Deletions Involving Long-Range Conserved Nongenic Sequences Upstream and Downstream of FOXL2 as a Novel Disease-Causing Mechanism in Blepharophimosis Syndrome

PubMed Central

Beysen, D.; Raes, J.; Leroy, B. P.; Lucassen, A.; Yates, J. R. W.; Clayton-Smith, J.; Ilyina, H.; Brooks, S. Sklower; Christin-Maitre, S.; Fellous, M.; Fryns, J. P.; Kim, J. R.; Lapunzina, P.; Lemyre, E.; Meire, F.; Messiaen, L. M.; Oley, C.; Splitt, M.; Thomson, J.; Peer, Y. Van de; Veitia, R. A.; De Paepe, A.; De Baere, E.

2005-01-01

The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes. PMID:15962237

Phylogenetic analysis reveals conservation and diversification of micro RNA166 genes among diverse plant species.

PubMed

Barik, Suvakanta; SarkarDas, Shabari; Singh, Archita; Gautam, Vibhav; Kumar, Pramod; Majee, Manoj; Sarkar, Ananda K

2014-01-01

Similar to the majority of the microRNAs, mature miR166s are derived from multiple members of MIR166 genes (precursors) and regulate various aspects of plant development by negatively regulating their target genes (Class III HD-ZIP). The evolutionary conservation or functional diversification of miRNA166 family members remains elusive. Here, we show the phylogenetic relationships among MIR166 precursor and mature sequences from three diverse model plant species. Despite strong conservation, some mature miR166 sequences, such as ppt-miR166m, have undergone sequence variation. Critical sequence variation in ppt-miR166m has led to functional diversification, as it targets non-HD-ZIPIII gene transcript (s). MIR166 precursor sequences have diverged in a lineage specific manner, and both precursors and mature osa-miR166i/j are highly conserved. Interestingly, polycistronic MIR166s were present in Physcomitrella and Oryza but not in Arabidopsis. The nature of cis-regulatory motifs on the upstream promoter sequences of MIR166 genes indicates their possible contribution to the functional variation observed among miR166 species. Copyright © 2013 Elsevier Inc. All rights reserved.

Human ribosomal RNA gene: nucleotide sequence of the transcription initiation region and comparison of three mammalian genes.

PubMed Central

Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M

1982-01-01

The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460

Comparative analysis on the structural features of the 5' flanking region of κ-casein genes from six different species

PubMed Central

Gerencsér, Ákos; Barta, Endre; Boa, Simon; Kastanis, Petros; Bösze, Zsuzsanna; Whitelaw, C Bruce A

2002-01-01

κ-casein plays an essential role in the formation, stabilisation and aggregation of milk micelles. Control of κ-casein expression reflects this essential role, although an understanding of the mechanisms involved lags behind that of the other milk protein genes. We determined the 5'-flanking sequences for the murine, rabbit and human κ-casein genes and compared them to the published ruminant sequences. The most conserved region was not the proximal promoter region but an approximately 400 bp long region centred 800 bp upstream of the TATA box. This region contained two highly conserved MGF/STAT5 sites with common spacing relative to each other. In this region, six conserved short stretches of similarity were also found which did not correspond to known transcription factor consensus sites. On the contrary to ruminant and human 5' regulatory sequences, the rabbit and murine 5'-flanking regions did not harbour any kind of repetitive elements. We generated a phylogenetic tree of the six species based on multiple alignment of the κ-casein sequences. This study identified conserved candidate transcriptional regulatory elements within the κ-casein gene promoter. PMID:11929628

Conserved noncoding sequences conserve biological networks and influence genome evolution.

PubMed

Xie, Jianbo; Qian, Kecheng; Si, Jingna; Xiao, Liang; Ci, Dong; Zhang, Deqiang

2018-05-01

Comparative genomics approaches have identified numerous conserved cis-regulatory sequences near genes in plant genomes. Despite the identification of these conserved noncoding sequences (CNSs), our knowledge of their functional importance and selection remains limited. Here, we used a combination of DNA methylome analysis, microarray expression analyses, and functional annotation to study these sequences in the model tree Populus trichocarpa. Methylation in CG contexts and non-CG contexts was lower in CNSs, particularly CNSs in the 5'-upstream regions of genes, compared with other sites in the genome. We observed that CNSs are enriched in genes with transcription and binding functions, and this also associated with syntenic genes and those from whole-genome duplications, suggesting that cis-regulatory sequences play a key role in genome evolution. We detected a significant positive correlation between CNS number and protein interactions, suggesting that CNSs may have roles in the evolution and maintenance of biological networks. The divergence of CNSs indicates that duplication-degeneration-complementation drives the subfunctionalization of a proportion of duplicated genes from whole-genome duplication. Furthermore, population genomics confirmed that most CNSs are under strong purifying selection and only a small subset of CNSs shows evidence of adaptive evolution. These findings provide a foundation for future studies exploring these key genomic features in the maintenance of biological networks, local adaptation, and transcription.

Transcriptional Regulation in Saccharomyces cerevisiae: Transcription Factor Regulation and Function, Mechanisms of Initiation, and Roles of Activators and Coactivators

PubMed Central

Hahn, Steven; Young, Elton T.

2011-01-01

Here we review recent advances in understanding the regulation of mRNA synthesis in Saccharomyces cerevisiae. Many fundamental gene regulatory mechanisms have been conserved in all eukaryotes, and budding yeast has been at the forefront in the discovery and dissection of these conserved mechanisms. Topics covered include upstream activation sequence and promoter structure, transcription factor classification, and examples of regulated transcription factor activity. We also examine advances in understanding the RNA polymerase II transcription machinery, conserved coactivator complexes, transcription activation domains, and the cooperation of these factors in gene regulatory mechanisms. PMID:22084422

Mutually Exclusive Splicing of the Insect Dscam Pre-mRNA Directed by Competing Intronic RNA Secondary Structures

PubMed Central

Graveley, Brenton R.

2008-01-01

Summary Drosophila Dscam encodes 38,016 distinct axon guidance receptors through the mutually exclusive alternative splicing of 95 variable exons. Importantly, known mechanisms that ensure the mutually exclusive splicing of pairs of exons cannot explain this phenomenon in Dscam. I have identified two classes of conserved elements in the Dscam exon 6 cluster, which contains 48 alternative exons—the docking site, located in the intron downstream of constitutive exon 5, and the selector sequences, which are located upstream of each exon 6 variant. Strikingly, each selector sequence is complementary to a portion of the docking site, and this pairing juxtaposes one, and only one, alternative exon to the upstream constitutive exon. The mutually exclusive nature of the docking site:selector sequence interactions suggests that the formation of these competing RNA structures is a central component of the mechanism guaranteeing that only one exon 6 variant is included in each Dscam mRNA. PMID:16213213

A Gibbs sampler for motif detection in phylogenetically close sequences

NASA Astrophysics Data System (ADS)

Siddharthan, Rahul; van Nimwegen, Erik; Siggia, Eric

2004-03-01

Genes are regulated by transcription factors that bind to DNA upstream of genes and recognize short conserved ``motifs'' in a random intergenic ``background''. Motif-finders such as the Gibbs sampler compare the probability of these short sequences being represented by ``weight matrices'' to the probability of their arising from the background ``null model'', and explore this space (analogous to a free-energy landscape). But closely related species may show conservation not because of functional sites but simply because they have not had sufficient time to diverge, so conventional methods will fail. We introduce a new Gibbs sampler algorithm that accounts for common ancestry when searching for motifs, while requiring minimal ``prior'' assumptions on the number and types of motifs, assessing the significance of detected motifs by ``tracking'' clusters that stay together. We apply this scheme to motif detection in sporulation-cycle genes in the yeast S. cerevisiae, using recent sequences of other closely-related Saccharomyces species.

Conservation of Transcription Start Sites within Genes across a Bacterial Genus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shao, Wenjun; Price, Morgan N.; Deutschbauer, Adam M.

Transcription start sites (TSSs) lying inside annotated genes, on the same or opposite strand, have been observed in diverse bacteria, but the function of these unexpected transcripts is unclear. Here, we use the metal-reducing bacterium Shewanella oneidensis MR-1 and its relatives to study the evolutionary conservation of unexpected TSSs. Using high-resolution tiling microarrays and 5'-end RNA sequencing, we identified 2,531 TSSs in S. oneidensis MR-1, of which 18% were located inside coding sequences (CDSs). Comparative transcriptome analysis with seven additional Shewanella species revealed that the majority (76%) of the TSSs within the upstream regions of annotated genes (gTSSs) were conserved.more » Thirty percent of the TSSs that were inside genes and on the sense strand (iTSSs) were also conserved. Sequence analysis around these iTSSs showed conserved promoter motifs, suggesting that many iTSS are under purifying selection. Furthermore, conserved iTSSs are enriched for regulatory motifs, suggesting that they are regulated, and they tend to eliminate polar effects, which confirms that they are functional. In contrast, the transcription of antisense TSSs located inside CDSs (aTSSs) was significantly less likely to be conserved (22%). However, aTSSs whose transcription was conserved often have conserved promoter motifs and drive the expression of nearby genes. Overall, our findings demonstrate that some internal TSSs are conserved and drive protein expression despite their unusual locations, but the majority are not conserved and may reflect noisy initiation of transcription rather than a biological function.« less

Genetic characterization of the UCS and Kex1 loci of Pneumocystis jirovecii.

PubMed

Esteves, F; Tavares, A; Costa, M C; Gaspar, J; Antunes, F; Matos, O

2009-02-01

Nucleotide variation in the Pneumocystis jirovecii upstream conserved sequence (UCS) and kexin-like serine protease (Kex1) loci was studied in pulmonary specimens from Portuguese HIV-positive patients. DNA was extracted and used for specific molecular sequence analysis. The number of UCS tandem repeats detected in 13 successfully sequenced isolates ranged from three (9 isolates, 69%) to four (4 isolates, 31%). A novel tandem repeat pattern and two novel polymorphisms were detected in the UCS region. For the Kex1 gene, the wild-type (24 isolates, 86%) was the most frequent sequence detected among the 28 sequenced isolates. Nevertheless, a nonsynonymous (1 isolate, 3%) and three synonymous (3 isolates, 11%) polymorphisms were detected and are described here for the first time.

Proliferating cell nuclear antigen (Pcna) as a direct downstream target gene of Hoxc8

DOE Office of Scientific and Technical Information (OSTI.GOV)

Min, Hyehyun; Lee, Ji-Yeon; Bok, Jinwoong

2010-02-19

Hoxc8 is a member of Hox family transcription factors that play crucial roles in spatiotemporal body patterning during embryogenesis. Hox proteins contain a conserved 61 amino acid homeodomain, which is responsible for recognition and binding of the proteins onto Hox-specific DNA binding motifs and regulates expression of their target genes. Previously, using proteome analysis, we identified Proliferating cell nuclear antigen (Pcna) as one of the putative target genes of Hoxc8. Here, we asked whether Hoxc8 regulates Pcna expression by directly binding to the regulatory sequence of Pcna. In mouse embryos at embryonic day 11.5, the expression pattern of Pcna wasmore » similar to that of Hoxc8 along the anteroposterior body axis. Moreover, Pcna transcript levels as well as cell proliferation rate were increased by overexpression of Hoxc8 in C3H10T1/2 mouse embryonic fibroblast cells. Characterization of 2.3 kb genomic sequence upstream of Pcna coding region revealed that the upstream sequence contains several Hox core binding sequences and one Hox-Pbx binding sequence. Direct binding of Hoxc8 proteins to the Pcna regulatory sequence was verified by chromatin immunoprecipitation assay. Taken together, our data suggest that Pcna is a direct downstream target of Hoxc8.« less

Two alternative ways of start site selection in human norovirus reinitiation of translation.

PubMed

Luttermann, Christine; Meyers, Gregor

2014-04-25

The calicivirus minor capsid protein VP2 is expressed via termination/reinitiation. This process depends on an upstream sequence element denoted termination upstream ribosomal binding site (TURBS). We have shown for feline calicivirus and rabbit hemorrhagic disease virus that the TURBS contains three sequence motifs essential for reinitiation. Motif 1 is conserved among caliciviruses and is complementary to a sequence in the 18 S rRNA leading to the model that hybridization between motif 1 and 18 S rRNA tethers the post-termination ribosome to the mRNA. Motif 2 and motif 2* are proposed to establish a secondary structure positioning the ribosome relative to the start site of the terminal ORF. Here, we analyzed human norovirus (huNV) sequences for the presence and importance of these motifs. The three motifs were identified by sequence analyses in the region upstream of the VP2 start site, and we showed that these motifs are essential for reinitiation of huNV VP2 translation. More detailed analyses revealed that the site of reinitiation is not fixed to a single codon and does not need to be an AUG, even though this codon is clearly preferred. Interestingly, we were able to show that reinitiation can occur at AUG codons downstream of the canonical start/stop site in huNV and feline calicivirus but not in rabbit hemorrhagic disease virus. Although reinitiation at the original start site is independent of the Kozak context, downstream initiation exhibits requirements for start site sequence context known for linear scanning. These analyses on start codon recognition give a more detailed insight into this fascinating mechanism of gene expression.

Robust Translation of the Nucleoid Protein Fis Requires a Remote Upstream AU Element and Is Enhanced by RNA Secondary Structure

PubMed Central

Nafissi, Maryam; Chau, Jeannette; Xu, Jimin

2012-01-01

Synthesis of the Fis nucleoid protein rapidly increases in response to nutrient upshifts, and Fis is one of the most abundant DNA binding proteins in Escherichia coli under nutrient-rich growth conditions. Previous work has shown that control of Fis synthesis occurs at transcription initiation of the dusB-fis operon. We show here that while translation of the dihydrouridine synthase gene dusB is low, unusual mechanisms operate to enable robust translation of fis. At least two RNA sequence elements located within the dusB coding region are responsible for high fis translation. The most important is an AU element centered 35 nucleotides (nt) upstream of the fis AUG, which may function as a binding site for ribosomal protein S1. In addition, a 44-nt segment located upstream of the AU element and predicted to form a stem-loop secondary structure plays a prominent role in enhancing fis translation. On the other hand, mutations close to the AUG, including over a potential Shine-Dalgarno sequence, have little effect on Fis protein levels. The AU element and stem-loop regions are phylogenetically conserved within dusB-fis operons of representative enteric bacteria. PMID:22389479

Genomic Structure of the Luciferase Gene from the Bioluminescent Beetle, Nyctophila cf. Caucasica

PubMed Central

Day, John C.; Chaichi, Mohammad J.; Najafil, Iraj; Whiteley, Andrew S.

2006-01-01

The gene coding for beetle luciferase, the enzyme responsible for bioluminescence in over two thousand coleopteran species has, to date, only been characterized from one Palearctic species of Lampyridae. Here we report the characterization of the luciferase gene from a female beetle of an Iranian lampyrid species, Nyctophila cf. caucasica (Coleoptera:Lampyridae). The luciferase gene was composed of seven exons, coding for 547 amino acids, separated by six introns spanning 1976 bp of genomic DNA. The deduced amino acid sequences of the luciferase gene of N. caucasica showed 98.9% homology to that of the Palearctic species Lampyris noctiluca. Analysis of the 810 bp upstream region of the luciferase gene revealed three TATA boxes and several other consensus transcriptional factor recognition sequences presenting evidence for a putative core promoter region conserved in Lampyrinae from -190 through to -155 upstream of the luciferase start codon. Along with the core promoter region the luciferase gene was compared with orthologous sequences from other lampyrid species and found to have greatest identity to Lampyris turkistanicus and Lampyris noctiluca. The significant sequence identity to the former is discussed in relation to taxonomic issues of Iranian lampyrids. PMID:20298115

Specific DNA binding of the two chicken Deformed family homeodomain proteins, Chox-1.4 and Chox-a.

PubMed Central

Sasaki, H; Yokoyama, E; Kuroiwa, A

1990-01-01

The cDNA clones encoding two chicken Deformed (Dfd) family homeobox containing genes Chox-1.4 and Chox-a were isolated. Comparison of their amino acid sequences with another chicken Dfd family homeodomain protein and with those of mouse homologues revealed that strong homologies are located in the amino terminal regions and around the homeodomains. Although homologies in other regions were relatively low, some short conserved sequences were also identified. E. coli-made full length proteins were purified and used for the production of specific antibodies and for DNA binding studies. The binding profiles of these proteins to the 5'-leader and 5'-upstream sequences of Chox-1.4 and Chox-a coding regions were analyzed by immunoprecipitation and DNase I footprint assays. These two Chox proteins bound to the same sites in the 5'-flanking sequences of their coding regions with various affinities and their binding affinities to each site were nearly the same. The consensus sequences of the high and low affinity binding sites were TAATGA(C/G) and CTAATTTT, respectively. A clustered binding site was identified in the 5'-upstream of the Chox-a gene, suggesting that this clustered binding site works as a cis-regulatory element for auto- and/or cross-regulation of Chox-a gene expression. Images PMID:1970866

Detection of hyper-conserved regions in hepatitis B virus X gene potentially useful for gene therapy.

PubMed

González, Carolina; Tabernero, David; Cortese, Maria Francesca; Gregori, Josep; Casillas, Rosario; Riveiro-Barciela, Mar; Godoy, Cristina; Sopena, Sara; Rando, Ariadna; Yll, Marçal; Lopez-Martinez, Rosa; Quer, Josep; Esteban, Rafael; Buti, Maria; Rodríguez-Frías, Francisco

2018-05-21

To detect hyper-conserved regions in the hepatitis B virus (HBV) X gene ( HBX ) 5' region that could be candidates for gene therapy. The study included 27 chronic hepatitis B treatment-naive patients in various clinical stages (from chronic infection to cirrhosis and hepatocellular carcinoma, both HBeAg-negative and HBeAg-positive), and infected with HBV genotypes A-F and H. In a serum sample from each patient with viremia > 3.5 log IU/mL, the HBX 5' end region [nucleotide (nt) 1255-1611] was PCR-amplified and submitted to next-generation sequencing (NGS). We assessed genotype variants by phylogenetic analysis, and evaluated conservation of this region by calculating the information content of each nucleotide position in a multiple alignment of all unique sequences (haplotypes) obtained by NGS. Conservation at the HBx protein amino acid (aa) level was also analyzed. NGS yielded 1333069 sequences from the 27 samples, with a median of 4578 sequences/sample (2487-9279, IQR 2817). In 14/27 patients (51.8%), phylogenetic analysis of viral nucleotide haplotypes showed a complex mixture of genotypic variants. Analysis of the information content in the haplotype multiple alignments detected 2 hyper-conserved nucleotide regions, one in the HBX upstream non-coding region (nt 1255-1286) and the other in the 5' end coding region (nt 1519-1603). This last region coded for a conserved amino acid region (aa 63-76) that partially overlaps a Kunitz-like domain. Two hyper-conserved regions detected in the HBX 5' end may be of value for targeted gene therapy, regardless of the patients' clinical stage or HBV genotype.

Insect sex determination: it all evolves around transformer.

PubMed

Verhulst, Eveline C; van de Zande, Louis; Beukeboom, Leo W

2010-08-01

Insects exhibit a variety of sex determining mechanisms including male or female heterogamety and haplodiploidy. The primary signal that starts sex determination is processed by a cascade of genes ending with the conserved switch doublesex that controls sexual differentiation. Transformer is the doublesex splicing regulator and has been found in all examined insects, indicating its ancestral function as a sex-determining gene. Despite this conserved function, the variation in transformer nucleotide sequence, amino acid composition and protein structure can accommodate a multitude of upstream sex determining signals. Transformer regulation of doublesex and its taxonomic distribution indicate that the doublesex-transformer axis is conserved among all insects and that transformer is the key gene around which variation in sex determining mechanisms has evolved.

The chloroplast tRNALys(UUU) gene from mustard (Sinapis alba) contains a class II intron potentially coding for a maturase-related polypeptide.

PubMed

Neuhaus, H; Link, G

1987-01-01

The trnK gene endocing the tRNALys(UUU) has been located on mustard (Sinapis alba) chloroplast DNA, 263 bp upstream of the psbA gene on the same strand. The nucleotide sequence of the trnK gene and its flanking regions as well as the putative transcription start and termination sites are shown. The 5' end of the transcript lies 121 bp upstream of the 5' tRNA coding region and is preceded by procaryotic-type "-10" and "-35" sequence elements, while the 3' end maps 2.77 kb downstream to a DNA region with possible stemloop secondary structure. The anticodon loop of the tRNALys is interrupted by a 2,574 bp intron containing a long open reading frame, which codes for 524 amino acids. Based on conserved stem and loop structures, this intron has characteristic features of a class II intron. A region near the carboxyl terminus of the derived polypeptide appears structurally related to maturases.

Nucleotide sequences and regulational analysis of genes involved in conversion of aniline to catechol in Pseudomonas putida UCC22(pTDN1).

PubMed Central

Fukumori, F; Saint, C P

1997-01-01

A 9,233-bp HindIII fragment of the aromatic amine catabolic plasmid pTDN1, isolated from a derivative of Pseudomonas putida mt-2 (UCC22), confers the ability to degrade aniline on P. putida KT2442. The fragment encodes six open reading frames which are arranged in the same direction. Their 5' upstream region is part of the direct-repeat sequence of pTDN1. Nucleotide sequence of 1.8 kb of the repeat sequence revealed only a single base pair change compared to the known sequence of IS1071 which is involved in the transposition of the chlorobenzoate genes (C. Nakatsu, J. Ng, R. Singh, N. Straus, and C. Wyndham, Proc. Natl. Acad. Sci. USA 88:8312-8316, 1991). Four open reading frames encode proteins with considerable homology to proteins found in other aromatic-compound degradation pathways. On the basis of sequence similarity, these genes are proposed to encode the large and small subunits of aniline oxygenase (tdnA1 and tdnA2, respectively), a reductase (tdnB), and a LysR-type regulatory gene (tdnR). The putative large subunit has a conserved [2Fe-2S]R Rieske-type ligand center. Two genes, tdnQ and tdnT, which may be involved in amino group transfer, are localized upstream of the putative oxygenase genes. The tdnQ gene product shares about 30% similarity with glutamine synthetases; however, a pUC-based plasmid carrying tdnQ did not support the growth of an Escherichia coli glnA strain in the absence of glutamine. TdnT possesses domains that are conserved among amidotransferases. The tdnQ, tdnA1, tdnA2, tdnB, and tdnR genes are essential for the conversion of aniline to catechol. PMID:8990291

Genomic dissection of conserved transcriptional regulation in intestinal epithelial cells

PubMed Central

Camp, J. Gray; Weiser, Matthew; Cocchiaro, Jordan L.; Kingsley, David M.; Furey, Terrence S.; Sheikh, Shehzad Z.; Rawls, John F.

2017-01-01

The intestinal epithelium serves critical physiologic functions that are shared among all vertebrates. However, it is unknown how the transcriptional regulatory mechanisms underlying these functions have changed over the course of vertebrate evolution. We generated genome-wide mRNA and accessible chromatin data from adult intestinal epithelial cells (IECs) in zebrafish, stickleback, mouse, and human species to determine if conserved IEC functions are achieved through common transcriptional regulation. We found evidence for substantial common regulation and conservation of gene expression regionally along the length of the intestine from fish to mammals and identified a core set of genes comprising a vertebrate IEC signature. We also identified transcriptional start sites and other putative regulatory regions that are differentially accessible in IECs in all 4 species. Although these sites rarely showed sequence conservation from fish to mammals, surprisingly, they drove highly conserved IEC expression in a zebrafish reporter assay. Common putative transcription factor binding sites (TFBS) found at these sites in multiple species indicate that sequence conservation alone is insufficient to identify much of the functionally conserved IEC regulatory information. Among the rare, highly sequence-conserved, IEC-specific regulatory regions, we discovered an ancient enhancer upstream from her6/HES1 that is active in a distinct population of Notch-positive cells in the intestinal epithelium. Together, these results show how combining accessible chromatin and mRNA datasets with TFBS prediction and in vivo reporter assays can reveal tissue-specific regulatory information conserved across 420 million years of vertebrate evolution. We define an IEC transcriptional regulatory network that is shared between fish and mammals and establish an experimental platform for studying how evolutionarily distilled regulatory information commonly controls IEC development and physiology. PMID:28850571

Authentication of meat from game and domestic species by SNaPshot minisequencing analysis.

PubMed

La Neve, Fabio; Civera, Tiziana; Mucci, Nadia; Bottero, Maria Teresa

2008-10-01

The aim of the present study is to develop an assay for the specific identification of meat from Capreolus capreolus, Cervus elaphus, Capra ibex, Rupicapra rupicapra, targeting sequences of the cytochrome b (cyt b) gene of mitochondrial DNA. The assay is also intended to enable differentiation between meat from these wild species as well as Ovis aries, Capra hircus, Bubalus bubalis, Bos taurus and Sus scrofa domestic species. The primers used in the preliminary PCR were designed in well conserved regions upstream and downstream of the diagnosis sites. They successfully amplified a conserved 232bp region from the cyt b gene of all the species taken into consideration. The sites of diagnosis have been interrogated using a minisequencing reaction and capillary electrophoresis. All the results of the multiplex PER (primer extension reaction) test were confirmed by fragment sequencing. The assay offers the possibility of discriminating nine species at the same time.

Molecular cloning of actin genes in Trichomonas vaginalis and phylogeny inferred from actin sequences.

PubMed

Bricheux, G; Brugerolle, G

1997-08-01

The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.

Characterization of Cer-1 cis-regulatory region during early Xenopus development.

PubMed

Silva, Ana Cristina; Filipe, Mário; Steinbeisser, Herbert; Belo, José António

2011-05-01

Cerberus-related molecules are well-known Wnt, Nodal, and BMP inhibitors that have been implicated in different processes including anterior–posterior patterning and left–right asymmetry. In both mouse and frog, two Cerberus-related genes have been isolated, mCer-1 and mCer-2, and Xcer and Xcoco, respectively. Until now, little is known about the mechanisms involved in their transcriptional regulation. Here, we report a heterologous analysis of the mouse Cerberus-1 gene upstream regulatory regions, responsible for its expression in the visceral endodermal cells. Our analysis showed that the consensus sequences for a TATA, CAAT, or GC boxes were absent but a TGTGG sequence was present at position -172 to -168 bp, relative to the ATG. Using a series of deletion constructs and transient expression in Xenopus embryos, we found that a fragment of 1.4 kb of Cer-1 promoter sequence could reproduce the endogenous expression pattern of Xenopus cerberus. A 0.7-kb mcer-1 upstream region was able to drive reporter expression to the involuting mesendodermal cells, while further deletions abolished reporter gene expression. Our results suggest that although no sequence similarity was found between mouse and Xenopus cerberus cis-regulatory regions, the signaling cascades regulating cerberus expression, during gastrulation, is conserved.

Sequence analysis of dolphin ferritin H and L subunits and possible iron-dependent translational control of dolphin ferritin gene

PubMed Central

Takaesu, Azusa; Watanabe, Kiyotaka; Takai, Shinji; Sasaki, Yukako; Orino, Koichi

2008-01-01

Background Iron-storage protein, ferritin plays a central role in iron metabolism. Ferritin has dual function to store iron and segregate iron for protection of iron-catalyzed reactive oxygen species. Tissue ferritin is composed of two kinds of subunits (H: heavy chain or heart-type subunit; L: light chain or liver-type subunit). Ferritin gene expression is controlled at translational level in iron-dependent manner or at transcriptional level in iron-independent manner. However, sequencing analysis of marine mammalian ferritin subunits has not yet been performed fully. The purpose of this study is to reveal cDNA-derived amino acid sequences of cetacean ferritin H and L subunits, and demonstrate the possibility of expression of these subunits, especially H subunit, by iron. Methods Sequence analyses of cetacean ferritin H and L subunits were performed by direct sequencing of polymerase chain reaction (PCR) fragments from cDNAs generated via reverse transcription-PCR of leukocyte total RNA prepared from blood samples of six different dolphin species (Pseudorca crassidens, Lagenorhynchus obliquidens, Grampus griseus, Globicephala macrorhynchus, Tursiops truncatus, and Delphinapterus leucas). The putative iron-responsive element sequence in the 5'-untranslated region of the six different dolphin species was revealed by direct sequencing of PCR fragments obtained using leukocyte genomic DNA. Results Dolphin H and L subunits consist of 182 and 174 amino acids, respectively, and amino acid sequence identities of ferritin subunits among these dolphins are highly conserved (H: 99–100%, (99→98) ; L: 98–100%). The conserved 28 bp IRE sequence was located -144 bp upstream from the initiation codon in the six different dolphin species. Conclusion These results indicate that six different dolphin species have conserved ferritin sequences, and suggest that these genes are iron-dependently expressed. PMID:18954429

Fungal Genes in Context: Genome Architecture Reflects Regulatory Complexity and Function

PubMed Central

Noble, Luke M.; Andrianopoulos, Alex

2013-01-01

Gene context determines gene expression, with local chromosomal environment most influential. Comparative genomic analysis is often limited in scope to conserved or divergent gene and protein families, and fungi are well suited to this approach with low functional redundancy and relatively streamlined genomes. We show here that one aspect of gene context, the amount of potential upstream regulatory sequence maintained through evolution, is highly predictive of both molecular function and biological process in diverse fungi. Orthologs with large upstream intergenic regions (UIRs) are strongly enriched in information processing functions, such as signal transduction and sequence-specific DNA binding, and, in the genus Aspergillus, include the majority of experimentally studied, high-level developmental and metabolic transcriptional regulators. Many uncharacterized genes are also present in this class and, by implication, may be of similar importance. Large intergenic regions also share two novel sequence characteristics, currently of unknown significance: they are enriched for plus-strand polypyrimidine tracts and an information-rich, putative regulatory motif that was present in the last common ancestor of the Pezizomycotina. Systematic consideration of gene UIR in comparative genomics, particularly for poorly characterized species, could help reveal organisms’ regulatory priorities. PMID:23699226

The immediate upstream region of the 5′-UTR from the AUG start codon has a pronounced effect on the translational efficiency in Arabidopsis thaliana

PubMed Central

Kim, Younghyun; Lee, Goeun; Jeon, Eunhyun; Sohn, Eun ju; Lee, Yongjik; Kang, Hyangju; Lee, Dong wook; Kim, Dae Heon; Hwang, Inhwan

2014-01-01

The nucleotide sequence around the translational initiation site is an important cis-acting element for post-transcriptional regulation. However, it has not been fully understood how the sequence context at the 5′-untranslated region (5′-UTR) affects the translational efficiency of individual mRNAs. In this study, we provide evidence that the 5′-UTRs of Arabidopsis genes showing a great difference in the nucleotide sequence vary greatly in translational efficiency with more than a 200-fold difference. Of the four types of nucleotides, the A residue was the most favourable nucleotide from positions −1 to −21 of the 5′-UTRs in Arabidopsis genes. In particular, the A residue in the 5′-UTR from positions −1 to −5 was required for a high-level translational efficiency. In contrast, the T residue in the 5′-UTR from positions −1 to −5 was the least favourable nucleotide in translational efficiency. Furthermore, the effect of the sequence context in the −1 to −21 region of the 5′-UTR was conserved in different plant species. Based on these observations, we propose that the sequence context immediately upstream of the AUG initiation codon plays a crucial role in determining the translational efficiency of plant genes. PMID:24084084

Cloning and bacterial expression of adenosine-5'-triphosphate sulfurylase from the enteric protozoan parasite Entamoeba histolytica.

PubMed

Nozaki, T; Arase, T; Shigeta, Y; Asai, T; Leustek, T; Takeuchi, T

1998-12-08

A gene encoding adenosine-5'-triphosphate sulfurylase (AS) was cloned from the enteric protozoan parasite Entamoeba histolytica by polymerase chain reaction using degenerate oligonucleotide primers corresponding to conserved regions of the protein from a variety of organisms. The deduced amino acid sequence of E. histolytica AS revealed a calculated molecular mass of 47925 Da and an unusual basic pI of 9.38. The amebic protein sequence showed 23-48% identities with AS from bacteria, yeasts, fungi, plants, and animals with the highest identities being to Synechocystis sp. and Bacillus subtilis (48 and 44%, respectively). Four conserved blocks including putative sulfate-binding and phosphate-binding regions were highly conserved in the E. histolytica AS. The upstream region of the AS gene contained three conserved elements reported for other E. histolytica genes. A recombinant E. histolytica AS revealed enzymatic activity, measured in both the forward and reverse directions. Expression of the E. histolytica AS complemented cysteine auxotrophy of the AS-deficient Escherichia coli strains. Genomic hybridization revealed that the AS gene exists as a single copy gene. In the literature, this is the first description of an AS gene in Protozoa.

Eukaryotic Elongation Factor 1A Interacts with the Upstream Pseudoknot Domain in the 3′ Untranslated Region of Tobacco Mosaic Virus RNA

PubMed Central

Zeenko, Vladimir V.; Ryabova, Lyubov A.; Spirin, Alexander S.; Rothnie, Helen M.; Hess, Daniel; Browning, Karen S.; Hohn, Thomas

2002-01-01

The genomic RNA of tobacco mosaic virus (TMV), like that of other positive-strand RNA viruses, acts as a template for both translation and replication. The highly structured 3′ untranslated region (UTR) of TMV RNAs plays an important role in both processes; it is not polyadenylated but ends with a tRNA-like structure (TLS) preceded by a conserved upstream pseudoknot domain (UPD). The TLS of tobamoviral RNAs can be specifically aminoacylated and, in this state, can interact with eukaryotic elongation factor 1A (eEF1A)/GTP with high affinity. Using a UV cross-linking assay, we detected another specific binding site for eEF1A/GTP, within the UPDs of TMV and crucifer-infecting tobamovirus (crTMV), that does not require aminoacylation. A mutational analysis revealed that UPD pseudoknot conformation and some conserved primary sequence elements are required for this interaction. Its possible role in the regulation of tobamovirus gene expression and replication is discussed. PMID:11991996

Nucleotide sequence of the gene for the Mr 32,000 thylakoid membrane protein from Spinacia oleracea and Nicotiana debneyi predicts a totally conserved primary translation product of Mr 38,950

PubMed Central

Zurawski, Gerard; Bohnert, Hans J.; Whitfeld, Paul R.; Bottomley, Warwick

1982-01-01

The gene for the so-called Mr 32,000 rapidly labeled photosystem II thylakoid membrane protein (here designated psbA) of spinach (Spinacia oleracea) chloroplasts is located on the chloroplast DNA in the large single-copy region immediately adjacent to one of the inverted repeat sequences. In this paper we show that the size of the mRNA for this protein is ≈ 1.25 kilobases and that the direction of transcription is towards the inverted repeat unit. The nucleotide sequence of the gene and its flanking regions is presented. The only large open reading frame in the sequence codes for a protein of Mr 38,950. The nucleotide sequence of psbA from Nicotiana debneyi also has been determined, and comparison of the sequences from the two species shows them to be highly conserved (>95% homology) throughout the entire reading frame. Conservation of the amino acid sequence is absolute, there being no changes in a total of 353 residues. This leads us to conclude that the primary translation product of psbA must be a protein of Mr 38,950. The protein is characterized by the complete absence of lysine residues and is relatively rich in hydrophobic amino acids, which tend to be clustered. Transcription of spinach psbA starts about 86 base pairs before the first ATG codon. Immediately upstream from this point there is a sequence typical of that found in E. coli promoters. An almost identical sequence occurs in the equivalent region of N. debneyi DNA. Images PMID:16593262

Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.

PubMed

Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua

2013-11-01

The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.

Arabidopsis intragenomic conserved noncoding sequence

PubMed Central

Thomas, Brian C.; Rapaka, Lakshmi; Lyons, Eric; Pedersen, Brent; Freeling, Michael

2007-01-01

After the most recent tetraploidy in the Arabidopsis lineage, most gene pairs lost one, but not both, of their duplicates. We manually inspected the 3,179 retained gene pairs and their surrounding gene space still present in the genome using a custom-made viewer application. The display of these pairs allowed us to define intragenic conserved noncoding sequences (CNSs), identify exon annotation errors, and discover potentially new genes. Using a strict algorithm to sort high-scoring pair sequences from the bl2seq data, we created a database of 14,944 intragenomic Arabidopsis CNSs. The mean CNS length is 31 bp, ranging from 15 to 285 bp. There are ≈1.7 CNSs associated with a typical gene, and Arabidopsis CNSs are found in all areas around exons, most frequently in the 5′ upstream region. Gene ontology classifications related to transcription, regulation, or “response to …” external or endogenous stimuli, especially hormones, tend to be significantly overrepresented among genes containing a large number of CNSs, whereas protein localization, transport, and metabolism are common among genes with no CNSs. There is a 1.5% overlap between these CNSs and the 218,982 putative RNAs in the Arabidopsis Small RNA Project database, allowing for two mismatches. These CNSs provide a unique set of noncoding sequences enriched for function. CNS function is implied by evolutionary conservation and independently supported because CNS-richness predicts regulatory gene ontology categories. PMID:17301222

An upstream sequence modulates phenazine production at the level of transcription and translation in the biological control strain Pseudomonas chlororaphis 30-84

PubMed Central

Wang, Dongping; Ries, Tessa R.; Pierson, Leland S.; Pierson, Elizabeth A.

2018-01-01

Phenazines are bacterial secondary metabolites and play important roles in the antagonistic activity of the biological control strain P. chlororaphis 30–84 against take-all disease of wheat. The expression of the P. chlororaphis 30–84 phenazine biosynthetic operon (phzXYFABCD) is dependent on the PhzR/PhzI quorum sensing system located immediately upstream of the biosynthetic operon as well as other regulatory systems including Gac/Rsm. Bioinformatic analysis of the sequence between the divergently oriented phzR and phzX promoters identified features within the 5’-untranslated region (5’-UTR) of phzX that are conserved only among 2OHPCA producing Pseudomonas. The conserved sequence features are potentially capable of producing secondary structures that negatively modulate one or both promoters. Transcriptional and translational fusion assays revealed that deletion of 90-bp of sequence at the 5’-UTR of phzX led to up to 4-fold greater expression of the reporters with the deletion compared to the controls, which indicated this sequence negatively modulates phenazine gene expression both transcriptionally and translationally. This 90-bp sequence was deleted from the P. chlororaphis 30–84 chromosome, resulting in 30-84Enh, which produces significantly more phenazine than the wild-type while retaining quorum sensing control. The transcriptional expression of phzR/phzI and amount of AHL signal produced by 30-84Enh also were significantly greater than for the wild-type, suggesting this 90-bp sequence also negatively affects expression of the quorum sensing genes. In addition, deletion of the 90-bp partially relieved RsmE-mediated translational repression, indicating a role for Gac/RsmE interaction. Compared to the wild-type, enhanced phenazine production by 30-84Enh resulted in improvement in fungal inhibition, biofilm formation, extracellular DNA release and suppression of take-all disease of wheat in soil without negative consequences on growth or rhizosphere persistence. This work provides greater insight into the regulation of phenazine biosynthesis with potential applications for improved biological control. PMID:29451920

Search for 5'-leader regulatory RNA structures based on gene annotation aided by the RiboGap database.

PubMed

Naghdi, Mohammad Reza; Smail, Katia; Wang, Joy X; Wade, Fallou; Breaker, Ronald R; Perreault, Jonathan

2017-03-15

The discovery of noncoding RNAs (ncRNAs) and their importance for gene regulation led us to develop bioinformatics tools to pursue the discovery of novel ncRNAs. Finding ncRNAs de novo is challenging, first due to the difficulty of retrieving large numbers of sequences for given gene activities, and second due to exponential demands on calculation needed for comparative genomics on a large scale. Recently, several tools for the prediction of conserved RNA secondary structure were developed, but many of them are not designed to uncover new ncRNAs, or are too slow for conducting analyses on a large scale. Here we present various approaches using the database RiboGap as a primary tool for finding known ncRNAs and for uncovering simple sequence motifs with regulatory roles. This database also can be used to easily extract intergenic sequences of eubacteria and archaea to find conserved RNA structures upstream of given genes. We also show how to extend analysis further to choose the best candidate ncRNAs for experimental validation. Copyright © 2017 Elsevier Inc. All rights reserved.

Highly conserved non-coding elements on either side of SOX9 associated with Pierre Robin sequence.

PubMed

Benko, Sabina; Fantes, Judy A; Amiel, Jeanne; Kleinjan, Dirk-Jan; Thomas, Sophie; Ramsay, Jacqueline; Jamshidi, Negar; Essafi, Abdelkader; Heaney, Simon; Gordon, Christopher T; McBride, David; Golzio, Christelle; Fisher, Malcolm; Perry, Paul; Abadie, Véronique; Ayuso, Carmen; Holder-Espinasse, Muriel; Kilpatrick, Nicky; Lees, Melissa M; Picard, Arnaud; Temple, I Karen; Thomas, Paul; Vazquez, Marie-Paule; Vekemans, Michel; Roest Crollius, Hugues; Hastie, Nicholas D; Munnich, Arnold; Etchevers, Heather C; Pelet, Anna; Farlie, Peter G; Fitzpatrick, David R; Lyonnet, Stanislas

2009-03-01

Pierre Robin sequence (PRS) is an important subgroup of cleft palate. We report several lines of evidence for the existence of a 17q24 locus underlying PRS, including linkage analysis results, a clustering of translocation breakpoints 1.06-1.23 Mb upstream of SOX9, and microdeletions both approximately 1.5 Mb centromeric and approximately 1.5 Mb telomeric of SOX9. We have also identified a heterozygous point mutation in an evolutionarily conserved region of DNA with in vitro and in vivo features of a developmental enhancer. This enhancer is centromeric to the breakpoint cluster and maps within one of the microdeletion regions. The mutation abrogates the in vitro enhancer function and alters binding of the transcription factor MSX1 as compared to the wild-type sequence. In the developing mouse mandible, the 3-Mb region bounded by the microdeletions shows a regionally specific chromatin decompaction in cells expressing Sox9. Some cases of PRS may thus result from developmental misexpression of SOX9 due to disruption of very-long-range cis-regulatory elements.

Conserved features of eukaryotic hsp70 genes revealed by comparison with the nucleotide sequence of human hsp70.

PubMed Central

Hunt, C; Morimoto, R I

1985-01-01

We have determined the nucleotide sequence of the human hsp70 gene and 5' flanking region. The hsp70 gene is transcribed as an uninterrupted primary transcript of 2440 nucleotides composed of a 5' noncoding leader sequence of 212 nucleotides, a 3' noncoding region of 242 nucleotides, and a continuous open reading frame of 1986 nucleotides that encodes a protein with predicted molecular mass of 69,800 daltons. Upstream of the 5' terminus are the canonical TATAAA box, the sequence ATTGG that corresponds in the inverted orientation to the CCAAT motif, and the dyad sequence CTGGAAT/ATTCCCG that shares homology in 12 of 14 positions with the consensus transcription regulatory sequence common to Drosophila heat shock genes. Comparison of the predicted amino acid sequences of human hsp70 with the published sequences of Drosophila hsp70 and Escherichia coli dnaK reveals that human hsp70 is 73% identical to Drosophila hsp70 and 47% identical to E. coli dnaK. Surprisingly, the nucleotide sequences of the human and Drosophila genes are 72% identical and human and E. coli genes are 50% identical, which is more highly conserved than necessary given the degeneracy of the genetic code. The lack of accumulated silent nucleotide substitutions leads us to propose that there may be additional information in the nucleotide sequence of the hsp70 gene or the corresponding mRNA that precludes the maximum divergence allowed in the silent codon positions. PMID:3931075

[Bioinformatics Analysis of Clustered Regularly Interspaced Short Palindromic Repeats in the Genomes of Shigella].

PubMed

Wang, Pengfei; Wang, Yingfang; Duan, Guangcai; Xue, Zerun; Wang, Linlin; Guo, Xiangjiao; Yang, Haiyan; Xi, Yuanlin

2015-04-01

This study was aimed to explore the features of clustered regularly interspaced short palindromic repeats (CRISPR) structures in Shigella by using bioinformatics. We used bioinformatics methods, including BLAST, alignment and RNA structure prediction, to analyze the CRISPR structures of Shigella genomes. The results showed that the CRISPRs existed in the four groups of Shigella, and the flanking sequences of upstream CRISPRs could be classified into the same group with those of the downstream. We also found some relatively conserved palindromic motifs in the leader sequences. Repeat sequences had the same group with corresponding flanking sequences, and could be classified into two different types by their RNA secondary structures, which contain "stem" and "ring". Some spacers were found to homologize with part sequences of plasmids or phages. The study indicated that there were correlations between repeat sequences and flanking sequences, and the repeats might act as a kind of recognition mechanism to mediate the interaction between foreign genetic elements and Cas proteins.

Molecular cloning and identification of the transcriptional regulatory domain of the goat neurokinin B gene TAC3.

PubMed

Suetomi, Yuta; Matsuda, Fuko; Uenoyama, Yoshihisa; Maeda, Kei-ichiro; Tsukamura, Hiroko; Ohkura, Satoshi

2013-10-01

Neurokinin B (NKB), encoded by TAC3, is thought to be an important accelerator of pulsatile gonadotropin-releasing hormone release. This study aimed to clarify the transcriptional regulatory mechanism of goat TAC3. First, we determined the full-length mRNA sequence of goat TAC3 from the hypothalamus to be 820 b, including a 381 b coding region, with the putative transcription start site located 143-b upstream of the start codon. The deduced amino acid sequence of NKB, which is produced from preproNKB, was completely conserved among goat, cattle, and human. Next, we cloned 5'-upstream region of goat TAC3 up to 3400 b from the translation initiation site, and this region was highly homologous with cattle TAC3 (89%). We used this goat TAC3 5'-upstream region to perform luciferase assays. We created a luciferase reporter vector containing DNA constructs from -2706, -1837, -834, -335, or -197 to +166 bp (the putative transcription start site was designated as +1) of goat TAC3 and these were transiently transfected into mouse hypothalamus-derived N7 cells and human neuroblastoma-derived SK-N-AS cells. The luciferase activity gradually increased with the deletion of the 5'-upstream region, suggesting that the transcriptional suppressive region is located between -2706 and -336 bp and that the core promoter exists downstream of -197 bp. Estradiol treatment did not lead to significant suppression of luciferase activity of any constructs, suggesting the existence of other factor(s) that regulate goat TAC3 transcription.

Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

PubMed

Levis, R; Schlesinger, S; Huang, H V

1990-04-01

Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA.

Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating sequences, and telomeres in Saccharomyces cerevisiae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buchman, A.R.; Kimmerly, W.J.; Rine, J.

1988-01-01

Two DNA-binding factors from Saccharomyces cerevisiae have been characterized, GRFI (general regulatory factor I) and ABFI (ARS-binding factor I), that recognize specific sequences within diverse genetic elements. GRFI bound to sequences at the negative regulatory elements (silencers) of the silent mating type loci HML E and HMR E and to the upstream activating sequence (UAS) required for transcription of the MAT ..cap alpha.. genes. A putative conserved UAS located at genes involved in translation (RPG box) was also recognized by GRFI. In addition, GRFI bound with high affinity to sequences within the (C/sub 1-3/A)-repeat region at yeast telomeres. Binding sitesmore » for GRFI with the highest affinity appeared to be of the form 5'-(A/G)(A/C)ACCCAN NCA(T/C)(T/C)-3', where N is any nucleotide. ABFI-binding sites were located next to autonomously replicating sequences (ARSs) at controlling elements of the silent mating type loci HMR E, HMR I, and HML I and were associated with ARS1, ARS2, and the 2..mu..m plasmid ARS. Two tandem ABFI binding sites were found between the HIS3 and DED1 genes, several kilobase pairs from any ARS, indicating that ABFI-binding sites are not restricted to ARSs. The sequences recognized by AFBI showed partial dyad-symmetry and appeared to be variations of the consensus 5'-TATCATTNNNNACGA-3'. GRFI and ABFI were both abundant DNA-binding factors and did not appear to be encoded by the SIR genes, whose product are required for repression of the silent mating type loci. Together, these results indicate that both GRFI and ABFI play multiple roles within the cell.« less

Separation of the PROX1 gene from upstream conserved elements in a complex inversion/translocation patient with hypoplastic left heart

PubMed Central

Gill, Harinder K; Parsons, Sian R; Spalluto, Cosma; Davies, Angela F; Knorz, Victoria J; Burlinson, Clare EG; Ng, Bee Ling; Carter, Nigel P; Ogilvie, Caroline Mackie; Wilson, David I; Roberts, Roland G

2009-01-01

Hypoplastic left heart (HLH) occurs in at least 1 in 10 000 live births but may be more common in utero. Its causes are poorly understood but a number of affected cases are associated with chromosomal abnormalities. We set out to localize the breakpoints in a patient with sporadic HLH and a de novo translocation. Initial studies showed that the apparently simple 1q41;3q27.1 translocation was actually combined with a 4-Mb inversion, also de novo, of material within 1q41. We therefore localized all four breakpoints and found that no known transcription units were disrupted. However we present a case, based on functional considerations, synteny and position of highly conserved non-coding sequence elements, and the heterozygous Prox1+/− mouse phenotype (ventricular hypoplasia), for the involvement of dysregulation of the PROX1 gene in the aetiology of HLH in this case. Accordingly, we show that the spatial expression pattern of PROX1 in the developing human heart is consistent with a role in cardiac development. We suggest that dysregulation of PROX1 gene expression due to separation from its conserved upstream elements is likely to have caused the heart defects observed in this patient, and that PROX1 should be considered as a potential candidate gene for other cases of HLH. The relevance of another breakpoint separating the cardiac gene ESRRG from a conserved downstream element is also discussed. PMID:19471316

The conserved upstream region of lscB/C determines expression of different levansucrase genes in plant pathogen Pseudomonas syringae

PubMed Central

2014-01-01

Background Pseudomonas syringae pv. glycinea PG4180 is an opportunistic plant pathogen which causes bacterial blight of soybean plants. It produces the exopolysaccharide levan by the enzyme levansucrase. Levansucrase has three gene copies in PG4180, two of which, lscB and lscC, are expressed while the third, lscA, is cryptic. Previously, nucleotide sequence alignments of lscB/C variants in various P. syringae showed that a ~450-bp phage-associated promoter element (PAPE) including the first 48 nucleotides of the ORF is absent in lscA. Results Herein, we tested whether this upstream region is responsible for the expression of lscB/C and lscA. Initially, the transcriptional start site for lscB/C was determined. A fusion of the PAPE with the ORF of lscA (lscB UpN A) was generated and introduced to a levan-negative mutant of PG4180. Additionally, fusions comprising of the non-coding part of the upstream region of lscB with lscA (lscB Up A) or the upstream region of lscA with lscB (lscA Up B) were generated. Transformants harboring the lscB UpN A or the lscB Up A fusion, respectively, showed levan formation while the transformant carrying lscA Up B did not. qRT-PCR and Western blot analyses showed that lscB UpN A had an expression similar to lscB while lscB Up A had a lower expression. Accuracy of protein fusions was confirmed by MALDI-TOF peptide fingerprinting. Conclusions Our data suggested that the upstream sequence of lscB is essential for expression of levansucrase while the N-terminus of LscB mediates an enhanced expression. In contrast, the upstream region of lscA does not lead to expression of lscB. We propose that lscA might be an ancestral levansucrase variant upstream of which the PAPE got inserted by potentially phage-mediated transposition events leading to expression of levansucrase in P. syringae. PMID:24670199

Molecular characterization of a 40 kDa OmpC-like porin from Serratia marcescens.

PubMed

Hutsul, J A; Worobec, E

1994-02-01

An oligonucleotide that encodes the N-terminal portion of a 41 kDa porin of Serratia marcescens was used to probe S. marcescens UOC-51 genomic DNA. An 11 kb EcoRI fragment which hybridized with the oligonucleotide was subcloned into Escherichia coli, examined for expression, and sequenced. The product expressed by the cloned gene was 40 kDa. The nucleotide sequence has an ORF of 1.13 kb. When the deduced amino acid sequence was aligned and compared to other enterobacterial porins the cloned S. marcescens porin most closely resembled E. coli OmpC. Although we did not detect osmoregulation or thermoregulation of any porins in S. marcescens UOC-51, sequences analogous to the E. coli osmoregulator OmpR-binding regions are seen upstream to the cloned gene. We examined the regulation of the S. marcescens porin in E. coli and found that its expression increased in a high salt environment. A micF gene, whose transcriptional product functions to inhibit synthesis of OmpF by hybridizing with the ompF transcript, was also seen upstream of the S. marcescens ompC. An alignment with the E. coli micF gene revealed that the functional region of the S. marcescens micF gene is conserved. Based on the results obtained we have determined that S. marcescens UOC-51 produces a 40 kDa porin similar to the E. coli OmpC porin.

ICAM-1-related long non-coding RNA: promoter analysis and expression in human retinal endothelial cells.

PubMed

Lumsden, Amanda L; Ma, Yuefang; Ashander, Liam M; Stempel, Andrew J; Keating, Damien J; Smith, Justine R; Appukuttan, Binoy

2018-05-09

Regulation of intercellular adhesion molecule (ICAM)-1 in retinal endothelial cells is a promising druggable target for retinal vascular diseases. The ICAM-1-related (ICR) long non-coding RNA stabilizes ICAM-1 transcript, increasing protein expression. However, studies of ICR involvement in disease have been limited as the promoter is uncharacterized. To address this issue, we undertook a comprehensive in silico analysis of the human ICR gene promoter region. We used genomic evolutionary rate profiling to identify a 115 base pair (bp) sequence within 500 bp upstream of the transcription start site of the annotated human ICR gene that was conserved across 25 eutherian genomes. A second constrained sequence upstream of the orthologous mouse gene (68 bp; conserved across 27 Eutherian genomes including human) was also discovered. Searching these elements identified 33 matrices predictive of binding sites for transcription factors known to be responsive to a broad range of pathological stimuli, including hypoxia, and metabolic and inflammatory proteins. Five phenotype-associated single nucleotide polymorphisms (SNPs) in the immediate vicinity of these elements included four SNPs (i.e. rs2569693, rs281439, rs281440 and rs11575074) predicted to impact binding motifs of transcription factors, and thus the expression of ICR and ICAM-1 genes, with potential to influence disease susceptibility. We verified that human retinal endothelial cells expressed ICR, and observed induction of expression by tumor necrosis factor-α.

Identification and expression analysis of cDNA encoding insulin-like growth factor 2 in horses

PubMed Central

KIKUCHI, Kohta; SASAKI, Keisuke; AKIZAWA, Hiroki; TSUKAHARA, Hayato; BAI, Hanako; TAKAHASHI, Masashi; NAMBO, Yasuo; HATA, Hiroshi; KAWAHARA, Manabu

2017-01-01

Insulin-like growth factor 2 (IGF2) is responsible for a broad range of physiological processes during fetal development and adulthood, but genomic analyses of IGF2 containing the 5ʹ- and 3ʹ-untranslated regions (UTRs) in equines have been limited. In this study, we characterized the IGF2 mRNA containing the UTRs, and determined its expression pattern in the fetal tissues of horses. The complete equine IGF2 mRNA sequence harboring another exon approximately 2.8 kb upstream from the canonical transcription start site was identified as a new transcript variant. As this upstream exon did not contain the start codon, the amino acid sequence was identical to the canonical variant. Analysis of the deduced amino acid sequence revealed that the protein possessed two major domains, IlGF and IGF2_C, and analysis of IGF2 sequence polymorphism in fetal tissues of Hokkaido native horse and Thoroughbreds revealed a single nucleotide polymorphism (T to C transition) at position 398 in Thoroughbreds, which caused an amino acid substitution at position 133 in the IGF2 sequence. Furthermore, the expression pattern of the IGF2 mRNA in the fetal tissues of horses was determined for the first time, and was found to be consistent with those of other species. Taken together, these results suggested that the transcriptional and translational products of the IGF2 gene have conserved functions in the fetal development of mammals, including horses. PMID:29151450

Transcription of two adjacent carbohydrate utilization gene clusters in Bifidobacterium breve UCC2003 is controlled by LacI- and repressor open reading frame kinase (ROK)-type regulators.

PubMed

O'Connell, Kerry Joan; Motherway, Mary O'Connell; Liedtke, Andrea; Fitzgerald, Gerald F; Paul Ross, R; Stanton, Catherine; Zomer, Aldert; van Sinderen, Douwe

2014-06-01

Members of the genus Bifidobacterium are commonly found in the gastrointestinal tracts of mammals, including humans, where their growth is presumed to be dependent on various diet- and/or host-derived carbohydrates. To understand transcriptional control of bifidobacterial carbohydrate metabolism, we investigated two genetic carbohydrate utilization clusters dedicated to the metabolism of raffinose-type sugars and melezitose. Transcriptomic and gene inactivation approaches revealed that the raffinose utilization system is positively regulated by an activator protein, designated RafR. The gene cluster associated with melezitose metabolism was shown to be subject to direct negative control by a LacI-type transcriptional regulator, designated MelR1, in addition to apparent indirect negative control by means of a second LacI-type regulator, MelR2. In silico analysis, DNA-protein interaction, and primer extension studies revealed the MelR1 and MelR2 operator sequences, each of which is positioned just upstream of or overlapping the correspondingly regulated promoter sequences. Similar analyses identified the RafR binding operator sequence located upstream of the rafB promoter. This study indicates that transcriptional control of gene clusters involved in carbohydrate metabolism in bifidobacteria is subject to conserved regulatory systems, representing either positive or negative control.

In Silico Analysis of Gene Expression Network Components Underlying Pigmentation Phenotypes in the Python Identified Evolutionarily Conserved Clusters of Transcription Factor Binding Sites

PubMed Central

2016-01-01

Color variation provides the opportunity to investigate the genetic basis of evolution and selection. Reptiles are less studied than mammals. Comparative genomics approaches allow for knowledge gained in one species to be leveraged for use in another species. We describe a comparative vertebrate analysis of conserved regulatory modules in pythons aimed at assessing bioinformatics evidence that transcription factors important in mammalian pigmentation phenotypes may also be important in python pigmentation phenotypes. We identified 23 python orthologs of mammalian genes associated with variation in coat color phenotypes for which we assessed the extent of pairwise protein sequence identity between pythons and mouse, dog, horse, cow, chicken, anole lizard, and garter snake. We next identified a set of melanocyte/pigment associated transcription factors (CREB, FOXD3, LEF-1, MITF, POU3F2, and USF-1) that exhibit relatively conserved sequence similarity within their DNA binding regions across species based on orthologous alignments across multiple species. Finally, we identified 27 evolutionarily conserved clusters of transcription factor binding sites within ~200-nucleotide intervals of the 1500-nucleotide upstream regions of AIM1, DCT, MC1R, MITF, MLANA, OA1, PMEL, RAB27A, and TYR from Python bivittatus. Our results provide insight into pigment phenotypes in pythons. PMID:27698666

In Silico Analysis of Gene Expression Network Components Underlying Pigmentation Phenotypes in the Python Identified Evolutionarily Conserved Clusters of Transcription Factor Binding Sites.

PubMed

Irizarry, Kristopher J L; Bryden, Randall L

2016-01-01

Color variation provides the opportunity to investigate the genetic basis of evolution and selection. Reptiles are less studied than mammals. Comparative genomics approaches allow for knowledge gained in one species to be leveraged for use in another species. We describe a comparative vertebrate analysis of conserved regulatory modules in pythons aimed at assessing bioinformatics evidence that transcription factors important in mammalian pigmentation phenotypes may also be important in python pigmentation phenotypes. We identified 23 python orthologs of mammalian genes associated with variation in coat color phenotypes for which we assessed the extent of pairwise protein sequence identity between pythons and mouse, dog, horse, cow, chicken, anole lizard, and garter snake. We next identified a set of melanocyte/pigment associated transcription factors (CREB, FOXD3, LEF-1, MITF, POU3F2, and USF-1) that exhibit relatively conserved sequence similarity within their DNA binding regions across species based on orthologous alignments across multiple species. Finally, we identified 27 evolutionarily conserved clusters of transcription factor binding sites within ~200-nucleotide intervals of the 1500-nucleotide upstream regions of AIM1, DCT, MC1R, MITF, MLANA, OA1, PMEL, RAB27A, and TYR from Python bivittatus . Our results provide insight into pigment phenotypes in pythons.

Motif finding in DNA sequences based on skipping nonconserved positions in background Markov chains.

PubMed

Zhao, Xiaoyan; Sze, Sing-Hoi

2011-05-01

One strategy to identify transcription factor binding sites is through motif finding in upstream DNA sequences of potentially co-regulated genes. Despite extensive efforts, none of the existing algorithms perform very well. We consider a string representation that allows arbitrary ignored positions within the nonconserved portion of single motifs, and use O(2(l)) Markov chains to model the background distributions of motifs of length l while skipping these positions within each Markov chain. By focusing initially on positions that have fixed nucleotides to define core occurrences, we develop an algorithm to identify motifs of moderate lengths. We compare the performance of our algorithm to other motif finding algorithms on a few benchmark data sets, and show that significant improvement in accuracy can be obtained when the sites are sufficiently conserved within a given sample, while comparable performance is obtained when the site conservation rate is low. A software program (PosMotif ) and detailed results are available online at http://faculty.cse.tamu.edu/shsze/posmotif.

Conservation of Endo16 expression in sea urchins despite evolutionary divergence in both cis and trans-acting components of transcriptional regulation

NASA Technical Reports Server (NTRS)

Romano, Laura A.; Wray, Gregory A.

2003-01-01

Evolutionary changes in transcriptional regulation undoubtedly play an important role in creating morphological diversity. However, there is little information about the evolutionary dynamics of cis-regulatory sequences. This study examines the functional consequence of evolutionary changes in the Endo16 promoter of sea urchins. The Endo16 gene encodes a large extracellular protein that is expressed in the endoderm and may play a role in cell adhesion. Its promoter has been characterized in exceptional detail in the purple sea urchin, Strongylocentrotus purpuratus. We have characterized the structure and function of the Endo16 promoter from a second sea urchin species, Lytechinus variegatus. The Endo16 promoter sequences have evolved in a strongly mosaic manner since these species diverged approximately 35 million years ago: the most proximal region (module A) is conserved, but the remaining modules (B-G) are unalignable. Despite extensive divergence in promoter sequences, the pattern of Endo16 transcription is largely conserved during embryonic and larval development. Transient expression assays demonstrate that 2.2 kb of upstream sequence in either species is sufficient to drive GFP reporter expression that correctly mimics this pattern of Endo16 transcription. Reciprocal cross-species transient expression assays imply that changes have also evolved in the set of transcription factors that interact with the Endo16 promoter. Taken together, these results suggest that stabilizing selection on the transcriptional output may have operated to maintain a similar pattern of Endo16 expression in S. purpuratus and L. variegatus, despite dramatic divergence in promoter sequence and mechanisms of transcriptional regulation.

Evidence for serial discontinuity in the fish community of a heavily impounded river

USGS Publications Warehouse

Miranda, Leandro E.; Dembkowski, D.J.

2016-01-01

In the Tennessee River, USA, we examined lengthwise patterns in fish community structure and species richness within and among nine reservoirs organized in sequence and connected through navigational locks. Within reservoirs, the riverine, transition and lacustrine zones supported distinct, although overlapping, nearshore fish assemblages; differences were also reflected in measures of species richness. Spatial patterns were most apparent for rheophilic species, which increased in species richness and representation upstream within each reservoir and downstream across the chain of reservoirs. This pattern resembled a sawtooth wave, with the amplitude of the wave peaking in the riverine zone below each dam, and progressively higher wave amplitude developing downstream in the reservoir chain. The observed sawtooth pattern supports the serial discontinuity concept in that the continuity of the riverine fish community is interrupted by the lacustrine conditions created behind each dam. Upstream within each reservoir, and downstream in the chain of reservoirs, habitat characteristics become more riverine. To promote sustainability of rheophilic fishes and maintain biodiversity in impounded rivers, conservation plans could emphasize maintenance and preservation of riverine environments of the reservoir's upper reaches, while remaining cognizant of the broader basin trends that provide opportunities for a lengthwise array of conservation and management policy. 

Application of a framework for extrapolating chemical effects ...

EPA Pesticide Factsheets

Cross-species extrapolation of toxicity data from limited surrogate test organisms to all wildlife with potential of chemical exposure remains a key challenge in ecological risk assessment. A number of factors affect extrapolation, including the chemical exposure, pharmacokinetics, life-stage, and pathway similarities/differences. Here we propose a framework using a tiered approach for species extrapolation that enables a transparent weight-of-evidence driven evaluation of pathway conservation (or lack thereof) in the context of adverse outcome pathways. Adverse outcome pathways describe the linkages from a molecular initiating event, defined as the chemical-biomolecule interaction, through subsequent key events leading to an adverse outcome of regulatory concern (e.g., mortality, reproductive dysfunction). Tier 1 of the extrapolation framework employs in silico evaluations of sequence and structural conservation of molecules (e.g., receptors, enzymes) associated with molecular initiating events or upstream key events. Such evaluations make use of available empirical and sequence data to assess taxonomic relevance. Tier 2 uses in vitro bioassays, such as enzyme inhibition/activation, competitive receptor binding, and transcriptional activation assays to explore functional conservation of pathways across taxa. Finally, Tier 3 provides a comparative analysis of in vivo responses between species utilizing well-established model organisms to assess departure from

Comparative analysis of the full genome sequence of European bat lyssavirus type 1 and type 2 with other lyssaviruses and evidence for a conserved transcription termination and polyadenylation motif in the G-L 3' non-translated region.

PubMed

Marston, D A; McElhinney, L M; Johnson, N; Müller, T; Conzelmann, K K; Tordo, N; Fooks, A R

2007-04-01

We report the first full-length genomic sequences for European bat lyssavirus type-1 (EBLV-1) and type-2 (EBLV-2). The EBLV-1 genomic sequence was derived from a virus isolated from a serotine bat in Hamburg, Germany, in 1968 and the EBLV-2 sequence was derived from a virus isolate from a human case of rabies that occurred in Scotland in 2002. A long-distance PCR strategy was used to amplify the open reading frames (ORFs), followed by standard and modified RACE (rapid amplification of cDNA ends) techniques to amplify the 3' and 5' ends. The lengths of each complete viral genome for EBLV-1 and EBLV-2 were 11 966 and 11 930 base pairs, respectively, and follow the standard rhabdovirus genome organization of five viral proteins. Comparison with other lyssavirus sequences demonstrates variation in degrees of homology, with the genomic termini showing a high degree of complementarity. The nucleoprotein was the most conserved, both intra- and intergenotypically, followed by the polymerase (L), matrix and glyco- proteins, with the phosphoprotein being the most variable. In addition, we have shown that the two EBLVs utilize a conserved transcription termination and polyadenylation (TTP) motif, approximately 50 nt upstream of the L gene start codon. All available lyssavirus sequences to date, with the exception of Pasteur virus (PV) and PV-derived isolates, use the second TTP site. This observation may explain differences in pathogenicity between lyssavirus strains, dependent on the length of the untranslated region, which might affect transcriptional activity and RNA stability.

Structural and functional analysis of mouse Msx1 gene promoter: sequence conservation with human MSX1 promoter points at potential regulatory elements.

PubMed

Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E

1998-06-01

Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.

Novel mechanism of conjoined gene formation in the human genome.

PubMed

Kim, Ryong Nam; Kim, Aeri; Choi, Sang-Haeng; Kim, Dae-Soo; Nam, Seong-Hyeuk; Kim, Dae-Won; Kim, Dong-Wook; Kang, Aram; Kim, Min-Young; Park, Kun-Hyang; Yoon, Byoung-Ha; Lee, Kang Seon; Park, Hong-Seog

2012-03-01

Recently, conjoined genes (CGs) have emerged as important genetic factors necessary for understanding the human genome. However, their formation mechanism and precise structures have remained mysterious. Based on a detailed structural analysis of 57 human CG transcript variants (CGTVs, discovered in this study) and all (833) known CGs in the human genome, we discovered that the poly(A) signal site from the upstream parent gene region is completely removed via the skipping or truncation of the final exon; consequently, CG transcription is terminated at the poly(A) signal site of the downstream parent gene. This result led us to propose a novel mechanism of CG formation: the complete removal of the poly(A) signal site from the upstream parent gene is a prerequisite for the CG transcriptional machinery to continue transcribing uninterrupted into the intergenic region and downstream parent gene. The removal of the poly(A) signal sequence from the upstream gene region appears to be caused by a deletion or truncation mutation in the human genome rather than post-transcriptional trans-splicing events. With respect to the characteristics of CG sequence structures, we found that intergenic regions are hot spots for novel exon creation during CGTV formation and that exons farther from the intergenic regions are more highly conserved in the CGTVs. Interestingly, many novel exons newly created within the intergenic and intragenic regions originated from transposable element sequences. Additionally, the CGTVs showed tumor tissue-biased expression. In conclusion, our study provides novel insights into the CG formation mechanism and expands the present concepts of the genetic structural landscape, gene regulation, and gene formation mechanisms in the human genome.

Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

PubMed Central

Levis, R; Schlesinger, S; Huang, H V

1990-01-01

Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA. Images PMID:2319651

Phyloscan: locating transcription-regulating binding sites in mixed aligned and unaligned sequence data.

PubMed

Palumbo, Michael J; Newberg, Lee A

2010-07-01

The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).

Sequences downstream of AAUAAA signals affect pre-mRNA cleavage and polyadenylation in vitro both directly and indirectly.

PubMed Central

Ryner, L C; Takagaki, Y; Manley, J L

1989-01-01

To investigate the role of sequences lying downstream of the conserved AAUAAA hexanucleotide in pre-mRNA cleavage and polyadenylation, deletions or substitutions were constructed in polyadenylation signals from simian virus 40 and adenovirus, and their effects were assayed in both crude and fractionated HeLa cell nuclear extracts. As expected, these sequences influenced the efficiency of both cleavage and polyadenylation as well as the accuracy of the cleavage reaction. Sequences near or upstream of the actual site of poly(A) addition appeared to specify a unique cleavage site, since their deletion resulted, in some cases, in heterogeneous cleavage. Furthermore, the sequences that allowed the simian virus 40 late pre-RNA to be cleaved preferentially by partially purified cleavage activity were also those at the cleavage site itself. Interestingly, sequences downstream of the cleavage site interacted with factors not directly involved in catalyzing cleavage and polyadenylation, since the effects of deletions were substantially diminished when partially purified components were used in assays. In addition, these sequences contained elements that could affect 3'-end formation both positively and negatively. Images PMID:2566911

The chicken skeletal alpha-actin gene promoter region exhibits partial dyad symmetry and a capacity to drive bidirectional transcription.

PubMed Central

Grichnik, J M; French, B A; Schwartz, R J

1988-01-01

The chicken skeletal alpha-actin gene promoter region (-202 to -12) provides myogenic transcriptional specificity. This promoter contains partial dyad symmetry about an axis at nucleotide -108 and in transfection experiments is capable of directing transcription in a bidirectional manner. At least three different transcription initiation start sites, oriented toward upstream sequences, were mapped 25 to 30 base pairs from TATA-like regions. The opposing transcriptional activity was potentiated upon the deletion of sequences proximal to the alpha-actin transcription start site. Thus, sequences which serve to position RNA polymerase for alpha-actin transcription may allow, in their absence, the selection of alternative and reverse-oriented start sites. Nuclear runoff transcription assays of embryonic muscle indicated that divergent transcription may occur in vivo but with rapid turnover of nuclear transcripts. Divergent transcriptional activity enabled us to define the 3' regulatory boundary of the skeletal alpha-actin promoter which retains a high level of myogenic transcriptional activity. The 3' regulatory border was detected when serial 3' deletions bisected the element (-91 CCAAA TATGG -82) which reduced transcriptional activity by 80%. Previously we showed that disruption of its upstream counterpart (-127 CCAAAGAAGG -136) resulted in about a 90% decrease in activity. These element pairs, which we describe as CCAAT box-associated repeats, are conserved in all sequenced vertebrate sarcomeric actin genes and may act in a cooperative manner to facilitate transcription in myogenic cells. Images PMID:3211124

Isolation of a gene (pbsC) required for siderophore biosynthesis in fluorescent Pseudomonas sp. strain M114.

PubMed

Adams, C; Dowling, D N; O'Sullivan, D J; O'Gara, F

1994-06-03

An iron-regulated gene, pbsC, required for siderophore production in fluorescent Pseudomonas sp. strain M114 has been identified. A kanamycin-resistance cassette was inserted at specific restriction sites within a 7 kb genomic fragment of M114 DNA and by marker exchange two siderophore-negative mutants, designated M1 and M2, were isolated. The nucleotide sequence of approximately 4 kb of the region flanking the insertion sites was determined and a large open reading frame (ORF) extending for 2409 bp was identified. This gene was designated pbsC (pseudobactin synthesis C) and its putative protein product termed PbsC. PbsC was found to be homologous to a family of enzymes involved in the biosynthesis of secondary metabolites, including EntF of Escherichia coli. These enzymes are believed to act via ATP-dependent binding of AMP to their substrate. Several areas of high sequence homology between these proteins and PbsC were observed, including a conserved AMP-binding domain. The expression of pbsC is iron-regulated as revealed when a DNA fragment containing the upstream region was cloned in a promoter probe vector and conjugated into the wild-type strain, M114. The nucleotide sequence upstream of the putative translational start site contains a region homologous to previously defined -16 to -25 sequences of iron-regulated genes but did not contain an iron-box consensus sequence. It was noted that inactivation of the pbsC gene also affected other iron-regulated phenotypes of Pseudomonas M114.

Partial Shotgun Sequencing of the Boechera stricta Genome Reveals Extensive Microsynteny and Promoter Conservation with Arabidopsis1[W

PubMed Central

Windsor, Aaron J.; Schranz, M. Eric; Formanová, Nataša; Gebauer-Jung, Steffi; Bishop, John G.; Schnabelrauch, Domenica; Kroymann, Juergen; Mitchell-Olds, Thomas

2006-01-01

Comparative genomics provides insight into the evolutionary dynamics that shape discrete sequences as well as whole genomes. To advance comparative genomics within the Brassicaceae, we have end sequenced 23,136 medium-sized insert clones from Boechera stricta, a wild relative of Arabidopsis (Arabidopsis thaliana). A significant proportion of these sequences, 18,797, are nonredundant and display highly significant similarity (BLASTn e-value ≤ 10−30) to low copy number Arabidopsis genomic regions, including more than 9,000 annotated coding sequences. We have used this dataset to identify orthologous gene pairs in the two species and to perform a global comparison of DNA regions 5′ to annotated coding regions. On average, the 500 nucleotides upstream to coding sequences display 71.4% identity between the two species. In a similar analysis, 61.4% identity was observed between 5′ noncoding sequences of Brassica oleracea and Arabidopsis, indicating that regulatory regions are not as diverged among these lineages as previously anticipated. By mapping the B. stricta end sequences onto the Arabidopsis genome, we have identified nearly 2,000 conserved blocks of microsynteny (bracketing 26% of the Arabidopsis genome). A comparison of fully sequenced B. stricta inserts to their homologous Arabidopsis genomic regions indicates that indel polymorphisms >5 kb contribute substantially to the genome size difference observed between the two species. Further, we demonstrate that microsynteny inferred from end-sequence data can be applied to the rapid identification and cloning of genomic regions of interest from nonmodel species. These results suggest that among diploid relatives of Arabidopsis, small- to medium-scale shotgun sequencing approaches can provide rapid and cost-effective benefits to evolutionary and/or functional comparative genomic frameworks. PMID:16607030

Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

PubMed

Wang, Cheng; Yu, Jie; Kallen, Caleb B

2008-01-01

The proliferating cell nuclear antigen (PCNA) is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE) sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2) enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

Tobacco chloroplast tRNALys(UUU) gene contains a 2.5-kilobase-pair intron: An open reading frame and a conserved boundary sequence in the intron

PubMed Central

Sugita, Mamoru; Shinozaki, Kazuo; Sugiura, Masahiro

1985-01-01

The nucleotide sequence of a tRNALys(UUU) gene on tobacco (Nicotiana tabacum) chloroplast DNA has been determined. This gene is located 215 base pairs upstream from the gene for the 32,000-dalton thylakoid membrane protein on the same DNA strand and has a 2526-base-pair intron in the anticodon loop. The intron boundary sequence does not follow the G-U/A-G rule but is similar to those of tobacco chloroplast split genes for tRNAGly(UCC) and ribosomal proteins L2 and S12. The intron contains one major open reading frame of 509 codons. The codon usage in the open reading frame resembles those observed in the genes for tobacco chloroplast proteins so far analyzed. The primary transcript of this tRNA gene is 2.7 kilobases long. Images PMID:16593561

Tobacco chloroplast tRNA(UUU) gene contains a 2.5-kilobase-pair intron: An open reading frame and a conserved boundary sequence in the intron.

PubMed

Sugita, M; Shinozaki, K; Sugiura, M

1985-06-01

The nucleotide sequence of a tRNA(Lys)(UUU) gene on tobacco (Nicotiana tabacum) chloroplast DNA has been determined. This gene is located 215 base pairs upstream from the gene for the 32,000-dalton thylakoid membrane protein on the same DNA strand and has a 2526-base-pair intron in the anticodon loop. The intron boundary sequence does not follow the G-U/A-G rule but is similar to those of tobacco chloroplast split genes for tRNA(Gly)(UCC) and ribosomal proteins L2 and S12. The intron contains one major open reading frame of 509 codons. The codon usage in the open reading frame resembles those observed in the genes for tobacco chloroplast proteins so far analyzed. The primary transcript of this tRNA gene is 2.7 kilobases long.

Transcription of Two Adjacent Carbohydrate Utilization Gene Clusters in Bifidobacterium breve UCC2003 Is Controlled by LacI- and Repressor Open Reading Frame Kinase (ROK)-Type Regulators

PubMed Central

O'Connell, Kerry Joan; O'Connell Motherway, Mary; Liedtke, Andrea; Fitzgerald, Gerald F.; Ross, R. Paul; Stanton, Catherine; Zomer, Aldert

2014-01-01

Members of the genus Bifidobacterium are commonly found in the gastrointestinal tracts of mammals, including humans, where their growth is presumed to be dependent on various diet- and/or host-derived carbohydrates. To understand transcriptional control of bifidobacterial carbohydrate metabolism, we investigated two genetic carbohydrate utilization clusters dedicated to the metabolism of raffinose-type sugars and melezitose. Transcriptomic and gene inactivation approaches revealed that the raffinose utilization system is positively regulated by an activator protein, designated RafR. The gene cluster associated with melezitose metabolism was shown to be subject to direct negative control by a LacI-type transcriptional regulator, designated MelR1, in addition to apparent indirect negative control by means of a second LacI-type regulator, MelR2. In silico analysis, DNA-protein interaction, and primer extension studies revealed the MelR1 and MelR2 operator sequences, each of which is positioned just upstream of or overlapping the correspondingly regulated promoter sequences. Similar analyses identified the RafR binding operator sequence located upstream of the rafB promoter. This study indicates that transcriptional control of gene clusters involved in carbohydrate metabolism in bifidobacteria is subject to conserved regulatory systems, representing either positive or negative control. PMID:24705323

Association of Amine-Receptor DNA Sequence Variants with Associative Learning in the Honeybee.

PubMed

Lagisz, Malgorzata; Mercer, Alison R; de Mouzon, Charlotte; Santos, Luana L S; Nakagawa, Shinichi

2016-03-01

Octopamine- and dopamine-based neuromodulatory systems play a critical role in learning and learning-related behaviour in insects. To further our understanding of these systems and resulting phenotypes, we quantified DNA sequence variations at six loci coding octopamine-and dopamine-receptors and their association with aversive and appetitive learning traits in a population of honeybees. We identified 79 polymorphic sequence markers (mostly SNPs and a few insertions/deletions) located within or close to six candidate genes. Intriguingly, we found that levels of sequence variation in the protein-coding regions studied were low, indicating that sequence variation in the coding regions of receptor genes critical to learning and memory is strongly selected against. Non-coding and upstream regions of the same genes, however, were less conserved and sequence variations in these regions were weakly associated with between-individual differences in learning-related traits. While these associations do not directly imply a specific molecular mechanism, they suggest that the cross-talk between dopamine and octopamine signalling pathways may influence olfactory learning and memory in the honeybee.

The glnAntrBC operon of Herbaspirillum seropedicae is transcribed by two oppositely regulated promoters upstream of glnA.

PubMed

Schwab, Stefan; Souza, Emanuel M; Yates, Marshall G; Persuhn, Darlene C; Steffens, M Berenice R; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U

2007-01-01

Herbaspirillum seropedicae is an endophytic bacterium that fixes nitrogen under microaerophilic conditions. The putative promoter sequences glnAp1 (sigma70-dependent) and glnAp2 (sigma54), and two NtrC-binding sites were identified upstream from the glnA, ntrB and ntrC genes of this microorganism. To study their transcriptional regulation, we used lacZ fusions to the H. seropedicae glnA gene, and the glnA-ntrB and ntrB-ntrC intergenic regions. Expression of glnA was up-regulated under low ammonium, but no transcription activity was detected from the intergenic regions under any condition tested, suggesting that glnA, ntrB and ntrC are co-transcribed from the promoters upstream of glnA. Ammonium regulation was lost in the ntrC mutant strain. A point mutation was introduced in the conserved -25/-24 dinucleotide (GG-->TT) of the putative sigma54-dependent promoter (glnAp2). Contrary to the wild-type promoter, glnA expression with the mutant glnAp2 promoter was repressed in the wild-type strain under low ammonium levels, but this repression was abolished in an ntrC background. Together our results indicate that the H. seropedicae glnAntrBC operon is regulated from two functional promoters upstream from glnA, which are oppositely regulated by the NtrC protein.

Designing synthetic RNAs to determine the relevance of structural motifs in picornavirus IRES elements

NASA Astrophysics Data System (ADS)

Fernandez-Chamorro, Javier; Lozano, Gloria; Garcia-Martin, Juan Antonio; Ramajo, Jorge; Dotu, Ivan; Clote, Peter; Martinez-Salas, Encarnacion

2016-04-01

The function of Internal Ribosome Entry Site (IRES) elements is intimately linked to their RNA structure. Viral IRES elements are organized in modular domains consisting of one or more stem-loops that harbor conserved RNA motifs critical for internal initiation of translation. A conserved motif is the pyrimidine-tract located upstream of the functional initiation codon in type I and II picornavirus IRES. By computationally designing synthetic RNAs to fold into a structure that sequesters the polypyrimidine tract in a hairpin, we establish a correlation between predicted inaccessibility of the pyrimidine tract and IRES activity, as determined in both in vitro and in vivo systems. Our data supports the hypothesis that structural sequestration of the pyrimidine-tract within a stable hairpin inactivates IRES activity, since the stronger the stability of the hairpin the higher the inhibition of protein synthesis. Destabilization of the stem-loop immediately upstream of the pyrimidine-tract also decreases IRES activity. Our work introduces a hybrid computational/experimental method to determine the importance of structural motifs for biological function. Specifically, we show the feasibility of using the software RNAiFold to design synthetic RNAs with particular sequence and structural motifs that permit subsequent experimental determination of the importance of such motifs for biological function.

Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

PubMed Central

Agervald, Åsa; Stensjö, Karin; Holmqvist, Marie; Lindblad, Peter

2008-01-01

Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs) were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the assembly of the small subunit of the enzyme. PMID:18442387

The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

PubMed Central

Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

1987-01-01

Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

Core histone genes of Giardia intestinalis: genomic organization, promoter structure, and expression

PubMed Central

Yee, Janet; Tang, Anita; Lau, Wei-Ling; Ritter, Heather; Delport, Dewald; Page, Melissa; Adam, Rodney D; Müller, Miklós; Wu, Gang

2007-01-01

Background Giardia intestinalis is a protist found in freshwaters worldwide, and is the most common cause of parasitic diarrhea in humans. The phylogenetic position of this parasite is still much debated. Histones are small, highly conserved proteins that associate tightly with DNA to form chromatin within the nucleus. There are two classes of core histone genes in higher eukaryotes: DNA replication-independent histones and DNA replication-dependent ones. Results We identified two copies each of the core histone H2a, H2b and H3 genes, and three copies of the H4 gene, at separate locations on chromosomes 3, 4 and 5 within the genome of Giardia intestinalis, but no gene encoding a H1 linker histone could be recognized. The copies of each gene share extensive DNA sequence identities throughout their coding and 5' noncoding regions, which suggests these copies have arisen from relatively recent gene duplications or gene conversions. The transcription start sites are at triplet A sequences 1–27 nucleotides upstream of the translation start codon for each gene. We determined that a 50 bp region upstream from the start of the histone H4 coding region is the minimal promoter, and a highly conserved 15 bp sequence called the histone motif (him) is essential for its activity. The Giardia core histone genes are constitutively expressed at approximately equivalent levels and their mRNAs are polyadenylated. Competition gel-shift experiments suggest that a factor within the protein complex that binds him may also be a part of the protein complexes that bind other promoter elements described previously in Giardia. Conclusion In contrast to other eukaryotes, the Giardia genome has only a single class of core histone genes that encode replication-independent histones. Our inability to locate a gene encoding the linker histone H1 leads us to speculate that the H1 protein may not be required for the compaction of Giardia's small and gene-rich genome. PMID:17425802

Evidence of birth-and-death evolution of 5S rRNA gene in Channa species (Teleostei, Perciformes).

PubMed

Barman, Anindya Sundar; Singh, Mamta; Singh, Rajeev Kumar; Lal, Kuldeep Kumar

2016-12-01

In higher eukaryotes, minor rDNA family codes for 5S rRNA that is arranged in tandem arrays and comprises of a highly conserved 120 bp long coding sequence with a variable non-transcribed spacer (NTS). Initially the 5S rDNA repeats are considered to be evolved by the process of concerted evolution. But some recent reports, including teleost fishes suggested that evolution of 5S rDNA repeat does not fit into the concerted evolution model and evolution of 5S rDNA family may be explained by a birth-and-death evolution model. In order to study the mode of evolution of 5S rDNA repeats in Perciformes fish species, nucleotide sequence and molecular organization of five species of genus Channa were analyzed in the present study. Molecular analyses revealed several variants of 5S rDNA repeats (four types of NTS) and networks created by a neighbor net algorithm for each type of sequences (I, II, III and IV) did not show a clear clustering in species specific manner. The stable secondary structure is predicted and upstream and downstream conserved regulatory elements were characterized. Sequence analyses also shown the presence of two putative pseudogenes in Channa marulius. Present study supported that 5S rDNA repeats in genus Channa were evolved under the process of birth-and-death.

Engineering Promoter Architecture in Oleaginous Yeast Yarrowia lipolytica.

PubMed

Shabbir Hussain, Murtaza; Gambill, Lauren; Smith, Spencer; Blenner, Mark A

2016-03-18

Eukaryotic promoters have a complex architecture to control both the strength and timing of gene transcription spanning up to thousands of bases from the initiation site. This complexity makes rational fine-tuning of promoters in fungi difficult to predict; however, this very same complexity enables multiple possible strategies for engineering promoter strength. Here, we studied promoter architecture in the oleaginous yeast, Yarrowia lipolytica. While recent studies have focused on upstream activating sequences, we systematically examined various components common in fungal promoters. Here, we examine several promoter components including upstream activating sequences, proximal promoter sequences, core promoters, and the TATA box in autonomously replicating expression plasmids and integrated into the genome. Our findings show that promoter strength can be fine-tuned through the engineering of the TATA box sequence, core promoter, and upstream activating sequences. Additionally, we identified a previously unreported oleic acid responsive transcription enhancement in the XPR2 upstream activating sequences, which illustrates the complexity of fungal promoters. The promoters engineered here provide new genetic tools for metabolic engineering in Y. lipolytica and provide promoter engineering strategies that may be useful in engineering other non-model fungal systems.

A gene-specific non-enhancer sequence is critical for expression from the promoter of the small heat shock protein gene αB-crystallin

PubMed Central

2014-01-01

Background Deciphering of the information content of eukaryotic promoters has remained confined to universal landmarks and conserved sequence elements such as enhancers and transcription factor binding motifs, which are considered sufficient for gene activation and regulation. Gene-specific sequences, interspersed between the canonical transacting factor binding sites or adjoining them within a promoter, are generally taken to be devoid of any regulatory information and have therefore been largely ignored. An unanswered question therefore is, do gene-specific sequences within a eukaryotic promoter have a role in gene activation? Here, we present an exhaustive experimental analysis of a gene-specific sequence adjoining the heat shock element (HSE) in the proximal promoter of the small heat shock protein gene, αB-crystallin (cryab). These sequences are highly conserved between the rodents and the humans. Results Using human retinal pigment epithelial cells in culture as the host, we have identified a 10-bp gene-specific promoter sequence (GPS), which, unlike an enhancer, controls expression from the promoter of this gene, only when in appropriate position and orientation. Notably, the data suggests that GPS in comparison with the HSE works in a context-independent fashion. Additionally, when moved upstream, about a nucleosome length of DNA (−154 bp) from the transcription start site (TSS), the activity of the promoter is markedly inhibited, suggesting its involvement in local promoter access. Importantly, we demonstrate that deletion of the GPS results in complete loss of cryab promoter activity in transgenic mice. Conclusions These data suggest that gene-specific sequences such as the GPS, identified here, may have critical roles in regulating gene-specific activity from eukaryotic promoters. PMID:24589182

Genome sequencing and comparative genomics of honey bee microsporidia, Nosema apis reveal novel insights into host-parasite interactions.

PubMed

Chen, Yan ping; Pettis, Jeffery S; Zhao, Yan; Liu, Xinyue; Tallon, Luke J; Sadzewicz, Lisa D; Li, Renhua; Zheng, Huoqing; Huang, Shaokang; Zhang, Xuan; Hamilton, Michele C; Pernal, Stephen F; Melathopoulos, Andony P; Yan, Xianghe; Evans, Jay D

2013-07-05

The microsporidia parasite Nosema contributes to the steep global decline of honey bees that are critical pollinators of food crops. There are two species of Nosema that have been found to infect honey bees, Nosema apis and N. ceranae. Genome sequencing of N. apis and comparative genome analysis with N. ceranae, a fully sequenced microsporidia species, reveal novel insights into host-parasite interactions underlying the parasite infections. We applied the whole-genome shotgun sequencing approach to sequence and assemble the genome of N. apis which has an estimated size of 8.5 Mbp. We predicted 2,771 protein- coding genes and predicted the function of each putative protein using the Gene Ontology. The comparative genomic analysis led to identification of 1,356 orthologs that are conserved between the two Nosema species and genes that are unique characteristics of the individual species, thereby providing a list of virulence factors and new genetic tools for studying host-parasite interactions. We also identified a highly abundant motif in the upstream promoter regions of N. apis genes. This motif is also conserved in N. ceranae and other microsporidia species and likely plays a role in gene regulation across the microsporidia. The availability of the N. apis genome sequence is a significant addition to the rapidly expanding body of microsprodian genomic data which has been improving our understanding of eukaryotic genome diversity and evolution in a broad sense. The predicted virulent genes and transcriptional regulatory elements are potential targets for innovative therapeutics to break down the life cycle of the parasite.

The Stream-Catchment (StreamCat) Dataset

EPA Science Inventory

Stream environments reflect, in part, the hydrologic integration of upstream landscapes. Characterizing upstream landscape features is critical for effectively understanding, managing, and conserving riverine ecosystems. However, watershed delineation is a major challenge if hund...

A subset of conserved mammalian long non-coding RNAs are fossils of ancestral protein-coding genes.

PubMed

Hezroni, Hadas; Ben-Tov Perry, Rotem; Meir, Zohar; Housman, Gali; Lubelsky, Yoav; Ulitsky, Igor

2017-08-30

Only a small portion of human long non-coding RNAs (lncRNAs) appear to be conserved outside of mammals, but the events underlying the birth of new lncRNAs in mammals remain largely unknown. One potential source is remnants of protein-coding genes that transitioned into lncRNAs. We systematically compare lncRNA and protein-coding loci across vertebrates, and estimate that up to 5% of conserved mammalian lncRNAs are derived from lost protein-coding genes. These lncRNAs have specific characteristics, such as broader expression domains, that set them apart from other lncRNAs. Fourteen lncRNAs have sequence similarity with the loci of the contemporary homologs of the lost protein-coding genes. We propose that selection acting on enhancer sequences is mostly responsible for retention of these regions. As an example of an RNA element from a protein-coding ancestor that was retained in the lncRNA, we describe in detail a short translated ORF in the JPX lncRNA that was derived from an upstream ORF in a protein-coding gene and retains some of its functionality. We estimate that ~ 55 annotated conserved human lncRNAs are derived from parts of ancestral protein-coding genes, and loss of coding potential is thus a non-negligible source of new lncRNAs. Some lncRNAs inherited regulatory elements influencing transcription and translation from their protein-coding ancestors and those elements can influence the expression breadth and functionality of these lncRNAs.

Structural organization of the porcine and human genes coding for a leydig cell-specific insulin-like peptide (LEY I-L) and chromosomal localization of the human gene (INSL3)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Burkhardt E.; Adham, I.M.; Brosig, B.

1994-03-01

Leydig insulin-like protein (LEY I-L) is a member of the insulin-like hormone superfamily. The LEY I-L gene (designated INSL3) is expressed exclusively in prenatal and postnatal Leydig cells. The authors report here the cloning and nucleotide sequence of porcine and human LEY I-L genes including the 5[prime] regions. Both genes consist of two exons and one intron. The organization of the LEY I-L gene is similar to that of insulin and relaxin. The transcription start site in the porcine and human LEY I-L gene is localized 13 and 14 bp upstream of the translation start site, respectively. Alignment of themore » 5[prime] flanking regions of both genes reveals that the first 107 nucleotides upstream of the transcription start site exhibit an overall sequence similarity of 80%. This conserved region contains a consensus TATAA box, a CAAT-like element (GAAT), and a consensus SP1 sequence (GGGCGG) at equivalent positions in both genes and therefore may play a role in regulation of expression of the LEY I-L gene. The porcine and human genome contains a single copy of the LEY I-L gene. By in situ hybridization, the human gene was assigned to bands p13.2-p12 of the short arm of chromosome 19. 25 refs., 6 figs.« less

Structural and functional analysis of an enhancer GPEI having a phorbol 12-O-tetradecanoate 13-acetate responsive element-like sequence found in the rat glutathione transferase P gene.

PubMed

Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M

1989-10-05

We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.

Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes.

PubMed

Majumder, P; Choudhury, A; Banerjee, M; Lahiri, A; Bhattacharyya, N P

2007-08-01

To investigate the mechanism of increased expression of caspase-1 caused by exogenous Hippi, observed earlier in HeLa and Neuro2A cells, in this work we identified a specific motif AAAGACATG (- 101 to - 93) at the caspase-1 gene upstream sequence where HIPPI could bind. Various mutations in this specific sequence compromised the interaction, showing the specificity of the interactions. In the luciferase reporter assay, when the reporter gene was driven by caspase-1 gene upstream sequences (- 151 to - 92) with the mutation G to T at position - 98, luciferase activity was decreased significantly in green fluorescent protein-Hippi-expressing HeLa cells in comparison to that obtained with the wild-type caspase-1 gene 60 bp upstream sequence, indicating the biological significance of such binding. It was observed that the C-terminal 'pseudo' death effector domain of HIPPI interacted with the 60 bp (- 151 to - 92) upstream sequence of the caspase-1 gene containing the motif. We further observed that expression of caspase-8 and caspase-10 was increased in green fluorescent protein-Hippi-expressing HeLa cells. In addition, HIPPI interacted in vitro with putative promoter sequences of these genes, containing a similar motif. In summary, we identified a novel function of HIPPI; it binds to specific upstream sequences of the caspase-1, caspase-8 and caspase-10 genes and alters the expression of the genes. This result showed the motif-specific interaction of HIPPI with DNA, and indicates that it could act as transcription regulator.

Molecular cloning and sequence analysis of the Anticarsia gemmatalis multicapsid nuclear polyhedrosis virus GP64 glycoprotein.

PubMed

Pilloff, Marcela Gabriela; Bilen, Marcos Fabián; Belaich, Mariano Nicolás; Lozano, Mario Enrique; Ghiringhelli, Pablo Daniel

2003-01-01

The gp64 locus of Anticarsia gemmatalis multicapsid nucleopolyhedrovirus isolate Santa Fe (AgMNPV-SF) was characterised molecularly in our laboratory. To this end, we have located and cloned a AgMNPV-SF genomic DNA fragment containing the gp64 gene and sequenced the complete gp64 locus. Nucleotide sequence analysis indicated that the AgMNPV gp64 gene consists of a 1500 nucleotide open reading frame (ORF), encoding a protein of 499 amino acids. Of the seven gp64 homologues identified to date, the AgMNPV gp64 ORF shared most sequence similarity with the gp64 gene of Orgyia pseudotsugata MNPV. The GP64 from AgMNPV is the smallest baculoviral envelope glycoprotein found to date, differing in 10 or more residues from the other group I nucleopolyhedroviruses. The biological activity of AgMNPV GP64 protein was assessed by cell fusion assays in UFL-AG-286 cells using the obtained recombinant plasmids. In the upstream and downstream regions, relative to the gp64 ORF, we found different conserved transcriptional and post-transcriptional regulatory elements, respectively.

A novel mammal-specific three partite enhancer element regulates node and notochord-specific Noto expression.

PubMed

Alten, Leonie; Schuster-Gossler, Karin; Eichenlaub, Michael P; Wittbrodt, Beate; Wittbrodt, Joachim; Gossler, Achim

2012-01-01

The vertebrate organizer and notochord have conserved, essential functions for embryonic development and patterning. The restricted expression of developmental regulators in these tissues is directed by specific cis-regulatory modules (CRMs) whose sequence conservation varies considerably. Some CRMs have been conserved throughout vertebrates and likely represent ancestral regulatory networks, while others have diverged beyond recognition but still function over a wide evolutionary range. Here we identify and characterize a mammalian-specific CRM required for node and notochord specific (NNC) expression of NOTO, a transcription factor essential for node morphogenesis, nodal cilia movement and establishment of laterality in mouse. A 523 bp enhancer region (NOCE) upstream the Noto promoter was necessary and sufficient for NNC expression from the endogenous Noto locus. Three subregions in NOCE together mediated full activity in vivo. Binding sites for known transcription factors in NOCE were functional in vitro but dispensable for NOCE activity in vivo. A FOXA2 site in combination with a novel motif was necessary for NOCE activity in vivo. Strikingly, syntenic regions in non-mammalian vertebrates showed no recognizable sequence similarities. In contrast to its activity in mouse NOCE did not drive NNC expression in transgenic fish. NOCE represents a novel, mammal-specific CRM required for the highly restricted Noto expression in the node and nascent notochord and thus regulates normal node development and function.

Transcriptional regulation of human eosinophil RNases by an evolutionary- conserved sequence motif in primate genome

PubMed Central

Wang, Hsiu-Yu; Chang, Hao-Teng; Pai, Tun-Wen; Wu, Chung-I; Lee, Yuan-Hung; Chang, Yen-Hsin; Tai, Hsiu-Ling; Tang, Chuan-Yi; Chou, Wei-Yao; Chang, Margaret Dah-Tsyr

2007-01-01

Background Human eosinophil-derived neurotoxin (edn) and eosinophil cationic protein (ecp) are members of a subfamily of primate ribonuclease (rnase) genes. Although they are generated by gene duplication event, distinct edn and ecp expression profile in various tissues have been reported. Results In this study, we obtained the upstream promoter sequences of several representative primate eosinophil rnases. Bioinformatic analysis revealed the presence of a shared 34-nucleotide (nt) sequence stretch located at -81 to -48 in all edn promoters and macaque ecp promoter. Such a unique sequence motif constituted a region essential for transactivation of human edn in hepatocellular carcinoma cells. Gel electrophoretic mobility shift assay, transient transfection and scanning mutagenesis experiments allowed us to identify binding sites for two transcription factors, Myc-associated zinc finger protein (MAZ) and SV-40 protein-1 (Sp1), within the 34-nt segment. Subsequent in vitro and in vivo binding assays demonstrated a direct molecular interaction between this 34-nt region and MAZ and Sp1. Interestingly, overexpression of MAZ and Sp1 respectively repressed and enhanced edn promoter activity. The regulatory transactivation motif was mapped to the evolutionarily conserved -74/-65 region of the edn promoter, which was guanidine-rich and critical for recognition by both transcription factors. Conclusion Our results provide the first direct evidence that MAZ and Sp1 play important roles on the transcriptional activation of the human edn promoter through specific binding to a 34-nt segment present in representative primate eosinophil rnase promoters. PMID:17927842

The Use of a Dexamethasone-inducible System to Synchronize Xa21 Expression to Study Rice Immunity.

PubMed

Caddell, Daniel F; Wei, Tong; Park, Chang-Jin; Ronald, Pamela C

2015-05-05

Inducible gene expression systems offer researchers the opportunity to synchronize target gene expression at particular developmental stages and in particular tissues. The glucocorticoid receptor (GR), a vertebrate steroid receptor, has been well adopted for this purpose in plants. To generate steroid-inducible plants, a construct of GAL4-binding domain-VP16 activation domain-GR fusion (GVG) with the target gene under the control of upstream activation sequence (UAS) has been developed and extensively used in plant research. Immune receptors perceive conserved molecular patterns secreted by pathogens and initiate robust immune responses. The rice immune receptor, XA21 , recognizes a molecular pattern highly conserved in all sequenced genomes of Xanthomonas , and confers robust resistance to X. oryzae pv. oryzae ( Xoo ). However, identifying genes downstream of XA21 has been hindered because of the restrained lesion and thus limited defense response region in the plants expressing Xa21 . Inducible expression allows for a synchronized immune response across a large amount of rice tissue, well suited for studying XA21-mediated immunity by genome-wide approaches such as transcriptomics and proteomics. In this protocol, we describe the use of this GVG system to synchronize Xa21 expression.

The Use of a Dexamethasone-inducible System to Synchronize Xa21 Expression to Study Rice Immunity

PubMed Central

Caddell, Daniel F.; Wei, Tong; Park, Chang-Jin; Ronald, Pamela C.

2016-01-01

Inducible gene expression systems offer researchers the opportunity to synchronize target gene expression at particular developmental stages and in particular tissues. The glucocorticoid receptor (GR), a vertebrate steroid receptor, has been well adopted for this purpose in plants. To generate steroid-inducible plants, a construct of GAL4-binding domain-VP16 activation domain-GR fusion (GVG) with the target gene under the control of upstream activation sequence (UAS) has been developed and extensively used in plant research. Immune receptors perceive conserved molecular patterns secreted by pathogens and initiate robust immune responses. The rice immune receptor, XA21, recognizes a molecular pattern highly conserved in all sequenced genomes of Xanthomonas, and confers robust resistance to X. oryzae pv. oryzae (Xoo). However, identifying genes downstream of XA21 has been hindered because of the restrained lesion and thus limited defense response region in the plants expressing Xa21. Inducible expression allows for a synchronized immune response across a large amount of rice tissue, well suited for studying XA21-mediated immunity by genome-wide approaches such as transcriptomics and proteomics. In this protocol, we describe the use of this GVG system to synchronize Xa21 expression. PMID:27525297

A mutation in an alternative untranslated exon of hexokinase 1 associated with hereditary motor and sensory neuropathy -- Russe (HMSNR).

PubMed

Hantke, Janina; Chandler, David; King, Rosalind; Wanders, Ronald J A; Angelicheva, Dora; Tournev, Ivailo; McNamara, Elyshia; Kwa, Marcel; Guergueltcheva, Velina; Kaneva, Radka; Baas, Frank; Kalaydjieva, Luba

2009-12-01

Hereditary Motor and Sensory Neuropathy -- Russe (HMSNR) is a severe autosomal recessive disorder, identified in the Gypsy population. Our previous studies mapped the gene to 10q22-q23 and refined the gene region to approximately 70 kb. Here we report the comprehensive sequencing analysis and fine mapping of this region, reducing it to approximately 26 kb of fully characterised sequence spanning the upstream exons of Hexokinase 1 (HK1). We identified two sequence variants in complete linkage disequilibrium, a G>C in a novel alternative untranslated exon (AltT2) and a G>A in the adjacent intron, segregating with the disease in affected families and present in the heterozygote state in only 5/790 population controls. Sequence conservation of the AltT2 exon in 16 species with invariable preservation of the G allele at the mutated site, strongly favour the exonic change as the pathogenic mutation. Analysis of the Hk1 upstream region in mouse mRNA from testis and neural tissues showed an abundance of AltT2-containing transcripts generated by extensive, developmentally regulated alternative splicing. Expression is very low compared with ubiquitous Hk1 and all transcripts skip exon1, which encodes the protein domain responsible for binding to the outer mitochondrial membrane, and regulation of energy production and apoptosis. Hexokinase activity measurement and immunohistochemistry of the peripheral nerve showed no difference between patients and controls. The mutational mechanism and functional effects remain unknown and could involve disrupted translational regulation leading to increased anti-apoptotic activity (suggested by the profuse regenerative activity in affected nerves), or impairment of an unknown HK1 function in the peripheral nervous system (PNS).

A mutation in an alternative untranslated exon of hexokinase 1 associated with Hereditary Motor and Sensory Neuropathy – Russe (HMSNR)

PubMed Central

Hantke, Janina; Chandler, David; King, Rosalind; Wanders, Ronald JA; Angelicheva, Dora; Tournev, Ivailo; McNamara, Elyshia; Kwa, Marcel; Guergueltcheva, Velina; Kaneva, Radka; Baas, Frank; Kalaydjieva, Luba

2009-01-01

Hereditary Motor and Sensory Neuropathy – Russe (HMSNR) is a severe autosomal recessive disorder, identified in the Gypsy population. Our previous studies mapped the gene to 10q22-q23 and refined the gene region to ∼70 kb. Here we report the comprehensive sequencing analysis and fine mapping of this region, reducing it to ∼26 kb of fully characterised sequence spanning the upstream exons of Hexokinase 1 (HK1). We identified two sequence variants in complete linkage disequilibrium, a G>C in a novel alternative untranslated exon (AltT2) and a G>A in the adjacent intron, segregating with the disease in affected families and present in the heterozygote state in only 5/790 population controls. Sequence conservation of the AltT2 exon in 16 species with invariable preservation of the G allele at the mutated site, strongly favour the exonic change as the pathogenic mutation. Analysis of the Hk1 upstream region in mouse mRNA from testis and neural tissues showed an abundance of AltT2-containing transcripts generated by extensive, developmentally regulated alternative splicing. Expression is very low compared with ubiquitous Hk1 and all transcripts skip exon1, which encodes the protein domain responsible for binding to the outer mitochondrial membrane, and regulation of energy production and apoptosis. Hexokinase activity measurement and immunohistochemistry of the peripheral nerve showed no difference between patients and controls. The mutational mechanism and functional effects remain unknown and could involve disrupted translational regulation leading to increased anti-apoptotic activity (suggested by the profuse regenerative activity in affected nerves), or impairment of an unknown HK1 function in the peripheral nervous system (PNS). PMID:19536174

Regulatory interactions between the human HOXB1, HOXB2, and HOXB3 proteins and the upstream sequence of the Otx2 gene in embryonal carcinoma cells.

PubMed

Guazzi, S; Pintonello, M L; Viganò, A; Boncinelli, E

1998-05-01

Vertebrate Hox and Otx genes encode homeodomain-containing transcription factors thought to transduce positional information along the body axis in the segmental portion of the trunk and in the rostral brain, respectively. Moreover, Hox and Otx2 genes show a complementary spatial regulation during embryogenesis. In this report, we show that a 1821-base pair (bp) upstream DNA fragment of the Otx2 gene is positively regulated by co-transfection with expression vectors for the human HOXB1, HOXB2, and HOXB3 proteins in an embryonal carcinoma cell line (NT2/D1) and that a shorter fragment of only 534 bp is able to drive this regulation. We also identified the HOXB1, HOXB2, and HOXB3 DNA-binding region on the 534-bp Otx2 genomic fragment using nuclear extracts from Hox-transfected COS cells and 12.5 days postcoitum mouse embryos or HOXB3 homeodomain-containing bacterial extracts. HOXB1, HOXB3, and nuclear extracts from 12.5 days postcoitum mouse embryos bind to a sequence containing two palindromic TAATTA sites, which bear four copies of the ATTA core sequence, a common feature of most HOM-C/HOX binding sites. HOXB2 protected an adjacent site containing a direct repeat of an ACTT sequence, quite divergent from the ATTA consensus. The region bound by the three homeoproteins is strikingly conserved through evolution and necessary (at least for HOXB1 and HOXB3) to mediate the up-regulation of the Otx2 transcription. Taken together, our data support the hypothesis that anteriorly expressed Hox genes might play a role in the refinement of the Otx2 early expression boundaries in vivo.

Characterization of Rous sarcoma virus polyadenylation site use in vitro

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maciolek, Nicole L.; McNally, Mark T.

2008-05-10

Polyadenylation of Rous sarcoma virus (RSV) RNA is inefficient, as approximately 15% of RSV RNAs represent read-through transcripts that use a downstream cellular polyadenylation site (poly(A) site). Read-through transcription has implications for the virus and the host since it is associated with oncogene capture and tumor induction. To explore the basis of inefficient RSV RNA 3'-end formation, we characterized RSV polyadenylation in vitro using HeLa cell nuclear extracts and HEK293 whole cell extracts. RSV polyadenylation substrates composed of the natural 3' end of viral RNA and various lengths of upstream sequence showed little or no polyadenylation, indicating that the RSVmore » poly(A) site is suboptimal. Efficiently used poly(A) sites often have identifiable upstream and downstream elements (USEs and DSEs) in close proximity to the conserved AAUAAA signal. The sequences upstream and downstream of the RSV poly(A) site deviate from those found in efficiently used poly(A) sites, which may explain inefficient RSV polyadenylation. To assess the quality of the RSV USEs and DSEs, the well-characterized SV40 late USEs and/or DSEs were substituted for the RSV elements and vice versa, which showed that the USEs and DSEs from RSV are suboptimal but functional. CstF interacted poorly with the RSV polyadenylation substrate, and the inactivity of the RSV poly(A) site was at least in part due to poor CstF binding since tethering CstF to the RSV substrate activated polyadenylation. Our data are consistent with poor polyadenylation factor binding sites in both the USE and DSE as the basis for inefficient use of the RSV poly(A) site and point to the importance of additional elements within RSV RNA in promoting 3' end formation.« less

Negative and Translation Termination-Dependent Positive Control of FLI-1 Protein Synthesis by Conserved Overlapping 5′ Upstream Open Reading Frames in Fli-1 mRNA

PubMed Central

Sarrazin, Sandrine; Starck, Joëlle; Gonnet, Colette; Doubeikovski, Alexandre; Melet, Fabrice; Morle, François

2000-01-01

The proto-oncogene Fli-1 encodes a transcription factor of the ets family whose overexpression is associated with multiple virally induced leukemias in mouse, inhibits murine and avian erythroid cell differentiation, and induces drastic perturbations of early development in Xenopus. This study demonstrates the surprisingly sophisticated regulation of Fli-1 mRNA translation. We establish that two FLI-1 protein isoforms (of 51 and 48 kDa) detected by Western blotting in vivo are synthesized by alternative translation initiation through the use of two highly conserved in-frame initiation codons, AUG +1 and AUG +100. Furthermore, we show that the synthesis of these two FLI-1 isoforms is regulated by two short overlapping 5′ upstream open reading frames (uORF) beginning at two highly conserved upstream initiation codons, AUG −41 and GUG −37, and terminating at two highly conserved stop codons, UGA +35 and UAA +15. The mutational analysis of these two 5′ uORF revealed that each of them negatively regulates FLI-1 protein synthesis by precluding cap-dependent scanning to the 48- and 51-kDa AUG codons. Simultaneously, the translation termination of the two 5′ uORF appears to enhance 48-kDa protein synthesis, by allowing downstream reinitiation at the 48-kDa AUG codon, and 51-kDa protein synthesis, by allowing scanning ribosomes to pile up and consequently allowing upstream initiation at the 51-kDa AUG codon. To our knowledge, this is the first example of a cellular mRNA displaying overlapping 5′ uORF whose translation termination appears to be involved in the positive control of translation initiation at both downstream and upstream initiation codons. PMID:10757781

The nucleotide sequence of the putative transcription initiation site of a cloned ribosomal RNA gene of the mouse.

PubMed Central

Urano, Y; Kominami, R; Mishima, Y; Muramatsu, M

1980-01-01

Approximately one kilobase pairs surrounding and upstream the transcription initiation site of a cloned ribosomal DNA (rDNA) of the mouse were sequenced. The putative transcription initiation site was determined by two independent methods: one nuclease S1 protection and the other reverse transcriptase elongation mapping using isolated 45S ribosomal RNA precursor (45S RNA) and appropriate restriction fragments of rDNA. Both methods gave an identical result; 45S RNA had a structure starting from ACTCTTAG---. Characteristically, mouse rDNA had many T clusters (greater than or equal to 5) upstream the initiation site, the longest being 21 consecutive T's. A pentadecanucleotide, TGCCTCCCGAGTGCA, appeared twice within 260 nucleotides upstream the putative initiation site. No such characteristic sequences were found downstream this site. Little similarity was found in the upstream of the transcription initiation site between the mouse, Xenopus laevis and Saccharomyces cerevisiae rDNA. Images PMID:6162156

Towards national mapping of aquatic condition (I): The Stream-Catchment (StreamCat) Dataset

EPA Science Inventory

Stream environments reflect, in part, the hydrologic integration of upstream landscapes. Characterizing upstream features is critical for effectively understanding, managing, and conserving riverine ecosystems. However, watershed delineation is a major challenge if hundreds to th...

Transcripts of the NADH-dehydrogenase subunit 3 gene are differentially edited in Oenothera mitochondria.

PubMed Central

Schuster, W; Wissinger, B; Unseld, M; Brennicke, A

1990-01-01

A number of cytosines are altered to be recognized as uridines in transcripts of the nad3 locus in mitochondria of the higher plant Oenothera. Such nucleotide modifications can be found at 16 different sites within the nad3 coding region. Most of these alterations in the mRNA sequence change codon identities to specify amino acids better conserved in evolution. Individual cDNA clones differ in their degree of editing at five nucleotide positions, three of which are silent, while two lead to codon alterations specifying different amino acids. None of the cDNA clones analysed is maximally edited at all possible sites, suggesting slow processing or lowered stringency of editing at these nucleotides. Differentially edited transcripts could be editing intermediates or could code for differing polypeptides. Two edited nucleotides in an open reading frame located upstream of nad3 change two amino acids in the deduced polypeptide. Part of the well-conserved ribosomal protein gene rps12 also encoded downstream of nad3 in other plants, is lost in Oenothera mitochondria by recombination events. The functional rps12 protein must be imported from the cytoplasm since the deleted sequences of this gene are not found in the Oenothera mitochondrial genome. The pseudogene sequence is not edited at any nucleotide position. Images Fig. 3. Fig. 4. Fig. 7. PMID:1688531

Myotonin protein-kinase [AGC]n trinucleotide repeat in seven nonhuman primates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Novelli, G.; Sineo, L.; Pontieri, E.

Myotonic dystrophy (DM) is due to a genomic instability of a trinucleotide [AGC]n motif, located at the 3{prime} UTR region of a protein-kinase gene (myotonin protein kinase, MT-PK). The [AGC] repeat is meiotically and mitotically unstable, and it is directly related to the manifestations of the disorder. Although a gene dosage effect of the MT-PK has been demonstrated n DM muscle, the mechanism(s) by which the intragenic repeat expansion leads to disease is largely unknown. This non-standard mutational event could reflect an evolutionary mechanism widespread among animal genomes. We have isolated and sequenced the complete 3{prime}UTR region of the MT-PKmore » gene in seven primates (macaque, orangutan, gorilla, chimpanzee, gibbon, owl monkey, saimiri), and examined by comparative sequence nucleotide analysis the [AGC]n intragenic repeat and the surrounding nucleotides. The genomic organization, including the [AGC]n repeat structure, was conserved in all examined species, excluding the gibbon (Hylobates agilis), in which the [AGC]n upstream sequence (GGAA) is replaced by a GA dinucleotide. The number of [AGC]n in the examined species ranged between 7 (gorilla) and 13 repeats (owl monkeys), with a polymorphism informative content (PIC) similar to that observed in humans. These results indicate that the 3{prime}UTR [AGC] repeat within the MT-PK gene is evolutionarily conserved, supporting that this region has important regulatory functions.« less

Disease-Causing 7.4 kb Cis-Regulatory Deletion Disrupting Conserved Non-Coding Sequences and Their Interaction with the FOXL2 Promotor: Implications for Mutation Screening

PubMed Central

Dostie, Josée; Lemire, Edmond; Bouchard, Philippe; Field, Michael; Jones, Kristie; Lorenz, Birgit; Menten, Björn; Buysse, Karen; Pattyn, Filip; Friedli, Marc; Ucla, Catherine; Rossier, Colette; Wyss, Carine; Speleman, Frank; De Paepe, Anne; Dekker, Job; Antonarakis, Stylianos E.; De Baere, Elfride

2009-01-01

To date, the contribution of disrupted potentially cis-regulatory conserved non-coding sequences (CNCs) to human disease is most likely underestimated, as no systematic screens for putative deleterious variations in CNCs have been conducted. As a model for monogenic disease we studied the involvement of genetic changes of CNCs in the cis-regulatory domain of FOXL2 in blepharophimosis syndrome (BPES). Fifty-seven molecularly unsolved BPES patients underwent high-resolution copy number screening and targeted sequencing of CNCs. Apart from three larger distant deletions, a de novo deletion as small as 7.4 kb was found at 283 kb 5′ to FOXL2. The deletion appeared to be triggered by an H-DNA-induced double-stranded break (DSB). In addition, it disrupts a novel long non-coding RNA (ncRNA) PISRT1 and 8 CNCs. The regulatory potential of the deleted CNCs was substantiated by in vitro luciferase assays. Interestingly, Chromosome Conformation Capture (3C) of a 625 kb region surrounding FOXL2 in expressing cellular systems revealed physical interactions of three upstream fragments and the FOXL2 core promoter. Importantly, one of these contains the 7.4 kb deleted fragment. Overall, this study revealed the smallest distant deletion causing monogenic disease and impacts upon the concept of mutation screening in human disease and developmental disorders in particular. PMID:19543368

Investigation of DNA sequence recognition by a streptomycete MarR family transcriptional regulator through surface plasmon resonance and X-ray crystallography

PubMed Central

Stevenson, Clare E. M.; Assaad, Aoun; Chandra, Govind; Le, Tung B. K.; Greive, Sandra J.; Bibb, Mervyn J.; Lawson, David M.

2013-01-01

Consistent with their complex lifestyles and rich secondary metabolite profiles, the genomes of streptomycetes encode a plethora of transcription factors, the vast majority of which are uncharacterized. Herein, we use Surface Plasmon Resonance (SPR) to identify and delineate putative operator sites for SCO3205, a MarR family transcriptional regulator from Streptomyces coelicolor that is well represented in sequenced actinomycete genomes. In particular, we use a novel SPR footprinting approach that exploits indirect ligand capture to vastly extend the lifetime of a standard streptavidin SPR chip. We define two operator sites upstream of sco3205 and a pseudopalindromic consensus sequence derived from these enables further potential operator sites to be identified in the S. coelicolor genome. We evaluate each of these through SPR and test the importance of the conserved bases within the consensus sequence. Informed by these results, we determine the crystal structure of a SCO3205-DNA complex at 2.8 Å resolution, enabling molecular level rationalization of the SPR data. Taken together, our observations support a DNA recognition mechanism involving both direct and indirect sequence readout. PMID:23748564

Identification and positional distribution analysis of transcription factor binding sites for genes from the wheat fl-cDNA sequences.

PubMed

Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui

2017-06-01

The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.

Promoter activity of polypyrimidine tract-binding protein genes of potato responds to environmental cues.

PubMed

Butler, Nathaniel M; Hannapel, David J

2012-12-01

Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.

Impacts of climate and land use change on reservoir sedimentation

USDA-ARS?s Scientific Manuscript database

Impacts of evolving climate and implementation of upstream soil conservation measures on sedimentation of the Fort Cobb Reservoir in West-Central Oklahoma are investigated. Conservation practices before the 1950s were few. Between 1950 and 2008, extensive soil conservation measures were implemented...

Engineering an efficient and tight D-amino acid-inducible gene expression system in Rhodosporidium/Rhodotorula species.

PubMed

Liu, Yanbin; Koh, Chong Mei John; Ngoh, Si Te; Ji, Lianghui

2015-10-26

Rhodosporidium and Rhodotorula are two genera of oleaginous red yeast with great potential for industrial biotechnology. To date, there is no effective method for inducible expression of proteins and RNAs in these hosts. We have developed a luciferase gene reporter assay based on a new codon-optimized LUC2 reporter gene (RtLUC2), which is flanked with CAR2 homology arms and can be integrated into the CAR2 locus in the nuclear genome at >90 % efficiency. We characterized the upstream DNA sequence of a D-amino acid oxidase gene (DAO1) from R. toruloides ATCC 10657 by nested deletions. By comparing the upstream DNA sequences of several putative DAO1 homologs of Basidiomycetous fungi, we identified a conserved DNA motif with a consensus sequence of AGGXXGXAGX11GAXGAXGG within a 0.2 kb region from the mRNA translation initiation site. Deletion of this motif led to strong mRNA transcription under non-inducing conditions. Interestingly, DAO1 promoter activity was enhanced about fivefold when the 108 bp intron 1 was included in the reporter construct. We identified a conserved CT-rich motif in the intron with a consensus sequence of TYTCCCYCTCCYCCCCACWYCCGA, deletion or point mutations of which drastically reduced promoter strength under both inducing and non-inducing conditions. Additionally, we created a selection marker-free DAO1-null mutant (∆dao1e) which displayed greatly improved inducible gene expression, particularly when both glucose and nitrogen were present in high levels. To avoid adding unwanted peptide to proteins to be expressed, we converted the original translation initiation codon to ATC and re-created a translation initiation codon at the start of exon 2. This promoter, named P DAO1-in1m1 , showed very similar luciferase activity to the wild-type promoter upon induction with D-alanine. The inducible system was tunable by adjusting the levels of inducers, carbon source and nitrogen source. The intron 1-containing DAO1 promoters coupled with a DAO1 null mutant makes an efficient and tight D-amino acid-inducible gene expression system in Rhodosporidium and Rhodotorula genera. The system will be a valuable tool for metabolic engineering and enzyme expression in these yeast hosts.

Functional analysis of the upstream regulatory region of chicken miR-17-92 cluster.

PubMed

Cheng, Min; Zhang, Wen-jian; Xing, Tian-yu; Yan, Xiao-hong; Li, Yu-mao; Li, Hui; Wang, Ning

2016-08-01

miR-17-92 cluster plays important roles in cell proliferation, differentiation, apoptosis, animal development and tumorigenesis. The transcriptional regulation of miR-17-92 cluster has been extensively studied in mammals, but not in birds. To date, avian miR-17-92 cluster genomic structure has not been fully determined. The promoter location and sequence of miR-17-92 cluster have not been determined, due to the existence of a genomic gap sequence upstream of miR-17-92 cluster in all the birds whose genomes have been sequenced. In this study, genome walking was used to close the genomic gap upstream of chicken miR-17-92 cluster. In addition, bioinformatics analysis, reporter gene assay and truncation mutagenesis were used to investigate functional role of the genomic gap sequence. Genome walking analysis showed that the gap region was 1704 bp long, and its GC content was 80.11%. Bioinformatics analysis showed that in the gap region, there was a 200 bp conserved sequence among the tested 10 species (Gallus gallus, Homo sapiens, Pan troglodytes, Bos taurus, Sus scrofa, Rattus norvegicus, Mus musculus, Possum, Danio rerio, Rana nigromaculata), which is core promoter region of mammalian miR-17-92 host gene (MIR17HG). Promoter luciferase reporter gene vector of the gap region was constructed and reporter assay was performed. The result showed that the promoter activity of pGL3-cMIR17HG (-4228/-2506) was 417 times than that of negative control (empty pGL3 basic vector), suggesting that chicken miR-17-92 cluster promoter exists in the gap region. To further gain insight into the promoter structure, two different truncations for the cloned gap sequence were generated by PCR. One had a truncation of 448 bp at the 5'-end and the other had a truncation of 894 bp at the 3'-end. Further reporter analysis showed that compared with the promoter activity of pGL3-cMIR17HG (-4228/-2506), the reporter activities of the 5'-end truncation and the 3'-end truncation were reduced by 19.82% and 60.14%, respectively. These data demonstrated that the important promoter region of chicken miR-17-92 cluster is located in the -3400/-2506 bp region. Our results lay the foundation for revealing the transcriptional regulatory mechanisms of chicken miR-17-92 cluster.

Complete nucleotide sequence and organization of the mitogenome of the silk moth Caligula boisduvalii (Lepidoptera: Saturniidae) and comparison with other lepidopteran insects.

PubMed

Hong, Mee Yeon; Lee, Eun Mee; Jo, Yong Hun; Park, Hae Chul; Kim, Seong Ryul; Hwang, Jae Sam; Jin, Byung Rae; Kang, Pil Don; Kim, Ki-Gyoung; Han, Yeon Soo; Kim, Iksoo

2008-04-30

The 15,360-bp long complete mitogenome of Caligula boisduvalii possesses a gene arrangement and content identical to other completely sequenced lepidopteran mitogenomes, but different from the common arrangement found in most insect order, as the result of the movement of tRNA(Met) to a position 5'-upstream of tRNA Ile. The 330-bp A+T-rich region is apparently capable of forming a stem-and-loop structure, which harbors the conserved flanking sequences at both ends. Dissimilar to what has been seen in other sequenced lepidopteran insects, the initiation codon for C. boisduvalii COI appears to be TTG, which is a rare, but apparently possible initiation codon. The ATP8, ATP6, ND4L, and ND6 genes, which neighbor another PCG at their 3' end, all harbored potential sequences for the formation of a hairpin structure. This is suggestive of the importance of such structures for the precise cleavage of the mRNA of mature PCGs. Phylogenetic analyses of available sequenced species of Bombycoidea, Pyraloidea, and Tortricidea supported the morphology-based current hypothesis that Bombycoidea and Pyraloidea are monophyletic (Obtectomera). As previously suggested, Bombycidae (Bombyx mori and B. mandarina) and Saturniidae (Antheraea pernyi and C. boisduvalii) formed a reciprocal monophyletic group.

Deciphering the molecular and functional basis of Dbl family proteins: a novel systematic approach toward classification of selective activation of the Rho family proteins.

PubMed

Jaiswal, Mamta; Dvorsky, Radovan; Ahmadian, Mohammad Reza

2013-02-08

The diffuse B-cell lymphoma (Dbl) family of the guanine nucleotide exchange factors is a direct activator of the Rho family proteins. The Rho family proteins are involved in almost every cellular process that ranges from fundamental (e.g. the establishment of cell polarity) to highly specialized processes (e.g. the contraction of vascular smooth muscle cells). Abnormal activation of the Rho proteins is known to play a crucial role in cancer, infectious and cognitive disorders, and cardiovascular diseases. However, the existence of 74 Dbl proteins and 25 Rho-related proteins in humans, which are largely uncharacterized, has led to increasing complexity in identifying specific upstream pathways. Thus, we comprehensively investigated sequence-structure-function-property relationships of 21 representatives of the Dbl protein family regarding their specificities and activities toward 12 Rho family proteins. The meta-analysis approach provides an unprecedented opportunity to broadly profile functional properties of Dbl family proteins, including catalytic efficiency, substrate selectivity, and signaling specificity. Our analysis has provided novel insights into the following: (i) understanding of the relative differences of various Rho protein members in nucleotide exchange; (ii) comparing and defining individual and overall guanine nucleotide exchange factor activities of a large representative set of the Dbl proteins toward 12 Rho proteins; (iii) grouping the Dbl family into functionally distinct categories based on both their catalytic efficiencies and their sequence-structural relationships; (iv) identifying conserved amino acids as fingerprints of the Dbl and Rho protein interaction; and (v) defining amino acid sequences conserved within, but not between, Dbl subfamilies. Therefore, the characteristics of such specificity-determining residues identified the regions or clusters conserved within the Dbl subfamilies.

Systematic analysis and evolution of 5S ribosomal DNA in metazoans.

PubMed

Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

2013-11-01

Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.

Systematic analysis and evolution of 5S ribosomal DNA in metazoans

PubMed Central

Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

2013-01-01

Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12 766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades. PMID:23838690

Conserved small mRNA with an unique, extended Shine-Dalgarno sequence

PubMed Central

Hahn, Julia; Migur, Anzhela; von Boeselager, Raphael Freiherr; Kubatova, Nina; Kubareva, Elena; Schwalbe, Harald

2017-01-01

ABSTRACT Up to now, very small protein-coding genes have remained unrecognized in sequenced genomes. We identified an mRNA of 165 nucleotides (nt), which is conserved in Bradyrhizobiaceae and encodes a polypeptide with 14 amino acid residues (aa). The small mRNA harboring a unique Shine-Dalgarno sequence (SD) with a length of 17 nt was localized predominantly in the ribosome-containing P100 fraction of Bradyrhizobium japonicum USDA 110. Strong interaction between the mRNA and 30S ribosomal subunits was demonstrated by their co-sedimentation in sucrose density gradient. Using translational fusions with egfp, we detected weak translation and found that it is impeded by both the extended SD and the GTG start codon (instead of ATG). Biophysical characterization (CD- and NMR-spectroscopy) showed that synthesized polypeptide remained unstructured in physiological puffer. Replacement of the start codon by a stop codon increased the stability of the transcript, strongly suggesting additional posttranscriptional regulation at the ribosome. Therefore, the small gene was named rreB (ribosome-regulated expression in Bradyrhizobiaceae). Assuming that the unique ribosome binding site (RBS) is a hallmark of rreB homologs or similarly regulated genes, we looked for similar putative RBS in bacterial genomes and detected regions with at least 16 nt complementarity to the 3′-end of 16S rRNA upstream of sORFs in Caulobacterales, Rhizobiales, Rhodobacterales and Rhodospirillales. In the Rhodobacter/Roseobacter lineage of α-proteobacteria the corresponding gene (rreR) is conserved and encodes an 18 aa protein. This shows how specific RBS features can be used to identify new genes with presumably similar control of expression at the RNA level. PMID:27834614

Amino acid similarities and divergences in the small surface proteins of genotype C hepatitis B viruses between nucleos(t)ide analogue-naïve and lamivudine-treated patients with chronic hepatitis B.

PubMed

Ding, Hai; Liu, Baoming; Zhao, Chengyu; Yang, Jingxian; Yan, Chunhui; Yan, Ling; Zhuang, Hui; Li, Tong

2014-02-01

Entire C-genotype small hepatitis B surface (SHBs) sequences were isolated from 139 nucleos(t)ide analogues (NA)-naïve and 74 lamivudine (LMV)-treated chronic hepatitis B (CHB) patients. The conservation and variability of total 226 amino acids (AAs) within the sequences were determined individually, revealing significant higher mutant isolate rate and mutation frequency in LMV-treated cohort than those in the NA-naïve one (P=0.009 and 0.0001, respectively). Three absolutely conserved fragments (s16-s19, s176-s181 and s185-s188) and seven moderately conserved regions (a few AA sites acquiring increased variability after LMV-treatment) were identified. The significant mutation rate increase after LMV-treatment occurred primarily in major hydrophilic region (except 'a' determinant) and transmembrane domain 3/4, but not in other upstream functional regions of SHBs. With little influence on immune escape-associated mutation frequencies within 'a' determinant, LMV-monotherapy significantly induced classical LMVr-associated mirror changes sE164D/rtV173L, sI195M/rtM204V and sW196L/S/rtM204I, as well as non-classical ones sG44E/rtS53N, sT47K/A/rtH55R/Q and sW182stop/rtV191I outside 'a' determinant. Interestingly, another newly-identified truncation mutation sC69stop/rtS78T decreased from 7.91% (11/139) in NA-naïve cohort to 2.70% (2/74) in LMV-treated one. Altogether, the altered AA conservation and diversity in SHBs sequences after LMV-treatment in genotype-C HBV infection might shed new insights into how LMV-therapy affects the SHBs variant evolution and its antigenicity. Copyright © 2013 Elsevier B.V. All rights reserved.

The yeast DNA ligase gene CDC9 is controlled by six orientation specific upstream activating sequences that respond to cellular proliferation but which alone cannot mediate cell cycle regulation.

PubMed Central

White, J H; Johnson, A L; Lowndes, N F; Johnston, L H

1991-01-01

By fusing the CDC9 structural gene to the PGK upstream sequences and the CDC9 upstream to lacZ, we showed that the cell cycle expression of CDC9 is largely due to transcriptional regulation. To investigate the role of six ATGATT upstream repeats in CDC9 regulation, synthetic copies of the sequence were attached to a heterologous gene. The repeats stimulated transcription strongly and additively, but, unlike conventional yeast UAS elements, only when present in one orientation. Transcription driven by the repeats declines in cells held at START of the cell cycle or in stationary phase, as occurs with CDC9. However, the repeats by themselves cannot impart cell cycle regulation to a heterologous gene. CDC9 may therefore be controlled by an activating system operating through the repeats that is sensitive to cellular proliferation and a separate mechanism that governs the periodic expression in the cell cycle. Images PMID:1901644

Small Deletion Variants Have Stable Breakpoints Commonly Associated with Alu Elements

PubMed Central

Coin, Lachlan J. M.; Steinfeld, Israel; Yakhini, Zohar; Sladek, Rob; Froguel, Philippe; Blakemore, Alexandra I. F.

2008-01-01

Copy number variants (CNVs) contribute significantly to human genomic variation, with over 5000 loci reported, covering more than 18% of the euchromatic human genome. Little is known, however, about the origin and stability of variants of different size and complexity. We investigated the breakpoints of 20 small, common deletions, representing a subset of those originally identified by array CGH, using Agilent microarrays, in 50 healthy French Caucasian subjects. By sequencing PCR products amplified using primers designed to span the deleted regions, we determined the exact size and genomic position of the deletions in all affected samples. For each deletion studied, all individuals carrying the deletion share identical upstream and downstream breakpoints at the sequence level, suggesting that the deletion event occurred just once and later became common in the population. This is supported by linkage disequilibrium (LD) analysis, which has revealed that most of the deletions studied are in moderate to strong LD with surrounding SNPs, and have conserved long-range haplotypes. Analysis of the sequences flanking the deletion breakpoints revealed an enrichment of microhomology at the breakpoint junctions. More significantly, we found an enrichment of Alu repeat elements, the overwhelming majority of which intersected deletion breakpoints at their poly-A tails. We found no enrichment of LINE elements or segmental duplications, in contrast to other reports. Sequence analysis revealed enrichment of a conserved motif in the sequences surrounding the deletion breakpoints, although whether this motif has any mechanistic role in the formation of some deletions has yet to be determined. Considered together with existing information on more complex inherited variant regions, and reports of de novo variants associated with autism, these data support the presence of different subgroups of CNV in the genome which may have originated through different mechanisms. PMID:18769679

Simian virus 40 major late promoter: an upstream DNA sequence required for efficient in vitro transcription.

PubMed Central

Brady, J; Radonovich, M; Thoren, M; Das, G; Salzman, N P

1984-01-01

We have previously identified an 11-base DNA sequence, 5'-G-G-T-A-C-C-T-A-A-C-C-3' (simian virus 40 [SV40] map position 294 to 304), which is important in the control of SV40 late RNA expression in vitro and in vivo (Brady et al., Cell 31:625-633, 1982). We report here the identification of another domain of the SV40 late promoter. A series of mutants with deletions extending from SV40 map position 0 to 300 was prepared by nuclease BAL 31 treatment. The cloned templates were then analyzed for efficiency and accuracy of late SV40 RNA expression in the Manley in vitro transcription system. Our studies showed that, in addition to the promoter domain near map position 300, there are essential DNA sequences between nucleotide positions 74 and 95 that are required for efficient expression of late SV40 RNA. Included in this SV40 DNA sequence were two of the six GGGCGG SV40 repeat sequences and an 11-nucleotide segment which showed strong homology with the upstream sequences required for the efficient in vitro and in vivo expression of the histone H2A gene. This upstream promoter sequence supported transcription with the same efficiency even when it was moved 72 nucleotides closer to the major late cap site. In vitro promoter competition analysis demonstrated that the upstream promoter sequence, independent of the 294 to 304 promoter element, is capable of binding polymerase-transcription factors required for SV40 late gene transcription. Finally, we show that DNA sequences which control the specificity of RNA initiation at nucleotide 325 lie downstream of map position 294. Images PMID:6321950

Analysis of Microbe-Associated Molecular Pattern-Responsive Synthetic Promoters with the Parsley Protoplast System.

PubMed

Kanofsky, Konstantin; Lehmeyer, Mona; Schulze, Jutta; Hehl, Reinhard

2016-01-01

Plants recognize pathogens by microbe-associated molecular patterns (MAMPs) and subsequently induce an immune response. The regulation of gene expression during the immune response depends largely on cis-sequences conserved in promoters of MAMP-responsive genes. These cis-sequences can be analyzed by constructing synthetic promoters linked to a reporter gene and by testing these constructs in transient expression systems. Here, the use of the parsley (Petroselinum crispum) protoplast system for analyzing MAMP-responsive synthetic promoters is described. The synthetic promoter consists of four copies of a potential MAMP-responsive cis-sequence cloned upstream of a minimal promoter and the uidA reporter gene. The reporter plasmid contains a second reporter gene, which is constitutively expressed and hence eliminates the requirement of a second plasmid used as a transformation control. The reporter plasmid is transformed into parsley protoplasts that are elicited by the MAMP Pep25. The MAMP responsiveness is validated by comparing the reporter gene activity from MAMP-treated and untreated cells and by normalizing reporter gene activity using the constitutively expressed reporter gene.

Cloning and functional characterization of the Xenopus orthologue of the Treacher Collins syndrome (TCOF1) gene product.

PubMed

Gonzales, Bianca; Yang, Hushan; Henning, Dale; Valdez, Benigno C

2005-10-10

Treacher Collins syndrome (TCS) is an autosomal dominant disorder of craniofacial development caused by mutations in the TCOF1 gene, which encodes the nucleolar phosphoprotein treacle. We previously reported a function for mammalian treacle in ribosomal DNA gene transcription by its interaction with upstream binding factor. As an initial step in the development of a TCS model for frog the cDNA that encodes the Xenopus laevis treacle was cloned. Although the derived amino acid sequence shows a poor homology with its mammalian orthologues, Xenopus treacle has 11 highly homologous direct repeats near the center of the protein molecule similar to those present in its human, dog and mouse orthologues. Comparison of their amino acid compositions indicates conservation of predominant specific amino acid residues. Antisense-mediated down-regulation of treacle expression in X. laevis oocytes resulted in inhibition of rDNA gene transcription. The results suggest evolutionary conservation of the function of treacle in ribosomal RNA biogenesis in higher eukaryotes.

Quantitative simulation tools to analyze up- and downstream interactions of soil and water conservation measures: supporting policy making in the Green Water Credits program of Kenya.

PubMed

Hunink, J E; Droogers, P; Kauffman, S; Mwaniki, B M; Bouma, J

2012-11-30

Upstream soil and water conservation measures in catchments can have positive impact both upstream in terms of less erosion and higher crop yields, but also downstream by less sediment flow into reservoirs and increased groundwater recharge. Green Water Credits (GWC) schemes are being developed to encourage upstream farmers to invest in soil and water conservation practices which will positively effect upstream and downstream water availability. Quantitative information on water and sediment fluxes is crucial as a basis for such financial schemes. A pilot design project in the large and strategically important Upper-Tana Basin in Kenya has the objective to develop a methodological framework for this purpose. The essence of the methodology is the integration and use of a collection of public domain tools and datasets: the so-called Green water and Blue water Assessment Toolkit (GBAT). This toolkit was applied in order to study different options to implement GWC in agricultural rainfed land for the pilot study. Impact of vegetative contour strips, mulching, and tied ridges were determined for: (i) three upstream key indicators: soil loss, crop transpiration and soil evaporation, and (ii) two downstream indicators: sediment inflow in reservoirs and groundwater recharge. All effects were compared with a baseline scenario of average conditions. Thus, not only actual land management was considered but also potential benefits of changed land use practices. Results of the simulations indicate that especially applying contour strips or tied ridges significantly reduces soil losses and increases groundwater recharge in the catchment. The model was used to build spatial expressions of the proposed management practices in order to assess their effectiveness. The developed procedure allows exploring the effects of soil conservation measures in a catchment to support the implementation of GWC. Copyright © 2012 Elsevier Ltd. All rights reserved.

Mutational Analysis of the TnrA-Binding Sites in the Bacillus subtilis nrgAB and gabP Promoter Regions

PubMed Central

Wray, Lewis V.; Zalieckas, Jill M.; Ferson, Amy E.; Fisher, Susan H.

1998-01-01

Transcription of the Bacillus subtilis nrgAB promoter is activated during nitrogen-limited growth by the TnrA protein. A common inverted repeat, TGTNAN7TNACA (TnrA site), is centered 49 to 51 bp upstream of the transcriptional start sites for the TnrA-regulated nrgAB, gabP P2, and nas promoters. Oligonucleotide-directed mutagenesis of the nrgAB promoter region showed that conserved nucleotides within the TnrA site, the A+T-rich region between the two TnrA half-sites, and an upstream A tract are all required for high-level activation of nrgAB expression. Mutations that alter the relative distance between the two half-sites of the nrgAB TnrA site abolish nitrogen regulation of nrgAB expression. Spacer mutations that change the relative distance between the TnrA site and −35 region of the nrgAB promoter reveal that activation of nrgAB expression occurs only when the TnrA site is located 49 to 51 bp upstream of the transcriptional start site. Mutational analysis of the conserved nucleotides in the gabP P2 TnrA site showed that this sequence is also required for nitrogen-regulated gabP P2 expression. The TnrA protein, expressed in an overproducing Escherichia coli strain, had a 625-fold-higher affinity for the wild-type nrgAB promoter DNA than for a mutated nrgAB promoter DNA fragment that is unable to activate nrgAB expression in vivo. These results indicate that the proposed TnrA site functions as the binding site for the TnrA protein. TnrA was found to activate nrgAB expression during late exponential growth in nutrient sporulation medium containing glucose, suggesting that cells become nitrogen limited during growth in this medium. PMID:9603886

Structural basis of UGUA recognition by the Nudix protein CFIm25 and implications for a regulatory role in mRNA 3′ processing

PubMed Central

Yang, Qin; Gilmartin, Gregory M.; Doublié, Sylvie

2010-01-01

Human Cleavage Factor Im (CFIm) is an essential component of the pre-mRNA 3′ processing complex that functions in the regulation of poly(A) site selection through the recognition of UGUA sequences upstream of the poly(A) site. Although the highly conserved 25 kDa subunit (CFIm25) of the CFIm complex possesses a characteristic α/β/α Nudix fold, CFIm25 has no detectable hydrolase activity. Here we report the crystal structures of the human CFIm25 homodimer in complex with UGUAAA and UUGUAU RNA sequences. CFIm25 is the first Nudix protein to be reported to bind RNA in a sequence-specific manner. The UGUA sequence contributes to binding specificity through an intramolecular G:A Watson–Crick/sugar-edge base interaction, an unusual pairing previously found to be involved in the binding specificity of the SAM-III riboswitch. The structures, together with mutational data, suggest a novel mechanism for the simultaneous sequence-specific recognition of two UGUA elements within the pre-mRNA. Furthermore, the mutually exclusive binding of RNA and the signaling molecule Ap4A (diadenosine tetraphosphate) by CFIm25 suggests a potential role for small molecules in the regulation of mRNA 3′ processing. PMID:20479262

Structural basis of UGUA recognition by the Nudix protein CFI(m)25 and implications for a regulatory role in mRNA 3' processing.

PubMed

Yang, Qin; Gilmartin, Gregory M; Doublié, Sylvie

2010-06-01

Human Cleavage Factor Im (CFI(m)) is an essential component of the pre-mRNA 3' processing complex that functions in the regulation of poly(A) site selection through the recognition of UGUA sequences upstream of the poly(A) site. Although the highly conserved 25 kDa subunit (CFI(m)25) of the CFI(m) complex possesses a characteristic alpha/beta/alpha Nudix fold, CFI(m)25 has no detectable hydrolase activity. Here we report the crystal structures of the human CFI(m)25 homodimer in complex with UGUAAA and UUGUAU RNA sequences. CFI(m)25 is the first Nudix protein to be reported to bind RNA in a sequence-specific manner. The UGUA sequence contributes to binding specificity through an intramolecular G:A Watson-Crick/sugar-edge base interaction, an unusual pairing previously found to be involved in the binding specificity of the SAM-III riboswitch. The structures, together with mutational data, suggest a novel mechanism for the simultaneous sequence-specific recognition of two UGUA elements within the pre-mRNA. Furthermore, the mutually exclusive binding of RNA and the signaling molecule Ap(4)A (diadenosine tetraphosphate) by CFI(m)25 suggests a potential role for small molecules in the regulation of mRNA 3' processing.

The Oenococcus oeni clpX Homologue Is a Heat Shock Gene Preferentially Expressed in Exponential Growth Phase

PubMed Central

Jobin, Michel-Philippe; Garmyn, Dominique; Diviès, Charles; Guzzo, Jean

1999-01-01

Using degenerated primers from conserved regions of previously studied clpX gene products, we cloned the clpX gene of the malolactic bacterium Oenococcus oeni. The clpX gene was sequenced, and the deduced protein of 413 amino acids (predicted molecular mass of 45,650 Da) was highly similar to previously analyzed clpX gene products from other organisms. An open reading frame located upstream of the clpX gene was identified as the tig gene by similarity of its predicted product to other bacterial trigger factors. ClpX was purified by using a maltose binding protein fusion system and was shown to possess an ATPase activity. Northern analyses indicated the presence of two independent 1.6-kb monocistronic clpX and tig mRNAs and also showed an increase in clpX mRNA amount after a temperature shift from 30 to 42°C. The clpX transcript is abundant in the early exponential growth phase and progressively declines to undetectable levels in the stationary phase. Thus, unlike hsp18, the gene encoding one of the major small heat shock proteins of Oenococcus oeni, clpX expression is related to the exponential growth phase and requires de novo protein synthesis. Primer extension analysis identified the 5′ end of clpX mRNA which is located 408 nucleotides upstream of a putative AUA start codon. The putative transcription start site allowed identification of a predicted promoter sequence with a high similarity to the consensus sequence found in the housekeeping gene promoter of gram-positive bacteria as well as Escherichia coli. PMID:10542163

Sequencing artifacts in the type A influenza databases and attempts to correct them.

PubMed

Suarez, David L; Chester, Nikki; Hatfield, Jason

2014-07-01

There are over 276 000 influenza gene sequences in public databases, with the quality of the sequences determined by the contributor. As part of a high school class project, influenza sequences with possible errors were identified in the public databases based on the size of the gene being longer than expected, with the hypothesis that these sequences would have an error. Students contacted sequence submitters alerting them of the possible sequence issue(s) and requested they the suspect sequence(s) be correct as appropriate. Type A influenza viruses were screened, and gene segments longer than the accepted size were identified for further analysis. Attention was placed on sequences with additional nucleotides upstream or downstream of the highly conserved non-coding ends of the viral segments. A total of 1081 sequences were identified that met this criterion. Three types of errors were commonly observed: non-influenza primer sequence wasn't removed from the sequence; PCR product was cloned and plasmid sequence was included in the sequence; and Taq polymerase added an adenine at the end of the PCR product. Internal insertions of nucleotide sequence were also commonly observed, but in many cases it was unclear if the sequence was correct or actually contained an error. A total of 215 sequences, or 22.8% of the suspect sequences, were corrected in the public databases in the first year of the student project. Unfortunately 138 additional sequences with possible errors were added to the databases in the second year. Additional awareness of the need for data integrity of sequences submitted to public databases is needed to fully reap the benefits of these large data sets. © 2014 The Authors. Influenza and Other Respiratory Viruses Published by John Wiley & Sons Ltd.

Distinct Escape Pathway by Hepatitis C Virus Genotype 1a from a Dominant CD8+ T Cell Response by Selection of Altered Epitope Processing.

PubMed

Walker, Andreas; Skibbe, Kathrin; Steinmann, Eike; Pfaender, Stephanie; Kuntzen, Thomas; Megger, Dominik A; Groten, Svenja; Sitek, Barbara; Lauer, Georg M; Kim, Arthur Y; Pietschmann, Thomas; Allen, Todd M; Timm, Joerg

2016-01-01

Antiviral CD8(+) T cells are a key component of the adaptive immune response against HCV, but their impact on viral control is influenced by preexisting viral variants in important target epitopes and the development of viral escape mutations. Immunodominant epitopes highly conserved across genotypes therefore are attractive for T cell based prophylactic vaccines. Here, we characterized the CD8(+) T cell response against the highly conserved HLA-B*51-restricted epitope IPFYGKAI1373-1380 located in the helicase domain of NS3 in people who inject drugs (PWID) exposed predominantly to HCV genotypes 1a and 3a. Despite this epitope being conserved in both genotypes, the corresponding CD8(+) T cell response was detected only in PWID infected with genotype 3a and HCV-RNA negative PWID, but not in PWID infected with genotype 1a. In genotype 3a, the detection of strong CD8(+) T cell responses was associated with epitope variants in the autologous virus consistent with immune escape. Analysis of viral sequences from multiple cohorts confirmed HLA-B*51-associated escape mutations inside the epitope in genotype 3a, but not in genotype 1a. Here, a distinct substitution in the N-terminal flanking region located 5 residues upstream of the epitope (S1368P; P = 0.00002) was selected in HLA-B*51-positive individuals. Functional assays revealed that the S1368P substitution impaired recognition of target cells presenting the endogenously processed epitope. The results highlight that, despite an epitope being highly conserved between two genotypes, there are major differences in the selected viral escape pathways and the corresponding T cell responses. HCV is able to evolutionary adapt to CD8(+) T cell immune pressure in multiple ways. Beyond selection of mutations inside targeted epitopes, this study demonstrates that HCV inhibits epitope processing by modification of the epitope flanking region under T cell immune pressure. Selection of a substitution five amino acids upstream of the epitope underlines that efficient antigen presentation strongly depends on its larger sequence context and that blocking of the multistep process of antigen processing by mutation is exploited also by HCV. The pathways to mutational escape of HCV are to some extent predictable but are distinct in different genotypes. Importantly, the selected escape pathway of HCV may have consequences for the destiny of antigen-specific CD8(+) T cells. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Abundance and functional diversity of riboswitches in microbial communities

PubMed Central

Kazanov, Marat D; Vitreschak, Alexey G; Gelfand, Mikhail S

2007-01-01

Background Several recently completed large-scale enviromental sequencing projects produced a large amount of genetic information about microbial communities ('metagenomes') which is not biased towards cultured organisms. It is a good source for estimation of the abundance of genes and regulatory structures in both known and unknown members of microbial communities. In this study we consider the distribution of RNA regulatory structures, riboswitches, in the Sargasso Sea, Minnesota Soil and Whale Falls metagenomes. Results Over three hundred riboswitches were found in about 2 Gbp metagenome DNA sequences. The abundabce of riboswitches in metagenomes was highest for the TPP, B12 and GCVT riboswitches; the S-box, RFN, YKKC/YXKD, YYBP/YKOY regulatory elements showed lower but significant abundance, while the LYS, G-box, GLMS and YKOK riboswitches were rare. Regions downstream of identified riboswitches were scanned for open reading frames. Comparative analysis of identified ORFs revealed new riboswitch-regulated functions for several classes of riboswitches. In particular, we have observed phosphoserine aminotransferase serC (COG1932) and malate synthase glcB (COG2225) to be regulated by the glycine (GCVT) riboswitch; fatty acid desaturase ole1 (COG1398), by the cobalamin (B12) riboswitch; 5-methylthioribose-1-phosphate isomerase ykrS (COG0182), by the SAM-riboswitch. We also identified conserved riboswitches upstream of genes of unknown function: thiamine (TPP), cobalamine (B12), and glycine (GCVT, upstream of genes from COG4198). Conclusion This study demonstrates applicability of bioinformatics to the analysis of RNA regulatory structures in metagenomes. PMID:17908319

Scapula development is governed by genetic interactions of Pbx1 with its family members and with Emx2 via their cooperative control of Alx1

PubMed Central

Capellini, Terence D.; Vaccari, Giulia; Ferretti, Elisabetta; Fantini, Sebastian; He, Mu; Pellegrini, Massimo; Quintana, Laura; Di Giacomo, Giuseppina; Sharpe, James; Selleri, Licia; Zappavigna, Vincenzo

2010-01-01

The genetic pathways underlying shoulder blade development are largely unknown, as gene networks controlling limb morphogenesis have limited influence on scapula formation. Analysis of mouse mutants for Pbx and Emx2 genes has suggested their potential roles in girdle development. In this study, by generating compound mutant mice, we examined the genetic control of scapula development by Pbx genes and their functional relationship with Emx2. Analyses of Pbx and Pbx1;Emx2 compound mutants revealed that Pbx genes share overlapping functions in shoulder development and that Pbx1 genetically interacts with Emx2 in this process. Here, we provide a biochemical basis for Pbx1;Emx2 genetic interaction by showing that Pbx1 and Emx2 can bind specific DNA sequences as heterodimers. Moreover, the expression of genes crucial for scapula development is altered in these mutants, indicating that Pbx genes act upstream of essential pathways for scapula formation. In particular, expression of Alx1, an effector of scapula blade patterning, is absent in all compound mutants. We demonstrate that Pbx1 and Emx2 bind in vivo to a conserved sequence upstream of Alx1 and cooperatively activate its transcription via this potential regulatory element. Our results establish an essential role for Pbx1 in genetic interactions with its family members and with Emx2 and delineate novel regulatory networks in shoulder girdle development. PMID:20627960

Characterization and Placement of Wetlands for Integrated Conservation Practice Planning

EPA Science Inventory

Constructed wetlands have been recognized as an efficient and cost-effective conservation practice to protect water quality through reducing the transport of sediments and nutrients from upstream croplands to downstream water bodies. The challenge resides in targeting the strateg...

The LINEs and SINEs of Entamoeba histolytica: comparative analysis and genomic distribution.

PubMed

Bakre, Abhijeet A; Rawal, Kamal; Ramaswamy, Ram; Bhattacharya, Alok; Bhattacharya, Sudha

2005-07-01

Autonomous non-long terminal repeat retrotransposons are commonly referred to as long interspersed elements (LINEs). Short non-autonomous elements that borrow the LINE machinery are called SINES. The Entamoeba histolytica genome contains three classes of LINEs and SINEs. Together the EhLINEs/SINEs account for about 6% of the genome. The recognizable functional domains in all three EhLINEs included reverse transcriptase and endonuclease. A novel feature was the presence of two types of members-some with a single long ORF (less frequent) and some with two ORFs (more frequent) in both EhLINE1 and 2. The two ORFs were generated by conserved changes leading to stop codon. Computational analysis of the immediate flanking sequences for each element showed that they inserted in AT-rich sequences, with a preponderance of Ts in the upstream site. The elements were very frequently located close to protein-coding genes and other EhLINEs/SINEs. The possible influence of these elements on expression of neighboring genes needs to be determined.

Nuclear localization of Merkel cell polyomavirus large T antigen in Merkel cell carcinoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakamura, Tomoyuki; Sato, Yuko; Watanabe, Daisuke

2010-03-15

To clarify whether mutations in the large T gene encoded by Merkel cell polyomavirus affect the expression and function of large T antigen in Merkel cell carcinoma cases, we investigated the expression of large T antigen in vitro and in vivo. Immunohistochemistry using a rabbit polyclonal antibody revealed that large T antigen was expressed in the nuclei of Merkel cell carcinoma cells with Merkel cell polyomavirus infection. Deletion mutant analyses identified an Arg-Lys-Arg-Lys sequence (amino acids 277-280) as a nuclear localization signal in large T antigen. Sequence analyses revealed that there were no mutations in the nuclear localization signal inmore » any of the eleven Merkel cell polyomavirus strains examined. Furthermore, stop codons were not observed in the upstream of the nuclear localization signal in any of the Merkel cell carcinoma cases examined. These data suggest that the nuclear localization signal is highly conserved and functional in Merkel cell carcinoma cases.« less

Membrane-bound human orphan cytochrome P450 2U1: Sequence singularities, construction of a full 3D model, and substrate docking.

PubMed

Ducassou, Lionel; Dhers, Laura; Jonasson, Gabriella; Pietrancosta, Nicolas; Boucher, Jean-Luc; Mansuy, Daniel; André, François

2017-09-01

Human cytochrome P450 2U1 (CYP2U1) is an orphan CYP that exhibits several distinctive characteristics among the 57 human CYPs with a highly conserved sequence in almost all living organisms. We compared its protein sequence with those of the 57 human CYPs and constructed a 3D structure of a full-length CYP2U1 model bound to a POPC membrane. We also performed docking experiments of arachidonic acid (AA) and N-arachidonoylserotonin (AS) in this model. The protein sequence of CYP2U1 displayed two unique characteristics when compared to those of the human CYPs, the presence of a longer N-terminal region upstream of the putative trans-membrane helix (TMH) containing 8 proline residues, and of an insert of about 20 amino acids containing 5 arginine residues between helices A' and A. Its N-terminal part upstream of TMH involved an additional short terminal helix, in a manner similar to what was reported in the crystal structure of Saccharomyces cerevisiae CYP51. Our model also showed a specific interaction between the charged residues of insert AA' and phosphate groups of lipid polar heads, suggesting a possible role of this insert in substrate recruitment. Docking of AA and AS in this model showed these substrates in channel 2ac, with the terminal alkyl chain of AA or the indole ring of AS close to the heme, in agreement with the reported CYP2U1-catalyzed AA and AS hydroxylation regioselectivities. This model should be useful to find new endogenous or exogenous CYP2U1 substrates and to interpret the regioselectivity of their hydroxylation. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

Identification of estrogen-responsive genes using a genome-wide analysis of promoter elements for transcription factor binding sites.

PubMed

Kamalakaran, Sitharthan; Radhakrishnan, Senthil K; Beck, William T

2005-06-03

We developed a pipeline to identify novel genes regulated by the steroid hormone-dependent transcription factor, estrogen receptor, through a systematic analysis of upstream regions of all human and mouse genes. We built a data base of putative promoter regions for 23,077 human and 19,984 mouse transcripts from National Center for Biotechnology Information annotation and 8793 human and 6785 mouse promoters from the Data Base of Transcriptional Start Sites. We used this data base of putative promoters to identify potential targets of estrogen receptor by identifying estrogen response elements (EREs) in their promoters. Our program correctly identified EREs in genes known to be regulated by estrogen in addition to several new genes whose putative promoters contained EREs. We validated six genes (KIAA1243, NRIP1, MADH9, NME3, TPD52L, and ABCG2) to be estrogen-responsive in MCF7 cells using reverse transcription PCR. To allow for extensibility of our program in identifying targets of other transcription factors, we have built a Web interface to access our data base and programs. Our Web-based program for Promoter Analysis of Genome, PAGen@UIC, allows a user to identify putative target genes for vertebrate transcription factors through the analysis of their upstream sequences. The interface allows the user to search the human and mouse promoter data bases for potential target genes containing one or more listed transcription factor binding sites (TFBSs) in their upstream elements, using either regular expression-based consensus or position weight matrices. The data base can also be searched for promoters harboring user-defined TFBSs given as a consensus or a position weight matrix. Furthermore, the user can retrieve putative promoter sequences for any given gene together with identified TFBSs located on its promoter. Orthologous promoters are also analyzed to determine conserved elements.

Comparative Sequence Analysis of the Plasmid-Encoded Regulator of Enteropathogenic Escherichia coli Strains

PubMed Central

Okeke, Iruka N.; Borneman, Jade A.; Shin, Sooan; Mellies, Jay L.; Quinn, Laura E.; Kaper, James B.

2001-01-01

Enteropathogenic Escherichia coli (EPEC) strains that carry the EPEC adherence factor (EAF) plasmid were screened for the presence of different EAF sequences, including those of the plasmid-encoded regulator (per). Considerable variation in gene content of EAF plasmids from different strains was seen. However, bfpA, the gene encoding the structural subunit for the bundle-forming pilus, bundlin, and per genes were found in 96.8% of strains. Sequence analysis of the per operon and its promoter region from 15 representative strains revealed that it is highly conserved. Most of the variation occurs in the 5′ two-thirds of the perA gene. In contrast, the C-terminal portion of the predicted PerA protein that contains the DNA-binding helix-turn-helix motif is 100% conserved in all strains that possess a full-length gene. In a minority of strains including the O119:H2 and canine isolates and in a subset of O128:H2 and O142:H6 strains, frameshift mutations in perA leading to premature truncation and consequent inactivation of the gene were identified. Cloned perA, -B, and -C genes from these strains, unlike those from strains with a functional operon, failed to activate the LEE1 operon and bfpA transcriptional fusions or to complement a per mutant in reference strain E2348/69. Furthermore, O119, O128, and canine strains that carry inactive per operons were deficient in virulence protein expression. The context in which the perABC operon occurs on the EAF plasmid varies. The sequence upstream of the per promoter region in EPEC reference strains E2348/69 and B171-8 was present in strains belonging to most serogroups. In a subset of O119:H2, O128:H2, and O142:H6 strains and in the canine isolate, this sequence was replaced by an IS1294-homologous sequence. PMID:11500429

Regulation of Lactobacillus casei Sorbitol Utilization Genes Requires DNA-Binding Transcriptional Activator GutR and the Conserved Protein GutM▿

PubMed Central

Alcántara, Cristina; Sarmiento-Rubiano, Luz Adriana; Monedero, Vicente; Deutscher, Josef; Pérez-Martínez, Gaspar; Yebra, María J.

2008-01-01

Sequence analysis of the five genes (gutRMCBA) downstream from the previously described sorbitol-6-phosphate dehydrogenase-encoding Lactobacillus casei gutF gene revealed that they constitute a sorbitol (glucitol) utilization operon. The gutRM genes encode putative regulators, while the gutCBA genes encode the EIIC, EIIBC, and EIIA proteins of a phosphoenolpyruvate-dependent sorbitol phosphotransferase system (PTSGut). The gut operon is transcribed as a polycistronic gutFRMCBA messenger, the expression of which is induced by sorbitol and repressed by glucose. gutR encodes a transcriptional regulator with two PTS-regulated domains, a galactitol-specific EIIB-like domain (EIIBGat domain) and a mannitol/fructose-specific EIIA-like domain (EIIAMtl domain). Its inactivation abolished gut operon transcription and sorbitol uptake, indicating that it acts as a transcriptional activator. In contrast, cells carrying a gutB mutation expressed the gut operon constitutively, but they failed to transport sorbitol, indicating that EIIBCGut negatively regulates GutR. A footprint analysis showed that GutR binds to a 35-bp sequence upstream from the gut promoter. A sequence comparison with the presumed promoter region of gut operons from various firmicutes revealed a GutR consensus motif that includes an inverted repeat. The regulation mechanism of the L. casei gut operon is therefore likely to be operative in other firmicutes. Finally, gutM codes for a conserved protein of unknown function present in all sequenced gut operons. A gutM mutant, the first constructed in a firmicute, showed drastically reduced gut operon expression and sorbitol uptake, indicating a regulatory role also for GutM. PMID:18676710

Characterization and placement of wetlands for integrated watershed conservation practice planning

USDA-ARS?s Scientific Manuscript database

Constructed wetlands have been recognized as an efficient and cost-effective conservation practice to protect water quality through reducing the transport of sediments and nutrients from upstream croplands to downstream water bodies. The challenge resides in targeting the strategic location of wetla...

Consumption‐Based Conservation Targeting: Linking Biodiversity Loss to Upstream Demand through a Global Wildlife Footprint

PubMed Central

Berlow, Eric; Conlisk, Erin; Erb, Karlheinz; Iha, Katsunori; Martinez, Neo; Newman, Erica A.; Plutzar, Christoph; Smith, Adam B.; Harte, John

2016-01-01

Abstract Although most conservation efforts address the direct, local causes of biodiversity loss, effective long‐term conservation will require complementary efforts to reduce the upstream economic pressures, such as demands for food and forest products, which ultimately drive these downstream losses. Here, we present a wildlife footprint analysis that links global losses of wild birds to consumer purchases across 57 economic sectors in 129 regions. The United States, India, China, and Brazil have the largest regional wildlife footprints, while per‐person footprints are highest in Mongolia, Australia, Botswana, and the United Arab Emirates. A US$100 purchase of bovine meat or rice products occupies approximately 0.1 km2 of wild bird ranges, displacing 1–2 individual birds, for 1 year. Globally significant importer regions, including Japan, the United Kingdom, Germany, Italy, and France, have large footprints that drive wildlife losses elsewhere in the world and represent important targets for consumption‐focused conservation attention. PMID:29104616

Target Site Recognition by a Diversity-Generating Retroelement

PubMed Central

Guo, Huatao; Tse, Longping V.; Nieh, Angela W.; Czornyj, Elizabeth; Williams, Steven; Oukil, Sabrina; Liu, Vincent B.; Miller, Jeff F.

2011-01-01

Diversity-generating retroelements (DGRs) are in vivo sequence diversification machines that are widely distributed in bacterial, phage, and plasmid genomes. They function to introduce vast amounts of targeted diversity into protein-encoding DNA sequences via mutagenic homing. Adenine residues are converted to random nucleotides in a retrotransposition process from a donor template repeat (TR) to a recipient variable repeat (VR). Using the Bordetella bacteriophage BPP-1 element as a prototype, we have characterized requirements for DGR target site function. Although sequences upstream of VR are dispensable, a 24 bp sequence immediately downstream of VR, which contains short inverted repeats, is required for efficient retrohoming. The inverted repeats form a hairpin or cruciform structure and mutational analysis demonstrated that, while the structure of the stem is important, its sequence can vary. In contrast, the loop has a sequence-dependent function. Structure-specific nuclease digestion confirmed the existence of a DNA hairpin/cruciform, and marker coconversion assays demonstrated that it influences the efficiency, but not the site of cDNA integration. Comparisons with other phage DGRs suggested that similar structures are a conserved feature of target sequences. Using a kanamycin resistance determinant as a reporter, we found that transplantation of the IMH and hairpin/cruciform-forming region was sufficient to target the DGR diversification machinery to a heterologous gene. In addition to furthering our understanding of DGR retrohoming, our results suggest that DGRs may provide unique tools for directed protein evolution via in vivo DNA diversification. PMID:22194701

The legumin gene family: structure of a B type gene of Vicia faba and a possible legumin gene specific regulatory element.

PubMed Central

Bäumlein, H; Wobus, U; Pustell, J; Kafatos, F C

1986-01-01

The field bean, Vicia faba L. var. minor, possesses two sub-families of 11 S legumin genes named A and B. We isolated from a genomic library a B-type gene (LeB4) and determined its primary DNA sequence. Gene LeB4 codes for a 484 amino acid residue prepropolypeptide, encompassing a signal peptide of 22 amino acid residues, an acidic, very hydrophilic alpha-chain of 281 residues and a basic, somewhat hydrophobic beta-chain of 181 residues. The latter two coding regions are immediately contiguous, but each is interrupted by a short intron. Type A legumin genes from soybean and pea are known to have introns in the same two positions, in addition to an extra intron (within the alpha-coding sequence). Sequence comparisons of legumin genes from these three plants revealed a highly conserved sequence element of at least 28 bp, centered at approximately 100 bp upstream of each cap site. The element is absent from the equivalent position of all non-legumin and other plant and fungal genes examined. We tentatively name this element "legumin box" and suggest that it may have a function in the regulation of legumin gene expression. PMID:3960730

Multiple mobile promoter regions for the rare carbapenem resistance gene of Bacteroides fragilis.

PubMed

Podglajen, I; Breuil, J; Rohaut, A; Monsempes, C; Collatz, E

2001-06-01

Two novel insertion sequences (IS), IS1187 and IS1188, are described upstream from the carbapenem resistance gene cfiA in strains of Bacteroides fragilis. Mapping, with the RACE procedure, of transcription start sites of cfiA in these and two other previously reported IS showed that transcription of this rarely encountered gene is initiated close to a variety of B. fragilis consensus promoter sequences, as recently defined (D. P. Bayley, E. R. Rocha, and C. J. Smith, FEMS Microbiol. Lett. 193:149-154, 2000). In the cases of IS1186 and IS1188, these sequences overlap with putative Esigma(70) promoter sequences, while in IS942 and IS1187 such sequences can be observed either upstream or downstream of the B. fragilis promoters.

Thyroglobulin Represents a Novel Molecular Architecture of Vertebrates.

PubMed

Holzer, Guillaume; Morishita, Yoshiaki; Fini, Jean-Baptiste; Lorin, Thibault; Gillet, Benjamin; Hughes, Sandrine; Tohmé, Marie; Deléage, Gilbert; Demeneix, Barbara; Arvan, Peter; Laudet, Vincent

2016-08-05

Thyroid hormones modulate not only multiple functions in vertebrates (energy metabolism, central nervous system function, seasonal changes in physiology, and behavior) but also in some non-vertebrates where they control critical post-embryonic developmental transitions such as metamorphosis. Despite their obvious biological importance, the thyroid hormone precursor protein, thyroglobulin (Tg), has been experimentally investigated only in mammals. This may bias our view of how thyroid hormones are produced in other organisms. In this study we searched genomic databases and found Tg orthologs in all vertebrates including the sea lamprey (Petromyzon marinus). We cloned a full-size Tg coding sequence from western clawed frog (Xenopus tropicalis) and zebrafish (Danio rerio). Comparisons between the representative mammal, amphibian, teleost fish, and basal vertebrate indicate that all of the different domains of Tg, as well as Tg regional structure, are conserved throughout the vertebrates. Indeed, in Xenopus, zebrafish, and lamprey Tgs, key residues, including the hormonogenic tyrosines and the disulfide bond-forming cysteines critical for Tg function, are well conserved despite overall divergence of amino acid sequences. We uncovered upstream sequences that include start codons of zebrafish and Xenopus Tgs and experimentally proved that these are full-length secreted proteins, which are specifically recognized by antibodies against rat Tg. By contrast, we have not been able to find any orthologs of Tg among non-vertebrate species. Thus, Tg appears to be a novel protein elaborated as a single event at the base of vertebrates and virtually unchanged thereafter. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

The leukemia associated ETO nuclear repressor gene is regulated by the GATA-1 transcription factor in erythroid/megakaryocytic cells

PubMed Central

2010-01-01

Background The Eight-Twenty-One (ETO) nuclear co-repressor gene belongs to the ETO homologue family also containing Myeloid Translocation Gene on chromosome 16 (MTG16) and myeloid translocation Gene-Related protein 1 (MTGR1). By chromosomal translocations ETO and MTG16 become parts of fusion proteins characteristic of morphological variants of acute myeloid leukemia. Normal functions of ETO homologues have as yet not been examined. The goal of this work was to identify structural and functional promoter elements upstream of the coding sequence of the ETO gene in order to explore lineage-specific hematopoietic expression and get hints to function. Results A putative proximal ETO promoter was identified within 411 bp upstream of the transcription start site. Strong ETO promoter activity was specifically observed upon transfection of a promoter reporter construct into erythroid/megakaryocytic cells, which have endogeneous ETO gene activity. An evolutionary conserved region of 228 bp revealed potential cis-elements involved in transcription of ETO. Disruption of the evolutionary conserved GATA -636 consensus binding site repressed transactivation and disruption of the ETS1 -705 consensus binding site enhanced activity of the ETO promoter. The promoter was stimulated by overexpression of GATA-1 into erythroid/megakaryocytic cells. Electrophoretic mobility shift assay with erythroid/megakaryocytic cells showed specific binding of GATA-1 to the GATA -636 site. Furthermore, results from chromatin immunoprecipitation showed GATA-1 binding in vivo to the conserved region of the ETO promoter containing the -636 site. The results suggest that the GATA -636 site may have a role in activation of the ETO gene activity in cells with erythroid/megakaryocytic potential. Leukemia associated AML1-ETO strongly suppressed an ETO promoter reporter in erythroid/megakaryocytic cells. Conclusions We demonstrate that the GATA-1 transcription factor binds and transactivates the ETO proximal promoter in an erythroid/megakaryocytic-specific manner. Thus, trans-acting factors that are essential in erythroid/megakaryocytic differentiation govern ETO expression. PMID:20487545

Influence of 5'-flanking sequence on 4.5SI RNA gene transcription by RNA polymerase III.

PubMed

Gogolevskaya, Irina K; Stasenko, Danil V; Tatosyan, Karina A; Kramerov, Dmitri A

2018-05-01

Short nuclear 4.5SI RNA can be found in three related rodent families. Its function remains unknown. The genes of 4.5SI RNA contain an internal promoter of RNA polymerase III composed of the boxes A and B. Here, the effect of the sequence immediately upstream of the mouse 4.5SI RNA gene on its transcription was studied. The gene with deletions and substitutions in the 5'-flanking sequence was used to transfect HeLa cells and its transcriptional activity was evaluated from the cellular level of 4.5SI RNA. Single-nucleotide substitutions in the region adjacent to the transcription start site (positions -2 to -8) decreased the expression activity of the gene down to 40%-60% of the control. The substitution of the conserved pentanucleotide AGAAT (positions -14 to -18) could either decrease (43%-56%) or increase (134%) the gene expression. A TATA-like box (TACATGA) was found at positions -24 to -30 of the 4.5SI RNA gene. Its replacement with a polylinker fragment of the vector did not decrease the transcription level, while its replacement with a GC-rich sequence almost completely (down to 2%-5%) suppressed the transcription of the 4.5SI RNA gene. The effect of plasmid sequences bordering the gene on its transcription by RNA polymerase III is discussed.

Cloning, sequencing, and expression of the Zymomonas mobilis phosphoglycerate mutase gene (pgm) in Escherichia coli.

PubMed Central

Yomano, L P; Scopes, R K; Ingram, L O

1993-01-01

Phosphoglycerate mutase is an essential glycolytic enzyme for Zymomonas mobilis, catalyzing the reversible interconversion of 3-phosphoglycerate and 2-phosphoglycerate. The pgm gene encoding this enzyme was cloned on a 5.2-kbp DNA fragment and expressed in Escherichia coli. Recombinants were identified by using antibodies directed against purified Z. mobilis phosphoglycerate mutase. The pgm gene contains a canonical ribosome-binding site, a biased pattern of codon usage, a long upstream untranslated region, and four promoters which share sequence homology. Interestingly, adhA and a D-specific 2-hydroxyacid dehydrogenase were found on the same DNA fragment and appear to form a cluster of genes which function in central metabolism. The translated sequence for Z. mobilis pgm was in full agreement with the 40 N-terminal amino acid residues determined by protein sequencing. The primary structure of the translated sequence is highly conserved (52 to 60% identity with other phosphoglycerate mutases) and also shares extensive homology with bisphosphoglycerate mutases (51 to 59% identity). Since Southern blots indicated the presence of only a single copy of pgm in the Z. mobilis chromosome, it is likely that the cloned pgm gene functions to provide both activities. Z. mobilis phosphoglycerate mutase is unusual in that it lacks the flexible tail and lysines at the carboxy terminus which are present in the enzyme isolated from all other organisms examined. Images PMID:8320209

Analysis of the Prefoldin Gene Family in 14 Plant Species

PubMed Central

Cao, Jun

2016-01-01

Prefoldin is a hexameric molecular chaperone complex present in all eukaryotes and archaea. The evolution of this gene family in plants is unknown. Here, I identified 140 prefoldin genes in 14 plant species. These prefoldin proteins were divided into nine groups through phylogenetic analysis. Highly conserved gene organization and motif distribution exist in each prefoldin group, implying their functional conservation. I also observed the segmental duplication of maize prefoldin gene family. Moreover, a few functional divergence sites were identified within each group pairs. Functional network analyses identified 78 co-expressed genes, and most of them were involved in carrying, binding and kinase activity. Divergent expression profiles of the maize prefoldin genes were further investigated in different tissues and development periods and under auxin and some abiotic stresses. I also found a few cis-elements responding to abiotic stress and phytohormone in the upstream sequences of the maize prefoldin genes. The results provided a foundation for exploring the characterization of the prefoldin genes in plants and will offer insights for additional functional studies. PMID:27014333

18 CFR 12.24 - Review and updating of plans.

Code of Federal Regulations, 2010 CFR

2010-04-01

... light of any significant changes in upstream or downstream circumstances which might affect water flows... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Review and updating of plans. 12.24 Section 12.24 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY...

18 CFR 12.24 - Review and updating of plans.

Code of Federal Regulations, 2012 CFR

2012-04-01

... light of any significant changes in upstream or downstream circumstances which might affect water flows... 18 Conservation of Power and Water Resources 1 2012-04-01 2012-04-01 false Review and updating of plans. 12.24 Section 12.24 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY...

18 CFR 12.24 - Review and updating of plans.

Code of Federal Regulations, 2011 CFR

2011-04-01

... light of any significant changes in upstream or downstream circumstances which might affect water flows... 18 Conservation of Power and Water Resources 1 2011-04-01 2011-04-01 false Review and updating of plans. 12.24 Section 12.24 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY...

18 CFR 12.24 - Review and updating of plans.

Code of Federal Regulations, 2014 CFR

2014-04-01

... light of any significant changes in upstream or downstream circumstances which might affect water flows... 18 Conservation of Power and Water Resources 1 2014-04-01 2014-04-01 false Review and updating of plans. 12.24 Section 12.24 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY...

18 CFR 12.24 - Review and updating of plans.

Code of Federal Regulations, 2013 CFR

2013-04-01

... light of any significant changes in upstream or downstream circumstances which might affect water flows... 18 Conservation of Power and Water Resources 1 2013-04-01 2013-04-01 false Review and updating of plans. 12.24 Section 12.24 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY...

18 CFR 11.10 - General provision; waiver and exemptions; definitions.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 18 Conservation of Power and Water Resources 1 2014-04-01 2014-04-01 false General provision; waiver and exemptions; definitions. 11.10 Section 11.10 Conservation of Power and Water Resources FEDERAL... upstream, project, usually by increasing or decreasing the release of water from a storage reservoir. (b...

18 CFR 11.10 - General provision; waiver and exemptions; definitions.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 18 Conservation of Power and Water Resources 1 2013-04-01 2013-04-01 false General provision; waiver and exemptions; definitions. 11.10 Section 11.10 Conservation of Power and Water Resources FEDERAL... upstream, project, usually by increasing or decreasing the release of water from a storage reservoir. (b...

18 CFR 11.10 - General provision; waiver and exemptions; definitions.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 18 Conservation of Power and Water Resources 1 2012-04-01 2012-04-01 false General provision; waiver and exemptions; definitions. 11.10 Section 11.10 Conservation of Power and Water Resources FEDERAL... upstream, project, usually by increasing or decreasing the release of water from a storage reservoir. (b...

18 CFR 11.10 - General provision; waiver and exemptions; definitions.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false General provision; waiver and exemptions; definitions. 11.10 Section 11.10 Conservation of Power and Water Resources FEDERAL... upstream, project, usually by increasing or decreasing the release of water from a storage reservoir. (b...

18 CFR 11.10 - General provision; waiver and exemptions; definitions.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 18 Conservation of Power and Water Resources 1 2011-04-01 2011-04-01 false General provision; waiver and exemptions; definitions. 11.10 Section 11.10 Conservation of Power and Water Resources FEDERAL... upstream, project, usually by increasing or decreasing the release of water from a storage reservoir. (b...

DNA barcoding and evaluation of genetic diversity in Cyprinidae fish in the midstream of the Yangtze River.

PubMed

Shen, Yanjun; Guan, Lihong; Wang, Dengqiang; Gan, Xiaoni

2016-05-01

The Yangtze River is the longest river in China and is divided into upstream and mid-downstream regions by the Three Gorges (the natural barriers of the Yangtze River), resulting in a complex distribution of fish. Dramatic changes to habitat environments may ultimately threaten fish survival; thus, it is necessary to evaluate the genetic diversity and propose protective measures. Species identification is the most significant task in many fields of biological research and in conservation efforts. DNA barcoding, which constitutes the analysis of a short fragment of the mitochondrial cytochrome c oxidase subunit I (COI) sequence, has been widely used for species identification. In this study, we collected 561 COI barcode sequences from 35 fish from the midstream of the Yangtze River. The intraspecific distances of all species were below 2% (with the exception of Acheilognathus macropterus and Hemibarbus maculatus). Nevertheless, all species could be unambiguously identified from the trees, barcoding gaps and taxonomic resolution ratio values. Furthermore, the COI barcode diversity was found to be low (≤0.5%), with the exception of H. maculatus (0.87%), A. macropterus (2.02%) and Saurogobio dabryi (0.82%). No or few shared haplotypes were detected between the upstream and downstream populations for ten species with overall nucleotide diversities greater than 0.00%, which indicated the likelihood of significant population genetic structuring. Our analyses indicated that DNA barcoding is an effective tool for the identification of cyprinidae fish in the midstream of the Yangtze River. It is vital that some protective measures be taken immediately because of the low COI barcode diversity.

Nucleosome exclusion from the interspecies-conserved central AT-rich region of the Ars insulator.

PubMed

Takagi, Haruna; Inai, Yuta; Watanabe, Shun-ichiro; Tatemoto, Sayuri; Yajima, Mamiko; Akasaka, Koji; Yamamoto, Takashi; Sakamoto, Naoaki

2012-01-01

The Ars insulator is a boundary element identified in the upstream region of the arylsulfatase (HpArs) gene in the sea urchin, Hemicentrotus pulcherrimus, and possesses the ability to both block enhancer-promoter communications and protect transgenes from silent chromatin. To understand the molecular mechanism of the Ars insulator, we investigated the correlation between chromatin structure, DNA structure and insulator activity. Nuclease digestion of nuclei isolated from sea urchin embryos revealed the presence of a nuclease-hypersensitive site within the Ars insulator. Analysis of micrococcal nuclease-sensitive sites in the Ars insulator, reconstituted with nucleosomes, showed the exclusion of nucleosomes from the central AT-rich region. Furthermore, the central AT-rich region in naked DNA was sensitive to nucleotide base modification by diethylpyrocarbonate (DEPC). These observations suggest that non-B-DNA structures in the central AT-rich region may inhibit nucleosomal formation, which leads to nuclease hypersensitivity. Furthermore, comparison of nucleotide sequences between the HpArs gene and its ortholog in Strongylocentrotus purpuratus revealed that the central AT-rich region of the Ars insulator is conserved, and this conserved region showed significant enhancer blocking activity. These results suggest that the central AT-rich nucleosome-free region plays an important role in the function of the Ars insulator.

Functional Organization of hsp70 Cluster in Camel (Camelus dromedarius) and Other Mammals

PubMed Central

Garbuz, David G.; Astakhova, Lubov N.; Zatsepina, Olga G.; Arkhipova, Irina R.; Nudler, Eugene; Evgen'ev, Michael B.

2011-01-01

Heat shock protein 70 (Hsp70) is a molecular chaperone providing tolerance to heat and other challenges at the cellular and organismal levels. We sequenced a genomic cluster containing three hsp70 family genes linked with major histocompatibility complex (MHC) class III region from an extremely heat tolerant animal, camel (Camelus dromedarius). Two hsp70 family genes comprising the cluster contain heat shock elements (HSEs), while the third gene lacks HSEs and should not be induced by heat shock. Comparison of the camel hsp70 cluster with the corresponding regions from several mammalian species revealed similar organization of genes forming the cluster. Specifically, the two heat inducible hsp70 genes are arranged in tandem, while the third constitutively expressed hsp70 family member is present in inverted orientation. Comparison of regulatory regions of hsp70 genes from camel and other mammals demonstrates that transcription factor matches with highest significance are located in the highly conserved 250-bp upstream region and correspond to HSEs followed by NF-Y and Sp1 binding sites. The high degree of sequence conservation leaves little room for putative camel-specific regulatory elements. Surprisingly, RT-PCR and 5′/3′-RACE analysis demonstrated that all three hsp70 genes are expressed in camel's muscle and blood cells not only after heat shock, but under normal physiological conditions as well, and may account for tolerance of camel cells to extreme environmental conditions. A high degree of evolutionary conservation observed for the hsp70 cluster always linked with MHC locus in mammals suggests an important role of such organization for coordinated functioning of these vital genes. PMID:22096537

Identification of novel craniofacial regulatory domains located far upstream of SOX9 and disrupted in Pierre Robin sequence

PubMed Central

Gordon, Christopher T.; Attanasio, Catia; Bhatia, Shipra; Benko, Sabina; Ansari, Morad; Tan, Tiong Y.; Munnich, Arnold; Pennacchio, Len A.; Abadie, Véronique; Temple, I. Karen; Goldenberg, Alice; van Heyningen, Veronica; Amiel, Jeanne; FitzPatrick, David; Kleinjan, Dirk A.; Visel, Axel; Lyonnet, Stanislas

2015-01-01

Mutations in the coding sequence of SOX9 cause campomelic dysplasia (CD), a disorder of skeletal development associated with 46,XY disorders of sex development (DSDs). Translocations, deletions and duplications within a ~2 Mb region upstream of SOX9 can recapitulate the CD-DSD phenotype fully or partially, suggesting the existence of an unusually large cis-regulatory control region. Pierre Robin sequence (PRS) is a craniofacial disorder that is frequently an endophenotype of CD and a locus for isolated PRS at ~1.2-1.5 Mb upstream of SOX9 has been previously reported. The craniofacial regulatory potential within this locus, and within the greater genomic domain surrounding SOX9, remains poorly defined. We report two novel deletions upstream of SOX9 in families with PRS, allowing refinement of the regions harbouring candidate craniofacial regulatory elements. In parallel, ChIP-Seq for p300 binding sites in mouse craniofacial tissue led to the identification of several novel craniofacial enhancers at the SOX9 locus, which were validated in transgenic reporter mice and zebrafish. Notably, some of the functionally validated elements fall within the PRS deletions. These studies suggest that multiple non-coding elements contribute to the craniofacial regulation of SOX9 expression, and that their disruption results in PRS. PMID:24934569

A conserved catalytic residue in the ubiquitin-conjugating enzyme family

PubMed Central

Wu, Pei-Ying; Hanlon, Mary; Eddins, Michael; Tsui, Colleen; Rogers, Richard S.; Jensen, Jane P.; Matunis, Michael J.; Weissman, Allan M.; Wolberger, Cynthia P.; Pickart, Cecile M.

2003-01-01

Ubiquitin (Ub) regulates diverse functions in eukaryotes through its attachment to other proteins. The defining step in this protein modification pathway is the attack of a substrate lysine residue on Ub bound through its C-terminus to the active site cysteine residue of a Ub-conjugating enzyme (E2) or certain Ub ligases (E3s). So far, these E2 and E3 cysteine residues are the only enzyme groups known to participate in the catalysis of conjugation. Here we show that a strictly conserved E2 asparagine residue is critical for catalysis of E2- and E2/RING E3-dependent isopeptide bond formation, but dispensable for upstream and downstream reactions of Ub thiol ester formation. In constrast, the strictly conserved histidine and proline residues immediately upstream of the asparagine are dispensable for catalysis of isopeptide bond formation. We propose that the conserved asparagine side chain stabilizes the oxyanion intermediate formed during lysine attack. The E2 asparagine is the first non-covalent catalytic group to be proposed in any Ub conjugation factor. PMID:14517261

The Histone Modification H3K27me3 Is Retained after Gene Duplication and Correlates with Conserved Noncoding Sequences in Arabidopsis

PubMed Central

Berke, Lidija; Snel, Berend

2014-01-01

The histone modification H3K27me3 is involved in repression of transcription and plays a crucial role in developmental transitions in both animals and plants. It is deposited by PRC2 (Polycomb repressive complex 2), a conserved protein complex. In Arabidopsis thaliana, H3K27me3 is found at 15% of all genes. These tend to encode transcription factors and other regulators important for development. However, it is not known how PRC2 is recruited to target loci nor how this set of target genes arose during Arabidopsis evolution. To resolve the latter, we integrated A. thaliana gene families with five independent genome-wide H3K27me3 data sets. Gene families were either significantly enriched or depleted of H3K27me3, showing a strong impact of shared ancestry to H3K27me3 distribution. To quantify this, we performed ancestral state reconstruction of H3K27me3 on phylogenetic trees of gene families. The set of H3K27me3-marked genes changed less than expected by chance, suggesting that H3K27me3 was retained after gene duplication. This retention suggests that the PRC2-recruiting signal could be encoded in the DNA and also conserved among certain duplicated genes. Indeed, H3K27me3-marked genes were overrepresented among paralogs sharing conserved noncoding sequences (CNSs) that are enriched with transcription factor binding sites. The association of upstream CNSs with H3K27me3-marked genes represents the first genome-wide connection between H3K27me3 and potential regulatory elements in plants. Thus, we propose that CNSs likely function as part of the PRC2 recruitment in plants. PMID:24567304

Identification of a factor in HeLa cells specific for an upstream transcriptional control sequence of an EIA-inducible adenovirus promoter and its relative abundance in infected and uninfected cells.

PubMed Central

SivaRaman, L; Subramanian, S; Thimmappaya, B

1986-01-01

Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943

The heptanucleotide motif GAGACGC is a key component of a cis-acting promoter element that is critical for SnSAG1 expression in Sarcocystis neurona.

PubMed

Gaji, Rajshekhar Y; Howe, Daniel K

2009-07-01

The apicomplexan parasite Sarcocystis neurona undergoes a complex process of intracellular development, during which many genes are temporally regulated. The described study was undertaken to begin identifying the basic promoter elements that control gene expression in S. neurona. Sequence analysis of the 5'-flanking region of five S. neurona genes revealed a conserved heptanucleotide motif GAGACGC that is similar to the WGAGACG motif described upstream of multiple genes in Toxoplasma gondii. The promoter region for the major surface antigen gene SnSAG1, which contains three heptanucleotide motifs within 135 bases of the transcription start site, was dissected by functional analysis using a dual luciferase reporter assay. These analyses revealed that a minimal promoter fragment containing all three motifs was sufficient to drive reporter molecule expression, with the presence and orientation of the 5'-most heptanucleotide motif being absolutely critical for promoter function. Further studies should help to identify additional sequence elements important for promoter function and for controlling gene expression during intracellular development by this apicomplexan pathogen.

Genetic variations associated with six-white-point coat pigmentation in Diannan small-ear pigs

PubMed Central

Lü, Meng-Die; Han, Xu-Man; Ma, Yun-Fei; Irwin, David M.; Gao, Yun; Deng, Jia-Kun; Adeola, Adeniyi C.; Xie, Hai-Bing; Zhang, Ya-Ping

2016-01-01

A common phenotypic difference among domestic animals is variation in coat color. Six-white-point is a pigmentation pattern observed in varying pig breeds, which seems to have evolved through several different mechanistic pathways. Herein, we re-sequenced whole genomes of 31 Diannan small-ear pigs from China and found that the six-white-point coat color in Diannan small-ear pigs is likely regulated by polygenic loci, rather than by the MC1R locus. Strong associations were observed at three loci (EDNRB, CNTLN, and PINK1), which explain about 20 percent of the total coat color variance in the Diannan small-ear pigs. We found a mutation that is highly differentiated between six-white-point and black Diannan small-ear pigs, which is located in a conserved noncoding sequence upstream of the EDNRB gene and is a putative binding site of the CEBPB protein. This study advances our understanding of coat color evolution in Diannan small-ear pigs and expands our traditional knowledge of coat color being a monogenic trait. PMID:27270507

Structure of the horseradish peroxidase isozyme C genes.

PubMed

Fujiyama, K; Takemura, H; Shibayama, S; Kobayashi, K; Choi, J K; Shinmyo, A; Takano, M; Yamada, Y; Okada, H

1988-05-02

We have isolated, cloned and characterized three cDNAs and two genomic DNAs corresponding to the mRNAs and genes for the horseradish (Armoracia rusticana) peroxidase isoenzyme C (HPR C). The amino acid sequence of HRP C1, deduced from the nucleotide sequence of one of the cDNA clone, pSK1, contained the same primary sequence as that of the purified enzyme established by Welinder [FEBS Lett. 72, 19-23 (1976)] with additional sequences at the N and C terminal. All three inserts in the cDNA clones, pSK1, pSK2 and pSK3, coded the same size of peptide (308 amino acid residues) if these are processed in the same way, and the amino acid sequence were homologous to each other by 91-94%. Functional amino acids, including His40, His170, Tyr185 and Arg183 and S-S-bond-forming Cys, were conserved in the three isozymes, but a few N-glycosylation sites were not the same. Two HRP C isoenzyme genomic genes, prxC1 and prxC2, were tandem on the chromosomal DNA and each gene consisted of four exons and three introns. The positions in the exons interrupted by introns were the same in two genes. We observed a putative promoter sequence 5' upstream and a poly(A) signal 3' downstream in both genes. The gene product of prxC1 might be processed with a signal sequence of 30 amino acid residues at the N terminus and a peptide consisting of 15 amino acid residues at the C terminus.

An Upstream Open Reading Frame Is Essential for Feedback Regulation of Ascorbate Biosynthesis in Arabidopsis

PubMed Central

Laing, William A.; Martínez-Sánchez, Marcela; Wright, Michele A.; Bulley, Sean M.; Brewster, Di; Dare, Andrew P.; Rassam, Maysoon; Wang, Daisy; Storey, Roy; Macknight, Richard C.; Hellens, Roger P.

2015-01-01

Ascorbate (vitamin C) is an essential antioxidant and enzyme cofactor in both plants and animals. Ascorbate concentration is tightly regulated in plants, partly to respond to stress. Here, we demonstrate that ascorbate concentrations are determined via the posttranscriptional repression of GDP-l-galactose phosphorylase (GGP), a major control enzyme in the ascorbate biosynthesis pathway. This regulation requires a cis-acting upstream open reading frame (uORF) that represses the translation of the downstream GGP open reading frame under high ascorbate concentration. Disruption of this uORF stops the ascorbate feedback regulation of translation and results in increased ascorbate concentrations in leaves. The uORF is predicted to initiate at a noncanonical codon (ACG rather than AUG) and encode a 60- to 65-residue peptide. Analysis of ribosome protection data from Arabidopsis thaliana showed colocation of high levels of ribosomes with both the uORF and the main coding sequence of GGP. Together, our data indicate that the noncanonical uORF is translated and encodes a peptide that functions in the ascorbate inhibition of translation. This posttranslational regulation of ascorbate is likely an ancient mechanism of control as the uORF is conserved in GGP genes from mosses to angiosperms. PMID:25724639

An upstream open reading frame is essential for feedback regulation of ascorbate biosynthesis in Arabidopsis.

PubMed

Laing, William A; Martínez-Sánchez, Marcela; Wright, Michele A; Bulley, Sean M; Brewster, Di; Dare, Andrew P; Rassam, Maysoon; Wang, Daisy; Storey, Roy; Macknight, Richard C; Hellens, Roger P

2015-03-01

Ascorbate (vitamin C) is an essential antioxidant and enzyme cofactor in both plants and animals. Ascorbate concentration is tightly regulated in plants, partly to respond to stress. Here, we demonstrate that ascorbate concentrations are determined via the posttranscriptional repression of GDP-l-galactose phosphorylase (GGP), a major control enzyme in the ascorbate biosynthesis pathway. This regulation requires a cis-acting upstream open reading frame (uORF) that represses the translation of the downstream GGP open reading frame under high ascorbate concentration. Disruption of this uORF stops the ascorbate feedback regulation of translation and results in increased ascorbate concentrations in leaves. The uORF is predicted to initiate at a noncanonical codon (ACG rather than AUG) and encode a 60- to 65-residue peptide. Analysis of ribosome protection data from Arabidopsis thaliana showed colocation of high levels of ribosomes with both the uORF and the main coding sequence of GGP. Together, our data indicate that the noncanonical uORF is translated and encodes a peptide that functions in the ascorbate inhibition of translation. This posttranslational regulation of ascorbate is likely an ancient mechanism of control as the uORF is conserved in GGP genes from mosses to angiosperms. © 2015 American Society of Plant Biologists. All rights reserved.

CHST6 mutations in North American subjects with macular corneal dystrophy: a comprehensive molecular genetic review.

PubMed

Klintworth, Gordon K; Smith, Clayton F; Bowling, Brandy L

2006-03-10

To evaluate mutations in the carbohydrate sulfotransferase-6 (CHST6) gene in American subjects with macular corneal dystrophy (MCD). We analyzed CHST6 in 57 patients from 31 families with MCD from the United States, 57 carriers (parents or children), and 27 unaffected blood relatives of affected subjects. We compared the observed nucleotide sequences with those found by numerous investigators in other populations with MCD and in controls. In 24 families, the corneal disorder could be explained by mutations in the coding region of CHST6 or in the region upstream of this gene in both the maternal and paternal chromosome. In most instances of MCD a homozygous or heterozygous missense mutation in exon 3 of CHST6 was found. Six cases resulted from a deletion upstream of CHST6. Nucleotide changes within the coding region of CHST6 are predicted to alter the encoded protein significantly within evolutionary conserved parts of the encoded sulfotransferase. Our findings support the hypothesis that CHST6 mutations are cardinal to the pathogenesis of MCD. Moreover, the observation that some cases of MCD cannot be explained by mutations in CHST6 suggests that MCD may result from other subtle changes in CHST6 or from genetic heterogeneity.

The Pochonia chlamydosporia serine protease gene vcp1 is subject to regulation by carbon, nitrogen and pH: implications for nematode biocontrol.

PubMed

Ward, Elaine; Kerry, Brian R; Manzanilla-López, Rosa H; Mutua, Gerald; Devonshire, Jean; Kimenju, John; Hirsch, Penny R

2012-01-01

The alkaline serine protease VCP1 of the fungus Pochonia chlamydosporia belongs to a family of subtilisin-like enzymes that are involved in infection of nematode and insect hosts. It is involved early in the infection process, removing the outer proteinaceous vitelline membrane of nematode eggs. Little is known about the regulation of this gene, even though an understanding of how nutrients and other factors affect its expression is critical for ensuring its efficacy as a biocontrol agent. This paper provides new information on the regulation of vcp1 expression. Sequence analysis of the upstream regulatory region of this gene in 30 isolates revealed that it was highly conserved and contained sequence motifs characteristic of genes that are subject to carbon, nitrogen and pH-regulation. Expression studies, monitoring enzyme activity and mRNA, confirmed that these factors affect VCP1 production. As expected, glucose reduced VCP1 expression and for a few hours so did ammonium chloride. Surprisingly, however, by 24 h VCP1 levels were increased in the presence of ammonium chloride for most isolates. Ambient pH also regulated VCP1 expression, with most isolates producing more VCP1 under alkaline conditions. There were some differences in the response of one isolate with a distinctive upstream sequence including a variant regulatory-motif profile. Cryo-scanning electron microscopy studies indicated that the presence of nematode eggs stimulates VCP1 production by P. chlamydosporia, but only where the two are in close contact. Overall, the results indicate that readily-metabolisable carbon sources and unfavourable pH in the rhizosphere/egg-mass environment may compromise nematode parasitism by P. chlamydosporia. However, contrary to previous indications using other nematophagous and entomopathogenic fungi, ammonium nitrate (e.g. from fertilizers) may enhance biocontrol potential in some circumstances.

Identification of a precursor genomic segment that provided a sequence unique to glycophorin B and E genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Onda, M.; Kudo, S.; Fukuda, M.

Human glycophorin A, B, and E (GPA, GPB, and GPE) genes belong to a gene family located at the long arm of chromosome 4. These three genes are homologous from the 5'-flanking sequence to the Alu sequence, which is 1 kb downstream from the exon encoding the transmembrane domain. Analysis of the Alu sequence and flanking direct repeat sequences suggested that the GPA gene most closely resembles the ancestral gene, whereas the GPB and GPE gene arose by homologous recombination within the Alu sequence, acquiring 3' sequences from an unrelated precursor genomic segment. Here the authors describe the identification ofmore » this putative precursor genomic segment. A human genomic library was screened by using the sequence of the 3' region of the GPB gene as a probe. The genomic clones isolated were found to contain an Alu sequence that appeared to be involved in the recombination. Downstream from the Alu sequence, the nucleotide sequence of the precursor genomic segment is almost identical to that of the GPB or GPE gene. In contrast, the upstream sequence of the genomic segment differs entirely from that of the GPA, GPB, and GPE genes. Conservation of the direct repeats flanking the Alu sequence of the genomic segment strongly suggests that the sequence of this genomic segment has been maintained during evolution. This identified genomic segment was found to reside downstream from the GPA gene by both gene mapping and in situ chromosomal localization. The precursor genomic segment was also identified in the orangutan genome, which is known to lack GPB and GPE genes. These results indicate that one of the duplicated ancestral glycophorin genes acquired a unique 3' sequence by unequal crossing-over through its Alu sequence and the further downstream Alu sequence present in the duplicated gene. Further duplication and divergence of this gene yielded the GPB and GPE genes. 37 refs., 5 figs.« less

Distribution of CpG Motifs in Upstream Gene Domains in a Reef Coral and Sea Anemone: Implications for Epigenetics in Cnidarians.

PubMed

Marsh, Adam G; Hoadley, Kenneth D; Warner, Mark E

2016-01-01

Coral reefs are under assault from stressors including global warming, ocean acidification, and urbanization. Knowing how these factors impact the future fate of reefs requires delineating stress responses across ecological, organismal and cellular scales. Recent advances in coral reef biology have integrated molecular processes with ecological fitness and have identified putative suites of temperature acclimation genes in a Scleractinian coral Acropora hyacinthus. We wondered what unique characteristics of these genes determined their coordinate expression in response to temperature acclimation, and whether or not other corals and cnidarians would likewise possess these features. Here, we focus on cytosine methylation as an epigenetic DNA modification that is responsive to environmental stressors. We identify common conserved patterns of cytosine-guanosine dinucleotide (CpG) motif frequencies in upstream promoter domains of different functional gene groups in two cnidarian genomes: a coral (Acropora digitifera) and an anemone (Nematostella vectensis). Our analyses show that CpG motif frequencies are prominent in the promoter domains of functional genes associated with environmental adaptation, particularly those identified in A. hyacinthus. Densities of CpG sites in upstream promoter domains near the transcriptional start site (TSS) are 1.38x higher than genomic background levels upstream of -2000 bp from the TSS. The increase in CpG usage suggests selection to allow for DNA methylation events to occur more frequently within 1 kb of the TSS. In addition, observed shifts in CpG densities among functional groups of genes suggests a potential role for epigenetic DNA methylation within promoter domains to impact functional gene expression responses in A. digitifera and N. vectensis. Identifying promoter epigenetic sequence motifs among genes within specific functional groups establishes an approach to describe integrated cellular responses to environmental stress in reef corals and potential roles of epigenetics on survival and fitness in the face of global climate change.

H-NS Facilitates Sequence Diversification of Horizontally Transferred DNAs during Their Integration in Host Chromosomes

PubMed Central

Higashi, Koichi; Tobe, Toru; Kanai, Akinori; Uyar, Ebru; Ishikawa, Shu; Suzuki, Yutaka; Ogasawara, Naotake; Kurokawa, Ken; Oshima, Taku

2016-01-01

Bacteria can acquire new traits through horizontal gene transfer. Inappropriate expression of transferred genes, however, can disrupt the physiology of the host bacteria. To reduce this risk, Escherichia coli expresses the nucleoid-associated protein, H-NS, which preferentially binds to horizontally transferred genes to control their expression. Once expression is optimized, the horizontally transferred genes may actually contribute to E. coli survival in new habitats. Therefore, we investigated whether and how H-NS contributes to this optimization process. A comparison of H-NS binding profiles on common chromosomal segments of three E. coli strains belonging to different phylogenetic groups indicated that the positions of H-NS-bound regions have been conserved in E. coli strains. The sequences of the H-NS-bound regions appear to have diverged more so than H-NS-unbound regions only when H-NS-bound regions are located upstream or in coding regions of genes. Because these regions generally contain regulatory elements for gene expression, sequence divergence in these regions may be associated with alteration of gene expression. Indeed, nucleotide substitutions in H-NS-bound regions of the ybdO promoter and coding regions have diversified the potential for H-NS-independent negative regulation among E. coli strains. The ybdO expression in these strains was still negatively regulated by H-NS, which reduced the effect of H-NS-independent regulation under normal growth conditions. Hence, we propose that, during E. coli evolution, the conservation of H-NS binding sites resulted in the diversification of the regulation of horizontally transferred genes, which may have facilitated E. coli adaptation to new ecological niches. PMID:26789284

Genome Sequencing of Ralstonia solanacearum CQPS-1, a Phylotype I Strain Collected from a Highland Area with Continuous Cropping of Tobacco

PubMed Central

Liu, Ying; Tang, Yuanman; Qin, Xiyun; Yang, Liang; Jiang, Gaofei; Li, Shili; Ding, Wei

2017-01-01

Ralstonia solanacearum, an agent of bacterial wilt, is a highly variable species with a broad host range and wide geographic distribution. As a species complex, it has extensive genetic diversity and its living environment is polymorphic like the lowland and the highland area, so more genomes are needed for studying population evolution and environment adaptation. In this paper, we reported the genome sequencing of R. solanacearum strain CQPS-1 isolated from wilted tobacco in Pengshui, Chongqing, China, a highland area with severely acidified soil and continuous cropping of tobacco more than 20 years. The comparative genomic analysis among different R. solanacearum strains was also performed. The completed genome size of CQPS-1 was 5.89 Mb and contained the chromosome (3.83 Mb) and the megaplasmid (2.06 Mb). A total of 5229 coding sequences were predicted (the chromosome and megaplasmid encoded 3573 and 1656 genes, respectively). A comparative analysis with eight strains from four phylotypes showed that there was some variation among the species, e.g., a large set of specific genes in CQPS-1. Type III secretion system gene cluster (hrp gene cluster) was conserved in CQPS-1 compared with the reference strain GMI1000. In addition, most genes coding core type III effectors were also conserved with GMI1000, but significant gene variation was found in the gene ripAA: the identity compared with strain GMI1000 was 75% and the hrpII box promoter in the upstream had significantly mutated. This study provided a potential resource for further understanding of the relationship between variation of pathogenicity factors and adaptation to the host environment. PMID:28620361

H-NS Facilitates Sequence Diversification of Horizontally Transferred DNAs during Their Integration in Host Chromosomes.

PubMed

Higashi, Koichi; Tobe, Toru; Kanai, Akinori; Uyar, Ebru; Ishikawa, Shu; Suzuki, Yutaka; Ogasawara, Naotake; Kurokawa, Ken; Oshima, Taku

2016-01-01

Bacteria can acquire new traits through horizontal gene transfer. Inappropriate expression of transferred genes, however, can disrupt the physiology of the host bacteria. To reduce this risk, Escherichia coli expresses the nucleoid-associated protein, H-NS, which preferentially binds to horizontally transferred genes to control their expression. Once expression is optimized, the horizontally transferred genes may actually contribute to E. coli survival in new habitats. Therefore, we investigated whether and how H-NS contributes to this optimization process. A comparison of H-NS binding profiles on common chromosomal segments of three E. coli strains belonging to different phylogenetic groups indicated that the positions of H-NS-bound regions have been conserved in E. coli strains. The sequences of the H-NS-bound regions appear to have diverged more so than H-NS-unbound regions only when H-NS-bound regions are located upstream or in coding regions of genes. Because these regions generally contain regulatory elements for gene expression, sequence divergence in these regions may be associated with alteration of gene expression. Indeed, nucleotide substitutions in H-NS-bound regions of the ybdO promoter and coding regions have diversified the potential for H-NS-independent negative regulation among E. coli strains. The ybdO expression in these strains was still negatively regulated by H-NS, which reduced the effect of H-NS-independent regulation under normal growth conditions. Hence, we propose that, during E. coli evolution, the conservation of H-NS binding sites resulted in the diversification of the regulation of horizontally transferred genes, which may have facilitated E. coli adaptation to new ecological niches.

Degenerative minimalism in the genome of a psyllid endosymbiont.

PubMed

Clark, M A; Baumann, L; Thao, M L; Moran, N A; Baumann, P

2001-03-01

Psyllids, like aphids, feed on plant phloem sap and are obligately associated with prokaryotic endosymbionts acquired through vertical transmission from an ancestral infection. We have sequenced 37 kb of DNA of the genome of Carsonella ruddii, the endosymbiont of psyllids, and found that it has a number of unusual properties revealing a more extreme case of degeneration than was previously reported from studies of eubacterial genomes, including that of the aphid endosymbiont Buchnera aphidicola. Among the unusual properties are an exceptionally low guanine-plus-cytosine content (19.9%), almost complete absence of intergenic spaces, operon fusion, and lack of the usual promoter sequences upstream of 16S rDNA. These features suggest the synthesis of long mRNAs and translational coupling. The most extreme instances of base compositional bias occur in the genes encoding proteins that have less highly conserved amino acid sequences; the guanine-plus-cytosine content of some protein-coding sequences is as low as 10%. The shift in base composition has a large effect on proteins: in polypeptides of C. ruddii, half of the residues consist of five amino acids with codons low in guanine plus cytosine. Furthermore, the proteins of C. ruddii are reduced in size, with an average of about 9% fewer amino acids than in homologous proteins of related bacteria. These observations suggest that the C. ruddii genome is not subject to constraints that limit the evolution of other known eubacteria.

Complete sequence of Tvv1, a family of Ty 1 copia-like retrotransposons of Vitis vinifera L., reconstituted by chromosome walking.

PubMed

Pelsy, F.; Merdinoglu, D.

2002-09-01

A chromosome-walking strategy was used to sequence and characterize retrotransposons in the grapevine genome. The reconstitution of a family of retroelements, named Tvv1, was achieved by six successive steps. These elements share a single, highly conserved open reading frame 4,153 nucleotides-long, putatively encoding the gag, pro, int, rt and rh proteins. Comparison of the Tvv1 open reading frame coding potential with those of drosophila copia and tobacco Tnt1, revealed that Tvv1 is closely related to Ty 1 copia-like retrotransposons. A highly variable untranslated leader region, upstream of the open reading frame, allowed us to differentiate Tvv1 variants, which represent a family of at least 28 copies, in varying sizes. This internal region is flanked by two long terminal repeats in direct orientation, sized between 149 and 157 bp. Among elements theoretically sized from 4,970 to 5,550 bp, we describe the full-length sequence of a reference element Tvv1-1, 5,343 nucleotides-long. The full-length sequence of Tvv1-1 compared to pea PDR1 shows a 53.3% identity. In addition, both elements contain long terminal repeats of nearly the same size in which the U5 region could be entirely absent. Therefore, we assume that Tvv1 and PDR1 could constitute a particular class of short LTRs retroelements.

Harnessing Gene Conversion in Chicken B Cells to Create a Human Antibody Sequence Repertoire

PubMed Central

Schusser, Benjamin; Yi, Henry; Collarini, Ellen J.; Izquierdo, Shelley Mettler; Harriman, William D.; Etches, Robert J.; Leighton, Philip A.

2013-01-01

Transgenic chickens expressing human sequence antibodies would be a powerful tool to access human targets and epitopes that have been intractable in mammalian hosts because of tolerance to conserved proteins. To foster the development of the chicken platform, it is beneficial to validate transgene constructs using a rapid, cell culture-based method prior to generating fully transgenic birds. We describe a method for the expression of human immunoglobulin variable regions in the chicken DT40 B cell line and the further diversification of these genes by gene conversion. Chicken VL and VH loci were knocked out in DT40 cells and replaced with human VK and VH genes. To achieve gene conversion of human genes in chicken B cells, synthetic human pseudogene arrays were inserted upstream of the functional human VK and VH regions. Proper expression of chimeric IgM comprised of human variable regions and chicken constant regions is shown. Most importantly, sequencing of DT40 genetic variants confirmed that the human pseudogene arrays contributed to the generation of diversity through gene conversion at both the Igl and Igh loci. These data show that engineered pseudogene arrays produce a diverse pool of human antibody sequences in chicken B cells, and suggest that these constructs will express a functional repertoire of chimeric antibodies in transgenic chickens. PMID:24278246

Sequence and Genetic Characterization of etrA, an fnr Analog that Regulates Anaerobic Respiration in Shewanella putrefaciens MR-1

NASA Technical Reports Server (NTRS)

Saffarini, Daad A.; Nelson, Kenneth H.

1993-01-01

An electron transport regulatory gene, etrA, has been isolated and characterized from the obligate respiratory bacterium Shewanella putrefaciens MR-l. The deduced amino acid sequence of etrA (EtrA) shows a high degree of identity to both the Fnr of Escherichia coli (73.6%) and the analogous protein (ANR) of Pseudomonas aeruginosa (50.8%). The four active cysteine residues of Fnr are conserved in EtrA, and the amino acid sequence of the DNA-binding domains of the two proteins are identical. Further, S.putrefaciens etrA is able to complement an fnr mutant of E.coli. In contrast to fnr, there is no recognizable Fnr box upstream of the etrA sequence. Gene replacement etr.A mutants of MR-1 were deficient in growth on nitrite, thiosulfate, sulfite, trimethylamine-N-oxide, dimethyl sulfoxide, Fe(III), and fumarate, suggesting that EtrA is involved in the regulation of the corresponding reductase genes. However, the mutants were all positive for reduction of and growth on nitrate and Mn(IV), indicating that EtrA is not involved in the regulation of these two systems. Southern blots of S.putrefaciens DNA with use of etrA as a probe revealed the expected etrA bands and a second set of hybridization signals whose genetic and functional properties remain to be determined.

Cloning and sequence analysis of the Antheraea pernyi nucleopolyhedrovirus gp64 gene.

PubMed

Wang, Wenbing; Zhu, Shanying; Wang, Liqun; Yu, Feng; Shen, Weide

2005-12-01

Frequent outbreaks of the purulence disease of Chinese oak silkworm are reported in Middle and Northeast China. The disease is produced by the pathogen Antheraea pernyi nucleopolyhedrovirus (AnpeNPV). To obtain molecular information of the virus, the polyhedra of AnpeNPV were purified and characterized. The genomic DNA of AnpeNPV was extracted and digested with HindIII. The genome size of AnpeNPV is estimated at 128 kb. Based on the analysis of DNA fragments digested with HindIII, 23 fragments were bigger than 564 bp. A genomic library was generated using HindIII and the positive clones were sequenced and analysed. The gp64 gene, encoding the baculovirus envelope protein GP64, was found in an insert. The nucleotide sequence analysis indicated that the AnpeNPV gp64 gene consists of a 1,530 nucleotide open reading frame (ORF), encoding a protein of 509 amino acids. Of the eight gp64 homologues, the AnpeNPV gp64 ORF shared the most sequence similarity with the gp64 gene of Anticarsia gemmatalis NPV, but not Bombyx mori NPV. The upstream region of the AnpeNPV gp64 ORF encoded the conserved transcriptional elements for early and late stage of the viral infection cycle. These results indicated that AnpeNPV belongs to group I NPV and was far removed in molecular phylogeny from the BmNPV.

Distant sequences determine 5′ end formation of cox3 transcripts in Arabidopsis thaliana ecotype C24

PubMed Central

Forner, Joachim; Weber, Bärbel; Wiethölter, Caterina; Meyer, Rhonda C.; Binder, Stefan

2005-01-01

The genomic environments and the transcripts of the mitochondrial cox3 gene are investigated in three Arabidopsis thaliana ecotypes. While the proximate 5′ sequences up to nucleotide position −584, the coding regions and the 3′ flanking regions are identical in Columbia (Col), C24 and Landsberg erecta (Ler), genomic variation is detected in regions further upstream. In the mitochondrial DNA of Col, a 1790 bp fragment flanked by a nonanucleotide direct repeat is present beyond position −584 with respect to the ATG. While in Ler only part of this insertion is conserved, this sequence is completely absent in C24, except for a single copy of the nonanucleotide direct repeat. Northern hybridization reveals identical major transcripts in the three ecotypes, but identifies an additional abundant 60 nt larger mRNA species in C24. The extremities of the most abundant mRNA species are identical in the three ecotypes. In C24, an extra major 5′ end is abundant. This terminus and the other major 5′ ends are located in identical sequence regions. Inspection of Atcox3 transcripts in C24/Col hybrids revealed a female inheritance of the mRNA species with the extra 5′ terminus. Thus, a mitochondrially encoded factor determines the generation of an extra 5′ mRNA end. PMID:16107557

Isolation and characterization of a water stress-specific genomic gene, pwsi 18, from rice.

PubMed

Joshee, N; Kisaka, H; Kitagawa, Y

1998-01-01

One of the water stress-specific cDNA clones of rice characterised previously, wsi18, was selected for further study. The wsi18 gene can be induced by water stress conditions such as mannitol, NaCl, and dryness, but not by ABA, cold, or heat. A genomic clone for wsi18, pwsi18, contained about 1.7 kbp of the 5' upstream sequence, two introns, and the full coding sequence. The 5'-upstream sequence of pwsi18 contained putative cis-acting elements, namely an ABA-responsive element (ABRE), three G-boxes, three E-boxes, a MEF-2 sequence, four direct and two inverted repeats, and four sequences similar to DRE, which is involved in the dehydration response of Arabidopsis genes. The gusA reporter gene under the control of the pwsi18 promoter showed transient expression in response to water stress. Deletion of the downstream DRE-like sequence between the distal G-boxes-2 and -3 resulted in rather low GUS expression.

Conserved regulatory elements of the promoter sequence of the gene rpoH of enteric bacteria

PubMed Central

Ramírez-Santos, Jesús; Collado-Vides, Julio; García-Varela, Martin; Gómez-Eichelmann, M. Carmen

2001-01-01

The rpoH regulatory region of different members of the enteric bacteria family was sequenced or downloaded from GenBank and compared. In addition, the transcriptional start sites of rpoH of Yersinia frederiksenii and Proteus mirabilis, two distant members of this family, were determined. Sequences similar to the σ70 promoters P1, P4 and P5, to the σE promoter P3 and to boxes DnaA1, DnaA2, cAMP receptor protein (CRP) boxes CRP1, CRP2 and box CytR present in Escherichia coli K12, were identified in sequences of closely related bacteria such as: E.coli, Shigella flexneri, Salmonella enterica serovar Typhimurium, Citrobacter freundii, Enterobacter cloacae and Klebsiella pneumoniae. In more distant bacteria, Y.frederiksenii and P.mirabilis, the rpoH regulatory region has a distal P1-like σ70 promoter and two proximal promoters: a heat-induced σE-like promoter and a σ70 promoter. Sequences similar to the regulatory boxes were not identified in these bacteria. This study suggests that the general pattern of transcription of the rpoH gene in enteric bacteria includes a distal σ70 promoter, >200 nt upstream of the initiation codon, and two proximal promoters: a heat-induced σE-like promoter and a σ70 promoter. A second proximal σ70 promoter under catabolite-regulation is probably present only in bacteria closely related to E.coli. PMID:11139607

Functional identification and regulatory analysis of Δ6-fatty acid desaturase from the oleaginous fungus Mucor sp. EIM-10.

PubMed

Jiang, Xianzhang; Liu, Hongjiao; Niu, Yongchao; Qi, Feng; Zhang, Mingliang; Huang, Jianzhong

2017-03-01

To enlarge the diversity of the desaturases associated with PUFA biosynthesis and to better understand the transcriptional regulation of desaturases, a Δ 6 -desaturase gene (Md6) from Mucor sp. and its 5'-upstream sequence was functionally identified in Saccharomyces cerevisiae. Expression of the Δ 6 -fatty acid desaturase (Md6) in S. cerevisiae showed that Md6 could convert linolenic acid to γ-linolenic acid. Computational analysis of the promoter of Md6 suggested it contains several eukaryotic fundamental transcription regulatory elements. In vivo functional analysis of the promoter showed the 5'-upstream sequence of Md6 could initiate expression of GFP and Md6 itself in S. cerevisiae. A series deletion analysis of the promoter suggested that sequence between -919 to -784 bp (relative to start site) named as eMd6 is the key factor for high activity of Δ 6 -desaturase. The activity of Δ 6 -desaturase was increased by 2.8-fold and 2.5-fold when the eMd6 sequence was placed upstream of -434 with forward or reverse orientations respectively. To our best knowledge, the native promoter of Md6 from Mucor is the strongest promoter for Δ 6 -desaturase reported so far and the sequence between -919 to -784 bp is an enhancer for Δ 6 -desaturase activity.

[Analysis of cis-regulatory element distribution in gene promoters of Gossypium raimondii and Arabidopsis thaliana].

PubMed

Sun, Gao-Fei; He, Shou-Pu; Du, Xiong-Ming

2013-10-01

Cotton genomic studies have boomed since the release of Gossypium raimondii draft genome. In this study, cis-regulatory element (CRE) in 1 kb length sequence upstream 5' UTR of annotated genes were selected and scanned in the Arabidopsis thaliana (At) and Gossypium raimondii (Gr) genomes, based on the database of PLACE (Plant cis-acting Regulatory DNA Elements). According to the definition of this study, 44 (12.3%) and 57 (15.5%) CREs presented "peak-like" distribution in the 1 kb selected sequences of both genomes, respectively. Thirty-four of them were peak-like distributed in both genomes, which could be further categorized into 4 types based on their core sequences. The coincidence of TATABOX peak position and their actual position ((-) -30 bp) indicated that the position of a common CRE was conservative in different genes, which suggested that the peak position of these CREs was their possible actual position of transcription factors. The position of a common CRE was also different between the two genomes due to stronger length variation of 5' UTR in Gr than At. Furthermore, most of the peak-like CREs were located in the region of -110 bp-0 bp, which suggested that concentrated distribution might be conductive to the interaction of transcription factors, and then regulate the gene expression in downstream.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Single-stranded DNA Binding by the Helix-Hairpin-Helix Domain of XPF Protein Contributes to the Substrate Specificity of the ERCC1-XPF Protein Complex*

PubMed Central

Das, Devashish; Faridounnia, Maryam; Kovacic, Lidija; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.

2017-01-01

The nucleotide excision repair protein complex ERCC1-XPF is required for incision of DNA upstream of DNA damage. Functional studies have provided insights into the binding of ERCC1-XPF to various DNA substrates. However, because no structure for the ERCC1-XPF-DNA complex has been determined, the mechanism of substrate recognition remains elusive. Here we biochemically characterize the substrate preferences of the helix-hairpin-helix (HhH) domains of XPF and ERCC-XPF and show that the binding to single-stranded DNA (ssDNA)/dsDNA junctions is dependent on joint binding to the DNA binding domain of ERCC1 and XPF. We reveal that the homodimeric XPF is able to bind various ssDNA sequences but with a clear preference for guanine-containing substrates. NMR titration experiments and in vitro DNA binding assays also show that, within the heterodimeric ERCC1-XPF complex, XPF specifically recognizes ssDNA. On the other hand, the HhH domain of ERCC1 preferentially binds dsDNA through the hairpin region. The two separate non-overlapping DNA binding domains in the ERCC1-XPF heterodimer jointly bind to an ssDNA/dsDNA substrate and, thereby, at least partially dictate the incision position during damage removal. Based on structural models, NMR titrations, DNA-binding studies, site-directed mutagenesis, charge distribution, and sequence conservation, we propose that the HhH domain of ERCC1 binds to dsDNA upstream of the damage, and XPF binds to the non-damaged strand within a repair bubble. PMID:28028171

Efficient activation of transcription in yeast by the BPV1 E2 protein.

PubMed Central

Stanway, C A; Sowden, M P; Wilson, L E; Kingsman, A J; Kingsman, S M

1989-01-01

The full-length gene product encoded by the E2 open reading frame (ORF) of bovine papillomavirus type 1 (BPV1) is a transcriptional transactivator. It is believed to mediate its effect on the BPV1 long control region (LCR) by binding to motifs with the consensus sequence ACCN6GGT. The minimal functional cis active site, called the E2 response element (E2RE), in mammalian cells comprises two copies of this motif. Here we have shown that E2 can function in Saccharomyces cerevisiae by placing an E2RE upstream of a synthetic yeast assay promoter which consists of a TATA motif and an mRNA initiation site, spaced correctly. This E2RE-minimal promoter is only transcriptionally active in the presence of E2 protein and the resulting mRNA is initiated at the authentic start site. This is the first report of a mammalian viral transactivator functioning in yeast. The level of activation by E2 via the E2RE was the same as observed with the highly efficient authentic PGK promoter where the upstream activation sequence is composed of three distinct elements. Furthermore a single E2 motif which is insufficient in mammalian cells as an activation site was as efficiently utilized in yeast as the E2RE (2 motifs). Previous studies have shown that mammalian cellular activators can function in yeast and our data now extend this to viral-specific activators. Our data indicate however that while the mechanism of transactivation is broadly conserved there may be significant differences at the detailed level. Images PMID:2539584

Cyclic nucleotide-gated ion channel gene family in rice, identification, characterization and experimental analysis of expression response to plant hormones, biotic and abiotic stresses.

PubMed

Nawaz, Zarqa; Kakar, Kaleem Ullah; Saand, Mumtaz A; Shu, Qing-Yao

2014-10-04

Cyclic nucleotide-gated channels (CNGCs) are Ca2+-permeable cation transport channels, which are present in both animal and plant systems. They have been implicated in the uptake of both essential and toxic cations, Ca2+ signaling, pathogen defense, and thermotolerance in plants. To date there has not been a genome-wide overview of the CNGC gene family in any economically important crop, including rice (Oryza sativa L.). There is an urgent need for a thorough genome-wide analysis and experimental verification of this gene family in rice. In this study, a total of 16 full length rice CNGC genes distributed on chromosomes 1-6, 9 and 12, were identified by employing comprehensive bioinformatics analyses. Based on phylogeny, the family of OsCNGCs was classified into four major groups (I-IV) and two sub-groups (IV-A and IV- B). Likewise, the CNGCs from all plant lineages clustered into four groups (I-IV), where group II was conserved in all land plants. Gene duplication analysis revealed that both chromosomal segmentation (OsCNGC1 and 2, 10 and 11, 15 and 16) and tandem duplications (OsCNGC1 and 2) significantly contributed to the expansion of this gene family. Motif composition and protein sequence analysis revealed that the CNGC specific domain "cyclic nucleotide-binding domain (CNBD)" comprises a "phosphate binding cassette" (PBC) and a "hinge" region that is highly conserved among the OsCNGCs. In addition, OsCNGC proteins also contain various other functional motifs and post-translational modification sites. We successively built a stringent motif: (LI-X(2)-[GS]-X-[FV]-X-G-[1]-ELL-X-W-X(12,22)-SA-X(2)-T-X(7)-[EQ]-AF-X-L) that recognizes the rice CNGCs specifically. Prediction of cis-acting regulatory elements in 5' upstream sequences and expression analyses through quantitative qPCR demonstrated that OsCNGC genes were highly responsive to multiple stimuli including hormonal (abscisic acid, indoleacetic acid, kinetin and ethylene), biotic (Pseudomonas fuscovaginae and Xanthomonas oryzae pv. oryzae) and abiotic (cold) stress. There are 16 CNGC genes in rice, which were probably expanded through chromosomal segmentation and tandem duplications and comprise a PBC and a "hinge" region in the CNBD domain, featured by a stringent motif. The various cis-acting regulatory elements in the upstream sequences may be responsible for responding to multiple stimuli, including hormonal, biotic and abiotic stresses.

Metagenomic Analysis of Ammonia-Oxidizing Archaea Affiliated with the Soil Group

PubMed Central

Bartossek, Rita; Spang, Anja; Weidler, Gerhard; Lanzen, Anders; Schleper, Christa

2012-01-01

Ammonia-oxidizing archaea (AOA) have recently been recognized as a significant component of many microbial communities and represent one of the most abundant prokaryotic groups in the biosphere. However, only few AOA have been successfully cultivated so far and information on the physiology and genomic content remains scarce. We have performed a metagenomic analysis to extend the knowledge of the AOA affiliated with group I.1b that is widespread in terrestrial habitats and of which no genome sequences has been described yet. A fosmid library was generated from samples of a radioactive thermal cave (46°C) in the Austrian Central Alps in which AOA had been found as a major part of the microbial community. Out of 16 fosmids that possessed either an amoA or 16S rRNA gene affiliating with AOA, 5 were fully sequenced, 4 of which grouped with the soil/I.1b (Nitrososphaera-) lineage, and 1 with marine/I.1a (Nitrosopumilus-) lineage. Phylogenetic analyses of amoBC and an associated conserved gene were congruent with earlier analyses based on amoA and 16S rRNA genes and supported the separation of the soil and marine group. Several putative genes that did not have homologs in currently available marine Thaumarchaeota genomes indicated that AOA of the soil group contain specific genes that are distinct from their marine relatives. Potential cis-regulatory elements around conserved promoter motifs found upstream of the amo genes in sequenced (meta-) genomes differed in marine and soil group AOA. On one fosmid, a group of genes including amoA and amoB were flanked by identical transposable insertion sequences, indicating that amoAB could potentially be co-mobilized in the form of a composite transposon. This might be one of the mechanisms that caused the greater variation in gene order compared to genomes in the marine counterparts. Our findings highlight the genetic diversity within the two major and widespread lineages of Thaumarchaeota. PMID:22723795

Sequence Requirements of the 5-Enolpyruvylshikimate-3-phosphate Synthase 5[prime]-Upstream Region for Tissue-Specific Expression in Flowers and Seedlings.

PubMed Central

Benfey, PN; Takatsuji, H; Ren, L; Shah, DM; Chua, NH

1990-01-01

We have analyzed expression from deletion derivatives of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) 5[prime]-upstream region in transgenic petunia flowers and seedlings. In seedlings, expression was strongest in root cortex cells and in trichomes. High-level expression in petals and in seedling roots was conferred by large (>500 base-pair) stretches of sequence, but was lost when smaller fragments were analyzed individually. This apparent requirement for extensive sequence suggests that combinations of cis-elements that are widely separated control tissue-specific expression from the EPSPS promoter. We have also used the high-level, petal-specific expression of the EPSPS promoter to change petal color in two mutant petunia lines. PMID:12354968

The primary structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase.

PubMed Central

Hitzeman, R A; Hagie, F E; Hayflick, J S; Chen, C Y; Seeburg, P H; Derynck, R

1982-01-01

The DNA sequence of the gene for the yeast glycolytic enzyme, 3-phosphoglycerate kinase (PGK), has been obtained by sequencing part of a 3.1 kbp HindIII fragment obtained from the yeast genome. The structural gene sequence corresponds to a reading frame of 1251 bp coding for 416 amino acids with no intervening DNA sequences. The amino acid sequence is approximately 65 percent homologous with human and horse PGK protein sequences and is in general agreement with the published protein sequence for yeast PGK. As for other highly expressed structural genes in yeast, the coding sequence is highly codon biased with 95 percent of the amino acids coded for by a select 25 codons (out of 61 possible). Besides structural DNA sequence, 291 bp of 5'-flanking sequence and 286 bp of 3'-flanking sequence were determined. Transcription starts 36 nucleotides upstream from the translational start and stops 86-93 nucleotides downstream from the translational stop. These results suggest a non-polyadenylated mRNA length of 1373 to 1380 nucleotides, which is consistent with the observed length of 1500 nucleotides for polyadenylated PGK mRNA. A sequence TATATATAAA is found at 145 nucleotides upstream from the translational start. This sequence resembles the TATAAA box that is possibly associated with RNA polymerase II binding. Images PMID:6296791

The katG mRNA of Mycobacterium tuberculosis and Mycobacterium smegmatis is processed at its 5' end and is stabilized by both a polypurine sequence and translation initiation

PubMed Central

Sala, Claudia; Forti, Francesca; Magnoni, Francesca; Ghisotti, Daniela

2008-01-01

Background In Mycobacterium tuberculosis and in Mycobacterium smegmatis the furA-katG loci, encoding the FurA regulatory protein and the KatG catalase-peroxidase, are highly conserved. In M. tuberculosis furA-katG constitute a single operon, whereas in M. smegmatis a single mRNA covering both genes could not be found. In both species, specific 5' ends have been identified: the first one, located upstream of the furA gene, corresponds to transcription initiation from the furA promoter; the second one is the katG mRNA 5' end, located in the terminal part of furA. Results In this work we demonstrate by in vitro transcription and by RNA polymerase Chromatin immunoprecipitation that no promoter is present in the M. smegmatis region covering the latter 5' end, suggesting that it is produced by specific processing of longer transcripts. Several DNA fragments of M. tuberculosis and M. smegmatis were inserted in a plasmid between the sigA promoter and the lacZ reporter gene, and expression of the reporter gene was measured. A polypurine sequence, located four bp upstream of the katG translation start codon, increased beta-galactosidase activity and stabilized the lacZ transcript. Mutagenesis of this sequence led to destabilization of the mRNA. Analysis of constructs, in which the polypurine sequence of M. smegmatis was followed by an increasing number of katG codons, demonstrated that mRNA stability requires translation of at least 20 amino acids. In order to define the requirements for the 5' processing of the katG transcript, we created several mutations in this region and analyzed the 5' ends of the transcripts: the distance from the polypurine sequence does not seem to influence the processing, neither the sequence around the cutting point. Only mutations which create a double stranded region around the processing site prevented RNA processing. Conclusion This is the first reported case in mycobacteria, in which both a polypurine sequence and translation initiation are shown to contribute to mRNA stability. The furA-katG mRNA is transcribed from the furA promoter and immediately processed; this processing is prevented by a double stranded RNA at the cutting site, suggesting that the endoribonuclease responsible for the cleavage cuts single stranded RNA. PMID:18394163

Analysis of eight out genes in a cluster required for pectic enzyme secretion by Erwinia chrysanthemi: sequence comparison with secretion genes from other gram-negative bacteria.

PubMed Central

Lindeberg, M; Collmer, A

1992-01-01

Many extracellular proteins produced by Erwinia chrysanthemi require the out gene products for transport across the outer membrane. In a previous report (S. Y. He, M. Lindeberg, A. K. Chatterjee, and A. Collmer, Proc. Natl. Acad. Sci. USA 88:1079-1083, 1991) cosmid pCPP2006, sufficient for secretion of Erwinia chrysanthemi extracellular proteins by Escherichia coli, was partially sequenced, revealing four out genes sharing high homology with pulH through pulK from Klebsiella oxytoca. The nucleotide sequence of eight additional out genes reveals homology with pulC through pulG, pulL, pulM, pulO, and other genes involved in secretion by various gram-negative bacteria. Although signal sequences and hydrophobic regions are generally conserved between Pul and Out proteins, four out genes contain unique inserts, a pulN homolog is not present, and outO appears to be transcribed separately from outC through outM. The sequenced region was subcloned, and an additional 7.6-kb region upstream was identified as being required for secretion in E. coli. out gene homologs were found on Erwinia carotovora cosmid clone pAKC651 but were not detected in E. coli. The outC-through-outM operon is weakly induced by polygalacturonic acid and strongly expressed in the early stationary phase. The out and pul genes are highly similar in sequence, hydropathic properties, and overall arrangement but differ in both transcriptional organization and the nature of their induction. Images PMID:1429461

DENSITY FLUCTUATIONS UPSTREAM AND DOWNSTREAM OF INTERPLANETARY SHOCKS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pitňa, A.; Šafránková, J.; Němeček, Z.

2016-03-01

Interplanetary (IP) shocks as typical large-scale disturbances arising from processes such as stream–stream interactions or Interplanetary Coronal Mass Ejection (ICME) launching play a significant role in the energy redistribution, dissipation, particle heating, acceleration, etc. They can change the properties of the turbulent cascade on shorter scales. We focus on changes of the level and spectral properties of ion flux fluctuations upstream and downstream of fast forward oblique shocks. Although the fluctuation level increases by an order of magnitude across the shock, the spectral slope in the magnetohydrodynamic range is conserved. The frequency spectra upstream of IP shocks are the same as those inmore » the solar wind (if not spoiled by foreshock waves). The spectral slopes downstream are roughly proportional to the corresponding slopes upstream, suggesting that the properties of the turbulent cascade are conserved across the shock; thus, the shock does not destroy the shape of the spectrum as turbulence passes through it. Frequency spectra downstream of IP shocks often exhibit “an exponential decay” in the ion kinetic range that was earlier reported at electron scales in the solar wind or at ion scales in the interstellar medium. We suggest that the exponential shape of ion flux spectra in this range is caused by stronger damping of the fluctuations in the downstream region.« less

Identification of a second flagellin gene and functional characterization of a sigma70-like promoter upstream of a Leptospira borgpetersenii flaB gene.

PubMed

Lin, Min; Dan, Hanhong; Li, Yijing

2004-02-01

Leptospira borgpetersenii, one of the causative agents of leptospirosis in both animals and humans, is a bacterial pathogen with characteristic motility that is mediated by the rotation of two periplasmic flagella (PF). The flaB gene coding for a core polypeptide subunit of PF was previously characterized by sequence analysis of its open reading frame (ORF) (M. Lin, J Biochem Mol Biol Biophys 2:181-187, 1999). The present study was undertaken to isolate and clone the uncharacterized sequence upstream of the flaB gene by using a PCR-based genome walking procedure. This has resulted in a 1470-bp genomic DNA sequence in which an 846-bp ORF coding for a 281-amino acid polypeptide (31.3 kDa) is identified 455 bp upstream from the flaB start codon. The encoded protein exhibits 72% amino acid identity to the deduced FlaB protein sequence of L. borgpetersenii and a high degree of sequence homology to the FlaB proteins of other spirochaetes. This has demonstrated for the first time that a second flaB gene homolog is present in a Leptospira species. The newly identified gene is designated flaB1, and the previously cloned flaB renamed flaB2. Within the intergenic sequence between flaB1 and flaB2, a potential stem-loop structure (12-bp inverted repeats) was identified 25 bp downstream of the flaB1 stop codon; this could serve as a transcription terminator for the flaB1 mRNA. Three E. coli-like promoter regions (I, II, and III) for binding Esigma(70), a regulatory sequence uncommonly found in flagellar genes, were predicted upstream of the flaB2 ORF. Only promoter region II contains a promoter that is functional in E. coli, as revealed at phenotypic and transcriptional levels by its capability of directing the expression of the chloramphenicol acetyltransferase (CAT) gene in the promoter probe vector pKK232-8. These observations may suggest that flaB1 and flaB2 are transcribed separately and do not form a transcriptional operon controlled by a single promoter.

Identification of a functional element in the promoter of the silkworm (Bombyx mori) fat body-specific gene Bmlp3.

PubMed

Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou

2014-08-01

30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.

Mammalian genome projects reveal new growth hormone (GH) sequences. Characterization of the GH-encoding genes of armadillo (Dasypus novemcinctus), hedgehog (Erinaceus europaeus), bat (Myotis lucifugus), hyrax (Procavia capensis), shrew (Sorex araneus), ground squirrel (Spermophilus tridecemlineatus), elephant (Loxodonta africana), cat (Felis catus) and opossum (Monodelphis domestica).

PubMed

Wallis, Michael

2008-01-15

Mammalian growth hormone (GH) sequences have been shown previously to display episodic evolution: the sequence is generally strongly conserved but on at least two occasions during mammalian evolution (on lineages leading to higher primates and ruminants) bursts of rapid evolution occurred. However, the number of mammalian orders studied previously has been relatively limited, and the availability of sequence data via mammalian genome projects provides the potential for extending the range of GH gene sequences examined. Complete or nearly complete GH gene sequences for six mammalian species for which no data were previously available have been extracted from the genome databases-Dasypus novemcinctus (nine-banded armadillo), Erinaceus europaeus (western European hedgehog), Myotis lucifugus (little brown bat), Procavia capensis (cape rock hyrax), Sorex araneus (European shrew), Spermophilus tridecemlineatus (13-lined ground squirrel). In addition incomplete data for several other species have been extended. Examination of the data in detail and comparison with previously available sequences has allowed assessment of the reliability of deduced sequences. Several of the new sequences differ substantially from the consensus sequence previously determined for eutherian GHs, indicating greater variability than previously recognised, and confirming the episodic pattern of evolution. The episodic pattern is not seen for signal sequences, 5' upstream sequence or synonymous substitutions-it is specific to the mature protein sequence, suggesting that it relates to the hormonal function. The substitutions accumulated during the course of GH evolution have occurred mainly on the side of the hormone facing away from the receptor, in a non-random fashion, and it is suggested that this may reflect interaction of the receptor-bound hormone with other proteins or small ligands.

The positive regulatory function of the 5'-proximal open reading frames in GCN4 mRNA can be mimicked by heterologous, short coding sequences.

PubMed Central

Williams, N P; Mueller, P P; Hinnebusch, A G

1988-01-01

Translational control of GCN4 expression in the yeast Saccharomyces cerevisiae is mediated by multiple AUG codons present in the leader of GCN4 mRNA, each of which initiates a short open reading frame of only two or three codons. Upstream AUG codons 3 and 4 are required to repress GCN4 expression in normal growth conditions; AUG codons 1 and 2 are needed to overcome this repression in amino acid starvation conditions. We show that the regulatory function of AUG codons 1 and 2 can be qualitatively mimicked by the AUG codons of two heterologous upstream open reading frames (URFs) containing the initiation regions of the yeast genes PGK and TRP1. These AUG codons inhibit GCN4 expression when present singly in the mRNA leader; however, they stimulate GCN4 expression in derepressing conditions when inserted upstream from AUG codons 3 and 4. This finding supports the idea that AUG codons 1 and 2 function in the control mechanism as translation initiation sites and further suggests that suppression of the inhibitory effects of AUG codons 3 and 4 is a general consequence of the translation of URF 1 and 2 sequences upstream. Several observations suggest that AUG codons 3 and 4 are efficient initiation sites; however, these sequences do not act as positive regulatory elements when placed upstream from URF 1. This result suggests that efficient translation is only one of the important properties of the 5' proximal URFs in GCN4 mRNA. We propose that a second property is the ability to permit reinitiation following termination of translation and that URF 1 is optimized for this regulatory function. Images PMID:3065626

Promoter analysis of the rabbit POU5F1 gene and its expression in preimplantation stage embryos.

PubMed

Kobolak, Julianna; Kiss, Katalin; Polgar, Zsuzsanna; Mamo, Solomon; Rogel-Gaillard, Claire; Tancos, Zsuzsanna; Bock, Istvan; Baji, Arpad G; Tar, Krisztina; Pirity, Melinda K; Dinnyes, Andras

2009-09-04

The POU5F1 gene encodes the octamer-binding transcription factor-4 (Oct4). It is crucial in the regulation of pluripotency during embryonic development and widely used as molecular marker of embryonic stem cells (ESCs). The objective of this study was to identify and to analyse the promoter region of rabbit POU5F1 gene; furthermore to examine its expression pattern in preimplantation stage rabbit embryos. The upstream region of rabbit POU5F1 was subcloned sequenced and four highly conserved promoter regions (CR1-4) were identified. The highest degree of similarity on sequence level was found among the conserved domains between rabbit and human. Among the enhancers the proximal enhancer region (PE-1A) exhibited the highest degree of homology (96.4%). Furthermore, the CR4 regulator domain containing the distal enhancer (DE-2A) was responsible for stem cell-specific expression. Also, BAC library screen revealed the existence of a processed pseudogene of rabbit POU5F1. The results of quantitative real-time PCR experiments showed that POU5F1 mRNA was abundantly present in oocytes and zygotes, but it was gradually reduced until the activation of the embryonic genome, thereafter a continuous increase in POU5F1 mRNA level was observed until blastocyst stage. By using the XYClone laser system the inner cell mass (ICM) and trophoblast portions of embryos were microdissected and examined separately and POU5F1 mRNA was detected in both cell types. In this study we provide a comparative sequence analysis of the regulatory region of rabbit POU5F1 gene. Our data suggest that the POU5F1 gene is strictly regulated during early mammalian development. We proposed that the well conserved CR4 region containing the DE-2A enhancer is responsible for the highly conserved ESC specific gene expression. Notably, we are the first to report that the rabbit POU5F1 is not restricted to ICM cells only, but it is expressed in trophoblast cells as well. This information may be well applicable to investigate further the possible phylogenetic role and the regulation of POU5F1 gene.

Do rivermouths alter nutrient and seston delivery to the nearshore?

USGS Publications Warehouse

Larson, James H.; Frost, Paul C.; Vallazza, Jon M.; Nelson, John; Richardson, William B.

2016-01-01

Tributary inputs to lakes and seas are often measured at riverine gages, upstream of lentic influence. Between these riverine gages and the nearshore zones of large waterbodies lie rivermouths, which may retain, transform and contribute materials to the nearshore zone. However, the magnitude and timing of these rivermouth effects have rarely been measured.During the summer of 2011, 23 tributary systems of the Laurentian Great Lakes were sampled from river to nearshore for dissolved and particulate carbon (C), nitrogen (N) and phosphorus (P) concentrations, as well as bulk seston and chlorophyll a concentrations. Three locations per system were sampled: in the upstream river, in the nearshore zone and at the outflow from the rivermouth to the lake. Using stable oxygen isotopes, a water-mixing model was developed to estimate the nutrient concentration that would occur at the rivermouth if mixing was strictly conservative (i.e. if no processing occurred within the rivermouth). Deviations between these conservative mixing estimates and measured nutrient concentrations were identified as rivermouth effects on nutrient concentrations.Rivermouths had higher concentration of C and P than nearshore areas and more chlorophyll athan upstream river waters. Compared to the conservative mixing model, rivermouths as a class appeared to be summer-time sources of N, P and chlorophyll a. Substantial among rivermouth variation occurred both in the effect size and direction for all constituents.Using principal component analysis, two groups of rivermouths were identified: rivermouths that had a large effect on most constituents and those that had very little effect on any of the measured constituents. ‘High-effect’ rivermouths had more abundant upstream croplands, which were presumably the sources of inorganic nutrients. Cross-validated models built using characteristics of the rivermouth were not good predictors of variation in rivermouth effects on most constituents.For consumers feeding on seston and microbes and vascular autotrophs directly taking up dissolved nutrients, rivermouths are more resource-rich than upstream riverine or nearby Great Lakes waters. Given declines over time in open-lake productivity within the Great Lakes, rivermouths may contribute more productivity than their size would suggest to the Great Lakes food web.

Caste development and reproduction: a genome-wide analysis of hallmarks of insect eusociality

PubMed Central

Cristino, A S; Nunes, F M F; Lobo, C H; Bitondi, M M G; Simões, Z L P; Da Fontoura Costa, L; Lattorff, H M G; Moritz, R F A; Evans, J D; Hartfelder, K

2006-01-01

The honey bee queen and worker castes are a model system for developmental plasticity. We used established expressed sequence tag information for a Gene Ontology based annotation of genes that are differentially expressed during caste development. Metabolic regulation emerged as a major theme, with a caste-specific difference in the expression of oxidoreductases vs. hydrolases. Motif searches in upstream regions revealed group-specific motifs, providing an entry point to cis-regulatory network studies on caste genes. For genes putatively involved in reproduction, meiosis-associated factors came out as highly conserved, whereas some determinants of embryonic axes either do not have clear orthologs (bag of marbles, gurken, torso), or appear to be lacking (trunk) in the bee genome. Our results are the outcome of a first genome-based initiative to provide an annotated framework for trends in gene regulation during female caste differentiation (representing developmental plasticity) and reproduction. PMID:17069641

Bacteroides fragilis mobilizable transposon Tn5520 requires a 71 base pair origin of transfer sequence and a single mobilization protein for relaxosome formation during conjugation.

PubMed

Vedantam, Gayatri; Knopf, Sarah; Hecht, David W

2006-01-01

Tn5520 is the smallest known bacterial mobilizable transposon and was isolated from an antibiotic resistant Bacteroides fragilis clinical isolate. When a conjugation apparatus is provided in trans, Tn5520 is mobilized (transferred) efficiently within, and from, both Bacteroides spp. and Escherichia coli. Only two genes are present on Tn5520; one encodes an integrase, and the other a multifunctional mobilization (Mob) protein BmpH. BmpH is essential for Tn5520 mobility. The focus of this study was to identify the Tn5520 origin of conjugative transfer (oriT) and to study BmpH-oriT binding. We delimited the functional Tn5520 oriT to a 71 bp sequence upstream of the bmpH gene. A plasmid vector harbouring this minimal 71 bp oriT was mobilized at the same frequency as that of intact Tn5520. The minimal oriT contains one 17 bp inverted repeat (IR) sequence. We constructed and tested multiple IR mutants and showed that the IR was essential in its entirety for mobilization. A nick site sequence (5'-GCTAC-3') was also identified within the minimal oriT; this sequence resembled nick sites found in plasmids of Gram positive origin. We further showed that mutation of a highly conserved GC dinucleotide in the nick site sequence completely abolished mobilization. We also purified BmpH and showed that it specifically bound a Tn5520 oriT fragment in electrophoretic mobility shift assays. We also identified non-nick site sequences within the minimal oriT that were essential for mobilization. We hypothesize that transposon-based single Mob protein systems may contribute to efficient gene dissemination from Bacteroides spp., because fewer DNA processing proteins are required for relaxosome formation.

Analysis of the vhoGAC and vhtGAC operons from Methanosarcina mazei strain Gö1, both encoding a membrane-bound hydrogenase and a cytochrome b.

PubMed

Deppenmeier, U; Blaut, M; Lentes, S; Herzberg, C; Gottschalk, G

1995-01-15

DNA encompassing the structural genes of two membrane-bound hydrogenases from Methanosarcina mazei Gö1 was cloned and sequenced. The genes, arranged in the order vhoG and vhoA as well as vhtG and vhtA, were identified as those encoding the small and the large subunits of the NiFe hydrogenases [Deppenmeier, U., Blaut, M., Schmidt, B. & Gottschalk, G. (1992) Arch. Microbiol. 157, 505-511]. Northern-blot analysis revealed that the structural genes formed part of two operons, both containing one additional open reading frame (vhoC and vhtC) which codes for a cytochrome b. This conclusion was drawn from the homology of the deduced N-terminal amino acid sequences of vhoC and vhtC and the N-terminus of a 27-kDa cytochrome isolated from Ms. mazei C16. VhoC and VhtC contain four tentative hydrophobic segments which might span the cytoplasmic membrane. Hydropathy plots suggest that His23 and His50 are involved in heme coordination. The comparison of the sequencing data of vhoG and vhtG with the experimentally determined N-terminus of the small subunit indicate the presence of a 48-amino-acid leader peptide in front of the polypeptides. VhoA and VhtA contained the conserved sequence DPCXXC in the C-terminal region, which excludes the presence of a selenocysteine residue in these hydrogenases. Promoter sequences were found upstream of vhoG and vhtG, respectively. Downstream of vhoC, a putative terminator sequence was identified. Alignments of the deduced amino acid sequences of the gene clusters vhoGAC and vhtGAC showed 92-97% identity. Only the C-termini of VhoC and VhtC were not similar.

Opposite consequences of two transcription pauses caused by an intrinsic terminator oligo(U): antitermination versus termination by bacteriophage T7 RNA polymerase.

PubMed

Lee, Sooncheol; Kang, Changwon

2011-05-06

The RNA oligo(U) sequence, along with an immediately preceding RNA hairpin structure, is an essential cis-acting element for bacterial class I intrinsic termination. This sequence not only causes a pause in transcription during the beginning of the termination process but also facilitates transcript release at the end of the process. In this study, the oligo(U) sequence of the bacteriophage T7 intrinsic terminator Tφ, rather than the hairpin structure, induced pauses of phage T7 RNA polymerase not only at the termination site, triggering a termination process, but also 3 bp upstream, exerting an antitermination effect. The upstream pause presumably allowed RNA to form a thermodynamically more stable secondary structure rather than a terminator hairpin and to persist because the 5'-half of the terminator hairpin-forming sequence could be sequestered by a farther upstream sequence via sequence-specific hybridization, prohibiting formation of the terminator hairpin and termination. The putative antiterminator RNA structure lacked several base pairs essential for termination when probed using RNases A, T1, and V1. When the antiterminator was destabilized by incorporation of IMP into nascent RNA at G residue positions, antitermination was abolished. Furthermore, antitermination strength increased with more stable antiterminator secondary structures and longer pauses. Thus, the oligo(U)-mediated pause prior to the termination site can exert a cis-acting antitermination activity on intrinsic terminator Tφ, and the termination efficiency depends primarily on the termination-interfering pause that precedes the termination-facilitating pause at the termination site.

DNA sequence requirements for the accurate transcription of a protein-coding plastid gene in a plastid in vitro system from mustard (Sinapis alba L.)

PubMed Central

Link, Gerhard

1984-01-01

A nuclease-treated plastid extract from mustard (Sinapis alba L.) allows efficient transcription of cloned plastid DNA templates. In this in vitro system, the major runoff transcript of the truncated gene for the 32 000 mol. wt. photosystem II protein was accurately initiated from a site close to or identical with the in vivo start site. By using plasmids with deletions in the 5'-flanking region of this gene as templates, a DNA region required for efficient and selective initiation was detected ˜28-35 nucleotides upstream of the transcription start site. This region contains the sequence element TTGACA, which matches the consensus sequence for prokaryotic `−35' promoter elements. In the absence of this region, a region ˜13-27 nucleotides upstream of the start site still enables a basic level of specific transcription. This second region contains the sequence element TATATAA, which matches the consensus sequence for the `TATA' box of genes transcribed by RNA polymerase II (or B). The region between the `TATA'-like element and the transcription start site is not sufficient but may be required for specific transcription of the plastid gene. This latter region contains the sequence element TATACT, which resembles the prokaryotic `−10' (Pribnow) box. Based on the structural and transcriptional features of the 5' upstream region, a `promoter switch' mechanism is proposed, which may account for the developmentally regulated expression of this plastid gene. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Figure 5. PMID:16453540

Distinct patterns of alteration of myc genes associated with integration of human papillomavirus type 16 or type 45 DNA in two genital tumours.

PubMed

Sastre-Garau, X; Favre, M; Couturier, J; Orth, G

2000-08-01

We previously described two genital carcinomas (IC2, IC4) containing human papillomavirus type 16 (HPV-16)- or HPV-18-related sequences integrated in chromosomal bands containing the c-myc (8q24) or N-myc (2p24) gene, respectively. The c-myc gene was rearranged and amplified in IC2 cells without evidence of overexpression. The N-myc gene was amplified and highly transcribed in IC4 cells. Here, the sequence of an 8039 bp IC4 DNA fragment containing the integrated viral sequences and the cellular junctions is reported. A 3948 bp segment of the genome of HPV-45 encompassing the upstream regulatory region and the E6 and E7 ORFs was integrated into the untranslated part of N-myc exon 3, upstream of the N-myc polyadenylation signal. Both N-myc and HPV-45 sequences were amplified 10- to 20-fold. The 3' ends of the major N-myc transcript were mapped upstream of the 5' junction. A minor N-myc/HPV-45 fusion transcript was also identified, as well as two abundant transcripts from the HPV-45 E6-E7 region. Large amounts of N-myc protein were detected in IC4 cells. A major alteration of c-myc sequences in IC2 cells involved the insertion of a non-coding sequence into the second intron and their co-amplification with the third exon, without any evidence for the integration of HPV-16 sequences within or close to the gene. Different patterns of myc gene alterations may thus be associated with integration of HPV DNA in genital tumours, including the activation of the protooncogene via a mechanism of insertional mutagenesis and/or gene amplification.

Transcription of the Streptococcus pyogenes Hyaluronic Acid Capsule Biosynthesis Operon Is Regulated by Previously Unknown Upstream Elements

PubMed Central

Falaleeva, Marina; Zurek, Oliwia W.; Watkins, Robert L.; Reed, Robert W.; Ali, Hadeel; Sumby, Paul; Voyich, Jovanka M.

2014-01-01

The important human pathogen Streptococcus pyogenes (group A Streptococcus [GAS]) produces a hyaluronic acid (HA) capsule that plays critical roles in immune evasion. Previous studies showed that the hasABC operon encoding the capsule biosynthesis enzymes is under the control of a single promoter, P1, which is negatively regulated by the two-component regulatory system CovR/S. In this work, we characterize the sequence upstream of P1 and identify a novel regulatory region controlling transcription of the capsule biosynthesis operon in the M1 serotype strain MGAS2221. This region consists of a promoter, P2, which initiates transcription of a novel small RNA, HasS, an intrinsic transcriptional terminator that inefficiently terminates HasS, permitting read-through transcription of hasABC, and a putative promoter which lies upstream of P2. Electrophoretic mobility shift assays, quantitative reverse transcription-PCR, and transcriptional reporter data identified CovR as a negative regulator of P2. We found that the P1 and P2 promoters are completely repressed by CovR, and capsule expression is regulated by the putative promoter upstream of P2. Deletion of hasS or of the terminator eliminates CovR-binding sequences, relieving repression and increasing read-through, hasA transcription, and capsule production. Sequence analysis of 44 GAS genomes revealed a high level of polymorphism in the HasS sequence region. Most of the HasS variations were located in the terminator sequences, suggesting that this region is under strong selective pressure. We discovered that the terminator deletion mutant is highly resistant to neutrophil-mediated killing and is significantly more virulent in a mouse model of GAS invasive disease than the wild-type strain. Together, these results are consistent with the naturally occurring mutations in this region modulating GAS virulence. PMID:25287924

Identification of an evolutionarily conserved regulatory element of the zebrafish col2a1a gene.

PubMed

Dale, Rodney M; Topczewski, Jacek

2011-09-15

Zebrafish (Danio rerio) is an excellent model organism for the study of vertebrate development including skeletogenesis. Studies of mammalian cartilage formation were greatly advanced through the use of a cartilage specific regulatory element of the Collagen type II alpha 1 (Col2a1) gene. In an effort to isolate such an element in zebrafish, we compared the expression of two col2a1 homologues and found that expression of col2a1b, a previously uncharacterized zebrafish homologue, only partially overlaps with col2a1a. We focused our analysis on col2a1a, as it is expressed in both the stacked chondrocytes and the perichondrium. By comparing the genomic sequence surrounding the predicted transcriptional start site of col2a1a among several species of teleosts we identified a small highly conserved sequence (R2) located 1.7 kb upstream of the presumptive transcriptional initiation site. Interestingly, neither the sequence nor location of this element is conserved between teleost and mammalian Col2a1. We generated transient and stable transgenic lines with just the R2 element or the entire 1.7 kb fragment 5' of the transcriptional initiation site. The identified regulatory elements enable the tracking of cellular development in various tissues by driving robust reporter expression in craniofacial cartilage, ear, notochord, floor plate, hypochord and fins in a pattern similar to the expression of endogenous col2a1a. Using a reporter gene driven by the R2 regulatory element, we analyzed the morphogenesis of the notochord sheath cells as they withdraw from the stack of initially uniform cells and encase the inflating vacuolated notochord cells. Finally, we show that like endogenous col2a1a, craniofacial expression of these reporter constructs depends on Sox9a transcription factor activity. At the same time, notochord expression is maintained after Sox9a knockdown, suggesting that other factors can activate expression through the identified regulatory element in this tissue. Copyright © 2011 Elsevier Inc. All rights reserved.

Identification of an evolutionarily conserved regulatory element of the zebrafish col2a1a gene

PubMed Central

Dale, Rodney M.; Topczewski, Jacek

2011-01-01

Zebrafish (Danio rerio) is an excellent model organism for the study of vertebrate development including skeletogenesis. Studies of mammalian cartilage formation were greatly advanced through the use of a cartilage specific regulatory element of the Collagen type II alpha 1 (Col2a1) gene. In an effort to isolate such an element in zebrafish, we compared the expression of two col2a1 homologues and found that expression of col2a1b, a previously uncharacterized zebrafish homologue, only partially overlaps with col2a1a. We focused our analysis on col2a1a, as it is expressed in both the stacked chondrocytes and the perichondrium. By comparing the genomic sequence surrounding the predicted transcriptional start site of col2a1a among several species of teleosts we identified a small highly conserved sequence (R2) located 1.7 kb upstream of the presumptive transcriptional initiation site. Interestingly, neither the sequence nor location of this element is conserved between teleost and mammalian Col2a1. We generated transient and stable transgenic lines with just the R2 element or the entire 1.7 kb fragment 5’ of the transcriptional initiation site. The identified regulatory elements enable the tracking of cellular development in various tissues by driving robust reporter expression in craniofacial cartilage, ear, notochord, floor plate, hypochord and fins in a pattern similar to the expression of endogenous col2a1a. Using a reporter gene driven by the R2 regulatory element, we analyzed the morphogenesis of the notochord sheath cells as they withdraw from the stack of initially uniform cells and encase the inflating vacuolated notochord cells. Finally, we show that like endogenous col2a1a, craniofacial expression of these reporter constructs depends on Sox9a transcription factor activity. At the same time, notochord expression is maintained after Sox9a knockdown, suggesting that other factors can activate expression through the identified regulatory element in this tissue. PMID:21723274

Avoidance of truncated proteins from unintended ribosome binding sites within heterologous protein coding sequences.

PubMed

Whitaker, Weston R; Lee, Hanson; Arkin, Adam P; Dueber, John E

2015-03-20

Genetic sequences ported into non-native hosts for synthetic biology applications can gain unexpected properties. In this study, we explored sequences functioning as ribosome binding sites (RBSs) within protein coding DNA sequences (CDSs) that cause internal translation, resulting in truncated proteins. Genome-wide prediction of bacterial RBSs, based on biophysical calculations employed by the RBS calculator, suggests a selection against internal RBSs within CDSs in Escherichia coli, but not those in Saccharomyces cerevisiae. Based on these calculations, silent mutations aimed at removing internal RBSs can effectively reduce truncation products from internal translation. However, a solution for complete elimination of internal translation initiation is not always feasible due to constraints of available coding sequences. Fluorescence assays and Western blot analysis showed that in genes with internal RBSs, increasing the strength of the intended upstream RBS had little influence on the internal translation strength. Another strategy to minimize truncated products from an internal RBS is to increase the relative strength of the upstream RBS with a concomitant reduction in promoter strength to achieve the same protein expression level. Unfortunately, lower transcription levels result in increased noise at the single cell level due to stochasticity in gene expression. At the low expression regimes desired for many synthetic biology applications, this problem becomes particularly pronounced. We found that balancing promoter strengths and upstream RBS strengths to intermediate levels can achieve the target protein concentration while avoiding both excessive noise and truncated protein.

Self-regulation of 70-kilodalton heat shock proteins in Saccharomyces cerevisiae.

PubMed Central

Stone, D E; Craig, E A

1990-01-01

To determine whether the 70-kilodalton heat shock proteins of Saccharomyces cerevisiae play a role in regulating their own synthesis, we studied the effect of overexpressing the SSA1 protein on the activity of the SSA1 5'-regulatory region. The constitutive level of Ssa1p was increased by fusing the SSA1 structural gene to the GAL1 promoter. A reporter vector consisting of an SSA1-lacZ translational fusion was used to assess SSA1 promoter activity. In a strain producing approximately 10-fold the normal heat shock level of Ssa1p, induction of beta-galactosidase activity by heat shock was almost entirely blocked. Expression of a transcriptional fusion vector in which the CYC1 upstream activating sequence of a CYC1-lacZ chimera was replaced by a sequence containing a heat shock upstream activating sequence (heat shock element 2) from the 5'-regulatory region of SSA1 was inhibited by excess Ssa1p. The repression of an SSA1 upstream activating sequence by the SSA1 protein indicates that SSA1 self-regulation is at least partially mediated at the transcriptional level. The expression of another transcriptional fusion vector, containing heat shock element 2 and a lesser amount of flanking sequence, is not inhibited when Ssa1p is overexpressed. This suggests the existence of an element, proximal to or overlapping heat shock element 2, that confers sensitivity to the SSA1 protein. Images PMID:2181281

Sequencing Conservation Actions Through Threat Assessments in the Southeastern United States

Treesearch

Robert D. Sutter; Christopher C. Szell

2006-01-01

The identification of conservation priorities is one of the leading issues in conservation biology. We present a project of The Nature Conservancy, called Sequencing Conservation Actions, which prioritizes conservation areas and identifies foci for crosscutting strategies at various geographic scales. We use the term “Sequencing” to mean an ordering of actions over...

Filling gaps in a large reserve network to address freshwater conservation needs.

PubMed

Hermoso, Virgilio; Filipe, Ana Filipa; Segurado, Pedro; Beja, Pedro

2015-09-15

Freshwater ecosystems and biodiversity are among the most threatened at global scale, but efforts for their conservation have been mostly peripheral to terrestrial conservation. For example, Natura 2000, the world's largest network of protected areas, fails to cover adequately the distribution of rare and endangered aquatic species, and lacks of appropriate spatial design to make conservation for freshwater biodiversity effective. Here, we develop a framework to identify a complementary set of priority areas and enhance the conservation opportunities of Natura 2000 for freshwater biodiversity, using the Iberian Peninsula as a case study. We use a systematic planning approach to identify a minimum set of additional areas that would help i) adequately represent all freshwater fish, amphibians and aquatic reptiles at three different target levels, ii) account for key ecological processes derived from riverscape connectivity, and iii) minimize the impact of threats, both within protected areas and propagated from upstream unprotected areas. Addressing all these goals would need an increase in area between 7 and 46%, depending on the conservation target used and strength of connectivity required. These new priority areas correspond to subcatchments inhabited by endangered and range restricted species, as well as additional subcatchments required to improve connectivity among existing protected areas and to increase protection against upstream threats. Our study should help guide future revisions of the design of Natura 2000, while providing a framework to address deficiencies in reserve networks for adequately protecting freshwater biodiversity elsewhere. Copyright © 2015 Elsevier Ltd. All rights reserved.

Characterization of ROP18 alleles in human toxoplasmosis.

PubMed

Sánchez, Víctor; de-la-Torre, Alejandra; Gómez-Marín, Jorge Enrique

2014-04-01

The role of the virulent gene ROP18 polymorphisms is not known in human toxoplasmosis. A total of 320 clinical samples were analyzed. In samples positive for ROP18 gene, we determined by an allele specific PCR, if patients got the upstream insertion positive ROP18 sequence Toxoplasma strain (mouse avirulent strain) or the upstream insertion negative ROP18 sequence Toxoplasma strain (mouse virulent strain). We designed an ELISA assay for antibodies against ROP18 derived peptides from the three major clonal lineages of Toxoplasma. 20 clinical samples were of quality for ROP18 allele analysis. In patients with ocular toxoplasmosis, a higher inflammatory reaction on eye was associated to a PCR negative result for the upstream region of ROP18. 23.3%, 33% and 16.6% of serums from individuals with ocular toxoplasmosis were positive for type I, type II and type III ROP18 derived peptides, respectively but this assay was affected by cross reaction. The absence of Toxoplasma ROP18 promoter insertion sequence in ocular toxoplasmosis was correlated with severe ocular inflammatory response. Determination of antibodies against ROP18 protein was not useful for serotyping in human toxoplasmosis. © 2013.

3’UTR Shortening Potentiates MicroRNA-Based Repression of Pro-differentiation Genes in Proliferating Human Cells

PubMed Central

Hoffman, Yonit; Bublik, Debora Rosa; P. Ugalde, Alejandro; Elkon, Ran; Biniashvili, Tammy; Agami, Reuven; Oren, Moshe; Pilpel, Yitzhak

2016-01-01

Most mammalian genes often feature alternative polyadenylation (APA) sites and hence diverse 3’UTR lengths. Proliferating cells were reported to favor APA sites that result in shorter 3’UTRs. One consequence of such shortening is escape of mRNAs from targeting by microRNAs (miRNAs) whose binding sites are eliminated. Such a mechanism might provide proliferation-related genes with an expression gain during normal or cancerous proliferation. Notably, miRNA sites tend to be more active when located near both ends of the 3’UTR compared to those located more centrally. Accordingly, miRNA sites located near the center of the full 3’UTR might become more active upon 3'UTR shortening. To address this conjecture we performed 3' sequencing to determine the 3' ends of all human UTRs in several cell lines. Remarkably, we found that conserved miRNA binding sites are preferentially enriched immediately upstream to APA sites, and this enrichment is more prominent in pro-differentiation/anti-proliferative genes. Binding sites of the miR17-92 cluster, upregulated in rapidly proliferating cells, are particularly enriched just upstream to APA sites, presumably conferring stronger inhibitory activity upon shortening. Thus 3’UTR shortening appears not only to enable escape from inhibition of growth promoting genes but also to potentiate repression of anti-proliferative genes. PMID:26908102

On the relationship between residue structural environment and sequence conservation in proteins.

PubMed

Liu, Jen-Wei; Lin, Jau-Ji; Cheng, Chih-Wen; Lin, Yu-Feng; Hwang, Jenn-Kang; Huang, Tsun-Tsao

2017-09-01

Residues that are crucial to protein function or structure are usually evolutionarily conserved. To identify the important residues in protein, sequence conservation is estimated, and current methods rely upon the unbiased collection of homologous sequences. Surprisingly, our previous studies have shown that the sequence conservation is closely correlated with the weighted contact number (WCN), a measure of packing density for residue's structural environment, calculated only based on the C α positions of a protein structure. Moreover, studies have shown that sequence conservation is correlated with environment-related structural properties calculated based on different protein substructures, such as a protein's all atoms, backbone atoms, side-chain atoms, or side-chain centroid. To know whether the C α atomic positions are adequate to show the relationship between residue environment and sequence conservation or not, here we compared C α atoms with other substructures in their contributions to the sequence conservation. Our results show that C α positions are substantially equivalent to the other substructures in calculations of various measures of residue environment. As a result, the overlapping contributions between C α atoms and the other substructures are high, yielding similar structure-conservation relationship. Take the WCN as an example, the average overlapping contribution to sequence conservation is 87% between C α and all-atom substructures. These results indicate that only C α atoms of a protein structure could reflect sequence conservation at the residue level. © 2017 Wiley Periodicals, Inc.

Genome of turbot rhabdovirus exhibits unusual non-coding regions and an additional ORF that could be expressed in fish cell.

PubMed

Zhu, Ruo-Lin; Lei, Xiao-Ying; Ke, Fei; Yuan, Xiu-Ping; Zhang, Qi-Ya

2011-02-01

Genomic sequence of Scophthalmus maximus rhabdovirus (SMRV) isolated from diseased turbot has been characterized. The complete genome of SMRV comprises 11,492 nucleotides and encodes five typical rhabdovirus genes N, P, M, G and L. In addition, two open reading frames (ORF) are predicted overlapping with P gene, one upstream of P and smaller than P (temporarily called Ps), and another in P gene which may encodes a protein similar to the vesicular stomatitis virus C protein. The C ORF is contained within the P ORF. The five typical proteins share the highest sequence identities (48.9%) with the corresponding proteins of rhabdoviruses in genus Vesiculovirus. Phylogenetic analysis of partial L protein sequence indicates that SMRV is close to genus Vesiculovirus. The first 13 nucleotides at the ends of the SMRV genome are absolutely inverse complementarity. The gene junctions between the five genes show conserved polyadenylation signal (CATGA(7)) and intergenic dinucleotide (CT) followed by putative transcription initiation sequence A(A/G)(C/G)A(A/G/T), which are different from known rhabdoviruses. The entire Ps ORF was cloned and expressed, and used to generate polyclonal antibody in mice. One obvious band could be detected in SMRV-infected carp leucocyte cells (CLCs) by anti-Ps/C serum via Western blot, and the subcellular localization of Ps-GFP fusion protein exhibited cytoplasm distribution as multiple punctuate or doughnut shaped foci of uneven size. Copyright © 2010 Elsevier B.V. All rights reserved.

Degenerative Minimalism in the Genome of a Psyllid Endosymbiont

PubMed Central

Clark, Marta A.; Baumann, Linda; Thao, MyLo Ly; Moran, Nancy A.; Baumann, Paul

2001-01-01

Psyllids, like aphids, feed on plant phloem sap and are obligately associated with prokaryotic endosymbionts acquired through vertical transmission from an ancestral infection. We have sequenced 37 kb of DNA of the genome of Carsonella ruddii, the endosymbiont of psyllids, and found that it has a number of unusual properties revealing a more extreme case of degeneration than was previously reported from studies of eubacterial genomes, including that of the aphid endosymbiont Buchnera aphidicola. Among the unusual properties are an exceptionally low guanine-plus-cytosine content (19.9%), almost complete absence of intergenic spaces, operon fusion, and lack of the usual promoter sequences upstream of 16S rDNA. These features suggest the synthesis of long mRNAs and translational coupling. The most extreme instances of base compositional bias occur in the genes encoding proteins that have less highly conserved amino acid sequences; the guanine-plus-cytosine content of some protein-coding sequences is as low as 10%. The shift in base composition has a large effect on proteins: in polypeptides of C. ruddii, half of the residues consist of five amino acids with codons low in guanine plus cytosine. Furthermore, the proteins of C. ruddii are reduced in size, with an average of about 9% fewer amino acids than in homologous proteins of related bacteria. These observations suggest that the C. ruddii genome is not subject to constraints that limit the evolution of other known eubacteria. PMID:11222582

Genetic characterization of UCS region of Pneumocystis jirovecii and construction of allelic profiles of Indian isolates based on sequence typing at three regions.

PubMed

Gupta, Rashmi; Mirdha, Bijay Ranjan; Guleria, Randeep; Kumar, Lalit; Luthra, Kalpana; Agarwal, Sanjay Kumar; Sreenivas, Vishnubhatla

2013-01-01

Pneumocystis jirovecii is an opportunistic pathogen that causes severe pneumonia in immunocompromised patients. To study the genetic diversity of P. jirovecii in India the upstream conserved sequence (UCS) region of Pneumocystis genome was amplified, sequenced and genotyped from a set of respiratory specimens obtained from 50 patients with a positive result for nested mitochondrial large subunit ribosomal RNA (mtLSU rRNA) PCR during the years 2005-2008. Of these 50 cases, 45 showed a positive PCR for UCS region. Variations in the tandem repeats in UCS region were characterized by sequencing all the positive cases. Of the 45 cases, one case showed five repeats, 11 cases showed four repeats, 29 cases showed three repeats and four cases showed two repeats. By running amplified DNA from all these cases on a high-resolution gel, mixed infection was observed in 12 cases (26.7%, 12/45). Forty three of 45 cases included in this study had previously been typed at mtLSU rRNA and internal transcribed spacer (ITS) region by our group. In the present study, the genotypes at those two regions were combined with UCS repeat patterns to construct allelic profiles of 43 cases. A total of 36 allelic profiles were observed in 43 isolates indicating high genetic variability. A statistically significant association was observed between mtLSU rRNA genotype 1, ITS type Ea and UCS repeat pattern 4. Copyright © 2012 Elsevier B.V. All rights reserved.

Evolution of Advection Upstream Splitting Method Schemes

NASA Technical Reports Server (NTRS)

Liou, Meng-Sing

2010-01-01

This paper focuses on the evolution of advection upstream splitting method(AUSM) schemes. The main ingredients that have led to the development of modern computational fluid dynamics (CFD) methods have been reviewed, thus the ideas behind AUSM. First and foremost is the concept of upwinding. Second, the use of Riemann problem in constructing the numerical flux in the finite-volume setting. Third, the necessity of including all physical processes, as characterised by the linear (convection) and nonlinear (acoustic) fields. Fourth, the realisation of separating the flux into convection and pressure fluxes. The rest of this review briefly outlines the technical evolution of AUSM and more details can be found in the cited references. Keywords: Computational fluid dynamics methods, hyperbolic systems, advection upstream splitting method, conservation laws, upwinding, CFD

Transcriptome dynamics through alternative polyadenylation in developmental and environmental responses in plants revealed by deep sequencing

PubMed Central

Shen, Yingjia; Venu, R.C.; Nobuta, Kan; Wu, Xiaohui; Notibala, Varun; Demirci, Caghan; Meyers, Blake C.; Wang, Guo-Liang; Ji, Guoli; Li, Qingshun Q.

2011-01-01

Polyadenylation sites mark the ends of mRNA transcripts. Alternative polyadenylation (APA) may alter sequence elements and/or the coding capacity of transcripts, a mechanism that has been demonstrated to regulate gene expression and transcriptome diversity. To study the role of APA in transcriptome dynamics, we analyzed a large-scale data set of RNA “tags” that signify poly(A) sites and expression levels of mRNA. These tags were derived from a wide range of tissues and developmental stages that were mutated or exposed to environmental treatments, and generated using digital gene expression (DGE)–based protocols of the massively parallel signature sequencing (MPSS-DGE) and the Illumina sequencing-by-synthesis (SBS-DGE) sequencing platforms. The data offer a global view of APA and how it contributes to transcriptome dynamics. Upon analysis of these data, we found that ∼60% of Arabidopsis genes have multiple poly(A) sites. Likewise, ∼47% and 82% of rice genes use APA, supported by MPSS-DGE and SBS-DGE tags, respectively. In both species, ∼49%–66% of APA events were mapped upstream of annotated stop codons. Interestingly, 10% of the transcriptomes are made up of APA transcripts that are differentially distributed among developmental stages and in tissues responding to environmental stresses, providing an additional level of transcriptome dynamics. Examples of pollen-specific APA switching and salicylic acid treatment-specific APA clearly demonstrated such dynamics. The significance of these APAs is more evident in the 3034 genes that have conserved APA events between rice and Arabidopsis. PMID:21813626

Building a dictionary for genomes: Identification of presumptive regulatory sites by statistical analysis

PubMed Central

Bussemaker, Harmen J.; Li, Hao; Siggia, Eric D.

2000-01-01

The availability of complete genome sequences and mRNA expression data for all genes creates new opportunities and challenges for identifying DNA sequence motifs that control gene expression. An algorithm, “MobyDick,” is presented that decomposes a set of DNA sequences into the most probable dictionary of motifs or words. This method is applicable to any set of DNA sequences: for example, all upstream regions in a genome or all genes expressed under certain conditions. Identification of words is based on a probabilistic segmentation model in which the significance of longer words is deduced from the frequency of shorter ones of various lengths, eliminating the need for a separate set of reference data to define probabilities. We have built a dictionary with 1,200 words for the 6,000 upstream regulatory regions in the yeast genome; the 500 most significant words (some with as few as 10 copies in all of the upstream regions) match 114 of 443 experimentally determined sites (a significance level of 18 standard deviations). When analyzing all of the genes up-regulated during sporulation as a group, we find many motifs in addition to the few previously identified by analyzing the subclusters individually to the expression subclusters. Applying MobyDick to the genes derepressed when the general repressor Tup1 is deleted, we find known as well as putative binding sites for its regulatory partners. PMID:10944202

Improved efficiency in amplification of Escherichia coli o-antigen gene clusters using genome-wide sequence comparison

USDA-ARS?s Scientific Manuscript database

Background: In many bacteria including E. coli, genes encoding O-antigens are clustered in the chromosome, with a 39-bp JUMPstart sequence and gnd gene located upstream and downstream of the cluster, respectively. For determining the DNA sequence of the E. coli O-antigen gene cluster, one set of P...

Prototype foamy virus envelope glycoprotein leader peptide processing is mediated by a furin-like cellular protease, but cleavage is not essential for viral infectivity.

PubMed

Duda, Anja; Stange, Annett; Lüftenegger, Daniel; Stanke, Nicole; Westphal, Dana; Pietschmann, Thomas; Eastman, Scott W; Linial, Maxine L; Rethwilm, Axel; Lindemann, Dirk

2004-12-01

Analogous to cellular glycoproteins, viral envelope proteins contain N-terminal signal sequences responsible for targeting them to the secretory pathway. The prototype foamy virus (PFV) envelope (Env) shows a highly unusual biosynthesis. Its precursor protein has a type III membrane topology with both the N and C terminus located in the cytoplasm. Coexpression of FV glycoprotein and interaction of its leader peptide (LP) with the viral capsid is essential for viral particle budding and egress. Processing of PFV Env into the particle-associated LP, surface (SU), and transmembrane (TM) subunits occur posttranslationally during transport to the cell surface by yet-unidentified cellular proteases. Here we provide strong evidence that furin itself or a furin-like protease and not the signal peptidase complex is responsible for both processing events. N-terminal protein sequencing of the SU and TM subunits of purified PFV Env-immunoglobulin G immunoadhesin identified furin consensus sequences upstream of both cleavage sites. Mutagenesis analysis of two overlapping furin consensus sequences at the PFV LP/SU cleavage site in the wild-type protein confirmed the sequencing data and demonstrated utilization of only the first site. Fully processed SU was almost completely absent in viral particles of mutants having conserved arginine residues replaced by alanines in the first furin consensus sequence, but normal processing was observed upon mutation of the second motif. Although these mutants displayed a significant loss in infectivity as a result of reduced particle release, no correlation to processing inhibition was observed, since another mutant having normal LP/SU processing had a similar defect.

B-Bolivia, an Allele of the Maize b1 Gene with Variable Expression, Contains a High Copy Retrotransposon-Related Sequence Immediately Upstream1

PubMed Central

Selinger, David A.; Chandler, Vicki L.

2001-01-01

The maize (Zea mays) b1 gene encodes a transcription factor that regulates the anthocyanin pigment pathway. Of the b1 alleles with distinct tissue-specific expression, B-Peru and B-Bolivia are the only alleles that confer seed pigmentation. B-Bolivia produces variable and weaker seed expression but darker, more regular plant expression relative to B-Peru. Our experiments demonstrated that B-Bolivia is not expressed in the seed when transmitted through the male. When transmitted through the female the proportion of kernels pigmented and the intensity of pigment varied. Molecular characterization of B-Bolivia demonstrated that it shares the first 530 bp of the upstream region with B-Peru, a region sufficient for seed expression. Immediately upstream of 530 bp, B-Bolivia is completely divergent from B-Peru. These sequences share sequence similarity to retrotransposons. Transient expression assays of various promoter constructs identified a 33-bp region in B-Bolivia that can account for the reduced aleurone pigment amounts (40%) observed with B-Bolivia relative to B-Peru. Transgenic plants carrying the B-Bolivia promoter proximal region produced pigmented seeds. Similar to native B-Bolivia, some transgene loci are variably expressed in seeds. In contrast to native B-Bolivia, the transgene loci are expressed in seeds when transmitted through both the male and female. Some transgenic lines produced pigment in vegetative tissues, but the tissue-specificity was different from B-Bolivia, suggesting the introduced sequences do not contain the B-Bolivia plant-specific regulatory sequences. We hypothesize that the chromatin context of the B-Bolivia allele controls its epigenetic seed expression properties, which could be influenced by the adjacent highly repeated retrotransposon sequence. PMID:11244116

Comparative Analysis of V-Akt Murine Thymoma Viral Oncogene Homolog 3 (AKT3) Gene between Cow and Buffalo Reveals Substantial Differences for Mastitis.

PubMed

Ullah, Farman; Bhattarai, Dinesh; Cheng, Zhangrui; Liang, Xianwei; Deng, Tingxian; Rehman, Zia Ur; Talpur, Hira Sajjad; Worku, Tesfaye; Brohi, Rahim Dad; Safdar, Muhammad; Ahmad, Muhammad Jamil; Salim, Mohammad; Khan, Momen; Ahmad, Hafiz Ishfaq; Zhang, Shujun

2018-01-01

AKT3 gene is a constituent of the serine/threonine protein kinase family and plays a crucial role in synthesis of milk fats and cholesterol by regulating activity of the sterol regulatory element binding protein (SREBP). AKT3 is highly conserved in mammals and its expression levels during the lactation periods of cattle are markedly increased. AKT3 is highly expressed in the intestine followed by mammary gland and it is also expressed in immune cells. It is involved in the TLR pathways as effectively as proinflammatory cytokines. The aims of this study were to investigate the sequences differences between buffalo and cow. Our results showed that there were substantial differences between buffalo and cow in some exons and noteworthy differences of the gene size in different regions. We also identified the important consensus sequence motifs, variation in 2000 upstream of ATG, substantial difference in the "3'UTR" region, and miRNA association in the buffalo sequences compared with the cow. In addition, genetic analyses, such as gene structure, phylogenetic tree, position of different motifs, and functional domains, were performed to establish their correlation with other species. This may indicate that a buffalo breed has potential resistance to disease, environment changes, and airborne microorganisms and some good production and reproductive traits.

Foxl2 function in ovarian development.

PubMed

Uhlenhaut, Nina Henriette; Treier, Mathias

2006-07-01

Foxl2 is a forkhead transcription factor essential for proper reproductive function in females. Human patients carrying mutations in the FOXL2 gene display blepharophimosis/ptosis/epicanthus inversus syndrome (BPES), an autosomal dominant disease associated with eyelid defects and premature ovarian failure in females. Recently, animal models for BPES have been developed that in combination with a catalogue of human FOXL2 mutations provide further insight into its molecular function. Mice homozygous mutant for Foxl2 display craniofacial malformations and female infertility. The analysis of the murine phenotype has revealed that Foxl2 is required for granulosa cell function. These ovarian somatic cells surround and nourish the oocyte and play an important role in follicle formation and activation. Mutations upstream of FOXL2 in humans, not affecting the coding sequence itself, have also been shown to cause BPES, which points to the existence of a distant regulatory element necessary for proper gene expression. The same regulatory sequences may be deleted in the goat polled intersex syndrome (PIS), in which FoxL2 expression is severely reduced. Sequence comparison of FoxL2 from several vertebrate species has shown that it is a highly conserved gene involved in ovary development. Thus, the detailed understanding of Foxl2 function and regulation and the identification of its transcriptional targets may open new avenues for the treatment of female infertility in the future.

Comparative Analysis of V-Akt Murine Thymoma Viral Oncogene Homolog 3 (AKT3) Gene between Cow and Buffalo Reveals Substantial Differences for Mastitis

PubMed Central

Bhattarai, Dinesh; Cheng, Zhangrui; Liang, Xianwei; Deng, Tingxian; Rehman, Zia Ur; Talpur, Hira Sajjad; Worku, Tesfaye; Brohi, Rahim Dad; Safdar, Muhammad; Ahmad, Muhammad Jamil; Salim, Mohammad; Khan, Momen; Ahmad, Hafiz Ishfaq

2018-01-01

AKT3 gene is a constituent of the serine/threonine protein kinase family and plays a crucial role in synthesis of milk fats and cholesterol by regulating activity of the sterol regulatory element binding protein (SREBP). AKT3 is highly conserved in mammals and its expression levels during the lactation periods of cattle are markedly increased. AKT3 is highly expressed in the intestine followed by mammary gland and it is also expressed in immune cells. It is involved in the TLR pathways as effectively as proinflammatory cytokines. The aims of this study were to investigate the sequences differences between buffalo and cow. Our results showed that there were substantial differences between buffalo and cow in some exons and noteworthy differences of the gene size in different regions. We also identified the important consensus sequence motifs, variation in 2000 upstream of ATG, substantial difference in the “3′UTR” region, and miRNA association in the buffalo sequences compared with the cow. In addition, genetic analyses, such as gene structure, phylogenetic tree, position of different motifs, and functional domains, were performed to establish their correlation with other species. This may indicate that a buffalo breed has potential resistance to disease, environment changes, and airborne microorganisms and some good production and reproductive traits. PMID:29862252

QTL Mapping of Sex Determination Loci Supports an Ancient Pathway in Ants and Honey Bees.

PubMed

Miyakawa, Misato O; Mikheyev, Alexander S

2015-11-01

Sex determination mechanisms play a central role in life-history characteristics, affecting mating systems, sex ratios, inbreeding tolerance, etc. Downstream components of sex determination pathways are highly conserved, but upstream components evolve rapidly. Evolutionary dynamics of sex determination remain poorly understood, particularly because mechanisms appear so diverse. Here we investigate the origins and evolution of complementary sex determination (CSD) in ants and bees. The honey bee has a well-characterized CSD locus, containing tandemly arranged homologs of the transformer gene [complementary sex determiner (csd) and feminizer (fem)]. Such tandem paralogs appear frequently in aculeate hymenopteran genomes. However, only comparative genomic, but not functional, data support a broader role for csd/fem in sex determination, and whether species other than the honey bee use this pathway remains controversial. Here we used a backcross to test whether csd/fem acts as a CSD locus in an ant (Vollenhovia emeryi). After sequencing and assembling the genome, we computed a linkage map, and conducted a quantitative trait locus (QTL) analysis of diploid male production using 68 diploid males and 171 workers. We found two QTLs on separate linkage groups (CsdQTL1 and CsdQTL2) that jointly explained 98.0% of the phenotypic variance. CsdQTL1 included two tandem transformer homologs. These data support the prediction that the same CSD mechanism has indeed been conserved for over 100 million years. CsdQTL2 had no similarity to CsdQTL1 and included a 236-kb region with no obvious CSD gene candidates, making it impossible to conclusively characterize it using our data. The sequence of this locus was conserved in at least one other ant genome that diverged >75 million years ago. By applying QTL analysis to ants for the first time, we support the hypothesis that elements of hymenopteran CSD are ancient, but also show that more remains to be learned about the diversity of CSD mechanisms.

Global analyses of TetR family transcriptional regulators in mycobacteria indicates conservation across species and diversity in regulated functions.

PubMed

Balhana, Ricardo J C; Singla, Ashima; Sikder, Mahmudul Hasan; Withers, Mike; Kendall, Sharon L

2015-06-27

Mycobacteria inhabit diverse niches and display high metabolic versatility. They can colonise both humans and animals and are also able to survive in the environment. In order to succeed, response to environmental cues via transcriptional regulation is required. In this study we focused on the TetR family of transcriptional regulators (TFTRs) in mycobacteria. We used InterPro to classify the entire complement of transcriptional regulators in 10 mycobacterial species and these analyses showed that TFTRs are the most abundant family of regulators in all species. We identified those TFTRs that are conserved across all species analysed and those that are unique to the pathogens included in the analysis. We examined genomic contexts of 663 of the conserved TFTRs and observed that the majority of TFTRs are separated by 200 bp or less from divergently oriented genes. Analyses of divergent genes indicated that the TFTRs control diverse biochemical functions not limited to efflux pumps. TFTRs typically bind to palindromic motifs and we identified 11 highly significant novel motifs in the upstream regions of divergently oriented TFTRs. The C-terminal ligand binding domain from the TFTR complement in M. tuberculosis showed great diversity in amino acid sequence but with an overall architecture common to other TFTRs. This study suggests that mycobacteria depend on TFTRs for the transcriptional control of a number of metabolic functions yet the physiological role of the majority of these regulators remain unknown.

Upstream dispersal of an invasive crayfish aided by a fish passage facility

USGS Publications Warehouse

Welsh, Stuart A.; Loughman, Zachary J.

2015-01-01

Fish passage facilities for reservoir dams have been used to restore habitat connectivity within riverine networks by allowing upstream passage for native species. These facilities may also support the spread of invasive species, an unintended consequence and potential downside of upstream passage structures. We documented dam passage of the invasive virile crayfish, Orconectes virilis (Hagen, 1870), at fish ladders designed for upstream passage of American eels, Anguilla rostrata (Lesueur, 1817), in the Shenandoah River drainage, USA. Ladder use and upstream passage of 11 virile crayfish occurred from 2007–2014 during periods of low river discharge (<30 m3s–1) and within a wide range of water temperatures from 9.0–28.6 °C. Virile crayfish that used the eel ladders were large adults with a mean carapace length and width of 48.0 mm and 24.1 mm, respectively. Our data demonstrated the use of species-specific fish ladders by a non-target non-native species, which has conservation and management implications for the spread of aquatic invasive species and upstream passage facilities. Specifically, managers should consider implementing long-term monitoring of fish passage facilities with emphasis on detection of invasive species, as well as methods to reduce or eliminate passage of invasive species. 

Conservation and diversification of Msx protein in metazoan evolution.

PubMed

Takahashi, Hirokazu; Kamiya, Akiko; Ishiguro, Akira; Suzuki, Atsushi C; Saitou, Naruya; Toyoda, Atsushi; Aruga, Jun

2008-01-01

Msx (/msh) family genes encode homeodomain (HD) proteins that control ontogeny in many animal species. We compared the structures of Msx genes from a wide range of Metazoa (Porifera, Cnidaria, Nematoda, Arthropoda, Tardigrada, Platyhelminthes, Mollusca, Brachiopoda, Annelida, Echiura, Echinodermata, Hemichordata, and Chordata) to gain an understanding of the role of these genes in phylogeny. Exon-intron boundary analysis suggested that the position of the intron located N-terminally to the HDs was widely conserved in all the genes examined, including those of cnidarians. Amino acid (aa) sequence comparison revealed 3 new evolutionarily conserved domains, as well as very strong conservation of the HDs. Two of the three domains were associated with Groucho-like protein binding in both a vertebrate and a cnidarian Msx homolog, suggesting that the interaction between Groucho-like proteins and Msx proteins was established in eumetazoan ancestors. Pairwise comparison among the collected HDs and their C-flanking aa sequences revealed that the degree of sequence conservation varied depending on the animal taxa from which the sequences were derived. Highly conserved Msx genes were identified in the Vertebrata, Cephalochordata, Hemichordata, Echinodermata, Mollusca, Brachiopoda, and Anthozoa. The wide distribution of the conserved sequences in the animal phylogenetic tree suggested that metazoan ancestors had already acquired a set of conserved domains of the current Msx family genes. Interestingly, although strongly conserved sequences were recovered from the Vertebrata, Cephalochordata, and Anthozoa, the sequences from the Urochordata and Hydrozoa showed weak conservation. Because the Vertebrata-Cephalochordata-Urochordata and Anthozoa-Hydrozoa represent sister groups in the Chordata and Cnidaria, respectively, Msx sequence diversification may have occurred differentially in the course of evolution. We speculate that selective loss of the conserved domains in Msx family proteins contributed to the diversification of animal body organization.

Transcriptional Activation of Pyoluteorin Operon Mediated by the LysR-Type Regulator PltR Bound at a 22 bp lys Box in Pseudomonas aeruginosa M18

PubMed Central

Wang, Guohao; Xu, Yuquan

2012-01-01

Pseudomonas aeruginosa M18, a rhizosphere-isolated bacterial strain showing strong antifungal activity, can produce secondary metabolites such as phenazine-1-carboxylic acid and pyoluteorin (Plt). The LysR-type transcriptional regulator PltR activates the Plt biosynthesis operon pltLABCDEFG, the expression of which is induced by Plt. Here, we identified and characterized the non-conserved pltL promoter (pltLp) specifically activated by PltR and its upstream neighboring lys box from the complicated pltR–pltL intergenic sequence. The 22 bp palindromic lys box, which consists of two 9 bp complementary inverted repeats interrupted by 4 bp, was found to contain the conserved, GC-rich LysR-binding motif (T-N11-A). Evidence obtained in vivo from mutational and lacZ report analyses and in vitro from electrophoretic mobility shift assays reveals that the PltR protein directly bound to the pltLp region as the indispensable binding motif “lys box”, thereby transcriptionally activating the pltLp-driven plt operon expression. Plt, as a potential non-essential coinducer of PltR, specifically induced the pltLp expression and thus strengthened its biosynthetic plt operon expression. PMID:22761817

Ancestral multipartite units in light-responsive plant promoters have structural features correlating with specific phototransduction pathways.

PubMed Central

Argüello-Astorga, G R; Herrera-Estrella, L R

1996-01-01

Regulation of plant gene transcription by light is mediated by multipartite cis-regulatory units. Previous attempts to identify structural features that are common to all light-responsive elements (LREs) have been unsuccessful. To address the question of what is needed to confer photoresponsiveness to a promoter, the upstream sequences from more than 110 light-regulated plant genes were analyzed by a new, phylogenetic-structural method. As a result, 30 distinct conserved DNA module arrays (CMAs) associated with light-responsive promoter regions were identified. Several of these CMAs have remained invariant throughout the evolutionary radiation of angiosperms and are conserved between homologous genes as well as between members of different gene families. The identified CMAs share a gene superfamily-specific core that correlates with the particular phytochrome-dependent transduction pathway that controls their expression, i.e. ACCTA(A/C)C(A/C) for the cGMP-dependent phenylpropanoid metabolism-associated genes, and GATA(A/T)GR for the Ca2+/calmodulin-dependent photosynthesis-associated nuclear genes. In addition to suggesting a general model for the functional and structural organization of LREs, the data obtained in this study indicate that angiosperm LREs probably evolved from complex cis-acting elements involved in regulatory processes other than photoregulation in gymnosperms. PMID:8938415

Repression of enhancer II activity by a negative regulatory element in the hepatitis B virus genome.

PubMed Central

Lo, W Y; Ting, L P

1994-01-01

Enhancer II of human hepatitis B virus has dual functions in vivo. Located at nucleotides (nt) 1646 to 1741, it can stimulate the surface and X promoters from a downstream position. Moreover, the same sequence can also function as upstream regulatory element that activates the core promoter in a position- and orientation-dependent manner. In this study, we report the identification and characterization of a negative regulatory element (NRE) upstream of enhancer II (nt 1613 to 1636) which can repress both the enhancer and upstream stimulatory function of the enhancer II sequence in differentiated liver cells. This NRE has marginal inhibitory effect by itself but a strong repressive function in the presence of a functional enhancer II. Mutational analysis reveals that sequence from nt 1616 to 1621 is required for repression of enhancer activity by the NRE. Gel shift analysis reveals that this negative regulatory region can be recognized by a specific protein factor(s) present at the 0.4 M NaCl fraction of HepG2 nuclear extracts. The discovery of the NRE indicates that HBV gene transcription is controlled by combined effects of both positive and negative regulation. It also provides a unique system with which to study the mechanism of negative regulation of gene expression. Images PMID:8107237

Identification of the HrpS binding site in the hrpL promoter and effect of the RpoN binding site of HrpS on the regulation of the type III secretion system in Erwinia amylovora.

PubMed

Lee, Jae Hoon; Sundin, George W; Zhao, Youfu

2016-06-01

The type III secretion system (T3SS) is a key pathogenicity factor in Erwinia amylovora. Previous studies have demonstrated that the T3SS in E. amylovora is transcriptionally regulated by an RpoN-HrpL sigma factor cascade, which is activated by the bacterial alarmone (p)ppGpp. In this study, the binding site of HrpS, an enhancer binding protein, was identified for the first time in plant-pathogenic bacteria. Complementation of the hrpL mutant with promoter deletion constructs of the hrpL gene and promoter activity analyses using various lengths of the hrpL promoter fused to a promoter-less green fluorescent protein (gfp) reporter gene delineated the upstream region for HrpS binding. Sequence analysis revealed a dyad symmetry sequence between -138 and -125 nucleotides (TGCAA-N4-TTGCA) as the potential HrpS binding site, which is conserved in the promoter of the hrpL gene among plant enterobacterial pathogens. Results of quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) and electrophoresis mobility shift assay coupled with site-directed mutagenesis (SDM) analysis showed that the intact dyad symmetry sequence was essential for HrpS binding, full activation of T3SS gene expression and virulence. In addition, the role of the GAYTGA motif (RpoN binding site) of HrpS in the regulation of T3SS gene expression in E. amylovora was characterized by complementation of the hrpS mutant using mutant variants generated by SDM. Results showed that a Y100F substitution of HrpS complemented the hrpS mutant, whereas Y100A and Y101A substitutions did not. These results suggest that tyrosine (Y) and phenylalanine (F) function interchangeably in the conserved GAYTGA motif of HrpS in E. amylovora. © 2015 BSPP AND JOHN WILEY & SONS LTD.

LexA Binds to Transcription Regulatory Site of Cell Division Gene ftsZ in Toxic Cyanobacterium Microcystis aeruginosa.

PubMed

Honda, Takashi; Morimoto, Daichi; Sako, Yoshihiko; Yoshida, Takashi

2018-05-17

Previously, we showed that DNA replication and cell division in toxic cyanobacterium Microcystis aeruginosa are coordinated by transcriptional regulation of cell division gene ftsZ and that an unknown protein specifically bound upstream of ftsZ (BpFz; DNA-binding protein to an upstream site of ftsZ) during successful DNA replication and cell division. Here, we purified BpFz from M. aeruginosa strain NIES-298 using DNA-affinity chromatography and gel-slicing combined with gel electrophoresis mobility shift assay (EMSA). The N-terminal amino acid sequence of BpFz was identified as TNLESLTQ, which was identical to that of transcription repressor LexA from NIES-843. EMSA analysis using mutant probes showed that the sequence GTACTAN 3 GTGTTC was important in LexA binding. Comparison of the upstream regions of lexA in the genomes of closely related cyanobacteria suggested that the sequence TASTRNNNNTGTWC could be a putative LexA recognition sequence (LexA box). Searches for TASTRNNNNTGTWC as a transcriptional regulatory site (TRS) in the genome of M. aeruginosa NIES-843 showed that it was present in genes involved in cell division, photosynthesis, and extracellular polysaccharide biosynthesis. Considering that BpFz binds to the TRS of ftsZ during normal cell division, LexA may function as a transcriptional activator of genes related to cell reproduction in M. aeruginosa, including ftsZ. This may be an example of informality in the control of bacterial cell division.

Construction of a self-cloning sake yeast that overexpresses alcohol acetyltransferase gene by a two-step gene replacement protocol.

PubMed

Hirosawa, I; Aritomi, K; Hoshida, H; Kashiwagi, S; Nishizawa, Y; Akada, R

2004-07-01

The commercial application of genetically modified industrial microorganisms has been problematic due to public concerns. We constructed a "self-cloning" sake yeast strain that overexpresses the ATF1 gene encoding alcohol acetyltransferase, to improve the flavor profile of Japanese sake. A constitutive yeast overexpression promoter, TDH3p, derived from the glyceraldehyde-3-phosphate dehydrogenase gene from sake yeast was fused to ATF1; and the 5' upstream non-coding sequence of ATF1 was further fused to TDH3p-ATF1. The fragment was placed on a binary vector, pGG119, containing a drug-resistance marker for transformation and a counter-selection marker for excision of unwanted DNA. The plasmid was integrated into the ATF1 locus of a sake yeast strain. This integration constructed tandem repeats of ATF1 and TDH3p-ATF1 sequences, between which the plasmid was inserted. Loss of the plasmid, which occurs through homologous recombination between either the TDH3p downstream ATF1 repeats or the TDH3p upstream repeat sequences, was selected by growing transformants on counter-selective medium. Recombination between the downstream repeats led to reversion to a wild type strain, but that between the upstream repeats resulted in a strain that possessed TDH3p-ATF1 without the extraneous DNA sequences. The self-cloning TDH3p-ATF1 yeast strain produced a higher amount of isoamyl acetate. This is the first expression-controlled self-cloning industrial yeast.

Functionally conserved enhancers with divergent sequences in distant vertebrates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Song; Oksenberg, Nir; Takayama, Sachiko

To examine the contributions of sequence and function conservation in the evolution of enhancers, we systematically identified enhancers whose sequences are not conserved among distant groups of vertebrate species, but have homologous function and are likely to be derived from a common ancestral sequence. In conclusion, our approach combined comparative genomics and epigenomics to identify potential enhancer sequences in the genomes of three groups of distantly related vertebrate species.

Functionally conserved enhancers with divergent sequences in distant vertebrates

DOE PAGES

Yang, Song; Oksenberg, Nir; Takayama, Sachiko; ...

2015-10-30

To examine the contributions of sequence and function conservation in the evolution of enhancers, we systematically identified enhancers whose sequences are not conserved among distant groups of vertebrate species, but have homologous function and are likely to be derived from a common ancestral sequence. In conclusion, our approach combined comparative genomics and epigenomics to identify potential enhancer sequences in the genomes of three groups of distantly related vertebrate species.

Analysis of conserved noncoding DNA in Drosophila reveals similar constraints in intergenic and intronic sequences.

PubMed

Bergman, C M; Kreitman, M

2001-08-01

Comparative genomic approaches to gene and cis-regulatory prediction are based on the principle that differential DNA sequence conservation reflects variation in functional constraint. Using this principle, we analyze noncoding sequence conservation in Drosophila for 40 loci with known or suspected cis-regulatory function encompassing >100 kb of DNA. We estimate the fraction of noncoding DNA conserved in both intergenic and intronic regions and describe the length distribution of ungapped conserved noncoding blocks. On average, 22%-26% of noncoding sequences surveyed are conserved in Drosophila, with median block length approximately 19 bp. We show that point substitution in conserved noncoding blocks exhibits transition bias as well as lineage effects in base composition, and occurs more than an order of magnitude more frequently than insertion/deletion (indel) substitution. Overall, patterns of noncoding DNA structure and evolution differ remarkably little between intergenic and intronic conserved blocks, suggesting that the effects of transcription per se contribute minimally to the constraints operating on these sequences. The results of this study have implications for the development of alignment and prediction algorithms specific to noncoding DNA, as well as for models of cis-regulatory DNA sequence evolution.

Enhancer elements upstream of the SHOX gene are active in the developing limb.

PubMed

Durand, Claudia; Bangs, Fiona; Signolet, Jason; Decker, Eva; Tickle, Cheryll; Rappold, Gudrun

2010-05-01

Léri-Weill Dyschondrosteosis (LWD) is a dominant skeletal disorder characterized by short stature and distinct bone anomalies. SHOX gene mutations and deletions of regulatory elements downstream of SHOX resulting in haploinsufficiency have been found in patients with LWD. SHOX encodes a homeodomain transcription factor and is known to be expressed in the developing limb. We have now analyzed the regulatory significance of the region upstream of the SHOX gene. By comparative genomic analyses, we identified several conserved non-coding elements, which subsequently were tested in an in ovo enhancer assay in both chicken limb bud and cornea, where SHOX is also expressed. In this assay, we found three enhancers to be active in the developing chicken limb, but none were functional in the developing cornea. A screening of 60 LWD patients with an intact SHOX coding and downstream region did not yield any deletion of the upstream enhancer region. Thus, we speculate that SHOX upstream deletions occur at a lower frequency because of the structural organization of this genomic region and/or that SHOX upstream deletions may cause a phenotype that differs from the one observed in LWD.

Enhancer elements upstream of the SHOX gene are active in the developing limb

PubMed Central

Durand, Claudia; Bangs, Fiona; Signolet, Jason; Decker, Eva; Tickle, Cheryll; Rappold, Gudrun

2010-01-01

Léri-Weill Dyschondrosteosis (LWD) is a dominant skeletal disorder characterized by short stature and distinct bone anomalies. SHOX gene mutations and deletions of regulatory elements downstream of SHOX resulting in haploinsufficiency have been found in patients with LWD. SHOX encodes a homeodomain transcription factor and is known to be expressed in the developing limb. We have now analyzed the regulatory significance of the region upstream of the SHOX gene. By comparative genomic analyses, we identified several conserved non-coding elements, which subsequently were tested in an in ovo enhancer assay in both chicken limb bud and cornea, where SHOX is also expressed. In this assay, we found three enhancers to be active in the developing chicken limb, but none were functional in the developing cornea. A screening of 60 LWD patients with an intact SHOX coding and downstream region did not yield any deletion of the upstream enhancer region. Thus, we speculate that SHOX upstream deletions occur at a lower frequency because of the structural organization of this genomic region and/or that SHOX upstream deletions may cause a phenotype that differs from the one observed in LWD. PMID:19997128

Biological function in the twilight zone of sequence conservation.

PubMed

Ponting, Chris P

2017-08-16

Strong DNA conservation among divergent species is an indicator of enduring functionality. With weaker sequence conservation we enter a vast 'twilight zone' in which sequence subject to transient or lower constraint cannot be distinguished easily from neutrally evolving, non-functional sequence. Twilight zone functional sequence is illuminated instead by principles of selective constraint and positive selection using genomic data acquired from within a species' population. Application of these principles reveals that despite being biochemically active, most twilight zone sequence is not functional.

Characterization and expression analysis of Toll-like receptor 3 cDNA from Atlantic salmon (Salmo salar).

PubMed

Vidal, R; González, R; Gil, F

2015-06-10

Innate pathway activation is fundamental for early anti-viral defense in fish, but currently there is insufficient understanding of how salmonid fish identify viral molecules and activate these pathways. The Toll-like receptor (TLR) is believed to play a crucial role in host defense of pathogenic microbes in the innate immune system. In the present study, the full-length cDNA of Salmo salar TLR3 (ssTLR3) was cloned. The ssTLR3 cDNA sequence was 6071 bp long, containing an open reading frame of 2754 bp and encoding 971 amino acids. The TLR group motifs, such as leucine-rich repeat (LRR) domains and Toll-interleukin-1 receptor (TIR) domains, were maintained in ssTLR3, with sixteen LRR domains and one TIR domain. In contrast to descriptions of the TLR3 in rainbow trout and the murine (TATA-less), we found a putative TATA box in the proximal promoter region 29 bp upstream of the transcription start point of ssTLR3. Multiple-sequence alignment analysis of the ssTLR3 protein-coding sequence with other known TLR3 sequences showed the sequence to be conserved among all species analyzed, implying that the function of the TLR3 had been sustained throughout evolution. The ssTLR3 mRNA expression patterns were measured using real-time PCR. The results revealed that TLR3 is widely expressed in various healthy tissues. Individuals challenged with infectious pancreatic necrosis virus and immunostimulated with polyinosinic:polycytidylic acid exhibited increased expression of TLR3 at the mRNA level, indicating that ssTLR3 may be involved in pathogen recognition in the early innate immune system.

A strategy for detecting the conservation of folding-nucleus residues in protein superfamilies.

PubMed

Michnick, S W; Shakhnovich, E

1998-01-01

Nucleation-growth theory predicts that fast-folding peptide sequences fold to their native structure via structures in a transition-state ensemble that share a small number of native contacts (the folding nucleus). Experimental and theoretical studies of proteins suggest that residues participating in folding nuclei are conserved among homologs. We attempted to determine if this is true in proteins with highly diverged sequences but identical folds (superfamilies). We describe a strategy based on comparisons of residue conservation in natural superfamily sequences with simulated sequences (generated with a Monte-Carlo sequence design strategy) for the same proteins. The basic assumptions of the strategy were that natural sequences will conserve residues needed for folding and stability plus function, the simulated sequences contain no functional conservation, and nucleus residues make native contacts with each other. Based on these assumptions, we identified seven potential nucleus residues in ubiquitin superfamily members. Non-nucleus conserved residues were also identified; these are proposed to be involved in stabilizing native interactions. We found that all superfamily members conserved the same potential nucleus residue positions, except those for which the structural topology is significantly different. Our results suggest that the conservation of the nucleus of a specific fold can be predicted by comparing designed simulated sequences with natural highly diverged sequences that fold to the same structure. We suggest that such a strategy could be used to help plan protein folding and design experiments, to identify new superfamily members, and to subdivide superfamilies further into classes having a similar folding mechanism.

Fine-tuning structural RNA alignments in the twilight zone.

PubMed

Bremges, Andreas; Schirmer, Stefanie; Giegerich, Robert

2010-04-30

A widely used method to find conserved secondary structure in RNA is to first construct a multiple sequence alignment, and then fold the alignment, optimizing a score based on thermodynamics and covariance. This method works best around 75% sequence similarity. However, in a "twilight zone" below 55% similarity, the sequence alignment tends to obscure the covariance signal used in the second phase. Therefore, while the overall shape of the consensus structure may still be found, the degree of conservation cannot be estimated reliably. Based on a combination of available methods, we present a method named planACstar for improving structure conservation in structural alignments in the twilight zone. After constructing a consensus structure by alignment folding, planACstar abandons the original sequence alignment, refolds the sequences individually, but consistent with the consensus, aligns the structures, irrespective of sequence, by a pure structure alignment method, and derives an improved sequence alignment from the alignment of structures, to be re-submitted to alignment folding, etc.. This circle may be iterated as long as structural conservation improves, but normally, one step suffices. Employing the tools ClustalW, RNAalifold, and RNAforester, we find that for sequences with 30-55% sequence identity, structural conservation can be improved by 10% on average, with a large variation, measured in terms of RNAalifold's own criterion, the structure conservation index.

Synergism between a half-site and an imperfect estrogen-responsive element, and cooperation with COUP-TFI are required for estrogen receptor (ER) to achieve a maximal estrogen-stimulation of rainbow trout ER gene.

PubMed

Petit, F G; Métivier, R; Valotaire, Y; Pakdel, F

1999-01-01

In all oviparous, liver represents one of the main E2-target tissues where estrogen receptor (ER) constitutes the key mediator of estrogen action. The rainbow trout estrogen receptor (rtER) gene expression is markedly up-regulated by estrogens and the sequences responsible for this autoregulation have been located in a 0.2 kb upstream transcription start site within - 40/- 248 enhancer region. Absence of interference with steroid hormone receptors and tissue-specific factors and a conserved basal transcriptional machinery between yeast and higher eukaryotes, make yeast a simple assay system that will enable determination of important cis-acting regulatory sequences within rtER gene promoter and identification of transcription factors implicated in the regulation of this gene. Deletion analysis allowed to show a synergistic effect between an imperfect estrogen-responsive element (ERE) and a consensus half-ERE to achieve a high hormone-dependent transcriptional activation of the rtER gene promoter in the presence of stably expressed rtER. As in mammalian cells, here we observed a positive regulation of the rtER gene promoter by the chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI) through enhancing autoregulation. Using a point mutation COUP-TFI mutant unable to bind DNA demonstrates that enhancement of rtER gene autoregulation requires the interaction of COUP-TFI to the DNA. Moreover, this enhancement of transcriptional activation by COUP-TFI requires specifically the AF-1 transactivation function of ER and can be observed in the presence of E2 or 4-hydroxytamoxifen but not ICI 164384. Thus, this paper describes the reconstitution of a hormone-responsive transcription unit in yeast in which the regulation of rtER gene promoter could be enhanced by the participation of cis-elements and/or trans-acting factors, such as ER itself or COUP-TF.

Identification of new TSGA10 transcript variants in human testis with conserved regulatory RNA elements in 5'untranslated region and distinct expression in breast cancer.

PubMed

Salehipour, Pouya; Nematzadeh, Mahsa; Mobasheri, Maryam Beigom; Afsharpad, Mandana; Mansouri, Kamran; Modarressi, Mohammad Hossein

2017-09-01

Testis specific gene antigen 10 (TSGA10) is a cancer testis antigen involved in the process of spermatogenesis. TSGA10 could also play an important role in the inhibition of angiogenesis by preventing nuclear localization of HIF-1α. Although it has been shown that TSGA10 messenger RNA (mRNA) is mainly expressed in testis and some tumors, the transcription pattern and regulatory mechanisms of this gene remain largely unknown. Here, we report that human TSGA10 comprises at least 22 exons and generates four different transcript variants. It was identified that using two distinct promoters and splicing of exons 4 and 7 produced these transcript variants, which have the same coding sequence, but the sequence of 5'untanslated region (5'UTR) is different between them. This is significant because conserved regulatory RNA elements like upstream open reading frame (uORF) and putative internal ribosome entry site (IRES) were found in this region which have different combinations in each transcript variant and it may influence translational efficiency of them in normal or unusual environmental conditions like hypoxia. To indicate the transcription pattern of TSGA10 in breast cancer, expression of identified transcript variants was analyzed in 62 breast cancer samples. We found that TSGA10 tends to express variants with shorter 5'UTR and fewer uORF elements in breast cancer tissues. Our study demonstrates for the first time the expression of different TSGA10 transcript variants in testis and breast cancer tissues and provides a first clue to a role of TSGA10 5'UTR in regulation of translation in unusual environmental conditions like hypoxia. Copyright © 2017. Published by Elsevier B.V.

Analysis of the primary structure of the long terminal repeat and the gag and pol genes of the human spumaretrovirus.

PubMed Central

Maurer, B; Bannert, H; Darai, G; Flügel, R M

1988-01-01

The nucleotide sequence of the human spumaretrovirus (HSRV) genome was determined. The 5' long terminal repeat region was analyzed by strong stop cDNA synthesis and S1 nuclease mapping. The length of the RU5 region was determined and found to be 346 nucleotides long. The 5' long terminal repeat is 1,123 base pairs long and is bound by an 18-base-pair primer-binding site complementary to the 3' end of mammalian lysine-1,2-specific tRNA. Open reading frames for gag and pol genes were identified. Surprisingly, the HSRV gag protein does not contain the cysteine motif of the nucleic acid-binding proteins found in and typical of all other retroviral gag proteins; instead the HSRV gag gene encodes a strongly basic protein reminiscent of those of hepatitis B virus and retrotransposons. The carboxy-terminal part of the HSRV gag gene products encodes a protease domain. The pol gene overlaps the gag gene and is postulated to be synthesized as a gag/pol precursor via translational frameshifting analogous to that of Rous sarcoma virus, with 7 nucleotides immediately upstream of the termination codons of gag conserved between the two viral genomes. The HSRV pol gene is 2,730 nucleotides long, and its deduced protein sequence is readily subdivided into three well-conserved domains, the reverse transcriptase, the RNase H, and the integrase. Although the degree of homology of the HSRV reverse transcriptase domain is highest to that of murine leukemia virus, the HSRV genomic organization is more similar to that of human and simian immunodeficiency viruses. The data justify classifying the spumaretroviruses as a third subfamily of Retroviridae. Images PMID:2451755

The human phospholamban gene: structure and expression.

PubMed

McTiernan, C F; Frye, C S; Lemster, B H; Kinder, E A; Ogletree-Hughes, M L; Moravec, C S; Feldman, A M

1999-03-01

Phospholamban, through modulation of sarcoplasmic reticulum calcium-ATPase activity, is a key regulator of cardiac diastolic function. Alterations in phospholamban expression may define parameters of muscle relaxation. In experimental animals, phospholamban is differentially expressed in various striated and smooth muscles, and within the four chambers of the heart. Decreased phospholamban expression within the heart during heart failure has also been observed. Furthermore, regulatory elements of mammalian phospholamban genes remain poorly defined. To extend these studies to humans, we (1) characterized phospholamban expression in various human organs, (2) isolated genomic clones encoding the human phospholamban gene, and (3) prepared human phospholamban promoter/luciferase reporter constructs and performed transient transfection assays to begin identification of regulatory elements. We observed that human ventricle and quadriceps displayed high levels of phospholamban transcripts and proteins, with markedly lower expression observed in smooth muscles, while the right atria also expressed low levels of phospholamban. The human phospholamban gene structure closely resembles that reported for chicken, rabbit, rat, and mouse. Comparison of the human to other mammalian phospholamban genes indicates a marked conservation of sequence for at least 217 bp upstream of the transcription start site, which contains conserved motifs for GATA, CP1/NFY, M-CAT-like, and E-box elements. Transient transfection assays with a series of plasmids containing deleted 5' flanking regions (between -2530 and -66 through +85) showed that sequences between -169 and the CP1-box at -93 were required for maximal promoter activity in neonatal rat cardiomyocytes. Activity of these reporters in HeLa cells was markedly lower than that observed in rat cardiomyocytes, suggesting at least a partial tissue selectivity of these reporter constructs.

Plutella xylostella granulovirus late gene promoter activity in the context of the Autographa californica multiple nucleopolyhedrovirus genome.

PubMed

Ren, He-Lin; Hu, Yuan; Guo, Ya-Jun; Li, Lu-Lin

2016-06-01

Within Baculoviridae, little is known about the molecular mechanisms of replication in betabaculoviruses, despite extensive studies in alphabaculoviruses. In this study, the promoters of nine late genes of the betabaculovirus Plutella xylostella granulovirus (PlxyGV) were cloned into a transient expression vector and the alphabaculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) genome, and compared with homologous late gene promoters of AcMNPV in Sf9 cells. In transient expression assays, all PlxyGV late promoters were activated in cells transfected with the individual reporter plasmids together with an AcMNPV bacmid. In infected cells, reporter gene expression levels with the promoters of PlxyGV e18 and AcMNPV vp39 and gp41 were significantly higher than those of the corresponding AcMNPV or PlxyGV promoters, which had fewer late promoter motifs. Observed expression levels were lower for the PlxyGV p6.9, pk1, gran, p10a, and p10b promoters than for the corresponding AcMNPV promoters, despite equal numbers of late promoter motifs, indicating that species-specific elements contained in some late promoters were favored by the native viral RNA polymerases for optimal transcription. The 8-nt sequence TAAATAAG encompassing the ATAAG motif was conserved in the AcMNPV polh, p10, and pk1 promoters. The 5-nt sequence CAATT located 4 or 5 nt upstream of the T/ATAAG motif was conserved in the promoters of PlxyGV gran, p10c, and pk1. The results of this study demonstrated that PlxyGV late gene promoters could be effectively activated by the RNA polymerase from AcMNPV, implying that late gene expression systems are regulated by similar mechanisms in alphabaculoviruses and betabaculoviruses.

Genetic, comparative genomic, and expression analyses of the Mc1r locus in the polychromatic Midas cichlid fish (Teleostei, Cichlidae Amphilophus sp.) species group.

PubMed

Henning, Frederico; Renz, Adina Josepha; Fukamachi, Shoji; Meyer, Axel

2010-05-01

Natural populations of the Midas cichlid species in several different crater lakes in Nicaragua exhibit a conspicuous color polymorphism. Most individuals are dark and the remaining have a gold coloration. The color morphs mate assortatively and sympatric population differentiation has been shown based on neutral molecular data. We investigated the color polymorphism using segregation analysis and a candidate gene approach. The segregation patterns observed in a mapping cross between a gold and a dark individual were consistent with a single dominant gene as a cause of the gold phenotype. This suggests that a simple genetic architecture underlies some of the speciation events in the Midas cichlids. We compared the expression levels of several candidate color genes Mc1r, Ednrb1, Slc45a2, and Tfap1a between the color morphs. Mc1r was found to be up regulated in the gold morph. Given its widespread association in color evolution and role on melanin synthesis, the Mc1r locus was further investigated using sequences derived from a genomic library. Comparative analysis revealed conserved synteny in relation to the majority of teleosts and highlighted several previously unidentified conserved non-coding elements (CNEs) in the upstream and downstream regions in the vicinity of Mc1r. The identification of the CNEs regions allowed the comparison of sequences from gold and dark specimens of natural populations. No polymorphisms were found between in the population sample and Mc1r showed no linkage to the gold phenotype in the mapping cross, demonstrating that it is not causally related to the color polymorphism in the Midas cichlid.

Sequence Elements Upstream of the Core Promoter Are Necessary for Full Transcription of the Capsule Gene Operon in Streptococcus pneumoniae Strain D39

PubMed Central

Wen, Zhensong; Sertil, Odeniel; Cheng, Yongxin; Zhang, Shanshan; Liu, Xue; Wang, Wen-Ching

2015-01-01

Streptococcus pneumoniae is a major bacterial pathogen in humans. Its polysaccharide capsule is a key virulence factor that promotes bacterial evasion of human phagocytic killing. While S. pneumoniae produces at least 94 antigenically different types of capsule, the genes for biosynthesis of almost all capsular types are arranged in the same locus. The transcription of the capsular polysaccharide (cps) locus is not well understood. This study determined the transcriptional features of the cps locus in the type 2 virulent strain D39. The initial analysis revealed that the cps genes are cotranscribed from a major transcription start site at the −25 nucleotide (G) upstream of cps2A, the first gene in the locus. Using unmarked chromosomal truncations and a luciferase-based transcriptional reporter, we showed that the full transcription of the cps genes not only depends on the core promoter immediately upstream of cps2A, but also requires additional elements upstream of the core promoter, particularly a 59-bp sequence immediately upstream of the core promoter. Unmarked deletions of these promoter elements in the D39 genome also led to significant reduction in CPS production and virulence in mice. Lastly, common cps gene (cps2ABCD) mutants did not show significant abnormality in cps transcription, although they produced significantly less CPS, indicating that the CpsABCD proteins are involved in the encapsulation of S. pneumoniae in a posttranscriptional manner. This study has yielded important information on the transcriptional characteristics of the cps locus in S. pneumoniae. PMID:25733517

Macrolide resistance in Legionella pneumophila: the role of LpeAB efflux pump.

PubMed

Massip, Clémence; Descours, Ghislaine; Ginevra, Christophe; Doublet, Patricia; Jarraud, Sophie; Gilbert, Christophe

2017-05-01

A previous study on 12 in vitro -selected azithromycin-resistant Legionella pneumophila lineages showed that ribosomal mutations were major macrolide resistance determinants. In addition to these mechanisms that have been well described in many species, mutations upstream of lpeAB operon, homologous to acrAB in Escherichia coli , were identified in two lineages. In this study, we investigated the role of LpeAB and of these mutations in macrolide resistance of L. pneumophila . The role of LpeAB was studied by testing the antibiotic susceptibility of WT, deleted and complemented L. pneumophila Paris strains. Translational fusion experiments using GFP as a reporter were conducted to investigate the consequences of the mutations observed in the upstream sequence of lpeAB operon. We demonstrated the involvement of LpeAB in an efflux pump responsible for a macrolide-specific reduced susceptibility of L. pneumophila Paris strain. Mutations in the upstream sequence of lpeAB operon were associated with an increased protein expression. Increased expression was also observed under sub-inhibitory macrolide concentrations in strains with both mutated and WT promoting regions. LpeAB are components of an efflux pump, which is a macrolide resistance determinant in L. pneumophila Paris strain. Mutations observed in the upstream sequence of lpeAB operon in resistant lineages led to an overexpression of this efflux pump. Sub-inhibitory concentrations of macrolides themselves participated in upregulating this efflux and could constitute a first step in the acquisition of a high macrolide resistance level. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

7 CFR 613.2 - Policy and objectives.

Code of Federal Regulations, 2011 CFR

2011-01-01

... working with experiment stations, crop improvement associations, and other State and Federal agencies. (b... related to: (1) Controlling soil erosion on all lands; (2) Conserving water; (3) Protecting upstream... enhancement; (12) Selecting plants that tolerate air pollution agents and toxic soil chemicals; (13) Selecting...

Structural studies of the nudix hydrolase DR1025 from deinococcus radiodurans and its ligand complexes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ranatunga, Wasantha; Hill, Emma E.; Mooster, Jana L.

We have determined the crystal structure, at 1.4, of the Nudix hydrolase DR1025 from the extremely radiation resistant bacterium Deinococcus radiodurans. The protein forms an intertwined homodimer by exchanging N-terminal segments between chains. We have identified additional conserved elements of the Nudix fold, including the metal-binding motif, a kinked b-strand characterized by a proline two positions upstream of the Nudix consensus sequence, and participation of the N-terminal extension in the formation of the substrate-binding pocket. Crystal structures were also solved of DR1025 crystallized in the presence of magnesium and either a GTP analog or Ap4A (both at 1.6 resolution). Inmore » the Ap4Aco-crystal, the electron density indicated that the product of asymmetric hydrolysis, ATP, was bound to the enzyme. The GTP analog bound structure showed that GTP was bound almost identically as ATP. Neither nucleoside triphosphate was further cleaved.« less

Mediator binding to UASs is broadly uncoupled from transcription and cooperative with TFIID recruitment to promoters.

PubMed

Grünberg, Sebastian; Henikoff, Steven; Hahn, Steven; Zentner, Gabriel E

2016-11-15

Mediator is a conserved, essential transcriptional coactivator complex, but its in vivo functions have remained unclear due to conflicting data regarding its genome-wide binding pattern obtained by genome-wide ChIP Here, we used ChEC-seq, a method orthogonal to ChIP, to generate a high-resolution map of Mediator binding to the yeast genome. We find that Mediator associates with upstream activating sequences (UASs) rather than the core promoter or gene body under all conditions tested. Mediator occupancy is surprisingly correlated with transcription levels at only a small fraction of genes. Using the same approach to map TFIID, we find that TFIID is associated with both TFIID- and SAGA-dependent genes and that TFIID and Mediator occupancy is cooperative. Our results clarify Mediator recruitment and binding to the genome, showing that Mediator binding to UASs is widespread, partially uncoupled from transcription, and mediated in part by TFIID. © 2016 The Authors.

Regulation of the cnr Cobalt and Nickel Resistance Determinant from Ralstonia sp. Strain CH34†

PubMed Central

Grass, Gregor; Große, Cornelia; Nies, Dietrich H.

2000-01-01

Ralstonia sp. strain CH34 is resistant to nickel and cobalt cations. Resistance is mediated by the cnr determinant located on plasmid pMOL28. The cnr genes are organized in two clusters, cnrYXH and cnrCBA. As revealed by reverse transcriptase PCR and primer extension, transcription from these operons is initiated from promoters located upstream of the cnrY and cnrC genes. These two promoters exhibit conserved sequences at the −10 (CCGTATA) and −35 (CRAGGGGRAG) regions. The CnrH gene product, which is required for expression of both operons, is a sigma factor belonging to the sigma L family, whose activity seems to be governed by the membrane-bound CnrY and CnrX gene products in response to Ni2+. Half-maximal activation from the cnrCBA operon was determined by using appropriate lacZ gene fusions and was shown to occur at an Ni2+ concentration of about 50 μM. PMID:10671463

Myostatin-2 gene structure and polymorphism of the promoter and first intron in the marine fish Sparus aurata: evidence for DNA duplications and/or translocations.

PubMed

Nadjar-Boger, Elisabeth; Funkenstein, Bruria

2011-02-01

Myostatin (MSTN) is a member of the transforming growth factor-ß superfamily that functions as a negative regulator of skeletal muscle development and growth in mammals. Fish express at least two genes for MSTN: MSTN-1 and MSTN-2. To date, MSTN-2 promoters have been cloned only from salmonids and zebrafish. Here we described the cloning and sequence analysis of MSTN-2 gene and its 5' flanking region in the marine fish Sparus aurata (saMSTN-2). We demonstrate the existence of three alleles of the promoter and three alleles of the first intron. Sequence comparison of the promoter region in the three alleles revealed that although the sequences of the first 1050 bp upstream of the translation start site are almost identical in the three alleles, a substantial sequence divergence is seen further upstream. Careful sequence analysis of the region upstream of the first 1050 bp in the three alleles identified several elements that appear to be repeated in some or all sequences, at different positions. This suggests that the promoter region of saMSTN-2 has been subjected to various chromosomal rearrangements during the course of evolution, reflecting either insertion or deletion events. Screening of several genomic DNA collections indicated differences in allele frequency, with allele 'b' being the most abundant, followed by allele 'c', whereas allele 'a' is relatively rare. Sequence analysis of saMSTN-2 gene also revealed polymorphism in the first intron, identifying three alleles. The length difference in alleles '1R' and '2R' of the first intron is due to the presence of one or two copies of a repeated block of approximately 150 bp, located at the 5' end of the first intron. The third allele, '4R', has an additional insertion of 323 bp located 116 bp upstream of the 3' end of the first intron. Analysis of several DNA collections showed that the '2R' allele is the most common, followed by the '4R' allele, whereas the '1R' allele is relatively rare. Progeny analysis of a full-sib family showed a Mendelian mode of inheritance of the two genetic loci. No clear association was found between the two genetic markers and growth rate. These results show for the first time a substantial degree of polymorphism in both the promoter and first intron of MSTN-2 gene in a perciform fish species which points to chromosomal rearrangements that took place during evolution.

LuFLA1PRO and LuBGAL1PRO promote gene expression in the phloem fibres of flax (Linum usitatissimum).

PubMed

Hobson, Neil; Deyholos, Michael K

2013-04-01

Cell type-specific promoters were identified that drive gene expression in an industrially important product. To identify flax (Linum usitatissimum) gene promoters, we analyzed the genomic regions upstream of a fasciclin-like arabinogalactan protein (LuFLA1) and a beta-galactosidase (LuBGAL1). Both of these genes encode transcripts that have been found to be highly enriched in tissues bearing phloem fibres. Using a beta-glucuronidase (GUS) reporter construct, we found that a 908-bp genomic sequence upstream of LuFLA1 (LuFLA1PRO) directed GUS expression with high specificity to phloem fibres undergoing secondary cell wall development. The DNA sequence upstream of LuBGAL1 (LuBGAL1PRO) likewise produced GUS staining in phloem fibres with developing secondary walls, as well as in tissues of developing flowers and seed bolls. These data provide further evidence of a specific role for LuFLA1 in phloem fibre development, and demonstrate the utility of LuFLA1PRO and LuBGAL1PRO as tools for biotechnology and further investigations of phloem fibre development.

Analysis of alterative cleavage and polyadenylation by 3′ region extraction and deep sequencing

PubMed Central

Hoque, Mainul; Ji, Zhe; Zheng, Dinghai; Luo, Wenting; Li, Wencheng; You, Bei; Park, Ji Yeon; Yehia, Ghassan; Tian, Bin

2012-01-01

Alternative cleavage and polyadenylation (APA) leads to mRNA isoforms with different coding sequences (CDS) and/or 3′ untranslated regions (3′UTRs). Using 3′ Region Extraction And Deep Sequencing (3′READS), a method which addresses the internal priming and oligo(A) tail issues that commonly plague polyA site (pA) identification, we comprehensively mapped pAs in the mouse genome, thoroughly annotating 3′ ends of genes and revealing over five thousand pAs (~8% of total) flanked by A-rich sequences, which have hitherto been overlooked. About 79% of mRNA genes and 66% of long non-coding RNA (lncRNA) genes have APA; but these two gene types have distinct usage patterns for pAs in introns and upstream exons. Promoter-distal pAs become relatively more abundant during embryonic development and cell differentiation, a trend affecting pAs in both 3′-most exons and upstream regions. Upregulated isoforms generally have stronger pAs, suggesting global modulation of the 3′ end processing activity in development and differentiation. PMID:23241633

Fast discovery and visualization of conserved regions in DNA sequences using quasi-alignment

PubMed Central

2013-01-01

Background Next Generation Sequencing techniques are producing enormous amounts of biological sequence data and analysis becomes a major computational problem. Currently, most analysis, especially the identification of conserved regions, relies heavily on Multiple Sequence Alignment and its various heuristics such as progressive alignment, whose run time grows with the square of the number and the length of the aligned sequences and requires significant computational resources. In this work, we present a method to efficiently discover regions of high similarity across multiple sequences without performing expensive sequence alignment. The method is based on approximating edit distance between segments of sequences using p-mer frequency counts. Then, efficient high-throughput data stream clustering is used to group highly similar segments into so called quasi-alignments. Quasi-alignments have numerous applications such as identifying species and their taxonomic class from sequences, comparing sequences for similarities, and, as in this paper, discovering conserved regions across related sequences. Results In this paper, we show that quasi-alignments can be used to discover highly similar segments across multiple sequences from related or different genomes efficiently and accurately. Experiments on a large number of unaligned 16S rRNA sequences obtained from the Greengenes database show that the method is able to identify conserved regions which agree with known hypervariable regions in 16S rRNA. Furthermore, the experiments show that the proposed method scales well for large data sets with a run time that grows only linearly with the number and length of sequences, whereas for existing multiple sequence alignment heuristics the run time grows super-linearly. Conclusion Quasi-alignment-based algorithms can detect highly similar regions and conserved areas across multiple sequences. Since the run time is linear and the sequences are converted into a compact clustering model, we are able to identify conserved regions fast or even interactively using a standard PC. Our method has many potential applications such as finding characteristic signature sequences for families of organisms and studying conserved and variable regions in, for example, 16S rRNA. PMID:24564200

Fast discovery and visualization of conserved regions in DNA sequences using quasi-alignment.

PubMed

Nagar, Anurag; Hahsler, Michael

2013-01-01

Next Generation Sequencing techniques are producing enormous amounts of biological sequence data and analysis becomes a major computational problem. Currently, most analysis, especially the identification of conserved regions, relies heavily on Multiple Sequence Alignment and its various heuristics such as progressive alignment, whose run time grows with the square of the number and the length of the aligned sequences and requires significant computational resources. In this work, we present a method to efficiently discover regions of high similarity across multiple sequences without performing expensive sequence alignment. The method is based on approximating edit distance between segments of sequences using p-mer frequency counts. Then, efficient high-throughput data stream clustering is used to group highly similar segments into so called quasi-alignments. Quasi-alignments have numerous applications such as identifying species and their taxonomic class from sequences, comparing sequences for similarities, and, as in this paper, discovering conserved regions across related sequences. In this paper, we show that quasi-alignments can be used to discover highly similar segments across multiple sequences from related or different genomes efficiently and accurately. Experiments on a large number of unaligned 16S rRNA sequences obtained from the Greengenes database show that the method is able to identify conserved regions which agree with known hypervariable regions in 16S rRNA. Furthermore, the experiments show that the proposed method scales well for large data sets with a run time that grows only linearly with the number and length of sequences, whereas for existing multiple sequence alignment heuristics the run time grows super-linearly. Quasi-alignment-based algorithms can detect highly similar regions and conserved areas across multiple sequences. Since the run time is linear and the sequences are converted into a compact clustering model, we are able to identify conserved regions fast or even interactively using a standard PC. Our method has many potential applications such as finding characteristic signature sequences for families of organisms and studying conserved and variable regions in, for example, 16S rRNA.

Genetic structure of the snakehead murrel, Channa striata (channidae) based on the cytochrome c oxidase subunit I gene: Influence of historical and geomorphological factors.

PubMed

Jamsari, Amirul Firdaus Jamaluddin; Jamaluddin, Jamsari Amirul Firdaus; Pau, Tan Min; Siti-Azizah, Mohd Nor

2011-01-01

Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and F(ST) revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area.

Genetic structure of the snakehead murrel, Channa striata (channidae) based on the cytochrome c oxidase subunit I gene: Influence of historical and geomorphological factors

PubMed Central

Jamaluddin, Jamsari Amirul Firdaus; Pau, Tan Min; Siti-Azizah, Mohd Nor

2011-01-01

Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and FST revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area. PMID:21637559

Isolation and characterization of the genes for two small RNAs of herpesvirus papio and their comparison with Epstein-Barr virus-encoded EBER RNAs.

PubMed

Howe, J G; Shu, M D

1988-08-01

Genes for the Epstein-Barr virus-encoded RNAs (EBERs), two low-molecular-weight RNAs encoded by the human gammaherpesvirus Epstein-Barr virus (EBV), hybridize to two small RNAs in a baboon cell line that contains a similar virus, herpesvirus papio (HVP). The genes for the HVP RNAs (HVP-1 and HVP-2) are located together in the small unique region at the left end of the viral genome and are transcribed by RNA polymerase III in a rightward direction, similar to the EBERs. There is significant similarity between EBER1 and HVP-1 RNA, except for an insert of 22 nucleotides which increases the length of HVP-1 RNA to 190 nucleotides. There is less similarity between the sequences of EBER2 and HVP-2 RNA, but both have a length of about 170 nucleotides. The predicted secondary structure of each HVP RNA is remarkably similar to that of the respective EBER, implying that the secondary structures are important for function. Upstream from the initiation sites of all four RNA genes are several highly conserved sequences which may function in the regulation of transcription. The HVP RNAs, together with the EBERs, are highly abundant in transformed cells and are efficiently bound by the cellular La protein.

Multiple Cis-acting elements modulate programmed -1 ribosomal frameshifting in Pea enation mosaic virus

PubMed Central

Gao, Feng; Simon, Anne E.

2016-01-01

Programmed -1 ribosomal frameshifting (-1 PRF) is used by many positive-strand RNA viruses for translation of required products. Despite extensive studies, it remains unresolved how cis-elements just downstream of the recoding site promote a precise level of frameshifting. The Umbravirus Pea enation mosaic virus RNA2 expresses its RNA polymerase by -1 PRF of the 5′-proximal ORF (p33). Three hairpins located in the vicinity of the recoding site are phylogenetically conserved among Umbraviruses. The central Recoding Stimulatory Element (RSE), located downstream of the p33 termination codon, is a large hairpin with two asymmetric internal loops. Mutational analyses revealed that sequences throughout the RSE and the RSE lower stem (LS) structure are important for frameshifting. SHAPE probing of mutants indicated the presence of higher order structure, and sequences in the LS may also adapt an alternative conformation. Long-distance pairing between the RSE and a 3′ terminal hairpin was less critical when the LS structure was stabilized. A basal level of frameshifting occurring in the absence of the RSE increases to 72% of wild-type when a hairpin upstream of the slippery site is also deleted. These results suggest that suppression of frameshifting may be needed in the absence of an active RSE conformation. PMID:26578603

Nuclear accumulation of the Arabidopsis immune receptor RPS4 is necessary for triggering EDS1-dependent defense.

PubMed

Wirthmueller, Lennart; Zhang, Yan; Jones, Jonathan D G; Parker, Jane E

2007-12-04

Recognition of specific pathogen molecules inside the cell by nucleotide-binding domain and leucine-rich repeat (NB-LRR) receptors constitutes an important layer of innate immunity in plants. Receptor activation triggers host cellular reprogramming involving transcriptional potentiation of basal defenses and localized programmed cell death. The sites and modes of action of NB-LRR receptors are, however, poorly understood. Arabidopsis Toll/Interleukin-1 (TIR) type NB-LRR receptor RPS4 recognizes the bacterial type III effector AvrRps4. We show that epitope-tagged RPS4 expressed under its native regulatory sequences distributes between endomembranes and nuclei in healthy and AvrRps4-triggered tissues. RPS4 accumulation in the nucleus, mediated by a bipartite nuclear localization sequence (NLS) at its C terminus, is necessary for triggering immunity through authentic activation by AvrRps4 in Arabidopsis or as an effector-independent "deregulated" receptor in tobacco. A strikingly conserved feature of TIR-NB-LRR receptors is their recruitment of the nucleocytoplasmic basal-defense regulator EDS1 in resistance to diverse pathogens. We find that EDS1 is an indispensable component of RPS4 signaling and that it functions downstream of RPS4 activation but upstream of RPS4-mediated transcriptional reprogramming in the nucleus.

The complete mitochondrial genome and its remarkable secondary structure for a stonefly Acroneuria hainana Wu (Insecta: Plecoptera, Perlidae).

PubMed

Huang, Mingchao; Wang, Yuyu; Liu, Xingyue; Li, Weihai; Kang, Zehui; Wang, Kai; Li, Xuankun; Yang, Ding

2015-02-15

The Plecoptera (stoneflies) is a hemimetabolous order of insects, whose larvae are usually used as indicators for fresh water biomonitoring. Herein, we describe the complete mitochondrial (mt) genome of a stonefly species, namely Acroneuria hainana Wu belonging to the family Perlidae. This mt genome contains 13 PCGs, 22 tRNA-coding genes and 2 rRNA-coding genes that are conserved in most insect mt genomes, and it also has the identical gene order with the insect ancestral gene order. However, there are three special initiation codons of ND1, ND5 and COI in PCGs: TTG, GTG and CGA, coding for L, V and R, respectively. Additionally, the 899-bp control region, with 73.30% A+T content, has two long repeated sequences which are found at the 3'-end closing to the tRNA(Ile) gene. Both of them can be folded into a stem-loop structure, whose adjacent upstream and downstream sequences can be also folded into stem-loop structures. It is presumed that the four special structures in series could be associated with the D-loop replication. It might be able to adjust the replication speed of two replicate directions. Copyright © 2014 Elsevier B.V. All rights reserved.

In vitro mapping of Myotonic Dystrophy (DM) gene promoter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Storbeck, C.J.; Sabourin, L.; Baird, S.

1994-09-01

The Myotonic Dystrophy Kinase (DMK) gene has been cloned and shared homology to serine/threonine protein kinases. Overexpression of this gene in stably transfected mouse myoblasts has been shown to inhibit fusion into myotubes while myoblasts stably transfected with an antisense construct show increased fusion potential. These experiments, along with data showing that the DM gene is highly expressed in muscle have highlighted the possibility of DMK being involved in myogenesis. The promoter region of the DM gene lacks a consensus TATA box and CAAT box, but harbours numerous transcription binding sites. Clones containing extended 5{prime} upstream sequences (UPS) of DMKmore » only weakly drive the reporter gene chloramphenicol acetyl transferase (CAT) when transfected into C2C12 mouse myoblasts. However, four E-boxes are present in the first intron of the DM gene and transient assays show increased expression of the CAT gene when the first intron is present downstream of these 5{prime} UPS in an orientation dependent manner. Comparison between mouse and human sequence reveals that the regions in the first intron where the E-boxes are located are highly conserved. The mapping of the promoter and the importance of the first intron in the control of DMK expression will be presented.« less

A Sequence-Independent, Unstructured Internal Ribosome Entry Site Is Responsible for Internal Expression of the Coat Protein of Turnip Crinkle Virus

PubMed Central

May, Jared; Johnson, Philip; Saleem, Huma

2017-01-01

ABSTRACT To maximize the coding potential of viral genomes, internal ribosome entry sites (IRES) can be used to bypass the traditional requirement of a 5′ cap and some/all of the associated translation initiation factors. Although viral IRES typically contain higher-order RNA structure, an unstructured sequence of about 84 nucleotides (nt) immediately upstream of the Turnip crinkle virus (TCV) coat protein (CP) open reading frame (ORF) has been found to promote internal expression of the CP from the genomic RNA (gRNA) both in vitro and in vivo. An absence of extensive RNA structure was predicted using RNA folding algorithms and confirmed by selective 2′-hydroxyl acylation analyzed by primer extension (SHAPE) RNA structure probing. Analysis of the IRES region in vitro by use of both the TCV gRNA and reporter constructs did not reveal any sequence-specific elements but rather suggested that an overall lack of structure was an important feature for IRES activity. The CP IRES is A-rich, independent of orientation, and strongly conserved among viruses in the same genus. The IRES was dependent on eIF4G, but not eIF4E, for activity. Low levels of CP accumulated in vivo in the absence of detectable TCV subgenomic RNAs, strongly suggesting that the IRES was active in the gRNA in vivo. Since the TCV CP also serves as the viral silencing suppressor, early translation of the CP from the viral gRNA is likely important for countering host defenses. Cellular mRNA IRES also lack extensive RNA structures or sequence conservation, suggesting that this viral IRES and cellular IRES may have similar strategies for internal translation initiation. IMPORTANCE Cap-independent translation is a common strategy among positive-sense, single-stranded RNA viruses for bypassing the host cell requirement of a 5′ cap structure. Viral IRES, in general, contain extensive secondary structure that is critical for activity. In contrast, we demonstrate that a region of viral RNA devoid of extensive secondary structure has IRES activity and produces low levels of viral coat protein in vitro and in vivo. Our findings may be applicable to cellular mRNA IRES that also have little or no sequences/structures in common. PMID:28179526

Deregulation of polycomb repressor complex 1 modifier AUTS2 in T-cell leukemia.

PubMed

Nagel, Stefan; Pommerenke, Claudia; Meyer, Corinna; Kaufmann, Maren; Drexler, Hans G; MacLeod, Roderick A F

2016-07-19

Recently, we identified deregulated expression of the B-cell specific transcription factor MEF2C in T-cell acute lymphoid leukemia (T-ALL). Here, we performed sequence analysis of a regulatory upstream section of MEF2C in T-ALL cell lines which, however, proved devoid of mutations. Unexpectedly, we found strong conservation between the regulatory upstream region of MEF2C (located at chromosomal band 5q14) and an intergenic stretch at 7q11 located between STAG3L4 and AUTS2, covering nearly 20 kb. While the non-coding gene STAG3L4 was inconspicuously expressed, AUTS2 was aberrantly upregulated in 6% of T-ALL patients (public dataset GSE42038) and in 3/24 T-ALL cell lines, two of which represented very immature differentiation stages. AUTS2 expression was higher in normal B-cells than in T-cells, indicating lineage-specific activity in lymphopoiesis. While excluding chromosomal aberrations, examinations of AUTS2 transcriptional regulation in T-ALL cells revealed activation by IL7-IL7R-STAT5-signalling and MEF2C. AUTS2 protein has been shown to interact with polycomb repressor complex 1 subtype 5 (PRC1.5), transforming this particular complex into an activator. Accordingly, expression profiling and functional analyses demonstrated that AUTS2 activated while PCGF5 repressed transcription of NKL homeobox gene MSX1 in T-ALL cells. Forced expression and pharmacological inhibition of EZH2 in addition to H3K27me3 analysis indicated that PRC2 repressed MSX1 as well. Taken together, we found that AUTS2 and MEF2C, despite lying on different chromosomes, share strikingly similar regulatory upstream regions and aberrant expression in T-ALL subsets. Our data implicate chromatin complexes PRC1/AUTS2 and PRC2 in a gene network in T-ALL regulating early lymphoid differentiation.

Localization of TFIIB binding regions using serial analysis of chromatin occupancy

PubMed Central

Yochum, Gregory S; Rajaraman, Veena; Cleland, Ryan; McWeeney, Shannon

2007-01-01

Background: RNA Polymerase II (RNAP II) is recruited to core promoters by the pre-initiation complex (PIC) of general transcription factors. Within the PIC, transcription factor for RNA polymerase IIB (TFIIB) determines the start site of transcription. TFIIB binding has not been localized, genome-wide, in metazoans. Serial analysis of chromatin occupancy (SACO) is an unbiased methodology used to empirically identify transcription factor binding regions. In this report, we use TFIIB and SACO to localize TFIIB binding regions across the rat genome. Results: A sample of the TFIIB SACO library was sequenced and 12,968 TFIIB genomic signature tags (GSTs) were assigned to the rat genome. GSTs are 20–22 base pair fragments that are derived from TFIIB bound chromatin. TFIIB localized to both non-protein coding and protein-coding loci. For 21% of the 1783 protein-coding genes in this sample of the SACO library, TFIIB binding mapped near the characterized 5' promoter that is upstream of the transcription start site (TSS). However, internal TFIIB binding positions were identified in 57% of the 1783 protein-coding genes. Internal positions are defined as those within an inclusive region greater than 2.5 kb downstream from the 5' TSS and 2.5 kb upstream from the transcription stop. We demonstrate that both TFIIB and TFIID (an additional component of PICs) bound to internal regions using chromatin immunoprecipitation (ChIP). The 5' cap of transcripts associated with internal TFIIB binding positions were identified using a cap-trapping assay. The 5' TSSs for internal transcripts were confirmed by primer extension. Additionally, an analysis of the functional annotation of mouse 3 (FANTOM3) databases indicates that internally initiated transcripts identified by TFIIB SACO in rat are conserved in mouse. Conclusion: Our findings that TFIIB binding is not restricted to the 5' upstream region indicates that the propensity for PIC to contribute to transcript diversity is far greater than previously appreciated. PMID:17997859

Motif types, motif locations and base composition patterns around the RNA polyadenylation site in microorganisms, plants and animals

PubMed Central

2014-01-01

Background The polyadenylation of RNA is critical for gene functioning, but the conserved sequence motifs (often called signal or signature motifs), motif locations and abundances, and base composition patterns around mRNA polyadenylation [poly(A)] sites are still uncharacterized in most species. The evolutionary tendency for poly(A) site selection is still largely unknown. Results We analyzed the poly(A) site regions of 31 species or phyla. Different groups of species showed different poly(A) signal motifs: UUACUU at the poly(A) site in the parasite Trypanosoma cruzi; UGUAAC (approximately 13 bases upstream of the site) in the alga Chlamydomonas reinhardtii; UGUUUG (or UGUUUGUU) at mainly the fourth base downstream of the poly(A) site in the parasite Blastocystis hominis; and AAUAAA at approximately 16 bases and approximately 19 bases upstream of the poly(A) site in animals and plants, respectively. Polyadenylation signal motifs are usually several hundred times more abundant around poly(A) sites than in whole genomes. These predominant motifs usually had very specific locations, whether upstream of, at, or downstream of poly(A) sites, depending on the species or phylum. The poly(A) site was usually an adenosine (A) in all analyzed species except for B. hominis, and there was weak A predominance in C. reinhardtii. Fungi, animals, plants, and the protist Phytophthora infestans shared a general base abundance pattern (or base composition pattern) of “U-rich—A-rich—U-rich—Poly(A) site—U-rich regions”, or U-A-U-A-U for short, with some variation for each kingdom or subkingdom. Conclusion This study identified the poly(A) signal motifs, motif locations, and base composition patterns around mRNA poly(A) sites in protists, fungi, plants, and animals and provided insight into poly(A) site evolution. PMID:25052519

The Most Deeply Conserved Noncoding Sequences in Plants Serve Similar Functions to Those in Vertebrates Despite Large Differences in Evolutionary Rates[W

PubMed Central

Burgess, Diane; Freeling, Michael

2014-01-01

In vertebrates, conserved noncoding elements (CNEs) are functionally constrained sequences that can show striking conservation over >400 million years of evolutionary distance and frequently are located megabases away from target developmental genes. Conserved noncoding sequences (CNSs) in plants are much shorter, and it has been difficult to detect conservation among distantly related genomes. In this article, we show not only that CNS sequences can be detected throughout the eudicot clade of flowering plants, but also that a subset of 37 CNSs can be found in all flowering plants (diverging ∼170 million years ago). These CNSs are functionally similar to vertebrate CNEs, being highly associated with transcription factor and development genes and enriched in transcription factor binding sites. Some of the most highly conserved sequences occur in genes encoding RNA binding proteins, particularly the RNA splicing–associated SR genes. Differences in sequence conservation between plants and animals are likely to reflect differences in the biology of the organisms, with plants being much more able to tolerate genomic deletions and whole-genome duplication events due, in part, to their far greater fecundity compared with vertebrates. PMID:24681619

BEAUTY: an enhanced BLAST-based search tool that integrates multiple biological information resources into sequence similarity search results.

PubMed

Worley, K C; Wiese, B A; Smith, R F

1995-09-01

BEAUTY (BLAST enhanced alignment utility) is an enhanced version of the NCBI's BLAST data base search tool that facilitates identification of the functions of matched sequences. We have created new data bases of conserved regions and functional domains for protein sequences in NCBI's Entrez data base, and BEAUTY allows this information to be incorporated directly into BLAST search results. A Conserved Regions Data Base, containing the locations of conserved regions within Entrez protein sequences, was constructed by (1) clustering the entire data base into families, (2) aligning each family using our PIMA multiple sequence alignment program, and (3) scanning the multiple alignments to locate the conserved regions within each aligned sequence. A separate Annotated Domains Data Base was constructed by extracting the locations of all annotated domains and sites from sequences represented in the Entrez, PROSITE, BLOCKS, and PRINTS data bases. BEAUTY performs a BLAST search of those Entrez sequences with conserved regions and/or annotated domains. BEAUTY then uses the information from the Conserved Regions and Annotated Domains data bases to generate, for each matched sequence, a schematic display that allows one to directly compare the relative locations of (1) the conserved regions, (2) annotated domains and sites, and (3) the locally aligned regions matched in the BLAST search. In addition, BEAUTY search results include World-Wide Web hypertext links to a number of external data bases that provide a variety of additional types of information on the function of matched sequences. This convenient integration of protein families, conserved regions, annotated domains, alignment displays, and World-Wide Web resources greatly enhances the biological informativeness of sequence similarity searches. BEAUTY searches can be performed remotely on our system using the "BCM Search Launcher" World-Wide Web pages (URL is < http:/ /gc.bcm.tmc.edu:8088/ search-launcher/launcher.html > ).

Unexpected substrate specificity of T4 DNA ligase revealed by in vitro selection

NASA Technical Reports Server (NTRS)

Harada, Kazuo; Orgel, Leslie E.

1993-01-01

We have used in vitro selection techniques to characterize DNA sequences that are ligated efficiently by T4 DNA ligase. We find that the ensemble of selected sequences ligates about 50 times as efficiently as the random mixture of sequences used as the input for selection. Surprisingly many of the selected sequences failed to produce a match at or close to the ligation junction. None of the 20 selected oligomers that we sequenced produced a match two bases upstream from the ligation junction.

A 5′ Splice Site-Proximal Enhancer Binds SF1 and Activates Exon Bridging of a Microexon

PubMed Central

Carlo, Troy; Sierra, Rebecca; Berget, Susan M.

2000-01-01

Internal exon size in vertebrates occurs over a narrow size range. Experimentally, exons shorter than 50 nucleotides are poorly included in mRNA unless accompanied by strengthened splice sites or accessory sequences that act as splicing enhancers, suggesting steric interference between snRNPs and other splicing factors binding simultaneously to the 3′ and 5′ splice sites of microexons. Despite these problems, very small naturally occurring exons exist. Here we studied the factors and mechanism involved in recognizing a constitutively included six-nucleotide exon from the cardiac troponin T gene. Inclusion of this exon is dependent on an enhancer located downstream of the 5′ splice site. This enhancer contains six copies of the simple sequence GGGGCUG. The enhancer activates heterologous microexons and will work when located either upstream or downstream of the target exon, suggesting an ability to bind factors that bridge splicing units. A single copy of this sequence is sufficient for in vivo exon inclusion and is the binding site for the known bridging mammalian splicing factor 1 (SF1). The enhancer and its bound SF1 act to increase recognition of the upstream exon during exon definition, such that competition of in vitro reactions with RNAs containing the GGGGCUG repeated sequence depress splicing of the upstream intron, assembly of the spliceosome on the 3′ splice site of the exon, and cross-linking of SF1. These results suggest a model in which SF1 bridges the small exon during initial assembly, thereby effectively extending the domain of the exon. PMID:10805741

Ebola virus RNA editing depends on the primary editing site sequence and an upstream secondary structure.

PubMed

Mehedi, Masfique; Hoenen, Thomas; Robertson, Shelly; Ricklefs, Stacy; Dolan, Michael A; Taylor, Travis; Falzarano, Darryl; Ebihara, Hideki; Porcella, Stephen F; Feldmann, Heinz

2013-01-01

Ebolavirus (EBOV), the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.

A short autocomplementary sequence plays an essential role in avian sarcoma-leukosis virus RNA dimerization.

PubMed

Fossé, P; Motté, N; Roumier, A; Gabus, C; Muriaux, D; Darlix, J L; Paoletti, J

1996-12-24

Retroviral genomes consist of two identical RNA molecules joined noncovalently near their 5'-ends. Recently, two models have been proposed for RNA dimer formation on the basis of results obtained in vitro with human immunodeficiency virus type 1 RNA and Moloney murine leukemia virus RNA. It was first proposed that viral RNA dimerizes by forming an interstrand quadruple helix with purine tetrads. The second model postulates that RNA dimerization is initiated by a loop-loop interaction between the two RNA molecules. In order to better characterize the dimerization process of retroviral genomic RNA, we analyzed the in vitro dimerization of avian sarcoma-leukosis virus (ASLV) RNA using different transcripts. We determined the requirements for heterodimer formation, the thermal dissociation of RNA dimers, and the influence of antisense DNA oligonucleotides on dimer formation. Our results strongly suggest that purine tetrads are not involved in dimer formation. Data show that an autocomplementary sequence located upstream from the splice donor site and within a major packaging signal plays a crucial role in ASLV RNA dimer formation in vitro. This sequence is able to form a stem-loop structure, and phylogenetic analysis reveals that it is conserved in 28 different avian sarcoma and leukosis viruses. These results suggest that dimerization of ASLV RNA is initiated by a loop-loop interaction between two RNA molecules and provide an additional argument for the ubiquity of the dimerization process via loop-loop interaction.

Whole-Exome Sequencing in a South American Cohort Links ALDH1A3, FOXN1 and Retinoic Acid Regulation Pathways to Autism Spectrum Disorders.

PubMed

Moreno-Ramos, Oscar A; Olivares, Ana María; Haider, Neena B; de Autismo, Liga Colombiana; Lattig, María Claudia

2015-01-01

Autism spectrum disorders (ASDs) are a range of complex neurodevelopmental conditions principally characterized by dysfunctions linked to mental development. Previous studies have shown that there are more than 1000 genes likely involved in ASD, expressed mainly in brain and highly interconnected among them. We applied whole exome sequencing in Colombian-South American trios. Two missense novel SNVs were found in the same child: ALDH1A3 (RefSeq NM_000693: c.1514T>C (p.I505T)) and FOXN1 (RefSeq NM_003593: c.146C>T (p.S49L)). Gene expression studies reveal that Aldh1a3 and Foxn1 are expressed in ~E13.5 mouse embryonic brain, as well as in adult piriform cortex (PC; ~P30). Conserved Retinoic Acid Response Elements (RAREs) upstream of human ALDH1A3 and FOXN1 and in mouse Aldh1a3 and Foxn1 genes were revealed using bioinformatic approximation. Chromatin immunoprecipitation (ChIP) assay using Retinoid Acid Receptor B (Rarb) as the immunoprecipitation target suggests RA regulation of Aldh1a3 and Foxn1 in mice. Our results frame a possible link of RA regulation in brain to ASD etiology, and a feasible non-additive effect of two apparently unrelated variants in ALDH1A3 and FOXN1 recognizing that every result given by next generation sequencing should be cautiously analyzed, as it might be an incidental finding.

[Cloning, expression and transcriptional analysis of biotin carboxyl carrier protein gene (accA) from Amycolatopsis mediterranei U32 ].

PubMed

Lu, Jie; Yao, Yufeng; Jiang, Weihong; Jiao, Ruishen

2003-02-01

Acetyl CoA carboxylase (EC 6.4.1.2, ACC) catalyzes the ATP-dependent carboxylation of acetyl CoA to yield malonyl CoA, which is the first committed step in fatty acid synthesis. A pair of degenerate PCR primers were designed according to the conserved amino acid sequence of AccA from M. tuberculosis and S. coelicolor. The product of the PCR amplification, a DNA fragment of 250bp was used as a probe for screening the U32 genomic cosmid library and its gene, accA, coding the biotinylated protein subunit of acetyl CoA carboxylase, was successfully cloned from U32. The accA ORF encodes a 598-amino-acid protein with the calculated molecular mass of 63.7kD, with 70.1% of G + C content. A typical Streptomyces RBS sequence, AGGAGG, was found at the - 6 position upstream of the start codon GTG. Analysis of the deduced amino acid sequence showed the presence of biotin-binding site and putative ATP-bicarbonate interaction region, which suggested the U32 AccA may act as a biotin carboxylase as well as a biotin carrier protein. Gene accA was then cloned into the pET28 (b) vector and expressed solubly in E. coli BL21 (DE3) by 0.1 mmol/L IPTG induction. Western blot confirmed the covalent binding of biotin with AccA. Northern blot analyzed transcriptional regulation of accA by 5 different nitrogen sources.

Characterization of a tandemly repeated DNA sequence family originally derived by retroposition of tRNA(Glu) in the newt.

PubMed

Nagahashi, S; Endoh, H; Suzuki, Y; Okada, N

1991-11-20

A previous report from this laboratory showed that in vitro transcription of total genomic DNA of the newt Cynopus pyrrhogaster resulted in a discrete sized 8 S RNA, which represented highly repetitive and transcribable sequences with a glutamic acid tRNA-like structure in the newt genome. We isolated four independent clones from a newt genomic library and determined the complete sequences of three 2000 to 2400 base-pair PstI fragments spanning the 8 S RNA gene. The glutamic acid tRNA-related segment in the 8 S RNA gene contains the CCA sequence expected as the 3' terminus of a tRNA molecule. Further, the 11 nucleotides located 13 nucleotides upstream from one of the two transcription initiation sites of the 8 S RNA were found to be repeated in the region upstream from the termination site, suggesting that the original unit, which is shorter than the 8 S RNA, was retrotransposed via cDNA intermediates from the PolIII transcript. In the upstream region of the 8 S RNA gene, a 360 nucleotide unit containing the glutamic acid tRNA-related segment was found to be duplicated (clones NE1 and NE10) or triplicated (clone NE3). Except for the difference in the number of the 360 nucleotide unit, the three sequences of the 2000 to 2400 base-pair PstI fragment were essentially the same with only a few mutations and minor deletions. Inverse polymerase chain reaction and sequence determination of the products, together with a Southern hybridization experiment, demonstrated that the family consists of a tandemly repeated unit of 3300, 3700 or 4100 base-pairs. Thus during evolution, this family in the newt was created by retroposition via cDNA intermediates, followed by duplication or triplication of the 360 nucleotide unit and multiplication of the 3300 to 4100 base-pair region at the DNA level.

A conserved mechanism for replication origin recognition and binding in archaea.

PubMed

Majerník, Alan I; Chong, James P J

2008-01-15

To date, methanogens are the only group within the archaea where firing DNA replication origins have not been demonstrated in vivo. In the present study we show that a previously identified cluster of ORB (origin recognition box) sequences do indeed function as an origin of replication in vivo in the archaeon Methanothermobacter thermautotrophicus. Although the consensus sequence of ORBs in M. thermautotrophicus is somewhat conserved when compared with ORB sequences in other archaea, the Cdc6-1 protein from M. thermautotrophicus (termed MthCdc6-1) displays sequence-specific binding that is selective for the MthORB sequence and does not recognize ORBs from other archaeal species. Stabilization of in vitro MthORB DNA binding by MthCdc6-1 requires additional conserved sequences 3' to those originally described for M. thermautotrophicus. By testing synthetic sequences bearing mutations in the MthORB consensus sequence, we show that Cdc6/ORB binding is critically dependent on the presence of an invariant guanine found in all archaeal ORB sequences. Mutation of a universally conserved arginine residue in the recognition helix of the winged helix domain of archaeal Cdc6-1 shows that specific origin sequence recognition is dependent on the interaction of this arginine residue with the invariant guanine. Recognition of a mutated origin sequence can be achieved by mutation of the conserved arginine residue to a lysine or glutamine residue. Thus despite a number of differences in protein and DNA sequences between species, the mechanism of origin recognition and binding appears to be conserved throughout the archaea.

EXONSAMPLER: a computer program for genome-wide and candidate gene exon sampling for targeted next-generation sequencing.

PubMed

Cosart, Ted; Beja-Pereira, Albano; Luikart, Gordon

2014-11-01

The computer program EXONSAMPLER automates the sampling of thousands of exon sequences from publicly available reference genome sequences and gene annotation databases. It was designed to provide exon sequences for the efficient, next-generation gene sequencing method called exon capture. The exon sequences can be sampled by a list of gene name abbreviations (e.g. IFNG, TLR1), or by sampling exons from genes spaced evenly across chromosomes. It provides a list of genomic coordinates (a bed file), as well as a set of sequences in fasta format. User-adjustable parameters for collecting exon sequences include a minimum and maximum acceptable exon length, maximum number of exonic base pairs (bp) to sample per gene, and maximum total bp for the entire collection. It allows for partial sampling of very large exons. It can preferentially sample upstream (5 prime) exons, downstream (3 prime) exons, both external exons, or all internal exons. It is written in the Python programming language using its free libraries. We describe the use of EXONSAMPLER to collect exon sequences from the domestic cow (Bos taurus) genome for the design of an exon-capture microarray to sequence exons from related species, including the zebu cow and wild bison. We collected ~10% of the exome (~3 million bp), including 155 candidate genes, and ~16,000 exons evenly spaced genomewide. We prioritized the collection of 5 prime exons to facilitate discovery and genotyping of SNPs near upstream gene regulatory DNA sequences, which control gene expression and are often under natural selection. © 2014 John Wiley & Sons Ltd.

Fine-tuning structural RNA alignments in the twilight zone

PubMed Central

2010-01-01

Background A widely used method to find conserved secondary structure in RNA is to first construct a multiple sequence alignment, and then fold the alignment, optimizing a score based on thermodynamics and covariance. This method works best around 75% sequence similarity. However, in a "twilight zone" below 55% similarity, the sequence alignment tends to obscure the covariance signal used in the second phase. Therefore, while the overall shape of the consensus structure may still be found, the degree of conservation cannot be estimated reliably. Results Based on a combination of available methods, we present a method named planACstar for improving structure conservation in structural alignments in the twilight zone. After constructing a consensus structure by alignment folding, planACstar abandons the original sequence alignment, refolds the sequences individually, but consistent with the consensus, aligns the structures, irrespective of sequence, by a pure structure alignment method, and derives an improved sequence alignment from the alignment of structures, to be re-submitted to alignment folding, etc.. This circle may be iterated as long as structural conservation improves, but normally, one step suffices. Conclusions Employing the tools ClustalW, RNAalifold, and RNAforester, we find that for sequences with 30-55% sequence identity, structural conservation can be improved by 10% on average, with a large variation, measured in terms of RNAalifold's own criterion, the structure conservation index. PMID:20433706

Upstream paths for Hippo signaling in Drosophila organ development.

PubMed

Choi, Kwang-Wook

2018-03-01

Organ growth is fundamental to animal development. One of major mechanisms for growth control is mediated by the conserved Hippo signaling pathway initially identified in Drosophila. The core of this pathway in Drosophila consists of a cascade of protein kinases Hippo and Warts that negatively regulate transcriptional coactivator Yorkie (Yki). Activation of Yki promotes cell survival and proliferation to induce organ growth. A key issue in Hippo signaling is to understand how core kinase cascade is activated. Activation of Hippo kinase cascade is regulated in the upstream by at least two transmembrane proteins Crumbs and Fat that act in parallel. These membrane proteins interact with additional factors such as FERM-domain proteins Expanded and Merlin to modulate subcellular localization and function of the Hippo kinase cascade. Hippo signaling is also influenced by cytoskeletal networks and cell tension in epithelia of developing organs. These upstream events in the regulation of Hippo signaling are only partially understood. This review focuses on our current understanding of some upstream processes involved in Hippo signaling in developing Drosophila organs. [BMB Reports 2018; 51(3): 134-142].

Genome-wide identification of conserved intronic non-coding sequences using a Bayesian segmentation approach.

PubMed

Algama, Manjula; Tasker, Edward; Williams, Caitlin; Parslow, Adam C; Bryson-Richardson, Robert J; Keith, Jonathan M

2017-03-27

Computational identification of non-coding RNAs (ncRNAs) is a challenging problem. We describe a genome-wide analysis using Bayesian segmentation to identify intronic elements highly conserved between three evolutionarily distant vertebrate species: human, mouse and zebrafish. We investigate the extent to which these elements include ncRNAs (or conserved domains of ncRNAs) and regulatory sequences. We identified 655 deeply conserved intronic sequences in a genome-wide analysis. We also performed a pathway-focussed analysis on genes involved in muscle development, detecting 27 intronic elements, of which 22 were not detected in the genome-wide analysis. At least 87% of the genome-wide and 70% of the pathway-focussed elements have existing annotations indicative of conserved RNA secondary structure. The expression of 26 of the pathway-focused elements was examined using RT-PCR, providing confirmation that they include expressed ncRNAs. Consistent with previous studies, these elements are significantly over-represented in the introns of transcription factors. This study demonstrates a novel, highly effective, Bayesian approach to identifying conserved non-coding sequences. Our results complement previous findings that these sequences are enriched in transcription factors. However, in contrast to previous studies which suggest the majority of conserved sequences are regulatory factor binding sites, the majority of conserved sequences identified using our approach contain evidence of conserved RNA secondary structures, and our laboratory results suggest most are expressed. Functional roles at DNA and RNA levels are not mutually exclusive, and many of our elements possess evidence of both. Moreover, ncRNAs play roles in transcriptional and post-transcriptional regulation, and this may contribute to the over-representation of these elements in introns of transcription factors. We attribute the higher sensitivity of the pathway-focussed analysis compared to the genome-wide analysis to improved alignment quality, suggesting that enhanced genomic alignments may reveal many more conserved intronic sequences.

DNA sequence analysis of ARS elements from chromosome III of Saccharomyces cerevisiae: identification of a new conserved sequence.

PubMed Central

Palzkill, T G; Oliver, S G; Newlon, C S

1986-01-01

Four fragments of Saccharomyces cerevisiae chromosome III DNA which carry ARS elements have been sequenced. Each fragment contains multiple copies of sequences that have at least 10 out of 11 bases of homology to a previously reported 11 bp core consensus sequence. A survey of these new ARS sequences and previously reported sequences revealed the presence of an additional 11 bp conserved element located on the 3' side of the T-rich strand of the core consensus. Subcloning analysis as well as deletion and transposon insertion mutagenesis of ARS fragments support a role for 3' conserved sequence in promoting ARS activity. PMID:3529036

Sense transcription through the S region is essential for immunoglobulin class switch recombination

PubMed Central

Haddad, Dania; Oruc, Zéliha; Puget, Nadine; Laviolette-Malirat, Nathalie; Philippe, Magali; Carrion, Claire; Le Bert, Marc; Khamlichi, Ahmed Amine

2011-01-01

Class switch recombination (CSR) occurs between highly repetitive sequences called switch (S) regions and is initiated by activation-induced cytidine deaminase (AID). CSR is preceded by a bidirectional transcription of S regions but the relative importance of sense and antisense transcription for CSR in vivo is unknown. We generated three mouse lines in which we attempted a premature termination of transcriptional elongation by inserting bidirectional transcription terminators upstream of Sμ, upstream of Sγ3 or downstream of Sγ3 sequences. The data show, at least for Sγ3, that sense transcriptional elongation across S region is absolutely required for CSR whereas its antisense counterpart is largely dispensable, strongly suggesting that sense transcription is sufficient for AID targeting to both DNA strands. PMID:21378751

PROSPECT improves cis-acting regulatory element prediction by integrating expression profile data with consensus pattern searches

PubMed Central

Fujibuchi, Wataru; Anderson, John S. J.; Landsman, David

2001-01-01

Consensus pattern and matrix-based searches designed to predict cis-acting transcriptional regulatory sequences have historically been subject to large numbers of false positives. We sought to decrease false positives by incorporating expression profile data into a consensus pattern-based search method. We have systematically analyzed the expression phenotypes of over 6000 yeast genes, across 121 expression profile experiments, and correlated them with the distribution of 14 known regulatory elements over sequences upstream of the genes. Our method is based on a metric we term probabilistic element assessment (PEA), which is a ranking of potential sites based on sequence similarity in the upstream regions of genes with similar expression phenotypes. For eight of the 14 known elements that we examined, our method had a much higher selectivity than a naïve consensus pattern search. Based on our analysis, we have developed a web-based tool called PROSPECT, which allows consensus pattern-based searching of gene clusters obtained from microarray data. PMID:11574681

A SHORT SEQUENCE IMMEDIATELY UPSTREAM OF THE INTERNAL REPEAT ELEMENTS IS CRITICAL FOR KSHV LANA MEDIATED DNA REPLICATION AND IMPACTS EPISOME PERSISTENCE

PubMed Central

León Vázquez, Erika De; Juillard, Franceline; Rosner, Bernard; Kaye, Kenneth M.

2013-01-01

Kaposi’s sarcoma-associated herpesvirus LANA (1162 residues) mediates episomal persistence of viral genomes during latency. LANA mediates viral DNA replication and segregates episomes to daughter nuclei. A 59 residue deletion immediately upstream of the internal repeat elements rendered LANA highly deficient for DNA replication and modestly deficient for the ability to segregate episomes, while smaller deletions did not. The 59 amino acid deletion reduced LANA episome persistence by ~14-fold, while sequentially smaller deletions resulted in ~3-fold, or no deficiency. Three distinct LANA regions reorganized heterochromatin, one of which contains the deleted sequence, but the deletion did not abolish LANA’s ability to alter chromatin. Therefore, this work identifies a short internal LANA sequence that is critical for DNA replication, has modest effects on episome segregation, and substantially impacts episome persistence; this region may exert its effects through an interacting host cell protein(s). PMID:24314665

A 21.7 kb DNA segment on the left arm of yeast chromosome XIV carries WHI3, GCR2, SPX18, SPX19, an homologue to the heat shock gene SSB1 and 8 new open reading frames of unknown function.

PubMed

Jonniaux, J L; Coster, F; Purnelle, B; Goffeau, A

1994-12-01

We report the amino acid sequence of 13 open reading frames (ORF > 299 bp) located on a 21.7 kb DNA segment from the left arm of chromosome XIV of Saccharomyces cerevisiae. Five open reading frames had been entirely or partially sequenced previously: WHI3, GCR2, SPX19, SPX18 and a heat shock gene similar to SSB1. The products of 8 other ORFs are new putative proteins among which N1394 is probably a membrane protein. N1346 contains a leucine zipper pattern and the corresponding ORF presents an HAP (global regulator of respiratory genes) upstream activating sequence in the promoting region. N1386 shares homologies with the DNA structure-specific recognition protein family SSRPs and the corresponding ORF is preceded by an MCB (MluI cell cycle box) upstream activating factor.

Expression of the Pasteurella haemolytica leukotoxin is inhibited by a locus that encodes an ATP-binding cassette homolog.

PubMed Central

Highlander, S K; Wickersham, E A; Garza, O; Weinstock, G M

1993-01-01

Multicopy and single-copy chromosomal fusions between the Pasteurella haemolytica leukotoxin regulatory region and the Escherichia coli beta-galactosidase gene have been constructed. These fusions were used as reporters to identify and isolate regulators of leukotoxin expression from a P. haemolytica cosmid library. A cosmid clone, which inhibited leukotoxin expression from multicopy and single-copy protein fusions, was isolated and found to contain the complete leukotoxin gene cluster plus additional upstream sequences. The locus responsible for inhibition of expression from leukotoxin-beta-galactosidase fusions was mapped within these upstream sequences, by transposon mutagenesis with Tn5, and its DNA sequence was determined. The inhibitory activity was found to be associated with a predicted 440-amino-acid reading frame (lapA) that lies within a four-gene arginine transport locus. LapA is predicted to be the nucleotide-binding component of this transport system and shares homology with the Clp family of proteases. Images PMID:8359916

Reducing DNA context dependence in bacterial promoters

PubMed Central

Carr, Swati B.; Densmore, Douglas M.

2017-01-01

Variation in the DNA sequence upstream of bacterial promoters is known to affect the expression levels of the products they regulate, sometimes dramatically. While neutral synthetic insulator sequences have been found to buffer promoters from upstream DNA context, there are no established methods for designing effective insulator sequences with predictable effects on expression levels. We address this problem with Degenerate Insulation Screening (DIS), a novel method based on a randomized 36-nucleotide insulator library and a simple, high-throughput, flow-cytometry-based screen that randomly samples from a library of 436 potential insulated promoters. The results of this screen can then be compared against a reference uninsulated device to select a set of insulated promoters providing a precise level of expression. We verify this method by insulating the constitutive, inducible, and repressible promotors of a four transcriptional-unit inverter (NOT-gate) circuit, finding both that order dependence is largely eliminated by insulation and that circuit performance is also significantly improved, with a 5.8-fold mean improvement in on/off ratio. PMID:28422998

Strong minor groove base conservation in sequence logos implies DNA distortion or base flipping during replication and transcription initiation.

PubMed

Schneider, T D

2001-12-01

The sequence logo for DNA binding sites of the bacteriophage P1 replication protein RepA shows unusually high sequence conservation ( approximately 2 bits) at a minor groove that faces RepA. However, B-form DNA can support only 1 bit of sequence conservation via contacts into the minor groove. The high conservation in RepA sites therefore implies a distorted DNA helix with direct or indirect contacts to the protein. Here I show that a high minor groove conservation signature also appears in sequence logos of sites for other replication origin binding proteins (Rts1, DnaA, P4 alpha, EBNA1, ORC) and promoter binding proteins (sigma(70), sigma(D) factors). This finding implies that DNA binding proteins generally use non-B-form DNA distortion such as base flipping to initiate replication and transcription.

G-quadruplex prediction in E. coli genome reveals a conserved putative G-quadruplex-Hairpin-Duplex switch.

PubMed

Kaplan, Oktay I; Berber, Burak; Hekim, Nezih; Doluca, Osman

2016-11-02

Many studies show that short non-coding sequences are widely conserved among regulatory elements. More and more conserved sequences are being discovered since the development of next generation sequencing technology. A common approach to identify conserved sequences with regulatory roles relies on topological changes such as hairpin formation at the DNA or RNA level. G-quadruplexes, non-canonical nucleic acid topologies with little established biological roles, are increasingly considered for conserved regulatory element discovery. Since the tertiary structure of G-quadruplexes is strongly dependent on the loop sequence which is disregarded by the generally accepted algorithm, we hypothesized that G-quadruplexes with similar topology and, indirectly, similar interaction patterns, can be determined using phylogenetic clustering based on differences in the loop sequences. Phylogenetic analysis of 52 G-quadruplex forming sequences in the Escherichia coli genome revealed two conserved G-quadruplex motifs with a potential regulatory role. Further analysis revealed that both motifs tend to form hairpins and G quadruplexes, as supported by circular dichroism studies. The phylogenetic analysis as described in this work can greatly improve the discovery of functional G-quadruplex structures and may explain unknown regulatory patterns. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

The highly conserved MraZ protein is a transcriptional regulator in Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eraso, Jesus M.; Markillie, Lye Meng; Mitchell, Hugh D.

2014-05-05

The mraZ and mraW genes are highly conserved in bacteria, both in sequence and location at the head of the division and cell wall (dcw) gene cluster. Although MraZ has structural similarity to the AbrB transition state regulator and the MazE antitoxin, and MraW is known to methylate ribosomal RNA, mraZ and mraW null mutants have no detectable growth phenotype in any species tested to date, hampering progress in understanding their physiological role. Here we show that overproduction of Escherichia coli MraZ perturbs cell division and the cell envelope, is more lethal at high levels or in minimal growth medium,more » and that MraW antagonizes these effects. MraZGFP localizes to the nucleoid, suggesting that it binds DNA. Indeed, purified MraZ directly binds a region upstream from its own promoter containing three direct repeats to regulate its own expression and that of downstream cell division and cell wall genes. MraZ-LacZ fusions are repressed by excess MraZ but not when DNA binding by MraZ is inhibited. RNAseq analysis indicates that MraZ is a global transcriptional regulator with numerous targets in addition to dcw genes. One of these targets, mioC, is directly bound by MraZ in a region with three direct repeats.« less

Rhodopseudomonas palustris CGA010 Proteome Implicates Extracytoplasmic Function Sigma Factor in Stress Response

DOE PAGES

Allen, Michael S.; Hurst, Gregory B.; Lu, Tse-Yuan S.; ...

2015-04-08

Rhodopseudomonas palustris encodes 16 extracytoplasmic function (ECF) σ factors. In this paper, to begin to investigate the regulatory network of one of these ECF σ factors, the whole proteome of R. palustris CGA010 was quantitatively analyzed by tandem mass spectrometry from cultures episomally expressing the ECF σ RPA4225 (ecfT) versus a WT control. Among the proteins with the greatest increase in abundance were catalase KatE, trehalose synthase, a DPS-like protein, and several regulatory proteins. Alignment of the cognate promoter regions driving expression of several upregulated proteins suggested a conserved binding motif in the -35 and -10 regions with the consensusmore » sequence GGAAC-18N-TT. Additionally, the putative anti-σ factor RPA4224, whose gene is contained in the same predicted operon as RPA4225, was identified as interacting directly with the predicted response regulator RPA4223 by mass spectrometry of affinity-isolated protein complexes. Furthermore, another gene (RPA4226) coding for a protein that contains a cytoplasmic histidine kinase domain is located immediately upstream of RPA4225. The genomic organization of orthologs for these four genes is conserved in several other strains of R. palustris as well as in closely related α-Proteobacteria. Finally, taken together, these data suggest that ECF σ RPA4225 and the three additional genes make up a sigma factor mimicry system in R. palustris.« less

Rhodopseudomonas palustris CGA010 Proteome Implicates Extracytoplasmic Function Sigma Factor in Stress Response

DOE Office of Scientific and Technical Information (OSTI.GOV)

Allen, Michael S.; Hurst, Gregory B.; Lu, Tse-Yuan S.

Rhodopseudomonas palustris encodes 16 extracytoplasmic function (ECF) σ factors. In this paper, to begin to investigate the regulatory network of one of these ECF σ factors, the whole proteome of R. palustris CGA010 was quantitatively analyzed by tandem mass spectrometry from cultures episomally expressing the ECF σ RPA4225 (ecfT) versus a WT control. Among the proteins with the greatest increase in abundance were catalase KatE, trehalose synthase, a DPS-like protein, and several regulatory proteins. Alignment of the cognate promoter regions driving expression of several upregulated proteins suggested a conserved binding motif in the -35 and -10 regions with the consensusmore » sequence GGAAC-18N-TT. Additionally, the putative anti-σ factor RPA4224, whose gene is contained in the same predicted operon as RPA4225, was identified as interacting directly with the predicted response regulator RPA4223 by mass spectrometry of affinity-isolated protein complexes. Furthermore, another gene (RPA4226) coding for a protein that contains a cytoplasmic histidine kinase domain is located immediately upstream of RPA4225. The genomic organization of orthologs for these four genes is conserved in several other strains of R. palustris as well as in closely related α-Proteobacteria. Finally, taken together, these data suggest that ECF σ RPA4225 and the three additional genes make up a sigma factor mimicry system in R. palustris.« less

Residues of E. coli topoisomerase I conserved for interaction with a specific cytosine base to facilitate DNA cleavage

PubMed Central

Narula, Gagandeep; Tse-Dinh, Yuk-Ching

2012-01-01

Bacterial and archaeal topoisomerase I display selectivity for a cytosine base 4 nt upstream from the DNA cleavage site. Recently, the solved crystal structure of Escherichia coli topoisomerase I covalently linked to a single-stranded oligonucleotide revealed that R169 and R173 interact with the cytosine base at the −4 position via hydrogen bonds while the phenol ring of Y177 wedges between the bases at the −4 and the −5 position. Substituting R169 to alanine changed the selectivity of the enzyme for the base at the −4 position from a cytosine to an adenine. The R173A mutant displayed similar sequence selectivity as the wild-type enzyme, but weaker cleavage and relaxation activity. Mutation of Y177 to serine or alanine rendered the enzyme inactive. Although mutation of each of these residues led to different outcomes, R169, R173 and Y177 work together to interact with a cytosine base at the −4 position to facilitate DNA cleavage. These strictly conserved residues might act after initial substrate binding as a Molecular Ruler to form a protein–DNA complex with the scissile phosphate positioned at the active site for optimal DNA cleavage by the tyrosine hydroxyl nucleophile to facilitate DNA cleavage in the reaction pathway. PMID:22833607

Conservation and variability of West Nile virus proteins.

PubMed

Koo, Qi Ying; Khan, Asif M; Jung, Keun-Ok; Ramdas, Shweta; Miotto, Olivo; Tan, Tin Wee; Brusic, Vladimir; Salmon, Jerome; August, J Thomas

2009-01-01

West Nile virus (WNV) has emerged globally as an increasingly important pathogen for humans and domestic animals. Studies of the evolutionary diversity of the virus over its known history will help to elucidate conserved sites, and characterize their correspondence to other pathogens and their relevance to the immune system. We describe a large-scale analysis of the entire WNV proteome, aimed at identifying and characterizing evolutionarily conserved amino acid sequences. This study, which used 2,746 WNV protein sequences collected from the NCBI GenPept database, focused on analysis of peptides of length 9 amino acids or more, which are immunologically relevant as potential T-cell epitopes. Entropy-based analysis of the diversity of WNV sequences, revealed the presence of numerous evolutionarily stable nonamer positions across the proteome (entropy value of < or = 1). The representation (frequency) of nonamers variant to the predominant peptide at these stable positions was, generally, low (< or = 10% of the WNV sequences analyzed). Eighty-eight fragments of length 9-29 amino acids, representing approximately 34% of the WNV polyprotein length, were identified to be identical and evolutionarily stable in all analyzed WNV sequences. Of the 88 completely conserved sequences, 67 are also present in other flaviviruses, and several have been associated with the functional and structural properties of viral proteins. Immunoinformatic analysis revealed that the majority (78/88) of conserved sequences are potentially immunogenic, while 44 contained experimentally confirmed human T-cell epitopes. This study identified a comprehensive catalogue of completely conserved WNV sequences, many of which are shared by other flaviviruses, and majority are potential epitopes. The complete conservation of these immunologically relevant sequences through the entire recorded WNV history suggests they will be valuable as components of peptide-specific vaccines or other therapeutic applications, for sequence-specific diagnosis of a wide-range of Flavivirus infections, and for studies of homologous sequences among other flaviviruses.

A Fast Alignment-Free Approach for De Novo Detection of Protein Conserved Regions

PubMed Central

Abnousi, Armen; Broschat, Shira L.; Kalyanaraman, Ananth

2016-01-01

Background Identifying conserved regions in protein sequences is a fundamental operation, occurring in numerous sequence-driven analysis pipelines. It is used as a way to decode domain-rich regions within proteins, to compute protein clusters, to annotate sequence function, and to compute evolutionary relationships among protein sequences. A number of approaches exist for identifying and characterizing protein families based on their domains, and because domains represent conserved portions of a protein sequence, the primary computation involved in protein family characterization is identification of such conserved regions. However, identifying conserved regions from large collections (millions) of protein sequences presents significant challenges. Methods In this paper we present a new, alignment-free method for detecting conserved regions in protein sequences called NADDA (No-Alignment Domain Detection Algorithm). Our method exploits the abundance of exact matching short subsequences (k-mers) to quickly detect conserved regions, and the power of machine learning is used to improve the prediction accuracy of detection. We present a parallel implementation of NADDA using the MapReduce framework and show that our method is highly scalable. Results We have compared NADDA with Pfam and InterPro databases. For known domains annotated by Pfam, accuracy is 83%, sensitivity 96%, and specificity 44%. For sequences with new domains not present in the training set an average accuracy of 63% is achieved when compared to Pfam. A boost in results in comparison with InterPro demonstrates the ability of NADDA to capture conserved regions beyond those present in Pfam. We have also compared NADDA with ADDA and MKDOM2, assuming Pfam as ground-truth. On average NADDA shows comparable accuracy, more balanced sensitivity and specificity, and being alignment-free, is significantly faster. Excluding the one-time cost of training, runtimes on a single processor were 49s, 10,566s, and 456s for NADDA, ADDA, and MKDOM2, respectively, for a data set comprised of approximately 2500 sequences. PMID:27552220

Two rapidly evolving genes contribute to male fitness in Drosophila

PubMed Central

Reinhardt, Josephine A; Jones, Corbin D

2013-01-01

Purifying selection often results in conservation of gene sequence and function. The most functionally conserved genes are also thought to be among the most biologically essential. These observations have led to the use of sequence conservation as a proxy for functional conservation. Here we describe two genes that are exceptions to this pattern. We show that lack of sequence conservation among orthologs of CG15460 and CG15323 – herein named jean-baptiste (jb) and karr respectively – does not necessarily predict lack of functional conservation. These two Drosophila melanogaster genes are among the most rapidly evolving protein-coding genes in this species, being nearly as diverged from their D. yakuba orthologs as random sequences are. jb and karr are both expressed at an elevated level in larval males and adult testes, but they are not accessory gland proteins and their loss does not affect male fertility. Instead, knockdown of these genes in D. melanogaster via RNA interference caused male-biased viability defects. These viability effects occur prior to the third instar for jb and during late pupation for karr. We show that putative orthologs to jb and karr are also expressed strongly in the testes of other Drosophila species and have similar gene structure across species despite low levels of sequence conservation. While standard molecular evolution tests could not reject neutrality, other data hint at a role for natural selection. Together these data provide a clear case where a lack of sequence conservation does not imply a lack of conservation of expression or function. PMID:24221639

Constraints on the evolution of a doublesex target gene arising from doublesex’s pleiotropic deployment

PubMed Central

Luo, Shengzhan D.; Baker, Bruce S.

2015-01-01

“Regulatory evolution,” that is, changes in a gene’s expression pattern through changes at its regulatory sequence, rather than changes at the coding sequence of the gene or changes of the upstream transcription factors, has been increasingly recognized as a pervasive evolution mechanism. Many somatic sexually dimorphic features of Drosophila melanogaster are the results of gene expression regulated by the doublesex (dsx) gene, which encodes sex-specific transcription factors (DSXF in females and DSXM in males). Rapid changes in such sexually dimorphic features are likely a result of changes at the regulatory sequence of the target genes. We focused on the Flavin-containing monooxygenase-2 (Fmo-2) gene, a likely direct dsx target, to elucidate how sexually dimorphic expression and its evolution are brought about. We found that dsx is deployed to regulate the Fmo-2 transcription both in the midgut and in fat body cells of the spermatheca (a female-specific tissue), through a canonical DSX-binding site in the Fmo-2 regulatory sequence. In the melanogaster group, Fmo-2 transcription in the midgut has evolved rapidly, in contrast to the conserved spermathecal transcription. We identified two cis-regulatory modules (CRM-p and CRM-d) that direct sexually monomorphic or dimorphic Fmo-2 transcription, respectively, in the midguts of these species. Changes of Fmo-2 transcription in the midgut from sexually dimorphic to sexually monomorphic in some species are caused by the loss of CRM-d function, but not the loss of the canonical DSX-binding site. Thus, conferring transcriptional regulation on a CRM level allows the regulation to evolve rapidly in one tissue while evading evolutionary constraints posed by other tissues. PMID:25675536

How Changes in Anti-SD Sequences Would Affect SD Sequences in Escherichia coli and Bacillus subtilis.

PubMed

Abolbaghaei, Akram; Silke, Jordan R; Xia, Xuhua

2017-05-05

The 3' end of the small ribosomal RNAs (ssu rRNA) in bacteria is directly involved in the selection and binding of mRNA transcripts during translation initiation via well-documented interactions between a Shine-Dalgarno (SD) sequence located upstream of the initiation codon and an anti-SD (aSD) sequence at the 3' end of the ssu rRNA. Consequently, the 3' end of ssu rRNA (3'TAIL) is strongly conserved among bacterial species because a change in the region may impact the translation of many protein-coding genes. Escherichia coli and Bacillus subtilis differ in their 3' ends of ssu rRNA, being GAUC ACCUCCUUA 3' in E. coli and GAUC ACCUCCUU UCU3' or GAUC ACCUCCUU UCUA3' in B. subtilis Such differences in 3'TAIL lead to species-specific SDs (designated SD Ec for E. coli and SD Bs for B. subtilis ) that can form strong and well-positioned SD/aSD pairing in one species but not in the other. Selection mediated by the species-specific 3'TAIL is expected to favor SD Bs against SD Ec in B. subtilis , but favor SD Ec against SD Bs in E. coli Among well-positioned SDs, SD Ec is used more in E. coli than in B. subtilis , and SD Bs more in B. subtilis than in E. coli Highly expressed genes and genes of high translation efficiency tend to have longer SDs than lowly expressed genes and genes with low translation efficiency in both species, but more so in B. subtilis than in E. coli Both species overuse SDs matching the bolded part of the 3'TAIL shown above. The 3'TAIL difference contributes to the host specificity of phages. Copyright © 2017 Abolbaghaei et al.

Comparative genomics of four closely related Clostridium perfringens bacteriophages reveals variable evolution among core genes with therapeutic potential

PubMed Central

2011-01-01

Background Because biotechnological uses of bacteriophage gene products as alternatives to conventional antibiotics will require a thorough understanding of their genomic context, we sequenced and analyzed the genomes of four closely related phages isolated from Clostridium perfringens, an important agricultural and human pathogen. Results Phage whole-genome tetra-nucleotide signatures and proteomic tree topologies correlated closely with host phylogeny. Comparisons of our phage genomes to 26 others revealed three shared COGs; of particular interest within this core genome was an endolysin (PF01520, an N-acetylmuramoyl-L-alanine amidase) and a holin (PF04531). Comparative analyses of the evolutionary history and genomic context of these common phage proteins revealed two important results: 1) strongly significant host-specific sequence variation within the endolysin, and 2) a protein domain architecture apparently unique to our phage genomes in which the endolysin is located upstream of its associated holin. Endolysin sequences from our phages were one of two very distinct genotypes distinguished by variability within the putative enzymatically-active domain. The shared or core genome was comprised of genes with multiple sequence types belonging to five pfam families, and genes belonging to 12 pfam families, including the holin genes, which were nearly identical. Conclusions Significant genomic diversity exists even among closely-related bacteriophages. Holins and endolysins represent conserved functions across divergent phage genomes and, as we demonstrate here, endolysins can have significant variability and host-specificity even among closely-related genomes. Endolysins in our phage genomes may be subject to different selective pressures than the rest of the genome. These findings may have important implications for potential biotechnological applications of phage gene products. PMID:21631945

Genetic Locus for Streptolysin S Production by Group A Streptococcus

PubMed Central

Nizet, Victor; Beall, Bernard; Bast, Darrin J.; Datta, Vivekananda; Kilburn, Laurie; Low, Donald E.; De Azavedo, Joyce C. S.

2000-01-01

Group A streptococcus (GAS) is an important human pathogen that causes pharyngitis and invasive infections, including necrotizing fasciitis. Streptolysin S (SLS) is the cytolytic factor that creates the zone of beta-hemolysis surrounding GAS colonies grown on blood agar. We recently reported the discovery of a potential genetic determinant involved in SLS production, sagA, encoding a small peptide of 53 amino acids (S. D. Betschel, S. M. Borgia, N. L. Barg, D. E. Low, and J. C. De Azavedo, Infect. Immun. 66:1671–1679, 1998). Using transposon mutagenesis, chromosomal walking steps, and data from the GAS genome sequencing project (www.genome.ou.edu/strep.html), we have now identified a contiguous nine-gene locus (sagA to sagI) involved in SLS production. The sag locus is conserved among GAS strains regardless of M protein type. Targeted plasmid integrational mutagenesis of each gene in the sag operon resulted in an SLS-negative phenotype. Targeted integrations (i) upstream of the sagA promoter and (ii) downstream of a terminator sequence after sagI did not affect SLS production, establishing the functional boundaries of the operon. A rho-independent terminator sequence between sagA and sagB appears to regulate the amount of sagA transcript produced versus transcript for the entire operon. Reintroduction of the nine-gene sag locus on a plasmid vector restored SLS activity to the nonhemolytic sagA knockout mutant. Finally, heterologous expression of the intact sag operon conferred the SLS beta-hemolytic phenotype to the nonhemolytic Lactococcus lactis. We conclude that gene products of the GAS sag operon are both necessary and sufficient for SLS production. Sequence homologies of sag operon gene products suggest that SLS is related to the bacteriocin family of microbial toxins. PMID:10858242

Characterization of Clostridium perfringens iota-toxin genes and expression in Escherichia coli.

PubMed

Perelle, S; Gibert, M; Boquet, P; Popoff, M R

1993-12-01

The iota toxin which is produced by Clostridium perfringens type E, is a binary toxin consisting of two independent polypeptides: Ia, which is an ADP-ribosyltransferase, and Ib, which is involved in the binding and internalization of the toxin into the cell. Two degenerate oligonucleotide probes deduced from partial amino acid sequence of each component of C. spiroforme toxin, which is closely related to the iota toxin, were used to clone three overlapping DNA fragments containing the iota-toxin genes from C. perfringens type E plasmid DNA. Two genes, in the same orientation, coding for Ia (387 amino acids) and Ib (875 amino acids) and separated by 243 noncoding nucleotides were identified. A predicted signal peptide was found for each component, and the secreted Ib displays two domains, the propeptide (172 amino acids) and the mature protein (664 amino acids). The Ia gene has been expressed in Escherichia coli and C. perfringens, under the control of its own promoter. The recombinant polypeptide obtained was recognized by Ia antibodies and ADP-ribosylated actin. The expression of the Ib gene was obtained in E. coli harboring a recombinant plasmid encompassing the putative promoter upstream of the Ia gene and the Ia and Ib genes. Two residues which have been found to be involved in the NAD+ binding site of diphtheria and pseudomonas toxins are conserved in the predicted Ia sequence (Glu-14 and Trp-19). The predicted amino acid Ib sequence shows 33.9% identity with and 54.4% similarity to the protective antigen of the anthrax toxin complex. In particular, the central region of Ib, which contains a predicted transmembrane segment (Leu-292 to Ser-308), presents 45% identity with the corresponding protective antigen sequence which is involved in the translocation of the toxin across the cell membrane.

Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection.

PubMed

Perina, Alejandra; Seoane, David; González-Tizón, Ana M; Rodríguez-Fariña, Fernanda; Martínez-Lage, Andrés

2011-10-17

The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection.

Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection

PubMed Central

2011-01-01

Background The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. Results The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. Conclusions These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection. PMID:22004418

Nucleotide sequence analysis reveals linked N-acetyl hydrolase, thioesterase, transport, and regulatory genes encoded by the bialaphos biosynthetic gene cluster of Streptomyces hygroscopicus.

PubMed Central

Raibaud, A; Zalacain, M; Holt, T G; Tizard, R; Thompson, C J

1991-01-01

Nucleotide sequence analysis of a 5,000-bp region of the bialaphos antibiotic production (bap) gene cluster defined five open reading frames (ORFs) which predicted structural genes in the order bah, ORF1, ORF2, and ORF3 followed by the regulatory gene, brpA (H. Anzai, T. Murakami, S. Imai, A. Satoh, K. Nagaoka, and C.J. Thompson, J. Bacteriol. 169:3482-3488, 1987). The four structural genes were translationally coupled and apparently cotranscribed from an undefined promoter(s) under the positive control of the brpA gene product. S1 mapping experiments indicated that brpA was transcribed by two promoters (brpAp1 and brpAp2) which initiate transcription 150 and 157 bp upstream of brp A within an intergenic region and at least one promoter further upstream within the bap gene cluster (brpAp3). All three transcripts were present at low levels during exponential growth and increased just before the stationary phase. The levels of the brpAp3 band continued to increase at the onset of stationary phase, whereas brpAp1-and brpAp2-protected fragments showed no further change. BrpA contained a possible helix-turn-helix motif at its C terminus which was similar to the C-terminal regulatory motif found in the receiver component of a family of two-component transcriptional activator proteins. This motif was not associated with the N-terminal domain conserved in other members of the family. The structural gene cluster sequenced began with bah, encoding a bialaphos acetylhydrolase which removes the N-acetyl group from bialaphos as one of the final steps in the biosynthetic pathway. The observation that Bah was similar to a rat and to a bacterial (Acinetobacter calcoaceticus) lipase probably reflects the fact that the ester bonds of triglycerides and the amide bond linking acetate to phosphinothricin are similar and hydrolysis is catalyzed by structurally related enzymes. This was followed by two regions encoding ORF1 and ORF2 which were similar to each other (48% nucleotide identity, 31% amino acid identity), as well as to GrsT, a protein encoded by a gene located adjacent to gramicidin S synthetase in Bacillus brevis, and to vertebrate (mallard duck and rat) thioesterases. The amino acid sequence and hydrophobicity profile of ORF3 indicated that it was related to a family of membrane transport proteins. It was strikingly similar to the citrate uptake protein encoded by the transposon Tn3411. Images PMID:2066341

Cis-regulatory signatures of orthologous stress-associated bZIP transcription factors from rice, sorghum and Arabidopsis based on phylogenetic footprints

PubMed Central

2012-01-01

Background The potential contribution of upstream sequence variation to the unique features of orthologous genes is just beginning to be unraveled. A core subset of stress-associated bZIP transcription factors from rice (Oryza sativa) formed ten clusters of orthologous groups (COG) with genes from the monocot sorghum (Sorghum bicolor) and dicot Arabidopsis (Arabidopsis thaliana). The total cis-regulatory information content of each stress-associated COG was examined by phylogenetic footprinting to reveal ortholog-specific, lineage-specific and species-specific conservation patterns. Results The most apparent pattern observed was the occurrence of spatially conserved ‘core modules’ among the COGs but not among paralogs. These core modules are comprised of various combinations of two to four putative transcription factor binding site (TFBS) classes associated with either developmental or stress-related functions. Outside the core modules are specific stress (ABA, oxidative, abiotic, biotic) or organ-associated signals, which may be functioning as ‘regulatory fine-tuners’ and further define lineage-specific and species-specific cis-regulatory signatures. Orthologous monocot and dicot promoters have distinct TFBS classes involved in disease and oxidative-regulated expression, while the orthologous rice and sorghum promoters have distinct combinations of root-specific signals, a pattern that is not particularly conserved in Arabidopsis. Conclusions Patterns of cis-regulatory conservation imply that each ortholog has distinct signatures, further suggesting that they are potentially unique in a regulatory context despite the presumed conservation of broad biological function during speciation. Based on the observed patterns of conservation, we postulate that core modules are likely primary determinants of basal developmental programming, which may be integrated with and further elaborated by additional intrinsic or extrinsic signals in conjunction with lineage-specific or species-specific regulatory fine-tuners. This synergy may be critical for finer-scale spatio-temporal regulation, hence unique expression profiles of homologous transcription factors from different species with distinct zones of ecological adaptation such as rice, sorghum and Arabidopsis. The patterns revealed from these comparisons set the stage for further empirical validation by functional genomics. PMID:22992304

Overexpression of the Lactobacillus plantarum peptidoglycan biosynthesis murA2 gene increases the tolerance of Escherichia coli to alcohols and enhances ethanol production.

PubMed

Yuan, Yongbo; Bi, Changhao; Nicolaou, Sergios A; Zingaro, Kyle A; Ralston, Matthew; Papoutsakis, Eleftherios T

2014-10-01

A major challenge in producing chemicals and biofuels is to increase the tolerance of the host organism to toxic products or byproducts. An Escherichia coli strain with superior ethanol and more generally alcohol tolerance was identified by screening a library constructed by randomly integrating Lactobacillus plantarum genomic DNA fragments into the E. coli chromosome via Cre-lox recombination. Sequencing identified the inserted DNA fragment as the murA2 gene and its upstream intergenic 973-bp sequence, both coded on the negative genomic DNA strand. Overexpression of this murA2 gene and its upstream 973-bp sequence significantly enhanced ethanol tolerance in both E. coli EC100 and wild type E. coli MG1655 strains by 4.1-fold and 2.0-fold compared to control strains, respectively. Tolerance to n-butanol and i-butanol in E. coli MG1655 was increased by 1.85-fold and 1.91-fold, respectively. We show that the intergenic 973-bp sequence contains a native promoter for the murA2 gene along with a long 5' UTR (286 nt) on the negative strand, while a noncoding, small RNA, named MurA2S, is expressed off the positive strand. MurA2S is expressed in E. coli and may interact with murA2, but it does not affect murA2's ability to enhance alcohol tolerance in E. coli. Overexpression of murA2 with its upstream region in the ethanologenic E. coli KO11 strain significantly improved ethanol production in cultures that simulate the industrial Melle-Boinot fermentation process.

Quantifying translational coupling in E. coli synthetic operons using RBS modulation and fluorescent reporters.

PubMed

Levin-Karp, Ayelet; Barenholz, Uri; Bareia, Tasneem; Dayagi, Michal; Zelcbuch, Lior; Antonovsky, Niv; Noor, Elad; Milo, Ron

2013-06-21

Translational coupling is the interdependence of translation efficiency of neighboring genes encoded within an operon. The degree of coupling may be quantified by measuring how the translation rate of a gene is modulated by the translation rate of its upstream gene. Translational coupling was observed in prokaryotic operons several decades ago, but the quantitative range of modulation translational coupling leads to and the factors governing this modulation were only partially characterized. In this study, we systematically quantify and characterize translational coupling in E. coli synthetic operons using a library of plasmids carrying fluorescent reporter genes that are controlled by a set of different ribosome binding site (RBS) sequences. The downstream gene expression level is found to be enhanced by the upstream gene expression via translational coupling with the enhancement level varying from almost no coupling to over 10-fold depending on the upstream gene's sequence. Additionally, we find that the level of translational coupling in our system is similar between the second and third locations in the operon. The coupling depends on the distance between the stop codon of the upstream gene and the start codon of the downstream gene. This study is the first to systematically and quantitatively characterize translational coupling in a synthetic E. coli operon. Our analysis will be useful in accurate manipulation of gene expression in synthetic biology and serves as a step toward understanding the mechanisms involved in translational expression modulation.

CSTminer: a web tool for the identification of coding and noncoding conserved sequence tags through cross-species genome comparison

PubMed Central

Castrignanò, Tiziana; Canali, Alessandro; Grillo, Giorgio; Liuni, Sabino; Mignone, Flavio; Pesole, Graziano

2004-01-01

The identification and characterization of genome tracts that are highly conserved across species during evolution may contribute significantly to the functional annotation of whole-genome sequences. Indeed, such sequences are likely to correspond to known or unknown coding exons or regulatory motifs. Here, we present a web server implementing a previously developed algorithm that, by comparing user-submitted genome sequences, is able to identify statistically significant conserved blocks and assess their coding or noncoding nature through the measure of a coding potential score. The web tool, available at http://www.caspur.it/CSTminer/, is dynamically interconnected with the Ensembl genome resources and produces a graphical output showing a map of detected conserved sequences and annotated gene features. PMID:15215464

Activation of HIV-1 pre-mRNA 3' processing in vitro requires both an upstream element and TAR.

PubMed Central

Gilmartin, G M; Fleming, E S; Oetjen, J

1992-01-01

The architecture of the human immunodeficiency virus type 1 (HIV-1) genome presents an intriguing dilemma for the 3' processing of viral transcripts--to disregard a canonical 'core' poly(A) site processing signal present at the 5' end of the transcript and yet to utilize efficiently an identical signal that resides at the 3' end of the message. The choice of processing sites in HIV-1 appears to be influenced by two factors: (i) proximity to the cap site, and (ii) sequences upstream of the core poly(A) site. We now demonstrate that an in vivo-defined upstream element that resides within the U3 region, 76 nucleotides upstream of the AAUAAA hexamer, acts specifically to enhance 3' processing at the HIV-1 core poly(A) site in vitro. We furthermore show that efficient in vitro 3' processing requires the RNA stem-loop structure of TAR, which serves to juxtapose spatially the upstream element and the core poly(A) site. An analysis of the stability of 3' processing complexes formed at the HIV-1 poly(A) site in vitro suggests that the upstream element may function by increasing processing complex stability at the core poly(A) site. Images PMID:1425577

End Joining-Mediated Gene Expression in Mammalian Cells Using PCR-Amplified DNA Constructs that Contain Terminator in Front of Promoter.

PubMed

Nakamura, Mikiko; Suzuki, Ayako; Akada, Junko; Tomiyoshi, Keisuke; Hoshida, Hisashi; Akada, Rinji

2015-12-01

Mammalian gene expression constructs are generally prepared in a plasmid vector, in which a promoter and terminator are located upstream and downstream of a protein-coding sequence, respectively. In this study, we found that front terminator constructs-DNA constructs containing a terminator upstream of a promoter rather than downstream of a coding region-could sufficiently express proteins as a result of end joining of the introduced DNA fragment. By taking advantage of front terminator constructs, FLAG substitutions, and deletions were generated using mutagenesis primers to identify amino acids specifically recognized by commercial FLAG antibodies. A minimal epitope sequence for polyclonal FLAG antibody recognition was also identified. In addition, we analyzed the sequence of a C-terminal Ser-Lys-Leu peroxisome localization signal, and identified the key residues necessary for peroxisome targeting. Moreover, front terminator constructs of hepatitis B surface antigen were used for deletion analysis, leading to the identification of regions required for the particle formation. Collectively, these results indicate that front terminator constructs allow for easy manipulations of C-terminal protein-coding sequences, and suggest that direct gene expression with PCR-amplified DNA is useful for high-throughput protein analysis in mammalian cells.

CodonLogo: a sequence logo-based viewer for codon patterns.

PubMed

Sharma, Virag; Murphy, David P; Provan, Gregory; Baranov, Pavel V

2012-07-15

Conserved patterns across a multiple sequence alignment can be visualized by generating sequence logos. Sequence logos show each column in the alignment as stacks of symbol(s) where the height of a stack is proportional to its informational content, whereas the height of each symbol within the stack is proportional to its frequency in the column. Sequence logos use symbols of either nucleotide or amino acid alphabets. However, certain regulatory signals in messenger RNA (mRNA) act as combinations of codons. Yet no tool is available for visualization of conserved codon patterns. We present the first application which allows visualization of conserved regions in a multiple sequence alignment in the context of codons. CodonLogo is based on WebLogo3 and uses the same heuristics but treats codons as inseparable units of a 64-letter alphabet. CodonLogo can discriminate patterns of codon conservation from patterns of nucleotide conservation that appear indistinguishable in standard sequence logos. The CodonLogo source code and its implementation (in a local version of the Galaxy Browser) are available at http://recode.ucc.ie/CodonLogo and through the Galaxy Tool Shed at http://toolshed.g2.bx.psu.edu/.

The F-ATPase operon from the oral streptococci S. mutans and S. sanguis: How structure relates to function

NASA Astrophysics Data System (ADS)

Kuhnert, Wendi Lee

1999-10-01

The oral microbe, Streptococcus mutans is known to be a primary contributor to the most common infection in humans, dental caries. In the plaque environment, resident bacteria metabolize dietary sucrose which results in the production of organic acids and a decrease in plaque pH. The proton-translocating ATPase (F-ATPase) protects the bacteria from acidification by extruding protons, at the expense of ATP, to maintain an internal pH which is more neutral than the external environment. Examination of this enzyme will help us to gain insight regarding its contribution to the aciduricity characteristics of oral bacteria. In this work, our goal was to begin the molecular dissection of the mechanism by which streptococcal ATPases are regulated and function enzymatically. Sequence analysis of the F-ATPase from the non-pathogenic S. sanguis revealed that the structural genes are homologous to S. mutans as well as other sequenced F-ATPases. Cloned subunits were functionally similar as shown by complementing E. coli ATPase mutants. S. sanguis/E. coli hybrid enzymes hydrolyzed ATP, but proton conduction was uncoupled as demonstrated with inhibition studies. Transcriptional regulation of the F-ATPase operon from S. mutans was examined using chloramphenicol acetyltransferase gene fusions. Fusions containing 136 bp of DNA upstream of the promoter showed higher levels of expression as compared to those with only 16 bp. Similar to ATPase enzymatic activity, CAT expression also increased during growth at low pH. Analysis of RNA demonstrated that ATPase mRNA levels were higher at low pH, which supported the CAT activity data. Therefore, the F-ATPase from S. mutans was regulated, at least partially, by both the DNA located upstream of the promoter as well as by pH. Examination of structural models of the F-ATPase from the pathogenic oral organisms S. mutans and Lactobacillus casei and the non- pathogenic S. sanguis showed that the differences noted in the sequence of the catalytic β subunit do not result in structural alterations. Therefore, the contribution that the F-ATPase makes towards the aciduricity of the oral streptococci is linked to its increased expression at low pH or perhaps to structural differences in the other, less-conserved, domains of the enzyme.

Induction of surfactin production in Bacillus subtilis by gsp, a gene located upstream of the gramicidin S operon in Bacillus brevis.

PubMed Central

Borchert, S; Stachelhaus, T; Marahiel, M A

1994-01-01

The deduced amino acid sequence of the gsp gene, located upstream of the 5' end of the gramicidin S operon (grs operon) in Bacillus brevis, showed a high degree of similarity to the sfp gene product, which is located downstream of the srfA operon in B. subtilis. The gsp gene complemented in trans a defect in the sfp gene (sfpO) and promoted production of the lipopeptide antibiotic surfactin. The functional homology of Gsp and Sfp and the sequence similarity of these two proteins to EntD suggest that the three proteins represent a new class of proteins involved in peptide secretion, in support of a hypothesis published previously (T. H. Grossman, M. Tuckman, S. Ellestad, and M. S. Osburne, J. Bacteriol. 175:6203-6211, 1993). Images PMID:7512553

VIZARD: analysis of Affymetrix Arabidopsis GeneChip data

NASA Technical Reports Server (NTRS)

Moseyko, Nick; Feldman, Lewis J.

2002-01-01

SUMMARY: The Affymetrix GeneChip Arabidopsis genome array has proved to be a very powerful tool for the analysis of gene expression in Arabidopsis thaliana, the most commonly studied plant model organism. VIZARD is a Java program created at the University of California, Berkeley, to facilitate analysis of Arabidopsis GeneChip data. It includes several integrated tools for filtering, sorting, clustering and visualization of gene expression data as well as tools for the discovery of regulatory motifs in upstream sequences. VIZARD also includes annotation and upstream sequence databases for the majority of genes represented on the Affymetrix Arabidopsis GeneChip array. AVAILABILITY: VIZARD is available free of charge for educational, research, and not-for-profit purposes, and can be downloaded at http://www.anm.f2s.com/research/vizard/ CONTACT: moseyko@uclink4.berkeley.edu.

Analysis of C. elegans VIG-1 expression.

PubMed

Shin, Kyoung-Hwa; Choi, Boram; Park, Yang-Seo; Cho, Nam Jeong

2008-12-31

Double-stranded RNA (dsRNA) induces gene silencing in a sequence-specific manner by a process known as RNA interference (RNAi). The RNA-induced silencing complex (RISC) is a multi-subunit ribonucleoprotein complex that plays a key role in RNAi. VIG (Vasa intronic gene) has been identified as a component of Drosophila RISC; however, the role VIG plays in regulating RNAi is poorly understood. Here, we examined the spatial and temporal expression patterns of VIG-1, the C. elegans ortholog of Drosophila VIG, using a vig-1::gfp fusion construct. This construct contains the 908-bp region immediately upstream of vig-1 gene translation initiation site. Analysis by confocal microscopy demonstrated GFP-VIG-1 expression in a number of tissues including the pharynx, body wall muscle, hypodermis, intestine, reproductive system, and nervous system at the larval and adult stages. Furthermore, western blot analysis showed that VIG-1 is present in each developmental stage examined. To investigate regulatory sequences for vig-1 gene expression, we generated constructs containing deletions in the upstream region. It was determined that the GFP expression pattern of a deletion construct (delta-908 to -597) was generally similar to that of the non-deletion construct. In contrast, removal of a larger segment (delta-908 to -191) resulted in the loss of GFP expression in most cell types. Collectively, these results indicate that the 406-bp upstream region (-596 to -191) contains essential regulatory sequences required for VIG-1 expression.

Sequence and transcriptional analysis of the barley ctDNA region upstream of psbD-psbC encoding trnK(UUU), rps16, trnQ(UUG), psbK, psbI, and trnS(GCU).

PubMed

Berends Sexton, T; Jones, J T; Mullet, J E

1990-05-01

A 6.25 kbp barley plastid DNA region located between psbA and psbD-psbC were sequenced and RNAs produced from this DNA were analyzed. TrnK(UUU), rps16 and trnQ(UUG) were located upstream of psbA. These genes were transcribed from the same DNA strand as psbA and multiple RNAs hybridized to them. TrnK and rsp16 contained introns; a 504 amino acid open reading frame (ORF504) was located within the trnK intron. Between trnQ and psbD-psbC was a 2.24 kbp region encoding psbK, psbI and trnS(GCU). PsbK and psbI are encoded on the same DNA strand as psbD-psbC whereas trnS(GCU) is transcribed from the opposite strand. Two large RNAs accumulate in barley etioplasts which contain psbK, psbI, anti-sense trnS(GCU) and psbD-psbC sequences. Other RNAs encode psbK and psbI only, or psbK only. The divergent trnS(GCU) located upstream of psbD-psbC and a second divergent trnS(UGA) located downstream of psbD-psbC were both expressed. Furthermore, RNA complementary to psbK and psbI mRNA was detected, suggesting that transcription from divergent overlapping transcription units may modulate expression from this DNA region.

Bacillus subtilis δ Factor Functions as a Transcriptional Regulator by Facilitating the Open Complex Formation.

PubMed

Prajapati, Ranjit Kumar; Sengupta, Shreya; Rudra, Paulami; Mukhopadhyay, Jayanta

2016-01-15

Most bacterial RNA polymerases (RNAP) contain five conserved subunits, viz. 2α, β, β', and ω. However, in many Gram-positive bacteria, especially in fermicutes, RNAP is associated with an additional factor, called δ. For over three decades since its identification, it had been thought that δ functioned as a subunit of RNAP to enhance the level of transcripts by recycling RNAP. In support of the previous observations, we also find that δ is involved in recycling of RNAP by releasing the RNA from the ternary complex. We further show that δ binds to RNA and is able to recycle RNAP when the length of the nascent RNA reaches a critical length. However, in this work we decipher a new function of δ. Performing biochemical and mutational analysis, we show that Bacillus subtilis δ binds to DNA immediately upstream of the promoter element at A-rich sequences on the abrB and rrnB1 promoters and facilitates open complex formation. As a result, δ facilitates RNAP to initiate transcription in the second scale, compared with minute scale in the absence of δ. Using transcription assay, we show that δ-mediated recycling of RNAP cannot be the sole reason for the enhancement of transcript yield. Our observation that δ does not bind to RNAP holo enzyme but is required to bind to DNA upstream of the -35 promoter element for transcription activation suggests that δ functions as a transcriptional regulator. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Deciphering the Regulatory Logic of an Ancient, Ultraconserved Nuclear Receptor Enhancer Module

PubMed Central

Bagamasbad, Pia D.; Bonett, Ronald M.; Sachs, Laurent; Buisine, Nicolas; Raj, Samhitha; Knoedler, Joseph R.; Kyono, Yasuhiro; Ruan, Yijun; Ruan, Xiaoan

2015-01-01

Cooperative, synergistic gene regulation by nuclear hormone receptors can increase sensitivity and amplify cellular responses to hormones. We investigated thyroid hormone (TH) and glucocorticoid (GC) synergy on the Krüppel-like factor 9 (Klf9) gene, which codes for a zinc finger transcription factor involved in development and homeostasis of diverse tissues. We identified regions of the Xenopus and mouse Klf9 genes 5–6 kb upstream of the transcription start sites that supported synergistic transactivation by TH plus GC. Within these regions, we found an orthologous sequence of approximately 180 bp that is highly conserved among tetrapods, but absent in other chordates, and possesses chromatin marks characteristic of an enhancer element. The Xenopus and mouse approximately 180-bp DNA element conferred synergistic transactivation by hormones in transient transfection assays, so we designate this the Klf9 synergy module (KSM). We identified binding sites within the mouse KSM for TH receptor, GC receptor, and nuclear factor κB. TH strongly increased recruitment of liganded GC receptor and serine 5 phosphorylated (initiating) RNA polymerase II to chromatin at the KSM, suggesting a mechanism for transcriptional synergy. The KSM is transcribed to generate long noncoding RNAs, which are also synergistically induced by combined hormone treatment, and the KSM interacts with the Klf9 promoter and a far upstream region through chromosomal looping. Our findings support that the KSM plays a central role in hormone regulation of vertebrate Klf9 genes, it evolved in the tetrapod lineage, and has been maintained by strong stabilizing selection. PMID:25866873

The proline-rich region of 18.5 kDa myelin basic protein binds to the SH3-domain of Fyn tyrosine kinase with the aid of an upstream segment to form a dynamic complex in vitro

PubMed Central

De Avila, Miguel; Vassall, Kenrick A.; Smith, Graham S. T.; Bamm, Vladimir V.; Harauz, George

2014-01-01

The intrinsically disordered 18.5 kDa classic isoform of MBP (myelin basic protein) interacts with Fyn kinase during oligodendrocyte development and myelination. It does so primarily via a central proline-rich SH3 (Src homology 3) ligand (T92–R104, murine 18.5 kDa MBP sequence numbering) that is part of a molecular switch due to its high degree of conservation and modification by MAP (mitogen-activated protein) and other kinases, especially at residues T92 and T95. Here, we show using co-transfection experiments of an early developmental oligodendroglial cell line (N19) that an MBP segment upstream of the primary ligand is involved in MBP–Fyn–SH3 association in cellula. Using solution NMR spectroscopy in vitro, we define this segment to comprise MBP residues (T62–L68), and demonstrate further that residues (V83–P93) are the predominant SH3-target, assessed by the degree of chemical shift change upon titration. We show by chemical shift index analysis that there is no formation of local poly-proline type II structure in the proline-rich segment upon binding, and by NOE (nuclear Overhauser effect) and relaxation measurements that MBP remains dynamic even while complexed with Fyn–SH3. The association is a new example first of a non-canonical SH3-domain interaction and second of a fuzzy MBP complex. PMID:25343306

The proline-rich region of 18.5 kDa myelin basic protein binds to the SH3-domain of Fyn tyrosine kinase with the aid of an upstream segment to form a dynamic complex in vitro.

PubMed

De Avila, Miguel; Vassall, Kenrick A; Smith, Graham S T; Bamm, Vladimir V; Harauz, George

2014-12-08

The intrinsically disordered 18.5 kDa classic isoform of MBP (myelin basic protein) interacts with Fyn kinase during oligodendrocyte development and myelination. It does so primarily via a central proline-rich SH3 (Src homology 3) ligand (T92-R104, murine 18.5 kDa MBP sequence numbering) that is part of a molecular switch due to its high degree of conservation and modification by MAP (mitogen-activated protein) and other kinases, especially at residues T92 and T95. Here, we show using co-transfection experiments of an early developmental oligodendroglial cell line (N19) that an MBP segment upstream of the primary ligand is involved in MBP-Fyn-SH3 association in cellula. Using solution NMR spectroscopy in vitro, we define this segment to comprise MBP residues (T62-L68), and demonstrate further that residues (V83-P93) are the predominant SH3-target, assessed by the degree of chemical shift change upon titration. We show by chemical shift index analysis that there is no formation of local poly-proline type II structure in the proline-rich segment upon binding, and by NOE (nuclear Overhauser effect) and relaxation measurements that MBP remains dynamic even while complexed with Fyn-SH3. The association is a new example first of a non-canonical SH3-domain interaction and second of a fuzzy MBP complex.

Intron Definition Is Required for Excision of the Minute Virus of Mice Small Intron and Definition of the Upstream Exon

PubMed Central

Haut, Donald D.; Pintel, D. J.

1998-01-01

Alternative splicing of pre-mRNAs plays a critical role in maximizing the coding capacity of the small parvovirus genome. The small-intron region of minute virus of mice (MVM) pre-mRNAs undergoes an unusual pattern of overlapping alternative splicing—using two donors (D1 and D2) and two acceptors (A1 and A2) within a region of 120 nucleotides—that determines the steady-state ratios of the various viral mRNAs. In this report, we show that the determinants that govern excision of the small intron are complex and are also required for efficient definition of the upstream exon. For the MVM small intron in its natural context, the two donors appear to compete for the splicing machinery: the position of D1 favors its usage, while the primary sequence of D2 must be more like the consensus sequence than is D1 to be used efficiently. We have genetically defined the branch points that are used for generation of the major and minor spliced forms and show that recognition of components of the small-intron acceptors is likely to be the dominant determinant in alternative small-intron excision. We have also identified a G-rich intronic enhancer sequence within the small intron that is essential for splicing of the minor form (D2 to A2) but not the major form (D1 to A1) of MVM mRNAs and is required for efficient definition of the upstream NS2-specific exon. In its natural context, the small intron appears to be excised by a mechanism consistent with intron definition. When the MVM small intron is expanded, various parameters of its excision are altered, indicating that critical cis-acting signals are context dependent. Relative use of the donors and acceptors is altered, and the upstream NS2-specific exon is no longer efficiently defined. The fact that definition of the upstream NS2-specific exon can be achieved by the MVM small intron in its natural context, but not when it is expanded, suggests that the multiple determinants that govern definition and excision of the small intron are required, in concert, for upstream exon definition. Our data are consistent with a model in which alternative splicing of the MVM P4-generated pre-mRNAs is governed by a hybrid of intron- and exon-defining mechanisms. PMID:9499034

Genetic diversity among the Eurytemora affinis species complex in the Scheldt estuary and its tributaries using ISSR-PCR marker assay

NASA Astrophysics Data System (ADS)

Gasmi, S.; Ferval, M.; Pelissier, C.; D'Amico, F.; Maris, T.; Tackx, M.; Legal, L.

2014-05-01

As an estuary being restored, the Scheldt (Belgium/The Netherlands) offers an interesting setting to study the response of organisms and ecosystems to changing conditions. This study specifically deals with this with regard to the spatio-temporal distribution and possible genetic differentiation among the species complex Eurytemora affinis (copepoda, calanoida). Until the 1990s, E. affinis typically occurred downstream the Scheldt estuary (Belgium/The Netherlands). In parallel to water quality improvement, E.affinis has recently also occurred upstream the estuary and in some of the tributaries. This paper aims to assess the origin of the copepod sibling species complex E. affinis occurring upstream the Scheldt estuary through genetic characterization. Using the Inter Simple Sequence Repeat (ISSR) technique, we explored genetic pools of the E. affinis complex in three Scheldt localities (downstream, middle-estuary and upstream) and two of its tributaries. Four ISSR primers produced 75 polymorphic loci. Bayesian and hierarchical analysis revealed different but close genetic entities in both down and upstream localities. The middle-estuary individuals were genetically a composite mix of downstream and upstream populations (84% from downstream and 16% from upstream). A distinctive separation of the tributaries and the main Scheldt stream populations suggests that two fully independent genetic pools are present. It is of note that the tributaries showed a lack of genetic subdivision, that upstream and downstream E. affinis populations are closely related, and that the downstream population is most likely at the origin of the upstream one, which implies the necessity to guarantee sufficient oxygen concentration levels throughout the estuarine continuum to guarantee the presence of this species upstream. The results of the ISSR technique are discussed in comparison with genetic studies on E. affinis using COI barcoding.

New families of site-specific repetitive DNA sequences that comprise constitutive heterochromatin of the Syrian hamster (Mesocricetus auratus, Cricetinae, Rodentia).

PubMed

Yamada, Kazuhiko; Kamimura, Eikichi; Kondo, Mariko; Tsuchiya, Kimiyuki; Nishida-Umehara, Chizuko; Matsuda, Yoichi

2006-02-01

We molecularly cloned new families of site-specific repetitive DNA sequences from BglII- and EcoRI-digested genomic DNA of the Syrian hamster (Mesocricetus auratus, Cricetrinae, Rodentia) and characterized them by chromosome in situ hybridization and filter hybridization. They were classified into six different types of repetitive DNA sequence families according to chromosomal distribution and genome organization. The hybridization patterns of the sequences were consistent with the distribution of C-positive bands and/or Hoechst-stained heterochromatin. The centromeric major satellite DNA and sex chromosome-specific and telomeric region-specific repetitive sequences were conserved in the same genus (Mesocricetus) but divergent in different genera. The chromosome-2-specific sequence was conserved in two genera, Mesocricetus and Cricetulus, and a low copy number of repetitive sequences on the heterochromatic chromosome arms were conserved in the subfamily Cricetinae but not in the subfamily Calomyscinae. By contrast, the other type of repetitive sequences on the heterochromatic chromosome arms, which had sequence similarities to a LINE sequence of rodents, was conserved through the three subfamilies, Cricetinae, Calomyscinae and Murinae. The nucleotide divergence of the repetitive sequences of heterochromatin was well correlated with the phylogenetic relationships of the Cricetinae species, and each sequence has been independently amplified and diverged in the same genome.

SEPT9 Mutations and a Conserved 17q25 Sequence in Sporadic and Hereditary Brachial Plexus Neuropathy

PubMed Central

Klein, Christopher J.; Wu, Yanhong; Cunningham, Julie M.; Windebank, Anthony J.; Dyck, P. James B.; Friedenberg, Scott M.; Klein, Diane M.; Dyck, Peter J.

2009-01-01

Background The clinical characteristics of sporadic brachial plexus neuropathy (S-BPN) and hereditary brachial plexus neuropathy (H-BPN) are similar. At times of attack inflammation in brachial plexus nerves has been identified in both conditions. SEPT-9 mutations (Arg88Trp, Ser93Phe, 5UTR-131G to C) occur in some families with H-BPN. These mutations were not found in American H-BPN kindreds with a conserved 500 Kb sequence of DNA at 17q25 (the location of SEPT-9) where a founder mutation has been suggested. Objective To study 17q25 and SEPT-9 in S-BPN (56 patients) and H-BPN (13 kindreds). Methods Allele analysis at 17q25, SEPT-9 DNA sequencing and mRNA analysis from lymphoblast cultures. Results A conserved 17q25 sequence was found in 5 of 13 H-BPN kindreds and one S-BPN patient. This conserved sequence was not found in the family with a SEPT-9 mutation (Arg88Trp) or controls (182). SEPT-9 mRNA expression did not differ between forms of H-BPN and controls. No known mutations of SEPT-9 were found in S-BPN. Conclusions/Relevance Rare S-BPN patients have the same conserved 17q25 sequence found in many American H-BPN kindreds. BPN patients with this conserved sequence do not appear to have SEPT-9 mutations or alterations of its mRNA expression levels in lymphoblast cultures. BPN patients with this conserved sequence may have the most common genetic cause in the Americas by a founder effect mutation. PMID:19204161

Three enhancer regions regulate gbx2 gene expression in the isthmic region during zebrafish development.

PubMed

Islam, Md Ekramul; Kikuta, Hiroshi; Inoue, Fumitaka; Kanai, Maiko; Kawakami, Atsushi; Parvin, Mst Shahnaj; Takeda, Hiroyuki; Yamasu, Kyo

2006-12-01

In vertebrate embryos, positioning of the boundary between the midbrain and hindbrain (MHB) and subsequent isthmus formation are dependent upon the interaction between the Otx2 and Gbx genes. In zebrafish, sequential expression of gbx1 and gbx2 in the anterior hindbrain contributes to this process, whereas in mouse embryos, a single Gbx gene (Gbx2) is responsible for MHB development. In the present study, to investigate the regulatory mechanism of gbx2 in the MHB/isthmic region of zebrafish embryos, we cloned the gene and showed that its organization is conserved among different vertebrates. Promoter analyses revealed three enhancers that direct reporter gene expression after the end of epiboly in the anterior-most hindbrain, which is a feature of the zebrafish gbx2 gene. One of the enhancers is located upstream of gbx2 (AMH1), while the other two enhancers are located downstream of gbx2 (AMH2 and AMH3). Detailed analysis of the AMH1 enhancer showed that it directs expression in the rhombomere 1 (r1) region and the dorsal thalamus, as has been shown for gbx2, whereas no expression was induced by the AMH1 enhancer in other embryonic regions in which gbx2 is expressed. The AMH1 enhancer is composed of multiple regulatory subregions that share the same spatial specificity. The most active of the regulatory subregions is a 291-bp region that contains at least two Pax2-binding sites, both of which are necessary for the function of the main component (PB1-A region) of the AMH1 enhancer. In accordance with these results, enhancer activity in the PB1-A region, as well as gbx2 expression in r1, was missing in no isthmus mutant embryos that lacked functional pax2a. In addition, we identified an upstream conserved sequence of 227bp that suppresses the enhancer activity of AMH1. Taken together, these findings suggest that gbx2 expression during the somitogenesis stage in zebrafish is regulated by a complex mechanism involving Pax2 as well as activators and suppressors in the regions flanking the gene.

Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).

PubMed

Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K

2011-09-01

Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

DOE Office of Scientific and Technical Information (OSTI.GOV)

Santini, Simona; Boore, Jeffrey L.; Meyer, Axel

2003-12-31

Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involvedmore » in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.« less

Terrace effects on soil erosion processes in a watershed of the loess plateau

USDA-ARS?s Scientific Manuscript database

Terraces in crop fields are one of the most important soil and water conservation measures that affect runoff and erosion processes in a watershed. In this paper, terrace effects on soil erosion and sediment transport in the upstream and middle sections of the Weihe River basin in the Loess Plateau ...

Flanking HS-62.5 and 3' HS1, and regions upstream of the LCR, are not required for beta-globin transcription.

PubMed

Bender, M A; Byron, Rachel; Ragoczy, Tobias; Telling, Agnes; Bulger, Michael; Groudine, Mark

2006-08-15

The locus control region (LCR) was thought to be necessary and sufficient for establishing and maintaining an open beta-globin locus chromatin domain in the repressive environment of the developing erythrocyte. However, deletion of the LCR from the endogenous locus had no significant effect on chromatin structure and did not silence transcription. Thus, the cis-regulatory elements that confer the open domain remain unidentified. The conserved DNaseI hypersensitivity sites (HSs) HS-62.5 and 3'HS1 that flank the locus, and the region upstream of the LCR have been implicated in globin gene regulation. The flanking HSs bind CCCTC binding factor (CTCF) and are thought to interact with the LCR to form a "chromatin hub" involved in beta-globin gene activation. Hispanic thalassemia, a deletion of the LCR and 27 kb upstream, leads to heterochromatinization and silencing of the locus. Thus, the region upstream of the LCR deleted in Hispanic thalassemia (upstream Hispanic region [UHR]) may be required for expression. To determine the importance of the UHR and flanking HSs for beta-globin expression, we generated and analyzed mice with targeted deletions of these elements. We demonstrate deletion of these regions alone, and in combination, do not affect transcription, bringing into question current models for the regulation of the beta-globin locus.

Identification of regulatory targets for the bacterial Nus factor complex.

PubMed

Baniulyte, Gabriele; Singh, Navjot; Benoit, Courtney; Johnson, Richard; Ferguson, Robert; Paramo, Mauricio; Stringer, Anne M; Scott, Ashley; Lapierre, Pascal; Wade, Joseph T

2017-12-11

Nus factors are broadly conserved across bacterial species, and are often essential for viability. A complex of five Nus factors (NusB, NusE, NusA, NusG and SuhB) is considered to be a dedicated regulator of ribosomal RNA folding, and has been shown to prevent Rho-dependent transcription termination. Here, we identify an additional cellular function for the Nus factor complex in Escherichia coli: repression of the Nus factor-encoding gene, suhB. This repression occurs primarily by translation inhibition, followed by Rho-dependent transcription termination. Thus, the Nus factor complex can prevent or promote Rho activity depending on the gene context. Conservation of putative NusB/E binding sites upstream of Nus factor genes suggests that Nus factor autoregulation occurs in many bacterial species. Additionally, many putative NusB/E binding sites are also found upstream of other genes in diverse species, and we demonstrate Nus factor regulation of one such gene in Citrobacter koseri. We conclude that Nus factors have an evolutionarily widespread regulatory function beyond ribosomal RNA, and that they are often autoregulatory.

A conserved post-transcriptional BMP2 switch in lung cells.

PubMed

Jiang, Shan; Fritz, David T; Rogers, Melissa B

2010-05-15

An ultra-conserved sequence in the bone morphogenetic protein 2 (BMP2) 3' untranslated region (UTR) markedly represses BMP2 expression in non-transformed lung cells. In contrast, the ultra-conserved sequence stimulates BMP2 expression in transformed lung cells. The ultra-conserved sequence functions as a post-transcriptional cis-regulatory switch. A common single-nucleotide polymorphism (SNP, rs15705, +A1123C), which has been shown to influence human morphology, disrupts a conserved element within the ultra-conserved sequence and altered reporter gene activity in non-transformed lung cells. This polymorphism changed the affinity of the BMP2 RNA for several proteins including nucleolin, which has an increased affinity for the C allele. Elevated BMP2 synthesis is associated with increased malignancy in mouse models of lung cancer and poor lung cancer patient prognosis. Understanding the cis- and trans-regulatory factors that control BMP2 synthesis is relevant to the initiation or progression of pathologies associated with abnormal BMP2 levels. (c) 2010 Wiley-Liss, Inc.

Phylogeny and Expression Analyses Reveal Important Roles for Plant PKS III Family during the Conquest of Land by Plants and Angiosperm Diversification

PubMed Central

Xie, Lulu; Liu, Pingli; Zhu, Zhixin; Zhang, Shifan; Zhang, Shujiang; Li, Fei; Zhang, Hui; Li, Guoliang; Wei, Yunxiao; Sun, Rifei

2016-01-01

Polyketide synthases (PKSs) utilize the products of primary metabolism to synthesize a wide array of secondary metabolites in both prokaryotic and eukaryotic organisms. PKSs can be grouped into three distinct classes, types I, II, and III, based on enzyme structure, substrate specificity, and catalytic mechanisms. The type III PKS enzymes function as homodimers, and are the only class of PKS that do not require acyl carrier protein. Plant type III PKS enzymes, also known as chalcone synthase (CHS)-like enzymes, are of particular interest due to their functional diversity. In this study, we mined type III PKS gene sequences from the genomes of six aquatic algae and 25 land plants (1 bryophyte, 1 lycophyte, 2 basal angiosperms, 16 core eudicots, and 5 monocots). PKS III sequences were found relatively conserved in all embryophytes, but not exist in algae. We also examined gene expression patterns by analyzing available transcriptome data, and identified potential cis-regulatory elements in upstream sequences. Phylogenetic trees of dicots angiosperms showed that plant type III PKS proteins fall into three clades. Clade A contains CHS/STS-type enzymes coding genes with diverse transcriptional expression patterns and enzymatic functions, while clade B is further divided into subclades b1 and b2, which consist of anther-specific CHS-like enzymes. Differentiation regions, such as amino acids 196-207 between clades A and B, and predicted positive selected sites within α-helixes in late appeared branches of clade A, account for the major diversification in substrate choice and catalytic reaction. The integrity and location of conserved cis-elements containing MYB and bHLH binding sites can affect transcription levels. Potential binding sites for transcription factors such as WRKY, SPL, or AP2/EREBP may contribute to tissue- or taxon-specific differences in gene expression. Our data shows that gene duplications and functional diversification of plant type III PKS enzymes played a critical role in the ancient conquest of the land by early plants and angiosperm diversification. PMID:27625671

Novel mutations of CHST6 in Iranian patients with macular corneal dystrophy

PubMed Central

Salehi, Zivar; Houshmand, Masoud; Mohamadi, Mohamad Javad; Promehr, Leila Azizade; Mozafarzadeh, Zahra

2009-01-01

Purpose To characterize mutations within the carbohydrate sulfotransferase 6 (CHST6) gene in Iranian subjects from 12 families with macular corneal dystrophy (MCD). Methods Genomic DNA was extracted from peripheral blood of 20 affected patients and 60 healthy volunteers followed by polymerase chain reaction (PCR) and direct sequencing of the CHST6 coding region. The observed nucleotide sequences were then compared with those found by investigators in other populations with MCD and in the controls. Results Analysis of CHST6 revealed 11 different mutations. These mutations were comprised of six novel missense mutations (p.F55L, p.P132L, p.S136G, p.C149Y, p.D203Y, and p.H249R), one novel nonsense mutation (p.S48X), one novel frame shift (after P297), and three previously reported missense mutations (p.P31L, p.C165Y, and p.R127C). The majority of the detected MCD mutations are located in the binding sites or the binding pocket, except the p.P31L and p.H249R mutations. Conclusions Nucleotide changes within the coding region of CHST6 are predicted to significantly alter the encoded sulfotransferase within the evolutionary conserved sequences. Our findings show that CHST6 mutations are responsible for the pathogenesis of MCD in Iranian patients. Moreover, the observation that some cases of MCD cannot be explained by mutations in the coding region of CHST6 suggests that MCD may result from possible upstream rearrangements in the CHST6 genomic region. PMID:19223992

Novel mutations of CHST6 in Iranian patients with macular corneal dystrophy.

PubMed

Birgani, Shiva Akbari; Salehi, Zivar; Houshmand, Masoud; Mohamadi, Mohamad Javad; Promehr, Leila Azizade; Mozafarzadeh, Zahra

2009-01-01

To characterize mutations within the carbohydrate sulfotransferase 6 (CHST6) gene in Iranian subjects from 12 families with macular corneal dystrophy (MCD). Genomic DNA was extracted from peripheral blood of 20 affected patients and 60 healthy volunteers followed by polymerase chain reaction (PCR) and direct sequencing of the CHST6 coding region. The observed nucleotide sequences were then compared with those found by investigators in other populations with MCD and in the controls. Analysis of CHST6 revealed 11 different mutations. These mutations were comprised of six novel missense mutations (p.F55L, p.P132L, p.S136G, p.C149Y, p.D203Y, and p.H249R), one novel nonsense mutation (p.S48X), one novel frame shift (after P297), and three previously reported missense mutations (p.P31L, p.C165Y, and p.R127C). The majority of the detected MCD mutations are located in the binding sites or the binding pocket, except the p.P31L and p.H249R mutations. Nucleotide changes within the coding region of CHST6 are predicted to significantly alter the encoded sulfotransferase within the evolutionary conserved sequences. Our findings show that CHST6 mutations are responsible for the pathogenesis of MCD in Iranian patients. Moreover, the observation that some cases of MCD cannot be explained by mutations in the coding region of CHST6 suggests that MCD may result from possible upstream rearrangements in the CHST6 genomic region.

Whole-Exome Sequencing in a South American Cohort Links ALDH1A3, FOXN1 and Retinoic Acid Regulation Pathways to Autism Spectrum Disorders

PubMed Central

Moreno-Ramos, Oscar A.; Olivares, Ana María; Haider, Neena B.; de Autismo, Liga Colombiana; Lattig, María Claudia

2015-01-01

Autism spectrum disorders (ASDs) are a range of complex neurodevelopmental conditions principally characterized by dysfunctions linked to mental development. Previous studies have shown that there are more than 1000 genes likely involved in ASD, expressed mainly in brain and highly interconnected among them. We applied whole exome sequencing in Colombian—South American trios. Two missense novel SNVs were found in the same child: ALDH1A3 (RefSeq NM_000693: c.1514T>C (p.I505T)) and FOXN1 (RefSeq NM_003593: c.146C>T (p.S49L)). Gene expression studies reveal that Aldh1a3 and Foxn1 are expressed in ~E13.5 mouse embryonic brain, as well as in adult piriform cortex (PC; ~P30). Conserved Retinoic Acid Response Elements (RAREs) upstream of human ALDH1A3 and FOXN1 and in mouse Aldh1a3 and Foxn1 genes were revealed using bioinformatic approximation. Chromatin immunoprecipitation (ChIP) assay using Retinoid Acid Receptor B (Rarb) as the immunoprecipitation target suggests RA regulation of Aldh1a3 and Foxn1 in mice. Our results frame a possible link of RA regulation in brain to ASD etiology, and a feasible non-additive effect of two apparently unrelated variants in ALDH1A3 and FOXN1 recognizing that every result given by next generation sequencing should be cautiously analyzed, as it might be an incidental finding. PMID:26352270

Autosomal Recessive Congenital Ichthyosis in American Bulldogs Is Associated With NIPAL4 (ICHTHYIN) Deficiency.

PubMed

Mauldin, E A; Wang, P; Evans, E; Cantner, C A; Ferracone, J D; Credille, K M; Casal, M L

2015-07-01

A minority of patients with nonsyndromic autosomal recessive congenital ichthyosis (ARCI) display mutations in NIPAL4 (ICHTHYIN). This protein plays a role in epidermal lipid metabolism, although the mechanism is unknown. The study describes a moderate form of ARCI in an extended pedigree of American Bulldogs that is linked to the gene encoding ichthyin. The gross phenotype was manifest as a disheveled pelage shortly after birth, generalized scaling, and adherent brown scale with erythema of the abdominal skin. Pedigree analysis indicated an autosomal recessive mode of inheritance. Ultrastructurally, the epidermis showed discontinuous lipid bilayers, unprocessed lipid within corneocytes, and abnormal lamellar bodies. Linkage analysis, performed by choosing simple sequence repeat markers and single-nucleotide polymorphisms near genes known to cause ACRI, revealed an association with NIPAL4. NIPAL4 was identified and sequenced using standard methods. No mutation was identified within the gene, but affected dogs had a SINE element 5' upstream of exon 1 in a highly conserved region. Of 545 DNA samples from American Bulldogs, 32 dogs (17 females, 15 males) were homozygous for the polymerase chain reaction fragment. All affected dogs were homozygous, with parents heterozygous for the insertion. Immunolabeling revealed an absence of ichthyin in the epidermis. This is the first description of ARCI associated with decreased expression of NIPAL4 in nonhuman species. © The Author(s) 2014.

Isolation and characterization of the genes for two small RNAs of herpesvirus papio and their comparison with Epstein-Barr virus-encoded EBER RNAs.

PubMed Central

Howe, J G; Shu, M D

1988-01-01

Genes for the Epstein-Barr virus-encoded RNAs (EBERs), two low-molecular-weight RNAs encoded by the human gammaherpesvirus Epstein-Barr virus (EBV), hybridize to two small RNAs in a baboon cell line that contains a similar virus, herpesvirus papio (HVP). The genes for the HVP RNAs (HVP-1 and HVP-2) are located together in the small unique region at the left end of the viral genome and are transcribed by RNA polymerase III in a rightward direction, similar to the EBERs. There is significant similarity between EBER1 and HVP-1 RNA, except for an insert of 22 nucleotides which increases the length of HVP-1 RNA to 190 nucleotides. There is less similarity between the sequences of EBER2 and HVP-2 RNA, but both have a length of about 170 nucleotides. The predicted secondary structure of each HVP RNA is remarkably similar to that of the respective EBER, implying that the secondary structures are important for function. Upstream from the initiation sites of all four RNA genes are several highly conserved sequences which may function in the regulation of transcription. The HVP RNAs, together with the EBERs, are highly abundant in transformed cells and are efficiently bound by the cellular La protein. Images PMID:2839701

HTRA1 promoter polymorphism predisposes Japanese to age-related macular degeneration.

PubMed

Yoshida, Tsunehiko; DeWan, Andrew; Zhang, Hong; Sakamoto, Ryosuke; Okamoto, Haru; Minami, Masayoshi; Obazawa, Minoru; Mizota, Atsushi; Tanaka, Minoru; Saito, Yoshihiro; Takagi, Ikue; Hoh, Josephine; Iwata, Takeshi

2007-04-04

To study the effect of candidate single nucleotide polymorphisms (SNPs) on chromosome 10q26, recently shown to be associated with wet age-related macular degeneration (AMD) in Chinese and Caucasian cohorts, in a Japanese cohort. Using genomic DNA isolated from peripheral blood of wet AMD cases and age-matched controls, we genotyped two SNPs, rs10490924, and rs11200638, on chromosome 10q26, 6.6 kb and 512 bp upstream of the HTRA1 gene, respectively, using temperature gradient capillary electrophoresis (TGCE) and direct sequencing. Association tests were performed for individual SNPs and jointly with SNP complement factor H (CFH) Y402H. The two SNPs, rs10490924 and rs11200638, are in complete linkage disequilibrium (D'=1). Previous sequence comparisons among seventeen species revealed that the genomic region containing rs11200638 was highly conserved while the region surrounding rs10490924 was not. The allelic association test for rs11200638 yielded a p-value <10(-11). SNP rs11200638 conferred disease risk in an autosomal recessive fashion: Odds ratio was 10.1 (95% CI 4.36, 23.06), adjusted for SNP CFH 402, for those carrying two copies of the risk allele, whereas indistinguishable from unity if carrying only one risk allele. The HTRA1 promoter polymorphism, rs11200638, is a strong candidate with a functional consequence that predisposes Japanese to develop neovascular AMD.

Discovery of functional non-coding conserved regions in the α-synuclein gene locus

PubMed Central

Sterling, Lori; Walter, Michael; Ting, Dennis; Schüle, Birgitt

2014-01-01

Several single nucleotide polymorphisms (SNPs) and the Rep-1 microsatellite marker of the α-synuclein ( SNCA) gene have consistently been shown to be associated with Parkinson’s disease, but the functional relevance is unclear. Based on these findings we hypothesized that conserved cis-regulatory elements in the SNCA genomic region regulate expression of SNCA, and that SNPs in these regions could be functionally modulating the expression of SNCA, thus contributing to neuronal demise and predisposing to Parkinson’s disease. In a pair-wise comparison of a 206kb genomic region encompassing the SNCA gene, we revealed 34 evolutionary conserved DNA sequences between human and mouse. All elements were cloned into reporter vectors and assessed for expression modulation in dual luciferase reporter assays.  We found that 12 out of 34 elements exhibited either an enhancement or reduction of the expression of the reporter gene. Three elements upstream of the SNCA gene displayed an approximately 1.5 fold (p<0.009) increase in expression. Of the intronic regions, three showed a 1.5 fold increase and two others indicated a 2 and 2.5 fold increase in expression (p<0.002). Three elements downstream of the SNCA gene showed 1.5 fold and 2.5 fold increase (p<0.0009). One element downstream of SNCA had a reduced expression of the reporter gene of 0.35 fold (p<0.0009) of normal activity. Our results demonstrate that the SNCA gene contains cis-regulatory regions that might regulate the transcription and expression of SNCA. Further studies in disease-relevant tissue types will be important to understand the functional impact of regulatory regions and specific Parkinson’s disease-associated SNPs and its function in the disease process. PMID:25566351

Identification of new members of the MAPK gene family in plants shows diverse conserved domains and novel activation loop variants.

PubMed

Mohanta, Tapan Kumar; Arora, Pankaj Kumar; Mohanta, Nibedita; Parida, Pratap; Bae, Hanhong

2015-02-06

Mitogen Activated Protein Kinase (MAPK) signaling is of critical importance in plants and other eukaryotic organisms. The MAPK cascade plays an indispensible role in the growth and development of plants, as well as in biotic and abiotic stress responses. The MAPKs are constitute the most downstream module of the three tier MAPK cascade and are phosphorylated by upstream MAP kinase kinases (MAPKK), which are in turn are phosphorylated by MAP kinase kinase kinase (MAPKKK). The MAPKs play pivotal roles in regulation of many cytoplasmic and nuclear substrates, thus regulating several biological processes. A total of 589 MAPKs genes were identified from the genome wide analysis of 40 species. The sequence analysis has revealed the presence of several N- and C-terminal conserved domains. The MAPKs were previously believed to be characterized by the presence of TEY/TDY activation loop motifs. The present study showed that, in addition to presence of activation loop TEY/TDY motifs, MAPKs are also contain MEY, TEM, TQM, TRM, TVY, TSY, TEC and TQY activation loop motifs. Phylogenetic analysis of all predicted MAPKs were clustered into six different groups (group A, B, C, D, E and F), and all predicted MAPKs were assigned with specific names based on their orthology based evolutionary relationships with Arabidopsis or Oryza MAPKs. We conducted global analysis of the MAPK gene family of plants from lower eukaryotes to higher eukaryotes and analyzed their genomic and evolutionary aspects. Our study showed the presence of several new activation loop motifs and diverse conserved domains in MAPKs. Advance study of newly identified activation loop motifs can provide further information regarding the downstream signaling cascade activated in response to a wide array of stress conditions, as well as plant growth and development.

Function-based classification of carbohydrate-active enzymes by recognition of short, conserved peptide motifs.

PubMed

Busk, Peter Kamp; Lange, Lene

2013-06-01

Functional prediction of carbohydrate-active enzymes is difficult due to low sequence identity. However, similar enzymes often share a few short motifs, e.g., around the active site, even when the overall sequences are very different. To exploit this notion for functional prediction of carbohydrate-active enzymes, we developed a simple algorithm, peptide pattern recognition (PPR), that can divide proteins into groups of sequences that share a set of short conserved sequences. When this method was used on 118 glycoside hydrolase 5 proteins with 9% average pairwise identity and representing four characterized enzymatic functions, 97% of the proteins were sorted into groups correlating with their enzymatic activity. Furthermore, we analyzed 8,138 glycoside hydrolase 13 proteins including 204 experimentally characterized enzymes with 28 different functions. There was a 91% correlation between group and enzyme activity. These results indicate that the function of carbohydrate-active enzymes can be predicted with high precision by finding short, conserved motifs in their sequences. The glycoside hydrolase 61 family is important for fungal biomass conversion, but only a few proteins of this family have been functionally characterized. Interestingly, PPR divided 743 glycoside hydrolase 61 proteins into 16 subfamilies useful for targeted investigation of the function of these proteins and pinpointed three conserved motifs with putative importance for enzyme activity. Furthermore, the conserved sequences were useful for cloning of new, subfamily-specific glycoside hydrolase 61 proteins from 14 fungi. In conclusion, identification of conserved sequence motifs is a new approach to sequence analysis that can predict carbohydrate-active enzyme functions with high precision.

Vascular gene expression: a hypothesis

PubMed Central

Martínez-Navarro, Angélica C.; Galván-Gordillo, Santiago V.; Xoconostle-Cázares, Beatriz; Ruiz-Medrano, Roberto

2013-01-01

The phloem is the conduit through which photoassimilates are distributed from autotrophic to heterotrophic tissues and is involved in the distribution of signaling molecules that coordinate plant growth and responses to the environment. Phloem function depends on the coordinate expression of a large array of genes. We have previously identified conserved motifs in upstream regions of the Arabidopsis genes, encoding the homologs of pumpkin phloem sap mRNAs, displaying expression in vascular tissues. This tissue-specific expression in Arabidopsis is predicted by the overrepresentation of GA/CT-rich motifs in gene promoters. In this work we have searched for common motifs in upstream regions of the homologous genes from plants considered to possess a “primitive” vascular tissue (a lycophyte), as well as from others that lack a true vascular tissue (a bryophyte), and finally from chlorophytes. Both lycophyte and bryophyte display motifs similar to those found in Arabidopsis with a significantly low E-value, while the chlorophytes showed either a different conserved motif or no conserved motif at all. These results suggest that these same genes are expressed coordinately in non-vascular plants; this coordinate expression may have been one of the prerequisites for the development of conducting tissues in plants. We have also analyzed the phylogeny of conserved proteins that may be involved in phloem function and development. The presence of CmPP16, APL, FT, and YDA in chlorophytes suggests the recruitment of ancient regulatory networks for the development of the vascular tissue during evolution while OPS is a novel protein specific to vascular plants. PMID:23882276

Trichomonas vaginalis ribosomal RNA: identification and characterisation of the transcription promoter and terminator sequences.

PubMed

Franco, Bernardo; Hernández, Roberto; López-Villaseñor, Imelda

2012-09-01

Trichomonas vaginalis is a parasitic protozoan of both medical and biological relevance. Transcriptional studies in this organism have focused mainly on type II pol promoters, whereas the elements necessary for transcription by polI or polIII have not been investigated. Here, with the aid of a transient transcription system, we characterised the rDNA intergenic region, defining both the promoter and the terminator sequences required for transcription. We defined the promoter as a compact region of approximately 180 bp. We also identified a potential upstream control element (UCE) that was located 80 bp upstream of the transcription start point (TSP). A transcription termination element was identified within a 34 bp region that was located immediately downstream of the 28S coding sequence. The function of this element depends upon polarity and the presence of both a stretch of uridine residues (U's) and a hairpin structure in the transcript. Our observations provide a strong basis for the study of DNA recognition by the polI transcriptional machinery in this early divergent organism. Copyright © 2012 Elsevier B.V. All rights reserved.

Functional region prediction with a set of appropriate homologous sequences-an index for sequence selection by integrating structure and sequence information with spatial statistics

PubMed Central

2012-01-01

Background The detection of conserved residue clusters on a protein structure is one of the effective strategies for the prediction of functional protein regions. Various methods, such as Evolutionary Trace, have been developed based on this strategy. In such approaches, the conserved residues are identified through comparisons of homologous amino acid sequences. Therefore, the selection of homologous sequences is a critical step. It is empirically known that a certain degree of sequence divergence in the set of homologous sequences is required for the identification of conserved residues. However, the development of a method to select homologous sequences appropriate for the identification of conserved residues has not been sufficiently addressed. An objective and general method to select appropriate homologous sequences is desired for the efficient prediction of functional regions. Results We have developed a novel index to select the sequences appropriate for the identification of conserved residues, and implemented the index within our method to predict the functional regions of a protein. The implementation of the index improved the performance of the functional region prediction. The index represents the degree of conserved residue clustering on the tertiary structure of the protein. For this purpose, the structure and sequence information were integrated within the index by the application of spatial statistics. Spatial statistics is a field of statistics in which not only the attributes but also the geometrical coordinates of the data are considered simultaneously. Higher degrees of clustering generate larger index scores. We adopted the set of homologous sequences with the highest index score, under the assumption that the best prediction accuracy is obtained when the degree of clustering is the maximum. The set of sequences selected by the index led to higher functional region prediction performance than the sets of sequences selected by other sequence-based methods. Conclusions Appropriate homologous sequences are selected automatically and objectively by the index. Such sequence selection improved the performance of functional region prediction. As far as we know, this is the first approach in which spatial statistics have been applied to protein analyses. Such integration of structure and sequence information would be useful for other bioinformatics problems. PMID:22643026

Transcriptional Activation Signals Found in the Epstein-Barr Virus (EBV) Latency C Promoter Are Conserved in the Latency C Promoter Sequences from Baboon and Rhesus Monkey EBV-Like Lymphocryptoviruses (Cercopithicine Herpesviruses 12 and 15)

PubMed Central

Fuentes-Pananá, Ezequiel M.; Swaminathan, Sankar; Ling, Paul D.

1999-01-01

The Epstein-Barr virus (EBV) EBNA2 protein is a transcriptional activator that controls viral latent gene expression and is essential for EBV-driven B-cell immortalization. EBNA2 is expressed from the viral C promoter (Cp) and regulates its own expression by activating Cp through interaction with the cellular DNA binding protein CBF1. Through regulation of Cp and EBNA2 expression, EBV controls the pattern of latent protein expression and the type of latency established. To gain further insight into the important regulatory elements that modulate Cp usage, we isolated and sequenced the Cp regions corresponding to nucleotides 10251 to 11479 of the EBV genome (−1079 to +144 relative to the transcription initiation site) from the EBV-like lymphocryptoviruses found in baboons (herpesvirus papio; HVP) and Rhesus macaques (RhEBV). Sequence comparison of the approximately 1,230-bp Cp regions from these primate viruses revealed that EBV and HVP Cp sequences are 64% conserved, EBV and RhEBV Cp sequences are 66% conserved, and HVP and RhEBV Cp sequences are 65% conserved relative to each other. Approximately 50% of the residues are conserved among all three sequences, yet all three viruses have retained response elements for glucocorticoids, two positionally conserved CCAAT boxes, and positionally conserved TATA boxes. The putative EBNA2 100-bp enhancers within these promoters contain 54 conserved residues, and the binding sites for CBF1 and CBF2 are well conserved. Cp usage in the HVP- and RhEBV-transformed cell lines was detected by S1 nuclease protection analysis. Transient-transfection analysis showed that promoters of both HVP and RhEBV are responsive to EBNA2 and that they bind CBF1 and CBF2 in gel mobility shift assays. These results suggest that similar mechanisms for regulation of latent gene expression are conserved among the EBV-related lymphocryptoviruses found in nonhuman primates. PMID:9847397

Transcriptional activation signals found in the Epstein-Barr virus (EBV) latency C promoter are conserved in the latency C promoter sequences from baboon and Rhesus monkey EBV-like lymphocryptoviruses (cercopithicine herpesviruses 12 and 15).

PubMed

Fuentes-Pananá, E M; Swaminathan, S; Ling, P D

1999-01-01

The Epstein-Barr virus (EBV) EBNA2 protein is a transcriptional activator that controls viral latent gene expression and is essential for EBV-driven B-cell immortalization. EBNA2 is expressed from the viral C promoter (Cp) and regulates its own expression by activating Cp through interaction with the cellular DNA binding protein CBF1. Through regulation of Cp and EBNA2 expression, EBV controls the pattern of latent protein expression and the type of latency established. To gain further insight into the important regulatory elements that modulate Cp usage, we isolated and sequenced the Cp regions corresponding to nucleotides 10251 to 11479 of the EBV genome (-1079 to +144 relative to the transcription initiation site) from the EBV-like lymphocryptoviruses found in baboons (herpesvirus papio; HVP) and Rhesus macaques (RhEBV). Sequence comparison of the approximately 1,230-bp Cp regions from these primate viruses revealed that EBV and HVP Cp sequences are 64% conserved, EBV and RhEBV Cp sequences are 66% conserved, and HVP and RhEBV Cp sequences are 65% conserved relative to each other. Approximately 50% of the residues are conserved among all three sequences, yet all three viruses have retained response elements for glucocorticoids, two positionally conserved CCAAT boxes, and positionally conserved TATA boxes. The putative EBNA2 100-bp enhancers within these promoters contain 54 conserved residues, and the binding sites for CBF1 and CBF2 are well conserved. Cp usage in the HVP- and RhEBV-transformed cell lines was detected by S1 nuclease protection analysis. Transient-transfection analysis showed that promoters of both HVP and RhEBV are responsive to EBNA2 and that they bind CBF1 and CBF2 in gel mobility shift assays. These results suggest that similar mechanisms for regulation of latent gene expression are conserved among the EBV-related lymphocryptoviruses found in nonhuman primates.

Combining protein sequence, structure, and dynamics: A novel approach for functional evolution analysis of PAS domain superfamily.

PubMed

Dong, Zheng; Zhou, Hongyu; Tao, Peng

2018-02-01

PAS domains are widespread in archaea, bacteria, and eukaryota, and play important roles in various functions. In this study, we aim to explore functional evolutionary relationship among proteins in the PAS domain superfamily in view of the sequence-structure-dynamics-function relationship. We collected protein sequences and crystal structure data from RCSB Protein Data Bank of the PAS domain superfamily belonging to three biological functions (nucleotide binding, photoreceptor activity, and transferase activity). Protein sequences were aligned and then used to select sequence-conserved residues and build phylogenetic tree. Three-dimensional structure alignment was also applied to obtain structure-conserved residues. The protein dynamics were analyzed using elastic network model (ENM) and validated by molecular dynamics (MD) simulation. The result showed that the proteins with same function could be grouped by sequence similarity, and proteins in different functional groups displayed statistically significant difference in their vibrational patterns. Interestingly, in all three functional groups, conserved amino acid residues identified by sequence and structure conservation analysis generally have a lower fluctuation than other residues. In addition, the fluctuation of conserved residues in each biological function group was strongly correlated with the corresponding biological function. This research suggested a direct connection in which the protein sequences were related to various functions through structural dynamics. This is a new attempt to delineate functional evolution of proteins using the integrated information of sequence, structure, and dynamics. © 2017 The Protein Society.

Deciphering the adaptation strategies of Desulfovibrio piezophilus to hydrostatic pressure through metabolic and transcriptional analyses.

PubMed

Amrani, Amira; van Helden, Jacques; Bergon, Aurélie; Aouane, Aicha; Ben Hania, Wajdi; Tamburini, Christian; Loriod, Béatrice; Imbert, Jean; Ollivier, Bernard; Pradel, Nathalie; Dolla, Alain

2016-08-01

Desulfovibrio piezophilus strain C1TLV30(T) is a mesophilic piezophilic sulfate-reducer isolated from Wood Falls at 1700 m depth in the Mediterranean Sea. In this study, we analysed the effect of the hydrostatic pressure on this deep-sea living bacterium at the physiologic and transcriptomic levels. Our results showed that lactate oxidation and energy metabolism were affected by the hydrostatic pressure. Especially, acetyl-CoA oxidation pathway and energy conservation through hydrogen and formate recycling would be more important when the hydrostatic pressure is above (26 MPa) than below (0.1 MPa) the optimal one (10 MPa). This work underlines also the role of the amino acid glutamate as a piezolyte for the Desulfovibrio genus. The transcriptomic analysis revealed 146 differentially expressed genes emphasizing energy production and conversion, amino acid transport and metabolism and cell motility and signal transduction mechanisms as hydrostatic pressure responding processes. This dataset allowed us to identify a sequence motif upstream of a subset of differentially expressed genes as putative pressure-dependent regulatory element. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

Quantifying the relationship between sequence and three-dimensional structure conservation in RNA

PubMed Central

2010-01-01

Background In recent years, the number of available RNA structures has rapidly grown reflecting the increased interest on RNA biology. Similarly to the studies carried out two decades ago for proteins, which gave the fundamental grounds for developing comparative protein structure prediction methods, we are now able to quantify the relationship between sequence and structure conservation in RNA. Results Here we introduce an all-against-all sequence- and three-dimensional (3D) structure-based comparison of a representative set of RNA structures, which have allowed us to quantitatively confirm that: (i) there is a measurable relationship between sequence and structure conservation that weakens for alignments resulting in below 60% sequence identity, (ii) evolution tends to conserve more RNA structure than sequence, and (iii) there is a twilight zone for RNA homology detection. Discussion The computational analysis here presented quantitatively describes the relationship between sequence and structure for RNA molecules and defines a twilight zone region for detecting RNA homology. Our work could represent the theoretical basis and limitations for future developments in comparative RNA 3D structure prediction. PMID:20550657

Differential sequence diversity at merozoite surface protein-1 locus of Plasmodium knowlesi from humans and macaques in Thailand.

PubMed

Putaporntip, Chaturong; Thongaree, Siriporn; Jongwutiwes, Somchai

2013-08-01

To determine the genetic diversity and potential transmission routes of Plasmodium knowlesi, we analyzed the complete nucleotide sequence of the gene encoding the merozoite surface protein-1 of this simian malaria (Pkmsp-1), an asexual blood-stage vaccine candidate, from naturally infected humans and macaques in Thailand. Analysis of Pkmsp-1 sequences from humans (n=12) and monkeys (n=12) reveals five conserved and four variable domains. Most nucleotide substitutions in conserved domains were dimorphic whereas three of four variable domains contained complex repeats with extensive sequence and size variation. Besides purifying selection in conserved domains, evidence of intragenic recombination scattering across Pkmsp-1 was detected. The number of haplotypes, haplotype diversity, nucleotide diversity and recombination sites of human-derived sequences exceeded that of monkey-derived sequences. Phylogenetic networks based on concatenated conserved sequences of Pkmsp-1 displayed a character pattern that could have arisen from sampling process or the presence of two independent routes of P. knowlesi transmission, i.e. from macaques to human and from human to humans in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.

Modulation of tissue repair by regeneration enhancer elements.

PubMed

Kang, Junsu; Hu, Jianxin; Karra, Ravi; Dickson, Amy L; Tornini, Valerie A; Nachtrab, Gregory; Gemberling, Matthew; Goldman, Joseph A; Black, Brian L; Poss, Kenneth D

2016-04-14

How tissue regeneration programs are triggered by injury has received limited research attention. Here we investigate the existence of enhancer regulatory elements that are activated in regenerating tissue. Transcriptomic analyses reveal that leptin b (lepb) is highly induced in regenerating hearts and fins of zebrafish. Epigenetic profiling identified a short DNA sequence element upstream and distal to lepb that acquires open chromatin marks during regeneration and enables injury-dependent expression from minimal promoters. This element could activate expression in injured neonatal mouse tissues and was divisible into tissue-specific modules sufficient for expression in regenerating zebrafish fins or hearts. Simple enhancer-effector transgenes employing lepb-linked sequences upstream of pro- or anti-regenerative factors controlled the efficacy of regeneration in zebrafish. Our findings provide evidence for 'tissue regeneration enhancer elements' (TREEs) that trigger gene expression in injury sites and can be engineered to modulate the regenerative potential of vertebrate organs.

Translation of the mRNA of the maize transcriptional activator Opaque-2 is inhibited by upstream open reading frames present in the leader sequence.

PubMed Central

Lohmer, S; Maddaloni, M; Motto, M; Salamini, F; Thompson, R D

1993-01-01

The protein encoded by the Opaque-2 (O2) gene is a transcription factor, translated from an mRNA that possesses an unusually long 5' leader sequence containing three upstream open reading frames (uORFs). The efficiency of translation of O2 mRNA has been tested in vivo by a transient assay in which the level of activation of the b32 promoter, a natural target of O2 protein, is measured. We show that uORF-less O2 alleles possess a higher transactivation value than the wild-type allele and that the reduction in transactivation due to the uORFs is a cis-dominant effect. The data presented indicate that both uORF1 and uORF2 are involved in the reducing effect and suggest that both are likely to be translated. PMID:8439744

Human Promoters Are Intrinsically Directional

PubMed Central

Duttke, Sascha H.C.; Lacadie, Scott A.; Ibrahim, Mahmoud M.; Glass, Christopher K.; Corcoran, David L.; Benner, Christopher; Heinz, Sven; Kadonaga, James T.; Ohler, Uwe

2015-01-01

Divergent transcription, in which reverse-oriented transcripts occur upstream of eukaryotic promoters in regions devoid of annotated genes, has been suggested to be a general property of active promoters. Here we show that the human basal RNA polymerase II transcriptional machinery and core promoter are inherently unidirectional, and that reverse-oriented transcripts originate from their own cognate reverse-directed core promoters. In vitro transcription analysis and mapping of nascent transcripts in cells revealed that sequences at reverse start sites are similar to those of their forward counterparts. The use of DNase I accessibility to define proximal promoter borders revealed that up to half of promoters are unidirectional and that unidirectional promoters are depleted at their upstream edges of reverse core promoter sequences and their associated chromatin features. Divergent transcription is thus not an inherent property of the transcription process, but rather the consequence of the presence of both forward- and reverse-directed core promoters. PMID:25639469

Airway and Feeding Outcomes of Mandibular Distraction, Tongue-Lip Adhesion, and Conservative Management in Pierre Robin Sequence: A Prospective Study.

PubMed

Khansa, Ibrahim; Hall, Courtney; Madhoun, Lauren L; Splaingard, Mark; Baylis, Adriane; Kirschner, Richard E; Pearson, Gregory D

2017-04-01

Pierre Robin sequence is characterized by mandibular retrognathia and glossoptosis resulting in airway obstruction and feeding difficulties. When conservative management fails, mandibular distraction osteogenesis or tongue-lip adhesion may be required to avoid tracheostomy. The authors' goal was to prospectively evaluate the airway and feeding outcomes of their comprehensive approach to Pierre Robin sequence, which includes conservative management, mandibular distraction osteogenesis, and tongue-lip adhesion. A longitudinal study of newborns with Pierre Robin sequence treated at a pediatric academic medical center between 2010 and 2015 was performed. Baseline feeding and respiratory data were collected. Patients underwent conservative management if they demonstrated sustainable weight gain without tube feeds, and if their airway was stable with positioning alone. Patients who required surgery underwent tongue-lip adhesion or mandibular distraction osteogenesis based on family and surgeon preference. Postoperative airway and feeding data were collected. Twenty-eight patients with Pierre Robin sequence were followed prospectively. Thirty-two percent had a syndrome. Ten underwent mandibular distraction osteogenesis, eight underwent tongue-lip adhesion, and 10 were treated conservatively. There were no differences in days to extubation or discharge, change in weight percentile, requirement for gastrostomy tube, or residual obstructive sleep apnea between the three groups. No patients required tracheostomy. The greatest reduction in apnea-hypopnea index occurred with mandibular distraction osteogenesis, followed by tongue-lip adhesion and conservative management. Careful selection of which patients with Pierre Robin sequence need surgery, and of the most appropriate surgical procedure for each patient, can minimize the need for postprocedure tracheostomy. A comprehensive approach to Pierre Robin sequence that includes conservative management, mandibular distraction osteogenesis, and tongue-lip adhesion can result in excellent airway and feeding outcomes. Therapeutic, II.

Inter-individual and intragenomic variations in the ITS region of Clonorchis sinensis (Trematoda: Opisthorchiidae) from Russia and Vietnam.

PubMed

Tatonova, Yulia V; Chelomina, Galina N; Nguyen, Hung Manh

2017-11-01

Here we examined the intraspecific genetic variability of Clonorchis sinensis from Russia and Vietnam using nuclear DNA sequences (the 5.8S gene and two internal transcribed spacers of the ribosomal cluster). Despite the low level of variability in the ITS1 region, this marker has revealed some features of C. sinensis across multiple geographic regions. The genetic diversity levels for the Russian and Vietnamese populations were similar (0.1 and 0.09%, respectively) but were significantly lower than the C. sinensis from China (0.31%). About half of the sequences of the Chinese (53%) and Korean (47%) populations and about a tenth of the Vietnamese (12%) and Russian (8%) sequences included a 5bp insertion. No sequences with nucleotide substitutions both upstream and downstream of the 5bp insertion were found within the whole data set. The population of northern China had both sequence variants (with substitutions either upstream or downstream of the insertion), while only one of these variants was presented at the other localities. The Vietnamese population had a higher frequency of intragenomic polymorphism than the Russian population (69% vs. 46% and 23% vs. 3% at the 114bp and 339bp positions, respectively). These data are discussed in connection with parasite origin and adaptation, and also its invasive capacity and drug-resistance. Copyright © 2017 Elsevier B.V. All rights reserved.

Ultra-deep sequencing reveals high prevalence and broad structural diversity of hepatitis B surface antigen mutations in a global population

PubMed Central

Gencay, Mikael; Hübner, Kirsten; Gohl, Peter; Seffner, Anja; Weizenegger, Michael; Neofytos, Dionysios; Batrla, Richard; Woeste, Andreas; Kim, Hyon-suk; Westergaard, Gaston; Reinsch, Christine; Brill, Eva; Thu Thuy, Pham Thi; Hoang, Bui Huu; Sonderup, Mark; Spearman, C. Wendy; Pabinger, Stephan; Gautier, Jérémie; Brancaccio, Giuseppina; Fasano, Massimo; Santantonio, Teresa; Gaeta, Giovanni B.; Nauck, Markus; Kaminski, Wolfgang E.

2017-01-01

The diversity of the hepatitis B surface antigen (HBsAg) has a significant impact on the performance of diagnostic screening tests and the clinical outcome of hepatitis B infection. Neutralizing or diagnostic antibodies against the HBsAg are directed towards its highly conserved major hydrophilic region (MHR), in particular towards its “a” determinant subdomain. Here, we explored, on a global scale, the genetic diversity of the HBsAg MHR in a large, multi-ethnic cohort of randomly selected subjects with HBV infection from four continents. A total of 1553 HBsAg positive blood samples of subjects originating from 20 different countries across Africa, America, Asia and central Europe were characterized for amino acid variation in the MHR. Using highly sensitive ultra-deep sequencing, we found 72.8% of the successfully sequenced subjects (n = 1391) demonstrated amino acid sequence variation in the HBsAg MHR. This indicates that the global variation frequency in the HBsAg MHR is threefold higher than previously reported. The majority of the amino acid mutations were found in the HBV genotypes B (28.9%) and C (25.4%). Collectively, we identified 345 distinct amino acid mutations in the MHR. Among these, we report 62 previously unknown mutations, which extends the worldwide pool of currently known HBsAg MHR mutations by 22%. Importantly, topological analysis identified the “a” determinant upstream flanking region as the structurally most diverse subdomain of the HBsAg MHR. The highest prevalence of “a” determinant region mutations was observed in subjects from Asia, followed by the African, American and European cohorts, respectively. Finally, we found that more than half (59.3%) of all HBV subjects investigated carried multiple MHR mutations. Together, this worldwide ultra-deep sequencing based genotyping study reveals that the global prevalence and structural complexity of variation in the hepatitis B surface antigen have, to date, been significantly underappreciated. PMID:28472040

Ultra-deep sequencing reveals high prevalence and broad structural diversity of hepatitis B surface antigen mutations in a global population.

PubMed

Gencay, Mikael; Hübner, Kirsten; Gohl, Peter; Seffner, Anja; Weizenegger, Michael; Neofytos, Dionysios; Batrla, Richard; Woeste, Andreas; Kim, Hyon-Suk; Westergaard, Gaston; Reinsch, Christine; Brill, Eva; Thu Thuy, Pham Thi; Hoang, Bui Huu; Sonderup, Mark; Spearman, C Wendy; Pabinger, Stephan; Gautier, Jérémie; Brancaccio, Giuseppina; Fasano, Massimo; Santantonio, Teresa; Gaeta, Giovanni B; Nauck, Markus; Kaminski, Wolfgang E

2017-01-01

The diversity of the hepatitis B surface antigen (HBsAg) has a significant impact on the performance of diagnostic screening tests and the clinical outcome of hepatitis B infection. Neutralizing or diagnostic antibodies against the HBsAg are directed towards its highly conserved major hydrophilic region (MHR), in particular towards its "a" determinant subdomain. Here, we explored, on a global scale, the genetic diversity of the HBsAg MHR in a large, multi-ethnic cohort of randomly selected subjects with HBV infection from four continents. A total of 1553 HBsAg positive blood samples of subjects originating from 20 different countries across Africa, America, Asia and central Europe were characterized for amino acid variation in the MHR. Using highly sensitive ultra-deep sequencing, we found 72.8% of the successfully sequenced subjects (n = 1391) demonstrated amino acid sequence variation in the HBsAg MHR. This indicates that the global variation frequency in the HBsAg MHR is threefold higher than previously reported. The majority of the amino acid mutations were found in the HBV genotypes B (28.9%) and C (25.4%). Collectively, we identified 345 distinct amino acid mutations in the MHR. Among these, we report 62 previously unknown mutations, which extends the worldwide pool of currently known HBsAg MHR mutations by 22%. Importantly, topological analysis identified the "a" determinant upstream flanking region as the structurally most diverse subdomain of the HBsAg MHR. The highest prevalence of "a" determinant region mutations was observed in subjects from Asia, followed by the African, American and European cohorts, respectively. Finally, we found that more than half (59.3%) of all HBV subjects investigated carried multiple MHR mutations. Together, this worldwide ultra-deep sequencing based genotyping study reveals that the global prevalence and structural complexity of variation in the hepatitis B surface antigen have, to date, been significantly underappreciated.

Comparative genomic analysis reveals a novel mitochondrial isoform of human rTS protein and unusual phylogenetic distribution of the rTS gene

PubMed Central

Liang, Ping; Nair, Jayakumar R; Song, Lei; McGuire, John J; Dolnick, Bruce J

2005-01-01

Background The rTS gene (ENOSF1), first identified in Homo sapiens as a gene complementary to the thymidylate synthase (TYMS) mRNA, is known to encode two protein isoforms, rTSα and rTSβ. The rTSβ isoform appears to be an enzyme responsible for the synthesis of signaling molecules involved in the down-regulation of thymidylate synthase, but the exact cellular functions of rTS genes are largely unknown. Results Through comparative genomic sequence analysis, we predicted the existence of a novel protein isoform, rTS, which has a 27 residue longer N-terminus by virtue of utilizing an alternative start codon located upstream of the start codon in rTSβ. We observed that a similar extended N-terminus could be predicted in all rTS genes for which genomic sequences are available and the extended regions are conserved from bacteria to human. Therefore, we reasoned that the protein with the extended N-terminus might represent an ancestral form of the rTS protein. Sequence analysis strongly predicts a mitochondrial signal sequence in the extended N-terminal of human rTSγ, which is absent in rTSβ. We confirmed the existence of rTS in human mitochondria experimentally by demonstrating the presence of both rTSγ and rTSβ proteins in mitochondria isolated by subcellular fractionation. In addition, our comprehensive analysis of rTS orthologous sequences reveals an unusual phylogenetic distribution of this gene, which suggests the occurrence of one or more horizontal gene transfer events. Conclusion The presence of two rTS isoforms in mitochondria suggests that the rTS signaling pathway may be active within mitochondria. Our report also presents an example of identifying novel protein isoforms and for improving gene annotation through comparative genomic analysis. PMID:16162288

Bioinformatic analysis suggests that the Orbivirus VP6 cistron encodes an overlapping gene

PubMed Central

Firth, Andrew E

2008-01-01

Background The genus Orbivirus includes several species that infect livestock – including Bluetongue virus (BTV) and African horse sickness virus (AHSV). These viruses have linear dsRNA genomes divided into ten segments, all of which have previously been assumed to be monocistronic. Results Bioinformatic evidence is presented for a short overlapping coding sequence (CDS) in the Orbivirus genome segment 9, overlapping the VP6 cistron in the +1 reading frame. In BTV, a 77–79 codon AUG-initiated open reading frame (hereafter ORFX) is present in all 48 segment 9 sequences analysed. The pattern of base variations across the 48-sequence alignment indicates that ORFX is subject to functional constraints at the amino acid level (even when the constraints due to coding in the overlapping VP6 reading frame are taken into account; MLOGD software). In fact the translated ORFX shows greater amino acid conservation than the overlapping region of VP6. The ORFX AUG codon has a strong Kozak context in all 48 sequences. Each has only one or two upstream AUG codons, always in the VP6 reading frame, and (with a single exception) always with weak or medium Kozak context. Thus, in BTV, ORFX may be translated via leaky scanning. A long (83–169 codon) ORF is present in a corresponding location and reading frame in all other Orbivirus species analysed except Saint Croix River virus (SCRV; the most divergent). Again, the pattern of base variations across sequence alignments indicates multiple coding in the VP6 and ORFX reading frames. Conclusion At ~9.5 kDa, the putative ORFX product in BTV is too small to appear on most published protein gels. Nonetheless, a review of past literature reveals a number of possible detections. We hope that presentation of this bioinformatic analysis will stimulate an attempt to experimentally verify the expression and functional role of ORFX, and hence lead to a greater understanding of the molecular biology of these important pathogens. PMID:18489030

The Number, Organization, and Size of Polymorphic Membrane Protein Coding Sequences as well as the Most Conserved Pmp Protein Differ within and across Chlamydia Species.

PubMed

Van Lent, Sarah; Creasy, Heather Huot; Myers, Garry S A; Vanrompay, Daisy

2016-01-01

Variation is a central trait of the polymorphic membrane protein (Pmp) family. The number of pmp coding sequences differs between Chlamydia species, but it is unknown whether the number of pmp coding sequences is constant within a Chlamydia species. The level of conservation of the Pmp proteins has previously only been determined for Chlamydia trachomatis. As different Pmp proteins might be indispensible for the pathogenesis of different Chlamydia species, this study investigated the conservation of Pmp proteins both within and across C. trachomatis,C. pneumoniae,C. abortus, and C. psittaci. The pmp coding sequences were annotated in 16 C. trachomatis, 6 C. pneumoniae, 2 C. abortus, and 16 C. psittaci genomes. The number and organization of polymorphic membrane coding sequences differed within and across the analyzed Chlamydia species. The length of coding sequences of pmpA,pmpB, and pmpH was conserved among all analyzed genomes, while the length of pmpE/F and pmpG, and remarkably also of the subtype pmpD, differed among the analyzed genomes. PmpD, PmpA, PmpH, and PmpA were the most conserved Pmp in C. trachomatis,C. pneumoniae,C. abortus, and C. psittaci, respectively. PmpB was the most conserved Pmp across the 4 analyzed Chlamydia species. © 2016 S. Karger AG, Basel.

Rearrangement of Upstream Sequences of the hTERT Gene During Cellular Immortalization

PubMed Central

Zhao, Yuanjun; Wang, Shuwen; Popova, Evgenya Y.; Grigoryev, Sergei A.; Zhu, Jiyue

2010-01-01

Telomerase expression, resulting from transcriptional activation of the hTERT gene, allows cells to acquire indefinite proliferative potential during cellular immortalization and tumorigenesis. However, mechanisms of hTERT gene activation in many immortal cell lines and cancer cells are poorly understood. Here, we report our studies on hTERT activation using genetically related pairs of telomerase-negative (Tel−) and -positive (Tel+) fibroblast lines. First, whereas transiently transfected plasmid reporters did not recapitulate the endogenous hTERT promoter, the promoter in chromosomally integrated bacterial artificial chromosome (BAC) reporters was activated in a subset of Tel+ cells, indicating that activation of the hTERT promoter required native chromatin context and/or distal regulatory elements. Second, the hTERT gene, located near the telomere of chromosome 5p, was translocated in all three Tel+ cell lines but not in their parental pre-crisis cells and Tel− immortal siblings. The breakage points were mapped to regions upstream of the hTERT promoter, indicating that the hTERT gene was the target of these chromosomal rearrangements. In two Tel+ cell lines, translocation of the endogenous hTERT gene appeared to be the major mechanism of its activation as the activity of hTERT promoter in many chromosomally integrated BAC reporters, with intact upstream and downstream neighboring loci, remained relatively low. Therefore, our results suggest that rearrangement of upstream sequences is an important new mechanism of hTERT promoter activation during cellular immortalization. The chromosomal rearrangements likely occurred during cellular crisis and facilitated by telomere dysfunction. Such translocations allowed the hTERT promoter to escape from the native condensed chromatin environment. PMID:19672873

Conservation of proteo-lipid nuclear membrane fusion machinery during early embryogenesis.

PubMed

Byrne, Richard D; Veeriah, Selvaraju; Applebee, Christopher J; Larijani, Banafshé

2014-01-01

The fusogenic lipid diacylglycerol is essential for remodeling gamete and zygote nuclear envelopes (NE) during early embryogenesis. It is unclear whether upstream signaling molecules are likewise conserved. Here we demonstrate PLCγ and its activator SFK1, which co-operate during male pronuclear envelope formation, also promote the subsequent male and female pronuclear fusion. PLCγ and SFK1 interact directly at the fusion site leading to PLCγ activation. This is accompanied by a spatially restricted reduction of PtdIns(4,5)P2. Consequently, pronuclear fusion is blocked by PLCγ or SFK1 inhibition. These findings identify new regulators of events in the early embryo and suggest a conserved "toolkit" of fusion machinery drives successive NE fusion events during embryogenesis.

Small gene family encoding an eggshell (chorion) protein of the human parasite Schistosoma mansoni

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bobek, L.A.; Rekosh, D.M.; Lo Verde, P.T.

1988-08-01

The authors isolated six independent genomic clones encoding schistosome chorion or eggshell proteins from a Schistosoma mansoni genomic library. A linkage map of five of the clones spanning 35 kilobase pairs (kbp) of the S. mansoni genome was constructed. The region contained two eggshell protein genes closely linked, separated by 7.5 kbp of intergenic DNA. The two genes of the cluster were arranged in the same orientation, that is, they were transcribed from the same strand. The sixth clone probably represents a third copy of the eggshell gene that is not contained within the 35-kbp region. The 5- end ofmore » the mRNA transcribed from these genes was defined by primer extension directly off the RNA. The ATCAT cap site sequence was homologous to a silkmoth chorion PuTCATT cap site sequence, where Pu indicates any purine. DNA sequence analysis showed that there were no introns in these genes. The DNA sequences of the three genes were very homologous to each other and to a cDNA clone, pSMf61-46, differing only in three or four nucleotices. A multiple TATA box was located at positions -23 to -31, and a CAAAT sequence was located at -52 upstream of the eggshell transcription unit. Comparison of sequences in regions further upstream with silkmoth and Drosophila sequences revealed very short elements that were shared. One such element, TCACGT, recently shown to be an essential cis-regulatory element for silkmoth chorion gene promoter function, was found at a similar position in all three organisms.« less

Both positive and negative regulatory elements mediate expression of a photoregulated CAB gene from Nicotiana plumbaginifolia.

PubMed Central

Castresana, C; Garcia-Luque, I; Alonso, E; Malik, V S; Cashmore, A R

1988-01-01

We have analyzed promoter regulatory elements from a photoregulated CAB gene (Cab-E) isolated from Nicotiana plumbaginifolia. These studies have been performed by introducing chimeric gene constructs into tobacco cells via Agrobacterium tumefaciens-mediated transformation. Expression studies on the regenerated transgenic plants have allowed us to characterize three positive and one negative cis-acting elements that influence photoregulated expression of the Cab-E gene. Within the upstream sequences we have identified two positive regulatory elements (PRE1 and PRE2) which confer maximum levels of photoregulated expression. These sequences contain multiple repeated elements related to the sequence-ACCGGCCCACTT-. We have also identified within the upstream region a negative regulatory element (NRE) extremely rich in AT sequences, which reduces the level of gene expression in the light. We have defined a light regulatory element (LRE) within the promoter region extending from -396 to -186 bp which confers photoregulated expression when fused to a constitutive nopaline synthase ('nos') promoter. Within this region there is a 132-bp element, extending from -368 to -234 bp, which on deletion from the Cab-E promoter reduces gene expression from high levels to undetectable levels. Finally, we have demonstrated for a full length Cab-E promoter conferring high levels of photoregulated expression, that sequences proximal to the Cab-E TATA box are not replaceable by corresponding sequences from a 'nos' promoter. This contrasts with the apparent equivalence of these Cab-E and 'nos' TATA box-proximal sequences in truncated promoters conferring low levels of photoregulated expression. Images PMID:2901343

Evolutionarily conserved regions and hydrophobic contacts at the superfamily level: The case of the fold-type I, pyridoxal-5′-phosphate-dependent enzymes

PubMed Central

Paiardini, Alessandro; Bossa, Francesco; Pascarella, Stefano

2004-01-01

The wealth of biological information provided by structural and genomic projects opens new prospects of understanding life and evolution at the molecular level. In this work, it is shown how computational approaches can be exploited to pinpoint protein structural features that remain invariant upon long evolutionary periods in the fold-type I, PLP-dependent enzymes. A nonredundant set of 23 superposed crystallographic structures belonging to this superfamily was built. Members of this family typically display high-structural conservation despite low-sequence identity. For each structure, a multiple-sequence alignment of orthologous sequences was obtained, and the 23 alignments were merged using the structural information to obtain a comprehensive multiple alignment of 921 sequences of fold-type I enzymes. The structurally conserved regions (SCRs), the evolutionarily conserved residues, and the conserved hydrophobic contacts (CHCs) were extracted from this data set, using both sequence and structural information. The results of this study identified a structural pattern of hydrophobic contacts shared by all of the superfamily members of fold-type I enzymes and involved in native interactions. This profile highlights the presence of a nucleus for this fold, in which residues participating in the most conserved native interactions exhibit preferential evolutionary conservation, that correlates significantly (r = 0.70) with the extent of mean hydrophobic contact value of their apolar fraction. PMID:15498941

Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

USDA-ARS?s Scientific Manuscript database

Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

Invasion versus isolation: Trade-offs in managing native salmonids with barriers to upstream movement

Treesearch

Kurt D. Fausch; Bruce E. Rieman; Jason B. Dunham; Michael K. Young; Douglas P. Peterson

2009-01-01

Conservation biologists often face the trade-off that increasing connectivity in fragmented landscapes to reduce extinction risk of native species can foster invasion by non-native species that enter via the corridors created, which can then increase extinction risk. This dilemma is acute for stream fishes, especially native salmonids, because their populations are...

Mycobacterium avium subsp. paratuberculosis PPE Protein MAP1152 and Conserved Protein MAP1156 are Antigenic in Experimentally and Naturally Infected Cattle

USDA-ARS?s Scientific Manuscript database

Mycobacterium avium subsp. paratuberculosis (MAP) causes Johne’s Disease (JD) in ruminants resulting in significant production losses. An insertion mutation upstream from the MAP1152-MAP1156 region causes a change in colony morphotype and results in an attenuated phenotype in bovine monocyte derive...

Bmal1 is a direct transcriptional target of the orphan nuclear receptor, NR2F1

USDA-ARS?s Scientific Manuscript database

Orphan nuclear receptor NR2F1 (also known as COUP-TFI, Chicken Ovalbumin Upstream Promoter Transcription Factor I) is a highly conserved member of the nuclear receptor superfamily. NR2F1 plays a critical role during embryonic development, particularly in the central and peripheral nervous systems a...

Water quality of the lower Columbia River basin; analysis of current and historical water-quality data through 1994

USGS Publications Warehouse

Fuhrer, Gregory J.; Tanner, Dwight Q.; Morace, Jennifer L.; McKenzie, Stuart W.; Skach, Kenneth A.

1996-01-01

Trend tests showed significant (r < 0.05) downward trends from 1973 to 1994 for three constituents at the Columbia River at Warrendale: phosphorus in unfiltered water, total dissolved solids, and specific conductance. These trends may be a consequence of more conservative agricultural practices in the area upstream from Warrendale.

Defective distal regulatory element at the 5' upstream of rat prolactin gene of steroid-nonresponsive GH-subclone.

PubMed

Kumar, V; Wong, D T; Pasion, S G; Biswas, D K

1987-12-08

The prolactin-nonproducing (PRL-) GH cell strains (rat pituitary tumor cells in culture). GH12C1 and F1BGH12C1, do not respond to steroid hormones estradiol or hydrocortisone (HC). However, the stimulatory effect of estradiol and the inhibitory effect of hydrocortisone on prolactin synthesis can be demonstrated in the prolactin-producing GH cell strain, GH4C1. In this investigation we have examined the 5' end flanking region of rat prolactin (rat PRL) gene of steroid-responsive, GH4C1 cells to identify the positive and negative regulatory elements and to verify the status of these elements in steroid-nonresponsive F1BGH12C1 cells. Results presented in this report demonstrate that the basel level expression of the co-transferred Neo gene (neomycin phosphoribosyl transferase) is modulated by the distal upstream regulatory elements of rat PRL gene in response to steroid hormones. The expression of adjacent Neo gene is inhibited by dexamethasone and is stimulated by estradiol in transfectants carrying distal regulatory elements (SRE) of steroid-responsive cells. These responses are not observed in transfectants with the rat PRL upstream sequences derived from steroid-nonresponsive cells. The basal level expression of the host cell alpha-2 tubulin gene is not affected by dexamethasone. We report here the identification of the distal steroid regulatory element (SRE) located between 3.8 and 7.8 kb upstream of the transcription initiation site of rat PRL gene. Both the positive and the negative effects of steroid hormones can be identified within this upstream sequence. This distal SRE appears to be nonfunctional in steroid-nonresponsive cells. Though the proximal SRE is functional, the defect in the distal SRE makes the GH substrain nonresponsive to steroid hormones. These results suggest that both the proximal and the distal SREs are essential for the mediation of action of steroid hormones in GH cells.

Labile trace metal contribution of the runoff collector to a semi-urban river.

PubMed

Villanueva, J D; Granger, D; Binet, G; Litrico, X; Huneau, F; Peyraube, N; Le Coustumer, P

2016-06-01

In this study, the distribution of labile trace metals (LTMs; Cd, Co, Cr, Cu, Ni, Pb, and Zn) in a semi-urban runoff collector was examined to assess its influence to a natural aqueous system (Jalle River, Bordeaux, France). This river is of high importance as it is part of a natural reserve dedicated to conserving aquatic flora and fauna. Two sampling campaigns with a differing precipitation condition (period 1, spring season; and period 2, summer season associated with storms) were considered. Precipitation and water flow were monitored. The collector is active as it is receptive to precipitation changes. It influences the river through discharging water, contributing LTMs, and channeling the mass fluxes. During period 2 where precipitation rate is higher, 25 % of the total water volume of the river was supplied by the collector. LTMs were detected at the collector. Measurements were done by using diffusive gradient in thin films (DGT) probes deployed during 1, 7, and 14 days in each period. The results showed that in an instantaneous period (day 1 or D1), most of these trace metals are above the environmental quality standards (Cd, Co, Cr, and Zn). The coefficient of determination (r (2) > 0.50) employed confirmed that the LTM concentrations in the downstream can be explained by the collector. While Co and Cr are from the upstream and the collector, Cd, Cu, and Zn are mostly provided by the collector. Ni, however, is mostly delivered by the upstream. Using the concentrations observed, the river can be affected by the collector in varying ways: (1) adding effect, resulting from the mix of the upstream and the collector (if upstream ˂ downstream); (2) diluted (if upstream ˃ downstream); and (3) conservative or unaffected (upstream ~ downstream). The range of LTM mass fluxes that the collector holds are as follows: (1) limited range or ˂10 g/day, Cd (0.04-1.75 g/day), Co (0.08-05.42 g/day), Ni (0.06-1.45 g/day), and Pb (0.08-9.89 g/day); (2) moderate range or 11-50 g/day, Cr (0.23-33.26 g/day) and Cu (0.77-37.88 g/day); and (3) wide range or ˃50 g/day, Zn (26.33-676.61 g/day). Hence, the collector is a major source of concern in terms of contamination. This is as the water with considerable LTMs is channeled openly to the river without any treatment.

RNA expression in a cartilaginous fish cell line reveals ancient 3′ noncoding regions highly conserved in vertebrates

PubMed Central

Forest, David; Nishikawa, Ryuhei; Kobayashi, Hiroshi; Parton, Angela; Bayne, Christopher J.; Barnes, David W.

2007-01-01

We have established a cartilaginous fish cell line [Squalus acanthias embryo cell line (SAE)], a mesenchymal stem cell line derived from the embryo of an elasmobranch, the spiny dogfish shark S. acanthias. Elasmobranchs (sharks and rays) first appeared >400 million years ago, and existing species provide useful models for comparative vertebrate cell biology, physiology, and genomics. Comparative vertebrate genomics among evolutionarily distant organisms can provide sequence conservation information that facilitates identification of critical coding and noncoding regions. Although these genomic analyses are informative, experimental verification of functions of genomic sequences depends heavily on cell culture approaches. Using ESTs defining mRNAs derived from the SAE cell line, we identified lengthy and highly conserved gene-specific nucleotide sequences in the noncoding 3′ UTRs of eight genes involved in the regulation of cell growth and proliferation. Conserved noncoding 3′ mRNA regions detected by using the shark nucleotide sequences as a starting point were found in a range of other vertebrate orders, including bony fish, birds, amphibians, and mammals. Nucleotide identity of shark and human in these regions was remarkably well conserved. Our results indicate that highly conserved gene sequences dating from the appearance of jawed vertebrates and representing potential cis-regulatory elements can be identified through the use of cartilaginous fish as a baseline. Because the expression of genes in the SAE cell line was prerequisite for their identification, this cartilaginous fish culture system also provides a physiologically valid tool to test functional hypotheses on the role of these ancient conserved sequences in comparative cell biology. PMID:17227856

Sequence conservation on the Y chromosome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gibson, L.H.; Yang-Feng, L.; Lau, C.

The Y chromosome is present in all mammals and is considered to be essential to sex determination. Despite intense genomic research, only a few genes have been identified and mapped to this chromosome in humans. Several of them, such as SRY and ZFY, have been demonstrated to be conserved and Y-located in other mammals. In order to address the issue of sequence conservation on the Y chromosome, we performed fluorescence in situ hybridization (FISH) with DNA from a human Y cosmid library as a probe to study the Y chromosomes from other mammalian species. Total DNA from 3,000-4,500 cosmid poolsmore » were labeled with biotinylated-dUTP and hybridized to metaphase chromosomes. For human and primate preparations, human cot1 DNA was included in the hybridization mixture to suppress the hybridization from repeat sequences. FISH signals were detected on the Y chromosomes of human, gorilla, orangutan and baboon (Old World monkey) and were absent on those of squirrel monkey (New World monkey), Indian munjac, wood lemming, Chinese hamster, rat and mouse. Since sequence analysis suggested that specific genes, e.g. SRY and ZFY, are conserved between these two groups, the lack of detectable hybridization in the latter group implies either that conservation of the human Y sequences is limited to the Y chromosomes of the great apes and Old World monkeys, or that the size of the syntenic segment is too small to be detected under the resolution of FISH, or that homologeous sequences have undergone considerable divergence. Further studies with reduced hybridization stringency are currently being conducted. Our results provide some clues as to Y-sequence conservation across species and demonstrate the limitations of FISH across species with total DNA sequences from a particular chromosome.« less

Evolutionary and biophysical relationships among the papillomavirus E2 proteins.

PubMed

Blakaj, Dukagjin M; Fernandez-Fuentes, Narcis; Chen, Zigui; Hegde, Rashmi; Fiser, Andras; Burk, Robert D; Brenowitz, Michael

2009-01-01

Infection by human papillomavirus (HPV) may result in clinical conditions ranging from benign warts to invasive cancer. The HPV E2 protein represses oncoprotein transcription and is required for viral replication. HPV E2 binds to palindromic DNA sequences of highly conserved four base pair sequences flanking an identical length variable 'spacer'. E2 proteins directly contact the conserved but not the spacer DNA. Variation in naturally occurring spacer sequences results in differential protein affinity that is dependent on their sensitivity to the spacer DNA's unique conformational and/or dynamic properties. This article explores the biophysical character of this core viral protein with the goal of identifying characteristics that associated with risk of virally caused malignancy. The amino acid sequence, 3d structure and electrostatic features of the E2 protein DNA binding domain are highly conserved; specific interactions with DNA binding sites have also been conserved. In contrast, the E2 protein's transactivation domain does not have extensive surfaces of highly conserved residues. Rather, regions of high conservation are localized to small surface patches. Implications to cancer biology are discussed.

HMMerThread: detecting remote, functional conserved domains in entire genomes by combining relaxed sequence-database searches with fold recognition.

PubMed

Bradshaw, Charles Richard; Surendranath, Vineeth; Henschel, Robert; Mueller, Matthias Stefan; Habermann, Bianca Hermine

2011-03-10

Conserved domains in proteins are one of the major sources of functional information for experimental design and genome-level annotation. Though search tools for conserved domain databases such as Hidden Markov Models (HMMs) are sensitive in detecting conserved domains in proteins when they share sufficient sequence similarity, they tend to miss more divergent family members, as they lack a reliable statistical framework for the detection of low sequence similarity. We have developed a greatly improved HMMerThread algorithm that can detect remotely conserved domains in highly divergent sequences. HMMerThread combines relaxed conserved domain searches with fold recognition to eliminate false positive, sequence-based identifications. With an accuracy of 90%, our software is able to automatically predict highly divergent members of conserved domain families with an associated 3-dimensional structure. We give additional confidence to our predictions by validation across species. We have run HMMerThread searches on eight proteomes including human and present a rich resource of remotely conserved domains, which adds significantly to the functional annotation of entire proteomes. We find ∼4500 cross-species validated, remotely conserved domain predictions in the human proteome alone. As an example, we find a DNA-binding domain in the C-terminal part of the A-kinase anchor protein 10 (AKAP10), a PKA adaptor that has been implicated in cardiac arrhythmias and premature cardiac death, which upon stress likely translocates from mitochondria to the nucleus/nucleolus. Based on our prediction, we propose that with this HLH-domain, AKAP10 is involved in the transcriptional control of stress response. Further remotely conserved domains we discuss are examples from areas such as sporulation, chromosome segregation and signalling during immune response. The HMMerThread algorithm is able to automatically detect the presence of remotely conserved domains in proteins based on weak sequence similarity. Our predictions open up new avenues for biological and medical studies. Genome-wide HMMerThread domains are available at http://vm1-hmmerthread.age.mpg.de.

HMMerThread: Detecting Remote, Functional Conserved Domains in Entire Genomes by Combining Relaxed Sequence-Database Searches with Fold Recognition

PubMed Central

Bradshaw, Charles Richard; Surendranath, Vineeth; Henschel, Robert; Mueller, Matthias Stefan; Habermann, Bianca Hermine

2011-01-01

Conserved domains in proteins are one of the major sources of functional information for experimental design and genome-level annotation. Though search tools for conserved domain databases such as Hidden Markov Models (HMMs) are sensitive in detecting conserved domains in proteins when they share sufficient sequence similarity, they tend to miss more divergent family members, as they lack a reliable statistical framework for the detection of low sequence similarity. We have developed a greatly improved HMMerThread algorithm that can detect remotely conserved domains in highly divergent sequences. HMMerThread combines relaxed conserved domain searches with fold recognition to eliminate false positive, sequence-based identifications. With an accuracy of 90%, our software is able to automatically predict highly divergent members of conserved domain families with an associated 3-dimensional structure. We give additional confidence to our predictions by validation across species. We have run HMMerThread searches on eight proteomes including human and present a rich resource of remotely conserved domains, which adds significantly to the functional annotation of entire proteomes. We find ∼4500 cross-species validated, remotely conserved domain predictions in the human proteome alone. As an example, we find a DNA-binding domain in the C-terminal part of the A-kinase anchor protein 10 (AKAP10), a PKA adaptor that has been implicated in cardiac arrhythmias and premature cardiac death, which upon stress likely translocates from mitochondria to the nucleus/nucleolus. Based on our prediction, we propose that with this HLH-domain, AKAP10 is involved in the transcriptional control of stress response. Further remotely conserved domains we discuss are examples from areas such as sporulation, chromosome segregation and signalling during immune response. The HMMerThread algorithm is able to automatically detect the presence of remotely conserved domains in proteins based on weak sequence similarity. Our predictions open up new avenues for biological and medical studies. Genome-wide HMMerThread domains are available at http://vm1-hmmerthread.age.mpg.de. PMID:21423752

Multiple splicing defects in an intronic false exon.

PubMed

Sun, H; Chasin, L A

2000-09-01

Splice site consensus sequences alone are insufficient to dictate the recognition of real constitutive splice sites within the typically large transcripts of higher eukaryotes, and large numbers of pseudoexons flanked by pseudosplice sites with good matches to the consensus sequences can be easily designated. In an attempt to identify elements that prevent pseudoexon splicing, we have systematically altered known splicing signals, as well as immediately adjacent flanking sequences, of an arbitrarily chosen pseudoexon from intron 1 of the human hprt gene. The substitution of a 5' splice site that perfectly matches the 5' consensus combined with mutation to match the CAG/G sequence of the 3' consensus failed to get this model pseudoexon included as the central exon in a dhfr minigene context. Provision of a real 3' splice site and a consensus 5' splice site and removal of an upstream inhibitory sequence were necessary and sufficient to confer splicing on the pseudoexon. This activated context also supported the splicing of a second pseudoexon sequence containing no apparent enhancer. Thus, both the 5' splice site sequence and the polypyrimidine tract of the pseudoexon are defective despite their good agreement with the consensus. On the other hand, the pseudoexon body did not exert a negative influence on splicing. The introduction into the pseudoexon of a sequence selected for binding to ASF/SF2 or its replacement with beta-globin exon 2 only partially reversed the effect of the upstream negative element and the defective polypyrimidine tract. These results support the idea that exon-bridging enhancers are not a prerequisite for constitutive exon definition and suggest that intrinsically defective splice sites and negative elements play important roles in distinguishing the real splicing signal from the vast number of false splicing signals.

A comparative genomics strategy for targeted discovery of single-nucleotide polymorphisms and conserved-noncoding sequences in orphan crops.

PubMed

Feltus, F A; Singh, H P; Lohithaswa, H C; Schulze, S R; Silva, T D; Paterson, A H

2006-04-01

Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species.

A Comparative Genomics Strategy for Targeted Discovery of Single-Nucleotide Polymorphisms and Conserved-Noncoding Sequences in Orphan Crops1[W

PubMed Central

Feltus, F.A.; Singh, H.P.; Lohithaswa, H.C.; Schulze, S.R.; Silva, T.D.; Paterson, A.H.

2006-01-01

Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species. PMID:16607031

Conservation of coevolving protein interfaces bridges prokaryote–eukaryote homologies in the twilight zone

PubMed Central

Rodriguez-Rivas, Juan; Marsili, Simone; Juan, David; Valencia, Alfonso

2016-01-01

Protein–protein interactions are fundamental for the proper functioning of the cell. As a result, protein interaction surfaces are subject to strong evolutionary constraints. Recent developments have shown that residue coevolution provides accurate predictions of heterodimeric protein interfaces from sequence information. So far these approaches have been limited to the analysis of families of prokaryotic complexes for which large multiple sequence alignments of homologous sequences can be compiled. We explore the hypothesis that coevolution points to structurally conserved contacts at protein–protein interfaces, which can be reliably projected to homologous complexes with distantly related sequences. We introduce a domain-centered protocol to study the interplay between residue coevolution and structural conservation of protein–protein interfaces. We show that sequence-based coevolutionary analysis systematically identifies residue contacts at prokaryotic interfaces that are structurally conserved at the interface of their eukaryotic counterparts. In turn, this allows the prediction of conserved contacts at eukaryotic protein–protein interfaces with high confidence using solely mutational patterns extracted from prokaryotic genomes. Even in the context of high divergence in sequence (the twilight zone), where standard homology modeling of protein complexes is unreliable, our approach provides sequence-based accurate information about specific details of protein interactions at the residue level. Selected examples of the application of prokaryotic coevolutionary analysis to the prediction of eukaryotic interfaces further illustrate the potential of this approach. PMID:27965389

Conservation of coevolving protein interfaces bridges prokaryote-eukaryote homologies in the twilight zone.

PubMed

Rodriguez-Rivas, Juan; Marsili, Simone; Juan, David; Valencia, Alfonso

2016-12-27

Protein-protein interactions are fundamental for the proper functioning of the cell. As a result, protein interaction surfaces are subject to strong evolutionary constraints. Recent developments have shown that residue coevolution provides accurate predictions of heterodimeric protein interfaces from sequence information. So far these approaches have been limited to the analysis of families of prokaryotic complexes for which large multiple sequence alignments of homologous sequences can be compiled. We explore the hypothesis that coevolution points to structurally conserved contacts at protein-protein interfaces, which can be reliably projected to homologous complexes with distantly related sequences. We introduce a domain-centered protocol to study the interplay between residue coevolution and structural conservation of protein-protein interfaces. We show that sequence-based coevolutionary analysis systematically identifies residue contacts at prokaryotic interfaces that are structurally conserved at the interface of their eukaryotic counterparts. In turn, this allows the prediction of conserved contacts at eukaryotic protein-protein interfaces with high confidence using solely mutational patterns extracted from prokaryotic genomes. Even in the context of high divergence in sequence (the twilight zone), where standard homology modeling of protein complexes is unreliable, our approach provides sequence-based accurate information about specific details of protein interactions at the residue level. Selected examples of the application of prokaryotic coevolutionary analysis to the prediction of eukaryotic interfaces further illustrate the potential of this approach.

Targeting Conserved Genes in Penicillium Species.

PubMed

Peterson, Stephen W

2017-01-01

Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of dideoxynucleotide-labeled fragments or NGS. The sequences are compared to a database of validated isolates. Identification of species indicates the potential of the fungus to make particular mycotoxins.

Nucleotide sequence of the ribosomal RNA gene of Physarum polycephalum: intron 2 and its flanking regions of the 26S rRNA gene.

PubMed Central

Nomiyama, H; Kuhara, S; Kukita, T; Otsuka, T; Sakaki, Y

1981-01-01

The 26S ribosomal RNA gene of Physarum polycephalum is interrupted by two introns, and we have previously determined the sequence of one of them (intron 1) (Nomiyama et al. Proc.Natl.Acad.Sci.USA 78, 1376-1380, 1981). In this study we sequenced the second intron (intron 2) of about 0.5 kb length and its flanking regions, and found that one nucleotide at each junction is identical in intron 1 and intron 2, though the junction regions share no other sequence homology. Comparison of the flanking exon sequences to E. coli 23S rRNA sequences shows that conserved sequences are interspersed with tracts having little homology. In particular, the region encompassing the intron 2 interruption site is highly conserved. The E. coli ribosomal protein L1 binding region is also conserved. Images PMID:6171776

Nucleotide sequence determination of guinea-pig casein B mRNA reveals homology with bovine and rat alpha s1 caseins and conservation of the non-coding regions of the mRNA.

PubMed Central

Hall, L; Laird, J E; Craig, R K

1984-01-01

Nucleotide sequence analysis of cloned guinea-pig casein B cDNA sequences has identified two casein B variants related to the bovine and rat alpha s1 caseins. Amino acid homology was largely confined to the known bovine or predicted rat phosphorylation sites and within the 'signal' precursor sequence. Comparison of the deduced nucleotide sequence of the guinea-pig and rat alpha s1 casein mRNA species showed greater sequence conservation in the non-coding than in the coding regions, suggesting a functional and possibly regulatory role for the non-coding regions of casein mRNA. The results provide insight into the evolution of the casein genes, and raise questions as to the role of conserved nucleotide sequences within the non-coding regions of mRNA species. Images Fig. 1. PMID:6548375

A short region of the promoter of the breast cancer associated PLU-1 gene can regulate transcription in vitro and in vivo.

PubMed

Catteau, Aurélie; Rosewell, Ian; Solomon, Ellen; Taylor-Papadimitriou, Joyce

2004-07-01

The recently cloned gene PLU-1 shows restricted expression in adult tissues, with high expression being found in testis, and transiently in the pregnant mammary gland. However, both the gene and the protein product are specifically up-regulated in breast cancer. To investigate the control of expression of the PLU-1 gene, we have cloned and functionally characterised the 5' flanking region of the gene, which was found to contain another putative gene. Two transcription start sites of the PLU-1 gene were mapped by 5' RACE. A short proximal 249 bp region was defined using reporter gene assays, which encompasses the major transcription start site and exhibits a strong constitutive promoter activity in all cell lines tested. However, regions upstream of this sequence repress transcription more effectively in a non-malignant breast cell line as compared to breast cancer cell lines. The 249 bp region is GC-rich and includes consensus Sp1 sites, GC boxes, cAMP-responsive element (CRE) and other putative cis-elements. Mutational analysis showed that two intact conserved Sp1 binding sites (shown here to bind Sp1 and/or Sp3) are critical for constitutive promoter activity, while a negative role for a neighbouring GC box is indicated. The sequence of the core promoter is highly conserved in the mouse and Plu-1 expression in the mouse embryo has been documented. Using transgenesis, we therefore examined the ability of the 249 bp fragment to control expression of a reporter gene during embryogenesis. We found that not only is the core promoter sufficient to activate transcription in vivo, but that the expression of the reporter gene coincides both temporally and spatially with regions where endogenous Plu-1 is highly expressed. This suggests that tissue specific controlling elements are found within the short fragment and are functional in the embryonic environment.

Functional importance of evolutionally conserved Tbx6 binding sites in the presomitic mesoderm-specific enhancer of Mesp2.

PubMed

Yasuhiko, Yukuto; Kitajima, Satoshi; Takahashi, Yu; Oginuma, Masayuki; Kagiwada, Harumi; Kanno, Jun; Saga, Yumiko

2008-11-01

The T-box transcription factor Tbx6 controls the expression of Mesp2, which encodes a basic helix-loop-helix transcription factor that has crucial roles in somitogenesis. In cultured cells, Tbx6 binding to the Mesp2 enhancer region is essential for the activation of Mesp2 by Notch signaling. However, it is not known whether this binding is required in vivo. Here we report that an Mesp2 enhancer knockout mouse bearing mutations in two crucial Tbx6 binding sites does not express Mesp2 in the presomitic mesoderm. This absence leads to impaired skeletal segmentation identical to that reported for Mesp2-null mice, indicating that these Tbx6 binding sites are indispensable for Mesp2 expression. T-box binding to the consensus sequences in the Mesp2 upstream region was confirmed by chromatin immunoprecipitation assays. Further enhancer analyses indicated that the number and spatial organization of the T-box binding sites are critical for initiating Mesp2 transcription via Notch signaling. We also generated a knock-in mouse in which the endogenous Mesp2 enhancer was replaced by the core enhancer of medaka mespb, an ortholog of mouse Mesp2. The homozygous enhancer knock-in mouse was viable and showed normal skeletal segmentation, indicating that the medaka mespb enhancer functionally replaced the mouse Mesp2 enhancer. These results demonstrate that there is significant evolutionary conservation of Mesp regulatory mechanisms between fish and mice.

Phylum-Level Conservation of Regulatory Information in Nematodes despite Extensive Non-coding Sequence Divergence

PubMed Central

Gordon, Kacy L.; Arthur, Robert K.; Ruvinsky, Ilya

2015-01-01

Gene regulatory information guides development and shapes the course of evolution. To test conservation of gene regulation within the phylum Nematoda, we compared the functions of putative cis-regulatory sequences of four sets of orthologs (unc-47, unc-25, mec-3 and elt-2) from distantly-related nematode species. These species, Caenorhabditis elegans, its congeneric C. briggsae, and three parasitic species Meloidogyne hapla, Brugia malayi, and Trichinella spiralis, represent four of the five major clades in the phylum Nematoda. Despite the great phylogenetic distances sampled and the extensive sequence divergence of nematode genomes, all but one of the regulatory elements we tested are able to drive at least a subset of the expected gene expression patterns. We show that functionally conserved cis-regulatory elements have no more extended sequence similarity to their C. elegans orthologs than would be expected by chance, but they do harbor motifs that are important for proper expression of the C. elegans genes. These motifs are too short to be distinguished from the background level of sequence similarity, and while identical in sequence they are not conserved in orientation or position. Functional tests reveal that some of these motifs contribute to proper expression. Our results suggest that conserved regulatory circuitry can persist despite considerable turnover within cis elements. PMID:26020930

Scop3D: three-dimensional visualization of sequence conservation.

PubMed

Vermeire, Tessa; Vermaere, Stijn; Schepens, Bert; Saelens, Xavier; Van Gucht, Steven; Martens, Lennart; Vandermarliere, Elien

2015-04-01

The integration of a protein's structure with its known sequence variation provides insight on how that protein evolves, for instance in terms of (changing) function or immunogenicity. Yet, collating the corresponding sequence variants into a multiple sequence alignment, calculating each position's conservation, and mapping this information back onto a relevant structure is not straightforward. We therefore built the Sequence Conservation on Protein 3D structure (scop3D) tool to perform these tasks automatically. The output consists of two modified PDB files in which the B-values for each position are replaced by the percentage sequence conservation, or the information entropy for each position, respectively. Furthermore, text files with absolute and relative amino acid occurrences for each position are also provided, along with snapshots of the protein from six distinct directions in space. The visualization provided by scop3D can for instance be used as an aid in vaccine development or to identify antigenic hotspots, which we here demonstrate based on an analysis of the fusion proteins of human respiratory syncytial virus and mumps virus. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Sequencing Needs for Viral Diagnostics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gardner, S N; Lam, M; Mulakken, N J

2004-01-26

We built a system to guide decisions regarding the amount of genomic sequencing required to develop diagnostic DNA signatures, which are short sequences that are sufficient to uniquely identify a viral species. We used our existing DNA diagnostic signature prediction pipeline, which selects regions of a target species genome that are conserved among strains of the target (for reliability, to prevent false negatives) and unique relative to other species (for specificity, to avoid false positives). We performed simulations, based on existing sequence data, to assess the number of genome sequences of a target species and of close phylogenetic relatives (''nearmore » neighbors'') that are required to predict diagnostic signature regions that are conserved among strains of the target species and unique relative to other bacterial and viral species. For DNA viruses such as variola (smallpox), three target genomes provide sufficient guidance for selecting species-wide signatures. Three near neighbor genomes are critical for species specificity. In contrast, most RNA viruses require four target genomes and no near neighbor genomes, since lack of conservation among strains is more limiting than uniqueness. SARS and Ebola Zaire are exceptional, as additional target genomes currently do not improve predictions, but near neighbor sequences are urgently needed. Our results also indicate that double stranded DNA viruses are more conserved among strains than are RNA viruses, since in most cases there was at least one conserved signature candidate for the DNA viruses and zero conserved signature candidates for the RNA viruses.« less

A rare case of 46, XX SRY-negative male with approximately 74-kb duplication in a region upstream of SOX9.

PubMed

Xiao, Bing; Ji, Xing; Xing, Ya; Chen, Ying-Wei; Tao, Jiong

2013-12-01

The 46, XX male disorder of sex development (DSD) is a rare genetic condition. Here, we report the case of a 46, XX SRY-negative male with complete masculinization. The coding region and exon/intron boundaries of the DAX1, SOX9 and RSPO1 genes were sequenced, and no mutations were detected. Using whole genome array analysis and real-time PCR, we identified a approximately 74-kb duplication in a region approximately 510-584 kb upstream of SOX9 (chr17:69,533,305-69,606,825, hg19). Combined with the results of previous studies, the minimum critical region associated with gonadal development is a 67-kb region located 584-517 kb upstream of SOX9. The amplification of this region might lead to SOX9 overexpression, causing female-to-male sex reversal. Gonadal-specific enhancers in the region upstream of SOX9 may activate the SOX9 expression through long-range regulation, thus triggering testicular differentiation. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Cloning and sequence analysis of a cDNA encoding the alpha-subunit of mouse beta-N-acetylhexosaminidase and comparison with the human enzyme.

PubMed Central

Beccari, T; Hoade, J; Orlacchio, A; Stirling, J L

1992-01-01

cDNAs encoding the mouse beta-N-acetylhexosaminidase alpha-subunit were isolated from a mouse testis library. The longest of these (1.7 kb) was sequenced and showed 83% similarity with the human alpha-subunit cDNA sequence. The 5' end of the coding sequence was obtained from a genomic DNA clone. Alignment of the human and mouse sequences showed that all three putative N-glycosylation sites are conserved, but that the mouse alpha-subunit has an additional site towards the C-terminus. All eight cysteines in the human sequence are conserved in the mouse. There are an additional two cysteines in the mouse alpha-subunit signal peptide. All amino acids affected in Tay-Sachs-disease mutations are conserved in the mouse. Images Fig. 1. PMID:1379046

Refining the regulatory region upstream of SOX9 associated with 46,XX testicular disorders of Sex Development (DSD).

PubMed

Hyon, Capucine; Chantot-Bastaraud, Sandra; Harbuz, Radu; Bhouri, Rakia; Perrot, Nicolas; Peycelon, Matthieu; Sibony, Mathilde; Rojo, Sandra; Piguel, Xavier; Bilan, Frederic; Gilbert-Dussardier, Brigitte; Kitzis, Alain; McElreavey, Ken; Siffroi, Jean-Pierre; Bashamboo, Anu

2015-08-01

Disorders of Sex Development (DSD) are a heterogeneous group of disorders affecting gonad and/or genito-urinary tract development and usually the endocrine-reproductive system. A genetic diagnosis is made in only around 20% of these cases. The genetic causes of 46,XX-SRY negative testicular DSD as well as ovotesticular DSD are poorly defined. Duplications involving a region located ∼600 kb upstream of SOX9, a key gene in testis development, were reported in several cases of 46,XX DSD. Recent studies have narrowed this region down to a 78 kb interval that is duplicated or deleted respectively in 46,XX or 46,XY DSD. We identified three phenotypically normal patients presenting with azoospermia and 46,XX testicular DSD. Two brothers carried a 83.8 kb duplication located ∼600 kb upstream of SOX9 that overlapped with the previously reported rearrangements. This duplication refines the minimal region associated with 46,XX-SRY negative DSD to a 40.7-41.9 kb element located ∼600 kb upstream of SOX9. Predicted enhancer elements and evolutionary-conserved binding sites for proteins known to be involved in testis determination are located within this region. © 2015 Wiley Periodicals, Inc.

RNA-DNA and DNA-DNA base-pairing at the upstream edge of the transcription bubble regulate translocation of RNA polymerase and transcription rate.

PubMed

KIreeva, Maria; Trang, Cyndi; Matevosyan, Gayane; Turek-Herman, Joshua; Chasov, Vitaly; Lubkowska, Lucyna; Kashlev, Mikhail

2018-06-20

Translocation of RNA polymerase (RNAP) along DNA may be rate-limiting for transcription elongation. The Brownian ratchet model posits that RNAP rapidly translocates back and forth until the post-translocated state is stabilized by NTP binding. An alternative model suggests that RNAP translocation is slow and poorly reversible. To distinguish between these two models, we take advantage of an observation that pyrophosphorolysis rates directly correlate with the abundance of the pre-translocated fraction. Pyrophosphorolysis by RNAP stabilized in the pre-translocated state by bacteriophage HK022 protein Nun was used as a reference point to determine the pre-translocated fraction in the absence of Nun. The stalled RNAP preferentially occupies the post-translocated state. The forward translocation rate depends, among other factors, on melting of the RNA-DNA base pair at the upstream edge of the transcription bubble. DNA-DNA base pairing immediately upstream from the RNA-DNA hybrid stabilizes the post-translocated state. This mechanism is conserved between E. coli RNAP and S. cerevisiae RNA polymerase II and is partially dependent on the lid domain of the catalytic subunit. Thus, the RNA-DNA hybrid and DNA reannealing at the upstream edge of the transcription bubble emerge as targets for regulation of the transcription elongation rate.

Genome-wide identification of conserved microRNA and their response to drought stress in Dongxiang wild rice (Oryza rufipogon Griff.).

PubMed

Zhang, Fantao; Luo, Xiangdong; Zhou, Yi; Xie, Jiankun

2016-04-01

To identify drought stress-responsive conserved microRNA (miRNA) from Dongxiang wild rice (Oryza rufipogon Griff., DXWR) on a genome-wide scale, high-throughput sequencing technology was used to sequence libraries of DXWR samples, treated with and without drought stress. 505 conserved miRNAs corresponding to 215 families were identified. 17 were significantly down-regulated and 16 were up-regulated under drought stress. Stem-loop qRT-PCR revealed the same expression patterns as high-throughput sequencing, suggesting the accuracy of the sequencing result was high. Potential target genes of the drought-responsive miRNA were predicted to be involved in diverse biological processes. Furthermore, 16 miRNA families were first identified to be involved in drought stress response from plants. These results present a comprehensive view of the conserved miRNA and their expression patterns under drought stress for DXWR, which will provide valuable information and sequence resources for future basis studies.

Conserved intergenic sequences revealed by CTAG-profiling in Salmonella: thermodynamic modeling for function prediction

NASA Astrophysics Data System (ADS)

Tang, Le; Zhu, Songling; Mastriani, Emilio; Fang, Xin; Zhou, Yu-Jie; Li, Yong-Guo; Johnston, Randal N.; Guo, Zheng; Liu, Gui-Rong; Liu, Shu-Lin

2017-03-01

Highly conserved short sequences help identify functional genomic regions and facilitate genomic annotation. We used Salmonella as the model to search the genome for evolutionarily conserved regions and focused on the tetranucleotide sequence CTAG for its potentially important functions. In Salmonella, CTAG is highly conserved across the lineages and large numbers of CTAG-containing short sequences fall in intergenic regions, strongly indicating their biological importance. Computer modeling demonstrated stable stem-loop structures in some of the CTAG-containing intergenic regions, and substitution of a nucleotide of the CTAG sequence would radically rearrange the free energy and disrupt the structure. The postulated degeneration of CTAG takes distinct patterns among Salmonella lineages and provides novel information about genomic divergence and evolution of these bacterial pathogens. Comparison of the vertically and horizontally transmitted genomic segments showed different CTAG distribution landscapes, with the genome amelioration process to remove CTAG taking place inward from both terminals of the horizontally acquired segment.

Development of a bioassay to screen for chemicals mimicking the anti-aging effects of calorie restriction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chiba, Takuya, E-mail: takuya@nagasaki-u.ac.jp; Tsuchiya, Tomoshi; Komatsu, Toshimitsu

2010-10-15

Research highlights: {yields} We identified four sequence motifs lying upstream of putative pro-longevity genes. {yields} One of these motifs binds to HNF-4{alpha}. {yields} HNF-4{alpha}/PGC-1{alpha} could up-regulate the transcription of a reporter gene linked to this motif. {yields} The reporter system described here could be used to screen candidate anti-aging molecules. -- Abstract: Suppression of the growth hormone/insulin-like growth factor-I pathway in Ames dwarf (DF) mice, and caloric restriction (CR) in normal mice extends lifespan and delays the onset of age-related disorders. In combination, these interventions have an additive effect on lifespan in Ames DF mice. Therefore, common signaling pathways regulatedmore » by DF and CR could have additive effects on longevity. In this study, we tried to identity the signaling mechanism and develop a system to assess pro-longevity status in cells and mice. We previously identified genes up-regulated in the liver of DF and CR mice by DNA microarray analysis. Motif analysis of the upstream sequences of those genes revealed four major consensus sequence motifs, which have been named dwarfism and calorie restriction-responsive elements (DFCR-REs). One of the synthesized sequences bound to hepatocyte nuclear factor-4{alpha} (HNF-4{alpha}), an important transcription factor involved in liver metabolism. Furthermore, using this sequence information, we developed a highly sensitive bioassay to identify chemicals mimicking the anti-aging effects of CR. When the reporter construct, containing an element upstream of a secreted alkaline phosphatase (SEAP) gene, was co-transfected with HNF-4{alpha} and its regulator peroxisome proliferator-activated receptor (PPAR) {gamma} coactivator-1{alpha} (PGC-1{alpha}), SEAP activity was increased compared with untransfected controls. Moreover, transient transgenic mice established using this construct showed increased SEAP activity in CR mice compared with ad libitum-fed mice. These data suggest that because of its rapidity, ease of use, and specificity, our bioassay will be more useful than the systems currently employed to screen for CR mimetics, which mimic the beneficial effects of CR. Our system will be particularly useful for high-throughput screening of natural and synthetic candidate molecules.« less

Transcriptional "silencer" element in rat repetitive sequences associated with the rat insulin 1 gene locus.

PubMed Central

Laimins, L; Holmgren-König, M; Khoury, G

1986-01-01

The enhancer elements from either simian virus 40 or murine sarcoma virus activate the expression of a transfected rat insulin 1 (rI1) gene when placed within 2.0 kilobases or less of the rI1 gene cap site. Inclusion of 4.0 kilobases of upstream rI1 sequence, however, results in a substantial reduction in the enhancer-dependent insulin gene expression. These observations suggested that a negative transcriptional regulatory element was present between 2.0 and 4.0 kilobases of the rI1 sequence. To test this notion, we employed a heterologous enhancer-dependent transcription assay in which the simian virus 40 72-base-pair repeat is linked to a human beta-globin gene. Addition of the upstream rI1 element to this system decreased the level of enhancer-dependent beta-globin transcription by a factor of 5 to 15. This rI1 "silencer" element functions in a manner relatively independent of position and orientation and requires a cis-dependent relationship to the transcription unit on which it acts. Thus, the silencer sequence seems to have a number of the characteristics of enhancer elements, and we suggest that it may function by the converse of the enhancer mechanism. The rI1 silencer sequence was identified as a member of a long interspersed rat repetitive family. Thus, a potential role for certain repetitive sequences interspersed throughout the eukaryotic genome may be to regulate gene expression by retaining transcriptional activity within defined domains. Images PMID:3010279

Characterization of the Campylobacter jejuni cryptic plasmid pTIW94 recovered from wild birds in the southeastern United States.

PubMed

Hiett, Kelli L; Rothrock, Michael J; Seal, Bruce S

2013-09-01

The complete nucleotide sequence was determined for a cryptic plasmid, pTIW94, recovered from several Campylobacter jejuni isolates from wild birds in the southeastern United States. pTIW94 is a circular molecule of 3860 nucleotides, with a G+C content (31.0%) similar to that of many Campylobacter spp. genomes. A typical origin of replication, with iteron sequences, was identified upstream of DNA sequences that demonstrated similarity to replication initiation proteins. A total of five open reading frames (ORFs) were identified; two of the five ORFs demonstrated significant similarity to plasmid pCC2228-2 found within Campylobacter coli. These two ORFs were similar to essential replication proteins RepA (100%; 26/26 aa identity) and RepB (95%; 327/346 aa identity). A third identified ORF demonstrated significant similarity (99%; 421/424 aa identity) to the MOB protein from C. coli 67-8, originally recovered from swine. The other two identified ORFs were either similar to hypothetical proteins from other Campylobacter spp., or exhibited no significant similarity to any DNA or protein sequence in the GenBank database. Promoter regions (-35 and -10 signal sites), ribosomal binding sites upstream of ORFs, and stem-loop structures were also identified within the plasmid. These results demonstrate that pTIW94 represents a previously un-reported small cryptic plasmid with unique sequences as well as highly similar sequences to other small plasmids found within Campylobacter spp., and that this cryptic plasmid is present among Campylobacter spp. recovered from different genera of wild birds. Copyright © 2013. Published by Elsevier Inc.

SSME Turbopump Turbine Computations

NASA Technical Reports Server (NTRS)

Jorgenson, P. G. E.

1985-01-01

A two-dimensional viscous code was developed to be used in the prediction of the flow in the SSME high-pressure turbopump blade passages. The rotor viscous code (RVC) employs a four-step Runge-Kutta scheme to solve the two-dimensional, thin-layer Navier-Stokes equations. The Baldwin-Lomax eddy-viscosity model is used for these turbulent flow calculations. A viable method was developed to use the relative exit conditions from an upstream blade row as the inlet conditions to the next blade row. The blade loading diagrams are compared with the meridional values obtained from an in-house quasithree-dimensional inviscid code. Periodic boundary conditions are imposed on a body-fitted C-grid computed by using the GRAPE GRids about Airfoils using Poisson's Equation (GRAPE) code. Total pressure, total temperature, and flow angle are specified at the inlet. The upstream-running Riemann invariant is extrapolated from the interior. Static pressure is specified at the exit such that mass flow is conserved from blade row to blade row, and the conservative variables are extrapolated from the interior. For viscous flows the noslip condition is imposed at the wall. The normal momentum equation gives the pressure at the wall. The density at the wall is obtained from the wall total temperature.

Functionally conserved cis-regulatory elements of COL18A1 identified through zebrafish transgenesis.

PubMed

Kague, Erika; Bessling, Seneca L; Lee, Josephine; Hu, Gui; Passos-Bueno, Maria Rita; Fisher, Shannon

2010-01-15

Type XVIII collagen is a component of basement membranes, and expressed prominently in the eye, blood vessels, liver, and the central nervous system. Homozygous mutations in COL18A1 lead to Knobloch Syndrome, characterized by ocular defects and occipital encephalocele. However, relatively little has been described on the role of type XVIII collagen in development, and nothing is known about the regulation of its tissue-specific expression pattern. We have used zebrafish transgenesis to identify and characterize cis-regulatory sequences controlling expression of the human gene. Candidate enhancers were selected from non-coding sequence associated with COL18A1 based on sequence conservation among mammals. Although these displayed no overt conservation with orthologous zebrafish sequences, four regions nonetheless acted as tissue-specific transcriptional enhancers in the zebrafish embryo, and together recapitulated the major aspects of col18a1 expression. Additional post-hoc computational analysis on positive enhancer sequences revealed alignments between mammalian and teleost sequences, which we hypothesize predict the corresponding zebrafish enhancers; for one of these, we demonstrate functional overlap with the orthologous human enhancer sequence. Our results provide important insight into the biological function and regulation of COL18A1, and point to additional sequences that may contribute to complex diseases involving COL18A1. More generally, we show that combining functional data with targeted analyses for phylogenetic conservation can reveal conserved cis-regulatory elements in the large number of cases where computational alignment alone falls short. Copyright 2009 Elsevier Inc. All rights reserved.

An RNA Element That Facilitates Programmed Ribosomal Readthrough in Turnip Crinkle Virus Adopts Multiple Conformations

PubMed Central

Kuhlmann, Micki M.; Chattopadhyay, Maitreyi; Stupina, Vera A.; Gao, Feng

2016-01-01

ABSTRACT Ribosome recoding is used by RNA viruses for translational readthrough or frameshifting past termination codons for the synthesis of extension products. Recoding sites, along with downstream recoding stimulatory elements (RSEs), have long been studied in reporter constructs, because these fragments alone mediate customary levels of recoding and are thus assumed to contain complete instructions for establishment of the proper ratio of termination to recoding. RSEs from the Tombusviridae and Luteoviridae are thought to be exceptions, since they contain a long-distance RNA-RNA connection with the 3′ end. This interaction has been suggested to substitute for pseudoknots, thought to be missing in tombusvirid RSEs. We provide evidence that the phylogenetically conserved RSE of the carmovirus Turnip crinkle virus (TCV) adopts an alternative, smaller structure that extends an upstream conserved hairpin and that this alternative structure is the predominant form of the RSE within nascent viral RNA in plant cells and when RNA is synthesized in vitro. The TCV RSE also contains an internal pseudoknot along with the long-distance interaction, and the pseudoknot is not compatible with the phylogenetically conserved structure. Conserved residues just past the recoding site are important for recoding, and these residues are also conserved in the RSEs of gammaretroviruses. Our data demonstrate the dynamic nature of the TCV RSE and suggest that studies using reporter constructs may not be effectively recapitulating RSE-mediated recoding within viral genomes. IMPORTANCE Ribosome recoding is used by RNA viruses to enable ribosomes to extend translation past termination codons for the synthesis of longer products. Recoding sites and a downstream recoding stimulatory element (RSE) mediate expected levels of recoding when excised and placed in reporter constructs and thus are assumed to contain complete instructions for the establishment of the proper ratio of termination to recoding. We provide evidence that most of the TCV RSE adopts an alternative structure that extends an upstream conserved hairpin and that this alternative structure, and not the phylogenetically conserved structure, is the predominant form of the RSE in RNA synthesized in vitro and in plant cells. The TCV RSE also contains an internal pseudoknot that is not compatible with the phylogenetically conserved structure and an RNA bridge to the 3′ end. These data suggest that the TCV RSE is structurally dynamic and that multiple conformations are likely required to regulate ribosomal readthrough. PMID:27440887

Dual Transcriptomic Profiling of Host and Microbiota during Health and Disease in Pediatric Asthma.

PubMed

Pérez-Losada, Marcos; Castro-Nallar, Eduardo; Bendall, Matthew L; Freishtat, Robert J; Crandall, Keith A

2015-01-01

High-throughput sequencing (HTS) analysis of microbial communities from the respiratory airways has heavily relied on the 16S rRNA gene. Given the intrinsic limitations of this approach, airway microbiome research has focused on assessing bacterial composition during health and disease, and its variation in relation to clinical and environmental factors, or other microbiomes. Consequently, very little effort has been dedicated to describing the functional characteristics of the airway microbiota and even less to explore the microbe-host interactions. Here we present a simultaneous assessment of microbiome and host functional diversity and host-microbe interactions from the same RNA-seq experiment, while accounting for variation in clinical metadata. Transcriptomic (host) and metatranscriptomic (microbiota) sequences from the nasal epithelium of 8 asthmatics and 6 healthy controls were separated in silico and mapped to available human and NCBI-NR protein reference databases. Human genes differentially expressed in asthmatics and controls were then used to infer upstream regulators involved in immune and inflammatory responses. Concomitantly, microbial genes were mapped to metabolic databases (COG, SEED, and KEGG) to infer microbial functions differentially expressed in asthmatics and controls. Finally, multivariate analysis was applied to find associations between microbiome characteristics and host upstream regulators while accounting for clinical variation. Our study showed significant differences in the metabolism of microbiomes from asthmatic and non-asthmatic children for up to 25% of the functional properties tested. Enrichment analysis of 499 differentially expressed host genes for inflammatory and immune responses revealed 43 upstream regulators differentially activated in asthma. Microbial adhesion (virulence) and Proteobacteria abundance were significantly associated with variation in the expression of the upstream regulator IL1A; suggesting that microbiome characteristics modulate host inflammatory and immune systems during asthma.

Erwinia carotovora subsp. carotovora extracellular protease: characterization and nucleotide sequence of the gene.

PubMed Central

Kyöstiö, S R; Cramer, C L; Lacy, G H

1991-01-01

The prt1 gene encoding extracellular protease from Erwinia carotovora subsp. carotovora EC14 in cosmid pCA7 was subcloned to create plasmid pSK1. The partial nucleotide sequence of the insert in pSK1 (1,878 bp) revealed a 1,041-bp open reading frame (ORF1) that correlated with protease activity in deletion mutants. ORF1 encodes a polypeptide of 347 amino acids with a calculated molecular mass of 38,826 Da. Escherichia coli transformed with pSK1 or pSK23, a subclone of pSK1, produces a protease (Prt1) intracellularly with a molecular mass of 38 kDa and a pI of 4.8. Prt1 activity was inhibited by phenanthroline, suggesting that it is a metalloprotease. The prt1 promoter was localized between 173 and 1,173 bp upstream of ORF1 by constructing transcriptional lacZ fusions. Primer extension identified the prt1 transcription start site 205 bp upstream of ORF1. The deduced amino acid sequence of ORF1 showed significant sequence identity to metalloproteases from Bacillus thermoproteolyticus (thermolysin), B. subtilis (neutral protease), Legionella pneumophila (metalloprotease), and Pseudomonas aeruginosa (elastase). It has less sequence similarity to metalloproteases from Serratia marcescens and Erwinia chrysanthemi. Locations for three zinc ligands and the active site for E. carotovora subsp. carotovora protease were predicted from thermolysin. Images FIG. 2 FIG. 5 FIG. 6 FIG. 8 FIG. 9 PMID:1917878

Identification, cloning, and sequencing of a fragment of Amsacta moorei entomopoxvirus DNA containing the spheroidin gene and three vaccinia virus-related open reading frames.

PubMed Central

Hall, R L; Moyer, R W

1991-01-01

Entomopoxvirus virions are frequently contained within crystalline occlusion bodies, which are composed of primarily a single protein, spheroidin, which is analogous to the polyhedrin protein of baculovirus. The spheroidin gene of Amsacta moorei entomopoxvirus was identified following the microsequencing of polypeptides generated from cyanogen bromide treatment of spheroidin and the subsequent synthesis of oligonucleotide hybridization probes. DNA sequencing of a 6.8-kb region of DNA containing the spheroidin gene showed that the spheroidin protein is derived from a 3.0-kb open reading frame potentially encoding a protein of 115 kDa. Three copies of the heptanucleotide, TTTTTNT, a sequence associated with early gene transcription in the vertebrate poxviruses, and four in-frame translational termination signals were found within 60 bp upstream of the putative spheroidin gene promoter (TAAATG). The spheroidin gene promoter region contains the sequence TAAATG, which is found in many late promoters of the vertebrate poxviruses and which serves as the site of transcriptional initiation, as shown by primer extension. Primer extension experiments also showed that spheroidin gene transcripts contain 5' poly(A) sequences typical of vertebrate poxvirus late transcripts. The 92 bases upstream of the initiating TAAATG are unusually A + T rich and contain only 7 G or C residues. An analysis of open reading frames around the spheroidin gene suggests that the colinear core of "essential genes" typical of the vertebrate poxviruses is absent in A. moorei entomopoxvirus. Images PMID:1942245

Survey of the transcriptome of Aspergillus oryzae via massively parallel mRNA sequencing

PubMed Central

Wang, Bin; Guo, Guangwu; Wang, Chao; Lin, Ying; Wang, Xiaoning; Zhao, Mouming; Guo, Yong; He, Minghui; Zhang, Yong; Pan, Li

2010-01-01

Aspergillus oryzae, an important filamentous fungus used in food fermentation and the enzyme industry, has been shown through genome sequencing and various other tools to have prominent features in its genomic composition. However, the functional complexity of the A. oryzae transcriptome has not yet been fully elucidated. Here, we applied direct high-throughput paired-end RNA-sequencing (RNA-Seq) to the transcriptome of A. oryzae under four different culture conditions. With the high resolution and sensitivity afforded by RNA-Seq, we were able to identify a substantial number of novel transcripts, new exons, untranslated regions, alternative upstream initiation codons and upstream open reading frames, which provide remarkable insight into the A. oryzae transcriptome. We were also able to assess the alternative mRNA isoforms in A. oryzae and found a large number of genes undergoing alternative splicing. Many genes and pathways that might be involved in higher levels of protein production in solid-state culture than in liquid culture were identified by comparing gene expression levels between different cultures. Our analysis indicated that the transcriptome of A. oryzae is much more complex than previously anticipated, and these results may provide a blueprint for further study of the A. oryzae transcriptome. PMID:20392818

Survey of the transcriptome of Aspergillus oryzae via massively parallel mRNA sequencing.

PubMed

Wang, Bin; Guo, Guangwu; Wang, Chao; Lin, Ying; Wang, Xiaoning; Zhao, Mouming; Guo, Yong; He, Minghui; Zhang, Yong; Pan, Li

2010-08-01

Aspergillus oryzae, an important filamentous fungus used in food fermentation and the enzyme industry, has been shown through genome sequencing and various other tools to have prominent features in its genomic composition. However, the functional complexity of the A. oryzae transcriptome has not yet been fully elucidated. Here, we applied direct high-throughput paired-end RNA-sequencing (RNA-Seq) to the transcriptome of A. oryzae under four different culture conditions. With the high resolution and sensitivity afforded by RNA-Seq, we were able to identify a substantial number of novel transcripts, new exons, untranslated regions, alternative upstream initiation codons and upstream open reading frames, which provide remarkable insight into the A. oryzae transcriptome. We were also able to assess the alternative mRNA isoforms in A. oryzae and found a large number of genes undergoing alternative splicing. Many genes and pathways that might be involved in higher levels of protein production in solid-state culture than in liquid culture were identified by comparing gene expression levels between different cultures. Our analysis indicated that the transcriptome of A. oryzae is much more complex than previously anticipated, and these results may provide a blueprint for further study of the A. oryzae transcriptome.

Coiled-coil length: Size does matter.

PubMed

Surkont, Jaroslaw; Diekmann, Yoan; Ryder, Pearl V; Pereira-Leal, Jose B

2015-12-01

Protein evolution is governed by processes that alter primary sequence but also the length of proteins. Protein length may change in different ways, but insertions, deletions and duplications are the most common. An optimal protein size is a trade-off between sequence extension, which may change protein stability or lead to acquisition of a new function, and shrinkage that decreases metabolic cost of protein synthesis. Despite the general tendency for length conservation across orthologous proteins, the propensity to accept insertions and deletions is heterogeneous along the sequence. For example, protein regions rich in repetitive peptide motifs are well known to extensively vary their length across species. Here, we analyze length conservation of coiled-coils, domains formed by an ubiquitous, repetitive peptide motif present in all domains of life, that frequently plays a structural role in the cell. We observed that, despite the repetitive nature, the length of coiled-coil domains is generally highly conserved throughout the tree of life, even when the remaining parts of the protein change, including globular domains. Length conservation is independent of primary amino acid sequence variation, and represents a conservation of domain physical size. This suggests that the conservation of domain size is due to functional constraints. © 2015 Wiley Periodicals, Inc.

Multiple origins of resistance-conferring mutations in Plasmodium vivax dihydrofolate reductase

PubMed Central

Hawkins, Vivian N; Auliff, Alyson; Prajapati, Surendra Kumar; Rungsihirunrat, Kanchana; Hapuarachchi, Hapuarachchige C; Maestre, Amanda; O'Neil, Michael T; Cheng, Qin; Joshi, Hema; Na-Bangchang, Kesara; Sibley, Carol Hopkins

2008-01-01

Background In order to maximize the useful therapeutic life of antimalarial drugs, it is crucial to understand the mechanisms by which parasites resistant to antimalarial drugs are selected and spread in natural populations. Recent work has demonstrated that pyrimethamine-resistance conferring mutations in Plasmodium falciparum dihydrofolate reductase (dhfr) have arisen rarely de novo, but spread widely in Asia and Africa. The origin and spread of mutations in Plasmodium vivax dhfr were assessed by constructing haplotypes based on sequencing dhfr and its flanking regions. Methods The P. vivax dhfr coding region, 792 bp upstream and 683 bp downstream were amplified and sequenced from 137 contemporary patient isolates from Colombia, India, Indonesia, Papua New Guinea, Sri Lanka, Thailand, and Vanuatu. A repeat motif located 2.6 kb upstream of dhfr was also sequenced from 75 of 137 patient isolates, and mutational relationships among the haplotypes were visualized using the programme Network. Results Synonymous and non-synonymous single nucleotide polymorphisms (SNPs) within the dhfr coding region were identified, as was the well-documented in-frame insertion/deletion (indel). SNPs were also identified upstream and downstream of dhfr, with an indel and a highly polymorphic repeat region identified upstream of dhfr. The regions flanking dhfr were highly variable. The double mutant (58R/117N) dhfr allele has evolved from several origins, because the 58R is encoded by at least 3 different codons. The triple (58R/61M/117T) and quadruple (57L/61M/117T/173F, 57I/58R/61M/117T and 57L/58R/61M/117T) mutant alleles had at least three independent origins in Thailand, Indonesia, and Papua New Guinea/Vanuatu. Conclusion It was found that the P. vivax dhfr coding region and its flanking intergenic regions are highly polymorphic and that mutations in P. vivax dhfr that confer antifolate resistance have arisen several times in the Asian region. This contrasts sharply with the selective sweep of rare antifolate resistant alleles observed in the P. falciparum populations in Asia and Africa. The finding of multiple origins of resistance-conferring mutations has important implications for drug policy. PMID:18442404

Multiple origins of resistance-conferring mutations in Plasmodium vivax dihydrofolate reductase.

PubMed

Hawkins, Vivian N; Auliff, Alyson; Prajapati, Surendra Kumar; Rungsihirunrat, Kanchana; Hapuarachchi, Hapuarachchige C; Maestre, Amanda; O'Neil, Michael T; Cheng, Qin; Joshi, Hema; Na-Bangchang, Kesara; Sibley, Carol Hopkins

2008-04-28

In order to maximize the useful therapeutic life of antimalarial drugs, it is crucial to understand the mechanisms by which parasites resistant to antimalarial drugs are selected and spread in natural populations. Recent work has demonstrated that pyrimethamine-resistance conferring mutations in Plasmodium falciparum dihydrofolate reductase (dhfr) have arisen rarely de novo, but spread widely in Asia and Africa. The origin and spread of mutations in Plasmodium vivax dhfr were assessed by constructing haplotypes based on sequencing dhfr and its flanking regions. The P. vivax dhfr coding region, 792 bp upstream and 683 bp downstream were amplified and sequenced from 137 contemporary patient isolates from Colombia, India, Indonesia, Papua New Guinea, Sri Lanka, Thailand, and Vanuatu. A repeat motif located 2.6 kb upstream of dhfr was also sequenced from 75 of 137 patient isolates, and mutational relationships among the haplotypes were visualized using the programme Network. Synonymous and non-synonymous single nucleotide polymorphisms (SNPs) within the dhfr coding region were identified, as was the well-documented in-frame insertion/deletion (indel). SNPs were also identified upstream and downstream of dhfr, with an indel and a highly polymorphic repeat region identified upstream of dhfr. The regions flanking dhfr were highly variable. The double mutant (58R/117N) dhfr allele has evolved from several origins, because the 58R is encoded by at least 3 different codons. The triple (58R/61M/117T) and quadruple (57L/61M/117T/173F, 57I/58R/61M/117T and 57L/58R/61M/117T) mutant alleles had at least three independent origins in Thailand, Indonesia, and Papua New Guinea/Vanuatu. It was found that the P. vivax dhfr coding region and its flanking intergenic regions are highly polymorphic and that mutations in P. vivax dhfr that confer antifolate resistance have arisen several times in the Asian region. This contrasts sharply with the selective sweep of rare antifolate resistant alleles observed in the P. falciparum populations in Asia and Africa. The finding of multiple origins of resistance-conferring mutations has important implications for drug policy.

Protein Sectors: Statistical Coupling Analysis versus Conservation

PubMed Central

Teşileanu, Tiberiu; Colwell, Lucy J.; Leibler, Stanislas

2015-01-01

Statistical coupling analysis (SCA) is a method for analyzing multiple sequence alignments that was used to identify groups of coevolving residues termed “sectors”. The method applies spectral analysis to a matrix obtained by combining correlation information with sequence conservation. It has been asserted that the protein sectors identified by SCA are functionally significant, with different sectors controlling different biochemical properties of the protein. Here we reconsider the available experimental data and note that it involves almost exclusively proteins with a single sector. We show that in this case sequence conservation is the dominating factor in SCA, and can alone be used to make statistically equivalent functional predictions. Therefore, we suggest shifting the experimental focus to proteins for which SCA identifies several sectors. Correlations in protein alignments, which have been shown to be informative in a number of independent studies, would then be less dominated by sequence conservation. PMID:25723535

Mapping the transcription start points of the Staphylococcus aureus eap, emp, and vwb promoters reveals a conserved octanucleotide sequence that is essential for expression of these genes.

PubMed

Harraghy, Niamh; Homerova, Dagmar; Herrmann, Mathias; Kormanec, Jan

2008-01-01

Mapping the transcription start points of the eap, emp, and vwb promoters revealed a conserved octanucleotide sequence (COS). Deleting this sequence abolished the expression of eap, emp, and vwb. However, electrophoretic mobility shift assays gave no evidence that this sequence was a binding site for SarA or SaeR, known regulators of eap and emp.

Alternative Oxidase Transcription Factors AOD2 and AOD5 of Neurospora crassa Control the Expression of Genes Involved in Energy Production and Metabolism.

PubMed

Qi, Zhigang; Smith, Kristina M; Bredeweg, Erin L; Bosnjak, Natasa; Freitag, Michael; Nargang, Frank E

2017-02-09

In Neurospora crassa , blocking the function of the standard mitochondrial electron transport chain results in the induction of an alternative oxidase (AOX). AOX transfers electrons directly from ubiquinol to molecular oxygen. AOX serves as a model of retrograde regulation since it is encoded by a nuclear gene that is regulated in response to signals from mitochondria. The N. crassa transcription factors AOD2 and AOD5 are necessary for the expression of the AOX gene. To gain insight into the mechanism by which these factors function, and to determine if they have roles in the expression of additional genes in N. crassa , we constructed strains expressing only tagged versions of the proteins. Cell fractionation experiments showed that both proteins are localized to the nucleus under both AOX inducing and noninducing conditions. Furthermore, chromatin immunoprecipitation and high throughput sequencing (ChIP-seq) analysis revealed that the proteins are bound to the promoter region of the AOX gene under both conditions. ChIP-seq also showed that the transcription factors bind to the upstream regions of a number of genes that are involved in energy production and metabolism. Dependence on AOD2 and AOD5 for the expression of several of these genes was verified by quantitative PCR. The majority of ChIP-seq peaks observed were enriched for both AOD2 and AOD5. However, we also observed occasional sites where one factor appeared to bind preferentially. The most striking of these was a conserved sequence that bound large amounts of AOD2 but little AOD5. This sequence was found within a 310 bp repeat unit that occurs at several locations in the genome. Copyright © 2017 Qi et al.

Identification of Immune-Related Genes and Development of SSR/SNP Markers from the Spleen Transcriptome of Schizothorax prenanti.

PubMed

Luo, Hui; Xiao, Shijun; Ye, Hua; Zhang, Zhengshi; Lv, Changhuan; Zheng, Shuming; Wang, Zhiyong; Wang, Xiaoqing

2016-01-01

Schizothorax prenanti (S. prenanti) is mainly distributed in the upstream regions of the Yangtze River and its tributaries in China. This species is indigenous and commercially important. However, in recent years, wild populations and aquacultures have faced the serious challenges of germplasm variation loss and an increased susceptibility to a range of pathogens. Currently, the genetics and immune mechanisms of S. prenanti are unknown, partly due to a lack of genome and transcriptome information. Here, we sought to identify genes related to immune functions and to identify molecular markers to study the function of these genes and for trait mapping. To this end, the transcriptome from spleen tissues of S. prenanti was analyzed and sequenced. Using paired-end reads from the Illumina Hiseq2500 platform, 48,517 transcripts were isolated from the spleen transcriptome. These transcripts could be clustered into 37,785 unigenes with an N50 length of 2,539 bp. The majority of the unigenes (35,653, 94.4%) were successfully annotated using non-redundant nucleotide sequence analysis (nt), and the non-redundant protein (nr), Swiss-Prot, Gene Ontology (GO), and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases. KEGG pathway assignment identified more than 500 immune-related genes. Furthermore, 7,545 putative simple sequence repeats (SSRs), 857,535 single nucleotide polymorphisms (SNPs), and 53,481 insertion/deletion (InDels) were detected from the transcriptome. This is the first reported high-throughput transcriptome analysis of S. prenanti, and it provides valuable genetic resources for the investigation of immune mechanisms, conservation of germplasm, and molecular marker-assisted breeding of S. prenanti.

Recruitment of the proneural gene scute to the Drosophila sex-determination pathway.

PubMed Central

Wrischnik, Lisa A; Timmer, John R; Megna, Lisa A; Cline, Thomas W

2003-01-01

In flies, scute (sc) works with its paralogs in the achaete-scute-complex (ASC) to direct neuronal development. However, in the family Drosophilidae, sc also acquired a role in the primary event of sex determination, X chromosome counting, by becoming an X chromosome signal element (XSE)-an evolutionary step shown here to have occurred after sc diverged from its closest paralog, achaete (ac). Two temperature-sensitive alleles, sc(sisB2) and sc(sisB3), which disrupt only sex determination, were recovered in a powerful F1 genetic selection and used to investigate how sc was recruited to the sex-determination pathway. sc(sisB2) revealed 3' nontranscribed regulatory sequences likely to be involved. The sc(sisB2) lesion abolished XSE activity when combined with mutations engineered in a sequence upstream of all XSEs. In contrast, changes in Sc protein sequence seem not to have been important for recruitment. The observation that the other new allele, sc(sisB3), eliminates the C-terminal half of Sc without affecting neurogenesis and that sc(sisB1), the most XSE-specific allele previously available, is a nonsense mutant, would seem to suggest the opposite, but we show that housefly Sc can substitute for fruit fly Sc in sex determination, despite lacking Drosophilidae-specific conserved residues in its C-terminal half. Lack of synergistic lethality among mutations in sc, twist, and dorsal argue against a proposed role for sc in mesoderm formation that had seemed potentially relevant to sex-pathway recruitment. The screen that yielded new sc alleles also generated autosomal duplications that argue against the textbook view that fruit fly sex signal evolution recruited a set of autosomal signal elements comparable to the XSEs. PMID:14704182

Carbapenem-Resistant Acinetobacter baumannii from Serbia: Revision of CarO Classification

PubMed Central

Novovic, Katarina; Mihajlovic, Sanja; Vasiljevic, Zorica; Filipic, Brankica; Begovic, Jelena; Jovcic, Branko

2015-01-01

Carbapenem-resistant A. baumannii present a significant therapeutic challenge for the treatment of nosocomial infections in many European countries. Although it is known that the gradient of A. baumannii prevalence increases from northern to southern Europe, this study provides the first data from Serbia. Twenty-eight carbapenem-resistant A. baumannii clinical isolates were collected at a Serbian pediatric hospital during a 2-year period. The majority of isolates (67.68%) belonged to the sequence type Group 1, European clonal complex II. All isolates harbored intrinsic OXA-51 and AmpC cephalosporinase. OXA-23 was detected in 16 isolates (57.14%), OXA-24 in 23 isolates (82.14%) and OXA-58 in 11 isolates (39.29%). Six of the isolates (21.43%) harbored all of the analyzed oxacillinases, except OXA-143 and OXA-235 that were not detected in this study. Production of oxacillinases was detected in different pulsotypes indicating the presence of horizontal gene transfer. NDM-1, VIM and IMP were not detected in analyzed clinical A. baumannii isolates. ISAba1 insertion sequence was present upstream of OXA-51 in one isolate, upstream of AmpC in 13 isolates and upstream of OXA-23 in 10 isolates. In silico analysis of carO sequences from analyzed A. baumannii isolates revealed the existence of two out of six highly polymorphic CarO variants. The phylogenetic analysis of CarO protein among Acinetobacter species revised the previous classification CarO variants into three groups based on strong bootstraps scores in the tree analysis. Group I comprises four variants (I-IV) while Groups II and III contain only one variant each. One half of the Serbian clinical isolates belong to Group I variant I, while the other half belongs to Group I variant III. PMID:25822626

Discovery and profiling of novel and conserved microRNAs during flower development in Carya cathayensis via deep sequencing.

PubMed

Wang, Zheng Jia; Huang, Jian Qin; Huang, You Jun; Li, Zheng; Zheng, Bing Song

2012-08-01

Hickory (Carya cathayensis Sarg.) is an economically important woody plant in China, but its long juvenile phase delays yield. MicroRNAs (miRNAs) are critical regulators of genes and important for normal plant development and physiology, including flower development. We used Solexa technology to sequence two small RNA libraries from two floral differentiation stages in hickory to identify miRNAs related to flower development. We identified 39 conserved miRNA sequences from 114 loci belonging to 23 families as well as two novel and ten potential novel miRNAs belonging to nine families. Moreover, 35 conserved miRNA*s and two novel miRNA*s were detected. Twenty miRNA sequences from 49 loci belonging to 11 families were differentially expressed; all were up-regulated at the later stage of flower development in hickory. Quantitative real-time PCR of 12 conserved miRNA sequences, five novel miRNA families, and two novel miRNA*s validated that all were expressed during hickory flower development, and the expression patterns were similar to those detected with Solexa sequencing. Finally, a total of 146 targets of the novel and conserved miRNAs were predicted. This study identified a diverse set of miRNAs that were closely related to hickory flower development and that could help in plant floral induction.

Evolutionary growth process of highly conserved sequences in vertebrate genomes.

PubMed

Ishibashi, Minaka; Noda, Akiko Ogura; Sakate, Ryuichi; Imanishi, Tadashi

2012-08-01

Genome sequence comparison between evolutionarily distant species revealed ultraconserved elements (UCEs) among mammals under strong purifying selection. Most of them were also conserved among vertebrates. Because they tend to be located in the flanking regions of developmental genes, they would have fundamental roles in creating vertebrate body plans. However, the evolutionary origin and selection mechanism of these UCEs remain unclear. Here we report that UCEs arose in primitive vertebrates, and gradually grew in vertebrate evolution. We searched for UCEs in two teleost fishes, Tetraodon nigroviridis and Oryzias latipes, and found 554 UCEs with 100% identity over 100 bps. Comparison of teleost and mammalian UCEs revealed 43 pairs of common, jawed-vertebrate UCEs (jUCE) with high sequence identities, ranging from 83.1% to 99.2%. Ten of them retain lower similarities to the Petromyzon marinus genome, and the substitution rates of four non-exonic jUCEs were reduced after the teleost-mammal divergence, suggesting that robust conservation had been acquired in the jawed vertebrate lineage. Our results indicate that prototypical UCEs originated before the divergence of jawed and jawless vertebrates and have been frozen as perfect conserved sequences in the jawed vertebrate lineage. In addition, our comparative sequence analyses of UCEs and neighboring regions resulted in a discovery of lineage-specific conserved sequences. They were added progressively to prototypical UCEs, suggesting step-wise acquisition of novel regulatory roles. Our results indicate that conserved non-coding elements (CNEs) consist of blocks with distinct evolutionary history, each having been frozen since different evolutionary era along the vertebrate lineage. Copyright © 2012 Elsevier B.V. All rights reserved.

Steady inviscid transonic flows over planar airfoils: A search for a simplified procedure

NASA Technical Reports Server (NTRS)

Magnus, R.; Yoshihara, H.

1973-01-01

A finite difference procedure based upon a system of unsteady equations in proper conservation form with either exact or small disturbance steady terms is used to calculate the steady flows over several classes of airfoils. The airfoil condition is fulfilled on a slab whose upstream extremity is a semi-circle overlaying the airfoil leading edge circle. The limitations of the small disturbance equations are demonstrated in an extreme example of a blunt-nosed, aft-cambered airfoil. The necessity of using the equations in proper conservation form to capture the shock properly is stressed. Ability of the steady relaxation procedures to capture the shock is briefly examined.

Sustainability of Water Resources in the Upstream Watershed- Based Community Engagement and Multistakeholder Cooperation

NASA Astrophysics Data System (ADS)

Brotosusilo, Agus; Utari, Dyah; Agung Satria, Afrizal

2016-02-01

The communities engagement become the backbone of the conservation in the Citanduy upstream watershed. It functioning as a major deal and the first one in keeping his own Watershed. This paper based on Community Engagement Grants (CEGs). Program Society-based empowerment approach is also emphasized in the viewpoint of environmental law that is useful to set governance and sanctions in watershed management. The type of activity to be undertaken are the expansion of awareness programs communities of the existence and condition of the watershed Citanduy, the formation of a cadre of conservationists environment that is primarily directed to children and women, the institutionalization of customary law environment, and afforestation by planting 100,000 prolific trees, tree conservationists, and Sunda endemic tree in the land surrounding the watershed upstream Citanduy. The Program involves several partners and stakeholders who helped in substance and operational support activities in the field.. Result of program shows that Community Engagement Grants need cooperation among stakeholders by positioning the community as main subject of changing, not as subject who does not understand their needs to change.

cisprimertool: software to implement a comparative genomics strategy for the development of conserved intron scanning (CIS) markers.

PubMed

Jayashree, B; Jagadeesh, V T; Hoisington, D

2008-05-01

The availability of complete, annotated genomic sequence information in model organisms is a rich resource that can be extended to understudied orphan crops through comparative genomic approaches. We report here a software tool (cisprimertool) for the identification of conserved intron scanning regions using expressed sequence tag alignments to a completely sequenced model crop genome. The method used is based on earlier studies reporting the assessment of conserved intron scanning primers (called CISP) within relatively conserved exons located near exon-intron boundaries from onion, banana, sorghum and pearl millet alignments with rice. The tool is freely available to academic users at http://www.icrisat.org/gt-bt/CISPTool.htm. © 2007 ICRISAT.

Conserved structures formed by heterogeneous RNA sequences drive silencing of an inflammation responsive post-transcriptional operon

PubMed Central

Basu, Abhijit; Jain, Niyati; Tolbert, Blanton S.; Komar, Anton A.

2017-01-01

Abstract RNA–protein interactions with physiological outcomes usually rely on conserved sequences within the RNA element. By contrast, activity of the diverse gamma-interferon-activated inhibitor of translation (GAIT)-elements relies on the conserved RNA folding motifs rather than the conserved sequence motifs. These elements drive the translational silencing of a group of chemokine (CC/CXC) and chemokine receptor (CCR) mRNAs, thereby helping to resolve physiological inflammation. Despite sequence dissimilarity, these RNA elements adopt common secondary structures (as revealed by 2D-1H NMR spectroscopy), providing a basis for their interaction with the RNA-binding GAIT complex. However, many of these elements (e.g. those derived from CCL22, CXCL13, CCR4 and ceruloplasmin (Cp) mRNAs) have substantially different affinities for GAIT complex binding. Toeprinting analysis shows that different positions within the overall conserved GAIT element structure contribute to differential affinities of the GAIT protein complex towards the elements. Thus, heterogeneity of GAIT elements may provide hierarchical fine-tuning of the resolution of inflammation. PMID:29069516

Early Evolution of Conserved Regulatory Sequences Associated with Development in Vertebrates

PubMed Central

McEwen, Gayle K.; Goode, Debbie K.; Parker, Hugo J.; Woolfe, Adam; Callaway, Heather; Elgar, Greg

2009-01-01

Comparisons between diverse vertebrate genomes have uncovered thousands of highly conserved non-coding sequences, an increasing number of which have been shown to function as enhancers during early development. Despite their extreme conservation over 500 million years from humans to cartilaginous fish, these elements appear to be largely absent in invertebrates, and, to date, there has been little understanding of their mode of action or the evolutionary processes that have modelled them. We have now exploited emerging genomic sequence data for the sea lamprey, Petromyzon marinus, to explore the depth of conservation of this type of element in the earliest diverging extant vertebrate lineage, the jawless fish (agnathans). We searched for conserved non-coding elements (CNEs) at 13 human gene loci and identified lamprey elements associated with all but two of these gene regions. Although markedly shorter and less well conserved than within jawed vertebrates, identified lamprey CNEs are able to drive specific patterns of expression in zebrafish embryos, which are almost identical to those driven by the equivalent human elements. These CNEs are therefore a unique and defining characteristic of all vertebrates. Furthermore, alignment of lamprey and other vertebrate CNEs should permit the identification of persistent sequence signatures that are responsible for common patterns of expression and contribute to the elucidation of the regulatory language in CNEs. Identifying the core regulatory code for development, common to all vertebrates, provides a foundation upon which regulatory networks can be constructed and might also illuminate how large conserved regulatory sequence blocks evolve and become fixed in genomic DNA. PMID:20011110

The location of a disease-associated polymorphism and genomic structure of the human 52-kDa Ro/SSA locus (SSA1)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsugu, H.; Horowitz, R.; Gibson, N.

1994-12-01

Sera from approximately 30% of patients with systemic lupus erythematosus (SLE) contain high titers of autoantibodies that bind to the 52-kDa Ro/SSA protein. We previously detected polymorphisms in the 52-kDa Ro/SSA gene (SSA1) with restriction enzymes, one of which is strongly associated with the presence of SLE (P < 0.0005) in African Americans. A higher disease frequency and more severe forms of the disease are commonly noted among these female patients. To determine the location and nature of this polymorphism, we obtained two clones that span 8.5 kb of the 52-kDa Ro/SSA locus including its upstream regulatory region. Six exonsmore » were identified, and their nucleotide sequences plus adjacent noncoding regions were determined. No differences were found between these exons and the coding region of one of the reported cDNAs. The disease-associated polymorphic site suggested by a restriction enzyme map and confirmed by DNA amplification and nucleotide sequencing was present upstream of exon 1. This polymorphism may be a genetic marker for a disease-related variation in the coding region for the protein or in the upstream regulatory region of this gene. Although this RFLP is present in Japanese, it is not associated with lupus in this race. 41 refs., 4 figs., 2 tabs.« less

Observations on the Growth of Roughness Elements Into Icing Feathers

NASA Technical Reports Server (NTRS)

Vargas, Mario; Tsao, Jen, Ching

2007-01-01

This work presents the results of an experiment conducted in the Icing Research Tunnel at NASA Glenn Research Center to understand the process by which icing feathers are formed in the initial stages of ice accretion formation on swept wings. Close-up photographic data were taken on an aluminum NACA 0012 swept wing tip airfoil. Two types of photographic data were obtained: time sequence close-up photographic data during the run and close-up photographic data of the ice accretion at the end of each run. Icing runs were conducted for short ice accretion times from 10 to 180 sec. The time sequence close-up photographic data was used to study the process frame by frame and to create movies of how the process developed. The movies confirmed that at glaze icing conditions in the attachment line area icing feathers develop from roughness elements. The close-up photographic data at the end of each run showed that roughness elements change into a pointed shape with an upstream facet and join on the side with other elements having the same change to form ridges with pointed shape and upstream facet. The ridges develop into feathers when the upstream facet grows away to form the stem of the feather. The ridges and their growth into feathers were observed to form the initial scallop tips present in complete scallops.

Transcription Start Site Evolution in Drosophila

PubMed Central

Main, Bradley J.; Smith, Andrew D.; Jang, Hyosik; Nuzhdin, Sergey V.

2013-01-01

Transcription start site (TSS) evolution remains largely undescribed in Drosophila, likely due to limited annotations in non-melanogaster species. In this study, we introduce a concise new method that selectively sequences from the 5′-end of mRNA and used it to identify TSS in four Drosophila species, including Drosophila melanogaster, D. simulans, D. sechellia, and D. pseudoobscura. For verification, we compared our results in D. melanogaster with known annotations, published 5′-rapid amplification of cDNA ends data, and with RNAseq from the same mRNA pool. Then, we paired 2,849 D. melanogaster TSS with its closest equivalent TSS in each species (likely to be its true ortholog) using the available multiple sequence alignments. Most of the D. melanogaster TSSs were successfully paired with an ortholog in each species (83%, 86%, and 55% for D. simulans, D. sechellia, and D. pseudoobscura, respectively). On the basis of the number and distribution of reads mapped at each TSS, we also estimated promoter-specific expression (PSE) and TSS peak shape, respectively. Among paired TSS orthologs, the location and promoter activity were largely conserved. TSS location appears important as PSE, and TSS peak shape was more frequently divergent among TSS that had moved. Unpaired TSS were surprisingly common in D. pseudoobscura. An increased mutation rate upstream of TSS might explain this pattern. We found an enrichment of ribosomal protein genes among diverged TSS, suggesting that TSS evolution is not uniform across the genome. PMID:23649539

The complete mitochondrial genome of the pink stem borer, Sesamia inferens, in comparison with four other Noctuid moths.

PubMed

Chai, Huan-Na; Du, Yu-Zhou

2012-01-01

The complete 15,413-bp mitochondrial genome (mitogenome) of Sesamia inferens (Walker) (Lepidoptera: Noctuidae) was sequenced and compared with those of four other noctuid moths. All of the mitogenomes analyzed displayed similar characteristics with respect to gene content, genome organization, nucleotide comparison, and codon usages. Twelve-one protein-coding genes (PCGs) utilized the standard ATN, but the cox1 gene used CGA as the initiation codon; cox1, cox2, and nad4 genes had the truncated termination codon T in the S. inferens mitogenome. All of the tRNA genes had typical cloverleaf secondary structures except for trnS1(AGN), in which the dihydrouridine (DHU) arm did not form a stable stem-loop structure. Both the secondary structures of rrnL and rrnS genes inferred from the S. inferens mitogenome closely resembled those of other noctuid moths. In the A+T-rich region, the conserved motif "ATAGA" followed by a long T-stretch was observed in all noctuid moths, but other specific tandem-repeat elements were more variable. Additionally, the S. inferens mitogenome contained a potential stem-loop structure, a duplicated 17-bp repeat element, a decuplicated segment, and a microsatellite "(AT)(7)", without a poly-A element upstream of the trnM in the A+T-rich region. Finally, the phylogenetic relationships were reconstructed based on amino acid sequences of mitochondrial 13 PCGs, which support the traditional morphologically based view of relationships within the Noctuidae.

The Complete Mitochondrial Genome of the Pink Stem Borer, Sesamia inferens, in Comparison with Four Other Noctuid Moths

PubMed Central

Chai, Huan-Na; Du, Yu-Zhou

2012-01-01

The complete 15,413-bp mitochondrial genome (mitogenome) of Sesamia inferens (Walker) (Lepidoptera: Noctuidae) was sequenced and compared with those of four other noctuid moths. All of the mitogenomes analyzed displayed similar characteristics with respect to gene content, genome organization, nucleotide comparison, and codon usages. Twelve-one protein-coding genes (PCGs) utilized the standard ATN, but the cox1 gene used CGA as the initiation codon; cox1, cox2, and nad4 genes had the truncated termination codon T in the S. inferens mitogenome. All of the tRNA genes had typical cloverleaf secondary structures except for trnS1(AGN), in which the dihydrouridine (DHU) arm did not form a stable stem-loop structure. Both the secondary structures of rrnL and rrnS genes inferred from the S. inferens mitogenome closely resembled those of other noctuid moths. In the A+T-rich region, the conserved motif “ATAGA” followed by a long T-stretch was observed in all noctuid moths, but other specific tandem-repeat elements were more variable. Additionally, the S. inferens mitogenome contained a potential stem-loop structure, a duplicated 17-bp repeat element, a decuplicated segment, and a microsatellite “(AT)7”, without a poly-A element upstream of the trnM in the A+T-rich region. Finally, the phylogenetic relationships were reconstructed based on amino acid sequences of mitochondrial 13 PCGs, which support the traditional morphologically based view of relationships within the Noctuidae. PMID:22949858

SeqFIRE: a web application for automated extraction of indel regions and conserved blocks from protein multiple sequence alignments.

PubMed

Ajawatanawong, Pravech; Atkinson, Gemma C; Watson-Haigh, Nathan S; Mackenzie, Bryony; Baldauf, Sandra L

2012-07-01

Analyses of multiple sequence alignments generally focus on well-defined conserved sequence blocks, while the rest of the alignment is largely ignored or discarded. This is especially true in phylogenomics, where large multigene datasets are produced through automated pipelines. However, some of the most powerful phylogenetic markers have been found in the variable length regions of multiple alignments, particularly insertions/deletions (indels) in protein sequences. We have developed Sequence Feature and Indel Region Extractor (SeqFIRE) to enable the automated identification and extraction of indels from protein sequence alignments. The program can also extract conserved blocks and identify fast evolving sites using a combination of conservation and entropy. All major variables can be adjusted by the user, allowing them to identify the sets of variables most suited to a particular analysis or dataset. Thus, all major tasks in preparing an alignment for further analysis are combined in a single flexible and user-friendly program. The output includes a numbered list of indels, alignments in NEXUS format with indels annotated or removed and indel-only matrices. SeqFIRE is a user-friendly web application, freely available online at www.seqfire.org/.

Regulation of iron assimilation: nucleotide sequence analysis of an iron-regulated promoter from a fluorescent pseudomonad.

PubMed

O'Sullivan, D J; O'Gara, F

1991-08-01

An iron-regulated promoter was cloned on a 2.1 kb Bg/II fragment from Pseudomonas sp. strain M114 and fused to the lacZ reporter gene. Iron-regulated lacZ expression from the resulting construct (pSP1) in strain M114 was mediated via the Fur-like repressor which also regulates siderophore production in this strain. A 390 bp StuI-PstI internal fragment contained the necessary information for iron-regulated promoter expression. This fragment was sequenced and the initiation point for transcription was determined by primer extension analysis. The region directly upstream of the transcription start point contained no significant homology to known promoter consensus sequences. However the -16 to -25 bp region contained homology to four other iron-regulated pseudomonad promoters. Deletion of bases downstream from the transcriptional start did not affect the iron-regulated expression of the promoter. The -37 and -43 bp regions exhibited some homology to the 19 bp Escherichia coli Fur-binding consensus sequence. When expressed in E. coli (via a cloned transacting factor from strain M114) lacZ expression from pSP1 was found to be regulated by iron. A region of greater than 77 bases but less than 131 upstream from the transcriptional start was found to be necessary for promoter activity, further suggesting that a transcriptional activator may be required for expression.

Identification of B Cells as a Major Site for Cyprinid Herpesvirus 3 Latency

PubMed Central

Reed, Aimee N.; Izume, Satoko; Dolan, Brian P.; LaPatra, Scott; Kent, Michael; Dong, Jing

2014-01-01

ABSTRACT Cyprinid herpesvirus 3 (CyHV-3), commonly known as koi herpesvirus (KHV), is a member of the Alloherpesviridae, and is a recently discovered emerging herpesvirus that is highly pathogenic for koi and common carp. Our previous study demonstrated that CyHV-3 becomes latent in peripheral white blood cells (WBC). In this study, CyHV-3 latency was further investigated in IgM+ WBC. The presence of the CyHV-3 genome in IgM+ WBC was about 20-fold greater than in IgM− WBC. To determine whether CyHV-3 expressed genes during latency, transcription from all eight open reading frames (ORFs) in the terminal repeat was investigated in IgM+ WBC from koi with latent CyHV-3 infection. Only a spliced ORF6 transcript was found to be abundantly expressed in IgM+ WBC from CyHV-3 latently infected koi. The spliced ORF6 transcript was also detected in vitro during productive infection as early as 1 day postinfection. The ORF6 transcript from in vitro infection begins at −127 bp upstream of the ATG codon and ends +188 bp downstream of the stop codon, +20 bp downstream of the polyadenylation signal. The hypothetical protein of ORF6 contains a consensus sequence with homology to a conserved domain of EBNA-3B and ICP4 from Epstein-Barr virus and herpes simplex virus 1, respectively, both members of the Herpesviridae. This is the first report of latent CyHV-3 in B cells and identification of gene transcription during latency for a member of the Alloherpesviridae. IMPORTANCE This is the first demonstration that a member of the Alloherpesviridae, cyprinid herpesvirus 3 (CyHV-3), establishes a latent infection in the B cells of its host, Cyprinus carpio. In addition, this is the first report of identification of gene transcription during latency for a member of Herpesvirales outside Herpesviridae. This is also the first report that the hypothetical protein of latent transcript of CyHV-3 contains a consensus sequence with homology to a conserved domain of EBNA-3B from Epstein-Barr virus and ICP4 from herpes simplex virus 1, which are genes important for latency. These strongly suggest that latency is evolutionally conserved across vertebrates. PMID:24899202

Identification of B cells as a major site for cyprinid herpesvirus 3 latency.

PubMed

Reed, Aimee N; Izume, Satoko; Dolan, Brian P; LaPatra, Scott; Kent, Michael; Dong, Jing; Jin, Ling

2014-08-01

Cyprinid herpesvirus 3 (CyHV-3), commonly known as koi herpesvirus (KHV), is a member of the Alloherpesviridae, and is a recently discovered emerging herpesvirus that is highly pathogenic for koi and common carp. Our previous study demonstrated that CyHV-3 becomes latent in peripheral white blood cells (WBC). In this study, CyHV-3 latency was further investigated in IgM(+) WBC. The presence of the CyHV-3 genome in IgM(+) WBC was about 20-fold greater than in IgM(-) WBC. To determine whether CyHV-3 expressed genes during latency, transcription from all eight open reading frames (ORFs) in the terminal repeat was investigated in IgM(+) WBC from koi with latent CyHV-3 infection. Only a spliced ORF6 transcript was found to be abundantly expressed in IgM(+) WBC from CyHV-3 latently infected koi. The spliced ORF6 transcript was also detected in vitro during productive infection as early as 1 day postinfection. The ORF6 transcript from in vitro infection begins at -127 bp upstream of the ATG codon and ends +188 bp downstream of the stop codon, +20 bp downstream of the polyadenylation signal. The hypothetical protein of ORF6 contains a consensus sequence with homology to a conserved domain of EBNA-3B and ICP4 from Epstein-Barr virus and herpes simplex virus 1, respectively, both members of the Herpesviridae. This is the first report of latent CyHV-3 in B cells and identification of gene transcription during latency for a member of the Alloherpesviridae. This is the first demonstration that a member of the Alloherpesviridae, cyprinid herpesvirus 3 (CyHV-3), establishes a latent infection in the B cells of its host, Cyprinus carpio. In addition, this is the first report of identification of gene transcription during latency for a member of Herpesvirales outside Herpesviridae. This is also the first report that the hypothetical protein of latent transcript of CyHV-3 contains a consensus sequence with homology to a conserved domain of EBNA-3B from Epstein-Barr virus and ICP4 from herpes simplex virus 1, which are genes important for latency. These strongly suggest that latency is evolutionally conserved across vertebrates. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liebhaber, S.A.; Weiss, I.; Cash, F.E.

Synthesis of normal human hemoglobin A, {alpha}{sub 2}{beta}{sub 2}, is based upon balanced expression of genes in the {alpha}-globin gene cluster on chromosome 15 and the {beta}-globin gene cluster on chromosome 11. Full levels of erythroid-specific activation of the {beta}-globin cluster depend on sequences located at a considerable distance 5{prime} to the {beta}-globin gene, referred to as the locus-activating or dominant control region. The existence of an analogous element(s) upstream of the {alpha}-globin cluster has been suggested from observations on naturally occurring deletions and experimental studies. The authors have identified an individual with {alpha}-thalassemia in whom structurally normal {alpha}-globin genesmore » have been inactivated in cis by a discrete de novo 35-kilobase deletion located {approximately}30 kilobases 5{prime} from the {alpha}-globin gene cluster. They conclude that this deletion inactivates expression of the {alpha}-globin genes by removing one or more of the previously identified upstream regulatory sequences that are critical to expression of the {alpha}-globin genes.« less

Computation of Feedback Aeroacoustic System by the CE/SE Method

NASA Technical Reports Server (NTRS)

Loh, Ching Y.; Wang, Xiao Y.; Chang, Sin-Chung; Jorgenson, Philip C. E.

2000-01-01

It is well known that due to vortex shedding in high speed flow over cutouts, cavities, and gaps, intense noise may be generated. Strong tonal oscillations occur in a feedback cycle in which the vortices shed from the upstream edge of the cavity convect downstream and impinge on the cavity lip, generating acoustic waves that propagate upstream to excite new vortices. Numerical simulation of such a complicated process requires a scheme that can: (1) resolve acoustic waves with low dispersion and numerical dissipation, (2) handle nonlinear and discontinuous waves (e.g. shocks), and (3) have an effective (near field) nonreflecting boundary condition (NRBC). The new space time conservation element and solution element method, or CE/SE for short, is a numerical method that meets the above requirements.

Principles of regulatory information conservation between mouse and human.

PubMed

Cheng, Yong; Ma, Zhihai; Kim, Bong-Hyun; Wu, Weisheng; Cayting, Philip; Boyle, Alan P; Sundaram, Vasavi; Xing, Xiaoyun; Dogan, Nergiz; Li, Jingjing; Euskirchen, Ghia; Lin, Shin; Lin, Yiing; Visel, Axel; Kawli, Trupti; Yang, Xinqiong; Patacsil, Dorrelyn; Keller, Cheryl A; Giardine, Belinda; Kundaje, Anshul; Wang, Ting; Pennacchio, Len A; Weng, Zhiping; Hardison, Ross C; Snyder, Michael P

2014-11-20

To broaden our understanding of the evolution of gene regulation mechanisms, we generated occupancy profiles for 34 orthologous transcription factors (TFs) in human-mouse erythroid progenitor, lymphoblast and embryonic stem-cell lines. By combining the genome-wide transcription factor occupancy repertoires, associated epigenetic signals, and co-association patterns, here we deduce several evolutionary principles of gene regulatory features operating since the mouse and human lineages diverged. The genomic distribution profiles, primary binding motifs, chromatin states, and DNA methylation preferences are well conserved for TF-occupied sequences. However, the extent to which orthologous DNA segments are bound by orthologous TFs varies both among TFs and with genomic location: binding at promoters is more highly conserved than binding at distal elements. Notably, occupancy-conserved TF-occupied sequences tend to be pleiotropic; they function in several tissues and also co-associate with many TFs. Single nucleotide variants at sites with potential regulatory functions are enriched in occupancy-conserved TF-occupied sequences.

Non coding extremities of the seven influenza virus type C vRNA segments: effect on transcription and replication by the type C and type A polymerase complexes

PubMed Central

Crescenzo-Chaigne, Bernadette; Barbezange, Cyril; van der Werf, Sylvie

2008-01-01

Background The transcription/replication of the influenza viruses implicate the terminal nucleotide sequences of viral RNA, which comprise sequences at the extremities conserved among the genomic segments as well as variable 3' and 5' non-coding (NC) regions. The plasmid-based system for the in vivo reconstitution of functional ribonucleoproteins, upon expression of viral-like RNAs together with the nucleoprotein and polymerase proteins has been widely used to analyze transcription/replication of influenza viruses. It was thus shown that the type A polymerase could transcribe and replicate type A, B, or C vRNA templates whereas neither type B nor type C polymerases were able to transcribe and replicate type A templates efficiently. Here we studied the importance of the NC regions from the seven segments of type C influenza virus for efficient transcription/replication by the type A and C polymerases. Results The NC sequences of the seven genomic segments of the type C influenza virus C/Johannesburg/1/66 strain were found to be more variable in length than those of the type A and B viruses. The levels of transcription/replication of viral-like vRNAs harboring the NC sequences of the respective type C virus segments flanking the CAT reporter gene were comparable in the presence of either type C or type A polymerase complexes except for the NS and PB2-like vRNAs. For the NS-like vRNA, the transcription/replication level was higher after introduction of a U residue at position 6 in the 5' NC region as for all other segments. For the PB2-like vRNA the CAT expression level was particularly reduced with the type C polymerase. Analysis of mutants of the 5' NC sequence in the PB2-like vRNA, the shortest 5' NC sequence among the seven segments, showed that additional sequences within the PB2 ORF were essential for the efficiency of transcription but not replication by the type C polymerase complex. Conclusion In the context of a PB2-like reporter vRNA template, the sequence upstream the polyU stretch plays a role in the transcription/replication process by the type C polymerase complex. PMID:18973655

Functionally essential, invariant glutamate near the C-terminus of strand beta 5 in various (alpha/beta)8-barrel enzymes as a possible indicator of their evolutionary relatedness.

PubMed

Janecek, S; Baláz, S

1995-08-01

Twelve different (alpha/beta)8-barrel enzymes belonging to three structurally distinct families were found to contain, near the C-terminus of their strand beta 5, a conserved invariant glutamic acid residue that plays an important functional role in each of these enzymes. The search was based on the idea that a conserved sequence region of an (alpha/beta)8-barrel enzyme should be more or less conserved also in the equivalent part of the structure of the other enzymes with this folding motif owing to their mutual evolutionary relatedness. For this purpose, the sequence region around the well conserved fifth beta-strand of alpha-amylase containing catalytic glutamate (Glu230, Aspergillus oryzae alpha-amylase numbering), was used as the sequence-structural template. The isolated sequence stretches of the 12 (alpha/beta)8-barrels are discussed from both the sequence-structural and the evolutionary point of view, the invariant glutamate residue being proposed to be a joining feature of the studied group of enzymes remaining from their ancestral (alpha/beta)8-barrel.

Comparative analysis of the small RNA transcriptomes of Pinus contorta and Oryza sativa

PubMed Central

Morin, Ryan D.; Aksay, Gozde; Dolgosheina, Elena; Ebhardt, H. Alexander; Magrini, Vincent; Mardis, Elaine R.; Sahinalp, S. Cenk; Unrau, Peter J.

2008-01-01

The diversity of microRNAs and small-interfering RNAs has been extensively explored within angiosperms by focusing on a few key organisms such as Oryza sativa and Arabidopsis thaliana. A deeper division of the plants is defined by the radiation of the angiosperms and gymnosperms, with the latter comprising the commercially important conifers. The conifers are expected to provide important information regarding the evolution of highly conserved small regulatory RNAs. Deep sequencing provides the means to characterize and quantitatively profile small RNAs in understudied organisms such as these. Pyrosequencing of small RNAs from O. sativa revealed, as expected, ∼21- and ∼24-nt RNAs. The former contained known microRNAs, and the latter largely comprised intergenic-derived sequences likely representing heterochromatin siRNAs. In contrast, sequences from Pinus contorta were dominated by 21-nt small RNAs. Using a novel sequence-based clustering algorithm, we identified sequences belonging to 18 highly conserved microRNA families in P. contorta as well as numerous clusters of conserved small RNAs of unknown function. Using multiple methods, including expressed sequence folding and machine learning algorithms, we found a further 53 candidate novel microRNA families, 51 appearing specific to the P. contorta library. In addition, alignment of small RNA sequences to the O. sativa genome revealed six perfectly conserved classes of small RNA that included chloroplast transcripts and specific types of genomic repeats. The conservation of microRNAs and other small RNAs between the conifers and the angiosperms indicates that important RNA silencing processes were highly developed in the earliest spermatophytes. Genomic mapping of all sequences to the O. sativa genome can be viewed at http://microrna.bcgsc.ca/cgi-bin/gbrowse/rice_build_3/. PMID:18323537

Characterization of Clostridium perfringens iota-toxin genes and expression in Escherichia coli.

PubMed Central

Perelle, S; Gibert, M; Boquet, P; Popoff, M R

1993-01-01

The iota toxin which is produced by Clostridium perfringens type E, is a binary toxin consisting of two independent polypeptides: Ia, which is an ADP-ribosyltransferase, and Ib, which is involved in the binding and internalization of the toxin into the cell. Two degenerate oligonucleotide probes deduced from partial amino acid sequence of each component of C. spiroforme toxin, which is closely related to the iota toxin, were used to clone three overlapping DNA fragments containing the iota-toxin genes from C. perfringens type E plasmid DNA. Two genes, in the same orientation, coding for Ia (387 amino acids) and Ib (875 amino acids) and separated by 243 noncoding nucleotides were identified. A predicted signal peptide was found for each component, and the secreted Ib displays two domains, the propeptide (172 amino acids) and the mature protein (664 amino acids). The Ia gene has been expressed in Escherichia coli and C. perfringens, under the control of its own promoter. The recombinant polypeptide obtained was recognized by Ia antibodies and ADP-ribosylated actin. The expression of the Ib gene was obtained in E. coli harboring a recombinant plasmid encompassing the putative promoter upstream of the Ia gene and the Ia and Ib genes. Two residues which have been found to be involved in the NAD+ binding site of diphtheria and pseudomonas toxins are conserved in the predicted Ia sequence (Glu-14 and Trp-19). The predicted amino acid Ib sequence shows 33.9% identity with and 54.4% similarity to the protective antigen of the anthrax toxin complex. In particular, the central region of Ib, which contains a predicted transmembrane segment (Leu-292 to Ser-308), presents 45% identity with the corresponding protective antigen sequence which is involved in the translocation of the toxin across the cell membrane. Images PMID:8225592

The complete mitochondrial genome of the fall webworm, Hyphantria cunea (Lepidoptera: Arctiidae)

PubMed Central

Liao, Fang; Wang, Lin; Wu, Song; Li, Yu-Ping; Zhao, Lei; Huang, Guo-Ming; Niu, Chun-Jing; Liu, Yan-Qun; Li, Ming-Gang

2010-01-01

The complete mitochondrial genome (mitogenome) of the fall webworm, Hyphantria cunea (Lepidoptera: Arctiidae) was determined. The genome is a circular molecule 15 481 bp long. It presents a typical gene organization and order for completely sequenced lepidopteran mitogenomes, but differs from the insect ancestral type for the placement of tRNAMet. The nucleotide composition of the genome is also highly A + T biased, accounting for 80.38%, with a slightly positive AT skewness (0.010), indicating the occurrence of more As than Ts, as found in the Noctuoidea species. All protein-coding genes (PCGs) are initiated by ATN codons, except for COI, which is tentatively designated by the CGA codon as observed in other lepidopterans. Four of 13 PCGs harbor the incomplete termination codon, T or TA. All tRNAs have a typical clover-leaf structure of mitochondrial tRNAs, except for tRNASer(AGN), the DHU arm of which could not form a stable stem-loop structure. The intergenic spacer sequence between tRNASer(AGN) and ND1 also contains the ATACTAA motif, which is conserved across the Lepidoptera order. The H. cunea A+T-rich region of 357 bp is comprised of non-repetitive sequences, but harbors several features common to the Lepidoptera insects, including the motif ATAGA followed by an 18 bp poly-T stretch, a microsatellite-like (AT)8 element preceded by the ATTTA motif, an 11 bp poly-A present immediately upstream tRNAMet. The phylogenetic analyses support the view that the H. cunea is closerly related to the Lymantria dispar than Ochrogaster lunifer, and support the hypothesis that Noctuoidea (H. cunea, L. dispar, and O. lunifer) and Geometroidea (Phthonandria atrilineata) are monophyletic. However, in the phylogenetic trees based on mitogenome sequences among the lepidopteran superfamilies, Papillonoidea (Artogeia melete, Acraea issoria, and Coreana raphaelis) joined basally within the monophyly of Lepidoptera, which is different to the traditional classification. PMID:20376208

Influence of Forced Flow on the Dendritic Growth of Fe-C Alloy: 3D vs 2D Simulation

NASA Astrophysics Data System (ADS)

Wang, Weiling; Wang, Zhaohui; Luo, Sen; Ji, Cheng; Zhu, Miaoyong

2017-12-01

A 3D parallel cellular automaton-finite volume method (CA-FVM) model was used to simulate the equiaxed dendritic growth of an Fe-0.82 wt pct C alloy with xy- in- out and xyz- in- out type forced flows and the columnar dendritic growth with y- in- out type forced flow. In addition, the similarities and differences between the results of the 3D and 2D models are discussed and summarized in detail. The capabilities of the 3D and 2D CA-FVM models to predict the dendritic growth of the alloy with forced flow are validated through comparison with the boundary layer correction and Oseen-Ivanstov models, respectively. Because the forced flow can pass around perpendicular arms of the dendrites, the secondary arms at the sides upstream from the perpendicular arms are more developed than those on the upstream side of the upstream arms, especially at higher inlet velocities. In addition, compared to the xy- in- out case, the growth of the downstream arms is less inhibited and the secondary arms are more developed in the xyz- in- out case because of the greater lateral flow around their tips. Compared to the 3D case, the 2D equiaxed dendrites are more asymmetrical and lack secondary arms because of the thicker solute envelope. In the 3D case, the columnar dendrites on the upstream side (left one) are promoted, while the middle and downstream dendrites are inhibited in sequence. However, the sequential inhibition starts on the upstream side in the 2D case. This is mainly because the melt can pass around the upstream branch in 3D space. However, it can only climb over the upstream tip in 2D space. Additionally, the secondary arms show upstream development, which is more significant with increasing inlet velocity. The level of development of the secondary arms is also affected by the decay of the forced flow in the flow direction.

Strategies for conserving native salmonid populations at risk from nonnative fish invasions: tradeoffs in using barriers to upstream movement

Treesearch

Kurt D. Fausch; Bruce E. Rieman; Michael Young; Jason B. Dunham

2006-01-01

Native salmonid populations in the inland West are often restricted to small isolated habitats at risk from invasion by nonnative salmonids. However, further isolating these populations using barriers to prevent invasions can increase their extinction risk. This monograph reviews the state of knowledge about this tradeoff between invasion and isolation. We present a...

DNA methylation inhibits expression and transposition of the Neurospora Tad retrotransposon.

PubMed

Zhou, Y; Cambareri, E B; Kinsey, J A

2001-06-01

Tad is a LINE-like retrotransposon of the filamentous fungus Neurospora crassa. We have analyzed both expression and transposition of this element using strains with a single copy of Tad located in the 5' noncoding sequences of the am (glutamate dehydrogenase) gene. Tad in this position has been shown to carry a de novo cytosine methylation signal which causes reversible methylation of both Tad and am upstream sequences. Here we find that methylation of the Tad sequences inhibits both Tad expression and transposition. This inhibition can be relieved by the use of 5-azacytidine, a drug which reduces cytosine methylation, or by placing the Tad/am sequences in a dim-2 genetic background.

Computational identification of developmental enhancers:conservation and function of transcription factor binding-site clustersin drosophila melanogaster and drosophila psedoobscura

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berman, Benjamin P.; Pfeiffer, Barret D.; Laverty, Todd R.

2004-08-06

The identification of sequences that control transcription in metazoans is a major goal of genome analysis. In a previous study, we demonstrated that searching for clusters of predicted transcription factor binding sites could discover active regulatory sequences, and identified 37 regions of the Drosophila melanogaster genome with high densities of predicted binding sites for five transcription factors involved in anterior-posterior embryonic patterning. Nine of these clusters overlapped known enhancers. Here, we report the results of in vivo functional analysis of 27 remaining clusters. We generated transgenic flies carrying each cluster attached to a basal promoter and reporter gene, and assayedmore » embryos for reporter gene expression. Six clusters are enhancers of adjacent genes: giant, fushi tarazu, odd-skipped, nubbin, squeeze and pdm2; three drive expression in patterns unrelated to those of neighboring genes; the remaining 18 do not appear to have enhancer activity. We used the Drosophila pseudoobscura genome to compare patterns of evolution in and around the 15 positive and 18 false-positive predictions. Although conservation of primary sequence cannot distinguish true from false positives, conservation of binding-site clustering accurately discriminates functional binding-site clusters from those with no function. We incorporated conservation of binding-site clustering into a new genome-wide enhancer screen, and predict several hundred new regulatory sequences, including 85 adjacent to genes with embryonic patterns. Measuring conservation of sequence features closely linked to function--such as binding-site clustering--makes better use of comparative sequence data than commonly used methods that examine only sequence identity.« less

Oligo kernels for datamining on biological sequences: a case study on prokaryotic translation initiation sites

PubMed Central

Meinicke, Peter; Tech, Maike; Morgenstern, Burkhard; Merkl, Rainer

2004-01-01

Background Kernel-based learning algorithms are among the most advanced machine learning methods and have been successfully applied to a variety of sequence classification tasks within the field of bioinformatics. Conventional kernels utilized so far do not provide an easy interpretation of the learnt representations in terms of positional and compositional variability of the underlying biological signals. Results We propose a kernel-based approach to datamining on biological sequences. With our method it is possible to model and analyze positional variability of oligomers of any length in a natural way. On one hand this is achieved by mapping the sequences to an intuitive but high-dimensional feature space, well-suited for interpretation of the learnt models. On the other hand, by means of the kernel trick we can provide a general learning algorithm for that high-dimensional representation because all required statistics can be computed without performing an explicit feature space mapping of the sequences. By introducing a kernel parameter that controls the degree of position-dependency, our feature space representation can be tailored to the characteristics of the biological problem at hand. A regularized learning scheme enables application even to biological problems for which only small sets of example sequences are available. Our approach includes a visualization method for transparent representation of characteristic sequence features. Thereby importance of features can be measured in terms of discriminative strength with respect to classification of the underlying sequences. To demonstrate and validate our concept on a biochemically well-defined case, we analyze E. coli translation initiation sites in order to show that we can find biologically relevant signals. For that case, our results clearly show that the Shine-Dalgarno sequence is the most important signal upstream a start codon. The variability in position and composition we found for that signal is in accordance with previous biological knowledge. We also find evidence for signals downstream of the start codon, previously introduced as transcriptional enhancers. These signals are mainly characterized by occurrences of adenine in a region of about 4 nucleotides next to the start codon. Conclusions We showed that the oligo kernel can provide a valuable tool for the analysis of relevant signals in biological sequences. In the case of translation initiation sites we could clearly deduce the most discriminative motifs and their positional variation from example sequences. Attractive features of our approach are its flexibility with respect to oligomer length and position conservation. By means of these two parameters oligo kernels can easily be adapted to different biological problems. PMID:15511290

Genomic sequences of murine gamma B- and gamma C-crystallin-encoding genes: promoter analysis and complete evolutionary pattern of mouse, rat and human gamma-crystallins.

PubMed

Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T

1993-12-22

The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.

Conserved noncoding sequences (CNSs) in higher plants.

PubMed

Freeling, Michael; Subramaniam, Shabarinath

2009-04-01

Plant conserved noncoding sequences (CNSs)--a specific category of phylogenetic footprint--have been shown experimentally to function. No plant CNS is conserved to the extent that ultraconserved noncoding sequences are conserved in vertebrates. Plant CNSs are enriched in known transcription factor or other cis-acting binding sites, and are usually clustered around genes. Genes that encode transcription factors and/or those that respond to stimuli are particularly CNS-rich. Only rarely could this function involve small RNA binding. Some transcribed CNSs encode short translation products as a form of negative control. Approximately 4% of Arabidopsis gene content is estimated to be both CNS-rich and occupies a relatively long stretch of chromosome: Bigfoot genes (long phylogenetic footprints). We discuss a 'DNA-templated protein assembly' idea that might help explain Bigfoot gene CNSs.

Genetic differences between blood- and brain-derived viral sequences from human immunodeficiency virus type 1-infected patients: evidence of conserved elements in the V3 region of the envelope protein of brain-derived sequences.

PubMed Central

Korber, B T; Kunstman, K J; Patterson, B K; Furtado, M; McEvilly, M M; Levy, R; Wolinsky, S M

1994-01-01

Human immunodeficiency virus type 1 (HIV-1) sequences were generated from blood and from brain tissue obtained by stereotactic biopsy from six patients undergoing a diagnostic neurosurgical procedure. Proviral DNA was directly amplified by nested PCR, and 8 to 36 clones from each sample were sequenced. Phylogenetic analysis of intrapatient envelope V3-V5 region HIV-1 DNA sequence sets revealed that brain viral sequences were clustered relative to the blood viral sequences, suggestive of tissue-specific compartmentalization of the virus in four of the six cases. In the other two cases, the blood and brain virus sequences were intermingled in the phylogenetic analyses, suggesting trafficking of virus between the two tissues. Slide-based PCR-driven in situ hybridization of two of the patients' brain biopsy samples confirmed our interpretation of the intrapatient phylogenetic analyses. Interpatient V3 region brain-derived sequence distances were significantly less than blood-derived sequence distances. Relative to the tip of the loop, the set of brain-derived viral sequences had a tendency towards negative or neutral charge compared with the set of blood-derived viral sequences. Entropy calculations were used as a measure of the variability at each position in alignments of blood and brain viral sequences. A relatively conserved set of positions were found, with a significantly lower entropy in the brain-than in the blood-derived viral sequences. These sites constitute a brain "signature pattern," or a noncontiguous set of amino acids in the V3 region conserved in viral sequences derived from brain tissue. This brain-derived signature pattern was also well preserved among isolates previously characterized in vitro as macrophage tropic. Macrophage-monocyte tropism may be the biological constraint that results in the conservation of the viral brain signature pattern. Images PMID:7933130

The kinetoplast DNA of the Australian trypanosome, Trypanosoma copemani, shares features with Trypanosoma cruzi and Trypanosoma lewisi.

PubMed

Botero, Adriana; Kapeller, Irit; Cooper, Crystal; Clode, Peta L; Shlomai, Joseph; Thompson, R C Andrew

2018-05-17

Kinetoplast DNA (kDNA) is the mitochondrial genome of trypanosomatids. It consists of a few dozen maxicircles and several thousand minicircles, all catenated topologically to form a two-dimensional DNA network. Minicircles are heterogeneous in size and sequence among species. They present one or several conserved regions that contain three highly conserved sequence blocks. CSB-1 (10 bp sequence) and CSB-2 (8 bp sequence) present lower interspecies homology, while CSB-3 (12 bp sequence) or the Universal Minicircle Sequence is conserved within most trypanosomatids. The Universal Minicircle Sequence is located at the replication origin of the minicircles, and is the binding site for the UMS binding protein, a protein involved in trypanosomatid survival and virulence. Here, we describe the structure and organisation of the kDNA of Trypanosoma copemani, a parasite that has been shown to infect mammalian cells and has been associated with the drastic decline of the endangered Australian marsupial, the woylie (Bettongia penicillata). Deep genomic sequencing showed that T. copemani presents two classes of minicircles that share sequence identity and organisation in the conserved sequence blocks with those of Trypanosoma cruzi and Trypanosoma lewisi. A 19,257 bp partial region of the maxicircle of T. copemani that contained the entire coding region was obtained. Comparative analysis of the T. copemani entire maxicircle coding region with the coding regions of T. cruzi and T. lewisi showed they share 71.05% and 71.28% identity, respectively. The shared features in the maxicircle/minicircle organisation and sequence between T. copemani and T. cruzi/T. lewisi suggest similarities in their process of kDNA replication, and are of significance in understanding the evolution of Australian trypanosomes. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Conserved Sequence Preferences Contribute to Substrate Recognition by the Proteasome*

PubMed Central

Yu, Houqing; Singh Gautam, Amit K.; Wilmington, Shameika R.; Wylie, Dennis; Martinez-Fonts, Kirby; Kago, Grace; Warburton, Marie; Chavali, Sreenivas; Inobe, Tomonao; Finkelstein, Ilya J.; Babu, M. Madan

2016-01-01

The proteasome has pronounced preferences for the amino acid sequence of its substrates at the site where it initiates degradation. Here, we report that modulating these sequences can tune the steady-state abundance of proteins over 2 orders of magnitude in cells. This is the same dynamic range as seen for inducing ubiquitination through a classic N-end rule degron. The stability and abundance of His3 constructs dictated by the initiation site affect survival of yeast cells and show that variation in proteasomal initiation can affect fitness. The proteasome's sequence preferences are linked directly to the affinity of the initiation sites to their receptor on the proteasome and are conserved between Saccharomyces cerevisiae, Schizosaccharomyces pombe, and human cells. These findings establish that the sequence composition of unstructured initiation sites influences protein abundance in vivo in an evolutionarily conserved manner and can affect phenotype and fitness. PMID:27226608

Promoters, toll like receptors and microRNAs: a strange association.

PubMed

Korla, Kalyani; Arrigo, Patrizio; Mitra, Chanchal K

2013-06-01

Toll-like receptors (TLRs) are proteins that play key role in the innate immune system. In the present study, -1000 base pairs upstream are taken from the transcription start site of the various TLR genes (10 known) in human. About 40 microRNAs have been identified that share 12-19 nucleotide sequence similarity with the promoter regions of 10 TLRs. It is proposed that the microRNA performs potential role in identification of promoter sequence and initiation of transcription.

Fine mapping and candidate gene analysis of the virescent gene v 1 in Upland cotton (Gossypium hirsutum).

PubMed

Mao, Guangzhi; Ma, Qiang; Wei, Hengling; Su, Junji; Wang, Hantao; Ma, Qifeng; Fan, Shuli; Song, Meizhen; Zhang, Xianlong; Yu, Shuxun

2018-02-01

The young leaves of virescent mutants are yellowish and gradually turn green as the plants reach maturity. Understanding the genetic basis of virescent mutants can aid research of the regulatory mechanisms underlying chloroplast development and chlorophyll biosynthesis, as well as contribute to the application of virescent traits in crop breeding. In this study, fine mapping was employed, and a recessive gene (v 1 ) from a virescent mutant of Upland cotton was narrowed to an 84.1-Kb region containing ten candidate genes. The GhChlI gene encodes the cotton Mg-chelatase I subunit (CHLI) and was identified as the candidate gene for the virescent mutation using gene annotation. BLAST analysis showed that the GhChlI gene has two copies, Gh_A10G0282 and Gh_D10G0283. Sequence analysis indicated that the coding region (CDS) of GhChlI is 1269 bp in length, with three predicted exons and one non-synonymous nucleotide mutation (G1082A) in the third exon of Gh_D10G0283, with an amino acid (AA) substitution of arginine (R) to lysine (K). GhChlI-silenced TM-1 plants exhibited a lower GhChlI expression level, a lower chlorophyll content, and the virescent phenotype. Analysis of upstream regulatory elements and expression levels of GhChlI showed that the expression quantity of GhChlI may be normal, and with the development of the true leaf, the increase in the Gh_A10G0282 dosage may partially make up for the deficiency of Gh_D10G0283 in the v 1 mutant. Phylogenetic analysis and sequence alignment revealed that the protein sequence encoded by the third exon of GhChlI is highly conserved across diverse plant species, in which AA substitutions among the completely conserved residues frequently result in changes in leaf color in various species. These results suggest that the mutation (G1082A) within the GhChlI gene may cause a functional defect of the GhCHLI subunit and thus the virescent phenotype in the v 1 mutant. The GhChlI mutation not only provides a tool for understanding the associations of CHLI protein function and the chlorophyll biosynthesis pathway but also has implications for cotton breeding.

Transcriptome analysis of thermophilic methylotrophic Bacillus methanolicus MGA3 using RNA-sequencing provides detailed insights into its previously uncharted transcriptional landscape.

PubMed

Irla, Marta; Neshat, Armin; Brautaset, Trygve; Rückert, Christian; Kalinowski, Jörn; Wendisch, Volker F

2015-02-14

Bacillus methanolicus MGA3 is a thermophilic, facultative ribulose monophosphate (RuMP) cycle methylotroph. Together with its ability to produce high yields of amino acids, the relevance of this microorganism as a promising candidate for biotechnological applications is evident. The B. methanolicus MGA3 genome consists of a 3,337,035 nucleotides (nt) circular chromosome, the 19,174 nt plasmid pBM19 and the 68,999 nt plasmid pBM69. 3,218 protein-coding regions were annotated on the chromosome, 22 on pBM19 and 82 on pBM69. In the present study, the RNA-seq approach was used to comprehensively investigate the transcriptome of B. methanolicus MGA3 in order to improve the genome annotation, identify novel transcripts, analyze conserved sequence motifs involved in gene expression and reveal operon structures. For this aim, two different cDNA library preparation methods were applied: one which allows characterization of the whole transcriptome and another which includes enrichment of primary transcript 5'-ends. Analysis of the primary transcriptome data enabled the detection of 2,167 putative transcription start sites (TSSs) which were categorized into 1,642 TSSs located in the upstream region (5'-UTR) of known protein-coding genes and 525 TSSs of novel antisense, intragenic, or intergenic transcripts. Firstly, 14 wrongly annotated translation start sites (TLSs) were corrected based on primary transcriptome data. Further investigation of the identified 5'-UTRs resulted in the detailed characterization of their length distribution and the detection of 75 hitherto unknown cis-regulatory RNA elements. Moreover, the exact TSSs positions were utilized to define conserved sequence motifs for translation start sites, ribosome binding sites and promoters in B. methanolicus MGA3. Based on the whole transcriptome data set, novel transcripts, operon structures and mRNA abundances were determined. The analysis of the operon structures revealed that almost half of the genes are transcribed monocistronically (940), whereas 1,164 genes are organized in 381 operons. Several of the genes related to methylotrophy had highly abundant transcripts. The extensive insights into the transcriptional landscape of B. methanolicus MGA3, gained in this study, represent a valuable foundation for further comparative quantitative transcriptome analyses and possibly also for the development of molecular biology tools which at present are very limited for this organism.

Genome-wide discovery of novel and conserved microRNAs in white shrimp (Litopenaeus vannamei).

PubMed

Xi, Qian-Yun; Xiong, Yuan-Yan; Wang, Yuan-Mei; Cheng, Xiao; Qi, Qi-En; Shu, Gang; Wang, Song-Bo; Wang, Li-Na; Gao, Ping; Zhu, Xiao-Tong; Jiang, Qing-Yan; Zhang, Yong-Liang; Liu, Li

2015-01-01

Of late years, a large amount of conserved and species-specific microRNAs (miRNAs) have been performed on identification from species which are economically important but lack a full genome sequence. In this study, Solexa deep sequencing and cross-species miRNA microarray were used to detect miRNAs in white shrimp. We identified 239 conserved miRNAs, 14 miRNA* sequences and 20 novel miRNAs by bioinformatics analysis from 7,561,406 high-quality reads representing 325,370 distinct sequences. The all 20 novel miRNAs were species-specific in white shrimp and not homologous in other species. Using the conserved miRNAs from the miRBase database as a query set to search for homologs from shrimp expressed sequence tags (ESTs), 32 conserved computationally predicted miRNAs were discovered in shrimp. In addition, using microarray analysis in the shrimp fed with Panax ginseng polysaccharide complex, 151 conserved miRNAs were identified, 18 of which were significant up-expression, while 49 miRNAs were significant down-expression. In particular, qRT-PCR analysis was also performed for nine miRNAs in three shrimp tissues such as muscle, gill and hepatopancreas. Results showed that these miRNAs expression are tissue specific. Combining results of the three methods, we detected 20 novel and 394 conserved miRNAs. Verification with quantitative reverse transcription (qRT-PCR) and Northern blot showed a high confidentiality of data. The study provides the first comprehensive specific miRNA profile of white shrimp, which includes useful information for future investigations into the function of miRNAs in regulation of shrimp development and immunology.

RNA Editing and Its Molecular Mechanism in Plant Organelles

PubMed Central

Ichinose, Mizuho; Sugita, Mamoru

2016-01-01

RNA editing by cytidine (C) to uridine (U) conversions is widespread in plant mitochondria and chloroplasts. In some plant taxa, “reverse” U-to-C editing also occurs. However, to date, no instance of RNA editing has yet been reported in green algae and the complex thalloid liverworts. RNA editing may have evolved in early land plants 450 million years ago. However, in some plant species, including the liverwort, Marchantia polymorpha, editing may have been lost during evolution. Most RNA editing events can restore the evolutionarily conserved amino acid residues in mRNAs or create translation start and stop codons. Therefore, RNA editing is an essential process to maintain genetic information at the RNA level. Individual RNA editing sites are recognized by plant-specific pentatricopeptide repeat (PPR) proteins that are encoded in the nuclear genome. These PPR proteins are characterized by repeat elements that bind specifically to RNA sequences upstream of target editing sites. In flowering plants, non-PPR proteins also participate in multiple RNA editing events as auxiliary factors. C-to-U editing can be explained by cytidine deamination. The proteins discovered to date are important factors for RNA editing but a bona fide RNA editing enzyme has yet to be identified. PMID:28025543

Retinoid regulation of the zebrafish cyp26a1 promoter.

PubMed

Hu, Ping; Tian, Miao; Bao, Jie; Xing, Guangdong; Gu, Xingxing; Gao, Xiang; Linney, Elwood; Zhao, Qingshun

2008-12-01

Cyp26A1 is a major enzyme that controls retinoic acid (RA) homeostasis by metabolizing RA into bio-inactive metabolites. Previous research revealed that the mouse Cyp26A1 promoter has two canonical RA response elements (RAREs) that underlie the regulation of the gene by RA. Analyzing the 2,533-base pairs (2.5 k) genomic sequence upstream of zebrafish cyp26a1 start codon, we report that the two RAREs are conserved in zebrafish cyp26a1 promoter. Mutagenesis demonstrated that the two RAREs work synergistically in RA inducibility of cyp26a1. Fusing the 2.5 k (kilobase pairs) fragment to the enhanced yellow fluorescent protein (eYFP) reporter gene, we have generated two transgenic lines of zebrafish [Tg(cyp26a1:eYFP)]. The transgenic zebrafish display expression patterns similar to that of cyp26a1 gene in vivo. Consistent with the in vitro results, the reporter activity is RA inducible in embryos. Taken together, our results demonstrate that the 2.5 k fragment underlies the regulation of the zebrafish cyp26a1 gene by RA. (c) 2008 Wiley-Liss, Inc.

Distinct colicin M-like bacteriocin-immunity pairs in Burkholderia.

PubMed

Ghequire, Maarten G K; De Mot, René

2015-11-27

The Escherichia coli bacteriocin colicin M (ColM) acts via degradation of the cell wall precursor lipid II in target cells. ColM producers avoid self-inhibition by a periplasmic immunity protein anchored in the inner membrane. In this study, we identified colM-like bacteriocin genes in genomes of several β-proteobacterial strains belonging to the Burkholderia cepacia complex (Bcc) and the Burkholderia pseudomallei group. Two selected Burkholderia ambifaria proteins, designated burkhocins M1 and M2, were produced recombinantly and showed antagonistic activity against Bcc strains. In their considerably sequence-diverged catalytic domain, a conserved aspartate residue equally proved pivotal for cytotoxicity. Immunity to M-type burkhocins is conferred upon susceptible strains by heterologous expression of a cognate gene located either upstream or downstream of the toxin gene. These genes lack homology with currently known ColM immunity genes and encode inner membrane-associated proteins of two distinct types, differing in predicted transmembrane topology and moiety exposed to the periplasm. The addition of burkhocins to the bacteriocin complement of Burkholderia reveals a wider phylogenetic distribution of ColM-like bacteriotoxins, beyond the γ-proteobacterial genera Escherichia, Pectobacterium and Pseudomonas, and illuminates the diversified nature of immunity-providing proteins.

Restraint of apoptosis during mitosis through interdomain phosphorylation of caspase-2

PubMed Central

Andersen, Joshua L; Johnson, Carrie E; Freel, Christopher D; Parrish, Amanda B; Day, Jennifer L; Buchakjian, Marisa R; Nutt, Leta K; Thompson, J Will; Moseley, M Arthur; Kornbluth, Sally

2009-01-01

The apoptotic initiator caspase-2 has been implicated in oocyte death, in DNA damage- and heat shock-induced death, and in mitotic catastrophe. We show here that the mitosis-promoting kinase, cdk1–cyclin B1, suppresses apoptosis upstream of mitochondrial cytochrome c release by phosphorylating caspase-2 within an evolutionarily conserved sequence at Ser 340. Phosphorylation of this residue, situated in the caspase-2 interdomain, prevents caspase-2 activation. S340 was susceptible to phosphatase 1 dephosphorylation, and an interaction between phosphatase 1 and caspase-2 detected during interphase was lost in mitosis. Expression of S340A non-phosphorylatable caspase-2 abrogated mitotic suppression of caspase-2 and apoptosis in various settings, including oocytes induced to undergo cdk1-dependent maturation. Moreover, U2OS cells treated with nocodazole were found to undergo mitotic catastrophe more readily when endogenous caspase-2 was replaced with the S340A mutant to lift mitotic inhibition. These data demonstrate that for apoptotic stimuli transduced by caspase-2, cell death is prevented during mitosis through the inhibitory phosphorylation of caspase-2 and suggest that under conditions of mitotic arrest, cdk1–cyclin B1 activity must be overcome for apoptosis to occur. PMID:19730412

Identification of Candidate Transcription Factor Binding Sites in the Cattle Genome

PubMed Central

Bickhart, Derek M.; Liu, George E.

2013-01-01

A resource that provides candidate transcription factor binding sites (TFBSs) does not currently exist for cattle. Such data is necessary, as predicted sites may serve as excellent starting locations for future omics studies to develop transcriptional regulation hypotheses. In order to generate this resource, we employed a phylogenetic footprinting approach—using sequence conservation across cattle, human and dog—and position-specific scoring matrices to identify 379,333 putative TFBSs upstream of nearly 8000 Mammalian Gene Collection (MGC) annotated genes within the cattle genome. Comparisons of our predictions to known binding site loci within the PCK1, ACTA1 and G6PC promoter regions revealed 75% sensitivity for our method of discovery. Additionally, we intersected our predictions with known cattle SNP variants in dbSNP and on the Illumina BovineHD 770k and Bos 1 SNP chips, finding 7534, 444 and 346 overlaps, respectively. Due to our stringent filtering criteria, these results represent high quality predictions of putative TFBSs within the cattle genome. All binding site predictions are freely available at http://bfgl.anri.barc.usda.gov/BovineTFBS/ or http://199.133.54.77/BovineTFBS. PMID:23433959

Variation in the genomic locations and sequence conservation of STAR elements among staphylococcal species provides insight into DNA repeat evolution

PubMed Central

2012-01-01

Background Staphylococcus aureus Repeat (STAR) elements are a type of interspersed intergenic direct repeat. In this study the conservation and variation in these elements was explored by bioinformatic analyses of published staphylococcal genome sequences and through sequencing of specific STAR element loci from a large set of S. aureus isolates. Results Using bioinformatic analyses, we found that the STAR elements were located in different genomic loci within each staphylococcal species. There was no correlation between the number of STAR elements in each genome and the evolutionary relatedness of staphylococcal species, however higher levels of repeats were observed in both S. aureus and S. lugdunensis compared to other staphylococcal species. Unexpectedly, sequencing of the internal spacer sequences of individual repeat elements from multiple isolates showed conservation at the sequence level within deep evolutionary lineages of S. aureus. Whilst individual STAR element loci were demonstrated to expand and contract, the sequences associated with each locus were stable and distinct from one another. Conclusions The high degree of lineage and locus-specific conservation of these intergenic repeat regions suggests that STAR elements are maintained due to selective or molecular forces with some of these elements having an important role in cell physiology. The high prevalence in two of the more virulent staphylococcal species is indicative of a potential role for STAR elements in pathogenesis. PMID:23020678

RNA from the 5' end of the R2 retrotransposon controls R2 protein binding to and cleavage of its DNA target site.

PubMed

Christensen, Shawn M; Ye, Junqiang; Eickbush, Thomas H

2006-11-21

Non-LTR retrotransposons insert into eukaryotic genomes by target-primed reverse transcription (TPRT), a process in which cleaved DNA targets are used to prime reverse transcription of the element's RNA transcript. Many of the steps in the integration pathway of these elements can be characterized in vitro for the R2 element because of the rigid sequence specificity of R2 for both its DNA target and its RNA template. R2 retrotransposition involves identical subunits of the R2 protein bound to different DNA sequences upstream and downstream of the insertion site. The key determinant regulating which DNA-binding conformation the protein adopts was found to be a 320-nt RNA sequence from near the 5' end of the R2 element. In the absence of this 5' RNA the R2 protein binds DNA sequences upstream of the insertion site, cleaves the first DNA strand, and conducts TPRT when RNA containing the 3' untranslated region of the R2 transcript is present. In the presence of the 320-nt 5' RNA, the R2 protein binds DNA sequences downstream of the insertion site. Cleavage of the second DNA strand by the downstream subunit does not appear to occur until after the 5' RNA is removed from this subunit. We postulate that the removal of the 5' RNA normally occurs during reverse transcription, and thus provides a critical temporal link to first- and second-strand DNA cleavage in the R2 retrotransposition reaction.

Marker genes that are less conserved in their sequences are useful for predicting genome-wide similarity levels between closely related prokaryotic strains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lan, Yemin; Rosen, Gail; Hershberg, Ruth

The 16s rRNA gene is so far the most widely used marker for taxonomical classification and separation of prokaryotes. Since it is universally conserved among prokaryotes, it is possible to use this gene to classify a broad range of prokaryotic organisms. At the same time, it has often been noted that the 16s rRNA gene is too conserved to separate between prokaryotes at finer taxonomic levels. In this paper, we examine how well levels of similarity of 16s rRNA and 73 additional universal or nearly universal marker genes correlate with genome-wide levels of gene sequence similarity. We demonstrate that themore » percent identity of 16s rRNA predicts genome-wide levels of similarity very well for distantly related prokaryotes, but not for closely related ones. In closely related prokaryotes, we find that there are many other marker genes for which levels of similarity are much more predictive of genome-wide levels of gene sequence similarity. Finally, we show that the identities of the markers that are most useful for predicting genome-wide levels of similarity within closely related prokaryotic lineages vary greatly between lineages. However, the most useful markers are always those that are least conserved in their sequences within each lineage. In conclusion, our results show that by choosing markers that are less conserved in their sequences within a lineage of interest, it is possible to better predict genome-wide gene sequence similarity between closely related prokaryotes than is possible using the 16s rRNA gene. We point readers towards a database we have created (POGO-DB) that can be used to easily establish which markers show lowest levels of sequence conservation within different prokaryotic lineages.« less

Marker genes that are less conserved in their sequences are useful for predicting genome-wide similarity levels between closely related prokaryotic strains

DOE PAGES

Lan, Yemin; Rosen, Gail; Hershberg, Ruth

2016-05-03

The 16s rRNA gene is so far the most widely used marker for taxonomical classification and separation of prokaryotes. Since it is universally conserved among prokaryotes, it is possible to use this gene to classify a broad range of prokaryotic organisms. At the same time, it has often been noted that the 16s rRNA gene is too conserved to separate between prokaryotes at finer taxonomic levels. In this paper, we examine how well levels of similarity of 16s rRNA and 73 additional universal or nearly universal marker genes correlate with genome-wide levels of gene sequence similarity. We demonstrate that themore » percent identity of 16s rRNA predicts genome-wide levels of similarity very well for distantly related prokaryotes, but not for closely related ones. In closely related prokaryotes, we find that there are many other marker genes for which levels of similarity are much more predictive of genome-wide levels of gene sequence similarity. Finally, we show that the identities of the markers that are most useful for predicting genome-wide levels of similarity within closely related prokaryotic lineages vary greatly between lineages. However, the most useful markers are always those that are least conserved in their sequences within each lineage. In conclusion, our results show that by choosing markers that are less conserved in their sequences within a lineage of interest, it is possible to better predict genome-wide gene sequence similarity between closely related prokaryotes than is possible using the 16s rRNA gene. We point readers towards a database we have created (POGO-DB) that can be used to easily establish which markers show lowest levels of sequence conservation within different prokaryotic lineages.« less

Conservation of Three-Dimensional Helix-Loop-Helix Structure through the Vertebrate Lineage Reopens the Cold Case of Gonadotropin-Releasing Hormone-Associated Peptide.

PubMed

Pérez Sirkin, Daniela I; Lafont, Anne-Gaëlle; Kamech, Nédia; Somoza, Gustavo M; Vissio, Paula G; Dufour, Sylvie

2017-01-01

GnRH-associated peptide (GAP) is the C-terminal portion of the gonadotropin-releasing hormone (GnRH) preprohormone. Although it was reported in mammals that GAP may act as a prolactin-inhibiting factor and can be co-secreted with GnRH into the hypophyseal portal blood, GAP has been practically out of the research circuit for about 20 years. Comparative studies highlighted the low conservation of GAP primary amino acid sequences among vertebrates, contributing to consider that this peptide only participates in the folding or carrying process of GnRH. Considering that the three-dimensional (3D) structure of a protein may define its function, the aim of this study was to evaluate if GAP sequences and 3D structures are conserved in the vertebrate lineage. GAP sequences from various vertebrates were retrieved from databases. Analysis of primary amino acid sequence identity and similarity, molecular phylogeny, and prediction of 3D structures were performed. Amino acid sequence comparison and phylogeny analyses confirmed the large variation of GAP sequences throughout vertebrate radiation. In contrast, prediction of the 3D structure revealed a striking conservation of the 3D structure of GAP1 (GAP associated with the hypophysiotropic type 1 GnRH), despite low amino acid sequence conservation. This GAP1 peptide presented a typical helix-loop-helix (HLH) structure in all the vertebrate species analyzed. This HLH structure could also be predicted for GAP2 in some but not all vertebrate species and in none of the GAP3 analyzed. These results allowed us to infer that selective pressures have maintained GAP1 HLH structure throughout the vertebrate lineage. The conservation of the HLH motif, known to confer biological activity to various proteins, suggests that GAP1 peptides may exert some hypophysiotropic biological functions across vertebrate radiation.

Conservation of Three-Dimensional Helix-Loop-Helix Structure through the Vertebrate Lineage Reopens the Cold Case of Gonadotropin-Releasing Hormone-Associated Peptide

PubMed Central

Pérez Sirkin, Daniela I.; Lafont, Anne-Gaëlle; Kamech, Nédia; Somoza, Gustavo M.; Vissio, Paula G.; Dufour, Sylvie

2017-01-01

GnRH-associated peptide (GAP) is the C-terminal portion of the gonadotropin-releasing hormone (GnRH) preprohormone. Although it was reported in mammals that GAP may act as a prolactin-inhibiting factor and can be co-secreted with GnRH into the hypophyseal portal blood, GAP has been practically out of the research circuit for about 20 years. Comparative studies highlighted the low conservation of GAP primary amino acid sequences among vertebrates, contributing to consider that this peptide only participates in the folding or carrying process of GnRH. Considering that the three-dimensional (3D) structure of a protein may define its function, the aim of this study was to evaluate if GAP sequences and 3D structures are conserved in the vertebrate lineage. GAP sequences from various vertebrates were retrieved from databases. Analysis of primary amino acid sequence identity and similarity, molecular phylogeny, and prediction of 3D structures were performed. Amino acid sequence comparison and phylogeny analyses confirmed the large variation of GAP sequences throughout vertebrate radiation. In contrast, prediction of the 3D structure revealed a striking conservation of the 3D structure of GAP1 (GAP associated with the hypophysiotropic type 1 GnRH), despite low amino acid sequence conservation. This GAP1 peptide presented a typical helix-loop-helix (HLH) structure in all the vertebrate species analyzed. This HLH structure could also be predicted for GAP2 in some but not all vertebrate species and in none of the GAP3 analyzed. These results allowed us to infer that selective pressures have maintained GAP1 HLH structure throughout the vertebrate lineage. The conservation of the HLH motif, known to confer biological activity to various proteins, suggests that GAP1 peptides may exert some hypophysiotropic biological functions across vertebrate radiation. PMID:28878737

Identification of a functional enhancer variant within the chronic pancreatitis-associated SPINK1 c.101A>G (p.Asn34Ser)-containing haplotype.

PubMed

Boulling, Arnaud; Masson, Emmanuelle; Zou, Wen-Bin; Paliwal, Sumit; Wu, Hao; Issarapu, Prachand; Bhaskar, Seema; Génin, Emmanuelle; Cooper, David N; Li, Zhao-Shen; Chandak, Giriraj R; Liao, Zhuan; Chen, Jian-Min; Férec, Claude

2017-08-01

The haplotype harboring the SPINK1 c.101A>G (p.Asn34Ser) variant (also known as rs17107315:T>C) represents the most important heritable risk factor for idiopathic chronic pancreatitis identified to date. The causal variant contained within this risk haplotype has however remained stubbornly elusive. Herein, we set out to resolve this enigma by employing a hypothesis-driven approach. First, we searched for variants in strong linkage disequilibrium (LD) with rs17107315:T>C using HaploReg v4.1. Second, we identified two candidate SNPs by visual inspection of sequences spanning all 25 SNPs found to be in LD with rs17107315:T>C, guided by prior knowledge of pancreas-specific transcription factors and their cognate binding sites. Third, employing a novel cis-regulatory module (CRM)-guided approach to further filter the two candidate SNPs yielded a solitary candidate causal variant. Finally, combining data from phylogenetic conservation and chromatin accessibility, cotransfection transactivation experiments, and population genetic studies, we suggest that rs142703147:C>A, which disrupts a PTF1L-binding site within an evolutionarily conserved HNF1A-PTF1L CRM located ∼4 kb upstream of the SPINK1 promoter, contributes to the aforementioned chronic pancreatitis risk haplotype. Further studies are required not only to improve the characterization of this functional SNP but also to identify other functional components that might contribute to this high-risk haplotype. © 2017 Wiley Periodicals, Inc.

Human homolog of the mouse sperm receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chamberlin, M.E.; Dean, J.

1990-08-01

The human zona pellucida, composed of three glycoproteins (ZP1, ZP2, and ZP3), forms an extracellular matrix that surrounds ovulated eggs and mediates species-specific fertilization. The genes that code for at least two of the zona proteins (ZP2 and ZP3) cross-hybridize with other mammalian DNA. The recently characterized mouse sperm receptor gene (Zp-3) was used to isolate its human homolog. The human homolog spans {approx}18.3 kilobase pairs (kbp) (compared to 8.6 kbp for the mouse gene) and contains eight exons, the sizes of which are strictly conserved between the two species. Four short (8-15 bp) sequences within the first 250 bpmore » of the 5{prime} flanking region in the human Zp-3 homolog are also present upstream of mouse Zp-3. These elements may modulate oocyte-specific gene expression. By using the polymerase chain reaction, a full-length cDNA of human ZP3 was isolated from human ovarian poly(A){sup +} RNA and used to deduce the structure of human ZP3 mRNA. Certain features of the human and mouse ZP3 transcripts are conserved. Both have unusually short 5{prime} and 3{prime} untranslated regions, both contain a single open reading frame that is 74% identical, and both code for 424 amino acid polypeptides that are 67% the same. The similarity between the two proteins may define domains that are important in maintaining the structural integrity of the zona pellucida, while the differences may play a role in mediating the species-specific events of mammalian fertilization.« less

Evidence for the Concerted Evolution between Short Linear Protein Motifs and Their Flanking Regions

PubMed Central

Chica, Claudia; Diella, Francesca; Gibson, Toby J.

2009-01-01

Background Linear motifs are short modules of protein sequences that play a crucial role in mediating and regulating many protein–protein interactions. The function of linear motifs strongly depends on the context, e.g. functional instances mainly occur inside flexible regions that are accessible for interaction. Sometimes linear motifs appear as isolated islands of conservation in multiple sequence alignments. However, they also occur in larger blocks of sequence conservation, suggesting an active role for the neighbouring amino acids. Results The evolution of regions flanking 116 functional linear motif instances was studied. The conservation of the amino acid sequence and order/disorder tendency of those regions was related to presence/absence of the instance. For the majority of the analysed instances, the pairs of sequences conserving the linear motif were also observed to maintain a similar local structural tendency and/or to have higher local sequence conservation when compared to pairs of sequences where one is missing the linear motif. Furthermore, those instances have a higher chance to co–evolve with the neighbouring residues in comparison to the distant ones. Those findings are supported by examples where the regulation of the linear motif–mediated interaction has been shown to depend on the modifications (e.g. phosphorylation) at neighbouring positions or is thought to benefit from the binding versatility of disordered regions. Conclusion The results suggest that flanking regions are relevant for linear motif–mediated interactions, both at the structural and sequence level. More interestingly, they indicate that the prediction of linear motif instances can be enriched with contextual information by performing a sequence analysis similar to the one presented here. This can facilitate the understanding of the role of these predicted instances in determining the protein function inside the broader context of the cellular network where they arise. PMID:19584925

CoSMoS: Conserved Sequence Motif Search in the proteome

PubMed Central

Liu, Xiao I; Korde, Neeraj; Jakob, Ursula; Leichert, Lars I

2006-01-01

Background With the ever-increasing number of gene sequences in the public databases, generating and analyzing multiple sequence alignments becomes increasingly time consuming. Nevertheless it is a task performed on a regular basis by researchers in many labs. Results We have now created a database called CoSMoS to find the occurrences and at the same time evaluate the significance of sequence motifs and amino acids encoded in the whole genome of the model organism Escherichia coli K12. We provide a precomputed set of multiple sequence alignments for each individual E. coli protein with all of its homologues in the RefSeq database. The alignments themselves, information about the occurrence of sequence motifs together with information on the conservation of each of the more than 1.3 million amino acids encoded in the E. coli genome can be accessed via the web interface of CoSMoS. Conclusion CoSMoS is a valuable tool to identify highly conserved sequence motifs, to find regions suitable for mutational studies in functional analyses and to predict important structural features in E. coli proteins. PMID:16433915

TEs or not TEs? That is the evolutionary question.

PubMed

Vaknin, Keren; Goren, Amir; Ast, Gil

2009-10-23

Transposable elements (TEs) have contributed a wide range of functional sequences to their host genomes. A recent paper in BMC Molecular Biology discusses the creation of new transcripts by transposable element insertion upstream of retrocopies and the involvement of such insertions in tissue-specific post-transcriptional regulation.

Identification of a Conserved Non-Protein-Coding Genomic Element that Plays an Essential Role in Alphabaculovirus Pathogenesis

PubMed Central

Kikhno, Irina

2014-01-01

Highly homologous sequences 154–157 bp in length grouped under the name of “conserved non-protein-coding element” (CNE) were revealed in all of the sequenced genomes of baculoviruses belonging to the genus Alphabaculovirus. A CNE alignment led to the detection of a set of highly conserved nucleotide clusters that occupy strictly conserved positions in the CNE sequence. The significant length of the CNE and conservation of both its length and cluster architecture were identified as a combination of characteristics that make this CNE different from known viral non-coding functional sequences. The essential role of the CNE in the Alphabaculovirus life cycle was demonstrated through the use of a CNE-knockout Autographa californica multiple nucleopolyhedrovirus (AcMNPV) bacmid. It was shown that the essential function of the CNE was not mediated by the presumed expression activities of the protein- and non-protein-coding genes that overlap the AcMNPV CNE. On the basis of the presented data, the AcMNPV CNE was categorized as a complex-structured, polyfunctional genomic element involved in an essential DNA transaction that is associated with an undefined function of the baculovirus genome. PMID:24740153

Delimiting regulatory sequences of the Drosophila melanogaster Ddc gene.

PubMed Central

Hirsh, J; Morgan, B A; Scholnick, S B

1986-01-01

We delimited sequences necessary for in vivo expression of the Drosophila melanogaster dopa decarboxylase gene Ddc. The expression of in vitro-altered genes was assayed following germ line integration via P-element vectors. Sequences between -209 and -24 were necessary for normally regulated expression, although genes lacking these sequences could be expressed at 10 to 50% of wild-type levels at specific developmental times. These genes showed components of normal developmental expression, which suggests that they retain some regulatory elements. All Ddc genes lacking the normal immediate 5'-flanking sequences were grossly deficient in larval central nervous system expression. Thus, this upstream region must contain at least one element necessary for this expression. A mutated Ddc gene without a normal TATA boxlike sequence used the normal RNA start points, indicating that this sequences is not required for start point specificity. Images PMID:3099170

Comparative Sequence and X-Inactivation Analyses of a Domain of Escape in Human Xp11.2 and the Conserved Segment in Mouse

PubMed Central

Tsuchiya, Karen D.; Greally, John M.; Yi, Yajun; Noel, Kevin P.; Truong, Jean-Pierre; Disteche, Christine M.

2004-01-01

We have performed X-inactivation and sequence analyses on 350 kb of sequence from human Xp11.2, a region shown previously to contain a cluster of genes that escape X inactivation, and we compared this region with the region of conserved synteny in mouse. We identified several new transcripts from this region in human and in mouse, which defined the full extent of the domain escaping X inactivation in both species. In human, escape from X inactivation involves an uninterrupted 235-kb domain of multiple genes. Despite highly conserved gene content and order between the two species, Smcx is the only mouse gene from the conserved segment that escapes inactivation. As repetitive sequences are believed to facilitate spreading of X inactivation along the chromosome, we compared the repetitive sequence composition of this region between the two species. We found that long terminal repeats (LTRs) were decreased in the human domain of escape, but not in the majority of the conserved mouse region adjacent to Smcx in which genes were subject to X inactivation, suggesting that these repeats might be excluded from escape domains to prevent spreading of silencing. Our findings indicate that genomic context, as well as gene-specific regulatory elements, interact to determine expression of a gene from the inactive X-chromosome. PMID:15197169

Effects of a Non-Conservative Sequence on the Properties of β-glucuronidase from Aspergillus terreus Li-20

PubMed Central

Liu, Yanli; Huangfu, Jie; Qi, Feng; Kaleem, Imdad; E, Wenwen; Li, Chun

2012-01-01

We cloned the β-glucuronidase gene (AtGUS) from Aspergillus terreus Li-20 encoding 657 amino acids (aa), which can transform glycyrrhizin into glycyrrhetinic acid monoglucuronide (GAMG) and glycyrrhetinic acid (GA). Based on sequence alignment, the C-terminal non-conservative sequence showed low identity with those of other species; thus, the partial sequence AtGUS(-3t) (1–592 aa) was amplified to determine the effects of the non-conservative sequence on the enzymatic properties. AtGUS and AtGUS(-3t) were expressed in E. coli BL21, producing AtGUS-E and AtGUS(-3t)-E, respectively. At the similar optimum temperature (55°C) and pH (AtGUS-E, 6.6; AtGUS(-3t)-E, 7.0) conditions, the thermal stability of AtGUS(-3t)-E was enhanced at 65°C, and the metal ions Co2+, Ca2+ and Ni2+ showed opposite effects on AtGUS-E and AtGUS(-3t)-E, respectively. Furthermore, Km of AtGUS(-3t)-E (1.95 mM) was just nearly one-seventh that of AtGUS-E (12.9 mM), whereas the catalytic efficiency of AtGUS(-3t)-E was 3.2 fold higher than that of AtGUS-E (7.16 vs. 2.24 mM s−1), revealing that the truncation of non-conservative sequence can significantly improve the catalytic efficiency of AtGUS. Conformational analysis illustrated significant difference in the secondary structure between AtGUS-E and AtGUS(-3t)-E by circular dichroism (CD). The results showed that the truncation of the non-conservative sequence could preferably alter and influence the stability and catalytic efficiency of enzyme. PMID:22347419

Computational identification of developmental enhancers:conservation and function of transcription factor binding-site clustersin drosophila melanogaster and drosophila psedoobscura

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berman, Benjamin P.; Pfeiffer, Barret D.; Laverty, Todd R.

2004-08-06

Background The identification of sequences that control transcription in metazoans is a major goal of genome analysis. In a previous study, we demonstrated that searching for clusters of predicted transcription factor binding sites could discover active regulatory sequences, and identified 37 regions of the Drosophila melanogaster genome with high densities of predicted binding sites for five transcription factors involved in anterior-posterior embryonic patterning. Nine of these clusters overlapped known enhancers. Here, we report the results of in vivo functional analysis of 27 remaining clusters. Results We generated transgenic flies carrying each cluster attached to a basal promoter and reporter gene,more » and assayed embryos for reporter gene expression. Six clusters are enhancers of adjacent genes: giant, fushi tarazu, odd-skipped, nubbin, squeeze and pdm2; three drive expression in patterns unrelated to those of neighboring genes; the remaining 18 do not appear to have enhancer activity. We used the Drosophila pseudoobscura genome to compare patterns of evolution in and around the 15 positive and 18 false-positive predictions. Although conservation of primary sequence cannot distinguish true from false positives, conservation of binding-site clustering accurately discriminates functional binding-site clusters from those with no function. We incorporated conservation of binding-site clustering into a new genome-wide enhancer screen, and predict several hundred new regulatory sequences, including 85 adjacent to genes with embryonic patterns. Conclusions Measuring conservation of sequence features closely linked to function - such as binding-site clustering - makes better use of comparative sequence data than commonly used methods that examine only sequence identity.« less

Constitutive expression of a salinity-induced wheat WRKY transcription factor enhances salinity and ionic stress tolerance in transgenic Arabidopsis thaliana.

PubMed

Qin, Yuxiang; Tian, Yanchen; Han, Lu; Yang, Xinchao

2013-10-25

The isolation and characterization of TaWRKY79, a wheat class II WRKY transcription factor, is described. Its 1297 bp coding region includes a 987 bp long open reading frame. TaWRKY79 was induced by stressing seedlings with either NaCl or abscisic acid (ABA). When a fusion between an 843 bp segment upstream of the TaWRKY79 coding sequence and GUS was introduced into Arabidopsis thaliana, GUS staining indicated that this upstream segment captured the sequence(s) required to respond to ABA or NaCl treatment. When TaWRKY79 was constitutively expressed as a transgene in A. thaliana, the transgenic plants showed an improved capacity to extend their primary root in the presence of either 100 mM NaCl, 10 mM LiCl or 2 μM ABA. The inference was that TaWRKY79 enhanced the level of tolerance to both salinity and ionic stress, while reducing the level of sensitivity to ABA. The ABA-related genes ABA1, ABA2 ABI1 and ABI5 were all up-regulated in the TaWRKY79 transgenic plants, suggesting that the transcription factor operates in an ABA-dependent pathway. Copyright © 2013. Published by Elsevier Inc.

Isolation of a polyphenol oxidase (PPO) cDNA from artichoke and expression analysis in wounded artichoke heads.

PubMed

Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo

2013-07-01

The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Insertion sequence transposition determines imipenem resistance in Acinetobacter baumannii.

PubMed

Kuo, Han-Yueh; Chang, Kai-Chih; Liu, Chih-Chin; Tang, Chuan Yi; Peng, Jhih-Hua; Lu, Chia-Wei; Tu, Chi-Chao; Liou, Ming-Li

2014-10-01

This study employed genomewide analysis to investigate potential resistance mechanisms in Acinetobacter baumannii following imipenem exposure. Imipenem-selected mutants were generated from the imipenem-susceptible strain ATCC 17978 by multistep selection resistance. Antibiotic susceptibilities were examined, and the selected mutants originated from the ATCC 17978 strain were confirmed by pulsed-field gel electrophoresis. The genomic sequence of a resistant mutant was analyzed using a next-generation sequencing platform, and genetic recombination was further confirmed by PCR. The result showed that phenotypic resistance was observed with carbapenem upon exposure to various concentrations of imipenem. Genomewide analysis showed that ISAba1 transposition was initiated by imipenem exposure at concentrations up to 0.5 mg/L. Transposition of ISAba1 upstream of blaOXA-95 was detected in all the selected mutants. The expression of blaOXA-95 was further analyzed by quantitative PCR, and the results demonstrated that a 200-fold increase in gene expression was required for resistance to imipenem. This study concluded that imipenem exposure at a concentration of 0.5 mg/L mediated the transposition of ISAba1 upstream of the blaOXA-95 gene and resulted in the overexpression of blaOXA-95 gene, which may play a major role in the resistance to imipenem in A. baumannii.

The Enhancer of split complex arose prior to the diversification of schizophoran flies and is strongly conserved between Drosophila and stalk-eyed flies (Diopsidae)

PubMed Central

2011-01-01

Background In Drosophila, the Enhancer of split complex (E(spl)-C) comprises 11 bHLH and Bearded genes that function during Notch signaling to repress proneural identity in the developing peripheral nervous system. Comparison with other insects indicates that the basal state for Diptera is a single bHLH and Bearded homolog and that the expansion of the gene complex occurred in the lineage leading to Drosophila. However, comparative genomic data from other fly species that would elucidate the origin and sequence of gene duplication for the complex is lacking. Therefore, in order to examine the evolutionary history of the complex within Diptera, we reconstructed, using several fosmid clones, the entire E(spl)-complex in the stalk-eyed fly, Teleopsis dalmanni and collected additional homologs of E(spl)-C genes from searches of dipteran EST databases and the Glossina morsitans genome assembly. Results Comparison of the Teleopsis E(spl)-C gene organization with Drosophila indicates complete conservation in gene number and orientation between the species except that T. dalmanni contains a duplicated copy of E(spl)m5 that is not present in Drosophila. Phylogenetic analysis of E(spl)-complex bHLH and Bearded genes for several dipteran species clearly demonstrates that all members of the complex were present prior to the diversification of schizophoran flies. Comparison of upstream regulatory elements and 3' UTR domains between the species also reveals strong conservation for many of the genes and identifies several novel characteristics of E(spl)-C regulatory evolution including the discovery of a previously unidentified, highly conserved SPS+A domain between E(spl)mγ and E(spl)mβ. Conclusion Identifying the phylogenetic origin of E(spl)-C genes and their associated regulatory DNA is essential to understanding the functional significance of this well-studied gene complex. Results from this study provide numerous insights into the evolutionary history of the complex and will help refine the focus of studies examining the adaptive consequences of this gene expansion. PMID:22151427