Sample records for conserved upstream elements

  1. Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2

    PubMed Central

    Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.

    2011-01-01

    Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290

  2. Mutations that alter a conserved element upstream of the potato virus X triple block and coat protein genes affect subgenomic RNA accumulation.

    PubMed

    Kim, K H; Hemenway, C

    1997-05-26

    The putative subgenomic RNA (sgRNA) promoter regions upstream of the potato virus X (PVX) triple block and coat protein (CP) genes contain sequences common to other potexviruses. The importance of these sequences to PVX sgRNA accumulation was determined by inoculation of Nicotiana tabacum NT1 cell suspension protoplasts with transcripts derived from wild-type and modified PVX cDNA clones. Analyses of RNA accumulation by S1 nuclease digestion and primer extension indicated that a conserved octanucleotide sequence element and the spacing between this element and the start-site for sgRNA synthesis are critical for accumulation of the two major sgRNA species. The impact of mutations on CP sgRNA levels was also reflected in the accumulation of CP. In contrast, genomic minus- and plus-strand RNA accumulation were not significantly affected by mutations in these regions. Studies involving inoculation of tobacco plants with the modified transcripts suggested that the conserved octanucleotide element functions in sgRNA accumulation and some other aspect of the infection process.

  3. Regulatory elements of Caenorhabditis elegans ribosomal protein genes

    PubMed Central

    2012-01-01

    Background Ribosomal protein genes (RPGs) are essential, tightly regulated, and highly expressed during embryonic development and cell growth. Even though their protein sequences are strongly conserved, their mechanism of regulation is not conserved across yeast, Drosophila, and vertebrates. A recent investigation of genomic sequences conserved across both nematode species and associated with different gene groups indicated the existence of several elements in the upstream regions of C. elegans RPGs, providing a new insight regarding the regulation of these genes in C. elegans. Results In this study, we performed an in-depth examination of C. elegans RPG regulation and found nine highly conserved motifs in the upstream regions of C. elegans RPGs using the motif discovery algorithm DME. Four motifs were partially similar to transcription factor binding sites from C. elegans, Drosophila, yeast, and human. One pair of these motifs was found to co-occur in the upstream regions of 250 transcripts including 22 RPGs. The distance between the two motifs displayed a complex frequency pattern that was related to their relative orientation. We tested the impact of three of these motifs on the expression of rpl-2 using a series of reporter gene constructs and showed that all three motifs are necessary to maintain the high natural expression level of this gene. One of the motifs was similar to the binding site of an orthologue of POP-1, and we showed that RNAi knockdown of pop-1 impacts the expression of rpl-2. We further determined the transcription start site of rpl-2 by 5’ RACE and found that the motifs lie 40–90 bases upstream of the start site. We also found evidence that a noncoding RNA, contained within the outron of rpl-2, is co-transcribed with rpl-2 and cleaved during trans-splicing. Conclusions Our results indicate that C. elegans RPGs are regulated by a complex novel series of regulatory elements that is evolutionarily distinct from those of all other species examined up until now. PMID:22928635

  4. Enhancer elements upstream of the SHOX gene are active in the developing limb.

    PubMed

    Durand, Claudia; Bangs, Fiona; Signolet, Jason; Decker, Eva; Tickle, Cheryll; Rappold, Gudrun

    2010-05-01

    Léri-Weill Dyschondrosteosis (LWD) is a dominant skeletal disorder characterized by short stature and distinct bone anomalies. SHOX gene mutations and deletions of regulatory elements downstream of SHOX resulting in haploinsufficiency have been found in patients with LWD. SHOX encodes a homeodomain transcription factor and is known to be expressed in the developing limb. We have now analyzed the regulatory significance of the region upstream of the SHOX gene. By comparative genomic analyses, we identified several conserved non-coding elements, which subsequently were tested in an in ovo enhancer assay in both chicken limb bud and cornea, where SHOX is also expressed. In this assay, we found three enhancers to be active in the developing chicken limb, but none were functional in the developing cornea. A screening of 60 LWD patients with an intact SHOX coding and downstream region did not yield any deletion of the upstream enhancer region. Thus, we speculate that SHOX upstream deletions occur at a lower frequency because of the structural organization of this genomic region and/or that SHOX upstream deletions may cause a phenotype that differs from the one observed in LWD.

  5. Enhancer elements upstream of the SHOX gene are active in the developing limb

    PubMed Central

    Durand, Claudia; Bangs, Fiona; Signolet, Jason; Decker, Eva; Tickle, Cheryll; Rappold, Gudrun

    2010-01-01

    Léri-Weill Dyschondrosteosis (LWD) is a dominant skeletal disorder characterized by short stature and distinct bone anomalies. SHOX gene mutations and deletions of regulatory elements downstream of SHOX resulting in haploinsufficiency have been found in patients with LWD. SHOX encodes a homeodomain transcription factor and is known to be expressed in the developing limb. We have now analyzed the regulatory significance of the region upstream of the SHOX gene. By comparative genomic analyses, we identified several conserved non-coding elements, which subsequently were tested in an in ovo enhancer assay in both chicken limb bud and cornea, where SHOX is also expressed. In this assay, we found three enhancers to be active in the developing chicken limb, but none were functional in the developing cornea. A screening of 60 LWD patients with an intact SHOX coding and downstream region did not yield any deletion of the upstream enhancer region. Thus, we speculate that SHOX upstream deletions occur at a lower frequency because of the structural organization of this genomic region and/or that SHOX upstream deletions may cause a phenotype that differs from the one observed in LWD. PMID:19997128

  6. Separation of the PROX1 gene from upstream conserved elements in a complex inversion/translocation patient with hypoplastic left heart

    PubMed Central

    Gill, Harinder K; Parsons, Sian R; Spalluto, Cosma; Davies, Angela F; Knorz, Victoria J; Burlinson, Clare EG; Ng, Bee Ling; Carter, Nigel P; Ogilvie, Caroline Mackie; Wilson, David I; Roberts, Roland G

    2009-01-01

    Hypoplastic left heart (HLH) occurs in at least 1 in 10 000 live births but may be more common in utero. Its causes are poorly understood but a number of affected cases are associated with chromosomal abnormalities. We set out to localize the breakpoints in a patient with sporadic HLH and a de novo translocation. Initial studies showed that the apparently simple 1q41;3q27.1 translocation was actually combined with a 4-Mb inversion, also de novo, of material within 1q41. We therefore localized all four breakpoints and found that no known transcription units were disrupted. However we present a case, based on functional considerations, synteny and position of highly conserved non-coding sequence elements, and the heterozygous Prox1+/− mouse phenotype (ventricular hypoplasia), for the involvement of dysregulation of the PROX1 gene in the aetiology of HLH in this case. Accordingly, we show that the spatial expression pattern of PROX1 in the developing human heart is consistent with a role in cardiac development. We suggest that dysregulation of PROX1 gene expression due to separation from its conserved upstream elements is likely to have caused the heart defects observed in this patient, and that PROX1 should be considered as a potential candidate gene for other cases of HLH. The relevance of another breakpoint separating the cardiac gene ESRRG from a conserved downstream element is also discussed. PMID:19471316

  7. DoOP: Databases of Orthologous Promoters, collections of clusters of orthologous upstream sequences from chordates and plants

    PubMed Central

    Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B.; Tóth, Gábor; Ortutay, Csaba P.; Patthy, László

    2005-01-01

    DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21 061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically. PMID:15608291

  8. DoOP: Databases of Orthologous Promoters, collections of clusters of orthologous upstream sequences from chordates and plants.

    PubMed

    Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B; Tóth, Gábor; Ortutay, Csaba P; Patthy, László

    2005-01-01

    DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21,061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically.

  9. Robust Translation of the Nucleoid Protein Fis Requires a Remote Upstream AU Element and Is Enhanced by RNA Secondary Structure

    PubMed Central

    Nafissi, Maryam; Chau, Jeannette; Xu, Jimin

    2012-01-01

    Synthesis of the Fis nucleoid protein rapidly increases in response to nutrient upshifts, and Fis is one of the most abundant DNA binding proteins in Escherichia coli under nutrient-rich growth conditions. Previous work has shown that control of Fis synthesis occurs at transcription initiation of the dusB-fis operon. We show here that while translation of the dihydrouridine synthase gene dusB is low, unusual mechanisms operate to enable robust translation of fis. At least two RNA sequence elements located within the dusB coding region are responsible for high fis translation. The most important is an AU element centered 35 nucleotides (nt) upstream of the fis AUG, which may function as a binding site for ribosomal protein S1. In addition, a 44-nt segment located upstream of the AU element and predicted to form a stem-loop secondary structure plays a prominent role in enhancing fis translation. On the other hand, mutations close to the AUG, including over a potential Shine-Dalgarno sequence, have little effect on Fis protein levels. The AU element and stem-loop regions are phylogenetically conserved within dusB-fis operons of representative enteric bacteria. PMID:22389479

  10. Computation of Feedback Aeroacoustic System by the CE/SE Method

    NASA Technical Reports Server (NTRS)

    Loh, Ching Y.; Wang, Xiao Y.; Chang, Sin-Chung; Jorgenson, Philip C. E.

    2000-01-01

    It is well known that due to vortex shedding in high speed flow over cutouts, cavities, and gaps, intense noise may be generated. Strong tonal oscillations occur in a feedback cycle in which the vortices shed from the upstream edge of the cavity convect downstream and impinge on the cavity lip, generating acoustic waves that propagate upstream to excite new vortices. Numerical simulation of such a complicated process requires a scheme that can: (1) resolve acoustic waves with low dispersion and numerical dissipation, (2) handle nonlinear and discontinuous waves (e.g. shocks), and (3) have an effective (near field) nonreflecting boundary condition (NRBC). The new space time conservation element and solution element method, or CE/SE for short, is a numerical method that meets the above requirements.

  11. Designing synthetic RNAs to determine the relevance of structural motifs in picornavirus IRES elements

    NASA Astrophysics Data System (ADS)

    Fernandez-Chamorro, Javier; Lozano, Gloria; Garcia-Martin, Juan Antonio; Ramajo, Jorge; Dotu, Ivan; Clote, Peter; Martinez-Salas, Encarnacion

    2016-04-01

    The function of Internal Ribosome Entry Site (IRES) elements is intimately linked to their RNA structure. Viral IRES elements are organized in modular domains consisting of one or more stem-loops that harbor conserved RNA motifs critical for internal initiation of translation. A conserved motif is the pyrimidine-tract located upstream of the functional initiation codon in type I and II picornavirus IRES. By computationally designing synthetic RNAs to fold into a structure that sequesters the polypyrimidine tract in a hairpin, we establish a correlation between predicted inaccessibility of the pyrimidine tract and IRES activity, as determined in both in vitro and in vivo systems. Our data supports the hypothesis that structural sequestration of the pyrimidine-tract within a stable hairpin inactivates IRES activity, since the stronger the stability of the hairpin the higher the inhibition of protein synthesis. Destabilization of the stem-loop immediately upstream of the pyrimidine-tract also decreases IRES activity. Our work introduces a hybrid computational/experimental method to determine the importance of structural motifs for biological function. Specifically, we show the feasibility of using the software RNAiFold to design synthetic RNAs with particular sequence and structural motifs that permit subsequent experimental determination of the importance of such motifs for biological function.

  12. Infection of capilloviruses requires subgenomic RNAs whose transcription is controlled by promoter-like sequences conserved among flexiviruses.

    PubMed

    Komatsu, Ken; Hirata, Hisae; Fukagawa, Takako; Yamaji, Yasuyuki; Okano, Yukari; Ishikawa, Kazuya; Adachi, Tatsushi; Maejima, Kensaku; Hashimoto, Masayoshi; Namba, Shigetou

    2012-07-01

    The first open-reading frame (ORF) of apple stem grooving virus (ASGV), of the genus Capillovirus, encodes an apparently chimeric polyprotein containing conserved regions for replicase (Rep) and coat protein (CP). However, our previous study revealed that ASGV mutants with distinct and discontinuous Rep- and CP-coding regions successfully infect plants, indicating that CP expressed via a subgenomic RNA (sgRNA) is sufficient for viability of the virus. Here we identified a transcription start site of the CP sgRNA and revealed that CP translated from the sgRNA is essential for ASGV infection. We mapped the transcription start sites of both the CP and the movement protein (MP) sgRNAs of ASGV and found a hexanucleotide motif, UUAGGU, conserved upstream from both sgRNA transcription start sites. Mutational analysis of the putative CP initiation codon and of the UUAGGU sequence upstream from the transcription start site of CP sgRNA demonstrated their importance for ASGV accumulation. Our results also demonstrated that potato virus T (PVT), an unassigned species closely related to ASGV, produces two sgRNAs putatively deployed for the CP and MP expression and that the same hexanucleotide motif as found in ASGV is located upstream from the transcription start sites of both sgRNAs. This motif, which constituted putative core elements of the sgRNA promoter, is broadly conserved among viruses in the families Alphaflexiviridae and Betaflexiviridae, suggesting that the gene expression strategy of the viruses in both families has been conserved throughout evolution. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Flanking HS-62.5 and 3' HS1, and regions upstream of the LCR, are not required for beta-globin transcription.

    PubMed

    Bender, M A; Byron, Rachel; Ragoczy, Tobias; Telling, Agnes; Bulger, Michael; Groudine, Mark

    2006-08-15

    The locus control region (LCR) was thought to be necessary and sufficient for establishing and maintaining an open beta-globin locus chromatin domain in the repressive environment of the developing erythrocyte. However, deletion of the LCR from the endogenous locus had no significant effect on chromatin structure and did not silence transcription. Thus, the cis-regulatory elements that confer the open domain remain unidentified. The conserved DNaseI hypersensitivity sites (HSs) HS-62.5 and 3'HS1 that flank the locus, and the region upstream of the LCR have been implicated in globin gene regulation. The flanking HSs bind CCCTC binding factor (CTCF) and are thought to interact with the LCR to form a "chromatin hub" involved in beta-globin gene activation. Hispanic thalassemia, a deletion of the LCR and 27 kb upstream, leads to heterochromatinization and silencing of the locus. Thus, the region upstream of the LCR deleted in Hispanic thalassemia (upstream Hispanic region [UHR]) may be required for expression. To determine the importance of the UHR and flanking HSs for beta-globin expression, we generated and analyzed mice with targeted deletions of these elements. We demonstrate deletion of these regions alone, and in combination, do not affect transcription, bringing into question current models for the regulation of the beta-globin locus.

  14. In silico Analysis of 3′-End-Processing Signals in Aspergillus oryzae Using Expressed Sequence Tags and Genomic Sequencing Data

    PubMed Central

    Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya

    2011-01-01

    To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533

  15. Refining the regulatory region upstream of SOX9 associated with 46,XX testicular disorders of Sex Development (DSD).

    PubMed

    Hyon, Capucine; Chantot-Bastaraud, Sandra; Harbuz, Radu; Bhouri, Rakia; Perrot, Nicolas; Peycelon, Matthieu; Sibony, Mathilde; Rojo, Sandra; Piguel, Xavier; Bilan, Frederic; Gilbert-Dussardier, Brigitte; Kitzis, Alain; McElreavey, Ken; Siffroi, Jean-Pierre; Bashamboo, Anu

    2015-08-01

    Disorders of Sex Development (DSD) are a heterogeneous group of disorders affecting gonad and/or genito-urinary tract development and usually the endocrine-reproductive system. A genetic diagnosis is made in only around 20% of these cases. The genetic causes of 46,XX-SRY negative testicular DSD as well as ovotesticular DSD are poorly defined. Duplications involving a region located ∼600 kb upstream of SOX9, a key gene in testis development, were reported in several cases of 46,XX DSD. Recent studies have narrowed this region down to a 78 kb interval that is duplicated or deleted respectively in 46,XX or 46,XY DSD. We identified three phenotypically normal patients presenting with azoospermia and 46,XX testicular DSD. Two brothers carried a 83.8 kb duplication located ∼600 kb upstream of SOX9 that overlapped with the previously reported rearrangements. This duplication refines the minimal region associated with 46,XX-SRY negative DSD to a 40.7-41.9 kb element located ∼600 kb upstream of SOX9. Predicted enhancer elements and evolutionary-conserved binding sites for proteins known to be involved in testis determination are located within this region. © 2015 Wiley Periodicals, Inc.

  16. An RNA Element That Facilitates Programmed Ribosomal Readthrough in Turnip Crinkle Virus Adopts Multiple Conformations

    PubMed Central

    Kuhlmann, Micki M.; Chattopadhyay, Maitreyi; Stupina, Vera A.; Gao, Feng

    2016-01-01

    ABSTRACT Ribosome recoding is used by RNA viruses for translational readthrough or frameshifting past termination codons for the synthesis of extension products. Recoding sites, along with downstream recoding stimulatory elements (RSEs), have long been studied in reporter constructs, because these fragments alone mediate customary levels of recoding and are thus assumed to contain complete instructions for establishment of the proper ratio of termination to recoding. RSEs from the Tombusviridae and Luteoviridae are thought to be exceptions, since they contain a long-distance RNA-RNA connection with the 3′ end. This interaction has been suggested to substitute for pseudoknots, thought to be missing in tombusvirid RSEs. We provide evidence that the phylogenetically conserved RSE of the carmovirus Turnip crinkle virus (TCV) adopts an alternative, smaller structure that extends an upstream conserved hairpin and that this alternative structure is the predominant form of the RSE within nascent viral RNA in plant cells and when RNA is synthesized in vitro. The TCV RSE also contains an internal pseudoknot along with the long-distance interaction, and the pseudoknot is not compatible with the phylogenetically conserved structure. Conserved residues just past the recoding site are important for recoding, and these residues are also conserved in the RSEs of gammaretroviruses. Our data demonstrate the dynamic nature of the TCV RSE and suggest that studies using reporter constructs may not be effectively recapitulating RSE-mediated recoding within viral genomes. IMPORTANCE Ribosome recoding is used by RNA viruses to enable ribosomes to extend translation past termination codons for the synthesis of longer products. Recoding sites and a downstream recoding stimulatory element (RSE) mediate expected levels of recoding when excised and placed in reporter constructs and thus are assumed to contain complete instructions for the establishment of the proper ratio of termination to recoding. We provide evidence that most of the TCV RSE adopts an alternative structure that extends an upstream conserved hairpin and that this alternative structure, and not the phylogenetically conserved structure, is the predominant form of the RSE in RNA synthesized in vitro and in plant cells. The TCV RSE also contains an internal pseudoknot that is not compatible with the phylogenetically conserved structure and an RNA bridge to the 3′ end. These data suggest that the TCV RSE is structurally dynamic and that multiple conformations are likely required to regulate ribosomal readthrough. PMID:27440887

  17. An Insulator Element Located at the Cyclin B1 Interacting Protein 1 Gene Locus Is Highly Conserved among Mammalian Species

    PubMed Central

    Yoshida, Wataru; Tomikawa, Junko; Inaki, Makoto; Kimura, Hiroshi; Onodera, Masafumi; Hata, Kenichiro; Nakabayashi, Kazuhiko

    2015-01-01

    Insulators are cis-elements that control the direction of enhancer and silencer activities (enhancer-blocking) and protect genes from silencing by heterochromatinization (barrier activity). Understanding insulators is critical to elucidate gene regulatory mechanisms at chromosomal domain levels. Here, we focused on a genomic region upstream of the mouse Ccnb1ip1 (cyclin B1 interacting protein 1) gene that was methylated in E9.5 embryos of the C57BL/6 strain, but unmethylated in those of the 129X1/SvJ and JF1/Ms strains. We hypothesized the existence of an insulator-type element that prevents the spread of DNA methylation within the 1.8 kbp segment, and actually identified a 242-bp and a 185-bp fragments that were located adjacent to each other and showed insulator and enhancer activities, respectively, in reporter assays. We designated these genomic regions as the Ccnb1ip1 insulator and the Ccnb1ip1 enhancer. The Ccnb1ip1 insulator showed enhancer-blocking activity in the luciferase assays and barrier activity in the colony formation assays. Further examination of the Ccnb1ip1 locus in other mammalian species revealed that the insulator and enhancer are highly conserved among a wide variety of species, and are located immediately upstream of the transcriptional start site of Ccnb1ip1. These newly identified cis-elements may be involved in transcriptional regulation of Ccnb1ip1, which is important in meiotic crossing-over and G2/M transition of the mitotic cell cycle. PMID:26110280

  18. Deletions involving long-range conserved nongenic sequences upstream and downstream of FOXL2 as a novel disease-causing mechanism in blepharophimosis syndrome.

    PubMed

    Beysen, D; Raes, J; Leroy, B P; Lucassen, A; Yates, J R W; Clayton-Smith, J; Ilyina, H; Brooks, S Sklower; Christin-Maitre, S; Fellous, M; Fryns, J P; Kim, J R; Lapunzina, P; Lemyre, E; Meire, F; Messiaen, L M; Oley, C; Splitt, M; Thomson, J; Van de Peer, Y; Veitia, R A; De Paepe, A; De Baere, E

    2005-08-01

    The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes.

  19. Deletions Involving Long-Range Conserved Nongenic Sequences Upstream and Downstream of FOXL2 as a Novel Disease-Causing Mechanism in Blepharophimosis Syndrome

    PubMed Central

    Beysen, D.; Raes, J.; Leroy, B. P.; Lucassen, A.; Yates, J. R. W.; Clayton-Smith, J.; Ilyina, H.; Brooks, S. Sklower; Christin-Maitre, S.; Fellous, M.; Fryns, J. P.; Kim, J. R.; Lapunzina, P.; Lemyre, E.; Meire, F.; Messiaen, L. M.; Oley, C.; Splitt, M.; Thomson, J.; Peer, Y. Van de; Veitia, R. A.; De Paepe, A.; De Baere, E.

    2005-01-01

    The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes. PMID:15962237

  20. Selection of Optimal Polypurine Tract Region Sequences during Moloney Murine Leukemia Virus Replication

    PubMed Central

    Robson, Nicole D.; Telesnitsky, Alice

    2000-01-01

    Retrovirus plus-strand synthesis is primed by a cleavage remnant of the polypurine tract (PPT) region of viral RNA. In this study, we tested replication properties for Moloney murine leukemia viruses with targeted mutations in the PPT and in conserved sequences upstream, as well as for pools of mutants with randomized sequences in these regions. The importance of maintaining some purine residues within the PPT was indicated both by examining the evolution of random PPT pools and from the replication properties of targeted mutants. Although many different PPT sequences could support efficient replication and one mutant that contained two differences in the core PPT was found to replicate as well as the wild type, some sequences in the core PPT clearly conferred advantages over others. Contributions of sequences upstream of the core PPT were examined with deletion mutants. A conserved T-stretch within the upstream sequence was examined in detail and found to be unimportant to helper functions. Evolution of virus pools containing randomized T-stretch sequences demonstrated marked preference for the wild-type sequence in six of its eight positions. These findings demonstrate that maintenance of the T-rich element is more important to viral replication than is maintenance of the core PPT. PMID:11044073

  1. A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements

    DOE PAGES

    Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.

    2015-03-22

    Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean ( Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we usemore » site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less

  2. A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.

    Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean ( Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we usemore » site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less

  3. A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements.

    PubMed

    Henry, Kelli F; Kawashima, Tomokazu; Goldberg, Robert B

    2015-06-01

    Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean (Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we use site-directed mutagenesis experiments in transgenic tobacco globular-stage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. A homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.

  4. Eukaryotic Elongation Factor 1A Interacts with the Upstream Pseudoknot Domain in the 3′ Untranslated Region of Tobacco Mosaic Virus RNA

    PubMed Central

    Zeenko, Vladimir V.; Ryabova, Lyubov A.; Spirin, Alexander S.; Rothnie, Helen M.; Hess, Daniel; Browning, Karen S.; Hohn, Thomas

    2002-01-01

    The genomic RNA of tobacco mosaic virus (TMV), like that of other positive-strand RNA viruses, acts as a template for both translation and replication. The highly structured 3′ untranslated region (UTR) of TMV RNAs plays an important role in both processes; it is not polyadenylated but ends with a tRNA-like structure (TLS) preceded by a conserved upstream pseudoknot domain (UPD). The TLS of tobamoviral RNAs can be specifically aminoacylated and, in this state, can interact with eukaryotic elongation factor 1A (eEF1A)/GTP with high affinity. Using a UV cross-linking assay, we detected another specific binding site for eEF1A/GTP, within the UPDs of TMV and crucifer-infecting tobamovirus (crTMV), that does not require aminoacylation. A mutational analysis revealed that UPD pseudoknot conformation and some conserved primary sequence elements are required for this interaction. Its possible role in the regulation of tobamovirus gene expression and replication is discussed. PMID:11991996

  5. Comparative analysis on the structural features of the 5' flanking region of κ-casein genes from six different species

    PubMed Central

    Gerencsér, Ákos; Barta, Endre; Boa, Simon; Kastanis, Petros; Bösze, Zsuzsanna; Whitelaw, C Bruce A

    2002-01-01

    κ-casein plays an essential role in the formation, stabilisation and aggregation of milk micelles. Control of κ-casein expression reflects this essential role, although an understanding of the mechanisms involved lags behind that of the other milk protein genes. We determined the 5'-flanking sequences for the murine, rabbit and human κ-casein genes and compared them to the published ruminant sequences. The most conserved region was not the proximal promoter region but an approximately 400 bp long region centred 800 bp upstream of the TATA box. This region contained two highly conserved MGF/STAT5 sites with common spacing relative to each other. In this region, six conserved short stretches of similarity were also found which did not correspond to known transcription factor consensus sites. On the contrary to ruminant and human 5' regulatory sequences, the rabbit and murine 5'-flanking regions did not harbour any kind of repetitive elements. We generated a phylogenetic tree of the six species based on multiple alignment of the κ-casein sequences. This study identified conserved candidate transcriptional regulatory elements within the κ-casein gene promoter. PMID:11929628

  6. Structural and functional analysis of mouse Msx1 gene promoter: sequence conservation with human MSX1 promoter points at potential regulatory elements.

    PubMed

    Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E

    1998-06-01

    Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.

  7. A Partial Least Squares Based Procedure for Upstream Sequence Classification in Prokaryotes.

    PubMed

    Mehmood, Tahir; Bohlin, Jon; Snipen, Lars

    2015-01-01

    The upstream region of coding genes is important for several reasons, for instance locating transcription factor, binding sites, and start site initiation in genomic DNA. Motivated by a recently conducted study, where multivariate approach was successfully applied to coding sequence modeling, we have introduced a partial least squares (PLS) based procedure for the classification of true upstream prokaryotic sequence from background upstream sequence. The upstream sequences of conserved coding genes over genomes were considered in analysis, where conserved coding genes were found by using pan-genomics concept for each considered prokaryotic species. PLS uses position specific scoring matrix (PSSM) to study the characteristics of upstream region. Results obtained by PLS based method were compared with Gini importance of random forest (RF) and support vector machine (SVM), which is much used method for sequence classification. The upstream sequence classification performance was evaluated by using cross validation, and suggested approach identifies prokaryotic upstream region significantly better to RF (p-value < 0.01) and SVM (p-value < 0.01). Further, the proposed method also produced results that concurred with known biological characteristics of the upstream region.

  8. ICAM-1-related long non-coding RNA: promoter analysis and expression in human retinal endothelial cells.

    PubMed

    Lumsden, Amanda L; Ma, Yuefang; Ashander, Liam M; Stempel, Andrew J; Keating, Damien J; Smith, Justine R; Appukuttan, Binoy

    2018-05-09

    Regulation of intercellular adhesion molecule (ICAM)-1 in retinal endothelial cells is a promising druggable target for retinal vascular diseases. The ICAM-1-related (ICR) long non-coding RNA stabilizes ICAM-1 transcript, increasing protein expression. However, studies of ICR involvement in disease have been limited as the promoter is uncharacterized. To address this issue, we undertook a comprehensive in silico analysis of the human ICR gene promoter region. We used genomic evolutionary rate profiling to identify a 115 base pair (bp) sequence within 500 bp upstream of the transcription start site of the annotated human ICR gene that was conserved across 25 eutherian genomes. A second constrained sequence upstream of the orthologous mouse gene (68 bp; conserved across 27 Eutherian genomes including human) was also discovered. Searching these elements identified 33 matrices predictive of binding sites for transcription factors known to be responsive to a broad range of pathological stimuli, including hypoxia, and metabolic and inflammatory proteins. Five phenotype-associated single nucleotide polymorphisms (SNPs) in the immediate vicinity of these elements included four SNPs (i.e. rs2569693, rs281439, rs281440 and rs11575074) predicted to impact binding motifs of transcription factors, and thus the expression of ICR and ICAM-1 genes, with potential to influence disease susceptibility. We verified that human retinal endothelial cells expressed ICR, and observed induction of expression by tumor necrosis factor-α.

  9. A subset of conserved mammalian long non-coding RNAs are fossils of ancestral protein-coding genes.

    PubMed

    Hezroni, Hadas; Ben-Tov Perry, Rotem; Meir, Zohar; Housman, Gali; Lubelsky, Yoav; Ulitsky, Igor

    2017-08-30

    Only a small portion of human long non-coding RNAs (lncRNAs) appear to be conserved outside of mammals, but the events underlying the birth of new lncRNAs in mammals remain largely unknown. One potential source is remnants of protein-coding genes that transitioned into lncRNAs. We systematically compare lncRNA and protein-coding loci across vertebrates, and estimate that up to 5% of conserved mammalian lncRNAs are derived from lost protein-coding genes. These lncRNAs have specific characteristics, such as broader expression domains, that set them apart from other lncRNAs. Fourteen lncRNAs have sequence similarity with the loci of the contemporary homologs of the lost protein-coding genes. We propose that selection acting on enhancer sequences is mostly responsible for retention of these regions. As an example of an RNA element from a protein-coding ancestor that was retained in the lncRNA, we describe in detail a short translated ORF in the JPX lncRNA that was derived from an upstream ORF in a protein-coding gene and retains some of its functionality. We estimate that ~ 55 annotated conserved human lncRNAs are derived from parts of ancestral protein-coding genes, and loss of coding potential is thus a non-negligible source of new lncRNAs. Some lncRNAs inherited regulatory elements influencing transcription and translation from their protein-coding ancestors and those elements can influence the expression breadth and functionality of these lncRNAs.

  10. Identification of the first PAR1 deletion encompassing upstream SHOX enhancers in a family with idiopathic short stature.

    PubMed

    Benito-Sanz, Sara; Aza-Carmona, Miriam; Rodríguez-Estevez, Amaya; Rica-Etxebarria, Ixaso; Gracia, Ricardo; Campos-Barros, Angel; Heath, Karen E

    2012-01-01

    Short stature homeobox-containing gene, MIM 312865 (SHOX) is located within the pseudoautosomal region 1 (PAR1) of the sex chromosomes. Mutations in SHOX or its downstream transcriptional regulatory elements represent the underlying molecular defect in ~60% of Léri-Weill dyschondrosteosis (LWD) and ~5-15% of idiopathic short stature (ISS) patients. Recently, three novel enhancer elements have been identified upstream of SHOX but to date, no PAR1 deletions upstream of SHOX have been observed that only encompass these enhancers in LWD or ISS patients. We set out to search for genetic alterations of the upstream SHOX regulatory elements in 63 LWD and 100 ISS patients with no known alteration in SHOX or the downstream enhancer regions using a specifically designed MLPA assay, which covers the PAR1 upstream of SHOX. An upstream SHOX deletion was identified in an ISS proband and her affected father. The deletion was confirmed and delimited by array-CGH, to extend ~286 kb. The deletion included two of the upstream SHOX enhancers without affecting SHOX. The 13.3-year-old proband had proportionate short stature with normal GH and IGF-I levels. In conclusion, we have identified the first PAR1 deletion encompassing only the upstream SHOX transcription regulatory elements in a family with ISS. The loss of these elements may result in SHOX haploinsufficiency because of decreased SHOX transcription. Therefore, this upstream region should be included in the routine analysis of PAR1 in patients with LWD, LMD and ISS.

  11. Identification of the first PAR1 deletion encompassing upstream SHOX enhancers in a family with idiopathic short stature

    PubMed Central

    Benito-Sanz, Sara; Aza-Carmona, Miriam; Rodríguez-Estevez, Amaya; Rica-Etxebarria, Ixaso; Gracia, Ricardo; Campos-Barros, Ángel; Heath, Karen E

    2012-01-01

    Short stature homeobox-containing gene, MIM 312865 (SHOX) is located within the pseudoautosomal region 1 (PAR1) of the sex chromosomes. Mutations in SHOX or its downstream transcriptional regulatory elements represent the underlying molecular defect in ∼60% of Léri-Weill dyschondrosteosis (LWD) and ∼5–15% of idiopathic short stature (ISS) patients. Recently, three novel enhancer elements have been identified upstream of SHOX but to date, no PAR1 deletions upstream of SHOX have been observed that only encompass these enhancers in LWD or ISS patients. We set out to search for genetic alterations of the upstream SHOX regulatory elements in 63 LWD and 100 ISS patients with no known alteration in SHOX or the downstream enhancer regions using a specifically designed MLPA assay, which covers the PAR1 upstream of SHOX. An upstream SHOX deletion was identified in an ISS proband and her affected father. The deletion was confirmed and delimited by array-CGH, to extend ∼286 kb. The deletion included two of the upstream SHOX enhancers without affecting SHOX. The 13.3-year-old proband had proportionate short stature with normal GH and IGF-I levels. In conclusion, we have identified the first PAR1 deletion encompassing only the upstream SHOX transcription regulatory elements in a family with ISS. The loss of these elements may result in SHOX haploinsufficiency because of decreased SHOX transcription. Therefore, this upstream region should be included in the routine analysis of PAR1 in patients with LWD, LMD and ISS. PMID:22071895

  12. Discovery of functional non-coding conserved regions in the α-synuclein gene locus

    PubMed Central

    Sterling, Lori; Walter, Michael; Ting, Dennis; Schüle, Birgitt

    2014-01-01

    Several single nucleotide polymorphisms (SNPs) and the Rep-1 microsatellite marker of the α-synuclein ( SNCA) gene have consistently been shown to be associated with Parkinson’s disease, but the functional relevance is unclear. Based on these findings we hypothesized that conserved cis-regulatory elements in the SNCA genomic region regulate expression of SNCA, and that SNPs in these regions could be functionally modulating the expression of SNCA, thus contributing to neuronal demise and predisposing to Parkinson’s disease. In a pair-wise comparison of a 206kb genomic region encompassing the SNCA gene, we revealed 34 evolutionary conserved DNA sequences between human and mouse. All elements were cloned into reporter vectors and assessed for expression modulation in dual luciferase reporter assays.  We found that 12 out of 34 elements exhibited either an enhancement or reduction of the expression of the reporter gene. Three elements upstream of the SNCA gene displayed an approximately 1.5 fold (p<0.009) increase in expression. Of the intronic regions, three showed a 1.5 fold increase and two others indicated a 2 and 2.5 fold increase in expression (p<0.002). Three elements downstream of the SNCA gene showed 1.5 fold and 2.5 fold increase (p<0.0009). One element downstream of SNCA had a reduced expression of the reporter gene of 0.35 fold (p<0.0009) of normal activity. Our results demonstrate that the SNCA gene contains cis-regulatory regions that might regulate the transcription and expression of SNCA. Further studies in disease-relevant tissue types will be important to understand the functional impact of regulatory regions and specific Parkinson’s disease-associated SNPs and its function in the disease process. PMID:25566351

  13. Characterization of Rous sarcoma virus polyadenylation site use in vitro

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maciolek, Nicole L.; McNally, Mark T.

    2008-05-10

    Polyadenylation of Rous sarcoma virus (RSV) RNA is inefficient, as approximately 15% of RSV RNAs represent read-through transcripts that use a downstream cellular polyadenylation site (poly(A) site). Read-through transcription has implications for the virus and the host since it is associated with oncogene capture and tumor induction. To explore the basis of inefficient RSV RNA 3'-end formation, we characterized RSV polyadenylation in vitro using HeLa cell nuclear extracts and HEK293 whole cell extracts. RSV polyadenylation substrates composed of the natural 3' end of viral RNA and various lengths of upstream sequence showed little or no polyadenylation, indicating that the RSVmore » poly(A) site is suboptimal. Efficiently used poly(A) sites often have identifiable upstream and downstream elements (USEs and DSEs) in close proximity to the conserved AAUAAA signal. The sequences upstream and downstream of the RSV poly(A) site deviate from those found in efficiently used poly(A) sites, which may explain inefficient RSV polyadenylation. To assess the quality of the RSV USEs and DSEs, the well-characterized SV40 late USEs and/or DSEs were substituted for the RSV elements and vice versa, which showed that the USEs and DSEs from RSV are suboptimal but functional. CstF interacted poorly with the RSV polyadenylation substrate, and the inactivity of the RSV poly(A) site was at least in part due to poor CstF binding since tethering CstF to the RSV substrate activated polyadenylation. Our data are consistent with poor polyadenylation factor binding sites in both the USE and DSE as the basis for inefficient use of the RSV poly(A) site and point to the importance of additional elements within RSV RNA in promoting 3' end formation.« less

  14. The LINEs and SINEs of Entamoeba histolytica: comparative analysis and genomic distribution.

    PubMed

    Bakre, Abhijeet A; Rawal, Kamal; Ramaswamy, Ram; Bhattacharya, Alok; Bhattacharya, Sudha

    2005-07-01

    Autonomous non-long terminal repeat retrotransposons are commonly referred to as long interspersed elements (LINEs). Short non-autonomous elements that borrow the LINE machinery are called SINES. The Entamoeba histolytica genome contains three classes of LINEs and SINEs. Together the EhLINEs/SINEs account for about 6% of the genome. The recognizable functional domains in all three EhLINEs included reverse transcriptase and endonuclease. A novel feature was the presence of two types of members-some with a single long ORF (less frequent) and some with two ORFs (more frequent) in both EhLINE1 and 2. The two ORFs were generated by conserved changes leading to stop codon. Computational analysis of the immediate flanking sequences for each element showed that they inserted in AT-rich sequences, with a preponderance of Ts in the upstream site. The elements were very frequently located close to protein-coding genes and other EhLINEs/SINEs. The possible influence of these elements on expression of neighboring genes needs to be determined.

  15. The Serum Response Factor and a Putative Novel Transcription Factor Regulate Expression of the Immediate-Early Gene Arc/Arg3.1 in Cultured Cortical Neurons

    PubMed Central

    Pintchovski, Sean A.; Peebles, Carol L.; Kim, Hong Joo; Verdin, Eric; Finkbeiner, Steven

    2010-01-01

    The immediate-early effector gene Arc/Arg3.1 is robustly upregulated by synaptic activity associated with learning and memory. Here we show in primary cortical neuron culture that diverse stimuli induce Arc expression through new transcription. Searching for regulatory regions important for Arc transcription, we found nine DNaseI-sensitive nucleosome-depleted sites at this genomic locus. A reporter gene encompassing these sites responded to synaptic activity in an NMDA receptor–dependent manner, consistent with endogenous Arc mRNA. Responsiveness mapped to two enhancer regions ∼6.5 kb and ∼1.4 kb upstream of Arc. We dissected these regions further and found that the proximal enhancer contains a functional and conserved “Zeste-like” response element that binds a putative novel nuclear protein in neurons. Therefore, activity regulates Arc transcription partly by a novel signaling pathway. We also found that the distal enhancer has a functional and highly conserved serum response element. This element binds serum response factor, which is recruited by synaptic activity to regulate Arc. Thus, Arc is the first target of serum response factor that functions at synapses to mediate plasticity. PMID:19193899

  16. Sedimentation, sediment quality, and upstream channel stability, John Redmond Reservoir, east-central Kansas, 1964-2009

    USGS Publications Warehouse

    Juracek, Kyle E.

    2010-01-01

    A combination of available bathymetric-survey information, bottom-sediment coring, and historical streamgage information was used to investigate sedimentation, sediment quality, and upstream channel stability for John Redmond Reservoir, east-central Kansas. Ongoing sedimentation is reducing the ability of the reservoir to serve several purposes including flood control, water supply, and recreation. The total estimated volume and mass of bottom sediment deposited between 1964 and 2009 in the conservation pool of the reservoir was 1.46 billion cubic feet and 55.8 billion pounds, respectively. The estimated sediment volume occupied about 41 percent of the conservation-pool, water-storage capacity of the reservoir. Water-storage capacity in the conservation pool has been lost to sedimentation at a rate of about 1 percent annually. Mean annual net sediment deposition since 1964 in the conservation pool of the reservoir was estimated to be 1.24 billion pounds per year. Mean annual net sediment yield from the reservoir basin was estimated to be 411,000 pounds per square mile per year Information from sediment cores shows that throughout the history of John Redmond Reservoir, total nitrogen concentrations in the deposited sediment generally were uniform indicating consistent nitrogen inputs to the reservoir. Total phosphorus concentrations in the deposited sediment were more variable than total nitrogen indicating the possibility of changing phosphorus inputs to the reservoir. As the principal limiting factor for primary production in most freshwater environments, phosphorus is of particular importance because increased inputs can contribute to accelerated reservoir eutrophication and the production of algal toxins and taste-and-odor compounds. The mean annual net loads of total nitrogen and total phosphorus deposited in the bottom sediment of the reservoir were estimated to be 2,350,000 pounds per year and 1,030,000 pounds per year, respectively. The estimated mean annual net yields of total nitrogen and total phosphorus from the reservoir basin were 779 pounds per square mile per year and 342 pounds per square mile per year, respectively. Trace element concentrations in the bottom sediment of John Redmond Reservoir generally were uniform over time. As is typical for eastern Kansas reservoirs, arsenic, chromium, and nickel concentrations typically exceeded the threshold-effects guidelines, which represent the concentrations above which toxic biological effects occasionally occur. Trace element concentrations did not exceed the probable-effects guidelines (available for eight trace elements), which represent the concentrations above which toxic biological effects usually or frequently occur. Organochlorine compounds either were not detected or were detected at concentrations that were less than the threshold-effects guidelines. Stream channel banks, compared to channel beds, likely are a more important source of sediment to John Redmond Reservoir from the upstream basin. Other sediment sources include surface-soil erosion in the basin and shoreline erosion in the reservoir.

  17. Monocyte-specific Accessibility of a Matrix Attachment Region in the Tumor Necrosis Factor Locus*

    PubMed Central

    Biglione, Sebastian; Tsytsykova, Alla V.; Goldfeld, Anne E.

    2011-01-01

    Regulation of TNF gene expression is cell type- and stimulus-specific. We have previously identified highly conserved noncoding regulatory elements within DNase I-hypersensitive sites (HSS) located 9 kb upstream (HSS−9) and 3 kb downstream (HSS+3) of the TNF gene, which play an important role in the transcriptional regulation of TNF in T cells. They act as enhancers and interact with the TNF promoter and with each other, generating a higher order chromatin structure. Here, we report a novel monocyte-specific AT-rich DNase I-hypersensitive element located 7 kb upstream of the TNF gene (HSS−7), which serves as a matrix attachment region in monocytes. We show that HSS−7 associates with topoisomerase IIα (Top2) in vivo and that induction of endogenous TNF mRNA expression is suppressed by etoposide, a Top2 inhibitor. Moreover, Top2 binds to and cleaves HSS−7 in in vitro analysis. Thus, HSS−7, which is selectively accessible in monocytes, can tether the TNF locus to the nuclear matrix via matrix attachment region formation, potentially promoting TNF gene expression by acting as a Top2 substrate. PMID:22027829

  18. Identification of estrogen-responsive genes using a genome-wide analysis of promoter elements for transcription factor binding sites.

    PubMed

    Kamalakaran, Sitharthan; Radhakrishnan, Senthil K; Beck, William T

    2005-06-03

    We developed a pipeline to identify novel genes regulated by the steroid hormone-dependent transcription factor, estrogen receptor, through a systematic analysis of upstream regions of all human and mouse genes. We built a data base of putative promoter regions for 23,077 human and 19,984 mouse transcripts from National Center for Biotechnology Information annotation and 8793 human and 6785 mouse promoters from the Data Base of Transcriptional Start Sites. We used this data base of putative promoters to identify potential targets of estrogen receptor by identifying estrogen response elements (EREs) in their promoters. Our program correctly identified EREs in genes known to be regulated by estrogen in addition to several new genes whose putative promoters contained EREs. We validated six genes (KIAA1243, NRIP1, MADH9, NME3, TPD52L, and ABCG2) to be estrogen-responsive in MCF7 cells using reverse transcription PCR. To allow for extensibility of our program in identifying targets of other transcription factors, we have built a Web interface to access our data base and programs. Our Web-based program for Promoter Analysis of Genome, PAGen@UIC, allows a user to identify putative target genes for vertebrate transcription factors through the analysis of their upstream sequences. The interface allows the user to search the human and mouse promoter data bases for potential target genes containing one or more listed transcription factor binding sites (TFBSs) in their upstream elements, using either regular expression-based consensus or position weight matrices. The data base can also be searched for promoters harboring user-defined TFBSs given as a consensus or a position weight matrix. Furthermore, the user can retrieve putative promoter sequences for any given gene together with identified TFBSs located on its promoter. Orthologous promoters are also analyzed to determine conserved elements.

  19. The leukemia associated ETO nuclear repressor gene is regulated by the GATA-1 transcription factor in erythroid/megakaryocytic cells

    PubMed Central

    2010-01-01

    Background The Eight-Twenty-One (ETO) nuclear co-repressor gene belongs to the ETO homologue family also containing Myeloid Translocation Gene on chromosome 16 (MTG16) and myeloid translocation Gene-Related protein 1 (MTGR1). By chromosomal translocations ETO and MTG16 become parts of fusion proteins characteristic of morphological variants of acute myeloid leukemia. Normal functions of ETO homologues have as yet not been examined. The goal of this work was to identify structural and functional promoter elements upstream of the coding sequence of the ETO gene in order to explore lineage-specific hematopoietic expression and get hints to function. Results A putative proximal ETO promoter was identified within 411 bp upstream of the transcription start site. Strong ETO promoter activity was specifically observed upon transfection of a promoter reporter construct into erythroid/megakaryocytic cells, which have endogeneous ETO gene activity. An evolutionary conserved region of 228 bp revealed potential cis-elements involved in transcription of ETO. Disruption of the evolutionary conserved GATA -636 consensus binding site repressed transactivation and disruption of the ETS1 -705 consensus binding site enhanced activity of the ETO promoter. The promoter was stimulated by overexpression of GATA-1 into erythroid/megakaryocytic cells. Electrophoretic mobility shift assay with erythroid/megakaryocytic cells showed specific binding of GATA-1 to the GATA -636 site. Furthermore, results from chromatin immunoprecipitation showed GATA-1 binding in vivo to the conserved region of the ETO promoter containing the -636 site. The results suggest that the GATA -636 site may have a role in activation of the ETO gene activity in cells with erythroid/megakaryocytic potential. Leukemia associated AML1-ETO strongly suppressed an ETO promoter reporter in erythroid/megakaryocytic cells. Conclusions We demonstrate that the GATA-1 transcription factor binds and transactivates the ETO proximal promoter in an erythroid/megakaryocytic-specific manner. Thus, trans-acting factors that are essential in erythroid/megakaryocytic differentiation govern ETO expression. PMID:20487545

  20. Highly conserved non-coding elements on either side of SOX9 associated with Pierre Robin sequence.

    PubMed

    Benko, Sabina; Fantes, Judy A; Amiel, Jeanne; Kleinjan, Dirk-Jan; Thomas, Sophie; Ramsay, Jacqueline; Jamshidi, Negar; Essafi, Abdelkader; Heaney, Simon; Gordon, Christopher T; McBride, David; Golzio, Christelle; Fisher, Malcolm; Perry, Paul; Abadie, Véronique; Ayuso, Carmen; Holder-Espinasse, Muriel; Kilpatrick, Nicky; Lees, Melissa M; Picard, Arnaud; Temple, I Karen; Thomas, Paul; Vazquez, Marie-Paule; Vekemans, Michel; Roest Crollius, Hugues; Hastie, Nicholas D; Munnich, Arnold; Etchevers, Heather C; Pelet, Anna; Farlie, Peter G; Fitzpatrick, David R; Lyonnet, Stanislas

    2009-03-01

    Pierre Robin sequence (PRS) is an important subgroup of cleft palate. We report several lines of evidence for the existence of a 17q24 locus underlying PRS, including linkage analysis results, a clustering of translocation breakpoints 1.06-1.23 Mb upstream of SOX9, and microdeletions both approximately 1.5 Mb centromeric and approximately 1.5 Mb telomeric of SOX9. We have also identified a heterozygous point mutation in an evolutionarily conserved region of DNA with in vitro and in vivo features of a developmental enhancer. This enhancer is centromeric to the breakpoint cluster and maps within one of the microdeletion regions. The mutation abrogates the in vitro enhancer function and alters binding of the transcription factor MSX1 as compared to the wild-type sequence. In the developing mouse mandible, the 3-Mb region bounded by the microdeletions shows a regionally specific chromatin decompaction in cells expressing Sox9. Some cases of PRS may thus result from developmental misexpression of SOX9 due to disruption of very-long-range cis-regulatory elements.

  1. The Stream-Catchment (StreamCat) Dataset

    EPA Science Inventory

    Stream environments reflect, in part, the hydrologic integration of upstream landscapes. Characterizing upstream landscape features is critical for effectively understanding, managing, and conserving riverine ecosystems. However, watershed delineation is a major challenge if hund...

  2. Identification of cis-acting regulatory elements in the human oxytocin gene promoter.

    PubMed

    Richard, S; Zingg, H H

    1991-12-01

    The expression of hormone-inducible genes is determined by the interaction of trans-acting factors with hormone-inducible elements and elements mediating basal and cell-specific expression. We have shown earlier that the gene encoding the hypothalamic nonapeptide oxytocin (OT) is under the control of an estrogen response element (ERE). The present study was aimed at identifying cis-acting elements mediating basal expression of the OT gene. A construct containing sequences -381 to +36 of the human OT gene was linked to a reporter gene and transiently transfected into a series of neuronal and nonneuronal cell lines. Expression of this construct was cell specific: it was highest in the neuroblastoma-derived cell line, Neuro-2a, and lowest in NIH 3T3 and JEG-3 cells. By 5' deletion analysis, we determined that a segment from -49 to +36 was capable of mediating cells-pecific promoter activity. Within this segment, we identified three proximal promoter elements (PPE-1, PPE-2, and PPE-3) that are each required for promoter activity. Most notably, mutation of a conserved purine-rich element (GAGAGA) contained within PPE-2 leads to a 10-fold decrease in promoter strength. Gel mobility shift analysis with three different double-stranded oligonucleotides demonstrated that each proximal promoter element binds distinct nuclear factors. In each case, only the homologous oligonucleotide, but neither of the oligonucleotides corresponding to adjacent elements, was able to act as a competitor. Thus, a different set of factors appears to bind independently to each element. By reinserting the homologous ERE or a heterologous glucocorticoid response element upstream of intact or altered proximal promoter segments we determined that removal or mutation of proximal promoter elements decreases basal expression, but does not abrogate the hormone responsiveness of the promoter. In conclusion, these results indicate that an important component of the transcriptional activity of the OT promoter resides in a small region extending only 50 bases upstream of the cap site and that this activity is the result of a cooperative interaction of at least three distinct proximal promoter elements.

  3. Mutually Exclusive Splicing of the Insect Dscam Pre-mRNA Directed by Competing Intronic RNA Secondary Structures

    PubMed Central

    Graveley, Brenton R.

    2008-01-01

    Summary Drosophila Dscam encodes 38,016 distinct axon guidance receptors through the mutually exclusive alternative splicing of 95 variable exons. Importantly, known mechanisms that ensure the mutually exclusive splicing of pairs of exons cannot explain this phenomenon in Dscam. I have identified two classes of conserved elements in the Dscam exon 6 cluster, which contains 48 alternative exons—the docking site, located in the intron downstream of constitutive exon 5, and the selector sequences, which are located upstream of each exon 6 variant. Strikingly, each selector sequence is complementary to a portion of the docking site, and this pairing juxtaposes one, and only one, alternative exon to the upstream constitutive exon. The mutually exclusive nature of the docking site:selector sequence interactions suggests that the formation of these competing RNA structures is a central component of the mechanism guaranteeing that only one exon 6 variant is included in each Dscam mRNA. PMID:16213213

  4. The chloroplast tRNALys(UUU) gene from mustard (Sinapis alba) contains a class II intron potentially coding for a maturase-related polypeptide.

    PubMed

    Neuhaus, H; Link, G

    1987-01-01

    The trnK gene endocing the tRNALys(UUU) has been located on mustard (Sinapis alba) chloroplast DNA, 263 bp upstream of the psbA gene on the same strand. The nucleotide sequence of the trnK gene and its flanking regions as well as the putative transcription start and termination sites are shown. The 5' end of the transcript lies 121 bp upstream of the 5' tRNA coding region and is preceded by procaryotic-type "-10" and "-35" sequence elements, while the 3' end maps 2.77 kb downstream to a DNA region with possible stemloop secondary structure. The anticodon loop of the tRNALys is interrupted by a 2,574 bp intron containing a long open reading frame, which codes for 524 amino acids. Based on conserved stem and loop structures, this intron has characteristic features of a class II intron. A region near the carboxyl terminus of the derived polypeptide appears structurally related to maturases.

  5. Activation of HIV-1 pre-mRNA 3' processing in vitro requires both an upstream element and TAR.

    PubMed Central

    Gilmartin, G M; Fleming, E S; Oetjen, J

    1992-01-01

    The architecture of the human immunodeficiency virus type 1 (HIV-1) genome presents an intriguing dilemma for the 3' processing of viral transcripts--to disregard a canonical 'core' poly(A) site processing signal present at the 5' end of the transcript and yet to utilize efficiently an identical signal that resides at the 3' end of the message. The choice of processing sites in HIV-1 appears to be influenced by two factors: (i) proximity to the cap site, and (ii) sequences upstream of the core poly(A) site. We now demonstrate that an in vivo-defined upstream element that resides within the U3 region, 76 nucleotides upstream of the AAUAAA hexamer, acts specifically to enhance 3' processing at the HIV-1 core poly(A) site in vitro. We furthermore show that efficient in vitro 3' processing requires the RNA stem-loop structure of TAR, which serves to juxtapose spatially the upstream element and the core poly(A) site. An analysis of the stability of 3' processing complexes formed at the HIV-1 poly(A) site in vitro suggests that the upstream element may function by increasing processing complex stability at the core poly(A) site. Images PMID:1425577

  6. Finding functional features in Saccharomyces genomes by phylogenetic footprinting.

    PubMed

    Cliften, Paul; Sudarsanam, Priya; Desikan, Ashwin; Fulton, Lucinda; Fulton, Bob; Majors, John; Waterston, Robert; Cohen, Barak A; Johnston, Mark

    2003-07-04

    The sifting and winnowing of DNA sequence that occur during evolution cause nonfunctional sequences to diverge, leaving phylogenetic footprints of functional sequence elements in comparisons of genome sequences. We searched for such footprints among the genome sequences of six Saccharomyces species and identified potentially functional sequences. Comparison of these sequences allowed us to revise the catalog of yeast genes and identify sequence motifs that may be targets of transcriptional regulatory proteins. Some of these conserved sequence motifs reside upstream of genes with similar functional annotations or similar expression patterns or those bound by the same transcription factor and are thus good candidates for functional regulatory sequences.

  7. Negative and Translation Termination-Dependent Positive Control of FLI-1 Protein Synthesis by Conserved Overlapping 5′ Upstream Open Reading Frames in Fli-1 mRNA

    PubMed Central

    Sarrazin, Sandrine; Starck, Joëlle; Gonnet, Colette; Doubeikovski, Alexandre; Melet, Fabrice; Morle, François

    2000-01-01

    The proto-oncogene Fli-1 encodes a transcription factor of the ets family whose overexpression is associated with multiple virally induced leukemias in mouse, inhibits murine and avian erythroid cell differentiation, and induces drastic perturbations of early development in Xenopus. This study demonstrates the surprisingly sophisticated regulation of Fli-1 mRNA translation. We establish that two FLI-1 protein isoforms (of 51 and 48 kDa) detected by Western blotting in vivo are synthesized by alternative translation initiation through the use of two highly conserved in-frame initiation codons, AUG +1 and AUG +100. Furthermore, we show that the synthesis of these two FLI-1 isoforms is regulated by two short overlapping 5′ upstream open reading frames (uORF) beginning at two highly conserved upstream initiation codons, AUG −41 and GUG −37, and terminating at two highly conserved stop codons, UGA +35 and UAA +15. The mutational analysis of these two 5′ uORF revealed that each of them negatively regulates FLI-1 protein synthesis by precluding cap-dependent scanning to the 48- and 51-kDa AUG codons. Simultaneously, the translation termination of the two 5′ uORF appears to enhance 48-kDa protein synthesis, by allowing downstream reinitiation at the 48-kDa AUG codon, and 51-kDa protein synthesis, by allowing scanning ribosomes to pile up and consequently allowing upstream initiation at the 51-kDa AUG codon. To our knowledge, this is the first example of a cellular mRNA displaying overlapping 5′ uORF whose translation termination appears to be involved in the positive control of translation initiation at both downstream and upstream initiation codons. PMID:10757781

  8. Towards national mapping of aquatic condition (I): The Stream-Catchment (StreamCat) Dataset

    EPA Science Inventory

    Stream environments reflect, in part, the hydrologic integration of upstream landscapes. Characterizing upstream features is critical for effectively understanding, managing, and conserving riverine ecosystems. However, watershed delineation is a major challenge if hundreds to th...

  9. Identification of an evolutionarily conserved regulatory element of the zebrafish col2a1a gene.

    PubMed

    Dale, Rodney M; Topczewski, Jacek

    2011-09-15

    Zebrafish (Danio rerio) is an excellent model organism for the study of vertebrate development including skeletogenesis. Studies of mammalian cartilage formation were greatly advanced through the use of a cartilage specific regulatory element of the Collagen type II alpha 1 (Col2a1) gene. In an effort to isolate such an element in zebrafish, we compared the expression of two col2a1 homologues and found that expression of col2a1b, a previously uncharacterized zebrafish homologue, only partially overlaps with col2a1a. We focused our analysis on col2a1a, as it is expressed in both the stacked chondrocytes and the perichondrium. By comparing the genomic sequence surrounding the predicted transcriptional start site of col2a1a among several species of teleosts we identified a small highly conserved sequence (R2) located 1.7 kb upstream of the presumptive transcriptional initiation site. Interestingly, neither the sequence nor location of this element is conserved between teleost and mammalian Col2a1. We generated transient and stable transgenic lines with just the R2 element or the entire 1.7 kb fragment 5' of the transcriptional initiation site. The identified regulatory elements enable the tracking of cellular development in various tissues by driving robust reporter expression in craniofacial cartilage, ear, notochord, floor plate, hypochord and fins in a pattern similar to the expression of endogenous col2a1a. Using a reporter gene driven by the R2 regulatory element, we analyzed the morphogenesis of the notochord sheath cells as they withdraw from the stack of initially uniform cells and encase the inflating vacuolated notochord cells. Finally, we show that like endogenous col2a1a, craniofacial expression of these reporter constructs depends on Sox9a transcription factor activity. At the same time, notochord expression is maintained after Sox9a knockdown, suggesting that other factors can activate expression through the identified regulatory element in this tissue. Copyright © 2011 Elsevier Inc. All rights reserved.

  10. Identification of an evolutionarily conserved regulatory element of the zebrafish col2a1a gene

    PubMed Central

    Dale, Rodney M.; Topczewski, Jacek

    2011-01-01

    Zebrafish (Danio rerio) is an excellent model organism for the study of vertebrate development including skeletogenesis. Studies of mammalian cartilage formation were greatly advanced through the use of a cartilage specific regulatory element of the Collagen type II alpha 1 (Col2a1) gene. In an effort to isolate such an element in zebrafish, we compared the expression of two col2a1 homologues and found that expression of col2a1b, a previously uncharacterized zebrafish homologue, only partially overlaps with col2a1a. We focused our analysis on col2a1a, as it is expressed in both the stacked chondrocytes and the perichondrium. By comparing the genomic sequence surrounding the predicted transcriptional start site of col2a1a among several species of teleosts we identified a small highly conserved sequence (R2) located 1.7 kb upstream of the presumptive transcriptional initiation site. Interestingly, neither the sequence nor location of this element is conserved between teleost and mammalian Col2a1. We generated transient and stable transgenic lines with just the R2 element or the entire 1.7 kb fragment 5’ of the transcriptional initiation site. The identified regulatory elements enable the tracking of cellular development in various tissues by driving robust reporter expression in craniofacial cartilage, ear, notochord, floor plate, hypochord and fins in a pattern similar to the expression of endogenous col2a1a. Using a reporter gene driven by the R2 regulatory element, we analyzed the morphogenesis of the notochord sheath cells as they withdraw from the stack of initially uniform cells and encase the inflating vacuolated notochord cells. Finally, we show that like endogenous col2a1a, craniofacial expression of these reporter constructs depends on Sox9a transcription factor activity. At the same time, notochord expression is maintained after Sox9a knockdown, suggesting that other factors can activate expression through the identified regulatory element in this tissue. PMID:21723274

  11. Staphylococcal SCCmec elements encode an active MCM-like helicase and thus may be replicative

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mir-Sanchis, Ignacio; Roman, Christina A.; Misiura, Agnieszka

    2016-08-29

    Methicillin-resistant Staphylococcus aureus (MRSA) is a public-health threat worldwide. Although the mobile genomic island responsible for this phenotype, staphylococcal cassette chromosome (SCC), has been thought to be nonreplicative, we predicted DNA-replication-related functions for some of the conserved proteins encoded by SCC. We show that one of these, Cch, is homologous to the self-loading initiator helicases of an unrelated family of genomic islands, that it is an active 3'-to-5' helicase and that the adjacent ORF encodes a single-stranded DNA–binding protein. Our 2.9-Å crystal structure of intact Cch shows that it forms a hexameric ring. Cch, like the archaeal and eukaryotic MCM-familymore » replicative helicases, belongs to the pre–sensor II insert clade of AAA+ ATPases. Additionally, we found that SCC elements are part of a broader family of mobile elements, all of which encode a replication initiator upstream of their recombinases. Replication after excision would enhance the efficiency of horizontal gene transfer.« less

  12. Genome-wide identification and expression analysis of YTH domain-containing RNA-binding protein family in cucumber (Cucumis sativus).

    PubMed

    Zhou, Yong; Hu, Lifang; Jiang, Lunwei; Liu, Shiqiang

    2018-06-01

    YTH domain-containing RNA-binding proteins are involved in post-transcriptional regulation and play important roles in the growth and development as well as abiotic stress responses of plants. However, YTH genes have not been previously studied in cucumber (Cucumis sativus). In this study, a total of five YTH genes (CsYTH1-CsYTH5) were identified in cucumber, which could be mapped on three out of the seven cucumber chromosomes. All CsYTH proteins had highly conserved C-terminal YTH domains, and two of them (CsYTH1 and CsYTH4) harbored extra CCCH and P/Q/N-rich domains. The phylogenesis, conserved motifs and exon-intron structure of YTH genes from cucumber, Arabidopsis and rice were also analyzed. The phylogenetically closely clustered YTHs shared similar gene structures and conserved motifs. An analysis of the cis-acting regulatory elements in the upstream region of these genes resulted in the identification of many cis-elements related to stress, hormone and development. Expression analysis based on the transcriptome data showed that some CsYTHs had development- or tissue-specific expression. In addition, their expression levels were altered under various stresses such as salt, drought, cold, and abscisic acid (ABA) treatments. These findings lay the foundation for the functional analysis of CsYTHs in the future.

  13. Highly tissue specific expression of Sphinx supports its male courtship related role in Drosophila melanogaster.

    PubMed

    Chen, Ying; Dai, Hongzheng; Chen, Sidi; Zhang, Luoying; Long, Manyuan

    2011-04-26

    Sphinx is a lineage-specific non-coding RNA gene involved in regulating courtship behavior in Drosophila melanogaster. The 5' flanking region of the gene is conserved across Drosophila species, with the proximal 300 bp being conserved out to D. virilis and a further 600 bp region being conserved amongst the melanogaster subgroup (D. melanogaster, D. simulans, D. sechellia, D. yakuba, and D. erecta). Using a green fluorescence protein transformation system, we demonstrated that a 253 bp region of the highly conserved segment was sufficient to drive sphinx expression in male accessory gland. GFP signals were also observed in brain, wing hairs and leg bristles. An additional ∼800 bp upstream region was able to enhance expression specifically in proboscis, suggesting the existence of enhancer elements. Using anti-GFP staining, we identified putative sphinx expression signal in the brain antennal lobe and inner antennocerebral tract, suggesting that sphinx might be involved in olfactory neuron mediated regulation of male courtship behavior. Whole genome expression profiling of the sphinx knockout mutation identified significant up-regulated gene categories related to accessory gland protein function and odor perception, suggesting sphinx might be a negative regulator of its target genes.

  14. Highly Tissue Specific Expression of Sphinx Supports Its Male Courtship Related Role in Drosophila melanogaster

    PubMed Central

    Chen, Sidi; Zhang, Luoying; Long, Manyuan

    2011-01-01

    Sphinx is a lineage-specific non-coding RNA gene involved in regulating courtship behavior in Drosophila melanogaster. The 5′ flanking region of the gene is conserved across Drosophila species, with the proximal 300 bp being conserved out to D. virilis and a further 600 bp region being conserved amongst the melanogaster subgroup (D. melanogaster, D. simulans, D. sechellia, D. yakuba, and D. erecta). Using a green fluorescence protein transformation system, we demonstrated that a 253 bp region of the highly conserved segment was sufficient to drive sphinx expression in male accessory gland. GFP signals were also observed in brain, wing hairs and leg bristles. An additional ∼800 bp upstream region was able to enhance expression specifically in proboscis, suggesting the existence of enhancer elements. Using anti-GFP staining, we identified putative sphinx expression signal in the brain antennal lobe and inner antennocerebral tract, suggesting that sphinx might be involved in olfactory neuron mediated regulation of male courtship behavior. Whole genome expression profiling of the sphinx knockout mutation identified significant up-regulated gene categories related to accessory gland protein function and odor perception, suggesting sphinx might be a negative regulator of its target genes. PMID:21541324

  15. Cloning and bacterial expression of adenosine-5'-triphosphate sulfurylase from the enteric protozoan parasite Entamoeba histolytica.

    PubMed

    Nozaki, T; Arase, T; Shigeta, Y; Asai, T; Leustek, T; Takeuchi, T

    1998-12-08

    A gene encoding adenosine-5'-triphosphate sulfurylase (AS) was cloned from the enteric protozoan parasite Entamoeba histolytica by polymerase chain reaction using degenerate oligonucleotide primers corresponding to conserved regions of the protein from a variety of organisms. The deduced amino acid sequence of E. histolytica AS revealed a calculated molecular mass of 47925 Da and an unusual basic pI of 9.38. The amebic protein sequence showed 23-48% identities with AS from bacteria, yeasts, fungi, plants, and animals with the highest identities being to Synechocystis sp. and Bacillus subtilis (48 and 44%, respectively). Four conserved blocks including putative sulfate-binding and phosphate-binding regions were highly conserved in the E. histolytica AS. The upstream region of the AS gene contained three conserved elements reported for other E. histolytica genes. A recombinant E. histolytica AS revealed enzymatic activity, measured in both the forward and reverse directions. Expression of the E. histolytica AS complemented cysteine auxotrophy of the AS-deficient Escherichia coli strains. Genomic hybridization revealed that the AS gene exists as a single copy gene. In the literature, this is the first description of an AS gene in Protozoa.

  16. Impacts of climate and land use change on reservoir sedimentation

    USDA-ARS?s Scientific Manuscript database

    Impacts of evolving climate and implementation of upstream soil conservation measures on sedimentation of the Fort Cobb Reservoir in West-Central Oklahoma are investigated. Conservation practices before the 1950s were few. Between 1950 and 2008, extensive soil conservation measures were implemented...

  17. A Hox regulatory network of hindbrain segmentation is conserved to the base of vertebrates.

    PubMed

    Parker, Hugo J; Bronner, Marianne E; Krumlauf, Robb

    2014-10-23

    A defining feature governing head patterning of jawed vertebrates is a highly conserved gene regulatory network that integrates hindbrain segmentation with segmentally restricted domains of Hox gene expression. Although non-vertebrate chordates display nested domains of axial Hox expression, they lack hindbrain segmentation. The sea lamprey, a jawless fish, can provide unique insights into vertebrate origins owing to its phylogenetic position at the base of the vertebrate tree. It has been suggested that lamprey may represent an intermediate state where nested Hox expression has not been coupled to the process of hindbrain segmentation. However, little is known about the regulatory network underlying Hox expression in lamprey or its relationship to hindbrain segmentation. Here, using a novel tool that allows cross-species comparisons of regulatory elements between jawed and jawless vertebrates, we report deep conservation of both upstream regulators and segmental activity of enhancer elements across these distant species. Regulatory regions from diverse gnathostomes drive segmental reporter expression in the lamprey hindbrain and require the same transcriptional inputs (for example, Kreisler (also known as Mafba), Krox20 (also known as Egr2a)) in both lamprey and zebrafish. We find that lamprey hox genes display dynamic segmentally restricted domains of expression; we also isolated a conserved exonic hox2 enhancer from lamprey that drives segmental expression in rhombomeres 2 and 4. Our results show that coupling of Hox gene expression to segmentation of the hindbrain is an ancient trait with origin at the base of vertebrates that probably led to the formation of rhombomeric compartments with an underlying Hox code.

  18. Apparatus for purifying exhaust gases of internal combustion engines

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kakinuma, O.; Oya, H.

    1980-06-03

    Apparatus for purifying the exhaust gases of internal combustion engines is disclosed is comprised of a pair of upstream exhaust pipes, a catalytic converter, and a downstream exhaust pipe. The catalytic converter comprises a shell having an inlet chamber, catalyst chamber, and an outlet chamber. The axial lines of the inlet ports are arranged to cross each other in the inlet chamber at a position near, but upstream of, the upstream facing end of said monolithic catalyst element, so that gas flow can diffuse to the entire plane of the element.

  19. The conserved upstream region of lscB/C determines expression of different levansucrase genes in plant pathogen Pseudomonas syringae

    PubMed Central

    2014-01-01

    Background Pseudomonas syringae pv. glycinea PG4180 is an opportunistic plant pathogen which causes bacterial blight of soybean plants. It produces the exopolysaccharide levan by the enzyme levansucrase. Levansucrase has three gene copies in PG4180, two of which, lscB and lscC, are expressed while the third, lscA, is cryptic. Previously, nucleotide sequence alignments of lscB/C variants in various P. syringae showed that a ~450-bp phage-associated promoter element (PAPE) including the first 48 nucleotides of the ORF is absent in lscA. Results Herein, we tested whether this upstream region is responsible for the expression of lscB/C and lscA. Initially, the transcriptional start site for lscB/C was determined. A fusion of the PAPE with the ORF of lscA (lscB UpN A) was generated and introduced to a levan-negative mutant of PG4180. Additionally, fusions comprising of the non-coding part of the upstream region of lscB with lscA (lscB Up A) or the upstream region of lscA with lscB (lscA Up B) were generated. Transformants harboring the lscB UpN A or the lscB Up A fusion, respectively, showed levan formation while the transformant carrying lscA Up B did not. qRT-PCR and Western blot analyses showed that lscB UpN A had an expression similar to lscB while lscB Up A had a lower expression. Accuracy of protein fusions was confirmed by MALDI-TOF peptide fingerprinting. Conclusions Our data suggested that the upstream sequence of lscB is essential for expression of levansucrase while the N-terminus of LscB mediates an enhanced expression. In contrast, the upstream region of lscA does not lead to expression of lscB. We propose that lscA might be an ancestral levansucrase variant upstream of which the PAPE got inserted by potentially phage-mediated transposition events leading to expression of levansucrase in P. syringae. PMID:24670199

  20. Quantitative simulation tools to analyze up- and downstream interactions of soil and water conservation measures: supporting policy making in the Green Water Credits program of Kenya.

    PubMed

    Hunink, J E; Droogers, P; Kauffman, S; Mwaniki, B M; Bouma, J

    2012-11-30

    Upstream soil and water conservation measures in catchments can have positive impact both upstream in terms of less erosion and higher crop yields, but also downstream by less sediment flow into reservoirs and increased groundwater recharge. Green Water Credits (GWC) schemes are being developed to encourage upstream farmers to invest in soil and water conservation practices which will positively effect upstream and downstream water availability. Quantitative information on water and sediment fluxes is crucial as a basis for such financial schemes. A pilot design project in the large and strategically important Upper-Tana Basin in Kenya has the objective to develop a methodological framework for this purpose. The essence of the methodology is the integration and use of a collection of public domain tools and datasets: the so-called Green water and Blue water Assessment Toolkit (GBAT). This toolkit was applied in order to study different options to implement GWC in agricultural rainfed land for the pilot study. Impact of vegetative contour strips, mulching, and tied ridges were determined for: (i) three upstream key indicators: soil loss, crop transpiration and soil evaporation, and (ii) two downstream indicators: sediment inflow in reservoirs and groundwater recharge. All effects were compared with a baseline scenario of average conditions. Thus, not only actual land management was considered but also potential benefits of changed land use practices. Results of the simulations indicate that especially applying contour strips or tied ridges significantly reduces soil losses and increases groundwater recharge in the catchment. The model was used to build spatial expressions of the proposed management practices in order to assess their effectiveness. The developed procedure allows exploring the effects of soil conservation measures in a catchment to support the implementation of GWC. Copyright © 2012 Elsevier Ltd. All rights reserved.

  1. Determination of the promoter region of mouse ribosomal RNA gene by an in vitro transcription system.

    PubMed Central

    Yamamoto, O; Takakusa, N; Mishima, Y; Kominami, R; Muramatsu, M

    1984-01-01

    Sequences required for a faithful and efficient transcription of a cloned mouse ribosomal RNA gene (rDNA) are determined by testing a series of deletion mutants in an in vitro transcription system utilizing two kinds of mouse cellular extract. Deletion of sequences upstream of -40 or downstream of +52 causes only slight reduction in promoter activity as compared with the "wild-type" template. For upstream deletion mutants, the removal of a sequence between -40 and -35 causes a significant decrease in the capacity to direct efficient initiation. This decrease becomes more pronounced when the deletion reaches -32 and the sequence A-T-C-T-T-T, conserved among mouse, rat, and human rDNAs, is lost. Residual template activity is further reduced as more upstream sequence is deleted and finally becomes undetectable when the deletion is extended from -22 down to -17, corresponding to the loss of the conserved sequence T-A-T-T-G. As for downstream deletion mutants, the removal of the sequence downstream of +23 causes some (and further deletions up to +11 cause a more) serious decrease in template activity in vitro. These deletions involve other conserved sequences downstream of the transcription start site. However, the removal of the original transcription start site does not abolish the transcription initiation completely, provided that the whole upstream sequence is intact. Images PMID:6320178

  2. The heptanucleotide motif GAGACGC is a key component of a cis-acting promoter element that is critical for SnSAG1 expression in Sarcocystis neurona.

    PubMed

    Gaji, Rajshekhar Y; Howe, Daniel K

    2009-07-01

    The apicomplexan parasite Sarcocystis neurona undergoes a complex process of intracellular development, during which many genes are temporally regulated. The described study was undertaken to begin identifying the basic promoter elements that control gene expression in S. neurona. Sequence analysis of the 5'-flanking region of five S. neurona genes revealed a conserved heptanucleotide motif GAGACGC that is similar to the WGAGACG motif described upstream of multiple genes in Toxoplasma gondii. The promoter region for the major surface antigen gene SnSAG1, which contains three heptanucleotide motifs within 135 bases of the transcription start site, was dissected by functional analysis using a dual luciferase reporter assay. These analyses revealed that a minimal promoter fragment containing all three motifs was sufficient to drive reporter molecule expression, with the presence and orientation of the 5'-most heptanucleotide motif being absolutely critical for promoter function. Further studies should help to identify additional sequence elements important for promoter function and for controlling gene expression during intracellular development by this apicomplexan pathogen.

  3. Ancestral multipartite units in light-responsive plant promoters have structural features correlating with specific phototransduction pathways.

    PubMed Central

    Argüello-Astorga, G R; Herrera-Estrella, L R

    1996-01-01

    Regulation of plant gene transcription by light is mediated by multipartite cis-regulatory units. Previous attempts to identify structural features that are common to all light-responsive elements (LREs) have been unsuccessful. To address the question of what is needed to confer photoresponsiveness to a promoter, the upstream sequences from more than 110 light-regulated plant genes were analyzed by a new, phylogenetic-structural method. As a result, 30 distinct conserved DNA module arrays (CMAs) associated with light-responsive promoter regions were identified. Several of these CMAs have remained invariant throughout the evolutionary radiation of angiosperms and are conserved between homologous genes as well as between members of different gene families. The identified CMAs share a gene superfamily-specific core that correlates with the particular phytochrome-dependent transduction pathway that controls their expression, i.e. ACCTA(A/C)C(A/C) for the cGMP-dependent phenylpropanoid metabolism-associated genes, and GATA(A/T)GR for the Ca2+/calmodulin-dependent photosynthesis-associated nuclear genes. In addition to suggesting a general model for the functional and structural organization of LREs, the data obtained in this study indicate that angiosperm LREs probably evolved from complex cis-acting elements involved in regulatory processes other than photoregulation in gymnosperms. PMID:8938415

  4. Two ABREs, two redundant root-specific and one W-box cis-acting elements are functional in the sunflower HAHB4 promoter.

    PubMed

    Manavella, Pablo A; Dezar, Carlos A; Ariel, Federico D; Chan, Raquel L

    2008-10-01

    HAHB4 is a sunflower gene encoding a homeodomain-leucine zipper (HD-Zip) transcription factor. It was previously demonstrated that this gene is regulated at the transcriptional level by several abiotic factors and hormones. A previous analysis in the PLACE database revealed the presence of four putative ABREs. In this work these four elements and also one W-box and two root-specific expression elements were characterized as functional. Site-directed mutagenesis on the promoter, stable transformation of Arabidopis plants as well as transient transformation of sunflower leaves, were performed. The analysis of the transformants was carried out by histochemistry and real time RT-PCR. The results indicate that just one ABRE out of the four is responsible for ABA, NaCl and drought regulation. However, NaCl induction occurs also by an additional ABA-independent way involving another two overlapped ABREs. On the other hand, it was determined that the W-box located 5' upstream is responsive to ethylene and only two root-specific expression elements, among the several detected, are functional but redundant. Conservation of molecular mechanisms between sunflower and Arabidopsis is strongly supported by this experimental work.

  5. Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

    PubMed Central

    Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

    1990-01-01

    The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

  6. Characterization and Placement of Wetlands for Integrated Conservation Practice Planning

    EPA Science Inventory

    Constructed wetlands have been recognized as an efficient and cost-effective conservation practice to protect water quality through reducing the transport of sediments and nutrients from upstream croplands to downstream water bodies. The challenge resides in targeting the strateg...

  7. Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating sequences, and telomeres in Saccharomyces cerevisiae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Buchman, A.R.; Kimmerly, W.J.; Rine, J.

    1988-01-01

    Two DNA-binding factors from Saccharomyces cerevisiae have been characterized, GRFI (general regulatory factor I) and ABFI (ARS-binding factor I), that recognize specific sequences within diverse genetic elements. GRFI bound to sequences at the negative regulatory elements (silencers) of the silent mating type loci HML E and HMR E and to the upstream activating sequence (UAS) required for transcription of the MAT ..cap alpha.. genes. A putative conserved UAS located at genes involved in translation (RPG box) was also recognized by GRFI. In addition, GRFI bound with high affinity to sequences within the (C/sub 1-3/A)-repeat region at yeast telomeres. Binding sitesmore » for GRFI with the highest affinity appeared to be of the form 5'-(A/G)(A/C)ACCCAN NCA(T/C)(T/C)-3', where N is any nucleotide. ABFI-binding sites were located next to autonomously replicating sequences (ARSs) at controlling elements of the silent mating type loci HMR E, HMR I, and HML I and were associated with ARS1, ARS2, and the 2..mu..m plasmid ARS. Two tandem ABFI binding sites were found between the HIS3 and DED1 genes, several kilobase pairs from any ARS, indicating that ABFI-binding sites are not restricted to ARSs. The sequences recognized by AFBI showed partial dyad-symmetry and appeared to be variations of the consensus 5'-TATCATTNNNNACGA-3'. GRFI and ABFI were both abundant DNA-binding factors and did not appear to be encoded by the SIR genes, whose product are required for repression of the silent mating type loci. Together, these results indicate that both GRFI and ABFI play multiple roles within the cell.« less

  8. Extended bounds limiter for high-order finite-volume schemes on unstructured meshes

    NASA Astrophysics Data System (ADS)

    Tsoutsanis, Panagiotis

    2018-06-01

    This paper explores the impact of the definition of the bounds of the limiter proposed by Michalak and Ollivier-Gooch in [56] (2009), for higher-order Monotone-Upstream Central Scheme for Conservation Laws (MUSCL) numerical schemes on unstructured meshes in the finite-volume (FV) framework. A new modification of the limiter is proposed where the bounds are redefined by utilising all the spatial information provided by all the elements in the reconstruction stencil. Numerical results obtained on smooth and discontinuous test problems of the Euler equations on unstructured meshes, highlight that the newly proposed extended bounds limiter exhibits superior performance in terms of accuracy and mesh sensitivity compared to the cell-based or vertex-based bounds implementations.

  9. Regulation of Bacteriocin Production in Streptococcus mutans by the Quorum-Sensing System Required for Development of Genetic Competence

    PubMed Central

    van der Ploeg, Jan R.

    2005-01-01

    In Streptococcus mutans, competence for genetic transformation and biofilm formation are dependent on the two-component signal transduction system ComDE together with the inducer peptide pheromone competence-stimulating peptide (CSP) (encoded by comC). Here, it is shown that the same system is also required for expression of the nlmAB genes, which encode a two-peptide nonlantibiotic bacteriocin. Expression from a transcriptional nlmAB′-lacZ fusion was highest at high cell density and was increased up to 60-fold following addition of CSP, but it was abolished when the comDE genes were interrupted. Two more genes, encoding another putative bacteriocin and a putative bacteriocin immunity protein, were also regulated by this system. The regions upstream of these genes and of two further putative bacteriocin-encoding genes and a gene encoding a putative bacteriocin immunity protein contained a conserved 9-bp repeat element just upstream of the transcription start, which suggests that expression of these genes is also dependent on the ComCDE regulatory system. Mutations in the repeat element of the nlmAB promoter region led to a decrease in CSP-dependent expression of nlmAB′-lacZ. In agreement with these results, a comDE mutant and mutants unable to synthesize or export CSP did not produce bacteriocins. It is speculated that, at high cell density, bacteriocin production is induced to liberate DNA from competing streptococci. PMID:15937160

  10. The chicken skeletal alpha-actin gene promoter region exhibits partial dyad symmetry and a capacity to drive bidirectional transcription.

    PubMed Central

    Grichnik, J M; French, B A; Schwartz, R J

    1988-01-01

    The chicken skeletal alpha-actin gene promoter region (-202 to -12) provides myogenic transcriptional specificity. This promoter contains partial dyad symmetry about an axis at nucleotide -108 and in transfection experiments is capable of directing transcription in a bidirectional manner. At least three different transcription initiation start sites, oriented toward upstream sequences, were mapped 25 to 30 base pairs from TATA-like regions. The opposing transcriptional activity was potentiated upon the deletion of sequences proximal to the alpha-actin transcription start site. Thus, sequences which serve to position RNA polymerase for alpha-actin transcription may allow, in their absence, the selection of alternative and reverse-oriented start sites. Nuclear runoff transcription assays of embryonic muscle indicated that divergent transcription may occur in vivo but with rapid turnover of nuclear transcripts. Divergent transcriptional activity enabled us to define the 3' regulatory boundary of the skeletal alpha-actin promoter which retains a high level of myogenic transcriptional activity. The 3' regulatory border was detected when serial 3' deletions bisected the element (-91 CCAAA TATGG -82) which reduced transcriptional activity by 80%. Previously we showed that disruption of its upstream counterpart (-127 CCAAAGAAGG -136) resulted in about a 90% decrease in activity. These element pairs, which we describe as CCAAT box-associated repeats, are conserved in all sequenced vertebrate sarcomeric actin genes and may act in a cooperative manner to facilitate transcription in myogenic cells. Images PMID:3211124

  11. Hormone-induced modifications of the chromatin structure surrounding upstream regulatory regions conserved between the mouse and rabbit whey acidic protein genes.

    PubMed Central

    Millot, Benjamin; Montoliu, Lluís; Fontaine, Marie-Louise; Mata, Teresa; Devinoy, Eve

    2003-01-01

    The upstream regulatory regions of the mouse and rabbit whey acidic protein (WAP) genes have been used extensively to target the efficient expression of foreign genes into the mammary gland of transgenic animals. Therefore both regions have been studied to elucidate fully the mechanisms controlling WAP gene expression. Three DNase I-hypersensitive sites (HSS0, HSS1 and HSS2) have been described upstream of the rabbit WAP gene in the lactating mammary gland and correspond to important regulatory regions. These sites are surrounded by variable chromatin structures during mammary-gland development. In the present study, we describe the upstream sequence of the mouse WAP gene. Analysis of genomic sequences shows that the mouse WAP gene is situated between two widely expressed genes (Cpr2 and Ramp3). We show that the hypersensitive sites found upstream of the rabbit WAP gene are also detected in the mouse WAP gene. Further, they encompass functional signal transducer and activator of transcription 5-binding sites, as has been observed in the rabbit. A new hypersensitive site (HSS3), not specific to the mammary gland, was mapped 8 kb upstream of the rabbit WAP gene. Unlike the three HSSs described above, HSS3 is also detected in the liver, but similar to HSS1, it does not depend on lactogenic hormone treatments during cell culture. The region surrounding HSS3 encompasses a potential matrix attachment region, which is also conserved upstream of the mouse WAP gene and contains a functional transcription factor Ets-1 (E26 transformation-specific-1)-binding site. Finally, we demonstrate for the first time that variations in the chromatin structure are dependent on prolactin alone. PMID:12580766

  12. Functional elements in the minimal promoter of the human proton-coupled folate transporter

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stark, Michal; Gonen, Nitzan; Assaraf, Yehuda G., E-mail: assaraf@tx.technion.ac.il

    2009-10-09

    The proton-coupled folate transporter (PCFT) is the dominant intestinal folate transporter, however, its promoter has yet to be revealed. Hence, we here cloned a 3.1 kb fragment upstream to the first ATG of the human PCFT gene and generated sequential deletion constructs evaluated in luciferase reporter assay. This analysis mapped the minimal promoter to 157 bp upstream to the first ATG. Crucial GC-box sites were identified within the minimal promoter and in its close vicinity which substantially contribute to promoter activity, as their disruption resulted in 94% loss of luciferase activity. We also identified upstream enhancer elements including YY1 andmore » AP1 which, although distantly located, prominently transactivated the minimal promoter, as their inactivation resulted in 50% decrease in reporter activity. This is the first functional identification of the minimal PCFT promoter harboring crucial GC-box elements that markedly contribute to its transcriptional activation via putative interaction with distal YY1 and AP1 enhancer elements.« less

  13. Characterization and placement of wetlands for integrated watershed conservation practice planning

    USDA-ARS?s Scientific Manuscript database

    Constructed wetlands have been recognized as an efficient and cost-effective conservation practice to protect water quality through reducing the transport of sediments and nutrients from upstream croplands to downstream water bodies. The challenge resides in targeting the strategic location of wetla...

  14. Consumption‐Based Conservation Targeting: Linking Biodiversity Loss to Upstream Demand through a Global Wildlife Footprint

    PubMed Central

    Berlow, Eric; Conlisk, Erin; Erb, Karlheinz; Iha, Katsunori; Martinez, Neo; Newman, Erica A.; Plutzar, Christoph; Smith, Adam B.; Harte, John

    2016-01-01

    Abstract Although most conservation efforts address the direct, local causes of biodiversity loss, effective long‐term conservation will require complementary efforts to reduce the upstream economic pressures, such as demands for food and forest products, which ultimately drive these downstream losses. Here, we present a wildlife footprint analysis that links global losses of wild birds to consumer purchases across 57 economic sectors in 129 regions. The United States, India, China, and Brazil have the largest regional wildlife footprints, while per‐person footprints are highest in Mongolia, Australia, Botswana, and the United Arab Emirates. A US$100 purchase of bovine meat or rice products occupies approximately 0.1 km2 of wild bird ranges, displacing 1–2 individual birds, for 1 year. Globally significant importer regions, including Japan, the United Kingdom, Germany, Italy, and France, have large footprints that drive wildlife losses elsewhere in the world and represent important targets for consumption‐focused conservation attention. PMID:29104616

  15. Defective distal regulatory element at the 5' upstream of rat prolactin gene of steroid-nonresponsive GH-subclone.

    PubMed

    Kumar, V; Wong, D T; Pasion, S G; Biswas, D K

    1987-12-08

    The prolactin-nonproducing (PRL-) GH cell strains (rat pituitary tumor cells in culture). GH12C1 and F1BGH12C1, do not respond to steroid hormones estradiol or hydrocortisone (HC). However, the stimulatory effect of estradiol and the inhibitory effect of hydrocortisone on prolactin synthesis can be demonstrated in the prolactin-producing GH cell strain, GH4C1. In this investigation we have examined the 5' end flanking region of rat prolactin (rat PRL) gene of steroid-responsive, GH4C1 cells to identify the positive and negative regulatory elements and to verify the status of these elements in steroid-nonresponsive F1BGH12C1 cells. Results presented in this report demonstrate that the basel level expression of the co-transferred Neo gene (neomycin phosphoribosyl transferase) is modulated by the distal upstream regulatory elements of rat PRL gene in response to steroid hormones. The expression of adjacent Neo gene is inhibited by dexamethasone and is stimulated by estradiol in transfectants carrying distal regulatory elements (SRE) of steroid-responsive cells. These responses are not observed in transfectants with the rat PRL upstream sequences derived from steroid-nonresponsive cells. The basal level expression of the host cell alpha-2 tubulin gene is not affected by dexamethasone. We report here the identification of the distal steroid regulatory element (SRE) located between 3.8 and 7.8 kb upstream of the transcription initiation site of rat PRL gene. Both the positive and the negative effects of steroid hormones can be identified within this upstream sequence. This distal SRE appears to be nonfunctional in steroid-nonresponsive cells. Though the proximal SRE is functional, the defect in the distal SRE makes the GH substrain nonresponsive to steroid hormones. These results suggest that both the proximal and the distal SREs are essential for the mediation of action of steroid hormones in GH cells.

  16. Gains and Losses of Transcription Factor Binding Sites in Saccharomyces cerevisiae and Saccharomyces paradoxus

    PubMed Central

    Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung

    2015-01-01

    Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). PMID:26220934

  17. Functional Intersection Area -- Oregon Department of Transportation

    DOT National Transportation Integrated Search

    1996-01-01

    This discussion paper addresses the concepts involved in defining the functional area of an intersection. The elements which comprise the upstream functional area are identified; dimensions of the upstream area exclusive of queue storage, are given f...

  18. Evaluation of wastewater contaminant transport in surface waters using verified Lagrangian sampling

    USGS Publications Warehouse

    Antweiler, Ronald C.; Writer, Jeffrey H.; Murphy, Sheila F.

    2014-01-01

    Contaminants released from wastewater treatment plants can persist in surface waters for substantial distances. Much research has gone into evaluating the fate and transport of these contaminants, but this work has often assumed constant flow from wastewater treatment plants. However, effluent discharge commonly varies widely over a 24-hour period, and this variation controls contaminant loading and can profoundly influence interpretations of environmental data. We show that methodologies relying on the normalization of downstream data to conservative elements can give spurious results, and should not be used unless it can be verified that the same parcel of water was sampled. Lagrangian sampling, which in theory samples the same water parcel as it moves downstream (the Lagrangian parcel), links hydrologic and chemical transformation processes so that the in-stream fate of wastewater contaminants can be quantitatively evaluated. However, precise Lagrangian sampling is difficult, and small deviations – such as missing the Lagrangian parcel by less than 1 h – can cause large differences in measured concentrations of all dissolved compounds at downstream sites, leading to erroneous conclusions regarding in-stream processes controlling the fate and transport of wastewater contaminants. Therefore, we have developed a method termed “verified Lagrangian” sampling, which can be used to determine if the Lagrangian parcel was actually sampled, and if it was not, a means for correcting the data to reflect the concentrations which would have been obtained had the Lagrangian parcel been sampled. To apply the method, it is necessary to have concentration data for a number of conservative constituents from the upstream, effluent, and downstream sites, along with upstream and effluent concentrations that are constant over the short-term (typically 2–4 h). These corrections can subsequently be applied to all data, including non-conservative constituents. Finally, we show how data from other studies can be corrected.

  19. Evaluation of wastewater contaminant transport in surface waters using verified Lagrangian sampling.

    PubMed

    Antweiler, Ronald C; Writer, Jeffrey H; Murphy, Sheila F

    2014-02-01

    Contaminants released from wastewater treatment plants can persist in surface waters for substantial distances. Much research has gone into evaluating the fate and transport of these contaminants, but this work has often assumed constant flow from wastewater treatment plants. However, effluent discharge commonly varies widely over a 24-hour period, and this variation controls contaminant loading and can profoundly influence interpretations of environmental data. We show that methodologies relying on the normalization of downstream data to conservative elements can give spurious results, and should not be used unless it can be verified that the same parcel of water was sampled. Lagrangian sampling, which in theory samples the same water parcel as it moves downstream (the Lagrangian parcel), links hydrologic and chemical transformation processes so that the in-stream fate of wastewater contaminants can be quantitatively evaluated. However, precise Lagrangian sampling is difficult, and small deviations - such as missing the Lagrangian parcel by less than 1h - can cause large differences in measured concentrations of all dissolved compounds at downstream sites, leading to erroneous conclusions regarding in-stream processes controlling the fate and transport of wastewater contaminants. Therefore, we have developed a method termed "verified Lagrangian" sampling, which can be used to determine if the Lagrangian parcel was actually sampled, and if it was not, a means for correcting the data to reflect the concentrations which would have been obtained had the Lagrangian parcel been sampled. To apply the method, it is necessary to have concentration data for a number of conservative constituents from the upstream, effluent, and downstream sites, along with upstream and effluent concentrations that are constant over the short-term (typically 2-4h). These corrections can subsequently be applied to all data, including non-conservative constituents. Finally, we show how data from other studies can be corrected. © 2013.

  20. 18 CFR 12.24 - Review and updating of plans.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... light of any significant changes in upstream or downstream circumstances which might affect water flows... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Review and updating of plans. 12.24 Section 12.24 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY...

  1. 18 CFR 12.24 - Review and updating of plans.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... light of any significant changes in upstream or downstream circumstances which might affect water flows... 18 Conservation of Power and Water Resources 1 2012-04-01 2012-04-01 false Review and updating of plans. 12.24 Section 12.24 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY...

  2. 18 CFR 12.24 - Review and updating of plans.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... light of any significant changes in upstream or downstream circumstances which might affect water flows... 18 Conservation of Power and Water Resources 1 2011-04-01 2011-04-01 false Review and updating of plans. 12.24 Section 12.24 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY...

  3. 18 CFR 12.24 - Review and updating of plans.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... light of any significant changes in upstream or downstream circumstances which might affect water flows... 18 Conservation of Power and Water Resources 1 2014-04-01 2014-04-01 false Review and updating of plans. 12.24 Section 12.24 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY...

  4. 18 CFR 12.24 - Review and updating of plans.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... light of any significant changes in upstream or downstream circumstances which might affect water flows... 18 Conservation of Power and Water Resources 1 2013-04-01 2013-04-01 false Review and updating of plans. 12.24 Section 12.24 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY...

  5. 18 CFR 11.10 - General provision; waiver and exemptions; definitions.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 18 Conservation of Power and Water Resources 1 2014-04-01 2014-04-01 false General provision; waiver and exemptions; definitions. 11.10 Section 11.10 Conservation of Power and Water Resources FEDERAL... upstream, project, usually by increasing or decreasing the release of water from a storage reservoir. (b...

  6. 18 CFR 11.10 - General provision; waiver and exemptions; definitions.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 18 Conservation of Power and Water Resources 1 2013-04-01 2013-04-01 false General provision; waiver and exemptions; definitions. 11.10 Section 11.10 Conservation of Power and Water Resources FEDERAL... upstream, project, usually by increasing or decreasing the release of water from a storage reservoir. (b...

  7. 18 CFR 11.10 - General provision; waiver and exemptions; definitions.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 18 Conservation of Power and Water Resources 1 2012-04-01 2012-04-01 false General provision; waiver and exemptions; definitions. 11.10 Section 11.10 Conservation of Power and Water Resources FEDERAL... upstream, project, usually by increasing or decreasing the release of water from a storage reservoir. (b...

  8. 18 CFR 11.10 - General provision; waiver and exemptions; definitions.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false General provision; waiver and exemptions; definitions. 11.10 Section 11.10 Conservation of Power and Water Resources FEDERAL... upstream, project, usually by increasing or decreasing the release of water from a storage reservoir. (b...

  9. 18 CFR 11.10 - General provision; waiver and exemptions; definitions.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 18 Conservation of Power and Water Resources 1 2011-04-01 2011-04-01 false General provision; waiver and exemptions; definitions. 11.10 Section 11.10 Conservation of Power and Water Resources FEDERAL... upstream, project, usually by increasing or decreasing the release of water from a storage reservoir. (b...

  10. Spatial and temporal distribution of metals in suspended particulate matter of the Kali estuary, India

    NASA Astrophysics Data System (ADS)

    Suja, S.; Kessarkar, Pratima M.; Fernandes, Lina L.; Kurian, Siby; Tomer, Arti

    2017-09-01

    Major (Al, Fe, Mn, Ti, Mg) and trace (Cu, Zn, Pb, Cr, Ni, Co, Zr, Rb, Sr, Ba, Li, Be, Sc, V, Ga, Nb, Mo, Sn, Sb, Cs, Hf, Ta, Bi, Th, U) elements and particulate organic carbon (POC) concentrations in surface suspended particulate matter (SPM) of the Kali estuary, (central west coast of India) were studied during the pre-monsoon, monsoon and post monsoon seasons to infer estuarine processes, source of SPM and Geoaccumulation Index (Igeo) assigned pollutionIgeo levels. Distribution of SPM indicates the presence of the estuarine turbidity maximum (ETM) during all three seasons near the river mouth and a second ETM during the post monsoon time in the upstream associated with salinities gradient. The SPM during the monsoon is finer grained (avg. 53 μm), characterized by uniformly low normalized elemental concentration, whereas the post and pre monsoon are characterized by high normalized elemental concentration with coarser grain size (avg. 202 μm and 173 μm respectively) with highest ratios in the upstream estuary. The elemental composition and principal component analysis for the upstream estuary SPM support more contribution from the upstream catchment area rocks during the monsoon season; there is additional contribution from the downstream catchment area during the pre and post monsoon period due to the tidal effect. The Kali estuarine SPM has higher Al, Fe, Mn, Ti, Mg, Ni, Co, Ba, Li and V with respect to Average World River SPM (WRSPM). Igeo values for the SPM indicate Kali Estuary to be severely enriched with Mn and moderately enriched with Cu, Zn, Ni, Co, U and Mo in the upstream estuary during pre and post monsoon seasons. Seasonal changes in salinity gradient (reduced freshwater flow due to closing of the dam gates), reduced velocity at meandering region of the estuary and POC of 1.6-2.3% resulted in co-precipitation of trace elements that were further fortified by flocculation and coagulation throughout the water column resulting in metal trapping in the upstream region.

  11. Hepatocyte nuclear factor-4alpha is a central transactivator of the mouse Ntcp gene.

    PubMed

    Geier, Andreas; Martin, Ina V; Dietrich, Christoph G; Balasubramaniyan, Natarajan; Strauch, Sonja; Suchy, Frederick J; Gartung, Carsten; Trautwein, Christian; Ananthanarayanan, Meenakshisundaram

    2008-08-01

    Sodium taurocholate cotransporting polypeptide (Ntcp) is the major uptake system for conjugated bile acids. Deletions of hepatocyte nuclear factor (HNF)-1alpha and retinoid X receptor-alpha:retinoic acid receptor-alpha binding sites in the mouse 5'-flanking region corresponding to putatively central regulatory elements of rat Ntcp do not significantly reduce promoter activity. We hypothesized that HNF-4alpha, which is increasingly recognized as a central regulator of hepatocyte function, may directly transactivate mouse (mNtcp). A 1.1-kb 5'-upstream region including the mouse Ntcp promoter was cloned and compared with the rat promoter. In contrast to a moderate 3.5-fold activation of mNtcp by HNF-1alpha, HNF-4alpha cotransfection led to a robust 20-fold activation. Deletion analysis of mouse and rat Ntcp promoters mapped a conserved HNF-4alpha consensus site at -345/-326 and -335/-316 bp, respectively. p-475bpmNtcpLUC is not transactivated by HNF-1alpha but shows a 50-fold enhanced activity upon cotransfection with HNF-4alpha. Gel mobility shift assays demonstrated a complex of the HNF-4alpha-element formed with liver nuclear extracts that was blocked by an HNF-4alpha specific antibody. HNF-4alpha binding was confirmed by chromatin immunoprecipitation. Using Hepa 1-6 cells, HNF-4alpha-knockdown resulted in a significant 95% reduction in NTCP mRNA. In conclusion, mouse Ntcp is regulated by HNF-4alpha via a conserved distal cis-element independently of HNF-1alpha.

  12. The legumin gene family: structure of a B type gene of Vicia faba and a possible legumin gene specific regulatory element.

    PubMed Central

    Bäumlein, H; Wobus, U; Pustell, J; Kafatos, F C

    1986-01-01

    The field bean, Vicia faba L. var. minor, possesses two sub-families of 11 S legumin genes named A and B. We isolated from a genomic library a B-type gene (LeB4) and determined its primary DNA sequence. Gene LeB4 codes for a 484 amino acid residue prepropolypeptide, encompassing a signal peptide of 22 amino acid residues, an acidic, very hydrophilic alpha-chain of 281 residues and a basic, somewhat hydrophobic beta-chain of 181 residues. The latter two coding regions are immediately contiguous, but each is interrupted by a short intron. Type A legumin genes from soybean and pea are known to have introns in the same two positions, in addition to an extra intron (within the alpha-coding sequence). Sequence comparisons of legumin genes from these three plants revealed a highly conserved sequence element of at least 28 bp, centered at approximately 100 bp upstream of each cap site. The element is absent from the equivalent position of all non-legumin and other plant and fungal genes examined. We tentatively name this element "legumin box" and suggest that it may have a function in the regulation of legumin gene expression. PMID:3960730

  13. Alphavirus replicon approach to promoterless analysis of IRES elements.

    PubMed

    Kamrud, K I; Custer, M; Dudek, J M; Owens, G; Alterson, K D; Lee, J S; Groebner, J L; Smith, J F

    2007-04-10

    Here we describe a system for promoterless analysis of putative internal ribosome entry site (IRES) elements using an alphavirus (family Togaviridae) replicon vector. The system uses the alphavirus subgenomic promoter to produce transcripts that, when modified to contain a spacer region upstream of an IRES element, allow analysis of cap-independent translation of genes of interest (GOI). If the IRES element is removed, translation of the subgenomic transcript can be reduced >95% compared to the same transcript containing a functional IRES element. Alphavirus replicons, used in this manner, offer an alternative to standard dicistronic DNA vectors or in vitro translation systems currently used to analyze putative IRES elements. In addition, protein expression levels varied depending on the spacer element located upstream of each IRES. The ability to modulate the level of expression from alphavirus vectors should extend the utility of these vectors in vaccine development.

  14. Alphavirus Replicon Approach to Promoterless Analysis of IRES Elements

    PubMed Central

    Kamrud, K.I.; Custer, M.; Dudek, J.M.; Owens, G.; Alterson, K.D.; Lee, J.S.; Groebner, J.L.; Smith, J.F.

    2007-01-01

    Here we describe a system for promoterless analysis of putative internal ribosome entry site (IRES) elements using an alphavirus (Family Togaviridae) replicon vector. The system uses the alphavirus subgenomic promoter to produce transcripts that, when modified to contain a spacer region upstream of an IRES element, allow analysis of cap-independent translation of genes of interest (GOI). If the IRES element is removed, translation of the subgenomic transcript can be reduced > 95 % compared to the same transcript containing a functional IRES element. Alphavirus replicons, used in this manner, offer an alternative to standard dicistronic DNA vectors or in-vitro translation systems currently used to analyze putative IRES elements. In addition, protein expression levels varied depending on the spacer element located upstream of each IRES. The ability to modulate the level of expression from alphavirus vectors should extend the utility of these vectors in vaccine development. PMID:17156813

  15. Mammalian monogamy is not controlled by a single gene

    PubMed Central

    Fink, Sabine; Excoffier, Laurent; Heckel, Gerald

    2006-01-01

    Complex social behavior in Microtus voles and other mammals has been postulated to be under the direct genetic control of a single locus: the arginine vasopressin 1a receptor (avpr1a) gene. Using a phylogenetic approach, we show that a repetitive element in the promoter region of avpr1a, which reportedly causes social monogamy, is actually widespread in nonmonogamous Microtus and other rodents. There was no evidence for intraspecific polymorphism in regard to the presence or absence of the repetitive element. Among 25 rodent species studied, the element was absent in only two closely related nonmonogamous species, indicating that this absence is certainly the result of an evolutionarily recent loss. Our analyses further demonstrate that the repetitive structures upstream of the avpr1a gene in humans and primates, which have been associated with social bonding, are evolutionarily distinct from those in rodents. Our evolutionary approach reveals that monogamy in rodents is not controlled by a single polymorphism in the promoter region of the avpr1a gene. We thus resolve the contradiction between the claims for an evolutionarily conserved genetic programming of social behavior in mammals and the vast evidence for highly complex and flexible mating systems. PMID:16832060

  16. Analysis of the Prefoldin Gene Family in 14 Plant Species

    PubMed Central

    Cao, Jun

    2016-01-01

    Prefoldin is a hexameric molecular chaperone complex present in all eukaryotes and archaea. The evolution of this gene family in plants is unknown. Here, I identified 140 prefoldin genes in 14 plant species. These prefoldin proteins were divided into nine groups through phylogenetic analysis. Highly conserved gene organization and motif distribution exist in each prefoldin group, implying their functional conservation. I also observed the segmental duplication of maize prefoldin gene family. Moreover, a few functional divergence sites were identified within each group pairs. Functional network analyses identified 78 co-expressed genes, and most of them were involved in carrying, binding and kinase activity. Divergent expression profiles of the maize prefoldin genes were further investigated in different tissues and development periods and under auxin and some abiotic stresses. I also found a few cis-elements responding to abiotic stress and phytohormone in the upstream sequences of the maize prefoldin genes. The results provided a foundation for exploring the characterization of the prefoldin genes in plants and will offer insights for additional functional studies. PMID:27014333

  17. Compilation of mRNA Polyadenylation Signals in Arabidopsis Revealed a New Signal Element and Potential Secondary Structures1[w

    PubMed Central

    Loke, Johnny C.; Stahlberg, Eric A.; Strenski, David G.; Haas, Brian J.; Wood, Paul Chris; Li, Qingshun Quinn

    2005-01-01

    Using a novel program, SignalSleuth, and a database containing authenticated polyadenylation [poly(A)] sites, we analyzed the composition of mRNA poly(A) signals in Arabidopsis (Arabidopsis thaliana), and reevaluated previously described cis-elements within the 3′-untranslated (UTR) regions, including near upstream elements and far upstream elements. As predicted, there are absences of high-consensus signal patterns. The AAUAAA signal topped the near upstream elements patterns and was found within the predicted location to only approximately 10% of 3′-UTRs. More importantly, we identified a new set, named cleavage elements, of poly(A) signals flanking both sides of the cleavage site. These cis-elements were not previously revealed by conventional mutagenesis and are contemplated as a cluster of signals for cleavage site recognition. Moreover, a single-nucleotide profile scan on the 3′-UTR regions unveiled a distinct arrangement of alternate stretches of U and A nucleotides, which led to a prediction of the formation of secondary structures. Using an RNA secondary structure prediction program, mFold, we identified three main types of secondary structures on the sequences analyzed. Surprisingly, these observed secondary structures were all interrupted in previously constructed mutations in these regions. These results will enable us to revise the current model of plant poly(A) signals and to develop tools to predict 3′-ends for gene annotation. PMID:15965016

  18. Nucleosome exclusion from the interspecies-conserved central AT-rich region of the Ars insulator.

    PubMed

    Takagi, Haruna; Inai, Yuta; Watanabe, Shun-ichiro; Tatemoto, Sayuri; Yajima, Mamiko; Akasaka, Koji; Yamamoto, Takashi; Sakamoto, Naoaki

    2012-01-01

    The Ars insulator is a boundary element identified in the upstream region of the arylsulfatase (HpArs) gene in the sea urchin, Hemicentrotus pulcherrimus, and possesses the ability to both block enhancer-promoter communications and protect transgenes from silent chromatin. To understand the molecular mechanism of the Ars insulator, we investigated the correlation between chromatin structure, DNA structure and insulator activity. Nuclease digestion of nuclei isolated from sea urchin embryos revealed the presence of a nuclease-hypersensitive site within the Ars insulator. Analysis of micrococcal nuclease-sensitive sites in the Ars insulator, reconstituted with nucleosomes, showed the exclusion of nucleosomes from the central AT-rich region. Furthermore, the central AT-rich region in naked DNA was sensitive to nucleotide base modification by diethylpyrocarbonate (DEPC). These observations suggest that non-B-DNA structures in the central AT-rich region may inhibit nucleosomal formation, which leads to nuclease hypersensitivity. Furthermore, comparison of nucleotide sequences between the HpArs gene and its ortholog in Strongylocentrotus purpuratus revealed that the central AT-rich region of the Ars insulator is conserved, and this conserved region showed significant enhancer blocking activity. These results suggest that the central AT-rich nucleosome-free region plays an important role in the function of the Ars insulator.

  19. Promoter activity of polypyrimidine tract-binding protein genes of potato responds to environmental cues.

    PubMed

    Butler, Nathaniel M; Hannapel, David J

    2012-12-01

    Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.

  20. Bacillus subtilis δ Factor Functions as a Transcriptional Regulator by Facilitating the Open Complex Formation.

    PubMed

    Prajapati, Ranjit Kumar; Sengupta, Shreya; Rudra, Paulami; Mukhopadhyay, Jayanta

    2016-01-15

    Most bacterial RNA polymerases (RNAP) contain five conserved subunits, viz. 2α, β, β', and ω. However, in many Gram-positive bacteria, especially in fermicutes, RNAP is associated with an additional factor, called δ. For over three decades since its identification, it had been thought that δ functioned as a subunit of RNAP to enhance the level of transcripts by recycling RNAP. In support of the previous observations, we also find that δ is involved in recycling of RNAP by releasing the RNA from the ternary complex. We further show that δ binds to RNA and is able to recycle RNAP when the length of the nascent RNA reaches a critical length. However, in this work we decipher a new function of δ. Performing biochemical and mutational analysis, we show that Bacillus subtilis δ binds to DNA immediately upstream of the promoter element at A-rich sequences on the abrB and rrnB1 promoters and facilitates open complex formation. As a result, δ facilitates RNAP to initiate transcription in the second scale, compared with minute scale in the absence of δ. Using transcription assay, we show that δ-mediated recycling of RNAP cannot be the sole reason for the enhancement of transcript yield. Our observation that δ does not bind to RNAP holo enzyme but is required to bind to DNA upstream of the -35 promoter element for transcription activation suggests that δ functions as a transcriptional regulator. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Deciphering the Regulatory Logic of an Ancient, Ultraconserved Nuclear Receptor Enhancer Module

    PubMed Central

    Bagamasbad, Pia D.; Bonett, Ronald M.; Sachs, Laurent; Buisine, Nicolas; Raj, Samhitha; Knoedler, Joseph R.; Kyono, Yasuhiro; Ruan, Yijun; Ruan, Xiaoan

    2015-01-01

    Cooperative, synergistic gene regulation by nuclear hormone receptors can increase sensitivity and amplify cellular responses to hormones. We investigated thyroid hormone (TH) and glucocorticoid (GC) synergy on the Krüppel-like factor 9 (Klf9) gene, which codes for a zinc finger transcription factor involved in development and homeostasis of diverse tissues. We identified regions of the Xenopus and mouse Klf9 genes 5–6 kb upstream of the transcription start sites that supported synergistic transactivation by TH plus GC. Within these regions, we found an orthologous sequence of approximately 180 bp that is highly conserved among tetrapods, but absent in other chordates, and possesses chromatin marks characteristic of an enhancer element. The Xenopus and mouse approximately 180-bp DNA element conferred synergistic transactivation by hormones in transient transfection assays, so we designate this the Klf9 synergy module (KSM). We identified binding sites within the mouse KSM for TH receptor, GC receptor, and nuclear factor κB. TH strongly increased recruitment of liganded GC receptor and serine 5 phosphorylated (initiating) RNA polymerase II to chromatin at the KSM, suggesting a mechanism for transcriptional synergy. The KSM is transcribed to generate long noncoding RNAs, which are also synergistically induced by combined hormone treatment, and the KSM interacts with the Klf9 promoter and a far upstream region through chromosomal looping. Our findings support that the KSM plays a central role in hormone regulation of vertebrate Klf9 genes, it evolved in the tetrapod lineage, and has been maintained by strong stabilizing selection. PMID:25866873

  2. A conserved catalytic residue in the ubiquitin-conjugating enzyme family

    PubMed Central

    Wu, Pei-Ying; Hanlon, Mary; Eddins, Michael; Tsui, Colleen; Rogers, Richard S.; Jensen, Jane P.; Matunis, Michael J.; Weissman, Allan M.; Wolberger, Cynthia P.; Pickart, Cecile M.

    2003-01-01

    Ubiquitin (Ub) regulates diverse functions in eukaryotes through its attachment to other proteins. The defining step in this protein modification pathway is the attack of a substrate lysine residue on Ub bound through its C-terminus to the active site cysteine residue of a Ub-conjugating enzyme (E2) or certain Ub ligases (E3s). So far, these E2 and E3 cysteine residues are the only enzyme groups known to participate in the catalysis of conjugation. Here we show that a strictly conserved E2 asparagine residue is critical for catalysis of E2- and E2/RING E3-dependent isopeptide bond formation, but dispensable for upstream and downstream reactions of Ub thiol ester formation. In constrast, the strictly conserved histidine and proline residues immediately upstream of the asparagine are dispensable for catalysis of isopeptide bond formation. We propose that the conserved asparagine side chain stabilizes the oxyanion intermediate formed during lysine attack. The E2 asparagine is the first non-covalent catalytic group to be proposed in any Ub conjugation factor. PMID:14517261

  3. Functional Organization of hsp70 Cluster in Camel (Camelus dromedarius) and Other Mammals

    PubMed Central

    Garbuz, David G.; Astakhova, Lubov N.; Zatsepina, Olga G.; Arkhipova, Irina R.; Nudler, Eugene; Evgen'ev, Michael B.

    2011-01-01

    Heat shock protein 70 (Hsp70) is a molecular chaperone providing tolerance to heat and other challenges at the cellular and organismal levels. We sequenced a genomic cluster containing three hsp70 family genes linked with major histocompatibility complex (MHC) class III region from an extremely heat tolerant animal, camel (Camelus dromedarius). Two hsp70 family genes comprising the cluster contain heat shock elements (HSEs), while the third gene lacks HSEs and should not be induced by heat shock. Comparison of the camel hsp70 cluster with the corresponding regions from several mammalian species revealed similar organization of genes forming the cluster. Specifically, the two heat inducible hsp70 genes are arranged in tandem, while the third constitutively expressed hsp70 family member is present in inverted orientation. Comparison of regulatory regions of hsp70 genes from camel and other mammals demonstrates that transcription factor matches with highest significance are located in the highly conserved 250-bp upstream region and correspond to HSEs followed by NF-Y and Sp1 binding sites. The high degree of sequence conservation leaves little room for putative camel-specific regulatory elements. Surprisingly, RT-PCR and 5′/3′-RACE analysis demonstrated that all three hsp70 genes are expressed in camel's muscle and blood cells not only after heat shock, but under normal physiological conditions as well, and may account for tolerance of camel cells to extreme environmental conditions. A high degree of evolutionary conservation observed for the hsp70 cluster always linked with MHC locus in mammals suggests an important role of such organization for coordinated functioning of these vital genes. PMID:22096537

  4. Adenovirus Delivered Short Hairpin RNA Targeting a Conserved Site in the 5′ Non-Translated Region Inhibits All Four Serotypes of Dengue Viruses

    PubMed Central

    Korrapati, Anil Babu; Swaminathan, Gokul; Singh, Aarti; Khanna, Navin; Swaminathan, Sathyamangalam

    2012-01-01

    Background Dengue is a mosquito-borne viral disease caused by four closely related serotypes of Dengue viruses (DENVs). This disease whose symptoms range from mild fever to potentially fatal haemorrhagic fever and hypovolemic shock, threatens nearly half the global population. There is neither a preventive vaccine nor an effective antiviral therapy against dengue disease. The difference between severe and mild disease appears to be dependent on the viral load. Early diagnosis may enable timely therapeutic intervention to blunt disease severity by reducing the viral load. Harnessing the therapeutic potential of RNA interference (RNAi) to attenuate DENV replication may offer one approach to dengue therapy. Methodology/Principal Findings We screened the non-translated regions (NTRs) of the RNA genomes of representative members of the four DENV serotypes for putative siRNA targets mapping to known transcription/translation regulatory elements. We identified a target site in the 5′ NTR that maps to the 5′ upstream AUG region, a highly conserved cis-acting element essential for viral replication. We used a replication-defective human adenovirus type 5 (AdV5) vector to deliver a short-hairpin RNA (shRNA) targeting this site into cells. We show that this shRNA matures to the cognate siRNA and is able to inhibit effectively antigen secretion, viral RNA replication and infectious virus production by all four DENV serotypes. Conclusion/Significance The data demonstrate the feasibility of using AdV5-mediated delivery of shRNAs targeting conserved sites in the viral genome to achieve inhibition of all four DENV serotypes. This paves the way towards exploration of RNAi as a possible therapeutic strategy to curtail DENV infection. PMID:22848770

  5. Spacing requirements for interactions between the C-terminal domain of the alpha subunit of Escherichia coli RNA polymerase and the cAMP receptor protein.

    PubMed Central

    Lloyd, G S; Busby, S J; Savery, N J

    1998-01-01

    During transcription initiation at bacterial promoters, the C-terminal domain of the RNA polymerase alpha subunit (alphaCTD) can interact with DNA-sequence elements (known as UP elements) and with activator proteins. We have constructed a series of semi-synthetic promoters carrying both an UP element and a consensus DNA-binding site for the Escherichia coli cAMP receptor protein (CRP; a factor that activates transcription by making direct contacts with alphaCTD). At these promoters, the UP element was located at a variety of distances upstream of the CRP-binding site, which was fixed at position -41.5 bp upstream of the transcript start. At some positions, the UP element caused enhanced promoter activity whereas, at other positions, it had very little effect. In no case was the CRP-dependence of the promoter relieved. DNase I and hydroxyl-radical footprinting were used to study ternary RNA polymerase-CRP-promoter complexes formed at two of the most active of these promoters, and co-operativity between the binding of CRP and purified alpha subunits was studied. The footprints show that alphaCTD binds to the UP element as it is displaced upstream but that this displacement does not prevent alphaCTD from being contacted by CRP. Models to account for this are discussed. PMID:9461538

  6. Contactor/filter improvements

    DOEpatents

    Stelman, David

    1989-01-01

    A contactor/filter arrangement for removing particulate contaminants from a gaseous stream includes a housing having a substantially vertically oriented granular material retention member with upstream and downstream faces, a substantially vertically oriented microporous gas filter element, wherein the retention member and the filter element are spaced apart to provide a zone for the passage of granular material therethrough. The housing further includes a gas inlet means, a gas outlet means, and means for moving a body of granular material through the zone. A gaseous stream containing particulate contaminants passes through the gas inlet means as well as through the upstream face of the granular material retention member, passing through the retention member, the body of granular material, the microporous gas filter element, exiting out of the gas outlet means. Disposed on the upstream face of the filter element is a cover screen which isolates the filter element from contact with the moving granular bed and collects a portion of the particulates so as to form a dust cake having openings small enough to exclude the granular material, yet large enough to receive the dust particles. In one embodiment, the granular material is comprised of prous alumina impregnated with CuO, with the cover screen cleaned by the action of the moving granular material as well as by backflow pressure pulses.

  7. Identification of novel craniofacial regulatory domains located far upstream of SOX9 and disrupted in Pierre Robin sequence

    PubMed Central

    Gordon, Christopher T.; Attanasio, Catia; Bhatia, Shipra; Benko, Sabina; Ansari, Morad; Tan, Tiong Y.; Munnich, Arnold; Pennacchio, Len A.; Abadie, Véronique; Temple, I. Karen; Goldenberg, Alice; van Heyningen, Veronica; Amiel, Jeanne; FitzPatrick, David; Kleinjan, Dirk A.; Visel, Axel; Lyonnet, Stanislas

    2015-01-01

    Mutations in the coding sequence of SOX9 cause campomelic dysplasia (CD), a disorder of skeletal development associated with 46,XY disorders of sex development (DSDs). Translocations, deletions and duplications within a ~2 Mb region upstream of SOX9 can recapitulate the CD-DSD phenotype fully or partially, suggesting the existence of an unusually large cis-regulatory control region. Pierre Robin sequence (PRS) is a craniofacial disorder that is frequently an endophenotype of CD and a locus for isolated PRS at ~1.2-1.5 Mb upstream of SOX9 has been previously reported. The craniofacial regulatory potential within this locus, and within the greater genomic domain surrounding SOX9, remains poorly defined. We report two novel deletions upstream of SOX9 in families with PRS, allowing refinement of the regions harbouring candidate craniofacial regulatory elements. In parallel, ChIP-Seq for p300 binding sites in mouse craniofacial tissue led to the identification of several novel craniofacial enhancers at the SOX9 locus, which were validated in transgenic reporter mice and zebrafish. Notably, some of the functionally validated elements fall within the PRS deletions. These studies suggest that multiple non-coding elements contribute to the craniofacial regulation of SOX9 expression, and that their disruption results in PRS. PMID:24934569

  8. Molecular links among the causative genes for ocular malformation: Otx2 and Sox2 coregulate Rax expression.

    PubMed

    Danno, Hiroki; Michiue, Tatsuo; Hitachi, Keisuke; Yukita, Akira; Ishiura, Shoichi; Asashima, Makoto

    2008-04-08

    The neural-related genes Sox2, Pax6, Otx2, and Rax have been associated with severe ocular malformations such as anophthalmia and microphthalmia, but it remains unclear as to how these genes are linked functionally. We analyzed the upstream signaling of Xenopus Rax (also known as Rx1) and identified the Otx2 and Sox2 proteins as direct upstream regulators of Rax. We revealed that endogenous Otx2 and Sox2 proteins bound to the conserved noncoding sequence (CNS1) located approximately 2 kb upstream of the Rax promoter. This sequence is conserved among vertebrates and is required for potent transcriptional activity. Reporter assays showed that Otx2 and Sox2 synergistically activated transcription via CNS1. Furthermore, the Otx2 and Sox2 proteins physically interacted with each other, and this interaction was affected by the Sox2-missense mutations identified in these ocular disorders. These results demonstrate that the direct interaction and interdependence between the Otx2 and Sox2 proteins coordinate Rax expression in eye development, providing molecular linkages among the genes responsible for ocular malformation.

  9. Gains and Losses of Transcription Factor Binding Sites in Saccharomyces cerevisiae and Saccharomyces paradoxus.

    PubMed

    Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung

    2015-07-27

    Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  10. Compound heterozygous deletions in pseudoautosomal region 1 in an infant with mild manifestations of langer mesomelic dysplasia.

    PubMed

    Tsuchiya, Takayoshi; Shibata, Minoru; Numabe, Hironao; Jinno, Tomoko; Nakabayashi, Kazuhiko; Nishimura, Gen; Nagai, Toshiro; Ogata, Tsutomu; Fukami, Maki

    2014-02-01

    Haploinsufficiency of SHOX on the short arm pseudoautosomal region (PAR1) leads to Leri-Weill dyschondrosteosis (LWD), and nullizygosity of SHOX results in Langer mesomelic dysplasia (LMD). Molecular defects of LWD/LMD include various microdeletions in PAR1 that involve exons and/or the putative upstream or downstream enhancer regions of SHOX, as well as several intragenic mutations. Here, we report on a Japanese male infant with mild manifestations of LMD and hitherto unreported microdeletions in PAR1. Clinical analysis revealed mesomelic short stature with various radiological findings indicative of LMD. Molecular analyses identified compound heterozygous deletions, that is, a maternally inherited ∼46 kb deletion involving the upstream region and exons 1-5 of SHOX, and a paternally inherited ∼500 kb deletion started from a position ∼300 kb downstream from SHOX. In silico analysis revealed that the downstream deletion did not affect the known putative enhancer regions of SHOX, although it encompassed several non-coding elements which were well conserved among various species with SHOX orthologs. These results provide the possibility of the presence of a novel enhancer for SHOX in the genomic region ∼300 to ∼800 kb downstream of the start codon. © 2013 Wiley Periodicals, Inc.

  11. Specific DNA binding of the two chicken Deformed family homeodomain proteins, Chox-1.4 and Chox-a.

    PubMed Central

    Sasaki, H; Yokoyama, E; Kuroiwa, A

    1990-01-01

    The cDNA clones encoding two chicken Deformed (Dfd) family homeobox containing genes Chox-1.4 and Chox-a were isolated. Comparison of their amino acid sequences with another chicken Dfd family homeodomain protein and with those of mouse homologues revealed that strong homologies are located in the amino terminal regions and around the homeodomains. Although homologies in other regions were relatively low, some short conserved sequences were also identified. E. coli-made full length proteins were purified and used for the production of specific antibodies and for DNA binding studies. The binding profiles of these proteins to the 5'-leader and 5'-upstream sequences of Chox-1.4 and Chox-a coding regions were analyzed by immunoprecipitation and DNase I footprint assays. These two Chox proteins bound to the same sites in the 5'-flanking sequences of their coding regions with various affinities and their binding affinities to each site were nearly the same. The consensus sequences of the high and low affinity binding sites were TAATGA(C/G) and CTAATTTT, respectively. A clustered binding site was identified in the 5'-upstream of the Chox-a gene, suggesting that this clustered binding site works as a cis-regulatory element for auto- and/or cross-regulation of Chox-a gene expression. Images PMID:1970866

  12. Synergism between a half-site and an imperfect estrogen-responsive element, and cooperation with COUP-TFI are required for estrogen receptor (ER) to achieve a maximal estrogen-stimulation of rainbow trout ER gene.

    PubMed

    Petit, F G; Métivier, R; Valotaire, Y; Pakdel, F

    1999-01-01

    In all oviparous, liver represents one of the main E2-target tissues where estrogen receptor (ER) constitutes the key mediator of estrogen action. The rainbow trout estrogen receptor (rtER) gene expression is markedly up-regulated by estrogens and the sequences responsible for this autoregulation have been located in a 0.2 kb upstream transcription start site within - 40/- 248 enhancer region. Absence of interference with steroid hormone receptors and tissue-specific factors and a conserved basal transcriptional machinery between yeast and higher eukaryotes, make yeast a simple assay system that will enable determination of important cis-acting regulatory sequences within rtER gene promoter and identification of transcription factors implicated in the regulation of this gene. Deletion analysis allowed to show a synergistic effect between an imperfect estrogen-responsive element (ERE) and a consensus half-ERE to achieve a high hormone-dependent transcriptional activation of the rtER gene promoter in the presence of stably expressed rtER. As in mammalian cells, here we observed a positive regulation of the rtER gene promoter by the chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI) through enhancing autoregulation. Using a point mutation COUP-TFI mutant unable to bind DNA demonstrates that enhancement of rtER gene autoregulation requires the interaction of COUP-TFI to the DNA. Moreover, this enhancement of transcriptional activation by COUP-TFI requires specifically the AF-1 transactivation function of ER and can be observed in the presence of E2 or 4-hydroxytamoxifen but not ICI 164384. Thus, this paper describes the reconstitution of a hormone-responsive transcription unit in yeast in which the regulation of rtER gene promoter could be enhanced by the participation of cis-elements and/or trans-acting factors, such as ER itself or COUP-TF.

  13. Identification of new TSGA10 transcript variants in human testis with conserved regulatory RNA elements in 5'untranslated region and distinct expression in breast cancer.

    PubMed

    Salehipour, Pouya; Nematzadeh, Mahsa; Mobasheri, Maryam Beigom; Afsharpad, Mandana; Mansouri, Kamran; Modarressi, Mohammad Hossein

    2017-09-01

    Testis specific gene antigen 10 (TSGA10) is a cancer testis antigen involved in the process of spermatogenesis. TSGA10 could also play an important role in the inhibition of angiogenesis by preventing nuclear localization of HIF-1α. Although it has been shown that TSGA10 messenger RNA (mRNA) is mainly expressed in testis and some tumors, the transcription pattern and regulatory mechanisms of this gene remain largely unknown. Here, we report that human TSGA10 comprises at least 22 exons and generates four different transcript variants. It was identified that using two distinct promoters and splicing of exons 4 and 7 produced these transcript variants, which have the same coding sequence, but the sequence of 5'untanslated region (5'UTR) is different between them. This is significant because conserved regulatory RNA elements like upstream open reading frame (uORF) and putative internal ribosome entry site (IRES) were found in this region which have different combinations in each transcript variant and it may influence translational efficiency of them in normal or unusual environmental conditions like hypoxia. To indicate the transcription pattern of TSGA10 in breast cancer, expression of identified transcript variants was analyzed in 62 breast cancer samples. We found that TSGA10 tends to express variants with shorter 5'UTR and fewer uORF elements in breast cancer tissues. Our study demonstrates for the first time the expression of different TSGA10 transcript variants in testis and breast cancer tissues and provides a first clue to a role of TSGA10 5'UTR in regulation of translation in unusual environmental conditions like hypoxia. Copyright © 2017. Published by Elsevier B.V.

  14. Small Deletion Variants Have Stable Breakpoints Commonly Associated with Alu Elements

    PubMed Central

    Coin, Lachlan J. M.; Steinfeld, Israel; Yakhini, Zohar; Sladek, Rob; Froguel, Philippe; Blakemore, Alexandra I. F.

    2008-01-01

    Copy number variants (CNVs) contribute significantly to human genomic variation, with over 5000 loci reported, covering more than 18% of the euchromatic human genome. Little is known, however, about the origin and stability of variants of different size and complexity. We investigated the breakpoints of 20 small, common deletions, representing a subset of those originally identified by array CGH, using Agilent microarrays, in 50 healthy French Caucasian subjects. By sequencing PCR products amplified using primers designed to span the deleted regions, we determined the exact size and genomic position of the deletions in all affected samples. For each deletion studied, all individuals carrying the deletion share identical upstream and downstream breakpoints at the sequence level, suggesting that the deletion event occurred just once and later became common in the population. This is supported by linkage disequilibrium (LD) analysis, which has revealed that most of the deletions studied are in moderate to strong LD with surrounding SNPs, and have conserved long-range haplotypes. Analysis of the sequences flanking the deletion breakpoints revealed an enrichment of microhomology at the breakpoint junctions. More significantly, we found an enrichment of Alu repeat elements, the overwhelming majority of which intersected deletion breakpoints at their poly-A tails. We found no enrichment of LINE elements or segmental duplications, in contrast to other reports. Sequence analysis revealed enrichment of a conserved motif in the sequences surrounding the deletion breakpoints, although whether this motif has any mechanistic role in the formation of some deletions has yet to be determined. Considered together with existing information on more complex inherited variant regions, and reports of de novo variants associated with autism, these data support the presence of different subgroups of CNV in the genome which may have originated through different mechanisms. PMID:18769679

  15. The human phospholamban gene: structure and expression.

    PubMed

    McTiernan, C F; Frye, C S; Lemster, B H; Kinder, E A; Ogletree-Hughes, M L; Moravec, C S; Feldman, A M

    1999-03-01

    Phospholamban, through modulation of sarcoplasmic reticulum calcium-ATPase activity, is a key regulator of cardiac diastolic function. Alterations in phospholamban expression may define parameters of muscle relaxation. In experimental animals, phospholamban is differentially expressed in various striated and smooth muscles, and within the four chambers of the heart. Decreased phospholamban expression within the heart during heart failure has also been observed. Furthermore, regulatory elements of mammalian phospholamban genes remain poorly defined. To extend these studies to humans, we (1) characterized phospholamban expression in various human organs, (2) isolated genomic clones encoding the human phospholamban gene, and (3) prepared human phospholamban promoter/luciferase reporter constructs and performed transient transfection assays to begin identification of regulatory elements. We observed that human ventricle and quadriceps displayed high levels of phospholamban transcripts and proteins, with markedly lower expression observed in smooth muscles, while the right atria also expressed low levels of phospholamban. The human phospholamban gene structure closely resembles that reported for chicken, rabbit, rat, and mouse. Comparison of the human to other mammalian phospholamban genes indicates a marked conservation of sequence for at least 217 bp upstream of the transcription start site, which contains conserved motifs for GATA, CP1/NFY, M-CAT-like, and E-box elements. Transient transfection assays with a series of plasmids containing deleted 5' flanking regions (between -2530 and -66 through +85) showed that sequences between -169 and the CP1-box at -93 were required for maximal promoter activity in neonatal rat cardiomyocytes. Activity of these reporters in HeLa cells was markedly lower than that observed in rat cardiomyocytes, suggesting at least a partial tissue selectivity of these reporter constructs.

  16. Modulation of tissue repair by regeneration enhancer elements.

    PubMed

    Kang, Junsu; Hu, Jianxin; Karra, Ravi; Dickson, Amy L; Tornini, Valerie A; Nachtrab, Gregory; Gemberling, Matthew; Goldman, Joseph A; Black, Brian L; Poss, Kenneth D

    2016-04-14

    How tissue regeneration programs are triggered by injury has received limited research attention. Here we investigate the existence of enhancer regulatory elements that are activated in regenerating tissue. Transcriptomic analyses reveal that leptin b (lepb) is highly induced in regenerating hearts and fins of zebrafish. Epigenetic profiling identified a short DNA sequence element upstream and distal to lepb that acquires open chromatin marks during regeneration and enables injury-dependent expression from minimal promoters. This element could activate expression in injured neonatal mouse tissues and was divisible into tissue-specific modules sufficient for expression in regenerating zebrafish fins or hearts. Simple enhancer-effector transgenes employing lepb-linked sequences upstream of pro- or anti-regenerative factors controlled the efficacy of regeneration in zebrafish. Our findings provide evidence for 'tissue regeneration enhancer elements' (TREEs) that trigger gene expression in injury sites and can be engineered to modulate the regenerative potential of vertebrate organs.

  17. Sequence Elements Upstream of the Core Promoter Are Necessary for Full Transcription of the Capsule Gene Operon in Streptococcus pneumoniae Strain D39

    PubMed Central

    Wen, Zhensong; Sertil, Odeniel; Cheng, Yongxin; Zhang, Shanshan; Liu, Xue; Wang, Wen-Ching

    2015-01-01

    Streptococcus pneumoniae is a major bacterial pathogen in humans. Its polysaccharide capsule is a key virulence factor that promotes bacterial evasion of human phagocytic killing. While S. pneumoniae produces at least 94 antigenically different types of capsule, the genes for biosynthesis of almost all capsular types are arranged in the same locus. The transcription of the capsular polysaccharide (cps) locus is not well understood. This study determined the transcriptional features of the cps locus in the type 2 virulent strain D39. The initial analysis revealed that the cps genes are cotranscribed from a major transcription start site at the −25 nucleotide (G) upstream of cps2A, the first gene in the locus. Using unmarked chromosomal truncations and a luciferase-based transcriptional reporter, we showed that the full transcription of the cps genes not only depends on the core promoter immediately upstream of cps2A, but also requires additional elements upstream of the core promoter, particularly a 59-bp sequence immediately upstream of the core promoter. Unmarked deletions of these promoter elements in the D39 genome also led to significant reduction in CPS production and virulence in mice. Lastly, common cps gene (cps2ABCD) mutants did not show significant abnormality in cps transcription, although they produced significantly less CPS, indicating that the CpsABCD proteins are involved in the encapsulation of S. pneumoniae in a posttranscriptional manner. This study has yielded important information on the transcriptional characteristics of the cps locus in S. pneumoniae. PMID:25733517

  18. DENSITY FLUCTUATIONS UPSTREAM AND DOWNSTREAM OF INTERPLANETARY SHOCKS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pitňa, A.; Šafránková, J.; Němeček, Z.

    2016-03-01

    Interplanetary (IP) shocks as typical large-scale disturbances arising from processes such as stream–stream interactions or Interplanetary Coronal Mass Ejection (ICME) launching play a significant role in the energy redistribution, dissipation, particle heating, acceleration, etc. They can change the properties of the turbulent cascade on shorter scales. We focus on changes of the level and spectral properties of ion flux fluctuations upstream and downstream of fast forward oblique shocks. Although the fluctuation level increases by an order of magnitude across the shock, the spectral slope in the magnetohydrodynamic range is conserved. The frequency spectra upstream of IP shocks are the same as those inmore » the solar wind (if not spoiled by foreshock waves). The spectral slopes downstream are roughly proportional to the corresponding slopes upstream, suggesting that the properties of the turbulent cascade are conserved across the shock; thus, the shock does not destroy the shape of the spectrum as turbulence passes through it. Frequency spectra downstream of IP shocks often exhibit “an exponential decay” in the ion kinetic range that was earlier reported at electron scales in the solar wind or at ion scales in the interstellar medium. We suggest that the exponential shape of ion flux spectra in this range is caused by stronger damping of the fluctuations in the downstream region.« less

  19. Vertical distribution of trace-element concentrations and occurrence of metallurgical slag particles in accumulated bed sediments of Lake Roosevelt, Washington, September 2002

    USGS Publications Warehouse

    Cox, S.E.; Bell, P.R.; Lowther, J.S.; Van Metre, P.C.

    2005-01-01

    Sediment cores were collected from six locations in Lake Roosevelt to determine the vertical distributions of trace-element concentrations in the accumulated sediments of Lake Roosevelt. Elevated concentrations of arsenic, cadmium, copper, lead, mercury, and zinc occurred throughout much of the accumulated sediments. Concentrations varied greatly within the sediment core profiles, often covering a range of 5 to 10 fold. Trace-element concentrations typically were largest below the surficial sediments in the lower one-half of each profile, with generally decreasing concentrations from the 1964 horizon to the surface of the core. The trace-element profiles reflect changes in historical discharges of trace elements to the Columbia River by an upstream smelter. All samples analyzed exceeded clean-up guidelines adopted by the Confederated Tribes of the Colville Reservation for cadmium, lead, and zinc and more than 70 percent of the samples exceeded cleanup guidelines for mercury, arsenic, and copper. Although 100 percent of the samples exceeded sediment guidelines for cadmium, lead, and zinc, surficial concentrations of arsenic, copper, and mercury in some cores were less than the sediment-quality guidelines. With the exception of copper, the trace-element profiles of the five cores collected along the pre-reservoir Columbia River channel typically showed trends of decreasing concentrations in sediments deposited after the 1964 time horizon. The decreasing concentrations of trace elements in the upper half of cores from along the pre-reservoir Columbia River showed a pattern of decreasing concentrations similar to reductions in trace-element loading in liquid effluent from an upstream smelter. Except for arsenic, trace-element concentrations typically were smaller at downstream reservoir locations along the pre-reservoir Columbia River. Trace-element concentration in sediments from the Spokane Arm of the reservoir showed distinct differences compared to the similarities observed in cores from along the pre-reservoir Columbia River. Particles of slag, which have physical and chemical characteristics of slag discharged to the Columbia River by a lead-zinc smelter upstream of the reservoir at Trail, British Columbia, were found in sediments of Lake Roosevelt. Slag particles are more common in the upstream reaches of the reservoir. The chemical composition of the interior matrix of slag collected from Lake Roosevelt closely approximated the reported elemental concentrations of fresh smelter slag, although evidence of slag weathering was observed. Exfoliation flakes were observed on the surface of weathered slag particles isolated from the core sediments. The concentrations of zinc on the exposed surface of slag grains were smaller than concentrations on interior surfaces. Weathering rinds also were observed in the cross section of weathered slag grains, indicating that the glassy slag material was undergoing hydration and chemical weathering. Trace elements observed in accumulated sediments in the middle and lower reaches of the reservoir are more likely due to the input from liquid effluent discharges compared to slag discharges from the upstream smelter.

  20. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    PubMed

    Wang, Cheng; Yu, Jie; Kallen, Caleb B

    2008-01-01

    The proliferating cell nuclear antigen (PCNA) is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE) sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2) enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  1. Complete sequence of Tvv1, a family of Ty 1 copia-like retrotransposons of Vitis vinifera L., reconstituted by chromosome walking.

    PubMed

    Pelsy, F.; Merdinoglu, D.

    2002-09-01

    A chromosome-walking strategy was used to sequence and characterize retrotransposons in the grapevine genome. The reconstitution of a family of retroelements, named Tvv1, was achieved by six successive steps. These elements share a single, highly conserved open reading frame 4,153 nucleotides-long, putatively encoding the gag, pro, int, rt and rh proteins. Comparison of the Tvv1 open reading frame coding potential with those of drosophila copia and tobacco Tnt1, revealed that Tvv1 is closely related to Ty 1 copia-like retrotransposons. A highly variable untranslated leader region, upstream of the open reading frame, allowed us to differentiate Tvv1 variants, which represent a family of at least 28 copies, in varying sizes. This internal region is flanked by two long terminal repeats in direct orientation, sized between 149 and 157 bp. Among elements theoretically sized from 4,970 to 5,550 bp, we describe the full-length sequence of a reference element Tvv1-1, 5,343 nucleotides-long. The full-length sequence of Tvv1-1 compared to pea PDR1 shows a 53.3% identity. In addition, both elements contain long terminal repeats of nearly the same size in which the U5 region could be entirely absent. Therefore, we assume that Tvv1 and PDR1 could constitute a particular class of short LTRs retroelements.

  2. Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).

    PubMed

    Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K

    2011-09-01

    Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

  3. Do rivermouths alter nutrient and seston delivery to the nearshore?

    USGS Publications Warehouse

    Larson, James H.; Frost, Paul C.; Vallazza, Jon M.; Nelson, John; Richardson, William B.

    2016-01-01

    Tributary inputs to lakes and seas are often measured at riverine gages, upstream of lentic influence. Between these riverine gages and the nearshore zones of large waterbodies lie rivermouths, which may retain, transform and contribute materials to the nearshore zone. However, the magnitude and timing of these rivermouth effects have rarely been measured.During the summer of 2011, 23 tributary systems of the Laurentian Great Lakes were sampled from river to nearshore for dissolved and particulate carbon (C), nitrogen (N) and phosphorus (P) concentrations, as well as bulk seston and chlorophyll a concentrations. Three locations per system were sampled: in the upstream river, in the nearshore zone and at the outflow from the rivermouth to the lake. Using stable oxygen isotopes, a water-mixing model was developed to estimate the nutrient concentration that would occur at the rivermouth if mixing was strictly conservative (i.e. if no processing occurred within the rivermouth). Deviations between these conservative mixing estimates and measured nutrient concentrations were identified as rivermouth effects on nutrient concentrations.Rivermouths had higher concentration of C and P than nearshore areas and more chlorophyll athan upstream river waters. Compared to the conservative mixing model, rivermouths as a class appeared to be summer-time sources of N, P and chlorophyll a. Substantial among rivermouth variation occurred both in the effect size and direction for all constituents.Using principal component analysis, two groups of rivermouths were identified: rivermouths that had a large effect on most constituents and those that had very little effect on any of the measured constituents. ‘High-effect’ rivermouths had more abundant upstream croplands, which were presumably the sources of inorganic nutrients. Cross-validated models built using characteristics of the rivermouth were not good predictors of variation in rivermouth effects on most constituents.For consumers feeding on seston and microbes and vascular autotrophs directly taking up dissolved nutrients, rivermouths are more resource-rich than upstream riverine or nearby Great Lakes waters. Given declines over time in open-lake productivity within the Great Lakes, rivermouths may contribute more productivity than their size would suggest to the Great Lakes food web.

  4. PUTATIVE GENE PROMOTER SEQUENCES IN THE CHLORELLA VIRUSES

    PubMed Central

    Fitzgerald, Lisa A.; Boucher, Philip T.; Yanai-Balser, Giane; Suhre, Karsten; Graves, Michael V.; Van Etten, James L.

    2008-01-01

    Three short (7 to 9 nucleotides) highly conserved nucleotide sequences were identified in the putative promoter regions (150 bp upstream and 50 bp downstream of the ATG translation start site) of three members of the genus Chlorovirus, family Phycodnaviridae. Most of these sequences occurred in similar locations within the defined promoter regions. The sequence and location of the motifs were often conserved among homologous ORFs within the Chlorovirus family. One of these conserved sequences (AATGACA) is predominately associated with genes expressed early in virus replication. PMID:18768195

  5. Efficient activation of transcription in yeast by the BPV1 E2 protein.

    PubMed Central

    Stanway, C A; Sowden, M P; Wilson, L E; Kingsman, A J; Kingsman, S M

    1989-01-01

    The full-length gene product encoded by the E2 open reading frame (ORF) of bovine papillomavirus type 1 (BPV1) is a transcriptional transactivator. It is believed to mediate its effect on the BPV1 long control region (LCR) by binding to motifs with the consensus sequence ACCN6GGT. The minimal functional cis active site, called the E2 response element (E2RE), in mammalian cells comprises two copies of this motif. Here we have shown that E2 can function in Saccharomyces cerevisiae by placing an E2RE upstream of a synthetic yeast assay promoter which consists of a TATA motif and an mRNA initiation site, spaced correctly. This E2RE-minimal promoter is only transcriptionally active in the presence of E2 protein and the resulting mRNA is initiated at the authentic start site. This is the first report of a mammalian viral transactivator functioning in yeast. The level of activation by E2 via the E2RE was the same as observed with the highly efficient authentic PGK promoter where the upstream activation sequence is composed of three distinct elements. Furthermore a single E2 motif which is insufficient in mammalian cells as an activation site was as efficiently utilized in yeast as the E2RE (2 motifs). Previous studies have shown that mammalian cellular activators can function in yeast and our data now extend this to viral-specific activators. Our data indicate however that while the mechanism of transactivation is broadly conserved there may be significant differences at the detailed level. Images PMID:2539584

  6. In-cell SHAPE uncovers dynamic interactions between the untranslated regions of the foot-and-mouth disease virus RNA.

    PubMed

    Diaz-Toledano, Rosa; Lozano, Gloria; Martinez-Salas, Encarnacion

    2017-02-17

    The genome of RNA viruses folds into 3D structures that include long-range RNA–RNA interactions relevant to control critical steps of the viral cycle. In particular, initiation of translation driven by the IRES element of foot-and-mouth disease virus is stimulated by the 3΄UTR. Here we sought to investigate the RNA local flexibility of the IRES element and the 3΄UTR in living cells. The SHAPE reactivity observed in vivo showed statistically significant differences compared to the free RNA, revealing protected or exposed positions within the IRES and the 3΄UTR. Importantly, the IRES local flexibility was modified in the presence of the 3΄UTR, showing significant protections at residues upstream from the functional start codon. Conversely, presence of the IRES element in cis altered the 3΄UTR local flexibility leading to an overall enhanced reactivity. Unlike the reactivity changes observed in the IRES element, the SHAPE differences of the 3΄UTR were large but not statistically significant, suggesting multiple dynamic RNA interactions. These results were supported by covariation analysis, which predicted IRES-3΄UTR conserved helices in agreement with the protections observed by SHAPE probing. Mutational analysis suggested that disruption of one of these interactions could be compensated by alternative base pairings, providing direct evidences for dynamic long-range interactions between these distant elements of the viral genome.

  7. Multiple Cis-acting elements modulate programmed -1 ribosomal frameshifting in Pea enation mosaic virus

    PubMed Central

    Gao, Feng; Simon, Anne E.

    2016-01-01

    Programmed -1 ribosomal frameshifting (-1 PRF) is used by many positive-strand RNA viruses for translation of required products. Despite extensive studies, it remains unresolved how cis-elements just downstream of the recoding site promote a precise level of frameshifting. The Umbravirus Pea enation mosaic virus RNA2 expresses its RNA polymerase by -1 PRF of the 5′-proximal ORF (p33). Three hairpins located in the vicinity of the recoding site are phylogenetically conserved among Umbraviruses. The central Recoding Stimulatory Element (RSE), located downstream of the p33 termination codon, is a large hairpin with two asymmetric internal loops. Mutational analyses revealed that sequences throughout the RSE and the RSE lower stem (LS) structure are important for frameshifting. SHAPE probing of mutants indicated the presence of higher order structure, and sequences in the LS may also adapt an alternative conformation. Long-distance pairing between the RSE and a 3′ terminal hairpin was less critical when the LS structure was stabilized. A basal level of frameshifting occurring in the absence of the RSE increases to 72% of wild-type when a hairpin upstream of the slippery site is also deleted. These results suggest that suppression of frameshifting may be needed in the absence of an active RSE conformation. PMID:26578603

  8. [Analysis of cis-regulatory element distribution in gene promoters of Gossypium raimondii and Arabidopsis thaliana].

    PubMed

    Sun, Gao-Fei; He, Shou-Pu; Du, Xiong-Ming

    2013-10-01

    Cotton genomic studies have boomed since the release of Gossypium raimondii draft genome. In this study, cis-regulatory element (CRE) in 1 kb length sequence upstream 5' UTR of annotated genes were selected and scanned in the Arabidopsis thaliana (At) and Gossypium raimondii (Gr) genomes, based on the database of PLACE (Plant cis-acting Regulatory DNA Elements). According to the definition of this study, 44 (12.3%) and 57 (15.5%) CREs presented "peak-like" distribution in the 1 kb selected sequences of both genomes, respectively. Thirty-four of them were peak-like distributed in both genomes, which could be further categorized into 4 types based on their core sequences. The coincidence of TATABOX peak position and their actual position ((-) -30 bp) indicated that the position of a common CRE was conservative in different genes, which suggested that the peak position of these CREs was their possible actual position of transcription factors. The position of a common CRE was also different between the two genomes due to stronger length variation of 5' UTR in Gr than At. Furthermore, most of the peak-like CREs were located in the region of -110 bp-0 bp, which suggested that concentrated distribution might be conductive to the interaction of transcription factors, and then regulate the gene expression in downstream.

  9. A novel mammal-specific three partite enhancer element regulates node and notochord-specific Noto expression.

    PubMed

    Alten, Leonie; Schuster-Gossler, Karin; Eichenlaub, Michael P; Wittbrodt, Beate; Wittbrodt, Joachim; Gossler, Achim

    2012-01-01

    The vertebrate organizer and notochord have conserved, essential functions for embryonic development and patterning. The restricted expression of developmental regulators in these tissues is directed by specific cis-regulatory modules (CRMs) whose sequence conservation varies considerably. Some CRMs have been conserved throughout vertebrates and likely represent ancestral regulatory networks, while others have diverged beyond recognition but still function over a wide evolutionary range. Here we identify and characterize a mammalian-specific CRM required for node and notochord specific (NNC) expression of NOTO, a transcription factor essential for node morphogenesis, nodal cilia movement and establishment of laterality in mouse. A 523 bp enhancer region (NOCE) upstream the Noto promoter was necessary and sufficient for NNC expression from the endogenous Noto locus. Three subregions in NOCE together mediated full activity in vivo. Binding sites for known transcription factors in NOCE were functional in vitro but dispensable for NOCE activity in vivo. A FOXA2 site in combination with a novel motif was necessary for NOCE activity in vivo. Strikingly, syntenic regions in non-mammalian vertebrates showed no recognizable sequence similarities. In contrast to its activity in mouse NOCE did not drive NNC expression in transgenic fish. NOCE represents a novel, mammal-specific CRM required for the highly restricted Noto expression in the node and nascent notochord and thus regulates normal node development and function.

  10. Greig syndrome: Analysis of the GL13 gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Grzeschik, K.H.; Gessler, M.; Heid, C.

    1994-09-01

    Disruption of the zinc finger gene GL13 by translocation events has been implicated as the cause for cephalopolysyndactyly syndrome (GCPS) in several patients. To characterize this genomic region on human chromosome 7p13, we have isolated a YAC contig of more than 1000 kb including the GL13 gene. About 550 kb from this area were subdivided into a cosmid contig with a two- to ten-fold clone coverage. In this region the cloned GL13 cDNA appears to correspond to at least 14 exons spread over a distance of 280 kb. A CpG island defined by two NotI sites and several BssHII andmore » KspI sites is located in a genomic fragment covering the most proximal exon of the cloned GL13 cDNA. Further upstream, five segments conserved between man and mouse were found. In the mouse this region has been characterized as the transgene integration site resulting in the add phenotype. Both the CpG islands and the conserved regions are likely candidates to search for GL13 promoter and control elements. Intron-exon boundaries and breakpoints of the translocation events within the gene region of patients were identified and characterized.« less

  11. Novel mechanism of conjoined gene formation in the human genome.

    PubMed

    Kim, Ryong Nam; Kim, Aeri; Choi, Sang-Haeng; Kim, Dae-Soo; Nam, Seong-Hyeuk; Kim, Dae-Won; Kim, Dong-Wook; Kang, Aram; Kim, Min-Young; Park, Kun-Hyang; Yoon, Byoung-Ha; Lee, Kang Seon; Park, Hong-Seog

    2012-03-01

    Recently, conjoined genes (CGs) have emerged as important genetic factors necessary for understanding the human genome. However, their formation mechanism and precise structures have remained mysterious. Based on a detailed structural analysis of 57 human CG transcript variants (CGTVs, discovered in this study) and all (833) known CGs in the human genome, we discovered that the poly(A) signal site from the upstream parent gene region is completely removed via the skipping or truncation of the final exon; consequently, CG transcription is terminated at the poly(A) signal site of the downstream parent gene. This result led us to propose a novel mechanism of CG formation: the complete removal of the poly(A) signal site from the upstream parent gene is a prerequisite for the CG transcriptional machinery to continue transcribing uninterrupted into the intergenic region and downstream parent gene. The removal of the poly(A) signal sequence from the upstream gene region appears to be caused by a deletion or truncation mutation in the human genome rather than post-transcriptional trans-splicing events. With respect to the characteristics of CG sequence structures, we found that intergenic regions are hot spots for novel exon creation during CGTV formation and that exons farther from the intergenic regions are more highly conserved in the CGTVs. Interestingly, many novel exons newly created within the intergenic and intragenic regions originated from transposable element sequences. Additionally, the CGTVs showed tumor tissue-biased expression. In conclusion, our study provides novel insights into the CG formation mechanism and expands the present concepts of the genetic structural landscape, gene regulation, and gene formation mechanisms in the human genome.

  12. Two alternative ways of start site selection in human norovirus reinitiation of translation.

    PubMed

    Luttermann, Christine; Meyers, Gregor

    2014-04-25

    The calicivirus minor capsid protein VP2 is expressed via termination/reinitiation. This process depends on an upstream sequence element denoted termination upstream ribosomal binding site (TURBS). We have shown for feline calicivirus and rabbit hemorrhagic disease virus that the TURBS contains three sequence motifs essential for reinitiation. Motif 1 is conserved among caliciviruses and is complementary to a sequence in the 18 S rRNA leading to the model that hybridization between motif 1 and 18 S rRNA tethers the post-termination ribosome to the mRNA. Motif 2 and motif 2* are proposed to establish a secondary structure positioning the ribosome relative to the start site of the terminal ORF. Here, we analyzed human norovirus (huNV) sequences for the presence and importance of these motifs. The three motifs were identified by sequence analyses in the region upstream of the VP2 start site, and we showed that these motifs are essential for reinitiation of huNV VP2 translation. More detailed analyses revealed that the site of reinitiation is not fixed to a single codon and does not need to be an AUG, even though this codon is clearly preferred. Interestingly, we were able to show that reinitiation can occur at AUG codons downstream of the canonical start/stop site in huNV and feline calicivirus but not in rabbit hemorrhagic disease virus. Although reinitiation at the original start site is independent of the Kozak context, downstream initiation exhibits requirements for start site sequence context known for linear scanning. These analyses on start codon recognition give a more detailed insight into this fascinating mechanism of gene expression.

  13. Filling gaps in a large reserve network to address freshwater conservation needs.

    PubMed

    Hermoso, Virgilio; Filipe, Ana Filipa; Segurado, Pedro; Beja, Pedro

    2015-09-15

    Freshwater ecosystems and biodiversity are among the most threatened at global scale, but efforts for their conservation have been mostly peripheral to terrestrial conservation. For example, Natura 2000, the world's largest network of protected areas, fails to cover adequately the distribution of rare and endangered aquatic species, and lacks of appropriate spatial design to make conservation for freshwater biodiversity effective. Here, we develop a framework to identify a complementary set of priority areas and enhance the conservation opportunities of Natura 2000 for freshwater biodiversity, using the Iberian Peninsula as a case study. We use a systematic planning approach to identify a minimum set of additional areas that would help i) adequately represent all freshwater fish, amphibians and aquatic reptiles at three different target levels, ii) account for key ecological processes derived from riverscape connectivity, and iii) minimize the impact of threats, both within protected areas and propagated from upstream unprotected areas. Addressing all these goals would need an increase in area between 7 and 46%, depending on the conservation target used and strength of connectivity required. These new priority areas correspond to subcatchments inhabited by endangered and range restricted species, as well as additional subcatchments required to improve connectivity among existing protected areas and to increase protection against upstream threats. Our study should help guide future revisions of the design of Natura 2000, while providing a framework to address deficiencies in reserve networks for adequately protecting freshwater biodiversity elsewhere. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Molecular links among the causative genes for ocular malformation: Otx2 and Sox2 coregulate Rax expression

    PubMed Central

    Danno, Hiroki; Michiue, Tatsuo; Hitachi, Keisuke; Yukita, Akira; Ishiura, Shoichi; Asashima, Makoto

    2008-01-01

    The neural-related genes Sox2, Pax6, Otx2, and Rax have been associated with severe ocular malformations such as anophthalmia and microphthalmia, but it remains unclear as to how these genes are linked functionally. We analyzed the upstream signaling of Xenopus Rax (also known as Rx1) and identified the Otx2 and Sox2 proteins as direct upstream regulators of Rax. We revealed that endogenous Otx2 and Sox2 proteins bound to the conserved noncoding sequence (CNS1) located ≈2 kb upstream of the Rax promoter. This sequence is conserved among vertebrates and is required for potent transcriptional activity. Reporter assays showed that Otx2 and Sox2 synergistically activated transcription via CNS1. Furthermore, the Otx2 and Sox2 proteins physically interacted with each other, and this interaction was affected by the Sox2-missense mutations identified in these ocular disorders. These results demonstrate that the direct interaction and interdependence between the Otx2 and Sox2 proteins coordinate Rax expression in eye development, providing molecular linkages among the genes responsible for ocular malformation. PMID:18385377

  15. From egg to gastrula: How the cell cycle is remodeled during the Drosophila mid-blastula transition

    PubMed Central

    Farrell, Jeffrey A.; O’Farrell, Patrick H.

    2015-01-01

    Many, if not most, embryos begin development with extremely short cell cycles that exhibit unusually rapid DNA replication and no gap phases. The commitment to the cell cycle in the early embryo appears to preclude many other cellular processes which only emerge as the cell cycle slows, at a major embryonic transition known as the mid-blastula transition (MBT) just prior to gastrulation. As reviewed here, genetic and molecular studies in Drosophila have identified changes that extend S phase and introduce a post-replicative gap phase, G2, to slow the cell cycle. While many mysteries remain about the upstream regulators of these changes, we review the core mechanisms of the change in cell cycle regulation and discuss advances in our understanding of how these might be timed and triggered. Finally, we consider how the elements of this program may be conserved or changed in other organisms. PMID:25195504

  16. Evolution of Advection Upstream Splitting Method Schemes

    NASA Technical Reports Server (NTRS)

    Liou, Meng-Sing

    2010-01-01

    This paper focuses on the evolution of advection upstream splitting method(AUSM) schemes. The main ingredients that have led to the development of modern computational fluid dynamics (CFD) methods have been reviewed, thus the ideas behind AUSM. First and foremost is the concept of upwinding. Second, the use of Riemann problem in constructing the numerical flux in the finite-volume setting. Third, the necessity of including all physical processes, as characterised by the linear (convection) and nonlinear (acoustic) fields. Fourth, the realisation of separating the flux into convection and pressure fluxes. The rest of this review briefly outlines the technical evolution of AUSM and more details can be found in the cited references. Keywords: Computational fluid dynamics methods, hyperbolic systems, advection upstream splitting method, conservation laws, upwinding, CFD

  17. Contactor/filter improvements

    DOEpatents

    Stelman, D.

    1988-06-30

    A contactor/filter arrangement for removing particulate contaminants from a gaseous stream is described. The filter includes a housing having a substantially vertically oriented granular material retention member with upstream and downstream faces, a substantially vertically oriented microporous gas filter element, wherein the retention member and the filter element are spaced apart to provide a zone for the passage of granular material therethrough. A gaseous stream containing particulate contaminants passes through the gas inlet means as well as through the upstream face of the granular material retention member, passing through the retention member, the body of granular material, the microporous gas filter element, exiting out of the gas outlet means. A cover screen isolates the filter element from contact with the moving granular bed. In one embodiment, the granular material is comprised of porous alumina impregnated with CuO, with the cover screen cleaned by the action of the moving granular material as well as by backflow pressure pulses. 6 figs.

  18. The immediate upstream region of the 5′-UTR from the AUG start codon has a pronounced effect on the translational efficiency in Arabidopsis thaliana

    PubMed Central

    Kim, Younghyun; Lee, Goeun; Jeon, Eunhyun; Sohn, Eun ju; Lee, Yongjik; Kang, Hyangju; Lee, Dong wook; Kim, Dae Heon; Hwang, Inhwan

    2014-01-01

    The nucleotide sequence around the translational initiation site is an important cis-acting element for post-transcriptional regulation. However, it has not been fully understood how the sequence context at the 5′-untranslated region (5′-UTR) affects the translational efficiency of individual mRNAs. In this study, we provide evidence that the 5′-UTRs of Arabidopsis genes showing a great difference in the nucleotide sequence vary greatly in translational efficiency with more than a 200-fold difference. Of the four types of nucleotides, the A residue was the most favourable nucleotide from positions −1 to −21 of the 5′-UTRs in Arabidopsis genes. In particular, the A residue in the 5′-UTR from positions −1 to −5 was required for a high-level translational efficiency. In contrast, the T residue in the 5′-UTR from positions −1 to −5 was the least favourable nucleotide in translational efficiency. Furthermore, the effect of the sequence context in the −1 to −21 region of the 5′-UTR was conserved in different plant species. Based on these observations, we propose that the sequence context immediately upstream of the AUG initiation codon plays a crucial role in determining the translational efficiency of plant genes. PMID:24084084

  19. Two distinct auto-regulatory loops operate at the PU.1 locus in B cells and myeloid cells

    PubMed Central

    Leddin, Mathias; Perrod, Chiara; Hoogenkamp, Maarten; Ghani, Saeed; Assi, Salam; Heinz, Sven; Wilson, Nicola K.; Follows, George; Schönheit, Jörg; Vockentanz, Lena; Mosammam, Ali M.; Chen, Wei; Tenen, Daniel G.; Westhead, David R.; Göttgens, Berthold

    2011-01-01

    The transcription factor PU.1 occupies a central role in controlling myeloid and early B-cell development, and its correct lineage-specific expression is critical for the differentiation choice of hematopoietic progenitors. However, little is known of how this tissue-specific pattern is established. We previously identified an upstream regulatory cis element whose targeted deletion in mice decreases PU.1 expression and causes leukemia. We show here that the upstream regulatory cis element alone is insufficient to confer physiologic PU.1 expression in mice but requires the cooperation with other, previously unidentified elements. Using a combination of transgenic studies, global chromatin assays, and detailed molecular analyses we present evidence that PU.1 is regulated by a novel mechanism involving cross talk between different cis elements together with lineage-restricted autoregulation. In this model, PU.1 regulates its expression in B cells and macrophages by differentially associating with cell type–specific transcription factors at one of its cis-regulatory elements to establish differential activity patterns at other elements. PMID:21239694

  20. Apparatus for purifying exhaust gases of internal combustion engines

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kakinuma, A.; Oya, H.

    1980-06-03

    Apparatus for purifying the exhaust gases of internal combustion engines is disclosed that is comprised of a pair of upstream exhaust pipes, a catalytic converter, and a downstream exhaust pipe. The catalytic converter comprises a cylindrical shell having an inlet chamber, a catalyst chamber, an outlet chamber, and a monolithic catalyst element in the catalyst chamber. The inlet chamber has inlet ports communicating with the upstream exhaust pipes respectively and axial lines of the inlet ports cross each other in the inlet chamber. In the inlet chamber, a diffusion means is provided to diffuse the exhaust gas for uniformly distributingmore » it to the catalyst element.« less

  1. Activation-dependent intrachromosomal interactions formed by the TNF gene promoter and two distal enhancers

    PubMed Central

    Tsytsykova, Alla V.; Rajsbaum, Ricardo; Falvo, James V.; Ligeiro, Filipa; Neely, Simon R.; Goldfeld, Anne E.

    2007-01-01

    Here we provide a mechanism for specific, efficient transcription of the TNF gene and, potentially, other genes residing within multigene loci. We identify and characterize highly conserved noncoding elements flanking the TNF gene, which undergo activation-dependent intrachromosomal interactions. These elements, hypersensitive site (HSS)−9 and HSS+3 (9 kb upstream and 3 kb downstream of the TNF gene, respectively), contain DNase I hypersensitive sites in naive, T helper 1, and T helper 2 primary T cells. Both HSS-9 and HSS+3 inducibly associate with acetylated histones, indicative of chromatin remodeling, bind the transcription factor nuclear factor of activated T cells (NFAT)p in vitro and in vivo, and function as enhancers of NFAT-dependent transactivation mediated by the TNF promoter. Using the chromosome conformation capture assay, we demonstrate that upon T cell activation intrachromosomal looping occurs in the TNF locus. HSS-9 and HSS+3 each associate with the TNF promoter and with each other, circularizing the TNF gene and bringing NFAT-containing nucleoprotein complexes into close proximity. TNF gene regulation thus reveals a mode of intrachromosomal interaction that combines a looped gene topology with interactions between enhancers and a gene promoter. PMID:17940009

  2. Transposable Elements versus the Fungal Genome: Impact on Whole-Genome Architecture and Transcriptional Profiles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Castanera, Raul; Lopez-Varas, Leticia; Borgognone, Alessandra

    Transposable elements (TEs) are exceptional contributors to eukaryotic genome diversity. Their ubiquitous presence impacts the genomes of nearly all species and mediates genome evolution by causing mutations and chromosomal rearrangements and by modulating gene expression. We performed an exhaustive analysis of the TE content in 18 fungal genomes, including strains of the same species and species of the same genera. Our results depicted a scenario of exceptional variability, with species having 0.02 to 29.8% of their genome consisting of transposable elements. A detailed analysis performed on two strains of Pleurotus ostreatus uncovered a genome that is populated mainly by Classmore » I elements, especially LTR-retrotransposons amplified in recent bursts from 0 to 2 million years (My) ago. The preferential accumulation of TEs in clusters led to the presence of genomic regions that lacked intra- and inter-specific conservation. In addition, we investigated the effect of TE insertions on the expression of their nearby upstream and downstream genes. Our results showed that an important number of genes under TE influence are significantly repressed, with stronger repression when genes are localized within transposon clusters. Our transcriptional analysis performed in four additional fungal models revealed that this TE-mediated silencing was present only in species with active cytosine methylation machinery. We hypothesize that this phenomenon is related to epigenetic defense mechanisms that are aimed to suppress TE expression and control their proliferation.« less

  3. Transposable Elements versus the Fungal Genome: Impact on Whole-Genome Architecture and Transcriptional Profiles

    DOE PAGES

    Castanera, Raul; Lopez-Varas, Leticia; Borgognone, Alessandra; ...

    2016-06-13

    Transposable elements (TEs) are exceptional contributors to eukaryotic genome diversity. Their ubiquitous presence impacts the genomes of nearly all species and mediates genome evolution by causing mutations and chromosomal rearrangements and by modulating gene expression. We performed an exhaustive analysis of the TE content in 18 fungal genomes, including strains of the same species and species of the same genera. Our results depicted a scenario of exceptional variability, with species having 0.02 to 29.8% of their genome consisting of transposable elements. A detailed analysis performed on two strains of Pleurotus ostreatus uncovered a genome that is populated mainly by Classmore » I elements, especially LTR-retrotransposons amplified in recent bursts from 0 to 2 million years (My) ago. The preferential accumulation of TEs in clusters led to the presence of genomic regions that lacked intra- and inter-specific conservation. In addition, we investigated the effect of TE insertions on the expression of their nearby upstream and downstream genes. Our results showed that an important number of genes under TE influence are significantly repressed, with stronger repression when genes are localized within transposon clusters. Our transcriptional analysis performed in four additional fungal models revealed that this TE-mediated silencing was present only in species with active cytosine methylation machinery. We hypothesize that this phenomenon is related to epigenetic defense mechanisms that are aimed to suppress TE expression and control their proliferation.« less

  4. Widespread promoter-mediated coordination of transcription and mRNA degradation

    PubMed Central

    2012-01-01

    Background Previous work showed that mRNA degradation is coordinated with transcription in yeast, and in several genes the control of mRNA degradation was linked to promoter elements through two different mechanisms. Here we show at the genomic scale that the coordination of transcription and mRNA degradation is promoter-dependent in yeast and is also observed in humans. Results We first demonstrate that swapping upstream cis-regulatory sequences between two yeast species affects both transcription and mRNA degradation and suggest that while some cis-regulatory elements control either transcription or degradation, multiple other elements enhance both processes. Second, we show that adjacent yeast genes that share a promoter (through divergent orientation) have increased similarity in their patterns of mRNA degradation, providing independent evidence for the promoter-mediated coupling of transcription to mRNA degradation. Finally, analysis of the differences in mRNA degradation rates between mammalian cell types or mammalian species suggests a similar coordination between transcription and mRNA degradation in humans. Conclusions Our results extend previous studies and suggest a pervasive promoter-mediated coordination between transcription and mRNA degradation in yeast. The diverse genes and regulatory elements associated with this coordination suggest that it is generated by a global mechanism of gene regulation and modulated by gene-specific mechanisms. The observation of a similar coupling in mammals raises the possibility that coupling of transcription and mRNA degradation may reflect an evolutionarily conserved phenomenon in gene regulation. PMID:23237624

  5. Observations on the Growth of Roughness Elements Into Icing Feathers

    NASA Technical Reports Server (NTRS)

    Vargas, Mario; Tsao, Jen, Ching

    2007-01-01

    This work presents the results of an experiment conducted in the Icing Research Tunnel at NASA Glenn Research Center to understand the process by which icing feathers are formed in the initial stages of ice accretion formation on swept wings. Close-up photographic data were taken on an aluminum NACA 0012 swept wing tip airfoil. Two types of photographic data were obtained: time sequence close-up photographic data during the run and close-up photographic data of the ice accretion at the end of each run. Icing runs were conducted for short ice accretion times from 10 to 180 sec. The time sequence close-up photographic data was used to study the process frame by frame and to create movies of how the process developed. The movies confirmed that at glaze icing conditions in the attachment line area icing feathers develop from roughness elements. The close-up photographic data at the end of each run showed that roughness elements change into a pointed shape with an upstream facet and join on the side with other elements having the same change to form ridges with pointed shape and upstream facet. The ridges develop into feathers when the upstream facet grows away to form the stem of the feather. The ridges and their growth into feathers were observed to form the initial scallop tips present in complete scallops.

  6. Upstream dispersal of an invasive crayfish aided by a fish passage facility

    USGS Publications Warehouse

    Welsh, Stuart A.; Loughman, Zachary J.

    2015-01-01

    Fish passage facilities for reservoir dams have been used to restore habitat connectivity within riverine networks by allowing upstream passage for native species. These facilities may also support the spread of invasive species, an unintended consequence and potential downside of upstream passage structures. We documented dam passage of the invasive virile crayfish, Orconectes virilis (Hagen, 1870), at fish ladders designed for upstream passage of American eels, Anguilla rostrata (Lesueur, 1817), in the Shenandoah River drainage, USA. Ladder use and upstream passage of 11 virile crayfish occurred from 2007–2014 during periods of low river discharge (<30 m3s–1) and within a wide range of water temperatures from 9.0–28.6 °C. Virile crayfish that used the eel ladders were large adults with a mean carapace length and width of 48.0 mm and 24.1 mm, respectively. Our data demonstrated the use of species-specific fish ladders by a non-target non-native species, which has conservation and management implications for the spread of aquatic invasive species and upstream passage facilities. Specifically, managers should consider implementing long-term monitoring of fish passage facilities with emphasis on detection of invasive species, as well as methods to reduce or eliminate passage of invasive species. 

  7. Inductively heated particulate matter filter regeneration control system

    DOEpatents

    Gonze, Eugene V; Paratore Jr., Michael J; Kirby, Kevin W; Phelps, Amanda; Gregoire, Daniel J

    2012-10-23

    A system includes a particulate matter (PM) filter with an upstream end for receiving exhaust gas, a downstream end and zones. The system also includes a heating element. A control module selectively activates the heating element to inductively heat one of the zones.

  8. Application of finite element approach to transonic flow problems

    NASA Technical Reports Server (NTRS)

    Hafez, M. M.; Murman, E. M.; Wellford, L. C., Jr.

    1976-01-01

    A variational finite element model for transonic small disturbance calculations is described. Different strategy is adopted in subsonic and supersonic regions, and blending elements are introduced between different regions. In the supersonic region, no upstream effect is allowed. If rectangular elements with linear shape functions are used, the model is similar to Murman's finite difference operators. Higher order shape functions, nonrectangular elements, and discontinuous approximation of shock waves are also discussed.

  9. Core histone genes of Giardia intestinalis: genomic organization, promoter structure, and expression

    PubMed Central

    Yee, Janet; Tang, Anita; Lau, Wei-Ling; Ritter, Heather; Delport, Dewald; Page, Melissa; Adam, Rodney D; Müller, Miklós; Wu, Gang

    2007-01-01

    Background Giardia intestinalis is a protist found in freshwaters worldwide, and is the most common cause of parasitic diarrhea in humans. The phylogenetic position of this parasite is still much debated. Histones are small, highly conserved proteins that associate tightly with DNA to form chromatin within the nucleus. There are two classes of core histone genes in higher eukaryotes: DNA replication-independent histones and DNA replication-dependent ones. Results We identified two copies each of the core histone H2a, H2b and H3 genes, and three copies of the H4 gene, at separate locations on chromosomes 3, 4 and 5 within the genome of Giardia intestinalis, but no gene encoding a H1 linker histone could be recognized. The copies of each gene share extensive DNA sequence identities throughout their coding and 5' noncoding regions, which suggests these copies have arisen from relatively recent gene duplications or gene conversions. The transcription start sites are at triplet A sequences 1–27 nucleotides upstream of the translation start codon for each gene. We determined that a 50 bp region upstream from the start of the histone H4 coding region is the minimal promoter, and a highly conserved 15 bp sequence called the histone motif (him) is essential for its activity. The Giardia core histone genes are constitutively expressed at approximately equivalent levels and their mRNAs are polyadenylated. Competition gel-shift experiments suggest that a factor within the protein complex that binds him may also be a part of the protein complexes that bind other promoter elements described previously in Giardia. Conclusion In contrast to other eukaryotes, the Giardia genome has only a single class of core histone genes that encode replication-independent histones. Our inability to locate a gene encoding the linker histone H1 leads us to speculate that the H1 protein may not be required for the compaction of Giardia's small and gene-rich genome. PMID:17425802

  10. Structural and functional analysis of an enhancer GPEI having a phorbol 12-O-tetradecanoate 13-acetate responsive element-like sequence found in the rat glutathione transferase P gene.

    PubMed

    Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M

    1989-10-05

    We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.

  11. Optimal frequency-response sensitivity of compressible flow over roughness elements

    NASA Astrophysics Data System (ADS)

    Fosas de Pando, Miguel; Schmid, Peter J.

    2017-04-01

    Compressible flow over a flat plate with two localised and well-separated roughness elements is analysed by global frequency-response analysis. This analysis reveals a sustained feedback loop consisting of a convectively unstable shear-layer instability, triggered at the upstream roughness, and an upstream-propagating acoustic wave, originating at the downstream roughness and regenerating the shear-layer instability at the upstream protrusion. A typical multi-peaked frequency response is recovered from the numerical simulations. In addition, the optimal forcing and response clearly extract the components of this feedback loop and isolate flow regions of pronounced sensitivity and amplification. An efficient parametric-sensitivity framework is introduced and applied to the reference case which shows that first-order increases in Reynolds number and roughness height act destabilising on the flow, while changes in Mach number or roughness separation cause corresponding shifts in the peak frequencies. This information is gained with negligible effort beyond the reference case and can easily be applied to more complex flows.

  12. The muscle creatine kinase gene is regulated by multiple upstream elements, including a muscle-specific enhancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jaynes, J.B.; Johnson, J.E.; Buskin, J.N.

    1988-01-01

    Muscle creatine kinase (MCK) is induced to high levels during skeletal muscle differentiation. The authors examined the upstream regulatory elements of the mouse MCK gene which specify its activation during myogenesis in culture. Fusion genes containing up to 3,300 nucleotides (nt) of MCK 5' flanking DNA in various positions and orientations relative to the bacterial chloramphenicol acetyltransferase (CAT) structural gene were transfected into cultured cells. Transient expression of CAT was compared between proliferating and differentiated MM14 mouse myoblasts and with nonmyogenic mouse L cells. The major effector of high-level expression was found to have the properties of a transcriptional enhancer.more » This element, located between 1,050 and 1,256 nt upstream of the transcription start site, was also found to have a major influence on the tissue and differentiation specificity of MCK expression; it activated either the MCK promoter or heterologous promoters only in differentiated muscle cells. Comparisons of viral and cellular enhancer sequences with the MCK enhancer revealed some similarities to essential regions of the simian virus 40 enhancer as well as to a region of the immunoglobulin heavy-chain enhancer, which has been implicated in tissue-specific protein binding. Even in the absence of the enhancer, low-level expression from a 776-nt MCK promoter retained differentiation specificity. In addition to positive regulatory elements, our data provide some evidence for negative regulatory elements with activity in myoblasts. These may contribute to the cell type and differentiation specificity of MCK expression.« less

  13. DNA sequence requirements for the accurate transcription of a protein-coding plastid gene in a plastid in vitro system from mustard (Sinapis alba L.)

    PubMed Central

    Link, Gerhard

    1984-01-01

    A nuclease-treated plastid extract from mustard (Sinapis alba L.) allows efficient transcription of cloned plastid DNA templates. In this in vitro system, the major runoff transcript of the truncated gene for the 32 000 mol. wt. photosystem II protein was accurately initiated from a site close to or identical with the in vivo start site. By using plasmids with deletions in the 5'-flanking region of this gene as templates, a DNA region required for efficient and selective initiation was detected ˜28-35 nucleotides upstream of the transcription start site. This region contains the sequence element TTGACA, which matches the consensus sequence for prokaryotic `−35' promoter elements. In the absence of this region, a region ˜13-27 nucleotides upstream of the start site still enables a basic level of specific transcription. This second region contains the sequence element TATATAA, which matches the consensus sequence for the `TATA' box of genes transcribed by RNA polymerase II (or B). The region between the `TATA'-like element and the transcription start site is not sufficient but may be required for specific transcription of the plastid gene. This latter region contains the sequence element TATACT, which resembles the prokaryotic `−10' (Pribnow) box. Based on the structural and transcriptional features of the 5' upstream region, a `promoter switch' mechanism is proposed, which may account for the developmentally regulated expression of this plastid gene. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Figure 5. PMID:16453540

  14. Estimating bioaccessibility of trace elements in particles suspended in the Athabasca River using sequential extraction.

    PubMed

    Javed, Muhammad Babar; Shotyk, William

    2018-05-10

    Employing protocols developed for polar snow and ice, water samples were collected upstream, midstream and downstream of open pit bitumen mines and upgraders along the Lower Athabasca River (AR). The purpose was to: i) estimate the bioaccessibility of trace elements associated with particulate matter in the AR using sequential extraction, and ii) determine whether their forms have been measurably impacted by industrial activities. Of the trace metals known to be enriched in bitumen (V, Ni, Mo and Re), a substantial proportion of V (78-93%) and Ni (35-81%) was found in the residual fraction representing stable minerals. In contrast, Mo and Re were partitioned mainly into more reactive forms (water soluble, acid extractable, reducible and oxidisable). Comparing the non-residual fractions in upstream versus downstream sites, only water soluble Re was significantly (P = 0.005) greater downstream of industry. In respect to the potentially toxic chalcophile elements (Cu, Pb and Tl), no measurable change was observed in Cu and Pb distribution in upstream versus downstream sites. Only residual Tl was found at upstream and midstream sites, whereas a significant proportion of Tl was also present in the reducible fraction in downstream sites. Overall, a greater proportion of trace metals in the residual fraction at midstream sites appears to be due to inputs of atmospheric dust, clearly evident in microscopic images: energy dispersive spectroscopy and x-ray diffraction analyses showed that these particles were predominantly silicates, which are assumed to have limited bioaccessibility. Copyright © 2018 Elsevier Ltd. All rights reserved.

  15. PROSPECT improves cis-acting regulatory element prediction by integrating expression profile data with consensus pattern searches

    PubMed Central

    Fujibuchi, Wataru; Anderson, John S. J.; Landsman, David

    2001-01-01

    Consensus pattern and matrix-based searches designed to predict cis-acting transcriptional regulatory sequences have historically been subject to large numbers of false positives. We sought to decrease false positives by incorporating expression profile data into a consensus pattern-based search method. We have systematically analyzed the expression phenotypes of over 6000 yeast genes, across 121 expression profile experiments, and correlated them with the distribution of 14 known regulatory elements over sequences upstream of the genes. Our method is based on a metric we term probabilistic element assessment (PEA), which is a ranking of potential sites based on sequence similarity in the upstream regions of genes with similar expression phenotypes. For eight of the 14 known elements that we examined, our method had a much higher selectivity than a naïve consensus pattern search. Based on our analysis, we have developed a web-based tool called PROSPECT, which allows consensus pattern-based searching of gene clusters obtained from microarray data. PMID:11574681

  16. Near-field flow structures about subcritical surface roughness

    NASA Astrophysics Data System (ADS)

    Doolittle, Charles J.; Drews, Scott D.; Goldstein, David B.

    2014-12-01

    Laminar flow over a periodic array of cylindrical surface roughness elements is simulated with an immersed boundary spectral method both to validate the method for subsequent studies and to examine how persistent streamwise vortices are introduced by a low Reynolds number roughness element. Direct comparisons are made with prior studies at a roughness-based Reynolds number Rek (=U(k) k/ν) of 205 and a diameter to spanwise spacing ratio d/λ of 1/3. Downstream velocity contours match present and past experiments very well. The shear layer developed over the top of the roughness element produces the downstream velocity deficit. Upstream of the roughness element, the vortex topology is found to be consistent with juncture flow experiments, creating three cores along the recirculation line. Streamtraces stemming from these upstream cores, however, have unexpectedly little effect on the downstream flowfield as lateral divergence of the boundary layer quickly dissipates their vorticity. Long physical relaxation time of the recirculating wake behind the roughness remains a prominent issue for simulating this type of flowfield.

  17. Dynamic regulation of VEGF-inducible genes by an ERK/ERG/p300 transcriptional network.

    PubMed

    Fish, Jason E; Cantu Gutierrez, Manuel; Dang, Lan T; Khyzha, Nadiya; Chen, Zhiqi; Veitch, Shawn; Cheng, Henry S; Khor, Melvin; Antounians, Lina; Njock, Makon-Sébastien; Boudreau, Emilie; Herman, Alexander M; Rhyner, Alexander M; Ruiz, Oscar E; Eisenhoffer, George T; Medina-Rivera, Alejandra; Wilson, Michael D; Wythe, Joshua D

    2017-07-01

    The transcriptional pathways activated downstream of vascular endothelial growth factor (VEGF) signaling during angiogenesis remain incompletely characterized. By assessing the signals responsible for induction of the Notch ligand delta-like 4 (DLL4) in endothelial cells, we find that activation of the MAPK/ERK pathway mirrors the rapid and dynamic induction of DLL4 transcription and that this pathway is required for DLL4 expression. Furthermore, VEGF/ERK signaling induces phosphorylation and activation of the ETS transcription factor ERG, a prerequisite for DLL4 induction. Transcription of DLL4 coincides with dynamic ERG-dependent recruitment of the transcriptional co-activator p300. Genome-wide gene expression profiling identified a network of VEGF-responsive and ERG-dependent genes, and ERG chromatin immunoprecipitation (ChIP)-seq revealed the presence of conserved ERG-bound putative enhancer elements near these target genes. Functional experiments performed in vitro and in vivo confirm that this network of genes requires ERK, ERG and p300 activity. Finally, genome-editing and transgenic approaches demonstrate that a highly conserved ERG-bound enhancer located upstream of HLX (which encodes a transcription factor implicated in sprouting angiogenesis) is required for its VEGF-mediated induction. Collectively, these findings elucidate a novel transcriptional pathway contributing to VEGF-dependent angiogenesis. © 2017. Published by The Company of Biologists Ltd.

  18. 10 CFR Appendix D to Part 436 - Energy Program Conservation Elements

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 3 2013-01-01 2013-01-01 false Energy Program Conservation Elements D Appendix D to Part 436 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION FEDERAL ENERGY MANAGEMENT AND PLANNING PROGRAMS Pt. 436, App. D Appendix D to Part 436—Energy Program Conservation Elements (a) In all successful energy...

  19. 10 CFR Appendix D to Part 436 - Energy Program Conservation Elements

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 3 2014-01-01 2014-01-01 false Energy Program Conservation Elements D Appendix D to Part 436 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION FEDERAL ENERGY MANAGEMENT AND PLANNING PROGRAMS Pt. 436, App. D Appendix D to Part 436—Energy Program Conservation Elements (a) In all successful energy...

  20. 10 CFR Appendix D to Part 436 - Energy Program Conservation Elements

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 3 2011-01-01 2011-01-01 false Energy Program Conservation Elements D Appendix D to Part 436 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION FEDERAL ENERGY MANAGEMENT AND PLANNING PROGRAMS Pt. 436, App. D Appendix D to Part 436—Energy Program Conservation Elements (a) In all successful energy...

  1. 10 CFR Appendix D to Part 436 - Energy Program Conservation Elements

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 3 2012-01-01 2012-01-01 false Energy Program Conservation Elements D Appendix D to Part 436 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION FEDERAL ENERGY MANAGEMENT AND PLANNING PROGRAMS Pt. 436, App. D Appendix D to Part 436—Energy Program Conservation Elements (a) In all successful energy...

  2. 10 CFR Appendix D to Part 436 - Energy Program Conservation Elements

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 3 2010-01-01 2010-01-01 false Energy Program Conservation Elements D Appendix D to Part 436 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION FEDERAL ENERGY MANAGEMENT AND PLANNING PROGRAMS Pt. 436, App. D Appendix D to Part 436—Energy Program Conservation Elements (a) In all successful energy...

  3. Shielded regeneration heating element for a particulate filter

    DOEpatents

    Gonze, Eugene V [Pinckney, MI; Ament, Frank [Troy, MI

    2011-01-04

    An exhaust system includes a particulate filter (PF) that is disposed downstream from an engine. The PF filters particulates within an exhaust from the engine. A heating element heats particulate matter in the PF. A catalyst substrate or a flow converter is disposed upstream from said heating element. The catalyst substrate oxidizes the exhaust prior to reception by the heating element. The flow converter converts turbulent exhaust flow to laminar exhaust flow prior to reception by the heating element.

  4. Prediction of Geomagnetic Activity and Key Parameters in High-latitude Ionosphere

    NASA Technical Reports Server (NTRS)

    Khazanov, George V.; Lyatsky, Wladislaw; Tan, Arjun; Ridley, Aaron

    2007-01-01

    Prediction of geomagnetic activity and related events in the Earth's magnetosphere and ionosphere are important tasks of US Space Weather Program. Prediction reliability is dependent on the prediction method, and elements included in the prediction scheme. Two of the main elements of such prediction scheme are: an appropriate geomagnetic activity index, and an appropriate coupling function (the combination of solar wind parameters providing the best correlation between upstream solar wind data and geomagnetic activity). We have developed a new index of geomagnetic activity, the Polar Magnetic (PM) index and an improved version of solar wind coupling function. PM index is similar to the existing polar cap PC index but it shows much better correlation with upstream solar wind/IMF data and other events in the magnetosphere and ionosphere. We investigate the correlation of PM index with upstream solar wind/IMF data for 10 years (1995-2004) that include both low and high solar activity. We also have introduced a new prediction function for the predicting of cross-polar-cap voltage and Joule heating based on using both PM index and upstream solar wind/IMF data. As we show such prediction function significantly increase the reliability of prediction of these important parameters. The correlation coefficients between the actual and predicted values of these parameters are approx. 0.9 and higher.

  5. 7 CFR 613.2 - Policy and objectives.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... working with experiment stations, crop improvement associations, and other State and Federal agencies. (b... related to: (1) Controlling soil erosion on all lands; (2) Conserving water; (3) Protecting upstream... enhancement; (12) Selecting plants that tolerate air pollution agents and toxic soil chemicals; (13) Selecting...

  6. A short region of the promoter of the breast cancer associated PLU-1 gene can regulate transcription in vitro and in vivo.

    PubMed

    Catteau, Aurélie; Rosewell, Ian; Solomon, Ellen; Taylor-Papadimitriou, Joyce

    2004-07-01

    The recently cloned gene PLU-1 shows restricted expression in adult tissues, with high expression being found in testis, and transiently in the pregnant mammary gland. However, both the gene and the protein product are specifically up-regulated in breast cancer. To investigate the control of expression of the PLU-1 gene, we have cloned and functionally characterised the 5' flanking region of the gene, which was found to contain another putative gene. Two transcription start sites of the PLU-1 gene were mapped by 5' RACE. A short proximal 249 bp region was defined using reporter gene assays, which encompasses the major transcription start site and exhibits a strong constitutive promoter activity in all cell lines tested. However, regions upstream of this sequence repress transcription more effectively in a non-malignant breast cell line as compared to breast cancer cell lines. The 249 bp region is GC-rich and includes consensus Sp1 sites, GC boxes, cAMP-responsive element (CRE) and other putative cis-elements. Mutational analysis showed that two intact conserved Sp1 binding sites (shown here to bind Sp1 and/or Sp3) are critical for constitutive promoter activity, while a negative role for a neighbouring GC box is indicated. The sequence of the core promoter is highly conserved in the mouse and Plu-1 expression in the mouse embryo has been documented. Using transgenesis, we therefore examined the ability of the 249 bp fragment to control expression of a reporter gene during embryogenesis. We found that not only is the core promoter sufficient to activate transcription in vivo, but that the expression of the reporter gene coincides both temporally and spatially with regions where endogenous Plu-1 is highly expressed. This suggests that tissue specific controlling elements are found within the short fragment and are functional in the embryonic environment.

  7. Repression of enhancer II activity by a negative regulatory element in the hepatitis B virus genome.

    PubMed Central

    Lo, W Y; Ting, L P

    1994-01-01

    Enhancer II of human hepatitis B virus has dual functions in vivo. Located at nucleotides (nt) 1646 to 1741, it can stimulate the surface and X promoters from a downstream position. Moreover, the same sequence can also function as upstream regulatory element that activates the core promoter in a position- and orientation-dependent manner. In this study, we report the identification and characterization of a negative regulatory element (NRE) upstream of enhancer II (nt 1613 to 1636) which can repress both the enhancer and upstream stimulatory function of the enhancer II sequence in differentiated liver cells. This NRE has marginal inhibitory effect by itself but a strong repressive function in the presence of a functional enhancer II. Mutational analysis reveals that sequence from nt 1616 to 1621 is required for repression of enhancer activity by the NRE. Gel shift analysis reveals that this negative regulatory region can be recognized by a specific protein factor(s) present at the 0.4 M NaCl fraction of HepG2 nuclear extracts. The discovery of the NRE indicates that HBV gene transcription is controlled by combined effects of both positive and negative regulation. It also provides a unique system with which to study the mechanism of negative regulation of gene expression. Images PMID:8107237

  8. Self-regulation of 70-kilodalton heat shock proteins in Saccharomyces cerevisiae.

    PubMed Central

    Stone, D E; Craig, E A

    1990-01-01

    To determine whether the 70-kilodalton heat shock proteins of Saccharomyces cerevisiae play a role in regulating their own synthesis, we studied the effect of overexpressing the SSA1 protein on the activity of the SSA1 5'-regulatory region. The constitutive level of Ssa1p was increased by fusing the SSA1 structural gene to the GAL1 promoter. A reporter vector consisting of an SSA1-lacZ translational fusion was used to assess SSA1 promoter activity. In a strain producing approximately 10-fold the normal heat shock level of Ssa1p, induction of beta-galactosidase activity by heat shock was almost entirely blocked. Expression of a transcriptional fusion vector in which the CYC1 upstream activating sequence of a CYC1-lacZ chimera was replaced by a sequence containing a heat shock upstream activating sequence (heat shock element 2) from the 5'-regulatory region of SSA1 was inhibited by excess Ssa1p. The repression of an SSA1 upstream activating sequence by the SSA1 protein indicates that SSA1 self-regulation is at least partially mediated at the transcriptional level. The expression of another transcriptional fusion vector, containing heat shock element 2 and a lesser amount of flanking sequence, is not inhibited when Ssa1p is overexpressed. This suggests the existence of an element, proximal to or overlapping heat shock element 2, that confers sensitivity to the SSA1 protein. Images PMID:2181281

  9. Abundance and functional diversity of riboswitches in microbial communities

    PubMed Central

    Kazanov, Marat D; Vitreschak, Alexey G; Gelfand, Mikhail S

    2007-01-01

    Background Several recently completed large-scale enviromental sequencing projects produced a large amount of genetic information about microbial communities ('metagenomes') which is not biased towards cultured organisms. It is a good source for estimation of the abundance of genes and regulatory structures in both known and unknown members of microbial communities. In this study we consider the distribution of RNA regulatory structures, riboswitches, in the Sargasso Sea, Minnesota Soil and Whale Falls metagenomes. Results Over three hundred riboswitches were found in about 2 Gbp metagenome DNA sequences. The abundabce of riboswitches in metagenomes was highest for the TPP, B12 and GCVT riboswitches; the S-box, RFN, YKKC/YXKD, YYBP/YKOY regulatory elements showed lower but significant abundance, while the LYS, G-box, GLMS and YKOK riboswitches were rare. Regions downstream of identified riboswitches were scanned for open reading frames. Comparative analysis of identified ORFs revealed new riboswitch-regulated functions for several classes of riboswitches. In particular, we have observed phosphoserine aminotransferase serC (COG1932) and malate synthase glcB (COG2225) to be regulated by the glycine (GCVT) riboswitch; fatty acid desaturase ole1 (COG1398), by the cobalamin (B12) riboswitch; 5-methylthioribose-1-phosphate isomerase ykrS (COG0182), by the SAM-riboswitch. We also identified conserved riboswitches upstream of genes of unknown function: thiamine (TPP), cobalamine (B12), and glycine (GCVT, upstream of genes from COG4198). Conclusion This study demonstrates applicability of bioinformatics to the analysis of RNA regulatory structures in metagenomes. PMID:17908319

  10. Structural organization of the porcine and human genes coding for a leydig cell-specific insulin-like peptide (LEY I-L) and chromosomal localization of the human gene (INSL3)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Burkhardt E.; Adham, I.M.; Brosig, B.

    1994-03-01

    Leydig insulin-like protein (LEY I-L) is a member of the insulin-like hormone superfamily. The LEY I-L gene (designated INSL3) is expressed exclusively in prenatal and postnatal Leydig cells. The authors report here the cloning and nucleotide sequence of porcine and human LEY I-L genes including the 5[prime] regions. Both genes consist of two exons and one intron. The organization of the LEY I-L gene is similar to that of insulin and relaxin. The transcription start site in the porcine and human LEY I-L gene is localized 13 and 14 bp upstream of the translation start site, respectively. Alignment of themore » 5[prime] flanking regions of both genes reveals that the first 107 nucleotides upstream of the transcription start site exhibit an overall sequence similarity of 80%. This conserved region contains a consensus TATAA box, a CAAT-like element (GAAT), and a consensus SP1 sequence (GGGCGG) at equivalent positions in both genes and therefore may play a role in regulation of expression of the LEY I-L gene. The porcine and human genome contains a single copy of the LEY I-L gene. By in situ hybridization, the human gene was assigned to bands p13.2-p12 of the short arm of chromosome 19. 25 refs., 6 figs.« less

  11. Scapula development is governed by genetic interactions of Pbx1 with its family members and with Emx2 via their cooperative control of Alx1

    PubMed Central

    Capellini, Terence D.; Vaccari, Giulia; Ferretti, Elisabetta; Fantini, Sebastian; He, Mu; Pellegrini, Massimo; Quintana, Laura; Di Giacomo, Giuseppina; Sharpe, James; Selleri, Licia; Zappavigna, Vincenzo

    2010-01-01

    The genetic pathways underlying shoulder blade development are largely unknown, as gene networks controlling limb morphogenesis have limited influence on scapula formation. Analysis of mouse mutants for Pbx and Emx2 genes has suggested their potential roles in girdle development. In this study, by generating compound mutant mice, we examined the genetic control of scapula development by Pbx genes and their functional relationship with Emx2. Analyses of Pbx and Pbx1;Emx2 compound mutants revealed that Pbx genes share overlapping functions in shoulder development and that Pbx1 genetically interacts with Emx2 in this process. Here, we provide a biochemical basis for Pbx1;Emx2 genetic interaction by showing that Pbx1 and Emx2 can bind specific DNA sequences as heterodimers. Moreover, the expression of genes crucial for scapula development is altered in these mutants, indicating that Pbx genes act upstream of essential pathways for scapula formation. In particular, expression of Alx1, an effector of scapula blade patterning, is absent in all compound mutants. We demonstrate that Pbx1 and Emx2 bind in vivo to a conserved sequence upstream of Alx1 and cooperatively activate its transcription via this potential regulatory element. Our results establish an essential role for Pbx1 in genetic interactions with its family members and with Emx2 and delineate novel regulatory networks in shoulder girdle development. PMID:20627960

  12. TEs or not TEs? That is the evolutionary question.

    PubMed

    Vaknin, Keren; Goren, Amir; Ast, Gil

    2009-10-23

    Transposable elements (TEs) have contributed a wide range of functional sequences to their host genomes. A recent paper in BMC Molecular Biology discusses the creation of new transcripts by transposable element insertion upstream of retrocopies and the involvement of such insertions in tissue-specific post-transcriptional regulation.

  13. A gene-specific non-enhancer sequence is critical for expression from the promoter of the small heat shock protein gene αB-crystallin

    PubMed Central

    2014-01-01

    Background Deciphering of the information content of eukaryotic promoters has remained confined to universal landmarks and conserved sequence elements such as enhancers and transcription factor binding motifs, which are considered sufficient for gene activation and regulation. Gene-specific sequences, interspersed between the canonical transacting factor binding sites or adjoining them within a promoter, are generally taken to be devoid of any regulatory information and have therefore been largely ignored. An unanswered question therefore is, do gene-specific sequences within a eukaryotic promoter have a role in gene activation? Here, we present an exhaustive experimental analysis of a gene-specific sequence adjoining the heat shock element (HSE) in the proximal promoter of the small heat shock protein gene, αB-crystallin (cryab). These sequences are highly conserved between the rodents and the humans. Results Using human retinal pigment epithelial cells in culture as the host, we have identified a 10-bp gene-specific promoter sequence (GPS), which, unlike an enhancer, controls expression from the promoter of this gene, only when in appropriate position and orientation. Notably, the data suggests that GPS in comparison with the HSE works in a context-independent fashion. Additionally, when moved upstream, about a nucleosome length of DNA (−154 bp) from the transcription start site (TSS), the activity of the promoter is markedly inhibited, suggesting its involvement in local promoter access. Importantly, we demonstrate that deletion of the GPS results in complete loss of cryab promoter activity in transgenic mice. Conclusions These data suggest that gene-specific sequences such as the GPS, identified here, may have critical roles in regulating gene-specific activity from eukaryotic promoters. PMID:24589182

  14. [Bioinformatics Analysis of Clustered Regularly Interspaced Short Palindromic Repeats in the Genomes of Shigella].

    PubMed

    Wang, Pengfei; Wang, Yingfang; Duan, Guangcai; Xue, Zerun; Wang, Linlin; Guo, Xiangjiao; Yang, Haiyan; Xi, Yuanlin

    2015-04-01

    This study was aimed to explore the features of clustered regularly interspaced short palindromic repeats (CRISPR) structures in Shigella by using bioinformatics. We used bioinformatics methods, including BLAST, alignment and RNA structure prediction, to analyze the CRISPR structures of Shigella genomes. The results showed that the CRISPRs existed in the four groups of Shigella, and the flanking sequences of upstream CRISPRs could be classified into the same group with those of the downstream. We also found some relatively conserved palindromic motifs in the leader sequences. Repeat sequences had the same group with corresponding flanking sequences, and could be classified into two different types by their RNA secondary structures, which contain "stem" and "ring". Some spacers were found to homologize with part sequences of plasmids or phages. The study indicated that there were correlations between repeat sequences and flanking sequences, and the repeats might act as a kind of recognition mechanism to mediate the interaction between foreign genetic elements and Cas proteins.

  15. Structural studies of the nudix hydrolase DR1025 from deinococcus radiodurans and its ligand complexes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ranatunga, Wasantha; Hill, Emma E.; Mooster, Jana L.

    We have determined the crystal structure, at 1.4, of the Nudix hydrolase DR1025 from the extremely radiation resistant bacterium Deinococcus radiodurans. The protein forms an intertwined homodimer by exchanging N-terminal segments between chains. We have identified additional conserved elements of the Nudix fold, including the metal-binding motif, a kinked b-strand characterized by a proline two positions upstream of the Nudix consensus sequence, and participation of the N-terminal extension in the formation of the substrate-binding pocket. Crystal structures were also solved of DR1025 crystallized in the presence of magnesium and either a GTP analog or Ap4A (both at 1.6 resolution). Inmore » the Ap4Aco-crystal, the electron density indicated that the product of asymmetric hydrolysis, ATP, was bound to the enzyme. The GTP analog bound structure showed that GTP was bound almost identically as ATP. Neither nucleoside triphosphate was further cleaved.« less

  16. Upstream paths for Hippo signaling in Drosophila organ development.

    PubMed

    Choi, Kwang-Wook

    2018-03-01

    Organ growth is fundamental to animal development. One of major mechanisms for growth control is mediated by the conserved Hippo signaling pathway initially identified in Drosophila. The core of this pathway in Drosophila consists of a cascade of protein kinases Hippo and Warts that negatively regulate transcriptional coactivator Yorkie (Yki). Activation of Yki promotes cell survival and proliferation to induce organ growth. A key issue in Hippo signaling is to understand how core kinase cascade is activated. Activation of Hippo kinase cascade is regulated in the upstream by at least two transmembrane proteins Crumbs and Fat that act in parallel. These membrane proteins interact with additional factors such as FERM-domain proteins Expanded and Merlin to modulate subcellular localization and function of the Hippo kinase cascade. Hippo signaling is also influenced by cytoskeletal networks and cell tension in epithelia of developing organs. These upstream events in the regulation of Hippo signaling are only partially understood. This review focuses on our current understanding of some upstream processes involved in Hippo signaling in developing Drosophila organs. [BMB Reports 2018; 51(3): 134-142].

  17. Transcriptional Regulation in Saccharomyces cerevisiae: Transcription Factor Regulation and Function, Mechanisms of Initiation, and Roles of Activators and Coactivators

    PubMed Central

    Hahn, Steven; Young, Elton T.

    2011-01-01

    Here we review recent advances in understanding the regulation of mRNA synthesis in Saccharomyces cerevisiae. Many fundamental gene regulatory mechanisms have been conserved in all eukaryotes, and budding yeast has been at the forefront in the discovery and dissection of these conserved mechanisms. Topics covered include upstream activation sequence and promoter structure, transcription factor classification, and examples of regulated transcription factor activity. We also examine advances in understanding the RNA polymerase II transcription machinery, conserved coactivator complexes, transcription activation domains, and the cooperation of these factors in gene regulatory mechanisms. PMID:22084422

  18. Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.

    PubMed

    Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua

    2013-11-01

    The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.

  19. Transcription initiation from the dihydrofolate reductase promoter is positioned by HIP1 binding at the initiation site.

    PubMed

    Means, A L; Farnham, P J

    1990-02-01

    We have identified a sequence element that specifies the position of transcription initiation for the dihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductase promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductase initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the dihydrofolate reductase initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the dihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).

  20. Changes in cis-regulatory elements of a key floral regulator are associated with divergence of inflorescence architectures.

    PubMed

    Kusters, Elske; Della Pina, Serena; Castel, Rob; Souer, Erik; Koes, Ronald

    2015-08-15

    Higher plant species diverged extensively with regard to the moment (flowering time) and position (inflorescence architecture) at which flowers are formed. This seems largely caused by variation in the expression patterns of conserved genes that specify floral meristem identity (FMI), rather than changes in the encoded proteins. Here, we report a functional comparison of the promoters of homologous FMI genes from Arabidopsis, petunia, tomato and Antirrhinum. Analysis of promoter-reporter constructs in petunia and Arabidopsis, as well as complementation experiments, showed that the divergent expression of leafy (LFY) and the petunia homolog aberrant leaf and flower (ALF) results from alterations in the upstream regulatory network rather than cis-regulatory changes. The divergent expression of unusual floral organs (UFO) from Arabidopsis, and the petunia homolog double top (DOT), however, is caused by the loss or gain of cis-regulatory promoter elements, which respond to trans-acting factors that are expressed in similar patterns in both species. Introduction of pUFO:UFO causes no obvious defects in Arabidopsis, but in petunia it causes the precocious and ectopic formation of flowers. This provides an example of how a change in a cis-regulatory region can account for a change in the plant body plan. © 2015. Published by The Company of Biologists Ltd.

  1. Cloning and functional analysis of 5'-upstream region of the Pokemon gene.

    PubMed

    Yang, Yutao; Zhou, Xiaowei; Zhu, Xudong; Zhang, Chuanfu; Yang, Zhixin; Xu, Long; Huang, Peitang

    2008-04-01

    Pokemon, the POK erythroid myeloid ontogenic factor, not only regulates the expression of many genes, but also plays an important role in cell tumorigenesis. To investigate the molecular mechanism regulating expression of the Pokemon gene in humans, its 5'-upstream region was cloned and analyzed. Transient analysis revealed that the Pokemon promoter is constitutive. Deletion analysis and a DNA decoy assay indicated that the NEG-U and NEG-D elements were involved in negative regulation of the Pokemon promoter, whereas the POS-D element was mainly responsible for its strong activity. Electrophoretic mobility shift assays suggested that the NEG-U, NEG-D and POS-D elements were specifically bound by the nuclear extract from A549 cells in vitro. Mutation analysis demonstrated that cooperation of the NEG-U and NEG-D elements led to negative regulation of the Pokemon promoter. Moreover, the NEG-U and NEG-D elements needed to be an appropriate distance apart in the Pokemon promoter in order to cooperate. Taken together, our results elucidate the mechanism underlying the regulation of Pokemon gene transcription, and also define a novel regulatory sequence that may be used to decrease expression of the Pokemon gene in cancer gene therapy.

  2. Alu-derived cis-element regulates tumorigenesis-dependent gastric expression of GASDERMIN B (GSDMB).

    PubMed

    Komiyama, Hiromitsu; Aoki, Aya; Tanaka, Shigekazu; Maekawa, Hiroshi; Kato, Yoriko; Wada, Ryo; Maekawa, Takeo; Tamura, Masaru; Shiroishi, Toshihiko

    2010-02-01

    GASDERMIN B (GSDMB) belongs to the novel gene family GASDERMIN (GSDM). All GSDM family members are located in amplicons, genomic regions often amplified during cancer development. Given that GSDMB is highly expressed in cancerous cells and the locus resides in an amplicon, GSDMB may be involved in cancer development and/or progression. However, only limited information is available on GSDMB expression in tissues, normal and cancerous, from cancer patients. Furthermore, the molecular mechanisms that regulate GSDMB expression in gastric tissues are poorly understood. We investigated the spatiotemporal expression patterns of GSDMB in gastric cancer patients and the 5' regulatory sequences upstream of GSDMB. GSDMB was not expressed in the majority of normal gastric-tissue samples, and the expression level was very low in the few normal samples with GSDMB expression. Most pre-cancer samples showed moderate GSDMB expression, and most cancerous samples showed augmented GSDMB expression. Analysis of genome sequences revealed that an Alu element resides in the 5' region upstream of GSDMB. Reporter assays using intact, deleted, and mutated Alu elements clearly showed that this Alu element positively regulates GSDMB expression and that a putative IKZF binding motif in this element is crucial to upregulate GSDMB expression.

  3. Evaluating the provenance of fine sediment in degraded Freshwater Pearl Mussel habitats.

    NASA Astrophysics Data System (ADS)

    Blake, Will; Haley, Steve; Goddard, Rupert; Stone, Peter; Broadhead, Kat

    2015-04-01

    Freshwater Pearl Mussels (FWPM), Margaritifera margaritifera, are among the most critically threatened freshwater bivalves worldwide. In addition to their important roles in particle processing, nutrient release, and sediment mixing, they also serve as an ideal target species for evaluation of aquatic ecosystem functioning especially in the context of their symbiotic relationship with Atlantic salmon Salmo salar and brown or sea trout Salmo trutta. Poor water quality, particularly eutrophication, and siltation are considered major contributory factors in the decline of the species hence management of diffuse water pollution from agriculture (DWPA) is a key priority in catchments that host FWPM habitats. Against this background, this study adopted a combined monitoring, surveying and sediment fingerprinting approach to determine the principal sources of fine sediment impacting FWPM habitats in the River Clun, a Special area of Conservation (SAC) for FWPMs in central western UK. Potential sediment production hotspot areas in the ca 200 km2 catchment area upstream of FWPM habitats were initially evaluated using the SCIMAP risk mapping tool. Suspended sediment monitoring was undertaken on the main stem channel where FWPM habitats are located and wet weather catchment walkover surveys undertaken along the upstream river and stream network. Within this monitoring framework, sediment fingerprinting was undertaken at two levels. The first level aimed to link primary catchment sources (cultivated and uncultivated soil, channel bank erosion, and material transported via roads and tracks) to suspended sediment output from each main tributary upstream of the FWPM beds. The second level linked silt in the FWMP beds to the main tributaries, as integrated source end-members, with the inclusion of main channel bank erosion, a notable feature of walkover surveys as an additional source. Geochemical fingerprints, determined by XRF spectroscopy, were dominated by conservative mineral-bound elements and results indicated the importance of mainstem channel bank erosion as a sediment source to the FWMP beds, in line with catchment walkover observations. In addition, broad subcatchment discrimination and subsequent sediment apportionment showed agreement with SCIMAP risk analysis for more intensively farmed areas. Fingerprinting results also suggested, however, an unexpected contribution from upland grazed areas, categorised as lower risk by SCIMAP. Detailed evaluation of primary sources in these areas was undertaken to evaluate this discrepancy and test the hypothesised importance of channel bank erosion at the subcatchment scale. The results highlight the benefits of adopting a combined monitoring, modelling and tracing approach to support targeted management of fine sediment problems. .

  4. Particle Velocity Measuring System

    NASA Technical Reports Server (NTRS)

    Arndt, G. Dickey (Inventor); Carl, James R. (Inventor)

    1998-01-01

    Method and apparatus are provided for determining the velocity of individual food particles within a liquid/solid food mixture that is cooked by an aseptic cooking method whereby the food mixture is heated as it flows through a flowline. At least one upstream and at least one downstream microwave transducer are provided to determine the minimum possible travel time of the fastest food particle through the flowline. In one embodiment, the upstream detector is not required. In another embodiment, a plurality of small dipole antenna markers are secured to a plurality of food particles to provide a plurality of signals as the markers pass the upstream and downstream transducers. The dipole antenna markers may also include a non-linear element to reradiate a harmonic frequency of a transmitter frequency. Upstream and downstream transducers include dipole antennas that are matched to the impedance of the food slurry and a signal transmission cable by various impedance matching means including unbalanced feed to the antennas.

  5. Trichomonas vaginalis ribosomal RNA: identification and characterisation of the transcription promoter and terminator sequences.

    PubMed

    Franco, Bernardo; Hernández, Roberto; López-Villaseñor, Imelda

    2012-09-01

    Trichomonas vaginalis is a parasitic protozoan of both medical and biological relevance. Transcriptional studies in this organism have focused mainly on type II pol promoters, whereas the elements necessary for transcription by polI or polIII have not been investigated. Here, with the aid of a transient transcription system, we characterised the rDNA intergenic region, defining both the promoter and the terminator sequences required for transcription. We defined the promoter as a compact region of approximately 180 bp. We also identified a potential upstream control element (UCE) that was located 80 bp upstream of the transcription start point (TSP). A transcription termination element was identified within a 34 bp region that was located immediately downstream of the 28S coding sequence. The function of this element depends upon polarity and the presence of both a stretch of uridine residues (U's) and a hairpin structure in the transcript. Our observations provide a strong basis for the study of DNA recognition by the polI transcriptional machinery in this early divergent organism. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Control of DEMETER DNA demethylase gene transcription in male and female gamete companion cells in Arabidopsis thaliana.

    PubMed

    Park, Jin-Sup; Frost, Jennifer M; Park, Kyunghyuk; Ohr, Hyonhwa; Park, Guen Tae; Kim, Seohyun; Eom, Hyunjoo; Lee, Ilha; Brooks, Janie S; Fischer, Robert L; Choi, Yeonhee

    2017-02-21

    The DEMETER (DME) DNA glycosylase initiates active DNA demethylation via the base-excision repair pathway and is vital for reproduction in Arabidopsis thaliana DME-mediated DNA demethylation is preferentially targeted to small, AT-rich, and nucleosome-depleted euchromatic transposable elements, influencing expression of adjacent genes and leading to imprinting in the endosperm. In the female gametophyte, DME expression and subsequent genome-wide DNA demethylation are confined to the companion cell of the egg, the central cell. Here, we show that, in the male gametophyte, DME expression is limited to the companion cell of sperm, the vegetative cell, and to a narrow window of time: immediately after separation of the companion cell lineage from the germline. We define transcriptional regulatory elements of DME using reporter genes, showing that a small region, which surprisingly lies within the DME gene, controls its expression in male and female companion cells. DME expression from this minimal promoter is sufficient to rescue seed abortion and the aberrant DNA methylome associated with the null dme-2 mutation. Within this minimal promoter, we found short, conserved enhancer sequences necessary for the transcriptional activities of DME and combined predicted binding motifs with published transcription factor binding coordinates to produce a list of candidate upstream pathway members in the genetic circuitry controlling DNA demethylation in gamete companion cells. These data show how DNA demethylation is regulated to facilitate endosperm gene imprinting and potential transgenerational epigenetic regulation, without subjecting the germline to potentially deleterious transposable element demethylation.

  7. The complete mitochondrial genome of the pink stem borer, Sesamia inferens, in comparison with four other Noctuid moths.

    PubMed

    Chai, Huan-Na; Du, Yu-Zhou

    2012-01-01

    The complete 15,413-bp mitochondrial genome (mitogenome) of Sesamia inferens (Walker) (Lepidoptera: Noctuidae) was sequenced and compared with those of four other noctuid moths. All of the mitogenomes analyzed displayed similar characteristics with respect to gene content, genome organization, nucleotide comparison, and codon usages. Twelve-one protein-coding genes (PCGs) utilized the standard ATN, but the cox1 gene used CGA as the initiation codon; cox1, cox2, and nad4 genes had the truncated termination codon T in the S. inferens mitogenome. All of the tRNA genes had typical cloverleaf secondary structures except for trnS1(AGN), in which the dihydrouridine (DHU) arm did not form a stable stem-loop structure. Both the secondary structures of rrnL and rrnS genes inferred from the S. inferens mitogenome closely resembled those of other noctuid moths. In the A+T-rich region, the conserved motif "ATAGA" followed by a long T-stretch was observed in all noctuid moths, but other specific tandem-repeat elements were more variable. Additionally, the S. inferens mitogenome contained a potential stem-loop structure, a duplicated 17-bp repeat element, a decuplicated segment, and a microsatellite "(AT)(7)", without a poly-A element upstream of the trnM in the A+T-rich region. Finally, the phylogenetic relationships were reconstructed based on amino acid sequences of mitochondrial 13 PCGs, which support the traditional morphologically based view of relationships within the Noctuidae.

  8. The Complete Mitochondrial Genome of the Pink Stem Borer, Sesamia inferens, in Comparison with Four Other Noctuid Moths

    PubMed Central

    Chai, Huan-Na; Du, Yu-Zhou

    2012-01-01

    The complete 15,413-bp mitochondrial genome (mitogenome) of Sesamia inferens (Walker) (Lepidoptera: Noctuidae) was sequenced and compared with those of four other noctuid moths. All of the mitogenomes analyzed displayed similar characteristics with respect to gene content, genome organization, nucleotide comparison, and codon usages. Twelve-one protein-coding genes (PCGs) utilized the standard ATN, but the cox1 gene used CGA as the initiation codon; cox1, cox2, and nad4 genes had the truncated termination codon T in the S. inferens mitogenome. All of the tRNA genes had typical cloverleaf secondary structures except for trnS1(AGN), in which the dihydrouridine (DHU) arm did not form a stable stem-loop structure. Both the secondary structures of rrnL and rrnS genes inferred from the S. inferens mitogenome closely resembled those of other noctuid moths. In the A+T-rich region, the conserved motif “ATAGA” followed by a long T-stretch was observed in all noctuid moths, but other specific tandem-repeat elements were more variable. Additionally, the S. inferens mitogenome contained a potential stem-loop structure, a duplicated 17-bp repeat element, a decuplicated segment, and a microsatellite “(AT)7”, without a poly-A element upstream of the trnM in the A+T-rich region. Finally, the phylogenetic relationships were reconstructed based on amino acid sequences of mitochondrial 13 PCGs, which support the traditional morphologically based view of relationships within the Noctuidae. PMID:22949858

  9. Cyclic nucleotide-gated ion channel gene family in rice, identification, characterization and experimental analysis of expression response to plant hormones, biotic and abiotic stresses.

    PubMed

    Nawaz, Zarqa; Kakar, Kaleem Ullah; Saand, Mumtaz A; Shu, Qing-Yao

    2014-10-04

    Cyclic nucleotide-gated channels (CNGCs) are Ca2+-permeable cation transport channels, which are present in both animal and plant systems. They have been implicated in the uptake of both essential and toxic cations, Ca2+ signaling, pathogen defense, and thermotolerance in plants. To date there has not been a genome-wide overview of the CNGC gene family in any economically important crop, including rice (Oryza sativa L.). There is an urgent need for a thorough genome-wide analysis and experimental verification of this gene family in rice. In this study, a total of 16 full length rice CNGC genes distributed on chromosomes 1-6, 9 and 12, were identified by employing comprehensive bioinformatics analyses. Based on phylogeny, the family of OsCNGCs was classified into four major groups (I-IV) and two sub-groups (IV-A and IV- B). Likewise, the CNGCs from all plant lineages clustered into four groups (I-IV), where group II was conserved in all land plants. Gene duplication analysis revealed that both chromosomal segmentation (OsCNGC1 and 2, 10 and 11, 15 and 16) and tandem duplications (OsCNGC1 and 2) significantly contributed to the expansion of this gene family. Motif composition and protein sequence analysis revealed that the CNGC specific domain "cyclic nucleotide-binding domain (CNBD)" comprises a "phosphate binding cassette" (PBC) and a "hinge" region that is highly conserved among the OsCNGCs. In addition, OsCNGC proteins also contain various other functional motifs and post-translational modification sites. We successively built a stringent motif: (LI-X(2)-[GS]-X-[FV]-X-G-[1]-ELL-X-W-X(12,22)-SA-X(2)-T-X(7)-[EQ]-AF-X-L) that recognizes the rice CNGCs specifically. Prediction of cis-acting regulatory elements in 5' upstream sequences and expression analyses through quantitative qPCR demonstrated that OsCNGC genes were highly responsive to multiple stimuli including hormonal (abscisic acid, indoleacetic acid, kinetin and ethylene), biotic (Pseudomonas fuscovaginae and Xanthomonas oryzae pv. oryzae) and abiotic (cold) stress. There are 16 CNGC genes in rice, which were probably expanded through chromosomal segmentation and tandem duplications and comprise a PBC and a "hinge" region in the CNBD domain, featured by a stringent motif. The various cis-acting regulatory elements in the upstream sequences may be responsible for responding to multiple stimuli, including hormonal, biotic and abiotic stresses.

  10. Upstream regulatory elements are necessary and sufficient for transcription of a U6 RNA gene by RNA polymerase III.

    PubMed Central

    Das, G; Henning, D; Wright, D; Reddy, R

    1988-01-01

    Whereas the genes coding for trimethyl guanosine-capped snRNAs are transcribed by RNA polymerase II, the U6 RNA genes are transcribed by RNA polymerase III. In this study, we have analyzed the cis-regulatory elements involved in the transcription of a mouse U6 snRNA gene in vitro and in frog oocytes. Transcriptional analysis of mutant U6 gene constructs showed that, unlike most known cases of polymerase III transcription, intragenic sequences except the initiation nucleotide are dispensable for efficient and accurate transcription of U6 gene in vitro. Transcription of 5' deletion mutants in vitro and in frog oocytes showed that the upstream region, within 79 bp from the initiation nucleotide, contains elements necessary for U6 gene transcription. Transcription studies were carried out in frog oocytes with U6 genes containing 5' distal sequence; these studies revealed that the distal element acts as an orientation-dependent enhancer when present upstream to the gene, while it is orientation-independent but distance-dependent enhancer when placed down-stream to the U6 gene. Analysis of 3' deletion mutants showed that the transcription termination of U6 RNA is dependent on a T cluster present on the 3' end of the gene, thus providing further support to other lines of evidence that U6 genes are transcribed by RNA polymerase III. These observations suggest the involvement of a composite of components of RNA polymerase II and III transcription machineries in the transcription of U6 genes by RNA polymerase III. Images PMID:3366121

  11. Conserved structures formed by heterogeneous RNA sequences drive silencing of an inflammation responsive post-transcriptional operon

    PubMed Central

    Basu, Abhijit; Jain, Niyati; Tolbert, Blanton S.; Komar, Anton A.

    2017-01-01

    Abstract RNA–protein interactions with physiological outcomes usually rely on conserved sequences within the RNA element. By contrast, activity of the diverse gamma-interferon-activated inhibitor of translation (GAIT)-elements relies on the conserved RNA folding motifs rather than the conserved sequence motifs. These elements drive the translational silencing of a group of chemokine (CC/CXC) and chemokine receptor (CCR) mRNAs, thereby helping to resolve physiological inflammation. Despite sequence dissimilarity, these RNA elements adopt common secondary structures (as revealed by 2D-1H NMR spectroscopy), providing a basis for their interaction with the RNA-binding GAIT complex. However, many of these elements (e.g. those derived from CCL22, CXCL13, CCR4 and ceruloplasmin (Cp) mRNAs) have substantially different affinities for GAIT complex binding. Toeprinting analysis shows that different positions within the overall conserved GAIT element structure contribute to differential affinities of the GAIT protein complex towards the elements. Thus, heterogeneity of GAIT elements may provide hierarchical fine-tuning of the resolution of inflammation. PMID:29069516

  12. High cancer-specific expression of mesothelin (MSLN) is attributable to an upstream enhancer containing a transcription enhancer factor dependent MCAT motif.

    PubMed

    Hucl, Tomas; Brody, Jonathan R; Gallmeier, Eike; Iacobuzio-Donahue, Christine A; Farrance, Iain K; Kern, Scott E

    2007-10-01

    Identification of genes with cancer-specific overexpression offers the potential to efficiently discover cancer-specific activities in an unbiased manner. We apply this paradigm to study mesothelin (MSLN) overexpression, a nearly ubiquitous, diagnostically and therapeutically useful characteristic of pancreatic cancer. We identified an 18-bp upstream enhancer, termed CanScript, strongly activating transcription from an otherwise weak tissue-nonspecific promoter and operating selectively in cells having aberrantly elevated cancer-specific MSLN transcription. Introducing mutations into CanScript showed two functionally distinct sites: an Sp1-like site and an MCAT element. Gel retardation and chromatin immunoprecipitation assays showed the MCAT element to be bound by transcription enhancer factor (TEF)-1 (TEAD1) in vitro and in vivo. The presence of TEF-1 was required for MSLN protein overexpression as determined by TEF-1 knockdown experiments. The cancer specificity seemed to be provided by a putative limiting cofactor of TEF-1 that could be outcompeted by exogenous TEF-1 only in a MSLN-overexpressing cell line. A CanScript concatemer offered enhanced activity. These results identify a TEF family member as a major regulator of MSLN overexpression, a fundamental characteristic of pancreatic and other cancers, perhaps due to an upstream and highly frequent aberrant cellular activity. The CanScript sequence represents a modular element for cancer-specific targeting, potentially suitable for nearly a third of human malignancies.

  13. Genome-wide identification of conserved intronic non-coding sequences using a Bayesian segmentation approach.

    PubMed

    Algama, Manjula; Tasker, Edward; Williams, Caitlin; Parslow, Adam C; Bryson-Richardson, Robert J; Keith, Jonathan M

    2017-03-27

    Computational identification of non-coding RNAs (ncRNAs) is a challenging problem. We describe a genome-wide analysis using Bayesian segmentation to identify intronic elements highly conserved between three evolutionarily distant vertebrate species: human, mouse and zebrafish. We investigate the extent to which these elements include ncRNAs (or conserved domains of ncRNAs) and regulatory sequences. We identified 655 deeply conserved intronic sequences in a genome-wide analysis. We also performed a pathway-focussed analysis on genes involved in muscle development, detecting 27 intronic elements, of which 22 were not detected in the genome-wide analysis. At least 87% of the genome-wide and 70% of the pathway-focussed elements have existing annotations indicative of conserved RNA secondary structure. The expression of 26 of the pathway-focused elements was examined using RT-PCR, providing confirmation that they include expressed ncRNAs. Consistent with previous studies, these elements are significantly over-represented in the introns of transcription factors. This study demonstrates a novel, highly effective, Bayesian approach to identifying conserved non-coding sequences. Our results complement previous findings that these sequences are enriched in transcription factors. However, in contrast to previous studies which suggest the majority of conserved sequences are regulatory factor binding sites, the majority of conserved sequences identified using our approach contain evidence of conserved RNA secondary structures, and our laboratory results suggest most are expressed. Functional roles at DNA and RNA levels are not mutually exclusive, and many of our elements possess evidence of both. Moreover, ncRNAs play roles in transcriptional and post-transcriptional regulation, and this may contribute to the over-representation of these elements in introns of transcription factors. We attribute the higher sensitivity of the pathway-focussed analysis compared to the genome-wide analysis to improved alignment quality, suggesting that enhanced genomic alignments may reveal many more conserved intronic sequences.

  14. Evidence of birth-and-death evolution of 5S rRNA gene in Channa species (Teleostei, Perciformes).

    PubMed

    Barman, Anindya Sundar; Singh, Mamta; Singh, Rajeev Kumar; Lal, Kuldeep Kumar

    2016-12-01

    In higher eukaryotes, minor rDNA family codes for 5S rRNA that is arranged in tandem arrays and comprises of a highly conserved 120 bp long coding sequence with a variable non-transcribed spacer (NTS). Initially the 5S rDNA repeats are considered to be evolved by the process of concerted evolution. But some recent reports, including teleost fishes suggested that evolution of 5S rDNA repeat does not fit into the concerted evolution model and evolution of 5S rDNA family may be explained by a birth-and-death evolution model. In order to study the mode of evolution of 5S rDNA repeats in Perciformes fish species, nucleotide sequence and molecular organization of five species of genus Channa were analyzed in the present study. Molecular analyses revealed several variants of 5S rDNA repeats (four types of NTS) and networks created by a neighbor net algorithm for each type of sequences (I, II, III and IV) did not show a clear clustering in species specific manner. The stable secondary structure is predicted and upstream and downstream conserved regulatory elements were characterized. Sequence analyses also shown the presence of two putative pseudogenes in Channa marulius. Present study supported that 5S rDNA repeats in genus Channa were evolved under the process of birth-and-death.

  15. Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

    PubMed Central

    Agervald, Åsa; Stensjö, Karin; Holmqvist, Marie; Lindblad, Peter

    2008-01-01

    Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs) were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the assembly of the small subunit of the enzyme. PMID:18442387

  16. Nuclear reactor control

    DOEpatents

    Cawley, William E.; Warnick, Robert F.

    1982-01-01

    1. In a nuclear reactor incorporating a plurality of columns of tubular fuel elements disposed in horizontal tubes in a mass of graphite wherein water flows through the tubes to cool the fuel elements, the improvement comprising at least one control column disposed in a horizontal tube including fewer fuel elements than in a normal column of fuel elements and tubular control elements disposed at both ends of said control column, and means for varying the horizontal displacement of the control column comprising a winch at the upstream end of the control column and a cable extending through the fuel and control elements and attached to the element at the downstream end of the column.

  17. Assessment of sediments in the riverine impoundments of national wildlife refuges in the Souris River Basin, North Dakota

    USGS Publications Warehouse

    Tangen, Brian A.; Laubhan, Murray K.; Gleason, Robert A.

    2014-01-01

    Accelerated sedimentation of reservoirs and riverine impoundments is a major concern throughout the United States. Sediments not only fill impoundments and reduce their effective life span, but they can reduce water quality by increasing turbidity and introducing harmful chemical constituents such as heavy metals, toxic elements, and nutrients. U.S. Fish and Wildlife Service national wildlife refuges in the north-central part of the United States have documented high amounts of sediment accretion in some wetlands that could negatively affect important aquatic habitats for migratory birds and other wetland-dependent wildlife. Therefore, information pertaining to sediment accumulation in refuge impoundments potentially is important to guide conservation planning, including future management actions of individual impoundments. Lands comprising Des Lacs, Upper Souris, and J. Clark Salyer National Wildlife Refuges, collectively known as the Souris River Basin refuges, encompass reaches of the Des Lacs and Souris Rivers of northwestern North Dakota. The riverine impoundments of the Souris River Basin refuges are vulnerable to sedimentation because of the construction of in-stream dams that interrupt and slow river flows and because of post-European settlement land-use changes that have increased the potential for soil erosion and transport to rivers. Information regarding sediments does not exist for these refuges, and U.S. Fish and Wildlife Service personnel have expressed interest in assessing refuge impoundments to support refuge management decisions. Sediment cores and surface sediment samples were collected from impoundments within Des Lacs, Upper Souris, and J. Clark Salyer National Wildlife Refuges during 2004–05. Cores were used to estimate sediment accretion rates using radioisotope (cesium-137 [137Cs], lead-210 [210Pb]) dating techniques. Sediment cores and surface samples were analyzed for a suite of elements and agrichemicals, respectively. Examination of core characteristics along the depth profile suggests that there has been regular sediment mixing and removal, as well as non-uniform sediment deposition with time. Estimated mean accretion rates based on the three methods of determination (two time markers for 137Cs, 210Pb) ranged from 0.22–0.35 centimeters per year, and approximately 70 percent of cores had less 137Cs than expected. Concentrations of sediment-associated elements generally were within reported reference ranges, and all agrichemicals analyzed were below detection limits. Results suggest that there does not appear to be widespread sediment accumulation in impoundments of the Souris River Basin refuges. In addition, there were no identifiable patterns among sedimentation rates from the upstream (Des Lacs, Upper Souris) to the downstream (J. Clark Salyer) refuges. There were, however, apparent upstream to downstream patterns of increased concentrations of some elements (for example, aluminum, boron, and vanadium) that may warrant further exploration. Future related monitoring and research efforts should focus on areas with high potential for sediment accumulation, such as upstream areas adjacent to dams, to identify potential sediment problems before they become too severe. Further, assessments of suspended sediments transported in the Des Lacs and Souris Rivers would augment interpretation of sedimentation data by identifying potential sediment sources and areas with the greatest potential for accumulation.

  18. Terrace effects on soil erosion processes in a watershed of the loess plateau

    USDA-ARS?s Scientific Manuscript database

    Terraces in crop fields are one of the most important soil and water conservation measures that affect runoff and erosion processes in a watershed. In this paper, terrace effects on soil erosion and sediment transport in the upstream and middle sections of the Weihe River basin in the Loess Plateau ...

  19. Identification of regulatory targets for the bacterial Nus factor complex.

    PubMed

    Baniulyte, Gabriele; Singh, Navjot; Benoit, Courtney; Johnson, Richard; Ferguson, Robert; Paramo, Mauricio; Stringer, Anne M; Scott, Ashley; Lapierre, Pascal; Wade, Joseph T

    2017-12-11

    Nus factors are broadly conserved across bacterial species, and are often essential for viability. A complex of five Nus factors (NusB, NusE, NusA, NusG and SuhB) is considered to be a dedicated regulator of ribosomal RNA folding, and has been shown to prevent Rho-dependent transcription termination. Here, we identify an additional cellular function for the Nus factor complex in Escherichia coli: repression of the Nus factor-encoding gene, suhB. This repression occurs primarily by translation inhibition, followed by Rho-dependent transcription termination. Thus, the Nus factor complex can prevent or promote Rho activity depending on the gene context. Conservation of putative NusB/E binding sites upstream of Nus factor genes suggests that Nus factor autoregulation occurs in many bacterial species. Additionally, many putative NusB/E binding sites are also found upstream of other genes in diverse species, and we demonstrate Nus factor regulation of one such gene in Citrobacter koseri. We conclude that Nus factors have an evolutionarily widespread regulatory function beyond ribosomal RNA, and that they are often autoregulatory.

  20. Computational methods in sequence and structure prediction

    NASA Astrophysics Data System (ADS)

    Lang, Caiyi

    This dissertation is organized into two parts. In the first part, we will discuss three computational methods for cis-regulatory element recognition in three different gene regulatory networks as the following: (a) Using a comprehensive "Phylogenetic Footprinting Comparison" method, we will investigate the promoter sequence structures of three enzymes (PAL, CHS and DFR) that catalyze sequential steps in the pathway from phenylalanine to anthocyanins in plants. Our result shows there exists a putative cis-regulatory element "AC(C/G)TAC(C)" in the upstream of these enzyme genes. We propose this cis-regulatory element to be responsible for the genetic regulation of these three enzymes and this element, might also be the binding site for MYB class transcription factor PAP1. (b) We will investigate the role of the Arabidopsis gene glutamate receptor 1.1 (AtGLR1.1) in C and N metabolism by utilizing the microarray data we obtained from AtGLR1.1 deficient lines (antiAtGLR1.1). We focus our investigation on the putatively co-regulated transcript profile of 876 genes we have collected in antiAtGLR1.1 lines. By (a) scanning the occurrence of several groups of known abscisic acid (ABA) related cisregulatory elements in the upstream regions of 876 Arabidopsis genes; and (b) exhaustive scanning of all possible 6-10 bps motif occurrence in the upstream regions of the same set of genes, we are able to make a quantative estimation on the enrichment level of each of the cis-regulatory element candidates. We finally conclude that one specific cis-regulatory element group, called "ABRE" elements, are statistically highly enriched within the 876-gene group as compared to their occurrence within the genome. (c) We will introduce a new general purpose algorithm, called "fuzzy REDUCE1", which we have developed recently for automated cis-regulatory element identification. In the second part, we will discuss our newly devised protein design framework. With this framework we have developed a software package which is capable of designing novel protein structures at the atomic resolution. This software package allows us to perform protein structure design with a flexible backbone. The backbone flexibility includes loop region relaxation as well as a secondary structure collective mode relaxation scheme. (Abstract shortened by UMI.)

  1. Submarine Alkalic Lavas Around the Hawaiian Hotspot; Plume and Non-Plume Signatures Determined by Noble Gases

    NASA Astrophysics Data System (ADS)

    Hanyu, T.; Clague, D. A.; Kaneoka, I.; Dunai, T. J.; Davies, G. R.

    2004-12-01

    Noble gas isotopic ratios were determined for submarine alkalic volcanic rocks distributed around the Hawaiian islands to constrain the origin of such alkalic volcanism. Samples were collected by dredging or using submersibles from the Kauai Channel between Oahu and Kauai, north of Molokai, northwest of Niihau, Southwest Oahu, South Arch and North Arch volcanic fields. Sites located downstream from the center of the hotspot have 3He/4He ratios close to MORB at about 8 Ra, demonstrating that the magmas erupted at these sites had minimum contribution of volatiles from a mantle plume. In contrast, the South Arch, located upstream of the hotspot on the Hawaiian Arch, has 3He/4He ratios between 17 and 21 Ra, indicating a strong plume influence. Differences in noble gas isotopic characteristics between alkalic volcanism downstream and upstream of the hotspot imply that upstream volcanism contains incipient melts from an upwelling mantle plume, having primitive 3He/4He. In combination with lithophile element isotopic data, we conclude that the most likely source of the upstream magmatism is depleted asthenospheric mantle that has been metasomatised by incipient melt from a mantle plume. After major melt extraction from the mantle plume during production of magmas for the shield stage, the plume material is highly depleted in noble gases and moderately depleted in lithophile elements. Partial melting of the depleted mantle impregnated by melts derived from this volatile depleted plume source may explain the isotopic characteristics of the downstream alkalic magmatism.

  2. FAT1 cadherin acts upstream of Hippo signalling through TAZ to regulate neuronal differentiation.

    PubMed

    Ahmed, Abdulrzag F; de Bock, Charles E; Lincz, Lisa F; Pundavela, Jay; Zouikr, Ihssane; Sontag, Estelle; Hondermarck, Hubert; Thorne, Rick F

    2015-12-01

    The Hippo pathway is emerging as a critical nexus that balances self-renewal of progenitors against differentiation; however, upstream elements in vertebrate Hippo signalling are poorly understood. High expression of Fat1 cadherin within the developing neuroepithelium and the manifestation of severe neurological phenotypes in Fat1-knockout mice suggest roles in neurogenesis. Using the SH-SY5Y model of neuronal differentiation and employing gene silencing techniques, we show that FAT1 acts to control neurite outgrowth, also driving cells towards terminal differentiation via inhibitory effects on proliferation. FAT1 actions were shown to be mediated through Hippo signalling where it activated core Hippo kinase components and antagonised functions of the Hippo effector TAZ. Suppression of FAT1 promoted the nucleocytoplasmic shuttling of TAZ leading to enhanced transcription of the Hippo target gene CTGF together with accompanying increases in nuclear levels of Smad3. Silencing of TAZ reversed the effects of FAT1 depletion thus connecting inactivation of TAZ-TGFbeta signalling with Hippo signalling mediated through FAT1. These findings establish FAT1 as a new upstream Hippo element regulating early stages of differentiation in neuronal cells.

  3. Identification of a negative element in the human vimentin promoter: modulation by the human T-cell leukemia virus type I Tax protein.

    PubMed Central

    Salvetti, A; Lilienbaum, A; Li, Z; Paulin, D; Gazzolo, L

    1993-01-01

    The vimentin gene is a member of the intermediate filament multigene family and encodes a protein expressed, in vivo, in all mesenchymal derivatives and, in vitro, in cell types of various origin. We have previously demonstrated that the expression of this growth-regulated gene could be trans activated by the 40-kDa Tax protein of HTLV-I (human T-cell leukemia virus type I) and that responsiveness to this viral protein was mediated by the presence of an NF-kappa B binding site located between -241 and -210 bp upstream of the mRNA cap site (A. Lilienbaum, M. Duc Dodon, C. Alexandre, L. Gazzolo, and D. Paulin, J. Virol. 64:256-263, 1990). These previous assays, performed with deletion mutants of the vimentin promoter linked to the chloramphenicol acetyltransferase gene, also revealed the presence of an upstream negative region between -529 and -241 bp. Interestingly, the inhibitory activity exerted by this negative region was overcome after cotransfection of a Tax-expressing plasmid. In this study, we further characterize the vimentin negative element and define the effect of the Tax protein on the inhibitory activity of this element. We first demonstrate that a 187-bp domain (-424 to -237 bp) behaves as a negative region when placed upstream either of the NF-kappa B binding site of vimentin or of a heterologous enhancer such as that present in the desmin gene promoter. The negative effect can be further assigned to a 32-bp element which is indeed shown to repress the basal or induced activity of the NF-kappa B binding site.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:8417364

  4. A Summary of the Space-Time Conservation Element and Solution Element (CESE) Method

    NASA Technical Reports Server (NTRS)

    Wang, Xiao-Yen J.

    2015-01-01

    The space-time Conservation Element and Solution Element (CESE) method for solving conservation laws is examined for its development motivation and design requirements. The characteristics of the resulting scheme are discussed. The discretization of the Euler equations is presented to show readers how to construct a scheme based on the CESE method. The differences and similarities between the CESE method and other traditional methods are discussed. The strengths and weaknesses of the method are also addressed.

  5. Vascular gene expression: a hypothesis

    PubMed Central

    Martínez-Navarro, Angélica C.; Galván-Gordillo, Santiago V.; Xoconostle-Cázares, Beatriz; Ruiz-Medrano, Roberto

    2013-01-01

    The phloem is the conduit through which photoassimilates are distributed from autotrophic to heterotrophic tissues and is involved in the distribution of signaling molecules that coordinate plant growth and responses to the environment. Phloem function depends on the coordinate expression of a large array of genes. We have previously identified conserved motifs in upstream regions of the Arabidopsis genes, encoding the homologs of pumpkin phloem sap mRNAs, displaying expression in vascular tissues. This tissue-specific expression in Arabidopsis is predicted by the overrepresentation of GA/CT-rich motifs in gene promoters. In this work we have searched for common motifs in upstream regions of the homologous genes from plants considered to possess a “primitive” vascular tissue (a lycophyte), as well as from others that lack a true vascular tissue (a bryophyte), and finally from chlorophytes. Both lycophyte and bryophyte display motifs similar to those found in Arabidopsis with a significantly low E-value, while the chlorophytes showed either a different conserved motif or no conserved motif at all. These results suggest that these same genes are expressed coordinately in non-vascular plants; this coordinate expression may have been one of the prerequisites for the development of conducting tissues in plants. We have also analyzed the phylogeny of conserved proteins that may be involved in phloem function and development. The presence of CmPP16, APL, FT, and YDA in chlorophytes suggests the recruitment of ancient regulatory networks for the development of the vascular tissue during evolution while OPS is a novel protein specific to vascular plants. PMID:23882276

  6. The yeast DNA ligase gene CDC9 is controlled by six orientation specific upstream activating sequences that respond to cellular proliferation but which alone cannot mediate cell cycle regulation.

    PubMed Central

    White, J H; Johnson, A L; Lowndes, N F; Johnston, L H

    1991-01-01

    By fusing the CDC9 structural gene to the PGK upstream sequences and the CDC9 upstream to lacZ, we showed that the cell cycle expression of CDC9 is largely due to transcriptional regulation. To investigate the role of six ATGATT upstream repeats in CDC9 regulation, synthetic copies of the sequence were attached to a heterologous gene. The repeats stimulated transcription strongly and additively, but, unlike conventional yeast UAS elements, only when present in one orientation. Transcription driven by the repeats declines in cells held at START of the cell cycle or in stationary phase, as occurs with CDC9. However, the repeats by themselves cannot impart cell cycle regulation to a heterologous gene. CDC9 may therefore be controlled by an activating system operating through the repeats that is sensitive to cellular proliferation and a separate mechanism that governs the periodic expression in the cell cycle. Images PMID:1901644

  7. Nutrient, suspended sediment, and trace element loads in the Blackstone River Basin in Massachusetts and Rhode Island, 2007 to 2009

    USGS Publications Warehouse

    Zimmerman, Marc J.; Waldron, Marcus C.; DeSimone, Leslie A.

    2015-01-01

    Analysis of the representative constituents (total phosphorus, total chromium, and suspended sediment) upstream and downstream of impoundments indicated that the existing impoundments, such as Rice City Pond, can be sources of particulate contaminant loads in the Blackstone River. Loads of particulate phosphorus, particulate chromium, and suspended sediment were consistently higher downstream from Rice City Pond than upstream during high-flow events, and there was a positive, linear relation between streamflow and changes in these constituents from upstream to downstream of the impoundment. Thus, particulate contaminants were mobilized from Rice City Pond during high-flow events and transported downstream. In contrast, downstream loads of particulate phosphorus, particulate chromium, and suspended sediment were generally lower than or equal to upstream loads for the former Rockdale Pond impoundment. Sediments associated with the former impoundment at Rockdale Pond, breached in the late 1960s, did not appear to be mobilized during the high-flow events monitored during this study.

  8. Sequence analysis of dolphin ferritin H and L subunits and possible iron-dependent translational control of dolphin ferritin gene

    PubMed Central

    Takaesu, Azusa; Watanabe, Kiyotaka; Takai, Shinji; Sasaki, Yukako; Orino, Koichi

    2008-01-01

    Background Iron-storage protein, ferritin plays a central role in iron metabolism. Ferritin has dual function to store iron and segregate iron for protection of iron-catalyzed reactive oxygen species. Tissue ferritin is composed of two kinds of subunits (H: heavy chain or heart-type subunit; L: light chain or liver-type subunit). Ferritin gene expression is controlled at translational level in iron-dependent manner or at transcriptional level in iron-independent manner. However, sequencing analysis of marine mammalian ferritin subunits has not yet been performed fully. The purpose of this study is to reveal cDNA-derived amino acid sequences of cetacean ferritin H and L subunits, and demonstrate the possibility of expression of these subunits, especially H subunit, by iron. Methods Sequence analyses of cetacean ferritin H and L subunits were performed by direct sequencing of polymerase chain reaction (PCR) fragments from cDNAs generated via reverse transcription-PCR of leukocyte total RNA prepared from blood samples of six different dolphin species (Pseudorca crassidens, Lagenorhynchus obliquidens, Grampus griseus, Globicephala macrorhynchus, Tursiops truncatus, and Delphinapterus leucas). The putative iron-responsive element sequence in the 5'-untranslated region of the six different dolphin species was revealed by direct sequencing of PCR fragments obtained using leukocyte genomic DNA. Results Dolphin H and L subunits consist of 182 and 174 amino acids, respectively, and amino acid sequence identities of ferritin subunits among these dolphins are highly conserved (H: 99–100%, (99→98) ; L: 98–100%). The conserved 28 bp IRE sequence was located -144 bp upstream from the initiation codon in the six different dolphin species. Conclusion These results indicate that six different dolphin species have conserved ferritin sequences, and suggest that these genes are iron-dependently expressed. PMID:18954429

  9. Conservation of proteo-lipid nuclear membrane fusion machinery during early embryogenesis.

    PubMed

    Byrne, Richard D; Veeriah, Selvaraju; Applebee, Christopher J; Larijani, Banafshé

    2014-01-01

    The fusogenic lipid diacylglycerol is essential for remodeling gamete and zygote nuclear envelopes (NE) during early embryogenesis. It is unclear whether upstream signaling molecules are likewise conserved. Here we demonstrate PLCγ and its activator SFK1, which co-operate during male pronuclear envelope formation, also promote the subsequent male and female pronuclear fusion. PLCγ and SFK1 interact directly at the fusion site leading to PLCγ activation. This is accompanied by a spatially restricted reduction of PtdIns(4,5)P2. Consequently, pronuclear fusion is blocked by PLCγ or SFK1 inhibition. These findings identify new regulators of events in the early embryo and suggest a conserved "toolkit" of fusion machinery drives successive NE fusion events during embryogenesis.

  10. Insect sex determination: it all evolves around transformer.

    PubMed

    Verhulst, Eveline C; van de Zande, Louis; Beukeboom, Leo W

    2010-08-01

    Insects exhibit a variety of sex determining mechanisms including male or female heterogamety and haplodiploidy. The primary signal that starts sex determination is processed by a cascade of genes ending with the conserved switch doublesex that controls sexual differentiation. Transformer is the doublesex splicing regulator and has been found in all examined insects, indicating its ancestral function as a sex-determining gene. Despite this conserved function, the variation in transformer nucleotide sequence, amino acid composition and protein structure can accommodate a multitude of upstream sex determining signals. Transformer regulation of doublesex and its taxonomic distribution indicate that the doublesex-transformer axis is conserved among all insects and that transformer is the key gene around which variation in sex determining mechanisms has evolved.

  11. Compressor Stator Time-Variant Aerodynamic Response to Upstream Rotor Wakes.

    DTIC Science & Technology

    1976-11-01

    periodic varia t i ons in pressure , velocity and flow direction in the exit field of an upstream element , wh i ch appea r as temporall y vary ing in a...compressor features blad i ng (42 rotor blades and 40 stator vanes , NACA 65 F Series ) that is aerodynamicall y l oaded to levels that are typical of...measurements were accom- — p lished by instrumenting a pair of the NACA Series 65 stator — vanes with flush mounted Ku lite thin -line des i gn dynamic

  12. The Histone Modification H3K27me3 Is Retained after Gene Duplication and Correlates with Conserved Noncoding Sequences in Arabidopsis

    PubMed Central

    Berke, Lidija; Snel, Berend

    2014-01-01

    The histone modification H3K27me3 is involved in repression of transcription and plays a crucial role in developmental transitions in both animals and plants. It is deposited by PRC2 (Polycomb repressive complex 2), a conserved protein complex. In Arabidopsis thaliana, H3K27me3 is found at 15% of all genes. These tend to encode transcription factors and other regulators important for development. However, it is not known how PRC2 is recruited to target loci nor how this set of target genes arose during Arabidopsis evolution. To resolve the latter, we integrated A. thaliana gene families with five independent genome-wide H3K27me3 data sets. Gene families were either significantly enriched or depleted of H3K27me3, showing a strong impact of shared ancestry to H3K27me3 distribution. To quantify this, we performed ancestral state reconstruction of H3K27me3 on phylogenetic trees of gene families. The set of H3K27me3-marked genes changed less than expected by chance, suggesting that H3K27me3 was retained after gene duplication. This retention suggests that the PRC2-recruiting signal could be encoded in the DNA and also conserved among certain duplicated genes. Indeed, H3K27me3-marked genes were overrepresented among paralogs sharing conserved noncoding sequences (CNSs) that are enriched with transcription factor binding sites. The association of upstream CNSs with H3K27me3-marked genes represents the first genome-wide connection between H3K27me3 and potential regulatory elements in plants. Thus, we propose that CNSs likely function as part of the PRC2 recruitment in plants. PMID:24567304

  13. A new numerical framework for solving conservation laws: The method of space-time conservation element and solution element

    NASA Technical Reports Server (NTRS)

    Chang, Sin-Chung; To, Wai-Ming

    1991-01-01

    A new numerical framework for solving conservation laws is being developed. It employs: (1) a nontraditional formulation of the conservation laws in which space and time are treated on the same footing, and (2) a nontraditional use of discrete variables such as numerical marching can be carried out by using a set of relations that represents both local and global flux conservation.

  14. Invasion versus isolation: Trade-offs in managing native salmonids with barriers to upstream movement

    Treesearch

    Kurt D. Fausch; Bruce E. Rieman; Jason B. Dunham; Michael K. Young; Douglas P. Peterson

    2009-01-01

    Conservation biologists often face the trade-off that increasing connectivity in fragmented landscapes to reduce extinction risk of native species can foster invasion by non-native species that enter via the corridors created, which can then increase extinction risk. This dilemma is acute for stream fishes, especially native salmonids, because their populations are...

  15. Mycobacterium avium subsp. paratuberculosis PPE Protein MAP1152 and Conserved Protein MAP1156 are Antigenic in Experimentally and Naturally Infected Cattle

    USDA-ARS?s Scientific Manuscript database

    Mycobacterium avium subsp. paratuberculosis (MAP) causes Johne’s Disease (JD) in ruminants resulting in significant production losses. An insertion mutation upstream from the MAP1152-MAP1156 region causes a change in colony morphotype and results in an attenuated phenotype in bovine monocyte derive...

  16. Bmal1 is a direct transcriptional target of the orphan nuclear receptor, NR2F1

    USDA-ARS?s Scientific Manuscript database

    Orphan nuclear receptor NR2F1 (also known as COUP-TFI, Chicken Ovalbumin Upstream Promoter Transcription Factor I) is a highly conserved member of the nuclear receptor superfamily. NR2F1 plays a critical role during embryonic development, particularly in the central and peripheral nervous systems a...

  17. Water quality of the lower Columbia River basin; analysis of current and historical water-quality data through 1994

    USGS Publications Warehouse

    Fuhrer, Gregory J.; Tanner, Dwight Q.; Morace, Jennifer L.; McKenzie, Stuart W.; Skach, Kenneth A.

    1996-01-01

    Trend tests showed significant (r < 0.05) downward trends from 1973 to 1994 for three constituents at the Columbia River at Warrendale: phosphorus in unfiltered water, total dissolved solids, and specific conductance. These trends may be a consequence of more conservative agricultural practices in the area upstream from Warrendale.

  18. Labile trace metal contribution of the runoff collector to a semi-urban river.

    PubMed

    Villanueva, J D; Granger, D; Binet, G; Litrico, X; Huneau, F; Peyraube, N; Le Coustumer, P

    2016-06-01

    In this study, the distribution of labile trace metals (LTMs; Cd, Co, Cr, Cu, Ni, Pb, and Zn) in a semi-urban runoff collector was examined to assess its influence to a natural aqueous system (Jalle River, Bordeaux, France). This river is of high importance as it is part of a natural reserve dedicated to conserving aquatic flora and fauna. Two sampling campaigns with a differing precipitation condition (period 1, spring season; and period 2, summer season associated with storms) were considered. Precipitation and water flow were monitored. The collector is active as it is receptive to precipitation changes. It influences the river through discharging water, contributing LTMs, and channeling the mass fluxes. During period 2 where precipitation rate is higher, 25 % of the total water volume of the river was supplied by the collector. LTMs were detected at the collector. Measurements were done by using diffusive gradient in thin films (DGT) probes deployed during 1, 7, and 14 days in each period. The results showed that in an instantaneous period (day 1 or D1), most of these trace metals are above the environmental quality standards (Cd, Co, Cr, and Zn). The coefficient of determination (r (2) > 0.50) employed confirmed that the LTM concentrations in the downstream can be explained by the collector. While Co and Cr are from the upstream and the collector, Cd, Cu, and Zn are mostly provided by the collector. Ni, however, is mostly delivered by the upstream. Using the concentrations observed, the river can be affected by the collector in varying ways: (1) adding effect, resulting from the mix of the upstream and the collector (if upstream ˂ downstream); (2) diluted (if upstream ˃ downstream); and (3) conservative or unaffected (upstream ~ downstream). The range of LTM mass fluxes that the collector holds are as follows: (1) limited range or ˂10 g/day, Cd (0.04-1.75 g/day), Co (0.08-05.42 g/day), Ni (0.06-1.45 g/day), and Pb (0.08-9.89 g/day); (2) moderate range or 11-50 g/day, Cr (0.23-33.26 g/day) and Cu (0.77-37.88 g/day); and (3) wide range or ˃50 g/day, Zn (26.33-676.61 g/day). Hence, the collector is a major source of concern in terms of contamination. This is as the water with considerable LTMs is channeled openly to the river without any treatment.

  19. Profiles of embryonic nuclear protein binding to the proximal promoter region of the soybean β-conglycinin α subunit gene.

    PubMed

    Yoshino, M; Tsutsumi, K; Kanazawa, A

    2015-01-01

    β-Conglycinin, a major component of seed storage protein in soybean, comprises three subunits: α, α' and β. The expression of genes for these subunits is strictly controlled during embryogenesis. The proximal promoter region up to 245 bp upstream of the transcription start site of the α subunit gene sufficiently confers spatial and temporal control of transcription in embryos. Here, the binding profile of nuclear proteins in the proximal promoter region of the α subunit gene was analysed. DNase I footprinting analysis indicated binding of proteins to the RY element and DNA regions including box I, a region conserved in cognate gene promoters. An electrophoretic mobility shift assay (EMSA) using different portions of box I as a probe revealed that multiple portions of box I bind to nuclear proteins. In addition, an EMSA using nuclear proteins extracted from embryos at different developmental stages indicated that the levels of major DNA-protein complexes on box I increased during embryo maturation. These results are consistent with the notion that box I is important for the transcriptional control of seed storage protein genes. Furthermore, the present data suggest that nuclear proteins bind to novel motifs in box I including 5'-TCAATT-3' rather than to predicted cis-regulatory elements. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

  20. The BMP pathway acts to directly regulate Tbx20 in the developing heart

    PubMed Central

    Mandel, Elizabeth M.; Kaltenbrun, Erin; Callis, Thomas E.; Zeng, Xin-Xin I.; Marques, Sara R.; Yelon, Deborah; Wang, Da-Zhi; Conlon, Frank L.

    2010-01-01

    TBX20 has been shown to be essential for vertebrate heart development. Mutations within the TBX20 coding region are associated with human congenital heart disease, and the loss of Tbx20 in a wide variety of model systems leads to cardiac defects and eventually heart failure. Despite the crucial role of TBX20 in a range of cardiac cellular processes, the signal transduction pathways that act upstream of Tbx20 remain unknown. Here, we have identified and characterized a conserved 334 bp Tbx20 cardiac regulatory element that is directly activated by the BMP/SMAD1 signaling pathway. We demonstrate that this element is both necessary and sufficient to drive cardiac-specific expression of Tbx20 in Xenopus, and that blocking SMAD1 signaling in vivo specifically abolishes transcription of Tbx20, but not that of other cardiac factors, such as Tbx5 and MHC, in the developing heart. We further demonstrate that activation of Tbx20 by SMAD1 is mediated by a set of novel, non-canonical, high-affinity SMAD-binding sites located within this regulatory element and that phospho-SMAD1 directly binds a non-canonical SMAD1 site in vivo. Finally, we show that these non-canonical sites are necessary and sufficient for Tbx20 expression in Xenopus, and that reporter constructs containing these sites are expressed in a cardiac-specific manner in zebrafish and mouse. Collectively, our findings define Tbx20 as a direct transcriptional target of the BMP/SMAD1 signaling pathway during cardiac maturation. PMID:20460370

  1. Cross-talk between abscisic acid-dependent and abscisic acid-independent pathways during abiotic stress.

    PubMed

    Roychoudhury, Aryadeep; Paul, Saikat; Basu, Supratim

    2013-07-01

    Salinity, drought and low temperature are the common forms of abiotic stress encountered by land plants. To cope with these adverse environmental factors, plants execute several physiological and metabolic responses. Both osmotic stress (elicited by water deficit or high salt) and cold stress increase the endogenous level of the phytohormone abscisic acid (ABA). ABA-dependent stomatal closure to reduce water loss is associated with small signaling molecules like nitric oxide, reactive oxygen species and cytosolic free calcium, and mediated by rapidly altering ion fluxes in guard cells. ABA also triggers the expression of osmotic stress-responsive (OR) genes, which usually contain single/multiple copies of cis-acting sequence called abscisic acid-responsive element (ABRE) in their upstream regions, mostly recognized by the basic leucine zipper-transcription factors (TFs), namely, ABA-responsive element-binding protein/ABA-binding factor. Another conserved sequence called the dehydration-responsive element (DRE)/C-repeat, responding to cold or osmotic stress, but not to ABA, occurs in some OR promoters, to which the DRE-binding protein/C-repeat-binding factor binds. In contrast, there are genes or TFs containing both DRE/CRT and ABRE, which can integrate input stimuli from salinity, drought, cold and ABA signaling pathways, thereby enabling cross-tolerance to multiple stresses. A strong candidate that mediates such cross-talk is calcium, which serves as a common second messenger for abiotic stress conditions and ABA. The present review highlights the involvement of both ABA-dependent and ABA-independent signaling components and their interaction or convergence in activating the stress genes. We restrict our discussion to salinity, drought and cold stress.

  2. Control of DEMETER DNA demethylase gene transcription in male and female gamete companion cells in Arabidopsis thaliana

    PubMed Central

    Park, Jin-Sup; Frost, Jennifer M.; Park, Kyunghyuk; Ohr, Hyonhwa; Park, Guen Tae; Kim, Seohyun; Eom, Hyunjoo; Lee, Ilha; Brooks, Janie S.; Fischer, Robert L.; Choi, Yeonhee

    2017-01-01

    The DEMETER (DME) DNA glycosylase initiates active DNA demethylation via the base-excision repair pathway and is vital for reproduction in Arabidopsis thaliana. DME-mediated DNA demethylation is preferentially targeted to small, AT-rich, and nucleosome-depleted euchromatic transposable elements, influencing expression of adjacent genes and leading to imprinting in the endosperm. In the female gametophyte, DME expression and subsequent genome-wide DNA demethylation are confined to the companion cell of the egg, the central cell. Here, we show that, in the male gametophyte, DME expression is limited to the companion cell of sperm, the vegetative cell, and to a narrow window of time: immediately after separation of the companion cell lineage from the germline. We define transcriptional regulatory elements of DME using reporter genes, showing that a small region, which surprisingly lies within the DME gene, controls its expression in male and female companion cells. DME expression from this minimal promoter is sufficient to rescue seed abortion and the aberrant DNA methylome associated with the null dme-2 mutation. Within this minimal promoter, we found short, conserved enhancer sequences necessary for the transcriptional activities of DME and combined predicted binding motifs with published transcription factor binding coordinates to produce a list of candidate upstream pathway members in the genetic circuitry controlling DNA demethylation in gamete companion cells. These data show how DNA demethylation is regulated to facilitate endosperm gene imprinting and potential transgenerational epigenetic regulation, without subjecting the germline to potentially deleterious transposable element demethylation. PMID:28130550

  3. Both positive and negative regulatory elements mediate expression of a photoregulated CAB gene from Nicotiana plumbaginifolia.

    PubMed Central

    Castresana, C; Garcia-Luque, I; Alonso, E; Malik, V S; Cashmore, A R

    1988-01-01

    We have analyzed promoter regulatory elements from a photoregulated CAB gene (Cab-E) isolated from Nicotiana plumbaginifolia. These studies have been performed by introducing chimeric gene constructs into tobacco cells via Agrobacterium tumefaciens-mediated transformation. Expression studies on the regenerated transgenic plants have allowed us to characterize three positive and one negative cis-acting elements that influence photoregulated expression of the Cab-E gene. Within the upstream sequences we have identified two positive regulatory elements (PRE1 and PRE2) which confer maximum levels of photoregulated expression. These sequences contain multiple repeated elements related to the sequence-ACCGGCCCACTT-. We have also identified within the upstream region a negative regulatory element (NRE) extremely rich in AT sequences, which reduces the level of gene expression in the light. We have defined a light regulatory element (LRE) within the promoter region extending from -396 to -186 bp which confers photoregulated expression when fused to a constitutive nopaline synthase ('nos') promoter. Within this region there is a 132-bp element, extending from -368 to -234 bp, which on deletion from the Cab-E promoter reduces gene expression from high levels to undetectable levels. Finally, we have demonstrated for a full length Cab-E promoter conferring high levels of photoregulated expression, that sequences proximal to the Cab-E TATA box are not replaceable by corresponding sequences from a 'nos' promoter. This contrasts with the apparent equivalence of these Cab-E and 'nos' TATA box-proximal sequences in truncated promoters conferring low levels of photoregulated expression. Images PMID:2901343

  4. Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Santini, Simona; Boore, Jeffrey L.; Meyer, Axel

    2003-12-31

    Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involvedmore » in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.« less

  5. Molecular cloning and sequence analysis of the Anticarsia gemmatalis multicapsid nuclear polyhedrosis virus GP64 glycoprotein.

    PubMed

    Pilloff, Marcela Gabriela; Bilen, Marcos Fabián; Belaich, Mariano Nicolás; Lozano, Mario Enrique; Ghiringhelli, Pablo Daniel

    2003-01-01

    The gp64 locus of Anticarsia gemmatalis multicapsid nucleopolyhedrovirus isolate Santa Fe (AgMNPV-SF) was characterised molecularly in our laboratory. To this end, we have located and cloned a AgMNPV-SF genomic DNA fragment containing the gp64 gene and sequenced the complete gp64 locus. Nucleotide sequence analysis indicated that the AgMNPV gp64 gene consists of a 1500 nucleotide open reading frame (ORF), encoding a protein of 499 amino acids. Of the seven gp64 homologues identified to date, the AgMNPV gp64 ORF shared most sequence similarity with the gp64 gene of Orgyia pseudotsugata MNPV. The GP64 from AgMNPV is the smallest baculoviral envelope glycoprotein found to date, differing in 10 or more residues from the other group I nucleopolyhedroviruses. The biological activity of AgMNPV GP64 protein was assessed by cell fusion assays in UFL-AG-286 cells using the obtained recombinant plasmids. In the upstream and downstream regions, relative to the gp64 ORF, we found different conserved transcriptional and post-transcriptional regulatory elements, respectively.

  6. Deciphering the adaptation strategies of Desulfovibrio piezophilus to hydrostatic pressure through metabolic and transcriptional analyses.

    PubMed

    Amrani, Amira; van Helden, Jacques; Bergon, Aurélie; Aouane, Aicha; Ben Hania, Wajdi; Tamburini, Christian; Loriod, Béatrice; Imbert, Jean; Ollivier, Bernard; Pradel, Nathalie; Dolla, Alain

    2016-08-01

    Desulfovibrio piezophilus strain C1TLV30(T) is a mesophilic piezophilic sulfate-reducer isolated from Wood Falls at 1700 m depth in the Mediterranean Sea. In this study, we analysed the effect of the hydrostatic pressure on this deep-sea living bacterium at the physiologic and transcriptomic levels. Our results showed that lactate oxidation and energy metabolism were affected by the hydrostatic pressure. Especially, acetyl-CoA oxidation pathway and energy conservation through hydrogen and formate recycling would be more important when the hydrostatic pressure is above (26 MPa) than below (0.1 MPa) the optimal one (10 MPa). This work underlines also the role of the amino acid glutamate as a piezolyte for the Desulfovibrio genus. The transcriptomic analysis revealed 146 differentially expressed genes emphasizing energy production and conversion, amino acid transport and metabolism and cell motility and signal transduction mechanisms as hydrostatic pressure responding processes. This dataset allowed us to identify a sequence motif upstream of a subset of differentially expressed genes as putative pressure-dependent regulatory element. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

  7. Transcriptional Dysregulation of MYC Reveals Common Enhancer-Docking Mechanism.

    PubMed

    Schuijers, Jurian; Manteiga, John Colonnese; Weintraub, Abraham Selby; Day, Daniel Sindt; Zamudio, Alicia Viridiana; Hnisz, Denes; Lee, Tong Ihn; Young, Richard Allen

    2018-04-10

    Transcriptional dysregulation of the MYC oncogene is among the most frequent events in aggressive tumor cells, and this is generally accomplished by acquisition of a super-enhancer somewhere within the 2.8 Mb TAD where MYC resides. We find that these diverse cancer-specific super-enhancers, differing in size and location, interact with the MYC gene through a common and conserved CTCF binding site located 2 kb upstream of the MYC promoter. Genetic perturbation of this enhancer-docking site in tumor cells reduces CTCF binding, super-enhancer interaction, MYC gene expression, and cell proliferation. CTCF binding is highly sensitive to DNA methylation, and this enhancer-docking site, which is hypomethylated in diverse cancers, can be inactivated through epigenetic editing with dCas9-DNMT. Similar enhancer-docking sites occur at other genes, including genes with prominent roles in multiple cancers, suggesting a mechanism by which tumor cell oncogenes can generally hijack enhancers. These results provide insights into mechanisms that allow a single target gene to be regulated by diverse enhancer elements in different cell types. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  8. Identification of a transient Sox5 expressing progenitor population in the neonatal ventral forebrain by a novel cis-regulatory element

    PubMed Central

    Hao, Hailing; Li, Ying; Tzatzalos, Evangeline; Gilbert, Jordana; Zala, Dhara; Bhaumik, Mantu; Cai, Li

    2014-01-01

    Precise control of lineage-specific gene expression in the neural stem/progenitor cells is crucial for generation of the diversity of neuronal and glial cell types in the central nervous system (CNS). The mechanism underlying such gene regulation, however, is not fully elucidated. Here, we report that a 377 bp evolutionarily conserved DNA fragment (CR5), located approximately 32 kbp upstream of Olig2 transcription start site, acts as a cis-regulator for gene expression in the development of the neonatal forebrain. CR5 is active in a time-specific and brain region-restricted manner. CR5 activity is not detected in the embryonic stage, but it is exclusively in a subset of Sox5+ cells in the neonatal ventral forebrain. Furthermore, we show that Sox5 binding motif in CR5 is important for this cell-specific gene regulatory activity; mutation of Sox5 binding motif in CR5 alters reporter gene expression with different cellular composition. Together, our study provides new insights into the regulation of cell-specific gene expression during CNS development. PMID:24954155

  9. Sequences downstream of AAUAAA signals affect pre-mRNA cleavage and polyadenylation in vitro both directly and indirectly.

    PubMed Central

    Ryner, L C; Takagaki, Y; Manley, J L

    1989-01-01

    To investigate the role of sequences lying downstream of the conserved AAUAAA hexanucleotide in pre-mRNA cleavage and polyadenylation, deletions or substitutions were constructed in polyadenylation signals from simian virus 40 and adenovirus, and their effects were assayed in both crude and fractionated HeLa cell nuclear extracts. As expected, these sequences influenced the efficiency of both cleavage and polyadenylation as well as the accuracy of the cleavage reaction. Sequences near or upstream of the actual site of poly(A) addition appeared to specify a unique cleavage site, since their deletion resulted, in some cases, in heterogeneous cleavage. Furthermore, the sequences that allowed the simian virus 40 late pre-RNA to be cleaved preferentially by partially purified cleavage activity were also those at the cleavage site itself. Interestingly, sequences downstream of the cleavage site interacted with factors not directly involved in catalyzing cleavage and polyadenylation, since the effects of deletions were substantially diminished when partially purified components were used in assays. In addition, these sequences contained elements that could affect 3'-end formation both positively and negatively. Images PMID:2566911

  10. Effects of metals on a montane aquatic system evaluated using an integrated assessment approach

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Beltman, D.; Lipton, J.; Cacela, D.

    Surface water, benthic invertebrates, aufwuchs, and sediments were sampled in a Rocky Mountain stream impacted by a cobalt-copper mine. A randomized study design was employed to ensure valid inferences beyond the areas sampled. As, Co, and Cu concentrations in all media downstream of the mine were 1--3 orders of magnitude greater than concentrations upstream, and concentrations in invertebrates were greater than those that adversely affect trout via dietary intake. Correlational analysis shows that bioaccumulation mechanisms and pathways between the different media differ from element to element; the differences are related to geochemical characteristics of the elements. The benthic invertebrate communitymore » is severely impacted for at least 50 km downstream of the mine: Ephemeropteran density, number of taxa, and total biomass are as low as 0.1% of values upstream. Other indices of the effects of metals on invertebrate communities that have been used elsewhere were ineffective in detecting these severe impacts. The integrated assessment approach used in this study provides information on contaminant sources, exposure pathways and mechanisms, and impacts to the stream ecosystem at several organizational levels.« less

  11. Metagenomic exploration reveals a marked change in the river resistome and mobilome after treated wastewater discharges.

    PubMed

    Lekunberri, Itziar; Balcázar, José Luis; Borrego, Carles M

    2018-03-01

    Mobile genetic elements (MGEs) are key agents in the spread of antibiotic resistance genes (ARGs) across environments. Here we used metagenomics to compare the river resistome (collection of all ARGs) and mobilome (e.g., integrases, transposases, integron integrases and insertion sequence common region "ISCR" elements) between samples collected upstream (n = 6) and downstream (n = 6) of an urban wastewater treatment plant (UWWTP). In comparison to upstream metagenomes, downstream metagenomes showed a drastic increase in the abundance of ARGs, as well as markers of MGEs, particularly integron integrases and ISCR elements. These changes were accompanied by a concomitant prevalence of 16S rRNA gene signatures of bacteria affiliated to families encompassing well-known human and animal pathogens. Our results confirm that chronic discharges of treated wastewater severely impact the river resistome affecting not only the abundance and diversity of ARGs but also their potential spread by enriching the river mobilome in a wide variety of MGEs. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Culvert roughness elements for native Utah fish passage : phase II.

    DOT National Transportation Integrated Search

    2012-04-01

    Native fishes have become an increasingly important concern when designing fish passable culverts. Many operational culverts constrict waterways which increase velocities and prevent upstream passage of small fish species. The current method to ensur...

  13. Sall4-Gli3 system in early limb progenitors is essential for the development of limb skeletal elements.

    PubMed

    Akiyama, Ryutaro; Kawakami, Hiroko; Wong, Julia; Oishi, Isao; Nishinakamura, Ryuichi; Kawakami, Yasuhiko

    2015-04-21

    Limb skeletal elements originate from the limb progenitor cells, which undergo expansion and patterning to develop each skeletal element. Posterior-distal skeletal elements, such as the ulna/fibula and posterior digits develop in a Sonic hedgehog (Shh)-dependent manner. However, it is poorly understood how anterior-proximal elements, such as the humerus/femur, the radius/tibia and the anterior digits, are developed. Here we show that the zinc finger factors Sall4 and Gli3 cooperate for proper development of the anterior-proximal skeletal elements and also function upstream of Shh-dependent posterior skeletal element development. Conditional inactivation of Sall4 in the mesoderm before limb outgrowth caused severe defects in the anterior-proximal skeletal elements in the hindlimb. We found that Gli3 expression is reduced in Sall4 mutant hindlimbs, but not in forelimbs. This reduction caused posteriorization of nascent hindlimb buds, which is correlated with a loss of anterior digits. In proximal development, Sall4 integrates Gli3 and the Plzf-Hox system, in addition to proliferative expansion of cells in the mesenchymal core of nascent hindlimb buds. Whereas forelimbs developed normally in Sall4 mutants, further genetic analysis identified that the Sall4-Gli3 system is a common regulator of the early limb progenitor cells in both forelimbs and hindlimbs. The Sall4-Gli3 system also functions upstream of the Shh-expressing ZPA and the Fgf8-expressing AER in fore- and hindlimbs. Therefore, our study identified a critical role of the Sall4-Gli3 system at the early steps of limb development for proper development of the appendicular skeletal elements.

  14. Highly conserved elements discovered in vertebrates are present in non-syntenic loci of tunicates, act as enhancers and can be transcribed during development

    PubMed Central

    Sanges, Remo; Hadzhiev, Yavor; Gueroult-Bellone, Marion; Roure, Agnes; Ferg, Marco; Meola, Nicola; Amore, Gabriele; Basu, Swaraj; Brown, Euan R.; De Simone, Marco; Petrera, Francesca; Licastro, Danilo; Strähle, Uwe; Banfi, Sandro; Lemaire, Patrick; Birney, Ewan; Müller, Ferenc; Stupka, Elia

    2013-01-01

    Co-option of cis-regulatory modules has been suggested as a mechanism for the evolution of expression sites during development. However, the extent and mechanisms involved in mobilization of cis-regulatory modules remains elusive. To trace the history of non-coding elements, which may represent candidate ancestral cis-regulatory modules affirmed during chordate evolution, we have searched for conserved elements in tunicate and vertebrate (Olfactores) genomes. We identified, for the first time, 183 non-coding sequences that are highly conserved between the two groups. Our results show that all but one element are conserved in non-syntenic regions between vertebrate and tunicate genomes, while being syntenic among vertebrates. Nevertheless, in all the groups, they are significantly associated with transcription factors showing specific functions fundamental to animal development, such as multicellular organism development and sequence-specific DNA binding. The majority of these regions map onto ultraconserved elements and we demonstrate that they can act as functional enhancers within the organism of origin, as well as in cross-transgenesis experiments, and that they are transcribed in extant species of Olfactores. We refer to the elements as ‘Olfactores conserved non-coding elements’. PMID:23393190

  15. RNA-DNA and DNA-DNA base-pairing at the upstream edge of the transcription bubble regulate translocation of RNA polymerase and transcription rate.

    PubMed

    KIreeva, Maria; Trang, Cyndi; Matevosyan, Gayane; Turek-Herman, Joshua; Chasov, Vitaly; Lubkowska, Lucyna; Kashlev, Mikhail

    2018-06-20

    Translocation of RNA polymerase (RNAP) along DNA may be rate-limiting for transcription elongation. The Brownian ratchet model posits that RNAP rapidly translocates back and forth until the post-translocated state is stabilized by NTP binding. An alternative model suggests that RNAP translocation is slow and poorly reversible. To distinguish between these two models, we take advantage of an observation that pyrophosphorolysis rates directly correlate with the abundance of the pre-translocated fraction. Pyrophosphorolysis by RNAP stabilized in the pre-translocated state by bacteriophage HK022 protein Nun was used as a reference point to determine the pre-translocated fraction in the absence of Nun. The stalled RNAP preferentially occupies the post-translocated state. The forward translocation rate depends, among other factors, on melting of the RNA-DNA base pair at the upstream edge of the transcription bubble. DNA-DNA base pairing immediately upstream from the RNA-DNA hybrid stabilizes the post-translocated state. This mechanism is conserved between E. coli RNAP and S. cerevisiae RNA polymerase II and is partially dependent on the lid domain of the catalytic subunit. Thus, the RNA-DNA hybrid and DNA reannealing at the upstream edge of the transcription bubble emerge as targets for regulation of the transcription elongation rate.

  16. Mutational analysis of TRAF6 reveals a conserved functional role of the RING dimerization interface and a potentially necessary but insufficient role of RING-dependent TRAF6 polyubiquitination towards NF-κB activation

    PubMed Central

    Megas, Charilaos; Hatzivassiliou, Eudoxia G.; Yin, Qian; Vignali, Dario A.A.; Mosialos, George

    2011-01-01

    TRAF6 is an E3 ubiquitin ligase that plays a pivotal role in the activation of NF-κB by innate and adaptive immunity stimuli. TRAF6 consists of a highly conserved carboxyl terminal TRAF-C domain which is preceded by a coiled coil domain and an amino terminal region that contains a RING domain and a series of putative zinc-finger motifs. The TRAF-C domain contributes to TRAF6 oligomerization and mediates the interaction of TRAF6 with upstream signaling molecules whereas the RING domain comprises the core of the ubiquitin ligase catalytic domain. In order to identify structural elements that are important for TRAF6-induced NF-κB activation, mutational analysis of the TRAF-C and RING domains was performed. Alterations of highly conserved residues of the TRAF-C domain of TRAF6 did not affect significantly the ability of the protein to activate NF-κB. On the other hand a number of functionally important residues (L77, Q82, R88, F118, N121 and E126) for the activation of NF-κB were identified within the RING domain of TRAF6. Interestingly, several homologues of these residues in TRAF2 were shown to have a conserved functional role in TRAF2-induced NF-κB activation and lie at the dimerization interface of the RING domain. Finally, whereas alteration of Q82, R88 and F118 compromised both the K63-linked polyubiquitination of TRAF6 and its ability to activate NF-κB, alteration of L77, N121 and E126 diminished the NF-κB activating function of TRAF6 without affecting TRAF6 K63-linked polyubiquitination. Our results support a conserved functional role of the TRAF RING domain dimerization interface and a potentially necessary but insufficient role for RING-dependent TRAF6 K63-linked polyubiquitination towards NF-κB activation in cells. PMID:21185369

  17. Mutational analysis of TRAF6 reveals a conserved functional role of the RING dimerization interface and a potentially necessary but insufficient role of RING-dependent TRAF6 polyubiquitination towards NF-κB activation.

    PubMed

    Megas, Charilaos; Hatzivassiliou, Eudoxia G; Yin, Qian; Marinopoulou, Elli; Hadweh, Paul; Vignali, Dario A A; Mosialos, George

    2011-05-01

    TRAF6 is an E3 ubiquitin ligase that plays a pivotal role in the activation of NF-κB by innate and adaptive immunity stimuli. TRAF6 consists of a highly conserved carboxyl terminal TRAF-C domain which is preceded by a coiled coil domain and an amino terminal region that contains a RING domain and a series of putative zinc-finger motifs. The TRAF-C domain contributes to TRAF6 oligomerization and mediates the interaction of TRAF6 with upstream signaling molecules whereas the RING domain comprises the core of the ubiquitin ligase catalytic domain. In order to identify structural elements that are important for TRAF6-induced NF-κB activation, mutational analysis of the TRAF-C and RING domains was performed. Alterations of highly conserved residues of the TRAF-C domain of TRAF6 did not affect significantly the ability of the protein to activate NF-κB. On the other hand a number of functionally important residues (L77, Q82, R88, F118, N121 and E126) for the activation of NF-κB were identified within the RING domain of TRAF6. Interestingly, several homologues of these residues in TRAF2 were shown to have a conserved functional role in TRAF2-induced NF-κB activation and lie at the dimerization interface of the RING domain. Finally, whereas alteration of Q82, R88 and F118 compromised both the K63-linked polyubiquitination of TRAF6 and its ability to activate NF-κB, alteration of L77, N121 and E126 diminished the NF-κB activating function of TRAF6 without affecting TRAF6 K63-linked polyubiquitination. Our results support a conserved functional role of the TRAF RING domain dimerization interface and a potentially necessary but insufficient role for RING-dependent TRAF6 K63-linked polyubiquitination towards NF-κB activation in cells. Copyright © 2010 Elsevier Inc. All rights reserved.

  18. Transcriptional dynamics of a conserved gene expression network associated with craniofacial divergence in Arctic charr.

    PubMed

    Ahi, Ehsan Pashay; Kapralova, Kalina Hristova; Pálsson, Arnar; Maier, Valerie Helene; Gudbrandsson, Jóhannes; Snorrason, Sigurdur S; Jónsson, Zophonías O; Franzdóttir, Sigrídur Rut

    2014-01-01

    Understanding the molecular basis of craniofacial variation can provide insights into key developmental mechanisms of adaptive changes and their role in trophic divergence and speciation. Arctic charr (Salvelinus alpinus) is a polymorphic fish species, and, in Lake Thingvallavatn in Iceland, four sympatric morphs have evolved distinct craniofacial structures. We conducted a gene expression study on candidates from a conserved gene coexpression network, focusing on the development of craniofacial elements in embryos of two contrasting Arctic charr morphotypes (benthic and limnetic). Four Arctic charr morphs were studied: one limnetic and two benthic morphs from Lake Thingvallavatn and a limnetic reference aquaculture morph. The presence of morphological differences at developmental stages before the onset of feeding was verified by morphometric analysis. Following up on our previous findings that Mmp2 and Sparc were differentially expressed between morphotypes, we identified a network of genes with conserved coexpression across diverse vertebrate species. A comparative expression study of candidates from this network in developing heads of the four Arctic charr morphs verified the coexpression relationship of these genes and revealed distinct transcriptional dynamics strongly correlated with contrasting craniofacial morphologies (benthic versus limnetic). A literature review and Gene Ontology analysis indicated that a significant proportion of the network genes play a role in extracellular matrix organization and skeletogenesis, and motif enrichment analysis of conserved noncoding regions of network candidates predicted a handful of transcription factors, including Ap1 and Ets2, as potential regulators of the gene network. The expression of Ets2 itself was also found to associate with network gene expression. Genes linked to glucocorticoid signalling were also studied, as both Mmp2 and Sparc are responsive to this pathway. Among those, several transcriptional targets and upstream regulators showed differential expression between the contrasting morphotypes. Interestingly, although selected network genes showed overlapping expression patterns in situ and no morph differences, Timp2 expression patterns differed between morphs. Our comparative study of transcriptional dynamics in divergent craniofacial morphologies of Arctic charr revealed a conserved network of coexpressed genes sharing functional roles in structural morphogenesis. We also implicate transcriptional regulators of the network as targets for future functional studies.

  19. High-Resolution Genuinely Multidimensional Solution of Conservation Laws by the Space-Time Conservation Element and Solution Element Method

    NASA Technical Reports Server (NTRS)

    Himansu, Ananda; Chang, Sin-Chung; Yu, Sheng-Tao; Wang, Xiao-Yen; Loh, Ching-Yuen; Jorgenson, Philip C. E.

    1999-01-01

    In this overview paper, we review the basic principles of the method of space-time conservation element and solution element for solving the conservation laws in one and two spatial dimensions. The present method is developed on the basis of local and global flux conservation in a space-time domain, in which space and time are treated in a unified manner. In contrast to the modern upwind schemes, the approach here does not use the Riemann solver and the reconstruction procedure as the building blocks. The drawbacks of the upwind approach, such as the difficulty of rationally extending the 1D scalar approach to systems of equations and particularly to multiple dimensions is here contrasted with the uniformity and ease of generalization of the Conservation Element and Solution Element (CE/SE) 1D scalar schemes to systems of equations and to multiple spatial dimensions. The assured compatibility with the simplest type of unstructured meshes, and the uniquely simple nonreflecting boundary conditions of the present method are also discussed. The present approach has yielded high-resolution shocks, rarefaction waves, acoustic waves, vortices, ZND detonation waves, and shock/acoustic waves/vortices interactions. Moreover, since no directional splitting is employed, numerical resolution of two-dimensional calculations is comparable to that of the one-dimensional calculations. Some sample applications displaying the strengths and broad applicability of the CE/SE method are reviewed.

  20. Identification of a functional element in the promoter of the silkworm (Bombyx mori) fat body-specific gene Bmlp3.

    PubMed

    Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou

    2014-08-01

    30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.

  1. A 3-dimensional mass conserving element for compressible flows

    NASA Technical Reports Server (NTRS)

    Fix, G.; Suri, M.

    1985-01-01

    A variety of finite element schemes has been used in the numerical approximation of compressible flows particularly in underwater acoustics. In many instances instabilities have been generated due to the lack of mass conservation. Two- and three-dimensional elements are developed which avoid these problems.

  2. Culvert roughness elements for native Utah fish passage : phase I.

    DOT National Transportation Integrated Search

    2011-01-01

    Laboratory flume testing of native Utah non-salmonid fish was performed to observe how : they use altered flow around obstacles to swim upstream. Three experimental setups included : a bare Plexiglas flume, vertical cylinders, and natural substrate p...

  3. SSME Turbopump Turbine Computations

    NASA Technical Reports Server (NTRS)

    Jorgenson, P. G. E.

    1985-01-01

    A two-dimensional viscous code was developed to be used in the prediction of the flow in the SSME high-pressure turbopump blade passages. The rotor viscous code (RVC) employs a four-step Runge-Kutta scheme to solve the two-dimensional, thin-layer Navier-Stokes equations. The Baldwin-Lomax eddy-viscosity model is used for these turbulent flow calculations. A viable method was developed to use the relative exit conditions from an upstream blade row as the inlet conditions to the next blade row. The blade loading diagrams are compared with the meridional values obtained from an in-house quasithree-dimensional inviscid code. Periodic boundary conditions are imposed on a body-fitted C-grid computed by using the GRAPE GRids about Airfoils using Poisson's Equation (GRAPE) code. Total pressure, total temperature, and flow angle are specified at the inlet. The upstream-running Riemann invariant is extrapolated from the interior. Static pressure is specified at the exit such that mass flow is conserved from blade row to blade row, and the conservative variables are extrapolated from the interior. For viscous flows the noslip condition is imposed at the wall. The normal momentum equation gives the pressure at the wall. The density at the wall is obtained from the wall total temperature.

  4. Evidence for serial discontinuity in the fish community of a heavily impounded river

    USGS Publications Warehouse

    Miranda, Leandro E.; Dembkowski, D.J.

    2016-01-01

    In the Tennessee River, USA, we examined lengthwise patterns in fish community structure and species richness within and among nine reservoirs organized in sequence and connected through navigational locks. Within reservoirs, the riverine, transition and lacustrine zones supported distinct, although overlapping, nearshore fish assemblages; differences were also reflected in measures of species richness. Spatial patterns were most apparent for rheophilic species, which increased in species richness and representation upstream within each reservoir and downstream across the chain of reservoirs. This pattern resembled a sawtooth wave, with the amplitude of the wave peaking in the riverine zone below each dam, and progressively higher wave amplitude developing downstream in the reservoir chain. The observed sawtooth pattern supports the serial discontinuity concept in that the continuity of the riverine fish community is interrupted by the lacustrine conditions created behind each dam. Upstream within each reservoir, and downstream in the chain of reservoirs, habitat characteristics become more riverine. To promote sustainability of rheophilic fishes and maintain biodiversity in impounded rivers, conservation plans could emphasize maintenance and preservation of riverine environments of the reservoir's upper reaches, while remaining cognizant of the broader basin trends that provide opportunities for a lengthwise array of conservation and management policy. 

  5. A Mammalian Conserved Element Derived from SINE Displays Enhancer Properties Recapitulating Satb2 Expression in Early-Born Callosal Projection Neurons

    PubMed Central

    Nakanishi, Akiko; Sasaki, Takeshi; Yan, Kuo; Tarabykin, Victor; Vigier, Lisa; Sumiyama, Kenta; Hirakawa, Mika; Nishihara, Hidenori; Pierani, Alessandra; Okada, Norihiro

    2011-01-01

    Short interspersed repetitive elements (SINEs) are highly repeated sequences that account for a significant proportion of many eukaryotic genomes and are usually considered “junk DNA”. However, we previously discovered that many AmnSINE1 loci are evolutionarily conserved across mammalian genomes, suggesting that they may have acquired significant functions involved in controlling mammalian-specific traits. Notably, we identified the AS021 SINE locus, located 390 kbp upstream of Satb2. Using transgenic mice, we showed that this SINE displays specific enhancer activity in the developing cerebral cortex. The transcription factor Satb2 is expressed by cortical neurons extending axons through the corpus callosum and is a determinant of callosal versus subcortical projection. Mouse mutants reveal a crucial function for Sabt2 in corpus callosum formation. In this study, we compared the enhancer activity of the AS021 locus with Satb2 expression during telencephalic development in the mouse. First, we showed that the AS021 enhancer is specifically activated in early-born Satb2+ neurons. Second, we demonstrated that the activity of the AS021 enhancer recapitulates the expression of Satb2 at later embryonic and postnatal stages in deep-layer but not superficial-layer neurons, suggesting the possibility that the expression of Satb2 in these two subpopulations of cortical neurons is under genetically distinct transcriptional control. Third, we showed that the AS021 enhancer is activated in neurons projecting through the corpus callosum, as described for Satb2+ neurons. Notably, AS021 drives specific expression in axons crossing through the ventral (TAG1−/NPY+) portion of the corpus callosum, confirming that it is active in a subpopulation of callosal neurons. These data suggest that exaptation of the AS021 SINE locus might be involved in enhancement of Satb2 expression, leading to the establishment of interhemispheric communication via the corpus callosum, a eutherian-specific brain structure. PMID:22174821

  6. Stenotrophomonas maltophilia responds to exogenous AHL signals through the LuxR solo SmoR (Smlt1839).

    PubMed

    Martínez, Paula; Huedo, Pol; Martinez-Servat, Sònia; Planell, Raquel; Ferrer-Navarro, Mario; Daura, Xavier; Yero, Daniel; Gibert, Isidre

    2015-01-01

    Quorum Sensing (QS) mediated by Acyl Homoserine Lactone (AHL) molecules are probably the most widespread and studied among Gram-negative bacteria. Canonical AHL systems are composed by a synthase (LuxI family) and a regulator element (LuxR family), whose genes are usually adjacent in the genome. However, incomplete AHL-QS machinery lacking the synthase LuxI is frequently observed in Proteobacteria, and the regulator element is then referred as LuxR solo. It has been shown that certain LuxR solos participate in interspecific communication by detecting signals produced by different organisms. In the case of Stenotrophomonas maltophilia, a preliminary genome sequence analysis revealed numerous putative luxR genes, none of them associated to a luxI gene. From these, the hypothetical LuxR solo Smlt1839, here designated SmoR, presents a conserved AHL binding domain and a helix-turn-helix DNA binding motif. Its genomic organization-adjacent to hchA gene-indicate that SmoR belongs to the new family "LuxR regulator chaperone HchA-associated." AHL-binding assays revealed that SmoR binds to AHLs in-vitro, at least to oxo-C8-homoserine lactone, and it regulates operon transcription, likely by recognizing a conserved palindromic regulatory box in the hchA upstream region. Supplementation with concentrated supernatants from Pseudomonas aeruginosa, which contain significant amounts of AHLs, promoted swarming motility in S. maltophilia. Contrarily, no swarming stimulation was observed when the P. aeruginosa supernatant was treated with the lactonase AiiA from Bacillus subtilis, confirming that AHL contributes to enhance the swarming ability of S. maltophilia. Finally, mutation of smoR resulted in a swarming alteration and an apparent insensitivity to the exogenous AHLs provided by P. aeruginosa. In conclusion, our results demonstrate that S. maltophilia senses AHLs produced by neighboring bacteria through the LuxR solo SmoR, regulating population behaviors such as swarming motility.

  7. Variation in the genomic locations and sequence conservation of STAR elements among staphylococcal species provides insight into DNA repeat evolution

    PubMed Central

    2012-01-01

    Background Staphylococcus aureus Repeat (STAR) elements are a type of interspersed intergenic direct repeat. In this study the conservation and variation in these elements was explored by bioinformatic analyses of published staphylococcal genome sequences and through sequencing of specific STAR element loci from a large set of S. aureus isolates. Results Using bioinformatic analyses, we found that the STAR elements were located in different genomic loci within each staphylococcal species. There was no correlation between the number of STAR elements in each genome and the evolutionary relatedness of staphylococcal species, however higher levels of repeats were observed in both S. aureus and S. lugdunensis compared to other staphylococcal species. Unexpectedly, sequencing of the internal spacer sequences of individual repeat elements from multiple isolates showed conservation at the sequence level within deep evolutionary lineages of S. aureus. Whilst individual STAR element loci were demonstrated to expand and contract, the sequences associated with each locus were stable and distinct from one another. Conclusions The high degree of lineage and locus-specific conservation of these intergenic repeat regions suggests that STAR elements are maintained due to selective or molecular forces with some of these elements having an important role in cell physiology. The high prevalence in two of the more virulent staphylococcal species is indicative of a potential role for STAR elements in pathogenesis. PMID:23020678

  8. From cytoskeletal dynamics to organ asymmetry: a nonlinear, regulative pathway underlies left-right patterning.

    PubMed

    McDowell, Gary; Rajadurai, Suvithan; Levin, Michael

    2016-12-19

    Consistent left-right (LR) asymmetry is a fundamental aspect of the bodyplan across phyla, and errors of laterality form an important class of human birth defects. Its molecular underpinning was first discovered as a sequential pathway of left- and right-sided gene expression that controlled positioning of the heart and visceral organs. Recent data have revised this picture in two important ways. First, the physical origin of chirality has been identified; cytoskeletal dynamics underlie the asymmetry of single-cell behaviour and patterning of the LR axis. Second, the pathway is not linear: early disruptions that alter the normal sidedness of upstream asymmetric genes do not necessarily induce defects in the laterality of the downstream genes or in organ situs Thus, the LR pathway is a unique example of two fascinating aspects of biology: the interplay of physics and genetics in establishing large-scale anatomy, and regulative (shape-homeostatic) pathways that correct molecular and anatomical errors over time. Here, we review aspects of asymmetry from its intracellular, cytoplasmic origins to the recently uncovered ability of the LR control circuitry to achieve correct gene expression and morphology despite reversals of key 'determinant' genes. We provide novel functional data, in Xenopus laevis, on conserved elements of the cytoskeleton that drive asymmetry, and comparatively analyse it together with previously published results in the field. Our new observations and meta-analysis demonstrate that despite aberrant expression of upstream regulatory genes, embryos can progressively normalize transcriptional cascades and anatomical outcomes. LR patterning can thus serve as a paradigm of how subcellular physics and gene expression cooperate to achieve developmental robustness of a body axis.This article is part of the themed issue 'Provocative questions in left-right asymmetry'. © 2016 The Author(s).

  9. From cytoskeletal dynamics to organ asymmetry: a nonlinear, regulative pathway underlies left–right patterning

    PubMed Central

    Rajadurai, Suvithan

    2016-01-01

    Consistent left–right (LR) asymmetry is a fundamental aspect of the bodyplan across phyla, and errors of laterality form an important class of human birth defects. Its molecular underpinning was first discovered as a sequential pathway of left- and right-sided gene expression that controlled positioning of the heart and visceral organs. Recent data have revised this picture in two important ways. First, the physical origin of chirality has been identified; cytoskeletal dynamics underlie the asymmetry of single-cell behaviour and patterning of the LR axis. Second, the pathway is not linear: early disruptions that alter the normal sidedness of upstream asymmetric genes do not necessarily induce defects in the laterality of the downstream genes or in organ situs. Thus, the LR pathway is a unique example of two fascinating aspects of biology: the interplay of physics and genetics in establishing large-scale anatomy, and regulative (shape-homeostatic) pathways that correct molecular and anatomical errors over time. Here, we review aspects of asymmetry from its intracellular, cytoplasmic origins to the recently uncovered ability of the LR control circuitry to achieve correct gene expression and morphology despite reversals of key ‘determinant’ genes. We provide novel functional data, in Xenopus laevis, on conserved elements of the cytoskeleton that drive asymmetry, and comparatively analyse it together with previously published results in the field. Our new observations and meta-analysis demonstrate that despite aberrant expression of upstream regulatory genes, embryos can progressively normalize transcriptional cascades and anatomical outcomes. LR patterning can thus serve as a paradigm of how subcellular physics and gene expression cooperate to achieve developmental robustness of a body axis. This article is part of the themed issue ‘Provocative questions in left–right asymmetry’. PMID:27821521

  10. Southern Great Plains Rapid Ecoregional Assessment: pre-assessment report

    USGS Publications Warehouse

    Assal, Timothy J.; Melcher, Cynthia P.; Carr, Natasha B.

    2015-01-01

    An overview on the ecology and management issues for each Conservation Element is provided, including distribution and ecology, landscape structure and dynamics, and associated species of management concern affiliated with each Conservation Element. For each Conservation Element, effects of the Change Agents are described. An overview of potential key ecological attributes and potential Change Agents are summarized by conceptual models and tables. The tables provide an organizational framework and background information for evaluating the key ecological attributes and Change Agents in Phase II.

  11. Low exhaust temperature electrically heated particulate matter filter system

    DOEpatents

    Gonze, Eugene V [Pinckney, MI; Paratore, Jr., Michael J.; Bhatia, Garima [Bangalore, IN

    2012-02-14

    A system includes a particulate matter (PM) filter, a sensor, a heating element, and a control module. The PM filter includes with an upstream end that receives exhaust gas, a downstream end and multiple zones. The sensor detects a temperature of the exhaust gas. The control module controls current to the heating element to convection heat one of the zones and initiate a regeneration process. The control module selectively increases current to the heating element relative to a reference regeneration current level when the temperature is less than a predetermined temperature.

  12. Steady inviscid transonic flows over planar airfoils: A search for a simplified procedure

    NASA Technical Reports Server (NTRS)

    Magnus, R.; Yoshihara, H.

    1973-01-01

    A finite difference procedure based upon a system of unsteady equations in proper conservation form with either exact or small disturbance steady terms is used to calculate the steady flows over several classes of airfoils. The airfoil condition is fulfilled on a slab whose upstream extremity is a semi-circle overlaying the airfoil leading edge circle. The limitations of the small disturbance equations are demonstrated in an extreme example of a blunt-nosed, aft-cambered airfoil. The necessity of using the equations in proper conservation form to capture the shock properly is stressed. Ability of the steady relaxation procedures to capture the shock is briefly examined.

  13. Sustainability of Water Resources in the Upstream Watershed- Based Community Engagement and Multistakeholder Cooperation

    NASA Astrophysics Data System (ADS)

    Brotosusilo, Agus; Utari, Dyah; Agung Satria, Afrizal

    2016-02-01

    The communities engagement become the backbone of the conservation in the Citanduy upstream watershed. It functioning as a major deal and the first one in keeping his own Watershed. This paper based on Community Engagement Grants (CEGs). Program Society-based empowerment approach is also emphasized in the viewpoint of environmental law that is useful to set governance and sanctions in watershed management. The type of activity to be undertaken are the expansion of awareness programs communities of the existence and condition of the watershed Citanduy, the formation of a cadre of conservationists environment that is primarily directed to children and women, the institutionalization of customary law environment, and afforestation by planting 100,000 prolific trees, tree conservationists, and Sunda endemic tree in the land surrounding the watershed upstream Citanduy. The Program involves several partners and stakeholders who helped in substance and operational support activities in the field.. Result of program shows that Community Engagement Grants need cooperation among stakeholders by positioning the community as main subject of changing, not as subject who does not understand their needs to change.

  14. Variation in conserved non-coding sequences on chromosome 5q andsusceptibility to asthma and atopy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Donfack, Joseph; Schneider, Daniel H.; Tan, Zheng

    2005-09-10

    Background: Evolutionarily conserved sequences likely havebiological function. Methods: To determine whether variation in conservedsequences in non-coding DNA contributes to risk for human disease, westudied six conserved non-coding elements in the Th2 cytokine cluster onhuman chromosome 5q31 in a large Hutterite pedigree and in samples ofoutbred European American and African American asthma cases and controls.Results: Among six conserved non-coding elements (>100 bp,>70percent identity; human-mouse comparison), we identified one singlenucleotide polymorphism (SNP) in each of two conserved elements and sixSNPs in the flanking regions of three conserved elements. We genotypedour samples for four of these SNPs and an additional three SNPs eachmore » inthe IL13 and IL4 genes. While there was only modest evidence forassociation with single SNPs in the Hutterite and European Americansamples (P<0.05), there were highly significant associations inEuropean Americans between asthma and haplotypes comprised of SNPs in theIL4 gene (P<0.001), including a SNP in a conserved non-codingelement. Furthermore, variation in the IL13 gene was strongly associatedwith total IgE (P = 0.00022) and allergic sensitization to mold allergens(P = 0.00076) in the Hutterites, and more modestly associated withsensitization to molds in the European Americans and African Americans (P<0.01). Conclusion: These results indicate that there is overalllittle variation in the conserved non-coding elements on 5q31, butvariation in IL4 and IL13, including possibly one SNP in a conservedelement, influence asthma and atopic phenotypes in diversepopulations.« less

  15. Conservative discretization of the Landau collision integral

    DOE PAGES

    Hirvijoki, E.; Adams, M. F.

    2017-03-28

    Here we describe a density, momentum-, and energy-conserving discretization of the nonlinear Landau collision integral. The method is suitable for both the finite-element and discontinuous Galerkin methods and does not require structured meshes. The conservation laws for the discretization are proven algebraically and demonstrated numerically for an axially symmetric nonlinear relaxation problem using a finite-element implementation.

  16. Comparative evolutionary genomics of the HADH2 gene encoding Aβ-binding alcohol dehydrogenase/17β-hydroxysteroid dehydrogenase type 10 (ABAD/HSD10)

    PubMed Central

    Marques, Alexandra T; Antunes, Agostinho; Fernandes, Pedro A; Ramos, Maria J

    2006-01-01

    Background The Aβ-binding alcohol dehydrogenase/17β-hydroxysteroid dehydrogenase type 10 (ABAD/HSD10) is an enzyme involved in pivotal metabolic processes and in the mitochondrial dysfunction seen in the Alzheimer's disease. Here we use comparative genomic analyses to study the evolution of the HADH2 gene encoding ABAD/HSD10 across several eukaryotic species. Results Both vertebrate and nematode HADH2 genes showed a six-exon/five-intron organization while those of the insects had a reduced and varied number of exons (two to three). Eutherian mammal HADH2 genes revealed some highly conserved noncoding regions, which may indicate the presence of functional elements, namely in the upstream region about 1 kb of the transcription start site and in the first part of intron 1. These regions were also conserved between Tetraodon and Fugu fishes. We identified a conserved alternative splicing event between human and dog, which have a nine amino acid deletion, causing the removal of the strand βF. This strand is one of the seven strands that compose the core β-sheet of the Rossman fold dinucleotide-binding motif characteristic of the short chain dehydrogenase/reductase (SDR) family members. However, the fact that the substrate binding cleft residues are retained and the existence of a shared variant between human and dog suggest that it might be functional. Molecular adaptation analyses across eutherian mammal orthologues revealed the existence of sites under positive selection, some of which being localized in the substrate-binding cleft and in the insertion 1 region on loop D (an important region for the Aβ-binding to the enzyme). Interestingly, a higher than expected number of nonsynonymous substitutions were observed between human/chimpanzee and orangutan, with six out of the seven amino acid replacements being under molecular adaptation (including three in loop D and one in the substrate binding loop). Conclusion Our study revealed that HADH2 genes maintained a reasonable conserved organization across a large evolutionary distance. The conserved noncoding regions identified among mammals and between pufferfishes, the evidence of an alternative splicing variant conserved between human and dog, and the detection of positive selection across eutherian mammals, may be of importance for further research on ABAD/HSD10 function and its implication in the Alzheimer's disease. PMID:16899120

  17. RNA connectivity requirements between conserved elements in the core of the yeast telomerase RNP

    PubMed Central

    Mefford, Melissa A; Rafiq, Qundeel; Zappulla, David C

    2013-01-01

    Telomerase is a specialized chromosome end-replicating enzyme required for genome duplication in many eukaryotes. An RNA and reverse transcriptase protein subunit comprise its enzymatic core. Telomerase is evolving rapidly, particularly its RNA component. Nevertheless, nearly all telomerase RNAs, including those of H. sapiens and S. cerevisiae, share four conserved structural elements: a core-enclosing helix (CEH), template-boundary element, template, and pseudoknot, in this order along the RNA. It is not clear how these elements coordinate telomerase activity. We find that although rearranging the order of the four conserved elements in the yeast telomerase RNA subunit, TLC1, disrupts activity, the RNA ends can be moved between the template and pseudoknot in vitro and in vivo. However, the ends disrupt activity when inserted between the other structured elements, defining an Area of Required Connectivity (ARC). Within the ARC, we find that only the junction nucleotides between the pseudoknot and CEH are essential. Integrating all of our findings provides a basic map of functional connections in the core of the yeast telomerase RNP and a framework to understand conserved element coordination in telomerase mechanism. PMID:24129512

  18. Wyoming Basin Rapid Ecoregional Assessment: Work Plan

    USGS Publications Warehouse

    Carr, Natasha B.; Garman, Steven L.; Walters, Annika; Ray, Andrea; Melcher, Cynthia P.; Wesner, Jeff S.; O’Donnell, Michael S.; Sherrill, Kirk R.; Babel, Nils C.; Bowen, Zachary H.

    2013-01-01

    The overall goal of the Rapid Ecoregional Assessments (REAs) being conducted for the Bureau of Land Management (BLM) is to provide information that supports regional planning and analysis for the management of ecological resources. The REA provides an assessment of baseline ecological conditions, an evaluation of current risks from drivers of ecosystem change, and a predictive capacity for evaluating future risks. The REA also may be used for identifying priority areas for conservation or restoration and for assessing the cumulative effects of a variety of land uses. There are several components of the REAs. Management Questions, developed by the BLM and partners for the ecoregion, identify the information needed for addressing land-management responsibilities. Conservation Elements represent regionally significant aquatic and terrestrial species and communities that are to be conserved and (or) restored. The REA also will evaluate major drivers of ecosystem change (Change Agents) currently affecting or likely to affect the status of Conservation Elements. We selected 8 major biomes and 19 species or species assemblages to be included as Conservation Elements. We will address the four primary Change Agents—development, fire, invasive species, and climate change—required for the REA. The purpose of the work plan for the Wyoming Basin REA is to document the selection process for, and final list of, Management Questions, Conservation Elements, and Change Agents. The work plan also presents the overall assessment framework that will be used to assess the status of Conservation Elements and answer Management Questions.

  19. The statistics of Pearce element diagrams and the Chayes closure problem

    NASA Astrophysics Data System (ADS)

    Nicholls, J.

    1988-05-01

    Pearce element ratios are defined as having a constituent in their denominator that is conserved in a system undergoing change. The presence of a conserved element in the denominator simplifies the statistics of such ratios and renders them subject to statistical tests, especially tests of significance of the correlation coefficient between Pearce element ratios. Pearce element ratio diagrams provide unambigous tests of petrologic hypotheses because they are based on the stoichiometry of rock-forming minerals. There are three ways to recognize a conserved element: 1. The petrologic behavior of the element can be used to select conserved ones. They are usually the incompatible elements. 2. The ratio of two conserved elements will be constant in a comagmatic suite. 3. An element ratio diagram that is not constructed with a conserved element in the denominator will have a trend with a near zero intercept. The last two criteria can be tested statistically. The significance of the slope, intercept and correlation coefficient can be tested by estimating the probability of obtaining the observed values from a random population of arrays. This population of arrays must satisfy two criteria: 1. The population must contain at least one array that has the means and variances of the array of analytical data for the rock suite. 2. Arrays with the means and variances of the data must not be so abundant in the population that nearly every array selected at random has the properties of the data. The population of random closed arrays can be obtained from a population of open arrays whose elements are randomly selected from probability distributions. The means and variances of these probability distributions are themselves selected from probability distributions which have means and variances equal to a hypothetical open array that would give the means and variances of the data on closure. This hypothetical open array is called the Chayes array. Alternatively, the population of random closed arrays can be drawn from the compositional space available to rock-forming processes. The minerals comprising the available space can be described with one additive component per mineral phase and a small number of exchange components. This space is called Thompson space. Statistics based on either space lead to the conclusion that Pearce element ratios are statistically valid and that Pearce element diagrams depict the processes that create chemical inhomogeneities in igneous rock suites.

  20. Strategies for conserving native salmonid populations at risk from nonnative fish invasions: tradeoffs in using barriers to upstream movement

    Treesearch

    Kurt D. Fausch; Bruce E. Rieman; Michael Young; Jason B. Dunham

    2006-01-01

    Native salmonid populations in the inland West are often restricted to small isolated habitats at risk from invasion by nonnative salmonids. However, further isolating these populations using barriers to prevent invasions can increase their extinction risk. This monograph reviews the state of knowledge about this tradeoff between invasion and isolation. We present a...

  1. Transcriptional "silencer" element in rat repetitive sequences associated with the rat insulin 1 gene locus.

    PubMed Central

    Laimins, L; Holmgren-König, M; Khoury, G

    1986-01-01

    The enhancer elements from either simian virus 40 or murine sarcoma virus activate the expression of a transfected rat insulin 1 (rI1) gene when placed within 2.0 kilobases or less of the rI1 gene cap site. Inclusion of 4.0 kilobases of upstream rI1 sequence, however, results in a substantial reduction in the enhancer-dependent insulin gene expression. These observations suggested that a negative transcriptional regulatory element was present between 2.0 and 4.0 kilobases of the rI1 sequence. To test this notion, we employed a heterologous enhancer-dependent transcription assay in which the simian virus 40 72-base-pair repeat is linked to a human beta-globin gene. Addition of the upstream rI1 element to this system decreased the level of enhancer-dependent beta-globin transcription by a factor of 5 to 15. This rI1 "silencer" element functions in a manner relatively independent of position and orientation and requires a cis-dependent relationship to the transcription unit on which it acts. Thus, the silencer sequence seems to have a number of the characteristics of enhancer elements, and we suggest that it may function by the converse of the enhancer mechanism. The rI1 silencer sequence was identified as a member of a long interspersed rat repetitive family. Thus, a potential role for certain repetitive sequences interspersed throughout the eukaryotic genome may be to regulate gene expression by retaining transcriptional activity within defined domains. Images PMID:3010279

  2. Isolation and functional characterization of TIF-IB, a factor that confers promoter specificity to mouse RNA polymerase I.

    PubMed

    Schnapp, A; Clos, J; Hädelt, W; Schreck, R; Cvekl, A; Grummt, I

    1990-03-25

    The murine ribosomal gene promoter contains two cis-acting control elements which operate in concert to promote efficient and accurate transcription initiation by RNA polymerase I. The start site proximal core element which is indispensable for promoter recognition by RNA polymerase I (pol I) encompasses sequences from position -39 to -1. An upstream control element (UCE) which is located between nucleotides -142 and -112 stimulates the efficiency of transcription initiation both in vivo and in vitro. Here we report the isolation and functional characterization of a specific rDNA binding protein, the transcription initiation factor TIF-IB, which specifically interacts with the core region of the mouse ribosomal RNA gene promoter. Highly purified TIF-IB complements transcriptional activity in the presence of two other essential initiation factors TIF-IA and TIF-IC. We demonstrate that the binding efficiency of purified TIF-IB to the core promoter is strongly enhanced by the presence in cis of the UCE. This positive effect of upstream sequences on TIF-IB binding is observed throughout the purification procedure suggesting that the synergistic action of the two distant promoter elements is not mediated by a protein different from TIF-IB. Increasing the distance between both control elements still facilitates stable factor binding but eliminates transcriptional activation. The results demonstrate that TIF-IB binding to the rDNA promoter is an essential early step in the assembly of a functional transcription initiation complex. The subsequent interaction of TIF-IB with other auxiliary transcription initiation factors, however, requires the correct spacing between the UCE and the core promoter element.

  3. The glnAntrBC operon of Herbaspirillum seropedicae is transcribed by two oppositely regulated promoters upstream of glnA.

    PubMed

    Schwab, Stefan; Souza, Emanuel M; Yates, Marshall G; Persuhn, Darlene C; Steffens, M Berenice R; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U

    2007-01-01

    Herbaspirillum seropedicae is an endophytic bacterium that fixes nitrogen under microaerophilic conditions. The putative promoter sequences glnAp1 (sigma70-dependent) and glnAp2 (sigma54), and two NtrC-binding sites were identified upstream from the glnA, ntrB and ntrC genes of this microorganism. To study their transcriptional regulation, we used lacZ fusions to the H. seropedicae glnA gene, and the glnA-ntrB and ntrB-ntrC intergenic regions. Expression of glnA was up-regulated under low ammonium, but no transcription activity was detected from the intergenic regions under any condition tested, suggesting that glnA, ntrB and ntrC are co-transcribed from the promoters upstream of glnA. Ammonium regulation was lost in the ntrC mutant strain. A point mutation was introduced in the conserved -25/-24 dinucleotide (GG-->TT) of the putative sigma54-dependent promoter (glnAp2). Contrary to the wild-type promoter, glnA expression with the mutant glnAp2 promoter was repressed in the wild-type strain under low ammonium levels, but this repression was abolished in an ntrC background. Together our results indicate that the H. seropedicae glnAntrBC operon is regulated from two functional promoters upstream from glnA, which are oppositely regulated by the NtrC protein.

  4. Conserved Noncoding Elements in the Most Distant Genera of Cephalochordates: The Goldilocks Principle

    PubMed Central

    Yue, Jia-Xing; Kozmikova, Iryna; Ono, Hiroki; Nossa, Carlos W.; Kozmik, Zbynek; Putnam, Nicholas H.; Yu, Jr-Kai; Holland, Linda Z.

    2016-01-01

    Cephalochordates, the sister group of vertebrates + tunicates, are evolving particularly slowly. Therefore, genome comparisons between two congeners of Branchiostoma revealed so many conserved noncoding elements (CNEs), that it was not clear how many are functional regulatory elements. To more effectively identify CNEs with potential regulatory functions, we compared noncoding sequences of genomes of the most phylogenetically distant cephalochordate genera, Asymmetron and Branchiostoma, which diverged approximately 120–160 million years ago. We found 113,070 noncoding elements conserved between the two species, amounting to 3.3% of the genome. The genomic distribution, target gene ontology, and enriched motifs of these CNEs all suggest that many of them are probably cis-regulatory elements. More than 90% of previously verified amphioxus regulatory elements were re-captured in this study. A search of the cephalochordate CNEs around 50 developmental genes in several vertebrate genomes revealed eight CNEs conserved between cephalochordates and vertebrates, indicating sequence conservation over >500 million years of divergence. The function of five CNEs was tested in reporter assays in zebrafish, and one was also tested in amphioxus. All five CNEs proved to be tissue-specific enhancers. Taken together, these findings indicate that even though Branchiostoma and Asymmetron are distantly related, as they are evolving slowly, comparisons between them are likely optimal for identifying most of their tissue-specific cis-regulatory elements laying the foundation for functional characterizations and a better understanding of the evolution of developmental regulation in cephalochordates. PMID:27412606

  5. Multidimensional directional flux weighted upwind scheme for multiphase flow modeling in heterogeneous porous media

    NASA Astrophysics Data System (ADS)

    Jin, G.

    2012-12-01

    Multiphase flow modeling is an important numerical tool for a better understanding of transport processes in the fields including, but not limited to, petroleum reservoir engineering, remedy of ground water contamination, and risk evaluation of greenhouse gases such as CO2 injected into deep saline reservoirs. However, accurate numerical modeling for multiphase flow remains many challenges that arise from the inherent tight coupling and strong non-linear nature of the governing equations and the highly heterogeneous media. The existence of counter current flow which is caused by the effect of adverse relative mobility contrast and gravitational and capillary forces will introduce additional numerical instability. Recently multipoint flux approximation (MPFA) has become a subject of extensive research and has been demonstrated with great success in reducing considerable grid orientation effects compared to the conventional single point upstream (SPU) weighting scheme, especially in higher dimensions. However, the present available MPFA schemes are mathematically targeted to certain types of grids in two dimensions, a more general form of MPFA scheme is needed for both 2-D and 3-D problems. In this work a new upstream weighting scheme based on multipoint directional incoming fluxes is proposed which incorporates full permeability tensor to account for the heterogeneity of the porous media. First, the multiphase governing equations are decoupled into an elliptic pressure equation and a hyperbolic or parabolic saturation depends on whether the gravitational and capillary pressures are presented or not. Next, a dual secondary grid (called finite volume grid) is formulated from a primary grid (called finite element grid) to create interaction regions for each grid cell over the entire simulation domain. Such a discretization must ensure the conservation of mass and maintain the continuity of the Darcy velocity across the boundaries between neighboring interaction regions. The pressure field is then implicitly calculated from the pressure equation, which in turn results in the derived velocity field for directional flux calculation at each grid node. Directional flux at the center of each interaction surface is also calculated by interpolation from the element nodal fluxes using shape functions. The MPFA scheme is performed by a specific linear combination of all incoming fluxes into the upstream cell represented by either nodal fluxes or interpolated surface boundary fluxes to produce an upwind directional fluxed weighted relative mobility at the center of the interaction region boundary. Such an upwind weighted relative mobility is then used for calculating the saturations of each fluid phase explicitly. The proposed upwind weighting scheme has been implemented into a mixed finite element-finite volume (FE-FV) method, which allows for handling complex reservoir geometry with second-order accuracies in approximating primary variables. The numerical solver has been tested with several bench mark test problems. The application of the proposed scheme to migration path analysis of CO2 injected into deep saline reservoirs in 3-D has demonstrated its ability and robustness in handling multiphase flow with adverse mobility contrast in highly heterogeneous porous media.

  6. Conserved Structural Elements in the V3 Crown of HIV-1 gp120

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jiang, X.; Burke, V; Totrov, M

    2010-01-01

    Binding of the third variable region (V3) of the HIV-1 envelope glycoprotein gp120 to the cell-surface coreceptors CCR5 or CXCR4 during viral entry suggests that there are conserved structural elements in this sequence-variable region. These conserved elements could serve as epitopes to be targeted by a vaccine against HIV-1. Here we perform a systematic structural analysis of representative human anti-V3 monoclonal antibodies in complex with V3 peptides, revealing that the crown of V3 has four conserved structural elements: an arch, a band, a hydrophobic core and the peptide backbone. These are either unaffected by or are subject to minimal sequencemore » variation. As these regions are targeted by cross-clade neutralizing human antibodies, they provide a blueprint for the design of vaccine immunogens that could elicit broadly cross-reactive protective antibodies.« less

  7. Molecular cloning of the transcription factor TFIIB homolog from Sulfolobus shibatae.

    PubMed Central

    Qureshi, S A; Khoo, B; Baumann, P; Jackson, S P

    1995-01-01

    The Archaea (archaebacteria) constitute a group of prokaryotes that are phylogenetically distinct from Eucarya (eukaryotes) and Bacteria (eubacteria). Although Archaea possess only one RNA polymerase, evidence suggests that their transcriptional apparatus is similar to that of Eucarya. For example, Archaea contain a homolog of the TATA-binding protein which interacts with the TATA-box like A-box sequence upstream of many archaeal genes. Here, we report the cloning of a Sulfolobus shibatae gene that encodes a protein (transcription factor TFB) with striking homology to the eukaryotic basal transcription factor TFIIB. We show by primer extension analysis that transcription of the S. shibatae TFB gene initiates 27 bp downstream from a consensus A-box element. Significantly, S. shibatae TFB contains an N-terminal putative metal-binding region and two imperfect direct repeats--structural features that are well conserved in eukaryotic TFIIBs. This suggests that TFB may perform analogous functions in Archaea and Eucarya. Consistent with this, we demonstrate that S. shibatae TFB promotes the binding of S. shibatae TBP to the A-box element of the Sulfolobus 16S/23S rRNA gene. Finally, we show that S. shibatae TFB is significantly more related to TFB of the archaeon Pyrococcus woesei than it is to eukaryotic TFIIBs. These data suggest that TFB arose in the common archaeal/eukaryotic ancestor and that the lineages leading to P. woesei and S. shibatae separated after the divergence of the archaeal and eukaryotic lines of descent. Images Fig. 2 Fig. 3 PMID:7597084

  8. Regulation of the plasma cell transcription factor Blimp-1 gene by Bach2 and Bcl6.

    PubMed

    Ochiai, Kyoko; Muto, Akihiko; Tanaka, Hiromu; Takahashi, Shinichiro; Igarashi, Kazuhiko

    2008-03-01

    B lymphocyte-induced maturation protein 1 (Blimp-1) is a key regulator for plasma cell differentiation. Prior to the terminal differentiation into plasma cells, Blimp-1 expression is suppressed in B cells by transcription repressors BTB and CNC homology 2 (Bach2) and B cell lymphoma 6 (Bcl6). Bach2 binds to the Maf recognition element (MARE) of the promoter upstream region of the Blimp-1 gene (Prdm1) by forming a heterodimer with MafK. Bach2 and Bcl6 were found to interact with each other in B cells. While both Bach2 and Bcl6 possess the BTB domain which mediates protein-protein interactions, they interacted in a BTB-independent manner. Bcl6 is known to repress Prdm1 through a Bcl6 recognition element 1 in the intron 5, in which a putative, evolutionarily conserved MARE was identified. Both repressed the expression of a reporter gene containing the intron 5 region depending on the presence of the respective binding sites in 18-81 pre-B cells. Co-expression of Bach2 and Bcl6 resulted in further repression of the reporter plasmid. Chromatin immunoprecipitation assays showed MafK to bind to the intron MARE in various B cell lines, thus suggesting that it binds as a heterodimer with Bach2. Therefore, the interaction between Bach2 and Bcl6 might be crucial for the proper repression of Prdm1 in B cells.

  9. Soybean (Glycine max) WRINKLED1 transcription factor, GmWRI1a, positively regulates seed oil accumulation.

    PubMed

    Chen, Liang; Zheng, Yuhong; Dong, Zhimin; Meng, Fanfan; Sun, Xingmiao; Fan, Xuhong; Zhang, Yunfeng; Wang, Mingliang; Wang, Shuming

    2018-04-01

    Soybean is the world's most important leguminous crop producing high-quality protein and oil. Elevating oil accumulation in soybean seed is always many researchers' goal. WRINKLED1 (WRI1) encodes a transcription factor of the APETALA2/ethylene responsive element-binding protein (AP2/EREBP) family that plays important roles during plant seed oil accumulation. In this study, we isolated and characterized three distinct orthologues of WRI1 in soybean (Glycine max) that display different organ-specific expression patterns, among which GmWRI1a was highly expressed in maturing soybean seed. Electrophoretic mobility shift assays and yeast one-hybrid experiments demonstrated that the GmWRI1a protein was capable of binding to AW-box, a conserved sequence in the proximal upstream regions of many genes involved in various steps of oil biosynthesis. Transgenic soybean seeds overexpressing GmWRI1a under the control of the seed-specific napin promoter showed the increased total oil and fatty acid content and the changed fatty acid composition. Furthermore, basing on the activated expressions in transgenic soybean seeds and existence of AW-box element in the promoter regions, direct downstream genes of GmWRI1a were identified, and their products were responsible for fatty acid production, elongation, desaturation and export from plastid. We conclude that GmWRI1a transcription factor can positively regulate oil accumulation in soybean seed by a complex gene expression network related to fatty acid biosynthesis.

  10. GLUCOCORTICOID RECEPTOR EXPRESSION DURING THE DEVELOPMENT OF THE EMBRYONIC MOUSE SECONDARY PALATE

    EPA Science Inventory

    Glucocorticoids are important regulators of embryonic growth and development. hese effects are mediated through glucocorticoid receptors (GR) which bind to glucocorticoid response elements upstream of regulated genes. his study examines the expression of GR and GR mRNA in embryon...

  11. A SHORT SEQUENCE IMMEDIATELY UPSTREAM OF THE INTERNAL REPEAT ELEMENTS IS CRITICAL FOR KSHV LANA MEDIATED DNA REPLICATION AND IMPACTS EPISOME PERSISTENCE

    PubMed Central

    León Vázquez, Erika De; Juillard, Franceline; Rosner, Bernard; Kaye, Kenneth M.

    2013-01-01

    Kaposi’s sarcoma-associated herpesvirus LANA (1162 residues) mediates episomal persistence of viral genomes during latency. LANA mediates viral DNA replication and segregates episomes to daughter nuclei. A 59 residue deletion immediately upstream of the internal repeat elements rendered LANA highly deficient for DNA replication and modestly deficient for the ability to segregate episomes, while smaller deletions did not. The 59 amino acid deletion reduced LANA episome persistence by ~14-fold, while sequentially smaller deletions resulted in ~3-fold, or no deficiency. Three distinct LANA regions reorganized heterochromatin, one of which contains the deleted sequence, but the deletion did not abolish LANA’s ability to alter chromatin. Therefore, this work identifies a short internal LANA sequence that is critical for DNA replication, has modest effects on episome segregation, and substantially impacts episome persistence; this region may exert its effects through an interacting host cell protein(s). PMID:24314665

  12. Isolation and characterization of a water stress-specific genomic gene, pwsi 18, from rice.

    PubMed

    Joshee, N; Kisaka, H; Kitagawa, Y

    1998-01-01

    One of the water stress-specific cDNA clones of rice characterised previously, wsi18, was selected for further study. The wsi18 gene can be induced by water stress conditions such as mannitol, NaCl, and dryness, but not by ABA, cold, or heat. A genomic clone for wsi18, pwsi18, contained about 1.7 kbp of the 5' upstream sequence, two introns, and the full coding sequence. The 5'-upstream sequence of pwsi18 contained putative cis-acting elements, namely an ABA-responsive element (ABRE), three G-boxes, three E-boxes, a MEF-2 sequence, four direct and two inverted repeats, and four sequences similar to DRE, which is involved in the dehydration response of Arabidopsis genes. The gusA reporter gene under the control of the pwsi18 promoter showed transient expression in response to water stress. Deletion of the downstream DRE-like sequence between the distal G-boxes-2 and -3 resulted in rather low GUS expression.

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liebhaber, S.A.; Weiss, I.; Cash, F.E.

    Synthesis of normal human hemoglobin A, {alpha}{sub 2}{beta}{sub 2}, is based upon balanced expression of genes in the {alpha}-globin gene cluster on chromosome 15 and the {beta}-globin gene cluster on chromosome 11. Full levels of erythroid-specific activation of the {beta}-globin cluster depend on sequences located at a considerable distance 5{prime} to the {beta}-globin gene, referred to as the locus-activating or dominant control region. The existence of an analogous element(s) upstream of the {alpha}-globin cluster has been suggested from observations on naturally occurring deletions and experimental studies. The authors have identified an individual with {alpha}-thalassemia in whom structurally normal {alpha}-globin genesmore » have been inactivated in cis by a discrete de novo 35-kilobase deletion located {approximately}30 kilobases 5{prime} from the {alpha}-globin gene cluster. They conclude that this deletion inactivates expression of the {alpha}-globin genes by removing one or more of the previously identified upstream regulatory sequences that are critical to expression of the {alpha}-globin genes.« less

  14. Early Evolution of Conserved Regulatory Sequences Associated with Development in Vertebrates

    PubMed Central

    McEwen, Gayle K.; Goode, Debbie K.; Parker, Hugo J.; Woolfe, Adam; Callaway, Heather; Elgar, Greg

    2009-01-01

    Comparisons between diverse vertebrate genomes have uncovered thousands of highly conserved non-coding sequences, an increasing number of which have been shown to function as enhancers during early development. Despite their extreme conservation over 500 million years from humans to cartilaginous fish, these elements appear to be largely absent in invertebrates, and, to date, there has been little understanding of their mode of action or the evolutionary processes that have modelled them. We have now exploited emerging genomic sequence data for the sea lamprey, Petromyzon marinus, to explore the depth of conservation of this type of element in the earliest diverging extant vertebrate lineage, the jawless fish (agnathans). We searched for conserved non-coding elements (CNEs) at 13 human gene loci and identified lamprey elements associated with all but two of these gene regions. Although markedly shorter and less well conserved than within jawed vertebrates, identified lamprey CNEs are able to drive specific patterns of expression in zebrafish embryos, which are almost identical to those driven by the equivalent human elements. These CNEs are therefore a unique and defining characteristic of all vertebrates. Furthermore, alignment of lamprey and other vertebrate CNEs should permit the identification of persistent sequence signatures that are responsible for common patterns of expression and contribute to the elucidation of the regulatory language in CNEs. Identifying the core regulatory code for development, common to all vertebrates, provides a foundation upon which regulatory networks can be constructed and might also illuminate how large conserved regulatory sequence blocks evolve and become fixed in genomic DNA. PMID:20011110

  15. The flow field around a pair of cubic roughness elements with different spacings immersed in turbulent boundary layer

    NASA Astrophysics Data System (ADS)

    Agarwal, Karuna; Gao, Jian; Katz, Joseph

    2017-11-01

    The shape, size, and spacing between roughness elements in turbulent boundary layers affect the associated drag and noise. Understanding them require data on the flow structure around these elements. Dual-view tomographic holography is used to study the 3D 3-component velocity field around a pair of cubic roughness elements immersed in a turbulent boundary layer at Reτ = 2500 . These a = 1 mm high cubes correspond to 4% of the half channel height and 90 wall units (δν = 11 μ m). Tests are performed for spanwise spacings of a, 1.5 a and 2.5 a. The sample volume is 385δν × 250δν × 190δν and the vector spacing is 5.4δν. Conversed statistics is obtained by recording 1500 realizations in volumes centered upstream, downstream and around a cube. The boundary layer separating upstream of the cube does not reattach until the wake region, resulting in formation of a vortical ``canopy'' that engulfs each cube. It is dominated by spanwise vorticity above the cube and separated region, bounded by vertical vorticity on the sides. Flow channeling in the space between cubes causes asymmetry in the vorticity distributions along the inner and outer walls. The legs of horseshoe vortices remain near the wall between cubes, but grow and expand in the wake region. Funded by NSF and ONR.

  16. Prioritizing conservation activities using reserve site selection methods and population viability analysis.

    PubMed

    Newbold, Stephen C; Siikamäki, Juha

    2009-10-01

    In recent years a large literature on reserve site selection (RSS) has developed at the interface between ecology, operations research, and environmental economics. Reserve site selection models use numerical optimization techniques to select sites for a network of nature reserves for protecting biodiversity. In this paper, we develop a population viability analysis (PVA) model for salmon and incorporate it into an RSS framework for prioritizing conservation activities in upstream watersheds. We use spawner return data for three closely related salmon stocks in the upper Columbia River basin and estimates of the economic costs of watershed protection from NOAA to illustrate the framework. We compare the relative cost-effectiveness of five alternative watershed prioritization methods, based on various combinations of biological and economic information. Prioritization based on biological benefit-economic cost comparisons and accounting for spatial interdependencies among watersheds substantially outperforms other more heuristic methods. When using this best-performing prioritization method, spending 10% of the cost of protecting all upstream watersheds yields 79% of the biological benefits (increase in stock persistence) from protecting all watersheds, compared to between 20% and 64% for the alternative methods. We also find that prioritization based on either costs or benefits alone can lead to severe reductions in cost-effectiveness.

  17. The Effect of Upstream Vane Wakes on Annular Diffuser Flows

    NASA Astrophysics Data System (ADS)

    Cherry, Erica; Padilla, Angelina; Elkins, Christopher; Eaton, John

    2008-11-01

    Experiments were performed to determine the sensitivity to inlet conditions of the flow in two annular diffusers. One of the diffusers was a conservative design typical of a diffuser directly upstream of the combustor in a jet engine. The other had the same length and inlet shape as the first diffuser but a larger area ratio and was meant to operate on the verge of separation. Each diffuser was connected to two different inlets, one containing a fully-developed channel flow, the other containing wakes from a row of airfoils. Three-component velocity measurements were taken on the flow in each inlet/diffuser combination using Magnetic Resonance Velocimetry. Results will be presented on the 3D velocity fields in the two diffusers and the effect of the airfoil wakes on separation and secondary flows.

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    King, David A.

    Oak Ridge Associated Universities (ORAU), under the Oak Ridge Institute for Science and Education (ORISE) contract, collected split surface water samples with Nuclear Fuel Services (NFS) representatives on August 21, 2013. Representatives from the U.S. Nuclear Regulatory Commission (NRC) and the Tennessee Department of Environment and Conservation were also in attendance. Samples were collected at four surface water stations, as required in the approved Request for Technical Assistance number 11-018. These stations included Nolichucky River upstream (NRU), Nolichucky River downstream (NRD), Martin Creek upstream (MCU), and Martin Creek downstream (MCD). Both ORAU and NFS performed gross alpha and gross betamore » analyses, and the comparison of results using the duplicate error ratio (DER), also known as the normalized absolute difference, are tabulated. All DER values were less than 3 and results are consistent with low (e.g., background) concentrations.« less

  19. Assessing dissolved carbon transport and transformation along an estuarine river with stable isotope analyses

    NASA Astrophysics Data System (ADS)

    He, Songjie; Xu, Y. Jun

    2017-10-01

    Estuaries play an important role in the dynamics of dissolved carbon from rivers to coastal oceans. However, our knowledge of dissolved carbon transport and transformation in mixing zones of the world's coastal rivers is still limited. This study aims to determine how dissolved inorganic carbon (DIC) and dissolved organic carbon (DOC) concentrations and stable isotopes (δ13CDIC and δ13CDOC) change along an 88-km long estuarine river, the Calcasieu River in Louisiana, southern USA, with salinity ranging from 0.02 to 21.92. The study is expected to elucidate which processes most likely control carbon dynamics in a freshwater-saltwater mixing system, and to evaluate the net metabolism of this estuary. Between May 2015 and February 2016, water samples were collected and in-situ measurements on ambient water conditions were performed during five field trips at six sites from upstream to downstream of the Calcasieu River, which enters the Northern Gulf of Mexico (NGOM). The DIC concentration and δ13CDIC increased rapidly with increasing salinity in the mixing zone. The average DIC concentration and δ13CDIC at the site closest to the NGOM (site 6) were 1.31 mM and -6.34‰, respectively, much higher than those at the site furthest upstream (site 1, 0.42 mM and -20.83‰). The DIC concentrations appeared to be largely influenced by conservative mixing, while high water temperature may have played a role in deviating DIC concentration from the conservative line due likely to increased respiration and decomposition. The δ13CDIC values were close to those suggested by the conservative mixing model for May, June and November, but lower than those for July and February, suggesting that an estuarine river can fluctuate from a balanced to a heterotrophic system (i.e., production/respiration (P/R) < 1) seasonally. Unlike the DIC longitudinal trend, the DOC concentrations in the river estuary decreased from upstream to downstream, but to a much smaller degree. The DOC concentrations consistently showed a deviation from those suggested by the conservative mixing model, which may have been a consequence of in-stream photosynthesis. This river estuary consistently showed depleted δ13CDOC values (i.e., from -30.56‰ to -25.92‰), suggesting that the DOC source in the mixing zone was highly terrestrially derived. However, in this relatively small isotopic range, δ13CDOC alone has limitations in differentiating carbon produced by aquatic photosynthesis from carbon produced by terrestrial photosynthesis in a river-ocean continuum.

  20. Road crossing designs and their impact on fish assemblages of Great Plains streams

    USGS Publications Warehouse

    Bouska, Wesley W.; Paukert, Craig P.

    2010-01-01

    A mark-recapture field study was conducted to determine fish passage at 5 concrete box culverts and 5 low-water crossings (concrete slabs vented by culverts) as well as 10 control sites (below a natural riffle) in Flint Hills streams of northeastern Kansas. Additionally, we tested the upstream passage of four fish species native to Great Plains streams (Topeka shiner Notropis topeka, green sunfish Lepomis cyanellus, red shiner Cyprinella lutrensis, and southern redbelly dace Phoxinus erythrogaster) through three simulated crossing designs (box culverts, round corrugated culverts, and natural rock riffles) at water velocities of 0.1 to 1.1 m/s in an experimental stream. The field study indicated that cyprinids were twice as likely to move upstream of box culverts than low-water crossings and 1.4 times as likely to move upstream of control reaches than any crossing type. The best models indicated that the proportion of cyprinids that moved upstream increased with decreased culvert slope and length, perching, and increased culvert width. Our controlled experiment indicated that fish can move through velocities up to 1.1 m/s in a 1.86-m simulated stream and that the proportion of fish that moved upstream did not differ among crossing designs for southern redbelly dace, green sunfish, or Topeka shiner; however, natural rock riffles had lower proportional movements (mean = 0.19) than the box (0.38) or corrugated culvert designs (0.43) for red shiners. Water velocity did not affect the proportional upstream movement of any species except that of Topeka shiners, which increased with water velocity. Crossing design alone may not determine fish passage, and water velocities up to 1.1 m/s may not affect the passage of many Great Plains fishes. Barriers to fish movement may be the result of other factors (e.g., perching, slope, and crossing length). The use of properly designed and installed crossings has promise in conserving Great Plains stream fishes.

  1. The value of countryside elements in the conservation of a threatened arboreal marsupial Petaurus norfolcensis in agricultural landscapes of south-eastern Australia--the disproportional value of scattered trees.

    PubMed

    Crane, Mason J; Lindenmayer, David B; Cunningham, Ross B

    2014-01-01

    Human activities, particularly agriculture, have transformed much of the world's terrestrial environment. Within these anthropogenic landscapes, a variety of relictual and semi-natural habitats exist, which we term countryside elements. The habitat value of countryside elements (hereafter termed 'elements') is increasingly recognised. We quantify the relative value of four kinds of such 'elements' (linear roadside remnants, native vegetation patches, scattered trees and tree plantings) used by a threatened Australian arboreal marsupial, the squirrel glider (Petaurus norfolcensis). We examined relationships between home range size and the availability of each 'element' and whether the usage was relative to predicted levels of use. The use of 'elements' by gliders was largely explained by their availability, but there was a preference for native vegetation patches and scattered trees. We found home range size was significantly smaller with increasing area of scattered trees and a contrasting effect with increasing area of linear roadside remnants or native vegetation patches. Our work showed that each 'element' was used and as such had a role in the conservation of the squirrel glider, but their relative value varied. We illustrate the need to assess the conservation value of countryside elements so they can be incorporated into the holistic management of agricultural landscapes. This work demonstrates the disproportional value of scattered trees, underscoring the need to specifically incorporate and/or enhance the protection and recruitment of scattered trees in biodiversity conservation policy and management.

  2. Shedding light on ovothiol biosynthesis in marine metazoans

    PubMed Central

    Castellano, Immacolata; Migliaccio, Oriana; D’Aniello, Salvatore; Merlino, Antonello; Napolitano, Alessandra; Palumbo, Anna

    2016-01-01

    Ovothiol, isolated from marine invertebrate eggs, is considered one of the most powerful antioxidant with potential for drug development. However, its biological functions in marine organisms still represent a matter of debate. In sea urchins, the most accepted view is that ovothiol protects the eggs by the high oxidative burst at fertilization. In this work we address the role of ovothiol during sea urchin development to give new insights on ovothiol biosynthesis in metazoans. The gene involved in ovothiol biosynthesis OvoA was identified in Paracentrotus lividus genome (PlOvoA). PlOvoA embryo expression significantly increased at the pluteus stage and was up-regulated by metals at concentrations mimicking polluted sea-water and by cyclic toxic algal blooms, leading to ovothiol biosynthesis. In silico analyses of the PlOvoA upstream region revealed metal and stress responsive elements. Structural protein models highlighted conserved active site residues likely responsible for ovothiol biosynthesis. Phylogenetic analyses indicated that OvoA evolved in most marine metazoans and was lost in bony vertebrates during the transition from the aquatic to terrestrial environment. These results highlight the crucial role of OvoA in protecting embryos released in seawater from environmental cues, thus allowing the survival under different conditions. PMID:26916575

  3. RNA Editing and Its Molecular Mechanism in Plant Organelles

    PubMed Central

    Ichinose, Mizuho; Sugita, Mamoru

    2016-01-01

    RNA editing by cytidine (C) to uridine (U) conversions is widespread in plant mitochondria and chloroplasts. In some plant taxa, “reverse” U-to-C editing also occurs. However, to date, no instance of RNA editing has yet been reported in green algae and the complex thalloid liverworts. RNA editing may have evolved in early land plants 450 million years ago. However, in some plant species, including the liverwort, Marchantia polymorpha, editing may have been lost during evolution. Most RNA editing events can restore the evolutionarily conserved amino acid residues in mRNAs or create translation start and stop codons. Therefore, RNA editing is an essential process to maintain genetic information at the RNA level. Individual RNA editing sites are recognized by plant-specific pentatricopeptide repeat (PPR) proteins that are encoded in the nuclear genome. These PPR proteins are characterized by repeat elements that bind specifically to RNA sequences upstream of target editing sites. In flowering plants, non-PPR proteins also participate in multiple RNA editing events as auxiliary factors. C-to-U editing can be explained by cytidine deamination. The proteins discovered to date are important factors for RNA editing but a bona fide RNA editing enzyme has yet to be identified. PMID:28025543

  4. Numerical analysis of the three-dimensional swirling flow in centrifugal compressor volutes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ayder, E.; Van den Braembussche, R.

    1994-07-01

    The improvement of centrifugal compressor performance and the control of the radial forces acting on the impeller due to the circumferential variation of the static pressure caused by the volute require a good understanding of the flow mechanisms and an accurate prediction of the flow pattern inside the volute. A three-dimensional volute calculation method has been developed for this purpose. The volute is discretized by means of hexahedral elements. A cell vertex finite volume approach is used in combination with a time-marching procedure. The numerical procedure makes use of a central space discretization and a four-step Runge-Kutta time-stepping scheme. Themore » artificial dissipation used in the solver is based on the fourth-order differences of the conservative variables. Implicit residual smoothing improves the convergence rate. The loss model implemented in the code accounts for the losses due to internal shear and friction losses on the walls. A comparison of the calculated and measured results inside a volute with elliptical cross section reveals that the modified Euler solver accurately predicts the velocity and pressure distribution inside and upstream of the volute.« less

  5. Retinoid regulation of the zebrafish cyp26a1 promoter.

    PubMed

    Hu, Ping; Tian, Miao; Bao, Jie; Xing, Guangdong; Gu, Xingxing; Gao, Xiang; Linney, Elwood; Zhao, Qingshun

    2008-12-01

    Cyp26A1 is a major enzyme that controls retinoic acid (RA) homeostasis by metabolizing RA into bio-inactive metabolites. Previous research revealed that the mouse Cyp26A1 promoter has two canonical RA response elements (RAREs) that underlie the regulation of the gene by RA. Analyzing the 2,533-base pairs (2.5 k) genomic sequence upstream of zebrafish cyp26a1 start codon, we report that the two RAREs are conserved in zebrafish cyp26a1 promoter. Mutagenesis demonstrated that the two RAREs work synergistically in RA inducibility of cyp26a1. Fusing the 2.5 k (kilobase pairs) fragment to the enhanced yellow fluorescent protein (eYFP) reporter gene, we have generated two transgenic lines of zebrafish [Tg(cyp26a1:eYFP)]. The transgenic zebrafish display expression patterns similar to that of cyp26a1 gene in vivo. Consistent with the in vitro results, the reporter activity is RA inducible in embryos. Taken together, our results demonstrate that the 2.5 k fragment underlies the regulation of the zebrafish cyp26a1 gene by RA. (c) 2008 Wiley-Liss, Inc.

  6. Shedding light on ovothiol biosynthesis in marine metazoans

    NASA Astrophysics Data System (ADS)

    Castellano, Immacolata; Migliaccio, Oriana; D'Aniello, Salvatore; Merlino, Antonello; Napolitano, Alessandra; Palumbo, Anna

    2016-02-01

    Ovothiol, isolated from marine invertebrate eggs, is considered one of the most powerful antioxidant with potential for drug development. However, its biological functions in marine organisms still represent a matter of debate. In sea urchins, the most accepted view is that ovothiol protects the eggs by the high oxidative burst at fertilization. In this work we address the role of ovothiol during sea urchin development to give new insights on ovothiol biosynthesis in metazoans. The gene involved in ovothiol biosynthesis OvoA was identified in Paracentrotus lividus genome (PlOvoA). PlOvoA embryo expression significantly increased at the pluteus stage and was up-regulated by metals at concentrations mimicking polluted sea-water and by cyclic toxic algal blooms, leading to ovothiol biosynthesis. In silico analyses of the PlOvoA upstream region revealed metal and stress responsive elements. Structural protein models highlighted conserved active site residues likely responsible for ovothiol biosynthesis. Phylogenetic analyses indicated that OvoA evolved in most marine metazoans and was lost in bony vertebrates during the transition from the aquatic to terrestrial environment. These results highlight the crucial role of OvoA in protecting embryos released in seawater from environmental cues, thus allowing the survival under different conditions.

  7. A cis-regulatory sequence driving metabolic insecticide resistance in mosquitoes: functional characterisation and signatures of selection.

    PubMed

    Wilding, Craig S; Smith, Ian; Lynd, Amy; Yawson, Alexander Egyir; Weetman, David; Paine, Mark J I; Donnelly, Martin J

    2012-09-01

    Although cytochrome P450 (CYP450) enzymes are frequently up-regulated in mosquitoes resistant to insecticides, no regulatory motifs driving these expression differences with relevance to wild populations have been identified. Transposable elements (TEs) are often enriched upstream of those CYP450s involved in insecticide resistance, leading to the assumption that they contribute regulatory motifs that directly underlie the resistance phenotype. A partial CuRE1 (Culex Repetitive Element 1) transposable element is found directly upstream of CYP9M10, a cytochrome P450 implicated previously in larval resistance to permethrin in the ISOP450 strain of Culex quinquefasciatus, but is absent from the equivalent genomic region of a susceptible strain. Via expression of CYP9M10 in Escherichia coli we have now demonstrated time- and NADPH-dependant permethrin metabolism, prerequisites for confirmation of a role in metabolic resistance, and through qPCR shown that CYP9M10 is >20-fold over-expressed in ISOP450 compared to a susceptible strain. In a fluorescent reporter assay the region upstream of CYP9M10 from ISOP450 drove 10× expression compared to the equivalent region (lacking CuRE1) from the susceptible strain. Close correspondence with the gene expression fold-change implicates the upstream region including CuRE1 as a cis-regulatory element involved in resistance. Only a single CuRE1 bearing allele, identical to the CuRE1 bearing allele in the resistant strain, is found throughout Sub-Saharan Africa, in contrast to the diversity encountered in non-CuRE1 alleles. This suggests a single origin and subsequent spread due to selective advantage. CuRE1 is detectable using a simple diagnostic. When applied to C. quinquefasciatus larvae from Ghana we have demonstrated a significant association with permethrin resistance in multiple field sites (mean Odds Ratio = 3.86) suggesting this marker has relevance to natural populations of vector mosquitoes. However, when CuRE1 was excised from the allele used in the reporter assay through fusion PCR, expression was unaffected, indicating that the TE has no direct role in resistance and hence that CuRE1 is acting only as a marker of an as yet unidentified regulatory motif in the association analysis. This suggests that a re-evaluation of the assumption that TEs contribute regulatory motifs involved in gene expression may be necessary. Copyright © 2012 Elsevier Ltd. All rights reserved.

  8. Genome sequencing and comparative genomics of honey bee microsporidia, Nosema apis reveal novel insights into host-parasite interactions.

    PubMed

    Chen, Yan ping; Pettis, Jeffery S; Zhao, Yan; Liu, Xinyue; Tallon, Luke J; Sadzewicz, Lisa D; Li, Renhua; Zheng, Huoqing; Huang, Shaokang; Zhang, Xuan; Hamilton, Michele C; Pernal, Stephen F; Melathopoulos, Andony P; Yan, Xianghe; Evans, Jay D

    2013-07-05

    The microsporidia parasite Nosema contributes to the steep global decline of honey bees that are critical pollinators of food crops. There are two species of Nosema that have been found to infect honey bees, Nosema apis and N. ceranae. Genome sequencing of N. apis and comparative genome analysis with N. ceranae, a fully sequenced microsporidia species, reveal novel insights into host-parasite interactions underlying the parasite infections. We applied the whole-genome shotgun sequencing approach to sequence and assemble the genome of N. apis which has an estimated size of 8.5 Mbp. We predicted 2,771 protein- coding genes and predicted the function of each putative protein using the Gene Ontology. The comparative genomic analysis led to identification of 1,356 orthologs that are conserved between the two Nosema species and genes that are unique characteristics of the individual species, thereby providing a list of virulence factors and new genetic tools for studying host-parasite interactions. We also identified a highly abundant motif in the upstream promoter regions of N. apis genes. This motif is also conserved in N. ceranae and other microsporidia species and likely plays a role in gene regulation across the microsporidia. The availability of the N. apis genome sequence is a significant addition to the rapidly expanding body of microsprodian genomic data which has been improving our understanding of eukaryotic genome diversity and evolution in a broad sense. The predicted virulent genes and transcriptional regulatory elements are potential targets for innovative therapeutics to break down the life cycle of the parasite.

  9. Human homolog of the mouse sperm receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chamberlin, M.E.; Dean, J.

    1990-08-01

    The human zona pellucida, composed of three glycoproteins (ZP1, ZP2, and ZP3), forms an extracellular matrix that surrounds ovulated eggs and mediates species-specific fertilization. The genes that code for at least two of the zona proteins (ZP2 and ZP3) cross-hybridize with other mammalian DNA. The recently characterized mouse sperm receptor gene (Zp-3) was used to isolate its human homolog. The human homolog spans {approx}18.3 kilobase pairs (kbp) (compared to 8.6 kbp for the mouse gene) and contains eight exons, the sizes of which are strictly conserved between the two species. Four short (8-15 bp) sequences within the first 250 bpmore » of the 5{prime} flanking region in the human Zp-3 homolog are also present upstream of mouse Zp-3. These elements may modulate oocyte-specific gene expression. By using the polymerase chain reaction, a full-length cDNA of human ZP3 was isolated from human ovarian poly(A){sup +} RNA and used to deduce the structure of human ZP3 mRNA. Certain features of the human and mouse ZP3 transcripts are conserved. Both have unusually short 5{prime} and 3{prime} untranslated regions, both contain a single open reading frame that is 74% identical, and both code for 424 amino acid polypeptides that are 67% the same. The similarity between the two proteins may define domains that are important in maintaining the structural integrity of the zona pellucida, while the differences may play a role in mediating the species-specific events of mammalian fertilization.« less

  10. Biodegradation of 17β-Estradiol, Estrone and Testosterone in Stream Sediments

    NASA Astrophysics Data System (ADS)

    Bradley, P. M.; Chapelle, F. H.; Barber, L. B.; McMahon, P. B.; Gray, J. L.; Kolpin, D. W.

    2009-12-01

    The potentials for in situ biodegradation of 17β-estradiol (E2), estrone (E1), and testosterone (T) were investigated in three, hydrologically-distinct, WWTP-impacted streams in the United States. Relative differences in the mineralization of [4-14C] substrates were assessed in oxic microcosms containing sediment or water-only from locations upstream and downstream of the WWTP outfall in each system. Upstream samples provided insight into the biodegradative potential of sediment microbial communities that were not under the immediate impact of WWTP effluent. Upstream sediment from all three systems demonstrated significant mineralization of the “A” ring of E2, E1 and T, with the potential of T biodegradation consistently greater than of E2 and no systematic difference in the potentials of E2 and E1. Downstream samples provided insight into the impacts of effluent on reproductive hormone biodegradation. Significant “A” ring mineralization was also observed in downstream sediment, with the potentials for E1 and T mineralization being substantially depressed relative to upstream samples. In marked contrast, the potentials for E2 mineralization immediately downstream of the WWTP outfalls were more than double that of upstream samples. E2 mineralization was also observed in water, albeit at insufficient rate to prevent substantial downstream transport in the water column. The results of this study indicate that, in combination with sediment sorption processes which effectively scavenge hydrophobic contaminants from the water column and immobilize them in the vicinity of the WWTP outfall, aerobic biodegradation of reproductive hormones can be an environmentally important mechanism for non-conservative (destructive) attenuation of hormonal endocrine disruptors in effluent-impacted streams.

  11. Transcriptional Regulation in Ebola Virus: Effects of Gene Border Structure and Regulatory Elements on Gene Expression and Polymerase Scanning Behavior

    PubMed Central

    Brauburger, Kristina; Boehmann, Yannik; Krähling, Verena

    2015-01-01

    ABSTRACT The highly pathogenic Ebola virus (EBOV) has a nonsegmented negative-strand (NNS) RNA genome containing seven genes. The viral genes either are separated by intergenic regions (IRs) of variable length or overlap. The structure of the EBOV gene overlaps is conserved throughout all filovirus genomes and is distinct from that of the overlaps found in other NNS RNA viruses. Here, we analyzed how diverse gene borders and noncoding regions surrounding the gene borders influence transcript levels and govern polymerase behavior during viral transcription. Transcription of overlapping genes in EBOV bicistronic minigenomes followed the stop-start mechanism, similar to that followed by IR-containing gene borders. When the gene overlaps were extended, the EBOV polymerase was able to scan the template in an upstream direction. This polymerase feature seems to be generally conserved among NNS RNA virus polymerases. Analysis of IR-containing gene borders showed that the IR sequence plays only a minor role in transcription regulation. Changes in IR length were generally well tolerated, but specific IR lengths led to a strong decrease in downstream gene expression. Correlation analysis revealed that these effects were largely independent of the surrounding gene borders. Each EBOV gene contains exceptionally long untranslated regions (UTRs) flanking the open reading frame. Our data suggest that the UTRs adjacent to the gene borders are the main regulators of transcript levels. A highly complex interplay between the different cis-acting elements to modulate transcription was revealed for specific combinations of IRs and UTRs, emphasizing the importance of the noncoding regions in EBOV gene expression control. IMPORTANCE Our data extend those from previous analyses investigating the implication of noncoding regions at the EBOV gene borders for gene expression control. We show that EBOV transcription is regulated in a highly complex yet not easily predictable manner by a set of interacting cis-active elements. These findings are important not only for the design of recombinant filoviruses but also for the design of other replicon systems widely used as surrogate systems to study the filovirus replication cycle under low biosafety levels. Insights into the complex regulation of EBOV transcription conveyed by noncoding sequences will also help to interpret the importance of mutations that have been detected within these regions, including in isolates of the current outbreak. PMID:26656691

  12. Transcriptional Regulation in Ebola Virus: Effects of Gene Border Structure and Regulatory Elements on Gene Expression and Polymerase Scanning Behavior.

    PubMed

    Brauburger, Kristina; Boehmann, Yannik; Krähling, Verena; Mühlberger, Elke

    2016-02-15

    The highly pathogenic Ebola virus (EBOV) has a nonsegmented negative-strand (NNS) RNA genome containing seven genes. The viral genes either are separated by intergenic regions (IRs) of variable length or overlap. The structure of the EBOV gene overlaps is conserved throughout all filovirus genomes and is distinct from that of the overlaps found in other NNS RNA viruses. Here, we analyzed how diverse gene borders and noncoding regions surrounding the gene borders influence transcript levels and govern polymerase behavior during viral transcription. Transcription of overlapping genes in EBOV bicistronic minigenomes followed the stop-start mechanism, similar to that followed by IR-containing gene borders. When the gene overlaps were extended, the EBOV polymerase was able to scan the template in an upstream direction. This polymerase feature seems to be generally conserved among NNS RNA virus polymerases. Analysis of IR-containing gene borders showed that the IR sequence plays only a minor role in transcription regulation. Changes in IR length were generally well tolerated, but specific IR lengths led to a strong decrease in downstream gene expression. Correlation analysis revealed that these effects were largely independent of the surrounding gene borders. Each EBOV gene contains exceptionally long untranslated regions (UTRs) flanking the open reading frame. Our data suggest that the UTRs adjacent to the gene borders are the main regulators of transcript levels. A highly complex interplay between the different cis-acting elements to modulate transcription was revealed for specific combinations of IRs and UTRs, emphasizing the importance of the noncoding regions in EBOV gene expression control. Our data extend those from previous analyses investigating the implication of noncoding regions at the EBOV gene borders for gene expression control. We show that EBOV transcription is regulated in a highly complex yet not easily predictable manner by a set of interacting cis-active elements. These findings are important not only for the design of recombinant filoviruses but also for the design of other replicon systems widely used as surrogate systems to study the filovirus replication cycle under low biosafety levels. Insights into the complex regulation of EBOV transcription conveyed by noncoding sequences will also help to interpret the importance of mutations that have been detected within these regions, including in isolates of the current outbreak. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  13. The Enhancer of split complex arose prior to the diversification of schizophoran flies and is strongly conserved between Drosophila and stalk-eyed flies (Diopsidae)

    PubMed Central

    2011-01-01

    Background In Drosophila, the Enhancer of split complex (E(spl)-C) comprises 11 bHLH and Bearded genes that function during Notch signaling to repress proneural identity in the developing peripheral nervous system. Comparison with other insects indicates that the basal state for Diptera is a single bHLH and Bearded homolog and that the expansion of the gene complex occurred in the lineage leading to Drosophila. However, comparative genomic data from other fly species that would elucidate the origin and sequence of gene duplication for the complex is lacking. Therefore, in order to examine the evolutionary history of the complex within Diptera, we reconstructed, using several fosmid clones, the entire E(spl)-complex in the stalk-eyed fly, Teleopsis dalmanni and collected additional homologs of E(spl)-C genes from searches of dipteran EST databases and the Glossina morsitans genome assembly. Results Comparison of the Teleopsis E(spl)-C gene organization with Drosophila indicates complete conservation in gene number and orientation between the species except that T. dalmanni contains a duplicated copy of E(spl)m5 that is not present in Drosophila. Phylogenetic analysis of E(spl)-complex bHLH and Bearded genes for several dipteran species clearly demonstrates that all members of the complex were present prior to the diversification of schizophoran flies. Comparison of upstream regulatory elements and 3' UTR domains between the species also reveals strong conservation for many of the genes and identifies several novel characteristics of E(spl)-C regulatory evolution including the discovery of a previously unidentified, highly conserved SPS+A domain between E(spl)mγ and E(spl)mβ. Conclusion Identifying the phylogenetic origin of E(spl)-C genes and their associated regulatory DNA is essential to understanding the functional significance of this well-studied gene complex. Results from this study provide numerous insights into the evolutionary history of the complex and will help refine the focus of studies examining the adaptive consequences of this gene expansion. PMID:22151427

  14. Sediment-quality assessment of Franklin D. Roosevelt Lake and the upstream reach of the Columbia River, Washington, 1992

    USGS Publications Warehouse

    Bortleson, Gilbert Carl; Cox, S.E.; Munn, M.D.; Schumaker, R.J.; Block, E.K.

    2001-01-01

    Elevated concentrations of trace elements were found in bed sediment of Lake Roosevelt and the Columbia River, its principal source of inflow. Trace-element concentrations in whole water samples did not exceed criteria for freshwater organisms. Bed sediments of Lake Roosevelt were analyzed for organic compounds associated with wood-pulp waste. Dioxins and furans were found in suspended sediment and water of the Columbia River. Abundance and diversity of benthic invertebrate communities were analyzed.

  15. Translation of the first upstream ORF in the hepatitis B virus pregenomic RNA modulates translation at the core and polymerase initiation codons

    PubMed Central

    Chen, Augustine; Kao, Y. F.; Brown, Chris M.

    2005-01-01

    The human hepatitis B virus (HBV) has a compact genome encoding four major overlapping coding regions: the core, polymerase, surface and X. The polymerase initiation codon is preceded by the partially overlapping core and four or more upstream initiation codons. There is evidence that several mechanisms are used to enable the synthesis of the polymerase protein, including leaky scanning and ribosome reinitiation. We have examined the first AUG in the pregenomic RNA, it precedes that of the core. It initiates an uncharacterized short upstream open reading frame (uORF), highly conserved in all HBV subtypes, we designated the C0 ORF. This arrangement suggested that expression of the core and polymerase may be affected by this uORF. Initiation at the C0 ORF was confirmed in reporter constructs in transfected cells. The C0 ORF had an inhibitory role in downstream expression from the core initiation site in HepG2 cells and in vitro, but also stimulated reinitiation at the polymerase start when in an optimal context. Our results indicate that the C0 ORF is a determinant in balancing the synthesis of the core and polymerase proteins. PMID:15731337

  16. A locally conservative stabilized continuous Galerkin finite element method for two-phase flow in poroelastic subsurfaces

    NASA Astrophysics Data System (ADS)

    Deng, Q.; Ginting, V.; McCaskill, B.; Torsu, P.

    2017-10-01

    We study the application of a stabilized continuous Galerkin finite element method (CGFEM) in the simulation of multiphase flow in poroelastic subsurfaces. The system involves a nonlinear coupling between the fluid pressure, subsurface's deformation, and the fluid phase saturation, and as such, we represent this coupling through an iterative procedure. Spatial discretization of the poroelastic system employs the standard linear finite element in combination with a numerical diffusion term to maintain stability of the algebraic system. Furthermore, direct calculation of the normal velocities from pressure and deformation does not entail a locally conservative field. To alleviate this drawback, we propose an element based post-processing technique through which local conservation can be established. The performance of the method is validated through several examples illustrating the convergence of the method, the effectivity of the stabilization term, and the ability to achieve locally conservative normal velocities. Finally, the efficacy of the method is demonstrated through simulations of realistic multiphase flow in poroelastic subsurfaces.

  17. GEMPIC: geometric electromagnetic particle-in-cell methods

    NASA Astrophysics Data System (ADS)

    Kraus, Michael; Kormann, Katharina; Morrison, Philip J.; Sonnendrücker, Eric

    2017-08-01

    We present a novel framework for finite element particle-in-cell methods based on the discretization of the underlying Hamiltonian structure of the Vlasov-Maxwell system. We derive a semi-discrete Poisson bracket, which retains the defining properties of a bracket, anti-symmetry and the Jacobi identity, as well as conservation of its Casimir invariants, implying that the semi-discrete system is still a Hamiltonian system. In order to obtain a fully discrete Poisson integrator, the semi-discrete bracket is used in conjunction with Hamiltonian splitting methods for integration in time. Techniques from finite element exterior calculus ensure conservation of the divergence of the magnetic field and Gauss' law as well as stability of the field solver. The resulting methods are gauge invariant, feature exact charge conservation and show excellent long-time energy and momentum behaviour. Due to the generality of our framework, these conservation properties are guaranteed independently of a particular choice of the finite element basis, as long as the corresponding finite element spaces satisfy certain compatibility conditions.

  18. An upwind space-time conservation element and solution element scheme for solving dusty gas flow model

    NASA Astrophysics Data System (ADS)

    Rehman, Asad; Ali, Ishtiaq; Qamar, Shamsul

    An upwind space-time conservation element and solution element (CE/SE) scheme is extended to numerically approximate the dusty gas flow model. Unlike central CE/SE schemes, the current method uses the upwind procedure to derive the numerical fluxes through the inner boundary of conservation elements. These upwind fluxes are utilized to calculate the gradients of flow variables. For comparison and validation, the central upwind scheme is also applied to solve the same dusty gas flow model. The suggested upwind CE/SE scheme resolves the contact discontinuities more effectively and preserves the positivity of flow variables in low density flows. Several case studies are considered and the results of upwind CE/SE are compared with the solutions of central upwind scheme. The numerical results show better performance of the upwind CE/SE method as compared to the central upwind scheme.

  19. QTL Mapping of Sex Determination Loci Supports an Ancient Pathway in Ants and Honey Bees.

    PubMed

    Miyakawa, Misato O; Mikheyev, Alexander S

    2015-11-01

    Sex determination mechanisms play a central role in life-history characteristics, affecting mating systems, sex ratios, inbreeding tolerance, etc. Downstream components of sex determination pathways are highly conserved, but upstream components evolve rapidly. Evolutionary dynamics of sex determination remain poorly understood, particularly because mechanisms appear so diverse. Here we investigate the origins and evolution of complementary sex determination (CSD) in ants and bees. The honey bee has a well-characterized CSD locus, containing tandemly arranged homologs of the transformer gene [complementary sex determiner (csd) and feminizer (fem)]. Such tandem paralogs appear frequently in aculeate hymenopteran genomes. However, only comparative genomic, but not functional, data support a broader role for csd/fem in sex determination, and whether species other than the honey bee use this pathway remains controversial. Here we used a backcross to test whether csd/fem acts as a CSD locus in an ant (Vollenhovia emeryi). After sequencing and assembling the genome, we computed a linkage map, and conducted a quantitative trait locus (QTL) analysis of diploid male production using 68 diploid males and 171 workers. We found two QTLs on separate linkage groups (CsdQTL1 and CsdQTL2) that jointly explained 98.0% of the phenotypic variance. CsdQTL1 included two tandem transformer homologs. These data support the prediction that the same CSD mechanism has indeed been conserved for over 100 million years. CsdQTL2 had no similarity to CsdQTL1 and included a 236-kb region with no obvious CSD gene candidates, making it impossible to conclusively characterize it using our data. The sequence of this locus was conserved in at least one other ant genome that diverged >75 million years ago. By applying QTL analysis to ants for the first time, we support the hypothesis that elements of hymenopteran CSD are ancient, but also show that more remains to be learned about the diversity of CSD mechanisms.

  20. Discrete conservation properties for shallow water flows using mixed mimetic spectral elements

    NASA Astrophysics Data System (ADS)

    Lee, D.; Palha, A.; Gerritsma, M.

    2018-03-01

    A mixed mimetic spectral element method is applied to solve the rotating shallow water equations. The mixed method uses the recently developed spectral element histopolation functions, which exactly satisfy the fundamental theorem of calculus with respect to the standard Lagrange basis functions in one dimension. These are used to construct tensor product solution spaces which satisfy the generalized Stokes theorem, as well as the annihilation of the gradient operator by the curl and the curl by the divergence. This allows for the exact conservation of first order moments (mass, vorticity), as well as higher moments (energy, potential enstrophy), subject to the truncation error of the time stepping scheme. The continuity equation is solved in the strong form, such that mass conservation holds point wise, while the momentum equation is solved in the weak form such that vorticity is globally conserved. While mass, vorticity and energy conservation hold for any quadrature rule, potential enstrophy conservation is dependent on exact spatial integration. The method possesses a weak form statement of geostrophic balance due to the compatible nature of the solution spaces and arbitrarily high order spatial error convergence.

  1. Risk assessment of imidacloprid use in forest settings on the aquatic macroinvertebrate community.

    PubMed

    Benton, Elizabeth P; Grant, Jerome F; Nichols, Rebecca J; Webster, R Jesse; Schwartz, John S; Bailey, Joseph K

    2017-11-01

    The isolated effects of a single insecticide can be difficult to assess in natural settings because of the presence of numerous pollutants in many watersheds. Imidacloprid use for suppressing hemlock woolly adelgid, Adelges tsugae (Annand) (Hemiptera: Adelgidae), in forests offers a rare opportunity to assess potential impacts on aquatic macroinvertebrates in relatively pristine landscapes. Aquatic macroinvertebrate communities were assessed in 9 streams in Great Smoky Mountains National Park (southern Appalachian Mountains, USA). The streams flow through hemlock conservation areas where imidacloprid soil drench treatments were applied for hemlock woolly adelgid suppression. Sites were located upstream and downstream of the imidacloprid treatments. Baseline species presence data (pre-imidacloprid treatment) were available from previous sample collections at downstream sites. Downstream and upstream sites did not vary in numerous community measures. Although comparisons of paired upstream and downstream sites showed differences in diversity in 7 streams, higher diversity was found more often in downstream sites. Macroinvertebrate functional feeding groups and life habits were similar between downstream and upstream sites. Downstream and baseline stream samples were similar. While some functional feeding group and life habit species richness categories varied, variations did not indicate poorer quality downstream communities. Imidacloprid treatments applied according to US Environmental Protection Agency federal restrictions did not result in negative effects to aquatic macroinvertebrate communities, which indicates that risks of imidacloprid use in forest settings are low. Environ Toxicol Chem 2017;36:3108-3119. © 2017 SETAC. © 2017 SETAC.

  2. On the role of acoustic feedback in boundary-layer instability.

    PubMed

    Wu, Xuesong

    2014-07-28

    In this paper, the classical triple-deck formalism is employed to investigate two instability problems in which an acoustic feedback loop plays an essential role. The first concerns a subsonic boundary layer over a flat plate on which two well-separated roughness elements are present. A spatially amplifying Tollmien-Schlichting (T-S) wave between the roughness elements is scattered by the downstream roughness to emit a sound wave that propagates upstream and impinges on the upstream roughness to regenerate the T-S wave, thereby forming a closed feedback loop in the streamwise direction. Numerical calculations suggest that, at high Reynolds numbers and for moderate roughness heights, the long-range acoustic coupling may lead to absolute instability, which is characterized by self-sustained oscillations at discrete frequencies. The dominant peak frequency may jump from one value to another as the Reynolds number, or the distance between the roughness elements, is varied gradually. The second problem concerns the supersonic 'twin boundary layers' that develop along two well-separated parallel flat plates. The two boundary layers are in mutual interaction through the impinging and reflected acoustic waves. It is found that the interaction leads to a new instability that is absent in the unconfined boundary layer. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

  3. Characterization of calcineurin-dependent response element binding protein and its involvement in copper-metallothionein gene expression in Neurospora

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kumar, Kalari Satish; Ravi Kumar, B.; Siddavattam, Dayananda

    2006-07-07

    In continuation of our recent observations indicating the presence of a lone calcineurin-dependent response element (CDRE) in the -3730 bp upstream region of copper-induced metallothionein (CuMT) gene of Neurospora [K.S. Kumar, S. Dayananda, C. Subramanyam, Copper alone, but not oxidative stress, induces copper-metallothionein gene in Neurospora crassa, FEMS Microbiol. Lett. 242 (2005) 45-50], we isolated and characterized the CDRE-binding protein. The cloned upstream region of CuMT gene was used as the template to specifically amplify CDRE element, which was immobilized on CNBr-activated Sepharose 4B for use as the affinity matrix to purify the CDRE binding protein from nuclear extracts obtainedmore » from Neurospora cultures grown in presence of copper. Two-dimensional gel electrophoresis of the affinity purified protein revealed the presence of a single 17 kDa protein, which was identified and characterized by MALDI-TOF. Peptide mass finger printing of tryptic digests and analysis of the 17 kDa protein matched with the regulatory {beta}-subunit of calcineurin (Ca{sup 2+}-calmodulin dependent protein phosphatase). Parallel identification of nuclear localization signals in this protein by in silico analysis suggests a putative role for calcineurin in the regulation of CuMT gene expression.« less

  4. The membrane-tethered transcription factor ANAC089 serves as redox-dependent suppressor of stromal ascorbate peroxidase gene expression

    PubMed Central

    Klein, Peter; Seidel, Thorsten; Stöcker, Benedikt; Dietz, Karl-Josef

    2012-01-01

    The stromal ascorbate peroxidase (sAPX) functions as central element of the chloroplast antioxidant defense system. Its expression is under retrograde control of chloroplast signals including redox- and reactive oxygen species-linked cues. The sAPX promoter of Arabidopsis thaliana was dissected in transient reporter assays using mesophyll protoplasts. The study revealed regulatory elements up to –1868 upstream of the start codon. By yeast-one-hybrid screening, the transcription factor ANAC089 was identified to bind to the promoter fragment 2 (–1262 to –1646 bp upstream of translational initiation). Upon mutation of the cis-acting element CACG, binding of ANAC089 was abolished. Expression of a fused fluorescent protein version and comparison with known endomembrane markers localized ANAC089 to the trans-Golgi network and the ER. The transcription factor was released upon treatment with reducing agents and targeted to the nucleus. Transactivation assays using wild type and mutated versions of the promoter showed a partial suppression of reporter expression. The data indicate that ANAC089 functions in a negative retrograde loop, lowering sAPX expression if the cell encounters a highly reducing condition. This conclusion was supported by reciprocal transcript accumulation of ANAC089 and sAPX during acclimation to low, normal, and high light conditions. PMID:23162559

  5. A nuclear factor I-like activity and a liver-specific repressor govern estrogen-regulated in vitro transcription from the Xenopus laevis vitellogenin B1 promoter.

    PubMed

    Corthésy, B; Cardinaux, J R; Claret, F X; Wahli, W

    1989-12-01

    A hormone-controlled in vitro transcription system derived from Xenopus liver nuclear extracts was exploited to identify novel cis-acting elements within the vitellogenin gene B1 promoter region. In addition to the already well-documented estrogen-responsive element (ERE), two elements were found within the 140 base pairs upstream of the transcription initiation site. One of them, a negative regulatory element, is responsible for the lack of promoter activity in the absence of the hormone and, as demonstrated by DNA-binding assays, interacts with a liver-specific transcription factor. The second is required in association with the estrogen-responsive element to mediate hormonal induction and is recognized by the Xenopus liver homolog of nuclear factor I.

  6. Identification and positional distribution analysis of transcription factor binding sites for genes from the wheat fl-cDNA sequences.

    PubMed

    Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui

    2017-06-01

    The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.

  7. Diel behavior of rare earth elements in a mountain stream with acidic to neutral pH

    USGS Publications Warehouse

    Gammons, C.H.; Wood, S.A.; Nimick, D.A.

    2005-01-01

    Diel (24-h) changes in concentrations of rare earth elements (REE) were investigated in Fisher Creek, a mountain stream in Montana that receives acid mine drainage in its headwaters. Three simultaneous 24-h samplings were conducted at an upstream station (pH = 3.3), an intermediate station (pH = 5.5), and a downstream station (pH = 6.8). The REE were found to behave conservatively at the two upstream stations. At the downstream station, REE partitioned into suspended particles to a degree that varied with the time of day, and concentrations of dissolved REE were 2.9- to 9.4-fold (190% to 830%) higher in the early morning vs. the late afternoon. The decrease in dissolved REE concentrations during the day coincided with a corresponding increase in the concentration of REE in suspended particles, such that diel changes in the total REE concentrations were relatively minor (27% to 55% increase at night). Across the lanthanide series, the heavy REE partitioned into the suspended solid phase to a greater extent than the light REE. Filtered samples from the downstream station showed a decrease in shale-normalized REE concentration across the lanthanide series, with positive anomalies at La and Gd, and a negative Eu anomaly. As the temperature of the creek increased in the afternoon, the slope of the REE profile steepened and the magnitude of the anomalies increased. The above observations are explained by cyclic adsorption of REE onto suspended particles of hydrous ferric and aluminum oxides (HFO, HAO). Conditional partition coefficients for each REE between the suspended solids and the aqueous phase reached a maximum at 1700 hours and a minimum at 0700 hours. This pattern is attributed to diel variations in stream temperature, possibly reinforced by kinetic factors (i.e., slower rates of reaction at night than during the day). Estimates of the enthalpy of adsorption of each REE onto suspended particles based on the field results averaged +82 kJ/mol and are similar in magnitude to estimates in the literature for adsorption of divalent metal cations onto clays and hydrous metal oxides. The results of this study have important implications to the use of REE as hydrogeochemical tracers in streams. Copyright ?? 2005 Elsevier Ltd.

  8. Molecular architecture of the hsp70 promoter after deletion of the TATA box or the upstream regulation region.

    PubMed Central

    Weber, J A; Taxman, D J; Lu, Q; Gilmour, D S

    1997-01-01

    GAGA factor, TFIID, and paused polymerase are present on the hsp70 promoter in Drosophila melanogaster prior to transcriptional activation. In order to investigate the interplay between these components, mutant constructs were analyzed after they had been transformed into flies on P elements. One construct lacked the TATA box and the other lacked the upstream regulatory region where GAGA factor binds. Transcription of each mutant during heat shock was at least 50-fold less than that of a normal promoter construct. Before and after heat shock, both mutant promoters were found to adopt a DNase I hypersensitive state that included the region downstream from the transcription start site. High-resolution analysis of the DNase I cutting pattern identified proteins that could be contributing to the hypersensitivity. GAGA factor footprints were clearly evident in the upstream region of the TATA deletion construct, and a partial footprint possibly caused by TFIID was evident on the TATA box of the upstream deletion construct. Permanganate treatment of intact salivary glands was used to further characterize each promoter construct. Paused polymerase and TFIID were readily detected on the normal promoter construct, whereas both deletions exhibited reduced levels of each of these factors. Hence both the TATA box and the upstream region are required to efficiently recruit TFIID and a paused polymerase to the promoter prior to transcriptional activation. In contrast, GAGA factor appears to be capable of binding and establishing a DNase I hypersensitive region in the absence of TFIID and polymerase. Interestingly, purified GAGA factor was found to bind near the transcription start site, and the strength of this interaction was increased by the presence of the upstream region. GAGA factor alone might be capable of establishing an open chromatin structure that encompasses the upstream regulatory region as well as the core promoter region, thus facilitating the binding of TFIID. PMID:9199313

  9. Numerical Investigation of a Model Scramjet Combustor Using DDES

    NASA Astrophysics Data System (ADS)

    Shin, Junsu; Sung, Hong-Gye

    2017-04-01

    Non-reactive flows moving through a model scramjet were investigated using a delayed detached eddy simulation (DDES), which is a hybrid scheme combining Reynolds averaged Navier-Stokes scheme and a large eddy simulation. The three dimensional Navier-Stokes equations were solved numerically on a structural grid using finite volume methods. An in-house was developed. This code used a monotonic upstream-centered scheme for conservation laws (MUSCL) with an advection upstream splitting method by pressure weight function (AUSMPW+) for space. In addition, a 4th order Runge-Kutta scheme was used with preconditioning for time integration. The geometries and boundary conditions of a scramjet combustor operated by DLR, a German aerospace center, were considered. The profiles of the lower wall pressure and axial velocity obtained from a time-averaged solution were compared with experimental results. Also, the mixing efficiency and total pressure recovery factor were provided in order to inspect the performance of the combustor.

  10. Conservation of Transcription Start Sites within Genes across a Bacterial Genus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shao, Wenjun; Price, Morgan N.; Deutschbauer, Adam M.

    Transcription start sites (TSSs) lying inside annotated genes, on the same or opposite strand, have been observed in diverse bacteria, but the function of these unexpected transcripts is unclear. Here, we use the metal-reducing bacterium Shewanella oneidensis MR-1 and its relatives to study the evolutionary conservation of unexpected TSSs. Using high-resolution tiling microarrays and 5'-end RNA sequencing, we identified 2,531 TSSs in S. oneidensis MR-1, of which 18% were located inside coding sequences (CDSs). Comparative transcriptome analysis with seven additional Shewanella species revealed that the majority (76%) of the TSSs within the upstream regions of annotated genes (gTSSs) were conserved.more » Thirty percent of the TSSs that were inside genes and on the sense strand (iTSSs) were also conserved. Sequence analysis around these iTSSs showed conserved promoter motifs, suggesting that many iTSS are under purifying selection. Furthermore, conserved iTSSs are enriched for regulatory motifs, suggesting that they are regulated, and they tend to eliminate polar effects, which confirms that they are functional. In contrast, the transcription of antisense TSSs located inside CDSs (aTSSs) was significantly less likely to be conserved (22%). However, aTSSs whose transcription was conserved often have conserved promoter motifs and drive the expression of nearby genes. Overall, our findings demonstrate that some internal TSSs are conserved and drive protein expression despite their unusual locations, but the majority are not conserved and may reflect noisy initiation of transcription rather than a biological function.« less

  11. Zebrafish U6 small nuclear RNA gene promoters contain a SPH element in an unusual location.

    PubMed

    Halbig, Kari M; Lekven, Arne C; Kunkel, Gary R

    2008-09-15

    Promoters for vertebrate small nuclear RNA (snRNA) genes contain a relatively simple array of transcriptional control elements, divided into proximal and distal regions. Most of these genes are transcribed by RNA polymerase II (e.g., U1, U2), whereas the U6 gene is transcribed by RNA polymerase III. Previously identified vertebrate U6 snRNA gene promoters consist of a proximal sequence element (PSE) and TATA element in the proximal region, plus a distal region with octamer (OCT) and SphI postoctamer homology (SPH) elements. We have found that zebrafish U6 snRNA promoters contain the SPH element in a novel proximal position immediately upstream of the TATA element. The zebrafish SPH element is recognized by SPH-binding factor/selenocysteine tRNA gene transcription activating factor/zinc finger protein 143 (SBF/Staf/ZNF143) in vitro. Furthermore, a zebrafish U6 promoter with a defective SPH element is inefficiently transcribed when injected into embryos.

  12. Nutrient elements in large Chinese estuaries

    NASA Astrophysics Data System (ADS)

    Zhang, Jing

    1996-07-01

    Based on comprehensive observations since 1983, this study summarizes major features of nutrient elements (nitrogen, phosphorus and silicon) in large Chinese river/estuary systems. Elevated nutrient element levels were observed in Chinese rivers, when compared to large and less disturbed aquatic systems (e.g. the Amazon, Zaire and Orinoco). Data from this study are similar to those obtained from the polluted and/or eutrophic rivers in Europe and North America (e.g. the Rhóne and Loire). Nutrient elements may have either conservative or active distributions, or both, in the mixing zone, depending on the element and the estuary. For example, non-conservative behaviors were observed in the upper estuary, where nutrient elements may be remobilized due to the strong desorption and variations of the fresh water end-member, but conservative distributions were found afterwards in the lower estuary. Outside the riverine effluent plumes, nutrient elements may be depleted in surface waters relative to elevated bioproduction, whereas the regeneration with respect to decomposition of organic material and/or nitrification/denitrification offshore, may sustain high levels of nutrient elements in near-bottom waters. Laboratory experiment data generally compares well with field observations. The high fluxes and area] yields of nutrient elements from large Chinese rivers, indicate the extensive use of chemical fertilizers and domestic waste drainage over watersheds in China.

  13. A boundary element method for Stokes flows with interfaces

    NASA Astrophysics Data System (ADS)

    Alinovi, Edoardo; Bottaro, Alessandro

    2018-03-01

    The boundary element method is a widely used and powerful technique to numerically describe multiphase flows with interfaces, satisfying Stokes' approximation. However, low viscosity ratios between immiscible fluids in contact at an interface and large surface tensions may lead to consistency issues as far as mass conservation is concerned. A simple and effective approach is described to ensure mass conservation at all viscosity ratios and capillary numbers within a standard boundary element framework. Benchmark cases are initially considered demonstrating the efficacy of the proposed technique in satisfying mass conservation, comparing with approaches and other solutions present in the literature. The methodology developed is finally applied to the problem of slippage over superhydrophobic surfaces.

  14. DNA sequence analysis of ARS elements from chromosome III of Saccharomyces cerevisiae: identification of a new conserved sequence.

    PubMed Central

    Palzkill, T G; Oliver, S G; Newlon, C S

    1986-01-01

    Four fragments of Saccharomyces cerevisiae chromosome III DNA which carry ARS elements have been sequenced. Each fragment contains multiple copies of sequences that have at least 10 out of 11 bases of homology to a previously reported 11 bp core consensus sequence. A survey of these new ARS sequences and previously reported sequences revealed the presence of an additional 11 bp conserved element located on the 3' side of the T-rich strand of the core consensus. Subcloning analysis as well as deletion and transposon insertion mutagenesis of ARS fragments support a role for 3' conserved sequence in promoting ARS activity. PMID:3529036

  15. BEHAVIOR OF ARSENIC AND OTHER REDOX-SENSITIVE ELEMENTS IN CROWLEY LAKE, CA: A RESERVOIR IN THE LOS ANGELES AQUEDUCT SYSTEM. (R826202)

    EPA Science Inventory

    Elevated arsenic concentrations in Crowley Lake derive from upstream geothermal inputs. We examined the water column of Crowley Lake under stratified and unstratified conditions, seeking evidence for algal uptake and transformation of arsenic and its deposition to and release fro...

  16. The human luteinizing hormone receptor gene promoter: activation by Sp1 and Sp3 and inhibitory regulation.

    PubMed

    Geng, Y; Tsai-Morris, C H; Zhang, Y; Dufau, M L

    1999-09-24

    To understand the transcriptional mechanism(s) of human LH receptor (LHR) gene expression, we have identified the dominant functional cis-elements that regulate the activity of the promoter domain (-1 to -176 bp from ATG). Mutagenesis demonstrated that the promoter activity was dependent on two Sp1 domains (-79 bp, -120 bp) in a transformed normal placental cell (PLC) and the choriocarcinoma JAR cell. Both elements interacted with endogenous Sp1 and Sp3 factors but not with Sp2 or Sp4. In Drosophila SL2 cells, the promoter was activated by either Sp1 or Sp3. An ERE half-site (EREhs) at -174 bp was inhibitory (by 100%), but was unresponsive to estradiol and did not bind the estrogen receptor or orphan receptors ERR1 and SF-1. The 5' upstream sequence (-177 to -2056 bp) inhibited promoter activity in PLC by 60%, but only minimally in JAR cells. Activation of the human LHR promoter through Sp1/3 factors is negatively regulated through EREhs and upstream sequences to exert control of gene expression. Copyright 1999 Academic Press.

  17. Hydrology and water-quality characteristics of Muddy Creek and Wolford Mountain Reservoir near Kremmling, Colorado, 1990 through 2001

    USGS Publications Warehouse

    Stevens, Michael R.; Sprague, Lori A.

    2003-01-01

    A water-quality monitoring program was begun in March 1985 on Muddy Creek in anticipation of the construction of a reservoir water-storage project. Wolford Mountain Reservoir was constructed by the Colorado River Water Conservation District during 1992-94. The reservoir began to be filled in 1995. Water quality generally was good in Muddy Creek and Wolford Mountain Reservoir throughout the period of record (collectively, 1990 through 2001), with low concentrations of nutrients (median total nitrogen less than 0.6 and median total phosphorus less than 0.05 milligrams per liter) and trace elements (median dissolved copper less than 2, median dissolved lead less than 1, and median dissolved zinc less than 20 micrograms per liter). Specific conductance ranged from 99 to 1,720 microsiemens per centimeter. Cation compositions at Muddy Creek sites were mixed calcium-magnesium-sodium. Anion compositions were primarily bicarbonate and sulfate. Suspended-sediment concentrations ranged from less than 50 milligrams per liter during low-flow periods to hundreds of milligrams per liter during snowmelt. Turbidity in prereservoir Muddy Creek generally was measured at less than 10 nephelometric turbidity units during low-flow periods and ranged to more than 360 nephelometric turbidity units during snowmelt. Compared to prereservoir conditions, turbidity in Muddy Creek downstream from the reservoir was substantially reduced because the reservoir acted as a sediment trap. During most years, peak flows were slightly reduced by the reservoir or similar to peaks upstream from the reservoir. The upper first to fifteenth percentiles of flows were decreased by operation of the reservoir compared to prereservoir flows. Generally, the fifteenth to one-hundredth percentiles of flow were increased by operation of the reservoir outflow compared to prereservoir flows. Nutrient transport in the inflow is proportional to the amount of inflow-water discharge in a given year. Some nitrogen was stored in the water column and gain/loss patterns for total nitrogen were somewhat related to reservoir storage. Nitrogen tended to move through the reservoir, whereas phosphorus was mostly trapped within the reservoir in bottom sediments. The reservoir gained phosphorus every year (1996- 2001) and, as a percentage, more phosphorus was retained than nitrogen in years when both were retained in the reservoir due to stronger phosphorus tendencies for adsorption, coprecipitation, and settling. Only small amounts of phosphorus were available in the water column at the outflow, and reservoir water-column storage did not influence phosphorus outflowloading patterns as much as settling further upstream in the reservoir. From 1990 to 2001, upstream from the reservoir, concentrations and values of dissolved solids, turbidity, some major ions, and dissolved iron increased (p-value less than 0.10), and acid-neutralizing capacity decreased. From 1990 to 2001, there were no significant (p-value less than 0.10) trends in nutrient concentrations upstream from the reservoir. From 1990 to 2001, downstream from the reservoir, trends in concentrations and values of dissolved solids, turbidity, major ions, total ammonia plus organic nitrogen, dissolved and total-recoverable iron, and total-recoverable manganese were downward. Upstream and downstream water-quality constituents for the prereservoir (1990 to 1995) period were compared. Concentrations and values of dissolved solids, major ions, turbidity, and manganese were greater (p-value less than 0.10) at the downstream site. From 1995 to 2001 (postconstruction), upstream and downstream water-quality constituents also were compared. Concentrations of specific conductance and major ions increased at the downstream site when compared to the upstream site (p-value less than 0.10), except for acid-neutralizing capacity and silica, which decreased. Turbidity, concentrations of total-recoverable and dissolved manganese, and

  18. SPECIAL ISSUE ON OPTICAL PROCESSING OF INFORMATION: Reversible logic elements as a new field of application of optical solitons

    NASA Astrophysics Data System (ADS)

    Maimistov, Andrei I.

    1995-10-01

    An analysis is made of the fundamental concepts of conservative logic. It is shown that the existing optical soliton switches can be converted into logic gates which act as conservative logic elements. A logic device of this type, based on a nonlinear fibre-optic directional coupler, is considered. Polarised solitons are used in this coupler. This use of solitons leads in a natural way to the desirability of developing conservative triple-valued logic.

  19. Non-functional plastid ndh gene fragments are present in the nuclear genome of Norway spruce (Picea abies L. Karsch): insights from in silico analysis of nuclear and organellar genomes.

    PubMed

    Ranade, Sonali Sachin; García-Gil, María Rosario; Rosselló, Josep A

    2016-04-01

    Many genes have been lost from the prokaryote plastidial genome during the early events of endosymbiosis in eukaryotes. Some of them were definitively lost, but others were relocated and functionally integrated to the host nuclear genomes through serial events of gene transfer during plant evolution. In gymnosperms, plastid genome sequencing has revealed the loss of ndh genes from several species of Gnetales and Pinaceae, including Norway spruce (Picea abies). This study aims to trace the ndh genes in the nuclear and organellar Norway spruce genomes. The plastid genomes of higher plants contain 11 ndh genes which are homologues of mitochondrial genes encoding subunits of the proton-pumping NADH-dehydrogenase (nicotinamide adenine dinucleotide dehydrogenase) or complex I (electron transport chain). Ndh genes encode 11 NDH polypeptides forming the Ndh complex (analogous to complex I) which seems to be primarily involved in chloro-respiration processes. We considered ndh genes from the plastidial genome of four gymnosperms (Cryptomeria japonica, Cycas revoluta, Ginkgo biloba, Podocarpus totara) and a single angiosperm species (Arabidopsis thaliana) to trace putative homologs in the nuclear and organellar Norway spruce genomes using tBLASTn to assess the evolutionary fate of ndh genes in Norway spruce and to address their genomic location(s), structure, integrity and functionality. The results obtained from tBLASTn were subsequently analyzed by performing homology search for finding ndh specific conserved domains using conserved domain search. We report the presence of non-functional plastid ndh gene fragments, excepting ndhE and ndhG genes, in the nuclear genome of Norway spruce. Regulatory transcriptional elements like promoters, TATA boxes and enhancers were detected in the upstream regions of some ndh fragments. We also found transposable elements in the flanking regions of few ndh fragments suggesting nuclear rearrangements in those regions. These evidences support the hypothesis that, at least in Picea, ndh translocations from the plastid to the nuclear genome have occurred, and that there might have been a functional machinery at some time during evolution to accommodate them within a nuclear-encoded environment, or attempts to form it.

  20. Phylogeny and Expression Analyses Reveal Important Roles for Plant PKS III Family during the Conquest of Land by Plants and Angiosperm Diversification

    PubMed Central

    Xie, Lulu; Liu, Pingli; Zhu, Zhixin; Zhang, Shifan; Zhang, Shujiang; Li, Fei; Zhang, Hui; Li, Guoliang; Wei, Yunxiao; Sun, Rifei

    2016-01-01

    Polyketide synthases (PKSs) utilize the products of primary metabolism to synthesize a wide array of secondary metabolites in both prokaryotic and eukaryotic organisms. PKSs can be grouped into three distinct classes, types I, II, and III, based on enzyme structure, substrate specificity, and catalytic mechanisms. The type III PKS enzymes function as homodimers, and are the only class of PKS that do not require acyl carrier protein. Plant type III PKS enzymes, also known as chalcone synthase (CHS)-like enzymes, are of particular interest due to their functional diversity. In this study, we mined type III PKS gene sequences from the genomes of six aquatic algae and 25 land plants (1 bryophyte, 1 lycophyte, 2 basal angiosperms, 16 core eudicots, and 5 monocots). PKS III sequences were found relatively conserved in all embryophytes, but not exist in algae. We also examined gene expression patterns by analyzing available transcriptome data, and identified potential cis-regulatory elements in upstream sequences. Phylogenetic trees of dicots angiosperms showed that plant type III PKS proteins fall into three clades. Clade A contains CHS/STS-type enzymes coding genes with diverse transcriptional expression patterns and enzymatic functions, while clade B is further divided into subclades b1 and b2, which consist of anther-specific CHS-like enzymes. Differentiation regions, such as amino acids 196-207 between clades A and B, and predicted positive selected sites within α-helixes in late appeared branches of clade A, account for the major diversification in substrate choice and catalytic reaction. The integrity and location of conserved cis-elements containing MYB and bHLH binding sites can affect transcription levels. Potential binding sites for transcription factors such as WRKY, SPL, or AP2/EREBP may contribute to tissue- or taxon-specific differences in gene expression. Our data shows that gene duplications and functional diversification of plant type III PKS enzymes played a critical role in the ancient conquest of the land by early plants and angiosperm diversification. PMID:27625671

  1. Regulatory motifs for CREB-binding protein and Nfe2l2 transcription factors in the upstream enhancer of the mitochondrial uncoupling protein 1 gene.

    PubMed

    Rim, Jong S; Kozak, Leslie P

    2002-09-13

    Thermogenesis against cold exposure in mammals occurs in brown adipose tissue (BAT) through mitochondrial uncoupling protein (UCP1). Expression of the Ucp1 gene is unique in brown adipocytes and is regulated tightly. The 5'-flanking region of the mouse Ucp1 gene contains cis-acting elements including PPRE, TRE, and four half-site cAMP-responsive elements (CRE) with BAT-specific enhancer elements. In the course of analyzing how these half-site CREs are involved in Ucp1 expression, we found that a DNA regulatory element for NF-E2 overlaps CRE2. Electrophoretic mobility shift assay and competition assays with the CRE2 element indicates that nuclear proteins from BAT, inguinal fat, and retroperitoneal fat tissue interact with the CRE2 motif (CGTCA) in a specific manner. A supershift assay using an antibody against the CRE-binding protein (CREB) shows specific affinity to the complex from CRE2 and nuclear extract of BAT. Additionally, Western blot analysis for phospho-CREB/ATF1 shows an increase in phosphorylation of CREB/ATF1 in HIB-1B cells after norepinephrine treatment. Transient transfection assay using luciferase reporter constructs also indicates that the two half-site CREs are involved in transcriptional regulation of Ucp1 in response to norepinephrine and cAMP. We also show that a second DNA regulatory element for NF-E2 is located upstream of the CRE2 region. This element, which is found in a similar location in the 5'-flanking region of the human and rodent Ucp1 genes, shows specific binding to rat and human NF-E2 by electrophoretic mobility shift assay with nuclear extracts from brown fat. Co-transfections with an Nfe2l2 expression vector and a luciferase reporter construct of the Ucp1 enhancer region provide additional evidence that Nfe2l2 is involved in the regulation of Ucp1 by cAMP-mediated signaling.

  2. Diverse Early Life-History Strategies in Migratory Amazonian Catfish: Implications for Conservation and Management.

    PubMed

    Hegg, Jens C; Giarrizzo, Tommaso; Kennedy, Brian P

    2015-01-01

    Animal migrations provide important ecological functions and can allow for increased biodiversity through habitat and niche diversification. However, aquatic migrations in general, and those of the world's largest fish in particular, are imperiled worldwide and are often poorly understood. Several species of large Amazonian catfish carry out some of the longest freshwater fish migrations in the world, travelling from the Amazon River estuary to the Andes foothills. These species are important apex predators in the main stem rivers of the Amazon Basin and make up the region's largest fishery. They are also the only species to utilize the entire Amazon Basin to complete their life cycle. Studies indicate both that the fisheries may be declining due to overfishing, and that the proposed and completed dams in their upstream range threaten spawning migrations. Despite this, surprisingly little is known about the details of these species' migrations, or their life history. Otolith microchemistry has been an effective method for quantifying and reconstructing fish migrations worldwide across multiple spatial scales and may provide a powerful tool to understand the movements of Amazonian migratory catfish. Our objective was to describe the migratory behaviors of the three most populous and commercially important migratory catfish species, Dourada (Brachyplatystoma rousseauxii), Piramutaba (Brachyplatystoma vaillantii), and Piraíba (Brachyplatystoma filamentosum). We collected fish from the mouth of the Amazon River and the Central Amazon and used strontium isotope signatures ((87)Sr/(86)Sr) recorded in their otoliths to determine the location of early rearing and subsequent. Fish location was determined through discriminant function classification, using water chemistry data from the literature as a training set. Where water chemistry data was unavailable, we successfully in predicted (87)Sr/(86)Sr isotope values using a regression-based approach that related the geology of the upstream watershed to the Sr isotope ratio. Our results provide the first reported otolith microchemical reconstruction of Brachyplatystoma migratory movements in the Amazon Basin. Our results indicate that juveniles exhibit diverse rearing strategies, rearing in both upstream and estuary environments. This contrasts with the prevailing understanding that juveniles rear in the estuary before migrating upstream; however, it is supported by some fisheries data that has indicated the presence of alternate spawning and rearing life-histories. The presence of alternate juvenile rearing strategies may have important implications for conservation and management of the fisheries in the region.

  3. Mass Conservation of the Unified Continuous and Discontinuous Element-Based Galerkin Methods on Dynamically Adaptive Grids with Application to Atmospheric Simulations

    DTIC Science & Technology

    2015-09-01

    Discontinuous Element-Based Galerkin Methods on Dynamically Adaptive Grids with Application to Atmospheric Simulations 5a. CONTRACT NUMBER 5b. GRANT NUMBER...Discontinuous Element-Based Galerkin Methods on Dynamically Adaptive Grids with Application to Atmospheric Simulations. Michal A. Koperaa,∗, Francis X...mass conservation, as it is an important feature for many atmospheric applications . We believe this is a good metric because, for smooth solutions

  4. A Study of Discharge Coefficient in Bileaflet Valves

    DTIC Science & Technology

    2001-10-25

    Granados J. Garcia MA. Luque I. Concha M. “Conservative operation for mitral stenosis with densely fibrosed or partially calcified valves. An eight...for aortic valves, whereas a lower value (around 0.7) has been proposed for valves mounted in the mitralic position, on account of the larger upstream...section; in the mitral position, then, a valve will have a smaller discharge coefficient (or Aeff/A ratio) than in the aortic position. Using dC =1

  5. T box transcription antitermination riboswitch: Influence of nucleotide sequence and orientation on tRNA binding by the antiterminator element

    PubMed Central

    Fauzi, Hamid; Agyeman, Akwasi; Hines, Jennifer V.

    2008-01-01

    Many bacteria utilize riboswitch transcription regulation to monitor and appropriately respond to cellular levels of important metabolites or effector molecules. The T box transcription antitermination riboswitch responds to cognate uncharged tRNA by specifically stabilizing an antiterminator element in the 5′-untranslated mRNA leader region and precluding formation of a thermodynamically more stable terminator element. Stabilization occurs when the tRNA acceptor end base pairs with the first four nucleotides in the seven nucleotide bulge of the highly conserved antiterminator element. The significance of the conservation of the antiterminator bulge nucleotides that do not base pair with the tRNA is unknown, but they are required for optimal function. In vitro selection was used to determine if the isolated antiterminator bulge context alone dictates the mode in which the tRNA acceptor end binds the bulge nucleotides. No sequence conservation beyond complementarity was observed and the location was not constrained to the first four bases of the bulge. The results indicate that formation of a structure that recognizes the tRNA acceptor end in isolation is not the determinant driving force for the high phylogenetic sequence conservation observed within the antiterminator bulge. Additional factors or T box leader features more likely influenced the phylogenetic sequence conservation. PMID:19152843

  6. Deep conservation of cis-regulatory elements in metazoans

    PubMed Central

    Maeso, Ignacio; Irimia, Manuel; Tena, Juan J.; Casares, Fernando; Gómez-Skarmeta, José Luis

    2013-01-01

    Despite the vast morphological variation observed across phyla, animals share multiple basic developmental processes orchestrated by a common ancestral gene toolkit. These genes interact with each other building complex gene regulatory networks (GRNs), which are encoded in the genome by cis-regulatory elements (CREs) that serve as computational units of the network. Although GRN subcircuits involved in ancient developmental processes are expected to be at least partially conserved, identification of CREs that are conserved across phyla has remained elusive. Here, we review recent studies that revealed such deeply conserved CREs do exist, discuss the difficulties associated with their identification and describe new approaches that will facilitate this search. PMID:24218633

  7. Diurnal cycles control the fate of contaminants at an Andean river confluence impacted by legacy mining

    NASA Astrophysics Data System (ADS)

    Pasten, P.; Guerra, P. A.; Simonson, K.; Bonilla, C.; Pizarro, G. E.; Escauriaza, C. R.; González, C.

    2014-12-01

    The importance of hydrologic-geochemical interactions in arid environments is a controlling factor in quality and quantity of water available for human consumption and agriculture. When acid drainage affects these watersheds, water quality is gravely degraded. Despite its effect on watersheds, the relationship between time changes in hydrological variables and water quality in arid regions has not been studied thoroughly. Temporal variations in acid drainage can control when the transport of toxic elements is increased. We performed field work at the Azufre River (pH 2, E.C~10.9 mS/cm) and Caracarani River (pH 8.7, E.C~1.2 mS/cm) confluence, located in the Northern Chilean Altiplano (at 4000 m asl). We registered stream flowrates (total flowrate~430 L/s), temperature and electric conductivity (E.C) hourly using in-stream data loggers during one year. We also measured turbidity and pH during one field survey at different distances from the junction, as a proxy of the formation of iron-aluminum particles that cycle trace elements in these environments. We found turbidity-pH diurnal cycles were caused by upstream hourly changes in upstream flowrate: when the Caracarani River flowrate reached its daily peak, particle formation occurred, while the dissolution of particles occurred when the Azufre River reached its maximum value. This last process occurred due to upstream freeze-thaw cycles. This study shows how the dynamics of natural confluences determines chemical transport. The formation of particles enriched in toxic elements can promote settling as a natural attenuation process, while their dissolution will produce their release and transport long distances downstream. It is important to consider time as an important variable in water quality monitoring and in water management infrastructure where pulses of contamination can have potentially negative effects in its use. Acknowledgements: Funding was provided by "Proyecto Fondecyt 1130936" and "CONICYT/FONDAP 15110020".

  8. Mutations That Stimulate flhDC Expression in Escherichia coli K-12.

    PubMed

    Fahrner, Karen A; Berg, Howard C

    2015-10-01

    Motility is a beneficial attribute that enables cells to access and explore new environments and to escape detrimental ones. The organelle of motility in Escherichia coli is the flagellum, and its production is initiated by the activating transcription factors FlhD and FlhC. The expression of these factors by the flhDC operon is highly regulated and influenced by environmental conditions. The flhDC promoter is recognized by σ(70) and is dependent on the transcriptional activator cyclic AMP (cAMP)-cAMP receptor protein complex (cAMP-CRP). A number of K-12 strains exhibit limited motility due to low expression levels of flhDC. We report here a large number of mutations that stimulate flhDC expression in such strains. They include single nucleotide changes in the -10 element of the promoter, in the promoter spacer, and in the cAMP-CRP binding region. In addition, we show that insertion sequence (IS) elements or a kanamycin gene located hundreds of base pairs upstream of the promoter can effectively enhance transcription, suggesting that the topology of a large upstream region plays a significant role in the regulation of flhDC expression. None of the mutations eliminated the requirement for cAMP-CRP for activation. However, several mutations allowed expression in the absence of the nucleoid organizing protein, H-NS, which is normally required for flhDC expression. The flhDC operon of Escherichia coli encodes transcription factors that initiate flagellar synthesis, an energetically costly process that is highly regulated. Few deregulating mutations have been reported thus far. This paper describes new single nucleotide mutations that stimulate flhDC expression, including a number that map to the promoter spacer region. In addition, this work shows that insertion sequence elements or a kanamycin gene located far upstream from the promoter or repressor binding sites also stimulate transcription, indicating a role of regional topology in the regulation of flhDC expression. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  9. Mutational Analysis of the TnrA-Binding Sites in the Bacillus subtilis nrgAB and gabP Promoter Regions

    PubMed Central

    Wray, Lewis V.; Zalieckas, Jill M.; Ferson, Amy E.; Fisher, Susan H.

    1998-01-01

    Transcription of the Bacillus subtilis nrgAB promoter is activated during nitrogen-limited growth by the TnrA protein. A common inverted repeat, TGTNAN7TNACA (TnrA site), is centered 49 to 51 bp upstream of the transcriptional start sites for the TnrA-regulated nrgAB, gabP P2, and nas promoters. Oligonucleotide-directed mutagenesis of the nrgAB promoter region showed that conserved nucleotides within the TnrA site, the A+T-rich region between the two TnrA half-sites, and an upstream A tract are all required for high-level activation of nrgAB expression. Mutations that alter the relative distance between the two half-sites of the nrgAB TnrA site abolish nitrogen regulation of nrgAB expression. Spacer mutations that change the relative distance between the TnrA site and −35 region of the nrgAB promoter reveal that activation of nrgAB expression occurs only when the TnrA site is located 49 to 51 bp upstream of the transcriptional start site. Mutational analysis of the conserved nucleotides in the gabP P2 TnrA site showed that this sequence is also required for nitrogen-regulated gabP P2 expression. The TnrA protein, expressed in an overproducing Escherichia coli strain, had a 625-fold-higher affinity for the wild-type nrgAB promoter DNA than for a mutated nrgAB promoter DNA fragment that is unable to activate nrgAB expression in vivo. These results indicate that the proposed TnrA site functions as the binding site for the TnrA protein. TnrA was found to activate nrgAB expression during late exponential growth in nutrient sporulation medium containing glucose, suggesting that cells become nitrogen limited during growth in this medium. PMID:9603886

  10. Distal regulatory regions restrict the expression of cis-linked genes to the tapetal cells.

    PubMed

    Franco, Luciana O; de O Manes, Carmem Lara; Hamdi, Said; Sachetto-Martins, Gilberto; de Oliveira, Dulce E

    2002-04-24

    The oleosin glycine-rich protein genes Atgrp-6, Atgrp-7, and Atgrp-8 occur in clusters in the Arabidopsis genome and are expressed specifically in the tapetum cells. The cis-regulatory regions involved in the tissue-specific gene expression were investigated by fusing different segments of the gene cluster to the uidA reporter gene. Common distal regulatory regions were identified that coordinate expression of the sequential genes. At least two of these genes were regulated spatially by proximal and distal sequences. The cis-acting elements (122 bp upstream of the transcriptional start point) drive the uidA expression to floral tissues, whereas distal 5' upstream regions restrict the gene activity to tapetal cells.

  11. Sequence Requirements of the 5-Enolpyruvylshikimate-3-phosphate Synthase 5[prime]-Upstream Region for Tissue-Specific Expression in Flowers and Seedlings.

    PubMed Central

    Benfey, PN; Takatsuji, H; Ren, L; Shah, DM; Chua, NH

    1990-01-01

    We have analyzed expression from deletion derivatives of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) 5[prime]-upstream region in transgenic petunia flowers and seedlings. In seedlings, expression was strongest in root cortex cells and in trichomes. High-level expression in petals and in seedling roots was conferred by large (>500 base-pair) stretches of sequence, but was lost when smaller fragments were analyzed individually. This apparent requirement for extensive sequence suggests that combinations of cis-elements that are widely separated control tissue-specific expression from the EPSPS promoter. We have also used the high-level, petal-specific expression of the EPSPS promoter to change petal color in two mutant petunia lines. PMID:12354968

  12. Method and apparatus for in-cell vacuuming of radiologically contaminated materials

    DOEpatents

    Spadaro, Peter R.; Smith, Jay E.; Speer, Elmer L.; Cecconi, Arnold L.

    1987-01-01

    A vacuum air flow operated cyclone separator arrangement for collecting, handling and packaging loose contaminated material in accordance with acceptable radiological and criticality control requirements. The vacuum air flow system includes a specially designed fail-safe prefilter installed upstream of the vacuum air flow power supply. The fail-safe prefilter provides in-cell vacuum system flow visualization and automatically reduces or shuts off the vacuum air flow in the event of an upstream prefilter failure. The system is effective for collecting and handling highly contaminated radiological waste in the form of dust, dirt, fuel element fines, metal chips and similar loose material in accordance with radiological and criticality control requirements for disposal by means of shipment and burial.

  13. Characterisation of the canine rod-cone dysplasia type one gene (rod photoreceptor cGMP phosphodiesterase beta subunit (PDEB)) - a model for human retinitis pigmentosa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Clements, P.J.M.; Gregory, C.Y.; Petersen-Jones, S.M.

    1994-09-01

    Rod-cone dysplasia type one (rod-1) is an early onset, autosomal recessive retinal dystrophy segregating in the Irish setter breed. It is a model for certain forms of human autosomal recessive retinitis pigmentosa (arRP) caused by mutations in the same gene, PDEB. We confirmed the codon 807 Trp to Stop mutation and were the first to show cosegregation of the mutant allele with disease in a pedigree. We believe that this currently represents the best animal model available for some aspects of arRP, since canine tissues are relatively easy to access compared to human and yet the canine eye is ofmore » comparable size, unlike that of the rd mouse. This facilitates therapeutic intervention particularly at the subretinal level. In order to more fully investigate this model we have been characterizing the PDEB gene in the normal dog. Using PCR we have partially mapped the intron/exon structure, demonstrating a very high degree of evolutionary conservation with the mouse and human genes. RT-PCR has been used to reveal expression in a variety of neural and non-neural tissues. A PCR product spanning exons 19 to 22 (which also contains the site for the rcd-1 mutation) is detected in retina but also in tissues such as visual cortex, cerebral cortex, cerebellum, lateral geniculate nucleus, adrenal gland, lung, kidney and ovary. All of these tissues gave a negative result with primers for rds/peripherin, a gene which is expressed in rods and cones. This raises interesting questions about the regulation of PDEB transcripts which is initially being investigated by Northern analysis. In addition, anchored PCR techniques have generated upstream genomic sequences and we are currently mapping the 5{prime} extent of the mRNA transcript in the retina. This will facilitate the analysis of potential upstream promoter elements involved in directing expression.« less

  14. The Space-Time Conservative Schemes for Large-Scale, Time-Accurate Flow Simulations with Tetrahedral Meshes

    NASA Technical Reports Server (NTRS)

    Venkatachari, Balaji Shankar; Streett, Craig L.; Chang, Chau-Lyan; Friedlander, David J.; Wang, Xiao-Yen; Chang, Sin-Chung

    2016-01-01

    Despite decades of development of unstructured mesh methods, high-fidelity time-accurate simulations are still predominantly carried out on structured, or unstructured hexahedral meshes by using high-order finite-difference, weighted essentially non-oscillatory (WENO), or hybrid schemes formed by their combinations. In this work, the space-time conservation element solution element (CESE) method is used to simulate several flow problems including supersonic jet/shock interaction and its impact on launch vehicle acoustics, and direct numerical simulations of turbulent flows using tetrahedral meshes. This paper provides a status report for the continuing development of the space-time conservation element solution element (CESE) numerical and software framework under the Revolutionary Computational Aerosciences (RCA) project. Solution accuracy and large-scale parallel performance of the numerical framework is assessed with the goal of providing a viable paradigm for future high-fidelity flow physics simulations.

  15. H-NS Facilitates Sequence Diversification of Horizontally Transferred DNAs during Their Integration in Host Chromosomes

    PubMed Central

    Higashi, Koichi; Tobe, Toru; Kanai, Akinori; Uyar, Ebru; Ishikawa, Shu; Suzuki, Yutaka; Ogasawara, Naotake; Kurokawa, Ken; Oshima, Taku

    2016-01-01

    Bacteria can acquire new traits through horizontal gene transfer. Inappropriate expression of transferred genes, however, can disrupt the physiology of the host bacteria. To reduce this risk, Escherichia coli expresses the nucleoid-associated protein, H-NS, which preferentially binds to horizontally transferred genes to control their expression. Once expression is optimized, the horizontally transferred genes may actually contribute to E. coli survival in new habitats. Therefore, we investigated whether and how H-NS contributes to this optimization process. A comparison of H-NS binding profiles on common chromosomal segments of three E. coli strains belonging to different phylogenetic groups indicated that the positions of H-NS-bound regions have been conserved in E. coli strains. The sequences of the H-NS-bound regions appear to have diverged more so than H-NS-unbound regions only when H-NS-bound regions are located upstream or in coding regions of genes. Because these regions generally contain regulatory elements for gene expression, sequence divergence in these regions may be associated with alteration of gene expression. Indeed, nucleotide substitutions in H-NS-bound regions of the ybdO promoter and coding regions have diversified the potential for H-NS-independent negative regulation among E. coli strains. The ybdO expression in these strains was still negatively regulated by H-NS, which reduced the effect of H-NS-independent regulation under normal growth conditions. Hence, we propose that, during E. coli evolution, the conservation of H-NS binding sites resulted in the diversification of the regulation of horizontally transferred genes, which may have facilitated E. coli adaptation to new ecological niches. PMID:26789284

  16. Molecular Basis for Glucocorticoid Induction of the Krüppel-Like Factor 9 Gene in Hippocampal Neurons

    PubMed Central

    Bagamasbad, Pia; Ziera, Tim; Borden, Steffen A.; Bonett, Ronald M.; Rozeboom, Aaron M.; Seasholtz, Audrey

    2012-01-01

    Stress has complex effects on hippocampal structure and function, which consequently affects learning and memory. These effects are mediated in part by circulating glucocorticoids (GC) acting via the intracellular GC receptor (GR) and mineralocorticoid receptor (MR). Here, we investigated GC regulation of Krüppel-like factor 9 (KLF9), a transcription factor implicated in neuronal development and plasticity. Injection of corticosterone (CORT) in postnatal d 6 and 30 mice increased Klf9 mRNA and heteronuclear RNA by 1 h in the hippocampal region. Treatment of the mouse hippocampal cell line HT-22 with CORT caused a time- and dose-dependent increase in Klf9 mRNA. The CORT induction of Klf9 was resistant to protein synthesis inhibition, suggesting that Klf9 is a direct CORT-response gene. In support of this hypothesis, we identified two GR/MR response elements (GRE/MRE) located −6.1 and −5.3 kb relative to the transcription start site, and we verified their functionality by enhancer-reporter, gel shift, and chromatin immunoprecipitation assays. The −5.3-kb GRE/MRE is largely conserved across tetrapods, but conserved orthologs of the −6.1-kb GRE/MRE were only detected in therian mammals. GC treatment caused recruitment of the GR, histone hyperacetylation, and nucleosome removal at Klf9 upstream regions. Our findings support a predominant role for GR, with a minor contribution of MR, in the direct regulation of Klf9 acting via two GRE/MRE located in the 5′-flanking region of the gene. KLF9 may play a key role in GC actions on hippocampal development and plasticity. PMID:22962255

  17. Understanding multiple stressors in a Mediterranean basin: Combined effects of land use, water scarcity and nutrient enrichment.

    PubMed

    Segurado, Pedro; Almeida, Carina; Neves, Ramiro; Ferreira, Maria Teresa; Branco, Paulo

    2018-05-15

    River basins are extremely complex hierarchical and directional systems that are affected by a multitude of interacting stressors. This complexity hampers effective management and conservation planning to be effectively implemented, especially under climate change. The objective of this work is to provide a wide scale approach to basin management by interpreting the effect of isolated and interacting factors in several biotic elements (fish, macroinvertebrates, phytobenthos and macrophytes). For that, a case study in the Sorraia basin (Central Portugal), a Mediterranean system mainly facing water scarcity and diffuse pollution problems, was chosen. To develop the proposed framework, a combination of process-based modelling to simulate hydrological and nutrient enrichment stressors and empirical modelling to relate these stressors - along with land use and natural background - with biotic indicators, was applied. Biotic indicators based on ecological quality ratios from WFD biomonitoring data were used as response variables. Temperature, river slope, % of agriculture in the upstream catchment and total N were the variables more frequently ranked as the most relevant. Both the two significant interactions found between single hydrological and nutrient enrichment stressors indicated antagonistic effects. This study demonstrates the potentialities of coupling process-based modelling with empirical modelling within a single framework, allowing relationships among different ecosystem states to be hierarchized, interpreted and predicted at multiple spatial and temporal scales. It also demonstrates how isolated and interacting stressors can have a different impact on biotic quality. When performing conservation or management plans, the stressor hierarchy should be considered as a way of prioritizing actions in a cost-effective perspective. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae).

    PubMed

    Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M

    2011-08-01

    The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at -25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant.

  19. The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae)

    PubMed Central

    Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M

    2011-01-01

    The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at −25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant. PMID:21364693

  20. Plutella xylostella granulovirus late gene promoter activity in the context of the Autographa californica multiple nucleopolyhedrovirus genome.

    PubMed

    Ren, He-Lin; Hu, Yuan; Guo, Ya-Jun; Li, Lu-Lin

    2016-06-01

    Within Baculoviridae, little is known about the molecular mechanisms of replication in betabaculoviruses, despite extensive studies in alphabaculoviruses. In this study, the promoters of nine late genes of the betabaculovirus Plutella xylostella granulovirus (PlxyGV) were cloned into a transient expression vector and the alphabaculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) genome, and compared with homologous late gene promoters of AcMNPV in Sf9 cells. In transient expression assays, all PlxyGV late promoters were activated in cells transfected with the individual reporter plasmids together with an AcMNPV bacmid. In infected cells, reporter gene expression levels with the promoters of PlxyGV e18 and AcMNPV vp39 and gp41 were significantly higher than those of the corresponding AcMNPV or PlxyGV promoters, which had fewer late promoter motifs. Observed expression levels were lower for the PlxyGV p6.9, pk1, gran, p10a, and p10b promoters than for the corresponding AcMNPV promoters, despite equal numbers of late promoter motifs, indicating that species-specific elements contained in some late promoters were favored by the native viral RNA polymerases for optimal transcription. The 8-nt sequence TAAATAAG encompassing the ATAAG motif was conserved in the AcMNPV polh, p10, and pk1 promoters. The 5-nt sequence CAATT located 4 or 5 nt upstream of the T/ATAAG motif was conserved in the promoters of PlxyGV gran, p10c, and pk1. The results of this study demonstrated that PlxyGV late gene promoters could be effectively activated by the RNA polymerase from AcMNPV, implying that late gene expression systems are regulated by similar mechanisms in alphabaculoviruses and betabaculoviruses.

  1. Genetic, comparative genomic, and expression analyses of the Mc1r locus in the polychromatic Midas cichlid fish (Teleostei, Cichlidae Amphilophus sp.) species group.

    PubMed

    Henning, Frederico; Renz, Adina Josepha; Fukamachi, Shoji; Meyer, Axel

    2010-05-01

    Natural populations of the Midas cichlid species in several different crater lakes in Nicaragua exhibit a conspicuous color polymorphism. Most individuals are dark and the remaining have a gold coloration. The color morphs mate assortatively and sympatric population differentiation has been shown based on neutral molecular data. We investigated the color polymorphism using segregation analysis and a candidate gene approach. The segregation patterns observed in a mapping cross between a gold and a dark individual were consistent with a single dominant gene as a cause of the gold phenotype. This suggests that a simple genetic architecture underlies some of the speciation events in the Midas cichlids. We compared the expression levels of several candidate color genes Mc1r, Ednrb1, Slc45a2, and Tfap1a between the color morphs. Mc1r was found to be up regulated in the gold morph. Given its widespread association in color evolution and role on melanin synthesis, the Mc1r locus was further investigated using sequences derived from a genomic library. Comparative analysis revealed conserved synteny in relation to the majority of teleosts and highlighted several previously unidentified conserved non-coding elements (CNEs) in the upstream and downstream regions in the vicinity of Mc1r. The identification of the CNEs regions allowed the comparison of sequences from gold and dark specimens of natural populations. No polymorphisms were found between in the population sample and Mc1r showed no linkage to the gold phenotype in the mapping cross, demonstrating that it is not causally related to the color polymorphism in the Midas cichlid.

  2. H-NS Facilitates Sequence Diversification of Horizontally Transferred DNAs during Their Integration in Host Chromosomes.

    PubMed

    Higashi, Koichi; Tobe, Toru; Kanai, Akinori; Uyar, Ebru; Ishikawa, Shu; Suzuki, Yutaka; Ogasawara, Naotake; Kurokawa, Ken; Oshima, Taku

    2016-01-01

    Bacteria can acquire new traits through horizontal gene transfer. Inappropriate expression of transferred genes, however, can disrupt the physiology of the host bacteria. To reduce this risk, Escherichia coli expresses the nucleoid-associated protein, H-NS, which preferentially binds to horizontally transferred genes to control their expression. Once expression is optimized, the horizontally transferred genes may actually contribute to E. coli survival in new habitats. Therefore, we investigated whether and how H-NS contributes to this optimization process. A comparison of H-NS binding profiles on common chromosomal segments of three E. coli strains belonging to different phylogenetic groups indicated that the positions of H-NS-bound regions have been conserved in E. coli strains. The sequences of the H-NS-bound regions appear to have diverged more so than H-NS-unbound regions only when H-NS-bound regions are located upstream or in coding regions of genes. Because these regions generally contain regulatory elements for gene expression, sequence divergence in these regions may be associated with alteration of gene expression. Indeed, nucleotide substitutions in H-NS-bound regions of the ybdO promoter and coding regions have diversified the potential for H-NS-independent negative regulation among E. coli strains. The ybdO expression in these strains was still negatively regulated by H-NS, which reduced the effect of H-NS-independent regulation under normal growth conditions. Hence, we propose that, during E. coli evolution, the conservation of H-NS binding sites resulted in the diversification of the regulation of horizontally transferred genes, which may have facilitated E. coli adaptation to new ecological niches.

  3. CalA, a Cyanobacterial AbrB Protein, Interacts with the Upstream Region of hypC and Acts as a Repressor of Its Transcription in the Cyanobacterium Nostoc sp. Strain PCC 7120▿ †

    PubMed Central

    Agervald, Åsa; Zhang, Xiaohui; Stensjö, Karin; Devine, Ellenor; Lindblad, Peter

    2010-01-01

    The filamentous, heterocystous, nitrogen-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain, depending on growth conditions, up to two hydrogenases directly involved in hydrogen metabolism. HypC is one out of at least seven auxiliary gene products required for synthesis of a functional hydrogenase, specifically involved in the maturation of the large subunit. In this study we present a protein, CalA (Alr0946 in the genome), belonging to the transcription regulator family AbrB, which in protein-DNA assays was found to interact with the upstream region of hypC. Transcriptional investigations showed that calA is cotranscribed with the downstream gene alr0947, which encodes a putative protease from the abortive infection superfamily, Abi. CalA was shown to interact specifically not only with the upstream region of hypC but also with its own upstream region, acting as a repressor on hypC. The bidirectional hydrogenase activity was significantly downregulated when CalA was overexpressed, demonstrating a correlation with the transcription factor, either direct or indirect. In silico studies showed that homologues to both CalA and Alr0947 are highly conserved proteins within cyanobacteria with very similar physical organizations of the corresponding structural genes. Possible functions of the cotranscribed downstream protein Alr0947 are presented. In addition, we present a three-dimensional (3D) model of the DNA binding domain of CalA and putative DNA binding mechanisms are discussed. PMID:20023111

  4. Molecular cloning and identification of the transcriptional regulatory domain of the goat neurokinin B gene TAC3.

    PubMed

    Suetomi, Yuta; Matsuda, Fuko; Uenoyama, Yoshihisa; Maeda, Kei-ichiro; Tsukamura, Hiroko; Ohkura, Satoshi

    2013-10-01

    Neurokinin B (NKB), encoded by TAC3, is thought to be an important accelerator of pulsatile gonadotropin-releasing hormone release. This study aimed to clarify the transcriptional regulatory mechanism of goat TAC3. First, we determined the full-length mRNA sequence of goat TAC3 from the hypothalamus to be 820 b, including a 381 b coding region, with the putative transcription start site located 143-b upstream of the start codon. The deduced amino acid sequence of NKB, which is produced from preproNKB, was completely conserved among goat, cattle, and human. Next, we cloned 5'-upstream region of goat TAC3 up to 3400 b from the translation initiation site, and this region was highly homologous with cattle TAC3 (89%). We used this goat TAC3 5'-upstream region to perform luciferase assays. We created a luciferase reporter vector containing DNA constructs from -2706, -1837, -834, -335, or -197 to +166 bp (the putative transcription start site was designated as +1) of goat TAC3 and these were transiently transfected into mouse hypothalamus-derived N7 cells and human neuroblastoma-derived SK-N-AS cells. The luciferase activity gradually increased with the deletion of the 5'-upstream region, suggesting that the transcriptional suppressive region is located between -2706 and -336 bp and that the core promoter exists downstream of -197 bp. Estradiol treatment did not lead to significant suppression of luciferase activity of any constructs, suggesting the existence of other factor(s) that regulate goat TAC3 transcription.

  5. Evaluating upstream passage and timing of approach by adult bigheaded carps at a gated dam on the Illinois River

    USGS Publications Warehouse

    Lubejko, Matthew; Whitledge, Greg; Coulter, Alison A.; Brey, Marybeth; Oliver, Devon; Garvey, James E.

    2017-01-01

    Dams are a conservation threat because they function as barriers to native fish movement; however, they may prevent the spread of invasive species. Invasive bigheaded carps (Hypophthalmichthys spp.) threaten the Great Lakes ecosystem and are advancing towards Lake Michigan via the Illinois River. Navigation dams on the Illinois River may deter bigheaded carps' upstream movement. We investigated the permeability of the Starved Rock Lock and Dam (SRLD), the most downstream gated Illinois River dam, to bigheaded carps' migration by examining the timing of individuals approaching and passing through SRLD in relation to gate openness, tailwater elevation, and water temperature. Using acoustic telemetry of (N = ~104 per year) tagged fish, 13 upstream passages of bigheaded carps occurred through SRLD between 2013 and 2016. Eleven passages occurred through the dam gates and 2 through the lock chamber, indicating deterrents (e.g., CO2) placed in SRLD lock chamber may only limit passage of a small proportion of all fish passing through the lock-and-dam structure. Passages were documented only in 2013 and 2015. Most of the dam gate passages occurred during high water when gates were completely out of the water. Timing of bigheaded carps approaching SRLD was positively correlated with rising water temperature and high tailwater elevation, and all fish approached during late March through mid-September. Movement through dams is rare; modifying gate operations to reduce gate openness during late spring and summer could further reduce the permeability of gated dams such as SRLD to bigheaded carps, slowing their upstream advance.

  6. Far-field connectivity of the UK's four largest marine protected areas: Four of a kind?

    NASA Astrophysics Data System (ADS)

    Robinson, J.; New, A. L.; Popova, E. E.; Srokosz, M. A.; Yool, A.

    2017-05-01

    Marine Protected Areas (MPAs) are established to conserve important ecosystems and protect marine species threatened in the wider ocean. However, even MPAs in remote areas are not wholly isolated from anthropogenic impacts. "Upstream" activities, possibly thousands of kilometers away, can influence MPAs through ocean currents that determine their connectivity. Persistent pollutants, such as plastics, can be transported from neighboring shelf regions to MPAs, or an ecosystem may be affected if larval dispersal is reduced from a seemingly remote upstream area. Thus, improved understanding of exactly where upstream is, and on what timescale it is connected, is important for protecting and monitoring MPAs. Here, we use a high-resolution (1/12°) ocean general circulation model and Lagrangian particle tracking to diagnose the connectivity of four of the UK's largest MPAs: Pitcairn; South Georgia and Sandwich Islands; Ascension; and the British Indian Ocean Territory (BIOT). We introduce the idea of a circulation "connectivity footprint", by which MPAs are connected to upstream areas. Annual connectivity footprints were calculated for the four MPAs, taking into account seasonal and inter-annual variability. These footprints showed that, on annual timescales, Pitcairn was not connected with land, whereas there was increasing connectivity for waters reaching South Georgia, Ascension, and, especially, BIOT. BIOT also had a high degree of both seasonal and inter-annual variability, which drastically changed its footprint, year-to-year. We advocate that such connectivity footprints are an inherent property of all MPAs, and need to be considered when MPAs are first proposed or their viability as refuges evaluated.

  7. Computational fluid dynamics modeling of intracranial aneurysms: effects of parent artery segmentation on intra-aneurysmal hemodynamics.

    PubMed

    Castro, M A; Putman, C M; Cebral, J R

    2006-09-01

    The purpose of this study is to show the influence of the upstream parent artery geometry on intraaneurysmal hemodynamics of cerebral aneurysms. Patient-specific models of 4 cerebral aneurysms (1 posterior communicating artery [PcomA], 2 middle cerebral artery [MCA], and 1 anterior communicating artery [AcomA]) were constructed from 3D rotational angiography images. Two geometric models were constructed for each aneurysm. One model had the native parent vessel geometry; the second model was truncated approximately 1 cm upstream from the aneurysm, and the parent artery replaced with a straight cylinder. Corresponding finite element grids were generated and computational fluid dynamics simulations were carried out under pulsatile flow conditions. The intra-aneurysmal flow patterns and wall shear stress (WSS) distributions were visualized and compared. Models using the truncated parent vessel underestimated the WSS in the aneurysms in all cases and shifted the impaction zone to the neck compared with the native geometry. These effects were more pronounced in the PcomA and AcomA aneurysms where upstream curvature was substantial. The MCA aneurysm with a long M1 segment was the least effected. The more laminar flow pattern within the parent vessel in truncated models resulted in a less complex intra-aneurysmal flow patterns with fewer vortices and less velocity at the dome. Failure to properly model the inflow stream contributed by the upstream parent artery can significantly influence the results of intra-aneurysmal hemodynamic models. The upstream portion of the parent vessel of cerebral aneurysms should be included to accurately represent the intra-aneurysmal hemodynamics.

  8. A Genome-Wide Identification of the WRKY Family Genes and a Survey of Potential WRKY Target Genes in Dendrobium officinale.

    PubMed

    He, Chunmei; Teixeira da Silva, Jaime A; Tan, Jianwen; Zhang, Jianxia; Pan, Xiaoping; Li, Mingzhi; Luo, Jianping; Duan, Jun

    2017-08-23

    The WRKY family, one of the largest families of transcription factors, plays important roles in the regulation of various biological processes, including growth, development and stress responses in plants. In the present study, 63 DoWRKY genes were identified from the Dendrobium officinale genome. These were classified into groups I, II, III and a non-group, each with 14, 28, 10 and 11 members, respectively. ABA-responsive, sulfur-responsive and low temperature-responsive elements were identified in the 1-k upstream regulatory region of DoWRKY genes. Subsequently, the expression of the 63 DoWRKY genes under cold stress was assessed, and the expression profiles of a large number of these genes were regulated by low temperature in roots and stems. To further understand the regulatory mechanism of DoWRKY genes in biological processes, potential WRKY target genes were investigated. Among them, most stress-related genes contained multiple W-box elements in their promoters. In addition, the genes involved in polysaccharide synthesis and hydrolysis contained W-box elements in their 1-k upstream regulatory regions, suggesting that DoWRKY genes may play a role in polysaccharide metabolism. These results provide a basis for investigating the function of WRKY genes and help to understand the downstream regulation network in plants within the Orchidaceae.

  9. Identification of a peroxisome proliferator-responsive element upstream of the gene encoding rat peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase.

    PubMed Central

    Zhang, B; Marcus, S L; Sajjadi, F G; Alvares, K; Reddy, J K; Subramani, S; Rachubinski, R A; Capone, J P

    1992-01-01

    Ciprofibrate, a hypolipidemic drug that acts as a peroxisome proliferator, induces the transcription of genes encoding peroxisomal beta-oxidation enzymes. To identify cis-acting promoter elements involved in this induction, 5.8 kilobase pairs of promoter sequence from the gene encoding rat peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase (EC 4.2.1.17/EC 1.1.1.35) was inserted upstream of a luciferase reporter gene. Transfection of this expression vector into rat hepatoma H4IIEC3 cells in the presence of ciprofibrate resulted in a 5- to 10-fold, cell type-specific increase in luciferase activity as compared to cells transfected in the absence of drug. A peroxisome proliferator-responsive element (PPRE) was localized to a 196-nucleotide region centered at position -2943 from the transcription start site. This PPRE conferred ciprofibrate responsiveness on a heterologous promoter and functioned independently of orientation or position. Gel retardation analysis with nuclear extracts demonstrated that ciprofibrate-treated or untreated H4IIEC3 cells, but not HeLa cells or monkey kidney cells, contained sequence-specific DNA binding factors that interact with the PPRE. These results have implications for understanding the mechanisms of coordinated transcriptional induction of genes encoding peroxisomal proteins by hypolipidemic agents and other peroxisome proliferators. Images PMID:1502166

  10. Promoter Recognition by Extracytoplasmic Function σ Factors: Analyzing DNA and Protein Interaction Motifs

    PubMed Central

    Guzina, Jelena

    2016-01-01

    ABSTRACT Extracytoplasmic function (ECF) σ factors are the largest and the most diverse group of alternative σ factors, but their mechanisms of transcription are poorly studied. This subfamily is considered to exhibit a rigid promoter structure and an absence of mixing and matching; both −35 and −10 elements are considered necessary for initiating transcription. This paradigm, however, is based on very limited data, which bias the analysis of diverse ECF σ subgroups. Here we investigate DNA and protein recognition motifs involved in ECF σ factor transcription by a computational analysis of canonical ECF subfamily members, much less studied ECF σ subgroups, and the group outliers, obtained from recently sequenced bacteriophages. The analysis identifies an extended −10 element in promoters for phage ECF σ factors; a comparison with bacterial σ factors points to a putative 6-amino-acid motif just C-terminal of domain σ2, which is responsible for the interaction with the identified extension of the −10 element. Interestingly, a similar protein motif is found C-terminal of domain σ2 in canonical ECF σ factors, at a position where it is expected to interact with a conserved motif further upstream of the −10 element. Moreover, the phiEco32 ECF σ factor lacks a recognizable −35 element and σ4 domain, which we identify in a homologous phage, 7-11, indicating that the extended −10 element can compensate for the lack of −35 element interactions. Overall, the results reveal greater flexibility in promoter recognition by ECF σ factors than previously recognized and raise the possibility that mixing and matching also apply to this group, a notion that remains to be biochemically tested. IMPORTANCE ECF σ factors are the most numerous group of alternative σ factors but have been little studied. Their promoter recognition mechanisms are obscured by the large diversity within the ECF σ factor group and the limited similarity with the well-studied housekeeping σ factors. Here we extensively compare bacterial and bacteriophage ECF σ factors and their promoters in order to infer DNA and protein recognition motifs involved in transcription initiation. We predict a more flexible promoter structure than is recognized by the current paradigm, which assumes rigidness, and propose that ECF σ promoter elements may complement (mix and match with) each other's strengths. These results warrant the refocusing of research efforts from the well-studied housekeeping σ factors toward the physiologically highly important, but insufficiently understood, alternative σ factors. PMID:27137497

  11. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  12. Some Effects of Compressibility on the Flow Through Fans and Turbines

    NASA Technical Reports Server (NTRS)

    Perl, W.; Epstein, H. T.

    1946-01-01

    The laws of conservation of mass, momentum, and energy are applied to the compressible flow through a two-dimensional cascade of airfoils. A fundamental relation between the ultimate upstream and downstream flow angles, the inlet Mach number, and the pressure ratio across the cascade is derived. Comparison with the corresponding relation for incompressible flow shows large differences. The fundamental relation reveals two ranges of flow angles and inlet Mach numbers, for which no ideal pressure ratio exists. One of these nonideal operating ranges is analogous to a similar type in incompressible flow. The other is characteristic only of compressible flow. The effect of variable axial-flow area is treated. Some implications of the basic conservation laws in the case of nonideal flow through cascades are discussed.

  13. uORFs with unusual translational start codons autoregulate expression of eukaryotic ornithine decarboxylase homologs

    PubMed Central

    Ivanov, Ivaylo P.; Loughran, Gary; Atkins, John F.

    2008-01-01

    In a minority of eukaryotic mRNAs, a small functional upstream ORF (uORF), often performing a regulatory role, precedes the translation start site for the main product(s). Here, conserved uORFs in numerous ornithine decarboxylase homologs are identified from yeast to mammals. Most have noncanonical evolutionarily conserved start codons, the main one being AUU, which has not been known as an initiator for eukaryotic chromosomal genes. The AUG-less uORF present in mouse antizyme inhibitor, one of the ornithine decarboxylase homologs in mammals, mediates polyamine-induced repression of the downstream main ORF. This repression is part of an autoregulatory circuit, and one of its sensors is the AUU codon, which suggests that translation initiation codon identity is likely used for regulation in eukaryotes. PMID:18626014

  14. Comparing Experiment and Computation of Hypersonic Laminar Boundary Layers with Isolated Roughness

    NASA Technical Reports Server (NTRS)

    Bathel, Brett F.; Iyer, Prahladh S.; Mahesh, Krishnan; Danehy, Paul M.; Inman, Jennifer A.; Jones, Stephen B.; Johansen, Craig T.

    2014-01-01

    Streamwise velocity profile behavior in a hypersonic laminar boundary layer in the presence of an isolated roughness element is presented for an edge Mach number of 8.2. Two different roughness element types are considered: a 2-mm tall, 4-mm diameter cylinder, and a 2-mm radius hemisphere. Measurements of the streamwise velocity behavior using nitric oxide (NO) planar laser-induced fluorescence (PLIF) molecular tagging velocimetry (MTV) have been performed on a 20-degree wedge model. The top surface of this model acts as a flat-plate and is oriented at 5 degrees with respect to the freestream flow. Computations using direct numerical simulation (DNS) of these flows have been performed and are compared to the measured velocity profiles. Particular attention is given to the characteristics of velocity profiles immediately upstream and downstream of the roughness elements. In these regions, the streamwise flow can experience strong deceleration or acceleration. An analysis in which experimentally measured MTV profile displacements are compared with DNS particle displacements is performed to determine if the assumption of constant velocity over the duration of the MTV measurement is valid. This assumption is typically made when reporting MTV-measured velocity profiles, and may result in significant errors when comparing MTV measurements to computations in regions with strong deceleration or acceleration. The DNS computations with the cylindrical roughness element presented in this paper were performed with and without air injection from a rectangular slot upstream of the cylinder. This was done to determine the extent to which gas seeding in the MTV measurements perturbs the boundary layer flowfield.

  15. Promoter-proximal rDNA terminator augments initiation by preventing disruption of the stable transcription complex caused by polymerase read-in

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Henderson, S.L.; Ryan, K.; Sollner-Webb, B.

    1989-02-01

    We have examined the mechanism by which transcriptional initiation at the mouse rDNA promoter is augmented by the RNA polymerase I terminator element that resides just upstream of it. Using templates in which terminator elements are instead positioned at the opposite side of the plasmid rather than proximal to the promoter, or conditions where transcription is terminated elsewhere in the plasmid by UV-induced lesions, we show that the terminator's stimulatory effect is not position dependent. Mouse terminator elements therefore do not stimulate via the previously postulated 'read-through enhancement' model in which terminated polymerases are handed off to an adjacent promotermore » in a concerted reaction. The position independence and orientation dependence of the terminator also makes it unlikely that the terminator functions as a promoter element or as an enhancer. Instead, terminators serve to augment initiation by preventing polymerases from reading completely around the plasmid and through the promoter from upstream, an event which we show interferes with subsequent rounds of initiation. Notably, this transcriptional interference arises because polymerase passage across a promoter disrupts the otherwise stable transcription complex, specifically releasing the bound transcription factor D. These liberated D molecules can then bind to other templates and activate their expression. The rDNA transcriptional interference is not due to a steric impediment to the binding of new polymerase molecules, and it does not similarly liberate the initiation-competent polymerase (factor C). These studies have also convincingly demonstrated that multiple rounds of transcription are obtained from rDNA template molecules in vitro.« less

  16. RNA from the 5' end of the R2 retrotransposon controls R2 protein binding to and cleavage of its DNA target site.

    PubMed

    Christensen, Shawn M; Ye, Junqiang; Eickbush, Thomas H

    2006-11-21

    Non-LTR retrotransposons insert into eukaryotic genomes by target-primed reverse transcription (TPRT), a process in which cleaved DNA targets are used to prime reverse transcription of the element's RNA transcript. Many of the steps in the integration pathway of these elements can be characterized in vitro for the R2 element because of the rigid sequence specificity of R2 for both its DNA target and its RNA template. R2 retrotransposition involves identical subunits of the R2 protein bound to different DNA sequences upstream and downstream of the insertion site. The key determinant regulating which DNA-binding conformation the protein adopts was found to be a 320-nt RNA sequence from near the 5' end of the R2 element. In the absence of this 5' RNA the R2 protein binds DNA sequences upstream of the insertion site, cleaves the first DNA strand, and conducts TPRT when RNA containing the 3' untranslated region of the R2 transcript is present. In the presence of the 320-nt 5' RNA, the R2 protein binds DNA sequences downstream of the insertion site. Cleavage of the second DNA strand by the downstream subunit does not appear to occur until after the 5' RNA is removed from this subunit. We postulate that the removal of the 5' RNA normally occurs during reverse transcription, and thus provides a critical temporal link to first- and second-strand DNA cleavage in the R2 retrotransposition reaction.

  17. Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene.

    PubMed Central

    Mavrothalassitis, G J; Watson, D K; Papas, T S

    1990-01-01

    The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical "TATA" and "CAAT" elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1400 base pairs (bp) upstream from the first major transcription initiation site. A G + C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long (approximately 250-bp) polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. This region of 159 bp contains putative binding sites for transcription factors Sp1 and AP2 (one for each), the GC element, one small forward repeat, one inverted repeat, and half of the polypurine-pyrimidine tract. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with "TATA-less" promoters. Images PMID:2405393

  18. An explicit mixed numerical method for mesoscale model

    NASA Technical Reports Server (NTRS)

    Hsu, H.-M.

    1981-01-01

    A mixed numerical method has been developed for mesoscale models. The technique consists of a forward difference scheme for time tendency terms, an upstream scheme for advective terms, and a central scheme for the other terms in a physical system. It is shown that the mixed method is conditionally stable and highly accurate for approximating the system of either shallow-water equations in one dimension or primitive equations in three dimensions. Since the technique is explicit and two time level, it conserves computer and programming resources.

  19. Computation of Laminar and Turbulent Flow in 90-Degree Square-Duct and Pipe Bends Using the Navier-Stokes Equations

    DTIC Science & Technology

    1982-04-01

    R.M. and Warming, R.F.: An Implicit Finite - Difference Algorithm for Hyperbolic Systems in Conservation Law Form. Journal of Computational Physics...Quincy Street C-40) Arlington, VA 22217 D 82 05-.10 I0, S4CURITY CLASSIFICATION OF THIS ’E(Wha, Doae Entotwed) Slength scale. Six different flow cases...forces upstream have produced a non-zero velocity gradient normal to the plane of curvature. Fluid with above (/below) average nioiiiei.tuili migrates

  20. Geographic variability in elevation and topographic constraints on the distribution of native and nonnative trout in the Great Basin

    USGS Publications Warehouse

    Warren, Dana R.; Dunham, Jason B.; Hockman-Wert, David

    2014-01-01

    Understanding local and geographic factors influencing species distributions is a prerequisite for conservation planning. Our objective in this study was to model local and geographic variability in elevations occupied by native and nonnative trout in the northwestern Great Basin, USA. To this end, we analyzed a large existing data set of trout presence (5,156 observations) to evaluate two fundamental factors influencing occupied elevations: climate-related gradients in geography and local constraints imposed by topography. We applied quantile regression to model upstream and downstream distribution elevation limits for each trout species commonly found in the region (two native and two nonnative species). With these models in hand, we simulated an upstream shift in elevation limits of trout distributions to evaluate potential consequences of habitat loss. Downstream elevation limits were inversely associated with latitude, reflecting regional gradients in temperature. Upstream limits were positively related to maximum stream elevation as expected. Downstream elevation limits were constrained topographically by valley bottom elevations in northern streams but not in southern streams, where limits began well above valley bottoms. Elevation limits were similar among species. Upstream shifts in elevation limits for trout would lead to more habitat loss in the north than in the south, a result attributable to differences in topography. Because downstream distributions of trout in the north extend into valley bottoms with reduced topographic relief, trout in more northerly latitudes are more likely to experience habitat loss associated with an upstream shift in lower elevation limits. By applying quantile regression to relatively simple information (species presence, elevation, geography, topography), we were able to identify elevation limits for trout in the Great Basin and explore the effects of potential shifts in these limits that could occur in response to changing climate conditions that alter streams directly (e.g., through changes in temperature and precipitation) or indirectly (e.g., through changing water use).

  1. On the primary variable switching technique for simulating unsaturated-saturated flows

    NASA Astrophysics Data System (ADS)

    Diersch, H.-J. G.; Perrochet, P.

    Primary variable switching appears as a promising numerical technique for variably saturated flows. While the standard pressure-based form of the Richards equation can suffer from poor mass balance accuracy, the mixed form with its improved conservative properties can possess convergence difficulties for dry initial conditions. On the other hand, variable switching can overcome most of the stated numerical problems. The paper deals with variable switching for finite elements in two and three dimensions. The technique is incorporated in both an adaptive error-controlled predictor-corrector one-step Newton (PCOSN) iteration strategy and a target-based full Newton (TBFN) iteration scheme. Both schemes provide different behaviors with respect to accuracy and solution effort. Additionally, a simplified upstream weighting technique is used. Compared with conventional approaches the primary variable switching technique represents a fast and robust strategy for unsaturated problems with dry initial conditions. The impact of the primary variable switching technique is studied over a wide range of mostly 2D and partly difficult-to-solve problems (infiltration, drainage, perched water table, capillary barrier), where comparable results are available. It is shown that the TBFN iteration is an effective but error-prone procedure. TBFN sacrifices temporal accuracy in favor of accelerated convergence if aggressive time step sizes are chosen.

  2. UCR1C is a novel activator of phosphodiesterase 4 (PDE4) long isoforms and attenuates cardiomyocyte hypertrophy.

    PubMed

    Wang, Li; Burmeister, Brian T; Johnson, Keven R; Baillie, George S; Karginov, Andrei V; Skidgel, Randal A; O'Bryan, John P; Carnegie, Graeme K

    2015-05-01

    Hypertrophy increases the risk of heart failure and arrhythmia. Prevention or reversal of the maladaptive hypertrophic phenotype has thus been proposed to treat heart failure. Chronic β-adrenergic receptor (β-AR) stimulation induces cardiomyocyte hypertrophy by elevating 3',5'-cyclic adenosine monophosphate (cAMP) levels and activating downstream effectors such protein kinase A (PKA). Conversely, hydrolysis of cAMP by phosphodiesterases (PDEs) spatiotemporally restricts cAMP signaling. Here, we demonstrate that PDE4, but not PDE3, is critical in regulating cardiomyocyte hypertrophy, and may represent a potential target for preventing maladaptive hypertrophy. We identify a sequence within the upstream conserved region 1 of PDE4D, termed UCR1C, as a novel activator of PDE4 long isoforms. UCR1C activates PDE4 in complex with A-kinase anchoring protein (AKAP)-Lbc resulting in decreased PKA signaling facilitated by AKAP-Lbc. Expression of UCR1C in cardiomyocytes inhibits hypertrophy in response to chronic β-AR stimulation. This effect is partially due to inhibition of nuclear PKA activity, which decreases phosphorylation of the transcription factor cAMP response element-binding protein (CREB). In conclusion, PDE4 activation by UCR1C attenuates cardiomyocyte hypertrophy by specifically inhibiting nuclear PKA activity. Published by Elsevier Inc.

  3. Cloning and characterization of microbial activated Aedes aegypti MEK4 (AaMEK4): influences of noncatalytic domains on enzymatic activity.

    PubMed

    Wu, R C-C; Cho, W-L

    2014-10-01

    Protein kinases are known to be involved in a number of signal transduction cascades. Both the stress-activated Jun N-terminal kinase (JNK) and mitogen-activated protein kinase (MAPK) p38 pathways have been shown to correlate with the insect immune response to microbial infection. MAP kinase kinase 4 (MEK4) is an upstream kinase of JNK and p38 kinase. The cDNA of AaMEK4 was cloned and characterized. AaMEK4 was activated by microbial lysates of Gram-positive, Gram-negative bacteria and yeast. The conserved lysine (K112 ) and the putative phosphorylation sites (S238 and T242 ) were shown to be important for kinase activity by site-directed mutagenesis. A common MAPK docking site (MAPK_dsA) was found and in addition, a new nearby docking site, MAPK_dsB, was identified in the N-terminal noncatalytic domain of AaMEK4. MAPK_dsB was shown to be a unique element in the MEK4 family. In this study, both MAPK_dsA and _dsB were demonstrated to be important to AaMEK4 enzymatic activity for the downstream protein kinase, Aap38. © 2014 The Royal Entomological Society.

  4. A super-family of transcriptional activators regulates bacteriophage packaging and lysis in Gram-positive bacteria

    PubMed Central

    Quiles-Puchalt, Nuria; Tormo-Más, María Ángeles; Campoy, Susana; Toledo-Arana, Alejandro; Monedero, Vicente; Lasa, Íñigo; Novick, Richard P.; Christie, Gail E.; Penadés, José R.

    2013-01-01

    The propagation of bacteriophages and other mobile genetic elements requires exploitation of the phage mechanisms involved in virion assembly and DNA packaging. Here, we identified and characterized four different families of phage-encoded proteins that function as activators required for transcription of the late operons (morphogenetic and lysis genes) in a large group of phages infecting Gram-positive bacteria. These regulators constitute a super-family of proteins, here named late transcriptional regulators (Ltr), which share common structural, biochemical and functional characteristics and are unique to this group of phages. They are all small basic proteins, encoded by genes present at the end of the early gene cluster in their respective phage genomes and expressed under cI repressor control. To control expression of the late operon, the Ltr proteins bind to a DNA repeat region situated upstream of the terS gene, activating its transcription. This involves the C-terminal part of the Ltr proteins, which control specificity for the DNA repeat region. Finally, we show that the Ltr proteins are the only phage-encoded proteins required for the activation of the packaging and lysis modules. In summary, we provide evidence that phage packaging and lysis is a conserved mechanism in Siphoviridae infecting a wide variety of Gram-positive bacteria. PMID:23771138

  5. [The role of integrons in dissemination of antibiotic resistance].

    PubMed

    Ploy, M C; Lambert, T; Gassama, A; Denis, F

    2000-01-01

    Bacteria can transfer genetic information to get protection against most antibiotics. The acquisition of resistance genes involves genetic mobile elements such as plasmids and transposons. Another genetic structures, named integrons, have been described and contain one or more gene cassettes located at a specific site. Integrons contain an intI gene encoding a site-specific recombinase belonging to the integrase family and a recombination site attI. A gene cassette includes an open reading frame and, at the 3'-end, a recombination site attC. Integration or excision of cassettes occurs by a site-specific recombination mechanism catalyzed by the integrase. However, insertion can rarely occur, at non-specific sites leading to a stable situation for the cassette. Cassettes are transcribed from a common promoter located in the 5'-conserved segment and expression of distal genes is reduced by the presence of upstream cassettes. Most gene cassettes encode antibiotic resistant determinants but antiseptic resistant genes have also been described. Integrons seem to have a major role in the spread of multidrug resistance in Gram-negative bacteria but integrons in Gram-positive bacteria have been recently described. Moreover, the finding of super-integrons with gene cassettes coding for other determinants (biochemical functions, virulence factors) in different Gram negative bacteria suggests that integrons are probably implied in bacterial genome evolution.

  6. Structural basis of UGUA recognition by the Nudix protein CFIm25 and implications for a regulatory role in mRNA 3′ processing

    PubMed Central

    Yang, Qin; Gilmartin, Gregory M.; Doublié, Sylvie

    2010-01-01

    Human Cleavage Factor Im (CFIm) is an essential component of the pre-mRNA 3′ processing complex that functions in the regulation of poly(A) site selection through the recognition of UGUA sequences upstream of the poly(A) site. Although the highly conserved 25 kDa subunit (CFIm25) of the CFIm complex possesses a characteristic α/β/α Nudix fold, CFIm25 has no detectable hydrolase activity. Here we report the crystal structures of the human CFIm25 homodimer in complex with UGUAAA and UUGUAU RNA sequences. CFIm25 is the first Nudix protein to be reported to bind RNA in a sequence-specific manner. The UGUA sequence contributes to binding specificity through an intramolecular G:A Watson–Crick/sugar-edge base interaction, an unusual pairing previously found to be involved in the binding specificity of the SAM-III riboswitch. The structures, together with mutational data, suggest a novel mechanism for the simultaneous sequence-specific recognition of two UGUA elements within the pre-mRNA. Furthermore, the mutually exclusive binding of RNA and the signaling molecule Ap4A (diadenosine tetraphosphate) by CFIm25 suggests a potential role for small molecules in the regulation of mRNA 3′ processing. PMID:20479262

  7. Structural basis of UGUA recognition by the Nudix protein CFI(m)25 and implications for a regulatory role in mRNA 3' processing.

    PubMed

    Yang, Qin; Gilmartin, Gregory M; Doublié, Sylvie

    2010-06-01

    Human Cleavage Factor Im (CFI(m)) is an essential component of the pre-mRNA 3' processing complex that functions in the regulation of poly(A) site selection through the recognition of UGUA sequences upstream of the poly(A) site. Although the highly conserved 25 kDa subunit (CFI(m)25) of the CFI(m) complex possesses a characteristic alpha/beta/alpha Nudix fold, CFI(m)25 has no detectable hydrolase activity. Here we report the crystal structures of the human CFI(m)25 homodimer in complex with UGUAAA and UUGUAU RNA sequences. CFI(m)25 is the first Nudix protein to be reported to bind RNA in a sequence-specific manner. The UGUA sequence contributes to binding specificity through an intramolecular G:A Watson-Crick/sugar-edge base interaction, an unusual pairing previously found to be involved in the binding specificity of the SAM-III riboswitch. The structures, together with mutational data, suggest a novel mechanism for the simultaneous sequence-specific recognition of two UGUA elements within the pre-mRNA. Furthermore, the mutually exclusive binding of RNA and the signaling molecule Ap(4)A (diadenosine tetraphosphate) by CFI(m)25 suggests a potential role for small molecules in the regulation of mRNA 3' processing.

  8. Modeling radium and radon transport through soil and vegetation

    USGS Publications Warehouse

    Kozak, J.A.; Reeves, H.W.; Lewis, B.A.

    2003-01-01

    A one-dimensional flow and transport model was developed to describe the movement of two fluid phases, gas and water, within a porous medium and the transport of 226Ra and 222Rn within and between these two phases. Included in this model is the vegetative uptake of water and aqueous 226Ra and 222Rn that can be extracted from the soil via the transpiration stream. The mathematical model is formulated through a set of phase balance equations and a set of species balance equations. Mass exchange, sink terms and the dependence of physical properties upon phase composition couple the two sets of equations. Numerical solution of each set, with iteration between the sets, is carried out leading to a set-iterative compositional model. The Petrov-Galerkin finite element approach is used to allow for upstream weighting if required for a given simulation. Mass lumping improves solution convergence and stability behavior. The resulting numerical model was applied to four problems and was found to produce accurate, mass conservative solutions when compared to published experimental and numerical results and theoretical column experiments. Preliminary results suggest that the model can be used as an investigative tool to determine the feasibility of phytoremediating radium and radon-contaminated soil. ?? 2003 Elsevier Science B.V. All rights reserved.

  9. Comparative Genomics of the Listeria monocytogenes ST204 Subgroup

    PubMed Central

    Fox, Edward M.; Allnutt, Theodore; Bradbury, Mark I.; Fanning, Séamus; Chandry, P. Scott

    2016-01-01

    The ST204 subgroup of Listeria monocytogenes is among the most frequently isolated in Australia from a range of environmental niches. In this study we provide a comparative genomics analysis of food and food environment isolates from geographically diverse sources. Analysis of the ST204 genomes showed a highly conserved core genome with the majority of variation seen in mobile genetic elements such as plasmids, transposons and phage insertions. Most strains (13/15) harbored plasmids, which although varying in size contained highly conserved sequences. Interestingly 4 isolates contained a conserved plasmid of 91,396 bp. The strains examined were isolated over a period of 12 years and from different geographic locations suggesting plasmids are an important component of the genetic repertoire of this subgroup and may provide a range of stress tolerance mechanisms. In addition to this 4 phage insertion sites and 2 transposons were identified among isolates, including a novel transposon. These genetic elements were highly conserved across isolates that harbored them, and also contained a range of genetic markers linked to stress tolerance and virulence. The maintenance of conserved mobile genetic elements in the ST204 population suggests these elements may contribute to the diverse range of niches colonized by ST204 isolates. Environmental stress selection may contribute to maintaining these genetic features, which in turn may be co-selecting for virulence markers relevant to clinical infection with ST204 isolates. PMID:28066377

  10. Comparative Genomics of the Listeria monocytogenes ST204 Subgroup.

    PubMed

    Fox, Edward M; Allnutt, Theodore; Bradbury, Mark I; Fanning, Séamus; Chandry, P Scott

    2016-01-01

    The ST204 subgroup of Listeria monocytogenes is among the most frequently isolated in Australia from a range of environmental niches. In this study we provide a comparative genomics analysis of food and food environment isolates from geographically diverse sources. Analysis of the ST204 genomes showed a highly conserved core genome with the majority of variation seen in mobile genetic elements such as plasmids, transposons and phage insertions. Most strains (13/15) harbored plasmids, which although varying in size contained highly conserved sequences. Interestingly 4 isolates contained a conserved plasmid of 91,396 bp. The strains examined were isolated over a period of 12 years and from different geographic locations suggesting plasmids are an important component of the genetic repertoire of this subgroup and may provide a range of stress tolerance mechanisms. In addition to this 4 phage insertion sites and 2 transposons were identified among isolates, including a novel transposon. These genetic elements were highly conserved across isolates that harbored them, and also contained a range of genetic markers linked to stress tolerance and virulence. The maintenance of conserved mobile genetic elements in the ST204 population suggests these elements may contribute to the diverse range of niches colonized by ST204 isolates. Environmental stress selection may contribute to maintaining these genetic features, which in turn may be co-selecting for virulence markers relevant to clinical infection with ST204 isolates.

  11. Stabilised finite-element methods for solving the level set equation with mass conservation

    NASA Astrophysics Data System (ADS)

    Kabirou Touré, Mamadou; Fahsi, Adil; Soulaïmani, Azzeddine

    2016-01-01

    Finite-element methods are studied for solving moving interface flow problems using the level set approach and a stabilised variational formulation proposed in Touré and Soulaïmani (2012; Touré and Soulaïmani To appear in 2016), coupled with a level set correction method. The level set correction is intended to enhance the mass conservation satisfaction property. The stabilised variational formulation (Touré and Soulaïmani 2012; Touré and Soulaïmani, To appear in 2016) constrains the level set function to remain close to the signed distance function, while the mass conservation is a correction step which enforces the mass balance. The eXtended finite-element method (XFEM) is used to take into account the discontinuities of the properties within an element. XFEM is applied to solve the Navier-Stokes equations for two-phase flows. The numerical methods are numerically evaluated on several test cases such as time-reversed vortex flow, a rigid-body rotation of Zalesak's disc, sloshing flow in a tank, a dam-break over a bed, and a rising bubble subjected to buoyancy. The numerical results show the importance of satisfying global mass conservation to accurately capture the interface position.

  12. Concentrations of mercury and other trace elements in walleye, smallmouth bass, and rainbow trout in Franklin D. Roosevelt Lake and the upper Columbia River, Washington, 1994

    USGS Publications Warehouse

    Munn, M.D.; Cox, S.E.; Dean, C.J.

    1995-01-01

    Three species of sportfish--walleye, smallmouth bass, and rainbow trout--were collected from Franklin D. Roosevelt Lake and the upstream reach of the Columbia River within the state of Washington, to determine the concentrations of mercury and other selected trace elements in fish tissue. Concentrations of total mercury in walleye fillets ranged from 0.11 to 0.44 milligram per kilogram, with the higher concentrations in the larger fish. Fillets of smallmouth bass and rainbow trout also contained mercury, but generally at lower concentrations. Other selected trace elements were found in fillet samples, but the concentrations were generally low depending on species and the specific trace element. The trace elements cadmium, copper, lead, and zinc were found in liver tissue of these same species with zinc consistently present in the highest concentration.

  13. Functional Architecture of T7 RNA Polymerase Transcription Complexes

    PubMed Central

    Nayak, Dhananjaya; Guo, Qing; Sousa, Rui

    2007-01-01

    Summary T7 RNA polymerase is the best-characterized member of a widespread family of single-subunit RNA polymerases. Crystal structures of T7 RNA polymerase initiation and elongation complexes have provided a wealth of detailed information on RNA polymerase interactions with the promoter and transcription bubble, but the absence of DNA downstream of the melted region of the template in the initiation complex structure, and the absence of DNA upstream of the transcription bubble in the elongation complex structure means that our picture of the functional architecture of T7 RNA polymerase transcription complexes remains incomplete. Here we use the site-specifically tethered chemical nucleases and functional characterization of directed T7 RNAP mutants to both reveal the architecture of the duplex DNA that flanks the transcription bubble in the T7 RNAP initiation and elongation complexes, and to define the function of the interactions made by these duplex elements. We find that downstream duplex interactions made with a cluster of lysines (K711/K713/K714) are present during both elongation and initiation where they contribute to stabilizing a bend in the downstream DNA that is important for promoter opening. The upstream DNA in the elongation complex is also found to be sharply bent at the upstream edge of the transcription bubble, thereby allowing formation of upstream duplex:polymerase interactions that contribute to elongation complex stability. PMID:17580086

  14. Identification of cis-elements and evaluation of upstream regulatory region of a rice anther-specific gene, OSIPP3, conferring pollen-specific expression in Oryza sativa (L.) ssp. indica.

    PubMed

    Manimaran, P; Raghurami Reddy, M; Bhaskar Rao, T; Mangrauthia, Satendra K; Sundaram, R M; Balachandran, S M

    2015-12-01

    Pollen-specific expression. Promoters comprise of various cis-regulatory elements which control development and physiology of plants by regulating gene expression. To understand the promoter specificity and also identification of functional cis-acting elements, progressive 5' deletion analysis of the promoter fragments is widely used. We have evaluated the activity of regulatory elements of 5' promoter deletion sequences of anther-specific gene OSIPP3, viz. OSIPP3-∆1 (1504 bp), OSIPP3-∆2 (968 bp), OSIPP3-∆3 (388 bp) and OSIPP3-∆4 (286 bp) through the expression of transgene GUS in rice. In silico analysis of 1504-bp sequence harboring different copy number of cis-acting regulatory elements such as POLLENLELAT52, GTGANTG10, enhancer element of LAT52 and LAT56 indicated that they were essential for high level of expression in pollen. Histochemical GUS analysis of the transgenic plants revealed that 1504- and 968-bp fragments directed GUS expression in roots and anthers, while the 388- and 286-bp fragments restricted the GUS expression to only pollen, of which 388 bp conferred strong GUS expression. Further, GUS staining analysis of different panicle development stages (P1-P6) confirmed that the GUS gene was preferentially expressed only at P6 stage (late pollen stage). The qRT-PCR analysis of GUS transcript revealed 23-fold higher expression of GUS transcript in OSIPP3-Δ1 followed by OSIPP3-Δ2 (eightfold) and OSIPP3-Δ3 (threefold) when compared to OSIPP3-Δ4. Based on our results, we proposed that among the two smaller fragments, the 388-bp upstream regulatory region could be considered as a promising candidate for pollen-specific expression of agronomically important transgenes in rice.

  15. Metal loading in Soda Butte Creek upstream of Yellowstone National Park, Montana and Wyoming; a retrospective analysis of previous research; and quantification of metal loading, August 1999

    USGS Publications Warehouse

    Boughton, G.K.

    2001-01-01

    Acid drainage from historic mining activities has affected the water quality and aquatic biota of Soda Butte Creek upstream of Yellowstone National Park. Numerous investigations focusing on metals contamination have been conducted in the Soda Butte Creek basin, but interpretations of how metals contamination is currently impacting Soda Butte Creek differ greatly. A retrospective analysis of previous research on metal loading in Soda Butte Creek was completed to provide summaries of studies pertinent to metal loading in Soda Butte Creek and to identify data gaps warranting further investigation. Identification and quantification of the sources of metal loading to Soda Butte Creek was recognized as a significant data gap. The McLaren Mine tailings impoundment and mill site has long been identified as a source of metals but its contribution relative to the total metal load entering Yellowstone National Park was unknown. A tracer-injection and synoptic-sampling study was designed to determine metal loads upstream of Yellowstone National Park.A tracer-injection and synoptic-sampling study was conducted on an 8,511-meter reach of Soda Butte Creek from upstream of the McLaren Mine tailings impoundment and mill site downstream to the Yellowstone National Park boundary in August 1999. Synoptic-sampling sites were selected to divide the creek into discrete segments. A lithium bromide tracer was injected continuously into Soda Butte Creek for 24.5 hours. Downstream dilution of the tracer and current-meter measurements were used to calculate the stream discharge. Stream discharge values, combined with constituent concentrations obtained by synoptic sampling, were used to quantify constituent loading in each segment of Soda Butte Creek.Loads were calculated for dissolved calcium, silica, and sulfate, as well as for dissolved and total-recoverable iron, aluminum, and manganese. Loads were not calculated for cadmium, copper, lead, and zinc because these elements were infrequently detected in mainstem synoptic samples. All of these elements were detected at high concentrations in the seeps draining the McLaren Mine tailings impoundment. The lack of detection of these elements in the downstream mainstem synoptic samples is probably because of sorption (coprecipitation and adsorption) to metal colloids in the stream.Most of the metal load that entered Soda Butte Creek was contributed by the inflows draining the McLaren Mine tailings impoundment (between 505 meters and 760 meters downstream from the tracer-injection site), Republic Creek (1,859 meters), and Unnamed Tributary (8,267 meters). Results indicate that treatment or removal of the McLaren Mine tailings impoundment would greatly reduce metal loading in Soda Butte Creek upstream of Yellowstone National Park. However, removing only that single source may not reduce metal loads to acceptable levels. The sources of metal loading in Republic Creek and Unnamed Tributary merit further investigation.

  16. RHIC Prefire Protection Masks

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Drees, A.; Biscardi, C.; Curcio, T.

    2015-01-07

    The protection of the RHIC experimental detectors from damage due to beam hitting close upstream elements in cases of abort kicker prefires requires some dedicated precautionary measures with two general options: to bring the beam close to a limiting aperture (i.e. the beam pipe wall), as far upstream of the detector components as possible or, alternatively, to bring a limiting aperture close to the circulating beam. During the FY 2014 RHIC Heavy Ion run the first option was chosen because of the limited time available for preparation before the start of the run. For future runs the second option, inmore » this case the installation of dual-sided movable masks, is preferred. The installation of the masks, one per ring, is planned before the start of the FY 2015 run.« less

  17. Water- and Bed-Sediment Quality of Seguchie Creek and Selected Wetlands Tributary to Mille Lacs Lake in Crow Wing County, Minnesota, October 2003 to October 2006

    USGS Publications Warehouse

    Fallon, James D.; Yaeger, Christine S.

    2009-01-01

    Mille Lacs Lake and its tributaries, located in east-central Minnesota, are important resources to the public. In addition, many wetlands and lakes that feed Mille Lacs Lake are of high resource quality and vulnerable to degradation. Construction of a new four-lane expansion of U.S. Highway 169 has been planned along the western part of the drainage area of Mille Lacs Lake in Crow Wing County. Concerns exist that the proposed highway could affect the resource quality of surface waters tributary to Mille Lacs Lake. Baseline water- and bed-sediment quality characteristics of surface waters tributary to Mille Lacs Lake were needed prior to the proposed highway construction. The U.S. Geological Survey, in cooperation with the Minnesota Department of Transportation, characterized the water- and bed-sediment quality at selected locations that the proposed route intersects from October 2003 to October 2006. Locations included Seguchie Creek upstream and downstream from the proposed route and three wetlands draining to Mille Lacs Lake. The mean streamflow of Seguchie Creek increased between the two sites: flow at the downstream streamflow-gaging station of 0.22 cubic meter per second was 5.6 percent greater than the mean streamflow at the upstream streamflow-gaging station of 0.21 cubic meter per second. Because of the large amount of storage immediately upstream from both gaging stations, increases in flow were gradual even during intense precipitation. The ranges of most constituent concentrations in water were nearly identical between the two sampling sites on Seguchie Creek. No concentrations exceeded applicable water-quality standards set by the State of Minnesota. Dissolved-oxygen concentrations at the downstream gaging station were less than the daily minimum standard of 4.0 milligrams per liter for 6 of 26 measurements. Constituent loads in Seguchie Creek were greater at the downstream site than the upstream site for all measured, including dissolved chloride (1.7 percent), ammonia plus organic nitrogen (13 percent), total phosphorus (62 percent), and suspended sediment (11 percent) during the study. All constituents had seasonal peaks in spring and fall. The large loads during the fall resulted from unusually large precipitation and streamflow patterns. This caused the two greatest streamflow peaks at both sites to occur during October (2004 and 2005). In Seguchie Creek, bed-sediment concentrations of five metals and trace elements (arsenic, cadmium, chromium, lead, and zinc) exceeded the Interim Sediment Quality Guidelines (ISQG) set by the Canadian Council of Ministers of the Environment. Bed-sediment samples from the upstream site had more exceedances of ISQGs for metals and trace elements than did samples from the downstream site (seven and two exceedances, respectively). Bed-sediment samples from the downstream site had more exceedances of ISQGs (20 exceedances) for semivolatile organic compounds than did samples from the upstream site (8 exceedances), indicating different sources for organic compounds than for metals and trace elements. Concentrations of 11 semivolatile organic compounds exceeded ISQGs: ancenaphthene, acenaphthylene, anthracene, benzo[a]anthracene, benzo[a]pyrene, chrysene, fluoranthene, fluorene, naphthalene, phenanthrene, and pyrene. In bed-sediment samples collected from three wetlands, concentrations of all six metals exceeded ISQGs: arsenic, cadmium, chromium, copper, lead, and zinc. Concentrations of three semivolatile organic compounds exceeded ISQGs: flouranthene, phenanthrene, and pyrene. Results indicate that areas appearing relatively undisturbed and of high resource value can have degraded quality from previous unknown land use.

  18. Southern Great Plains Rapid Ecoregional assessment—Volume I. Ecological communities

    USGS Publications Warehouse

    Reese, Gordon C.; Burris, Lucy; Carr, Natasha B.; Leinwand, Ian I.F.; Melcher, Cynthia P.

    2017-10-19

    The Southern Great Plains Rapid Ecoregional Assessment was conducted in partnership with the Bureau of Land Management (BLM) and the Great Plains Landscape Conservation Cooperative. The overall goal of the Rapid Ecoregional Assessments (REAs) is to compile and synthesize regional datasets to facilitate evaluation of the cumulative effects of change agents on priority ecological communities and species. In particular, the REAs identify and map the distribution of communities and wildlife habitats at broad spatial extents and provide assessments of ecological conditions. The REAs also identify where and to what degree ecological resources are currently at risk from change agents, such as development, fire, invasive species, and climate change. The REAs can help managers identify and prioritize potential areas for conservation or restoration, assess cumulative effects as required by the National Environmental Policy Act, and inform landscape-level planning and management decisions for multiple uses of public lands.Management questions form the basis for the REA framework and were developed in conjunction with the BLM and other stakeholders. Conservation elements are communities and species that are of regional management concern. Core management questions relate to the key ecological attributes and change agents associated with each conservation element. Integrated management questions synthesize the results of the primary core management questions into overall landscape-level ranks for each conservation element.The ecological communities evaluated as conservation elements are shortgrass, mixed-grass, and sand prairies; all grasslands; riparian and nonplaya wetlands; playa wetlands and saline lakes; and prairie streams and rivers. Species and species assemblages evaluated are the freshwater mussel assemblage, Arkansas River shiner (Notropis girardi), ferruginous hawk (Buteo regalis), lesser prairie chicken (Tympanuchus pallidicinctus), snowy plover (Charadrius nivosus), mountain plover (Charadrius montanus), long-billed curlew (Numenius americanus), interior least tern (Sternula antillarum athalassos), burrowing owl (Athene cunicularia hypugaea), black-tailed prairie dog (Cynomys ludovicianus), bat assemblage, swift fox (Vulpes velox), and mule deer (Odocoileus hemionus).The Southern Great Plains REA is summarized in a series of three reports and associated datasets. The pre-assessment report (available online at https://pubs.usgs.gov/of/2015/1003/) summarizes the process used by the REA stakeholders to select management questions, conservation elements, and change agents. It also provides background information for each conservation element. Volume I of the Southern Great Plains REA report (this volume) addresses the ecological communities. Volume II will address the species and species assemblages. All source and derived datasets used to produce the maps and graphs for REAs are available online at the BLM Landscape Approach Data Portal (https://landscape.blm.gov/geoportal/catalog/REAs/REAs.page).

  19. Molecular cloning and functional characterization of the promoter region of the human uncoupling protein-2 gene.

    PubMed

    Tu, N; Chen, H; Winnikes, U; Reinert, I; Marmann, G; Pirke, K M; Lentes, K U

    1999-11-19

    As a member of the uncoupling protein family, UCP2 is ubiquitously expressed in rodents and humans, implicating a major role in thermogenesis. To analyze promoter function and regulatory motifs involved in the transcriptional regulation of UCP2 gene expression, 3.3 kb of 5'-flanking region of the human UCP2 (hUCP2) gene have been cloned. Sequence analysis showed that the promoter region of hUCP2 lacks a classical TATA or CAAT box, however, appeared GC-rich resulting in the presence of several Sp-1 motifs and Ap-1/-2 binding sites near the transcription initiation site. Functional characterization of human UCP2 promoter-CAT fusion constructs in transient expression assays showed that minimal promoter activity was observed within 65 bp upstream of the transcriptional start site (+1). 75 bp further upstream (from nt -141 to -66) a strong cis-acting regulatory element (or enhancer) was identified, which significantly enhanced basal promoter activity. The regulation of human UCP2 gene expression involves complex interactions among positive and negative regulatory elements distributed over a minimum of 3.3 kb of the promoter region. Copyright 1999 Academic Press.

  20. Parallel CE/SE Computations via Domain Decomposition

    NASA Technical Reports Server (NTRS)

    Himansu, Ananda; Jorgenson, Philip C. E.; Wang, Xiao-Yen; Chang, Sin-Chung

    2000-01-01

    This paper describes the parallelization strategy and achieved parallel efficiency of an explicit time-marching algorithm for solving conservation laws. The Space-Time Conservation Element and Solution Element (CE/SE) algorithm for solving the 2D and 3D Euler equations is parallelized with the aid of domain decomposition. The parallel efficiency of the resultant algorithm on a Silicon Graphics Origin 2000 parallel computer is checked.

  1. Electron cooling and finite potential drop in a magnetized plasma expansion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martinez-Sanchez, M.; Navarro-Cavallé, J.; Ahedo, E.

    2015-05-15

    The steady, collisionless, slender flow of a magnetized plasma into a surrounding vacuum is considered. The ion component is modeled as mono-energetic, while electrons are assumed Maxwellian upstream. The magnetic field has a convergent-divergent geometry, and attention is restricted to its paraxial region, so that 2D and drift effects are ignored. By using the conservation of energy and magnetic moment of particles and the quasi-neutrality condition, the ambipolar electric field and the distribution functions of both species are calculated self-consistently, paying attention to the existence of effective potential barriers associated to magnetic mirroring. The solution is used to find themore » total potential drop for a set of upstream conditions, plus the axial evolution of various moments of interest (density, temperatures, and heat fluxes). The results illuminate the behavior of magnetic nozzles, plasma jets, and other configurations of interest, showing, in particular, in the divergent plasma the collisionless cooling of electrons, and the generation of collisionless electron heat fluxes.« less

  2. Sleep-Active Neurons: Conserved Motors of Sleep

    PubMed Central

    Bringmann, Henrik

    2018-01-01

    Sleep is crucial for survival and well-being. This behavioral and physiological state has been studied in all major genetically accessible model animals, including rodents, fish, flies, and worms. Genetic and optogenetic studies have identified several neurons that control sleep, making it now possible to compare circuit mechanisms across species. The “motor” of sleep across animal species is formed by neurons that depolarize at the onset of sleep to actively induce this state by directly inhibiting wakefulness. These sleep-inducing neurons are themselves controlled by inhibitory or activating upstream pathways, which act as the “drivers” of the sleep motor: arousal inhibits “sleep-active” neurons whereas various sleep-promoting “tiredness” pathways converge onto sleep-active neurons to depolarize them. This review provides the first overview of sleep-active neurons across the major model animals. The occurrence of sleep-active neurons and their regulation by upstream pathways in both vertebrate and invertebrate species suggests that these neurons are general and ancient components that evolved early in the history of nervous systems. PMID:29618588

  3. On the Instability of Large Slopes in the Upstream of Wu River, Taiwan

    NASA Astrophysics Data System (ADS)

    Shou, Keh-Jian; Lin, Jia-Fei

    2015-04-01

    Considering the existence of various types of landslides (shallow and deep-seated) and the importance of protection targets (the landslide might affect a residential area, cut a road, isolate a village, etc.), this study aims to analyze the landslide susceptibility along the Lixing Industrial Road, i.e., Nantou County Road # 89, in the upstream of Wu River. Focusing on the selected typical large scale landslides, the data and information of the landslides were collected from the field and the government (including the local government, the Soil and Water Conservation Bureau, and the highway agencies). Based on the data of Li-DAR and the information from boreholes, the temporal behavior and the complex mechanism of large scale landslides were analyzed. To assess the spatial hazard of the landslides, probabilistic analysis was applied. The study of the landslide mechanism can help to understand the behavior of landslides in similar geologic conditions, and the results of hazard analysis can be applied for risk prevention and management in the study area.

  4. Phylogenetic analysis reveals conservation and diversification of micro RNA166 genes among diverse plant species.

    PubMed

    Barik, Suvakanta; SarkarDas, Shabari; Singh, Archita; Gautam, Vibhav; Kumar, Pramod; Majee, Manoj; Sarkar, Ananda K

    2014-01-01

    Similar to the majority of the microRNAs, mature miR166s are derived from multiple members of MIR166 genes (precursors) and regulate various aspects of plant development by negatively regulating their target genes (Class III HD-ZIP). The evolutionary conservation or functional diversification of miRNA166 family members remains elusive. Here, we show the phylogenetic relationships among MIR166 precursor and mature sequences from three diverse model plant species. Despite strong conservation, some mature miR166 sequences, such as ppt-miR166m, have undergone sequence variation. Critical sequence variation in ppt-miR166m has led to functional diversification, as it targets non-HD-ZIPIII gene transcript (s). MIR166 precursor sequences have diverged in a lineage specific manner, and both precursors and mature osa-miR166i/j are highly conserved. Interestingly, polycistronic MIR166s were present in Physcomitrella and Oryza but not in Arabidopsis. The nature of cis-regulatory motifs on the upstream promoter sequences of MIR166 genes indicates their possible contribution to the functional variation observed among miR166 species. Copyright © 2013 Elsevier Inc. All rights reserved.

  5. Mass-conservative reconstruction of Galerkin velocity fields for transport simulations

    NASA Astrophysics Data System (ADS)

    Scudeler, C.; Putti, M.; Paniconi, C.

    2016-08-01

    Accurate calculation of mass-conservative velocity fields from numerical solutions of Richards' equation is central to reliable surface-subsurface flow and transport modeling, for example in long-term tracer simulations to determine catchment residence time distributions. In this study we assess the performance of a local Larson-Niklasson (LN) post-processing procedure for reconstructing mass-conservative velocities from a linear (P1) Galerkin finite element solution of Richards' equation. This approach, originally proposed for a-posteriori error estimation, modifies the standard finite element velocities by imposing local conservation on element patches. The resulting reconstructed flow field is characterized by continuous fluxes on element edges that can be efficiently used to drive a second order finite volume advective transport model. Through a series of tests of increasing complexity that compare results from the LN scheme to those using velocity fields derived directly from the P1 Galerkin solution, we show that a locally mass-conservative velocity field is necessary to obtain accurate transport results. We also show that the accuracy of the LN reconstruction procedure is comparable to that of the inherently conservative mixed finite element approach, taken as a reference solution, but that the LN scheme has much lower computational costs. The numerical tests examine steady and unsteady, saturated and variably saturated, and homogeneous and heterogeneous cases along with initial and boundary conditions that include dry soil infiltration, alternating solute and water injection, and seepage face outflow. Typical problems that arise with velocities derived from P1 Galerkin solutions include outgoing solute flux from no-flow boundaries, solute entrapment in zones of low hydraulic conductivity, and occurrences of anomalous sources and sinks. In addition to inducing significant mass balance errors, such manifestations often lead to oscillations in concentration values that can moreover cause the numerical solution to explode. These problems do not occur when using LN post-processed velocities.

  6. Temporal genetic monitoring of hybridization between native westslope cutthroat trout and introduced rainbow trout in the Stehekin River, Washington

    USGS Publications Warehouse

    Ostberg, Carl O.; Chase, Dorothy M.

    2012-01-01

    Introgressive hybridization with introduced rainbow trout (RBT) (Oncorhynchus mykiss) has led to the loss of native cutthroat trout species (O. clarkii) throughout their range, creating conservation concerns. Monitoring temporal hybridization trends provides resource managers with a tool for determining population status and information for establishing conservation goals for native cutthroat trout. In this study, we re-sampled six locations in 2010 within the Stehekin River watershed, North Cascades National Park, which were originally sampled between 1999 and 2003. We used genetic markers to monitor changes in hybridization levels between sampling periods in the native westslope cutthroat trout (WCT) (O. c. lewisi) stemming from past RBT introductions. Additionally, two new locations from the lower Stehekin drainage were added to the baseline data. We found that the frequency of WCT, RBT, and their hybrids was not significantly different between monitoring periods, but that RBT allele frequencies decreased in two locations and increased in one location. We also found a consistent, substantial reduction in the frequency of RBT alleles over the monitoring period in the Stehekin River upstream of Bridge Creek (SR3) compared to the Stehekin River downstream of Bridge Creek (SR1 -2) and within lower Bridge Creek (BR1) although these three locations are confined to a small geographic area (approximately 5 km). Ecological and/or evolutionary processes likely restrict the dispersal of RBT alleles in the Stehekin River upstream of Bridge Creek.

  7. The positive regulatory function of the 5'-proximal open reading frames in GCN4 mRNA can be mimicked by heterologous, short coding sequences.

    PubMed Central

    Williams, N P; Mueller, P P; Hinnebusch, A G

    1988-01-01

    Translational control of GCN4 expression in the yeast Saccharomyces cerevisiae is mediated by multiple AUG codons present in the leader of GCN4 mRNA, each of which initiates a short open reading frame of only two or three codons. Upstream AUG codons 3 and 4 are required to repress GCN4 expression in normal growth conditions; AUG codons 1 and 2 are needed to overcome this repression in amino acid starvation conditions. We show that the regulatory function of AUG codons 1 and 2 can be qualitatively mimicked by the AUG codons of two heterologous upstream open reading frames (URFs) containing the initiation regions of the yeast genes PGK and TRP1. These AUG codons inhibit GCN4 expression when present singly in the mRNA leader; however, they stimulate GCN4 expression in derepressing conditions when inserted upstream from AUG codons 3 and 4. This finding supports the idea that AUG codons 1 and 2 function in the control mechanism as translation initiation sites and further suggests that suppression of the inhibitory effects of AUG codons 3 and 4 is a general consequence of the translation of URF 1 and 2 sequences upstream. Several observations suggest that AUG codons 3 and 4 are efficient initiation sites; however, these sequences do not act as positive regulatory elements when placed upstream from URF 1. This result suggests that efficient translation is only one of the important properties of the 5' proximal URFs in GCN4 mRNA. We propose that a second property is the ability to permit reinitiation following termination of translation and that URF 1 is optimized for this regulatory function. Images PMID:3065626

  8. Whole body-element composition of Atlantic salmon Salmo salar influenced by migration direction and life stage in three distinct populations.

    PubMed

    Ebel, J D; Leroux, S J; Robertson, M J; Dempson, J B

    2016-11-01

    Body-element content was measured for three life stages of wild Atlantic salmon Salmo salar from three distinct Newfoundland populations as individuals crossed between freshwater and marine ecosystems. Life stage explained most of the variation in observed body-element concentration whereas river of capture explained very little variation. Element composition of downstream migrating post-spawn adults (i.e. kelts) and juvenile smolts were similar and the composition of these two life stages strongly differed from adults migrating upstream to spawn. Low variation within life stages and across populations suggests that S. salar may exert rheostatic control of their body-element composition. Additionally, observed differences in trace element concentration between adults and other life stages were probably driven by the high carbon concentration in adults because abundant elements, such as carbon, can strongly influence the observed concentrations of less abundant elements. Thus, understanding variation among individuals in trace elements composition requires the measurement of more abundant elements. Changes in element concentration with ontogeny have important consequences the role of fishes in ecosystem nutrient cycling and should receive further attention. © 2016 The Fisheries Society of the British Isles.

  9. Finite elements and finite differences for transonic flow calculations

    NASA Technical Reports Server (NTRS)

    Hafez, M. M.; Murman, E. M.; Wellford, L. C.

    1978-01-01

    The paper reviews the chief finite difference and finite element techniques used for numerical solution of nonlinear mixed elliptic-hyperbolic equations governing transonic flow. The forms of the governing equations for unsteady two-dimensional transonic flow considered are the Euler equation, the full potential equation in both conservative and nonconservative form, the transonic small-disturbance equation in both conservative and nonconservative form, and the hodograph equations for the small-disturbance case and the full-potential case. Finite difference methods considered include time-dependent methods, relaxation methods, semidirect methods, and hybrid methods. Finite element methods include finite element Lax-Wendroff schemes, implicit Galerkin method, mixed variational principles, dual iterative procedures, optimal control methods and least squares.

  10. Transforming Growth Factor-β/SMAD Target Gene SKIL Is Negatively Regulated by the Transcriptional Cofactor Complex SNON-SMAD4*

    PubMed Central

    Tecalco-Cruz, Angeles C.; Sosa-Garrocho, Marcela; Vázquez-Victorio, Genaro; Ortiz-García, Layla; Domínguez-Hüttinger, Elisa; Macías-Silva, Marina

    2012-01-01

    The human SKI-like (SKIL) gene encodes the SMAD transcriptional corepressor SNON that antagonizes TGF-β signaling. SNON protein levels are tightly regulated by the TGF-β pathway: whereas a short stimulation with TGF-β decreases SNON levels by its degradation via the proteasome, longer TGF-β treatment increases SNON levels by inducing SKIL gene expression. Here, we investigated the molecular mechanisms involved in the self-regulation of SKIL gene expression by SNON. Bioinformatics analysis showed that the human SKIL gene proximal promoter contains a TGF-β response element (TRE) bearing four groups of SMAD-binding elements that are also conserved in mouse. Two regions of 408 and 648 bp of the human SKIL gene (∼2.4 kb upstream of the ATG initiation codon) containing the core promoter, transcription start site, and the TRE were cloned for functional analysis. Binding of SMAD and SNON proteins to the TRE region of the SKIL gene promoter after TGF-β treatment was demonstrated by ChIP and sequential ChIP assays. Interestingly, the SNON-SMAD4 complex negatively regulated basal SKIL gene expression through binding the promoter and recruiting histone deacetylases. In response to TGF-β signal, SNON is removed from the SKIL gene promoter, and then the activated SMAD complexes bind the promoter to induce SKIL gene expression. Subsequently, the up-regulated SNON protein in complex with SMAD4 represses its own expression as part of the negative feedback loop regulating the TGF-β pathway. Accordingly, when the SNON-SMAD4 complex is absent as in some cancer cells lacking SMAD4 the regulation of some TGF-β target genes is modified. PMID:22674574

  11. Recruitment of the proneural gene scute to the Drosophila sex-determination pathway.

    PubMed Central

    Wrischnik, Lisa A; Timmer, John R; Megna, Lisa A; Cline, Thomas W

    2003-01-01

    In flies, scute (sc) works with its paralogs in the achaete-scute-complex (ASC) to direct neuronal development. However, in the family Drosophilidae, sc also acquired a role in the primary event of sex determination, X chromosome counting, by becoming an X chromosome signal element (XSE)-an evolutionary step shown here to have occurred after sc diverged from its closest paralog, achaete (ac). Two temperature-sensitive alleles, sc(sisB2) and sc(sisB3), which disrupt only sex determination, were recovered in a powerful F1 genetic selection and used to investigate how sc was recruited to the sex-determination pathway. sc(sisB2) revealed 3' nontranscribed regulatory sequences likely to be involved. The sc(sisB2) lesion abolished XSE activity when combined with mutations engineered in a sequence upstream of all XSEs. In contrast, changes in Sc protein sequence seem not to have been important for recruitment. The observation that the other new allele, sc(sisB3), eliminates the C-terminal half of Sc without affecting neurogenesis and that sc(sisB1), the most XSE-specific allele previously available, is a nonsense mutant, would seem to suggest the opposite, but we show that housefly Sc can substitute for fruit fly Sc in sex determination, despite lacking Drosophilidae-specific conserved residues in its C-terminal half. Lack of synergistic lethality among mutations in sc, twist, and dorsal argue against a proposed role for sc in mesoderm formation that had seemed potentially relevant to sex-pathway recruitment. The screen that yielded new sc alleles also generated autosomal duplications that argue against the textbook view that fruit fly sex signal evolution recruited a set of autosomal signal elements comparable to the XSEs. PMID:14704182

  12. Transforming growth factor-β/SMAD Target gene SKIL is negatively regulated by the transcriptional cofactor complex SNON-SMAD4.

    PubMed

    Tecalco-Cruz, Angeles C; Sosa-Garrocho, Marcela; Vázquez-Victorio, Genaro; Ortiz-García, Layla; Domínguez-Hüttinger, Elisa; Macías-Silva, Marina

    2012-08-03

    The human SKI-like (SKIL) gene encodes the SMAD transcriptional corepressor SNON that antagonizes TGF-β signaling. SNON protein levels are tightly regulated by the TGF-β pathway: whereas a short stimulation with TGF-β decreases SNON levels by its degradation via the proteasome, longer TGF-β treatment increases SNON levels by inducing SKIL gene expression. Here, we investigated the molecular mechanisms involved in the self-regulation of SKIL gene expression by SNON. Bioinformatics analysis showed that the human SKIL gene proximal promoter contains a TGF-β response element (TRE) bearing four groups of SMAD-binding elements that are also conserved in mouse. Two regions of 408 and 648 bp of the human SKIL gene (∼2.4 kb upstream of the ATG initiation codon) containing the core promoter, transcription start site, and the TRE were cloned for functional analysis. Binding of SMAD and SNON proteins to the TRE region of the SKIL gene promoter after TGF-β treatment was demonstrated by ChIP and sequential ChIP assays. Interestingly, the SNON-SMAD4 complex negatively regulated basal SKIL gene expression through binding the promoter and recruiting histone deacetylases. In response to TGF-β signal, SNON is removed from the SKIL gene promoter, and then the activated SMAD complexes bind the promoter to induce SKIL gene expression. Subsequently, the up-regulated SNON protein in complex with SMAD4 represses its own expression as part of the negative feedback loop regulating the TGF-β pathway. Accordingly, when the SNON-SMAD4 complex is absent as in some cancer cells lacking SMAD4 the regulation of some TGF-β target genes is modified.

  13. Organic carbon, and major and trace element dynamic and fate in a large river subjected to poorly-regulated urban and industrial pressures (Sebou River, Morocco).

    PubMed

    Hayzoun, H; Garnier, C; Durrieu, G; Lenoble, V; Le Poupon, C; Angeletti, B; Ouammou, A; Mounier, S

    2015-01-01

    An annual-basis study of the impacts of the anthropogenic inputs from Fez urban area on the water geochemistry of the Sebou and Fez Rivers was conducted mostly focusing on base flow conditions, in addition to the sampling of industrial wastewater characteristic of the various pressures in the studied environment. The measured trace metals dissolved/particulate partitioning was compared to the ones predicted using the WHAM-VII chemical speciation code. The Sebou River, upstream from Fez city, showed a weakly polluted status. Contrarily, high levels of major ions, organic carbon and trace metals were encountered in the Fez River and the Sebou River downstream the Fez inputs, due to the discharge of urban and industrial untreated and hugely polluted wastewaters. Trace metals were especially enriched in particles with levels even exceeding those recorded in surface sediments. The first group of elements (Al, Fe, Mn, Ti, U and V) showed strong inter-relationships, impoverishment in Fez particles/sediments and stable partition coefficient (Kd), linked to their lithogenic origin from Sebou watershed erosion. Conversely, most of the studied trace metals/metalloids, originated from anthropogenic sources, underwent significant changes of Kd and behaved non-conservatively in the Sebou/Fez water mixing. Dissolved/particulate partitioning was correctly assessed by WHAM-VII modeling for Cu, Pb and Zn, depicting significant differences in chemical speciation in the Fez River when compared to that in the Sebou River. The results of this study demonstrated that a lack of compliance in environmental regulations certainly explained this poor status. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Characterization of 5' end of human thromboxane receptor gene. Organizational analysis and mapping of protein kinase C--responsive elements regulating expression in platelets.

    PubMed

    D'Angelo, D D; Davis, M G; Houser, W A; Eubank, J J; Ritchie, M E; Dorn, G W

    1995-09-01

    Platelet thromboxane receptors are acutely and reversibly upregulated after acute myocardial infarction. To determine if platelet thromboxane receptors are under transcriptional control, we isolated and characterized human genomic DNA clones containing the 5' flanking region of the thromboxane receptor gene. The exon-intron structure of the 5' portion of the thromboxane receptor gene was determined initially by comparing the nucleotide sequence of the 5' flanking genomic clone with that of a novel human uterine thromboxane receptor cDNA that extended the mRNA 141 bp further upstream than the previously identified human placental cDNA. A major transcription initiation site was located in three human tissues approximately 560 bp upstream from the translation initiation codon and 380 bp upstream from any previously identified transcription initiation site. The thromboxane receptor gene has neither a TATA nor a CAAT consensus site. Promoter function of the 5' flanking region of the thromboxane receptor gene was evaluated by transfection of thromboxane receptor gene promoter/chloramphenicol acetyltransferase (CAT) chimera plasmids into platelet-like K562 cells. Thromboxane receptor promoter activity, as assessed by CAT expression, was relatively weak but was significantly enhanced by phorbol ester treatment. Functional analysis of 5' deletion constructs in transfected K562 cells and gel mobility shift localized the major phorbol ester-responsive motifs in the thromboxane receptor gene promoter to a cluster of activator protein-2 (AP-2) binding consensus sites located approximately 1.8 kb 5' from the transcription initiation site. These studies are the first to determine the structure and organization of the 5' end of the thromboxane receptor gene and demonstrate that thromboxane receptor gene expression can be regulated by activation of protein kinase C via induction of an AP-2-like nuclear factor binding to upstream promoter elements. These findings strongly suggest that the mechanism for previously described upregulation of platelet thromboxane receptors after acute myocardial infarction is increased thromboxane receptor gene transcription in platelet-progenitor cells.

  15. Disrupted auto-regulation of the spliceosomal gene SNRPB causes cerebro–costo–mandibular syndrome

    PubMed Central

    Lynch, Danielle C.; Revil, Timothée; Schwartzentruber, Jeremy; Bhoj, Elizabeth J.; Innes, A. Micheil; Lamont, Ryan E.; Lemire, Edmond G.; Chodirker, Bernard N.; Taylor, Juliet P.; Zackai, Elaine H.; McLeod, D. Ross; Kirk, Edwin P.; Hoover-Fong, Julie; Fleming, Leah; Savarirayan, Ravi; Boycott, Kym; MacKenzie, Alex; Brudno, Michael; Bulman, Dennis; Dyment, David; Majewski, Jacek; Jerome-Majewska, Loydie A.; Parboosingh, Jillian S.; Bernier, Francois P.

    2014-01-01

    Elucidating the function of highly conserved regulatory sequences is a significant challenge in genomics today. Certain intragenic highly conserved elements have been associated with regulating levels of core components of the spliceosome and alternative splicing of downstream genes. Here we identify mutations in one such element, a regulatory alternative exon of SNRPB as the cause of cerebro–costo–mandibular syndrome. This exon contains a premature termination codon that triggers nonsense-mediated mRNA decay when included in the transcript. These mutations cause increased inclusion of the alternative exon and decreased overall expression of SNRPB. We provide evidence for the functional importance of this conserved intragenic element in the regulation of alternative splicing and development, and suggest that the evolution of such a regulatory mechanism has contributed to the complexity of mammalian development. PMID:25047197

  16. Disrupted auto-regulation of the spliceosomal gene SNRPB causes cerebro-costo-mandibular syndrome.

    PubMed

    Lynch, Danielle C; Revil, Timothée; Schwartzentruber, Jeremy; Bhoj, Elizabeth J; Innes, A Micheil; Lamont, Ryan E; Lemire, Edmond G; Chodirker, Bernard N; Taylor, Juliet P; Zackai, Elaine H; McLeod, D Ross; Kirk, Edwin P; Hoover-Fong, Julie; Fleming, Leah; Savarirayan, Ravi; Majewski, Jacek; Jerome-Majewska, Loydie A; Parboosingh, Jillian S; Bernier, Francois P

    2014-07-22

    Elucidating the function of highly conserved regulatory sequences is a significant challenge in genomics today. Certain intragenic highly conserved elements have been associated with regulating levels of core components of the spliceosome and alternative splicing of downstream genes. Here we identify mutations in one such element, a regulatory alternative exon of SNRPB as the cause of cerebro-costo-mandibular syndrome. This exon contains a premature termination codon that triggers nonsense-mediated mRNA decay when included in the transcript. These mutations cause increased inclusion of the alternative exon and decreased overall expression of SNRPB. We provide evidence for the functional importance of this conserved intragenic element in the regulation of alternative splicing and development, and suggest that the evolution of such a regulatory mechanism has contributed to the complexity of mammalian development.

  17. Influence of the conservative rotor loads on the near wake of a wind turbine

    NASA Astrophysics Data System (ADS)

    Herráez, I.; Micallef, D.; van Kuik, G. A. M.

    2017-05-01

    The presence of conservative forces on rotor blades is neglected in the blade element theory and all the numerical methods derived from it (like e.g. the blade element momentum theory and the actuator line technique). This might seem a reasonable simplification of the real flow of rotor blades, since conservative loads, by definition, do not contribute to the power conversion. However, conservative loads originating from the chordwise bound vorticity might affect the tip vortex trajectory, as we discussed in a previous work. In that work we also hypothesized that this effect, in turn, could influence the wake induction and correspondingly the rotor performance. In the current work we extend a standard actuator line model in order to account for the conservative loads at the blade tip. This allows to isolate the influence of conservative forces from other effects. The comparison of numerical results with and without conservative loads enables to confirm qualitatively their relevance for the near wake and the rotor performance. However, an accurate quantitative assessment of the effect still remains out of reach due to the inherent uncertainty of the numerical model.

  18. Efficiency of plasma actuator ionization in shock wave modification in a rarefied supersonic flow over a flat plate

    NASA Astrophysics Data System (ADS)

    Joussot, Romain; Lago, Viviana; Parisse, Jean-Denis

    2014-12-01

    This paper describes experimental and numerical investigations focused on the shock wave modification, induced by a dc glow discharge, of a Mach 2 flow under rarefied regime. The model under investigation is a flat plate equipped with a plasma actuator composed of two electrodes. The glow discharge is generated by applying a negative potential to the upstream electrode, enabling the creation of a weakly ionized plasma. The natural flow (i.e. without the plasma) exhibits a thick laminar boundary layer and a shock wave with a hyperbolic shape. Images of the flow obtained with an ICCD camera revealed that the plasma discharge induces an increase in the shock wave angle. Thermal effects (volumetric, and at the surface) and plasma effects (ionization, and thermal non-equilibrium) are the most relevant processes explaining the observed modifications. The effect induced by the heating of the flat plate surface is studied experimentally by replacing the upstream electrode by a heating element, and numerically by modifying the thermal boundary condition of the model surface. The results show that for a similar temperature distribution over the plate surface, modifications induced by the heating element are lower than those produced by the plasma. This difference shows that other effects than purely thermal effects are involved with the plasma actuator. Measurements of the electron density with a Langmuir probe highlight the fact that the ionization degree plays an important role into the modification of the flow. The gas properties, especially the isentropic exponent, are indeed modified by the plasma above the actuator and upstream the flat plate. This leads to a local modification of the flow conditions, inducing an increase in the shock wave angle.

  19. A real-time control system of gene expression using ligand-bound nucleic acid aptamer for metabolic engineering.

    PubMed

    Wang, Jing; Cui, Xun; Yang, Le; Zhang, Zhe; Lv, Liping; Wang, Haoyuan; Zhao, Zhenmin; Guan, Ningzi; Dong, Lichun; Chen, Rachel

    2017-07-01

    Artificial control of bio-functions through regulating gene expression is one of the most important and attractive technologies to build novel living systems that are useful in the areas of chemical synthesis, nanotechnology, pharmacology, cell biology. Here, we present a novel real-time control system of gene regulation that includes an enhancement element by introducing duplex DNA aptamers upstream promoter and a repression element by introducing a RNA aptamer upstream ribosome binding site. With the presence of ligands corresponding to the DNA aptamers, the expression of the target gene can be potentially enhanced at the transcriptional level by strengthening the recognition capability of RNAP to the recognition region and speeding up the separation efficiency of the unwinding region due to the induced DNA bubble around the thrombin-bound aptamers; while with the presence of RNA aptamer ligand, the gene expression can be repressed at the translational level by weakening the recognition capability of ribosome to RBS due to the shielding of RBS by the formed aptamer-ligand complex upstream RBS. The effectiveness and potential utility of the developed gene regulation system were demonstrated by regulating the expression of ecaA gene in the cell-free systems. The realistic metabolic engineering application of the system has also tested by regulating the expression of mgtC gene and thrombin cDNA in Escherichia coli JD1021 for controlling metabolic flux and improving thrombin production, verifying that the real-time control system of gene regulation is able to realize the dynamic regulation of gene expression with potential applications in bacterial physiology studies and metabolic engineering. Copyright © 2017. Published by Elsevier Inc.

  20. Genomic dissection of conserved transcriptional regulation in intestinal epithelial cells

    PubMed Central

    Camp, J. Gray; Weiser, Matthew; Cocchiaro, Jordan L.; Kingsley, David M.; Furey, Terrence S.; Sheikh, Shehzad Z.; Rawls, John F.

    2017-01-01

    The intestinal epithelium serves critical physiologic functions that are shared among all vertebrates. However, it is unknown how the transcriptional regulatory mechanisms underlying these functions have changed over the course of vertebrate evolution. We generated genome-wide mRNA and accessible chromatin data from adult intestinal epithelial cells (IECs) in zebrafish, stickleback, mouse, and human species to determine if conserved IEC functions are achieved through common transcriptional regulation. We found evidence for substantial common regulation and conservation of gene expression regionally along the length of the intestine from fish to mammals and identified a core set of genes comprising a vertebrate IEC signature. We also identified transcriptional start sites and other putative regulatory regions that are differentially accessible in IECs in all 4 species. Although these sites rarely showed sequence conservation from fish to mammals, surprisingly, they drove highly conserved IEC expression in a zebrafish reporter assay. Common putative transcription factor binding sites (TFBS) found at these sites in multiple species indicate that sequence conservation alone is insufficient to identify much of the functionally conserved IEC regulatory information. Among the rare, highly sequence-conserved, IEC-specific regulatory regions, we discovered an ancient enhancer upstream from her6/HES1 that is active in a distinct population of Notch-positive cells in the intestinal epithelium. Together, these results show how combining accessible chromatin and mRNA datasets with TFBS prediction and in vivo reporter assays can reveal tissue-specific regulatory information conserved across 420 million years of vertebrate evolution. We define an IEC transcriptional regulatory network that is shared between fish and mammals and establish an experimental platform for studying how evolutionarily distilled regulatory information commonly controls IEC development and physiology. PMID:28850571

  1. Silver concentrations and selected hydrologic data in the Upper Colorado River basin, 1991-92

    USGS Publications Warehouse

    Johncox, D.A.

    1993-01-01

    The U.S. Geological Survey, in cooperation with the Colorado River Water Conservation District and the Northern Colorado Water Conservancy District, collected water and sediment samples in May and September 1991 and 1992 from nine stream-sampling sites and three lake-sampling sites within the Upper Colorado River Basin upstream from Kremmling, Colorado. Data were collected to determine the present (1992) conditions of the Upper Colorado River Basin regarding silver concentrations in the water and sediment. Lake-water and stream-water samples were analyzed for concentrations of total recoverable silver, dissolved silver, and suspended solids. Lake- and stream-bottom material was analyzed for concentrations of total recoverable silver. Additional data collected were streamflow, specific conductance, pH, and water temperature. Transparency (Secchi-disk measurements) also was measured in the lakes.

  2. Energy balance and mass conservation in reduced order models of fluid flows

    NASA Astrophysics Data System (ADS)

    Mohebujjaman, Muhammad; Rebholz, Leo G.; Xie, Xuping; Iliescu, Traian

    2017-10-01

    In this paper, we investigate theoretically and computationally the conservation properties of reduced order models (ROMs) for fluid flows. Specifically, we investigate whether the ROMs satisfy the same (or similar) energy balance and mass conservation as those satisfied by the Navier-Stokes equations. All of our theoretical findings are illustrated and tested in numerical simulations of a 2D flow past a circular cylinder at a Reynolds number Re = 100. First, we investigate the ROM energy balance. We show that using the snapshot average for the centering trajectory (which is a popular treatment of nonhomogeneous boundary conditions in ROMs) yields an incorrect energy balance. Then, we propose a new approach, in which we replace the snapshot average with the Stokes extension. Theoretically, the Stokes extension produces an accurate energy balance. Numerically, the Stokes extension yields more accurate results than the standard snapshot average, especially for longer time intervals. Our second contribution centers around ROM mass conservation. We consider ROMs created using two types of finite elements: the standard Taylor-Hood (TH) element, which satisfies the mass conservation weakly, and the Scott-Vogelius (SV) element, which satisfies the mass conservation pointwise. Theoretically, the error estimates for the SV-ROM are sharper than those for the TH-ROM. Numerically, the SV-ROM yields significantly more accurate results, especially for coarser meshes and longer time intervals.

  3. RUDI, a short interspersed element of the V-SINE superfamily widespread in molluscan genomes.

    PubMed

    Luchetti, Andrea; Šatović, Eva; Mantovani, Barbara; Plohl, Miroslav

    2016-06-01

    Short interspersed elements (SINEs) are non-autonomous retrotransposons that are widespread in eukaryotic genomes. They exhibit a chimeric sequence structure consisting of a small RNA-related head, an anonymous body and an AT-rich tail. Although their turnover and de novo emergence is rapid, some SINE elements found in distantly related species retain similarity in certain core segments (or highly conserved domains, HCD). We have characterized a new SINE element named RUDI in the bivalve molluscs Ruditapes decussatus and R. philippinarum and found this element to be widely distributed in the genomes of a number of mollusc species. An unexpected structural feature of RUDI is the HCD domain type V, which was first found in non-amniote vertebrate SINEs and in the SINE from one cnidarian species. In addition to the V domain, the overall sequence conservation pattern of RUDI elements resembles that found in ancient AmnSINE (~310 Myr old) and Au SINE (~320 Myr old) families, suggesting that RUDI might be among the most ancient SINE families. Sequence conservation suggests a monophyletic origin of RUDI. Nucleotide variability and phylogenetic analyses suggest long-term vertical inheritance combined with at least one horizontal transfer event as the most parsimonious explanation for the observed taxonomic distribution.

  4. A conserved RNA structural element within the hepatitis B virus post-transcriptional regulatory element enhance nuclear export of intronless transcripts and repress the splicing mechanism.

    PubMed

    Visootsat, Akasit; Payungporn, Sunchai; T-Thienprasert, Nattanan P

    2015-12-01

    Hepatitis B virus (HBV) infection is a primary cause of hepatocellular carcinoma and liver cirrhosis worldwide. To develop novel antiviral drugs, a better understanding of HBV gene expression regulation is vital. One important aspect is to understand how HBV hijacks the cellular machinery to export unspliced RNA from the nucleus. The HBV post-transcriptional regulatory element (HBV PRE) has been proposed to be the HBV RNA nuclear export element. However, the function remains controversial, and the core element is unclear. This study, therefore, aimed to identify functional regulatory elements within the HBV PRE and investigate their functions. Using bioinformatics programs based on sequence conservation and conserved RNA secondary structures, three regulatory elements were predicted, namely PRE 1151-1410, PRE 1520-1620 and PRE 1650-1684. PRE 1151-1410 significantly increased intronless and unspliced luciferase activity in both HepG2 and COS-7 cells. Likewise, PRE 1151-1410 significantly elevated intronless and unspliced HBV surface transcripts in liver cancer cells. Moreover, motif analysis predicted that PRE 1151-1410 contains several regulatory motifs. This study reported the roles of PRE 1151-1410 in intronless transcript nuclear export and the splicing mechanism. Additionally, these results provide knowledge in the field of HBV RNA regulation. Moreover, PRE 1151-1410 may be used to enhance the expression of other mRNAs in intronless reporter plasmids.

  5. Environmental impact of coal mining and coal seam gas production on surface water quality in the Sydney basin, Australia.

    PubMed

    Ali, A; Strezov, V; Davies, P; Wright, I

    2017-08-01

    The extraction of coal and coal seam gas (CSG) will generate produced water that, if not adequately treated, will pollute surface and groundwater systems. In Australia, the discharge of produced water from coal mining and related activities is regulated by the state environment agency through a pollution licence. This licence sets the discharge limits for a range of analytes to protect the environment into which the produced water is discharged. This study reports on the impact of produced water from coal mine activities located within or discharging into high conservation environments, such as National Parks, in the outer region of Sydney, Australia. The water samples upstream and downstream from the discharge points from six mines were taken, and 110 parameters were tested. The results were assessed against a water quality index (WQI) which accounts for pH, turbidity, dissolved oxygen, biochemical oxygen demand, total dissolved solids, total phosphorus, nitrate nitrogen and E .coli. The water quality assessment based on the trace metal contents against various national maximum admissible concentration (MAC) and their corresponding environmental impacts was also included in the study which also established a base value of water quality for further study. The study revealed that impacted water downstream of the mine discharge points contained higher metal content than the upstream reference locations. In many cases, the downstream water was above the Australia and New Zealand Environment Conservation Council and international water quality guidelines for freshwater stream. The major outliers to the guidelines were aluminium (Al), iron (Fe), manganese (Mn), nickel (Ni) and zinc (Zn). The WQI of surface water at and downstream of the discharge point was lower when compared to upstream or reference conditions in the majority of cases. Toxicology indices of metals present in industrial discharges were used as an additional tool to assess water quality, and the newly proposed environmental water quality index (EWQI) lead to better trend in the impact of coal and coal seam gas mining activities on surface water quality when compared to the upstream reference water samples. Metal content limits were based on the impact points assigned by the Agency for Toxic Substances and Disease Registry, USA. For environmental and health impact assessment, the approach used in this study can be applied as a model to provide a basis to assess the anthropogenic contribution from the industrial and mining activities on the environment.

  6. Diverse Early Life-History Strategies in Migratory Amazonian Catfish: Implications for Conservation and Management

    PubMed Central

    Hegg, Jens C.; Giarrizzo, Tommaso; Kennedy, Brian P.

    2015-01-01

    Animal migrations provide important ecological functions and can allow for increased biodiversity through habitat and niche diversification. However, aquatic migrations in general, and those of the world’s largest fish in particular, are imperiled worldwide and are often poorly understood. Several species of large Amazonian catfish carry out some of the longest freshwater fish migrations in the world, travelling from the Amazon River estuary to the Andes foothills. These species are important apex predators in the main stem rivers of the Amazon Basin and make up the region’s largest fishery. They are also the only species to utilize the entire Amazon Basin to complete their life cycle. Studies indicate both that the fisheries may be declining due to overfishing, and that the proposed and completed dams in their upstream range threaten spawning migrations. Despite this, surprisingly little is known about the details of these species’ migrations, or their life history. Otolith microchemistry has been an effective method for quantifying and reconstructing fish migrations worldwide across multiple spatial scales and may provide a powerful tool to understand the movements of Amazonian migratory catfish. Our objective was to describe the migratory behaviors of the three most populous and commercially important migratory catfish species, Dourada (Brachyplatystoma rousseauxii), Piramutaba (Brachyplatystoma vaillantii), and Piraíba (Brachyplatystoma filamentosum). We collected fish from the mouth of the Amazon River and the Central Amazon and used strontium isotope signatures (87Sr/86Sr) recorded in their otoliths to determine the location of early rearing and subsequent. Fish location was determined through discriminant function classification, using water chemistry data from the literature as a training set. Where water chemistry data was unavailable, we successfully in predicted 87Sr/86Sr isotope values using a regression-based approach that related the geology of the upstream watershed to the Sr isotope ratio. Our results provide the first reported otolith microchemical reconstruction of Brachyplatystoma migratory movements in the Amazon Basin. Our results indicate that juveniles exhibit diverse rearing strategies, rearing in both upstream and estuary environments. This contrasts with the prevailing understanding that juveniles rear in the estuary before migrating upstream; however, it is supported by some fisheries data that has indicated the presence of alternate spawning and rearing life-histories. The presence of alternate juvenile rearing strategies may have important implications for conservation and management of the fisheries in the region. PMID:26153984

  7. ERalpha and AP-1 interact in vivo with a specific sequence of the F promoter of the human ERalpha gene in osteoblasts.

    PubMed

    Lambertini, Elisabetta; Tavanti, Elisa; Torreggiani, Elena; Penolazzi, Letizia; Gambari, Roberto; Piva, Roberta

    2008-07-01

    Estrogen-responsive genes often have an estrogen response element (ERE) positioned next to activator protein-1 (AP-1) binding sites. Considering that the interaction between ERE and AP-1 elements has been described for the modulation of bone-specific genes, we investigated the 17-beta-estradiol responsiveness and the role of these cis-elements present in the F promoter of the human estrogen receptor alpha (ERalpha) gene. The F promoter, containing the sequence analyzed here, is one of the multiple promoters of the human ERalpha gene and is the only active promoter in bone tissue. Through electrophoretic mobility shift (EMSA), chromatin immunoprecipitation (ChIP), and re-ChIP assays, we investigated the binding of ERalpha and four members of the AP-1 family (c-Jun, c-fos, Fra-2, and ATF2) to a region located approximately 800 bp upstream of the transcriptional start site of exon F of the human ERalpha gene in SaOS-2 osteoblast-like cells. Reporter gene assay experiments in combination with DNA binding assays demonstrated that F promoter activity is under the control of upstream cis-acting elements which are recognized by specific combinations of ERalpha, c-Jun, c-fos, and ATF2 homo- and heterodimers. Moreover, ChIP and re-ChIP experiments showed that these nuclear factors bind the F promoter in vivo with a simultaneous occupancy stimulated by 17-beta-estradiol. Taken together, our findings support a model in which ERalpha/AP-1 complexes modulate F promoter activity under conditions of 17-beta-estradiol stimulation. (c) 2008 Wiley-Liss, Inc.

  8. Lentivirus Vectors Incorporating the Immunoglobulin Heavy Chain Enhancer and Matrix Attachment Regions Provide Position-Independent Expression in B Lymphocytes

    PubMed Central

    Lutzko, Carolyn; Senadheera, Dinithi; Skelton, Dianne; Petersen, Denise; Kohn, Donald B.

    2003-01-01

    In the present studies we developed lentivirus vectors with regulated, consistent transgene expression in B lymphocytes by incorporating the immunoglobulin heavy chain enhancer (Eμ) with and without associated matrix attachment regions (EμMAR) into lentivirus vectors. Incorporation of these fragments upstream of phosphoglycerate kinase (PGK) or cytomegalovirus promoters resulted in a two- to threefold increase in enhanced green fluorescent protein (EGFP) mean fluorescence intensity (MFI) in B-lymphoid but not T-lymphoid, myeloid, fibroblast, or carcinoma cell lines. A 1-log increase in EGFP expression was observed in B-lymphoid cells (but not myeloid cells) differentiated from human CD34+ progenitors in vitro transduced with Eμ- and EμMAR-containing lentivectors. Lastly, we evaluated the expression from the EμMAR element in mice 2 to 24 weeks posttransplant with transduced hematopoietic stem cells. In mice receiving vectors with the Eμ and EμMAR elements upstream of the PGK promoter, there was a 2- to 10-fold increase in EGFP expression in B cells (but not other cell types). Evaluation of the coefficient of variation of expression among different cell types demonstrated that consistent, position-independent transgene expression was observed exclusively in B cells transduced with the EμMAR-containing vector and not other cells types or vectors. Proviral genomes with the EμMAR element had increased chromatin accessibility, which likely contributed to the position independence of expression in B lymphocytes. In summary, incorporation of the EμMAR element in lentivirus vectors resulted in enhanced, position-independent expression in primary B lymphocytes. These vectors provide a useful tool for the study of B-lymphocyte biology and the development of gene therapy for disorders affecting B lymphocytes, such as immune deficiencies. PMID:12805432

  9. Functional organization of DNA elements regulating SM30alpha, a spicule matrix gene of sea urchin embryos.

    PubMed

    Yamasu, K; Wilt, F H

    1999-02-01

    The SM30a gene encodes a protein in the embryonic endoskeleton of the sea urchin Strongylocentrotus purpuratus, and is specifically expressed in the skeletogenic primary mesenchyme cell lineage. To clarify the mechanism for the differentiation of this cell lineage, which proceeds rather autonomously in the embryo, regulation of the SM30alpha gene was investigated previously and it was shown that the distal DNA region upstream of this gene from - 1.6 to - 1.0 kb contained numerous negative regulatory elements that suppressed the ectopic expression of the gene in the gut. Here we study the influence of the proximal region from - 303 to + 104 bp. Analysis of the expression of reporter constructs indicated that a strong positive enhancer element existed in the region from -142 to -105bp. This element worked both in forward and reverse orientations and additively when placed tandemly upstream to the reporter gene. In addition, other weaker positive and negative regulatory sites were also detected throughout the proximal region. Electrophoretic gel mobility shift analyses showed that multiple nuclear proteins were bound to the putative strong enhancer region. One of the proteins binding to this region was present in ear y blastulae, a time when the SM30 gene was still silent, but it was not in prism embryos actively expressing the gene. The binding region for this blastula-specific protein was narrowed down to the region from - 132 to -122 bp, which included the consensus binding site for the mammalian proto-oncogene product, Ets. Two possible SpGCF1 binding sites were identified in the vicinity of the enhancer region. This information was used to make a comparison of the general regulatory architecture of genes that contribute to the formation of the skeletal spicule.

  10. Accumulation of trace elements, pesticides, and polychlorinated biphenyls in sediments and the clam Corbicula manilensis of the Apalachicola River, Florida

    USGS Publications Warehouse

    Elder, J.F.; Mattraw, H.C.

    1984-01-01

    A survey of trace element and synthetic organic compound concentrations in botton materials was conducted on the Apalachichola River in northwest Florida in 1979-80 as part of the Apalachicola River Quality Assessment. Substances analyzed included trace elements (predominantly heavy metals), organochlorine insecticides, organophosphorus insecticides, chlorinated phenoxy-acid herbicides, and polychlorinated biphenyls (PCBs). Three kinds of materials were surveyed: fine-grained sediments, whole-body tissue of the Asiatic clam Corbicula manilensis, and bottom-load organic detritus. No hazardous levels of any of the substances were found. Concentrations in the fine-grained sediments and clams were generally at least ten times lower than maximum limits considered safe for biota of aquatic systems. A comparison of trace-substance data from the Apalachicola River with data from Lake Seminole (upstream) and Apalachicola Bay (downstream) showed lower concentrations in riverine clams. Sediment concentrations in all parts of the system were comparable. Most trace substances in the Apalachicola River enter the river from the upstream part of the basin (the Chattahoochee and Flint Rivers in Georgia and Alabama) and from nonpoint sources throughout the basin. There are no major point discharges along the Apalachicola. Trend analysis was limited by the scope of the study, but did not reveal any spatial or temporal trends in concentrations of any of the substances analyzed. Concentrations of organic compounds and most metals in Corbicula manilensis did not correlate with those in sediments.

  11. A proximal promoter region of Arabidopsis DREB2C confers tissue-specific expression under heat stress.

    PubMed

    Chen, Huan; Je, Jihyun; Song, Chieun; Hwang, Jung Eun; Lim, Chae Oh

    2012-09-01

    The dehydration-responsive element-binding factor 2C (DREB2C) is a member of the CBF/DREB subfamily of proteins, which contains a single APETALA2/Ethylene responsive element-binding factor (AP2/ERF) domain. To identify the expression pattern of the DREB2C gene, which contains multiple transcription cis-regulatory elements in its promoter, an approximately 1.4 kb upstream DREB2C sequence was fused to the β-glucuronidase reporter gene (GUS) and the recombinant p1244 construct was transformed into Arabidopsis thaliana (L.) Heynh. The promoter of the gene directed prominent GUS activity in the vasculature in diverse young dividing tissues. Upon applying heat stress (HS), GUS staining was also enhanced in the vasculature of the growing tissues. Analysis of a series of 5'-deletions of the DREB2C promoter revealed that a proximal upstream sequence sufficient for the tissue-specific spatial and temporal induction of GUS expression by HS is localized in the promoter region between -204 and -34 bps relative to the transcriptional start site. Furthermore, electrophoretic mobility shift assay (EMSA) demonstrated that nuclear protein binding activities specific to a -120 to -32 bp promoter fragment increased after HS. These results indicate that the TATA-proximal region and some latent trans-acting factors may cooperate in HS-induced activation of the Arabidopsis DREB2C promoter. © 2012 Institute of Botany, Chinese Academy of Sciences.

  12. NFATc1 regulation of the human β3 integrin promoter in osteoclast differentiation

    PubMed Central

    Crotti, Tania N.; Flannery, Merrilee; Walsh, Nicole C.; Fleming, Joseph D.; Goldring, Steven R.; McHugh, Kevin P.

    2006-01-01

    The transcription factor NFATc1 plays an essential role in transducing signals from RANKL in osteoclast differentiation. To date, however, the specific transcriptional targets of NFATc1 are unknown. Expression of the β3 integrin is required for normal osteoclast function. We therefore examined the role of NFATc1 in human β3 integrin expression in osteoclast differentiation. Analysis of the mouse and human β3 gene promoters revealed considerable sequence homology across a 1.3 kb region upstream of the transcription start site (TSS), with conserved NFAT binding elements present. The region −1242 to +29 (relative to the TSS) was cloned as a luciferase reporter construct (pB3-1.3) and a deletion construct removing to −997 (pB3-1) made. The deletion of 245 bp 5′ removed three conserved NFAT sites including a consensus NFAT:AP-1 site. The pB3-1.3 reporter construct was induced by treatment with RANKL in the range 2.5–40 ng/ml and dose-dependently induced by co-transfection with human NFATc1 in RAW264.7 cells. The pB3-1 deletion construct was minimally induced with RANKL treatment and unresponsive to co-transfected NFATc1. Direct NFAT binding to two of the consensus NFAT sites within this 245 bp 5′ region was demonstrated by EMSA and supershift with anti-NFAT antibodies. Mutation of two of the conserved NFAT sites in the −1242 to −997 fragment was required to prevent binding. The double NFAT mutant, in the context of the full-length promoter was unresponsive to RANKL treatment or co-transfected NFATc1. We generated cell-permeable TAT-dominant-negative (dn)NFATc1 fusion proteins to assess the effect of blockade of NFAT signaling. Transduction with dnNFAT inhibited RANKL induction of the human β3 integrin promoter. Involvement of the NFATc1-calcineurin pathway in regulating the human β3 integrin promoter was further confirmed using the calcineurin pathway inhibitory peptide 11R-VIVIT. Together these results establish the β3 gene as a direct target of NFATc1 in RANKL-dependent osteoclast formation. PMID:16513293

  13. Finite element solution for energy conservation using a highly stable explicit integration algorithm

    NASA Technical Reports Server (NTRS)

    Baker, A. J.; Manhardt, P. D.

    1972-01-01

    Theoretical derivation of a finite element solution algorithm for the transient energy conservation equation in multidimensional, stationary multi-media continua with irregular solution domain closure is considered. The complete finite element matrix forms for arbitrarily irregular discretizations are established, using natural coordinate function representations. The algorithm is embodied into a user-oriented computer program (COMOC) which obtains transient temperature distributions at the node points of the finite element discretization using a highly stable explicit integration procedure with automatic error control features. The finite element algorithm is shown to posses convergence with discretization for a transient sample problem. The condensed form for the specific heat element matrix is shown to be preferable to the consistent form. Computed results for diverse problems illustrate the versatility of COMOC, and easily prepared output subroutines are shown to allow quick engineering assessment of solution behavior.

  14. Evolutionarily Conserved, Growth Plate Zone-Specific Regulation of the Matrilin-1 Promoter: L-Sox5/Sox6 and Nfi Factors Bound near TATA Finely Tune Activation by Sox9 ▿

    PubMed Central

    Nagy, Andrea; Kénesi, Erzsébet; Rentsendorj, Otgonchimeg; Molnár, Annamária; Szénási, Tibor; Sinkó, Ildikó; Zvara, Ágnes; Thottathil Oommen, Sajit; Barta, Endre; Puskás, László G.; Lefebvre, Veronique; Kiss, Ibolya

    2011-01-01

    To help uncover the mechanisms underlying the staggered expression of cartilage-specific genes in the growth plate, we dissected the transcriptional mechanisms driving expression of the matrilin-1 gene (Matn1). We show that a unique assembly of evolutionarily conserved cis-acting elements in the Matn1 proximal promoter restricts expression to the proliferative and prehypertrophic zones of the growth plate. These elements functionally interact with distal elements and likewise are capable of restricting the domain of activity of a pancartilaginous Col2a1 enhancer. The proximal elements include a Pe1 element binding the chondrogenic L-Sox5, Sox6, and Sox9 proteins, a SI element binding Nfi proteins, and an initiator Ine element binding the Sox trio and other factors. Sox9 binding to Pe1 is indispensable for functional interaction with the distal promoter. Binding of L-Sox5/Sox6 to Ine and Nfib to SI modulates Sox9 transactivation in a protein dose-dependent manner, possibly to enhance Sox9 activity in early stages of chondrogenesis and repress it at later stages. Hence, our data suggest a novel model whereby Sox and Nfi proteins bind to conserved Matn1 proximal elements and functionally interact with each other to finely tune gene expression in specific zones of the cartilage growth plate. PMID:21173167

  15. Behavior and reproductive ecology of the Sicklefin Redhorse: An imperiled southern Appalachian Mountain fish

    USGS Publications Warehouse

    Favrot, Scott D.; Kwak, Thomas J.

    2018-01-01

    Many nongame fishes are poorly understood but are essential to maintaining healthy aquatic ecosystems globally. The undescribed Sicklefin Redhorse Moxostoma sp. is a rare, imperiled, nongame fish endemic to two southern Appalachian Mountain river basins. Little is known of its behavior and ecology, but this information is urgently needed for conservation planning. We assessed the spatial and temporal bounds of spawning migration, quantified seasonal weekly movement patterns, and characterized seasonal and spawning behavior using radiotelemetry and weir sampling in the Hiwassee River basin, North Carolina–Georgia, during 2006 and 2007. Hiwassee River tributaries were occupied predominantly during the fish's spawning season, lower reaches of the tributaries and the Hiwassee River were primarily occupied during the postspawning season (i.e., summer and fall), and lower lotic reaches of Hiwassee River (upstream from Hiwassee Lake) were occupied during winter. Adults occupied Hiwassee Lake only as a movement corridor during spawning migrations. Both sexes conducted upstream spawning migrations simultaneously, but males occupied spawning tributaries longer than females. Sicklefin Redhorse exhibited interannual spawning‐area and tributary fidelity. Cold water temperatures associated with hypolimnetic releases from reservoirs and meteorological conditions influenced spawning migration distance and timing. During 2007, decreased discharges during the spawning season were associated with decreases in migration distance and spawning tributary occupancy duration. Foraging was the dominant behavior observed annually, followed by reproductive behaviors (courting and spawning) during the spawning season. No agonistic reproductive behavior was observed, but females exhibited a repetitious postspawning digging behavior that may be unique in the family Catostomidae. Our findings suggest that protection and restoration of river continuity, natural flow regimes, seasonally appropriate water temperatures, and geographic range expansion are critical components to include in Sicklefin Redhorse conservation planning. Fisheries and ecosystem managers can use our findings to justify sensitive management decisions that conserve and restore critical streams and rivers occupied by this imperiled species.

  16. Differential regulation of mnp2, a new manganese peroxidase-encoding gene from the ligninolytic fungus Trametes versicolor PRL 572

    Treesearch

    Tomas Johansson; Per Olof Nyman; Daniel Cullen

    2002-01-01

    A peroxidase-encoding gene, mnp2, and its corresponding cDNA were characterized from the white-rot basidiomycete Trametes versicolor PRL 572. We used quantitative reverse transcriptase-mediated PCR to identify mnp2 transcripts in nutrient-limited stationary cultures. Although mnp2 lacks upstream metal response elements (MREs), addition of MnSO4 to cultures increased...

  17. Efficient High-Order Accurate Methods using Unstructured Grids for Hydrodynamics and Acoustics

    DTIC Science & Technology

    2007-08-31

    Leer. On upstream differencing and godunov-type schemes for hyperbolic conservation laws. SIAM Review, 25(1):35-61, 1983. [46] F . Eleuterio Toro ...early stage [4-61. The basic idea can be surmised from simple approximation theory. If a continuous function f is to be approximated over a set of...a2f 4h4 a4ff(x+eh) = f (x)+-- + _ •-+• e +0 +... (1) where 0 < e < 1 for approximations inside the interval of width h. For a second-order approximation

  18. Identification of hot spot area of sediment contamination in a lake system using texture characteristics.

    PubMed

    Sheela, A M; Letha, J; Joseph, Sabu; Thomas, Jobin

    2013-04-01

    Texture plays an important role in the identification of polluted stretch in a lake system. The organic matter as well as toxic elements get accumulated in the finer sediments. The aim of the work is to show the spatio-temporal distribution of texture of the lake sediment (Akkulam-Veli lake, Kerala) and to identify the hot spot areas of contamination. Hot spot areas vary with seasons. During PRM, (premonsoon), the upstream portion of the Akkulam lake is the hot spot. During MON (monsoon), the downstream portion of the Akkulam lake and the upstream portion of the Veli lake are the hot spots. During POM (postmonsoon), hot spot area is the downstream portion of the Akkulam lake. This methodology can be used for the quick identification of hot spots in water bodies.

  19. Protecting LHC components against radiation resulting from an unsynchronized beam abort

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nikolai V. Mokhov et al.

    2001-06-26

    The effect of possible accidental beam loss in the LHC on the IP5 and IP6 insertion elements is studied via realistic Monte Carlo simulations. The scenario studied is beam loss due to unsynchronized abort at an accidental prefire of one of the abort kicker modules. Simulations show that this beam loss would result in severe heating of the IP5 and IP6 superconducting (SC) quadrupoles. Contrary to the previous considerations with a stationary set of collimators in IP5, collimators in IP6 close to the cause are proposed: a movable collimator upstream of the Q4 quadrupole and a stationary one upstream ofmore » the extraction septumMSD. The calculated temperature rise in the optimal set of collimators is quite acceptable. All SC magnets are protected by these collimators against damage.« less

  20. The CGTCA sequence motif is essential for biological activity of the vasoactive intestinal peptide gene cAMP-regulated enhancer.

    PubMed Central

    Fink, J S; Verhave, M; Kasper, S; Tsukada, T; Mandel, G; Goodman, R H

    1988-01-01

    cAMP-regulated transcription of the human vasoactive intestinal peptide gene is dependent upon a 17-base-pair DNA element located 70 base pairs upstream from the transcriptional initiation site. This element is similar to sequences in other genes known to be regulated by cAMP and to sequences in several viral enhancers. We have demonstrated that the vasoactive intestinal peptide regulatory element is an enhancer that depends upon the integrity of two CGTCA sequence motifs for biological activity. Mutations in either of the CGTCA motifs diminish the ability of the element to respond to cAMP. Enhancers containing the CGTCA motif from the somatostatin and adenovirus genes compete for binding of nuclear proteins from C6 glioma and PC12 cells to the vasoactive intestinal peptide enhancer, suggesting that CGTCA-containing enhancers interact with similar transacting factors. Images PMID:2842787

  1. Phylum-Level Conservation of Regulatory Information in Nematodes despite Extensive Non-coding Sequence Divergence

    PubMed Central

    Gordon, Kacy L.; Arthur, Robert K.; Ruvinsky, Ilya

    2015-01-01

    Gene regulatory information guides development and shapes the course of evolution. To test conservation of gene regulation within the phylum Nematoda, we compared the functions of putative cis-regulatory sequences of four sets of orthologs (unc-47, unc-25, mec-3 and elt-2) from distantly-related nematode species. These species, Caenorhabditis elegans, its congeneric C. briggsae, and three parasitic species Meloidogyne hapla, Brugia malayi, and Trichinella spiralis, represent four of the five major clades in the phylum Nematoda. Despite the great phylogenetic distances sampled and the extensive sequence divergence of nematode genomes, all but one of the regulatory elements we tested are able to drive at least a subset of the expected gene expression patterns. We show that functionally conserved cis-regulatory elements have no more extended sequence similarity to their C. elegans orthologs than would be expected by chance, but they do harbor motifs that are important for proper expression of the C. elegans genes. These motifs are too short to be distinguished from the background level of sequence similarity, and while identical in sequence they are not conserved in orientation or position. Functional tests reveal that some of these motifs contribute to proper expression. Our results suggest that conserved regulatory circuitry can persist despite considerable turnover within cis elements. PMID:26020930

  2. Arbitrary-Order Conservative and Consistent Remapping and a Theory of Linear Maps: Part II

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ullrich, Paul A.; Devendran, Dharshi; Johansen, Hans

    2016-04-01

    The focus on this series of articles is on the generation of accurate, conservative, consistent, and (optionally) monotone linear offline maps. This paper is the second in the series. It extends on the first part by describing four examples of 2D linear maps that can be constructed in accordance with the theory of the earlier work. The focus is again on spherical geometry, although these techniques can be readily extended to arbitrary manifolds. The four maps include conservative, consistent, and (optionally) monotone linear maps (i) between two finite-volume meshes, (ii) from finite-volume to finite-element meshes using a projection-type approach, (iii)more » from finite-volume to finite-element meshes using volumetric integration, and (iv) between two finite-element meshes. Arbitrary order of accuracy is supported for each of the described nonmonotone maps.« less

  3. Theria-Specific Homeodomain and cis-Regulatory Element Evolution of the Dlx3–4 Bigene Cluster in 12 Different Mammalian Species

    PubMed Central

    SUMIYAMA, KENTA; MIYAKE, TSUTOMU; GRIMWOOD, JANE; STUART, ANDREW; DICKSON, MARK; SCHMUTZ, JEREMY; RUDDLE, FRANK H.; MYERS, RICHARD M.; AMEMIYA, CHRIS T.

    2013-01-01

    The mammalian Dlx3 and Dlx4 genes are configured as a bigene cluster, and their respective expression patterns are controlled temporally and spatially by cis-elements that largely reside within the intergenic region of the cluster. Previous work revealed that there are conspicuously conserved elements within the intergenic region of the Dlx3–4 bigene clusters of mouse and human. In this paper we have extended these analyses to include 12 additional mammalian taxa (including a marsupial and a monotreme) in order to better define the nature and molecular evolutionary trends of the coding and non-coding functional elements among morphologically divergent mammals. Dlx3–4 regions were fully sequenced from 12 divergent taxa of interest. We identified three theria-specific amino acid replacements in homeodomain of Dlx4 gene that functions in placenta. Sequence analyses of constrained nucleotide sites in the intergenic non-coding region showed that many of the intergenic conserved elements are highly conserved and have evolved slowly within the mammals. In contrast, a branchial arch/craniofacial enhancer I37-2 exhibited accelerated evolution at the branch between the monotreme and therian common ancestor despite being highly conserved among therian species. Functional analysis of I37-2 in transgenic mice has shown that the equivalent region of the platypus fails to drive transcriptional activity in branchial arches. These observations, taken together with our molecular evolutionary data, suggest that theria-specific episodic changes in the I37-2 element may have contributed to craniofacial innovation at the base of the mammalian lineage. PMID:22951979

  4. Phylogenetic distribution and evolutionary dynamics of the sex determination genes doublesex and transformer in insects.

    PubMed

    Geuverink, E; Beukeboom, L W

    2014-01-01

    Sex determination in insects is characterized by a gene cascade that is conserved at the bottom but contains diverse primary signals at the top. The bottom master switch gene doublesex is found in all insects. Its upstream regulator transformer is present in the orders Hymenoptera, Coleoptera and Diptera, but has thus far not been found in Lepidoptera and in the basal lineages of Diptera. transformer is presumed to be ancestral to the holometabolous insects based on its shared domains and conserved features of autoregulation and sex-specific splicing. We interpret that its absence in basal lineages of Diptera and its order-specific conserved domains indicate multiple independent losses or recruitments into the sex determination cascade. Duplications of transformer are found in derived families within the Hymenoptera, characterized by their complementary sex determination mechanism. As duplications are not found in any other insect order, they appear linked to the haplodiploid reproduction of the Hymenoptera. Further phylogenetic analyses combined with functional studies are needed to understand the evolutionary history of the transformer gene among insects. © 2013 S. Karger AG, Basel.

  5. A Lagrangian discontinuous Galerkin hydrodynamic method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Xiaodong; Morgan, Nathaniel Ray; Burton, Donald E.

    Here, we present a new Lagrangian discontinuous Galerkin (DG) hydrodynamic method for solving the two-dimensional gas dynamic equations on unstructured hybrid meshes. The physical conservation laws for the momentum and total energy are discretized using a DG method based on linear Taylor expansions. Three different approaches are investigated for calculating the density variation over the element. The first approach evolves a Taylor expansion of the specific volume field. The second approach follows certain finite element methods and uses the strong mass conservation to calculate the density field at a location inside the element or on the element surface. The thirdmore » approach evolves a Taylor expansion of the density field. The nodal velocity, and the corresponding forces, are explicitly calculated by solving a multidirectional approximate Riemann problem. An effective limiting strategy is presented that ensures monotonicity of the primitive variables. This new Lagrangian DG hydrodynamic method conserves mass, momentum, and total energy. Results from a suite of test problems are presented to demonstrate the robustness and expected second-order accuracy of this new method.« less

  6. A Lagrangian discontinuous Galerkin hydrodynamic method

    DOE PAGES

    Liu, Xiaodong; Morgan, Nathaniel Ray; Burton, Donald E.

    2017-12-11

    Here, we present a new Lagrangian discontinuous Galerkin (DG) hydrodynamic method for solving the two-dimensional gas dynamic equations on unstructured hybrid meshes. The physical conservation laws for the momentum and total energy are discretized using a DG method based on linear Taylor expansions. Three different approaches are investigated for calculating the density variation over the element. The first approach evolves a Taylor expansion of the specific volume field. The second approach follows certain finite element methods and uses the strong mass conservation to calculate the density field at a location inside the element or on the element surface. The thirdmore » approach evolves a Taylor expansion of the density field. The nodal velocity, and the corresponding forces, are explicitly calculated by solving a multidirectional approximate Riemann problem. An effective limiting strategy is presented that ensures monotonicity of the primitive variables. This new Lagrangian DG hydrodynamic method conserves mass, momentum, and total energy. Results from a suite of test problems are presented to demonstrate the robustness and expected second-order accuracy of this new method.« less

  7. Use of a Drosophila Genome-Wide Conserved Sequence Database to Identify Functionally Related cis-Regulatory Enhancers

    PubMed Central

    Brody, Thomas; Yavatkar, Amarendra S; Kuzin, Alexander; Kundu, Mukta; Tyson, Leonard J; Ross, Jermaine; Lin, Tzu-Yang; Lee, Chi-Hon; Awasaki, Takeshi; Lee, Tzumin; Odenwald, Ward F

    2012-01-01

    Background: Phylogenetic footprinting has revealed that cis-regulatory enhancers consist of conserved DNA sequence clusters (CSCs). Currently, there is no systematic approach for enhancer discovery and analysis that takes full-advantage of the sequence information within enhancer CSCs. Results: We have generated a Drosophila genome-wide database of conserved DNA consisting of >100,000 CSCs derived from EvoPrints spanning over 90% of the genome. cis-Decoder database search and alignment algorithms enable the discovery of functionally related enhancers. The program first identifies conserved repeat elements within an input enhancer and then searches the database for CSCs that score highly against the input CSC. Scoring is based on shared repeats as well as uniquely shared matches, and includes measures of the balance of shared elements, a diagnostic that has proven to be useful in predicting cis-regulatory function. To demonstrate the utility of these tools, a temporally-restricted CNS neuroblast enhancer was used to identify other functionally related enhancers and analyze their structural organization. Conclusions: cis-Decoder reveals that co-regulating enhancers consist of combinations of overlapping shared sequence elements, providing insights into the mode of integration of multiple regulating transcription factors. The database and accompanying algorithms should prove useful in the discovery and analysis of enhancers involved in any developmental process. Developmental Dynamics 241:169–189, 2012. © 2011 Wiley Periodicals, Inc. Key findings A genome-wide catalog of Drosophila conserved DNA sequence clusters. cis-Decoder discovers functionally related enhancers. Functionally related enhancers share balanced sequence element copy numbers. Many enhancers function during multiple phases of development. PMID:22174086

  8. Study on Information Management for the Conservation of Traditional Chinese Architectural Heritage - 3d Modelling and Metadata Representation

    NASA Astrophysics Data System (ADS)

    Yen, Y. N.; Weng, K. H.; Huang, H. Y.

    2013-07-01

    After over 30 years of practise and development, Taiwan's architectural conservation field is moving rapidly into digitalization and its applications. Compared to modern buildings, traditional Chinese architecture has considerably more complex elements and forms. To document and digitize these unique heritages in their conservation lifecycle is a new and important issue. This article takes the caisson ceiling of the Taipei Confucius Temple, octagonal with 333 elements in 8 types, as a case study for digitization practise. The application of metadata representation and 3D modelling are the two key issues to discuss. Both Revit and SketchUp were appliedin this research to compare its effectiveness to metadata representation. Due to limitation of the Revit database, the final 3D models wasbuilt with SketchUp. The research found that, firstly, cultural heritage databasesmustconvey that while many elements are similar in appearance, they are unique in value; although 3D simulations help the general understanding of architectural heritage, software such as Revit and SketchUp, at this stage, could onlybe used tomodel basic visual representations, and is ineffective indocumenting additional critical data ofindividually unique elements. Secondly, when establishing conservation lifecycle information for application in management systems, a full and detailed presentation of the metadata must also be implemented; the existing applications of BIM in managing conservation lifecycles are still insufficient. Results of the research recommends SketchUp as a tool for present modelling needs, and BIM for sharing data between users, but the implementation of metadata representation is of the utmost importance.

  9. Fast acting multiple element valve

    DOEpatents

    Yang, Jefferson Y. S.; Wada, James M.

    1991-01-01

    A plurality of slide valve elements having plural axial-spaced annular parts and an internal slide are inserted into a bulkhead in a fluid conduit from a downstream side of the bulkhead, locked in place by a bayonet coupling and set screw, and project through the bulkhead into the upstream conduit. Pneumatic lines connecting the slide valve element actuator to pilot valves are brought out the throat of the valve element to the downstream side. Pilot valves are radially spaced around the exterior of the valve to permit the pneumatic lines to be made identical, thereby to minimize adverse timing tolerances in operation due to pressure variations. Ring manifolds surround the valve adjacent respective pilot valve arrangements to further reduce adverse timing tolerances due to pressure variations, the manifolds being directly connected to the respective pilot valves. Position sensors are provided the valve element slides to signal the precise time at which a slide reaches or passes through a particular point in its stroke to initiate a calibrated timing function.

  10. Conserving biodiversity on native rangelands: Symposium proceedings

    Treesearch

    Daniel W. Uresk; Greg L. Schenbeck; James T. O' Rourke

    1997-01-01

    These proceedings are the result of a symposium, "Conserving biodiversity on native rangelands" held on August 17, 1995 in Fort Robinson State Park, NE. The purpose of this symposium was to provide a forum to discuss how elements of rangeland biodiversity are being conserved today. We asked, "How resilient and sustainable are rangeland systems to the...

  11. An assessment of the benefits of the use of NASA developed fuel conservative technology in the US commercial aircraft fleet

    NASA Technical Reports Server (NTRS)

    1975-01-01

    Cost and benefits of a fuel conservative aircraft technology program proposed by NASA are estimated. NASA defined six separate technology elements for the proposed program: (a) engine component improvement (b) composite structures (c) turboprops (d) laminar flow control (e) fuel conservative engine and (f) fuel conservative transport. There were two levels postulated: The baseline program was estimated to cost $490 million over 10 years with peak funding in 1980. The level two program was estimated to cost an additional $180 million also over 10 years. Discussions with NASA and with representatives of the major commercial airframe manufacturers were held to estimate the combinations of the technology elements most likely to be implemented, the potential fuel savings from each combination, and reasonable dates for incorporation of these new aircraft into the fleet.

  12. Hydrology and water quality of Elkhead Creek and Elkhead Reservoir near Craig, Colorado, July 1995-September 2001

    USGS Publications Warehouse

    Kuhn, Gerhard; Stevens, Michael R.; Elliott, John G.

    2003-01-01

    The U.S. Geological Survey, in cooperation with the Colorado River Water Conservation District, collected and analyzed baseline streamflow and water-quality information for Elkhead Creek and water-quality and trophic-state information for Elkhead Reservoir from July 1995 through September 2001. In the study area, Elkhead Creek is a meandering, alluvial stream dominated by snowmelt in mountainous headwaters that produces most of the annual discharge volume and discharge peaks during late spring and early summer. During most of water year 1996 (a typical year), daily mean discharge at station 09246400 (downstream from the reservoir) was similar to daily mean discharge at station 09246200 (upstream from the reservoir). Flow-duration curves for stations 09246200 and 09246400 were nearly identical, except for discharges less than about 10 cubic feet per second. Specific conductance generally had an inverse relation to discharge in Elkhead Creek. During late fall and winter when discharge was small and derived mostly from ground water, specific conductance was high, whereas during spring and early summer, when discharge was large and derived mostly from snowmelt, specific conductance was low. Water temperatures in Elkhead Creek were smallest during winter, about 0.0 degrees Celsius (oC), and largest during summer, about 20?25oC. Concentrations of major ions, nutrients, trace elements, organic carbon, and suspended sediment in Elkhead Creek indicated no substantial within-year variability and no substantial differences in variability from one year to the next. A seasonal pattern in the concentration data was evident for most constituents. The seasonal concentration pattern for most of the dissolved constituents followed the seasonal pattern of specific conductance, whereas some nutrients, some trace elements, and suspended sediment followed the seasonal pattern of discharge. Statistical differences between station 09246200 (upstream from the reservoir) and station 09246400 (downstream from the reservoir) were indicated for specific conductance, dissolved calcium, magnesium, sodium, and sulfate, acid-neutralizing capacity, and dissolved solids. Trend analysis indicated upward temporal trends for pH, dissolved ammonia plus organic nitrogen, total nitrogen, and total phosphorus at station 09246200; upward temporal trends for dissolved and total ammonia plus organic nitrogen, total nitrogen, and total phosphorus were indicated at station 09246400. No downward trends were indicated for any constituents. Annual loads for dissolved constituents during water years 1996?2001 were consistently larger at station 09246400 than at station 09246200, except for silica and sulfate. Mean monthly loads for dissolved constituents followed the seasonal pattern of discharge, indicating that most of the annual loads were transported during March?June. Annual dissolved nutrient loads at stations 09246400 and 09246200 were not substantially different, except for total phosphorus and total nitrogen loads, which were smaller at the downstream station than at the upstream station, most likely due to biological uptake and settling in the reservoir. Mean annual suspended-sediment load during water years 1996?2001 was about 87-percent smaller at the downstream station than at the upstream station. Temperature in Elkhead Reservoir varied seasonally, from about 0oC during winter when ice develops on the reservoir to about 20oC during summer. Specific conductance varied from minimums of 138 to 169 microsiemens per centimeter at 25oC (?S/cm) during snowmelt inflow to maximums of 424 to 610 ?S/cm during early spring low flow (April). Median pH in the reservoir ranged from 7.2 to 8.0 at all sites near the surface. Median dissolved oxygen ranged from 7.1 to 7.2 milligrams per liter (mg/L) in near-surface samples and from 4.8 to 5.6 mg/L in near-bottom samples. During reservoir stratification, specific conductance generally was largest in the e

  13. The method of space-time and conservation element and solution element: A new approach for solving the Navier-Stokes and Euler equations

    NASA Technical Reports Server (NTRS)

    Chang, Sin-Chung

    1995-01-01

    A new numerical framework for solving conservation laws is being developed. This new framework differs substantially in both concept and methodology from the well-established methods, i.e., finite difference, finite volume, finite element, and spectral methods. It is conceptually simple and designed to overcome several key limitations of the above traditional methods. A two-level scheme for solving the convection-diffusion equation is constructed and used to illuminate the major differences between the present method and those previously mentioned. This explicit scheme, referred to as the a-mu scheme, has two independent marching variables.

  14. How Physical Processes are Informing River Management Actions at Marble Bluff Dam, Truckee River, Nevada

    NASA Astrophysics Data System (ADS)

    Bountry, J.; Godaire, J.; Bradley, D. N.

    2017-12-01

    At the terminus of the Truckee River into Pyramid Lake (Nevada, USA), upstream river management actions have dramatically reshaped the river landscape, posing significant challenges for the management of endangered aquatic species and maintenance of existing infrastructure. Within the last 100 years, upstream water withdrawal for human uses has resulted in a rapid lowering of Pyramid Lake which initiated up to 90 ft of channel incision. In 1976 Marble Bluff Dam was constructed to halt the upstream progression of channel incision and protect upstream agricultural lands, tribal resources, and infrastructure. Since construction an additional 40 ft of lake lowering and subsequent channel lowering now poses a potential risk to the structural integrity of the dam. The dynamic downstream river combined with ongoing reservoir sedimentation pose challenges to fish passage facilities that enable migration of numerous endangered cui-ui and threatened Lahontan Cutthroat Trout (LCT) to upstream spawning areas each year. These facilities include a fish lock at the dam, a fish bypass channel which allows fish to avoid the shallow delta area during low lake levels, and a meandering channel constructed by the Nature Conservancy to connect the bypass channel to the receding Pyramid Lake. The reservoir formed by Marble Bluff Dam has completely filled with sediment which impacts fish passage facilities. The original operating manual for the dam recommends year-round flushing of sediment through radial gates, but this can no longer be accomplished. During critical fish migration periods in the spring operators must ensure fish entrance channels downstream of the dam are not buried with released sediment and fish are not trapped in a portion of the reservoir full of sediment that would risk sending them back over the dam. To help inform future reservoir sediment and infrastructure management strategies, we bracket a range of potential river responses to lake level lowering and floods using historical trends, current field data, and hydraulic and sediment transport models. We present options for adaptive management for dam and reservoir sediment operations that incorporates monitoring of river processes to inform annual implementation strategies along with long-term planning.

  15. De novo mutations in regulatory elements in neurodevelopmental disorders

    PubMed Central

    Short, Patrick J.; McRae, Jeremy F.; Gallone, Giuseppe; Sifrim, Alejandro; Won, Hyejung; Geschwind, Daniel H.; Wright, Caroline F.; Firth, Helen V; FitzPatrick, David R.; Barrett, Jeffrey C.; Hurles, Matthew E.

    2018-01-01

    We previously estimated that 42% of patients with severe developmental disorders carry pathogenic de novo mutations in coding sequences. The role of de novo mutations in regulatory elements affecting genes associated with developmental disorders, or other genes, has been essentially unexplored. We identified de novo mutations in three classes of putative regulatory elements in almost 8,000 patients with developmental disorders. Here we show that de novo mutations in highly evolutionarily conserved fetal brain-active elements are significantly and specifically enriched in neurodevelopmental disorders. We identified a significant twofold enrichment of recurrently mutated elements. We estimate that, genome-wide, 1-3% of patients without a diagnostic coding variant carry pathogenic de novo mutations in fetal brain-active regulatory elements and that only 0.15% of all possible mutations within highly conserved fetal brain-active elements cause neurodevelopmental disorders with a dominant mechanism. Our findings represent a robust estimate of the contribution of de novo mutations in regulatory elements to this genetically heterogeneous set of disorders, and emphasize the importance of combining functional and evolutionary evidence to identify regulatory causes of genetic disorders. PMID:29562236

  16. A direct Arbitrary-Lagrangian-Eulerian ADER-WENO finite volume scheme on unstructured tetrahedral meshes for conservative and non-conservative hyperbolic systems in 3D

    NASA Astrophysics Data System (ADS)

    Boscheri, Walter; Dumbser, Michael

    2014-10-01

    In this paper we present a new family of high order accurate Arbitrary-Lagrangian-Eulerian (ALE) one-step ADER-WENO finite volume schemes for the solution of nonlinear systems of conservative and non-conservative hyperbolic partial differential equations with stiff source terms on moving tetrahedral meshes in three space dimensions. A WENO reconstruction technique is used to achieve high order of accuracy in space, while an element-local space-time Discontinuous Galerkin finite element predictor on moving curved meshes is used to obtain a high order accurate one-step time discretization. Within the space-time predictor the physical element is mapped onto a reference element using a high order isoparametric approach, where the space-time basis and test functions are given by the Lagrange interpolation polynomials passing through a predefined set of space-time nodes. Since our algorithm is cell-centered, the final mesh motion is computed by using a suitable node solver algorithm. A rezoning step as well as a flattener strategy are used in some of the test problems to avoid mesh tangling or excessive element deformations that may occur when the computation involves strong shocks or shear waves. The ALE algorithm presented in this article belongs to the so-called direct ALE methods because the final Lagrangian finite volume scheme is based directly on a space-time conservation formulation of the governing PDE system, with the rezoned geometry taken already into account during the computation of the fluxes. We apply our new high order unstructured ALE schemes to the 3D Euler equations of compressible gas dynamics, for which a set of classical numerical test problems has been solved and for which convergence rates up to sixth order of accuracy in space and time have been obtained. We furthermore consider the equations of classical ideal magnetohydrodynamics (MHD) as well as the non-conservative seven-equation Baer-Nunziato model of compressible multi-phase flows with stiff relaxation source terms.

  17. A Gibbs sampler for motif detection in phylogenetically close sequences

    NASA Astrophysics Data System (ADS)

    Siddharthan, Rahul; van Nimwegen, Erik; Siggia, Eric

    2004-03-01

    Genes are regulated by transcription factors that bind to DNA upstream of genes and recognize short conserved ``motifs'' in a random intergenic ``background''. Motif-finders such as the Gibbs sampler compare the probability of these short sequences being represented by ``weight matrices'' to the probability of their arising from the background ``null model'', and explore this space (analogous to a free-energy landscape). But closely related species may show conservation not because of functional sites but simply because they have not had sufficient time to diverge, so conventional methods will fail. We introduce a new Gibbs sampler algorithm that accounts for common ancestry when searching for motifs, while requiring minimal ``prior'' assumptions on the number and types of motifs, assessing the significance of detected motifs by ``tracking'' clusters that stay together. We apply this scheme to motif detection in sporulation-cycle genes in the yeast S. cerevisiae, using recent sequences of other closely-related Saccharomyces species.

  18. Authentication of meat from game and domestic species by SNaPshot minisequencing analysis.

    PubMed

    La Neve, Fabio; Civera, Tiziana; Mucci, Nadia; Bottero, Maria Teresa

    2008-10-01

    The aim of the present study is to develop an assay for the specific identification of meat from Capreolus capreolus, Cervus elaphus, Capra ibex, Rupicapra rupicapra, targeting sequences of the cytochrome b (cyt b) gene of mitochondrial DNA. The assay is also intended to enable differentiation between meat from these wild species as well as Ovis aries, Capra hircus, Bubalus bubalis, Bos taurus and Sus scrofa domestic species. The primers used in the preliminary PCR were designed in well conserved regions upstream and downstream of the diagnosis sites. They successfully amplified a conserved 232bp region from the cyt b gene of all the species taken into consideration. The sites of diagnosis have been interrogated using a minisequencing reaction and capillary electrophoresis. All the results of the multiplex PER (primer extension reaction) test were confirmed by fragment sequencing. The assay offers the possibility of discriminating nine species at the same time.

  19. USAF Hearing Conservation Program, DOEHRS-HC Data Repository Annual Report: CY15

    DTIC Science & Technology

    2017-05-31

    AFRL-SA-WP-SR-2017-0014 USAF Hearing Conservation Program, DOEHRS-HC Data Repository Annual Report: CY15 Daniel A. Williams...Conservation Program, DOEHRS-HC Data Repository Annual Report: CY15 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR...Health Readiness System-Hearing Conservation Data Repository (DOEHRS-HC DR). Major command- and installation-level reports are available quarterly

  20. Spatiotemporal patterns and habitat associations of smallmouth bass (Micropterus dolomieu) invading salmon-rearing habitat

    USGS Publications Warehouse

    Lawrence, David J.; Olden, Julian D.; Torgersen, Christian E.

    2012-01-01

    1. Smallmouth bass (Micropterus dolomieu) have been widely introduced to fresh waters throughout the world to promote recreational fishing opportunities. In the Pacific Northwest (U.S.A.), upstream range expansions of predatory bass, especially into subyearling salmon-rearing grounds, are of increasing conservation concern, yet have received little scientific inquiry. Understanding the habitat characteristics that influence bass distribution and the timing and extent of bass and salmon overlap will facilitate the development of management strategies that mitigate potential ecological impacts of bass.2. We employed a spatially continuous sampling design to determine the extent of bass and subyearling Chinook salmon (Oncorhynchus tshawytscha) sympatry in the North Fork John Day River (NFJDR), a free-flowing river system in the Columbia River Basin that contains an upstream expanding population of non-native bass. Extensive (i.e. 53 km) surveys were conducted over 2 years and during an early and late summer period of each year, because these seasons provide a strong contrast in the river’s water temperature and flow condition. Classification and regression trees were applied to determine the primary habitat correlates of bass abundance at reach and channel-unit scales.3. Our study revealed that bass seasonally occupy up to 22% of the length of the mainstem NFJDR where subyearling Chinook salmon occur, and the primary period of sympatry between these species was in the early summer and not during peak water temperatures in late summer. Where these species co-occurred, bass occupied 60–76% of channel units used by subyearling Chinook salmon in the early summer and 28–46% of the channel units they occupied in the late summer. Because these rearing salmon were well below the gape limitation of bass, this overlap could result in either direct predation or sublethal effects of bass on subyearling Chinook salmon. The upstream extent of bass increased 10–23 km (2009 and 2010, respectively) as stream temperatures seasonally warmed, but subyearling Chinook salmon were also found farther upstream during this time.4. Our multiscale analysis suggests that bass were selecting habitat based on antecedent thermal history at a broad scale, and if satisfactory temperature conditions were met, mesoscale habitat features (i.e. channel-unit type and depth) played an additional role in determining bass abundance. The upstream extent of bass in the late summer corresponded to a high-gradient geomorphic discontinuity in the NFJDR, which probably hindered further upstream movements of bass. The habitat determinants and upstream extent of bass were largely consistent across years, despite marked differences in the magnitude and timing of spring peak flows prior to bass spawning.5. The overriding influence of water temperature on smallmouth bass distribution suggests that managers may be able limit future upstream range expansions of bass into salmon-rearing habitat by concentrating on restoration activities that mitigate climate- or land-use-related stream warming. These management activities could be prioritised to capitalise on survival bottlenecks in the life history of bass and spatially focused on landscape knick points such as high-gradient discontinuities to discourage further upstream movements of bass.

  1. Human ribosomal RNA gene: nucleotide sequence of the transcription initiation region and comparison of three mammalian genes.

    PubMed Central

    Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M

    1982-01-01

    The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460

  2. Use of frequency analysis and the extended streamflow prediction procedure to estimate evacuation dates for the joint-use pool of Pueblo Reservoir, Colorado

    USGS Publications Warehouse

    Kuhn, Gerhard; Nickless, R.C.

    1994-01-01

    Part of the storage space of Pueblo Reservoir consists of a 65,950 acre-foot joint-use pool (JUP) that can be used to provide additional conservation capacity from November 1 to April 14; however, the JUP must be evacuated by April 15 and used only for flood-control capacity until November 1. A study was completed to determine if the JUP possibly could be used for conservation storage for any number of days from April 15 through May 14 under certain hydrologic conditions. The methods of the study were: (1) Frequency analysis of recorded daily mean discharge data for streamflow-gaging stations upstream and downstream from Pueblo Reservoir, and (2) Implementation of the extended streamflow prediction (ESP) procedure for the Arkansas River basin upstream from the reservoir. The frequency analyses enabled estimation of daily discharges at selected exceedance probabilities (EP's), including the 0.01 EP that was used in design of the flood- storage capacity of Pueblo Reservoir. The ESP procedure enabled probabilistic forecasts of inflow volume to the reservoir for April 15 through May 14. Daily discharges derived from the frequency analyses were routed through Pueblo Reservoir to estimate evacuation dates of the JUP for different reservoir inflow volumes; the estimates indicated a relation between the inflow volume and the JUP evacuation date. To apply the study results, only a ESP forecast of the April 15-May 14 reservoir inflow volume is needed. Study results indicate the JUP possibly could be used as late as May 5 depending on the forecast inflow volume.

  3. Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in

    The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitablemore » statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.« less

  4. Regulation of the grapevine polygalacturonase-inhibiting protein encoding gene: expression pattern, induction profile and promoter analysis.

    PubMed

    Joubert, D Albert; de Lorenzo, Giulia; Vivier, Melané A

    2013-03-01

    Regulation of defense in plants is a complex process mediated by various signaling pathways. Promoter analysis of defense-related genes is useful to understand these signaling pathways involved in regulation. To this end, the regulation of the polygalacturonase-inhibiting protein encoding gene from Vitis vinifera L. (Vvpgip1) was analyzed with regard to expression pattern and induction profile as well as the promoter in terms of putative regulatory elements present, core promoter size and the start of transcription. Expression of Vvpgip1 is tissue-specific and developmentally regulated. Vvpgip1 expression was induced in response to auxin, salicylic acid and sugar treatment, wounding and pathogen infection. The start of transcription was mapped to 17 bp upstream of the ATG and the core promoter was mapped to the 137 bp upstream of the ATG. Fructose- and Botrytis responsiveness were identified in the region between positions -3.1 and -1.5 kb. The analyses showed induction in water when the leaves were submersed and this response and the response to wounding mapped to the region between positions -1.1 and -0.1 kb. In silico analyses revealed putative cis-acting elements in these areas that correspond well to the induction stimuli tested.

  5. Differential Acetylation of Histone H3 at the Regulatory Region of OsDREB1b Promoter Facilitates Chromatin Remodelling and Transcription Activation during Cold Stress

    PubMed Central

    Roy, Dipan; Paul, Amit; Roy, Adrita; Ghosh, Ritesh; Ganguly, Payel; Chaudhuri, Shubho

    2014-01-01

    The rice ortholog of DREB1, OsDREB1b, is transcriptionally induced by cold stress and over-expression of OsDREB1b results in increase tolerance towards high salt and freezing stress. This spatio-temporal expression of OsDREB1b is preceded by the change in chromatin structure at the promoter and the upstream region for gene activation. The promoter and the upstream region of OsDREB1b genes appear to be arranged into a nucleosome array. Nucleosome mapping of ∼700bp upstream region of OsDREB1b shows two positioned nucleosomes between −610 to −258 and a weakly positioned nucleosome at the core promoter and the TSS. Upon cold stress, there is a significant change in the nucleosome arrangement at the upstream region with increase in DNaseI hypersensitivity or MNase digestion in the vicinity of cis elements and TATA box at the core promoter. ChIP assays shows hyper-acetylation of histone H3K9 throughout the locus whereas region specific increase was observed in H3K14ac and H3K27ac. Moreover, there is an enrichment of RNA PolII occupancy at the promoter region during transcription activation. There is no significant change in the H3 occupancy in OsDREB1b locus negating the possibility of nucleosome loss during cold stress. Interestingly, cold induced enhanced transcript level of OsDREB1b as well as histone H3 acetylation at the upstream region was found to diminish when stressed plants were returned to normal temperature. The result indicates absolute necessity of changes in chromatin conformation for the transcription up-regulation of OsDREB1b gene in response to cold stress. The combined results show the existence of closed chromatin conformation at the upstream and promoter region of OsDREB1b in the transcription “off” state. During cold stress, changes in region specific histone modification marks promote the alteration of chromatin structure to facilitate the binding of transcription machinery for proper gene expression. PMID:24940877

  6. Autosomal Recessive Congenital Ichthyosis in American Bulldogs Is Associated With NIPAL4 (ICHTHYIN) Deficiency.

    PubMed

    Mauldin, E A; Wang, P; Evans, E; Cantner, C A; Ferracone, J D; Credille, K M; Casal, M L

    2015-07-01

    A minority of patients with nonsyndromic autosomal recessive congenital ichthyosis (ARCI) display mutations in NIPAL4 (ICHTHYIN). This protein plays a role in epidermal lipid metabolism, although the mechanism is unknown. The study describes a moderate form of ARCI in an extended pedigree of American Bulldogs that is linked to the gene encoding ichthyin. The gross phenotype was manifest as a disheveled pelage shortly after birth, generalized scaling, and adherent brown scale with erythema of the abdominal skin. Pedigree analysis indicated an autosomal recessive mode of inheritance. Ultrastructurally, the epidermis showed discontinuous lipid bilayers, unprocessed lipid within corneocytes, and abnormal lamellar bodies. Linkage analysis, performed by choosing simple sequence repeat markers and single-nucleotide polymorphisms near genes known to cause ACRI, revealed an association with NIPAL4. NIPAL4 was identified and sequenced using standard methods. No mutation was identified within the gene, but affected dogs had a SINE element 5' upstream of exon 1 in a highly conserved region. Of 545 DNA samples from American Bulldogs, 32 dogs (17 females, 15 males) were homozygous for the polymerase chain reaction fragment. All affected dogs were homozygous, with parents heterozygous for the insertion. Immunolabeling revealed an absence of ichthyin in the epidermis. This is the first description of ARCI associated with decreased expression of NIPAL4 in nonhuman species. © The Author(s) 2014.

  7. Structural basis for concerted recruitment and activation of IRF-3 by innate immune adaptor proteins

    DOE PAGES

    Zhao, Baoyu; Shu, Chang; Gao, Xinsheng; ...

    2016-06-02

    Type I IFNs are key cytokines mediating innate antiviral immunity. cGMP-AMP synthase, ritinoic acid-inducible protein 1 (RIG-I)–like receptors, and Toll-like receptors recognize microbial double-stranded (ds)DNA, dsRNA, and LPS to induce the expression of type I IFNs. These signaling pathways converge at the recruitment and activation of the transcription factor IRF-3 (IFN regulatory factor 3). The adaptor proteins STING (stimulator of IFN genes), MAVS (mitochondrial antiviral signaling), and TRIF (TIR domain-containing adaptor inducing IFN-β) mediate the recruitment of IRF-3 through a conserved pLxIS motif. Here in this paper, we show that the pLxIS motif of phosphorylated STING, MAVS, and TRIF bindsmore » to IRF-3 in a similar manner, whereas residues upstream of the motif confer specificity. The structure of the IRF-3 phosphomimetic mutant S386/396E bound to the cAMP response element binding protein (CREB)-binding protein reveals that the pLxIS motif also mediates IRF-3 dimerization and activation. Moreover, rotavirus NSP1 (nonstructural protein 1) employs a pLxIS motif to target IRF-3 for degradation, but phosphorylation of NSP1 is not required for its activity. These results suggest a concerted mechanism for the recruitment and activation of IRF-3 that can be subverted by viral proteins to evade innate immune responses.« less

  8. Comparative Analysis of V-Akt Murine Thymoma Viral Oncogene Homolog 3 (AKT3) Gene between Cow and Buffalo Reveals Substantial Differences for Mastitis.

    PubMed

    Ullah, Farman; Bhattarai, Dinesh; Cheng, Zhangrui; Liang, Xianwei; Deng, Tingxian; Rehman, Zia Ur; Talpur, Hira Sajjad; Worku, Tesfaye; Brohi, Rahim Dad; Safdar, Muhammad; Ahmad, Muhammad Jamil; Salim, Mohammad; Khan, Momen; Ahmad, Hafiz Ishfaq; Zhang, Shujun

    2018-01-01

    AKT3 gene is a constituent of the serine/threonine protein kinase family and plays a crucial role in synthesis of milk fats and cholesterol by regulating activity of the sterol regulatory element binding protein (SREBP). AKT3 is highly conserved in mammals and its expression levels during the lactation periods of cattle are markedly increased. AKT3 is highly expressed in the intestine followed by mammary gland and it is also expressed in immune cells. It is involved in the TLR pathways as effectively as proinflammatory cytokines. The aims of this study were to investigate the sequences differences between buffalo and cow. Our results showed that there were substantial differences between buffalo and cow in some exons and noteworthy differences of the gene size in different regions. We also identified the important consensus sequence motifs, variation in 2000 upstream of ATG, substantial difference in the "3'UTR" region, and miRNA association in the buffalo sequences compared with the cow. In addition, genetic analyses, such as gene structure, phylogenetic tree, position of different motifs, and functional domains, were performed to establish their correlation with other species. This may indicate that a buffalo breed has potential resistance to disease, environment changes, and airborne microorganisms and some good production and reproductive traits.

  9. Prediction of fire growth on furniture using CFD

    NASA Astrophysics Data System (ADS)

    Pehrson, Richard David

    A fire growth calculation method has been developed that couples a computational fluid dynamics (CFD) model with bench scale cone calorimeter test data for predicting the rate of flame spread on compartment contents such as furniture. The commercial CFD code TASCflow has been applied to solve time averaged conservation equations using an algebraic multigrid solver with mass weighted skewed upstream differencing for advection. Closure models include k-e for turbulence, eddy breakup for combustion following a single step irreversible reaction with Arrhenius rate constant, finite difference radiation transfer, and conjugate heat transfer. Radiation properties are determined from concentrations of soot, CO2 and H2O using the narrow band model of Grosshandler and exponential wide band curve fit model of Modak. The growth in pyrolyzing area is predicted by treating flame spread as a series of piloted ignitions based on coupled gas-fluid boundary conditions. The mass loss rate from a given surface element follows the bench scale test data for input to the combustion prediction. The fire growth model has been tested against foam-fabric mattresses and chairs burned in the furniture calorimeter. In general, agreement between model and experiment for peak heat release rate (HRR), time to peak HRR, and total energy lost is within +/-20%. Used as a proxy for the flame spread velocity, the slope of the HRR curve predicted by model agreed with experiment within +/-20% for all but one case.

  10. Report of a Novel SHOX Missense Variant in a Boy With Short Stature and His Mother With Leri–Weill Dyschondrosteosis

    PubMed Central

    Lucchetti, Laura; Prontera, Paolo; Mencarelli, Amedea; Sallicandro, Ester; Mencarelli, Annalisa; Cofini, Marta; Leonardi, Alberto; Stangoni, Gabriela; Penta, Laura; Esposito, Susanna

    2018-01-01

    Heterozygous mutations in the SHOX gene or in the upstream and downstream enhancer elements are associated with 2–22% of cases of idiopathic short stature (OMIM #300582) and with 60% of cases of Leri–Weill dyschondrosteosis (OMIM #127300) with which female subjects are generally more severely affected. Approximately 80–90% of SHOX pathogenic variants are deletions or duplications, and the remaining 10–20% are point mutations that primarily give rise to missense variants. The clinical interpretation of novel variants, particularly missense variants, can be challenging and can remain of uncertain significance. Here, we describe a novel missense variant (c.1044 G>T, p.Arg118Met) in a Moroccan boy with a disproportionately short stature and without any radiological traits or bone deformities and in his mother, who had a disproportionately short stature and a Madelung deformity. This variant has not been reported to date in the updated SHOX allelic variant or Human Gene Mutation Databases nor is it listed as a polymorphism in the ExAC browser, dbSNP, or 1000G. This mutation was predicted to be deleterious by three different bioinformatics tools since it modifies an amino acid in a highly conserved DNA-binding domain of the SHOX protein. Based on this evidence, the patient was treated with recombinant human growth hormone. PMID:29692759

  11. The SHOX region and its mutations.

    PubMed

    Capone, L; Iughetti, L; Sabatini, S; Bacciaglia, A; Forabosco, A

    2010-06-01

    The short stature homeobox-containing (SHOX) gene lies in the pseudoautosomal region 1 (PAR1) that comprises 2.6 Mb of the short-arm tips of both the X and Y chromosomes. It is known that its heterozygous mutations cause Leri-Weill dyschondrosteosis (LWD) (OMIM #127300), while its homozygous mutations cause a severe form of dwarfism known as Langer mesomelic dysplasia (LMD) (OMIM #249700). The analysis of 238 LWD patients between 1998 and 2007 by multiple authors shows a prevalence of deletions (46.4%) compared to point mutations (21.2%). On the whole, deletions and point mutations account for about 67% of LWD patients. SHOX is located within a 1000 kb desert region without genes. The comparative genomic analysis of this region between genomes of different vertebrates has led to the identification of evolutionarily conserved non-coding DNA elements (CNE). Further functional studies have shown that one of these CNE downstream of the SHOX gene is necessary for the expression of SHOX; this is considered to be typical "enhancer" activity. Including the enhancer, the overall mutation of the SHOX region in LWD patients does not hold in 100% of cases. Various authors have demonstrated the existence of other CNE both downstream and upstream of SHOX regions. The resulting conclusion is that it is necessary to reanalyze all LWD/LMD patients without SHOX mutations for the presence of mutations in the 5'- and 3'-flanking SHOX regions.

  12. Molecular genetic analysis of macular corneal dystrophy patients from North India.

    PubMed

    Paliwal, Preeti; Sharma, Arundhati; Tandon, Radhika; Sharma, Namrata; Titiyal, Jeevan S; Sen, Seema; Vajpayee, Rasik B

    2012-01-01

    To identify underlying genetic defects in the carbohydrate sulfotransferase-6 (CHST6) gene in North Indian patients with macular corneal dystrophy (MCD). 30 clinically diagnosed MCD patients from 21 families and 50 healthy normal controls were recruited in the study. Detailed clinical evaluation in the patients was undertaken followed by histopathology and ultrastructural studies in corneal tissues. DNA from blood samples was amplified for the CHST6 coding and upstream region followed by direct sequencing and in silico analysis. We identified pathogenic mutations in 17 patients from 11 families. Of these 4 were novel (p.Ser54Tyr, p.Gln58Arg, p.Leu59His and p.Leu293Phe), 2 were previously reported (Arg93His and Glu274Lys) homozygous, 1 heterozygous stop codon (p.Trp123X) and 2 compound heterozygous (p.Arg93His + p.Arg97Pro; p.Leu22Arg + p.Gln58X) mutations. A missense single-nucleotide polymorphism was also identified in 11 patients. The novel mutations were conserved as shown by in silico analysis. Thirteen patients did not show any pathogenic CHST6 changes. This is the first report on molecular analysis of MCD in North Indian patients. All cases could not be explained by mutations in CHST6, suggesting that MCD may result from other changes in the regulatory elements of CHST6 or from genetic heterogeneity. Copyright © 2012 S. Karger AG, Basel.

  13. Foxl2 function in ovarian development.

    PubMed

    Uhlenhaut, Nina Henriette; Treier, Mathias

    2006-07-01

    Foxl2 is a forkhead transcription factor essential for proper reproductive function in females. Human patients carrying mutations in the FOXL2 gene display blepharophimosis/ptosis/epicanthus inversus syndrome (BPES), an autosomal dominant disease associated with eyelid defects and premature ovarian failure in females. Recently, animal models for BPES have been developed that in combination with a catalogue of human FOXL2 mutations provide further insight into its molecular function. Mice homozygous mutant for Foxl2 display craniofacial malformations and female infertility. The analysis of the murine phenotype has revealed that Foxl2 is required for granulosa cell function. These ovarian somatic cells surround and nourish the oocyte and play an important role in follicle formation and activation. Mutations upstream of FOXL2 in humans, not affecting the coding sequence itself, have also been shown to cause BPES, which points to the existence of a distant regulatory element necessary for proper gene expression. The same regulatory sequences may be deleted in the goat polled intersex syndrome (PIS), in which FoxL2 expression is severely reduced. Sequence comparison of FoxL2 from several vertebrate species has shown that it is a highly conserved gene involved in ovary development. Thus, the detailed understanding of Foxl2 function and regulation and the identification of its transcriptional targets may open new avenues for the treatment of female infertility in the future.

  14. Duplicate Maize Wrinkled1 Transcription Factors Activate Target Genes Involved in Seed Oil Biosynthesis1[C][W

    PubMed Central

    Pouvreau, Benjamin; Baud, Sébastien; Vernoud, Vanessa; Morin, Valérie; Py, Cyrille; Gendrot, Ghislaine; Pichon, Jean-Philippe; Rouster, Jacques; Paul, Wyatt; Rogowsky, Peter M.

    2011-01-01

    WRINKLED1 (WRI1), a key regulator of seed oil biosynthesis in Arabidopsis (Arabidopsis thaliana), was duplicated during the genome amplification of the cereal ancestor genome 90 million years ago. Both maize (Zea mays) coorthologs ZmWri1a and ZmWri1b show a strong transcriptional induction during the early filling stage of the embryo and complement the reduced fatty acid content of Arabidopsis wri1-4 seeds, suggesting conservation of molecular function. Overexpression of ZmWri1a not only increases the fatty acid content of the mature maize grain but also the content of certain amino acids, of several compounds involved in amino acid biosynthesis, and of two intermediates of the tricarboxylic acid cycle. Transcriptomic experiments identified 18 putative target genes of this transcription factor, 12 of which contain in their upstream regions an AW box, the cis-element bound by AtWRI1. In addition to functions related to late glycolysis and fatty acid biosynthesis in plastids, the target genes also have functions related to coenzyme A biosynthesis in mitochondria and the production of glycerol backbones for triacylglycerol biosynthesis in the cytoplasm. Interestingly, the higher seed oil content in ZmWri1a overexpression lines is not accompanied by a reduction in starch, thus opening possibilities for the use of the transgenic maize lines in breeding programs. PMID:21474435

  15. Control of Endothelin-A Receptor Expression by Progesterone Is Enhanced by Synergy With Gata2

    PubMed Central

    Zhang, Yanping; Knutsen, Gregory R.; Brown, Matthew D.

    2013-01-01

    The endothelin-A receptor (Ednra) is involved in several physiological, pathological, and developmental pathways. Known for its function in vasoconstriction after being activated by endothelin-1, Ednra also controls cephalic neural crest cell development and appears to play a role in several pathologies, including cancer and periodontitis. However, the mechanisms regulating Ednra expression have not been identified despite its important functions. In this study, we investigated the role progesterone plays in Ednra gene expression in vivo and in vitro. In mice, pregnancy promotes Ednra expression in the heart, kidney, lung, uterus, and placenta, and the up-regulation is mediated by progesterone. We determined that the conserved region between −5.7 and −4.2 kb upstream of the mouse Ednra gene is necessary for the progesterone response. We also found that progesterone mediates Ednra activation through progesterone receptor B activation by its recruitment to PRE6, one of the 6 progesterone response elements found in that locus. However, gene activation by means of a GATA2 site was also necessary for the progesterone response. The Gata2 transcription factor enhances the progesterone response mediated by the progesterone receptor B. Together these results indicate that progesterone regulates Ednra expression by synergizing with Gata2 activity, a previously unknown mechanism. This mechanism may have an impact on pathologies involving the endothelin signaling. PMID:23592430

  16. Comparative Analysis of V-Akt Murine Thymoma Viral Oncogene Homolog 3 (AKT3) Gene between Cow and Buffalo Reveals Substantial Differences for Mastitis

    PubMed Central

    Bhattarai, Dinesh; Cheng, Zhangrui; Liang, Xianwei; Deng, Tingxian; Rehman, Zia Ur; Talpur, Hira Sajjad; Worku, Tesfaye; Brohi, Rahim Dad; Safdar, Muhammad; Ahmad, Muhammad Jamil; Salim, Mohammad; Khan, Momen; Ahmad, Hafiz Ishfaq

    2018-01-01

    AKT3 gene is a constituent of the serine/threonine protein kinase family and plays a crucial role in synthesis of milk fats and cholesterol by regulating activity of the sterol regulatory element binding protein (SREBP). AKT3 is highly conserved in mammals and its expression levels during the lactation periods of cattle are markedly increased. AKT3 is highly expressed in the intestine followed by mammary gland and it is also expressed in immune cells. It is involved in the TLR pathways as effectively as proinflammatory cytokines. The aims of this study were to investigate the sequences differences between buffalo and cow. Our results showed that there were substantial differences between buffalo and cow in some exons and noteworthy differences of the gene size in different regions. We also identified the important consensus sequence motifs, variation in 2000 upstream of ATG, substantial difference in the “3′UTR” region, and miRNA association in the buffalo sequences compared with the cow. In addition, genetic analyses, such as gene structure, phylogenetic tree, position of different motifs, and functional domains, were performed to establish their correlation with other species. This may indicate that a buffalo breed has potential resistance to disease, environment changes, and airborne microorganisms and some good production and reproductive traits. PMID:29862252

  17. Structural basis for concerted recruitment and activation of IRF-3 by innate immune adaptor proteins

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao, Baoyu; Shu, Chang; Gao, Xinsheng

    Type I IFNs are key cytokines mediating innate antiviral immunity. cGMP-AMP synthase, ritinoic acid-inducible protein 1 (RIG-I)–like receptors, and Toll-like receptors recognize microbial double-stranded (ds)DNA, dsRNA, and LPS to induce the expression of type I IFNs. These signaling pathways converge at the recruitment and activation of the transcription factor IRF-3 (IFN regulatory factor 3). The adaptor proteins STING (stimulator of IFN genes), MAVS (mitochondrial antiviral signaling), and TRIF (TIR domain-containing adaptor inducing IFN-β) mediate the recruitment of IRF-3 through a conserved pLxIS motif. Here in this paper, we show that the pLxIS motif of phosphorylated STING, MAVS, and TRIF bindsmore » to IRF-3 in a similar manner, whereas residues upstream of the motif confer specificity. The structure of the IRF-3 phosphomimetic mutant S386/396E bound to the cAMP response element binding protein (CREB)-binding protein reveals that the pLxIS motif also mediates IRF-3 dimerization and activation. Moreover, rotavirus NSP1 (nonstructural protein 1) employs a pLxIS motif to target IRF-3 for degradation, but phosphorylation of NSP1 is not required for its activity. These results suggest a concerted mechanism for the recruitment and activation of IRF-3 that can be subverted by viral proteins to evade innate immune responses.« less

  18. Cloning and sequence analysis of the Antheraea pernyi nucleopolyhedrovirus gp64 gene.

    PubMed

    Wang, Wenbing; Zhu, Shanying; Wang, Liqun; Yu, Feng; Shen, Weide

    2005-12-01

    Frequent outbreaks of the purulence disease of Chinese oak silkworm are reported in Middle and Northeast China. The disease is produced by the pathogen Antheraea pernyi nucleopolyhedrovirus (AnpeNPV). To obtain molecular information of the virus, the polyhedra of AnpeNPV were purified and characterized. The genomic DNA of AnpeNPV was extracted and digested with HindIII. The genome size of AnpeNPV is estimated at 128 kb. Based on the analysis of DNA fragments digested with HindIII, 23 fragments were bigger than 564 bp. A genomic library was generated using HindIII and the positive clones were sequenced and analysed. The gp64 gene, encoding the baculovirus envelope protein GP64, was found in an insert. The nucleotide sequence analysis indicated that the AnpeNPV gp64 gene consists of a 1,530 nucleotide open reading frame (ORF), encoding a protein of 509 amino acids. Of the eight gp64 homologues, the AnpeNPV gp64 ORF shared the most sequence similarity with the gp64 gene of Anticarsia gemmatalis NPV, but not Bombyx mori NPV. The upstream region of the AnpeNPV gp64 ORF encoded the conserved transcriptional elements for early and late stage of the viral infection cycle. These results indicated that AnpeNPV belongs to group I NPV and was far removed in molecular phylogeny from the BmNPV.

  19. Short interspersed elements (SINEs) from insectivores. Two classes of mammalian SINEs distinguished by A-rich tail structure.

    PubMed

    Borodulina, O R; Kramerov, D A

    2001-10-01

    Four tRNA-related SINE families were isolated from the genome of the shrew Sorex araneus (SOR element), mole Mogera robusta (TAL element), and hedgehog Mesechinus dauuricus (ERI-1 and ERI-2 elements). Each of these SINEs families is specific for a single Insectivora family: SOR, for Soricidae (shrews); TAL, for Talpidae (moles and desmans); ERI-1 and ERI-2, for Erinaceidae (hedgehogs). There is a long polypyrimidine region (TC-motif) in TAL, ERI-1, and ERI-2 elements located immediately upstream of an A-rich tail with polyadenylation signals (AATAAA) and an RNA polymerase III terminator (T(4-6)) or TCT(3-4)). Ten out of 14 analyzed mammalian tRNA-related SINE families have an A-rich tail similar to that of TAL, ERI-1, and ERI-2 elements. These elements were assigned to class T+. The other four SINEs including SOR element have no polyadenylation signal and transcription terminator in their A-rich tail and were assigned to class T-. Class T+ SINEs occur only in mammals, and most of them have a long polypyrimidine region. Possible models of retroposition of class T+ and T- SINEs are discussed.

  20. In Silico Analysis of Gene Expression Network Components Underlying Pigmentation Phenotypes in the Python Identified Evolutionarily Conserved Clusters of Transcription Factor Binding Sites

    PubMed Central

    2016-01-01

    Color variation provides the opportunity to investigate the genetic basis of evolution and selection. Reptiles are less studied than mammals. Comparative genomics approaches allow for knowledge gained in one species to be leveraged for use in another species. We describe a comparative vertebrate analysis of conserved regulatory modules in pythons aimed at assessing bioinformatics evidence that transcription factors important in mammalian pigmentation phenotypes may also be important in python pigmentation phenotypes. We identified 23 python orthologs of mammalian genes associated with variation in coat color phenotypes for which we assessed the extent of pairwise protein sequence identity between pythons and mouse, dog, horse, cow, chicken, anole lizard, and garter snake. We next identified a set of melanocyte/pigment associated transcription factors (CREB, FOXD3, LEF-1, MITF, POU3F2, and USF-1) that exhibit relatively conserved sequence similarity within their DNA binding regions across species based on orthologous alignments across multiple species. Finally, we identified 27 evolutionarily conserved clusters of transcription factor binding sites within ~200-nucleotide intervals of the 1500-nucleotide upstream regions of AIM1, DCT, MC1R, MITF, MLANA, OA1, PMEL, RAB27A, and TYR from Python bivittatus. Our results provide insight into pigment phenotypes in pythons. PMID:27698666

  1. In Silico Analysis of Gene Expression Network Components Underlying Pigmentation Phenotypes in the Python Identified Evolutionarily Conserved Clusters of Transcription Factor Binding Sites.

    PubMed

    Irizarry, Kristopher J L; Bryden, Randall L

    2016-01-01

    Color variation provides the opportunity to investigate the genetic basis of evolution and selection. Reptiles are less studied than mammals. Comparative genomics approaches allow for knowledge gained in one species to be leveraged for use in another species. We describe a comparative vertebrate analysis of conserved regulatory modules in pythons aimed at assessing bioinformatics evidence that transcription factors important in mammalian pigmentation phenotypes may also be important in python pigmentation phenotypes. We identified 23 python orthologs of mammalian genes associated with variation in coat color phenotypes for which we assessed the extent of pairwise protein sequence identity between pythons and mouse, dog, horse, cow, chicken, anole lizard, and garter snake. We next identified a set of melanocyte/pigment associated transcription factors (CREB, FOXD3, LEF-1, MITF, POU3F2, and USF-1) that exhibit relatively conserved sequence similarity within their DNA binding regions across species based on orthologous alignments across multiple species. Finally, we identified 27 evolutionarily conserved clusters of transcription factor binding sites within ~200-nucleotide intervals of the 1500-nucleotide upstream regions of AIM1, DCT, MC1R, MITF, MLANA, OA1, PMEL, RAB27A, and TYR from Python bivittatus . Our results provide insight into pigment phenotypes in pythons.

  2. Conserved noncoding sequences conserve biological networks and influence genome evolution.

    PubMed

    Xie, Jianbo; Qian, Kecheng; Si, Jingna; Xiao, Liang; Ci, Dong; Zhang, Deqiang

    2018-05-01

    Comparative genomics approaches have identified numerous conserved cis-regulatory sequences near genes in plant genomes. Despite the identification of these conserved noncoding sequences (CNSs), our knowledge of their functional importance and selection remains limited. Here, we used a combination of DNA methylome analysis, microarray expression analyses, and functional annotation to study these sequences in the model tree Populus trichocarpa. Methylation in CG contexts and non-CG contexts was lower in CNSs, particularly CNSs in the 5'-upstream regions of genes, compared with other sites in the genome. We observed that CNSs are enriched in genes with transcription and binding functions, and this also associated with syntenic genes and those from whole-genome duplications, suggesting that cis-regulatory sequences play a key role in genome evolution. We detected a significant positive correlation between CNS number and protein interactions, suggesting that CNSs may have roles in the evolution and maintenance of biological networks. The divergence of CNSs indicates that duplication-degeneration-complementation drives the subfunctionalization of a proportion of duplicated genes from whole-genome duplication. Furthermore, population genomics confirmed that most CNSs are under strong purifying selection and only a small subset of CNSs shows evidence of adaptive evolution. These findings provide a foundation for future studies exploring these key genomic features in the maintenance of biological networks, local adaptation, and transcription.

  3. Long-Range Control of Gene Expression: Emerging Mechanisms and Disruption in Disease

    PubMed Central

    Kleinjan, Dirk A.; van Heyningen, Veronica

    2005-01-01

    Transcriptional control is a major mechanism for regulating gene expression. The complex machinery required to effect this control is still emerging from functional and evolutionary analysis of genomic architecture. In addition to the promoter, many other regulatory elements are required for spatiotemporally and quantitatively correct gene expression. Enhancer and repressor elements may reside in introns or up- and downstream of the transcription unit. For some genes with highly complex expression patterns—often those that function as key developmental control genes—the cis-regulatory domain can extend long distances outside the transcription unit. Some of the earliest hints of this came from disease-associated chromosomal breaks positioned well outside the relevant gene. With the availability of wide-ranging genome sequence comparisons, strong conservation of many noncoding regions became obvious. Functional studies have shown many of these conserved sites to be transcriptional regulatory elements that sometimes reside inside unrelated neighboring genes. Such sequence-conserved elements generally harbor sites for tissue-specific DNA-binding proteins. Developmentally variable chromatin conformation can control protein access to these sites and can regulate transcription. Disruption of these finely tuned mechanisms can cause disease. Some regulatory element mutations will be associated with phenotypes distinct from any identified for coding-region mutations. PMID:15549674

  4. Water-quality trends for selected sampling sites in the upper Clark Fork Basin, Montana, water years 1996-2010

    USGS Publications Warehouse

    Sando, Steven K.; Vecchia, Aldo V.; Lorenz, David L.; Barnhart, Elliott P.

    2014-01-01

    A large-scale trend analysis was done on specific conductance, selected trace elements (arsenic, cadmium, copper, iron, lead, manganese, and zinc), and suspended-sediment data for 22 sites in the upper Clark Fork Basin for water years 1996–2010. Trend analysis was conducted by using two parametric methods: a time-series model (TSM) and multiple linear regression on time, streamflow, and season (MLR). Trend results for 1996–2010 indicate moderate to large decreases in flow-adjusted concentrations (FACs) and loads of copper (and other metallic elements) and suspended sediment in Silver Bow Creek upstream from Warm Springs. Deposition of metallic elements and suspended sediment within Warm Springs Ponds substantially reduces the downstream transport of those constituents. However, mobilization of copper and suspended sediment from floodplain tailings and stream banks in the Clark Fork reach from Galen to Deer Lodge is a large source of metallic elements and suspended sediment, which also affects downstream transport of those constituents. Copper and suspended-sediment loads mobilized from within this reach accounted for about 40 and 20 percent, respectively, of the loads for Clark Fork at Turah Bridge (site 20); whereas, streamflow contributed from within this reach only accounted for about 8 percent of the streamflow at Turah Bridge. Minor changes in FACs and loads of copper and suspended sediment are indicated for this reach during 1996–2010. Clark Fork reaches downstream from Deer Lodge are relatively smaller sources of metallic elements than the reach from Galen to Deer Lodge. In general, small decreases in loads and FACs of copper and suspended sediment are indicated for Clark Fork sites downstream from Deer Lodge during 1996–2010. Thus, although large decreases in FACs and loads of copper and suspended sediment are indicated for Silver Bow Creek upstream from Warm Springs, those large decreases are not translated to the more downstream reaches largely because of temporal stationarity in constituent transport relations in the Clark Fork reach from Galen to Deer Lodge. Unlike metallic elements, arsenic (a metalloid element) in streams in the upper Clark Fork Basin typically is mostly in dissolved phase, has less variability in concentrations, and has weaker direct relations with suspended-sediment concentrations and streamflow. Arsenic trend results for 1996–2010 indicate generally moderate decreases in FACs and loads in Silver Bow Creek upstream from Opportunity. In general, small temporal changes in loads and FACs of arsenic are indicated for Silver Bow Creek and Clark Fork reaches downstream from Opportunity during 1996–2010. Contribution of arsenic (from Warm Springs Ponds, the Mill-Willow bypass, and groundwater sources) in the Silver Bow Creek reach from Opportunity to Warm Springs is a relatively large source of arsenic. Arsenic loads originating from within this reach accounted for about 11 percent of the load for Clark Fork at Turah Bridge; whereas, streamflow contributed from within this reach only accounted for about 2 percent of the streamflow at Turah Bridge.

  5. 3D PRINTING SUSTAINABLE BUILDING COMPONENTS FOR FACADES AND AS WINDOW ELEMENTS

    EPA Science Inventory

    The façade elements we design will be targeted at the construction industry and will be evaluated in the context of rapid manufacturing, energy conservation, thermal performance, structural strength, durability and construction assembly. The façade element des...

  6. Differential regulation of mnp2, a new manganese peroxidase-encoding gene from the ligninolytic fungus Trametes versicolor PRL 572.

    PubMed

    Johansson, Tomas; Nyman, Per Olof; Cullen, Daniel

    2002-04-01

    A peroxidase-encoding gene, mnp2, and its corresponding cDNA were characterized from the white-rot basidiomycete Trametes versicolor PRL 572. We used quantitative reverse transcriptase-mediated PCR to identify mnp2 transcripts in nutrient-limited stationary cultures. Although mnp2 lacks upstream metal response elements (MREs), addition of MnSO(4) to cultures increased mnp2 transcript levels 250-fold. In contrast, transcript levels of an MRE-containing gene of T. versicolor, mnp1, increased only eightfold under the same conditions. Thus, the manganese peroxidase genes in T. versicolor are differentially regulated, and upstream MREs are not necessarily involved. Our results support the hypothesis that fungal and plant peroxidases arose through an ancient duplication and folding of two structural domains, since we found the mnp1 and mnp2 polypeptides to have internal homology.

  7. Differential Regulation of mnp2, a New Manganese Peroxidase-Encoding Gene from the Ligninolytic Fungus Trametes versicolor PRL 572

    PubMed Central

    Johansson, Tomas; Nyman, Per Olof; Cullen, Daniel

    2002-01-01

    A peroxidase-encoding gene, mnp2, and its corresponding cDNA were characterized from the white-rot basidiomycete Trametes versicolor PRL 572. We used quantitative reverse transcriptase-mediated PCR to identify mnp2 transcripts in nutrient-limited stationary cultures. Although mnp2 lacks upstream metal response elements (MREs), addition of MnSO4 to cultures increased mnp2 transcript levels 250-fold. In contrast, transcript levels of an MRE-containing gene of T. versicolor, mnp1, increased only eightfold under the same conditions. Thus, the manganese peroxidase genes in T. versicolor are differentially regulated, and upstream MREs are not necessarily involved. Our results support the hypothesis that fungal and plant peroxidases arose through an ancient duplication and folding of two structural domains, since we found the mnp1 and mnp2 polypeptides to have internal homology. PMID:11916737

  8. Hydrodynamic Influence Dabanhu River Bridge Holes Widening Based on Two-Dimensional Finite Element Numerical Model

    NASA Astrophysics Data System (ADS)

    Li, Dong Feng; Bai, Fu Qing; Nie, Hui

    2018-06-01

    In order to analyze the influence of bridge holes widening on hydrodynamic such as water level, a two-dimensional mathematical model was used to calculate the hydrodynamic factors, river network flow velocity vector distribution is given, water level and difference of bridge widening before and after is calculated and charted, water surface gradient in seven different river sections near the upper reaches of bridges is counted and revealed. The results of hydrodynamic calculation indicate that The Maximum and the minimum deducing numerical value of the water level after bridge widening is 0.028m, and 0.018m respective. the seven sections water surface gradient becomes smaller until it becomes negative, the influence of bridge widening on the upstream is basically over, the range of influence is about 450m from the bridge to the upstream. reach

  9. Genetic evidence for conserved non-coding element function across species–the ears have it

    PubMed Central

    Turner, Eric E.; Cox, Timothy C.

    2014-01-01

    Comparison of genomic sequences from diverse vertebrate species has revealed numerous highly conserved regions that do not appear to encode proteins or functional RNAs. Often these “conserved non-coding elements,” or CNEs, can direct gene expression to specific tissues in transgenic models, demonstrating they have regulatory function. CNEs are frequently found near “developmental” genes, particularly transcription factors, implying that these elements have essential regulatory roles in development. However, actual examples demonstrating CNE regulatory functions across species have been few, and recent loss-of-function studies of several CNEs in mice have shown relatively minor effects. In this Perspectives article, we discuss new findings in “fancy” rats and Highland cattle demonstrating that function of a CNE near the Hmx1 gene is crucial for normal external ear development and when disrupted can mimic loss-of function Hmx1 coding mutations in mice and humans. These findings provide important support for conserved developmental roles of CNEs in divergent species, and reinforce the concept that CNEs should be examined systematically in the ongoing search for genetic causes of human developmental disorders in the era of genome-scale sequencing. PMID:24478720

  10. Small gene family encoding an eggshell (chorion) protein of the human parasite Schistosoma mansoni

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bobek, L.A.; Rekosh, D.M.; Lo Verde, P.T.

    1988-08-01

    The authors isolated six independent genomic clones encoding schistosome chorion or eggshell proteins from a Schistosoma mansoni genomic library. A linkage map of five of the clones spanning 35 kilobase pairs (kbp) of the S. mansoni genome was constructed. The region contained two eggshell protein genes closely linked, separated by 7.5 kbp of intergenic DNA. The two genes of the cluster were arranged in the same orientation, that is, they were transcribed from the same strand. The sixth clone probably represents a third copy of the eggshell gene that is not contained within the 35-kbp region. The 5- end ofmore » the mRNA transcribed from these genes was defined by primer extension directly off the RNA. The ATCAT cap site sequence was homologous to a silkmoth chorion PuTCATT cap site sequence, where Pu indicates any purine. DNA sequence analysis showed that there were no introns in these genes. The DNA sequences of the three genes were very homologous to each other and to a cDNA clone, pSMf61-46, differing only in three or four nucleotices. A multiple TATA box was located at positions -23 to -31, and a CAAAT sequence was located at -52 upstream of the eggshell transcription unit. Comparison of sequences in regions further upstream with silkmoth and Drosophila sequences revealed very short elements that were shared. One such element, TCACGT, recently shown to be an essential cis-regulatory element for silkmoth chorion gene promoter function, was found at a similar position in all three organisms.« less

  11. Numerical simulation of scouring-deposition variations caused by rainfall-induced landslides in the upstream of Zengwun River, Taiwan

    NASA Astrophysics Data System (ADS)

    Lee, Ming-Hsi; Liao, Yi-Wen; Tsai, Kuang-Jung

    2017-04-01

    In recent years, the increasing sediment disasters of severe rainfall-induced landslides on human lives and lifeline facilities worldwide have advanced the necessity to find out both economically acceptable and useful techniques to predict the occurrence and destructive power of the disasters. In August 2009, Typhoon Morakot brought a large amount of rainfall with both high intensity and long duration to a vast area of Taiwan. Unfortunately, this resulted in a catastrophic landslide in watershed of Zengwun-River reservoir, southern Taiwan. Meanwhile, large amounts of landslides were formed in the upstream of Zengwun River. The major scope of this study is to apply numerical model to simulate the scouring-deposition variations caused by rainfall-induced landslides that occurred in the upstream of Zengwun River during Typhoon Morakot. This study proposed the relation diagrams of the intermediate diameter (d50), recurrence interval (T) and scouring-deposition depth (D), and applied the diagrams to understand the impacts of the scouring-deposition variations on the structures for water and soil conservation and their measurements. Based on the simulation of scouring-deposition variation at the Da-Bu dam and Da-Bang dam, this study also discussed the scouring-deposition variations of different sections under different scenarios (including flow rate, intermediate diameters and structures). In summary, the result suggested that the diagrams of the intermediate diameter, recurrence interval and scouring-deposition depth could be used as the reference for designing the check dams, ground sills and lateral constructions.

  12. A priori error estimates for an hp-version of the discontinuous Galerkin method for hyperbolic conservation laws

    NASA Technical Reports Server (NTRS)

    Bey, Kim S.; Oden, J. Tinsley

    1993-01-01

    A priori error estimates are derived for hp-versions of the finite element method for discontinuous Galerkin approximations of a model class of linear, scalar, first-order hyperbolic conservation laws. These estimates are derived in a mesh dependent norm in which the coefficients depend upon both the local mesh size h(sub K) and a number p(sub k) which can be identified with the spectral order of the local approximations over each element.

  13. Conserved Elements Vaccine for HIV | NCI Technology Transfer Center | TTC

    Cancer.gov

    Researchers at the National Cancer Institute (NCI) developed a DNA vaccine using conserved elements of HIV-1 Gag, administered in a prime-boost vaccination protocol. Two of the HIV Gag CE DNA vectors have been tested in a rhesus macaque model. Priming with the Gag CE vaccine and boosting with full length Gag DNA showed increased immune responses when compared to vaccination with Gag alone. Researchers seek licensing and/or co-development research collaborations for development this DNA vaccine.

  14. A key role for foxQ2 in anterior head and central brain patterning in insects

    PubMed Central

    Kitzmann, Peter; Weißkopf, Matthias; Schacht, Magdalena Ines

    2017-01-01

    ABSTRACT Anterior patterning of animals is based on a set of highly conserved transcription factors but the interactions within the protostome anterior gene regulatory network (aGRN) remain enigmatic. Here, we identify the red flour beetle Tribolium castaneum ortholog of foxQ2 (Tc-foxQ2) as a novel upstream component of the aGRN. It is required for the development of the labrum and higher order brain structures, namely the central complex and the mushroom bodies. We reveal Tc-foxQ2 interactions by RNAi and heat shock-mediated misexpression. Surprisingly, Tc-foxQ2 and Tc-six3 mutually activate each other, forming a novel regulatory module at the top of the aGRN. Comparisons of our results with those of sea urchins and cnidarians suggest that foxQ2 has acquired more upstream functions in the aGRN during protostome evolution. Our findings expand the knowledge on foxQ2 gene function to include essential roles in epidermal development and central brain patterning. PMID:28811313

  15. The effector gene xopAE of Xanthomonas euvesicatoria 85-10 is part of an operon and encodes an E3 ubiquitin ligase.

    PubMed

    Popov, Georgy; Majhi, Bharat Bhusan; Sessa, Guido

    2018-05-21

    The type III effector XopAE from the Xanthomonas euvesicatoria strain 85-10 ( Xe 85-10) was previously shown to inhibit plant immunity and enhance pathogen-induced disease symptoms. Evolutionary analysis of 60 xopAE alleles ( AEal ) revealed that the xopAE locus is conserved in multiple Xanthomonas species. The majority of xopAE alleles (55 out of 60) encodes a single ORF ( xopAE ), while in 5 alleles, including AEal 37 of the Xe 85-10 strain, a frame-shift splits the locus into two ORFs ( hpaF and a truncated xopAE ). To test whether the second ORF of AEal 37 ( xopAE 85-10 ) is translated, we examined expression of YFP fused downstream to truncated or mutant forms of the locus in Xanthomonas bacteria. YFP fluorescence was detected at maximal levels when the reporter was in proximity of an internal ribosome-binding site upstream to a rare ATT start codon in the xopAE 85-10 ORF, but severely reduced when these elements were abolished. In agreement with the notion that xopAE 85- 10 is a functional gene, its protein product was translocated into plant cells by the type III secretion system and translocation was dependent on its upstream ORF hpaF. Homology modeling predicted that XopAE 85-10 contains an E3 ligase XL-box domain at the C-terminus, and in vitro assays demonstrated that this domain displays mono-ubiquitination activity. Remarkably, the XL-box was essential for XopAE 85-10 to inhibit PAMP-induced gene expression in Arabidopsis protoplasts. Together, these results indicate that the xopAE 85-10 gene resides in a functional operon, which utilizes the alternative start codon ATT, and encodes a novel XL-box E3 ligase. Importance Xanthomonas bacteria utilize a type III secretion system to cause disease in many crops. This study provides insights into evolution, translocation and biochemical function of the XopAE type III secreted effector contributing to the understanding of Xanthomonas-host interactions. We establish XopAE as core effector of seven Xanthomonas species and elucidate evolution of the Xanthomonas euvesicatoria xopAE locus, which contains an operon encoding a truncated effector. Our findings indicate that this operon evolved from the split of a multi-domains gene into two ORFs that conserved the original domain function. Analysis of xopAE 85-10 translation provides the first evidence for translation initiation from an ATT codon in Xanthomonas Our data demonstrate that XopAE 85-10 is an XL-box E3 ubiquitin ligase and provide insights into structure and function of this effector family. Copyright © 2018 American Society for Microbiology.

  16. A new flux conserving Newton's method scheme for the two-dimensional, steady Navier-Stokes equations

    NASA Technical Reports Server (NTRS)

    Scott, James R.; Chang, Sin-Chung

    1993-01-01

    A new numerical method is developed for the solution of the two-dimensional, steady Navier-Stokes equations. The method that is presented differs in significant ways from the established numerical methods for solving the Navier-Stokes equations. The major differences are described. First, the focus of the present method is on satisfying flux conservation in an integral formulation, rather than on simulating conservation laws in their differential form. Second, the present approach provides a unified treatment of the dependent variables and their unknown derivatives. All are treated as unknowns together to be solved for through simulating local and global flux conservation. Third, fluxes are balanced at cell interfaces without the use of interpolation or flux limiters. Fourth, flux conservation is achieved through the use of discrete regions known as conservation elements and solution elements. These elements are not the same as the standard control volumes used in the finite volume method. Fifth, the discrete approximation obtained on each solution element is a functional solution of both the integral and differential form of the Navier-Stokes equations. Finally, the method that is presented is a highly localized approach in which the coupling to nearby cells is only in one direction for each spatial coordinate, and involves only the immediately adjacent cells. A general third-order formulation for the steady, compressible Navier-Stokes equations is presented, and then a Newton's method scheme is developed for the solution of incompressible, low Reynolds number channel flow. It is shown that the Jacobian matrix is nearly block diagonal if the nonlinear system of discrete equations is arranged approximately and a proper pivoting strategy is used. Numerical results are presented for Reynolds numbers of 100, 1000, and 2000. Finally, it is shown that the present scheme can resolve the developing channel flow boundary layer using as few as six to ten cells per channel width, depending on the Reynolds number.

  17. Achieving a golden mean: mechanisms by which coronaviruses ensure synthesis of the correct stoichiometric ratios of viral proteins.

    PubMed

    Plant, Ewan P; Rakauskaite, Rasa; Taylor, Deborah R; Dinman, Jonathan D

    2010-05-01

    In retroviruses and the double-stranded RNA totiviruses, the efficiency of programmed -1 ribosomal frameshifting is critical for ensuring the proper ratios of upstream-encoded capsid proteins to downstream-encoded replicase enzymes. The genomic organizations of many other frameshifting viruses, including the coronaviruses, are very different, in that their upstream open reading frames encode nonstructural proteins, the frameshift-dependent downstream open reading frames encode enzymes involved in transcription and replication, and their structural proteins are encoded by subgenomic mRNAs. The biological significance of frameshifting efficiency and how the relative ratios of proteins encoded by the upstream and downstream open reading frames affect virus propagation has not been explored before. Here, three different strategies were employed to test the hypothesis that the -1 PRF signals of coronaviruses have evolved to produce the correct ratios of upstream- to downstream-encoded proteins. Specifically, infectious clones of the severe acute respiratory syndrome (SARS)-associated coronavirus harboring mutations that lower frameshift efficiency decreased infectivity by >4 orders of magnitude. Second, a series of frameshift-promoting mRNA pseudoknot mutants was employed to demonstrate that the frameshift signals of the SARS-associated coronavirus and mouse hepatitis virus have evolved to promote optimal frameshift efficiencies. Finally, we show that a previously described frameshift attenuator element does not actually affect frameshifting per se but rather serves to limit the fraction of ribosomes available for frameshifting. The findings of these analyses all support a "golden mean" model in which viruses use both programmed ribosomal frameshifting and translational attenuation to control the relative ratios of their encoded proteins.

  18. XX males SRY negative: a confirmed cause of infertility.

    PubMed

    Vetro, Annalisa; Ciccone, Roberto; Giorda, Roberto; Patricelli, Maria Grazia; Della Mina, Erika; Forlino, Antonella; Zuffardi, Orsetta

    2011-10-01

    SOX9 is a widely expressed transcription factor playing several relevant functions during development and essential for testes differentiation. It is considered to be the direct target gene of the protein encoded by SRY and its overexpression in an XX murine gonad can lead to male development in the absence of Sry. Recently, a family was reported with a 178 kb duplication in the gene desert region ending about 500 kb upstream of SOX9 in which 46,XY duplicated persons were completely normal and fertile whereas the 46,XX ones were males who came to clinical attention because of infertility. We report a family with two azoospermic brothers, both 46,XX, SRY negative, having a 96 kb triplication 500 kb upstream of SOX9. Both subjects have been analyzed trough oligonucleotide array-CGH and the triplication was confirmed and characterised through qPCR, defining the minimal region of amplification upstream of SOX9 associated with 46,XX infertile males, SRY negative. Our results confirm that even in absence of SRY, complete male differentiation may occur, possibly driven by overexpression of SOX9 in the gonadal ridge, as a consequence of the amplification of a gene desert region. We hypothesize that this region contains gonadal specific long-range regulation elements whose alteration may impair the normal sex development. Our data show that normal XX males, with alteration in copy number or, possibly, in the critical sequence upstream to SOX9 are a new category of infertility inherited in a dominant way with expression limited to the XX background.

  19. Rearrangement of Upstream Sequences of the hTERT Gene During Cellular Immortalization

    PubMed Central

    Zhao, Yuanjun; Wang, Shuwen; Popova, Evgenya Y.; Grigoryev, Sergei A.; Zhu, Jiyue

    2010-01-01

    Telomerase expression, resulting from transcriptional activation of the hTERT gene, allows cells to acquire indefinite proliferative potential during cellular immortalization and tumorigenesis. However, mechanisms of hTERT gene activation in many immortal cell lines and cancer cells are poorly understood. Here, we report our studies on hTERT activation using genetically related pairs of telomerase-negative (Tel−) and -positive (Tel+) fibroblast lines. First, whereas transiently transfected plasmid reporters did not recapitulate the endogenous hTERT promoter, the promoter in chromosomally integrated bacterial artificial chromosome (BAC) reporters was activated in a subset of Tel+ cells, indicating that activation of the hTERT promoter required native chromatin context and/or distal regulatory elements. Second, the hTERT gene, located near the telomere of chromosome 5p, was translocated in all three Tel+ cell lines but not in their parental pre-crisis cells and Tel− immortal siblings. The breakage points were mapped to regions upstream of the hTERT promoter, indicating that the hTERT gene was the target of these chromosomal rearrangements. In two Tel+ cell lines, translocation of the endogenous hTERT gene appeared to be the major mechanism of its activation as the activity of hTERT promoter in many chromosomally integrated BAC reporters, with intact upstream and downstream neighboring loci, remained relatively low. Therefore, our results suggest that rearrangement of upstream sequences is an important new mechanism of hTERT promoter activation during cellular immortalization. The chromosomal rearrangements likely occurred during cellular crisis and facilitated by telomere dysfunction. Such translocations allowed the hTERT promoter to escape from the native condensed chromatin environment. PMID:19672873

  20. E2-mediated cathepsin D (CTSD) activation involves looping of distal enhancer elements.

    PubMed

    Bretschneider, Nancy; Kangaspeska, Sara; Seifert, Martin; Reid, George; Gannon, Frank; Denger, Stefanie

    2008-08-01

    Estrogen receptor alpha (ERalpha) is a ligand dependent transcription factor that regulates the expression of target genes through interacting with cis-acting estrogen response elements (EREs). However, only a minority of ERalpha binding sites are located within the proximal promoter regions of responsive genes. Here we report the characterization of an ERE located 9kbp upstream of the TSS of the cathepsin D gene (CTSD) that up-regulates CTSD expression upon estrogen stimulation in MCF-7 cells. Using ChIP, we show recruitment of ERalpha and phosphorylated PolII at the CTSD distal enhancer region. Moreover, we determine the kinetics of transient CpG methylation on the promoter region of CTSD and for the first time, at a distal enhancer element. We show that ERalpha is crucial for long-distance regulation of CTSD expression involving a looping mechanism.

  1. Conserved structure and inferred evolutionary history of long terminal repeats (LTRs)

    PubMed Central

    2013-01-01

    Background Long terminal repeats (LTRs, consisting of U3-R-U5 portions) are important elements of retroviruses and related retrotransposons. They are difficult to analyse due to their variability. The aim was to obtain a more comprehensive view of structure, diversity and phylogeny of LTRs than hitherto possible. Results Hidden Markov models (HMM) were created for 11 clades of LTRs belonging to Retroviridae (class III retroviruses), animal Metaviridae (Gypsy/Ty3) elements and plant Pseudoviridae (Copia/Ty1) elements, complementing our work with Orthoretrovirus HMMs. The great variation in LTR length of plant Metaviridae and the few divergent animal Pseudoviridae prevented building HMMs from both of these groups. Animal Metaviridae LTRs had the same conserved motifs as retroviral LTRs, confirming that the two groups are closely related. The conserved motifs were the short inverted repeats (SIRs), integrase recognition signals (5´TGTTRNR…YNYAACA 3´); the polyadenylation signal or AATAAA motif; a GT-rich stretch downstream of the polyadenylation signal; and a less conserved AT-rich stretch corresponding to the core promoter element, the TATA box. Plant Pseudoviridae LTRs differed slightly in having a conserved TATA-box, TATATA, but no conserved polyadenylation signal, plus a much shorter R region. The sensitivity of the HMMs for detection in genomic sequences was around 50% for most models, at a relatively high specificity, suitable for genome screening. The HMMs yielded consensus sequences, which were aligned by creating an HMM model (a ‘Superviterbi’ alignment). This yielded a phylogenetic tree that was compared with a Pol-based tree. Both LTR and Pol trees supported monophyly of retroviruses. In both, Pseudoviridae was ancestral to all other LTR retrotransposons. However, the LTR trees showed the chromovirus portion of Metaviridae clustering together with Pseudoviridae, dividing Metaviridae into two portions with distinct phylogeny. Conclusion The HMMs clearly demonstrated a unitary conserved structure of LTRs, supporting that they arose once during evolution. We attempted to follow the evolution of LTRs by tracing their functional foundations, that is, acquisition of RNAse H, a combined promoter/ polyadenylation site, integrase, hairpin priming and the primer binding site (PBS). Available information did not support a simple evolutionary chain of events. PMID:23369192

  2. Conservation: Toward firmer ground

    NASA Technical Reports Server (NTRS)

    1975-01-01

    The following aspects of energy conservation were reviewed in order to place the problems in proper perspective: history and goals, conservation accounting-criteria, and a method to overcome obstacles. The effect of changing prices and available supplies of energy sources and their causes on consumption levels during the last few decades were described. Some examples of attainable conservation goals were listed and justified. A number of specific criteria applicable to conservation accounting were given. Finally, a discussion was presented to relate together the following aspects of energy conservation: widespread impact, involvement of government, industry, politics, moral and ethical aspects, urgency and time element.

  3. Detection of hyper-conserved regions in hepatitis B virus X gene potentially useful for gene therapy.

    PubMed

    González, Carolina; Tabernero, David; Cortese, Maria Francesca; Gregori, Josep; Casillas, Rosario; Riveiro-Barciela, Mar; Godoy, Cristina; Sopena, Sara; Rando, Ariadna; Yll, Marçal; Lopez-Martinez, Rosa; Quer, Josep; Esteban, Rafael; Buti, Maria; Rodríguez-Frías, Francisco

    2018-05-21

    To detect hyper-conserved regions in the hepatitis B virus (HBV) X gene ( HBX ) 5' region that could be candidates for gene therapy. The study included 27 chronic hepatitis B treatment-naive patients in various clinical stages (from chronic infection to cirrhosis and hepatocellular carcinoma, both HBeAg-negative and HBeAg-positive), and infected with HBV genotypes A-F and H. In a serum sample from each patient with viremia > 3.5 log IU/mL, the HBX 5' end region [nucleotide (nt) 1255-1611] was PCR-amplified and submitted to next-generation sequencing (NGS). We assessed genotype variants by phylogenetic analysis, and evaluated conservation of this region by calculating the information content of each nucleotide position in a multiple alignment of all unique sequences (haplotypes) obtained by NGS. Conservation at the HBx protein amino acid (aa) level was also analyzed. NGS yielded 1333069 sequences from the 27 samples, with a median of 4578 sequences/sample (2487-9279, IQR 2817). In 14/27 patients (51.8%), phylogenetic analysis of viral nucleotide haplotypes showed a complex mixture of genotypic variants. Analysis of the information content in the haplotype multiple alignments detected 2 hyper-conserved nucleotide regions, one in the HBX upstream non-coding region (nt 1255-1286) and the other in the 5' end coding region (nt 1519-1603). This last region coded for a conserved amino acid region (aa 63-76) that partially overlaps a Kunitz-like domain. Two hyper-conserved regions detected in the HBX 5' end may be of value for targeted gene therapy, regardless of the patients' clinical stage or HBV genotype.

  4. The Plasmodium selenoproteome

    PubMed Central

    Lobanov, Alexey V.; Delgado, Cesar; Rahlfs, Stefan; Novoselov, Sergey V.; Kryukov, Gregory V.; Gromer, Stephan; Hatfield, Dolph L.; Becker, Katja; Gladyshev, Vadim N.

    2006-01-01

    The use of selenocysteine (Sec) as the 21st amino acid in the genetic code has been described in all three major domains of life. However, within eukaryotes, selenoproteins are only known in animals and algae. In this study, we characterized selenoproteomes and Sec insertion systems in protozoan Apicomplexa parasites. We found that among these organisms, Plasmodium and Toxoplasma utilized Sec, whereas Cryptosporidium did not. However, Plasmodium had no homologs of known selenoproteins. By searching computationally for evolutionarily conserved selenocysteine insertion sequence (SECIS) elements, which are RNA structures involved in Sec insertion, we identified four unique Plasmodium falciparum selenoprotein genes. These selenoproteins were incorrectly annotated in PlasmoDB, were conserved in other Plasmodia and had no detectable homologs in other species. We provide evidence that two Plasmodium SECIS elements supported Sec insertion into parasite and endogenous selenoproteins when they were expressed in mammalian cells, demonstrating that the Plasmodium SECIS elements are functional and indicating conservation of Sec insertion between Apicomplexa and animals. Dependence of the plasmodial parasites on selenium suggests possible strategies for antimalarial drug development. PMID:16428245

  5. Strategies for enhancing bioluminescent bacterial sensor performance by promoter region manipulation

    PubMed Central

    Bilic, Benny; Belkin, Shimshon

    2010-01-01

    Genetically engineered microbial reporter strains are based upon the fusion of an inducible sensing element upstream of a reporting element, so that the construct emits a dose-dependent signal when exposed to the inducing compound(s) or stress factor(s). In this communication1 we described several general approaches undertaken in order to enhance the sensing performance of such promoter::reporter fusions. Significant improvements in detection sensitivity, response kinetics and signal intensity were achieved by modi fication of the length of the promoter-containing DNA fragment, by random or site-directed mutagenesis and by promoter duplication. The general nature of these genetics manipulations makes them applicable to other types of promoter::reporter fusions. PMID:21326942

  6. The P1-RKDG method for two-dimensional Euler equations of gas dynamics

    NASA Technical Reports Server (NTRS)

    Cockburn, Bernardo; Shu, Chi-Wang

    1991-01-01

    A class of nonlinearly stable Runge-Kutta local projection discontinuous Galerkin (RKDG) finite element methods for conservation laws is investigated. Two dimensional Euler equations for gas dynamics are solved using P1 elements. The generalization of the local projections, which for scalar nonlinear conservation laws was designed to satisfy a local maximum principle, to systems of conservation laws such as the Euler equations of gas dynamics using local characteristic decompositions is discussed. Numerical examples include the standard regular shock reflection problem, the forward facing step problem, and the double Mach reflection problem. These preliminary numerical examples are chosen to show the capacity of the approach to obtain nonlinearly stable results comparable with the modern nonoscillatory finite difference methods.

  7. SECIS elements in the coding regions of selenoprotein transcripts are functional in higher eukaryotes

    PubMed Central

    Mix, Heiko; Lobanov, Alexey V.; Gladyshev, Vadim N.

    2007-01-01

    Expression of selenocysteine (Sec)-containing proteins requires the presence of a cis-acting mRNA structure, called selenocysteine insertion sequence (SECIS) element. In bacteria, this structure is located in the coding region immediately downstream of the Sec-encoding UGA codon, whereas in eukaryotes a completely different SECIS element has evolved in the 3′-untranslated region. Here, we report that SECIS elements in the coding regions of selenoprotein mRNAs support Sec insertion in higher eukaryotes. Comprehensive computational analysis of all available viral genomes revealed a SECIS element within the ORF of a naturally occurring selenoprotein homolog of glutathione peroxidase 4 in fowlpox virus. The fowlpox SECIS element supported Sec insertion when expressed in mammalian cells as part of the coding region of viral or mammalian selenoproteins. In addition, readthrough at UGA was observed when the viral SECIS element was located upstream of the Sec codon. We also demonstrate successful de novo design of a functional SECIS element in the coding region of a mammalian selenoprotein. Our data provide evidence that the location of the SECIS element in the untranslated region is not a functional necessity but rather is an evolutionary adaptation to enable a more efficient synthesis of selenoproteins. PMID:17169995

  8. Mammal indicator species for protected areas and managed forests in a landscape conservation area in northern India

    Treesearch

    Pradeep K. Mathur; Harish Kumar; John F. Lehmkuhl; Anshuman Tripathi; Vishwas B. Sawarkar; Rupak De

    2010-01-01

    There is a realization that managed forests and other natural areas in the landscape matrix can and must make significant contributions to biodiversity conservation. Often, however, there are no consistent baseline vegetation or wildlife data for assessing the status of biodiversity elements across protected and managed areas for conservation planning, nor is there a...

  9. Metagenomic Analysis of Ammonia-Oxidizing Archaea Affiliated with the Soil Group

    PubMed Central

    Bartossek, Rita; Spang, Anja; Weidler, Gerhard; Lanzen, Anders; Schleper, Christa

    2012-01-01

    Ammonia-oxidizing archaea (AOA) have recently been recognized as a significant component of many microbial communities and represent one of the most abundant prokaryotic groups in the biosphere. However, only few AOA have been successfully cultivated so far and information on the physiology and genomic content remains scarce. We have performed a metagenomic analysis to extend the knowledge of the AOA affiliated with group I.1b that is widespread in terrestrial habitats and of which no genome sequences has been described yet. A fosmid library was generated from samples of a radioactive thermal cave (46°C) in the Austrian Central Alps in which AOA had been found as a major part of the microbial community. Out of 16 fosmids that possessed either an amoA or 16S rRNA gene affiliating with AOA, 5 were fully sequenced, 4 of which grouped with the soil/I.1b (Nitrososphaera-) lineage, and 1 with marine/I.1a (Nitrosopumilus-) lineage. Phylogenetic analyses of amoBC and an associated conserved gene were congruent with earlier analyses based on amoA and 16S rRNA genes and supported the separation of the soil and marine group. Several putative genes that did not have homologs in currently available marine Thaumarchaeota genomes indicated that AOA of the soil group contain specific genes that are distinct from their marine relatives. Potential cis-regulatory elements around conserved promoter motifs found upstream of the amo genes in sequenced (meta-) genomes differed in marine and soil group AOA. On one fosmid, a group of genes including amoA and amoB were flanked by identical transposable insertion sequences, indicating that amoAB could potentially be co-mobilized in the form of a composite transposon. This might be one of the mechanisms that caused the greater variation in gene order compared to genomes in the marine counterparts. Our findings highlight the genetic diversity within the two major and widespread lineages of Thaumarchaeota. PMID:22723795

  10. Molecular cloning of doublesex genes of four cladocera (water flea) species.

    PubMed

    Toyota, Kenji; Kato, Yasuhiko; Sato, Masaru; Sugiura, Naomi; Miyagawa, Shinichi; Miyakawa, Hitoshi; Watanabe, Hajime; Oda, Shigeto; Ogino, Yukiko; Hiruta, Chizue; Mizutani, Takeshi; Tatarazako, Norihisa; Paland, Susanne; Jackson, Craig; Colbourne, John K; Iguchi, Taisen

    2013-04-10

    The gene doublesex (dsx) is known as a key factor regulating genetic sex determination in many organisms. We previously identified two dsx genes (DapmaDsx1 and DapmaDsx2) from a freshwater branchiopod crustacean, Daphnia magna, which are expressed in males but not in females. D. magna produces males by parthenogenesis in response to environmental cues (environmental sex determination) and we showed that DapmaDsx1 expression during embryonic stages is responsible for the male trait development. The D. magna dsx genes are thought to have arisen by a cladoceran-specific duplication; therefore, to investigate evolutionary conservation of sex specific expression of dsx genes and to further assess their functions in the environmental sex determination, we searched for dsx homologs in four closely related cladoceran species. We identified homologs of both dsx genes from, D. pulex, D. galeata, and Ceriodaphnia dubia, yet only a single dsx gene was found from Moina macrocopa. The deduced amino acid sequences of all 9 dsx homologs contained the DM and oligomerization domains, which are characteristic for all arthropod DSX family members. Molecular phylogenetic analysis suggested that the dsx gene duplication likely occurred prior to the divergence of these cladoceran species, because that of the giant tiger prawn Penaeus monodon is rooted ancestrally to both DSX1 and DSX2 of cladocerans. Therefore, this result also suggested that M. macrocopa lost dsx2 gene secondarily. Furthermore, all dsx genes identified in this study showed male-biased expression levels, yet only half of the putative 5' upstream regulatory elements are preserved in D. magna and D. pulex. The all dsx genes of five cladoceran species examined had similar amino acid structure containing highly conserved DM and oligomerization domains, and exhibited sexually dimorphic expression patterns, suggesting that these genes may have similar functions for environmental sex determination in cladocerans.

  11. Molecular cloning of doublesex genes of four cladocera (water flea) species

    PubMed Central

    2013-01-01

    Background The gene doublesex (dsx) is known as a key factor regulating genetic sex determination in many organisms. We previously identified two dsx genes (DapmaDsx1 and DapmaDsx2) from a freshwater branchiopod crustacean, Daphnia magna, which are expressed in males but not in females. D. magna produces males by parthenogenesis in response to environmental cues (environmental sex determination) and we showed that DapmaDsx1 expression during embryonic stages is responsible for the male trait development. The D. magna dsx genes are thought to have arisen by a cladoceran-specific duplication; therefore, to investigate evolutionary conservation of sex specific expression of dsx genes and to further assess their functions in the environmental sex determination, we searched for dsx homologs in four closely related cladoceran species. Results We identified homologs of both dsx genes from, D. pulex, D. galeata, and Ceriodaphnia dubia, yet only a single dsx gene was found from Moina macrocopa. The deduced amino acid sequences of all 9 dsx homologs contained the DM and oligomerization domains, which are characteristic for all arthropod DSX family members. Molecular phylogenetic analysis suggested that the dsx gene duplication likely occurred prior to the divergence of these cladoceran species, because that of the giant tiger prawn Penaeus monodon is rooted ancestrally to both DSX1 and DSX2 of cladocerans. Therefore, this result also suggested that M. macrocopa lost dsx2 gene secondarily. Furthermore, all dsx genes identified in this study showed male-biased expression levels, yet only half of the putative 5’ upstream regulatory elements are preserved in D. magna and D. pulex. Conclusions The all dsx genes of five cladoceran species examined had similar amino acid structure containing highly conserved DM and oligomerization domains, and exhibited sexually dimorphic expression patterns, suggesting that these genes may have similar functions for environmental sex determination in cladocerans. PMID:23575357

  12. The Mouse Solitary Odorant Receptor Gene Promoters as Models for the Study of Odorant Receptor Gene Choice.

    PubMed

    Degl'Innocenti, Andrea; Parrilla, Marta; Harr, Bettina; Teschke, Meike

    2016-01-01

    In vertebrates, several anatomical regions located within the nasal cavity mediate olfaction. Among these, the main olfactory epithelium detects most conventional odorants. Olfactory sensory neurons, provided with cilia exposed to the air, detect volatile chemicals via an extremely large family of seven-transmembrane chemoreceptors named odorant receptors. Their genes are expressed in a monogenic and monoallelic fashion: a single allele of a single odorant receptor gene is transcribed in a given mature neuron, through a still uncharacterized molecular mechanism known as odorant receptor gene choice. Odorant receptor genes are typically arranged in genomic clusters, but a few are isolated (we call them solitary) from the others within a region broader than 1 Mb upstream and downstream with respect to their transcript's coordinates. The study of clustered genes is problematic, because of redundancy and ambiguities in their regulatory elements: we propose to use the solitary genes as simplified models to understand odorant receptor gene choice. Here we define number and identity of the solitary genes in the mouse genome (C57BL/6J), and assess the conservation of the solitary status in some mammalian orthologs. Furthermore, we locate their putative promoters, predict their homeodomain binding sites (commonly present in the promoters of odorant receptor genes) and compare candidate promoter sequences with those of wild-caught mice. We also provide expression data from histological sections. In the mouse genome there are eight intact solitary genes: Olfr19 (M12), Olfr49, Olfr266, Olfr267, Olfr370, Olfr371, Olfr466, Olfr1402; five are conserved as solitary in rat. These genes are all expressed in the main olfactory epithelium of three-day-old mice. The C57BL/6J candidate promoter of Olfr370 has considerably varied compared to its wild-type counterpart. Within the putative promoter for Olfr266 a homeodomain binding site is predicted. As a whole, our findings favor Olfr266 as a model gene to investigate odorant receptor gene choice.

  13. Building Virtual Watersheds: A Global Opportunity to Strengthen Resource Management and Conservation.

    PubMed

    Benda, Lee; Miller, Daniel; Barquin, Jose; McCleary, Richard; Cai, TiJiu; Ji, Y

    2016-03-01

    Modern land-use planning and conservation strategies at landscape to country scales worldwide require complete and accurate digital representations of river networks, encompassing all channels including the smallest headwaters. The digital river networks, integrated with widely available digital elevation models, also need to have analytical capabilities to support resource management and conservation, including attributing river segments with key stream and watershed data, characterizing topography to identify landforms, discretizing land uses at scales necessary to identify human-environment interactions, and connecting channels downstream and upstream, and to terrestrial environments. We investigate the completeness and analytical capabilities of national to regional scale digital river networks that are available in five countries: Canada, China, Russia, Spain, and United States using actual resource management and conservation projects involving 12 university, agency, and NGO organizations. In addition, we review one pan-European and one global digital river network. Based on our analysis, we conclude that the majority of the regional, national, and global scale digital river networks in our sample lack in network completeness, analytical capabilities or both. To address this limitation, we outline a general framework to build as complete as possible digital river networks and to integrate them with available digital elevation models to create robust analytical capabilities (e.g., virtual watersheds). We believe this presents a global opportunity for in-country agencies, or international players, to support creation of virtual watersheds to increase environmental problem solving, broaden access to the watershed sciences, and strengthen resource management and conservation in countries worldwide.

  14. Sociohydrological Impacts of Water Conservation Under Anthropogenic Drought in Austin, TX (USA)

    NASA Astrophysics Data System (ADS)

    Breyer, Betsy; Zipper, Samuel C.; Qiu, Jiangxiao

    2018-04-01

    Municipal water providers increasingly respond to drought by implementing outdoor water use restrictions to reduce urban water withdrawals and maintain water availability. However, restricting urban outdoor water use to support watershed-scale drought resilience may generate unanticipated cross-scale interactions, for example, by altering drought response and recovery in urban vegetation or urban streamflow. Despite this, urban water conservation is rarely conceptualized or modeled as endogenous to the water cycle. Here we investigate cross-scale interactions among urban water conservation and water availability, water use, and sociohydrological response in Austin, TX (USA) during a recent anthropogenic (human-influenced) drought. Multiscalar statistical analyses demonstrated that outdoor water conservation for reservoir management at the municipal scale produced responses that can cascade both "upward" from the city to the watershed (e.g., decoupling streamflow patterns upstream and downstream of Austin at the watershed scale) and "downward" to exert heterogeneous effects within the city (e.g., redistributing water along a socioeconomic gradient at submunicipal scales, with effects on terrestrial and aquatic ecosystems). We suggest that adapting to anthropogenic drought through irrigation curtailment requires sustained engagement between hydrology and social sciences to integrate socioeconomic status and political feedbacks within and among irrigator groups into the water cycle. Findings from this cross-disciplinary study highlight the importance of a multiscalar and spatially explicit perspectives in urban sociohydrology research to uncover how water conservation as adaptation to anthropogenic drought links hydrological processes with issues of socioeconomic inequality and spatiotemporal scale in the Anthropocene.

  15. Building Virtual Watersheds: A Global Opportunity to Strengthen Resource Management and Conservation

    NASA Astrophysics Data System (ADS)

    Benda, Lee; Miller, Daniel; Barquin, Jose; McCleary, Richard; Cai, TiJiu; Ji, Y.

    2016-03-01

    Modern land-use planning and conservation strategies at landscape to country scales worldwide require complete and accurate digital representations of river networks, encompassing all channels including the smallest headwaters. The digital river networks, integrated with widely available digital elevation models, also need to have analytical capabilities to support resource management and conservation, including attributing river segments with key stream and watershed data, characterizing topography to identify landforms, discretizing land uses at scales necessary to identify human-environment interactions, and connecting channels downstream and upstream, and to terrestrial environments. We investigate the completeness and analytical capabilities of national to regional scale digital river networks that are available in five countries: Canada, China, Russia, Spain, and United States using actual resource management and conservation projects involving 12 university, agency, and NGO organizations. In addition, we review one pan-European and one global digital river network. Based on our analysis, we conclude that the majority of the regional, national, and global scale digital river networks in our sample lack in network completeness, analytical capabilities or both. To address this limitation, we outline a general framework to build as complete as possible digital river networks and to integrate them with available digital elevation models to create robust analytical capabilities (e.g., virtual watersheds). We believe this presents a global opportunity for in-country agencies, or international players, to support creation of virtual watersheds to increase environmental problem solving, broaden access to the watershed sciences, and strengthen resource management and conservation in countries worldwide.

  16. Optimization-based limiters for the spectral element method

    NASA Astrophysics Data System (ADS)

    Guba, Oksana; Taylor, Mark; St-Cyr, Amik

    2014-06-01

    We introduce a new family of optimization based limiters for the h-p spectral element method. The native spectral element advection operator is oscillatory, but due to its mimetic properties it is locally conservative and has a monotone property with respect to element averages. We exploit this property to construct locally conservative quasimonotone and sign-preserving limiters. The quasimonotone limiter prevents all overshoots and undershoots at the element level, but is not strictly non-oscillatory. It also maintains quasimonotonicity even with the addition of a dissipation term such as viscosity or hyperviscosity. The limiters are based on a least-squares formulation with equality and inequality constraints and are local to each element. We evaluate the new limiters using a deformational flow test case for advection on the surface of the sphere. We focus on mesh refinement for moderate (p=3) and high order (p=6) elements. As expected, the spectral element method obtains its formal order of accuracy for smooth problems without limiters. For advection of fields with cusps and discontinuities, the high order convergence is lost, but in all cases, p=6 outperforms p=3 for the same degrees of freedom.

  17. Site-specific mutagenesis of the nodule-infected cell expression (NICE) element and the AT-rich element ATRE-BS2* of the Sesbania rostrata leghemoglobin glb3 promoter.

    PubMed Central

    Szczyglowski, K; Szabados, L; Fujimoto, S Y; Silver, D; de Bruijn, F J

    1994-01-01

    Sesbania rostrata leghemoglobin glb3 (Srglb3) promoter sequences responsible for expression in infected cells of transgenic Lotus corniculatus nodules were delimited to a 78-bp Dral-Hinfl fragment. This region, which is located between coordinates -194 to -116 relative to the start codon of the Srglb3 gene, was named the nodule-infected cell expression (NICE) element. Insertion of the NICE element into the truncated nopaline synthase promoter was found to confer a nodule-specific expression pattern on this normally root-enhanced promoter. Within the NICE element, three distinct motifs ([A]AAAGAT, TTGTCTCTT, and CACCC[T]) were identified; they are highly conserved in the promoter regions of a variety of plant (leg)hemoglobin genes. The NICE element and the adjacent AT-rich element (ATRE-BS2*) were subjected to site-directed mutagenesis. The expression patterns of nine selected Srglb3 promoter fragments carrying mutations in ATRE-BS2* and 19 with mutations in the NICE element were examined. Mutations in ATRE-BS2* had varying effects on Srglb3 promoter activity, ranging from a two- to threefold reduction to a slight stimulation of activity. Mutations in the highly conserved (A)AAAGAT motif of the NICE element reduced Srglb3 promoter activity two- to fourfold, whereas mutations in the TCTT portion of the TTGTCTCTT motif virtually abolished promoter activity, demonstrating the essential nature of these motifs for Srglb3 gene expression. An A-to-T substitution in the CACCC(T) motif of the NICE element also abolished Srglb3 promoter activity, while a C-to-T mutation at position 4 resulted in a threefold reduction of promoter strength. The latter phenotypes resemble the effect of similar mutations in the conserved CACCC motif located in the promoter region of mammalian beta-globin genes. The possible analogies between these two systems will be discussed. PMID:8180496

  18. Distribution of CpG Motifs in Upstream Gene Domains in a Reef Coral and Sea Anemone: Implications for Epigenetics in Cnidarians.

    PubMed

    Marsh, Adam G; Hoadley, Kenneth D; Warner, Mark E

    2016-01-01

    Coral reefs are under assault from stressors including global warming, ocean acidification, and urbanization. Knowing how these factors impact the future fate of reefs requires delineating stress responses across ecological, organismal and cellular scales. Recent advances in coral reef biology have integrated molecular processes with ecological fitness and have identified putative suites of temperature acclimation genes in a Scleractinian coral Acropora hyacinthus. We wondered what unique characteristics of these genes determined their coordinate expression in response to temperature acclimation, and whether or not other corals and cnidarians would likewise possess these features. Here, we focus on cytosine methylation as an epigenetic DNA modification that is responsive to environmental stressors. We identify common conserved patterns of cytosine-guanosine dinucleotide (CpG) motif frequencies in upstream promoter domains of different functional gene groups in two cnidarian genomes: a coral (Acropora digitifera) and an anemone (Nematostella vectensis). Our analyses show that CpG motif frequencies are prominent in the promoter domains of functional genes associated with environmental adaptation, particularly those identified in A. hyacinthus. Densities of CpG sites in upstream promoter domains near the transcriptional start site (TSS) are 1.38x higher than genomic background levels upstream of -2000 bp from the TSS. The increase in CpG usage suggests selection to allow for DNA methylation events to occur more frequently within 1 kb of the TSS. In addition, observed shifts in CpG densities among functional groups of genes suggests a potential role for epigenetic DNA methylation within promoter domains to impact functional gene expression responses in A. digitifera and N. vectensis. Identifying promoter epigenetic sequence motifs among genes within specific functional groups establishes an approach to describe integrated cellular responses to environmental stress in reef corals and potential roles of epigenetics on survival and fitness in the face of global climate change.

  19. Synergistic and singular effects of river discharge and lunar illumination on dam passage of upstream migrant yellow-phase American eels

    USGS Publications Warehouse

    Welsh, Stuart A.; Aldinger, Joni L.; Braham, Melissa A.; Zimmerman, Jennifer L.

    2016-01-01

    Monitoring of dam passage can be useful for management and conservation assessments of American eel, particularly if passage counts can be examined over multiple years. During a 7-year study (2007–2013) of upstream migration of American eels within the lower Shenandoah River (Potomac River drainage), we counted and measured American eels at the Millville Dam eel pass, where annual study periods were determined by the timing of the eel pass installation during spring or summer and removal during fall. Daily American eel counts were analysed with negative binomial regression models, with and without a year (YR) effect, and with the following time-varying environmental covariates: river discharge of the Shenandoah River at Millville (RDM) and of the Potomac River at Point of Rocks, lunar illumination (LI), water temperature, and cloud cover. A total of 17 161 yellow-phase American eels used the pass during the seven annual periods, and length measurements were obtained from 9213 individuals (mean = 294 mm TL, s.e. = 0.49, range 183–594 mm). Data on passage counts of American eels supported an additive-effects model (YR + LI + RDM) where parameter estimates were positive for river discharge (β = 7.3, s.e. = 0.01) and negative for LI (β = −1.9, s.e. = 0.34). Interestingly, RDM and LI acted synergistically and singularly as correlates of upstream migration of American eels, but the highest daily counts and multiple-day passage events were associated with increased RDM. Annual installation of the eel pass during late spring or summer prevented an early spring assessment, a period with higher RDM relative to those values obtained during sampling periods. Because increases in river discharge are climatically controlled events, upstream migration events of American eels within the Potomac River drainage are likely linked to the influence of climate variability on flow regime.

  20. Allele frequencies of variants in ultra conserved elements identify selective pressure on transcription factor binding.

    PubMed

    Silla, Toomas; Kepp, Katrin; Tai, E Shyong; Goh, Liang; Davila, Sonia; Catela Ivkovic, Tina; Calin, George A; Voorhoeve, P Mathijs

    2014-01-01

    Ultra-conserved genes or elements (UCGs/UCEs) in the human genome are extreme examples of conservation. We characterized natural variations in 2884 UCEs and UCGs in two distinct populations; Singaporean Chinese (n = 280) and Italian (n = 501) by using a pooled sample, targeted capture, sequencing approach. We identify, with high confidence, in these regions the abundance of rare SNVs (MAF<0.5%) of which 75% is not present in dbSNP137. UCEs association studies for complex human traits can use this information to model expected background variation and thus necessary power for association studies. By combining our data with 1000 Genome Project data, we show in three independent datasets that prevalent UCE variants (MAF>5%) are more often found in relatively less-conserved nucleotides within UCEs, compared to rare variants. Moreover, prevalent variants are less likely to overlap transcription factor binding site. Using SNPfold we found no significant influence of RNA secondary structure on UCE conservation. All together, these results suggest UCEs are not under selective pressure as a stretch of DNA but are under differential evolutionary pressure on the single nucleotide level.

Top