a trade-off between sequence extension, which may change protein stability or lead to acquisition of a new function, and shrinkage that decreases metabolic cost of protein synthesis. Despite the general tendency for length conservation across orthologous proteins, the propensity to accept insertions and deletions is heterogeneous along the sequence. For example, protein regions rich in repetitive peptide motifs are well known to extensively vary their length across species. Here, we analyze length conservation of coiled-coils, domains formed by an ubiquitous, repetitive peptide motif present in all domains of life, that frequently plays a structural role in the cell. We observed that, despite the repetitive nature, the length of coiled-coil domains is generally highly conserved throughout the tree of life, even when the remaining parts of the protein change, including globular domains. Length conservation is independent of primary amino acid sequence variation, and represents a conservation of domain physical size. This suggests that the conservation of domain size is due to functional constraints. © 2015 Wiley Periodicals, Inc.
Magnetic resonance imaging in active surveillance—a modern approach
Moore, Caroline M.
2018-01-01
In recent years, active surveillance has been increasingly adopted as a conservative management approach to low and sometimes intermediate risk prostate cancer, to avoid or delay treatment until there is evidence of higher risk disease. A number of studies have investigated the role of multiparametric magnetic resonance imaging (mpMRI) in this setting. MpMRI refers to the use of multiple MRI sequences (T2-weighted anatomical and functional imaging which can include diffusion-weighted imaging, dynamic contrast enhanced imaging, spectroscopy). Each of the parameters investigates different aspects of the prostate gland (anatomy, cellularity, vascularity, etc.). In addition to a qualitative assessment, the radiologist can also extrapolate quantitative imaging biomarkers from these sequences, for example the apparent diffusion coefficient from diffusion-weighted imaging. There are many different types of articles (e.g., reviews, commentaries, consensus meetings, etc.) that address the use of mpMRI in men on active surveillance for prostate cancer. In this paper, we compare original articles that investigate the role of the different mpMRI sequences in men on active surveillance for prostate cancer, in order to discuss the relative utility of the different sequences, and combinations of sequences. We searched MEDLINE/PubMed for manuscripts published from inception to 1st December 2017. The search terms used were (prostate cancer or prostate adenocarcinoma or prostatic carcinoma or prostate carcinoma or prostatic adenocarcinoma) and (MRI or NMR or magnetic resonance imaging or mpMRI or multiparametric MRI) and active surveillance. Overall, 425 publications were found. All abstracts were reviewed to identify papers with original data. Twenty-five papers were analysed and summarised. Some papers based their analysis only on one mpMRI sequence, while others assessed two or more. The evidence from this review suggests that qualitative assessments and quantitative data from different mpMRI sequences hold promise in the management of men on active surveillance for prostate cancer. Both qualitative and quantitative approaches should be considered when assessing mpMRI of the prostate. There is a need for robust studies assessing the relative utility of different combinations of sequences in a systematic manner to determine the most efficient use of mpMRI in men on active surveillance. PMID:29594026
Protein Sectors: Statistical Coupling Analysis versus Conservation
Teşileanu, Tiberiu; Colwell, Lucy J.; Leibler, Stanislas
2015-01-01
Statistical coupling analysis (SCA) is a method for analyzing multiple sequence alignments that was used to identify groups of coevolving residues termed “sectors”. The method applies spectral analysis to a matrix obtained by combining correlation information with sequence conservation. It has been asserted that the protein sectors identified by SCA are functionally significant, with different sectors controlling different biochemical properties of the protein. Here we reconsider the available experimental data and note that it involves almost exclusively proteins with a single sector. We show that in this case sequence conservation is the dominating factor in SCA, and can alone be used to make statistically equivalent functional predictions. Therefore, we suggest shifting the experimental focus to proteins for which SCA identifies several sectors. Correlations in protein alignments, which have been shown to be informative in a number of independent studies, would then be less dominated by sequence conservation. PMID:25723535
Harraghy, Niamh; Homerova, Dagmar; Herrmann, Mathias; Kormanec, Jan
2008-01-01
Mapping the transcription start points of the eap, emp, and vwb promoters revealed a conserved octanucleotide sequence (COS). Deleting this sequence abolished the expression of eap, emp, and vwb. However, electrophoretic mobility shift assays gave no evidence that this sequence was a binding site for SarA or SaeR, known regulators of eap and emp.
Characterization of the heart transcriptome of the white shark (Carcharodon carcharias)
2013-01-01
Background The white shark (Carcharodon carcharias) is a globally distributed, apex predator possessing physical, physiological, and behavioral traits that have garnered it significant public attention. In addition to interest in the genetic basis of its form and function, as a representative of the oldest extant jawed vertebrate lineage, white sharks are also of conservation concern due to their small population size and threat from overfishing. Despite this, surprisingly little is known about the biology of white sharks, and genomic resources are unavailable. To address this deficit, we combined Roche-454 and Illumina sequencing technologies to characterize the first transciptome of any tissue for this species. Results From white shark heart cDNA we generated 665,399 Roche 454 reads (median length 387-bp) that were assembled into 141,626 contigs (mean length 503-bp). We also generated 78,566,588 Illumina reads, which we aligned to the 454 contigs producing 105,014 454/Illumina consensus sequences. To these, we added 3,432 non-singleton 454 contigs. By comparing these sequences to the UniProtKB/Swiss-Prot database we were able to annotate 21,019 translated open reading frames (ORFs) of ≥ 20 amino acids. Of these, 19,277 were additionally assigned Gene Ontology (GO) functional annotations. While acknowledging the limitations of our single tissue transcriptome, Fisher tests showed the white shark transcriptome to be significantly enriched for numerous metabolic GO terms compared to the zebra fish and human transcriptomes, with white shark showing more similarity to human than to zebra fish (i.e. fewer terms were significantly different). We also compared the transcriptome to other available elasmobranch sequences, for signatures of positive selection and identified several genes of putative adaptive significance on the white shark lineage. The white shark transcriptome also contained 8,404 microsatellites (dinucleotide, trinucleotide, or tetranucleotide motifs ≥ five perfect repeats). Detailed characterization of these microsatellites showed that ORFs with trinucleotide repeats, were significantly enriched for transcription regulatory roles and that trinucleotide frequency within ORFs was lower than for a wide range of taxonomic groups including other vertebrates. Conclusion The white shark heart transcriptome represents a valuable resource for future elasmobranch functional and comparative genomic studies, as well as for population and other biological studies vital for effective conservation of this globally vulnerable species. PMID:24112713
Characterization of the heart transcriptome of the white shark (Carcharodon carcharias).
Richards, Vincent P; Suzuki, Haruo; Stanhope, Michael J; Shivji, Mahmood S
2013-10-11
The white shark (Carcharodon carcharias) is a globally distributed, apex predator possessing physical, physiological, and behavioral traits that have garnered it significant public attention. In addition to interest in the genetic basis of its form and function, as a representative of the oldest extant jawed vertebrate lineage, white sharks are also of conservation concern due to their small population size and threat from overfishing. Despite this, surprisingly little is known about the biology of white sharks, and genomic resources are unavailable. To address this deficit, we combined Roche-454 and Illumina sequencing technologies to characterize the first transciptome of any tissue for this species. From white shark heart cDNA we generated 665,399 Roche 454 reads (median length 387-bp) that were assembled into 141,626 contigs (mean length 503-bp). We also generated 78,566,588 Illumina reads, which we aligned to the 454 contigs producing 105,014 454/Illumina consensus sequences. To these, we added 3,432 non-singleton 454 contigs. By comparing these sequences to the UniProtKB/Swiss-Prot database we were able to annotate 21,019 translated open reading frames (ORFs) of ≥ 20 amino acids. Of these, 19,277 were additionally assigned Gene Ontology (GO) functional annotations. While acknowledging the limitations of our single tissue transcriptome, Fisher tests showed the white shark transcriptome to be significantly enriched for numerous metabolic GO terms compared to the zebra fish and human transcriptomes, with white shark showing more similarity to human than to zebra fish (i.e. fewer terms were significantly different). We also compared the transcriptome to other available elasmobranch sequences, for signatures of positive selection and identified several genes of putative adaptive significance on the white shark lineage. The white shark transcriptome also contained 8,404 microsatellites (dinucleotide, trinucleotide, or tetranucleotide motifs ≥ five perfect repeats). Detailed characterization of these microsatellites showed that ORFs with trinucleotide repeats, were significantly enriched for transcription regulatory roles and that trinucleotide frequency within ORFs was lower than for a wide range of taxonomic groups including other vertebrates. The white shark heart transcriptome represents a valuable resource for future elasmobranch functional and comparative genomic studies, as well as for population and other biological studies vital for effective conservation of this globally vulnerable species.
Westbrook, Jared W.; Chhatre, Vikram E.; Wu, Le-Shin; Chamala, Srikar; Neves, Leandro Gomide; Muñoz, Patricio; Martínez-García, Pedro J.; Neale, David B.; Kirst, Matias; Mockaitis, Keithanne; Nelson, C. Dana; Peter, Gary F.; Echt, Craig S.
2015-01-01
A consensus genetic map for Pinus taeda (loblolly pine) and Pinus elliottii (slash pine) was constructed by merging three previously published P. taeda maps with a map from a pseudo-backcross between P. elliottii and P. taeda. The consensus map positioned 3856 markers via genotyping of 1251 individuals from four pedigrees. It is the densest linkage map for a conifer to date. Average marker spacing was 0.6 cM and total map length was 2305 cM. Functional predictions of mapped genes were improved by aligning expressed sequence tags used for marker discovery to full-length P. taeda transcripts. Alignments to the P. taeda genome mapped 3305 scaffold sequences onto 12 linkage groups. The consensus genetic map was used to compare the genome-wide linkage disequilibrium in a population of distantly related P. taeda individuals (ADEPT2) used for association genetic studies and a multiple-family pedigree used for genomic selection (CCLONES). The prevalence and extent of LD was greater in CCLONES as compared to ADEPT2; however, extended LD with LGs or between LGs was rare in both populations. The average squared correlations, r2, between SNP alleles less than 1 cM apart were less than 0.05 in both populations and r2 did not decay substantially with genetic distance. The consensus map and analysis of linkage disequilibrium establish a foundation for comparative association mapping and genomic selection in P. taeda and P. elliottii. PMID:26068575
Wang, Zheng Jia; Huang, Jian Qin; Huang, You Jun; Li, Zheng; Zheng, Bing Song
2012-08-01
Hickory (Carya cathayensis Sarg.) is an economically important woody plant in China, but its long juvenile phase delays yield. MicroRNAs (miRNAs) are critical regulators of genes and important for normal plant development and physiology, including flower development. We used Solexa technology to sequence two small RNA libraries from two floral differentiation stages in hickory to identify miRNAs related to flower development. We identified 39 conserved miRNA sequences from 114 loci belonging to 23 families as well as two novel and ten potential novel miRNAs belonging to nine families. Moreover, 35 conserved miRNA*s and two novel miRNA*s were detected. Twenty miRNA sequences from 49 loci belonging to 11 families were differentially expressed; all were up-regulated at the later stage of flower development in hickory. Quantitative real-time PCR of 12 conserved miRNA sequences, five novel miRNA families, and two novel miRNA*s validated that all were expressed during hickory flower development, and the expression patterns were similar to those detected with Solexa sequencing. Finally, a total of 146 targets of the novel and conserved miRNAs were predicted. This study identified a diverse set of miRNAs that were closely related to hickory flower development and that could help in plant floral induction.
Radford, Devon R; Leon-Velarde, Carlos G; Chen, Shu; Hamidi Oskouei, Amir M; Balamurugan, Sampathkumar
2018-03-29
The genomes of two strains of Salmonella enterica subsp. enterica serovar Cubana and serovar Muenchen, isolated from dry hazelnuts and chia seeds, respectively, were sequenced using the Illumina MiSeq platform, assembled de novo using the overlap-layout-consensus method, and aligned to their respective most identical sequence genome scaffolds using MUMMER and BLAST searches. Copyright © 2018 Radford et al.
2014-01-01
Background Next-generation DNA sequencing (NGS) technologies have made huge impacts in many fields of biological research, but especially in evolutionary biology. One area where NGS has shown potential is for high-throughput sequencing of complete mtDNA genomes (of humans and other animals). Despite the increasing use of NGS technologies and a better appreciation of their importance in answering biological questions, there remain significant obstacles to the successful implementation of NGS-based projects, especially for new users. Results Here we present an ‘A to Z’ protocol for obtaining complete human mitochondrial (mtDNA) genomes – from DNA extraction to consensus sequence. Although designed for use on humans, this protocol could also be used to sequence small, organellar genomes from other species, and also nuclear loci. This protocol includes DNA extraction, PCR amplification, fragmentation of PCR products, barcoding of fragments, sequencing using the 454 GS FLX platform, and a complete bioinformatics pipeline (primer removal, reference-based mapping, output of coverage plots and SNP calling). Conclusions All steps in this protocol are designed to be straightforward to implement, especially for researchers who are undertaking next-generation sequencing for the first time. The molecular steps are scalable to large numbers (hundreds) of individuals and all steps post-DNA extraction can be carried out in 96-well plate format. Also, the protocol has been assembled so that individual ‘modules’ can be swapped out to suit available resources. PMID:24460871
Evolutionary growth process of highly conserved sequences in vertebrate genomes.
Ishibashi, Minaka; Noda, Akiko Ogura; Sakate, Ryuichi; Imanishi, Tadashi
2012-08-01
Genome sequence comparison between evolutionarily distant species revealed ultraconserved elements (UCEs) among mammals under strong purifying selection. Most of them were also conserved among vertebrates. Because they tend to be located in the flanking regions of developmental genes, they would have fundamental roles in creating vertebrate body plans. However, the evolutionary origin and selection mechanism of these UCEs remain unclear. Here we report that UCEs arose in primitive vertebrates, and gradually grew in vertebrate evolution. We searched for UCEs in two teleost fishes, Tetraodon nigroviridis and Oryzias latipes, and found 554 UCEs with 100% identity over 100 bps. Comparison of teleost and mammalian UCEs revealed 43 pairs of common, jawed-vertebrate UCEs (jUCE) with high sequence identities, ranging from 83.1% to 99.2%. Ten of them retain lower similarities to the Petromyzon marinus genome, and the substitution rates of four non-exonic jUCEs were reduced after the teleost-mammal divergence, suggesting that robust conservation had been acquired in the jawed vertebrate lineage. Our results indicate that prototypical UCEs originated before the divergence of jawed and jawless vertebrates and have been frozen as perfect conserved sequences in the jawed vertebrate lineage. In addition, our comparative sequence analyses of UCEs and neighboring regions resulted in a discovery of lineage-specific conserved sequences. They were added progressively to prototypical UCEs, suggesting step-wise acquisition of novel regulatory roles. Our results indicate that conserved non-coding elements (CNEs) consist of blocks with distinct evolutionary history, each having been frozen since different evolutionary era along the vertebrate lineage. Copyright © 2012 Elsevier B.V. All rights reserved.
Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum
DOE Office of Scientific and Technical Information (OSTI.GOV)
C.A.Reddy, PI
2005-06-30
G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all themore » three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in other basidiomycete laccases are conserved in the LAC1 protein of G.lucidum. Eight putative N-glycosylation sites as well as consensus eukaryotic promoter sequence and polyadenylation signal sequences are also found. Coding sequence of lac4 is interrupted by 7 introns, encodes a mature protein of 525aa (Mr: 57,750), and has 98% nt homology to lac1, but was otherwise identical. Molecular masses of GLAC1 and GLAC4 were 49.8 kDa (462aa) and 52.5 kDa (524aa) in comparison to T. versicolr laccase which was 56.3 kDa (524aa). Predicted PI values of GLAC1, GLAC4 and T. versicolor laccase are, respectively 4.5, 4.7, and 4.2. Eight other laccase clones, distinct from lac1 and lac4 have recently been isolated from G. lucidum Our results show the existence of a laccase multi-gene family in G. lucidum in agreement with our earlier results showing multiple isoforms of laccase in this organism.« less
Investigating intra-host and intra-herd sequence diversity of foot-and-mouth disease virus.
King, David J; Freimanis, Graham L; Orton, Richard J; Waters, Ryan A; Haydon, Daniel T; King, Donald P
2016-10-01
Due to the poor-fidelity of the enzymes involved in RNA genome replication, foot-and-mouth disease (FMD) virus samples comprise of unique polymorphic populations. In this study, deep sequencing was utilised to characterise the diversity of FMD virus (FMDV) populations in 6 infected cattle present on a single farm during the series of outbreaks in the UK in 2007. A novel RT-PCR method was developed to amplify a 7.6kb nucleotide fragment encompassing the polyprotein coding region of the FMDV genome. Illumina sequencing of each sample identified the fine polymorphic structures at each nucleotide position, from consensus level changes to variants present at a 0.24% frequency. These data were used to investigate population dynamics of FMDV at both herd and host levels, evaluate the impact of host on the viral swarm structure and to identify transmission links with viruses recovered from other farms in the same series of outbreaks. In 7 samples, from 6 different animals, a total of 5 consensus level variants were identified, in addition to 104 sub-consensus variants of which 22 were shared between 2 or more animals. Further analysis revealed differences in swarm structures from samples derived from the same animal suggesting the presence of distinct viral populations evolving independently at different lesion sites within the same infected animal. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Rabinowitz, Mitchell; Latella, Lauren; Stern, Chadly; Jost, John T
2016-01-01
Several contagious diseases were nearly eradicated through childhood vaccination, but some parents have decided in recent years not to fully vaccinate their children, raising new public health concerns. The question of whether and how beliefs about vaccination are linked to political ideology has been hotly debated. This study investigates the effects of ideology on perceptions of harms and benefits related to vaccination as well as judgments of others' attitudes. A total of 367 U.S. adults (131 men, 236 women; Mage = 34.92 years, range = 18-72) completed an online survey through Mechanical Turk. Results revealed that liberals were significantly more likely to endorse pro-vaccination statements and to regard them as "facts" (rather than "beliefs"), in comparison with moderates and conservatives. Whereas conservatives overestimated the proportion of like-minded others who agreed with them, liberals underestimated the proportion of others who agreed with them. That is, conservatives exhibited the "truly false consensus effect," whereas liberals exhibited an "illusion of uniqueness" with respect to beliefs about vaccination. Conservative and moderate parents in this sample were less likely than liberals to report having fully vaccinated their children prior to the age of two. A clear limitation of this study is that the sample is not representative of the U.S. Nevertheless, a recognition of ideological sources of potential variability in health-related beliefs and perceptions is a prerequisite for the design of effective forms of public communication.
Latella, Lauren; Stern, Chadly; Jost, John T.
2016-01-01
Several contagious diseases were nearly eradicated through childhood vaccination, but some parents have decided in recent years not to fully vaccinate their children, raising new public health concerns. The question of whether and how beliefs about vaccination are linked to political ideology has been hotly debated. This study investigates the effects of ideology on perceptions of harms and benefits related to vaccination as well as judgments of others’ attitudes. A total of 367 U.S. adults (131 men, 236 women; Mage = 34.92 years, range = 18–72) completed an online survey through Mechanical Turk. Results revealed that liberals were significantly more likely to endorse pro-vaccination statements and to regard them as “facts” (rather than “beliefs”), in comparison with moderates and conservatives. Whereas conservatives overestimated the proportion of like-minded others who agreed with them, liberals underestimated the proportion of others who agreed with them. That is, conservatives exhibited the “truly false consensus effect,” whereas liberals exhibited an “illusion of uniqueness” with respect to beliefs about vaccination. Conservative and moderate parents in this sample were less likely than liberals to report having fully vaccinated their children prior to the age of two. A clear limitation of this study is that the sample is not representative of the U.S. population. Nevertheless, a recognition of ideological sources of potential variability in health-related beliefs and perceptions is a prerequisite for the design of effective forms of public communication. PMID:27391965
Jayashree, B; Jagadeesh, V T; Hoisington, D
2008-05-01
The availability of complete, annotated genomic sequence information in model organisms is a rich resource that can be extended to understudied orphan crops through comparative genomic approaches. We report here a software tool (cisprimertool) for the identification of conserved intron scanning regions using expressed sequence tag alignments to a completely sequenced model crop genome. The method used is based on earlier studies reporting the assessment of conserved intron scanning primers (called CISP) within relatively conserved exons located near exon-intron boundaries from onion, banana, sorghum and pearl millet alignments with rice. The tool is freely available to academic users at http://www.icrisat.org/gt-bt/CISPTool.htm. © 2007 ICRISAT.
Basu, Abhijit; Jain, Niyati; Tolbert, Blanton S.; Komar, Anton A.
2017-01-01
Abstract RNA–protein interactions with physiological outcomes usually rely on conserved sequences within the RNA element. By contrast, activity of the diverse gamma-interferon-activated inhibitor of translation (GAIT)-elements relies on the conserved RNA folding motifs rather than the conserved sequence motifs. These elements drive the translational silencing of a group of chemokine (CC/CXC) and chemokine receptor (CCR) mRNAs, thereby helping to resolve physiological inflammation. Despite sequence dissimilarity, these RNA elements adopt common secondary structures (as revealed by 2D-1H NMR spectroscopy), providing a basis for their interaction with the RNA-binding GAIT complex. However, many of these elements (e.g. those derived from CCL22, CXCL13, CCR4 and ceruloplasmin (Cp) mRNAs) have substantially different affinities for GAIT complex binding. Toeprinting analysis shows that different positions within the overall conserved GAIT element structure contribute to differential affinities of the GAIT protein complex towards the elements. Thus, heterogeneity of GAIT elements may provide hierarchical fine-tuning of the resolution of inflammation. PMID:29069516
Early Evolution of Conserved Regulatory Sequences Associated with Development in Vertebrates
McEwen, Gayle K.; Goode, Debbie K.; Parker, Hugo J.; Woolfe, Adam; Callaway, Heather; Elgar, Greg
2009-01-01
Comparisons between diverse vertebrate genomes have uncovered thousands of highly conserved non-coding sequences, an increasing number of which have been shown to function as enhancers during early development. Despite their extreme conservation over 500 million years from humans to cartilaginous fish, these elements appear to be largely absent in invertebrates, and, to date, there has been little understanding of their mode of action or the evolutionary processes that have modelled them. We have now exploited emerging genomic sequence data for the sea lamprey, Petromyzon marinus, to explore the depth of conservation of this type of element in the earliest diverging extant vertebrate lineage, the jawless fish (agnathans). We searched for conserved non-coding elements (CNEs) at 13 human gene loci and identified lamprey elements associated with all but two of these gene regions. Although markedly shorter and less well conserved than within jawed vertebrates, identified lamprey CNEs are able to drive specific patterns of expression in zebrafish embryos, which are almost identical to those driven by the equivalent human elements. These CNEs are therefore a unique and defining characteristic of all vertebrates. Furthermore, alignment of lamprey and other vertebrate CNEs should permit the identification of persistent sequence signatures that are responsible for common patterns of expression and contribute to the elucidation of the regulatory language in CNEs. Identifying the core regulatory code for development, common to all vertebrates, provides a foundation upon which regulatory networks can be constructed and might also illuminate how large conserved regulatory sequence blocks evolve and become fixed in genomic DNA. PMID:20011110
Barik, Suvakanta; SarkarDas, Shabari; Singh, Archita; Gautam, Vibhav; Kumar, Pramod; Majee, Manoj; Sarkar, Ananda K
2014-01-01
Similar to the majority of the microRNAs, mature miR166s are derived from multiple members of MIR166 genes (precursors) and regulate various aspects of plant development by negatively regulating their target genes (Class III HD-ZIP). The evolutionary conservation or functional diversification of miRNA166 family members remains elusive. Here, we show the phylogenetic relationships among MIR166 precursor and mature sequences from three diverse model plant species. Despite strong conservation, some mature miR166 sequences, such as ppt-miR166m, have undergone sequence variation. Critical sequence variation in ppt-miR166m has led to functional diversification, as it targets non-HD-ZIPIII gene transcript (s). MIR166 precursor sequences have diverged in a lineage specific manner, and both precursors and mature osa-miR166i/j are highly conserved. Interestingly, polycistronic MIR166s were present in Physcomitrella and Oryza but not in Arabidopsis. The nature of cis-regulatory motifs on the upstream promoter sequences of MIR166 genes indicates their possible contribution to the functional variation observed among miR166 species. Copyright © 2013 Elsevier Inc. All rights reserved.
Ajawatanawong, Pravech; Atkinson, Gemma C; Watson-Haigh, Nathan S; Mackenzie, Bryony; Baldauf, Sandra L
2012-07-01
Analyses of multiple sequence alignments generally focus on well-defined conserved sequence blocks, while the rest of the alignment is largely ignored or discarded. This is especially true in phylogenomics, where large multigene datasets are produced through automated pipelines. However, some of the most powerful phylogenetic markers have been found in the variable length regions of multiple alignments, particularly insertions/deletions (indels) in protein sequences. We have developed Sequence Feature and Indel Region Extractor (SeqFIRE) to enable the automated identification and extraction of indels from protein sequence alignments. The program can also extract conserved blocks and identify fast evolving sites using a combination of conservation and entropy. All major variables can be adjusted by the user, allowing them to identify the sets of variables most suited to a particular analysis or dataset. Thus, all major tasks in preparing an alignment for further analysis are combined in a single flexible and user-friendly program. The output includes a numbered list of indels, alignments in NEXUS format with indels annotated or removed and indel-only matrices. SeqFIRE is a user-friendly web application, freely available online at www.seqfire.org/.
ERIC Educational Resources Information Center
Morey, Candice C.; Miron, Monica D.
2016-01-01
Among models of working memory, there is not yet a consensus about how to describe functions specific to storing verbal or visual-spatial memories. We presented aural-verbal and visual-spatial lists simultaneously and sometimes cued one type of information after presentation, comparing accuracy in conditions with and without informative…
Homologues of insulinase, a new superfamily of metalloendopeptidases.
Rawlings, N D; Barrett, A J
1991-01-01
On the basis of a statistical analysis of an alignment of the amino acid sequences, a new superfamily of metalloendopeptidases is proposed, consisting of human insulinase, Escherichia coli protease III and mitochondrial processing endopeptidases from Saccharomyces and Neurospora. These enzymes do not contain the 'HEXXH' consensus sequence found in all previously recognized zinc metalloendopeptidases. PMID:2025223
50 CFR 600.758 - Preparation of report.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 50 Wildlife and Fisheries 8 2010-10-01 2010-10-01 false Preparation of report. 600.758 Section 600.758 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND ATMOSPHERIC... shall specify: (1) All the areas where consensus was reached by the FNP, including, if appropriate...
50 CFR 660.518 - Pacific Coast Treaty Indian Rights.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 50 Wildlife and Fisheries 9 2010-10-01 2010-10-01 false Pacific Coast Treaty Indian Rights. 660.518 Section 660.518 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND...(s) and, insofar as possible, with tribal consensus. [66 FR 44987, Aug. 27, 2001] ...
Common Viral Integration Sites Identified in Avian Leukosis Virus-Induced B-Cell Lymphomas
Justice, James F.; Morgan, Robin W.
2015-01-01
ABSTRACT Avian leukosis virus (ALV) induces B-cell lymphoma and other neoplasms in chickens by integrating within or near cancer genes and perturbing their expression. Four genes—MYC, MYB, Mir-155, and TERT—have previously been identified as common integration sites in these virus-induced lymphomas and are thought to play a causal role in tumorigenesis. In this study, we employ high-throughput sequencing to identify additional genes driving tumorigenesis in ALV-induced B-cell lymphomas. In addition to the four genes implicated previously, we identify other genes as common integration sites, including TNFRSF1A, MEF2C, CTDSPL, TAB2, RUNX1, MLL5, CXorf57, and BACH2. We also analyze the genome-wide ALV integration landscape in vivo and find increased frequency of ALV integration near transcriptional start sites and within transcripts. Previous work has shown ALV prefers a weak consensus sequence for integration in cultured human cells. We confirm this consensus sequence for ALV integration in vivo in the chicken genome. PMID:26670384
Ulloa, Mauricio; Hulse-Kemp, Amanda M; De Santiago, Luis M; Stelly, David M; Burke, John J
2017-01-01
High-density linkage maps are vital to supporting the correct placement of scaffolds and gene sequences on chromosomes and fundamental to contemporary organismal research and scientific approaches to genetic improvement, especially in paleopolyploids with exceptionally complex genomes, eg, upland cotton ( Gossypium hirsutum L., "2n = 52"). Three independently developed intraspecific upland mapping populations were analyzed to generate 3 high-density genetic linkage single-nucleotide polymorphism (SNP) maps and a consensus map using the CottonSNP63K array. The populations consisted of a previously reported F 2 , a recombinant inbred line (RIL), and reciprocal RIL population, from "Phytogen 72" and "Stoneville 474" cultivars. The cluster file provided 7417 genotyped SNP markers, resulting in 26 linkage groups corresponding to the 26 chromosomes (c) of the allotetraploid upland cotton (AD) 1 arisen from the merging of 2 genomes ("A" Old World and "D" New World). Patterns of chromosome-specific recombination were largely consistent across mapping populations. The high-density genetic consensus map included 7244 SNP markers that spanned 3538 cM and comprised 3824 SNP bins, of which 1783 and 2041 were in the A t and D t subgenomes with 1825 and 1713 cM map lengths, respectively. Subgenome average distances were nearly identical, indicating that subgenomic differences in bin number arose due to the high numbers of SNPs on the D t subgenome. Examination of expected recombination frequency or crossovers (COs) on the chromosomes within each population of the 2 subgenomes revealed that COs were also not affected by the SNPs or SNP bin number in these subgenomes. Comparative alignment analyses identified historical ancestral A t -subgenomic translocations of c02 and c03, as well as of c04 and c05. The consensus map SNP sequences aligned with high congruency to the NBI assembly of Gossypium hirsutum . However, the genomic comparisons revealed evidence of additional unconfirmed possible duplications, inversions and translocations, and unbalance SNP sequence homology or SNP sequence/loci genomic dominance, or homeolog loci bias of the upland tetraploid A t and D t subgenomes. The alignments indicated that 364 SNP-associated previously unintegrated scaffolds can be placed in pseudochromosomes of the NBI G hirsutum assembly. This is the first intraspecific SNP genetic linkage consensus map assembled in G hirsutum with a core of reproducible mendelian SNP markers assayed on different populations and it provides further knowledge of chromosome arrangement of genic and nongenic SNPs. Together, the consensus map and RIL populations provide a synergistically useful platform for localizing and identifying agronomically important loci for improvement of the cotton crop.
Zhang, Lin-Lin; Tan, Mei-Juan; Liu, Guang-Lei; Chi, Zhe; Wang, Guang-Yuan; Chi, Zhen-Ming
2015-04-01
The INU1 gene encoding an exo-inulinase from the marine-derived yeast Candida membranifaciens subsp. flavinogenie W14-3 was cloned and characterized. It had an open reading frame of 1,536 bp long encoding an inulinase. The coding region of it was not interrupted by any intron. The cloned gene encoded 512 amino acid residues of a protein with a putative signal peptide of 23 amino acids and a calculated molecular mass of 57.8 kDa. The protein sequence deduced from the inulinase gene contained the inulinase consensus sequences (WMNDPNGL), (RDP), ECP FS and Q. The protein also had six conserved putative N-glycosylation sites. The deduced inulinase from the yeast strain W14-3 was found to be closely related to that from Candida kutaonensis sp. nov. KRF1, Kluyveromyces marxianus, and Cryptococcus aureus G7a. The inulinase gene with its signal peptide encoding sequence was subcloned into the pMIRSC11 expression vector and expressed in Saccharomyces sp. W0. The recombinant yeast strain W14-3-INU-112 obtained could produce 16.8 U/ml of inulinase activity and 12.5 % (v/v) ethanol from 250 g/l of inulin within 168 h. The monosaccharides were detected after the hydrolysis of inulin with the crude inulinase (the yeast culture). All the results indicated that the cloned gene and the recombinant yeast strain W14-3-INU-112 had potential applications in biotechnology.
Identification of Novel Betaherpesviruses in Iberian Bats Reveals Parallel Evolution
Vázquez-Morón, Sonia; Aznar-López, Carolina; Ibáñez, Carlos; Garin, Inazio; Aihartza, Joxerra; Casas, Inmaculada; Tenorio, Antonio; Echevarría, Juan Emilio
2016-01-01
A thorough search for bat herpesviruses was carried out in oropharyngeal samples taken from most of the bat species present in the Iberian Peninsula from the Vespertilionidae, Miniopteridae, Molossidae and Rhinolophidae families, in addition to a colony of captive fruit bats from the Pteropodidae family. By using two degenerate consensus PCR methods targeting two conserved genes, distinct and previously unrecognized bat-hosted herpesviruses were identified for the most of the tested species. All together a total of 42 potentially novel bat herpesviruses were partially characterized. Thirty-two of them were tentatively assigned to the Betaherpesvirinae subfamily while the remaining 10 were allocated into the Gammaherpesvirinae subfamily. Significant diversity was observed among the novel sequences when compared with type herpesvirus species of the ICTV-approved genera. The inferred phylogenetic relationships showed that most of the betaherpesviruses sequences fell into a well-supported unique monophyletic clade and support the recognition of a new betaherpesvirus genus. This clade is subdivided into three major clades, corresponding to the families of bats studied. This supports the hypothesis of a species-specific parallel evolution process between the potentially new betaherpesviruses and their bat hosts. Interestingly, two of the betaherpesviruses’ sequences detected in rhinolophid bats clustered together apart from the rest, closely related to viruses that belong to the Roseolovirus genus. This suggests a putative third roseolo lineage. On the contrary, no phylogenetic structure was detected among several potentially novel bat-hosted gammaherpesviruses found in the study. Remarkably, all of the possible novel bat herpesviruses described in this study are linked to a unique bat species. PMID:28036408
Selection of cholera toxin specific IgNAR single-domain antibodies from a naïve shark library.
Liu, Jinny L; Anderson, George P; Delehanty, James B; Baumann, Richard; Hayhurst, Andrew; Goldman, Ellen R
2007-03-01
Shark immunoglobulin new antigen receptor (IgNAR, also referred to as NAR) variable domains (Vs) are single-domain antibody (sdAb) fragments containing only two hypervariable loop structures forming 3D topologies for a wide range of antigen recognition and binding. Their small size ( approximately 12kDa) and high solubility, thermostability and binding specificity make IgNARs an exceptional alternative source of engineered antibodies for sensor applications. Here, two new shark NAR V display libraries containing >10(7) unique clones from non-immunized (naïve) adult spiny dogfish (Squalus acanthias) and smooth dogfish (Mustelus canis) sharks were constructed. The most conserved consensus sequences derived from random clone sequence were compared with published nurse shark (Ginglymostoma cirratum) sequences. Cholera toxin (CT) was chosen for panning one of the naïve display libraries due to its severe pathogenicity and commercial availability. Three very similar CT binders were selected and purified soluble monomeric anti-CT sdAbs were characterized using Luminex(100) and traditional ELISA assays. These novel anti-CT sdAbs selected from our newly constructed shark NAR V sdAb library specifically bound to soluble antigen, without cross reacting with other irrelevant antigens. They also showed superior heat stability, exhibiting slow loss of activity over the course of one hour at high temperature (95 degrees C), while conventional antibodies lost all activity in the first 5-10min. The successful isolation of target specific sdAbs from one of our non-biased NAR libraries, demonstrate their ability to provide binders against an unacquainted antigen of interest.
Congenital analbuminemia caused by a novel aberrant splicing in the albumin gene
Caridi, Gianluca; Dagnino, Monica; Erdeve, Omer; Di Duca, Marco; Yildiz, Duran; Alan, Serdar; Atasay, Begum; Arsan, Saadet; Campagnoli, Monica; Galliano, Monica; Minchiotti, Lorenzo
2014-01-01
Introduction: Congenital analbuminemia is a rare autosomal recessive disorder manifested by the presence of a very low amount of circulating serum albumin. It is an allelic heterogeneous defect, caused by variety of mutations within the albumin gene in homozygous or compound heterozygous state. Herein we report the clinical and molecular characterization of a new case of congenital analbuminemia diagnosed in a female newborn of consanguineous (first degree cousins) parents from Ankara, Turkey, who presented with a low albumin concentration (< 8 g/L) and severe clinical symptoms. Materials and methods: The albumin gene of the index case was screened by single-strand conformation polymorphism, heteroduplex analysis, and direct DNA sequencing. The effect of the splicing mutation was evaluated by examining the cDNA obtained by reverse transcriptase - polymerase chain reaction (RT-PCR) from the albumin mRNA extracted from proband’s leukocytes. Results: DNA sequencing revealed that the proband is homozygous, and both parents are heterozygous, for a novel G>A transition at position c.1652+1, the first base of intron 12, which inactivates the strongly conserved GT dinucleotide at the 5′ splice site consensus sequence of this intron. The splicing defect results in the complete skipping of the preceding exon (exon 12) and in a frame-shift within exon 13 with a premature stop codon after the translation of three mutant amino acid residues. Conclusions: Our results confirm the clinical diagnosis of congenital analbuminemia in the proband and the inheritance of the trait and contribute to shed light on the molecular genetics of analbuminemia. PMID:24627724
Scammell, Jonathan G.; Funkhouser, Jane D.; Moyer, Felricia S.; Gibson, Susan V.; Willis, Donna L.
2008-01-01
The goal of this study was to characterize the gonadotropins expressed in pituitary glands of the New World squirrel monkey (Saimiri sp.) and owl monkey (Aotus sp.). The various subunits were amplified from total RNA from squirrel monkey and owl monkey pituitary glands by reverse transcription-polymerase chain reaction and the deduced amino acid sequences compared to those of other species. Mature squirrel monkey and owl monkey glycoprotein hormone α-polypeptides (96 amino acids in length) were determined to be 80% homologous to the human sequence. The sequences of mature β subunits of follicle stimulating hormone (FSHβ) from squirrel monkey and owl monkey (111 amino acids in length) are 92% homologous to human FSHβ. New World primate glycoprotein hormone α-polypeptides and FSHβ subunits showed conservation of all cysteine residues and consensus N-linked glycosylation sites. Attempts to amplify the β-subunit of luteinizing hormone from squirrel monkey and owl monkey pituitary glands were unsuccessful. Rather, the β-subunit of chorionic gonadotropin (CG) was amplified from pituitaries of both New World primates. Squirrel monkey and owl monkey CGβ are 143 and 144 amino acids in length and 77% homologous with human CGβ. The greatest divergence is in the C terminus, where all four sites for O-linked glycosylation in human CGβ, responsible for delayed metabolic clearance, are predicted to be absent in New World primate CGβs. It is likely that CG secreted from pituitary of New World primates exhibits a relatively short half-life compared to human CG. PMID:17897645
Scammell, Jonathan G; Funkhouser, Jane D; Moyer, Felricia S; Gibson, Susan V; Willis, Donna L
2008-02-01
The goal of this study was to characterize the gonadotropins expressed in pituitary glands of the New World squirrel monkey (Saimiri sp.) and owl monkey (Aotus sp.). The various subunits were amplified from total RNA from squirrel monkey and owl monkey pituitary glands by reverse transcription-polymerase chain reaction and the deduced amino acid sequences compared to those of other species. Mature squirrel monkey and owl monkey glycoprotein hormone alpha-polypeptides (96 amino acids in length) were determined to be 80% homologous to the human sequence. The sequences of mature beta subunits of follicle stimulating hormone (FSHbeta) from squirrel monkey and owl monkey (111 amino acids in length) are 92% homologous to human FSHbeta. New World primate glycoprotein hormone alpha-polypeptides and FSHbeta subunits showed conservation of all cysteine residues and consensus N-linked glycosylation sites. Attempts to amplify the beta-subunit of luteinizing hormone from squirrel monkey and owl monkey pituitary glands were unsuccessful. Rather, the beta-subunit of chorionic gonadotropin (CG) was amplified from pituitaries of both New World primates. Squirrel monkey and owl monkey CGbeta are 143 and 144 amino acids in length and 77% homologous with human CGbeta. The greatest divergence is in the C terminus, where all four sites for O-linked glycosylation in human CGbeta, responsible for delayed metabolic clearance, are predicted to be absent in New World primate CGbetas. It is likely that CG secreted from pituitary of New World primates exhibits a relatively short half-life compared to human CG.
Plus and minus RNAs of peach latent mosaic viroid self-cleave in vitro via hammerhead structures.
Hernández, C; Flores, R
1992-01-01
Peach latent mosaic viroid (PLMVd), the causal agent of peach latent mosaic disease, has been sequenced and found to be a circular RNA molecule of 337 nucleotide residues, which adopts a branched conformation when it is folded in the model of lowest free energy. PLMVd exhibits limited homologies with other viroids and some satellite RNAs, but it does not have any of the central conserved sequences characteristic of the subgroups of typical viroids. However, a segment of approximately one-third of the PLMVd sequence has the elements required to form in the RNAs of both polarities the hammerhead structures proposed to act in the in vitro self-cleavage of avocado sunblotch viroid (ASBVd) and some satellite RNAs. Plus and minus partial- and full-length RNA transcripts of PLMVd containing the hammerhead structures displayed self-cleavage during transcription and after purification as predicted by these structures. These data are consistent with the high stability of the PLMVd hammerhead structures, more similar to the corresponding structures of some satellite RNAs than to those of ASBVd, and indicate that the self-cleavage reactions of PLMVd are most probably mediated by single hammerhead structures. Our results support the inclusion of PLMVd in a viroid subgroup represented by ASBVd, whose members are characterized by their ability to self-cleave in vitro, and probably in vivo, through hammerhead structures. A consensus phylogenetic tree has been obtained suggesting that PLMVd, together with ASBVd, may represent an evolutionary link between viroids and viroid-like satellite RNAs. Images PMID:1373888
Simonini, Sara; Roig-Villanova, Irma; Gregis, Veronica; Colombo, Bilitis; Colombo, Lucia; Kater, Martin M.
2012-01-01
BASIC PENTACYSTEINE (BPC) transcription factors have been identified in a large variety of plant species. In Arabidopsis thaliana there are seven BPC genes, which, except for BPC5, are expressed ubiquitously. BPC genes are functionally redundant in a wide range of developmental processes. Recently, we reported that BPC1 binds to guanine and adenine (GA)–rich consensus sequences in the SEEDSTICK (STK) promoter in vitro and induces conformational changes. Here we show by chromatin immunoprecipitation experiments that in vivo BPCs also bind to the consensus boxes, and when these were mutated, expression from the STK promoter was derepressed, resulting in ectopic expression in the inflorescence. We also reveal that SHORT VEGETATIVE PHASE (SVP) is a direct regulator of STK. SVP is a floral meristem identity gene belonging to the MADS box gene family. The SVP-APETALA1 (AP1) dimer recruits the SEUSS (SEU)-LEUNIG (LUG) transcriptional cosuppressor to repress floral homeotic gene expression in the floral meristem. Interestingly, we found that GA consensus sequences in the STK promoter to which BPCs bind are essential for recruitment of the corepressor complex to this promoter. Our data suggest that we have identified a new regulatory mechanism controlling plant gene expression that is probably generally used, when considering BPCs’ wide expression profile and the frequent presence of consensus binding sites in plant promoters. PMID:23054472
Principles of regulatory information conservation between mouse and human.
Cheng, Yong; Ma, Zhihai; Kim, Bong-Hyun; Wu, Weisheng; Cayting, Philip; Boyle, Alan P; Sundaram, Vasavi; Xing, Xiaoyun; Dogan, Nergiz; Li, Jingjing; Euskirchen, Ghia; Lin, Shin; Lin, Yiing; Visel, Axel; Kawli, Trupti; Yang, Xinqiong; Patacsil, Dorrelyn; Keller, Cheryl A; Giardine, Belinda; Kundaje, Anshul; Wang, Ting; Pennacchio, Len A; Weng, Zhiping; Hardison, Ross C; Snyder, Michael P
2014-11-20
To broaden our understanding of the evolution of gene regulation mechanisms, we generated occupancy profiles for 34 orthologous transcription factors (TFs) in human-mouse erythroid progenitor, lymphoblast and embryonic stem-cell lines. By combining the genome-wide transcription factor occupancy repertoires, associated epigenetic signals, and co-association patterns, here we deduce several evolutionary principles of gene regulatory features operating since the mouse and human lineages diverged. The genomic distribution profiles, primary binding motifs, chromatin states, and DNA methylation preferences are well conserved for TF-occupied sequences. However, the extent to which orthologous DNA segments are bound by orthologous TFs varies both among TFs and with genomic location: binding at promoters is more highly conserved than binding at distal elements. Notably, occupancy-conserved TF-occupied sequences tend to be pleiotropic; they function in several tissues and also co-associate with many TFs. Single nucleotide variants at sites with potential regulatory functions are enriched in occupancy-conserved TF-occupied sequences.
Modeling repetitive, non‐globular proteins
Basu, Koli; Campbell, Robert L.; Guo, Shuaiqi; Sun, Tianjun
2016-01-01
Abstract While ab initio modeling of protein structures is not routine, certain types of proteins are more straightforward to model than others. Proteins with short repetitive sequences typically exhibit repetitive structures. These repetitive sequences can be more amenable to modeling if some information is known about the predominant secondary structure or other key features of the protein sequence. We have successfully built models of a number of repetitive structures with novel folds using knowledge of the consensus sequence within the sequence repeat and an understanding of the likely secondary structures that these may adopt. Our methods for achieving this success are reviewed here. PMID:26914323
Hunting down the chimera of multiple disciplinarity in conservation science.
Pooley, Simon P; Mendelsohn, J Andrew; Milner-Gulland, E J
2014-02-01
The consensus is that both ecological and social factors are essential dimensions of conservation research and practice. However, much of the literature on multiple disciplinary collaboration focuses on the difficulties of undertaking it. This review of the challenges of conducting multiple disciplinary collaboration offers a framework for thinking about the diversity and complexity of this endeavor. We focused on conceptual challenges, of which 5 main categories emerged: methodological challenges, value judgments, theories of knowledge, disciplinary prejudices, and interdisciplinary communication. The major problems identified in these areas have proved remarkably persistent in the literature surveyed (c.1960-2012). Reasons for these failures to learn from past experience include the pressure to produce positive outcomes and gloss over disagreements, the ephemeral nature of many such projects and resulting lack of institutional memory, and the apparent complexity and incoherence of the endeavor. We suggest that multiple disciplinary collaboration requires conceptual integration among carefully selected multiple disciplinary team members united in investigating a shared problem or question. We outline a 9-point sequence of steps for setting up a successful multiple disciplinary project. This encompasses points on recruitment, involving stakeholders, developing research questions, negotiating power dynamics and hidden values and conceptual differences, explaining and choosing appropriate methods, developing a shared language, facilitating on-going communications, and discussing data integration and project outcomes. Although numerous solutions to the challenges of multiple disciplinary research have been proposed, lessons learned are often lost when projects end or experienced individuals move on. We urge multiple disciplinary teams to capture the challenges recognized, and solutions proposed, by their researchers while projects are in process. A database of well-documented case studies would showcase theories and methods from a variety of disciplines and their interactions, enable better comparative study and evaluation, and provide a useful resource for developing future projects and training multiple disciplinary researchers. © 2013 The Authors. Conservation Biology published by Wiley Periodicals, Inc. on behalf of Society for Conservation Biology.
Janecek, S; Baláz, S
1995-08-01
Twelve different (alpha/beta)8-barrel enzymes belonging to three structurally distinct families were found to contain, near the C-terminus of their strand beta 5, a conserved invariant glutamic acid residue that plays an important functional role in each of these enzymes. The search was based on the idea that a conserved sequence region of an (alpha/beta)8-barrel enzyme should be more or less conserved also in the equivalent part of the structure of the other enzymes with this folding motif owing to their mutual evolutionary relatedness. For this purpose, the sequence region around the well conserved fifth beta-strand of alpha-amylase containing catalytic glutamate (Glu230, Aspergillus oryzae alpha-amylase numbering), was used as the sequence-structural template. The isolated sequence stretches of the 12 (alpha/beta)8-barrels are discussed from both the sequence-structural and the evolutionary point of view, the invariant glutamate residue being proposed to be a joining feature of the studied group of enzymes remaining from their ancestral (alpha/beta)8-barrel.
Nanoplatforms for highly sensitive fluorescence detection of cancer-related proteases.
Wang, Hongwang; Udukala, Dinusha N; Samarakoon, Thilani N; Basel, Matthew T; Kalita, Mausam; Abayaweera, Gayani; Manawadu, Harshi; Malalasekera, Aruni; Robinson, Colette; Villanueva, David; Maynez, Pamela; Bossmann, Leonie; Riedy, Elizabeth; Barriga, Jenny; Wang, Ni; Li, Ping; Higgins, Daniel A; Zhu, Gaohong; Troyer, Deryl L; Bossmann, Stefan H
2014-02-01
Numerous proteases are known to be necessary for cancer development and progression including matrix metalloproteinases (MMPs), tissue serine proteases, and cathepsins. The goal of this research is to develop an Fe/Fe3O4 nanoparticle-based system for clinical diagnostics, which has the potential to measure the activity of cancer-associated proteases in biospecimens. Nanoparticle-based "light switches" for measuring protease activity consist of fluorescent cyanine dyes and porphyrins that are attached to Fe/Fe3O4 nanoparticles via consensus sequences. These consensus sequences can be cleaved in the presence of the correct protease, thus releasing a fluorescent dye from the Fe/Fe3O4 nanoparticle, resulting in highly sensitive (down to 1 × 10(-16) mol l(-1) for 12 proteases), selective, and fast nanoplatforms (required time: 60 min).
Comparative analysis of the small RNA transcriptomes of Pinus contorta and Oryza sativa
Morin, Ryan D.; Aksay, Gozde; Dolgosheina, Elena; Ebhardt, H. Alexander; Magrini, Vincent; Mardis, Elaine R.; Sahinalp, S. Cenk; Unrau, Peter J.
2008-01-01
The diversity of microRNAs and small-interfering RNAs has been extensively explored within angiosperms by focusing on a few key organisms such as Oryza sativa and Arabidopsis thaliana. A deeper division of the plants is defined by the radiation of the angiosperms and gymnosperms, with the latter comprising the commercially important conifers. The conifers are expected to provide important information regarding the evolution of highly conserved small regulatory RNAs. Deep sequencing provides the means to characterize and quantitatively profile small RNAs in understudied organisms such as these. Pyrosequencing of small RNAs from O. sativa revealed, as expected, ∼21- and ∼24-nt RNAs. The former contained known microRNAs, and the latter largely comprised intergenic-derived sequences likely representing heterochromatin siRNAs. In contrast, sequences from Pinus contorta were dominated by 21-nt small RNAs. Using a novel sequence-based clustering algorithm, we identified sequences belonging to 18 highly conserved microRNA families in P. contorta as well as numerous clusters of conserved small RNAs of unknown function. Using multiple methods, including expressed sequence folding and machine learning algorithms, we found a further 53 candidate novel microRNA families, 51 appearing specific to the P. contorta library. In addition, alignment of small RNA sequences to the O. sativa genome revealed six perfectly conserved classes of small RNA that included chloroplast transcripts and specific types of genomic repeats. The conservation of microRNAs and other small RNAs between the conifers and the angiosperms indicates that important RNA silencing processes were highly developed in the earliest spermatophytes. Genomic mapping of all sequences to the O. sativa genome can be viewed at http://microrna.bcgsc.ca/cgi-bin/gbrowse/rice_build_3/. PMID:18323537
Carlson, Jonathan M.; Chan, Benjamin; Chopera, Denis R.; Brumme, Chanson J.; Markle, Tristan J.; Martin, Eric; Shahid, Aniqa; Anmole, Gursev; Mwimanzi, Philip; Nassab, Pauline; Penney, Kali A.; Rahman, Manal A.; Milloy, M.-J.; Schechter, Martin T.; Markowitz, Martin; Carrington, Mary; Walker, Bruce D.; Wagner, Theresa; Buchbinder, Susan; Fuchs, Jonathan; Koblin, Beryl; Mayer, Kenneth H.; Harrigan, P. Richard; Brockman, Mark A.; Poon, Art F. Y.; Brumme, Zabrina L.
2014-01-01
HLA-restricted immune escape mutations that persist following HIV transmission could gradually spread through the viral population, thereby compromising host antiviral immunity as the epidemic progresses. To assess the extent and phenotypic impact of this phenomenon in an immunogenetically diverse population, we genotypically and functionally compared linked HLA and HIV (Gag/Nef) sequences from 358 historic (1979–1989) and 382 modern (2000–2011) specimens from four key cities in the North American epidemic (New York, Boston, San Francisco, Vancouver). Inferred HIV phylogenies were star-like, with approximately two-fold greater mean pairwise distances in modern versus historic sequences. The reconstructed epidemic ancestral (founder) HIV sequence was essentially identical to the North American subtype B consensus. Consistent with gradual diversification of a “consensus-like” founder virus, the median “background” frequencies of individual HLA-associated polymorphisms in HIV (in individuals lacking the restricting HLA[s]) were ∼2-fold higher in modern versus historic HIV sequences, though these remained notably low overall (e.g. in Gag, medians were 3.7% in the 2000s versus 2.0% in the 1980s). HIV polymorphisms exhibiting the greatest relative spread were those restricted by protective HLAs. Despite these increases, when HIV sequences were analyzed as a whole, their total average burden of polymorphisms that were “pre-adapted” to the average host HLA profile was only ∼2% greater in modern versus historic eras. Furthermore, HLA-associated polymorphisms identified in historic HIV sequences were consistent with those detectable today, with none identified that could explain the few HIV codons where the inferred epidemic ancestor differed from the modern consensus. Results are therefore consistent with slow HIV adaptation to HLA, but at a rate unlikely to yield imminent negative implications for cellular immunity, at least in North America. Intriguingly, temporal changes in protein activity of patient-derived Nef (though not Gag) sequences were observed, suggesting functional implications of population-level HIV evolution on certain viral proteins. PMID:24762668
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fong, H.K.W.; Yoshimoto, K.K.; Eversole-Cire, P.
1988-05-01
Recent molecular cloning of cDNA for the ..cap alpha.. subunit of bovine transducin (a guanine nucleotide-binding regulatory protein, or G protein) has revealed the presence of two retinal-specific transducins, called T/sub r/ and T/sub c/, which are expressed in rod or cone photoreceptor cells. In a further study of G-protein diversity and signal transduction in the retina, the authors have identified a G-protein ..cap alpha.. subunit, which they refer to as G/sub z/..cap alpha.., by isolating a human retinal cDNA clone that cross-hybridizes at reduced stringency with bovine T/sub r/ ..cap alpha..-subunit cDNA. The deduced amino acid sequence of G/submore » z/..cap alpha.. is 41-67% identical with those of other known G-protein ..cap alpha.. subunits. However, the 355-residue G/sub z/..cap alpha.. lacks a consensus site for ADP-ribosylation by pertussis toxin, and its amino acid sequence varies within a number of regions that are strongly conserved among all of the other G-protein ..cap alpha.. subunits. They suggest that G/sub z/..cap alpha.., which appears to be highly expressed in neural tissues, represents a member of a subfamily of G proteins that mediate signal transduction in pertussis toxin-insensitive systems.« less
Keeran, Nisha S; Ganesan, G; Parida, Ajay K
2017-04-01
Heavy metal pollution of agricultural soils is one of the most severe ecological problems in the world. Prosopis juliflora, a phreatophytic tree species, grows well in heavy metal laden industrial sites and is known to accumulate heavy metals. Heavy Metal ATPases (HMAs) are ATP driven heavy metal pumps that translocate heavy metals across biological membranes thus helping the plant in heavy metal tolerance and phytoremediation. In the present study we have isolated and characterized a novel 28.9 kDa heavy metal ATPase peptide (PjHMT) from P. juliflora which shows high similarity to the C-terminal region of P 1B ATPase HMA1. It also shows the absence of the invariant signature sequence DKTGT, and the metal binding CPX motif but the presence of conserved regions like MVGEGINDAPAL (ATP binding consensus sequence), HEGGTLLVCLNS (metal binding domain) and MLTGD, GEGIND and HEGG motifs which play important roles in metal transport or ATP binding. PjHMT, was found to be upregulated under cadmium and zinc stress. Heterologous expression of PjHMT in yeast showed a higher accumulation and tolerance of heavy metals in yeast. Further, transgenic tobacco plants constitutively expressing PjHMT also showed increased accumulation and tolerance to cadmium. Thus, this study suggests that the transport peptide from P. juliflora may have an important role in Cd uptake and thus in phytoremediation.
Guo, B Z; Xu, G; Cao, Y G; Holbrook, C C; Lynch, R E
2006-02-01
Preharvest aflatoxin contamination has been identified by the peanut industry as a serious issue in food safety and human health because of the carcinogenic toxicity. Drought stress is the most important environmental factor exacerbating Aspergillus infection and aflatoxin contamination in peanut. The development of drought-tolerant peanut cultivars could reduce aflatoxin contamination and would represent a major advance in the peanut industry. In this study, we identified a novel PLD gene in peanut (Arachis hypogaea), encoding a putative phospholipase D (PLD, EC 3.1.4.4). The completed cDNA sequence was obtained by using the consensus-degenerated hybrid oligonucleotide primer strategy. The deduced amino acid sequence shows high identity with known PLDs, and has similar conserved domains. The PLD gene expression under drought stress has been studied using four peanut lines: Tifton 8 and A13 (both drought tolerant) and Georgia Green (moderate) and PI 196754 (drought sensitive). Northern analysis showed that PLD gene expression was induced faster by drought stress in the drought-sensitive lines than the drought tolerance lines. Southern analysis showed that cultivated peanut has multiple copies (3 to 5 copies) of the PLD gene. These results suggest that peanut PLD may be involved in drought sensitivity and tolerance responses. Peanut PLD gene expression may be useful as a tool in germplasm screening for drought tolerance.
Weak Negative and Positive Selection and the Drift Load at Splice Sites
Denisov, Stepan V.; Bazykin, Georgii A.; Sutormin, Roman; Favorov, Alexander V.; Mironov, Andrey A.; Gelfand, Mikhail S.; Kondrashov, Alexey S.
2014-01-01
Splice sites (SSs) are short sequences that are crucial for proper mRNA splicing in eukaryotic cells, and therefore can be expected to be shaped by strong selection. Nevertheless, in mammals and in other intron-rich organisms, many of the SSs often involve nonconsensus (Nc), rather than consensus (Cn), nucleotides, and beyond the two critical nucleotides, the SSs are not perfectly conserved between species. Here, we compare the SS sequences between primates, and between Drosophila fruit flies, to reveal the pattern of selection acting at SSs. Cn-to-Nc substitutions are less frequent, and Nc-to-Cn substitutions are more frequent, than neutrally expected, indicating, respectively, negative and positive selection. This selection is relatively weak (1 < |4Nes| < 4), and has a similar efficiency in primates and in Drosophila. Within some nucleotide positions, the positive selection in favor of Nc-to-Cn substitutions is weaker than the negative selection maintaining already established Cn nucleotides; this difference is due to site-specific negative selection favoring current Nc nucleotides. In general, however, the strength of negative selection protecting the Cn alleles is similar in magnitude to the strength of positive selection favoring replacement of Nc alleles, as expected under the simple nearly neutral turnover. In summary, although a fraction of the Nc nucleotides within SSs is maintained by selection, the abundance of deleterious nucleotides in this class suggests a substantial genome-wide drift load. PMID:24966225
Molecular characteristic and physiological role of DOPA-decarboxylase.
Guenter, Joanna; Lenartowski, Robert
2016-12-31
The enzyme DOPA decarboxylase (aromatic-L-amino-acid decarboxylase, DDC) plays an important role in the dopaminergic system and participates in the uptake and decarboxylation of amine precursors in the peripheral tissues. Apart from catecholamines, DDC catalyses the biosynthesis of serotonin and trace amines. It has been shown that the DDC amino acid sequence is highly evolutionarily conserved across many species. The activity of holoenzyme is regulated by stimulation/blockade of membrane receptors, phosphorylation of serine residues, and DDC interaction with regulatory proteins. A single gene codes for DDC both in neuronal and non-neuronal tissue, but synthesized isoforms of mRNA differ in the 5' UTR and in the presence of alternative exons. Tissue-specific expression of the DDC gene is controlled by two spatially distinct promoters - neuronal and non-neuronal. Several consensus sequences recognized by the HNF and POU family proteins have been mapped in the neuronal DDC promoter. Since DDC is located close to the imprinted gene cluster, its expression can be subjected to tightly controlled epigenetic regulation. Perturbations in DDC expression result in a range of neurodegenerative and psychiatric disorders and correlate with neoplasia. Apart from the above issues, the role of DDC in prostate cancer, bipolar affective disorder, Parkinson's disease and DDC deficiency is discussed in our review. Moreover, novel and prospective clinical treatments based on gene therapy and stem cells for the diseases mentioned above are described.
Ridenour, John B; Smith, Jonathon E; Bluhm, Burton H
2016-09-01
Contamination of maize ( Zea mays ) with fumonisins produced by the fungus Fusarium verticillioides is a global concern for food safety. Fumonisins are a group of polyketide-derived secondary metabolites linked to esophageal cancer and neural tube birth defects in humans and numerous toxicoses in livestock. Despite the importance of fumonisins in global maize production, the regulation of fumonisin biosynthesis during kernel pathogenesis is poorly understood. The HAP complex is a conserved, heterotrimeric transcriptional regulator that binds the consensus sequence CCAAT to modulate gene expression. Recently, functional characterization of the Hap3 subunit linked the HAP complex to the regulation of secondary metabolism and stalk rot pathogenesis in F. verticillioides . Here, we determine the involvement of HAP3 in fumonisin biosynthesis and kernel pathogenesis. Deletion of HAP3 suppressed fumonisin biosynthesis on both nonviable and live maize kernels and impaired pathogenesis in living kernels. Transcriptional profiling via RNA sequencing indicated that the HAP complex regulates at least 1,223 genes in F. verticillioides , representing nearly 10% of all predicted genes. Disruption of the HAP complex caused the misregulation of biosynthetic gene clusters underlying the production of secondary metabolites, including fusarins. Taken together, these results reveal that the HAP complex is a central regulator of fumonisin biosynthesis and kernel pathogenesis and works as both a positive and negative regulator of secondary metabolism in F. verticillioides .
Designing probe from E6 genome region of human Papillomavirus 16 for sensing applications.
Parmin, Nor Azizah; Hashim, Uda; Gopinath, Subash C B
2018-02-01
Human Papillomavirus (HPV) is a standout amongst the most commonly reported over 100 types, among them genotypes 16, 18, 31 and 45 are the high-risk HPV. Herein, we designed the oligonucleotide probe for the detection of predominant HPV type 16 for the sensing applications. Conserved amino acid sequences within E6 region of the open reading frame in the HPV genome was used as the basis to design oligonucleotide probe to detect cervical cancer. Analyses of E6 amino acid sequences from the high-risk HPVs were done to check the percentage of similarity and consensus regions that cause different cancers, including cervical cancer. Basic local alignment search tools (BLAST) have given extra statistical parameters, for example, desire values (E-values) and score bits. The probe, 'GGG GTC GGT GGA CCG GTC GAT GTA' was designed with 66.7% GC content. This oligonucleotide probe is designed with the length of 24 mer, GC percent is between 40 and 70, and the melting point (Tm) is above 50°C. The probe needed an acceptable length between 22 and 31 mer. The choice of region is identified here can be used as a probe, has implications for HPV detection techniques in biosensor especially for clinical determination of cervical cancer. Copyright © 2017 Elsevier B.V. All rights reserved.
Jeong, Yongsu; Epstein, Douglas J
2003-08-01
The establishment of the floor plate at the ventral midline of the CNS is dependent on an inductive signaling process mediated by the secreted protein Sonic hedgehog (Shh). To understand molecularly how floor plate induction proceeds we identified a Shh-responsive regulatory element that directs transgene reporter expression to the ventral midline of the CNS and notochord in a Shh-like manner and characterized critical cis-acting sequences regulating this element. Cross-species comparisons narrowed the activity of the Shh floor plate enhancer to an 88-bp sequence within intron 2 of Shh that included highly conserved binding sites matching the consensus for homeodomain, Tbx and Foxa transcription factors. Mutational analysis revealed that the homeodomain and Foxa binding sites are each required for activation of the Shh floor plate enhancer, whereas the Tbx site was required for repression in regions of the CNS where Shh is not normally expressed. We further show that Shh enhancer activity was detected in the mouse node from where the floor plate and notochord precursors derive. Shh reporter expression was restricted to the ventral (mesodermal) layer of the node in a pattern similar to endogenous Shh. X-gal-positive cells emerging from the node were only detected in the notochord lineage, suggesting that the floor plate and notochord arise from distinct precursors in the mouse node.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cohen, Michael J.; King, Cason R.; Dikeakos, Jimmy D.
The immortalizing function of the human adenovirus 5 E1A oncoprotein requires efficient localization to the nucleus. In 1987, a consensus monopartite nuclear localization sequence (NLS) was identified at the C-terminus of E1A. Since that time, various experiments have suggested that other regions of E1A influence nuclear import. In addition, a novel bipartite NLS was recently predicted at the C-terminal region of E1A in silico. In this study, we used immunofluorescence microscopy and co-immunoprecipitation analysis with importin-α to verify that full nuclear localization of E1A requires the well characterized NLS spanning residues 285–289, as well as a second basic patch situatedmore » between residues 258 and 263 ({sup 258}RVGGRRQAVECIEDLLNEPGQPLDLSCKRPRP{sup 289}). Thus, the originally described NLS located at the C-terminus of E1A is actually a bipartite signal, which had been misidentified in the existing literature as a monopartite signal, altering our understanding of one of the oldest documented NLSs. - Highlights: • Human adenovirus E1A is localized to the nucleus. • The C-terminus of E1A contains a bipartite nuclear localization signal (NLS). • This signal was previously misidentified to be a monopartite NLS. • Key basic amino acid residues within this sequence are highly conserved.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Berman, Benjamin P.; Pfeiffer, Barret D.; Laverty, Todd R.
2004-08-06
The identification of sequences that control transcription in metazoans is a major goal of genome analysis. In a previous study, we demonstrated that searching for clusters of predicted transcription factor binding sites could discover active regulatory sequences, and identified 37 regions of the Drosophila melanogaster genome with high densities of predicted binding sites for five transcription factors involved in anterior-posterior embryonic patterning. Nine of these clusters overlapped known enhancers. Here, we report the results of in vivo functional analysis of 27 remaining clusters. We generated transgenic flies carrying each cluster attached to a basal promoter and reporter gene, and assayedmore » embryos for reporter gene expression. Six clusters are enhancers of adjacent genes: giant, fushi tarazu, odd-skipped, nubbin, squeeze and pdm2; three drive expression in patterns unrelated to those of neighboring genes; the remaining 18 do not appear to have enhancer activity. We used the Drosophila pseudoobscura genome to compare patterns of evolution in and around the 15 positive and 18 false-positive predictions. Although conservation of primary sequence cannot distinguish true from false positives, conservation of binding-site clustering accurately discriminates functional binding-site clusters from those with no function. We incorporated conservation of binding-site clustering into a new genome-wide enhancer screen, and predict several hundred new regulatory sequences, including 85 adjacent to genes with embryonic patterns. Measuring conservation of sequence features closely linked to function--such as binding-site clustering--makes better use of comparative sequence data than commonly used methods that examine only sequence identity.« less
Tatsumi, Masatoshi; Tsutsumi, Hiroyuki
2014-01-01
ABSTRACT Although significant clinical efficacy and safety of rotavirus vaccines were recently revealed in many countries, the mechanism of their attenuation is not well understood. We passaged serially a cell culture-adapted murine rotavirus EB strain in mouse pups or in cell cultures alternately and repeatedly and fully sequenced all 11 genes of 21 virus samples passaged in mice or in cell cultures. Sequence analysis revealed that mouse-passaged viruses that regained virulence almost consistently acquired four kinds of amino acid (aa) substitutions in VP4 and substitution in aa 37 (Val to Ala) in NSP4. In addition, they gained and invariably conserved the 3′ consensus sequence in NSP1. The molecular changes occurred along with the acquisition of virulence during passages in mice and then disappeared following passages in cell cultures. Intraperitoneal injection of recombinant NSP4 proteins confirmed the aa 37 site as important for its diarrheagenic activity in mice. These genome changes are likely to be correlated with rotavirus virulence. IMPORTANCE Serial passage of a virulent wild-type virus in vitro often results in loss of virulence of the virus in an original animal host, while serial passage of a cell culture-adapted avirulent virus in vivo often gains virulence in an animal host. Actually, live attenuated virus vaccines were originally produced by serial passage in cell cultures. Although clinical efficacy and safety of rotavirus vaccines were recently revealed, the mechanism of their attenuation is not well understood. We passaged serially a murine rotavirus by alternating switch of host (mice or cell cultures) repeatedly and sequenced the eleven genes of the passaged viruses to identify mutations associated with the emergence or disappearance of virulence. Sequence analysis revealed that changes in three genes (VP4, NSP1, and NSP4) were associated with virulence in mice. Intraperitoneal injection of recombinant NSP4 proteins confirmed its diarrheagenic activity in mice. These genome changes are likely to be correlated with rotavirus virulence. PMID:24599996
Tsugawa, Takeshi; Tatsumi, Masatoshi; Tsutsumi, Hiroyuki
2014-05-01
Although significant clinical efficacy and safety of rotavirus vaccines were recently revealed in many countries, the mechanism of their attenuation is not well understood. We passaged serially a cell culture-adapted murine rotavirus EB strain in mouse pups or in cell cultures alternately and repeatedly and fully sequenced all 11 genes of 21 virus samples passaged in mice or in cell cultures. Sequence analysis revealed that mouse-passaged viruses that regained virulence almost consistently acquired four kinds of amino acid (aa) substitutions in VP4 and substitution in aa 37 (Val to Ala) in NSP4. In addition, they gained and invariably conserved the 3' consensus sequence in NSP1. The molecular changes occurred along with the acquisition of virulence during passages in mice and then disappeared following passages in cell cultures. Intraperitoneal injection of recombinant NSP4 proteins confirmed the aa 37 site as important for its diarrheagenic activity in mice. These genome changes are likely to be correlated with rotavirus virulence. Serial passage of a virulent wild-type virus in vitro often results in loss of virulence of the virus in an original animal host, while serial passage of a cell culture-adapted avirulent virus in vivo often gains virulence in an animal host. Actually, live attenuated virus vaccines were originally produced by serial passage in cell cultures. Although clinical efficacy and safety of rotavirus vaccines were recently revealed, the mechanism of their attenuation is not well understood. We passaged serially a murine rotavirus by alternating switch of host (mice or cell cultures) repeatedly and sequenced the eleven genes of the passaged viruses to identify mutations associated with the emergence or disappearance of virulence. Sequence analysis revealed that changes in three genes (VP4, NSP1, and NSP4) were associated with virulence in mice. Intraperitoneal injection of recombinant NSP4 proteins confirmed its diarrheagenic activity in mice. These genome changes are likely to be correlated with rotavirus virulence.
Negrisolo, Enrico; Kuhl, Heiner; Forcato, Claudio; Vitulo, Nicola; Reinhardt, Richard; Patarnello, Tomaso; Bargelloni, Luca
2010-12-01
Comparative genomics holds the promise to magnify the information obtained from individual genome sequencing projects, revealing common features conserved across genomes and identifying lineage-specific characteristics. To implement such a comparative approach, a robust phylogenetic framework is required to accurately reconstruct evolution at the genome level. Among vertebrate taxa, teleosts represent the second best characterized group, with high-quality draft genome sequences for five model species (Danio rerio, Gasterosteus aculeatus, Oryzias latipes, Takifugu rubripes, and Tetraodon nigroviridis), and several others are in the finishing lane. However, the relationships among the acanthomorph teleost model fishes remain an unresolved taxonomic issue. Here, a genomic region spanning over 1.2 million base pairs was sequenced in the teleost fish Dicentrarchus labrax. Together with genomic data available for the above fish models, the new sequence was used to identify unique orthologous genomic regions shared across all target taxa. Different strategies were applied to produce robust multiple gene and genomic alignments spanning from 11,802 to 186,474 amino acid/nucleotide positions. Ten data sets were analyzed according to Bayesian inference, maximum likelihood, maximum parsimony, and neighbor joining methods. Extensive analyses were performed to explore the influence of several factors (e.g., alignment methodology, substitution model, data set partitions, and long-branch attraction) on the tree topology. Although a general consensus was observed for a closer relationship between G. aculeatus (Gasterosteidae) and Di. labrax (Moronidae) with the atherinomorph O. latipes (Beloniformes) sister taxon of this clade, with the tetraodontiform group Ta. rubripes and Te. nigroviridis (Tetraodontiformes) representing a more distantly related taxon among acanthomorph model fish species, conflicting results were obtained between data sets and methods, especially with respect to the choice of alignment methodology applied to noncoding parts of the genomic region under study. This may limit the use of intergenic/noncoding sequences in phylogenomics until more robust alignment algorithms are developed.
Human Splice-Site Prediction with Deep Neural Networks.
Naito, Tatsuhiko
2018-04-18
Accurate splice-site prediction is essential to delineate gene structures from sequence data. Several computational techniques have been applied to create a system to predict canonical splice sites. For classification tasks, deep neural networks (DNNs) have achieved record-breaking results and often outperformed other supervised learning techniques. In this study, a new method of splice-site prediction using DNNs was proposed. The proposed system receives an input sequence data and returns an answer as to whether it is splice site. The length of input is 140 nucleotides, with the consensus sequence (i.e., "GT" and "AG" for the donor and acceptor sites, respectively) in the middle. Each input sequence model is applied to the pretrained DNN model that determines the probability that an input is a splice site. The model consists of convolutional layers and bidirectional long short-term memory network layers. The pretraining and validation were conducted using the data set tested in previously reported methods. The performance evaluation results showed that the proposed method can outperform the previous methods. In addition, the pattern learned by the DNNs was visualized as position frequency matrices (PFMs). Some of PFMs were very similar to the consensus sequence. The trained DNN model and the brief source code for the prediction system are uploaded. Further improvement will be achieved following the further development of DNNs.
50 CFR 600.758 - Preparation of report.
Code of Federal Regulations, 2011 CFR
2011-10-01
... Preparation of report. (a) At the conclusion of the negotiations, an FNP may submit a report. Such report shall specify: (1) All the areas where consensus was reached by the FNP, including, if appropriate, proposed conservation and management measures. (2) Any other information submitted by members of the FNP...
USDA-ARS?s Scientific Manuscript database
Transcriptional activation domains (TAD) are difficult to predict and identify, since they are not conserved and have little consensus. Here, we describe a yeast-based screening method that is able to identify individual amino acid residues involved in transcriptional activation in a high throughput...
Chapter 10: Management recommendations
Deborah M. Finch; Janie Agyagos; Tracy McCarthey; Robert M. Marshall; Scott H. Stoleson; Mary J. Whitfield
2000-01-01
This chapter was developed over a series of meetings using a group-consensus process. Our recommendations are based on published results, on information compiled in the previous chapters, on expert opinion, and on unpublished data of conservation team members. This chapter is available as temporary guidance until the Recovery Plan for the southwestern willow flycatcher...
A novel application of cultural consensus models to evaluate conservation education programs.
Nekaris, K A I; McCabe, Sharon; Spaan, Denise; Ali, Muhammad Imron; Nijman, Vincent
2018-04-01
Conservation professionals recognize the need to evaluate education initiatives with a flexible approach that is culturally appropriate. Cultural-consensus theory (CCT) provides a framework for measuring the extent to which beliefs are communally held and has long been applied by social scientists. In a conservation-education context, we applied CCT and used free lists (i.e., a list of items on a topic stated in order of cultural importance) and domain analysis (analysis of how free lists go together within a cultural group) to evaluate a conservation education program in which we used a children's picture book to increase knowledge about and empathy for a critically endangered mammal, the Javan slow loris (Nycticebus javanicus). We extracted free lists of keywords generated by students (n = 580 in 18 schools) from essays they wrote before and after the education program. In 2 classroom sessions conducted approximately 18 weeks apart, we asked students to write an essay about their knowledge of the target species and then presented a book and several activities about slow loris ecology. Prior to the second session, we asked students to write a second essay. We generated free lists from both essays, quantified salience of terms used, and conducted minimal residuals factor analysis to determine presence of cultural domains surrounding slow lorises in each session. Students increased their use of words accurately associated with slow loris ecology and conservation from 43% in initial essays to 76% in final essays. Domain coherence increased from 22% to 47% across schools. Fifteen factors contributed to the domain slow loris. Between the first and second essays, factors that showed the greatest change were feeding ecology and slow loris as a forest protector, which increased 7-fold, and the humancentric factor, which decreased 5-fold. As demonstrated by knowledge retention and creation of unique stories and conservation opinions, children achieved all six levels of Bloom's taxonomy of learning domains. Free from the constraints of questionnaires and surveys, CCT methods provide a promising avenue to evaluate conservation education programs. © 2017 Society for Conservation Biology.
Cost Analysis of a Surgical Consensus Guideline in Breast-Conserving Surgery.
Yu, Jennifer; Elmore, Leisha C; Cyr, Amy E; Aft, Rebecca L; Gillanders, William E; Margenthaler, Julie A
2017-08-01
The Society of Surgical Oncology and American Society of Radiation Oncology consensus statement was the first professional guideline in breast oncology to declare "no ink on tumor" as a negative margin in patients with stages I/II breast cancer undergoing breast-conservation therapy. We sought to analyze the financial impact of this guideline at our institution using a historic cohort. We identified women undergoing re-excision after breast-conserving surgery for invasive breast cancer from 2010 through 2013 using a prospectively maintained institutional database. Clinical and billing data were extracted from the medical record and from administrative resources using CPT codes. Descriptive statistics were used in data analysis. Of 254 women in the study population, 238 (93.7%) had stage I/II disease and 182 (71.7%) had invasive disease with ductal carcinoma in situ. A subcohort of 83 patients (32.7%) who underwent breast-conservation therapy for stage I/II disease without neoadjuvant chemotherapy had negative margins after the index procedure, per the Society of Surgical Oncology and American Society of Radiation Oncology guideline. The majority had invasive ductal carcinoma (n = 70 [84.3%]) and had invasive disease (n = 45 [54.2%]), and/or ductal carcinoma in situ (n = 49 [59.0%]) within 1 mm of the specimen margin. Seventy-nine patients underwent 1 re-excision and 4 patients underwent 2 re-excisions, accounting for 81 hours of operative time. Considering facility fees and primary surgeon billing alone, the overall estimated cost reduction would have been $195,919, or $2,360 per affected patient, under the guideline recommendations. Implementation of the Society of Surgical Oncology and American Society of Radiation Oncology consensus guideline holds great potential to optimize resource use. Application of the guideline to a retrospective cohort at our institution would have decreased the overall re-excision rate by 5.6% and reduced costs by nearly $200,000. Additional analysis of patient outcomes and margin assessment methods is needed to define the long-term impact on surgical practice. Copyright © 2017 American College of Surgeons. Published by Elsevier Inc. All rights reserved.
Amexis, Georgios; Oeth, Paul; Abel, Kenneth; Ivshina, Anna; Pelloquin, Francois; Cantor, Charles R.; Braun, Andreas; Chumakov, Konstantin
2001-01-01
RNA viruses exist as quasispecies, heterogeneous and dynamic mixtures of mutants having one or more consensus sequences. An adequate description of the genomic structure of such viral populations must include the consensus sequence(s) plus a quantitative assessment of sequence heterogeneities. For example, in quality control of live attenuated viral vaccines, the presence of even small quantities of mutants or revertants may indicate incomplete or unstable attenuation that may influence vaccine safety. Previously, we demonstrated the monitoring of oral poliovirus vaccine with the use of mutant analysis by PCR and restriction enzyme cleavage (MAPREC). In this report, we investigate genetic variation in live attenuated mumps virus vaccine by using both MAPREC and a platform (DNA MassArray) based on matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry. Mumps vaccines prepared from the Jeryl Lynn strain typically contain at least two distinct viral substrains, JL1 and JL2, which have been characterized by full length sequencing. We report the development of assays for characterizing sequence variants in these substrains and demonstrate their use in quantitative analysis of substrains and sequence variations in mixed virus cultures and mumps vaccines. The results obtained from both the MAPREC and MALDI-TOF methods showed excellent correlation. This suggests the potential utility of MALDI-TOF for routine quality control of live viral vaccines and for assessment of genetic stability and quantitative monitoring of genetic changes in other RNA viruses of clinical interest. PMID:11593021
Conserved noncoding sequences (CNSs) in higher plants.
Freeling, Michael; Subramaniam, Shabarinath
2009-04-01
Plant conserved noncoding sequences (CNSs)--a specific category of phylogenetic footprint--have been shown experimentally to function. No plant CNS is conserved to the extent that ultraconserved noncoding sequences are conserved in vertebrates. Plant CNSs are enriched in known transcription factor or other cis-acting binding sites, and are usually clustered around genes. Genes that encode transcription factors and/or those that respond to stimuli are particularly CNS-rich. Only rarely could this function involve small RNA binding. Some transcribed CNSs encode short translation products as a form of negative control. Approximately 4% of Arabidopsis gene content is estimated to be both CNS-rich and occupies a relatively long stretch of chromosome: Bigfoot genes (long phylogenetic footprints). We discuss a 'DNA-templated protein assembly' idea that might help explain Bigfoot gene CNSs.
Korber, B T; Kunstman, K J; Patterson, B K; Furtado, M; McEvilly, M M; Levy, R; Wolinsky, S M
1994-01-01
Human immunodeficiency virus type 1 (HIV-1) sequences were generated from blood and from brain tissue obtained by stereotactic biopsy from six patients undergoing a diagnostic neurosurgical procedure. Proviral DNA was directly amplified by nested PCR, and 8 to 36 clones from each sample were sequenced. Phylogenetic analysis of intrapatient envelope V3-V5 region HIV-1 DNA sequence sets revealed that brain viral sequences were clustered relative to the blood viral sequences, suggestive of tissue-specific compartmentalization of the virus in four of the six cases. In the other two cases, the blood and brain virus sequences were intermingled in the phylogenetic analyses, suggesting trafficking of virus between the two tissues. Slide-based PCR-driven in situ hybridization of two of the patients' brain biopsy samples confirmed our interpretation of the intrapatient phylogenetic analyses. Interpatient V3 region brain-derived sequence distances were significantly less than blood-derived sequence distances. Relative to the tip of the loop, the set of brain-derived viral sequences had a tendency towards negative or neutral charge compared with the set of blood-derived viral sequences. Entropy calculations were used as a measure of the variability at each position in alignments of blood and brain viral sequences. A relatively conserved set of positions were found, with a significantly lower entropy in the brain-than in the blood-derived viral sequences. These sites constitute a brain "signature pattern," or a noncontiguous set of amino acids in the V3 region conserved in viral sequences derived from brain tissue. This brain-derived signature pattern was also well preserved among isolates previously characterized in vitro as macrophage tropic. Macrophage-monocyte tropism may be the biological constraint that results in the conservation of the viral brain signature pattern. Images PMID:7933130
Micro-bias and macro-performance.
Seaver, S M D; Moreira, A A; Sales-Pardo, M; Malmgren, R D; Diermeier, D; Amaral, L A N
2009-02-01
We use agent-based modeling to investigate the effect of conservatism and partisanship on the efficiency with which large populations solve the density classification task - a paradigmatic problem for information aggregation and consensus building. We find that conservative agents enhance the populations' ability to efficiently solve the density classification task despite large levels of noise in the system. In contrast, we find that the presence of even a small fraction of partisans holding the minority position will result in deadlock or a consensus on an incorrect answer. Our results provide a possible explanation for the emergence of conservatism and suggest that even low levels of partisanship can lead to significant social costs.
SOSORT consensus paper: school screening for scoliosis. Where are we today?
Grivas, Theodoros B; Wade, Marian H; Negrini, Stefano; O'Brien, Joseph P; Maruyama, Toru; Hawes, Martha C; Rigo, Manuel; Weiss, Hans Rudolf; Kotwicki, Tomasz; Vasiliadis, Elias S; Sulam, Lior Neuhaus; Neuhous, Tamar
2007-01-01
This report is the SOSORT Consensus Paper on School Screening for Scoliosis discussed at the 4th International Conference on Conservative Management of Spinal Deformities, presented by SOSORT, on May 2007. The objectives were numerous, 1) the inclusion of the existing information on the issue, 2) the analysis and discussion of the responses by the meeting attendees to the twenty six questions of the questionnaire, 3) the impact of screening on frequency of surgical treatment and of its discontinuation, 4) the reasons why these programs must be continued, 5) the evolving aim of School Screening for Scoliosis and 6) recommendations for improvement of the procedure. PMID:18039374
Botero, Adriana; Kapeller, Irit; Cooper, Crystal; Clode, Peta L; Shlomai, Joseph; Thompson, R C Andrew
2018-05-17
Kinetoplast DNA (kDNA) is the mitochondrial genome of trypanosomatids. It consists of a few dozen maxicircles and several thousand minicircles, all catenated topologically to form a two-dimensional DNA network. Minicircles are heterogeneous in size and sequence among species. They present one or several conserved regions that contain three highly conserved sequence blocks. CSB-1 (10 bp sequence) and CSB-2 (8 bp sequence) present lower interspecies homology, while CSB-3 (12 bp sequence) or the Universal Minicircle Sequence is conserved within most trypanosomatids. The Universal Minicircle Sequence is located at the replication origin of the minicircles, and is the binding site for the UMS binding protein, a protein involved in trypanosomatid survival and virulence. Here, we describe the structure and organisation of the kDNA of Trypanosoma copemani, a parasite that has been shown to infect mammalian cells and has been associated with the drastic decline of the endangered Australian marsupial, the woylie (Bettongia penicillata). Deep genomic sequencing showed that T. copemani presents two classes of minicircles that share sequence identity and organisation in the conserved sequence blocks with those of Trypanosoma cruzi and Trypanosoma lewisi. A 19,257 bp partial region of the maxicircle of T. copemani that contained the entire coding region was obtained. Comparative analysis of the T. copemani entire maxicircle coding region with the coding regions of T. cruzi and T. lewisi showed they share 71.05% and 71.28% identity, respectively. The shared features in the maxicircle/minicircle organisation and sequence between T. copemani and T. cruzi/T. lewisi suggest similarities in their process of kDNA replication, and are of significance in understanding the evolution of Australian trypanosomes. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.
Conserved Sequence Preferences Contribute to Substrate Recognition by the Proteasome*
Yu, Houqing; Singh Gautam, Amit K.; Wilmington, Shameika R.; Wylie, Dennis; Martinez-Fonts, Kirby; Kago, Grace; Warburton, Marie; Chavali, Sreenivas; Inobe, Tomonao; Finkelstein, Ilya J.; Babu, M. Madan
2016-01-01
The proteasome has pronounced preferences for the amino acid sequence of its substrates at the site where it initiates degradation. Here, we report that modulating these sequences can tune the steady-state abundance of proteins over 2 orders of magnitude in cells. This is the same dynamic range as seen for inducing ubiquitination through a classic N-end rule degron. The stability and abundance of His3 constructs dictated by the initiation site affect survival of yeast cells and show that variation in proteasomal initiation can affect fitness. The proteasome's sequence preferences are linked directly to the affinity of the initiation sites to their receptor on the proteasome and are conserved between Saccharomyces cerevisiae, Schizosaccharomyces pombe, and human cells. These findings establish that the sequence composition of unstructured initiation sites influences protein abundance in vivo in an evolutionarily conserved manner and can affect phenotype and fitness. PMID:27226608
Genome-wide discovery of novel and conserved microRNAs in white shrimp (Litopenaeus vannamei).
Xi, Qian-Yun; Xiong, Yuan-Yan; Wang, Yuan-Mei; Cheng, Xiao; Qi, Qi-En; Shu, Gang; Wang, Song-Bo; Wang, Li-Na; Gao, Ping; Zhu, Xiao-Tong; Jiang, Qing-Yan; Zhang, Yong-Liang; Liu, Li
2015-01-01
Of late years, a large amount of conserved and species-specific microRNAs (miRNAs) have been performed on identification from species which are economically important but lack a full genome sequence. In this study, Solexa deep sequencing and cross-species miRNA microarray were used to detect miRNAs in white shrimp. We identified 239 conserved miRNAs, 14 miRNA* sequences and 20 novel miRNAs by bioinformatics analysis from 7,561,406 high-quality reads representing 325,370 distinct sequences. The all 20 novel miRNAs were species-specific in white shrimp and not homologous in other species. Using the conserved miRNAs from the miRBase database as a query set to search for homologs from shrimp expressed sequence tags (ESTs), 32 conserved computationally predicted miRNAs were discovered in shrimp. In addition, using microarray analysis in the shrimp fed with Panax ginseng polysaccharide complex, 151 conserved miRNAs were identified, 18 of which were significant up-expression, while 49 miRNAs were significant down-expression. In particular, qRT-PCR analysis was also performed for nine miRNAs in three shrimp tissues such as muscle, gill and hepatopancreas. Results showed that these miRNAs expression are tissue specific. Combining results of the three methods, we detected 20 novel and 394 conserved miRNAs. Verification with quantitative reverse transcription (qRT-PCR) and Northern blot showed a high confidentiality of data. The study provides the first comprehensive specific miRNA profile of white shrimp, which includes useful information for future investigations into the function of miRNAs in regulation of shrimp development and immunology.
Accurate Typing of Human Leukocyte Antigen Class I Genes by Oxford Nanopore Sequencing.
Liu, Chang; Xiao, Fangzhou; Hoisington-Lopez, Jessica; Lang, Kathrin; Quenzel, Philipp; Duffy, Brian; Mitra, Robi David
2018-04-03
Oxford Nanopore Technologies' MinION has expanded the current DNA sequencing toolkit by delivering long read lengths and extreme portability. The MinION has the potential to enable expedited point-of-care human leukocyte antigen (HLA) typing, an assay routinely used to assess the immunologic compatibility between organ donors and recipients, but the platform's high error rate makes it challenging to type alleles with accuracy. We developed and validated accurate typing of HLA by Oxford nanopore (Athlon), a bioinformatic pipeline that i) maps nanopore reads to a database of known HLA alleles, ii) identifies candidate alleles with the highest read coverage at different resolution levels that are represented as branching nodes and leaves of a tree structure, iii) generates consensus sequences by remapping the reads to the candidate alleles, and iv) calls the final diploid genotype by blasting consensus sequences against the reference database. Using two independent data sets generated on the R9.4 flow cell chemistry, Athlon achieved a 100% accuracy in class I HLA typing at the two-field resolution. Copyright © 2018 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
CHROMA: consensus-based colouring of multiple alignments for publication.
Goodstadt, L; Ponting, C P
2001-09-01
CHROMA annotates multiple protein sequence alignments by consensus to produce formatted and coloured text suitable for incorporation into other documents for publication. The package is designed to be flexible and reliable, and has a simple-to-use graphical user interface running under Microsoft Windows. Both the executables and source code for CHROMA running under Windows and Linux (portable command-line only) are freely available at http://www.lg.ndirect.co.uk/chroma. Software enquiries should be directed to CHROMA@lg.ndirect.co.uk.
2012-01-01
Background Staphylococcus aureus Repeat (STAR) elements are a type of interspersed intergenic direct repeat. In this study the conservation and variation in these elements was explored by bioinformatic analyses of published staphylococcal genome sequences and through sequencing of specific STAR element loci from a large set of S. aureus isolates. Results Using bioinformatic analyses, we found that the STAR elements were located in different genomic loci within each staphylococcal species. There was no correlation between the number of STAR elements in each genome and the evolutionary relatedness of staphylococcal species, however higher levels of repeats were observed in both S. aureus and S. lugdunensis compared to other staphylococcal species. Unexpectedly, sequencing of the internal spacer sequences of individual repeat elements from multiple isolates showed conservation at the sequence level within deep evolutionary lineages of S. aureus. Whilst individual STAR element loci were demonstrated to expand and contract, the sequences associated with each locus were stable and distinct from one another. Conclusions The high degree of lineage and locus-specific conservation of these intergenic repeat regions suggests that STAR elements are maintained due to selective or molecular forces with some of these elements having an important role in cell physiology. The high prevalence in two of the more virulent staphylococcal species is indicative of a potential role for STAR elements in pathogenesis. PMID:23020678
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lan, Yemin; Rosen, Gail; Hershberg, Ruth
The 16s rRNA gene is so far the most widely used marker for taxonomical classification and separation of prokaryotes. Since it is universally conserved among prokaryotes, it is possible to use this gene to classify a broad range of prokaryotic organisms. At the same time, it has often been noted that the 16s rRNA gene is too conserved to separate between prokaryotes at finer taxonomic levels. In this paper, we examine how well levels of similarity of 16s rRNA and 73 additional universal or nearly universal marker genes correlate with genome-wide levels of gene sequence similarity. We demonstrate that themore » percent identity of 16s rRNA predicts genome-wide levels of similarity very well for distantly related prokaryotes, but not for closely related ones. In closely related prokaryotes, we find that there are many other marker genes for which levels of similarity are much more predictive of genome-wide levels of gene sequence similarity. Finally, we show that the identities of the markers that are most useful for predicting genome-wide levels of similarity within closely related prokaryotic lineages vary greatly between lineages. However, the most useful markers are always those that are least conserved in their sequences within each lineage. In conclusion, our results show that by choosing markers that are less conserved in their sequences within a lineage of interest, it is possible to better predict genome-wide gene sequence similarity between closely related prokaryotes than is possible using the 16s rRNA gene. We point readers towards a database we have created (POGO-DB) that can be used to easily establish which markers show lowest levels of sequence conservation within different prokaryotic lineages.« less
Lan, Yemin; Rosen, Gail; Hershberg, Ruth
2016-05-03
The 16s rRNA gene is so far the most widely used marker for taxonomical classification and separation of prokaryotes. Since it is universally conserved among prokaryotes, it is possible to use this gene to classify a broad range of prokaryotic organisms. At the same time, it has often been noted that the 16s rRNA gene is too conserved to separate between prokaryotes at finer taxonomic levels. In this paper, we examine how well levels of similarity of 16s rRNA and 73 additional universal or nearly universal marker genes correlate with genome-wide levels of gene sequence similarity. We demonstrate that themore » percent identity of 16s rRNA predicts genome-wide levels of similarity very well for distantly related prokaryotes, but not for closely related ones. In closely related prokaryotes, we find that there are many other marker genes for which levels of similarity are much more predictive of genome-wide levels of gene sequence similarity. Finally, we show that the identities of the markers that are most useful for predicting genome-wide levels of similarity within closely related prokaryotic lineages vary greatly between lineages. However, the most useful markers are always those that are least conserved in their sequences within each lineage. In conclusion, our results show that by choosing markers that are less conserved in their sequences within a lineage of interest, it is possible to better predict genome-wide gene sequence similarity between closely related prokaryotes than is possible using the 16s rRNA gene. We point readers towards a database we have created (POGO-DB) that can be used to easily establish which markers show lowest levels of sequence conservation within different prokaryotic lineages.« less
Pérez Sirkin, Daniela I; Lafont, Anne-Gaëlle; Kamech, Nédia; Somoza, Gustavo M; Vissio, Paula G; Dufour, Sylvie
2017-01-01
GnRH-associated peptide (GAP) is the C-terminal portion of the gonadotropin-releasing hormone (GnRH) preprohormone. Although it was reported in mammals that GAP may act as a prolactin-inhibiting factor and can be co-secreted with GnRH into the hypophyseal portal blood, GAP has been practically out of the research circuit for about 20 years. Comparative studies highlighted the low conservation of GAP primary amino acid sequences among vertebrates, contributing to consider that this peptide only participates in the folding or carrying process of GnRH. Considering that the three-dimensional (3D) structure of a protein may define its function, the aim of this study was to evaluate if GAP sequences and 3D structures are conserved in the vertebrate lineage. GAP sequences from various vertebrates were retrieved from databases. Analysis of primary amino acid sequence identity and similarity, molecular phylogeny, and prediction of 3D structures were performed. Amino acid sequence comparison and phylogeny analyses confirmed the large variation of GAP sequences throughout vertebrate radiation. In contrast, prediction of the 3D structure revealed a striking conservation of the 3D structure of GAP1 (GAP associated with the hypophysiotropic type 1 GnRH), despite low amino acid sequence conservation. This GAP1 peptide presented a typical helix-loop-helix (HLH) structure in all the vertebrate species analyzed. This HLH structure could also be predicted for GAP2 in some but not all vertebrate species and in none of the GAP3 analyzed. These results allowed us to infer that selective pressures have maintained GAP1 HLH structure throughout the vertebrate lineage. The conservation of the HLH motif, known to confer biological activity to various proteins, suggests that GAP1 peptides may exert some hypophysiotropic biological functions across vertebrate radiation.
Pérez Sirkin, Daniela I.; Lafont, Anne-Gaëlle; Kamech, Nédia; Somoza, Gustavo M.; Vissio, Paula G.; Dufour, Sylvie
2017-01-01
GnRH-associated peptide (GAP) is the C-terminal portion of the gonadotropin-releasing hormone (GnRH) preprohormone. Although it was reported in mammals that GAP may act as a prolactin-inhibiting factor and can be co-secreted with GnRH into the hypophyseal portal blood, GAP has been practically out of the research circuit for about 20 years. Comparative studies highlighted the low conservation of GAP primary amino acid sequences among vertebrates, contributing to consider that this peptide only participates in the folding or carrying process of GnRH. Considering that the three-dimensional (3D) structure of a protein may define its function, the aim of this study was to evaluate if GAP sequences and 3D structures are conserved in the vertebrate lineage. GAP sequences from various vertebrates were retrieved from databases. Analysis of primary amino acid sequence identity and similarity, molecular phylogeny, and prediction of 3D structures were performed. Amino acid sequence comparison and phylogeny analyses confirmed the large variation of GAP sequences throughout vertebrate radiation. In contrast, prediction of the 3D structure revealed a striking conservation of the 3D structure of GAP1 (GAP associated with the hypophysiotropic type 1 GnRH), despite low amino acid sequence conservation. This GAP1 peptide presented a typical helix-loop-helix (HLH) structure in all the vertebrate species analyzed. This HLH structure could also be predicted for GAP2 in some but not all vertebrate species and in none of the GAP3 analyzed. These results allowed us to infer that selective pressures have maintained GAP1 HLH structure throughout the vertebrate lineage. The conservation of the HLH motif, known to confer biological activity to various proteins, suggests that GAP1 peptides may exert some hypophysiotropic biological functions across vertebrate radiation. PMID:28878737
Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi
2014-01-01
We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5' flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster.
Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi
2014-01-01
We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5′ flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster. PMID:25099698
Evidence for the Concerted Evolution between Short Linear Protein Motifs and Their Flanking Regions
Chica, Claudia; Diella, Francesca; Gibson, Toby J.
2009-01-01
Background Linear motifs are short modules of protein sequences that play a crucial role in mediating and regulating many protein–protein interactions. The function of linear motifs strongly depends on the context, e.g. functional instances mainly occur inside flexible regions that are accessible for interaction. Sometimes linear motifs appear as isolated islands of conservation in multiple sequence alignments. However, they also occur in larger blocks of sequence conservation, suggesting an active role for the neighbouring amino acids. Results The evolution of regions flanking 116 functional linear motif instances was studied. The conservation of the amino acid sequence and order/disorder tendency of those regions was related to presence/absence of the instance. For the majority of the analysed instances, the pairs of sequences conserving the linear motif were also observed to maintain a similar local structural tendency and/or to have higher local sequence conservation when compared to pairs of sequences where one is missing the linear motif. Furthermore, those instances have a higher chance to co–evolve with the neighbouring residues in comparison to the distant ones. Those findings are supported by examples where the regulation of the linear motif–mediated interaction has been shown to depend on the modifications (e.g. phosphorylation) at neighbouring positions or is thought to benefit from the binding versatility of disordered regions. Conclusion The results suggest that flanking regions are relevant for linear motif–mediated interactions, both at the structural and sequence level. More interestingly, they indicate that the prediction of linear motif instances can be enriched with contextual information by performing a sequence analysis similar to the one presented here. This can facilitate the understanding of the role of these predicted instances in determining the protein function inside the broader context of the cellular network where they arise. PMID:19584925
CoSMoS: Conserved Sequence Motif Search in the proteome
Liu, Xiao I; Korde, Neeraj; Jakob, Ursula; Leichert, Lars I
2006-01-01
Background With the ever-increasing number of gene sequences in the public databases, generating and analyzing multiple sequence alignments becomes increasingly time consuming. Nevertheless it is a task performed on a regular basis by researchers in many labs. Results We have now created a database called CoSMoS to find the occurrences and at the same time evaluate the significance of sequence motifs and amino acids encoded in the whole genome of the model organism Escherichia coli K12. We provide a precomputed set of multiple sequence alignments for each individual E. coli protein with all of its homologues in the RefSeq database. The alignments themselves, information about the occurrence of sequence motifs together with information on the conservation of each of the more than 1.3 million amino acids encoded in the E. coli genome can be accessed via the web interface of CoSMoS. Conclusion CoSMoS is a valuable tool to identify highly conserved sequence motifs, to find regions suitable for mutational studies in functional analyses and to predict important structural features in E. coli proteins. PMID:16433915
Kikhno, Irina
2014-01-01
Highly homologous sequences 154–157 bp in length grouped under the name of “conserved non-protein-coding element” (CNE) were revealed in all of the sequenced genomes of baculoviruses belonging to the genus Alphabaculovirus. A CNE alignment led to the detection of a set of highly conserved nucleotide clusters that occupy strictly conserved positions in the CNE sequence. The significant length of the CNE and conservation of both its length and cluster architecture were identified as a combination of characteristics that make this CNE different from known viral non-coding functional sequences. The essential role of the CNE in the Alphabaculovirus life cycle was demonstrated through the use of a CNE-knockout Autographa californica multiple nucleopolyhedrovirus (AcMNPV) bacmid. It was shown that the essential function of the CNE was not mediated by the presumed expression activities of the protein- and non-protein-coding genes that overlap the AcMNPV CNE. On the basis of the presented data, the AcMNPV CNE was categorized as a complex-structured, polyfunctional genomic element involved in an essential DNA transaction that is associated with an undefined function of the baculovirus genome. PMID:24740153