Sample records for consistent gene expression

  1. Evaluating the consistency of gene sets used in the analysis of bacterial gene expression data.

    PubMed

    Tintle, Nathan L; Sitarik, Alexandra; Boerema, Benjamin; Young, Kylie; Best, Aaron A; Dejongh, Matthew

    2012-08-08

    Statistical analyses of whole genome expression data require functional information about genes in order to yield meaningful biological conclusions. The Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) are common sources of functionally grouped gene sets. For bacteria, the SEED and MicrobesOnline provide alternative, complementary sources of gene sets. To date, no comprehensive evaluation of the data obtained from these resources has been performed. We define a series of gene set consistency metrics directly related to the most common classes of statistical analyses for gene expression data, and then perform a comprehensive analysis of 3581 Affymetrix® gene expression arrays across 17 diverse bacteria. We find that gene sets obtained from GO and KEGG demonstrate lower consistency than those obtained from the SEED and MicrobesOnline, regardless of gene set size. Despite the widespread use of GO and KEGG gene sets in bacterial gene expression data analysis, the SEED and MicrobesOnline provide more consistent sets for a wide variety of statistical analyses. Increased use of the SEED and MicrobesOnline gene sets in the analysis of bacterial gene expression data may improve statistical power and utility of expression data.

  2. Single cell transcriptome analysis of MCF-7 reveals consistently and inconsistently expressed gene groups each associated with distinct cellular localization and functions

    PubMed Central

    Chen, Tzu-Han; Shiau, Hsin-Chieh

    2018-01-01

    Single cell transcriptome (SCT) analysis provides superior resolution to illustrate tumor cell heterogeneity for clinical implications. We characterized four SCTs of MCF-7 using 143 housekeeping genes (HKGs) as control, of which lactate dehydrogenase B (LDHB) expression is silenced. These SCT libraries mapped to 11,423, 11,486, 10,380, and 11,306 RefSeq genes (UCSC), respectively. High consistency in HKG expression levels across all four SCTs, along with transcriptional silencing of LDHB, was observed, suggesting a high sensitivity and reproducibility of the SCT analysis. Cross-library comparison on expression levels by scatter plotting revealed a linear correlation and an 83–94% overlap in transcript isoforms and expressed genes were also observed. To gain insight of transcriptional diversity among the SCTs, expressed genes were split into consistently expressed (CE) (expressed in all SCTs) and inconsistently expressed (IE) (expressed in some but not all SCTs) genes for further characterization, along with the 142 expressed HKGs as a reference. Distinct transcriptional strengths were found among these groups, with averages of 1,612.0, 88.0 and 1.2 FPKM for HKGs, CE and IE, respectively. Comparison between CE and IE groups further indicated that expressions of CE genes vary more significantly than that of IE genes. Gene Ontology analysis indicated that proteins encoded by CE genes are mainly involved in fundamental intracellular activities, while proteins encoded by IE genes are mainly for extracellular activities, especially acting as receptors or ion channels. The diversified gene expressions, especially for those encoded by IE genes, may contribute to cancer drug resistance. PMID:29920548

  3. Population Level Purifying Selection and Gene Expression Shape Subgenome Evolution in Maize.

    PubMed

    Pophaly, Saurabh D; Tellier, Aurélien

    2015-12-01

    The maize ancestor experienced a recent whole-genome duplication (WGD) followed by gene erosion which generated two subgenomes, the dominant subgenome (maize1) experiencing fewer deletions than maize2. We take advantage of available extensive polymorphism and gene expression data in maize to study purifying selection and gene expression divergence between WGD retained paralog pairs. We first report a strong correlation in nucleotide diversity between duplicate pairs, except for upstream regions. We then show that maize1 genes are under stronger purifying selection than maize2. WGD retained genes have higher gene dosage and biased Gene Ontologies consistent with previous studies. The relative gene expression of paralogs across tissues demonstrates that 98% of duplicate pairs have either subfunctionalized in a tissuewise manner or have diverged consistently in their expression thereby preventing functional complementation. Tissuewise subfunctionalization seems to be a hallmark of transcription factors, whereas consistent repression occurs for macromolecular complexes. We show that dominant gene expression is a strong determinant of the strength of purifying selection, explaining the inferred stronger negative selection on maize1 genes. We propose a novel expression-based classification of duplicates which is more robust to explain observed polymorphism patterns than the subgenome location. Finally, upstream regions of repressed genes exhibit an enrichment in transposable elements which indicates a possible mechanism for expression divergence. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. Transcriptional response of honey bee larvae infected with the bacterial pathogen Paenibacillus larvae.

    PubMed

    Cornman, Robert Scott; Lopez, Dawn; Evans, Jay D

    2013-01-01

    American foulbrood disease of honey bees is caused by the bacterium Paenibacillus larvae. Infection occurs per os in larvae and systemic infection requires a breaching of the host peritrophic matrix and midgut epithelium. Genetic variation exists for both bacterial virulence and host resistance, and a general immunity is achieved by larvae as they age, the basis of which has not been identified. To quickly identify a pool of candidate genes responsive to P. larvae infection, we sequenced transcripts from larvae inoculated with P. larvae at 12 hours post-emergence and incubated for 72 hours, and compared expression levels to a control cohort. We identified 75 genes with significantly higher expression and six genes with significantly lower expression. In addition to several antimicrobial peptides, two genes encoding peritrophic-matrix domains were also up-regulated. Extracellular matrix proteins, proteases/protease inhibitors, and members of the Osiris gene family were prevalent among differentially regulated genes. However, analysis of Drosophila homologs of differentially expressed genes revealed spatial and temporal patterns consistent with developmental asynchrony as a likely confounder of our results. We therefore used qPCR to measure the consistency of gene expression changes for a subset of differentially expressed genes. A replicate experiment sampled at both 48 and 72 hours post infection allowed further discrimination of genes likely to be involved in host response. The consistently responsive genes in our test set included a hymenopteran-specific protein tyrosine kinase, a hymenopteran specific serine endopeptidase, a cytochrome P450 (CYP9Q1), and a homolog of trynity, a zona pellucida domain protein. Of the known honey bee antimicrobial peptides, apidaecin was responsive at both time-points studied whereas hymenoptaecin was more consistent in its level of change between biological replicates and had the greatest increase in expression by RNA-seq analysis.

  5. Parallel Gene Expression Differences between Low and High Latitude Populations of Drosophila melanogaster and D. simulans

    PubMed Central

    Zhao, Li; Wit, Janneke; Svetec, Nicolas; Begun, David J.

    2015-01-01

    Gene expression variation within species is relatively common, however, the role of natural selection in the maintenance of this variation is poorly understood. Here we investigate low and high latitude populations of Drosophila melanogaster and its sister species, D. simulans, to determine whether the two species show similar patterns of population differentiation, consistent with a role for spatially varying selection in maintaining gene expression variation. We compared at two temperatures the whole male transcriptome of D. melanogaster and D. simulans sampled from Panama City (Panama) and Maine (USA). We observed a significant excess of genes exhibiting differential expression in both species, consistent with parallel adaptation to heterogeneous environments. Moreover, the majority of genes showing parallel expression differentiation showed the same direction of differential expression in the two species and the magnitudes of expression differences between high and low latitude populations were correlated across species, further bolstering the conclusion that parallelism for expression phenotypes results from spatially varying selection. However, the species also exhibited important differences in expression phenotypes. For example, the genomic extent of genotype × environment interaction was much more common in D. melanogaster. Highly differentiated SNPs between low and high latitudes were enriched in the 3’ UTRs and CDS of the geographically differently expressed genes in both species, consistent with an important role for cis-acting variants in driving local adaptation for expression-related phenotypes. PMID:25950438

  6. Parallel Gene Expression Differences between Low and High Latitude Populations of Drosophila melanogaster and D. simulans.

    PubMed

    Zhao, Li; Wit, Janneke; Svetec, Nicolas; Begun, David J

    2015-05-01

    Gene expression variation within species is relatively common, however, the role of natural selection in the maintenance of this variation is poorly understood. Here we investigate low and high latitude populations of Drosophila melanogaster and its sister species, D. simulans, to determine whether the two species show similar patterns of population differentiation, consistent with a role for spatially varying selection in maintaining gene expression variation. We compared at two temperatures the whole male transcriptome of D. melanogaster and D. simulans sampled from Panama City (Panama) and Maine (USA). We observed a significant excess of genes exhibiting differential expression in both species, consistent with parallel adaptation to heterogeneous environments. Moreover, the majority of genes showing parallel expression differentiation showed the same direction of differential expression in the two species and the magnitudes of expression differences between high and low latitude populations were correlated across species, further bolstering the conclusion that parallelism for expression phenotypes results from spatially varying selection. However, the species also exhibited important differences in expression phenotypes. For example, the genomic extent of genotype × environment interaction was much more common in D. melanogaster. Highly differentiated SNPs between low and high latitudes were enriched in the 3' UTRs and CDS of the geographically differently expressed genes in both species, consistent with an important role for cis-acting variants in driving local adaptation for expression-related phenotypes.

  7. A proof of the DBRF-MEGN method, an algorithm for deducing minimum equivalent gene networks

    PubMed Central

    2011-01-01

    Background We previously developed the DBRF-MEGN (difference-based regulation finding-minimum equivalent gene network) method, which deduces the most parsimonious signed directed graphs (SDGs) consistent with expression profiles of single-gene deletion mutants. However, until the present study, we have not presented the details of the method's algorithm or a proof of the algorithm. Results We describe in detail the algorithm of the DBRF-MEGN method and prove that the algorithm deduces all of the exact solutions of the most parsimonious SDGs consistent with expression profiles of gene deletion mutants. Conclusions The DBRF-MEGN method provides all of the exact solutions of the most parsimonious SDGs consistent with expression profiles of gene deletion mutants. PMID:21699737

  8. Transcriptional Response of Honey Bee Larvae Infected with the Bacterial Pathogen Paenibacillus larvae

    PubMed Central

    Cornman, Robert Scott; Lopez, Dawn; Evans, Jay D.

    2013-01-01

    American foulbrood disease of honey bees is caused by the bacterium Paenibacillus larvae. Infection occurs per os in larvae and systemic infection requires a breaching of the host peritrophic matrix and midgut epithelium. Genetic variation exists for both bacterial virulence and host resistance, and a general immunity is achieved by larvae as they age, the basis of which has not been identified. To quickly identify a pool of candidate genes responsive to P. larvae infection, we sequenced transcripts from larvae inoculated with P. larvae at 12 hours post-emergence and incubated for 72 hours, and compared expression levels to a control cohort. We identified 75 genes with significantly higher expression and six genes with significantly lower expression. In addition to several antimicrobial peptides, two genes encoding peritrophic-matrix domains were also up-regulated. Extracellular matrix proteins, proteases/protease inhibitors, and members of the Osiris gene family were prevalent among differentially regulated genes. However, analysis of Drosophila homologs of differentially expressed genes revealed spatial and temporal patterns consistent with developmental asynchrony as a likely confounder of our results. We therefore used qPCR to measure the consistency of gene expression changes for a subset of differentially expressed genes. A replicate experiment sampled at both 48 and 72 hours post infection allowed further discrimination of genes likely to be involved in host response. The consistently responsive genes in our test set included a hymenopteran-specific protein tyrosine kinase, a hymenopteran specific serine endopeptidase, a cytochrome P450 (CYP9Q1), and a homolog of trynity, a zona pellucida domain protein. Of the known honey bee antimicrobial peptides, apidaecin was responsive at both time-points studied whereas hymenoptaecin was more consistent in its level of change between biological replicates and had the greatest increase in expression by RNA-seq analysis. PMID:23762370

  9. Gene expression inference with deep learning.

    PubMed

    Chen, Yifei; Li, Yi; Narayan, Rajiv; Subramanian, Aravind; Xie, Xiaohui

    2016-06-15

    Large-scale gene expression profiling has been widely used to characterize cellular states in response to various disease conditions, genetic perturbations, etc. Although the cost of whole-genome expression profiles has been dropping steadily, generating a compendium of expression profiling over thousands of samples is still very expensive. Recognizing that gene expressions are often highly correlated, researchers from the NIH LINCS program have developed a cost-effective strategy of profiling only ∼1000 carefully selected landmark genes and relying on computational methods to infer the expression of remaining target genes. However, the computational approach adopted by the LINCS program is currently based on linear regression (LR), limiting its accuracy since it does not capture complex nonlinear relationship between expressions of genes. We present a deep learning method (abbreviated as D-GEX) to infer the expression of target genes from the expression of landmark genes. We used the microarray-based Gene Expression Omnibus dataset, consisting of 111K expression profiles, to train our model and compare its performance to those from other methods. In terms of mean absolute error averaged across all genes, deep learning significantly outperforms LR with 15.33% relative improvement. A gene-wise comparative analysis shows that deep learning achieves lower error than LR in 99.97% of the target genes. We also tested the performance of our learned model on an independent RNA-Seq-based GTEx dataset, which consists of 2921 expression profiles. Deep learning still outperforms LR with 6.57% relative improvement, and achieves lower error in 81.31% of the target genes. D-GEX is available at https://github.com/uci-cbcl/D-GEX CONTACT: xhx@ics.uci.edu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  10. Gene expression inference with deep learning

    PubMed Central

    Chen, Yifei; Li, Yi; Narayan, Rajiv; Subramanian, Aravind; Xie, Xiaohui

    2016-01-01

    Motivation: Large-scale gene expression profiling has been widely used to characterize cellular states in response to various disease conditions, genetic perturbations, etc. Although the cost of whole-genome expression profiles has been dropping steadily, generating a compendium of expression profiling over thousands of samples is still very expensive. Recognizing that gene expressions are often highly correlated, researchers from the NIH LINCS program have developed a cost-effective strategy of profiling only ∼1000 carefully selected landmark genes and relying on computational methods to infer the expression of remaining target genes. However, the computational approach adopted by the LINCS program is currently based on linear regression (LR), limiting its accuracy since it does not capture complex nonlinear relationship between expressions of genes. Results: We present a deep learning method (abbreviated as D-GEX) to infer the expression of target genes from the expression of landmark genes. We used the microarray-based Gene Expression Omnibus dataset, consisting of 111K expression profiles, to train our model and compare its performance to those from other methods. In terms of mean absolute error averaged across all genes, deep learning significantly outperforms LR with 15.33% relative improvement. A gene-wise comparative analysis shows that deep learning achieves lower error than LR in 99.97% of the target genes. We also tested the performance of our learned model on an independent RNA-Seq-based GTEx dataset, which consists of 2921 expression profiles. Deep learning still outperforms LR with 6.57% relative improvement, and achieves lower error in 81.31% of the target genes. Availability and implementation: D-GEX is available at https://github.com/uci-cbcl/D-GEX. Contact: xhx@ics.uci.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26873929

  11. Reprogramming Microbes for the Remote Detection of Environmental Threats

    DTIC Science & Technology

    2013-10-15

    Riboswitches consist of an aptamer that recognizes the ligand and an expression platform that couples ligand binding to a change in gene expression. Using in...vitro selection, it is possible to screen large (~10^13 member) libraries of RNA sequences to discover new aptamers . However, limitations in...consist of an aptamer that recognizes the ligand and an expression platform that couples ligand binding to a change in gene expression. Using in

  12. Extraordinary diversity of visual opsin genes in dragonflies

    PubMed Central

    Futahashi, Ryo; Kawahara-Miki, Ryouka; Kinoshita, Michiyo; Yoshitake, Kazutoshi; Yajima, Shunsuke; Arikawa, Kentaro; Fukatsu, Takema

    2015-01-01

    Dragonflies are colorful and large-eyed animals strongly dependent on color vision. Here we report an extraordinary large number of opsin genes in dragonflies and their characteristic spatiotemporal expression patterns. Exhaustive transcriptomic and genomic surveys of three dragonflies of the family Libellulidae consistently identified 20 opsin genes, consisting of 4 nonvisual opsin genes and 16 visual opsin genes of 1 UV, 5 short-wavelength (SW), and 10 long-wavelength (LW) type. Comprehensive transcriptomic survey of the other dragonflies representing an additional 10 families also identified as many as 15–33 opsin genes. Molecular phylogenetic analysis revealed dynamic multiplications and losses of the opsin genes in the course of evolution. In contrast to many SW and LW genes expressed in adults, only one SW gene and several LW genes were expressed in larvae, reflecting less visual dependence and LW-skewed light conditions for their lifestyle under water. In this context, notably, the sand-burrowing or pit-dwelling species tended to lack SW gene expression in larvae. In adult visual organs: (i) many SW genes and a few LW genes were expressed in the dorsal region of compound eyes, presumably for processing SW-skewed light from the sky; (ii) a few SW genes and many LW genes were expressed in the ventral region of compound eyes, probably for perceiving terrestrial objects; and (iii) expression of a specific LW gene was associated with ocelli. Our findings suggest that the stage- and region-specific expressions of the diverse opsin genes underlie the behavior, ecology, and adaptation of dragonflies. PMID:25713365

  13. Gene expression variability in human hepatic drug metabolizing enzymes and transporters.

    PubMed

    Yang, Lun; Price, Elvin T; Chang, Ching-Wei; Li, Yan; Huang, Ying; Guo, Li-Wu; Guo, Yongli; Kaput, Jim; Shi, Leming; Ning, Baitang

    2013-01-01

    Interindividual variability in the expression of drug-metabolizing enzymes and transporters (DMETs) in human liver may contribute to interindividual differences in drug efficacy and adverse reactions. Published studies that analyzed variability in the expression of DMET genes were limited by sample sizes and the number of genes profiled. We systematically analyzed the expression of 374 DMETs from a microarray data set consisting of gene expression profiles derived from 427 human liver samples. The standard deviation of interindividual expression for DMET genes was much higher than that for non-DMET genes. The 20 DMET genes with the largest variability in the expression provided examples of the interindividual variation. Gene expression data were also analyzed using network analysis methods, which delineates the similarities of biological functionalities and regulation mechanisms for these highly variable DMET genes. Expression variability of human hepatic DMET genes may affect drug-gene interactions and disease susceptibility, with concomitant clinical implications.

  14. A big data pipeline: Identifying dynamic gene regulatory networks from time-course Gene Expression Omnibus data with applications to influenza infection.

    PubMed

    Carey, Michelle; Ramírez, Juan Camilo; Wu, Shuang; Wu, Hulin

    2018-07-01

    A biological host response to an external stimulus or intervention such as a disease or infection is a dynamic process, which is regulated by an intricate network of many genes and their products. Understanding the dynamics of this gene regulatory network allows us to infer the mechanisms involved in a host response to an external stimulus, and hence aids the discovery of biomarkers of phenotype and biological function. In this article, we propose a modeling/analysis pipeline for dynamic gene expression data, called Pipeline4DGEData, which consists of a series of statistical modeling techniques to construct dynamic gene regulatory networks from the large volumes of high-dimensional time-course gene expression data that are freely available in the Gene Expression Omnibus repository. This pipeline has a consistent and scalable structure that allows it to simultaneously analyze a large number of time-course gene expression data sets, and then integrate the results across different studies. We apply the proposed pipeline to influenza infection data from nine studies and demonstrate that interesting biological findings can be discovered with its implementation.

  15. Computing and Applying Atomic Regulons to Understand Gene Expression and Regulation

    PubMed Central

    Faria, José P.; Davis, James J.; Edirisinghe, Janaka N.; Taylor, Ronald C.; Weisenhorn, Pamela; Olson, Robert D.; Stevens, Rick L.; Rocha, Miguel; Rocha, Isabel; Best, Aaron A.; DeJongh, Matthew; Tintle, Nathan L.; Parrello, Bruce; Overbeek, Ross; Henry, Christopher S.

    2016-01-01

    Understanding gene function and regulation is essential for the interpretation, prediction, and ultimate design of cell responses to changes in the environment. An important step toward meeting the challenge of understanding gene function and regulation is the identification of sets of genes that are always co-expressed. These gene sets, Atomic Regulons (ARs), represent fundamental units of function within a cell and could be used to associate genes of unknown function with cellular processes and to enable rational genetic engineering of cellular systems. Here, we describe an approach for inferring ARs that leverages large-scale expression data sets, gene context, and functional relationships among genes. We computed ARs for Escherichia coli based on 907 gene expression experiments and compared our results with gene clusters produced by two prevalent data-driven methods: Hierarchical clustering and k-means clustering. We compared ARs and purely data-driven gene clusters to the curated set of regulatory interactions for E. coli found in RegulonDB, showing that ARs are more consistent with gold standard regulons than are data-driven gene clusters. We further examined the consistency of ARs and data-driven gene clusters in the context of gene interactions predicted by Context Likelihood of Relatedness (CLR) analysis, finding that the ARs show better agreement with CLR predicted interactions. We determined the impact of increasing amounts of expression data on AR construction and find that while more data improve ARs, it is not necessary to use the full set of gene expression experiments available for E. coli to produce high quality ARs. In order to explore the conservation of co-regulated gene sets across different organisms, we computed ARs for Shewanella oneidensis, Pseudomonas aeruginosa, Thermus thermophilus, and Staphylococcus aureus, each of which represents increasing degrees of phylogenetic distance from E. coli. Comparison of the organism-specific ARs showed that the consistency of AR gene membership correlates with phylogenetic distance, but there is clear variability in the regulatory networks of closely related organisms. As large scale expression data sets become increasingly common for model and non-model organisms, comparative analyses of atomic regulons will provide valuable insights into fundamental regulatory modules used across the bacterial domain. PMID:27933038

  16. Molecular profiling of tumor progression in head and neck cancer.

    PubMed

    Belbin, Thomas J; Singh, Bhuvanesh; Smith, Richard V; Socci, Nicholas D; Wreesmann, Volkert B; Sanchez-Carbayo, Marta; Masterson, Jessica; Patel, Snehal; Cordon-Cardo, Carlos; Prystowsky, Michael B; Childs, Geoffrey

    2005-01-01

    To assess gene expression changes associated with tumor progression in patients with squamous cell carcinoma of the oral cavity. A microarray containing 17 840 complementary DNA clones was used to measure gene expression changes associated with tumor progression in 9 patients with squamous cell carcinoma of the oral cavity. Samples were taken for analysis from the primary tumor, nodal metastasis, and "normal" mucosa from the patients' oral cavity. Tertiary care facility. Patients Nine patients with stage III or stage IV untreated oral cavity squamous cell carcinoma. Our analysis to categorize genes based on their expression patterns has identified 140 genes that consistently increased in expression during progression from normal tissue to invasive tumor and subsequently to metastatic node (in at least 4 of the 9 cases studied). A similar list of 94 genes has been identified that decreased in expression during tumor progression and metastasis. We validated this gene discovery approach by selecting moesin (a member of the ezrin/radixin/moesin [ERM] family of cytoskeletal proteins) and one of the genes that consistently increased in expression during tumor progression for subsequent immunohistochemical analysis using a head and neck squamous cell carcinoma tissue array. A distinct pattern of gene expression, with progressive up- or down-regulation of expression, is found during the progression from histologically normal tissue to primary carcinoma and to nodal metastasis.

  17. Glioma IL13Rα2 Is Associated with Mesenchymal Signature Gene Expression and Poor Patient Prognosis

    PubMed Central

    Starr, Renate; Deng, Xutao; Badie, Behnam; Yuan, Yate-Ching; Forman, Stephen J.; Barish, Michael E.

    2013-01-01

    A major challenge for successful immunotherapy against glioma is the identification and characterization of validated targets. We have taken a bioinformatics approach towards understanding the biological context of IL-13 receptor α2 (IL13Rα2) expression in brain tumors, and its functional significance for patient survival. Querying multiple gene expression databases, we show that IL13Rα2 expression increases with glioma malignancy grade, and expression for high-grade tumors is bimodal, with approximately 58% of WHO grade IV gliomas over-expressing this receptor. By several measures, IL13Rα2 expression in patient samples and low-passage primary glioma lines most consistently correlates with the expression of signature genes defining mesenchymal subclass tumors and negatively correlates with proneural signature genes as defined by two studies. Positive associations were also noted with proliferative signature genes, whereas no consistent associations were found with either classical or neural signature genes. Probing the potential functional consequences of this mesenchymal association through IPA analysis suggests that IL13Rα2 expression is associated with activation of proinflammatory and immune pathways characteristic of mesenchymal subclass tumors. In addition, survival analyses indicate that IL13Rα2 over-expression is associated with poor patient prognosis, a single gene correlation ranking IL13Rα2 in the top ~1% of total gene expression probes with regard to survival association with WHO IV gliomas. This study better defines the functional consequences of IL13Rα2 expression by demonstrating association with mesenchymal signature gene expression and poor patient prognosis. It thus highlights the utility of IL13Rα2 as a therapeutic target, and helps define patient populations most likely to respond to immunotherapy in present and future clinical trials. PMID:24204956

  18. Glioma IL13Rα2 is associated with mesenchymal signature gene expression and poor patient prognosis.

    PubMed

    Brown, Christine E; Warden, Charles D; Starr, Renate; Deng, Xutao; Badie, Behnam; Yuan, Yate-Ching; Forman, Stephen J; Barish, Michael E

    2013-01-01

    A major challenge for successful immunotherapy against glioma is the identification and characterization of validated targets. We have taken a bioinformatics approach towards understanding the biological context of IL-13 receptor α2 (IL13Rα2) expression in brain tumors, and its functional significance for patient survival. Querying multiple gene expression databases, we show that IL13Rα2 expression increases with glioma malignancy grade, and expression for high-grade tumors is bimodal, with approximately 58% of WHO grade IV gliomas over-expressing this receptor. By several measures, IL13Rα2 expression in patient samples and low-passage primary glioma lines most consistently correlates with the expression of signature genes defining mesenchymal subclass tumors and negatively correlates with proneural signature genes as defined by two studies. Positive associations were also noted with proliferative signature genes, whereas no consistent associations were found with either classical or neural signature genes. Probing the potential functional consequences of this mesenchymal association through IPA analysis suggests that IL13Rα2 expression is associated with activation of proinflammatory and immune pathways characteristic of mesenchymal subclass tumors. In addition, survival analyses indicate that IL13Rα2 over-expression is associated with poor patient prognosis, a single gene correlation ranking IL13Rα2 in the top ~1% of total gene expression probes with regard to survival association with WHO IV gliomas. This study better defines the functional consequences of IL13Rα2 expression by demonstrating association with mesenchymal signature gene expression and poor patient prognosis. It thus highlights the utility of IL13Rα2 as a therapeutic target, and helps define patient populations most likely to respond to immunotherapy in present and future clinical trials.

  19. Picking Cell Lines for High-Throughput Transcriptomic Toxicity ...

    EPA Pesticide Factsheets

    High throughput, whole genome transcriptomic profiling is a promising approach to comprehensively evaluate chemicals for potential biological effects. To be useful for in vitro toxicity screening, gene expression must be quantified in a set of representative cell types that captures the diversity of potential responses across chemicals. The ideal dataset to select these cell types would consist of hundreds of cell types treated with thousands of chemicals, but does not yet exist. However, basal gene expression data may be useful as a surrogate for representing the relevant biological space necessary for cell type selection. The goal of this study was to identify a small (< 20) number of cell types that capture a large, quantifiable fraction of basal gene expression diversity. Three publicly available collections of Affymetrix U133+2.0 cellular gene expression data were used: 1) 59 cell lines from the NCI60 set; 2) 303 primary cell types from the Mabbott et al (2013) expression atlas; and 3) 1036 cell lines from the Cancer Cell Line Encyclopedia. The data were RMA normalized, log-transformed, and the probe sets mapped to HUGO gene identifiers. The results showed that <20 cell lines capture only a small fraction of the total diversity in basal gene expression when evaluated using either the entire set of 20960 HUGO genes or a subset of druggable genes likely to be chemical targets. The fraction of the total gene expression variation explained was consistent when

  20. Identification of General Patterns of Sex-Biased Expression in Daphnia, a Genus with Environmental Sex Determination

    PubMed Central

    Molinier, Cécile; Reisser, Céline M.O.; Fields, Peter; Ségard, Adeline; Galimov, Yan; Haag, Christoph R.

    2018-01-01

    Daphnia reproduce by cyclic-parthenogenesis, where phases of asexual reproduction are intermitted by sexual production of diapause stages. This life cycle, together with environmental sex determination, allow the comparison of gene expression between genetically identical males and females. We investigated gene expression differences between males and females in four genotypes of Daphnia magna and compared the results with published data on sex-biased gene expression in two other Daphnia species, each representing one of the major phylogenetic clades within the genus. We found that 42% of all annotated genes showed sex-biased expression in D. magna. This proportion is similar both to estimates from other Daphnia species as well as from species with genetic sex determination, suggesting that sex-biased expression is not reduced under environmental sex determination. Among 7453 single copy, one-to-one orthologs in the three Daphnia species, 707 consistently showed sex-biased expression and 675 were biased in the same direction in all three species. Hence these genes represent a core-set of genes with consistent sex-differential expression in the genus. A functional analysis identified that several of them are involved in known sex determination pathways. Moreover, 75% were overexpressed in females rather than males, a pattern that appears to be a general feature of sex-biased gene expression in Daphnia. PMID:29535148

  1. Identification of General Patterns of Sex-Biased Expression in Daphnia, a Genus with Environmental Sex Determination.

    PubMed

    Molinier, Cécile; Reisser, Céline M O; Fields, Peter; Ségard, Adeline; Galimov, Yan; Haag, Christoph R

    2018-05-04

    Daphnia reproduce by cyclic-parthenogenesis, where phases of asexual reproduction are intermitted by sexual production of diapause stages. This life cycle, together with environmental sex determination, allow the comparison of gene expression between genetically identical males and females. We investigated gene expression differences between males and females in four genotypes of Daphnia magna and compared the results with published data on sex-biased gene expression in two other Daphnia species, each representing one of the major phylogenetic clades within the genus. We found that 42% of all annotated genes showed sex-biased expression in D. magna This proportion is similar both to estimates from other Daphnia species as well as from species with genetic sex determination, suggesting that sex-biased expression is not reduced under environmental sex determination. Among 7453 single copy, one-to-one orthologs in the three Daphnia species, 707 consistently showed sex-biased expression and 675 were biased in the same direction in all three species. Hence these genes represent a core-set of genes with consistent sex-differential expression in the genus. A functional analysis identified that several of them are involved in known sex determination pathways. Moreover, 75% were overexpressed in females rather than males, a pattern that appears to be a general feature of sex-biased gene expression in Daphnia . Copyright © 2018 Molinier et al.

  2. UNCLES: method for the identification of genes differentially consistently co-expressed in a specific subset of datasets.

    PubMed

    Abu-Jamous, Basel; Fa, Rui; Roberts, David J; Nandi, Asoke K

    2015-06-04

    Collective analysis of the increasingly emerging gene expression datasets are required. The recently proposed binarisation of consensus partition matrices (Bi-CoPaM) method can combine clustering results from multiple datasets to identify the subsets of genes which are consistently co-expressed in all of the provided datasets in a tuneable manner. However, results validation and parameter setting are issues that complicate the design of such methods. Moreover, although it is a common practice to test methods by application to synthetic datasets, the mathematical models used to synthesise such datasets are usually based on approximations which may not always be sufficiently representative of real datasets. Here, we propose an unsupervised method for the unification of clustering results from multiple datasets using external specifications (UNCLES). This method has the ability to identify the subsets of genes consistently co-expressed in a subset of datasets while being poorly co-expressed in another subset of datasets, and to identify the subsets of genes consistently co-expressed in all given datasets. We also propose the M-N scatter plots validation technique and adopt it to set the parameters of UNCLES, such as the number of clusters, automatically. Additionally, we propose an approach for the synthesis of gene expression datasets using real data profiles in a way which combines the ground-truth-knowledge of synthetic data and the realistic expression values of real data, and therefore overcomes the problem of faithfulness of synthetic expression data modelling. By application to those datasets, we validate UNCLES while comparing it with other conventional clustering methods, and of particular relevance, biclustering methods. We further validate UNCLES by application to a set of 14 real genome-wide yeast datasets as it produces focused clusters that conform well to known biological facts. Furthermore, in-silico-based hypotheses regarding the function of a few previously unknown genes in those focused clusters are drawn. The UNCLES method, the M-N scatter plots technique, and the expression data synthesis approach will have wide application for the comprehensive analysis of genomic and other sources of multiple complex biological datasets. Moreover, the derived in-silico-based biological hypotheses represent subjects for future functional studies.

  3. The chemiluminescence based Ziplex automated workstation focus array reproduces ovarian cancer Affymetrix GeneChip expression profiles.

    PubMed

    Quinn, Michael C J; Wilson, Daniel J; Young, Fiona; Dempsey, Adam A; Arcand, Suzanna L; Birch, Ashley H; Wojnarowicz, Paulina M; Provencher, Diane; Mes-Masson, Anne-Marie; Englert, David; Tonin, Patricia N

    2009-07-06

    As gene expression signatures may serve as biomarkers, there is a need to develop technologies based on mRNA expression patterns that are adaptable for translational research. Xceed Molecular has recently developed a Ziplex technology, that can assay for gene expression of a discrete number of genes as a focused array. The present study has evaluated the reproducibility of the Ziplex system as applied to ovarian cancer research of genes shown to exhibit distinct expression profiles initially assessed by Affymetrix GeneChip analyses. The new chemiluminescence-based Ziplex gene expression array technology was evaluated for the expression of 93 genes selected based on their Affymetrix GeneChip profiles as applied to ovarian cancer research. Probe design was based on the Affymetrix target sequence that favors the 3' UTR of transcripts in order to maximize reproducibility across platforms. Gene expression analysis was performed using the Ziplex Automated Workstation. Statistical analyses were performed to evaluate reproducibility of both the magnitude of expression and differences between normal and tumor samples by correlation analyses, fold change differences and statistical significance testing. Expressions of 82 of 93 (88.2%) genes were highly correlated (p < 0.01) in a comparison of the two platforms. Overall, 75 of 93 (80.6%) genes exhibited consistent results in normal versus tumor tissue comparisons for both platforms (p < 0.001). The fold change differences were concordant for 87 of 93 (94%) genes, where there was agreement between the platforms regarding statistical significance for 71 (76%) of 87 genes. There was a strong agreement between the two platforms as shown by comparisons of log2 fold differences of gene expression between tumor versus normal samples (R = 0.93) and by Bland-Altman analysis, where greater than 90% of expression values fell within the 95% limits of agreement. Overall concordance of gene expression patterns based on correlations, statistical significance between tumor and normal ovary data, and fold changes was consistent between the Ziplex and Affymetrix platforms. The reproducibility and ease-of-use of the technology suggests that the Ziplex array is a suitable platform for translational research.

  4. Differentially expressed microRNAs in lung adenocarcinoma invert effects of copy number aberrations of prognostic genes

    PubMed Central

    Tokar, Tomas; Pastrello, Chiara; Ramnarine, Varune R.; Zhu, Chang-Qi; Craddock, Kenneth J.; Pikor, Larrisa A.; Vucic, Emily A.; Vary, Simon; Shepherd, Frances A.; Tsao, Ming-Sound; Lam, Wan L.; Jurisica, Igor

    2018-01-01

    In many cancers, significantly down- or upregulated genes are found within chromosomal regions with DNA copy number alteration opposite to the expression changes. Generally, this paradox has been overlooked as noise, but can potentially be a consequence of interference of epigenetic regulatory mechanisms, including microRNA-mediated control of mRNA levels. To explore potential associations between microRNAs and paradoxes in non-small-cell lung cancer (NSCLC) we curated and analyzed lung adenocarcinoma (LUAD) data, comprising gene expressions, copy number aberrations (CNAs) and microRNA expressions. We integrated data from 1,062 tumor samples and 241 normal lung samples, including newly-generated array comparative genomic hybridization (aCGH) data from 63 LUAD samples. We identified 85 “paradoxical” genes whose differential expression consistently contrasted with aberrations of their copy numbers. Paradoxical status of 70 out of 85 genes was validated on sample-wise basis using The Cancer Genome Atlas (TCGA) LUAD data. Of these, 41 genes are prognostic and form a clinically relevant signature, which we validated on three independent datasets. By meta-analysis of results from 9 LUAD microRNA expression studies we identified 24 consistently-deregulated microRNAs. Using TCGA-LUAD data we showed that deregulation of 19 of these microRNAs explains differential expression of the paradoxical genes. Our results show that deregulation of paradoxical genes is crucial in LUAD and their expression pattern is maintained epigenetically, defying gene copy number status. PMID:29507679

  5. A transversal approach to predict gene product networks from ontology-based similarity

    PubMed Central

    Chabalier, Julie; Mosser, Jean; Burgun, Anita

    2007-01-01

    Background Interpretation of transcriptomic data is usually made through a "standard" approach which consists in clustering the genes according to their expression patterns and exploiting Gene Ontology (GO) annotations within each expression cluster. This approach makes it difficult to underline functional relationships between gene products that belong to different expression clusters. To address this issue, we propose a transversal analysis that aims to predict functional networks based on a combination of GO processes and data expression. Results The transversal approach presented in this paper consists in computing the semantic similarity between gene products in a Vector Space Model. Through a weighting scheme over the annotations, we take into account the representativity of the terms that annotate a gene product. Comparing annotation vectors results in a matrix of gene product similarities. Combined with expression data, the matrix is displayed as a set of functional gene networks. The transversal approach was applied to 186 genes related to the enterocyte differentiation stages. This approach resulted in 18 functional networks proved to be biologically relevant. These results were compared with those obtained through a standard approach and with an approach based on information content similarity. Conclusion Complementary to the standard approach, the transversal approach offers new insight into the cellular mechanisms and reveals new research hypotheses by combining gene product networks based on semantic similarity, and data expression. PMID:17605807

  6. Identifying Epigenetic Biomarkers using Maximal Relevance and Minimal Redundancy Based Feature Selection for Multi-Omics Data.

    PubMed

    Mallik, Saurav; Bhadra, Tapas; Maulik, Ujjwal

    2017-01-01

    Epigenetic Biomarker discovery is an important task in bioinformatics. In this article, we develop a new framework of identifying statistically significant epigenetic biomarkers using maximal-relevance and minimal-redundancy criterion based feature (gene) selection for multi-omics dataset. Firstly, we determine the genes that have both expression as well as methylation values, and follow normal distribution. Similarly, we identify the genes which consist of both expression and methylation values, but do not follow normal distribution. For each case, we utilize a gene-selection method that provides maximal-relevant, but variable-weighted minimum-redundant genes as top ranked genes. For statistical validation, we apply t-test on both the expression and methylation data consisting of only the normally distributed top ranked genes to determine how many of them are both differentially expressed andmethylated. Similarly, we utilize Limma package for performing non-parametric Empirical Bayes test on both expression and methylation data comprising only the non-normally distributed top ranked genes to identify how many of them are both differentially expressed and methylated. We finally report the top-ranking significant gene-markerswith biological validation. Moreover, our framework improves positive predictive rate and reduces false positive rate in marker identification. In addition, we provide a comparative analysis of our gene-selection method as well as othermethods based on classificationperformances obtained using several well-known classifiers.

  7. The nitrogen responsive transcriptome in potato (Solanum tuberosum L.) reveals significant gene regulatory motifs.

    PubMed

    Gálvez, José Héctor; Tai, Helen H; Lagüe, Martin; Zebarth, Bernie J; Strömvik, Martina V

    2016-05-19

    Nitrogen (N) is the most important nutrient for the growth of potato (Solanum tuberosum L.). Foliar gene expression in potato plants with and without N supplementation at 180 kg N ha(-1) was compared at mid-season. Genes with consistent differences in foliar expression due to N supplementation over three cultivars and two developmental time points were examined. In total, thirty genes were found to be over-expressed and nine genes were found to be under-expressed with supplemented N. Functional relationships between over-expressed genes were found. The main metabolic pathway represented among differentially expressed genes was amino acid metabolism. The 1000 bp upstream flanking regions of the differentially expressed genes were analysed and nine overrepresented motifs were found using three motif discovery algorithms (Seeder, Weeder and MEME). These results point to coordinated gene regulation at the transcriptional level controlling steady state potato responses to N sufficiency.

  8. The nitrogen responsive transcriptome in potato (Solanum tuberosum L.) reveals significant gene regulatory motifs

    PubMed Central

    Gálvez, José Héctor; Tai, Helen H.; Lagüe, Martin; Zebarth, Bernie J.; Strömvik, Martina V.

    2016-01-01

    Nitrogen (N) is the most important nutrient for the growth of potato (Solanum tuberosum L.). Foliar gene expression in potato plants with and without N supplementation at 180 kg N ha−1 was compared at mid-season. Genes with consistent differences in foliar expression due to N supplementation over three cultivars and two developmental time points were examined. In total, thirty genes were found to be over-expressed and nine genes were found to be under-expressed with supplemented N. Functional relationships between over-expressed genes were found. The main metabolic pathway represented among differentially expressed genes was amino acid metabolism. The 1000 bp upstream flanking regions of the differentially expressed genes were analysed and nine overrepresented motifs were found using three motif discovery algorithms (Seeder, Weeder and MEME). These results point to coordinated gene regulation at the transcriptional level controlling steady state potato responses to N sufficiency. PMID:27193058

  9. Gene Expression and Pharmacodynamic Changes in 1,760 Systemic Lupus Erythematosus Patients From Two Phase III Trials of BAFF Blockade With Tabalumab.

    PubMed

    Hoffman, Robert W; Merrill, Joan T; Alarcón-Riquelme, Marta M E; Petri, Michelle; Dow, Ernst R; Nantz, Eric; Nisenbaum, Laura K; Schroeder, Krista M; Komocsar, Wendy J; Perumal, Narayanan B; Linnik, Matthew D; Airey, David C; Liu, Yushi; Rocha, Guilherme V; Higgs, Richard E

    2017-03-01

    To characterize baseline gene expression and pharmacodynamically induced changes in whole blood gene expression in 1,760 systemic lupus erythematosus (SLE) patients from 2 phase III, 52-week, randomized, placebo-controlled, double-blind studies in which patients were treated with the BAFF-blocking IgG4 monoclonal antibody tabalumab. Patient samples were obtained from SLE patients from the ILLUMINATE-1 and ILLUMINATE-2 studies, and control samples were obtained from healthy donors. Blood was collected in Tempus tubes at baseline, week 16, and week 52. RNA was analyzed using Affymetrix Human Transcriptome Array 2.0 and NanoString. At baseline, expression of the interferon (IFN) response gene was elevated in patients compared with controls, with 75% of patients being positive for this IFN response gene signature. There was, however, substantial heterogeneity of IFN response gene expression and complex relationships among gene networks. The IFN response gene signature was a predictor of time to disease flare, independent of anti-double-stranded DNA (anti-dsDNA) antibody and C3 and C4 levels, and overall disease activity. Pharmacodynamically induced changes in gene expression following tabalumab treatment were extensive, occurring predominantly in B cell-related and immunoglobulin genes, and were consistent with other pharmacodynamic changes including anti-dsDNA antibody, C3, and immunoglobulin levels. SLE patients demonstrated increased expression of an IFN response gene signature (75% of patients had an elevated IFN response gene signature) at baseline in ILLUMINATE-1 and ILLUMINATE-2. Substantial heterogeneity of gene expression was detected among individual patients and in gene networks. The IFN response gene signature was an independent risk factor for future disease flares. Pharmacodynamic changes in gene expression were consistent with the mechanism of BAFF blockade by tabalumab. © 2016, American College of Rheumatology.

  10. Identifying spatially similar gene expression patterns in early stage fruit fly embryo images: binary feature versus invariant moment digital representations

    PubMed Central

    Gurunathan, Rajalakshmi; Van Emden, Bernard; Panchanathan, Sethuraman; Kumar, Sudhir

    2004-01-01

    Background Modern developmental biology relies heavily on the analysis of embryonic gene expression patterns. Investigators manually inspect hundreds or thousands of expression patterns to identify those that are spatially similar and to ultimately infer potential gene interactions. However, the rapid accumulation of gene expression pattern data over the last two decades, facilitated by high-throughput techniques, has produced a need for the development of efficient approaches for direct comparison of images, rather than their textual descriptions, to identify spatially similar expression patterns. Results The effectiveness of the Binary Feature Vector (BFV) and Invariant Moment Vector (IMV) based digital representations of the gene expression patterns in finding biologically meaningful patterns was compared for a small (226 images) and a large (1819 images) dataset. For each dataset, an ordered list of images, with respect to a query image, was generated to identify overlapping and similar gene expression patterns, in a manner comparable to what a developmental biologist might do. The results showed that the BFV representation consistently outperforms the IMV representation in finding biologically meaningful matches when spatial overlap of the gene expression pattern and the genes involved are considered. Furthermore, we explored the value of conducting image-content based searches in a dataset where individual expression components (or domains) of multi-domain expression patterns were also included separately. We found that this technique improves performance of both IMV and BFV based searches. Conclusions We conclude that the BFV representation consistently produces a more extensive and better list of biologically useful patterns than the IMV representation. The high quality of results obtained scales well as the search database becomes larger, which encourages efforts to build automated image query and retrieval systems for spatial gene expression patterns. PMID:15603586

  11. Partitioning of functional gene expression data using principal points.

    PubMed

    Kim, Jaehee; Kim, Haseong

    2017-10-12

    DNA microarrays offer motivation and hope for the simultaneous study of variations in multiple genes. Gene expression is a temporal process that allows variations in expression levels with a characterized gene function over a period of time. Temporal gene expression curves can be treated as functional data since they are considered as independent realizations of a stochastic process. This process requires appropriate models to identify patterns of gene functions. The partitioning of the functional data can find homogeneous subgroups of entities for the massive genes within the inherent biological networks. Therefor it can be a useful technique for the analysis of time-course gene expression data. We propose a new self-consistent partitioning method of functional coefficients for individual expression profiles based on the orthonormal basis system. A principal points based functional partitioning method is proposed for time-course gene expression data. The method explores the relationship between genes using Legendre coefficients as principal points to extract the features of gene functions. Our proposed method provides high connectivity in connectedness after clustering for simulated data and finds a significant subsets of genes with the increased connectivity. Our approach has comparative advantages that fewer coefficients are used from the functional data and self-consistency of principal points for partitioning. As real data applications, we are able to find partitioned genes through the gene expressions found in budding yeast data and Escherichia coli data. The proposed method benefitted from the use of principal points, dimension reduction, and choice of orthogonal basis system as well as provides appropriately connected genes in the resulting subsets. We illustrate our method by applying with each set of cell-cycle-regulated time-course yeast genes and E. coli genes. The proposed method is able to identify highly connected genes and to explore the complex dynamics of biological systems in functional genomics.

  12. Computational genetic neuroanatomy of the developing mouse brain: dimensionality reduction, visualization, and clustering.

    PubMed

    Ji, Shuiwang

    2013-07-11

    The structured organization of cells in the brain plays a key role in its functional efficiency. This delicate organization is the consequence of unique molecular identity of each cell gradually established by precise spatiotemporal gene expression control during development. Currently, studies on the molecular-structural association are beginning to reveal how the spatiotemporal gene expression patterns are related to cellular differentiation and structural development. In this article, we aim at a global, data-driven study of the relationship between gene expressions and neuroanatomy in the developing mouse brain. To enable visual explorations of the high-dimensional data, we map the in situ hybridization gene expression data to a two-dimensional space by preserving both the global and the local structures. Our results show that the developing brain anatomy is largely preserved in the reduced gene expression space. To provide a quantitative analysis, we cluster the reduced data into groups and measure the consistency with neuroanatomy at multiple levels. Our results show that the clusters in the low-dimensional space are more consistent with neuroanatomy than those in the original space. Gene expression patterns and developing brain anatomy are closely related. Dimensionality reduction and visual exploration facilitate the study of this relationship.

  13. Analysis of bHLH coding genes using gene co-expression network approach.

    PubMed

    Srivastava, Swati; Sanchita; Singh, Garima; Singh, Noopur; Srivastava, Gaurava; Sharma, Ashok

    2016-07-01

    Network analysis provides a powerful framework for the interpretation of data. It uses novel reference network-based metrices for module evolution. These could be used to identify module of highly connected genes showing variation in co-expression network. In this study, a co-expression network-based approach was used for analyzing the genes from microarray data. Our approach consists of a simple but robust rank-based network construction. The publicly available gene expression data of Solanum tuberosum under cold and heat stresses were considered to create and analyze a gene co-expression network. The analysis provide highly co-expressed module of bHLH coding genes based on correlation values. Our approach was to analyze the variation of genes expression, according to the time period of stress through co-expression network approach. As the result, the seed genes were identified showing multiple connections with other genes in the same cluster. Seed genes were found to be vary in different time periods of stress. These analyzed seed genes may be utilized further as marker genes for developing the stress tolerant plant species.

  14. Comparative methods for the analysis of gene-expression evolution: an example using yeast functional genomic data.

    PubMed

    Oakley, Todd H; Gu, Zhenglong; Abouheif, Ehab; Patel, Nipam H; Li, Wen-Hsiung

    2005-01-01

    Understanding the evolution of gene function is a primary challenge of modern evolutionary biology. Despite an expanding database from genomic and developmental studies, we are lacking quantitative methods for analyzing the evolution of some important measures of gene function, such as gene-expression patterns. Here, we introduce phylogenetic comparative methods to compare different models of gene-expression evolution in a maximum-likelihood framework. We find that expression of duplicated genes has evolved according to a nonphylogenetic model, where closely related genes are no more likely than more distantly related genes to share common expression patterns. These results are consistent with previous studies that found rapid evolution of gene expression during the history of yeast. The comparative methods presented here are general enough to test a wide range of evolutionary hypotheses using genomic-scale data from any organism.

  15. RNA-seq reveals more consistent reference genes for gene expression studies in human non-melanoma skin cancers

    PubMed Central

    Tan, Jean-Marie; Payne, Elizabeth J.; Lin, Lynlee L.; Sinnya, Sudipta; Raphael, Anthony P.; Lambie, Duncan; Frazer, Ian H.; Dinger, Marcel E.; Soyer, H. Peter

    2017-01-01

    Identification of appropriate reference genes (RGs) is critical to accurate data interpretation in quantitative real-time PCR (qPCR) experiments. In this study, we have utilised next generation RNA sequencing (RNA-seq) to analyse the transcriptome of a panel of non-melanoma skin cancer lesions, identifying genes that are consistently expressed across all samples. Genes encoding ribosomal proteins were amongst the most stable in this dataset. Validation of this RNA-seq data was examined using qPCR to confirm the suitability of a set of highly stable genes for use as qPCR RGs. These genes will provide a valuable resource for the normalisation of qPCR data for the analysis of non-melanoma skin cancer. PMID:28852586

  16. Honey Bee Aggression Supports a Link Between Gene Regulation and Behavioral Evolution

    USDA-ARS?s Scientific Manuscript database

    A prominent theory holds that animal phenotypes arise by evolutionary changes in the regulation of gene expression. Emerging from studies of animal development, evidence for this theory consists largely of differences in temporal or spatial patterns of gene expression that are related to morphologi...

  17. Altered gene expression in dry age-related macular degeneration suggests early loss of choroidal endothelial cells.

    PubMed

    Whitmore, S Scott; Braun, Terry A; Skeie, Jessica M; Haas, Christine M; Sohn, Elliott H; Stone, Edwin M; Scheetz, Todd E; Mullins, Robert F

    2013-01-01

    Age-related macular degeneration (AMD) is a major cause of blindness in developed countries. The molecular pathogenesis of early events in AMD is poorly understood. We investigated differential gene expression in samples of human retinal pigment epithelium (RPE) and choroid from early AMD and control maculas with exon-based arrays. Gene expression levels in nine human donor eyes with early AMD and nine control human donor eyes were assessed using Affymetrix Human Exon ST 1.0 arrays. Two controls did not pass quality control and were removed. Differentially expressed genes were annotated using the Database for Annotation, Visualization and Integrated Discovery (DAVID), and gene set enrichment analysis (GSEA) was performed on RPE-specific and endothelium-associated gene sets. The complement factor H (CFH) genotype was also assessed, and differential expression was analyzed regarding high AMD risk (YH/HH) and low AMD risk (YY) genotypes. Seventy-five genes were identified as differentially expressed (raw p value <0.01; ≥50% fold change, mean log2 expression level in AMD or control ≥ median of all average gene expression values); however, no genes were significant (adj. p value <0.01) after correction for multiple hypothesis testing. Of 52 genes with decreased expression in AMD (fold change <0.5; raw p value <0.01), 18 genes were identified by DAVID analysis as associated with vision or neurologic processes. The GSEA of the RPE-associated and endothelium-associated genes revealed a significant decrease in genes typically expressed by endothelial cells in the early AMD group compared to controls, consistent with previous histologic and proteomic studies. Analysis of the CFH genotype indicated decreased expression of ADAMTS9 in eyes with high-risk genotypes (fold change = -2.61; raw p value=0.0008). GSEA results suggest that RPE transcripts are preserved or elevated in early AMD, concomitant with loss of endothelial cell marker expression. These results are consistent with the notion that choroidal endothelial cell dropout or dedifferentiation occurs early in the pathogenesis of AMD.

  18. Genomic instability of osteosarcoma cell lines in culture: impact on the prediction of metastasis relevant genes.

    PubMed

    Muff, Roman; Rath, Prisni; Ram Kumar, Ram Mohan; Husmann, Knut; Born, Walter; Baudis, Michael; Fuchs, Bruno

    2015-01-01

    Osteosarcoma is a rare but highly malignant cancer of the bone. As a consequence, the number of established cell lines used for experimental in vitro and in vivo osteosarcoma research is limited and the value of these cell lines relies on their stability during culture. Here we investigated the stability in gene expression by microarray analysis and array genomic hybridization of three low metastatic cell lines and derivatives thereof with increased metastatic potential using cells of different passages. The osteosarcoma cell lines showed altered gene expression during in vitro culture, and it was more pronounced in two metastatic cell lines compared to the respective parental cells. Chromosomal instability contributed in part to the altered gene expression in SAOS and LM5 cells with low and high metastatic potential. To identify metastasis-relevant genes in a background of passage-dependent altered gene expression, genes involved in "Pathways in cancer" that were consistently regulated under all passage comparisons were evaluated. Genes belonging to "Hedgehog signaling pathway" and "Wnt signaling pathway" were significantly up-regulated, and IHH, WNT10B and TCF7 were found up-regulated in all three metastatic compared to the parental cell lines. Considerable instability during culture in terms of gene expression and chromosomal aberrations was observed in osteosarcoma cell lines. The use of cells from different passages and a search for genes consistently regulated in early and late passages allows the analysis of metastasis-relevant genes despite the observed instability in gene expression in osteosarcoma cell lines during culture.

  19. Transcriptome dynamics along axolotl regenerative development are consistent with an extensive reduction in gene expression heterogeneity in dedifferentiated cells

    PubMed Central

    2017-01-01

    Although in recent years the study of gene expression variation in the absence of genetic or environmental cues or gene expression heterogeneity has intensified considerably, many basic and applied biological fields still remain unaware of how useful the study of gene expression heterogeneity patterns might be for the characterization of biological systems and/or processes. Largely based on the modulator effect chromatin compaction has for gene expression heterogeneity and the extensive changes in chromatin compaction known to occur for specialized cells that are naturally or artificially induced to revert to less specialized states or dedifferentiate, I recently hypothesized that processes that concur with cell dedifferentiation would show an extensive reduction in gene expression heterogeneity. The confirmation of the existence of such trend could be of wide interest because of the biomedical and biotechnological relevance of cell dedifferentiation-based processes, i.e., regenerative development, cancer, human induced pluripotent stem cells, or plant somatic embryogenesis. Here, I report the first empirical evidence consistent with the existence of an extensive reduction in gene expression heterogeneity for processes that concur with cell dedifferentiation by analyzing transcriptome dynamics along forearm regenerative development in Ambystoma mexicanum or axolotl. Also, I briefly discuss on the utility of the study of gene expression heterogeneity dynamics might have for the characterization of cell dedifferentiation-based processes, and the engineering of tools that afforded better monitoring and modulating such processes. Finally, I reflect on how a transitional reduction in gene expression heterogeneity for dedifferentiated cells can promote a long-term increase in phenotypic heterogeneity following cell dedifferentiation with potential adverse effects for biomedical and biotechnological applications. PMID:29134148

  20. Network-based differential gene expression analysis suggests cell cycle related genes regulated by E2F1 underlie the molecular difference between smoker and non-smoker lung adenocarcinoma

    PubMed Central

    2013-01-01

    Background Differential gene expression (DGE) analysis is commonly used to reveal the deregulated molecular mechanisms of complex diseases. However, traditional DGE analysis (e.g., the t test or the rank sum test) tests each gene independently without considering interactions between them. Top-ranked differentially regulated genes prioritized by the analysis may not directly relate to the coherent molecular changes underlying complex diseases. Joint analyses of co-expression and DGE have been applied to reveal the deregulated molecular modules underlying complex diseases. Most of these methods consist of separate steps: first to identify gene-gene relationships under the studied phenotype then to integrate them with gene expression changes for prioritizing signature genes, or vice versa. It is warrant a method that can simultaneously consider gene-gene co-expression strength and corresponding expression level changes so that both types of information can be leveraged optimally. Results In this paper, we develop a gene module based method for differential gene expression analysis, named network-based differential gene expression (nDGE) analysis, a one-step integrative process for prioritizing deregulated genes and grouping them into gene modules. We demonstrate that nDGE outperforms existing methods in prioritizing deregulated genes and discovering deregulated gene modules using simulated data sets. When tested on a series of smoker and non-smoker lung adenocarcinoma data sets, we show that top differentially regulated genes identified by the rank sum test in different sets are not consistent while top ranked genes defined by nDGE in different data sets significantly overlap. nDGE results suggest that a differentially regulated gene module, which is enriched for cell cycle related genes and E2F1 targeted genes, plays a role in the molecular differences between smoker and non-smoker lung adenocarcinoma. Conclusions In this paper, we develop nDGE to prioritize deregulated genes and group them into gene modules by simultaneously considering gene expression level changes and gene-gene co-regulations. When applied to both simulated and empirical data, nDGE outperforms the traditional DGE method. More specifically, when applied to smoker and non-smoker lung cancer sets, nDGE results illustrate the molecular differences between smoker and non-smoker lung cancer. PMID:24341432

  1. MicroRNA profiling in the dentate gyrus in epileptic rats: The role of miR-187-3p.

    PubMed

    Zhang, Suya; Kou, Yubin; Hu, Chunmei; Han, Yan

    2017-06-01

    This study aimed to explore the role of aberrant miRNA expression in epilepsy and to identify more potential genes associated with epileptogenesis.The miRNA expression profile of GSE49850, which included 20 samples from the rat epileptic dentate gyrus at 7, 14, 30, and 90 days after electrical stimulation and 20 additional samples from sham time-matched controls, was downloaded from the Gene Expression Omnibus database. The significantly differentially expressed miRNAs were identified in stimulated samples at each time point compared to time-matched controls, respectively. The target genes of consistently differentially expressed miRNAs were screened from miRDB and microRNA.org databases, followed by Gene Ontology (GO) and pathway enrichment analysis and regulatory network construction. The overlapping target genes for consistently differentially expressed miRNAs were also identified from these 2 databases. Furthermore, the potential binding sites of miRNAs and their target genes were analyzed.Rno-miR-187-3p was consistently downregulated in stimulated groups compared with time-matched controls. The predicted target genes of rno-miR-187-3p were enriched in different GO terms and pathways. In addition, 7 overlapping target genes of rno-miR-187-3p were identified, including NFS1, PAQR4, CAND1, DCLK1, PRKAR2A, AKAP3, and KCNK10. These 7 overlapping target genes were determined to have a different number of matched binding sites with rno-miR-187-3p.Our study suggests that miR-187-3p may play an important role in epilepsy development and progression via regulating numerous target genes, such as NFS1, CAND1, DCLK1, AKAP3, and KCNK10. Determining the underlying mechanism of the role of miR-187-3p in epilepsy may make it a potential therapeutic option.

  2. Optimal consistency in microRNA expression analysis using reference-gene-based normalization.

    PubMed

    Wang, Xi; Gardiner, Erin J; Cairns, Murray J

    2015-05-01

    Normalization of high-throughput molecular expression profiles secures differential expression analysis between samples of different phenotypes or biological conditions, and facilitates comparison between experimental batches. While the same general principles apply to microRNA (miRNA) normalization, there is mounting evidence that global shifts in their expression patterns occur in specific circumstances, which pose a challenge for normalizing miRNA expression data. As an alternative to global normalization, which has the propensity to flatten large trends, normalization against constitutively expressed reference genes presents an advantage through their relative independence. Here we investigated the performance of reference-gene-based (RGB) normalization for differential miRNA expression analysis of microarray expression data, and compared the results with other normalization methods, including: quantile, variance stabilization, robust spline, simple scaling, rank invariant, and Loess regression. The comparative analyses were executed using miRNA expression in tissue samples derived from subjects with schizophrenia and non-psychiatric controls. We proposed a consistency criterion for evaluating methods by examining the overlapping of differentially expressed miRNAs detected using different partitions of the whole data. Based on this criterion, we found that RGB normalization generally outperformed global normalization methods. Thus we recommend the application of RGB normalization for miRNA expression data sets, and believe that this will yield a more consistent and useful readout of differentially expressed miRNAs, particularly in biological conditions characterized by large shifts in miRNA expression.

  3. Whole Genome Gene Expression Meta-Analysis of Inflammatory Bowel Disease Colon Mucosa Demonstrates Lack of Major Differences between Crohn's Disease and Ulcerative Colitis

    PubMed Central

    Østvik, Ann E.; Drozdov, Ignat; Gustafsson, Bjørn I.; Kidd, Mark; Beisvag, Vidar; Torp, Sverre H.; Waldum, Helge L.; Martinsen, Tom Christian; Damås, Jan Kristian; Espevik, Terje; Sandvik, Arne K.

    2013-01-01

    Background In inflammatory bowel disease (IBD), genetic susceptibility together with environmental factors disturbs gut homeostasis producing chronic inflammation. The two main IBD subtypes are Ulcerative colitis (UC) and Crohn’s disease (CD). We present the to-date largest microarray gene expression study on IBD encompassing both inflamed and un-inflamed colonic tissue. A meta-analysis including all available, comparable data was used to explore important aspects of IBD inflammation, thereby validating consistent gene expression patterns. Methods Colon pinch biopsies from IBD patients were analysed using Illumina whole genome gene expression technology. Differential expression (DE) was identified using LIMMA linear model in the R statistical computing environment. Results were enriched for gene ontology (GO) categories. Sets of genes encoding antimicrobial proteins (AMP) and proteins involved in T helper (Th) cell differentiation were used in the interpretation of the results. All available data sets were analysed using the same methods, and results were compared on a global and focused level as t-scores. Results Gene expression in inflamed mucosa from UC and CD are remarkably similar. The meta-analysis confirmed this. The patterns of AMP and Th cell-related gene expression were also very similar, except for IL23A which was consistently higher expressed in UC than in CD. Un-inflamed tissue from patients demonstrated minimal differences from healthy controls. Conclusions There is no difference in the Th subgroup involvement between UC and CD. Th1/Th17 related expression, with little Th2 differentiation, dominated both diseases. The different IL23A expression between UC and CD suggests an IBD subtype specific role. AMPs, previously little studied, are strongly overexpressed in IBD. The presented meta-analysis provides a sound background for further research on IBD pathobiology. PMID:23468882

  4. Whole genome gene expression meta-analysis of inflammatory bowel disease colon mucosa demonstrates lack of major differences between Crohn's disease and ulcerative colitis.

    PubMed

    Granlund, Atle van Beelen; Flatberg, Arnar; Østvik, Ann E; Drozdov, Ignat; Gustafsson, Bjørn I; Kidd, Mark; Beisvag, Vidar; Torp, Sverre H; Waldum, Helge L; Martinsen, Tom Christian; Damås, Jan Kristian; Espevik, Terje; Sandvik, Arne K

    2013-01-01

    In inflammatory bowel disease (IBD), genetic susceptibility together with environmental factors disturbs gut homeostasis producing chronic inflammation. The two main IBD subtypes are Ulcerative colitis (UC) and Crohn's disease (CD). We present the to-date largest microarray gene expression study on IBD encompassing both inflamed and un-inflamed colonic tissue. A meta-analysis including all available, comparable data was used to explore important aspects of IBD inflammation, thereby validating consistent gene expression patterns. Colon pinch biopsies from IBD patients were analysed using Illumina whole genome gene expression technology. Differential expression (DE) was identified using LIMMA linear model in the R statistical computing environment. Results were enriched for gene ontology (GO) categories. Sets of genes encoding antimicrobial proteins (AMP) and proteins involved in T helper (Th) cell differentiation were used in the interpretation of the results. All available data sets were analysed using the same methods, and results were compared on a global and focused level as t-scores. Gene expression in inflamed mucosa from UC and CD are remarkably similar. The meta-analysis confirmed this. The patterns of AMP and Th cell-related gene expression were also very similar, except for IL23A which was consistently higher expressed in UC than in CD. Un-inflamed tissue from patients demonstrated minimal differences from healthy controls. There is no difference in the Th subgroup involvement between UC and CD. Th1/Th17 related expression, with little Th2 differentiation, dominated both diseases. The different IL23A expression between UC and CD suggests an IBD subtype specific role. AMPs, previously little studied, are strongly overexpressed in IBD. The presented meta-analysis provides a sound background for further research on IBD pathobiology.

  5. Comparative toxicogenomic analysis of oral Cr(VI) exposure effects in rat and mouse small intestinal epithelia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kopec, Anna K.; Thompson, Chad M.; Kim, Suntae

    2012-07-15

    Continuous exposure to high concentrations of hexavalent chromium [Cr(VI)] in drinking water results in intestinal tumors in mice but not rats. Concentration-dependent gene expression effects were evaluated in female F344 rat duodenal and jejunal epithelia following 7 and 90 days of exposure to 0.3–520 mg/L (as sodium dichromate dihydrate, SDD) in drinking water. Whole-genome microarrays identified 3269 and 1815 duodenal, and 4557 and 1534 jejunal differentially expressed genes at 8 and 91 days, respectively, with significant overlaps between the intestinal segments. Functional annotation identified gene expression changes associated with oxidative stress, cell cycle, cell death, and immune response that weremore » consistent with reported changes in redox status and histopathology. Comparative analysis with B6C3F1 mouse data from a similarly designed study identified 2790 differentially expressed rat orthologs in the duodenum compared to 5013 mouse orthologs at day 8, and only 1504 rat and 3484 mouse orthologs at day 91. Automated dose–response modeling resulted in similar median EC{sub 50}s in the rodent duodenal and jejunal mucosae. Comparative examination of differentially expressed genes also identified divergently regulated orthologs. Comparable numbers of differentially expressed genes were observed at equivalent Cr concentrations (μg Cr/g duodenum). However, mice accumulated higher Cr levels than rats at ≥ 170 mg/L SDD, resulting in a ∼ 2-fold increase in the number of differentially expressed genes. These qualitative and quantitative differences in differential gene expression, which correlate with differences in tissue dose, likely contribute to the disparate intestinal tumor outcomes. -- Highlights: ► Cr(VI) elicits dose-dependent changes in gene expression in rat intestine. ► Cr(VI) elicits less differential gene expression in rats compared to mice. ► Cr(VI) gene expression can be phenotypically anchored to intestinal changes. ► Species-specific and divergent changes are consistent with species-specific tumors.« less

  6. Validation of reference genes for RT-qPCR analysis in Herbaspirillum seropedicae.

    PubMed

    Pessoa, Daniella Duarte Villarinho; Vidal, Marcia Soares; Baldani, José Ivo; Simoes-Araujo, Jean Luiz

    2016-08-01

    The RT-qPCR technique needs a validated set of reference genes for ensuring the consistency of the results from the gene expression. Expression stabilities for 9 genes from Herbaspirillum seropedicae, strain HRC54, grown with different carbon sources were calculated using geNorm and NormFinder, and the gene rpoA showed the best stability values. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Mechanisms Underlying Adaptation to Life in Hydrogen Sulfide–Rich Environments

    PubMed Central

    Kelley, Joanna L.; Arias-Rodriguez, Lenin; Patacsil Martin, Dorrelyn; Yee, Muh-Ching; Bustamante, Carlos D.; Tobler, Michael

    2016-01-01

    Hydrogen sulfide (H2S) is a potent toxicant interfering with oxidative phosphorylation in mitochondria and creating extreme environmental conditions in aquatic ecosystems. The mechanistic basis of adaptation to perpetual exposure to H2S remains poorly understood. We investigated evolutionarily independent lineages of livebearing fishes that have colonized and adapted to springs rich in H2S and compared their genome-wide gene expression patterns with closely related lineages from adjacent, nonsulfidic streams. Significant differences in gene expression were uncovered between all sulfidic and nonsulfidic population pairs. Variation in the number of differentially expressed genes among population pairs corresponded to differences in divergence times and rates of gene flow, which is consistent with neutral drift driving a substantial portion of gene expression variation among populations. Accordingly, there was little evidence for convergent evolution shaping large-scale gene expression patterns among independent sulfide spring populations. Nonetheless, we identified a small number of genes that was consistently differentially expressed in the same direction in all sulfidic and nonsulfidic population pairs. Functional annotation of shared differentially expressed genes indicated upregulation of genes associated with enzymatic H2S detoxification and transport of oxidized sulfur species, oxidative phosphorylation, energy metabolism, and pathways involved in responses to oxidative stress. Overall, our results suggest that modification of processes associated with H2S detoxification and toxicity likely complement each other to mediate elevated H2S tolerance in sulfide spring fishes. Our analyses allow for the development of novel hypotheses about biochemical and physiological mechanisms of adaptation to extreme environments. PMID:26861137

  8. Intrinsic gene expression subsets of diffuse cutaneous systemic sclerosis are stable in serial skin biopsies

    PubMed Central

    Pendergrass, Sarah A.; Lemaire, Raphael; Francis, Ian; Mahoney, J. Matthew; Lafyatis, Robert; Whitfield, Michael L.

    2012-01-01

    Skin biopsy gene expression was analyzed by DNA microarray from 13 dSSc patients enrolled in an open label study of rituximab, 9 dSSc patients not treated with rituximab, and 9 healthy controls. These data recapitulate the patient ‘intrinsic’ gene expression subsets described previously including proliferation, inflammatory, and normal-like groups. Serial skin biopsies showed consistent and non-progressing gene expression over time, and importantly, the patients in the inflammatory subset do not move to the fibroproliferative subset, and vice versa. We were unable to detect significant differences in gene expression before and after rituximab treatment, consistent with an apparent lack of clinical response. Serial biopsies from each patient stayed within the same gene expression subset regardless of treatment regimen or the time point at which they were taken. Collectively, these data emphasize the heterogeneous nature of SSc and demonstrate that the intrinsic subsets are an inherent, reproducible and stable feature of the disease that is independent of disease duration. Moreover, these data have fundamental importance for the future development of personalized therapy for SSc; drugs targeting inflammation are likely to benefit those patients with an inflammatory signature, whereas drugs targeting fibrosis are likely to benefit those with a fibroproliferative signature. PMID:22318389

  9. Computational genetic neuroanatomy of the developing mouse brain: dimensionality reduction, visualization, and clustering

    PubMed Central

    2013-01-01

    Background The structured organization of cells in the brain plays a key role in its functional efficiency. This delicate organization is the consequence of unique molecular identity of each cell gradually established by precise spatiotemporal gene expression control during development. Currently, studies on the molecular-structural association are beginning to reveal how the spatiotemporal gene expression patterns are related to cellular differentiation and structural development. Results In this article, we aim at a global, data-driven study of the relationship between gene expressions and neuroanatomy in the developing mouse brain. To enable visual explorations of the high-dimensional data, we map the in situ hybridization gene expression data to a two-dimensional space by preserving both the global and the local structures. Our results show that the developing brain anatomy is largely preserved in the reduced gene expression space. To provide a quantitative analysis, we cluster the reduced data into groups and measure the consistency with neuroanatomy at multiple levels. Our results show that the clusters in the low-dimensional space are more consistent with neuroanatomy than those in the original space. Conclusions Gene expression patterns and developing brain anatomy are closely related. Dimensionality reduction and visual exploration facilitate the study of this relationship. PMID:23845024

  10. Discovering causal signaling pathways through gene-expression patterns

    PubMed Central

    Parikh, Jignesh R.; Klinger, Bertram; Xia, Yu; Marto, Jarrod A.; Blüthgen, Nils

    2010-01-01

    High-throughput gene-expression studies result in lists of differentially expressed genes. Most current meta-analyses of these gene lists include searching for significant membership of the translated proteins in various signaling pathways. However, such membership enrichment algorithms do not provide insight into which pathways caused the genes to be differentially expressed in the first place. Here, we present an intuitive approach for discovering upstream signaling pathways responsible for regulating these differentially expressed genes. We identify consistently regulated signature genes specific for signal transduction pathways from a panel of single-pathway perturbation experiments. An algorithm that detects overrepresentation of these signature genes in a gene group of interest is used to infer the signaling pathway responsible for regulation. We expose our novel resource and algorithm through a web server called SPEED: Signaling Pathway Enrichment using Experimental Data sets. SPEED can be freely accessed at http://speed.sys-bio.net/. PMID:20494976

  11. Comparative brain transcriptomic analyses of scouting across distinct behavioural and ecological contexts in honeybees

    PubMed Central

    Liang, Zhengzheng S.; Mattila, Heather R.; Rodriguez-Zas, Sandra L.; Southey, Bruce R.; Seeley, Thomas D.; Robinson, Gene E.

    2014-01-01

    Individual differences in behaviour are often consistent across time and contexts, but it is not clear whether such consistency is reflected at the molecular level. We explored this issue by studying scouting in honeybees in two different behavioural and ecological contexts: finding new sources of floral food resources and finding a new nest site. Brain gene expression profiles in food-source and nest-site scouts showed a significant overlap, despite large expression differences associated with the two different contexts. Class prediction and ‘leave-one-out’ cross-validation analyses revealed that a bee's role as a scout in either context could be predicted with 92.5% success using 89 genes at minimum. We also found that genes related to four neurotransmitter systems were part of a shared brain molecular signature in both types of scouts, and the two types of scouts were more similar for genes related to glutamate and GABA than catecholamine or acetylcholine signalling. These results indicate that consistent behavioural tendencies across different ecological contexts involve a mixture of similarities and differences in brain gene expression. PMID:25355476

  12. Comparison of gene expression response to neutron and x-ray irradiation using mouse blood.

    PubMed

    Broustas, Constantinos G; Xu, Yanping; Harken, Andrew D; Garty, Guy; Amundson, Sally A

    2017-01-03

    In the event of an improvised nuclear device detonation, the prompt radiation exposure would consist of photons plus a neutron component that would contribute to the total dose. As neutrons cause more complex and difficult to repair damage to cells that would result in a more severe health burden to affected individuals, it is paramount to be able to estimate the contribution of neutrons to an estimated dose, to provide information for those making treatment decisions. Mice exposed to either 0.25 or 1 Gy of neutron or 1 or 4 Gy x-ray radiation were sacrificed at 1 or 7 days after exposure. Whole genome microarray analysis identified 7285 and 5045 differentially expressed genes in the blood of mice exposed to neutron or x-ray radiation, respectively. Neutron exposure resulted in mostly downregulated genes, whereas x-rays showed both down- and up-regulated genes. A total of 34 differentially expressed genes were regulated in response to all ≥1 Gy exposures at both times. Of these, 25 genes were consistently downregulated at days 1 and 7, whereas 9 genes, including the transcription factor E2f2, showed bi-directional regulation; being downregulated at day 1, while upregulated at day 7. Gene ontology analysis revealed that genes involved in nucleic acid metabolism processes were persistently downregulated in neutron irradiated mice, whereas genes involved in lipid metabolism were upregulated in x-ray irradiated animals. Most biological processes significantly enriched at both timepoints were consistently represented by either under- or over-expressed genes. In contrast, cell cycle processes were significant among down-regulated genes at day 1, but among up-regulated genes at day 7 after exposure to either neutron or x-rays. Cell cycle genes downregulated at day 1 were mostly distinct from the cell cycle genes upregulated at day 7. However, five cell cycle genes, Fzr1, Ube2c, Ccna2, Nusap1, and Cdc25b, were both downregulated at day 1 and upregulated at day 7. We describe, for the first time, the gene expression profile of mouse blood cells following exposure to neutrons. We have found that neutron radiation results in both distinct and common gene expression patterns compared with x-ray radiation.

  13. Regulation of the X Chromosome in the Germline and Soma of Drosophila melanogaster Males.

    PubMed

    Argyridou, Eliza; Parsch, John

    2018-05-04

    During the evolution of heteromorphic sex chromosomes, the sex-specific Y chromosome degenerates, while the X chromosome evolves new mechanisms of regulation. Using bioinformatic and experimental approaches, we investigate the expression of the X chromosome in Drosophila melanogaster . We observe nearly complete X chromosome dosage compensation in male somatic tissues, but not in testis. The X chromosome contains disproportionately fewer genes with high expression in testis than the autosomes, even after accounting for the lack of dosage compensation, which suggests that another mechanism suppresses their expression in the male germline. This is consistent with studies of reporter genes and transposed genes, which find that the same gene has higher expression when autosomal than when X-linked. Using a new reporter gene that is expressed in both testis and somatic tissues, we find that the suppression of X-linked gene expression is limited to genes with high expression in testis and that the extent of the suppression is positively correlated with expression level.

  14. Transcriptional landscape of human cancers.

    PubMed

    Li, Mengyuan; Sun, Qingrong; Wang, Xiaosheng

    2017-05-23

    The homogeneity and heterogeneity in somatic mutations, copy number alterations and methylation across different cancer types have been extensively explored. However, the related exploration based on transcriptome data is lacking. In this study we explored gene expression profiles across 33 human cancer types using The Cancer Genome Atlas (TCGA) data. We identified consistently upregulated genes (such as E2F1, EZH2, FOXM1, MYBL2, PLK1, TTK, AURKA/B and BUB1) and consistently downregulated genes (such as SCARA5, MYOM1, NKAPL, PEG3, USP2, SLC5A7 and HMGCLL1) across various cancers. The dysregulation of these genes is likely to be associated with poor clinical outcomes in cancer. The dysregulated pathways commonly in cancers include cell cycle, DNA replication, repair, and recombination, Notch signaling, p53 signaling, Wnt signaling, TGFβ signaling, immune response etc. We also identified genes consistently upregulated or downregulated in highly-advanced cancers compared to lowly-advanced cancers. The highly (low) expressed genes in highly-advanced cancers are likely to have higher (lower) expression levels in cancers than in normal tissue, indicating that common gene expression perturbations drive cancer initiation and cancer progression. In addition, we identified a substantial number of genes exclusively dysregulated in a single cancer type or inconsistently dysregulated in different cancer types, demonstrating the intertumor heterogeneity. More importantly, we found a number of genes commonly dysregulated in various cancers such as PLP1, MYOM1, NKAPL and USP2 which were investigated in few cancer related studies, and thus represent our novel findings. Our study provides comprehensive portraits of transcriptional landscape of human cancers.

  15. Transcriptional landscape of human cancers

    PubMed Central

    Li, Mengyuan; Sun, Qingrong; Wang, Xiaosheng

    2017-01-01

    The homogeneity and heterogeneity in somatic mutations, copy number alterations and methylation across different cancer types have been extensively explored. However, the related exploration based on transcriptome data is lacking. In this study we explored gene expression profiles across 33 human cancer types using The Cancer Genome Atlas (TCGA) data. We identified consistently upregulated genes (such as E2F1, EZH2, FOXM1, MYBL2, PLK1, TTK, AURKA/B and BUB1) and consistently downregulated genes (such as SCARA5, MYOM1, NKAPL, PEG3, USP2, SLC5A7 and HMGCLL1) across various cancers. The dysregulation of these genes is likely to be associated with poor clinical outcomes in cancer. The dysregulated pathways commonly in cancers include cell cycle, DNA replication, repair, and recombination, Notch signaling, p53 signaling, Wnt signaling, TGFβ signaling, immune response etc. We also identified genes consistently upregulated or downregulated in highly-advanced cancers compared to lowly-advanced cancers. The highly (low) expressed genes in highly-advanced cancers are likely to have higher (lower) expression levels in cancers than in normal tissue, indicating that common gene expression perturbations drive cancer initiation and cancer progression. In addition, we identified a substantial number of genes exclusively dysregulated in a single cancer type or inconsistently dysregulated in different cancer types, demonstrating the intertumor heterogeneity. More importantly, we found a number of genes commonly dysregulated in various cancers such as PLP1, MYOM1, NKAPL and USP2 which were investigated in few cancer related studies, and thus represent our novel findings. Our study provides comprehensive portraits of transcriptional landscape of human cancers. PMID:28427185

  16. Identification of the Consistently Altered Metabolic Targets in Human Hepatocellular Carcinoma.

    PubMed

    Nwosu, Zeribe Chike; Megger, Dominik Andre; Hammad, Seddik; Sitek, Barbara; Roessler, Stephanie; Ebert, Matthias Philip; Meyer, Christoph; Dooley, Steven

    2017-09-01

    Cancer cells rely on metabolic alterations to enhance proliferation and survival. Metabolic gene alterations that repeatedly occur in liver cancer are largely unknown. We aimed to identify metabolic genes that are consistently deregulated, and are of potential clinical significance in human hepatocellular carcinoma (HCC). We studied the expression of 2,761 metabolic genes in 8 microarray datasets comprising 521 human HCC tissues. Genes exclusively up-regulated or down-regulated in 6 or more datasets were defined as consistently deregulated. The consistent genes that correlated with tumor progression markers ( ECM2 and MMP9) (Pearson correlation P < .05) were used for Kaplan-Meier overall survival analysis in a patient cohort. We further compared proteomic expression of metabolic genes in 19 tumors vs adjacent normal liver tissues. We identified 634 consistent metabolic genes, ∼60% of which are not yet described in HCC. The down-regulated genes (n = 350) are mostly involved in physiologic hepatocyte metabolic functions (eg, xenobiotic, fatty acid, and amino acid metabolism). In contrast, among consistently up-regulated metabolic genes (n = 284) are those involved in glycolysis, pentose phosphate pathway, nucleotide biosynthesis, tricarboxylic acid cycle, oxidative phosphorylation, proton transport, membrane lipid, and glycan metabolism. Several metabolic genes (n = 434) correlated with progression markers, and of these, 201 predicted overall survival outcome in the patient cohort analyzed. Over 90% of the metabolic targets significantly altered at the protein level were similarly up- or down-regulated as in genomic profile. We provide the first exposition of the consistently altered metabolic genes in HCC and show that these genes are potentially relevant targets for onward studies in preclinical and clinical contexts.

  17. A Pilot Proteogenomic Study with Data Integration Identifies MCT1 and GLUT1 as Prognostic Markers in Lung Adenocarcinoma.

    PubMed

    Stewart, Paul A; Parapatics, Katja; Welsh, Eric A; Müller, André C; Cao, Haoyun; Fang, Bin; Koomen, John M; Eschrich, Steven A; Bennett, Keiryn L; Haura, Eric B

    2015-01-01

    We performed a pilot proteogenomic study to compare lung adenocarcinoma to lung squamous cell carcinoma using quantitative proteomics (6-plex TMT) combined with a customized Affymetrix GeneChip. Using MaxQuant software, we identified 51,001 unique peptides that mapped to 7,241 unique proteins and from these identified 6,373 genes with matching protein expression for further analysis. We found a minor correlation between gene expression and protein expression; both datasets were able to independently recapitulate known differences between the adenocarcinoma and squamous cell carcinoma subtypes. We found 565 proteins and 629 genes to be differentially expressed between adenocarcinoma and squamous cell carcinoma, with 113 of these consistently differentially expressed at both the gene and protein levels. We then compared our results to published adenocarcinoma versus squamous cell carcinoma proteomic data that we also processed with MaxQuant. We selected two proteins consistently overexpressed in squamous cell carcinoma in all studies, MCT1 (SLC16A1) and GLUT1 (SLC2A1), for further investigation. We found differential expression of these same proteins at the gene level in our study as well as in other public gene expression datasets. These findings combined with survival analysis of public datasets suggest that MCT1 and GLUT1 may be potential prognostic markers in adenocarcinoma and druggable targets in squamous cell carcinoma. Data are available via ProteomeXchange with identifier PXD002622.

  18. Validation of housekeeping genes as an internal control for gene expression studies in Giardia lamblia using quantitative real-time PCR.

    PubMed

    Marcial-Quino, Jaime; Fierro, Francisco; De la Mora-De la Mora, Ignacio; Enríquez-Flores, Sergio; Gómez-Manzo, Saúl; Vanoye-Carlo, America; Garcia-Torres, Itzhel; Sierra-Palacios, Edgar; Reyes-Vivas, Horacio

    2016-04-25

    The analysis of transcript levels of specific genes is important for understanding transcriptional regulation and for the characterization of gene function. Real-time quantitative reverse transcriptase PCR (RT-qPCR) has become a powerful tool to quantify gene expression. The objective of this study was to identify reliable housekeeping genes in Giardia lamblia. Twelve genes were selected for this purpose, and their expression was analyzed in the wild type WB strain and in two strains with resistance to nitazoxanide (NTZ) and metronidazole (MTZ), respectively. RefFinder software analysis showed that the expression of the genes is different in the three strains. The integrated data from the four analyses showed that the NADH oxidase (NADH) and aldolase (ALD) genes were the most steadily expressed genes, whereas the glyceraldehyde-3-phosphate dehydrogenase gene was the most unstable. Additionally, the relative expression of seven genes were quantified in the NTZ- and MTZ-resistant strains by RT-qPCR, using the aldolase gene as the internal control, and the results showed a consistent differential pattern of expression in both strains. The housekeeping genes found in this work will facilitate the analysis of mRNA expression levels of other genes of interest in G. lamblia. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Validation of Reference Genes for RT-qPCR Studies of Gene Expression in Preharvest and Postharvest Longan Fruits under Different Experimental Conditions

    PubMed Central

    Wu, Jianyang; Zhang, Hongna; Liu, Liqin; Li, Weicai; Wei, Yongzan; Shi, Shengyou

    2016-01-01

    Reverse transcription quantitative PCR (RT-qPCR) as the accurate and sensitive method is use for gene expression analysis, but the veracity and reliability result depends on whether select appropriate reference gene or not. To date, several reliable reference gene validations have been reported in fruits trees, but none have been done on preharvest and postharvest longan fruits. In this study, 12 candidate reference genes, namely, CYP, RPL, GAPDH, TUA, TUB, Fe-SOD, Mn-SOD, Cu/Zn-SOD, 18SrRNA, Actin, Histone H3, and EF-1a, were selected. Expression stability of these genes in 150 longan samples was evaluated and analyzed using geNorm and NormFinder algorithms. Preharvest samples consisted of seven experimental sets, including different developmental stages, organs, hormone stimuli (NAA, 2,4-D, and ethephon) and abiotic stresses (bagging and girdling with defoliation). Postharvest samples consisted of different temperature treatments (4 and 22°C) and varieties. Our findings indicate that appropriate reference gene(s) should be picked for each experimental condition. Our data further showed that the commonly used reference gene Actin does not exhibit stable expression across experimental conditions in longan. Expression levels of the DlACO gene, which is a key gene involved in regulating fruit abscission under girdling with defoliation treatment, was evaluated to validate our findings. In conclusion, our data provide a useful framework for choice of suitable reference genes across different experimental conditions for RT-qPCR analysis of preharvest and postharvest longan fruits. PMID:27375640

  20. Featured Article: Transcriptional landscape analysis identifies differently expressed genes involved in follicle-stimulating hormone induced postmenopausal osteoporosis.

    PubMed

    Maasalu, Katre; Laius, Ott; Zhytnik, Lidiia; Kõks, Sulev; Prans, Ele; Reimann, Ene; Märtson, Aare

    2017-01-01

    Osteoporosis is a disorder associated with bone tissue reorganization, bone mass, and mineral density. Osteoporosis can severely affect postmenopausal women, causing bone fragility and osteoporotic fractures. The aim of the current study was to compare blood mRNA profiles of postmenopausal women with and without osteoporosis, with the aim of finding different gene expressions and thus targets for future osteoporosis biomarker studies. Our study consisted of transcriptome analysis of whole blood serum from 12 elderly female osteoporotic patients and 12 non-osteoporotic elderly female controls. The transcriptome analysis was performed with RNA sequencing technology. For data analysis, the edgeR package of R Bioconductor was used. Two hundred and fourteen genes were expressed differently in osteoporotic compared with non-osteoporotic patients. Statistical analysis revealed 20 differently expressed genes with a false discovery rate of less than 1.47 × 10 -4 among osteoporotic patients. The expression of 10 genes were up-regulated and 10 down-regulated. Further statistical analysis identified a potential osteoporosis mRNA biomarker pattern consisting of six genes: CACNA1G, ALG13, SBK1, GGT7, MBNL3, and RIOK3. Functional ingenuity pathway analysis identified the strongest candidate genes with regard to potential involvement in a follicle-stimulating hormone activated network of increased osteoclast activity and hypogonadal bone loss. The differentially expressed genes identified in this study may contribute to future research of postmenopausal osteoporosis blood biomarkers.

  1. Validating internal controls for quantitative plant gene expression studies.

    PubMed

    Brunner, Amy M; Yakovlev, Igor A; Strauss, Steven H

    2004-08-18

    Real-time reverse transcription PCR (RT-PCR) has greatly improved the ease and sensitivity of quantitative gene expression studies. However, accurate measurement of gene expression with this method relies on the choice of a valid reference for data normalization. Studies rarely verify that gene expression levels for reference genes are adequately consistent among the samples used, nor compare alternative genes to assess which are most reliable for the experimental conditions analyzed. Using real-time RT-PCR to study the expression of 10 poplar (genus Populus) housekeeping genes, we demonstrate a simple method for determining the degree of stability of gene expression over a set of experimental conditions. Based on a traditional method for analyzing the stability of varieties in plant breeding, it defines measures of gene expression stability from analysis of variance (ANOVA) and linear regression. We found that the potential internal control genes differed widely in their expression stability over the different tissues, developmental stages and environmental conditions studied. Our results support that quantitative comparisons of candidate reference genes are an important part of real-time RT-PCR studies that seek to precisely evaluate variation in gene expression. The method we demonstrated facilitates statistical and graphical evaluation of gene expression stability. Selection of the best reference gene for a given set of experimental conditions should enable detection of biologically significant changes in gene expression that are too small to be revealed by less precise methods, or when highly variable reference genes are unknowingly used in real-time RT-PCR experiments.

  2. Evaluating intra- and inter-individual variation in the human placental transcriptome.

    PubMed

    Hughes, David A; Kircher, Martin; He, Zhisong; Guo, Song; Fairbrother, Genevieve L; Moreno, Carlos S; Khaitovich, Philipp; Stoneking, Mark

    2015-03-19

    Gene expression variation is a phenotypic trait of particular interest as it represents the initial link between genotype and other phenotypes. Analyzing how such variation apportions among and within groups allows for the evaluation of how genetic and environmental factors influence such traits. It also provides opportunities to identify genes and pathways that may have been influenced by non-neutral processes. Here we use a population genetics framework and next generation sequencing to evaluate how gene expression variation is apportioned among four human groups in a natural biological tissue, the placenta. We estimate that on average, 33.2%, 58.9%, and 7.8% of the placental transcriptome is explained by variation within individuals, among individuals, and among human groups, respectively. Additionally, when technical and biological traits are included in models of gene expression they each account for roughly 2% of total gene expression variation. Notably, the variation that is significantly different among groups is enriched in biological pathways associated with immune response, cell signaling, and metabolism. Many biological traits demonstrate correlated changes in expression in numerous pathways of potential interest to clinicians and evolutionary biologists. Finally, we estimate that the majority of the human placental transcriptome exhibits expression profiles consistent with neutrality; the remainder are consistent with stabilizing selection, directional selection, or diversifying selection. We apportion placental gene expression variation into individual, population, and biological trait factors and identify how each influence the transcriptome. Additionally, we advance methods to associate expression profiles with different forms of selection.

  3. Iron Biofortification and Homeostasis in Transgenic Cassava Roots Expressing the Algal Iron Assimilatory Gene, FEA1

    PubMed Central

    Ihemere, Uzoma E.; Narayanan, Narayanan N.; Sayre, Richard T.

    2012-01-01

    We have engineered the tropical root crop cassava (Manihot esculenta) to express the Chlamydomonas reinhardtii iron assimilatory gene, FEA1, in its storage roots with the objective of enhancing the root nutritional qualities. Iron levels in mature cassava storage roots were increased from 10 to 36 ppm in the highest iron accumulating transgenic lines. These iron levels are sufficient to meet the minimum daily requirement for iron in a 500 g meal. Significantly, the expression of the FEA1 gene in storage roots did not alter iron levels in leaves. Transgenic plants also had normal levels of zinc in leaves and roots consistent with the specific uptake of ferrous iron mediated by the FEA1 protein. Relative to wild-type plants, fibrous roots of FEA1 expressing plants had reduced Fe (III) chelate reductase activity consistent with the more efficient uptake of iron in the transgenic plants. We also show that multiple cassava genes involved in iron homeostasis have altered tissue-specific patterns of expression in leaves, stems, and roots of transgenic plants consistent with increased iron sink strength in transgenic roots. These results are discussed in terms of strategies for the iron biofortification of plants. PMID:22993514

  4. Interactions between Bmp-4 and Msx-1 act to restrict gene expression to odontogenic mesenchyme.

    PubMed

    Tucker, A S; Al Khamis, A; Sharpe, P T

    1998-08-01

    Tooth development is regulated by a reciprocal series of epithelial-mesenchymal interactions. Bmp4 has been identified as a candidate signalling molecule in these interactions, initially as an epithelial signal and then later at the bud stage as a mesenchymal signal (Vainio et al. [1993] Cell 75:45-58). A target gene for Bmp4 signalling is the homeobox gene Msx-1, identified by the ability of recombinant Bmp4 protein to induce expression in mesenchyme. There is, however, no evidence that Bmp4 is the endogenous inducer of Msx-1 expression. Msx-1 and Bmp-4 show dynamic, interactive patterns of expression in oral epithelium and ectomesenchyme during the early stages of tooth development. In this study, we compare the temporal and spatial expression of these two genes to determine whether the changing expression patterns of these genes are consistent with interactions between the two molecules. We show that changes in Bmp-4 expression precede changes in Msx-1 expression. At embryonic day (E)10.5-E11.0, expression patterns are consistent with BMP4 from the epithelium, inducing or maintaining Msx-1 in underlying mesenchyme. At E11.5, Bmp-4 expression shifts from epithelium to mesenchyme and is rapidly followed by localised up-regulation of Msx-1 expression at the sites of Bmp-4 expression. Using cultured explants of developing mandibles, we confirm that exogenous BMP4 is capable of replacing the endogenous source in epithelium and inducing Msx-1 gene expression in mesenchyme. By using noggin, a BMP inhibitor, we show that endogenous Msx-1 expression can be inhibited at E10.5 and E11.5, providing the first evidence that endogenous Bmp-4 from the epithelium is responsible for regulating the early spatial expression of Msx-1. We also show that the mesenchymal shift in Bmp-4 is responsible for up-regulating Msx-1 specifically at the sites of future tooth formation. Thus, we establish that a reciprocal series of interactions act to restrict expression of both genes to future sites of tooth formation, creating a positive feedback loop that maintains expression of both genes in tooth mesenchymal cells.

  5. Prefrontal cortex expression of chromatin modifier genes in male WSP and WSR mice changes across ethanol dependence, withdrawal, and abstinence.

    PubMed

    Hashimoto, Joel G; Gavin, David P; Wiren, Kristine M; Crabbe, John C; Guizzetti, Marina

    2017-05-01

    Alcohol-use disorder (AUD) is a relapsing disorder associated with excessive ethanol consumption. Recent studies support the involvement of epigenetic mechanisms in the development of AUD. Studies carried out so far have focused on a few specific epigenetic modifications. The goal of this project was to investigate gene expression changes of epigenetic regulators that mediate a broad array of chromatin modifications after chronic alcohol exposure, chronic alcohol exposure followed by 8 h withdrawal, and chronic alcohol exposure followed by 21 days of abstinence in Withdrawal-Resistant (WSR) and Withdrawal Seizure-Prone (WSP) selected mouse lines. We found that chronic vapor exposure to highly intoxicating levels of ethanol alters the expression of several chromatin remodeling genes measured by quantitative PCR array analyses. The identified effects were independent of selected lines, which, however, displayed baseline differences in epigenetic gene expression. We reported dysregulation in the expression of genes involved in histone acetylation, deacetylation, lysine and arginine methylation and ubiquitinationhylation during chronic ethanol exposure and withdrawal, but not after 21 days of abstinence. Ethanol-induced changes are consistent with decreased histone acetylation and with decreased deposition of the permissive ubiquitination mark H2BK120ub, associated with reduced transcription. On the other hand, ethanol-induced changes in the expression of genes involved in histone lysine methylation are consistent with increased transcription. The net result of these modifications on gene expression is likely to depend on the combination of the specific histone tail modifications present at a given time on a given promoter. Since alcohol does not modulate gene expression unidirectionally, it is not surprising that alcohol does not unidirectionally alter chromatin structure toward a closed or open state, as suggested by the results of this study. Published by Elsevier Inc.

  6. Prefrontal cortex expression of chromatin modifier genes in male WSP and WSR mice changes across ethanol dependence, withdrawal, and abstinence

    PubMed Central

    Hashimoto, Joel G.; Gavin, David P.; Wiren, Kristine M.; Crabbe, John C.; Guizzetti, Marina

    2017-01-01

    Alcohol-use disorder (AUD) is a relapsing disorder associated with excessive ethanol consumption. Recent studies support the involvement of epigenetic mechanisms in the development of AUD. Studies carried out so far have focused on a few specific epigenetic modifications. The goal of this project was to investigate gene expression changes of epigenetic regulators that mediate a broad array of chromatin modifications after chronic alcohol exposure, chronic alcohol exposure followed by 8 h withdrawal, and chronic alcohol exposure followed by 21 days of abstinence in Withdrawal-Resistant (WSR) and Withdrawal Seizure-Prone (WSP) selected mouse lines. We found that chronic vapor exposure to highly intoxicating levels of ethanol alters the expression of several chromatin remodeling genes measured by quantitative PCR array analyses. The identified effects were independent of selected lines, which, however, displayed baseline differences in epigenetic gene expression. We reported dysregulation in the expression of genes involved in histone acetylation, deacetylation, lysine and arginine methylation and ubiquitination, and in DNA methylation during chronic ethanol exposure and withdrawal, but not after 21 days of abstinence. Ethanol-induced changes are consistent with decreased histone acetylation and with decreased deposition of the permissive ubiquitination mark H2BK120ub, associated with reduced transcription. On the other hand, ethanol-induced changes in the expression of genes involved in histone lysine methylation are consistent with increased transcription. The net result of these modifications on gene expression is likely to depend on the combination of the specific histone tail modifications present at a given time on a given promoter. Since alcohol does not modulate gene expression unidirectionally, it is not surprising that alcohol does not unidirectionally alter chromatin structure toward a closed or open state, as suggested by the results of this study. PMID:28433423

  7. Environmental effects on resistance gene expression in milk stage popcorn kernels and associations with mycotoxin production.

    PubMed

    Dowd, Patrick F; Johnson, Eric T

    2015-05-01

    Like other forms of maize, popcorn is subject to increased levels of contamination by a variety of different mycotoxins under stress conditions, although levels generally are less than dent maize under comparable stress. Gene array analysis was used to determine expression differences of disease resistance-associated genes in milk stage kernels from commercial popcorn fields over 3 years. Relatively lower expression of resistance gene types was noted in years with higher temperatures and lower rainfall, which was consistent with prior results for many previously identified resistance response-associated genes. The lower rates of expression occurred for genes such as chitinases, protease inhibitors, and peroxidases; enzymes involved in the synthesis of cell wall barriers and secondary metabolites; and regulatory proteins. However, expression of several specific resistance genes previously associated with mycotoxins, such as aflatoxin in dent maize, was not affected. Insect damage altered the spectrum of resistance gene expression differences compared to undamaged ears. Correlation analyses showed expression differences of some previously reported resistance genes that were highly associated with mycotoxin levels and included glucanases, protease inhibitors, peroxidases, and thionins.

  8. Regulation of endogenous human gene expression by ligand-inducible TALE transcription factors.

    PubMed

    Mercer, Andrew C; Gaj, Thomas; Sirk, Shannon J; Lamb, Brian M; Barbas, Carlos F

    2014-10-17

    The construction of increasingly sophisticated synthetic biological circuits is dependent on the development of extensible tools capable of providing specific control of gene expression in eukaryotic cells. Here, we describe a new class of synthetic transcription factors that activate gene expression in response to extracellular chemical stimuli. These inducible activators consist of customizable transcription activator-like effector (TALE) proteins combined with steroid hormone receptor ligand-binding domains. We demonstrate that these ligand-responsive TALE transcription factors allow for tunable and conditional control of gene activation and can be used to regulate the expression of endogenous genes in human cells. Since TALEs can be designed to recognize any contiguous DNA sequence, the conditional gene regulatory system described herein will enable the design of advanced synthetic gene networks.

  9. Differential Expression of Three α-Galactosidase Genes and a Single β-Galactosidase Gene from Aspergillus niger

    PubMed Central

    de Vries, Ronald P.; van den Broeck, Hetty C.; Dekkers, Ester; Manzanares, Paloma; de Graaff, Leo H.; Visser, Jaap

    1999-01-01

    A gene encoding a third α-galactosidase (AglB) from Aspergillus niger has been cloned and sequenced. The gene consists of an open reading frame of 1,750 bp containing six introns. The gene encodes a protein of 443 amino acids which contains a eukaryotic signal sequence of 16 amino acids and seven putative N-glycosylation sites. The mature protein has a calculated molecular mass of 48,835 Da and a predicted pI of 4.6. An alignment of the AglB amino acid sequence with those of other α-galactosidases revealed that it belongs to a subfamily of α-galactosidases that also includes A. niger AglA. A. niger AglC belongs to a different subfamily that consists mainly of prokaryotic α-galactosidases. The expression of aglA, aglB, aglC, and lacA, the latter of which encodes an A. niger β-galactosidase, has been studied by using a number of monomeric, oligomeric, and polymeric compounds as growth substrates. Expression of aglA is only detected on galactose and galactose-containing oligomers and polymers. The aglB gene is expressed on all of the carbon sources tested, including glucose. Elevated expression was observed on xylan, which could be assigned to regulation via XlnR, the xylanolytic transcriptional activator. Expression of aglC was only observed on glucose, fructose, and combinations of glucose with xylose and galactose. High expression of lacA was detected on arabinose, xylose, xylan, and pectin. Similar to aglB, the expression on xylose and xylan can be assigned to regulation via XlnR. All four genes have distinct expression patterns which seem to mirror the natural substrates of the encoded proteins. PMID:10347026

  10. Identification of genes whose expression is altered by obesity throughout the arterial tree.

    PubMed

    Padilla, Jaume; Jenkins, Nathan T; Thorne, Pamela K; Martin, Jeffrey S; Rector, R Scott; Davis, J Wade; Laughlin, M Harold

    2014-11-15

    We used next-generation RNA sequencing (RNA-Seq) technology on the whole transcriptome to identify genes whose expression is consistently affected by obesity across multiple arteries. Specifically, we examined transcriptional profiles of the iliac artery as well as the feed artery, first, second, and third branch order arterioles in the soleus, gastrocnemius, and diaphragm muscles from obese Otsuka Long-Evans Tokushima Fatty (OLETF) and lean Long-Evans Tokushima Otsuka (LETO) rats. Within the gastrocnemius and soleus muscles, the number of genes differentially expressed with obesity tended to increase with increasing branch order arteriole number (i.e., decreasing size of the artery). This trend was opposite in the diaphragm. We found a total of 15 genes that were consistently upregulated with obesity (MIS18A, CTRB1, FAM151B, FOLR2, PXMP4, OAS1B, SREBF2, KLRA17, SLC25A44, SNX10, SLFN3, MEF2BNB, IRF7, RAD23A, LGALS3BP) and five genes that were consistently downregulated with obesity (C2, GOLGA7, RIN3, PCP4, CYP2E1). A small fraction (∼9%) of the genes affected by obesity was modulated across all arteries examined. In conclusion, the present study identifies a select number of genes (i.e., 20 genes) whose expression is consistently altered throughout the arterial network in response to obesity and provides further insight into the heterogeneous vascular effects of obesity. Although there is no known direct function of the majority of 20 genes related to vascular health, the obesity-associated upregulation of SREBF2, LGALS3BP, IRF7, and FOLR2 across all arteries is suggestive of an unfavorable vascular phenotypic alteration with obesity. These data may serve as an important resource for identifying novel therapeutic targets against obesity-related vascular complications.

  11. Identification of genes whose expression is altered by obesity throughout the arterial tree

    PubMed Central

    Jenkins, Nathan T.; Thorne, Pamela K.; Martin, Jeffrey S.; Rector, R. Scott; Davis, J. Wade; Laughlin, M. Harold

    2014-01-01

    We used next-generation RNA sequencing (RNA-Seq) technology on the whole transcriptome to identify genes whose expression is consistently affected by obesity across multiple arteries. Specifically, we examined transcriptional profiles of the iliac artery as well as the feed artery, first, second, and third branch order arterioles in the soleus, gastrocnemius, and diaphragm muscles from obese Otsuka Long-Evans Tokushima Fatty (OLETF) and lean Long-Evans Tokushima Otsuka (LETO) rats. Within the gastrocnemius and soleus muscles, the number of genes differentially expressed with obesity tended to increase with increasing branch order arteriole number (i.e., decreasing size of the artery). This trend was opposite in the diaphragm. We found a total of 15 genes that were consistently upregulated with obesity (MIS18A, CTRB1, FAM151B, FOLR2, PXMP4, OAS1B, SREBF2, KLRA17, SLC25A44, SNX10, SLFN3, MEF2BNB, IRF7, RAD23A, LGALS3BP) and five genes that were consistently downregulated with obesity (C2, GOLGA7, RIN3, PCP4, CYP2E1). A small fraction (∼9%) of the genes affected by obesity was modulated across all arteries examined. In conclusion, the present study identifies a select number of genes (i.e., 20 genes) whose expression is consistently altered throughout the arterial network in response to obesity and provides further insight into the heterogeneous vascular effects of obesity. Although there is no known direct function of the majority of 20 genes related to vascular health, the obesity-associated upregulation of SREBF2, LGALS3BP, IRF7, and FOLR2 across all arteries is suggestive of an unfavorable vascular phenotypic alteration with obesity. These data may serve as an important resource for identifying novel therapeutic targets against obesity-related vascular complications. PMID:25271210

  12. SIR2 and other genes are abundantly expressed in long-lived natural segregants for replicative aging of the budding yeast Saccharomyces cerevisiae.

    PubMed

    Guo, Zhenhua; Adomas, Aleksandra B; Jackson, Erin D; Qin, Hong; Townsend, Jeffrey P

    2011-06-01

    We investigated the mechanism underlying the natural variation in longevity within natural populations using the model budding yeast, Saccharomyces cerevisiae. We analyzed whole-genome gene expression in four progeny of a natural S. cerevisiae strain that display differential replicative aging. Genes with different expression levels in short- and long-lived strains were classified disproportionately into metabolism, transport, development, transcription or cell cycle, and organelle organization (mitochondrial, chromosomal, and cytoskeletal). With several independent validating experiments, we detected 15 genes with consistent differential expression levels between the long- and the short-lived progeny. Among those 15, SIR2, HSP30, and TIM17 were upregulated in long-lived strains, which is consistent with the known effects of gene silencing, stress response, and mitochondrial function on aging. The link between SIR2 and yeast natural life span variation offers some intriguing ties to the allelic association of the human homolog SIRT1 to visceral obesity and metabolic response to lifestyle intervention. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  13. Gene expression pattern recognition algorithm inferences to classify samples exposed to chemical agents

    NASA Astrophysics Data System (ADS)

    Bushel, Pierre R.; Bennett, Lee; Hamadeh, Hisham; Green, James; Ableson, Alan; Misener, Steve; Paules, Richard; Afshari, Cynthia

    2002-06-01

    We present an analysis of pattern recognition procedures used to predict the classes of samples exposed to pharmacologic agents by comparing gene expression patterns from samples treated with two classes of compounds. Rat liver mRNA samples following exposure for 24 hours with phenobarbital or peroxisome proliferators were analyzed using a 1700 rat cDNA microarray platform. Sets of genes that were consistently differentially expressed in the rat liver samples following treatment were stored in the MicroArray Project System (MAPS) database. MAPS identified 238 genes in common that possessed a low probability (P < 0.01) of being randomly detected as differentially expressed at the 95% confidence level. Hierarchical cluster analysis on the 238 genes clustered specific gene expression profiles that separated samples based on exposure to a particular class of compound.

  14. Reference Genes for qPCR Analysis in Resin-Tapped Adult Slash Pine As a Tool to Address the Molecular Basis of Commercial Resinosis

    PubMed Central

    de Lima, Júlio C.; de Costa, Fernanda; Füller, Thanise N.; Rodrigues-Corrêa, Kelly C. da Silva; Kerber, Magnus R.; Lima, Mariano S.; Fett, Janette P.; Fett-Neto, Arthur G.

    2016-01-01

    Pine oleoresin is a major source of terpenes, consisting of turpentine (mono- and sesquiterpenes) and rosin (diterpenes) fractions. Higher oleoresin yields are of economic interest, since oleoresin derivatives make up a valuable source of materials for chemical industries. Oleoresin can be extracted from living trees, often by the bark streak method, in which bark removal is done periodically, followed by application of stimulant paste containing sulfuric acid and other chemicals on the freshly wounded exposed surface. To better understand the molecular basis of chemically-stimulated and wound induced oleoresin production, we evaluated the stability of 11 putative reference genes for the purpose of normalization in studying Pinus elliottii gene expression during oleoresinosis. Samples for RNA extraction were collected from field-grown adult trees under tapping operations using stimulant pastes with different compositions and at various time points after paste application. Statistical methods established by geNorm, NormFinder, and BestKeeper softwares were consistent in pointing as adequate reference genes HISTO3 and UBI. To confirm expression stability of the candidate reference genes, expression profiles of putative P. elliottii orthologs of resin biosynthesis-related genes encoding Pinus contorta β-pinene synthase [PcTPS-(−)β-pin1], P. contorta levopimaradiene/abietadiene synthase (PcLAS1), Pinus taeda α-pinene synthase [PtTPS-(+)αpin], and P. taeda α-farnesene synthase (PtαFS) were examined following stimulant paste application. Increased oleoresin yields observed in stimulated treatments using phytohormone-based pastes were consistent with higher expression of pinene synthases. Overall, the expression of all genes examined matched the expected profiles of oleoresin-related transcript changes reported for previously examined conifers. PMID:27379135

  15. Reference Genes for qPCR Analysis in Resin-Tapped Adult Slash Pine As a Tool to Address the Molecular Basis of Commercial Resinosis.

    PubMed

    de Lima, Júlio C; de Costa, Fernanda; Füller, Thanise N; Rodrigues-Corrêa, Kelly C da Silva; Kerber, Magnus R; Lima, Mariano S; Fett, Janette P; Fett-Neto, Arthur G

    2016-01-01

    Pine oleoresin is a major source of terpenes, consisting of turpentine (mono- and sesquiterpenes) and rosin (diterpenes) fractions. Higher oleoresin yields are of economic interest, since oleoresin derivatives make up a valuable source of materials for chemical industries. Oleoresin can be extracted from living trees, often by the bark streak method, in which bark removal is done periodically, followed by application of stimulant paste containing sulfuric acid and other chemicals on the freshly wounded exposed surface. To better understand the molecular basis of chemically-stimulated and wound induced oleoresin production, we evaluated the stability of 11 putative reference genes for the purpose of normalization in studying Pinus elliottii gene expression during oleoresinosis. Samples for RNA extraction were collected from field-grown adult trees under tapping operations using stimulant pastes with different compositions and at various time points after paste application. Statistical methods established by geNorm, NormFinder, and BestKeeper softwares were consistent in pointing as adequate reference genes HISTO3 and UBI. To confirm expression stability of the candidate reference genes, expression profiles of putative P. elliottii orthologs of resin biosynthesis-related genes encoding Pinus contorta β-pinene synthase [PcTPS-(-)β-pin1], P. contorta levopimaradiene/abietadiene synthase (PcLAS1), Pinus taeda α-pinene synthase [PtTPS-(+)αpin], and P. taeda α-farnesene synthase (PtαFS) were examined following stimulant paste application. Increased oleoresin yields observed in stimulated treatments using phytohormone-based pastes were consistent with higher expression of pinene synthases. Overall, the expression of all genes examined matched the expected profiles of oleoresin-related transcript changes reported for previously examined conifers.

  16. Diurnal and developmental differences in gene expression between adult dispersing and flightless morphs of the wing polymorphic cricket, Gryllus firmus: Implications for life-history evolution.

    PubMed

    Zera, Anthony J; Vellichirammal, Neetha Nanoth; Brisson, Jennifer A

    2018-04-12

    The functional basis of life history adaptation is a key topic of research in life history evolution. Studies of wing-polymorphism in the cricket Gryllus firmus have played a prominent role in this field. However, prior in-depth investigations of morph specialization have primarily focused on a single hormone, juvenile hormone, and a single aspect of intermediary metabolism, the fatty-acid biosynthetic component of lipid metabolism. Moreover, the role of diurnal variation in life history adaptation in G. firmus has been understudied, as is the case for organisms in general. Here, we identify genes whose expression differs consistently between the morphs independent of time-of-day during early adulthood, as well as genes that exhibit a strong pattern of morph-specific diurnal expression. We find strong, consistent, morph-specific differences in the expression of genes involved in endocrine regulation, carbohydrate and lipid metabolism, and immunity - in particular, in the expression of an insulin-like-peptide precursor gene and genes involved in triglyceride production. We also find that the flight-capable morph exhibited a substantially greater number of genes exhibiting diurnal change in gene expression compared with the flightless morph, correlated with the greater circadian change in the hemolymph juvenile titer in the dispersing morph. In fact, diurnal differences in expression within the dispersing morph at different times of the day were significantly greater in magnitude than differences between dispersing and flightless morphs at the same time-of-day. These results provide important baseline information regarding the potential role of variable gene expression on life history specialization in morphs of G. firmus, and the first information on genetically-variable, diurnal change in gene expression, associated with a key life history polymorphism. These results also suggest the existence of prominent morph-specific circadian differences in gene expression in G. firmus, possibly caused by the morph-specific circadian rhythm in the juvenile hormone titer. Copyright © 2018 Elsevier Ltd. All rights reserved.

  17. The transcriptional landscape of seasonal coat colour moult in the snowshoe hare.

    PubMed

    Ferreira, Mafalda S; Alves, Paulo C; Callahan, Colin M; Marques, João P; Mills, L Scott; Good, Jeffrey M; Melo-Ferreira, José

    2017-08-01

    Seasonal coat colour change is an important adaptation to seasonally changing environments but the evolution of this and other circannual traits remains poorly understood. In this study, we use gene expression to understand seasonal coat colour moulting in wild snowshoe hares (Lepus americanus). We used hair colour to follow the progression of the moult, simultaneously sampling skin from three moulting stages in hares collected during the peak of the spring moult from white winter to brown summer pelage. Using RNA sequencing, we tested whether patterns of expression were consistent with predictions based on the established phases of the hair growth cycle. We found functionally consistent clustering across skin types, with 766 genes differentially expressed between moult stages. "White" pelage showed more differentially expressed genes that were upregulated relative to other skin types, involved in the transition between late telogen (quiescent stage) and the onset of anagen (proliferative stage). Skin samples from transitional "intermediate" and "brown" pelage were transcriptionally similar and resembled the regressive transition to catagen (regressive stage). We also detected differential expression of several key circadian clock and pigmentation genes, providing important means to dissect the bases of alternate seasonal colour morphs. Our results reveal that pelage colour is a useful biomarker for seasonal change but that there is a consistent lag between the main gene expression waves and change in visible coat colour. These experiments establish that developmental sampling from natural populations of nonmodel organisms can provide a crucial resource to dissect the genetic basis and evolution of complex seasonally changing traits. © 2017 John Wiley & Sons Ltd.

  18. Transcriptional profile of breast muscle in heat stressed layers is similar to that of broiler chickens at control temperature.

    PubMed

    Zahoor, Imran; de Koning, Dirk-Jan; Hocking, Paul M

    2017-09-20

    In recent years, the commercial importance of changes in muscle function of broiler chickens and of the corresponding effects on meat quality has increased. Furthermore, broilers are more sensitive to heat stress during transport and at high ambient temperatures than smaller egg-laying chickens. We hypothesised that heat stress would amplify muscle damage and expression of genes that are involved in such changes and, thus, lead to the identification of pathways and networks associated with broiler muscle and meat quality traits. Broiler and layer chickens were exposed to control or high ambient temperatures to characterise differences in gene expression between the two genotypes and the two environments. Whole-genome expression studies in breast muscles of broiler and layer chickens were conducted before and after heat stress; 2213 differentially-expressed genes were detected based on a significant (P < 0.05) genotype × treatment interaction. This gene set was analysed with the BioLayout Express 3D and Ingenuity Pathway Analysis software and relevant biological pathways and networks were identified. Genes involved in functions related to inflammatory reactions, cell death, oxidative stress and tissue damage were upregulated in control broilers compared with control and heat-stressed layers. Expression of these genes was further increased in heat-stressed broilers. Differences in gene expression between broiler and layer chickens under control and heat stress conditions suggest that damage of breast muscles in broilers at normal ambient temperatures is similar to that in heat-stressed layers and is amplified when broilers are exposed to heat stress. The patterns of gene expression of the two genotypes under heat stress were almost the polar opposite of each other, which is consistent with the conclusion that broiler chickens were not able to cope with heat stress by dissipating their body heat. The differentially expressed gene networks and pathways were consistent with the pathological changes that are observed in the breast muscle of heat-stressed broilers.

  19. Transcriptomic Profiling of Central Nervous System Regions in Three Species of Honey Bee during Dance Communication Behavior

    PubMed Central

    Sen Sarma, Moushumi; Rodriguez-Zas, Sandra L.; Hong, Feng; Zhong, Sheng; Robinson, Gene E.

    2009-01-01

    Background We conducted a large-scale transcriptomic profiling of selected regions of the central nervous system (CNS) across three species of honey bees, in foragers that were performing dance behavior to communicate to their nestmates the location, direction and profitability of an attractive floral resource. We used microarrays to measure gene expression in bees from Apis mellifera, dorsata and florea, species that share major traits unique to the genus and also show striking differences in biology and dance communication. The goals of this study were to determine the extent of regional specialization in gene expression and to explore the molecular basis of dance communication. Principal Findings This “snapshot” of the honey bee CNS during dance behavior provides strong evidence for both species-consistent and species-specific differences in gene expression. Gene expression profiles in the mushroom bodies consistently showed the biggest differences relative to the other CNS regions. There were strong similarities in gene expression between the central brain and the second thoracic ganglion across all three species; many of the genes were related to metabolism and energy production. We also obtained gene expression differences between CNS regions that varied by species: A. mellifera differed the most, while dorsata and florea tended to be more similar. Significance Species differences in gene expression perhaps mirror known differences in nesting habit, ecology and dance behavior between mellifera, florea and dorsata. Species-specific differences in gene expression in selected CNS regions that relate to synaptic activity and motor control provide particularly attractive candidate genes to explain the differences in dance behavior exhibited by these three honey bee species. Similarities between central brain and thoracic ganglion provide a unique perspective on the potential coupling of these two motor-related regions during dance behavior and perhaps provide a snapshot of the energy intensive process of dance output generation. Mushroom body results reflect known roles for this region in the regulation of learning, memory and rhythmic behavior. PMID:19641619

  20. Transcriptomic profiling of central nervous system regions in three species of honey bee during dance communication behavior.

    PubMed

    Sen Sarma, Moushumi; Rodriguez-Zas, Sandra L; Hong, Feng; Zhong, Sheng; Robinson, Gene E

    2009-07-29

    We conducted a large-scale transcriptomic profiling of selected regions of the central nervous system (CNS) across three species of honey bees, in foragers that were performing dance behavior to communicate to their nestmates the location, direction and profitability of an attractive floral resource. We used microarrays to measure gene expression in bees from Apis mellifera, dorsata and florea, species that share major traits unique to the genus and also show striking differences in biology and dance communication. The goals of this study were to determine the extent of regional specialization in gene expression and to explore the molecular basis of dance communication. This "snapshot" of the honey bee CNS during dance behavior provides strong evidence for both species-consistent and species-specific differences in gene expression. Gene expression profiles in the mushroom bodies consistently showed the biggest differences relative to the other CNS regions. There were strong similarities in gene expression between the central brain and the second thoracic ganglion across all three species; many of the genes were related to metabolism and energy production. We also obtained gene expression differences between CNS regions that varied by species: A. mellifera differed the most, while dorsata and florea tended to be more similar. Species differences in gene expression perhaps mirror known differences in nesting habit, ecology and dance behavior between mellifera, florea and dorsata. Species-specific differences in gene expression in selected CNS regions that relate to synaptic activity and motor control provide particularly attractive candidate genes to explain the differences in dance behavior exhibited by these three honey bee species. Similarities between central brain and thoracic ganglion provide a unique perspective on the potential coupling of these two motor-related regions during dance behavior and perhaps provide a snapshot of the energy intensive process of dance output generation. Mushroom body results reflect known roles for this region in the regulation of learning, memory and rhythmic behavior.

  1. Validating internal controls for quantitative plant gene expression studies

    PubMed Central

    Brunner, Amy M; Yakovlev, Igor A; Strauss, Steven H

    2004-01-01

    Background Real-time reverse transcription PCR (RT-PCR) has greatly improved the ease and sensitivity of quantitative gene expression studies. However, accurate measurement of gene expression with this method relies on the choice of a valid reference for data normalization. Studies rarely verify that gene expression levels for reference genes are adequately consistent among the samples used, nor compare alternative genes to assess which are most reliable for the experimental conditions analyzed. Results Using real-time RT-PCR to study the expression of 10 poplar (genus Populus) housekeeping genes, we demonstrate a simple method for determining the degree of stability of gene expression over a set of experimental conditions. Based on a traditional method for analyzing the stability of varieties in plant breeding, it defines measures of gene expression stability from analysis of variance (ANOVA) and linear regression. We found that the potential internal control genes differed widely in their expression stability over the different tissues, developmental stages and environmental conditions studied. Conclusion Our results support that quantitative comparisons of candidate reference genes are an important part of real-time RT-PCR studies that seek to precisely evaluate variation in gene expression. The method we demonstrated facilitates statistical and graphical evaluation of gene expression stability. Selection of the best reference gene for a given set of experimental conditions should enable detection of biologically significant changes in gene expression that are too small to be revealed by less precise methods, or when highly variable reference genes are unknowingly used in real-time RT-PCR experiments. PMID:15317655

  2. Histone acetylation is associated with differential gene expression in the rapid and robust memory CD8+ T-cell response

    PubMed Central

    Fann, Monchou; Godlove, Jason M.; Catalfamo, Marta; Wood, William H.; Chrest, Francis J.; Chun, Nicholas; Granger, Larry; Wersto, Robert; Madara, Karen; Becker, Kevin; Henkart, Pierre A.; Weng, Nan-ping

    2006-01-01

    To understand the molecular basis for the rapid and robust memory T-cell responses, we examined gene expression and chromatin modification by histone H3 lysine 9 (H3K9) acetylation in resting and activated human naive and memory CD8+ T cells. We found that, although overall gene expression patterns were similar, a number of genes are differentially expressed in either memory or naive cells in their resting and activated states. To further elucidate the basis for differential gene expression, we assessed the role of histone H3K9 acetylation in differential gene expression. Strikingly, higher H3K9 acetylation levels were detected in resting memory cells, prior to their activation, for those genes that were differentially expressed following activation, indicating that hyperacetylation of histone H3K9 may play a role in selective and rapid gene expression of memory CD8+ T cells. Consistent with this model, we showed that inducing high levels of H3K9 acetylation resulted in an increased expression in naive cells of those genes that are normally expressed differentially in memory cells. Together, these findings suggest that differential gene expression mediated at least in part by histone H3K9 hyperacetylation may be responsible for the rapid and robust memory CD8+ T-cell response. PMID:16868257

  3. Biological and Clinical Significance of MAD2L1 and BUB1, Genes Frequently Appearing in Expression Signatures for Breast Cancer Prognosis

    PubMed Central

    Wang, Zhanwei; Katsaros, Dionyssios; Shen, Yi; Fu, Yuanyuan; Canuto, Emilie Marion; Benedetto, Chiara; Lu, Lingeng; Chu, Wen-Ming; Risch, Harvey A.; Yu, Herbert

    2015-01-01

    To investigate the biologic relevance and clinical implication of genes involved in multiple gene expression signatures for breast cancer prognosis, we identified 16 published gene expression signatures, and selected two genes, MAD2L1 and BUB1. These genes appeared in 5 signatures and were involved in cell-cycle regulation. We analyzed the expression of these genes in relation to tumor features and disease outcomes. In vitro experiments were also performed in two breast cancer cell lines, MDA-MB-231 and MDA-MB-468, to assess cell proliferation, migration and invasion after knocking down the expression of these genes. High expression of these genes was found to be associated with aggressive tumors and poor disease-free survival of 203 breast cancer patients in our study, and the association with survival was confirmed in an online database consisting of 914 patients. In vitro experiments demonstrated that lowering the expression of these genes by siRNAs reduced tumor cell growth and inhibited cell migration and invasion. Our investigation suggests that MAD2L1 and BUB1 may play important roles in breast cancer progression, and measuring the expression of these genes may assist the prediction of breast cancer prognosis. PMID:26287798

  4. Systems biology definition of the core proteome of metabolism and expression is consistent with high-throughput data.

    PubMed

    Yang, Laurence; Tan, Justin; O'Brien, Edward J; Monk, Jonathan M; Kim, Donghyuk; Li, Howard J; Charusanti, Pep; Ebrahim, Ali; Lloyd, Colton J; Yurkovich, James T; Du, Bin; Dräger, Andreas; Thomas, Alex; Sun, Yuekai; Saunders, Michael A; Palsson, Bernhard O

    2015-08-25

    Finding the minimal set of gene functions needed to sustain life is of both fundamental and practical importance. Minimal gene lists have been proposed by using comparative genomics-based core proteome definitions. A definition of a core proteome that is supported by empirical data, is understood at the systems-level, and provides a basis for computing essential cell functions is lacking. Here, we use a systems biology-based genome-scale model of metabolism and expression to define a functional core proteome consisting of 356 gene products, accounting for 44% of the Escherichia coli proteome by mass based on proteomics data. This systems biology core proteome includes 212 genes not found in previous comparative genomics-based core proteome definitions, accounts for 65% of known essential genes in E. coli, and has 78% gene function overlap with minimal genomes (Buchnera aphidicola and Mycoplasma genitalium). Based on transcriptomics data across environmental and genetic backgrounds, the systems biology core proteome is significantly enriched in nondifferentially expressed genes and depleted in differentially expressed genes. Compared with the noncore, core gene expression levels are also similar across genetic backgrounds (two times higher Spearman rank correlation) and exhibit significantly more complex transcriptional and posttranscriptional regulatory features (40% more transcription start sites per gene, 22% longer 5'UTR). Thus, genome-scale systems biology approaches rigorously identify a functional core proteome needed to support growth. This framework, validated by using high-throughput datasets, facilitates a mechanistic understanding of systems-level core proteome function through in silico models; it de facto defines a paleome.

  5. Utility and Limitations of Using Gene Expression Data to Identify Functional Associations

    PubMed Central

    Peng, Cheng; Shiu, Shin-Han

    2016-01-01

    Gene co-expression has been widely used to hypothesize gene function through guilt-by association. However, it is not clear to what degree co-expression is informative, whether it can be applied to genes involved in different biological processes, and how the type of dataset impacts inferences about gene functions. Here our goal is to assess the utility and limitations of using co-expression as a criterion to recover functional associations between genes. By determining the percentage of gene pairs in a metabolic pathway with significant expression correlation, we found that many genes in the same pathway do not have similar transcript profiles and the choice of dataset, annotation quality, gene function, expression similarity measure, and clustering approach significantly impacts the ability to recover functional associations between genes using Arabidopsis thaliana as an example. Some datasets are more informative in capturing coordinated expression profiles and larger data sets are not always better. In addition, to recover the maximum number of known pathways and identify candidate genes with similar functions, it is important to explore rather exhaustively multiple dataset combinations, similarity measures, clustering algorithms and parameters. Finally, we validated the biological relevance of co-expression cluster memberships with an independent phenomics dataset and found that genes that consistently cluster with leucine degradation genes tend to have similar leucine levels in mutants. This study provides a framework for obtaining gene functional associations by maximizing the information that can be obtained from gene expression datasets. PMID:27935950

  6. Skin transcriptome profiles associated with coat color in sheep

    PubMed Central

    2013-01-01

    Background Previous molecular genetic studies of physiology and pigmentation of sheep skin have focused primarily on a limited number of genes and proteins. To identify additional genes that may play important roles in coat color regulation, Illumina sequencing technology was used to catalog global gene expression profiles in skin of sheep with white versus black coat color. Results There were 90,006 and 74,533 unigenes assembled from the reads obtained from white and black sheep skin, respectively. Genes encoding for the ribosomal proteins and keratin associated proteins were most highly expressed. A total of 2,235 known genes were differentially expressed in black versus white sheep skin, with 479 genes up-regulated and 1,756 genes down-regulated. A total of 845 novel genes were differentially expressed in black versus white sheep skin, consisting of 107 genes which were up-regulated (including 2 highly expressed genes exclusively expressed in black sheep skin) and 738 genes that were down-regulated. There was also a total of 49 known coat color genes expressed in sheep skin, from which 13 genes showed higher expression in black sheep skin. Many of these up-regulated genes, such as DCT, MATP, TYR and TYRP1, are members of the components of melanosomes and their precursor ontology category. Conclusion The white and black sheep skin transcriptome profiles obtained provide a valuable resource for future research to understand the network of gene expression controlling skin physiology and melanogenesis in sheep. PMID:23758853

  7. Juxtaposed genes in 7q21-22 amplicon contribute for two major gastric cancer sub-Types by mutual exclusive expression.

    PubMed

    Tamilzhalagan, Sembulingam; Muthuswami, Muthulakshmi; Ganesan, Kumaresan

    2017-04-01

    Genomic Copy Number Variations (CNV) and the associated gene signatures are useful for cancer prognosis, diagnosis, and targeted therapeutics. Earlier, 7q21-22 region was reported for frequent amplification in gastric cancer and potential candidate genes were identified. An analysis of the expression pattern of the 159 genes located in this amplicon revealed the consistent elevated expression of 21 genes in gastric tumors. These genes are closely arranged within the 20 Mb region, and they showed a bimodal expression pattern. SHFM1 and 14 other genes are expressed in intestinal type gastric tumors. COL1A2 and PCOLCE genes of this region are expressed in diffuse type gastric tumors. Similarly, genome-wide expression neighbors of SHFM1 and COL1A2 also showed mutually exclusive expression pattern, and stratify intestinal and diffuse type gastric tumors. The expression of COL1A2 gene-set is associated with poor prognosis, whereas the SHFM1 gene-set is associated with better prognosis among the gastric cancer patients. Despite being physical neighbors, the SHFM1 and COL1A2 genes express differentially in the two major clinical sub-types of gastric cancer in a mutually exclusive manner. The tight gene regulations operating between these juxtaposed genes deserve investigation to understand the molecular regulatory switch defining the determinants of the gastric cancer sub-types. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  8. Genome-wide gene expression effects in B6C3F1 mouse intestinal epithelia following 7 and 90 days of exposure to hexavalent chromium in drinking water

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kopec, Anna K.; Kim, Suntae; Forgacs, Agnes L.

    2012-02-15

    Chronic administration of high doses of hexavalent chromium [Cr(VI)] as sodium dichromate dihydrate (SDD) elicits alimentary cancers in mice. To further elucidate key events underlying tumor formation, a 90-day drinking water study was conducted in B6C3F1 mice. Differential gene expression was examined in duodenal and jejunal epithelial samples following 7 or 90 days of exposure to 0, 0.3, 4, 14, 60, 170 or 520 mg/L SDD in drinking water. Genome-wide microarray analyses identified 6562 duodenal and 4448 jejunal unique differentially expressed genes at day 8, and 4630 and 4845 unique changes, respectively, in the duodenum and jejunum at day 91.more » Comparative analysis identified significant overlap in duodenal and jejunal differential gene expression. Automated dose–response modeling identified > 80% of the differentially expressed genes exhibited sigmoidal dose–response curves with EC{sub 50} values ranging from 10 to 100 mg/L SDD. Only 16 genes satisfying the dose-dependent differential expression criteria had EC{sub 50} values < 10 mg/L SDD, 3 of which were regulated by Nrf2, suggesting oxidative stress in response to SDD at low concentrations. Analyses of differentially expressed genes identified over-represented functions associated with oxidative stress, cell cycle, lipid metabolism, and immune responses consistent with the reported effects on redox status and histopathology at corresponding SDD drinking water concentrations. Collectively, these data are consistent with a mode of action involving oxidative stress and cytotoxicity as early key events. This suggests that the tumorigenic effects of chronic Cr(VI) oral exposure likely require chronic tissue damage and compensatory epithelial cell proliferation. Highlights: ► Mouse small intestine gene expression is highly responsive to hexavalent chromium [Cr(VI)]. ► Cr(VI) elicits more differential gene expression after 7 days of exposure than 90 days of exposure. ► Oral exposure to Cr(VI) leads to oxidative stress, cell cycle, lipid and immune dysregulation. ► Cr(VI) elicits dose-dependent changes in gene expression with an overall median EC{sub 50} of 47 mg/L SDD.« less

  9. Comparative molecular analyses of select pH- and osmoregulatory genes in three freshwater crayfish Cherax quadricarinatus, C. destructor and C. cainii.

    PubMed

    Ali, Muhammad Y; Pavasovic, Ana; Dammannagoda, Lalith K; Mather, Peter B; Prentis, Peter J

    2017-01-01

    Systemic acid-base balance and osmotic/ionic regulation in decapod crustaceans are in part maintained by a set of transport-related enzymes such as carbonic anhydrase (CA), Na + /K + -ATPase (NKA), H + -ATPase (HAT), Na + /K + /2Cl - cotransporter (NKCC), Na + /Cl - /HCO[Formula: see text] cotransporter (NBC), Na + /H + exchanger (NHE), Arginine kinase (AK), Sarcoplasmic Ca +2 -ATPase (SERCA) and Calreticulin (CRT). We carried out a comparative molecular analysis of these genes in three commercially important yet eco-physiologically distinct freshwater crayfish , Cherax quadricarinatus, C. destructor and C. cainii , with the aim to identify mutations in these genes and determine if observed patterns of mutations were consistent with the action of natural selection. We also conducted a tissue-specific expression analysis of these genes across seven different organs, including gills, hepatopancreas, heart, kidney, liver, nerve and testes using NGS transcriptome data. The molecular analysis of the candidate genes revealed a high level of sequence conservation across the three Cherax sp. Hyphy analysis revealed that all candidate genes showed patterns of molecular variation consistent with neutral evolution. The tissue-specific expression analysis showed that 46% of candidate genes were expressed in all tissue types examined, while approximately 10% of candidate genes were only expressed in a single tissue type. The largest number of genes was observed in nerve (84%) and gills (78%) and the lowest in testes (66%). The tissue-specific expression analysis also revealed that most of the master genes regulating pH and osmoregulation (CA, NKA, HAT, NKCC, NBC, NHE) were expressed in all tissue types indicating an important physiological role for these genes outside of osmoregulation in other tissue types. The high level of sequence conservation observed in the candidate genes may be explained by the important role of these genes as well as potentially having a number of other basic physiological functions in different tissue types.

  10. Rrp1b, a New Candidate Susceptibility Gene for Breast Cancer Progression and Metastasis

    PubMed Central

    Crawford, Nigel P. S; Qian, Xiaolan; Ziogas, Argyrios; Papageorge, Alex G; Boersma, Brenda J; Walker, Renard C; Lukes, Luanne; Rowe, William L; Zhang, Jinghui; Ambs, Stefan; Lowy, Douglas R; Anton-Culver, Hoda; Hunter, Kent W

    2007-01-01

    A novel candidate metastasis modifier, ribosomal RNA processing 1 homolog B (Rrp1b), was identified through two independent approaches. First, yeast two-hybrid, immunoprecipitation, and functional assays demonstrated a physical and functional interaction between Rrp1b and the previous identified metastasis modifier Sipa1. In parallel, using mouse and human metastasis gene expression data it was observed that extracellular matrix (ECM) genes are common components of metastasis predictive signatures, suggesting that ECM genes are either important markers or causal factors in metastasis. To investigate the relationship between ECM genes and poor prognosis in breast cancer, expression quantitative trait locus analysis of polyoma middle-T transgene-induced mammary tumor was performed. ECM gene expression was found to be consistently associated with Rrp1b expression. In vitro expression of Rrp1b significantly altered ECM gene expression, tumor growth, and dissemination in metastasis assays. Furthermore, a gene signature induced by ectopic expression of Rrp1b in tumor cells predicted survival in a human breast cancer gene expression dataset. Finally, constitutional polymorphism within RRP1B was found to be significantly associated with tumor progression in two independent breast cancer cohorts. These data suggest that RRP1B may be a novel susceptibility gene for breast cancer progression and metastasis. PMID:18081427

  11. Regulation of MET by FOXP2, genes implicated in higher cognitive dysfunction and autism risk.

    PubMed

    Mukamel, Zohar; Konopka, Genevieve; Wexler, Eric; Osborn, Gregory E; Dong, Hongmei; Bergman, Mica Y; Levitt, Pat; Geschwind, Daniel H

    2011-08-10

    Autism spectrum disorder (ASD) is a highly heritable, behaviorally defined, heterogeneous disorder of unknown pathogenesis. Several genetic risk genes have been identified, including the gene encoding the receptor tyrosine kinase MET, which regulates neuronal differentiation and growth. An ASD-associated polymorphism disrupts MET gene transcription, and there are reduced levels of MET protein expression in the mature temporal cortex of subjects with ASD. To address the possible neurodevelopmental contribution of MET to ASD pathogenesis, we examined the expression and transcriptional regulation of MET by a transcription factor, FOXP2, which is implicated in regulation of cognition and language, two functions altered in ASD. MET mRNA expression in the midgestation human fetal cerebral cortex is strikingly restricted, localized to portions of the temporal and occipital lobes. Within the cortical plate of the temporal lobe, the pattern of MET expression is highly complementary to the expression pattern of FOXP2, suggesting the latter may play a role in repression of gene expression. Consistent with this, MET and FOXP2 also are reciprocally expressed by differentiating normal human neuronal progenitor cells (NHNPs) in vitro, leading us to assess whether FOXP2 transcriptionally regulates MET. Indeed, FOXP2 binds directly to the 5' regulatory region of MET, and overexpression of FOXP2 results in transcriptional repression of MET. The expression of MET in restricted human neocortical regions, and its regulation in part by FOXP2, is consistent with genetic evidence for MET contributing to ASD risk.

  12. MICROARRAY QUALITY CONTROL PROJECT: A COMPREHENSIVE GENE EXPRESSION TECHNOLOGY SURVEY DEMONSTRATES MEASURABLE CONSISTENCY AND CONCORDANT RESULTS BETWEEN PLATFORMS

    EPA Science Inventory

    Over the last decade, the introduction of microarray technology has had a profound impact on gene expression research. The publication of studies with dissimilar or altogether contradictory results, obtained using different microarray platforms to analyze identical RNA samples, h...

  13. Contributions to Statistical Problems Related to Microarray Data

    ERIC Educational Resources Information Center

    Hong, Feng

    2009-01-01

    Microarray is a high throughput technology to measure the gene expression. Analysis of microarray data brings many interesting and challenging problems. This thesis consists three studies related to microarray data. First, we propose a Bayesian model for microarray data and use Bayes Factors to identify differentially expressed genes. Second, we…

  14. Genetic and epigenetic architecture of sex-biased expression in the jewel wasps Nasonia vitripennis and giraulti

    PubMed Central

    Wang, Xu; Werren, John H.; Clark, Andrew G.

    2015-01-01

    There is extraordinary diversity in sexual dimorphism (SD) among animals, but little is known about its epigenetic basis. To study the epigenetic architecture of SD in a haplodiploid system, we performed RNA-seq and whole-genome bisulfite sequencing of adult females and males from two closely related parasitoid wasps, Nasonia vitripennis and Nasonia giraulti. More than 75% of expressed genes displayed significantly sex-biased expression. As a consequence, expression profiles are more similar between species within each sex than between sexes within each species. Furthermore, extremely male- and female-biased genes are enriched for totally different functional categories: male-biased genes for key enzymes in sex-pheromone synthesis and female-biased genes for genes involved in epigenetic regulation of gene expression. Remarkably, just 70 highly expressed, extremely male-biased genes account for 10% of all transcripts in adult males. Unlike expression profiles, DNA methylomes are highly similar between sexes within species, with no consistent sex differences in methylation found. Therefore, methylation changes cannot explain the extensive level of sex-biased gene expression observed. Female-biased genes have smaller sequence divergence between species, higher conservation to other hymenopterans, and a broader expression range across development. Overall, female-biased genes have been recruited from genes with more conserved and broadly expressing “house-keeping” functions, whereas male-biased genes are more recently evolved and are predominately testis specific. In summary, Nasonia accomplish a striking degree of sex-biased expression without sex chromosomes or epigenetic differences in methylation. We propose that methylation provides a general signal for constitutive gene expression, whereas other sex-specific signals cause sex-biased gene expression. PMID:26100871

  15. Gene expression correlates of postinfective fatigue syndrome after infectious mononucleosis.

    PubMed

    Cameron, Barbara; Galbraith, Sally; Zhang, Yun; Davenport, Tracey; Vollmer-Conna, Ute; Wakefield, Denis; Hickie, Ian; Dunsmuir, William; Whistler, Toni; Vernon, Suzanne; Reeves, William C; Lloyd, Andrew R

    2007-07-01

    Infectious mononucleosis (IM) commonly triggers a protracted postinfective fatigue syndrome (PIFS) of unknown pathogenesis. Seven subjects with PIFS with 6 or more months of disabling symptoms and 8 matched control subjects who had recovered promptly from documented IM were studied. The expression of 30,000 genes was examined in the peripheral blood by microarray analysis in 65 longitudinally collected samples. Gene expression patterns associated with PIFS were sought by correlation with symptom factor scores. Differential expression of 733 genes was identified when samples collected early during the illness and at the late (recovered) time point were compared. Of these genes, 234 were found to be significantly correlated with the reported severity of the fatigue symptom factor, and 180 were found to be correlated with the musculoskeletal pain symptom factor. Validation by analysis of the longitudinal expression pattern revealed 35 genes for which changes in expression were consistent with the illness course. These genes included several that are involved in signal transduction pathways, metal ion binding, and ion channel activity. Gene expression correlates of the cardinal symptoms of PIFS after IM have been identified. Further studies of these gene products may help to elucidate the pathogenesis of PIFS.

  16. Stable zymomonas mobilis xylose and arabinose fermenting strains

    DOEpatents

    Zhang, Min [Lakewood, CO; Chou, Yat-Chen [Taipei, TW

    2008-04-08

    The present invention briefly includes a transposon for stable insertion of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, and at least one promoter for expression of the structural genes in the bacterium, a pair of inverted insertion sequences, the operons contained inside the insertion sequences, and a transposase gene located outside of the insertion sequences. A plasmid shuttle vector for transformation of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, at least one promoter for expression of the structural genes in the bacterium, and at least two DNA fragments having homology with a gene in the bacterial genome to be transformed, is also provided.The transposon and shuttle vectors are useful in constructing significantly different Zymomonas mobilis strains, according to the present invention, which are useful in the conversion of the cellulose derived pentose sugars into fuels and chemicals, using traditional fermentation technology, because they are stable for expression in a non-selection medium.

  17. PCFT/SLC46A1 promoter methylation and restoration of gene expression in human leukemia cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gonen, Nitzan; Bram, Eran E.; Assaraf, Yehuda G.

    2008-11-28

    The proton-coupled folate transporter (PCFT/SLC46A1) displays optimal and prominent folate and antifolate transport activity at acidic pH in human carcinoma cells but poor activity in leukemia cells. Consistently herein, human leukemia cell lines expressed poor PCFT transcript levels, whereas various carcinoma cell lines showed substantial PCFT gene expression. We identified a CpG island with high density at nucleotides -200 through +100 and explored its role in PCFT promoter silencing. Leukemia cells with barely detectable PCFT transcripts consistently harbored 85-100% methylation of this CpG island, whereas no methylation was found in carcinoma cells. Treatment with 5-Aza-2'-deoxycytidine which induced demethylation but notmore » with the histone deacetylase inhibitor trichostatin A, restored 50-fold PCFT expression only in leukemia cells. These findings constitute the first demonstration of the dominant epigenetic silencing of the PCFT gene in leukemia cells. The potential translational implications of the restoration of PCFT expression in chemotherapy of leukemia are discussed.« less

  18. Mitochondria, oligodendrocytes and inflammation in bipolar disorder: evidence from transcriptome studies points to intriguing parallels with multiple sclerosis

    PubMed Central

    Konradi, Christine; Sillivan, Stephanie E.; Clay, Hayley B.

    2011-01-01

    Gene expression studies of bipolar disorder (BPD) have shown changes in transcriptome profiles in multiple brain regions. Here we summarize the most consistent findings in the scientific literature, and compare them to data from schizophrenia (SZ) and major depressive disorder (MDD). The transcriptome profiles of all three disorders overlap, making the existence of a BPD-specific profile unlikely. Three groups of functionally related genes are consistently expressed at altered levels in BPD, SZ and MDD. Genes involved in energy metabolism and mitochondrial function are downregulated, genes involved in immune response and inflammation are upregulated, and genes expressed in oligodendrocytes are downregulated. Experimental paradigms for multiple sclerosis demonstrate a tight link between energy metabolism, inflammation and demyelination. These studies also show variabilities in the extent of oligodendrocyte stress, which can vary from a downregulation of oligodendrocyte genes, such as observed in psychiatric disorders, to cell death and brain lesions seen in multiple sclerosis. We conclude that experimental models of multiple sclerosis could be of interest for the research of BPD, SZ and MDD. PMID:21310238

  19. A Self-Directed Method for Cell-Type Identification and Separation of Gene Expression Microarrays

    PubMed Central

    Zuckerman, Neta S.; Noam, Yair; Goldsmith, Andrea J.; Lee, Peter P.

    2013-01-01

    Gene expression analysis is generally performed on heterogeneous tissue samples consisting of multiple cell types. Current methods developed to separate heterogeneous gene expression rely on prior knowledge of the cell-type composition and/or signatures - these are not available in most public datasets. We present a novel method to identify the cell-type composition, signatures and proportions per sample without need for a-priori information. The method was successfully tested on controlled and semi-controlled datasets and performed as accurately as current methods that do require additional information. As such, this method enables the analysis of cell-type specific gene expression using existing large pools of publically available microarray datasets. PMID:23990767

  20. Accelerated recruitment of new brain development genes into the human genome.

    PubMed

    Zhang, Yong E; Landback, Patrick; Vibranovski, Maria D; Long, Manyuan

    2011-10-01

    How the human brain evolved has attracted tremendous interests for decades. Motivated by case studies of primate-specific genes implicated in brain function, we examined whether or not the young genes, those emerging genome-wide in the lineages specific to the primates or rodents, showed distinct spatial and temporal patterns of transcription compared to old genes, which had existed before primate and rodent split. We found consistent patterns across different sources of expression data: there is a significantly larger proportion of young genes expressed in the fetal or infant brain of humans than in mouse, and more young genes in humans have expression biased toward early developing brains than old genes. Most of these young genes are expressed in the evolutionarily newest part of human brain, the neocortex. Remarkably, we also identified a number of human-specific genes which are expressed in the prefrontal cortex, which is implicated in complex cognitive behaviors. The young genes upregulated in the early developing human brain play diverse functional roles, with a significant enrichment of transcription factors. Genes originating from different mechanisms show a similar expression bias in the developing brain. Moreover, we found that the young genes upregulated in early brain development showed rapid protein evolution compared to old genes also expressed in the fetal brain. Strikingly, genes expressed in the neocortex arose soon after its morphological origin. These four lines of evidence suggest that positive selection for brain function may have contributed to the origination of young genes expressed in the developing brain. These data demonstrate a striking recruitment of new genes into the early development of the human brain.

  1. The Arabidopsis BRAHMA Chromatin-Remodeling ATPase Is Involved in Repression of Seed Maturation Genes in Leaves1[W][OA

    PubMed Central

    Tang, Xurong; Hou, Anfu; Babu, Mohan; Nguyen, Vi; Hurtado, Lidia; Lu, Qing; Reyes, Jose C.; Wang, Aiming; Keller, Wilfred A.; Harada, John J.; Tsang, Edward W.T.; Cui, Yuhai

    2008-01-01

    Synthesis and accumulation of seed storage proteins (SSPs) is an important aspect of the seed maturation program. Genes encoding SSPs are specifically and highly expressed in the seed during maturation. However, the mechanisms that repress the expression of these genes in leaf tissue are not well understood. To gain insight into the repression mechanisms, we performed a genetic screen for mutants that express SSPs in leaves. Here, we show that mutations affecting BRAHMA (BRM), a SNF2 chromatin-remodeling ATPase, cause ectopic expression of a subset of SSPs and other embryogenesis-related genes in leaf tissue. Consistent with the notion that such SNF2-like ATPases form protein complexes in vivo, we observed similar phenotypes for mutations of AtSWI3C, a BRM-interacting partner, and BSH, a SNF5 homolog and essential SWI/SNF subunit. Chromatin immunoprecipitation experiments show that BRM is recruited to the promoters of a number of embryogenesis genes in wild-type leaves, including the 2S genes, expressed in brm leaves. Consistent with its role in nucleosome remodeling, BRM appears to affect the chromatin structure of the At2S2 promoter. Thus, the BRM-containing chromatin-remodeling ATPase complex involved in many aspects of plant development mediates the repression of SSPs in leaf tissue. PMID:18508955

  2. High-resolution gene expression data from blastoderm embryos of the scuttle fly Megaselia abdita

    PubMed Central

    Wotton, Karl R; Jiménez-Guri, Eva; Crombach, Anton; Cicin-Sain, Damjan; Jaeger, Johannes

    2015-01-01

    Gap genes are involved in segment determination during early development in dipteran insects (flies, midges, and mosquitoes). We carried out a systematic quantitative comparative analysis of the gap gene network across different dipteran species. Our work provides mechanistic insights into the evolution of this pattern-forming network. As a central component of our project, we created a high-resolution quantitative spatio-temporal data set of gap and maternal co-ordinate gene expression in the blastoderm embryo of the non-drosophilid scuttle fly, Megaselia abdita. Our data include expression patterns in both wild-type and RNAi-treated embryos. The data—covering 10 genes, 10 time points, and over 1,000 individual embryos—consist of original embryo images, quantified expression profiles, extracted positions of expression boundaries, and integrated expression patterns, plus metadata and intermediate processing steps. These data provide a valuable resource for researchers interested in the comparative study of gene regulatory networks and pattern formation, an essential step towards a more quantitative and mechanistic understanding of developmental evolution. PMID:25977812

  3. Cellular immunity to viral antigens limits E1-deleted adenoviruses for gene therapy.

    PubMed Central

    Yang, Y; Nunes, F A; Berencsi, K; Furth, E E; Gönczöl, E; Wilson, J M

    1994-01-01

    An important limitation that has emerged in the use of adenoviruses for gene therapy has been loss of recombinant gene expression that occurs concurrent with the development of pathology in the organ expressing the transgene. We have used liver-directed approaches to gene therapy in mice to study mechanisms that underlie the problems with transient expression and pathology that have characterized in vivo applications of first-generation recombinant adenoviruses (i.e., those deleted of E1a and E1b). Our data are consistent with the following hypothesis. Cells harboring the recombinant viral genome express the transgene as desired; however, low-level expression of viral genes also occurs. A virus-specific cellular immune response is stimulated that leads to destruction of the genetically modified hepatocytes, massive hepatitis, and repopulation of the liver with nontransgene-containing hepatocytes. These findings suggest approaches for improving recombinant adenoviruses that are based on further crippling the virus to limit expression of nondeleted viral genes. Images PMID:8183921

  4. Hox gene expression during postlarval development of the polychaete Alitta virens.

    PubMed

    Bakalenko, Nadezhda I; Novikova, Elena L; Nesterenko, Alexander Y; Kulakova, Milana A

    2013-05-01

    Hox genes are the family of transcription factors that play a key role in the patterning of the anterior-posterior axis of all bilaterian animals. These genes display clustered organization and colinear expression. Expression boundaries of individual Hox genes usually correspond with morphological boundaries of the body. Previously, we studied Hox gene expression during larval development of the polychaete Alitta virens (formerly Nereis virens) and discovered that Hox genes are expressed in nereid larva according to the spatial colinearity principle. Adult Alitta virens consist of multiple morphologically similar segments, which are formed sequentially in the growth zone. Since the worm grows for most of its life, postlarval segments constantly change their position along the anterior-posterior axis. We studied the expression dynamics of the Hox cluster during postlarval development of the nereid Alitta virens and found that 8 out of 11 Hox genes are transcribed as wide gene-specific gradients in the ventral nerve cord, ectoderm, and mesoderm. The expression domains constantly shift in accordance with the changing proportions of the growing worm, so expression domains of most Hox genes do not have stable anterior or/and posterior boundaries.In the course of our study, we revealed long antisense RNA (asRNA) for some Hox genes. Expression patterns of two of these genes were analyzed using whole-mount in-situ hybridization. This is the first discovery of antisense RNA for Hox genes in Lophotrochozoa. Hox gene expression in juvenile A. virens differs significantly from Hox gene expression patterns both in A. virens larva and in other Bilateria.We suppose that the postlarval function of the Hox genes in this polychaete is to establish and maintain positional coordinates in a constantly growing body, as opposed to creating morphological difference between segments.

  5. Transcriptome study of differential expression in schizophrenia

    PubMed Central

    Sanders, Alan R.; Göring, Harald H. H.; Duan, Jubao; Drigalenko, Eugene I.; Moy, Winton; Freda, Jessica; He, Deli; Shi, Jianxin; Gejman, Pablo V.

    2013-01-01

    Schizophrenia genome-wide association studies (GWAS) have identified common SNPs, rare copy number variants (CNVs) and a large polygenic contribution to illness risk, but biological mechanisms remain unclear. Bioinformatic analyses of significantly associated genetic variants point to a large role for regulatory variants. To identify gene expression abnormalities in schizophrenia, we generated whole-genome gene expression profiles using microarrays on lymphoblastoid cell lines (LCLs) from 413 cases and 446 controls. Regression analysis identified 95 transcripts differentially expressed by affection status at a genome-wide false discovery rate (FDR) of 0.05, while simultaneously controlling for confounding effects. These transcripts represented 89 genes with functions such as neurotransmission, gene regulation, cell cycle progression, differentiation, apoptosis, microRNA (miRNA) processing and immunity. This functional diversity is consistent with schizophrenia's likely significant pathophysiological heterogeneity. The overall enrichment of immune-related genes among those differentially expressed by affection status is consistent with hypothesized immune contributions to schizophrenia risk. The observed differential expression of extended major histocompatibility complex (xMHC) region histones (HIST1H2BD, HIST1H2BC, HIST1H2BH, HIST1H2BG and HIST1H4K) converges with the genetic evidence from GWAS, which find the xMHC to be the most significant susceptibility locus. Among the differentially expressed immune-related genes, B3GNT2 is implicated in autoimmune disorders previously tied to schizophrenia risk (rheumatoid arthritis and Graves’ disease), and DICER1 is pivotal in miRNA processing potentially linking to miRNA alterations in schizophrenia (e.g. MIR137, the second strongest GWAS finding). Our analysis provides novel candidate genes for further study to assess their potential contribution to schizophrenia. PMID:23904455

  6. Genome-wide gene expression effects in B6C3F1 mouse intestinal epithelia following 7 and 90days of exposure to hexavalent chromium in drinking water.

    PubMed

    Kopec, Anna K; Kim, Suntae; Forgacs, Agnes L; Zacharewski, Timothy R; Proctor, Deborah M; Harris, Mark A; Haws, Laurie C; Thompson, Chad M

    2012-02-15

    Chronic administration of high doses of hexavalent chromium [Cr(VI)] as sodium dichromate dihydrate (SDD) elicits alimentary cancers in mice. To further elucidate key events underlying tumor formation, a 90-day drinking water study was conducted in B6C3F1 mice. Differential gene expression was examined in duodenal and jejunal epithelial samples following 7 or 90days of exposure to 0, 0.3, 4, 14, 60, 170 or 520mg/L SDD in drinking water. Genome-wide microarray analyses identified 6562 duodenal and 4448 jejunal unique differentially expressed genes at day 8, and 4630 and 4845 unique changes, respectively, in the duodenum and jejunum at day 91. Comparative analysis identified significant overlap in duodenal and jejunal differential gene expression. Automated dose-response modeling identified >80% of the differentially expressed genes exhibited sigmoidal dose-response curves with EC(50) values ranging from 10 to 100mg/L SDD. Only 16 genes satisfying the dose-dependent differential expression criteria had EC(50) values <10mg/L SDD, 3 of which were regulated by Nrf2, suggesting oxidative stress in response to SDD at low concentrations. Analyses of differentially expressed genes identified over-represented functions associated with oxidative stress, cell cycle, lipid metabolism, and immune responses consistent with the reported effects on redox status and histopathology at corresponding SDD drinking water concentrations. Collectively, these data are consistent with a mode of action involving oxidative stress and cytotoxicity as early key events. This suggests that the tumorigenic effects of chronic Cr(VI) oral exposure likely require chronic tissue damage and compensatory epithelial cell proliferation. Copyright © 2011 Elsevier Inc. All rights reserved.

  7. Alteration of development and gene expression induced by in ovo-nanoinjection of 3-hydroxybenzo[c]phenanthrene into Japanese medaka (Oryzias latipes) embryos.

    PubMed

    Chen, Kun; Tsutsumi, Yuki; Yoshitake, Shuhei; Qiu, Xuchun; Xu, Hai; Hashiguchi, Yasuyuki; Honda, Masato; Tashiro, Kosuke; Nakayama, Kei; Hano, Takeshi; Suzuki, Nobuo; Hayakawa, Kazuichi; Shimasaki, Yohei; Oshima, Yuji

    2017-01-01

    Benzo[c]phenanthrene (BcP) is a highly toxic polycyclic aromatic hydrocarbon (PAHs) found throughout the environment. In fish, it is metabolized to 3-hydroxybenzo[c]phenanthrene (3-OHBcP). In the present study, we observed the effects of 1nM 3-OHBcP on the development and gene expression of Japanese medaka (Oryzias latipes) embryos. Embryos were nanoinjected with the chemical after fertilization. Survival, developmental stage, and heart rate of the embryos were observed, and gene expression differences were quantified by messenger RNA sequencing (mRNA-Seq). The exposure to 1nM 3-OHBcP accelerated the development of medaka embryos on the 1st, 4th, and 6th days post fertilization (dpf), and increased heart rates significantly on the 5th dpf. Physical development differences of exposed medaka embryos were consistent with the gene expression profiles of the mRNA-Seq results for the 3rd dpf, which show that the expression of 780 genes differed significantly between the solvent control and 1nM 3-OHBcP exposure groups. The obvious expression changes in the exposure group were found for genes involved in organ formation (eye, muscle, heart), energy supply (ATPase and ATP synthase), and stress-response (heat shock protein genes). The acceleration of development and increased heart rate, which were consistent with the changes in mRNA expression, suggested that 3-OHBcP affects the development of medaka embryos. The observation on the developmental stages and heart beat, in ovo-nanoinjection and mRNA-Seq may be efficient tools to evaluate the effects of chemicals on embryos. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Analysis of Bos taurus and Sus scrofa X and Y chromosome transcriptome highlights reproductive driver genes

    PubMed Central

    Khan, Faheem Ahmed; Liu, Hui; Zhou, Hao; Wang, Kai; Qamar, Muhammad Tahir Ul; Pandupuspitasari, Nuruliarizki Shinta; Shujun, Zhang

    2017-01-01

    The biology of sperm, its capability of fertilizing an egg and its role in sex ratio are the major biological questions in reproductive biology. To answer these question we integrated X and Y chromosome transcriptome across different species: Bos taurus and Sus scrofa and identified reproductive driver genes based on Weighted Gene Co-Expression Network Analysis (WGCNA) algorithm. Our strategy resulted in 11007 and 10445 unique genes consisting of 9 and 11 reproductive modules in Bos taurus and Sus scrofa, respectively. The consensus module calculation yields an overall 167 overlapped genes which were mapped to 846 DEGs in Bos taurus to finally get a list of 67 dual feature genes. We develop gene co-expression network of selected 67 genes that consists of 58 nodes (27 down-regulated and 31 up-regulated genes) enriched to 66 GO biological process (BP) including 6 GO annotations related to reproduction and two KEGG pathways. Moreover, we searched significantly related TF (ISRE, AP1FJ, RP58, CREL) and miRNAs (bta-miR-181a, bta-miR-17-5p, bta-miR-146b, bta-miR-146a) which targeted the genes in co-expression network. In addition we performed genetic analysis including phylogenetic, functional domain identification, epigenetic modifications, mutation analysis of the most important reproductive driver genes PRM1, PPP2R2B and PAFAH1B1 and finally performed a protein docking analysis to visualize their therapeutic and gene expression regulation ability. PMID:28903352

  9. Supervised group Lasso with applications to microarray data analysis

    PubMed Central

    Ma, Shuangge; Song, Xiao; Huang, Jian

    2007-01-01

    Background A tremendous amount of efforts have been devoted to identifying genes for diagnosis and prognosis of diseases using microarray gene expression data. It has been demonstrated that gene expression data have cluster structure, where the clusters consist of co-regulated genes which tend to have coordinated functions. However, most available statistical methods for gene selection do not take into consideration the cluster structure. Results We propose a supervised group Lasso approach that takes into account the cluster structure in gene expression data for gene selection and predictive model building. For gene expression data without biological cluster information, we first divide genes into clusters using the K-means approach and determine the optimal number of clusters using the Gap method. The supervised group Lasso consists of two steps. In the first step, we identify important genes within each cluster using the Lasso method. In the second step, we select important clusters using the group Lasso. Tuning parameters are determined using V-fold cross validation at both steps to allow for further flexibility. Prediction performance is evaluated using leave-one-out cross validation. We apply the proposed method to disease classification and survival analysis with microarray data. Conclusion We analyze four microarray data sets using the proposed approach: two cancer data sets with binary cancer occurrence as outcomes and two lymphoma data sets with survival outcomes. The results show that the proposed approach is capable of identifying a small number of influential gene clusters and important genes within those clusters, and has better prediction performance than existing methods. PMID:17316436

  10. Effects of hibernation on bone marrow transcriptome in thirteen-lined ground squirrels.

    PubMed

    Cooper, Scott T; Sell, Shawn S; Fahrenkrog, Molly; Wilkinson, Kory; Howard, David R; Bergen, Hannah; Cruz, Estefania; Cash, Steve E; Andrews, Matthew T; Hampton, Marshall

    2016-07-01

    Mammalian hibernators adapt to prolonged periods of immobility, hypometabolism, hypothermia, and oxidative stress, each capable of reducing bone marrow activity. In this study bone marrow transcriptomes were compared among thirteen-lined ground squirrels collected in July, winter torpor, and winter interbout arousal (IBA). The results were consistent with a suppression of acquired immune responses, and a shift to innate immune responses during hibernation through higher complement expression. Consistent with the increase in adipocytes found in bone marrow of hibernators, expression of genes associated with white adipose tissue are higher during hibernation. Genes that should strengthen the bone by increasing extracellular matrix were higher during hibernation, especially the collagen genes. Finally, expression of heat shock proteins were lower, and cold-response genes were higher, during hibernation. No differential expression of hematopoietic genes involved in erythrocyte or megakaryocyte production was observed. This global view of the changes in the bone marrow transcriptome over both short term (torpor vs. IBA) and long term (torpor vs. July) hypothermia can explain several observations made about circulating blood cells and the structure and strength of the bone during hibernation. Copyright © 2016 the American Physiological Society.

  11. Clustering Algorithms: Their Application to Gene Expression Data

    PubMed Central

    Oyelade, Jelili; Isewon, Itunuoluwa; Oladipupo, Funke; Aromolaran, Olufemi; Uwoghiren, Efosa; Ameh, Faridah; Achas, Moses; Adebiyi, Ezekiel

    2016-01-01

    Gene expression data hide vital information required to understand the biological process that takes place in a particular organism in relation to its environment. Deciphering the hidden patterns in gene expression data proffers a prodigious preference to strengthen the understanding of functional genomics. The complexity of biological networks and the volume of genes present increase the challenges of comprehending and interpretation of the resulting mass of data, which consists of millions of measurements; these data also inhibit vagueness, imprecision, and noise. Therefore, the use of clustering techniques is a first step toward addressing these challenges, which is essential in the data mining process to reveal natural structures and identify interesting patterns in the underlying data. The clustering of gene expression data has been proven to be useful in making known the natural structure inherent in gene expression data, understanding gene functions, cellular processes, and subtypes of cells, mining useful information from noisy data, and understanding gene regulation. The other benefit of clustering gene expression data is the identification of homology, which is very important in vaccine design. This review examines the various clustering algorithms applicable to the gene expression data in order to discover and provide useful knowledge of the appropriate clustering technique that will guarantee stability and high degree of accuracy in its analysis procedure. PMID:27932867

  12. Context-specific metabolic networks are consistent with experiments.

    PubMed

    Becker, Scott A; Palsson, Bernhard O

    2008-05-16

    Reconstructions of cellular metabolism are publicly available for a variety of different microorganisms and some mammalian genomes. To date, these reconstructions are "genome-scale" and strive to include all reactions implied by the genome annotation, as well as those with direct experimental evidence. Clearly, many of the reactions in a genome-scale reconstruction will not be active under particular conditions or in a particular cell type. Methods to tailor these comprehensive genome-scale reconstructions into context-specific networks will aid predictive in silico modeling for a particular situation. We present a method called Gene Inactivity Moderated by Metabolism and Expression (GIMME) to achieve this goal. The GIMME algorithm uses quantitative gene expression data and one or more presupposed metabolic objectives to produce the context-specific reconstruction that is most consistent with the available data. Furthermore, the algorithm provides a quantitative inconsistency score indicating how consistent a set of gene expression data is with a particular metabolic objective. We show that this algorithm produces results consistent with biological experiments and intuition for adaptive evolution of bacteria, rational design of metabolic engineering strains, and human skeletal muscle cells. This work represents progress towards producing constraint-based models of metabolism that are specific to the conditions where the expression profiling data is available.

  13. A comparative study of the Arabidopsis thaliana guard-cell transcriptome and its modulation by sucrose

    USDA-ARS?s Scientific Manuscript database

    To test the hypothesis that photosynthesis-derived sugar signals guard cells to adjust stomatal opening, we determined the profile of genes expressed in isolated guard cells. The results revealed that expression of 289 genes increased in guard cells in response to sucrose. Consistent with the hypoth...

  14. Selection-driven evolution of sex-biased genes is consistent with sexual selection in Arabidopsis thaliana.

    PubMed

    Gossmann, Toni I; Schmid, Marc W; Grossniklaus, Ueli; Schmid, Karl J

    2014-03-01

    Sex-biased genes are genes with a preferential or specific expression in one sex and tend to show an accelerated rate of evolution in animals. Various hypotheses--which are not mutually exclusive--have been put forth to explain observed patterns of rapid evolution. One possible explanation is positive selection, but this has been shown only in few animal species and mostly for male-specific genes. Here, we present a large-scale study that investigates evolutionary patterns of sex-biased genes in the predominantly self-fertilizing plant Arabidopsis thaliana. Unlike most animal species, A. thaliana does not possess sex chromosomes, its flowers develop both male and female sexual organs, and it is characterized by low outcrossing rates. Using cell-specific gene expression data, we identified genes whose expression is enriched in comparison with all other tissues in the male and female gametes (sperm, egg, and central cell), as well as in synergids, pollen, and pollen tubes, which also play an important role in reproduction. Genes specifically expressed in gametes and synergids show higher rates of protein evolution compared with the genome-wide average and no evidence for positive selection. In contrast, pollen- and pollen tube-specific genes not only have lower rates of protein evolution but also exhibit a higher proportion of adaptive amino acid substitutions. We show that this is the result of increased levels of purifying and positive selection among genes with pollen- and pollen tube-specific expression. The increased proportion of adaptive substitutions cannot be explained by the fact that pollen- and pollen tube-expressed genes are enriched in segmental duplications, are on average older, or have a larger effective population size. Our observations are consistent with prezygotic sexual selection as a result of interactions during pollination and pollen tube growth such as pollen tube competition.

  15. Transcriptomic Identification of ADH1B as a Novel Candidate Gene for Obesity and Insulin Resistance in Human Adipose Tissue in Mexican Americans from the Veterans Administration Genetic Epidemiology Study (VAGES)

    PubMed Central

    Winnier, Deidre A.; Fourcaudot, Marcel; Norton, Luke; Abdul-Ghani, Muhammad A.; Hu, Shirley L.; Farook, Vidya S.; Coletta, Dawn K.; Kumar, Satish; Puppala, Sobha; Chittoor, Geetha; Dyer, Thomas D.; Arya, Rector; Carless, Melanie; Lehman, Donna M.; Curran, Joanne E.; Cromack, Douglas T.; Tripathy, Devjit; Blangero, John; Duggirala, Ravindranath; Göring, Harald H. H.; DeFronzo, Ralph A.; Jenkinson, Christopher P.

    2015-01-01

    Type 2 diabetes (T2D) is a complex metabolic disease that is more prevalent in ethnic groups such as Mexican Americans, and is strongly associated with the risk factors obesity and insulin resistance. The goal of this study was to perform whole genome gene expression profiling in adipose tissue to detect common patterns of gene regulation associated with obesity and insulin resistance. We used phenotypic and genotypic data from 308 Mexican American participants from the Veterans Administration Genetic Epidemiology Study (VAGES). Basal fasting RNA was extracted from adipose tissue biopsies from a subset of 75 unrelated individuals, and gene expression data generated on the Illumina BeadArray platform. The number of gene probes with significant expression above baseline was approximately 31,000. We performed multiple regression analysis of all probes with 15 metabolic traits. Adipose tissue had 3,012 genes significantly associated with the traits of interest (false discovery rate, FDR ≤ 0.05). The significance of gene expression changes was used to select 52 genes with significant (FDR ≤ 10-4) gene expression changes across multiple traits. Gene sets/Pathways analysis identified one gene, alcohol dehydrogenase 1B (ADH1B) that was significantly enriched (P < 10-60) as a prime candidate for involvement in multiple relevant metabolic pathways. Illumina BeadChip derived ADH1B expression data was consistent with quantitative real time PCR data. We observed significant inverse correlations with waist circumference (2.8 x 10-9), BMI (5.4 x 10-6), and fasting plasma insulin (P < 0.001). These findings are consistent with a central role for ADH1B in obesity and insulin resistance and provide evidence for a novel genetic regulatory mechanism for human metabolic diseases related to these traits. PMID:25830378

  16. Fractal Clustering and Knowledge-driven Validation Assessment for Gene Expression Profiling.

    PubMed

    Wang, Lu-Yong; Balasubramanian, Ammaiappan; Chakraborty, Amit; Comaniciu, Dorin

    2005-01-01

    DNA microarray experiments generate a substantial amount of information about the global gene expression. Gene expression profiles can be represented as points in multi-dimensional space. It is essential to identify relevant groups of genes in biomedical research. Clustering is helpful in pattern recognition in gene expression profiles. A number of clustering techniques have been introduced. However, these traditional methods mainly utilize shape-based assumption or some distance metric to cluster the points in multi-dimension linear Euclidean space. Their results shows poor consistence with the functional annotation of genes in previous validation study. From a novel different perspective, we propose fractal clustering method to cluster genes using intrinsic (fractal) dimension from modern geometry. This method clusters points in such a way that points in the same clusters are more self-affine among themselves than to the points in other clusters. We assess this method using annotation-based validation assessment for gene clusters. It shows that this method is superior in identifying functional related gene groups than other traditional methods.

  17. Cross-Study Homogeneity of Psoriasis Gene Expression in Skin across a Large Expression Range

    PubMed Central

    Kerkof, Keith; Timour, Martin; Russell, Christopher B.

    2013-01-01

    Background In psoriasis, only limited overlap between sets of genes identified as differentially expressed (psoriatic lesional vs. psoriatic non-lesional) was found using statistical and fold-change cut-offs. To provide a framework for utilizing prior psoriasis data sets we sought to understand the consistency of those sets. Methodology/Principal Findings Microarray expression profiling and qRT-PCR were used to characterize gene expression in PP and PN skin from psoriasis patients. cDNA (three new data sets) and cRNA hybridization (four existing data sets) data were compared using a common analysis pipeline. Agreement between data sets was assessed using varying qualitative and quantitative cut-offs to generate a DEG list in a source data set and then using other data sets to validate the list. Concordance increased from 67% across all probe sets to over 99% across more than 10,000 probe sets when statistical filters were employed. The fold-change behavior of individual genes tended to be consistent across the multiple data sets. We found that genes with <2-fold change values were quantitatively reproducible between pairs of data-sets. In a subset of transcripts with a role in inflammation changes detected by microarray were confirmed by qRT-PCR with high concordance. For transcripts with both PN and PP levels within the microarray dynamic range, microarray and qRT-PCR were quantitatively reproducible, including minimal fold-changes in IL13, TNFSF11, and TNFRSF11B and genes with >10-fold changes in either direction such as CHRM3, IL12B and IFNG. Conclusions/Significance Gene expression changes in psoriatic lesions were consistent across different studies, despite differences in patient selection, sample handling, and microarray platforms but between-study comparisons showed stronger agreement within than between platforms. We could use cut-offs as low as log10(ratio) = 0.1 (fold-change = 1.26), generating larger gene lists that validate on independent data sets. The reproducibility of PP signatures across data sets suggests that different sample sets can be productively compared. PMID:23308107

  18. Use of toxicogenomics for identifying genetic markers of pulmonary oedema

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Balharry, Dominique; Oreffo, Victor; Richards, Roy

    2005-04-15

    This study was undertaken primarily to identify genetic markers of oedema and inflammation. Mild pulmonary injury was induced following the instillation of the oedema-producing agent, bleomycin (0.5 units). Oedema was then confirmed by conventional toxicology (lavage protein levels, free cell counts and lung/body weight ratios) and histology 3 days post-bleomycin instillation.The expression profile of 1176 mRNA species was determined for bleomycin-exposed lung (Clontech Atlas macroarray, n = 9). To obtain pertinent results from these data, it was necessary to develop a simple, effective method for bioinformatic analysis of altered gene expression. Data were log{sub 10} transformed followed by global normalisation.more » Differential gene expression was accepted if: (a) genes were statistically significant (P {<=} 0.05) from a two-tailed t test; (b) genes were consistently outside a two standard deviation (SD) range from control levels. A combination of these techniques identified 31 mRNA transcripts (approximately 3%) which were significantly altered in bleomycin treated tissue. Of these genes, 26 were down-regulated whilst only five were up-regulated. Two distinct clusters were identified, with 17 genes classified as encoding hormone receptors, and nine as encoding ion channels. Both these clusters were consistently down-regulated.The magnitude of the changes in gene expression were quantified and confirmed by Q-PCR (n = 6), validating the macroarray data and the bioinformatic analysis employed.In conclusion, this study has developed a suitable macroarray analysis procedure and provides the basis for a better understanding of the gene expression changes occurring during the early phase of drug-induced pulmonary oedema.« less

  19. Analysis of Ly49 gene transcripts in mature NK cells supports a role for the Pro1 element in gene activation, not gene expression.

    PubMed

    McCullen, M V; Li, H; Cam, M; Sen, S K; McVicar, D W; Anderson, S K

    2016-09-01

    The variegated expression of murine Ly49 loci has been associated with the probabilistic behavior of an upstream promoter active in immature cells, the Pro1 element. However, recent data suggest that Pro1 may be active in mature natural killer (NK) cells and function as an enhancer element. To assess directly if Pro1 transcripts are present in mature Ly49-expressing NK cells, RNA-sequencing of the total transcript pool was performed on freshly isolated splenic NK cells sorted for expression of either Ly49G or Ly49I. No Pro1 transcripts were detected from the Ly49a, Ly49c or Ly49i genes in mature Ly49(+) NK cells that contained high levels of Pro2 transcripts. Low levels of Ly49g Pro1 transcripts were found in both Ly49G(+) and Ly49G(-) populations, consistent with the presence of a small population of mature NK cells undergoing Ly49g gene activation, as previously demonstrated by culture of splenic NK cells in interleukin-2. Ly49 gene reporter constructs containing Pro1 failed to show any enhancer activity of Pro1 on Pro2 in a mature Ly49-expressing cell line. Taken together, the results are consistent with Pro1 transcription having a role in gene activation in developing NK, and argue against a role for Pro1 in Ly49 gene transcription by mature NK cells.

  20. Hi-C Chromatin Interaction Networks Predict Co-expression in the Mouse Cortex

    PubMed Central

    Hulsman, Marc; Lelieveldt, Boudewijn P. F.; de Ridder, Jeroen; Reinders, Marcel

    2015-01-01

    The three dimensional conformation of the genome in the cell nucleus influences important biological processes such as gene expression regulation. Recent studies have shown a strong correlation between chromatin interactions and gene co-expression. However, predicting gene co-expression from frequent long-range chromatin interactions remains challenging. We address this by characterizing the topology of the cortical chromatin interaction network using scale-aware topological measures. We demonstrate that based on these characterizations it is possible to accurately predict spatial co-expression between genes in the mouse cortex. Consistent with previous findings, we find that the chromatin interaction profile of a gene-pair is a good predictor of their spatial co-expression. However, the accuracy of the prediction can be substantially improved when chromatin interactions are described using scale-aware topological measures of the multi-resolution chromatin interaction network. We conclude that, for co-expression prediction, it is necessary to take into account different levels of chromatin interactions ranging from direct interaction between genes (i.e. small-scale) to chromatin compartment interactions (i.e. large-scale). PMID:25965262

  1. Regulation of human genome expression and RNA splicing by human papillomavirus 16 E2 protein.

    PubMed

    Gauson, Elaine J; Windle, Brad; Donaldson, Mary M; Caffarel, Maria M; Dornan, Edward S; Coleman, Nicholas; Herzyk, Pawel; Henderson, Scott C; Wang, Xu; Morgan, Iain M

    2014-11-01

    Human papillomavirus 16 (HPV16) is causative in human cancer. The E2 protein regulates transcription from and replication of the viral genome; the role of E2 in regulating the host genome has been less well studied. We have expressed HPV16 E2 (E2) stably in U2OS cells; these cells tolerate E2 expression well and gene expression analysis identified 74 genes showing differential expression specific to E2. Analysis of published gene expression data sets during cervical cancer progression identified 20 of the genes as being altered in a similar direction as the E2 specific genes. In addition, E2 altered the splicing of many genes implicated in cancer and cell motility. The E2 expressing cells showed no alteration in cell growth but were altered in cell motility, consistent with the E2 induced altered splicing predicted to affect this cellular function. The results present a model system for investigating E2 regulation of the host genome. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Aging and Gene Expression in the Primate Brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fraser, Hunter B.; Khaitovich, Philipp; Plotkin, Joshua B.

    2005-02-18

    It is well established that gene expression levels in many organisms change during the aging process, and the advent of DNA microarrays has allowed genome-wide patterns of transcriptional changes associated with aging to be studied in both model organisms and various human tissues. Understanding the effects of aging on gene expression in the human brain is of particular interest, because of its relation to both normal and pathological neurodegeneration. Here we show that human cerebral cortex, human cerebellum, and chimpanzee cortex each undergo different patterns of age-related gene expression alterations. In humans, many more genes undergo consistent expression changes inmore » the cortex than in the cerebellum; in chimpanzees, many genes change expression with age in cortex, but the pattern of changes in expression bears almost no resemblance to that of human cortex. These results demonstrate the diversity of aging patterns present within the human brain, as well as how rapidly genome-wide patterns of aging can evolve between species; they may also have implications for the oxidative free radical theory of aging, and help to improve our understanding of human neurodegenerative diseases.« less

  3. A comparative view of early development in the corals Favia lizardensis, Ctenactis echinata, and Acropora millepora - morphology, transcriptome, and developmental gene expression.

    PubMed

    Okubo, Nami; Hayward, David C; Forêt, Sylvain; Ball, Eldon E

    2016-02-29

    Research into various aspects of coral biology has greatly increased in recent years due to anthropogenic threats to coral health including pollution, ocean warming and acidification. However, knowledge of coral early development has lagged. The present paper describes the embryonic development of two previously uncharacterized robust corals, Favia lizardensis (a massive brain coral) and Ctenactis echinata (a solitary coral) and compares it to that of the previously characterized complex coral, Acropora millepora, both morphologically and in terms of the expression of a set of key developmental genes. Illumina sequencing of mixed age embryos was carried out, resulting in embryonic transcriptomes consisting of 40605 contigs for C.echinata (N50 = 1080 bp) and 48536 contigs for F.lizardensis (N50 = 1496 bp). The transcriptomes have been annotated against Swiss-Prot and were sufficiently complete to enable the identification of orthologs of many key genes controlling development in bilaterians. Developmental series of images of whole mounts and sections reveal that the early stages of both species contain a blastocoel, consistent with their membership of the robust clade. In situ hybridization was used to examine the expression of the developmentally important genes brachyury, chordin and forkhead. The expression of brachyury and forkhead was consistent with that previously reported for Acropora and allowed us to confirm that the pseudo-blastopore sometimes seen in robust corals such as Favia spp. is not directly associated with gastrulation. C.echinata chordin expression, however, differed from that seen in the other two corals. Embryonic transcriptomes were assembled for the brain coral Favia lizardensis and the solitary coral Ctenactis echinata. Both species have a blastocoel in their early developmental stages, consistent with their phylogenetic position as members of the robust clade. Expression of the key developmental genes brachyury, chordin and forkhead was investigated, allowing comparison to that of their orthologs in Acropora, Nematostella and bilaterians and demonstrating that even within the Anthozoa there are significant differences in expression patterns.

  4. Strong Magnetic Field Induced Changes of Gene Expression in Arabidopsis

    NASA Astrophysics Data System (ADS)

    Paul, A.-L.; Ferl, R. J.; Klingenberg, B.; Brooks, J. S.; Morgan, A. N.; Yowtak, J.; Meisel, M. W.

    2005-07-01

    We review our studies of the biological impact of magnetic field strengths of up to 30 T on transgenic arabidopsis plants engineered with a stress response gene consisting of the alcohol dehydrogenase (Adh) gene promoter driving the β-glucuronidase (GUS) gene reporter. Field strengths in excess of 15 T induce expression of the Adh/GUS transgene in the roots and leaves. Microarray analyses indicate that such field strengths have a far reaching effect on the genome. Wide spread induction of stress-related genes and transcription factors, and a depression of genes associated with cell wall metabolism are prominent examples.

  5. Adult mouse brain gene expression patterns bear an embryologic imprint

    PubMed Central

    Zapala, Matthew A.; Hovatta, Iiris; Ellison, Julie A.; Wodicka, Lisa; Del Rio, Jo A.; Tennant, Richard; Tynan, Wendy; Broide, Ron S.; Helton, Rob; Stoveken, Barbara S.; Winrow, Christopher; Lockhart, Daniel J.; Reilly, John F.; Young, Warren G.; Bloom, Floyd E.; Lockhart, David J.; Barlow, Carrolee

    2005-01-01

    The current model to explain the organization of the mammalian nervous system is based on studies of anatomy, embryology, and evolution. To further investigate the molecular organization of the adult mammalian brain, we have built a gene expression-based brain map. We measured gene expression patterns for 24 neural tissues covering the mouse central nervous system and found, surprisingly, that the adult brain bears a transcriptional “imprint” consistent with both embryological origins and classic evolutionary relationships. Embryonic cellular position along the anterior–posterior axis of the neural tube was shown to be closely associated with, and possibly a determinant of, the gene expression patterns in adult structures. We also observed a significant number of embryonic patterning and homeobox genes with region-specific expression in the adult nervous system. The relationships between global expression patterns for different anatomical regions and the nature of the observed region-specific genes suggest that the adult brain retains a degree of overall gene expression established during embryogenesis that is important for regional specificity and the functional relationships between regions in the adult. The complete collection of extensively annotated gene expression data along with data mining and visualization tools have been made available on a publicly accessible web site (www.barlow-lockhart-brainmapnimhgrant.org). PMID:16002470

  6. Analysis of lamprey clustered Fox genes: insight into Fox gene evolution and expression in vertebrates.

    PubMed

    Wotton, Karl R; Shimeld, Sebastian M

    2011-12-01

    In the human genome, members of the FoxC, FoxF, FoxL1, and FoxQ1 gene families are found in two paralagous clusters. One cluster contains the genes FOXQ1, FOXF2, FOXC1 and the second consists of FOXF1, FOXC2, and FOXL1. In jawed vertebrates these genes are known to be expressed in different pharyngeal tissues and all, except FoxQ1, are involved in patterning the early embryonic mesoderm. We have previously traced the evolution of this cluster in the bony vertebrates, and the gene content is identical in the dogfish, a member of the most basally branching lineage of the jawed vertebrates. Here we extend these analyses to jawless vertebrates. Using genomic searches and molecular approaches we have identified homologues of these genes from lampreys. We identify two FoxC genes, two FoxF genes, two FoxQ1 genes and single FoxL1 gene. We examine the embryonic expression of one predominantly mesodermally expressed gene family, FoxC, and the endodermally expressed member of the cluster, FoxQ1. We identified FoxQ1 transcripts in the pharyngeal endoderm, while the two FoxC genes are differentially expressed in the pharyngeal mesenchyme and ectoderm. Furthermore we identify conserved expression of lamprey FoxC genes in the paraxial and intermediate mesoderms. We interpret our results through a chordate-wide comparison of expression patterns and discuss gene content in the context of theories on the evolution of the vertebrate genome. 2011 Elsevier B.V. All rights reserved.

  7. Expression patterns of WRKY genes in di-haploid Populus simonii × P. nigra in response to salinity stress revealed by quantitative real-time PCR and RNA sequencing.

    PubMed

    Wang, Shengji; Wang, Jiying; Yao, Wenjing; Zhou, Boru; Li, Renhua; Jiang, Tingbo

    2014-10-01

    Spatio-temporal expression patterns of 13 out of 119 poplar WRKY genes indicated dynamic and tissue-specific roles of WRKY family proteins in salinity stress tolerance. To understand the expression patterns of poplar WRKY genes under salinity stress, 51 of the 119 WRKY genes were selected from di-haploid Populus simonii × P. nigra by quantitative real-time PCR (qRT-PCR). We used qRT-PCR to profile the expression of the top 13 genes under salinity stress across seven time points, and employed RNA-Seq platforms to cross-validate it. Results demonstrated that all the 13 WRKY genes were expressed in root, stem, and leaf tissues, but their expression levels and overall patterns varied notably in these tissues. Regarding overall gene expression in roots, the 13 genes were significantly highly expressed at all six time points after the treatment, reaching the plateau of expression at hour 9. In leaves, the 13 genes were similarly up-regulated from 3 to 12 h in response to NaCl treatment. In stems, however, expression levels of the 13 genes did not show significant changes after the NaCl treatment. Regarding individual gene expression across the time points and the three tissues, the 13 genes can be classified into three clusters: the lowly expressed Cluster 1 containing PthWRKY28, 45 and 105; intermediately expressed Clusters 2 including PthWRKY56, 88 and 116; and highly expressed Cluster 3 consisting of PthWRKY41, 44, 51, 61, 62, 75 and 106. In general, genes in Cluster 2 and 3 displayed a dynamic pattern of "induced amplification-recovering", suggesting that these WRKY genes and corresponding pathways may play a critical role in mediating salt response and tolerance in a dynamic and tissue-specific manner.

  8. Anterior-posterior regionalized gene expression in the Ciona notochord

    PubMed Central

    Veeman, Michael

    2014-01-01

    Background In the simple ascidian chordate Ciona the signaling pathways and gene regulatory networks giving rise to initial notochord induction are largely understood and the mechanisms of notochord morphogenesis are being systematically elucidated. The notochord has generally been thought of as a non-compartmentalized or regionalized organ that is not finely patterned at the level of gene expression. Quantitative imaging methods have recently shown, however, that notochord cell size, shape and behavior vary consistently along the anterior-posterior (AP) axis. Results Here we screen candidate genes by whole mount in situ hybridization for potential AP asymmetry. We identify 4 genes that show non-uniform expression in the notochord. Ezrin/radixin/moesin (ERM) is expressed more strongly in the secondary notochord lineage than the primary. CTGF is expressed stochastically in a subset of notochord cells. A novel calmodulin-like gene (BCamL) is expressed more strongly at both the anterior and posterior tips of the notochord. A TGF-β ortholog is expressed in a gradient from posterior to anterior. The asymmetries in ERM, BCamL and TGF-β expression are evident even before the notochord cells have intercalated into a single-file column. Conclusions We conclude that the Ciona notochord is not a homogeneous tissue but instead shows distinct patterns of regionalized gene expression. PMID:24288133

  9. Anterior-posterior regionalized gene expression in the Ciona notochord.

    PubMed

    Reeves, Wendy; Thayer, Rachel; Veeman, Michael

    2014-04-01

    In the simple ascidian chordate Ciona, the signaling pathways and gene regulatory networks giving rise to initial notochord induction are largely understood and the mechanisms of notochord morphogenesis are being systematically elucidated. The notochord has generally been thought of as a non-compartmentalized or regionalized organ that is not finely patterned at the level of gene expression. Quantitative imaging methods have recently shown, however, that notochord cell size, shape, and behavior vary consistently along the anterior-posterior (AP) axis. Here we screen candidate genes by whole mount in situ hybridization for potential AP asymmetry. We identify 4 genes that show non-uniform expression in the notochord. Ezrin/radixin/moesin (ERM) is expressed more strongly in the secondary notochord lineage than the primary. CTGF is expressed stochastically in a subset of notochord cells. A novel calmodulin-like gene (BCamL) is expressed more strongly at both the anterior and posterior tips of the notochord. A TGF-β ortholog is expressed in a gradient from posterior to anterior. The asymmetries in ERM, BCamL, and TGF-β expression are evident even before the notochord cells have intercalated into a single-file column. We conclude that the Ciona notochord is not a homogeneous tissue but instead shows distinct patterns of regionalized gene expression. Copyright © 2013 Wiley Periodicals, Inc.

  10. Analysis and interpretation of transcriptomic data obtained from extended Warburg effect genes in patients with clear cell renal cell carcinoma

    PubMed Central

    Sanders, Edward; Diehl, Svenja

    2015-01-01

    Background Many cancers adopt a metabolism that is characterized by the well-known Warburg effect (aerobic glycolysis). Recently, numerous attempts have been made to treat cancer by targeting one or more gene products involved in this pathway without notable success. This work outlines a transcriptomic approach to identify genes that are highly perturbed in clear cell renal cell carcinoma (CCRCC). Methods We developed a model of the extended Warburg effect and outlined the model using Cytoscape. Following this, gene expression fold changes (FCs) for tumor and adjacent normal tissue from patients with CCRCC (GSE6344) were mapped on to the network. Gene expression values with FCs of greater than two were considered as potential targets for treatment of CCRCC. Results The Cytoscape network includes glycolysis, gluconeogenesis, the pentose phosphate pathway (PPP), the TCA cycle, the serine/glycine pathway, and partial glutaminolysis and fatty acid synthesis pathways. Gene expression FCs for nine of the 10 CCRCC patients in the GSE6344 data set were consistent with a shift to aerobic glycolysis. Genes involved in glycolysis and the synthesis and transport of lactate were over-expressed, as was the gene that codes for the kinase that inhibits the conversion of pyruvate to acetyl-CoA. Interestingly, genes that code for unique proteins involved in gluconeogenesis were strongly under-expressed as was also the case for the serine/glycine pathway. These latter two results suggest that the role attributed to the M2 isoform of pyruvate kinase (PKM2), frequently the principal isoform of PK present in cancer: i.e. causing a buildup of glucose metabolites that are shunted into branch pathways for synthesis of key biomolecules, may not be operative in CCRCC. The fact that there was no increase in the expression FC of any gene in the PPP is consistent with this hypothesis. Literature protein data generally support the transcriptomic findings. Conclusions A number of key genes have been identified that could serve as valid targets for anti-cancer pharmaceutical agents. Genes that are highly over-expressed include ENO2, HK2, PFKP, SLC2A3, PDK1, and SLC16A1. Genes that are highly under-expressed include ALDOB, PKLR, PFKFB2, G6PC, PCK1, FBP1, PC, and SUCLG1. PMID:25859558

  11. Gene expression profiling of mucolipidosis type IV fibroblasts reveals deregulation of genes with relevant functions in lysosome physiology.

    PubMed

    Bozzato, Andrea; Barlati, Sergio; Borsani, Giuseppe

    2008-04-01

    Mucolipidosis type IV (MLIV, MIM 252650) is an autosomal recessive lysosomal storage disorder that causes mental and motor retardation as well as visual impairment. The lysosomal storage defect in MLIV is consistent with abnormalities of membrane traffic and organelle dynamics in the late endocytic pathway. MLIV is caused by mutations in the MCOLN1 gene, which codes for mucolipin-1 (MLN1), a member of the large family of transient receptor potential (TRP) cation channels. Although a number of studies have been performed on mucolipin-1, the pathological mechanisms underlying MLIV are not fully understood. To identify genes that characterize pathogenic changes in mucolipidosis type IV, we compared the expression profiles of three MLIV and three normal skin fibroblasts cell lines using oligonucleotide microarrays. Genes that were differentially expressed in patients' cells were identified. 231 genes were up-regulated, and 116 down-regulated. Real-Time RT-PCR performed on selected genes in six independent MLIV fibroblasts cell lines was generally consistent with the microarray findings. This study allowed to evidence the modulation at the transcriptional level of a discrete number of genes relevant in biological processes which are altered in the disease such as endosome/lysosome trafficking, lysosome biogenesis, organelle acidification and lipid metabolism.

  12. Genomic, cDNA and embryonic expression analysis of zebrafish IRF6, the gene mutated in the human oral clefting disorders Van der Woude and popliteal pterygium syndromes.

    PubMed

    Ben, Jin; Jabs, Ethylin Wang; Chong, Samuel S

    2005-06-01

    Van der Woude syndrome (VWS) and popliteal pterygium syndrome (PPS) are autosomal dominant clefting disorders recently discovered to be caused by mutations in the IRF6 (Interferon Regulatory Factor 6) gene. The IRF gene family consists of nine members encoding transcription factors that share a highly conserved helix-turn-helix DNA-binding domain and a less conserved protein-binding domain. Most IRFs regulate the expression of interferon-alpha and -beta after viral infection, but the function of IRF6 remains unknown. We have isolated a full-length zebrafish irf6 cDNA, which encodes a 492 amino acid protein that contains a Smad-IRF interaction motif and a DNA-binding domain. The zebrafish irf6 gene consists of eight exons and maps to linkage group 22 closest to marker unp1375. By in situ hybridization analysis of embryo whole-mounts and cryosections, we demonstrate that irf6 is first expressed as a maternal transcript. During gastrulation, irf6 expression was concentrated in the forerunner cells. From the bud stage to the 3-somite stage, irf6 expression was observed in the Kupffer's vesicle. No expression could be detected at the 6-somite and 10-somite stages. At the 14-somite stage, expression was detected in the otic placode. At the 17-somite stage, strong expression was also observed in the cloaca. During the pharyngula, hatch and larva periods up to 5 days post-fertilization, irf6 was expressed in the pharyngeal arches, olfactory and otic placodes, and in the epithelial cells of endoderm derived tissues. The latter tissues include the mouth, pharynx, esophagus, endodermal lining of swim bladder, liver, exocrine pancreas, and associated ducts. Overall, the zebrafish expression data are consistent with the observations of lip pits in VWS patients, as well as more recent reports of alae nasi, otitis media and sensorineural hearing loss documented in some patients.

  13. Gene expression profile of mouse prostate tumors reveals dysregulations in major biological processes and identifies potential murine targets for preclinical development of human prostate cancer therapy.

    PubMed

    Haram, Kerstyn M; Peltier, Heidi J; Lu, Bin; Bhasin, Manoj; Otu, Hasan H; Choy, Bob; Regan, Meredith; Libermann, Towia A; Latham, Gary J; Sanda, Martin G; Arredouani, Mohamed S

    2008-10-01

    Translation of preclinical studies into effective human cancer therapy is hampered by the lack of defined molecular expression patterns in mouse models that correspond to the human counterpart. We sought to generate an open source TRAMP mouse microarray dataset and to use this array to identify differentially expressed genes from human prostate cancer (PCa) that have concordant expression in TRAMP tumors, and thereby represent lead targets for preclinical therapy development. We performed microarrays on total RNA extracted and amplified from eight TRAMP tumors and nine normal prostates. A subset of differentially expressed genes was validated by QRT-PCR. Differentially expressed TRAMP genes were analyzed for concordant expression in publicly available human prostate array datasets and a subset of resulting genes was analyzed by QRT-PCR. Cross-referencing differentially expressed TRAMP genes to public human prostate array datasets revealed 66 genes with concordant expression in mouse and human PCa; 56 between metastases and normal and 10 between primary tumor and normal tissues. Of these 10 genes, two, Sox4 and Tubb2a, were validated by QRT-PCR. Our analysis also revealed various dysregulations in major biologic pathways in the TRAMP prostates. We report a TRAMP microarray dataset of which a gene subset was validated by QRT-PCR with expression patterns consistent with previous gene-specific TRAMP studies. Concordance analysis between TRAMP and human PCa associated genes supports the utility of the model and suggests several novel molecular targets for preclinical therapy.

  14. Reference genes for gene expression studies in wheat flag leaves grown under different farming conditions

    PubMed Central

    2011-01-01

    Background Internal control genes with highly uniform expression throughout the experimental conditions are required for accurate gene expression analysis as no universal reference genes exists. In this study, the expression stability of 24 candidate genes from Triticum aestivum cv. Cubus flag leaves grown under organic and conventional farming systems was evaluated in two locations in order to select suitable genes that can be used for normalization of real-time quantitative reverse-transcription PCR (RT-qPCR) reactions. The genes were selected among the most common used reference genes as well as genes encoding proteins involved in several metabolic pathways. Findings Individual genes displayed different expression rates across all samples assayed. Applying geNorm, a set of three potential reference genes were suitable for normalization of RT-qPCR reactions in winter wheat flag leaves cv. Cubus: TaFNRII (ferredoxin-NADP(H) oxidoreductase; AJ457980.1), ACT2 (actin 2; TC234027), and rrn26 (a putative homologue to RNA 26S gene; AL827977.1). In addition of these three genes that were also top-ranked by NormFinder, two extra genes: CYP18-2 (Cyclophilin A, AY456122.1) and TaWIN1 (14-3-3 like protein, AB042193) were most consistently stably expressed. Furthermore, we showed that TaFNRII, ACT2, and CYP18-2 are suitable for gene expression normalization in other two winter wheat varieties (Tommi and Centenaire) grown under three treatments (organic, conventional and no nitrogen) and a different environment than the one tested with cv. Cubus. Conclusions This study provides a new set of reference genes which should improve the accuracy of gene expression analyses when using wheat flag leaves as those related to the improvement of nitrogen use efficiency for cereal production. PMID:21951810

  15. Cellular reprogramming dynamics follow a simple 1D reaction coordinate

    NASA Astrophysics Data System (ADS)

    Teja Pusuluri, Sai; Lang, Alex H.; Mehta, Pankaj; Castillo, Horacio E.

    2018-01-01

    Cellular reprogramming, the conversion of one cell type to another, induces global changes in gene expression involving thousands of genes, and understanding how cells globally alter their gene expression profile during reprogramming is an ongoing problem. Here we reanalyze time-course data on cellular reprogramming from differentiated cell types to induced pluripotent stem cells (iPSCs) and show that gene expression dynamics during reprogramming follow a simple 1D reaction coordinate. This reaction coordinate is independent of both the time it takes to reach the iPSC state as well as the details of the experimental protocol used. Using Monte-Carlo simulations, we show that such a reaction coordinate emerges from epigenetic landscape models where cellular reprogramming is viewed as a ‘barrier-crossing’ process between cell fates. Overall, our analysis and model suggest that gene expression dynamics during reprogramming follow a canonical trajectory consistent with the idea of an ‘optimal path’ in gene expression space for reprogramming.

  16. Stability evaluation of reference genes for gene expression analysis by RT-qPCR in soybean under different conditions.

    PubMed

    Wan, Qiao; Chen, Shuilian; Shan, Zhihui; Yang, Zhonglu; Chen, Limiao; Zhang, Chanjuan; Yuan, Songli; Hao, Qinnan; Zhang, Xiaojuan; Qiu, Dezhen; Chen, Haifeng; Zhou, Xinan

    2017-01-01

    Real-time quantitative reverse transcription PCR is a sensitive and widely used technique to quantify gene expression. To achieve a reliable result, appropriate reference genes are highly required for normalization of transcripts in different samples. In this study, 9 previously published reference genes (60S, Fbox, ELF1A, ELF1B, ACT11, TUA5, UBC4, G6PD, CYP2) of soybean [Glycine max (L.) Merr.] were selected. The expression stability of the 9 genes was evaluated under conditions of biotic stress caused by infection with soybean mosaic virus, nitrogen stress, across different cultivars and developmental stages. ΔCt and geNorm algorithms were used to evaluate and rank the expression stability of the 9 reference genes. Results obtained from two algorithms showed high consistency. Moreover, results of pairwise variation showed that two reference genes were sufficient to normalize the expression levels of target genes under each experimental setting. For virus infection, ELF1A and ELF1B were the most stable reference genes for accurate normalization. For different developmental stages, Fbox and G6PD had the highest expression stability between two soybean cultivars (Tanlong No. 1 and Tanlong No. 2). ELF1B and ACT11 were identified as the most stably expressed reference genes both under nitrogen stress and among different cultivars. The results showed that none of the candidate reference genes were uniformly expressed at different conditions, and selecting appropriate reference genes was pivotal for gene expression studies with particular condition and tissue. The most stable combination of genes identified in this study will help to achieve more accurate and reliable results in a wide variety of samples in soybean.

  17. Differential Gene Expression for Investigation of Escherichia coli Biofilm Inhibition by Plant Extract Ursolic Acid

    PubMed Central

    Ren, Dacheng; Zuo, Rongjun; González Barrios, Andrés F.; Bedzyk, Laura A.; Eldridge, Gary R.; Pasmore, Mark E.; Wood, Thomas K.

    2005-01-01

    After 13,000 samples of compounds purified from plants were screened, a new biofilm inhibitor, ursolic acid, has been discovered and identified. Using both 96-well microtiter plates and a continuous flow chamber with COMSTAT analysis, 10 μg of ursolic acid/ml inhibited Escherichia coli biofilm formation 6- to 20-fold when added upon inoculation and when added to a 24-h biofilm; however, ursolic acid was not toxic to E. coli, Pseudomonas aeruginosa, Vibrio harveyi, and hepatocytes. Similarly, 10 μg of ursolic acid/ml inhibited biofilm formation by >87% for P. aeruginosa in both complex and minimal medium and by 57% for V. harveyi in minimal medium. To investigate the mechanism of this nontoxic inhibition on a global genetic basis, DNA microarrays were used to study the gene expression profiles of E. coli K-12 grown with or without ursolic acid. Ursolic acid at 10 and 30 μg/ml induced significantly (P < 0.05) 32 and 61 genes, respectively, and 19 genes were consistently induced. The consistently induced genes have functions for chemotaxis and mobility (cheA, tap, tar, and motAB), heat shock response (hslSTV and mopAB), and unknown functions (such as b1566 and yrfHI). There were 31 and 17 genes repressed by 10 and 30 μg of ursolic acid/ml, respectively, and 12 genes were consistently repressed that have functions in cysteine synthesis (cysK) and sulfur metabolism (cysD), as well as unknown functions (such as hdeAB and yhaDFG). Ursolic acid inhibited biofilms without interfering with quorum sensing, as shown with the V. harveyi AI-1 and AI-2 reporter systems. As predicted by the differential gene expression, deleting motAB counteracts ursolic acid inhibition (the paralyzed cells no longer become too motile). Based on the differential gene expression, it was also discovered that sulfur metabolism (through cysB) affects biofilm formation (in the absence of ursolic acid). PMID:16000817

  18. β-Carotene-9′,10′-Oxygenase Status Modulates the Impact of Dietary Tomato and Lycopene on Hepatic Nuclear Receptor–, Stress-, and Metabolism-Related Gene Expression in Mice123

    PubMed Central

    Tan, Hsueh-Li; Moran, Nancy E.; Cichon, Morgan J.; Riedl, Ken M.; Schwartz, Steven J.; Erdman, John W.; Pearl, Dennis K.; Thomas-Ahner, Jennifer M.; Clinton, Steven K.

    2014-01-01

    Tomato and lycopene (ψ, ψ-carotene) consumption is hypothesized to protect against nonalcoholic steatohepatitis and hepatocarcinogenesis, processes that may depend upon diet and gene interactions. To investigate the interaction of tomato or lycopene feeding with β-carotene-9′,10′-monooxygenase (Bco2) on hepatic metabolic and signaling pathways, male wild-type (WT) and Bco2−/− mice (3-wk-old; n = 36) were fed semi-purified control, 10% tomato powder–containing, or 0.25% lycopene beadlet–containing diets for 3 wk. Serum lycopene concentrations were higher in lycopene- and tomato-fed Bco2−/− mice compared with WT (P = 0.03). Tomato- and lycopene-fed mice had detectable hepatic apolipoprotein (apo)-6′-, apo-8′-, and apo-12′-lycopenal concentrations. Hepatic expression of β-carotene-15,15’-monooxygenase was increased in Bco2−/− mice compared with WT (P = 0.02), but not affected by diet. Evaluation of hepatic gene expression by focused quantitative reverse transcriptase-polymerase chain reaction arrays for nuclear receptors and coregulators (84 genes) and stress and metabolism (82 genes) genes indicates that tomato feeding affected 31 genes (≥1.5-fold, P < 0.05) and lycopene feeding affected 19 genes, 16 of which were affected by both diets. Lycopene down-regulation of 7 nuclear receptors and coregulators, estrogen-related receptor-α, histone deacetylase 3, nuclear receptor coactivator 4, RevErbA-β, glucocorticoid receptor, peroxisome proliferator-activated receptor (PPAR)-α, and PPAR-γ, coactivator 1 β was dependent upon interaction with Bco2 status. Lycopene and tomato feeding induced gene expression patterns consistent with decreased lipid uptake, decreased cell proliferation and mitosis, down-regulated aryl hydrocarbon receptor signaling, and decreased expression of genes involved in retinoid X receptor heterodimer activation. Tomato feeding also caused expression changes consistent with down-regulation of DNA synthesis and terpenoid metabolism. These data suggest tomato components, particularly lycopene, affect hepatic gene expression, potentially affecting hepatic responses to metabolic, infectious, or chemical stress. PMID:24553694

  19. A comprehensive comparison of RNA-Seq-based transcriptome analysis from reads to differential gene expression and cross-comparison with microarrays: a case study in Saccharomyces cerevisiae

    PubMed Central

    Nookaew, Intawat; Papini, Marta; Pornputtapong, Natapol; Scalcinati, Gionata; Fagerberg, Linn; Uhlén, Matthias; Nielsen, Jens

    2012-01-01

    RNA-seq, has recently become an attractive method of choice in the studies of transcriptomes, promising several advantages compared with microarrays. In this study, we sought to assess the contribution of the different analytical steps involved in the analysis of RNA-seq data generated with the Illumina platform, and to perform a cross-platform comparison based on the results obtained through Affymetrix microarray. As a case study for our work we, used the Saccharomyces cerevisiae strain CEN.PK 113-7D, grown under two different conditions (batch and chemostat). Here, we asses the influence of genetic variation on the estimation of gene expression level using three different aligners for read-mapping (Gsnap, Stampy and TopHat) on S288c genome, the capabilities of five different statistical methods to detect differential gene expression (baySeq, Cuffdiff, DESeq, edgeR and NOISeq) and we explored the consistency between RNA-seq analysis using reference genome and de novo assembly approach. High reproducibility among biological replicates (correlation ≥0.99) and high consistency between the two platforms for analysis of gene expression levels (correlation ≥0.91) are reported. The results from differential gene expression identification derived from the different statistical methods, as well as their integrated analysis results based on gene ontology annotation are in good agreement. Overall, our study provides a useful and comprehensive comparison between the two platforms (RNA-seq and microrrays) for gene expression analysis and addresses the contribution of the different steps involved in the analysis of RNA-seq data. PMID:22965124

  20. RT-PCR detection of Candida albicans ALS gene expression in the reconstituted human epithelium (RHE) model of oral candidiasis and in model biofilms.

    PubMed

    Green, Clayton B; Cheng, Georgina; Chandra, Jyotsna; Mukherjee, Pranab; Ghannoum, Mahmoud A; Hoyer, Lois L

    2004-02-01

    An RT-PCR assay was developed to analyse expression patterns of genes in the Candida albicans ALS (agglutinin-like sequence) family. Inoculation of a reconstituted human buccal epithelium (RHE) model of mucocutaneous candidiasis with strain SC5314 showed destruction of the epithelial layer by C. albicans and also formation of an upper fungal layer that had characteristics similar to a biofilm. RT-PCR analysis of total RNA samples extracted from C. albicans-inoculated buccal RHE showed that ALS1, ALS2, ALS3, ALS4, ALS5 and ALS9 were consistently detected over time as destruction of the RHE progressed. Detection of transcripts from ALS7, and particularly from ALS6, was more sporadic, but not associated with a strictly temporal pattern. The expression pattern of ALS genes in C. albicans cultures used to inoculate the RHE was similar to that observed in the RHE model, suggesting that contact of C. albicans with buccal RHE does little to alter ALS gene expression. RT-PCR analysis of RNA samples extracted from model denture and catheter biofilms showed similar gene expression patterns to the buccal RHE specimens. Results from the RT-PCR analysis of biofilm RNA specimens were consistent between various C. albicans strains during biofilm development and were comparable to gene expression patterns in planktonic cells. The RT-PCR assay described here will be useful for analysis of human clinical specimens and samples from other disease models. The method will provide further insight into the role of ALS genes and their encoded proteins in the diverse interactions between C. albicans and its host.

  1. Differential co-expression analysis reveals a novel prognostic gene module in ovarian cancer.

    PubMed

    Gov, Esra; Arga, Kazim Yalcin

    2017-07-10

    Ovarian cancer is one of the most significant disease among gynecological disorders that women suffered from over the centuries. However, disease-specific and effective biomarkers were still not available, since studies have focused on individual genes associated with ovarian cancer, ignoring the interactions and associations among the gene products. Here, ovarian cancer differential co-expression networks were reconstructed via meta-analysis of gene expression data and co-expressed gene modules were identified in epithelial cells from ovarian tumor and healthy ovarian surface epithelial samples to propose ovarian cancer associated genes and their interactions. We propose a novel, highly interconnected, differentially co-expressed, and co-regulated gene module in ovarian cancer consisting of 84 prognostic genes. Furthermore, the specificity of the module to ovarian cancer was shown through analyses of datasets in nine other cancers. These observations underscore the importance of transcriptome based systems biomarkers research in deciphering the elusive pathophysiology of ovarian cancer, and here, we present reciprocal interplay between candidate ovarian cancer genes and their transcriptional regulatory dynamics. The corresponding gene module might provide new insights on ovarian cancer prognosis and treatment strategies that continue to place a significant burden on global health.

  2. The Temporal Program of Peripheral Blood Gene Expression in the Response of Nonhuman Primates to Ebola Hemorrhagic Fever

    DTIC Science & Technology

    2007-08-28

    the family Filoviridae. The EBOV genus consists of four distinct species: Ivory Coast Ebola virus, Reston Ebola virus, Sudan Ebola virus, and Zaire...S, Liu CL, Belcher CE, Botstein D, Staudt LM, Brown PO, Relman DA: Stereotyped and specific gene expression programs in human innate immune responses

  3. Ogura-CMS in Chinese cabbage (Brassica rapa ssp. pekinensis) causes delayed expression of many nuclear genes.

    PubMed

    Dong, Xiangshu; Kim, Wan Kyu; Lim, Yong-Pyo; Kim, Yeon-Ki; Hur, Yoonkang

    2013-02-01

    We investigated the mechanism regulating cytoplasmic male sterility (CMS) in Brassica rapa ssp. pekinensis using floral bud transcriptome analyses of Ogura-CMS Chinese cabbage and its maintainer line in B. rapa 300-K oligomeric probe (Br300K) microarrays. Ogura-CMS Chinese cabbage produced few and infertile pollen grains on indehiscent anthers. Compared to the maintainer line, CMS plants had shorter filaments and plant growth, and delayed flowering and pollen development. In microarray analysis, 4646 genes showed different expression, depending on floral bud size, between Ogura-CMS and its maintainer line. We found 108 and 62 genes specifically expressed in Ogura-CMS and its maintainer line, respectively. Ogura-CMS line-specific genes included stress-related, redox-related, and B. rapa novel genes. In the maintainer line, genes related to pollen coat and germination were specifically expressed in floral buds longer than 3mm, suggesting insufficient expression of these genes in Ogura-CMS is directly related to dysfunctional pollen. In addition, many nuclear genes associated with auxin response, ATP synthesis, pollen development and stress response had delayed expression in Ogura-CMS plants compared to the maintainer line, which is consistent with the delay in growth and development of Ogura-CMS plants. Delayed expression may reduce pollen grain production and/or cause sterility, implying that mitochondrial, retrograde signaling delays nuclear gene expression. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  4. Analysis of the differential gene and protein expression profile of the rolled leaf mutant of transgenic rice (Oryza sativa L.).

    PubMed

    Zhu, Qiuqiang; Yu, Shuguang; Chen, Guanshui; Ke, Lanlan; Pan, Daren

    2017-01-01

    The importance of leaf rolling in rice (Oryza sativa L.) has been widely recognized. Although several studies have investigated rice leaf rolling and identified some related genes, knowledge of the molecular mechanism underlying rice leaf rolling, especially outward leaf rolling, is limited. Therefore, in this study, differential proteomics and gene expression profiling were used to analyze rolled leaf mutant of transgenic rice in order to investigate differentially expressed genes and proteins related to rice leaf rolling. To this end, 28 differentially expressed proteins related to rolling leaf traits were isolated and identified. Digital expression profiling detected 10 genes related to rice leaf rolling. Some of the proteins and genes detected are involved in lipid metabolism, which is related to the development of bulliform cells, such as phosphoinositide phospholipase C, Mgll gene, and At4g26790 gene. The "omics"-level techniques were useful for simultaneously isolating several proteins and genes related to rice leaf rolling. In addition, the results of the analysis of differentially expressed proteins and genes were closely consistent with those from a corresponding functional analysis of cellular mechanisms; our study findings might form the basis for further research on the molecular mechanisms underlying rice leaf rolling.

  5. Preferential Allele Expression Analysis Identifies Shared Germline and Somatic Driver Genes in Advanced Ovarian Cancer

    PubMed Central

    Halabi, Najeeb M.; Martinez, Alejandra; Al-Farsi, Halema; Mery, Eliane; Puydenus, Laurence; Pujol, Pascal; Khalak, Hanif G.; McLurcan, Cameron; Ferron, Gwenael; Querleu, Denis; Al-Azwani, Iman; Al-Dous, Eman; Mohamoud, Yasmin A.; Malek, Joel A.; Rafii, Arash

    2016-01-01

    Identifying genes where a variant allele is preferentially expressed in tumors could lead to a better understanding of cancer biology and optimization of targeted therapy. However, tumor sample heterogeneity complicates standard approaches for detecting preferential allele expression. We therefore developed a novel approach combining genome and transcriptome sequencing data from the same sample that corrects for sample heterogeneity and identifies significant preferentially expressed alleles. We applied this analysis to epithelial ovarian cancer samples consisting of matched primary ovary and peritoneum and lymph node metastasis. We find that preferentially expressed variant alleles include germline and somatic variants, are shared at a relatively high frequency between patients, and are in gene networks known to be involved in cancer processes. Analysis at a patient level identifies patient-specific preferentially expressed alleles in genes that are targets for known drugs. Analysis at a site level identifies patterns of site specific preferential allele expression with similar pathways being impacted in the primary and metastasis sites. We conclude that genes with preferentially expressed variant alleles can act as cancer drivers and that targeting those genes could lead to new therapeutic strategies. PMID:26735499

  6. CLIC, a tool for expanding biological pathways based on co-expression across thousands of datasets

    PubMed Central

    Li, Yang; Liu, Jun S.; Mootha, Vamsi K.

    2017-01-01

    In recent years, there has been a huge rise in the number of publicly available transcriptional profiling datasets. These massive compendia comprise billions of measurements and provide a special opportunity to predict the function of unstudied genes based on co-expression to well-studied pathways. Such analyses can be very challenging, however, since biological pathways are modular and may exhibit co-expression only in specific contexts. To overcome these challenges we introduce CLIC, CLustering by Inferred Co-expression. CLIC accepts as input a pathway consisting of two or more genes. It then uses a Bayesian partition model to simultaneously partition the input gene set into coherent co-expressed modules (CEMs), while assigning the posterior probability for each dataset in support of each CEM. CLIC then expands each CEM by scanning the transcriptome for additional co-expressed genes, quantified by an integrated log-likelihood ratio (LLR) score weighted for each dataset. As a byproduct, CLIC automatically learns the conditions (datasets) within which a CEM is operative. We implemented CLIC using a compendium of 1774 mouse microarray datasets (28628 microarrays) or 1887 human microarray datasets (45158 microarrays). CLIC analysis reveals that of 910 canonical biological pathways, 30% consist of strongly co-expressed gene modules for which new members are predicted. For example, CLIC predicts a functional connection between protein C7orf55 (FMC1) and the mitochondrial ATP synthase complex that we have experimentally validated. CLIC is freely available at www.gene-clic.org. We anticipate that CLIC will be valuable both for revealing new components of biological pathways as well as the conditions in which they are active. PMID:28719601

  7. Combined expressional analysis, bioinformatics and targeted proteomics identify new potential therapeutic targets in glioblastoma stem cells.

    PubMed

    Stangeland, Biljana; Mughal, Awais A; Grieg, Zanina; Sandberg, Cecilie Jonsgar; Joel, Mrinal; Nygård, Ståle; Meling, Torstein; Murrell, Wayne; Vik Mo, Einar O; Langmoen, Iver A

    2015-09-22

    Glioblastoma (GBM) is both the most common and the most lethal primary brain tumor. It is thought that GBM stem cells (GSCs) are critically important in resistance to therapy. Therefore, there is a strong rationale to target these cells in order to develop new molecular therapies.To identify molecular targets in GSCs, we compared gene expression in GSCs to that in neural stem cells (NSCs) from the adult human brain, using microarrays. Bioinformatic filtering identified 20 genes (PBK/TOPK, CENPA, KIF15, DEPDC1, CDC6, DLG7/DLGAP5/HURP, KIF18A, EZH2, HMMR/RHAMM/CD168, NOL4, MPP6, MDM1, RAPGEF4, RHBDD1, FNDC3B, FILIP1L, MCC, ATXN7L4/ATXN7L1, P2RY5/LPAR6 and FAM118A) that were consistently expressed in GSC cultures and consistently not expressed in NSC cultures. The expression of these genes was confirmed in clinical samples (TCGA and REMBRANDT). The first nine genes were highly co-expressed in all GBM subtypes and were part of the same protein-protein interaction network. Furthermore, their combined up-regulation correlated negatively with patient survival in the mesenchymal GBM subtype. Using targeted proteomics and the COGNOSCENTE database we linked these genes to GBM signalling pathways.Nine genes: PBK, CENPA, KIF15, DEPDC1, CDC6, DLG7, KIF18A, EZH2 and HMMR should be further explored as targets for treatment of GBM.

  8. Retinal expression of Wnt-pathway mediated genes in low-density lipoprotein receptor-related protein 5 (Lrp5) knockout mice.

    PubMed

    Chen, Jing; Stahl, Andreas; Krah, Nathan M; Seaward, Molly R; Joyal, Jean-Sebastian; Juan, Aimee M; Hatton, Colman J; Aderman, Christopher M; Dennison, Roberta J; Willett, Keirnan L; Sapieha, Przemyslaw; Smith, Lois E H

    2012-01-01

    Mutations in low-density lipoprotein receptor-related protein 5 (Lrp5) impair retinal angiogenesis in patients with familial exudative vitreoretinopathy (FEVR), a rare type of blinding vascular eye disease. The defective retinal vasculature phenotype in human FEVR patients is recapitulated in Lrp5 knockout (Lrp5(-/-)) mouse with delayed and incomplete development of retinal vessels. In this study we examined gene expression changes in the developing Lrp5(-/-) mouse retina to gain insight into the molecular mechanisms that underlie the pathology of FEVR in humans. Gene expression levels were assessed with an Illumina microarray on total RNA from Lrp5(-/-) and WT retinas isolated on postnatal day (P) 8. Regulated genes were confirmed using RT-qPCR analysis. Consistent with a role in vascular development, we identified expression changes in genes involved in cell-cell adhesion, blood vessel morphogenesis and membrane transport in Lrp5(-/-) retina compared to WT retina. In particular, tight junction protein claudin5 and amino acid transporter slc38a5 are both highly down-regulated in Lrp5(-/-) retina. Similarly, several Wnt ligands including Wnt7b show decreased expression levels. Plasmalemma vesicle associated protein (plvap), an endothelial permeability marker, in contrast, is up-regulated consistent with increased permeability in Lrp5(-/-) retinas. Together these data suggest that Lrp5 regulates multiple groups of genes that influence retinal angiogenesis and may contribute to the pathogenesis of FEVR.

  9. Noise in gene expression is coupled to growth rate.

    PubMed

    Keren, Leeat; van Dijk, David; Weingarten-Gabbay, Shira; Davidi, Dan; Jona, Ghil; Weinberger, Adina; Milo, Ron; Segal, Eran

    2015-12-01

    Genetically identical cells exposed to the same environment display variability in gene expression (noise), with important consequences for the fidelity of cellular regulation and biological function. Although population average gene expression is tightly coupled to growth rate, the effects of changes in environmental conditions on expression variability are not known. Here, we measure the single-cell expression distributions of approximately 900 Saccharomyces cerevisiae promoters across four environmental conditions using flow cytometry, and find that gene expression noise is tightly coupled to the environment and is generally higher at lower growth rates. Nutrient-poor conditions, which support lower growth rates, display elevated levels of noise for most promoters, regardless of their specific expression values. We present a simple model of noise in expression that results from having an asynchronous population, with cells at different cell-cycle stages, and with different partitioning of the cells between the stages at different growth rates. This model predicts non-monotonic global changes in noise at different growth rates as well as overall higher variability in expression for cell-cycle-regulated genes in all conditions. The consistency between this model and our data, as well as with noise measurements of cells growing in a chemostat at well-defined growth rates, suggests that cell-cycle heterogeneity is a major contributor to gene expression noise. Finally, we identify gene and promoter features that play a role in gene expression noise across conditions. Our results show the existence of growth-related global changes in gene expression noise and suggest their potential phenotypic implications. © 2015 Keren et al.; Published by Cold Spring Harbor Laboratory Press.

  10. Noise in gene expression is coupled to growth rate

    PubMed Central

    Keren, Leeat; van Dijk, David; Weingarten-Gabbay, Shira; Davidi, Dan; Jona, Ghil; Weinberger, Adina; Milo, Ron; Segal, Eran

    2015-01-01

    Genetically identical cells exposed to the same environment display variability in gene expression (noise), with important consequences for the fidelity of cellular regulation and biological function. Although population average gene expression is tightly coupled to growth rate, the effects of changes in environmental conditions on expression variability are not known. Here, we measure the single-cell expression distributions of approximately 900 Saccharomyces cerevisiae promoters across four environmental conditions using flow cytometry, and find that gene expression noise is tightly coupled to the environment and is generally higher at lower growth rates. Nutrient-poor conditions, which support lower growth rates, display elevated levels of noise for most promoters, regardless of their specific expression values. We present a simple model of noise in expression that results from having an asynchronous population, with cells at different cell-cycle stages, and with different partitioning of the cells between the stages at different growth rates. This model predicts non-monotonic global changes in noise at different growth rates as well as overall higher variability in expression for cell-cycle–regulated genes in all conditions. The consistency between this model and our data, as well as with noise measurements of cells growing in a chemostat at well-defined growth rates, suggests that cell-cycle heterogeneity is a major contributor to gene expression noise. Finally, we identify gene and promoter features that play a role in gene expression noise across conditions. Our results show the existence of growth-related global changes in gene expression noise and suggest their potential phenotypic implications. PMID:26355006

  11. Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

    PubMed

    Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm

    2015-05-01

    Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

  12. dictyExpress: a Dictyostelium discoideum gene expression database with an explorative data analysis web-based interface.

    PubMed

    Rot, Gregor; Parikh, Anup; Curk, Tomaz; Kuspa, Adam; Shaulsky, Gad; Zupan, Blaz

    2009-08-25

    Bioinformatics often leverages on recent advancements in computer science to support biologists in their scientific discovery process. Such efforts include the development of easy-to-use web interfaces to biomedical databases. Recent advancements in interactive web technologies require us to rethink the standard submit-and-wait paradigm, and craft bioinformatics web applications that share analytical and interactive power with their desktop relatives, while retaining simplicity and availability. We have developed dictyExpress, a web application that features a graphical, highly interactive explorative interface to our database that consists of more than 1000 Dictyostelium discoideum gene expression experiments. In dictyExpress, the user can select experiments and genes, perform gene clustering, view gene expression profiles across time, view gene co-expression networks, perform analyses of Gene Ontology term enrichment, and simultaneously display expression profiles for a selected gene in various experiments. Most importantly, these tasks are achieved through web applications whose components are seamlessly interlinked and immediately respond to events triggered by the user, thus providing a powerful explorative data analysis environment. dictyExpress is a precursor for a new generation of web-based bioinformatics applications with simple but powerful interactive interfaces that resemble that of the modern desktop. While dictyExpress serves mainly the Dictyostelium research community, it is relatively easy to adapt it to other datasets. We propose that the design ideas behind dictyExpress will influence the development of similar applications for other model organisms.

  13. dictyExpress: a Dictyostelium discoideum gene expression database with an explorative data analysis web-based interface

    PubMed Central

    Rot, Gregor; Parikh, Anup; Curk, Tomaz; Kuspa, Adam; Shaulsky, Gad; Zupan, Blaz

    2009-01-01

    Background Bioinformatics often leverages on recent advancements in computer science to support biologists in their scientific discovery process. Such efforts include the development of easy-to-use web interfaces to biomedical databases. Recent advancements in interactive web technologies require us to rethink the standard submit-and-wait paradigm, and craft bioinformatics web applications that share analytical and interactive power with their desktop relatives, while retaining simplicity and availability. Results We have developed dictyExpress, a web application that features a graphical, highly interactive explorative interface to our database that consists of more than 1000 Dictyostelium discoideum gene expression experiments. In dictyExpress, the user can select experiments and genes, perform gene clustering, view gene expression profiles across time, view gene co-expression networks, perform analyses of Gene Ontology term enrichment, and simultaneously display expression profiles for a selected gene in various experiments. Most importantly, these tasks are achieved through web applications whose components are seamlessly interlinked and immediately respond to events triggered by the user, thus providing a powerful explorative data analysis environment. Conclusion dictyExpress is a precursor for a new generation of web-based bioinformatics applications with simple but powerful interactive interfaces that resemble that of the modern desktop. While dictyExpress serves mainly the Dictyostelium research community, it is relatively easy to adapt it to other datasets. We propose that the design ideas behind dictyExpress will influence the development of similar applications for other model organisms. PMID:19706156

  14. Comparative molecular analyses of select pH- and osmoregulatory genes in three freshwater crayfish Cherax quadricarinatus, C. destructor and C. cainii

    PubMed Central

    Pavasovic, Ana; Dammannagoda, Lalith K.; Mather, Peter B.; Prentis, Peter J.

    2017-01-01

    Systemic acid-base balance and osmotic/ionic regulation in decapod crustaceans are in part maintained by a set of transport-related enzymes such as carbonic anhydrase (CA), Na+/K+-ATPase (NKA), H+-ATPase (HAT), Na+/K+/2Cl− cotransporter (NKCC), Na+/Cl−/HCO\\documentclass[12pt]{minimal} \\usepackage{amsmath} \\usepackage{wasysym} \\usepackage{amsfonts} \\usepackage{amssymb} \\usepackage{amsbsy} \\usepackage{upgreek} \\usepackage{mathrsfs} \\setlength{\\oddsidemargin}{-69pt} \\begin{document} }{}${}_{3}^{-}$\\end{document}3− cotransporter (NBC), Na+/H+ exchanger (NHE), Arginine kinase (AK), Sarcoplasmic Ca+2-ATPase (SERCA) and Calreticulin (CRT). We carried out a comparative molecular analysis of these genes in three commercially important yet eco-physiologically distinct freshwater crayfish, Cherax quadricarinatus, C. destructor and C. cainii, with the aim to identify mutations in these genes and determine if observed patterns of mutations were consistent with the action of natural selection. We also conducted a tissue-specific expression analysis of these genes across seven different organs, including gills, hepatopancreas, heart, kidney, liver, nerve and testes using NGS transcriptome data. The molecular analysis of the candidate genes revealed a high level of sequence conservation across the three Cherax sp. Hyphy analysis revealed that all candidate genes showed patterns of molecular variation consistent with neutral evolution. The tissue-specific expression analysis showed that 46% of candidate genes were expressed in all tissue types examined, while approximately 10% of candidate genes were only expressed in a single tissue type. The largest number of genes was observed in nerve (84%) and gills (78%) and the lowest in testes (66%). The tissue-specific expression analysis also revealed that most of the master genes regulating pH and osmoregulation (CA, NKA, HAT, NKCC, NBC, NHE) were expressed in all tissue types indicating an important physiological role for these genes outside of osmoregulation in other tissue types. The high level of sequence conservation observed in the candidate genes may be explained by the important role of these genes as well as potentially having a number of other basic physiological functions in different tissue types. PMID:28852583

  15. Thermal reactionomes reveal divergent responses to thermal extremes in warm and cool-climate ant species.

    PubMed

    Stanton-Geddes, John; Nguyen, Andrew; Chick, Lacy; Vincent, James; Vangala, Mahesh; Dunn, Robert R; Ellison, Aaron M; Sanders, Nathan J; Gotelli, Nicholas J; Cahan, Sara Helms

    2016-03-02

    The distributions of species and their responses to climate change are in part determined by their thermal tolerances. However, little is known about how thermal tolerance evolves. To test whether evolutionary extension of thermal limits is accomplished through enhanced cellular stress response (enhanced response), constitutively elevated expression of protective genes (genetic assimilation) or a shift from damage resistance to passive mechanisms of thermal stability (tolerance), we conducted an analysis of the reactionome: the reaction norm for all genes in an organism's transcriptome measured across an experimental gradient. We characterized thermal reactionomes of two common ant species in the eastern U.S, the northern cool-climate Aphaenogaster picea and the southern warm-climate Aphaenogaster carolinensis, across 12 temperatures that spanned their entire thermal breadth. We found that at least 2 % of all genes changed expression with temperature. The majority of upregulation was specific to exposure to low temperatures. The cool-adapted A. picea induced expression of more genes in response to extreme temperatures than did A. carolinensis, consistent with the enhanced response hypothesis. In contrast, under high temperatures the warm-adapted A. carolinensis downregulated many of the genes upregulated in A. picea, and required more extreme temperatures to induce down-regulation in gene expression, consistent with the tolerance hypothesis. We found no evidence for a trade-off between constitutive and inducible gene expression as predicted by the genetic assimilation hypothesis. These results suggest that increases in upper thermal limits may require an evolutionary shift in response mechanism away from damage repair toward tolerance and prevention.

  16. Differential expression of three galaxin-related genes during settlement and metamorphosis in the scleractinian coral Acropora millepora

    PubMed Central

    Reyes-Bermudez, Alejandro; Lin, Zhiyi; Hayward, David C; Miller, David J; Ball, Eldon E

    2009-01-01

    Background The coral skeleton consists of CaCO3 deposited upon an organic matrix primarily as aragonite. Currently galaxin, from Galaxea fascicularis, is the only soluble protein component of the organic matrix that has been characterized from a coral. Three genes related to galaxin were identified in the coral Acropora millepora. Results One of the Acropora genes (Amgalaxin) encodes a clear galaxin ortholog, while the others (Amgalaxin-like 1 and Amgalaxin-like 2) encode larger and more divergent proteins. All three proteins are predicted to be extracellular and share common structural features, most notably the presence of repetitive motifs containing dicysteine residues. In situ hybridization reveals distinct, but partially overlapping, spatial expression of the genes in patterns consistent with distinct roles in calcification. Both of the Amgalaxin-like genes are expressed exclusively in the early stages of calcification, while Amgalaxin continues to be expressed in the adult, consistent with the situation in the coral Galaxea. Conclusion Comparisons with molluscs suggest functional convergence in the two groups; lustrin A/pearlin proteins may be the mollusc counterparts of galaxin, whereas the galaxin-like proteins combine characteristics of two distinct proteins involved in mollusc calcification. Database searches indicate that, although sequences with high similarity to the galaxins are restricted to the Scleractinia, more divergent members of this protein family are present in other cnidarians and some other metazoans. We suggest that ancestral galaxins may have been secondarily recruited to roles in calcification in the Triassic, when the Scleractinia first appeared. Understanding the evolution of the broader galaxin family will require wider sampling and expression analysis in a range of cnidarians and other animals. PMID:19638240

  17. Differentially expressed genes in the silk gland of silkworm (Bombyx mori) treated with TiO2 NPs.

    PubMed

    Xue, Bin; Li, Fanchi; Hu, Jingsheng; Tian, Jianghai; Li, Jinxin; Cheng, Xiaoyu; Hu, Jiahuan; Li, Bing

    2017-05-05

    Silk gland is a silkworm organ where silk proteins are synthesized and secreted. Dietary supplement of TiO 2 nanoparticles (NPs) promotes silk protein synthesis in silkworms. In this study, digital gene expression (DGE) tag was used to analyze the gene expression profile of the posterior silk gland of silkworms that were fed with TiO 2 NPs. In total, 5,702,823 and 6,150,719 clean tags, 55,096 and 74,715 distinct tags were detected in TiO 2 NPs treated and control groups, respectively. Compared with the control, TiO 2 NPs treated silkworms showed 306 differentially expressed genes, including 137 upregulated genes and 169 downregulated genes. Of these differentially expressed genes, 106 genes were related to silk protein synthesis, among which 97 genes were upregulated and 9 genes were downregulated. Pathway mapping using the Kyoto Encyclopedia of Genes and Genomes (KEGG) showed that 20 pathways were significantly enriched in TiO 2 NPs treated silkworms, and the metabolic pathway-related genes were the most significantly enriched. The DGE results were verified by qRT-PCR analysis of eight differentially expressed genes. The DGE and qRT-PCR results were consistent for all three upregulated genes and three of the five downregulated genes, but the expression trends of the remaining two genes were different between qRT-PCR and DGE analysis. This study enhances our understanding of the mechanism of TiO 2 NPs promoted silk protein synthesis. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Profiling differential gene expression of corals along a transect of waters adjacent to the Bermuda municipal dump.

    PubMed

    Morgan, Michael B; Edge, Sara E; Snell, Terry W

    2005-01-01

    A coral cDNA array containing 32 genes was used to examine the gene expression profiles of coral populations located at four sites that varied with distance from a semi-submerged municipal dump in Castle Harbour, Bermuda (previously identified as a point source of anthropogenic stressors). Genes on the array represent transcripts induced under controlled laboratory conditions to a variety of stressors both natural (temperature, sediment, salinity, darkness) and xenobiotic (heavy metals, pesticides, PAH) in origin. The gene expression profiles produced revealed information about the types of stressors. Consistent with other studies undertaken in Castle Harbour, the coral cDNA array detected responses to heavy metals, sedimentation, as well as oxidative stress.

  19. Digital gene expression analysis of gene expression differences within Brassica diploids and allopolyploids.

    PubMed

    Jiang, Jinjin; Wang, Yue; Zhu, Bao; Fang, Tingting; Fang, Yujie; Wang, Youping

    2015-01-27

    Brassica includes many successfully cultivated crop species of polyploid origin, either by ancestral genome triplication or by hybridization between two diploid progenitors, displaying complex repetitive sequences and transposons. The U's triangle, which consists of three diploids and three amphidiploids, is optimal for the analysis of complicated genomes after polyploidization. Next-generation sequencing enables the transcriptome profiling of polyploids on a global scale. We examined the gene expression patterns of three diploids (Brassica rapa, B. nigra, and B. oleracea) and three amphidiploids (B. napus, B. juncea, and B. carinata) via digital gene expression analysis. In total, the libraries generated between 5.7 and 6.1 million raw reads, and the clean tags of each library were mapped to 18547-21995 genes of B. rapa genome. The unambiguous tag-mapped genes in the libraries were compared. Moreover, the majority of differentially expressed genes (DEGs) were explored among diploids as well as between diploids and amphidiploids. Gene ontological analysis was performed to functionally categorize these DEGs into different classes. The Kyoto Encyclopedia of Genes and Genomes analysis was performed to assign these DEGs into approximately 120 pathways, among which the metabolic pathway, biosynthesis of secondary metabolites, and peroxisomal pathway were enriched. The non-additive genes in Brassica amphidiploids were analyzed, and the results indicated that orthologous genes in polyploids are frequently expressed in a non-additive pattern. Methyltransferase genes showed differential expression pattern in Brassica species. Our results provided an understanding of the transcriptome complexity of natural Brassica species. The gene expression changes in diploids and allopolyploids may help elucidate the morphological and physiological differences among Brassica species.

  20. Global gene expression profiling of brown to white adipose tissue transformation in sheep reveals novel transcriptional components linked to adipose remodeling.

    PubMed

    Basse, Astrid L; Dixen, Karen; Yadav, Rachita; Tygesen, Malin P; Qvortrup, Klaus; Kristiansen, Karsten; Quistorff, Bjørn; Gupta, Ramneek; Wang, Jun; Hansen, Jacob B

    2015-03-19

    Large mammals are capable of thermoregulation shortly after birth due to the presence of brown adipose tissue (BAT). The majority of BAT disappears after birth and is replaced by white adipose tissue (WAT). We analyzed the postnatal transformation of adipose in sheep with a time course study of the perirenal adipose depot. We observed changes in tissue morphology, gene expression and metabolism within the first two weeks of postnatal life consistent with the expected transition from BAT to WAT. The transformation was characterized by massively decreased mitochondrial abundance and down-regulation of gene expression related to mitochondrial function and oxidative phosphorylation. Global gene expression profiling demonstrated that the time points grouped into three phases: a brown adipose phase, a transition phase and a white adipose phase. Between the brown adipose and the transition phase 170 genes were differentially expressed, and 717 genes were differentially expressed between the transition and the white adipose phase. Thirty-eight genes were shared among the two sets of differentially expressed genes. We identified a number of regulated transcription factors, including NR1H3, MYC, KLF4, ESR1, RELA and BCL6, which were linked to the overall changes in gene expression during the adipose tissue remodeling. Finally, the perirenal adipose tissue expressed both brown and brite/beige adipocyte marker genes at birth, the expression of which changed substantially over time. Using global gene expression profiling of the postnatal BAT to WAT transformation in sheep, we provide novel insight into adipose tissue plasticity in a large mammal, including identification of novel transcriptional components linked to adipose tissue remodeling. Moreover, our data set provides a useful resource for further studies in adipose tissue plasticity.

  1. Multi-membership gene regulation in pathway based microarray analysis

    PubMed Central

    2011-01-01

    Background Gene expression analysis has been intensively researched for more than a decade. Recently, there has been elevated interest in the integration of microarray data analysis with other types of biological knowledge in a holistic analytical approach. We propose a methodology that can be facilitated for pathway based microarray data analysis, based on the observation that a substantial proportion of genes present in biochemical pathway databases are members of a number of distinct pathways. Our methodology aims towards establishing the state of individual pathways, by identifying those truly affected by the experimental conditions based on the behaviour of such genes. For that purpose it considers all the pathways in which a gene participates and the general census of gene expression per pathway. Results We utilise hill climbing, simulated annealing and a genetic algorithm to analyse the consistency of the produced results, through the application of fuzzy adjusted rand indexes and hamming distance. All algorithms produce highly consistent genes to pathways allocations, revealing the contribution of genes to pathway functionality, in agreement with current pathway state visualisation techniques, with the simulated annealing search proving slightly superior in terms of efficiency. Conclusions We show that the expression values of genes, which are members of a number of biochemical pathways or modules, are the net effect of the contribution of each gene to these biochemical processes. We show that by manipulating the pathway and module contribution of such genes to follow underlying trends we can interpret microarray results centred on the behaviour of these genes. PMID:21939531

  2. Multi-membership gene regulation in pathway based microarray analysis.

    PubMed

    Pavlidis, Stelios P; Payne, Annette M; Swift, Stephen M

    2011-09-22

    Gene expression analysis has been intensively researched for more than a decade. Recently, there has been elevated interest in the integration of microarray data analysis with other types of biological knowledge in a holistic analytical approach. We propose a methodology that can be facilitated for pathway based microarray data analysis, based on the observation that a substantial proportion of genes present in biochemical pathway databases are members of a number of distinct pathways. Our methodology aims towards establishing the state of individual pathways, by identifying those truly affected by the experimental conditions based on the behaviour of such genes. For that purpose it considers all the pathways in which a gene participates and the general census of gene expression per pathway. We utilise hill climbing, simulated annealing and a genetic algorithm to analyse the consistency of the produced results, through the application of fuzzy adjusted rand indexes and hamming distance. All algorithms produce highly consistent genes to pathways allocations, revealing the contribution of genes to pathway functionality, in agreement with current pathway state visualisation techniques, with the simulated annealing search proving slightly superior in terms of efficiency. We show that the expression values of genes, which are members of a number of biochemical pathways or modules, are the net effect of the contribution of each gene to these biochemical processes. We show that by manipulating the pathway and module contribution of such genes to follow underlying trends we can interpret microarray results centred on the behaviour of these genes.

  3. Differential replication dynamics for large and small Vibrio chromosomes affect gene dosage, expression and location

    PubMed Central

    Dryselius, Rikard; Izutsu, Kaori; Honda, Takeshi; Iida, Tetsuya

    2008-01-01

    Background Replication of bacterial chromosomes increases copy numbers of genes located near origins of replication relative to genes located near termini. Such differential gene dosage depends on replication rate, doubling time and chromosome size. Although little explored, differential gene dosage may influence both gene expression and location. For vibrios, a diverse family of fast growing gammaproteobacteria, gene dosage may be particularly important as they harbor two chromosomes of different size. Results Here we examined replication dynamics and gene dosage effects for the separate chromosomes of three Vibrio species. We also investigated locations for specific gene types within the genome. The results showed consistently larger gene dosage differences for the large chromosome which also initiated replication long before the small. Accordingly, large chromosome gene expression levels were generally higher and showed an influence from gene dosage. This was reflected by a higher abundance of growth essential and growth contributing genes of which many locate near the origin of replication. In contrast, small chromosome gene expression levels were low and appeared independent of gene dosage. Also, species specific genes are highly abundant and an over-representation of genes involved in transcription could explain its gene dosage independent expression. Conclusion Here we establish a link between replication dynamics and differential gene dosage on one hand and gene expression levels and the location of specific gene types on the other. For vibrios, this relationship appears connected to a polarisation of genetic content between its chromosomes, which may both contribute to and be enhanced by an improved adaptive capacity. PMID:19032792

  4. Automated Discovery of Functional Generality of Human Gene Expression Programs

    PubMed Central

    Gerber, Georg K; Dowell, Robin D; Jaakkola, Tommi S; Gifford, David K

    2007-01-01

    An important research problem in computational biology is the identification of expression programs, sets of co-expressed genes orchestrating normal or pathological processes, and the characterization of the functional breadth of these programs. The use of human expression data compendia for discovery of such programs presents several challenges including cellular inhomogeneity within samples, genetic and environmental variation across samples, uncertainty in the numbers of programs and sample populations, and temporal behavior. We developed GeneProgram, a new unsupervised computational framework based on Hierarchical Dirichlet Processes that addresses each of the above challenges. GeneProgram uses expression data to simultaneously organize tissues into groups and genes into overlapping programs with consistent temporal behavior, to produce maps of expression programs, which are sorted by generality scores that exploit the automatically learned groupings. Using synthetic and real gene expression data, we showed that GeneProgram outperformed several popular expression analysis methods. We applied GeneProgram to a compendium of 62 short time-series gene expression datasets exploring the responses of human cells to infectious agents and immune-modulating molecules. GeneProgram produced a map of 104 expression programs, a substantial number of which were significantly enriched for genes involved in key signaling pathways and/or bound by NF-κB transcription factors in genome-wide experiments. Further, GeneProgram discovered expression programs that appear to implicate surprising signaling pathways or receptor types in the response to infection, including Wnt signaling and neurotransmitter receptors. We believe the discovered map of expression programs involved in the response to infection will be useful for guiding future biological experiments; genes from programs with low generality scores might serve as new drug targets that exhibit minimal “cross-talk,” and genes from high generality programs may maintain common physiological responses that go awry in disease states. Further, our method is multipurpose, and can be applied readily to novel compendia of biological data. PMID:17696603

  5. Silk gene expression of theridiid spiders: implications for male-specific silk use.

    PubMed

    Correa-Garhwal, Sandra M; Chaw, R Crystal; Clarke, Thomas H; Ayoub, Nadia A; Hayashi, Cheryl Y

    2017-06-01

    Spiders (order Araneae) rely on their silks for essential tasks, such as dispersal, prey capture, and reproduction. Spider silks are largely composed of spidroins, members of a protein family that are synthesized in silk glands. As needed, silk stored in silk glands is extruded through spigots on the spinnerets. Nearly all studies of spider silks have been conducted on females; thus, little is known about male silk biology. To shed light on silk use by males, we compared silk gene expression profiles of mature males to those of females from three cob-web weaving species (Theridiidae). We de novo assembled species-specific male transcriptomes from Latrodectus hesperus, Latrodectus geometricus, and Steatoda grossa followed by differential gene expression analyses. Consistent with their complement of silk spigots, male theridiid spiders express appreciable amounts of aciniform, major ampullate, minor ampullate, and pyriform spidroin genes but not tubuliform spidroin genes. The relative expression levels of particular spidroin genes varied between sexes and species. Because mature males desert their prey-capture webs and become cursorial in their search for mates, we anticipated that major ampullate (dragline) spidroin genes would be the silk genes most highly expressed by males. Indeed, major ampullate spidroin genes had the highest expression in S. grossa males. However, minor ampullate spidroin genes were the most highly expressed spidroin genes in L. geometricus and L. hesperus males. Our expression profiling results suggest species-specific adaptive divergence of silk use by male theridiids. Copyright © 2017 The Authors. Published by Elsevier GmbH.. All rights reserved.

  6. Biased gene expression in early honeybee larval development

    PubMed Central

    2013-01-01

    Background Female larvae of the honeybee (Apis mellifera) develop into either queens or workers depending on nutrition. This nutritional stimulus triggers different developmental trajectories, resulting in adults that differ from each other in physiology, behaviour and life span. Results To understand how these trajectories are established we have generated a comprehensive atlas of gene expression throughout larval development. We found substantial differences in gene expression between worker and queen-destined larvae at 6 hours after hatching. Some of these early changes in gene expression are maintained throughout larval development, indicating that caste-specific developmental trajectories are established much earlier than previously thought. Within our gene expression data we identified processes that potentially underlie caste differentiation. Queen-destined larvae have higher expression of genes involved in transcription, translation and protein folding early in development with a later switch to genes involved in energy generation. Using RNA interference, we were able to demonstrate that one of these genes, hexamerin 70b, has a role in caste differentiation. Both queen and worker developmental trajectories are associated with the expression of genes that have alternative splice variants, although only a single variant of a gene tends to be differentially expressed in a given caste. Conclusions Our data, based on the biases in gene expression early in development together with published data, supports the idea that caste development in the honeybee consists of two phases; an initial biased phase of development, where larvae can still switch to the other caste by differential feeding, followed by commitment to a particular developmental trajectory. PMID:24350621

  7. Regulatory role of AINTEGUMENTA in organ initiation and growth

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krizek, Beth Allyn; Lebioda, Lukasz

    2005-03-01

    Although several members of the plant-specific AP2/ERF family of transcription factors are important developmental regulators, many genes in this large protein family remain uncharacterized. Here, we present a phylogenetic analysis of the18 genes that make up the AP2 subgroup of this family. We report expression analyses of seven Arabidopsis genes most closely related to the floral development gene AINTEGUMENTA and show that all AINTEGUMENTA-like (AIL) genes are transcribed in multiple tissues during development. They are expressed primarily in young actively dividing tissues of a plant and not in mature leaves or stems. The spatial distribution of AIL5, AIL6, and AIL7more » mRNA in inflorescences was characterized by in situ hybridization. Each of these genes is expressed in a spatially and temporally distinct pattern within inflorescence meristems and flowers. Ectopic expression of AIL5 resulted in a larger floral organ phenotype, similar to that resulting from ectopic expression of ANT. Our results are consistent with AIL genes having roles in specification of meristematic or division-competent states.« less

  8. Gene expression analysis of whole blood RNA from pigs infected with low and high pathogenic African swine fever viruses

    DOE PAGES

    Jaing, Crystal; Rowland, Raymond R. R.; Allen, Jonathan E.; ...

    2017-08-31

    African swine fever virus (ASFV) is a macrophage-tropic virus responsible for ASF, a transboundary disease that threatens swine production world-wide. Since there are no vaccines available to control ASF after an outbreak, obtaining an understanding of the virus-host interaction is important for developing new intervention strategies. In this study, a whole transcriptomic RNA-Seq method was used to characterize differentially expressed genes in pigs infected with a low pathogenic ASFV isolate, OUR T88/3 (OURT), or the highly pathogenic Georgia 2007/1 (GRG). After infection, pigs infected with OURT showed no or few clinical signs; whereas, GRG produced clinical signs consistent with acutemore » ASF. RNA-Seq detected the expression of ASFV genes from the whole blood of the GRG, but not the OURT pigs, consistent with the pathotypes of these strains and the replication of GRG in circulating monocytes. Even though GRG and OURT possess different pathogenic properties, there was significant overlap in the most upregulated host genes. A small number of differentially expressed microRNAs were also detected in GRG and OURT pigs. These data confirm previous studies describing the response of macrophages and lymphocytes to ASFV infection, as well as reveal unique gene pathways upregulated in response to infection with GRG.« less

  9. Metatranscriptome Analysis of Fig Flowers Provides Insights into Potential Mechanisms for Mutualism Stability and Gall Induction.

    PubMed

    Martinson, Ellen O; Hackett, Jeremiah D; Machado, Carlos A; Arnold, A Elizabeth

    2015-01-01

    A striking property of the mutualism between figs and their pollinating wasps is that wasps consistently oviposit in the inner flowers of the fig syconium, which develop into galls that house developing larvae. Wasps typically do not use the outer ring of flowers, which develop into seeds. To better understand differences between gall and seed flowers, we used a metatranscriptomic approach to analyze eukaryotic gene expression within fig flowers at the time of oviposition choice and early gall development. Consistent with the unbeatable seed hypothesis, we found significant differences in gene expression between gall- and seed flowers in receptive syconia prior to oviposition. In particular, transcripts assigned to flavonoids and carbohydrate metabolism were significantly up-regulated in gall flowers relative to seed flowers. In response to oviposition, gall flowers significantly up-regulated the expression of chalcone synthase, which previously has been connected to gall formation in other plants. We propose several genes encoding proteins with signal peptides or associations with venom of other Hymenoptera as candidate genes for gall initiation or growth. This study simultaneously evaluates the gene expression profile of both mutualistic partners in a plant-insect mutualism and provides insight into a possible stability mechanism in the ancient fig-fig wasp association.

  10. Metatranscriptome Analysis of Fig Flowers Provides Insights into Potential Mechanisms for Mutualism Stability and Gall Induction

    PubMed Central

    Martinson, Ellen O.; Hackett, Jeremiah D.; Machado, Carlos A.; Arnold, A. Elizabeth

    2015-01-01

    A striking property of the mutualism between figs and their pollinating wasps is that wasps consistently oviposit in the inner flowers of the fig syconium, which develop into galls that house developing larvae. Wasps typically do not use the outer ring of flowers, which develop into seeds. To better understand differences between gall and seed flowers, we used a metatranscriptomic approach to analyze eukaryotic gene expression within fig flowers at the time of oviposition choice and early gall development. Consistent with the unbeatable seed hypothesis, we found significant differences in gene expression between gall- and seed flowers in receptive syconia prior to oviposition. In particular, transcripts assigned to flavonoids and carbohydrate metabolism were significantly up-regulated in gall flowers relative to seed flowers. In response to oviposition, gall flowers significantly up-regulated the expression of chalcone synthase, which previously has been connected to gall formation in other plants. We propose several genes encoding proteins with signal peptides or associations with venom of other Hymenoptera as candidate genes for gall initiation or growth. This study simultaneously evaluates the gene expression profile of both mutualistic partners in a plant-insect mutualism and provides insight into a possible stability mechanism in the ancient fig-fig wasp association. PMID:26090817

  11. Identification of upstream transcription factors (TFs) for expression signature genes in breast cancer.

    PubMed

    Zang, Hongyan; Li, Ning; Pan, Yuling; Hao, Jingguang

    2017-03-01

    Breast cancer is a common malignancy among women with a rising incidence. Our intention was to detect transcription factors (TFs) for deeper understanding of the underlying mechanisms of breast cancer. Integrated analysis of gene expression datasets of breast cancer was performed. Then, functional annotation of differentially expressed genes (DEGs) was conducted, including Gene Ontology (GO) enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment. Furthermore, TFs were identified and a global transcriptional regulatory network was constructed. Seven publically available GEO datasets were obtained, and a set of 1196 DEGs were identified (460 up-regulated and 736 down-regulated). Functional annotation results showed that cell cycle was the most significantly enriched pathway, which was consistent with the fact that cell cycle is closely related to various tumors. Fifty-three differentially expressed TFs were identified, and the regulatory networks consisted of 817 TF-target interactions between 46 TFs and 602 DEGs in the context of breast cancer. Top 10 TFs covering the most downstream DEGs were SOX10, NFATC2, ZNF354C, ARID3A, BRCA1, FOXO3, GATA3, ZEB1, HOXA5 and EGR1. The transcriptional regulatory networks could enable a better understanding of regulatory mechanisms of breast cancer pathology and provide an opportunity for the development of potential therapy.

  12. Gene expression analysis of whole blood RNA from pigs infected with low and high pathogenic African swine fever viruses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jaing, Crystal; Rowland, Raymond R. R.; Allen, Jonathan E.

    African swine fever virus (ASFV) is a macrophage-tropic virus responsible for ASF, a transboundary disease that threatens swine production world-wide. Since there are no vaccines available to control ASF after an outbreak, obtaining an understanding of the virus-host interaction is important for developing new intervention strategies. In this study, a whole transcriptomic RNA-Seq method was used to characterize differentially expressed genes in pigs infected with a low pathogenic ASFV isolate, OUR T88/3 (OURT), or the highly pathogenic Georgia 2007/1 (GRG). After infection, pigs infected with OURT showed no or few clinical signs; whereas, GRG produced clinical signs consistent with acutemore » ASF. RNA-Seq detected the expression of ASFV genes from the whole blood of the GRG, but not the OURT pigs, consistent with the pathotypes of these strains and the replication of GRG in circulating monocytes. Even though GRG and OURT possess different pathogenic properties, there was significant overlap in the most upregulated host genes. A small number of differentially expressed microRNAs were also detected in GRG and OURT pigs. These data confirm previous studies describing the response of macrophages and lymphocytes to ASFV infection, as well as reveal unique gene pathways upregulated in response to infection with GRG.« less

  13. Molecular Profile of Peripheral Blood Mononuclear Cells from Patients with Rheumatoid Arthritis

    PubMed Central

    Edwards, Christopher J; Feldman, Jeffrey L; Beech, Jonathan; Shields, Kathleen M; Stover, Jennifer A; Trepicchio, William L; Larsen, Glenn; Foxwell, Brian MJ; Brennan, Fionula M; Feldmann, Marc; Pittman, Debra D

    2007-01-01

    Rheumatoid arthritis (RA) is a chronic inflammatory arthritis. Currently, diagnosis of RA may take several weeks, and factors used to predict a poor prognosis are not always reliable. Gene expression in RA may consist of a unique signature. Gene expression analysis has been applied to synovial tissue to define molecularly distinct forms of RA; however, expression analysis of tissue taken from a synovial joint is invasive and clinically impractical. Recent studies have demonstrated that unique gene expression changes can be identified in peripheral blood mononuclear cells (PBMCs) from patients with cancer, multiple sclerosis, and lupus. To identify RA disease-related genes, we performed a global gene expression analysis. RNA from PBMCs of 9 RA patients and 13 normal volunteers was analyzed on an oligonucleotide array. Compared with normal PBMCs, 330 transcripts were differentially expressed in RA. The differentially regulated genes belong to diverse functional classes and include genes involved in calcium binding, chaperones, cytokines, transcription, translation, signal transduction, extracellular matrix, integral to plasma membrane, integral to intracellular membrane, mitochondrial, ribosomal, structural, enzymes, and proteases. A k-nearest neighbor analysis identified 29 transcripts that were preferentially expressed in RA. Ten genes with increased expression in RA PBMCs compared with controls mapped to a RA susceptibility locus, 6p21.3. These results suggest that analysis of RA PBMCs at the molecular level may provide a set of candidate genes that could yield an easily accessible gene signature to aid in early diagnosis and treatment. PMID:17515956

  14. Using the gene ontology for microarray data mining: a comparison of methods and application to age effects in human prefrontal cortex.

    PubMed

    Pavlidis, Paul; Qin, Jie; Arango, Victoria; Mann, John J; Sibille, Etienne

    2004-06-01

    One of the challenges in the analysis of gene expression data is placing the results in the context of other data available about genes and their relationships to each other. Here, we approach this problem in the study of gene expression changes associated with age in two areas of the human prefrontal cortex, comparing two computational methods. The first method, "overrepresentation analysis" (ORA), is based on statistically evaluating the fraction of genes in a particular gene ontology class found among the set of genes showing age-related changes in expression. The second method, "functional class scoring" (FCS), examines the statistical distribution of individual gene scores among all genes in the gene ontology class and does not involve an initial gene selection step. We find that FCS yields more consistent results than ORA, and the results of ORA depended strongly on the gene selection threshold. Our findings highlight the utility of functional class scoring for the analysis of complex expression data sets and emphasize the advantage of considering all available genomic information rather than sets of genes that pass a predetermined "threshold of significance."

  15. Patterns of homoeologous gene expression shown by RNA sequencing in hexaploid bread wheat

    PubMed Central

    2014-01-01

    Background Bread wheat (Triticum aestivum) has a large, complex and hexaploid genome consisting of A, B and D homoeologous chromosome sets. Therefore each wheat gene potentially exists as a trio of A, B and D homoeoloci, each of which may contribute differentially to wheat phenotypes. We describe a novel approach combining wheat cytogenetic resources (chromosome substitution ‘nullisomic-tetrasomic’ lines) with next generation deep sequencing of gene transcripts (RNA-Seq), to directly and accurately identify homoeologue-specific single nucleotide variants and quantify the relative contribution of individual homoeoloci to gene expression. Results We discover, based on a sample comprising ~5-10% of the total wheat gene content, that at least 45% of wheat genes are expressed from all three distinct homoeoloci. Most of these genes show strikingly biased expression patterns in which expression is dominated by a single homoeolocus. The remaining ~55% of wheat genes are expressed from either one or two homoeoloci only, through a combination of extensive transcriptional silencing and homoeolocus loss. Conclusions We conclude that wheat is tending towards functional diploidy, through a variety of mechanisms causing single homoeoloci to become the predominant source of gene transcripts. This discovery has profound consequences for wheat breeding and our understanding of wheat evolution. PMID:24726045

  16. Large-scale identification of differentially expressed genes during pupa development reveals solute carrier gene is essential for pupal pigmentation in Chilo suppressalis.

    PubMed

    Sun, Yang; Huang, Shuijin; Wang, Shuping; Guo, Dianhao; Ge, Chang; Xiao, Huamei; Jie, Wencai; Yang, Qiupu; Teng, Xiaolu; Li, Fei

    2017-04-01

    Insects undergo metamorphosis, involving an abrupt change in body structure through cell growth and differentiation. Rice stem stripped borer (SSB), Chilo suppressalis, is one of the most destructive rice pests. However, little is known about the regulation mechanism of metamorphosis development in this notorious insect pest. Here, we studied the expression of 22,197 SSB genes at seven time points during pupa development with a customized microarray, identifying 622 differentially expressed genes (DEG) during pupa development. Gene ontology (GO) analysis of these DEGs indicated that the genes related to substance metabolism were highly expressed in the early pupa, which participate in the physiological processes of larval tissue disintegration at these stages. In comparison, highly expressed genes in the late pupal stages were mainly associated with substance biosynthesis, consistent with adult organ formation at these stages. There were 27 solute carrier (SLC) genes that were highly expressed during pupa development. We knocked down SLC22A3 at the prepupal stage, demonstrating that silencing SLC22A3 induced a deficiency in pupa stiffness and pigmentation. The RNAi-treated individuals had white and soft pupa, suggesting that this gene has an essential role in pupal development. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Circular RNA and gene expression profiles in gastric cancer based on microarray chip technology.

    PubMed

    Sui, Weiguo; Shi, Zhoufang; Xue, Wen; Ou, Minglin; Zhu, Ying; Chen, Jiejing; Lin, Hua; Liu, Fuhua; Dai, Yong

    2017-03-01

    The aim of the present study was to screen gastric cancer (GC) tissue and adjacent tissue for differences in mRNA and circular (circRNA) expression, to analyze the differences in circRNA and mRNA expression, and to investigate the circRNA expression in gastric carcinoma and its mechanism. circRNA and mRNA differential expression profiles generated using Agilent microarray technology were analyzed in the GC tissues and adjacent tissues. qRT-PCR was used to verify the differential expression of circRNAs and mRNAs according to the interactions between circRNAs and miRNAs as well as the possible existence of miRNA and mRNA interactions. We found that: i) the circRNA expression profile revealed 1,285 significant differences in circRNA expression, with circRNA expression downregulated in 594 samples and upregulated in 691 samples via interactions with miRNAs. The qRT-PCR validation experiments showed that hsa_circRNA_400071, hsa_circRNA_000543 and hsa_circRNA_001959 expression was consistent with the microarray analysis results. ii) 29,112 genes were found in the GC tissues and adjacent tissues, including 5,460 differentially expressed genes. Among them, 2,390 differentially expressed genes were upregulated and 3,070 genes were downregulated. Gene Ontology (GO) analysis of the differentially expressed genes revealed these genes involved in biological process classification, cellular component classification and molecular function classification. Pathway analysis of the differentially expressed genes identified 83 significantly enriched genes, including 28 upregulated genes and 55 downregulated genes. iii) 69 differentially expressed circRNAs were found that might adsorb specific miRNAs to regulate the expression of their target gene mRNAs. The conclusions are: i) differentially expressed circRNAs had corresponding miRNA binding sites. These circRNAs regulated the expression of target genes through interactions with miRNAs and might become new molecular biomarkers for GC in the future. ii) Differentially expressed genes may be involved in the occurrence of GC via a variety of mechanisms. iii) CD44, CXXC5, MYH9, MALAT1 and other genes may have important implications for the occurrence and development of GC through the regulation, interaction, and mutual influence of circRNA-miRNA-mRNA via different mechanisms.

  18. Identification of candidate genes involved in neuroblastoma progression by combining genomic and expression microarrays with survival data.

    PubMed

    Łastowska, M; Viprey, V; Santibanez-Koref, M; Wappler, I; Peters, H; Cullinane, C; Roberts, P; Hall, A G; Tweddle, D A; Pearson, A D J; Lewis, I; Burchill, S A; Jackson, M S

    2007-11-22

    Identifying genes, whose expression is consistently altered by chromosomal gains or losses, is an important step in defining genes of biological relevance in a wide variety of tumour types. However, additional criteria are needed to discriminate further among the large number of candidate genes identified. This is particularly true for neuroblastoma, where multiple genomic copy number changes of proven prognostic value exist. We have used Affymetrix microarrays and a combination of fluorescent in situ hybridization and single nucleotide polymorphism (SNP) microarrays to establish expression profiles and delineate copy number alterations in 30 primary neuroblastomas. Correlation of microarray data with patient survival and analysis of expression within rodent neuroblastoma cell lines were then used to define further genes likely to be involved in the disease process. Using this approach, we identify >1000 genes within eight recurrent genomic alterations (loss of 1p, 3p, 4p, 10q and 11q, 2p gain, 17q gain, and the MYCN amplicon) whose expression is consistently altered by copy number change. Of these, 84 correlate with patient survival, with the minimal regions of 17q gain and 4p loss being enriched significantly for such genes. These include genes involved in RNA and DNA metabolism, and apoptosis. Orthologues of all but one of these genes on 17q are overexpressed in rodent neuroblastoma cell lines. A significant excess of SNPs whose copy number correlates with survival is also observed on proximal 4p in stage 4 tumours, and we find that deletion of 4p is associated with improved outcome in an extended cohort of tumours. These results define the major impact of genomic copy number alterations upon transcription within neuroblastoma, and highlight genes on distal 17q and proximal 4p for downstream analyses. They also suggest that integration of discriminators, such as survival and comparative gene expression, with microarray data may be useful in the identification of critical genes within regions of loss or gain in many human cancers.

  19. Impact of Solar Radiation on Gene Expression in Bacteria

    PubMed Central

    Matallana-Surget, Sabine; Wattiez, Ruddy

    2013-01-01

    Microorganisms often regulate their gene expression at the level of transcription and/or translation in response to solar radiation. In this review, we present the use of both transcriptomics and proteomics to advance knowledge in the field of bacterial response to damaging radiation. Those studies pertain to diverse application areas such as fundamental microbiology, water treatment, microbial ecology and astrobiology. Even though it has been demonstrated that mRNA abundance is not always consistent with the protein regulation, we present here an exhaustive review on how bacteria regulate their gene expression at both transcription and translation levels to enable biomarkers identification and comparison of gene regulation from one bacterial species to another. PMID:28250399

  20. Transcriptomic correlates of neuron electrophysiological diversity

    PubMed Central

    Li, Brenna; Crichlow, Cindy-Lee; Mancarci, B. Ogan; Pavlidis, Paul

    2017-01-01

    How neuronal diversity emerges from complex patterns of gene expression remains poorly understood. Here we present an approach to understand electrophysiological diversity through gene expression by integrating pooled- and single-cell transcriptomics with intracellular electrophysiology. Using neuroinformatics methods, we compiled a brain-wide dataset of 34 neuron types with paired gene expression and intrinsic electrophysiological features from publically accessible sources, the largest such collection to date. We identified 420 genes whose expression levels significantly correlated with variability in one or more of 11 physiological parameters. We next trained statistical models to infer cellular features from multivariate gene expression patterns. Such models were predictive of gene-electrophysiological relationships in an independent collection of 12 visual cortex cell types from the Allen Institute, suggesting that these correlations might reflect general principles relating expression patterns to phenotypic diversity across very different cell types. Many associations reported here have the potential to provide new insights into how neurons generate functional diversity, and correlations of ion channel genes like Gabrd and Scn1a (Nav1.1) with resting potential and spiking frequency are consistent with known causal mechanisms. Our work highlights the promise and inherent challenges in using cell type-specific transcriptomics to understand the mechanistic origins of neuronal diversity. PMID:29069078

  1. Ectopic expression of different cytokinin-regulated transcription factor genes of Arabidopsis thaliana alters plant growth and development.

    PubMed

    Köllmer, Ireen; Werner, Tomáš; Schmülling, Thomas

    2011-08-15

    The plant hormone cytokinin rapidly alters the steady state transcript levels of a number of transcription factor genes suggesting that these might have a function in mediating cytokinin effects. Here we report the analysis of Arabidopsis thaliana plants with an altered expression level of four different cytokinin-regulated transcription factor genes. These include GATA22 (also known as CGA1/GNL), two genes coding for members of the homeodomain zip (HD zip) class II transcription factor family (HAT4, HAT22), and bHLH64. Ectopic expression of the GATA22 gene induced the development of chloroplasts in root tissue where it is normally suppressed and led to the formation of shorter and less branched roots. Overexpression of HAT22 lowered the seedlings chlorophyll content and caused an earlier onset of leaf senescence. Enhanced expression of the HAT4 gene led to severe defects in inflorescence stem development and to a decrease in root growth and branching, while hat4 insertional mutants developed a larger root system. 35S:bHLH64 transgenic plants showed a pleiotropic phenotype, consisting of larger rosettes, reduced chlorophyll content and an elongated and thickened hypocotyl. Flower development was strongly disturbed leading to sterile plants. The results are consistent with specific functions of these transcription factor genes in regulating part of the cytokinin activities and suggest their action as convergence point with other signalling pathways, particularly those of gibberellin and light. Copyright © 2011 Elsevier GmbH. All rights reserved.

  2. Downregulation of the expression of mitochondrial electron transport complex genes in autism brains.

    PubMed

    Anitha, Ayyappan; Nakamura, Kazuhiko; Thanseem, Ismail; Matsuzaki, Hideo; Miyachi, Taishi; Tsujii, Masatsugu; Iwata, Yasuhide; Suzuki, Katsuaki; Sugiyama, Toshiro; Mori, Norio

    2013-05-01

    Mitochondrial dysfunction (MtD) and abnormal brain bioenergetics have been implicated in autism, suggesting possible candidate genes in the electron transport chain (ETC). We compared the expression of 84 ETC genes in the post-mortem brains of autism patients and controls. Brain tissues from the anterior cingulate gyrus, motor cortex, and thalamus of autism patients (n = 8) and controls (n = 10) were obtained from Autism Tissue Program, USA. Quantitative real-time PCR arrays were used to quantify gene expression. We observed reduced expression of several ETC genes in autism brains compared to controls. Eleven genes of Complex I, five genes each of Complex III and Complex IV, and seven genes of Complex V showed brain region-specific reduced expression in autism. ATP5A1 (Complex V), ATP5G3 (Complex V) and NDUFA5 (Complex I) showed consistently reduced expression in all the brain regions of autism patients. Upon silencing ATP5A1, the expression of mitogen-activated protein kinase 13 (MAPK13), a p38 MAPK responsive to stress stimuli, was upregulated in HEK 293 cells. This could have been induced by oxidative stress due to impaired ATP synthesis. We report new candidate genes involved in abnormal brain bioenergetics in autism, supporting the hypothesis that mitochondria, critical for neurodevelopment, may play a role in autism. © 2012 The Authors; Brain Pathology © 2012 International Society of Neuropathology.

  3. Unlocking the potential of publicly available microarray data using inSilicoDb and inSilicoMerging R/Bioconductor packages.

    PubMed

    Taminau, Jonatan; Meganck, Stijn; Lazar, Cosmin; Steenhoff, David; Coletta, Alain; Molter, Colin; Duque, Robin; de Schaetzen, Virginie; Weiss Solís, David Y; Bersini, Hugues; Nowé, Ann

    2012-12-24

    With an abundant amount of microarray gene expression data sets available through public repositories, new possibilities lie in combining multiple existing data sets. In this new context, analysis itself is no longer the problem, but retrieving and consistently integrating all this data before delivering it to the wide variety of existing analysis tools becomes the new bottleneck. We present the newly released inSilicoMerging R/Bioconductor package which, together with the earlier released inSilicoDb R/Bioconductor package, allows consistent retrieval, integration and analysis of publicly available microarray gene expression data sets. Inside the inSilicoMerging package a set of five visual and six quantitative validation measures are available as well. By providing (i) access to uniformly curated and preprocessed data, (ii) a collection of techniques to remove the batch effects between data sets from different sources, and (iii) several validation tools enabling the inspection of the integration process, these packages enable researchers to fully explore the potential of combining gene expression data for downstream analysis. The power of using both packages is demonstrated by programmatically retrieving and integrating gene expression studies from the InSilico DB repository [https://insilicodb.org/app/].

  4. Mechanical stretch is a highly selective regulator of gene expression in human bladder smooth muscle cells.

    PubMed

    Adam, Rosalyn M; Eaton, Samuel H; Estrada, Carlos; Nimgaonkar, Ashish; Shih, Shu-Ching; Smith, Lois E H; Kohane, Isaac S; Bägli, Darius; Freeman, Michael R

    2004-12-15

    Application of mechanical stimuli has been shown to alter gene expression in bladder smooth muscle cells (SMC). To date, only a limited number of "stretch-responsive" genes in this cell type have been reported. We employed oligonucleotide arrays to identify stretch-sensitive genes in primary culture human bladder SMC subjected to repetitive mechanical stimulation for 4 h. Differential gene expression between stretched and nonstretched cells was assessed using Significance Analysis of Microarrays (SAM). Expression of 20 out of 11,731 expressed genes ( approximately 0.17%) was altered >2-fold following stretch, with 19 genes induced and one gene (FGF-9) repressed. Using real-time RT-PCR, we tested independently the responsiveness of 15 genes to stretch and to platelet-derived growth factor-BB (PDGF-BB), another hypertrophic stimulus for bladder SMC. In response to both stimuli, expression of 13 genes increased, 1 gene (FGF-9) decreased, and 1 gene was unchanged. Six transcripts (HB-EGF, BMP-2, COX-2, LIF, PAR-2, and FGF-9) were evaluated using an ex vivo rat model of bladder distension. HB-EGF, BMP-2, COX-2, LIF, and PAR-2 increased with bladder stretch ex vivo, whereas FGF-9 decreased, consistent with expression changes observed in vitro. In silico analysis of microarray data using the FIRED algorithm identified c-jun, AP-1, ATF-2, and neurofibromin-1 (NF-1) as potential transcriptional mediators of stretch signals. Furthermore, the promoters of 9 of 13 stretch-responsive genes contained AP-1 binding sites. These observations identify stretch as a highly selective regulator of gene expression in bladder SMC. Moreover, they suggest that mechanical and growth factor signals converge on common transcriptional regulators that include members of the AP-1 family.

  5. Selective inhibition of yeast regulons by daunorubicin: A transcriptome-wide analysis

    PubMed Central

    Rojas, Marta; Casado, Marta; Portugal, José; Piña, Benjamin

    2008-01-01

    Background The antitumor drug daunorubicin exerts some of its cytotoxic effects by binding to DNA and inhibiting the transcription of different genes. We analysed this effect in vivo at the transcriptome level using the budding yeast Saccharomyces cerevisiae as a model and sublethal (IC40) concentrations of the drug to minimise general toxic effects. Results Daunorubicin affected a minor proportion (14%) of the yeast transcriptome, increasing the expression of 195 genes and reducing expression of 280 genes. Daunorubicin down-regulated genes included essentially all genes involved in the glycolytic pathway, the tricarboxylic acid cycle and alcohol metabolism, whereas transcription of ribosomal protein genes was not affected or even slightly increased. This pattern is consistent with a specific inhibition of glucose usage in treated cells, with only minor effects on proliferation or other basic cell functions. Analysis of promoters of down-regulated genes showed that they belong to a limited number of transcriptional regulatory units (regulons). Consistently, data mining showed that daunorubicin-induced changes in expression patterns were similar to those observed in yeast strains deleted for some transcription factors functionally related to the glycolysis and/or the cAMP regulatory pathway, which appeared to be particularly sensitive to daunorubicin. Conclusion The effects of daunorubicin treatment on the yeast transcriptome are consistent with a model in which this drug impairs binding of different transcription factors by competing for their DNA binding sequences, therefore limiting their effectiveness and affecting the corresponding regulatory networks. This proposed mechanism might have broad therapeutic implications against cancer cells growing under hypoxic conditions. PMID:18667070

  6. Mapping gene expression patterns during myeloid differentiation using the EML hematopoietic progenitor cell line.

    PubMed

    Du, Yang; Campbell, Janee L; Nalbant, Demet; Youn, Hyewon; Bass, Ann C Hughes; Cobos, Everardo; Tsai, Schickwann; Keller, Jonathan R; Williams, Simon C

    2002-07-01

    The detailed examination of the molecular events that control the early stages of myeloid differentiation has been hampered by the relative scarcity of hematopoietic stem cells and the lack of suitable cell line models. In this study, we examined the expression of several myeloid and nonmyeloid genes in the murine EML hematopoietic stem cell line. Expression patterns for 19 different genes were examined by Northern blotting and RT-PCR in RNA samples from EML, a variety of other immortalized cell lines, and purified murine hematopoietic stem cells. Representational difference analysis (RDA) was performed to identify differentially expressed genes in EML. Expression patterns of genes encoding transcription factors (four members of the C/EBP family, GATA-1, GATA-2, PU.1, CBFbeta, SCL, and c-myb) in EML were examined and were consistent with the proposed functions of these proteins in hematopoietic differentiation. Expression levels of three markers of terminal myeloid differentiation (neutrophil elastase, proteinase 3, and Mac-1) were highest in EML cells at the later stages of differentiation. In a search for genes that were differentially expressed in EML cells during myeloid differentiation, six cDNAs were isolated. These included three known genes (lysozyme, histidine decarboxylase, and tryptophan hydroxylase) and three novel genes. Expression patterns of known genes in differentiating EML cells accurately reflected their expected expression patterns based on previous studies. The identification of three novel genes, two of which encode proteins that may act as regulators of hematopoietic differentiation, suggests that EML is a useful model system for the molecular analysis of hematopoietic differentiation.

  7. Geographical Genomics of Human Leukocyte Gene Expression Variation in Southern Morocco

    PubMed Central

    Idaghdour, Youssef; Czika, Wendy; Shianna, Kevin V.; Lee, S. Hong; Visscher, Peter M.; Martin, Hilary C.; Miclaus, Kelci; Jadallah, Sami J.; Goldstein, David B.; Wolfinger, Russell D.; Gibson, Greg

    2009-01-01

    Studies of the genetics of gene expression reveal expression SNPs that explain variation in transcript abundance. Here we address the robustness of eSNP associations to environmental geography and population structure in a comparison of 194 Arab and Amazigh individuals from a city and two villages in southern Morocco. Gene expression differed between pairs of locations for up to a third of all transcripts, with notable enrichment for ribosomal biosynthesis and oxidative phosphorylation. Robust associations were observed in the leukocyte samples with cis-eSNPs (P < 10−08) for 346 genes, and trans-eSNPs (P < 10−11) with 10 genes. All of these were consistent across the three sample locations and after controlling for ethnicity and relatedness. No evidence for large-effect trans-acting mediators of the pervasive environmental influence was found and instead genetic and environmental factors acted in a largely additive manner. PMID:19966804

  8. CHARACTERIZATION OF INFLAMMATORY GENE EXPRESSION AND GALECTIN-3 FUNCTION AFTER SPINAL CORD INJURY IN MICE

    PubMed Central

    Pajoohesh-Ganji, Ahdeah; Knoblach, Susan M.; Faden, Alan I.; Byrnes, Kimberly R.

    2012-01-01

    Inflammation has long been implicated in secondary tissue damage after spinal cord injury (SCI). Our previous studies of inflammatory gene expression in rats after SCI revealed two temporally correlated clusters: the first was expressed early after injury and the second was up-regulated later, with peak expression at 1–2 weeks and persistent up-regulation through 6 months. To further address the role of inflammation after SCI, we examined inflammatory genes in a second species, mice, through 28 days after SCI. Using anchor gene clustering analysis, we found similar expression patterns for both the acute and chronic gene clusters previously identified after rat SCI. The acute group returned to normal expression levels by 7 days post-injury. The chronic group, which included C1qB, p22phox and galectin-3, showed peak expression at 7 days and remained up-regulated through 28 days. Immunohistochemistry and western blot analysis showed that the protein expression of these genes was consistent with the mRNA expression. Further exploration of the role of one of these genes, galectin-3, suggests that galectin-3 may contribute to secondary injury. In summary, our findings extend our prior gene profiling data by demonstrating the chronic expression of a cluster of microglial associated inflammatory genes after SCI in mice. Moreover, by demonstrating that inhibition of one such factor improves recovery, the findings suggest that such chronic up-regulation of inflammatory processes may contribute to secondary tissue damage after SCI, and that there may be a broader therapeutic window for neuroprotection than generally accepted. PMID:22884909

  9. Complexities of gene expression patterns in natural populations of an extremophile fish (Poecilia mexicana, Poeciliidae)

    PubMed Central

    Passow, Courtney N.; Brown, Anthony P.; Arias-Rodriguez, Lenin; Yee, Muh-Ching; Sockell, Alexandra; Schartl, Manfred; Warren, Wesley C.; Bustamante, Carlos; Kelley, Joanna L.; Tobler, Michael

    2017-01-01

    Variation in gene expression can provide insights into organismal responses to environmental stress and physiological mechanisms mediating adaptation to habitats with contrasting environmental conditions. We performed an RNA-sequencing experiment to quantify gene expression patterns in fish adapted to habitats with different combinations of environmental stressors, including the presence of toxic hydrogen sulphide (H2S) and the absence of light in caves. We specifically asked how gene expression varies among populations living in different habitats, whether population differences were consistent among organs, and whether there is evidence for shared expression responses in populations exposed to the same stressors. We analysed organ-specific transcriptome-wide data from four ecotypes of Poecilia mexicana (nonsulphidic surface, sulphidic surface, nonsulphidic cave and sulphidic cave). The majority of variation in gene expression was correlated with organ type, and the presence of specific environmental stressors elicited unique expression differences among organs. Shared patterns of gene expression between populations exposed to the same environmental stressors increased with levels of organismal organization (from transcript to gene to physiological pathway). In addition, shared patterns of gene expression were more common between populations from sulphidic than populations from cave habitats, potentially indicating that physiochemical stressors with clear biochemical consequences can constrain the diversity of adaptive solutions that mitigate their adverse effects. Overall, our analyses provided insights into transcriptional variation in a unique system, in which adaptation to H2S and darkness coincide. Functional annotations of differentially expressed genes provide a springboard for investigating physiological mechanisms putatively underlying adaptation to extreme environments. PMID:28598519

  10. Expression of gentisate 1,2-dioxygenase (gdoA) genes involved in aromatic degradation in two haloarchaeal genera.

    PubMed

    Fairley, D J; Wang, G; Rensing, C; Pepper, I L; Larkin, M J

    2006-12-01

    Gentisate-1,2-dioxygenase genes (gdoA), with homology to a number of bacterial dioxygenases, and genes encoding a putative coenzyme A (CoA)-synthetase subunit (acdB) and a CoA-thioesterase (tieA) were identified in two haloarchaeal isolates. In Haloarcula sp. D1, gdoA was expressed during growth on 4-hydroxybenzoate but not benzoate, and acdB and tieA were not expressed during growth on any of the aromatic substrates tested. In contrast, gdoA was expressed in Haloferax sp. D1227 during growth on benzoate, 3-hydroxybenzoate, cinnamate and phenylpropionate, and both acdB and tieA were expressed during growth on benzoate, cinnamate and phenylpropionate, but not on 3-hydroxybenzoate. This pattern of induction is consistent with these genes encoding steps in a CoA-mediated benzoate pathway in this strain.

  11. Vascular Gene Expression in Nonneoplastic and Malignant Brain

    PubMed Central

    Madden, Stephen L.; Cook, Brian P.; Nacht, Mariana; Weber, William D.; Callahan, Michelle R.; Jiang, Yide; Dufault, Michael R.; Zhang, Xiaoming; Zhang, Wen; Walter-Yohrling, Jennifer; Rouleau, Cecile; Akmaev, Viatcheslav R.; Wang, Clarence J.; Cao, Xiaohong; St. Martin, Thia B.; Roberts, Bruce L.; Teicher, Beverly A.; Klinger, Katherine W.; Stan, Radu-Virgil; Lucey, Brenden; Carson-Walter, Eleanor B.; Laterra, John; Walter, Kevin A.

    2004-01-01

    Malignant gliomas are uniformly lethal tumors whose morbidity is mediated in large part by the angiogenic response of the brain to the invading tumor. This profound angiogenic response leads to aggressive tumor invasion and destruction of surrounding brain tissue as well as blood-brain barrier breakdown and life-threatening cerebral edema. To investigate the molecular mechanisms governing the proliferation of abnormal microvasculature in malignant brain tumor patients, we have undertaken a cell-specific transcriptome analysis from surgically harvested nonneoplastic and tumor-associated endothelial cells. SAGE-derived endothelial cell gene expression patterns from glioma and nonneoplastic brain tissue reveal distinct gene expression patterns and consistent up-regulation of certain glioma endothelial marker genes across patient samples. We define the G-protein-coupled receptor RDC1 as a tumor endothelial marker whose expression is distinctly induced in tumor endothelial cells of both brain and peripheral vasculature. Further, we demonstrate that the glioma-induced gene, PV1, shows expression both restricted to endothelial cells and coincident with endothelial cell tube formation. As PV1 provides a framework for endothelial cell caveolar diaphragms, this protein may serve to enhance glioma-induced disruption of the blood-brain barrier and transendothelial exchange. Additional characterization of this extensive brain endothelial cell gene expression database will provide unique molecular insights into vascular gene expression. PMID:15277233

  12. Characterization of Pseudomonas putida Genes Responsive to Nutrient Limitation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Syn, Chris K.; Magnuson, Jon K.; Kingsley, Mark T.

    2004-06-01

    The low bioavailability of nutrients and oxygen in the soil environment has hampered successful expression of biodegradation/biocontrol genes that are driven by promoters highly active during routine laboratory conditions of high nutrient- and oxygen-availability. Hence, in the present study, expression of the gus-tagged genes in 12 Tn5-gus mutants of the soil microbe Pseudomonas putida PNL-MK25 was examined under various conditions chosen to mimic the soil environment: low carbon, phosphate, nitrate, or oxygen, and in the rhizosphere. Based on their expression profiles, three nutrient-responsive mutant (NRM) strains, NRM5, NRM7, and NRM17, were selected for identification of the tagged genes. In themore » mutant strain NRM5, expression of the glutamate dehydrogenase (gdhA) gene was increased between 4.9- to 26.4-fold under various low nutrient conditions. In NRM7, expression of the novel NADPH:quinone oxidoreductase-like (nql) gene was consistently amongst the highest and was synergistically upregulated by low nutrient and anoxic conditions. The cyoD gene in NRM17, which encodes the fourth subunit of the cytochrome o ubiquinol oxidase complex, had decreased expression in low nutrient conditions but its absolute expression levels was still amongst the highest. Additionally, it was independent of oxygen availability, in contrast to that in E. coli.« less

  13. Knockdown of the schizophrenia susceptibility gene TCF4 alters gene expression and proliferation of progenitor cells from the developing human neocortex.

    PubMed

    Hill, Matthew J; Killick, Richard; Navarrete, Katherinne; Maruszak, Aleksandra; McLaughlin, Gemma M; Williams, Brenda P; Bray, Nicholas J

    2017-05-01

    Common variants in the TCF4 gene are among the most robustly supported genetic risk factors for schizophrenia. Rare TCF4 deletions and loss-of-function point mutations cause Pitt-Hopkins syndrome, a developmental disorder associated with severe intellectual disability. To explore molecular and cellular mechanisms by which TCF4 perturbation could interfere with human cortical development, we experimentally reduced the endogenous expression of TCF4 in a neural progenitor cell line derived from the developing human cerebral cortex using RNA interference. Effects on genome-wide gene expression were assessed by microarray, followed by Gene Ontology and pathway analysis of differentially expressed genes. We tested for genetic association between the set of differentially expressed genes and schizophrenia using genome-wide association study data from the Psychiatric Genomics Consortium and competitive gene set analysis (MAGMA). Effects on cell proliferation were assessed using high content imaging. Genes that were differentially expressed following TCF4 knockdown were highly enriched for involvement in the cell cycle. There was a nonsignificant trend for genetic association between the differentially expressed gene set and schizophrenia. Consistent with the gene expression data, TCF4 knockdown was associated with reduced proliferation of cortical progenitor cells in vitro. A detailed mechanistic explanation of how TCF4 knockdown alters human neural progenitor cell proliferation is not provided by this study. Our data indicate effects of TCF4 perturbation on human cortical progenitor cell proliferation, a process that could contribute to cognitive deficits in individuals with Pitt-Hopkins syndrome and risk for schizophrenia.

  14. Optimal Scaling of Digital Transcriptomes

    PubMed Central

    Glusman, Gustavo; Caballero, Juan; Robinson, Max; Kutlu, Burak; Hood, Leroy

    2013-01-01

    Deep sequencing of transcriptomes has become an indispensable tool for biology, enabling expression levels for thousands of genes to be compared across multiple samples. Since transcript counts scale with sequencing depth, counts from different samples must be normalized to a common scale prior to comparison. We analyzed fifteen existing and novel algorithms for normalizing transcript counts, and evaluated the effectiveness of the resulting normalizations. For this purpose we defined two novel and mutually independent metrics: (1) the number of “uniform” genes (genes whose normalized expression levels have a sufficiently low coefficient of variation), and (2) low Spearman correlation between normalized expression profiles of gene pairs. We also define four novel algorithms, one of which explicitly maximizes the number of uniform genes, and compared the performance of all fifteen algorithms. The two most commonly used methods (scaling to a fixed total value, or equalizing the expression of certain ‘housekeeping’ genes) yielded particularly poor results, surpassed even by normalization based on randomly selected gene sets. Conversely, seven of the algorithms approached what appears to be optimal normalization. Three of these algorithms rely on the identification of “ubiquitous” genes: genes expressed in all the samples studied, but never at very high or very low levels. We demonstrate that these include a “core” of genes expressed in many tissues in a mutually consistent pattern, which is suitable for use as an internal normalization guide. The new methods yield robustly normalized expression values, which is a prerequisite for the identification of differentially expressed and tissue-specific genes as potential biomarkers. PMID:24223126

  15. Mind-controlled transgene expression by a wireless-powered optogenetic designer cell implant.

    PubMed

    Folcher, Marc; Oesterle, Sabine; Zwicky, Katharina; Thekkottil, Thushara; Heymoz, Julie; Hohmann, Muriel; Christen, Matthias; Daoud El-Baba, Marie; Buchmann, Peter; Fussenegger, Martin

    2014-11-11

    Synthetic devices for traceless remote control of gene expression may provide new treatment opportunities in future gene- and cell-based therapies. Here we report the design of a synthetic mind-controlled gene switch that enables human brain activities and mental states to wirelessly programme the transgene expression in human cells. An electroencephalography (EEG)-based brain-computer interface (BCI) processing mental state-specific brain waves programs an inductively linked wireless-powered optogenetic implant containing designer cells engineered for near-infrared (NIR) light-adjustable expression of the human glycoprotein SEAP (secreted alkaline phosphatase). The synthetic optogenetic signalling pathway interfacing the BCI with target gene expression consists of an engineered NIR light-activated bacterial diguanylate cyclase (DGCL) producing the orthogonal second messenger cyclic diguanosine monophosphate (c-di-GMP), which triggers the stimulator of interferon genes (STING)-dependent induction of synthetic interferon-β promoters. Humans generating different mental states (biofeedback control, concentration, meditation) can differentially control SEAP production of the designer cells in culture and of subcutaneous wireless-powered optogenetic implants in mice.

  16. Molecular characterization and expression analysis of Triticum aestivum squamosa-promoter binding protein-box genes involved in ear development.

    PubMed

    Zhang, Bin; Liu, Xia; Zhao, Guangyao; Mao, Xinguo; Li, Ang; Jing, Ruilian

    2014-06-01

    Wheat (Triticum aestivum L.) is one of the most important crops in the world. Squamosa-promoter binding protein (SBP)-box genes play a critical role in regulating flower and fruit development. In this study, 10 novel SBP-box genes (TaSPL genes) were isolated from wheat ((Triticum aestivum L.) cultivar Yanzhan 4110). Phylogenetic analysis classified the TaSPL genes into five groups (G1-G5). The motif combinations and expression patterns of the TaSPL genes varied among the five groups with each having own distinctive characteristics: TaSPL20/21 in G1 and TaSPL17 in G2 mainly expressed in the shoot apical meristem and the young ear, and their expression levels responded to development of the ear; TaSPL6/15 belonging to G3 were upregulated and TaSPL1/23 in G4 were downregulated during grain development; the gene in G5 (TaSPL3) expressed constitutively. Thus, the consistency of the phylogenetic analysis, motif compositions, and expression patterns of the TaSPL genes revealed specific gene structures and functions. On the other hand, the diverse gene structures and different expression patterns suggested that wheat SBP-box genes have a wide range of functions. The results also suggest a potential role for wheat SBP-box genes in ear development. This study provides a significant beginning of functional analysis of SBP-box genes in wheat. © 2014 The Authors. Journal of Integrative Plant Biology Published by Wiley Publishing Asia Pty Ltd on behalf of Institute of Botany, Chinese Academy of Sciences.

  17. Gene expression analysis of E. coli strains provides insights into the role of gene regulation in diversification

    PubMed Central

    Vital, Marius; Chai, Benli; Østman, Bjørn; Cole, James; Konstantinidis, Konstantinos T; Tiedje, James M

    2015-01-01

    Escherichia coli spans a genetic continuum from enteric strains to several phylogenetically distinct, atypical lineages that are rare in humans, but more common in extra-intestinal environments. To investigate the link between gene regulation, phylogeny and diversification in this species, we analyzed global gene expression profiles of four strains representing distinct evolutionary lineages, including a well-studied laboratory strain, a typical commensal (enteric) strain and two environmental strains. RNA-Seq was employed to compare the whole transcriptomes of strains grown under batch, chemostat and starvation conditions. Highly differentially expressed genes showed a significantly lower nucleotide sequence identity compared with other genes, indicating that gene regulation and coding sequence conservation are directly connected. Overall, distances between the strains based on gene expression profiles were largely dependent on the culture condition and did not reflect phylogenetic relatedness. Expression differences of commonly shared genes (all four strains) and E. coli core genes were consistently smaller between strains characterized by more similar primary habitats. For instance, environmental strains exhibited increased expression of stress defense genes under carbon-limited growth and entered a more pronounced survival-like phenotype during starvation compared with other strains, which stayed more alert for substrate scavenging and catabolism during no-growth conditions. Since those environmental strains show similar genetic distance to each other and to the other two strains, these findings cannot be simply attributed to genetic relatedness but suggest physiological adaptations. Our study provides new insights into ecologically relevant gene-expression and underscores the role of (differential) gene regulation for the diversification of the model bacterial species. PMID:25343512

  18. Comprehensive analysis of gene expression patterns in Friedreich's ataxia fibroblasts by RNA sequencing reveals altered levels of protein synthesis factors and solute carriers

    PubMed Central

    Li, Yanjie; Lu, Yue; Lin, Kevin; Hauser, Lauren A.; Lynch, David R.

    2017-01-01

    ABSTRACT Friedreich's ataxia (FRDA) is an autosomal recessive neurodegenerative disease usually caused by large homozygous expansions of GAA repeat sequences in intron 1 of the frataxin (FXN) gene. FRDA patients homozygous for GAA expansions have low FXN mRNA and protein levels when compared with heterozygous carriers or healthy controls. Frataxin is a mitochondrial protein involved in iron–sulfur cluster synthesis, and many FRDA phenotypes result from deficiencies in cellular metabolism due to lowered expression of FXN. Presently, there is no effective treatment for FRDA, and biomarkers to measure therapeutic trial outcomes and/or to gauge disease progression are lacking. Peripheral tissues, including blood cells, buccal cells and skin fibroblasts, can readily be isolated from FRDA patients and used to define molecular hallmarks of disease pathogenesis. For instance, FXN mRNA and protein levels as well as FXN GAA-repeat tract lengths are routinely determined using all of these cell types. However, because these tissues are not directly involved in disease pathogenesis, their relevance as models of the molecular aspects of the disease is yet to be decided. Herein, we conducted unbiased RNA sequencing to profile the transcriptomes of fibroblast cell lines derived from 18 FRDA patients and 17 unaffected control individuals. Bioinformatic analyses revealed significantly upregulated expression of genes encoding plasma membrane solute carrier proteins in FRDA fibroblasts. Conversely, the expression of genes encoding accessory factors and enzymes involved in cytoplasmic and mitochondrial protein synthesis was consistently decreased in FRDA fibroblasts. Finally, comparison of genes differentially expressed in FRDA fibroblasts to three previously published gene expression signatures defined for FRDA blood cells showed substantial overlap between the independent datasets, including correspondingly deficient expression of antioxidant defense genes. Together, these results indicate that gene expression profiling of cells derived from peripheral tissues can, in fact, consistently reveal novel molecular pathways of the disease. When performed on statistically meaningful sample group sizes, unbiased global profiling analyses utilizing peripheral tissues are critical for the discovery and validation of FRDA disease biomarkers. PMID:29125828

  19. Identification and Expression Profiles of Six Transcripts Encoding Carboxylesterase Protein in Vitis flexuosa Infected with Pathogens.

    PubMed

    Islam, Md Zaherul; Yun, Hae Keun

    2016-08-01

    Plants protect themselves from pathogen attacks via several mechanisms, including hypersensitive cell death. Recognition of pathogen attack by the plant resistance gene triggers expression of carboxylesterase genes associated with hypersensitive response. We identified six transcripts of carboxylesterase genes, Vitis flexuosa carboxylesterase 5585 (VfCXE5585), VfCXE12827, VfCXE13132, VfCXE17159, VfCXE18231, and VfCXE47674, which showed different expression patterns upon transcriptome analysis of V. flexuosa inoculated with Elsinoe ampelina. The lengths of genes ranged from 1,098 to 1,629 bp, and their encoded proteins consisted of 309 to 335 amino acids. The predicted amino acid sequences showed hydrolase like domains in all six transcripts and contained two conserved motifs, GXSXG of serine hydrolase characteristics and HGGGF related to the carboxylesterase family. The deduced amino acid sequence also contained a potential catalytic triad consisted of serine, aspartic acid and histidine. Of the six transcripts, VfCXE12827 showed upregulated expression against E. ampelina at all time points. Three genes (VfCXE5585, VfCXE12827, and VfCXE13132) showed upregulation, while others (VfCXE17159, VfCXE18231, and VfCXE47674) were down regulated in grapevines infected with Botrytis cinerea. All transcripts showed upregulated expression against Rhizobium vitis at early and later time points except VfCXE12827, and were downregulated for up to 48 hours post inoculation (hpi) after upregulation at 1 hpi in response to R. vitis infection. All tested genes showed high and differential expression in response to pathogens, indicating that they all may play a role in defense pathways during pathogen infection in grapevines.

  20. Identification and Expression Profiles of Six Transcripts Encoding Carboxylesterase Protein in Vitis flexuosa Infected with Pathogens

    PubMed Central

    Islam, Md. Zaherul; Yun, Hae Keun

    2016-01-01

    Plants protect themselves from pathogen attacks via several mechanisms, including hypersensitive cell death. Recognition of pathogen attack by the plant resistance gene triggers expression of carboxylesterase genes associated with hypersensitive response. We identified six transcripts of carboxylesterase genes, Vitis flexuosa carboxylesterase 5585 (VfCXE5585), VfCXE12827, VfCXE13132, VfCXE17159, VfCXE18231, and VfCXE47674, which showed different expression patterns upon transcriptome analysis of V. flexuosa inoculated with Elsinoe ampelina. The lengths of genes ranged from 1,098 to 1,629 bp, and their encoded proteins consisted of 309 to 335 amino acids. The predicted amino acid sequences showed hydrolase like domains in all six transcripts and contained two conserved motifs, GXSXG of serine hydrolase characteristics and HGGGF related to the carboxylesterase family. The deduced amino acid sequence also contained a potential catalytic triad consisted of serine, aspartic acid and histidine. Of the six transcripts, VfCXE12827 showed upregulated expression against E. ampelina at all time points. Three genes (VfCXE5585, VfCXE12827, and VfCXE13132) showed upregulation, while others (VfCXE17159, VfCXE18231, and VfCXE47674) were down regulated in grapevines infected with Botrytis cinerea. All transcripts showed upregulated expression against Rhizobium vitis at early and later time points except VfCXE12827, and were downregulated for up to 48 hours post inoculation (hpi) after upregulation at 1 hpi in response to R. vitis infection. All tested genes showed high and differential expression in response to pathogens, indicating that they all may play a role in defense pathways during pathogen infection in grapevines. PMID:27493610

  1. Alternative Sigma Factor Over-Expression Enables Heterologous Expression of a Type II Polyketide Biosynthetic Pathway in Escherichia coli

    PubMed Central

    Stevens, David Cole; Conway, Kyle R.; Pearce, Nelson; Villegas-Peñaranda, Luis Roberto; Garza, Anthony G.; Boddy, Christopher N.

    2013-01-01

    Background Heterologous expression of bacterial biosynthetic gene clusters is currently an indispensable tool for characterizing biosynthetic pathways. Development of an effective, general heterologous expression system that can be applied to bioprospecting from metagenomic DNA will enable the discovery of a wealth of new natural products. Methodology We have developed a new Escherichia coli-based heterologous expression system for polyketide biosynthetic gene clusters. We have demonstrated the over-expression of the alternative sigma factor σ54 directly and positively regulates heterologous expression of the oxytetracycline biosynthetic gene cluster in E. coli. Bioinformatics analysis indicates that σ54 promoters are present in nearly 70% of polyketide and non-ribosomal peptide biosynthetic pathways. Conclusions We have demonstrated a new mechanism for heterologous expression of the oxytetracycline polyketide biosynthetic pathway, where high-level pleiotropic sigma factors from the heterologous host directly and positively regulate transcription of the non-native biosynthetic gene cluster. Our bioinformatics analysis is consistent with the hypothesis that heterologous expression mediated by the alternative sigma factor σ54 may be a viable method for the production of additional polyketide products. PMID:23724102

  2. Engineering of a green-light inducible gene expression system in Synechocystis sp. PCC6803.

    PubMed

    Abe, Koichi; Miyake, Kotone; Nakamura, Mayumi; Kojima, Katsuhiro; Ferri, Stefano; Ikebukuro, Kazunori; Sode, Koji

    2014-03-01

    In order to construct a green-light-regulated gene expression system for cyanobacteria, we characterized a green-light sensing system derived from Synechocystis sp. PCC6803, consisting of the green-light sensing histidine kinase CcaS, the cognate response regulator CcaR, and the promoter of cpcG2 (PcpcG 2 ). CcaS and CcaR act as a genetic controller and activate gene expression from PcpcG 2 with green-light illumination. The green-light induction level of the native PcpcG 2 was investigated using GFPuv as a reporter gene inserted in a broad-host-range vector. A clear induction of protein expression from native PcpcG 2 under green-light illumination was observed; however, the expression level was very low compared with Ptrc , which was reported to act as a constitutive promoter in cyanobacteria. Therefore, a Shine-Dalgarno-like sequence derived from the cpcB gene was inserted in the 5' untranslated region of the cpcG2 gene, and the expression level of CcaR was increased. Thus, constructed engineered green-light sensing system resulted in about 40-fold higher protein expression than with the wild-type promoter with a high ON/OFF ratio under green-light illumination. The engineered green-light gene expression system would be a useful genetic tool for controlling gene expression in the emergent cyanobacterial bioprocesses. © 2013 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

  3. Replication pattern of the pericentromeric region of chromosome 10q and expression of the RET protooncogene.

    PubMed

    Cinti, R; Schena, F; Passalacqua, M; Ceccherini, I; Ravazzolo, R

    2004-08-15

    Regulation of the RET gene is highly specific during embryo development and is strictly tissue-specific. Control of transcription depends on mechanisms influenced by epigenetic processes, in particular, histone acetylation at regions flanking the 5' end of the gene. Since the RET gene is mapped in the pericentromeric region of the human chromosome 10, the implication of epigenetic processes is even more striking and worth to be investigated in an extended chromosomal tract. One experimental approach to study the chromatin status in relationship with gene transcription is to assess the replication timing, which we did by using fluorescent in situ hybridization in cells expressing or not expressing the RET gene. By using probes spanning a 700-kb genomic region from the RET locus toward the centromere, we found a relationship between RET expression and early replication. Different patterns were observed between cells naturally expressing RET and cells induced to expression of RET by treatment with sodium butyrate, an inhibitor of histone deacetylases. Three-dimensional analysis of the nuclear localization of fluorescent signals by confocal microscopy showed difference of localization between the RET probe and a probe for a housekeeping gene, G3PDH, located at 12p13.3, in cells that do not express RET, in accordance with previous data for other genes and chromosomal regions. However, RET-expressing cells showed a localization of signals which was not consistent with that expected for expressed genes.

  4. Dominance and Sexual Dimorphism Pervade the Salix purpurea L. Transcriptome

    DOE PAGES

    Carlson, Craig H.; Choi, Yongwook; Chan, Agnes P.; ...

    2017-09-01

    The heritability of gene expression is critical in understanding heterosis and is dependent on allele-specific regulation by local and remote factors in the genome. We used RNA-Seq to test whether variation in gene expression among F 1 and F 2 intraspecific Salix purpurea progeny is attributable to cis- and trans-regulatory divergence. We assessed the mode of inheritance based on gene expression levels and allele-specific expression for F1 and F2 intraspecific progeny in two distinct tissue types: shoot tip and stem internode. In addition, we explored sexually dimorphic patterns of inheritance and regulatory divergence among F 1 progeny individuals. We showmore » that in S. purpurea intraspecific crosses, gene expression inheritance largely exhibits a maternal dominant pattern, regardless of tissue type or pedigree. A significantly greater number of cis- and trans-regulated genes coincided with upregulation of the maternal parent allele in the progeny, irrespective of the magnitude, whereas the paternal allele was higher expressed for genes showing cis × trans or compensatory regulation. Importantly, consistent with previous genetic mapping results for sex in shrub willow, we have delimited sex-biased gene expression to a 2 Mb pericentromeric region on S. purpurea chr15 and further refined the sex determination region. Lastly, altogether, our results offer insight into the inheritance of gene expression in S. purpurea as well as evidence of sexually dimorphic expression which may have contributed to the evolution of dioecy in Salix.« less

  5. Dominance and Sexual Dimorphism Pervade the Salix purpurea L. Transcriptome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Carlson, Craig H.; Choi, Yongwook; Chan, Agnes P.

    The heritability of gene expression is critical in understanding heterosis and is dependent on allele-specific regulation by local and remote factors in the genome. We used RNA-Seq to test whether variation in gene expression among F 1 and F 2 intraspecific Salix purpurea progeny is attributable to cis- and trans-regulatory divergence. We assessed the mode of inheritance based on gene expression levels and allele-specific expression for F1 and F2 intraspecific progeny in two distinct tissue types: shoot tip and stem internode. In addition, we explored sexually dimorphic patterns of inheritance and regulatory divergence among F 1 progeny individuals. We showmore » that in S. purpurea intraspecific crosses, gene expression inheritance largely exhibits a maternal dominant pattern, regardless of tissue type or pedigree. A significantly greater number of cis- and trans-regulated genes coincided with upregulation of the maternal parent allele in the progeny, irrespective of the magnitude, whereas the paternal allele was higher expressed for genes showing cis × trans or compensatory regulation. Importantly, consistent with previous genetic mapping results for sex in shrub willow, we have delimited sex-biased gene expression to a 2 Mb pericentromeric region on S. purpurea chr15 and further refined the sex determination region. Lastly, altogether, our results offer insight into the inheritance of gene expression in S. purpurea as well as evidence of sexually dimorphic expression which may have contributed to the evolution of dioecy in Salix.« less

  6. ROLES OF CELL-INTRINSIC AND MICROENVIRONMENTAL FACTORS IN PHOTORECEPTOR CELL DIFFERENTIATION

    PubMed Central

    Bradford, Rebecca L.; Wang, Chenwei; Zack, Donald J.; Adler, Ruben

    2005-01-01

    Photoreceptor differentiation requires the coordinated expression of numerous genes. It is unknown whether those genes share common regulatory mechanisms or are independently regulated by distinct mechanisms. To distinguish between these scenarios, we have used in situ hybridization, RT-PCR and real time PCR to analyze the expression of visual pigments and other photoreceptor-specific genes during chick embryo retinal development in ovo, as well as in retinal cell cultures treated with molecules that regulate the expression of particular visual pigments. In ovo, onset of gene expression was asynchronous, becoming detectable at the time of photoreceptor generation (ED 5–8) for some photoreceptor genes, but only around the time of outer segment formation (ED 14–16) for others. Treatment of retinal cell cultures with activin, staurosporine or CNTF selectively induced or down-regulated specific visual pigment genes, but many cognate rod- or cone-specific genes were not affected by the treatments. These results indicate that many photoreceptor genes are independently regulated during development, are consistent with the existence of at least two distinct stages of gene expression during photoreceptor differentiation, suggest that intrinsic, coordinated regulation of a cascade of gene expression triggered by a commitment to the photoreceptor fate is not a general mechanism of photoreceptor differentiation, and imply that using a single photoreceptor-specific “marker” as a proxy to identify photoreceptor cell fate is problematic. PMID:16120439

  7. Molecular evolution and expression of oxygen transport genes in livebearing fishes (Poeciliidae) from hydrogen sulfide rich springs.

    PubMed

    Barts, Nicholas; Greenway, Ryan; Passow, Courtney N; Arias-Rodriguez, Lenin; Kelley, Joanna L; Tobler, Michael

    2018-04-01

    Hydrogen sulfide (H 2 S) is a natural toxicant in some aquatic environments that has diverse molecular targets. It binds to oxygen transport proteins, rendering them non-functional by reducing oxygen-binding affinity. Hence, organisms permanently inhabiting H 2 S-rich environments are predicted to exhibit adaptive modifications to compensate for the reduced capacity to transport oxygen. We investigated 10 lineages of fish of the family Poeciliidae that have colonized freshwater springs rich in H 2 S-along with related lineages from non-sulfidic environments-to test hypotheses about the expression and evolution of oxygen transport genes in a phylogenetic context. We predicted shifts in the expression of and signatures of positive selection on oxygen transport genes upon colonization of H 2 S-rich habitats. Our analyses indicated significant shifts in gene expression for multiple hemoglobin genes in lineages that have colonized H 2 S-rich environments, and three hemoglobin genes exhibited relaxed selection in sulfidic compared to non-sulfidic lineages. However, neither changes in gene expression nor signatures of selection were consistent among all lineages in H 2 S-rich environments. Oxygen transport genes may consequently be predictable targets of selection during adaptation to sulfidic environments, but changes in gene expression and molecular evolution of oxygen transport genes in H 2 S-rich environments are not necessarily repeatable across replicated lineages.

  8. [Non-viral gene therapy approach for regenerative recovery of skin wounds in mammals].

    PubMed

    Efremov, A M; Dukhovlinov, I V; Dizhe, E B; Burov, S V; Leko, M V; Akif'ev, B N; Mogilenko, D A; Ivanov, I A; Perevozchikov, A P; Orlov, S V

    2010-01-01

    The rate and character of skin tissue regeneration after wounds, burns and other traumas depend on the cell proliferation within damaged area. Acceleration of healing by stimulation of cell proliferation and extracellular matrix synthesis is one of the most important tasks of modern medicine. There are gene therapy approaches to wound treatment consisting in the transfer of genes encoding mitogenic growth factors to wound area. The most important step in the development of gene therapy approaches is the design of gene delivery tools. In spite of high efficacy of viral vectors, the non-viral means have some preferences (low toxicity, low immunogenity, safety and the absence of backside effects). Among non-viral gene delivery tools, molecular conjugates are the most popular because of their efficacy, simplicity, and the capacity to the targeted gene transfer. In the present work we have developed two molecular conjugates--NLS-TSF7 and NLS-TSF12 consisting of the modified signal of nuclear localization of T-antigen of SV40 virus (cationic part) and the peptide ligands of mammalian transferrin receptor (ligand part). These conjugates bind to plasmid DNA with formation of polyelectrolytic complexes and are capable to deliver plasmid DNA into cells expressing transferrin receptors by receptor-mediated endocytosis. Transfer of the expression vector of luciferase gene in the complex with molecular conjugate NLS-TSF7 to murine surface tissues led to about 100 fold increasing of luciferase activity in comparison with the transfer of free expression vector. Treatment of slash wounds in mice with the complexes of expression vector of synthetic human gene encoding insulin-like growth factor 1 with molecular conjugates NLS-TSF7 led to acceleration of healing in comparison with mice treated with free expression vector. The results obtained confirm the high efficiency of the developed regenerative gene therapy approach for the treatment of damaged skin tissues in mammals.

  9. IDPT: Insights into potential intrinsically disordered proteins through transcriptomic analysis of genes for prostate carcinoma epigenetic data.

    PubMed

    Mallik, Saurav; Sen, Sagnik; Maulik, Ujjwal

    2016-07-15

    Involvement of intrinsically disordered proteins (IDPs) with various dreadful diseases like cancer is an interesting research topic. In order to gain novel insights into the regulation of IDPs, in this article, we perform a transcriptomic analysis of mRNAs (genes) for transcripts encoding IDPs on a human multi-omics prostate carcinoma dataset having both gene expression and methylation data. In this regard, firstly the genes that consist of both the expression and methylation data, and that are corresponding to the cancer-related prostate-tissue-specific disordered proteins of MobiDb database, are selected. We apply standard t-test for determining differentially expressed genes as well as differentially methylated genes. A network having these genes and their targeter miRNAs from Diana Tarbase v7.0 database and corresponding Transcription Factors from TRANSFAC and ITFP databases, is then built. Thereafter, we perform literature search, and KEGG pathway and Gene Ontology analyses using DAVID database. Finally, we report several significant potential gene-markers (with the corresponding IDPs) that have inverse relationship between differential expression and methylation patterns, and that are hub genes of the TF-miRNA-gene network. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Tumor SHB gene expression affects disease characteristics in human acute myeloid leukemia.

    PubMed

    Jamalpour, Maria; Li, Xiujuan; Cavelier, Lucia; Gustafsson, Karin; Mostoslavsky, Gustavo; Höglund, Martin; Welsh, Michael

    2017-10-01

    The mouse Shb gene coding for the Src Homology 2-domain containing adapter protein B has recently been placed in context of BCRABL1-induced myeloid leukemia in mice and the current study was performed in order to relate SHB to human acute myeloid leukemia (AML). Publicly available AML databases were mined for SHB gene expression and patient survival. SHB gene expression was determined in the Uppsala cohort of AML patients by qPCR. Cell proliferation was determined after SHB gene knockdown in leukemic cell lines. Despite a low frequency of SHB gene mutations, many tumors overexpressed SHB mRNA compared with normal myeloid blood cells. AML patients with tumors expressing low SHB mRNA displayed longer survival times. A subgroup of AML exhibiting a favorable prognosis, acute promyelocytic leukemia (APL) with a PMLRARA translocation, expressed less SHB mRNA than AML tumors in general. When examining genes co-expressed with SHB in AML tumors, four other genes ( PAX5, HDAC7, BCORL1, TET1) related to leukemia were identified. A network consisting of these genes plus SHB was identified that relates to certain phenotypic characteristics, such as immune cell, vascular and apoptotic features. SHB knockdown in the APL PMLRARA cell line NB4 and the monocyte/macrophage cell line MM6 adversely affected proliferation, linking SHB gene expression to tumor cell expansion and consequently to patient survival. It is concluded that tumor SHB gene expression relates to AML survival and its subgroup APL. Moreover, this gene is included in a network of genes that plays a role for an AML phenotype exhibiting certain immune cell, vascular and apoptotic characteristics.

  11. Modeling Bi-modality Improves Characterization of Cell Cycle on Gene Expression in Single Cells

    PubMed Central

    Danaher, Patrick; Finak, Greg; Krouse, Michael; Wang, Alice; Webster, Philippa; Beechem, Joseph; Gottardo, Raphael

    2014-01-01

    Advances in high-throughput, single cell gene expression are allowing interrogation of cell heterogeneity. However, there is concern that the cell cycle phase of a cell might bias characterizations of gene expression at the single-cell level. We assess the effect of cell cycle phase on gene expression in single cells by measuring 333 genes in 930 cells across three phases and three cell lines. We determine each cell's phase non-invasively without chemical arrest and use it as a covariate in tests of differential expression. We observe bi-modal gene expression, a previously-described phenomenon, wherein the expression of otherwise abundant genes is either strongly positive, or undetectable within individual cells. This bi-modality is likely both biologically and technically driven. Irrespective of its source, we show that it should be modeled to draw accurate inferences from single cell expression experiments. To this end, we propose a semi-continuous modeling framework based on the generalized linear model, and use it to characterize genes with consistent cell cycle effects across three cell lines. Our new computational framework improves the detection of previously characterized cell-cycle genes compared to approaches that do not account for the bi-modality of single-cell data. We use our semi-continuous modelling framework to estimate single cell gene co-expression networks. These networks suggest that in addition to having phase-dependent shifts in expression (when averaged over many cells), some, but not all, canonical cell cycle genes tend to be co-expressed in groups in single cells. We estimate the amount of single cell expression variability attributable to the cell cycle. We find that the cell cycle explains only 5%–17% of expression variability, suggesting that the cell cycle will not tend to be a large nuisance factor in analysis of the single cell transcriptome. PMID:25032992

  12. Annotation of gene function in citrus using gene expression information and co-expression networks

    PubMed Central

    2014-01-01

    Background The genus Citrus encompasses major cultivated plants such as sweet orange, mandarin, lemon and grapefruit, among the world’s most economically important fruit crops. With increasing volumes of transcriptomics data available for these species, Gene Co-expression Network (GCN) analysis is a viable option for predicting gene function at a genome-wide scale. GCN analysis is based on a “guilt-by-association” principle whereby genes encoding proteins involved in similar and/or related biological processes may exhibit similar expression patterns across diverse sets of experimental conditions. While bioinformatics resources such as GCN analysis are widely available for efficient gene function prediction in model plant species including Arabidopsis, soybean and rice, in citrus these tools are not yet developed. Results We have constructed a comprehensive GCN for citrus inferred from 297 publicly available Affymetrix Genechip Citrus Genome microarray datasets, providing gene co-expression relationships at a genome-wide scale (33,000 transcripts). The comprehensive citrus GCN consists of a global GCN (condition-independent) and four condition-dependent GCNs that survey the sweet orange species only, all citrus fruit tissues, all citrus leaf tissues, or stress-exposed plants. All of these GCNs are clustered using genome-wide, gene-centric (guide) and graph clustering algorithms for flexibility of gene function prediction. For each putative cluster, gene ontology (GO) enrichment and gene expression specificity analyses were performed to enhance gene function, expression and regulation pattern prediction. The guide-gene approach was used to infer novel roles of genes involved in disease susceptibility and vitamin C metabolism, and graph-clustering approaches were used to investigate isoprenoid/phenylpropanoid metabolism in citrus peel, and citric acid catabolism via the GABA shunt in citrus fruit. Conclusions Integration of citrus gene co-expression networks, functional enrichment analysis and gene expression information provide opportunities to infer gene function in citrus. We present a publicly accessible tool, Network Inference for Citrus Co-Expression (NICCE, http://citrus.adelaide.edu.au/nicce/home.aspx), for the gene co-expression analysis in citrus. PMID:25023870

  13. Meta-analysis of cancer gene expression signatures reveals new cancer genes, SAGE tags and tumor associated regions of co-regulation

    PubMed Central

    Kavak, Erşen; Ünlü, Mustafa; Nistér, Monica; Koman, Ahmet

    2010-01-01

    Cancer is among the major causes of human death and its mechanism(s) are not fully understood. We applied a novel meta-analysis approach to multiple sets of merged serial analysis of gene expression and microarray cancer data in order to analyze transcriptome alterations in human cancer. Our methodology, which we denote ‘COgnate Gene Expression patterNing in tumours’ (COGENT), unmasked numerous genes that were differentially expressed in multiple cancers. COGENT detected well-known tumor-associated (TA) genes such as TP53, EGFR and VEGF, as well as many multi-cancer, but not-yet-tumor-associated genes. In addition, we identified 81 co-regulated regions on the human genome (RIDGEs) by using expression data from all cancers. Some RIDGEs (28%) consist of paralog genes while another subset (30%) are specifically dysregulated in tumors but not in normal tissues. Furthermore, a significant number of RIDGEs are associated with GC-rich regions on the genome. All assembled data is freely available online (www.oncoreveal.org) as a tool implementing COGENT analysis of multi-cancer genes and RIDGEs. These findings engender a deeper understanding of cancer biology by demonstrating the existence of a pool of under-studied multi-cancer genes and by highlighting the cancer-specificity of some TA-RIDGEs. PMID:20621981

  14. Genes@Work: an efficient algorithm for pattern discovery and multivariate feature selection in gene expression data.

    PubMed

    Lepre, Jorge; Rice, J Jeremy; Tu, Yuhai; Stolovitzky, Gustavo

    2004-05-01

    Despite the growing literature devoted to finding differentially expressed genes in assays probing different tissues types, little attention has been paid to the combinatorial nature of feature selection inherent to large, high-dimensional gene expression datasets. New flexible data analysis approaches capable of searching relevant subgroups of genes and experiments are needed to understand multivariate associations of gene expression patterns with observed phenotypes. We present in detail a deterministic algorithm to discover patterns of multivariate gene associations in gene expression data. The patterns discovered are differential with respect to a control dataset. The algorithm is exhaustive and efficient, reporting all existent patterns that fit a given input parameter set while avoiding enumeration of the entire pattern space. The value of the pattern discovery approach is demonstrated by finding a set of genes that differentiate between two types of lymphoma. Moreover, these genes are found to behave consistently in an independent dataset produced in a different laboratory using different arrays, thus validating the genes selected using our algorithm. We show that the genes deemed significant in terms of their multivariate statistics will be missed using other methods. Our set of pattern discovery algorithms including a user interface is distributed as a package called Genes@Work. This package is freely available to non-commercial users and can be downloaded from our website (http://www.research.ibm.com/FunGen).

  15. Phytoplankton-bacterial interactions mediate micronutrient colimitation at the coastal Antarctic sea ice edge.

    PubMed

    Bertrand, Erin M; McCrow, John P; Moustafa, Ahmed; Zheng, Hong; McQuaid, Jeffrey B; Delmont, Tom O; Post, Anton F; Sipler, Rachel E; Spackeen, Jenna L; Xu, Kai; Bronk, Deborah A; Hutchins, David A; Allen, Andrew E

    2015-08-11

    Southern Ocean primary productivity plays a key role in global ocean biogeochemistry and climate. At the Southern Ocean sea ice edge in coastal McMurdo Sound, we observed simultaneous cobalamin and iron limitation of surface water phytoplankton communities in late Austral summer. Cobalamin is produced only by bacteria and archaea, suggesting phytoplankton-bacterial interactions must play a role in this limitation. To characterize these interactions and investigate the molecular basis of multiple nutrient limitation, we examined transitions in global gene expression over short time scales, induced by shifts in micronutrient availability. Diatoms, the dominant primary producers, exhibited transcriptional patterns indicative of co-occurring iron and cobalamin deprivation. The major contributor to cobalamin biosynthesis gene expression was a gammaproteobacterial population, Oceanospirillaceae ASP10-02a. This group also contributed significantly to metagenomic cobalamin biosynthesis gene abundance throughout Southern Ocean surface waters. Oceanospirillaceae ASP10-02a displayed elevated expression of organic matter acquisition and cell surface attachment-related genes, consistent with a mutualistic relationship in which they are dependent on phytoplankton growth to fuel cobalamin production. Separate bacterial groups, including Methylophaga, appeared to rely on phytoplankton for carbon and energy sources, but displayed gene expression patterns consistent with iron and cobalamin deprivation. This suggests they also compete with phytoplankton and are important cobalamin consumers. Expression patterns of siderophore- related genes offer evidence for bacterial influences on iron availability as well. The nature and degree of this episodic colimitation appear to be mediated by a series of phytoplankton-bacterial interactions in both positive and negative feedback loops.

  16. Phytoplankton–bacterial interactions mediate micronutrient colimitation at the coastal Antarctic sea ice edge

    PubMed Central

    Bertrand, Erin M.; McCrow, John P.; Moustafa, Ahmed; Zheng, Hong; McQuaid, Jeffrey B.; Delmont, Tom O.; Post, Anton F.; Sipler, Rachel E.; Spackeen, Jenna L.; Xu, Kai; Bronk, Deborah A.; Hutchins, David A.; Allen, Andrew E.

    2015-01-01

    Southern Ocean primary productivity plays a key role in global ocean biogeochemistry and climate. At the Southern Ocean sea ice edge in coastal McMurdo Sound, we observed simultaneous cobalamin and iron limitation of surface water phytoplankton communities in late Austral summer. Cobalamin is produced only by bacteria and archaea, suggesting phytoplankton–bacterial interactions must play a role in this limitation. To characterize these interactions and investigate the molecular basis of multiple nutrient limitation, we examined transitions in global gene expression over short time scales, induced by shifts in micronutrient availability. Diatoms, the dominant primary producers, exhibited transcriptional patterns indicative of co-occurring iron and cobalamin deprivation. The major contributor to cobalamin biosynthesis gene expression was a gammaproteobacterial population, Oceanospirillaceae ASP10-02a. This group also contributed significantly to metagenomic cobalamin biosynthesis gene abundance throughout Southern Ocean surface waters. Oceanospirillaceae ASP10-02a displayed elevated expression of organic matter acquisition and cell surface attachment-related genes, consistent with a mutualistic relationship in which they are dependent on phytoplankton growth to fuel cobalamin production. Separate bacterial groups, including Methylophaga, appeared to rely on phytoplankton for carbon and energy sources, but displayed gene expression patterns consistent with iron and cobalamin deprivation. This suggests they also compete with phytoplankton and are important cobalamin consumers. Expression patterns of siderophore- related genes offer evidence for bacterial influences on iron availability as well. The nature and degree of this episodic colimitation appear to be mediated by a series of phytoplankton–bacterial interactions in both positive and negative feedback loops. PMID:26221022

  17. Analysis of Microbe-Associated Molecular Pattern-Responsive Synthetic Promoters with the Parsley Protoplast System.

    PubMed

    Kanofsky, Konstantin; Lehmeyer, Mona; Schulze, Jutta; Hehl, Reinhard

    2016-01-01

    Plants recognize pathogens by microbe-associated molecular patterns (MAMPs) and subsequently induce an immune response. The regulation of gene expression during the immune response depends largely on cis-sequences conserved in promoters of MAMP-responsive genes. These cis-sequences can be analyzed by constructing synthetic promoters linked to a reporter gene and by testing these constructs in transient expression systems. Here, the use of the parsley (Petroselinum crispum) protoplast system for analyzing MAMP-responsive synthetic promoters is described. The synthetic promoter consists of four copies of a potential MAMP-responsive cis-sequence cloned upstream of a minimal promoter and the uidA reporter gene. The reporter plasmid contains a second reporter gene, which is constitutively expressed and hence eliminates the requirement of a second plasmid used as a transformation control. The reporter plasmid is transformed into parsley protoplasts that are elicited by the MAMP Pep25. The MAMP responsiveness is validated by comparing the reporter gene activity from MAMP-treated and untreated cells and by normalizing reporter gene activity using the constitutively expressed reporter gene.

  18. Evolution and Variation of Renin Genes in Mice

    PubMed Central

    Dickinson, Douglas P.; Gross, Kenneth W.; Piccini, Nina; Wilson, Carol M.

    1984-01-01

    Inbred strains of mice carry Ren-1, a gene encoding the thermostable Renin-1 isozyme. Ren-1 is expressed at relatively low levels in mouse submandibular gland and kidney. Some strains also carry Ren-2, a gene encoding the thermolabile Renin-2 isozyme. Ren-2 is expressed at high levels in the mouse submandibular gland and at very low levels, if at all, in the kidney. Ren-1 and Ren-2 are closely linked on mouse chromosome 1, show extensive homology in coding and noncoding regions and provide a model for studying the regulation of gene expression. An investigation of renin genes and enzymatic activity in wild-derived mice identified several restriction site polymorphisms as well as putative variants in renin gene expression and protein structure. The number of renin genes carried by different subpopulations of wild-derived mice is consistent with the occurrence of a gene duplication event prior to the divergence of M. spretus (2.75–5.5 million yr ago). This conclusion is in agreement with a prior estimate based upon comparative sequence analysis of Ren-1 and Ren-2 from inbred laboratory mice. PMID:6389258

  19. Embryonic stem cell-like features of testicular carcinoma in situ revealed by genome-wide gene expression profiling.

    PubMed

    Almstrup, Kristian; Hoei-Hansen, Christina E; Wirkner, Ute; Blake, Jonathon; Schwager, Christian; Ansorge, Wilhelm; Nielsen, John E; Skakkebaek, Niels E; Rajpert-De Meyts, Ewa; Leffers, Henrik

    2004-07-15

    Carcinoma in situ (CIS) is the common precursor of histologically heterogeneous testicular germ cell tumors (TGCTs), which in recent decades have markedly increased and now are the most common malignancy of young men. Using genome-wide gene expression profiling, we identified >200 genes highly expressed in testicular CIS, including many never reported in testicular neoplasms. Expression was further verified by semiquantitative reverse transcription-PCR and in situ hybridization. Among the highest expressed genes were NANOG and POU5F1, and reverse transcription-PCR revealed possible changes in their stoichiometry on progression into embryonic carcinoma. We compared the CIS expression profile with patterns reported in embryonic stem cells (ESCs), which revealed a substantial overlap that may be as high as 50%. We also demonstrated an over-representation of expressed genes in regions of 17q and 12, reported as unstable in cultured ESCs. The close similarity between CIS and ESCs explains the pluripotency of CIS. Moreover, the findings are consistent with an early prenatal origin of TGCTs and thus suggest that etiologic factors operating in utero are of primary importance for the incidence trends of TGCTs. Finally, some of the highly expressed genes identified in this study are promising candidates for new diagnostic markers for CIS and/or TGCTs.

  20. Gene expression changes consistent with neuroAIDS and impaired working memory in HIV-1 transgenic rats

    PubMed Central

    2014-01-01

    Background A thorough investigation of the neurobiology of HIV-induced neuronal dysfunction and its evolving phenotype in the setting of viral suppression has been limited by the lack of validated small animal models to probe the effects of concomitant low level expression of multiple HIV-1 products in disease-relevant cells in the CNS. Results We report the results of gene expression profiling of the hippocampus of HIV-1 Tg rats, a rodent model of HIV infection in which multiple HIV-1 proteins are expressed under the control of the viral LTR promoter in disease-relevant cells including microglia and astrocytes. The Gene Set Enrichment Analysis (GSEA) algorithm was used for pathway analysis. Gene expression changes observed are consistent with astrogliosis and microgliosis and include evidence of inflammation and cell proliferation. Among the genes with increased expression in HIV-1 Tg rats was the interferon stimulated gene 15 (ISG-15), which was previously shown to be increased in the cerebrospinal fluid (CSF) of HIV patients and to correlate with neuropsychological impairment and neuropathology, and prostaglandin D2 (PGD2) synthase (Ptgds), which has been associated with immune activation and the induction of astrogliosis and microgliosis. GSEA-based pathway analysis highlighted a broad dysregulation of genes involved in neuronal trophism and neurodegenerative disorders. Among the latter are genesets associated with Huntington’s disease, Parkinson’s disease, mitochondrial, peroxisome function, and synaptic trophism and plasticity, such as IGF, ErbB and netrin signaling and the PI3K signal transduction pathway, a mediator of neural plasticity and of a vast array of trophic signals. Additionally, gene expression analyses also show altered lipid metabolism and peroxisomes dysfunction. Supporting the functional significance of these gene expression alterations, HIV-1 Tg rats showed working memory impairments in spontaneous alternation behavior in the T-Maze, a paradigm sensitive to prefrontal cortex and hippocampal function. Conclusions Altogether, differentially regulated genes and pathway analysis identify specific pathways that can be targeted therapeutically to increase trophic support, e.g. IGF, ErbB and netrin signaling, and reduce neuroinflammation, e.g. PGD2 synthesis, which may be beneficial in the treatment of chronic forms of HIV-associated neurocognitive disorders in the setting of viral suppression. PMID:24980976

  1. Developmental Transcriptomic Features of the Carcinogenic Liver Fluke, Clonorchis sinensis

    PubMed Central

    Cho, Pyo Yun; Kim, Tae Im; Cho, Shin-Hyeong; Choi, Sang-Haeng; Park, Hong-Seog; Kim, Tong-Soo; Hong, Sung-Jong

    2011-01-01

    Clonorchis sinensis is the causative agent of the life-threatening disease endemic to China, Korea, and Vietnam. It is estimated that about 15 million people are infected with this fluke. C. sinensis provokes inflammation, epithelial hyperplasia, and periductal fibrosis in bile ducts, and may cause cholangiocarcinoma in chronically infected individuals. Accumulation of a large amount of biological information about the adult stage of this liver fluke in recent years has advanced our understanding of the pathological interplay between this parasite and its hosts. However, no developmental gene expression profiles of C. sinensis have been published. In this study, we generated gene expression profiles of three developmental stages of C. sinensis by analyzing expressed sequence tags (ESTs). Complementary DNA libraries were constructed from the adult, metacercaria, and egg developmental stages of C. sinensis. A total of 52,745 ESTs were generated and assembled into 12,830 C. sinensis assembled EST sequences, and then these assemblies were further categorized into groups according to biological functions and developmental stages. Most of the genes that were differentially expressed in the different stages were consistent with the biological and physical features of the particular developmental stage; high energy metabolism, motility and reproduction genes were differentially expressed in adults, minimal metabolism and final host adaptation genes were differentially expressed in metacercariae, and embryonic genes were differentially expressed in eggs. The higher expression of glucose transporters, proteases, and antioxidant enzymes in the adults accounts for active uptake of nutrients and defense against host immune attacks. The types of ion channels present in C. sinensis are consistent with its parasitic nature and phylogenetic placement in the tree of life. We anticipate that the transcriptomic information on essential regulators of development, bile chemotaxis, and physico-metabolic pathways in C. sinensis that presented in this study will guide further studies to identify novel drug targets and diagnostic antigens. PMID:21738807

  2. Directed random walks and constraint programming reveal active pathways in hepatocyte growth factor signaling.

    PubMed

    Kittas, Aristotelis; Delobelle, Aurélien; Schmitt, Sabrina; Breuhahn, Kai; Guziolowski, Carito; Grabe, Niels

    2016-01-01

    An effective means to analyze mRNA expression data is to take advantage of established knowledge from pathway databases, using methods such as pathway-enrichment analyses. However, pathway databases are not case-specific and expression data could be used to infer gene-regulation patterns in the context of specific pathways. In addition, canonical pathways may not always describe the signaling mechanisms properly, because interactions can frequently occur between genes in different pathways. Relatively few methods have been proposed to date for generating and analyzing such networks, preserving the causality between gene interactions and reasoning over the qualitative logic of regulatory effects. We present an algorithm (MCWalk) integrated with a logic programming approach, to discover subgraphs in large-scale signaling networks by random walks in a fully automated pipeline. As an exemplary application, we uncover the signal transduction mechanisms in a gene interaction network describing hepatocyte growth factor-stimulated cell migration and proliferation from gene-expression measured with microarray and RT-qPCR using in-house perturbation experiments in a keratinocyte-fibroblast co-culture. The resulting subgraphs illustrate possible associations of hepatocyte growth factor receptor c-Met nodes, differentially expressed genes and cellular states. Using perturbation experiments and Answer Set programming, we are able to select those which are more consistent with the experimental data. We discover key regulator nodes by measuring the frequency with which they are traversed when connecting signaling between receptors and significantly regulated genes and predict their expression-shift consistently with the measured data. The Java implementation of MCWalk is publicly available under the MIT license at: https://bitbucket.org/akittas/biosubg. © 2015 FEBS.

  3. Effects of advancing gestation and non-Caucasian race on ductus arteriosus gene expression

    PubMed Central

    Waleh, Nahid; Barrette, Anne Marie; Dagle, John M.; Momany, Allison; Jin, Chengshi; Hills, Nancy K.; Shelton, Elaine L.; Reese, Jeff; Clyman, Ronald I.

    2015-01-01

    Objective To identify genes affected by advancing gestation and racial/ethnic origin in human ductus arteriosus (DA). Study design We collected three sets of DA tissue (n=93, n=89, n=91; total = 273 fetuses) from second trimester pregnancies. We examined four genes, with DNA polymorphisms that distribute along racial lines, to identify "Caucasian" and "Non-Caucasian" DA. We used RT-PCR to measure RNA expression of 48 candidate genes involved in functional closure of the DA, and used multivariable regression analyses to examine the relationships between advancing gestation, "Non-Caucasian" race, and gene expression. Results Mature gestation and Non-Caucasian race are significant predictors for identifying infants who will close their patent DA when treated with indomethacin. Advancing gestation consistently altered gene expression in pathways involved with oxygen-induced constriction (e.g., calcium-channels, potassium-channels, and endothelin signaling), contractile protein maturation, tissue remodeling, and prostaglandin and nitric oxide signaling in all three tissue sets. None of the pathways involved with oxygen-induced constriction appeared to be altered in "Non-Caucasian" DA. Two genes, SLCO2A1 and NOS3, (involved with prostaglandin reuptake/metabolism and nitric oxide production, respectively) were consistently decreased in "Non-Caucasian" DA. Conclusions Prostaglandins and nitric oxide are the most important vasodilators opposing DA closure. Indomethacin inhibits prostaglandin production, but not nitric oxide production. Because decreased SLCO2A1 and NOS3 expression can lead to increased prostaglandin and decreased nitric oxide concentrations, we speculate that prostaglandin-mediated vasodilation may play a more dominant role in maintaining the "Non-Caucasian" PDA, making it more likely to close when inhibited by indomethacin. PMID:26265282

  4. Gene expression signature of benign prostatic hyperplasia revealed by cDNA microarray analysis.

    PubMed

    Luo, Jun; Dunn, Thomas; Ewing, Charles; Sauvageot, Jurga; Chen, Yidong; Trent, Jeffrey; Isaacs, William

    2002-05-15

    Despite the high prevalence of benign prostatic hyperplasia (BPH) in the aging male, little is known regarding the etiology of this disease. A better understanding of the molecular etiology of BPH would be facilitated by a comprehensive analysis of gene expression patterns that are characteristic of benign growth in the prostate gland. Since genes differentially expressed between BPH and normal prostate tissues are likely to reflect underlying pathogenic mechanisms involved in the development of BPH, we performed comparative gene expression analysis using cDNA microarray technology to identify candidate genes associated with BPH. Total RNA was extracted from a set of 9 BPH specimens from men with extensive hyperplasia and a set of 12 histologically normal prostate tissues excised from radical prostatectomy specimens. Each of these 21 RNA samples was labeled with Cy3 in a reverse transcription reaction and cohybridized with a Cy5 labeled common reference sample to a cDNA microarray containing 6,500 human genes. Normalized fluorescent intensity ratios from each hybridization experiment were extracted to represent the relative mRNA abundance for each gene in each sample. Weighted gene and random permutation analyses were performed to generate a subset of genes with statistically significant differences in expression between BPH and normal prostate tissues. Semi-quantitative PCR analysis was performed to validate differential expression. A subset of 76 genes involved in a wide range of cellular functions was identified to be differentially expressed between BPH and normal prostate tissues. Semi-quantitative PCR was performed on 10 genes and 8 were validated. Genes consistently upregulated in BPH when compared to normal prostate tissues included: a restricted set of growth factors and their binding proteins (e.g. IGF-1 and -2, TGF-beta3, BMP5, latent TGF-beta binding protein 1 and -2); hydrolases, proteases, and protease inhibitors (e.g. neuropathy target esterase, MMP2, alpha-2-macroglobulin); stress response enzymes (e.g. COX2, GSTM5); and extracellular matrix molecules (e.g. laminin alpha 4 and beta 1, chondroitin sulfate proteoglycan 2, lumican). Genes consistently expressing less mRNA in BPH than in normal prostate tissues were less commonly observed and included the transcription factor KLF4, thrombospondin 4, nitric oxide synthase 2A, transglutaminase 3, and gastrin releasing peptide. We identified a diverse set of genes that are potentially related to benign prostatic hyperplasia, including genes both previously implicated in BPH pathogenesis as well as others not previously linked to this disease. Further targeted validation and investigations of these genes at the DNA, mRNA, and protein levels are warranted to determine the clinical relevance and possible therapeutic utility of these genes. Copyright 2002 Wiley-Liss, Inc.

  5. AhR-mediated gene expression in the developing mouse telencephalon.

    PubMed

    Gohlke, Julia M; Stockton, Pat S; Sieber, Stella; Foley, Julie; Portier, Christopher J

    2009-11-01

    We hypothesize that TCDD-induced developmental neurotoxicity is modulated through an AhR-dependent interaction with key regulatory neuronal differentiation pathways during telencephalon development. To test this hypothesis we examined global gene expression in both dorsal and ventral telencephalon tissues in E13.5 AhR-/- and wildtype mice exposed to TCDD or vehicle. Consistent with previous biochemical, pathological and behavioral studies, our results suggest TCDD initiated changes in gene expression in the developing telencephalon are primarily AhR-dependent, as no statistically significant gene expression changes are evident after TCDD exposure in AhR-/- mice. Based on a gene regulatory network for neuronal specification in the developing telencephalon, the present analysis suggests differentiation of GABAergic neurons in the ventral telencephalon is compromised in TCDD exposed and AhR-/- mice. In addition, our analysis suggests Sox11 may be directly regulated by AhR based on gene expression and comparative genomics analyses. In conclusion, this analysis supports the hypothesis that AhR has a specific role in the normal development of the telencephalon and provides a mechanistic framework for neurodevelopmental toxicity of chemicals that perturb AhR signaling.

  6. Fully moderated T-statistic for small sample size gene expression arrays.

    PubMed

    Yu, Lianbo; Gulati, Parul; Fernandez, Soledad; Pennell, Michael; Kirschner, Lawrence; Jarjoura, David

    2011-09-15

    Gene expression microarray experiments with few replications lead to great variability in estimates of gene variances. Several Bayesian methods have been developed to reduce this variability and to increase power. Thus far, moderated t methods assumed a constant coefficient of variation (CV) for the gene variances. We provide evidence against this assumption, and extend the method by allowing the CV to vary with gene expression. Our CV varying method, which we refer to as the fully moderated t-statistic, was compared to three other methods (ordinary t, and two moderated t predecessors). A simulation study and a familiar spike-in data set were used to assess the performance of the testing methods. The results showed that our CV varying method had higher power than the other three methods, identified a greater number of true positives in spike-in data, fit simulated data under varying assumptions very well, and in a real data set better identified higher expressing genes that were consistent with functional pathways associated with the experiments.

  7. Stem cell and neurogenic gene-expression profiles link prostate basal cells to aggressive prostate cancer

    PubMed Central

    Zhang, Dingxiao; Park, Daechan; Zhong, Yi; Lu, Yue; Rycaj, Kiera; Gong, Shuai; Chen, Xin; Liu, Xin; Chao, Hsueh-Ping; Whitney, Pamela; Calhoun-Davis, Tammy; Takata, Yoko; Shen, Jianjun; Iyer, Vishwanath R.; Tang, Dean G.

    2016-01-01

    The prostate gland mainly contains basal and luminal cells constructed as a pseudostratified epithelium. Annotation of prostate epithelial transcriptomes provides a foundation for discoveries that can impact disease understanding and treatment. Here we describe a genome-wide transcriptome analysis of human benign prostatic basal and luminal epithelial populations using deep RNA sequencing. Through molecular and biological characterizations, we show that the differential gene-expression profiles account for their distinct functional properties. Strikingly, basal cells preferentially express gene categories associated with stem cells, neurogenesis and ribosomal RNA (rRNA) biogenesis. Consistent with this profile, basal cells functionally exhibit intrinsic stem-like and neurogenic properties with enhanced rRNA transcription activity. Of clinical relevance, the basal cell gene-expression profile is enriched in advanced, anaplastic, castration-resistant and metastatic prostate cancers. Therefore, we link the cell-type-specific gene signatures to aggressive subtypes of prostate cancer and identify gene signatures associated with adverse clinical features. PMID:26924072

  8. Stem cell and neurogenic gene-expression profiles link prostate basal cells to aggressive prostate cancer.

    PubMed

    Zhang, Dingxiao; Park, Daechan; Zhong, Yi; Lu, Yue; Rycaj, Kiera; Gong, Shuai; Chen, Xin; Liu, Xin; Chao, Hsueh-Ping; Whitney, Pamela; Calhoun-Davis, Tammy; Takata, Yoko; Shen, Jianjun; Iyer, Vishwanath R; Tang, Dean G

    2016-02-29

    The prostate gland mainly contains basal and luminal cells constructed as a pseudostratified epithelium. Annotation of prostate epithelial transcriptomes provides a foundation for discoveries that can impact disease understanding and treatment. Here we describe a genome-wide transcriptome analysis of human benign prostatic basal and luminal epithelial populations using deep RNA sequencing. Through molecular and biological characterizations, we show that the differential gene-expression profiles account for their distinct functional properties. Strikingly, basal cells preferentially express gene categories associated with stem cells, neurogenesis and ribosomal RNA (rRNA) biogenesis. Consistent with this profile, basal cells functionally exhibit intrinsic stem-like and neurogenic properties with enhanced rRNA transcription activity. Of clinical relevance, the basal cell gene-expression profile is enriched in advanced, anaplastic, castration-resistant and metastatic prostate cancers. Therefore, we link the cell-type-specific gene signatures to aggressive subtypes of prostate cancer and identify gene signatures associated with adverse clinical features.

  9. Ecological transcriptomics of lake-type and riverine sockeye salmon (Oncorhynchus nerka)

    PubMed Central

    2011-01-01

    Background There are a growing number of genomes sequenced with tentative functions assigned to a large proportion of the individual genes. Model organisms in laboratory settings form the basis for the assignment of gene function, and the ecological context of gene function is lacking. This work addresses this shortcoming by investigating expressed genes of sockeye salmon (Oncorhynchus nerka) muscle tissue. We compared morphology and gene expression in natural juvenile sockeye populations related to river and lake habitats. Based on previously documented divergent morphology, feeding strategy, and predation in association with these distinct environments, we expect that burst swimming is favored in riverine population and continuous swimming is favored in lake-type population. In turn we predict that morphology and expressed genes promote burst swimming in riverine sockeye and continuous swimming in lake-type sockeye. Results We found the riverine sockeye population had deep, robust bodies and lake-type had shallow, streamlined bodies. Gene expression patterns were measured using a 16K microarray, discovering 141 genes with significant differential expression. Overall, the identity and function of these genes was consistent with our hypothesis. In addition, Gene Ontology (GO) enrichment analyses with a larger set of differentially expressed genes found the "biosynthesis" category enriched for the riverine population and the "metabolism" category enriched for the lake-type population. Conclusions This study provides a framework for understanding sockeye life history from a transcriptomic perspective and a starting point for more extensive, targeted studies determining the ecological context of genes. PMID:22136247

  10. Suppression of prolactin gene expression in GH cells correlates with site-specific DNA methylation.

    PubMed

    Zhang, Z X; Kumar, V; Rivera, R T; Pasion, S G; Chisholm, J; Biswas, D K

    1989-10-01

    Prolactin- (PRL) producing and nonproducing subclones of the GH line of (rat) pituitary tumor cells have been compared to elucidate the regulatory mechanisms of PRL gene expression. Particular emphasis was placed on delineating the molecular basis of the suppressed state of the PRL gene in the prolactin-nonproducing (PRL-) GH subclone (GH(1)2C1). We examined six methylatable cytosine residues (5, -CCGG- and 1, -GCGC-) within the 30-kb region of the PRL gene in these subclones. This analysis revealed that -CCGG-sequences of the transcribed region, and specifically, one in the fourth exon of the PRL gene, were heavily methylated in the PRL-, GH(1)2C1 cells. Furthermore, the inhibition of PRL gene expression in GH(1)2C1 was reversed by short-term treatment of the cells with a sublethal concentration of azacytidine (AzaC), an inhibitor of DNA methylation. The reversion of PRL gene expression by AzaC was correlated with the concurrent demethylation of the same -CCGG- sequences in the transcribed region of PRL gene. An inverse correlation between PRL gene expression and the level of methylation of the internal -C- residues in the specific -CCGG-sequence of the transcribed region of the PRL gene was demonstrated. The DNase I sensitivity of these regions of the PRL gene in PRL+, PRL-, and AzaC-treated cells was also consistent with an inverse relationship between methylation state, a higher order of structural modification, and gene expression.(ABSTRACT TRUNCATED AT 250 WORDS)

  11. Ecological transcriptomics of lake-type and riverine sockeye salmon (Oncorhynchus nerka).

    PubMed

    Pavey, Scott A; Sutherland, Ben J G; Leong, Jong; Robb, Adrienne; von Schalburg, Kris; Hamon, Troy R; Koop, Ben F; Nielsen, Jennifer L

    2011-12-02

    There are a growing number of genomes sequenced with tentative functions assigned to a large proportion of the individual genes. Model organisms in laboratory settings form the basis for the assignment of gene function, and the ecological context of gene function is lacking. This work addresses this shortcoming by investigating expressed genes of sockeye salmon (Oncorhynchus nerka) muscle tissue. We compared morphology and gene expression in natural juvenile sockeye populations related to river and lake habitats. Based on previously documented divergent morphology, feeding strategy, and predation in association with these distinct environments, we expect that burst swimming is favored in riverine population and continuous swimming is favored in lake-type population. In turn we predict that morphology and expressed genes promote burst swimming in riverine sockeye and continuous swimming in lake-type sockeye. We found the riverine sockeye population had deep, robust bodies and lake-type had shallow, streamlined bodies. Gene expression patterns were measured using a 16 k microarray, discovering 141 genes with significant differential expression. Overall, the identity and function of these genes was consistent with our hypothesis. In addition, Gene Ontology (GO) enrichment analyses with a larger set of differentially expressed genes found the "biosynthesis" category enriched for the riverine population and the "metabolism" category enriched for the lake-type population. This study provides a framework for understanding sockeye life history from a transcriptomic perspective and a starting point for more extensive, targeted studies determining the ecological context of genes.

  12. Modeling genome-wide dynamic regulatory network in mouse lungs with influenza infection using high-dimensional ordinary differential equations.

    PubMed

    Wu, Shuang; Liu, Zhi-Ping; Qiu, Xing; Wu, Hulin

    2014-01-01

    The immune response to viral infection is regulated by an intricate network of many genes and their products. The reverse engineering of gene regulatory networks (GRNs) using mathematical models from time course gene expression data collected after influenza infection is key to our understanding of the mechanisms involved in controlling influenza infection within a host. A five-step pipeline: detection of temporally differentially expressed genes, clustering genes into co-expressed modules, identification of network structure, parameter estimate refinement, and functional enrichment analysis, is developed for reconstructing high-dimensional dynamic GRNs from genome-wide time course gene expression data. Applying the pipeline to the time course gene expression data from influenza-infected mouse lungs, we have identified 20 distinct temporal expression patterns in the differentially expressed genes and constructed a module-based dynamic network using a linear ODE model. Both intra-module and inter-module annotations and regulatory relationships of our inferred network show some interesting findings and are highly consistent with existing knowledge about the immune response in mice after influenza infection. The proposed method is a computationally efficient, data-driven pipeline bridging experimental data, mathematical modeling, and statistical analysis. The application to the influenza infection data elucidates the potentials of our pipeline in providing valuable insights into systematic modeling of complicated biological processes.

  13. Evaluation and Selection of Appropriate Reference Genes for Real-Time Quantitative PCR Analysis of Gene Expression in Nile Tilapia (Oreochromis niloticus) during Vaccination and Infection

    PubMed Central

    Wang, Erlong; Wang, Kaiyu; Chen, Defang; Wang, Jun; He, Yang; Long, Bo; Yang, Lei; Yang, Qian; Geng, Yi; Huang, Xiaoli; Ouyang, Ping; Lai, Weimin

    2015-01-01

    qPCR as a powerful and attractive methodology has been widely applied to aquaculture researches for gene expression analyses. However, the suitable reference selection is critical for normalizing target genes expression in qPCR. In the present study, six commonly used endogenous controls were selected as candidate reference genes to evaluate and analyze their expression levels, stabilities and normalization to immune-related gene IgM expression during vaccination and infection in spleen of tilapia with RefFinder and GeNorm programs. The results showed that all of these candidate reference genes exhibited transcriptional variations to some extent at different periods. Among them, EF1A was the most stable reference with RefFinder, followed by 18S rRNA, ACTB, UBCE, TUBA and GAPDH respectively and the optimal number of reference genes for IgM normalization under different experiment sets was two with GeNorm. Meanwhile, combination the Cq (quantification cycle) value and the recommended comprehensive ranking of reference genes, EF1A and ACTB, the two optimal reference genes, were used together as reference genes for accurate analysis of immune-related gene expression during vaccination and infection in Nile tilapia with qPCR. Moreover, the highest IgM expression level was at two weeks post-vaccination when normalized to EF1A, 18S rRNA, ACTB, and EF1A together with ACTB compared to one week post-vaccination before normalizing, which was also consistent with the IgM antibody titers detection by ELISA. PMID:25941937

  14. Gene Expression Profiling of Multiple Leiomyomata Uteri and Matched Normal Tissue from a Single Patient

    PubMed Central

    Dimitrova, Irina K.; Richer, Jennifer K.; Rudolph, Michael C.; Spoelstra, Nicole S.; Reno, Elaine M.; Medina, Theresa M.; Bradford, Andrew P.

    2009-01-01

    Objective To identify differentially expressed genes between fibroid and adjacent normal myometrium in an identical hormonal and genetic background. Design Array analysis of 3 leiomyomata and matched adjacent normal myometrium in a single patient. Setting University of Colorado Hospital. Patient(s) A single female undergoing medically indicated hysterectomy for symptomatic fibroids. Interventions(s) mRNA isolation and microarray analysis, reverse-transcriptase polymerase chain reaction, western blotting and immunohistochemistry. Main Outcome Measure(s) Changes in mRNA and protein levels in leiomyomata and matched normal myometrium. Result(s) Expression of 197 genes was increased and 619 decreased, significantly by at least 2 fold, in leiomyomata relative to normal myometrium. Expression profiles between tumors were similar and normal myometrial samples showed minimal variation. Changes in, and variation of, expression of selected genes were confirmed in additional normal and leiomyoma samples from multiple patients. Conclusion(s) Analysis of multiple tumors from a single patient confirmed changes in expression of genes described in previous, apparently disparate, studies and identified novel targets. Gene expression profiles in leiomyomata are consistent with increased activation of mitogenic pathways and inhibition of apoptosis. Down-regulation of genes implicated in invasion and metastasis, of cancers, was observed in fibroids. This expression pattern may underlie the benign nature of uterine leiomyomata and may aid in the differential diagnosis of leiomyosarcoma. PMID:18672237

  15. A powerful nonparametric method for detecting differentially co-expressed genes: distance correlation screening and edge-count test.

    PubMed

    Zhang, Qingyang

    2018-05-16

    Differential co-expression analysis, as a complement of differential expression analysis, offers significant insights into the changes in molecular mechanism of different phenotypes. A prevailing approach to detecting differentially co-expressed genes is to compare Pearson's correlation coefficients in two phenotypes. However, due to the limitations of Pearson's correlation measure, this approach lacks the power to detect nonlinear changes in gene co-expression which is common in gene regulatory networks. In this work, a new nonparametric procedure is proposed to search differentially co-expressed gene pairs in different phenotypes from large-scale data. Our computational pipeline consisted of two main steps, a screening step and a testing step. The screening step is to reduce the search space by filtering out all the independent gene pairs using distance correlation measure. In the testing step, we compare the gene co-expression patterns in different phenotypes by a recently developed edge-count test. Both steps are distribution-free and targeting nonlinear relations. We illustrate the promise of the new approach by analyzing the Cancer Genome Atlas data and the METABRIC data for breast cancer subtypes. Compared with some existing methods, the new method is more powerful in detecting nonlinear type of differential co-expressions. The distance correlation screening can greatly improve computational efficiency, facilitating its application to large data sets.

  16. An Integrated Analysis of MicroRNA and mRNA Expression Profiles to Identify RNA Expression Signatures in Lambskin Hair Follicles in Hu Sheep

    PubMed Central

    Lv, Xiaoyang; Sun, Wei; Yin, Jinfeng; Ni, Rong; Su, Rui; Wang, Qingzeng; Gao, Wen; Bao, Jianjun; Yu, Jiarui; Wang, Lihong; Chen, Ling

    2016-01-01

    Wave patterns in lambskin hair follicles are an important factor determining the quality of sheep’s wool. Hair follicles in lambskin from Hu sheep, a breed unique to China, have 3 types of waves, designated as large, medium, and small. The quality of wool from small wave follicles is excellent, while the quality of large waves is considered poor. Because no molecular and biological studies on hair follicles of these sheep have been conducted to date, the molecular mechanisms underlying the formation of different wave patterns is currently unknown. The aim of this article was to screen the candidate microRNAs (miRNA) and genes for the development of hair follicles in Hu sheep. Two-day-old Hu lambs were selected from full-sib individuals that showed large, medium, and small waves. Integrated analysis of microRNA and mRNA expression profiles employed high-throughout sequencing technology. Approximately 13, 24, and 18 differentially expressed miRNAs were found between small and large waves, small and medium waves, and medium and large waves, respectively. A total of 54, 190, and 81 differentially expressed genes were found between small and large waves, small and medium waves, and medium and large waves, respectively, by RNA sequencing (RNA-seq) analysis. Differentially expressed genes were classified using gene ontology and pathway analyses. They were found to be mainly involved in cell differentiation, proliferation, apoptosis, growth, immune response, and ion transport, and were associated with MAPK and the Notch signaling pathway. Reverse transcription-polymerase chain reaction (RT-PCR) analyses of differentially-expressed miRNA and genes were consistent with sequencing results. Integrated analysis of miRNA and mRNA expression indicated that, compared to small waves, large waves included 4 downregulated miRNAs that had regulatory effects on 8 upregulated genes and 3 upregulated miRNAs, which in turn influenced 13 downregulated genes. Compared to small waves, medium waves included 13 downregulated miRNAs that had regulatory effects on 64 upregulated genes and 4 upregulated miRNAs, which in turn had regulatory effects on 22 downregulated genes. Compared to medium waves, large waves consisted of 13 upregulated miRNAs that had regulatory effects on 48 downregulated genes. These differentially expressed miRNAs and genes may play a significant role in forming different patterns, and provide evidence for the molecular mechanisms underlying the formation of hair follicles of varying patterns. PMID:27404636

  17. Molecular characterization of the equine testis-specific protein 1 (TPX1) and acidic epididymal glycoprotein 2 (AEG2) genes encoding members of the cysteine-rich secretory protein (CRISP) family.

    PubMed

    Giese, Alexander; Jude, Rony; Kuiper, Heidi; Raudsepp, Terje; Piumi, Francois; Schambony, Alexandra; Guérin, Gérard; Chowdhary, Bhanu P; Distl, Ottmar; Töpfer-Petersen, Edda; Leeb, Tosso

    2002-10-16

    The cysteine-rich secretory protein (CRISP) family consists of three members called acidic epididymal glycoprotein 1 (AEG1), AEG2, and testis-specific protein 1 (TPX1), which share 16 conserved cysteine residues at their C-termini. The CRISP proteins are primarily expressed in different sections of the male genital tract and are thought to mediate cell-cell interactions of male germ cells with other cells during sperm maturation or during fertilization. Therefore, their genes are of interest as candidate genes for inherited male fertility dysfunctions and as putative quantitative trait loci for male fertility traits. In this report, the cloning and DNA sequence of 137 kb of horse genomic DNA from equine chromosome 20q22 containing the closely linked equine TPX1 and AEG2 genes are described. The equine TPX1 gene consists of ten exons spanning 18 kb while the AEG2 gene consists of eight exons that are spread over 24 kb. The expression of these two genes was investigated in several tissues by reverse transcription polymerase chain reaction analysis and Western blotting. Comparative genome analysis between horse, human, and mouse indicates that all three CRISP genes are clustered on one chromosomal location, which shows conserved synteny between these species.

  18. GAPTrap: A Simple Expression System for Pluripotent Stem Cells and Their Derivatives.

    PubMed

    Kao, Tim; Labonne, Tanya; Niclis, Jonathan C; Chaurasia, Ritu; Lokmic, Zerina; Qian, Elizabeth; Bruveris, Freya F; Howden, Sara E; Motazedian, Ali; Schiesser, Jacqueline V; Costa, Magdaline; Sourris, Koula; Ng, Elizabeth; Anderson, David; Giudice, Antonietta; Farlie, Peter; Cheung, Michael; Lamande, Shireen R; Penington, Anthony J; Parish, Clare L; Thomson, Lachlan H; Rafii, Arash; Elliott, David A; Elefanty, Andrew G; Stanley, Edouard G

    2016-09-13

    The ability to reliably express fluorescent reporters or other genes of interest is important for using human pluripotent stem cells (hPSCs) as a platform for investigating cell fates and gene function. We describe a simple expression system, designated GAPTrap (GT), in which reporter genes, including GFP, mCherry, mTagBFP2, luc2, Gluc, and lacZ are inserted into the GAPDH locus in hPSCs. Independent clones harboring variations of the GT vectors expressed remarkably consistent levels of the reporter gene. Differentiation experiments showed that reporter expression was reliably maintained in hematopoietic cells, cardiac mesoderm, definitive endoderm, and ventral midbrain dopaminergic neurons. Similarly, analysis of teratomas derived from GT-lacZ hPSCs showed that β-galactosidase expression was maintained in a spectrum of cell types representing derivatives of the three germ layers. Thus, the GAPTrap vectors represent a robust and straightforward tagging system that enables indelible labeling of PSCs and their differentiated derivatives. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Gene expression in WAT from healthy humans and monkeys correlates with FGF21-induced browning of WAT in mice.

    PubMed

    Schlessinger, Karni; Li, Wenyu; Tan, Yejun; Liu, Franklin; Souza, Sandra C; Tozzo, Effie; Liu, Kevin; Thompson, John R; Wang, Liangsu; Muise, Eric S

    2015-09-01

    Identify a gene expression signature in white adipose tissue (WAT) that reports on WAT browning and is associated with a healthy phenotype. RNA from several different adipose depots across three species were analyzed by whole transcriptome profiling, including 1) mouse subcutaneous white fat, brown fat, and white fat after in vivo treatment with FGF21; 2) human subcutaneous and omental fat from insulin-sensitive and insulin-resistant patients; and 3) rhesus monkey subcutaneous fat from healthy and dysmetabolic individuals. A "browning" signature in mice was identified by cross-referencing the FGF21-induced signature in WAT with the brown adipose tissue (BAT) vs. WAT comparison. In addition, gene expression levels in WAT from insulin-sensitive/healthy vs. insulin-resistant/dysmetabolic humans and rhesus monkeys, respectively, correlated with the gene expression levels in mouse BAT vs. WAT. A subset of 49 genes were identified that were consistently regulated or differentially expressed in the mouse and human data sets that could be used to monitor browning of WAT across species. Gene expression profiles of WATs from healthy insulin-sensitive individuals correlate with those of BAT and FGF21-induced browning of WAT. © 2015 The Obesity Society.

  20. Biochemical characteristics and gene expression profiles of two paralogous luciferases from the Japanese firefly Pyrocoelia atripennis (Coleoptera, Lampyridae, Lampyrinae): insight into the evolution of firefly luciferase genes.

    PubMed

    Bessho-Uehara, Manabu; Konishi, Kaori; Oba, Yuichi

    2017-08-09

    Two paralogous genes of firefly luciferase, Luc1 and Luc2, have been isolated from the species in two subfamilies, Luciolinae and Photurinae, of the family Lampyridae. The gene expression profiles have previously been examined only in the species of Luciolinae. Here we isolated Luc1 and Luc2 genes from the Japanese firefly Pyrocoelia atripennis. This is the first report of the presence of both Luc1 and Luc2 genes in the species of the subfamily Lampyrinae and of the exon-intron structure of Luc2 in the family Lampyridae. The luminescence of both gene products peaked at 547 nm under neutral buffer conditions, and the spectrum of Luc1, but not Luc2, was red-shifted under acidic conditions, as observed for Luc2 in the Luciolinae species. The semi-quantitative reverse transcription-polymerase chain reaction suggested that Luc1 was expressed in lanterns of all the stages except eggs, while Luc2 was expressed in the non-lantern bodies of eggs, prepupae, pupae, and female adults. These expression profiles are consistent with those in the Luciolinae species. Considering the distant phylogenetic relationship between Lampyrinae and Luciolinae in Lampyridae, we propose that fireflies generally possess two different luciferase genes and the biochemical properties and gene expression profiles for each paralog are conserved among lampyrid species.

  1. The human desmin locus: gene organization and LCR-mediated transcriptional control.

    PubMed

    Tam, Jennifer L Y; Triantaphyllopoulos, Kostas; Todd, Helen; Raguz, Selina; de Wit, Ton; Morgan, Jennifer E; Partridge, Terence A; Makrinou, Eleni; Grosveld, Frank; Antoniou, Michael

    2006-06-01

    Locus control regions (LCRs) are defined by their ability to confer reproducible physiological levels of transgene expression in mice and therefore thought to possess the ability to generate dominantly a transcriptionally active chromatin structure. We report the first characterization of a muscle-cell-specific LCR, which is linked to the human desmin gene (DES). The DES LCR consists of five regions of muscle-specific DNase I hypersensitivity (HS) localized between -9 and -18 kb 5' of DES and reproducibly drives full physiological levels of expression in all muscle cell types. The DES LCR DNase I HS regions are highly conserved between humans and other mammals and can potentially bind a broad range of muscle-specific and ubiquitous transcription factors. Bioinformatics and direct molecular analysis show that the DES locus consists of three muscle-specific (DES) or muscle preferentially expressed genes (APEG1 and SPEG, the human orthologue of murine striated-muscle-specific serine/threonine protein kinase, Speg). The DES LCR may therefore regulate expression of SPEG and APEG1 as well as DES.

  2. Arachidonic acid alters tomato HMG expression and fruit growth and induces 3-hydroxy-3-methylglutaryl coenzyme A reductase-independent lycopene accumulation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rodriguez-Concepcion, M.; Gruissem, W.

    Regulation of isoprenoid end-product synthesis required for normal growth and development in plants is not well understood. To investigate the extent to which specific genes for the enzyme 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) are involved in end-product regulation, the authors manipulated expression of the HMG1 and HMG2 genes in tomato (Lycopersicon esculentum) fruit using arachidonic acid (AA). In developing young fruit AA blocked fruit growth, inhibited HMG1, and activated HMG2 expression. These results are consistent with other reports indicating that HMG1 expression is closely correlated with growth processes requiring phytosterol production. In mature-green fruit AA strongly induced the expression ofmore » HMG2, PSY1 (the gene for phytoene synthase), and lycopene accumulation before the normal onset of carotenoid synthesis and ripening. The induction of lycopene synthesis was not blocked by inhibition of HMGR activity using mevinolin, suggesting that cytoplasmic HMGR is not required for carotenoid synthesis. Their results are consistent with the function of an alternative plastid isoprenoid pathway (the Rohmer pathway) that appears to direct the production of carotenoids during tomato fruit ripening.« less

  3. SPP1 and AGER as potential prognostic biomarkers for lung adenocarcinoma.

    PubMed

    Zhang, Weiguo; Fan, Junli; Chen, Qiang; Lei, Caipeng; Qiao, Bin; Liu, Qin

    2018-05-01

    Overdue treatment and prognostic evaluation lead to low survival rates in patients with lung adenocarcinoma (LUAD). To date, effective biomarkers for prognosis are still required. The aim of the present study was to screen differentially expressed genes (DEGs) as biomarkers for prognostic evaluation of LUAD. DEGs in tumor and normal samples were identified and analyzed for Kyoto Encyclopedia of Genes and Genomes/Gene Ontology functional enrichments. The common genes that are up and downregulated were selected for prognostic analysis using RNAseq data in The Cancer Genome Atlas. Differential expression analysis was performed with 164 samples in GSE10072 and GSE7670 datasets. A total of 484 DEGs that were present in GSE10072 and GSE7670 datasets were screened, including secreted phosphoprotein 1 (SPP1) that was highly expressed and DEGs ficolin 3, advanced glycosylation end-product specific receptor (AGER), transmembrane protein 100 that were lowly expressed in tumor tissues. These four key genes were subsequently verified using an independent dataset, GSE19804. The gene expression model was consistent with GSE10072 and GSE7670 datasets. The dysregulation of highly expressed SPP1 and lowly expressed AGER significantly reduced the median survival time of patients with LUAD. These findings suggest that SPP1 and AGER are risk factors for LUAD, and these two genes may be utilized in the prognostic evaluation of patients with LUAD. Additionally, the key genes and functional enrichments may provide a reference for investigating the molecular expression mechanisms underlying LUAD.

  4. Turning publicly available gene expression data into discoveries using gene set context analysis.

    PubMed

    Ji, Zhicheng; Vokes, Steven A; Dang, Chi V; Ji, Hongkai

    2016-01-08

    Gene Set Context Analysis (GSCA) is an open source software package to help researchers use massive amounts of publicly available gene expression data (PED) to make discoveries. Users can interactively visualize and explore gene and gene set activities in 25,000+ consistently normalized human and mouse gene expression samples representing diverse biological contexts (e.g. different cells, tissues and disease types, etc.). By providing one or multiple genes or gene sets as input and specifying a gene set activity pattern of interest, users can query the expression compendium to systematically identify biological contexts associated with the specified gene set activity pattern. In this way, researchers with new gene sets from their own experiments may discover previously unknown contexts of gene set functions and hence increase the value of their experiments. GSCA has a graphical user interface (GUI). The GUI makes the analysis convenient and customizable. Analysis results can be conveniently exported as publication quality figures and tables. GSCA is available at https://github.com/zji90/GSCA. This software significantly lowers the bar for biomedical investigators to use PED in their daily research for generating and screening hypotheses, which was previously difficult because of the complexity, heterogeneity and size of the data. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Tissue-specific promoter utilisation of the kallikrein-related peptidase genes, KLK5 and KLK7, and cellular localisation of the encoded proteins suggest roles in exocrine pancreatic function.

    PubMed

    Dong, Ying; Matigian, Nick; Harvey, Tracey J; Samaratunga, Hemamali; Hooper, John D; Clements, Judith A

    2008-02-01

    Abstract Tissue kallikrein (kallikrein 1) was first identified in pancreas and is the namesake of the kallikrein-related peptidase (KLK) family. KLK1 and the other 14 members of the human KLK family are encoded by 15 serine protease genes clustered at chromosome 19q13.4. Our Northern blot analysis of 19 normal human tissues for expression of KLK4 to KLK15 identified pancreas as a common expression site for the gene cluster spanning KLK5 to KLK13, as well as for KLK15 which is located adjacent to KLK1. Consistent with previous reports detailing the ability of KLK genes to generate organ- and disease-specific transcripts, detailed molecular and in silico analyses indicated that KLK5 and KLK7 generate transcripts in pancreas variant from those in skin or ovary. Consistently, we identified in the promoters of these KLK genes motifs which conform with consensus binding sites for transcription factors conferring pancreatic expression. In addition, immunohistochemical analysis revealed predominant localisation of KLK5 and KLK7 in acinar cells of the exocrine pancreas, suggesting roles for these enzymes in digestion. Our data also support expression patterns derived from gene duplication events in the human KLK cluster. These findings suggest that, in addition to KLK1, other related KLK enzymes will function in the exocrine pancreas.

  6. Genome multiplication as adaptation to tissue survival: evidence from gene expression in mammalian heart and liver.

    PubMed

    Anatskaya, Olga V; Vinogradov, Alexander E

    2007-01-01

    To elucidate the functional significance of genome multiplication in somatic tissues, we performed a large-scale analysis of ploidy-associated changes in expression of non-tissue-specific (i.e., broadly expressed) genes in the heart and liver of human and mouse (6585 homologous genes were analyzed). These species have inverse patterns of polyploidization in cardiomyocytes and hepatocytes. The between-species comparison of two pairs of homologous tissues with crisscross contrast in ploidy levels allows the removal of the effects of species and tissue specificity on the profile of gene activity. The different tests performed from the standpoint of modular biology revealed a consistent picture of ploidy-associated alteration in a wide range of functional gene groups. The major effects consisted of hypoxia-inducible factor-triggered changes in main cellular processes and signaling pathways, activation of defense against DNA lesions, acceleration of protein turnover and transcription, and the impairment of apoptosis, the immune response, and cytoskeleton maintenance. We also found a severe decline in aerobic respiration and stimulation of sugar and fatty acid metabolism. These metabolic rearrangements create a special type of metabolism that can be considered intermediate between aerobic and anaerobic. The metabolic and physiological changes revealed (reflected in the alteration of gene expression) help explain the unique ability of polyploid tissues to combine proliferation and differentiation, which are separated in diploid tissues. We argue that genome multiplication promotes cell survival and tissue regeneration under stressful conditions.

  7. A genomics approach to understanding the role of auxin in apple (Malus x domestica) fruit size control.

    PubMed

    Devoghalaere, Fanny; Doucen, Thomas; Guitton, Baptiste; Keeling, Jeannette; Payne, Wendy; Ling, Toby John; Ross, John James; Hallett, Ian Charles; Gunaseelan, Kularajathevan; Dayatilake, G A; Diak, Robert; Breen, Ken C; Tustin, D Stuart; Costes, Evelyne; Chagné, David; Schaffer, Robert James; David, Karine Myriam

    2012-01-13

    Auxin is an important phytohormone for fleshy fruit development, having been shown to be involved in the initial signal for fertilisation, fruit size through the control of cell division and cell expansion, and ripening related events. There is considerable knowledge of auxin-related genes, mostly from work in model species. With the apple genome now available, it is possible to carry out genomics studies on auxin-related genes to identify genes that may play roles in specific stages of apple fruit development. High amounts of auxin in the seed compared with the fruit cortex were observed in 'Royal Gala' apples, with amounts increasing through fruit development. Injection of exogenous auxin into developing apples at the start of cell expansion caused an increase in cell size. An expression analysis screen of auxin-related genes involved in auxin reception, homeostasis, and transcriptional regulation showed complex patterns of expression in each class of gene. Two mapping populations were phenotyped for fruit size over multiple seasons, and multiple quantitative trait loci (QTLs) were observed. One QTL mapped to a region containing an Auxin Response Factor (ARF106). This gene is expressed during cell division and cell expansion stages, consistent with a potential role in the control of fruit size. The application of exogenous auxin to apples increased cell expansion, suggesting that endogenous auxin concentrations are at least one of the limiting factors controlling fruit size. The expression analysis of ARF106 linked to a strong QTL for fruit weight suggests that the auxin signal regulating fruit size could partially be modulated through the function of this gene. One class of gene (GH3) removes free auxin by conjugation to amino acids. The lower expression of these GH3 genes during rapid fruit expansion is consistent with the apple maximising auxin concentrations at this point.

  8. A genomics approach to understanding the role of auxin in apple (Malus x domestica) fruit size control

    PubMed Central

    2012-01-01

    Background Auxin is an important phytohormone for fleshy fruit development, having been shown to be involved in the initial signal for fertilisation, fruit size through the control of cell division and cell expansion, and ripening related events. There is considerable knowledge of auxin-related genes, mostly from work in model species. With the apple genome now available, it is possible to carry out genomics studies on auxin-related genes to identify genes that may play roles in specific stages of apple fruit development. Results High amounts of auxin in the seed compared with the fruit cortex were observed in 'Royal Gala' apples, with amounts increasing through fruit development. Injection of exogenous auxin into developing apples at the start of cell expansion caused an increase in cell size. An expression analysis screen of auxin-related genes involved in auxin reception, homeostasis, and transcriptional regulation showed complex patterns of expression in each class of gene. Two mapping populations were phenotyped for fruit size over multiple seasons, and multiple quantitative trait loci (QTLs) were observed. One QTL mapped to a region containing an Auxin Response Factor (ARF106). This gene is expressed during cell division and cell expansion stages, consistent with a potential role in the control of fruit size. Conclusions The application of exogenous auxin to apples increased cell expansion, suggesting that endogenous auxin concentrations are at least one of the limiting factors controlling fruit size. The expression analysis of ARF106 linked to a strong QTL for fruit weight suggests that the auxin signal regulating fruit size could partially be modulated through the function of this gene. One class of gene (GH3) removes free auxin by conjugation to amino acids. The lower expression of these GH3 genes during rapid fruit expansion is consistent with the apple maximising auxin concentrations at this point. PMID:22243694

  9. Vegetables affect the expression of genes involved in anticarcinogenic processes in the colonic mucosa of C57BL/6 female mice.

    PubMed

    van Breda, Simone G J; van Agen, Ebienus; van Sanden, Suzy; Burzykowski, Tomasz; Kienhuis, Anne S; Kleinjans, Jos C S; van Delft, Joost H M

    2005-08-01

    There is abundant epidemiological evidence that vegetable consumption decreases colorectal cancer (CRC) risk. However, the molecular targets in the genome are mostly unknown. The present study investigated the effects of vegetable consumption on gene expression in the colon mucosa of female C57Bl/6 mice using cDNA microarray technology. Mice were fed one of 8 diets: a control diet containing no vegetables (diet 1); a diet containing 100 g/kg (diet 2, 10% dose), 200 g/kg (diet 3, 20% dose), or 400 g/kg (diet 4, 40% dose) of a vegetable mixture; or a diet containing 70 g/kg of cauliflower (diet 5, 7% dose), 73 g/kg of carrots (diet 6, 7.3% dose), 226 g/kg of peas (diet 7, 22.6% dose); or 31 g/kg of onions (diet 8, 3.1% dose). The vegetable mixture used in diets 2 to 4 consisted of the 4 individual vegetables used in diets 5 to 8: cauliflower (30% wet wt), carrots (30% wet wt), peas (30% wet wt), and onions (10% wet wt). To assess gene expression changes, colonic mucosal cells were collected after the mice were killed. Total RNA was isolated and microarray technology was used to measure the expression levels of 602 genes simultaneously. For 39 genes, significant dose-dependent effects were found, although in general the relations were not linear. For 15 genes, the altered expression could indeed explain reduced cancer risk at various stages of CRC development. Eleven genes were modulated by the vegetable mixture as well as by one or more of the individual vegetables. For 7 of the genes, the modulation by the mixture was due to the effect of a particular vegetable. These genes are of particular interest because they were consistently affected and could be involved in the prevention of CRC by vegetable consumption.

  10. Expression levels of the innate response gene RIG-I and its regulators RNF125 and TRIM25 in HIV-1-infected adult and pediatric individuals.

    PubMed

    Britto, Alan M A; Amoedo, Nívea D; Pezzuto, Paula; Afonso, Adriana O; Martínez, Ana M B; Silveira, Jussara; Sion, Fernando S; Machado, Elizabeth S; Soares, Marcelo A; Giannini, Ana L M

    2013-07-31

    TLRs (Toll-like receptors) and RLRs (RIG-I-like receptors) mediate innate immune responses by detecting microorganism invasion. RIG-I activation results in the production of interferon (IFN) type 1 and IFN responsive genes (ISGs). As the ubiquitin ligases RNF125 and TRIM25 are involved in regulating RIG-I function, our aim was to assess whether the levels of these three genes vary between healthy and HIV-infected individuals and whether these levels are related to disease progression. Gene expression analyses for RIG-I, RNF125, and TRIM25 were performed for HIV-infected adults and the children's peripheral blood mononuclear cells (PBMCs). Reverse transcription-quantitative PCRs (RT-qPCRs) were performed in order to quantify the expression levels of RIG-I, RNF125 and TRIM25 from PBMCs purified from control or HIV-infected individuals. Controls express higher levels of the three genes when compared to HIV-infected patients. These expressions are clearly distinct between healthy and progressors, and are reproduced in adults and children. In controls, RNF125 is the highest expressed gene, whereas in progressors, RIG-I is either the highest expressed gene or is expressed similarly to RNF125 and TRIM25. A pattern of expression of RIG-I, RNF125, and TRIM25 genes in HIV patients is evident. The high expression of RNF125 in healthy individuals reflects the importance of keeping RIG-I function off, inhibiting unnecessary IFN production. Consistent with this assumption, RNF125 levels are lower in HIV patients and importantly, the RNF125/RIG-I ratio is lower in patients who progress to AIDS. Our results might help to predict disease progression and unveil the role of poorly characterized host genes during HIV infection.

  11. Analysis of gene expression profile induced by EMP-1 in esophageal cancer cells using cDNA Microarray

    PubMed Central

    Wang, Hai-Tao; Kong, Jian-Ping; Ding, Fang; Wang, Xiu-Qin; Wang, Ming-Rong; Liu, Lian-Xin; Wu, Min; Liu, Zhi-Hua

    2003-01-01

    AIM: To obtain human esophageal cancer cell EC9706 stably expressed epithelial membrane protein-1 (EMP-1) with integrated eukaryotic plasmid harboring the open reading frame (ORF) of human EMP-1, and then to study the mechanism by which EMP-1 exerts its diverse cellular action on cell proliferation and altered gene profile by exploring the effect of EMP-1. METHODS: The authors first constructed pcDNA3.1/myc-his expression vector harboring the ORF of EMP-1 and then transfected it into human esophageal carcinoma cell line EC9706. The positive clones were analyzed by Western blot and RT-PCR. Moreover, the cell growth curve was observed and the cell cycle was checked by FACS technique. Using cDNA microarray technology, the authors compared the gene expression pattern in positive clones with control. To confirm the gene expression profile, semi-quantitative RT-PCR was carried out for 4 of the randomly picked differentially expressed genes. For those differentially expressed genes, classification was performed according to their function and cellular component. RESULTS: Human EMP-1 gene can be stably expressed in EC9706 cell line transfected with human EMP-1. The authors found the cell growth decreased, among which S phase was arrested and G1 phase was prolonged in the transfected positive clones. By cDNA microarray analysis, 35 genes showed an over 2.0 fold change in expression level after transfection, with 28 genes being consistently up-regulated and 7 genes being down-regulated. Among the classified genes, almost half of the induced genes (13 out of 28 genes) were related to cell signaling, cell communication and particularly to adhesion. CONCLUSION: Overexpression of human EMP-1 gene can inhibit the proliferation of EC9706 cell with S phase arrested and G1 phase prolonged. The cDNA microarray analysis suggested that EMP-1 may be one of regulators involved in cell signaling, cell communication and adhesion regulators. PMID:12632483

  12. Analysis of gene expression profile induced by EMP-1 in esophageal cancer cells using cDNA Microarray.

    PubMed

    Wang, Hai-Tao; Kong, Jian-Ping; Ding, Fang; Wang, Xiu-Qin; Wang, Ming-Rong; Liu, Lian-Xin; Wu, Min; Liu, Zhi-Hua

    2003-03-01

    To obtain human esophageal cancer cell EC9706 stably expressed epithelial membrane protein-1 (EMP-1) with integrated eukaryotic plasmid harboring the open reading frame (ORF) of human EMP-1, and then to study the mechanism by which EMP-1 exerts its diverse cellular action on cell proliferation and altered gene profile by exploring the effect of EMP-1. The authors first constructed pcDNA3.1/myc-his expression vector harboring the ORF of EMP-1 and then transfected it into human esophageal carcinoma cell line EC9706. The positive clones were analyzed by Western blot and RT-PCR. Moreover, the cell growth curve was observed and the cell cycle was checked by FACS technique. Using cDNA microarray technology, the authors compared the gene expression pattern in positive clones with control. To confirm the gene expression profile, semi-quantitative RT-PCR was carried out for 4 of the randomly picked differentially expressed genes. For those differentially expressed genes, classification was performed according to their function and cellular component. Human EMP-1 gene can be stably expressed in EC9706 cell line transfected with human EMP-1. The authors found the cell growth decreased, among which S phase was arrested and G1 phase was prolonged in the transfected positive clones. By cDNA microarray analysis, 35 genes showed an over 2.0 fold change in expression level after transfection, with 28 genes being consistently up-regulated and 7 genes being down-regulated. Among the classified genes, almost half of the induced genes (13 out of 28 genes) were related to cell signaling, cell communication and particularly to adhesion. Overexpression of human EMP-1 gene can inhibit the proliferation of EC9706 cell with S phase arrested and G1 phase prolonged. The cDNA microarray analysis suggested that EMP-1 may be one of regulators involved in cell signaling, cell communication and adhesion regulators.

  13. Periodontal therapy alters gene expression of peripheral blood monocytes

    PubMed Central

    Papapanou, Panos N.; Sedaghatfar, Michael H.; Demmer, Ryan T.; Wolf, Dana L.; Yang, Jun; Roth, Georg A.; Celenti, Romanita; Belusko, Paul B.; Lalla, Evanthia; Pavlidis, Paul

    2009-01-01

    Aims We investigated the effects of periodontal therapy on gene expression of peripheral blood monocytes. Methods Fifteen patients with periodontitis gave blood samples at four time points: 1 week before periodontal treatment (#1), at treatment initiation (baseline, #2), 6-week (#3) and 10-week post-baseline (#4). At baseline and 10 weeks, periodontal status was recorded and subgingival plaque samples were obtained. Periodontal therapy (periodontal surgery and extractions without adjunctive antibiotics) was completed within 6 weeks. At each time point, serum concentrations of 19 biomarkers were determined. Peripheral blood monocytes were purified, RNA was extracted, reverse-transcribed, labelled and hybridized with AffymetrixU133Plus2.0 chips. Expression profiles were analysed using linear random-effects models. Further analysis of gene ontology terms summarized the expression patterns into biologically relevant categories. Differential expression of selected genes was confirmed by real-time reverse transcriptase-polymerase chain reaction in a subset of patients. Results Treatment resulted in a substantial improvement in clinical periodontal status and reduction in the levels of several periodontal pathogens. Expression profiling over time revealed more than 11,000 probe sets differentially expressed at a false discovery rate of <0.05. Approximately 1/3 of the patients showed substantial changes in expression in genes relevant to innate immunity, apoptosis and cell signalling. Conclusions The data suggest that periodontal therapy may alter monocytic gene expression in a manner consistent with a systemic anti-inflammatory effect. PMID:17716309

  14. Iterative local Gaussian clustering for expressed genes identification linked to malignancy of human colorectal carcinoma

    PubMed Central

    Wasito, Ito; Hashim, Siti Zaiton M; Sukmaningrum, Sri

    2007-01-01

    Gene expression profiling plays an important role in the identification of biological and clinical properties of human solid tumors such as colorectal carcinoma. Profiling is required to reveal underlying molecular features for diagnostic and therapeutic purposes. A non-parametric density-estimation-based approach called iterative local Gaussian clustering (ILGC), was used to identify clusters of expressed genes. We used experimental data from a previous study by Muro and others consisting of 1,536 genes in 100 colorectal cancer and 11 normal tissues. In this dataset, the ILGC finds three clusters, two large and one small gene clusters, similar to their results which used Gaussian mixture clustering. The correlation of each cluster of genes and clinical properties of malignancy of human colorectal cancer was analysed for the existence of tumor or normal, the existence of distant metastasis and the existence of lymph node metastasis. PMID:18305825

  15. Iterative local Gaussian clustering for expressed genes identification linked to malignancy of human colorectal carcinoma.

    PubMed

    Wasito, Ito; Hashim, Siti Zaiton M; Sukmaningrum, Sri

    2007-12-30

    Gene expression profiling plays an important role in the identification of biological and clinical properties of human solid tumors such as colorectal carcinoma. Profiling is required to reveal underlying molecular features for diagnostic and therapeutic purposes. A non-parametric density-estimation-based approach called iterative local Gaussian clustering (ILGC), was used to identify clusters of expressed genes. We used experimental data from a previous study by Muro and others consisting of 1,536 genes in 100 colorectal cancer and 11 normal tissues. In this dataset, the ILGC finds three clusters, two large and one small gene clusters, similar to their results which used Gaussian mixture clustering. The correlation of each cluster of genes and clinical properties of malignancy of human colorectal cancer was analysed for the existence of tumor or normal, the existence of distant metastasis and the existence of lymph node metastasis.

  16. Genome-Wide Screening of Genes Showing Altered Expression in Liver Metastases of Human Colorectal Cancers by cDNA Microarray1

    PubMed Central

    Yanagawa, Rempei; Furukawa, Yoichi; Tsunoda, Tatsuhiko; Kitahara, Osamu; Kameyama, Masao; Murata, Kohei; Ishikawa, Osamu; Nakamura, Yusuke

    2001-01-01

    Abstract In spite of intensive and increasingly successful attempts to determine the multiple steps involved in colorectal carcinogenesis, the mechanisms responsible for metastasis of colorectal tumors to the liver remain to be clarified. To identify genes that are candidates for involvement in the metastatic process, we analyzed genome-wide expression profiles of 10 primary colorectal cancers and their corresponding metastatic lesions by means of a cDNA microarray consisting of 9121 human genes. This analysis identified 40 genes whose expression was commonly upregulated in metastatic lesions, and 7 that were commonly downregulated. The upregulated genes encoded proteins involved in cell adhesion, or remodeling of the actin cytoskeleton. Investigation of the functions of more of the altered genes should improve our understanding of metastasis and may identify diagnostic markers and/or novel molecular targets for prevention or therapy of metastatic lesions. PMID:11687950

  17. eMBI: Boosting Gene Expression-based Clustering for Cancer Subtypes.

    PubMed

    Chang, Zheng; Wang, Zhenjia; Ashby, Cody; Zhou, Chuan; Li, Guojun; Zhang, Shuzhong; Huang, Xiuzhen

    2014-01-01

    Identifying clinically relevant subtypes of a cancer using gene expression data is a challenging and important problem in medicine, and is a necessary premise to provide specific and efficient treatments for patients of different subtypes. Matrix factorization provides a solution by finding checker-board patterns in the matrices of gene expression data. In the context of gene expression profiles of cancer patients, these checkerboard patterns correspond to genes that are up- or down-regulated in patients with particular cancer subtypes. Recently, a new matrix factorization framework for biclustering called Maximum Block Improvement (MBI) is proposed; however, it still suffers several problems when applied to cancer gene expression data analysis. In this study, we developed many effective strategies to improve MBI and designed a new program called enhanced MBI (eMBI), which is more effective and efficient to identify cancer subtypes. Our tests on several gene expression profiling datasets of cancer patients consistently indicate that eMBI achieves significant improvements in comparison with MBI, in terms of cancer subtype prediction accuracy, robustness, and running time. In addition, the performance of eMBI is much better than another widely used matrix factorization method called nonnegative matrix factorization (NMF) and the method of hierarchical clustering, which is often the first choice of clinical analysts in practice.

  18. eMBI: Boosting Gene Expression-based Clustering for Cancer Subtypes

    PubMed Central

    Chang, Zheng; Wang, Zhenjia; Ashby, Cody; Zhou, Chuan; Li, Guojun; Zhang, Shuzhong; Huang, Xiuzhen

    2014-01-01

    Identifying clinically relevant subtypes of a cancer using gene expression data is a challenging and important problem in medicine, and is a necessary premise to provide specific and efficient treatments for patients of different subtypes. Matrix factorization provides a solution by finding checker-board patterns in the matrices of gene expression data. In the context of gene expression profiles of cancer patients, these checkerboard patterns correspond to genes that are up- or down-regulated in patients with particular cancer subtypes. Recently, a new matrix factorization framework for biclustering called Maximum Block Improvement (MBI) is proposed; however, it still suffers several problems when applied to cancer gene expression data analysis. In this study, we developed many effective strategies to improve MBI and designed a new program called enhanced MBI (eMBI), which is more effective and efficient to identify cancer subtypes. Our tests on several gene expression profiling datasets of cancer patients consistently indicate that eMBI achieves significant improvements in comparison with MBI, in terms of cancer subtype prediction accuracy, robustness, and running time. In addition, the performance of eMBI is much better than another widely used matrix factorization method called nonnegative matrix factorization (NMF) and the method of hierarchical clustering, which is often the first choice of clinical analysts in practice. PMID:25374455

  19. Comparative modular analysis of gene expression in vertebrate organs.

    PubMed

    Piasecka, Barbara; Kutalik, Zoltán; Roux, Julien; Bergmann, Sven; Robinson-Rechavi, Marc

    2012-03-29

    The degree of conservation of gene expression between homologous organs largely remains an open question. Several recent studies reported some evidence in favor of such conservation. Most studies compute organs' similarity across all orthologous genes, whereas the expression level of many genes are not informative about organ specificity. Here, we use a modularization algorithm to overcome this limitation through the identification of inter-species co-modules of organs and genes. We identify such co-modules using mouse and human microarray expression data. They are functionally coherent both in terms of genes and of organs from both organisms. We show that a large proportion of genes belonging to the same co-module are orthologous between mouse and human. Moreover, their zebrafish orthologs also tend to be expressed in the corresponding homologous organs. Notable exceptions to the general pattern of conservation are the testis and the olfactory bulb. Interestingly, some co-modules consist of single organs, while others combine several functionally related organs. For instance, amygdala, cerebral cortex, hypothalamus and spinal cord form a clearly discernible unit of expression, both in mouse and human. Our study provides a new framework for comparative analysis which will be applicable also to other sets of large-scale phenotypic data collected across different species.

  20. Gene-specific cell labeling using MiMIC transposons

    PubMed Central

    Gnerer, Joshua P.; Venken, Koen J. T.; Dierick, Herman A.

    2015-01-01

    Binary expression systems such as GAL4/UAS, LexA/LexAop and QF/QUAS have greatly enhanced the power of Drosophila as a model organism by allowing spatio-temporal manipulation of gene function as well as cell and neural circuit function. Tissue-specific expression of these heterologous transcription factors relies on random transposon integration near enhancers or promoters that drive the binary transcription factor embedded in the transposon. Alternatively, gene-specific promoter elements are directly fused to the binary factor within the transposon followed by random or site-specific integration. However, such insertions do not consistently recapitulate endogenous expression. We used Minos-Mediated Integration Cassette (MiMIC) transposons to convert host loci into reliable gene-specific binary effectors. MiMIC transposons allow recombinase-mediated cassette exchange to modify the transposon content. We developed novel exchange cassettes to convert coding intronic MiMIC insertions into gene-specific binary factor protein-traps. In addition, we expanded the set of binary factor exchange cassettes available for non-coding intronic MiMIC insertions. We show that binary factor conversions of different insertions in the same locus have indistinguishable expression patterns, suggesting that they reliably reflect endogenous gene expression. We show the efficacy and broad applicability of these new tools by dissecting the cellular expression patterns of the Drosophila serotonin receptor gene family. PMID:25712101

  1. Antisense transcriptional interference mediates condition-specific gene repression in budding yeast.

    PubMed

    Nevers, Alicia; Doyen, Antonia; Malabat, Christophe; Néron, Bertrand; Kergrohen, Thomas; Jacquier, Alain; Badis, Gwenael

    2018-05-18

    Pervasive transcription generates many unstable non-coding transcripts in budding yeast. The transcription of such noncoding RNAs, in particular antisense RNAs (asRNAs), has been shown in a few examples to repress the expression of the associated mRNAs. Yet, such mechanism is not known to commonly contribute to the regulation of a given class of genes. Using a mutant context that stabilized pervasive transcripts, we observed that the least expressed mRNAs during the exponential phase were associated with high levels of asRNAs. These asRNAs also overlapped their corresponding gene promoters with a much higher frequency than average. Interrupting antisense transcription of a subset of genes corresponding to quiescence-enriched mRNAs restored their expression. The underlying mechanism acts in cis and involves several chromatin modifiers. Our results convey that transcription interference represses up to 30% of the 590 least expressed genes, which includes 163 genes with quiescence-enriched mRNAs. We also found that pervasive transcripts constitute a higher fraction of the transcriptome in quiescence relative to the exponential phase, consistent with gene expression itself playing an important role to suppress pervasive transcription. Accordingly, the HIS1 asRNA, normally only present in quiescence, is expressed in exponential phase upon HIS1 mRNA transcription interruption.

  2. Microarray-based identification of differentially expressed genes in extramammary Paget’s disease

    PubMed Central

    Lin, Jin-Ran; Liang, Jun; Zhang, Qiao-An; Huang, Qiong; Wang, Shang-Shang; Qin, Hai-Hong; Chen, Lian-Jun; Xu, Jin-Hua

    2015-01-01

    Extramammary Paget’s disease (EMPD) is a rare cutaneous malignancy accounting for approximately 1-2% of vulvar cancers. The rarity of this disease has caused difficulties in characterization and the molecular mechanism underlying EMPD development remains largely unclear. Here we used microarray analysis to identify differentially expressed genes in EMPD of the scrotum comparing with normal epithelium from healthy donors. Agilent single-channel microarray was used to compare the gene expression between 6 EMPD specimens and 6 normal scrotum epithelium samples. A total of 799 up-regulated genes and 723 down-regulated genes were identified in EMPD tissues. Real-time PCR was conducted to verify the differential expression of some representative genes, including ERBB4, TCF3, PAPSS2, PIK3R3, PRLR, SULT1A1, TCF7L1, and CREB3L4. Generally, the real-time PCR results were consistent with microarray data, and the expression of ERBB4, PRLR, TCF3, PIK3R3, SULT1A1, and TCF7L1 was significantly overexpressed in EMPD (P<0.05). Moreover, the overexpression of PRLR in EMPD, a receptor for the anterior pituitary hormone prolactin (PRL), was confirmed by immunohistochemistry. These data demonstrate that the differentially expressed genes from the microarray-based identification are tightly associated with EMPD occurrence. PMID:26221264

  3. Bioinformatic detection of E47, E2F1 and SREBP1 transcription factors as potential regulators of genes associated to acquisition of endometrial receptivity

    PubMed Central

    2011-01-01

    Background The endometrium is a dynamic tissue whose changes are driven by the ovarian steroidal hormones. Its main function is to provide an adequate substrate for embryo implantation. Using microarray technology, several reports have provided the gene expression patterns of human endometrial tissue during the window of implantation. However it is required that biological connections be made across these genomic datasets to take full advantage of them. The objective of this work was to perform a research synthesis of available gene expression profiles related to acquisition of endometrial receptivity for embryo implantation, in order to gain insights into its molecular basis and regulation. Methods Gene expression datasets were intersected to determine a consensus endometrial receptivity transcript list (CERTL). For this cluster of genes we determined their functional annotations using available web-based databases. In addition, promoter sequences were analyzed to identify putative transcription factor binding sites using bioinformatics tools and determined over-represented features. Results We found 40 up- and 21 down-regulated transcripts in the CERTL. Those more consistently increased were C4BPA, SPP1, APOD, CD55, CFD, CLDN4, DKK1, ID4, IL15 and MAP3K5 whereas the more consistently decreased were OLFM1, CCNB1, CRABP2, EDN3, FGFR1, MSX1 and MSX2. Functional annotation of CERTL showed it was enriched with transcripts related to the immune response, complement activation and cell cycle regulation. Promoter sequence analysis of genes revealed that DNA binding sites for E47, E2F1 and SREBP1 transcription factors were the most consistently over-represented and in both up- and down-regulated genes during the window of implantation. Conclusions Our research synthesis allowed organizing and mining high throughput data to explore endometrial receptivity and focus future research efforts on specific genes and pathways. The discovery of possible new transcription factors orchestrating the CERTL opens new alternatives for understanding gene expression regulation in uterine function. PMID:21272326

  4. Evidence for a Common Toolbox Based on Necrotrophy in a Fungal Lineage Spanning Necrotrophs, Biotrophs, Endophytes, Host Generalists and Specialists

    PubMed Central

    Andrew, Marion; Barua, Reeta; Short, Steven M.; Kohn, Linda M.

    2012-01-01

    The Sclerotiniaceae (Ascomycotina, Leotiomycetes) is a relatively recently evolved lineage of necrotrophic host generalists, and necrotrophic or biotrophic host specialists, some latent or symptomless. We hypothesized that they inherited a basic toolbox of genes for plant symbiosis from their common ancestor. Maintenance and evolutionary diversification of symbiosis could require selection on toolbox genes or on timing and magnitude of gene expression. The genes studied were chosen because their products have been previously investigated as pathogenicity factors in the Sclerotiniaceae. They encode proteins associated with cell wall degradation: acid protease 1 (acp1), aspartyl protease (asps), and polygalacturonases (pg1, pg3, pg5, pg6), and the oxalic acid (OA) pathway: a zinc finger transcription factor (pac1), and oxaloacetate acetylhydrolase (oah), catalyst in OA production, essential for full symptom production in Sclerotinia sclerotiorum. Site-specific likelihood analyses provided evidence for purifying selection in all 8 pathogenicity-related genes. Consistent with an evolutionary arms race model, positive selection was detected in 5 of 8 genes. Only generalists produced large, proliferating disease lesions on excised Arabidopsis thaliana leaves and oxalic acid by 72 hours in vitro. In planta expression of oah was 10–300 times greater among the necrotrophic host generalists than necrotrophic and biotrophic host specialists; pac1 was not differentially expressed. Ability to amplify 6/8 pathogenicity related genes and produce oxalic acid in all genera are consistent with the common toolbox hypothesis for this gene sample. That our data did not distinguish biotrophs from necrotrophs is consistent with 1) a common toolbox based on necrotrophy and 2) the most conservative interpretation of the 3-locus housekeeping gene phylogeny – a baseline of necrotrophy from which forms of biotrophy emerged at least twice. Early oah overexpression likely expands the host range of necrotrophic generalists in the Sclerotiniaceae, while specialists and biotrophs deploy oah, or other as-yet-unknown toolbox genes, differently. PMID:22253834

  5. Genome-wide profiling of gene expression in the epididymis of alpha-chlorohydrin-induced infertile rats using an oligonucleotide microarray

    PubMed Central

    2010-01-01

    Background As one of the chlorinated antifertility compounds, alpha-chlorohydrin (ACH) can inhibit glyceraldehyde-3-phosphate dehydrogenase (G3PDH) activity in epididymal sperm and affect sperm energy metabolism, maturation and fertilization, eventually leading to male infertility. Further studies demonstrated that the inhibitory effect of ACH on G3PDH is not only confined to epididymal sperm but also to the epididymis. Moreover, little investigation on gene expression changes in the epididymis after ACH treatment has been conducted. Therefore, gene expression studies may indicate new epididymal targets related to sperm maturation and fertility through the analysis of ACH-treated infertile animals. Methods Rats were treated with ACH for ten consecutive days, and then each male rat copulated with two female rats in proestrus. Then sperm maturation and other fertility parameters were analyzed. Furthermore, we identified epididymal-specific genes that are associated with fertility between control and ACH groups using an Affymetrix Rat 230 2.0 oligo-microarray. Finally, we performed RT-PCR analysis for several differentially expressed genes to validate the alteration in gene expression observed by oligonucleotide microarray. Results Among all the differentially expressed genes, we analyzed and screened the down-regulated genes associated with metabolism processes, which are considered the major targets of ACH action. Simultaneously, the genes that were up-regulated by chlorohydrin were detected. The genes that negatively regulate sperm maturation and fertility include apoptosis and immune-related genes and have not been reported previously. The overall results of PCR analysis for selected genes were consistent with the array data. Conclusions In this study, we have described the genome-wide profiles of gene expression in the epididymides of infertile rats induced by ACH, which could become potential epididymal specific targets for male contraception and infertility treatment. PMID:20409345

  6. Genome-wide profiling of gene expression in the epididymis of alpha-chlorohydrin-induced infertile rats using an oligonucleotide microarray.

    PubMed

    Xie, Shuwu; Zhu, Yan; Ma, Li; Lu, Yingying; Zhou, Jieyun; Gui, Youlun; Cao, Lin

    2010-04-22

    As one of the chlorinated antifertility compounds, alpha-chlorohydrin (ACH) can inhibit glyceraldehyde-3-phosphate dehydrogenase (G3PDH) activity in epididymal sperm and affect sperm energy metabolism, maturation and fertilization, eventually leading to male infertility. Further studies demonstrated that the inhibitory effect of ACH on G3PDH is not only confined to epididymal sperm but also to the epididymis. Moreover, little investigation on gene expression changes in the epididymis after ACH treatment has been conducted. Therefore, gene expression studies may indicate new epididymal targets related to sperm maturation and fertility through the analysis of ACH-treated infertile animals. Rats were treated with ACH for ten consecutive days, and then each male rat copulated with two female rats in proestrus. Then sperm maturation and other fertility parameters were analyzed. Furthermore, we identified epididymal-specific genes that are associated with fertility between control and ACH groups using an Affymetrix Rat 230 2.0 oligo-microarray. Finally, we performed RT-PCR analysis for several differentially expressed genes to validate the alteration in gene expression observed by oligonucleotide microarray. Among all the differentially expressed genes, we analyzed and screened the down-regulated genes associated with metabolism processes, which are considered the major targets of ACH action. Simultaneously, the genes that were up-regulated by chlorohydrin were detected. The genes that negatively regulate sperm maturation and fertility include apoptosis and immune-related genes and have not been reported previously. The overall results of PCR analysis for selected genes were consistent with the array data. In this study, we have described the genome-wide profiles of gene expression in the epididymides of infertile rats induced by ACH, which could become potential epididymal specific targets for male contraception and infertility treatment.

  7. Mutually exclusive expression of human red and green visual pigment-reporter transgenes occurs at high frequency in murine cone photoreceptors.

    PubMed

    Wang, Y; Smallwood, P M; Cowan, M; Blesh, D; Lawler, A; Nathans, J

    1999-04-27

    This study examines the mechanism of mutually exclusive expression of the human X-linked red and green visual pigment genes in their respective cone photoreceptors by asking whether this expression pattern can be produced in a mammal that normally carries only a single X-linked visual pigment gene. To address this question, we generated transgenic mice that carry a single copy of a minimal human X chromosome visual pigment gene array in which the red and green pigment gene transcription units were replaced, respectively, by alkaline phosphatase and beta-galactosidase reporters. As determined by histochemical staining, the reporters are expressed exclusively in cone photoreceptor cells. In 20 transgenic mice carrying any one of three independent transgene insertion events, an average of 63% of expressing cones have alkaline phosphatase activity, 10% have beta-galactosidase activity, and 27% have activity for both reporters. Thus, mutually exclusive expression of red and green pigment transgenes can be achieved in a large fraction of cones in a dichromat mammal, suggesting a facile evolutionary path for the development of trichromacy after visual pigment gene duplication. These observations are consistent with a model of visual pigment expression in which stochastic pairing occurs between a locus control region and either the red or the green pigment gene promotor.

  8. Comparative expression profiling of Nicotiana benthamiana leaves systemically infected with three fruit tree viruses.

    PubMed

    Dardick, Christopher

    2007-08-01

    Plant viruses cause a wide array of disease symptoms and cytopathic effects. Although some of these changes are virus specific, many appear to be common even among diverse viruses. Currently, little is known about the underlying molecular determinants. To identify gene expression changes that are concomitant with virus symptoms, we performed comparative expression profiling experiments on Nicotiana benthamiana leaves infected with one of three different fruit tree viruses that produce distinct symptoms: Plum pox potyvirus (PPV; leaf distortion and mosaic), Tomato ringspot nepovirus (ToRSV; tissue necrosis and general chlorosis), and Prunus necrotic ringspot ilarvirus (PNRSV; subtle chlorotic mottling). The numbers of statistically significant genes identified were consistent with the severity of the observed symptoms: 1,082 (ToRSV), 744 (PPV), and 89 (PNRSV). In all, 56% of the gene expression changes found in PPV-infected leaves also were altered by ToRSV, 87% of which changed in the same direction. Both PPV- and ToRSV-infected leaves showed widespread repression of genes associated with plastid functions. PPV uniquely induced the expression of large numbers of cytosolic ribosomal genes whereas ToRSV repressed the expression of plastidic ribosomal genes. How these and other observed expression changes might be associated with symptom development are discussed.

  9. Genomic and expression analysis of the vanG-like gene cluster of Clostridium difficile.

    PubMed

    Peltier, Johann; Courtin, Pascal; El Meouche, Imane; Catel-Ferreira, Manuella; Chapot-Chartier, Marie-Pierre; Lemée, Ludovic; Pons, Jean-Louis

    2013-07-01

    Primary antibiotic treatment of Clostridium difficile intestinal diseases requires metronidazole or vancomycin therapy. A cluster of genes homologous to enterococcal glycopeptides resistance vanG genes was found in the genome of C. difficile 630, although this strain remains sensitive to vancomycin. This vanG-like gene cluster was found to consist of five ORFs: the regulatory region consisting of vanR and vanS and the effector region consisting of vanG, vanXY and vanT. We found that 57 out of 83 C. difficile strains, representative of the main lineages of the species, harbour this vanG-like cluster. The cluster is expressed as an operon and, when present, is found at the same genomic location in all strains. The vanG, vanXY and vanT homologues in C. difficile 630 are co-transcribed and expressed to a low level throughout the growth phases in the absence of vancomycin. Conversely, the expression of these genes is strongly induced in the presence of subinhibitory concentrations of vancomycin, indicating that the vanG-like operon is functional at the transcriptional level in C. difficile. Hydrophilic interaction liquid chromatography (HILIC-HPLC) and MS analysis of cytoplasmic peptidoglycan precursors of C. difficile 630 grown without vancomycin revealed the exclusive presence of a UDP-MurNAc-pentapeptide with an alanine at the C terminus. UDP-MurNAc-pentapeptide [d-Ala] was also the only peptidoglycan precursor detected in C. difficile grown in the presence of vancomycin, corroborating the lack of vancomycin resistance. Peptidoglycan structures of a vanG-like mutant strain and of a strain lacking the vanG-like cluster did not differ from the C. difficile 630 strain, indicating that the vanG-like cluster also has no impact on cell-wall composition.

  10. Comparative analysis of gene expression profiles of hip articular cartilage between non-traumatic necrosis and osteoarthritis.

    PubMed

    Wang, Wenyu; Liu, Yang; Hao, Jingcan; Zheng, Shuyu; Wen, Yan; Xiao, Xiao; He, Awen; Fan, Qianrui; Zhang, Feng; Liu, Ruiyu

    2016-10-10

    Hip cartilage destruction is consistently observed in the non-traumatic osteonecrosis of femoral head (NOFH) and accelerates its bone necrosis. The molecular mechanism underlying the cartilage damage of NOFH remains elusive. In this study, we conducted a systematically comparative study of gene expression profiles between NOFH and osteoarthritis (OA). Hip articular cartilage specimens were collected from 12 NOFH patients and 12 controls with traumatic femoral neck fracture for microarray (n=4) and quantitative real-time PCR validation experiments (n=8). Gene expression profiling of articular cartilage was performed using Agilent Human 4×44K Microarray chip. The accuracy of microarray experiment was further validated by qRT-PCR. Gene expression results of OA hip cartilage were derived from previously published study. Significance Analysis of Microarrays (SAM) software was applied for identifying differently expressed genes. Gene ontology (GO) and pathway enrichment analysis were conducted by Gene Set Enrichment Analysis software and DAVID tool, respectively. Totally, 27 differently expressed genes were identified for NOFH. Comparing the gene expression profiles of NOFH cartilage and OA cartilage detected 8 common differently expressed genes, including COL5A1, OGN, ANGPTL4, CRIP1, NFIL3, METRNL, ID2 and STEAP1. GO comparative analysis identified 10 common significant GO terms, mainly implicated in apoptosis and development process. Pathway comparative analysis observed that ECM-receptor interaction pathway and focal adhesion pathway were enriched in the differently expressed genes of both NOFH and hip OA. In conclusion, we identified a set of differently expressed genes, GO and pathways for NOFH articular destruction, some of which were also involved in the hip OA. Our study results may help to reveal the pathogenetic similarities and differences of cartilage damage of NOFH and hip OA. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Pluripotency, Differentiation, and Reprogramming: A Gene Expression Dynamics Model with Epigenetic Feedback Regulation

    PubMed Central

    Miyamoto, Tadashi; Furusawa, Chikara; Kaneko, Kunihiko

    2015-01-01

    Embryonic stem cells exhibit pluripotency: they can differentiate into all types of somatic cells. Pluripotent genes such as Oct4 and Nanog are activated in the pluripotent state, and their expression decreases during cell differentiation. Inversely, expression of differentiation genes such as Gata6 and Gata4 is promoted during differentiation. The gene regulatory network controlling the expression of these genes has been described, and slower-scale epigenetic modifications have been uncovered. Although the differentiation of pluripotent stem cells is normally irreversible, reprogramming of cells can be experimentally manipulated to regain pluripotency via overexpression of certain genes. Despite these experimental advances, the dynamics and mechanisms of differentiation and reprogramming are not yet fully understood. Based on recent experimental findings, we constructed a simple gene regulatory network including pluripotent and differentiation genes, and we demonstrated the existence of pluripotent and differentiated states from the resultant dynamical-systems model. Two differentiation mechanisms, interaction-induced switching from an expression oscillatory state and noise-assisted transition between bistable stationary states, were tested in the model. The former was found to be relevant to the differentiation process. We also introduced variables representing epigenetic modifications, which controlled the threshold for gene expression. By assuming positive feedback between expression levels and the epigenetic variables, we observed differentiation in expression dynamics. Additionally, with numerical reprogramming experiments for differentiated cells, we showed that pluripotency was recovered in cells by imposing overexpression of two pluripotent genes and external factors to control expression of differentiation genes. Interestingly, these factors were consistent with the four Yamanaka factors, Oct4, Sox2, Klf4, and Myc, which were necessary for the establishment of induced pluripotent stem cells. These results, based on a gene regulatory network and expression dynamics, contribute to our wider understanding of pluripotency, differentiation, and reprogramming of cells, and they provide a fresh viewpoint on robustness and control during development. PMID:26308610

  12. Stochastic and epigenetic changes of gene expression in Arabidopsis polyploids.

    PubMed

    Wang, Jianlin; Tian, Lu; Madlung, Andreas; Lee, Hyeon-Se; Chen, Meng; Lee, Jinsuk J; Watson, Brian; Kagochi, Trevor; Comai, Luca; Chen, Z Jeffrey

    2004-08-01

    Polyploidization is an abrupt speciation mechanism for eukaryotes and is especially common in plants. However, little is known about patterns and mechanisms of gene regulation during early stages of polyploid formation. Here we analyzed differential expression patterns of the progenitors' genes among successive selfing generations and independent lineages. The synthetic Arabidopsis allotetraploid lines were produced by a genetic cross between A. thaliana and A. arenosa autotetraploids. We found that some progenitors' genes are differentially expressed in early generations, whereas other genes are silenced in late generations or among different siblings within a selfing generation, suggesting that the silencing of progenitors' genes is rapidly and/or stochastically established. Moreover, a subset of genes is affected in autotetraploid and multiple independent allotetraploid lines and in A. suecica, a natural allotetraploid derived from A. thaliana and A. arenosa, indicating locus-specific susceptibility to ploidy-dependent gene regulation. The role of DNA methylation in silencing progenitors' genes is tested in DNA-hypomethylation transgenic lines of A. suecica using RNA interference (RNAi). Two silenced genes are reactivated in both ddm1- and met1-RNAi lines, consistent with the demethylation of centromeric repeats and gene-specific regions in the genome. A rapid and stochastic process of differential gene expression is reinforced by epigenetic regulation during polyploid formation and evolution. Copyright 2004 Genetics Society of America

  13. Functional and evolutionary insights from the Ciona notochord transcriptome.

    PubMed

    Reeves, Wendy M; Wu, Yuye; Harder, Matthew J; Veeman, Michael T

    2017-09-15

    The notochord of the ascidian Ciona consists of only 40 cells, and is a longstanding model for studying organogenesis in a small, simple embryo. Here, we perform RNAseq on flow-sorted notochord cells from multiple stages to define a comprehensive Ciona notochord transcriptome. We identify 1364 genes with enriched expression and extensively validate the results by in situ hybridization. These genes are highly enriched for Gene Ontology terms related to the extracellular matrix, cell adhesion and cytoskeleton. Orthologs of 112 of the Ciona notochord genes have known notochord expression in vertebrates, more than twice as many as predicted by chance alone. This set of putative effector genes with notochord expression conserved from tunicates to vertebrates will be invaluable for testing hypotheses about notochord evolution. The full set of Ciona notochord genes provides a foundation for systems-level studies of notochord gene regulation and morphogenesis. We find only modest overlap between this set of notochord-enriched transcripts and the genes upregulated by ectopic expression of the key notochord transcription factor Brachyury, indicating that Brachyury is not a notochord master regulator gene as strictly defined. © 2017. Published by The Company of Biologists Ltd.

  14. Decreased gene expression of CD2AP in Chinese patients with sporadic Alzheimer's disease.

    PubMed

    Tao, Qing-Qing; Liu, Zhi-Jun; Sun, Yi-Min; Li, Hong-Lei; Yang, Ping; Liu, De-Shan; Jiang, Bin; Li, Xiao-Yan; Xu, Jian-Feng; Wu, Zhi-Ying

    2017-08-01

    Many sporadic Alzheimer's disease (SAD) risk genes have been identified in the last decades, but most of them have not been consistently accepted. Here, we sought to identify SAD-associated genes and their potential mechanisms involved in SAD pathogenesis. A 2-stage design was employed. In stage 1, 95 variants in 75 genes that were previously reported as SAD-risk genes in Caucasian populations were evaluated in 1857 subjects (422 SAD patients and 1435 controls). In stage 2, a subset of promising variants found in stage 1 were further evaluated in an independent cohort of 1001 subjects (254 SAD and 747 controls). Variants in CD2AP were significantly associated with SAD risk in our subjects. Furthermore, CD2AP gene expression in peripheral blood lymphocytes (PBL) from 209 SAD patients and 213 controls was determined. CD2AP gene expression in PBL was significantly decreased in patients with SAD as compared with controls. Our study suggests that CD2AP is an SAD-risk gene in Chinese Han population and CD2AP gene expression is decreased in the PBL of patients with SAD, indicating its possible systemic involvement in SAD. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Antagonizing the Spemann organizer: role of the homeobox gene Xvent-1.

    PubMed Central

    Gawantka, V; Delius, H; Hirschfeld, K; Blumenstock, C; Niehrs, C

    1995-01-01

    We have identified a novel homeobox gene, Xvent-1, that is differentially expressed in the ventral marginal zone of the early Xenopus gastrula. Evidence is presented from mRNA microinjection experiments for a role for this gene in dorsoventral patterning of mesoderm. First, Xvent-1 is induced by BMP-4, a gene known to be a key regulator of ventral mesoderm development. Second, Xvent-1 and the organizer-specific gene goosecoid are able to interact, directly or indirectly, in a cross-regulatory loop suppressing each other's expression, consistent with their mutually exclusive expression in the marginal zone. Third, microinjection of Xvent-1 mRNA ventralizes dorsal mesoderm. The results suggest that Xvent-1 functions in a ventral signaling pathway that maintains the ventral mesodermal state and antagonizes the Spemann organizer. Images PMID:8557046

  16. Sexual selection drives evolution and rapid turnover of male gene expression.

    PubMed

    Harrison, Peter W; Wright, Alison E; Zimmer, Fabian; Dean, Rebecca; Montgomery, Stephen H; Pointer, Marie A; Mank, Judith E

    2015-04-07

    The profound and pervasive differences in gene expression observed between males and females, and the unique evolutionary properties of these genes in many species, have led to the widespread assumption that they are the product of sexual selection and sexual conflict. However, we still lack a clear understanding of the connection between sexual selection and transcriptional dimorphism, often termed sex-biased gene expression. Moreover, the relative contribution of sexual selection vs. drift in shaping broad patterns of expression, divergence, and polymorphism remains unknown. To assess the role of sexual selection in shaping these patterns, we assembled transcriptomes from an avian clade representing the full range of sexual dimorphism and sexual selection. We use these species to test the links between sexual selection and sex-biased gene expression evolution in a comparative framework. Through ancestral reconstruction of sex bias, we demonstrate a rapid turnover of sex bias across this clade driven by sexual selection and show it to be primarily the result of expression changes in males. We use phylogenetically controlled comparative methods to demonstrate that phenotypic measures of sexual selection predict the proportion of male-biased but not female-biased gene expression. Although male-biased genes show elevated rates of coding sequence evolution, consistent with previous reports in a range of taxa, there is no association between sexual selection and rates of coding sequence evolution, suggesting that expression changes may be more important than coding sequence in sexual selection. Taken together, our results highlight the power of sexual selection to act on gene expression differences and shape genome evolution.

  17. Floral Meristem Identity Genes Are Expressed during Tendril Development in Grapevine1

    PubMed Central

    Calonje, Myriam; Cubas, Pilar; Martínez-Zapater, José M.; Carmona, María José

    2004-01-01

    To study the early steps of flower initiation and development in grapevine (Vitis vinifera), we have isolated two MADS-box genes, VFUL-L and VAP1, the putative FUL-like and AP1 grapevine orthologs, and analyzed their expression patterns during vegetative and reproductive development. Both genes are expressed in lateral meristems that, in grapevine, can give rise to either inflorescences or tendrils. They are also coexpressed in inflorescence and flower meristems. During flower development, VFUL-L transcripts are restricted to the central part of young flower meristems and, later, to the prospective carpel-forming region, which is consistent with a role of this gene in floral transition and carpel and fruit development. Expression pattern of VAP1 suggests that it may play a role in flowering transition and flower development. However, its lack of expression in sepal primordia, does not support its role as an A-function gene in grapevine. Neither VFUL-L nor VAP1 expression was detected in vegetative organs such as leaves or roots. In contrast, they are expressed throughout tendril development. Transcription of both genes in tendrils of very young plants that have not undergone flowering transition indicates that this expression is independent of the flowering process. These unique expression patterns of genes typically involved in reproductive development have implications on our understanding of flower induction and initiation in grapevine, on the origin of grapevine tendrils and on the functional roles of AP1-and FUL-like genes in plant development. These results also provide molecular support to the hypothesis that Vitis tendrils are modified reproductive organs adapted to climb. PMID:15247405

  18. Global transgenerational gene expression dynamics in two newly synthesized allohexaploid wheat (Triticum aestivum) lines

    PubMed Central

    2012-01-01

    Background Alteration in gene expression resulting from allopolyploidization is a prominent feature in plants, but its spectrum and extent are not fully known. Common wheat (Triticum aestivum) was formed via allohexaploidization about 10,000 years ago, and became the most important crop plant. To gain further insights into the genome-wide transcriptional dynamics associated with the onset of common wheat formation, we conducted microarray-based genome-wide gene expression analysis on two newly synthesized allohexaploid wheat lines with chromosomal stability and a genome constitution analogous to that of the present-day common wheat. Results Multi-color GISH (genomic in situ hybridization) was used to identify individual plants from two nascent allohexaploid wheat lines between Triticum turgidum (2n = 4x = 28; genome BBAA) and Aegilops tauschii (2n = 2x = 14; genome DD), which had a stable chromosomal constitution analogous to that of common wheat (2n = 6x = 42; genome BBAADD). Genome-wide analysis of gene expression was performed for these allohexaploid lines along with their parental plants from T. turgidum and Ae. tauschii, using the Affymetrix Gene Chip Wheat Genome-Array. Comparison with the parental plants coupled with inclusion of empirical mid-parent values (MPVs) revealed that whereas the great majority of genes showed the expected parental additivity, two major patterns of alteration in gene expression in the allohexaploid lines were identified: parental dominance expression and non-additive expression. Genes involved in each of the two altered expression patterns could be classified into three distinct groups, stochastic, heritable and persistent, based on their transgenerational heritability and inter-line conservation. Strikingly, whereas both altered patterns of gene expression showed a propensity of inheritance, identity of the involved genes was highly stochastic, consistent with the involvement of diverse Gene Ontology (GO) terms. Nonetheless, those genes showing non-additive expression exhibited a significant enrichment for vesicle-function. Conclusions Our results show that two patterns of global alteration in gene expression are conditioned by allohexaploidization in wheat, that is, parental dominance expression and non-additive expression. Both altered patterns of gene expression but not the identity of the genes involved are likely to play functional roles in stabilization and establishment of the newly formed allohexaploid plants, and hence, relevant to speciation and evolution of T. aestivum. PMID:22277161

  19. Identification and expression analysis of cold and freezing stress responsive genes of Brassica oleracea.

    PubMed

    Ahmed, Nasar Uddin; Jung, Hee-Jeong; Park, Jong-In; Cho, Yong-Gu; Hur, Yoonkang; Nou, Ill-Sup

    2015-01-10

    Cold and freezing stress is a major environmental constraint to the production of Brassica crops. Enhancement of tolerance by exploiting cold and freezing tolerance related genes offers the most efficient approach to address this problem. Cold-induced transcriptional profiling is a promising approach to the identification of potential genes related to cold and freezing stress tolerance. In this study, 99 highly expressed genes were identified from a whole genome microarray dataset of Brassica rapa. Blast search analysis of the Brassica oleracea database revealed the corresponding homologous genes. To validate their expression, pre-selected cold tolerant and susceptible cabbage lines were analyzed. Out of 99 BoCRGs, 43 were differentially expressed in response to varying degrees of cold and freezing stress in the contrasting cabbage lines. Among the differentially expressed genes, 18 were highly up-regulated in the tolerant lines, which is consistent with their microarray expression. Additionally, 12 BoCRGs were expressed differentially after cold stress treatment in two contrasting cabbage lines, and BoCRG54, 56, 59, 62, 70, 72 and 99 were predicted to be involved in cold regulatory pathways. Taken together, the cold-responsive genes identified in this study provide additional direction for elucidating the regulatory network of low temperature stress tolerance and developing cold and freezing stress resistant Brassica crops. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Whole Transcriptome Analysis of Pre-invasive and Invasive Early Squamous Lung Carcinoma in Archival Laser Microdissected Samples.

    PubMed

    Koper, Andre; Zeef, Leo A H; Joseph, Leena; Kerr, Keith; Gosney, John; Lindsay, Mark A; Booton, Richard

    2017-01-10

    Preinvasive squamous cell cancer (PSCC) are local transformations of bronchial epithelia that are frequently observed in current or former smokers. Their different grades and sizes suggest a continuum of dysplastic change with increasing severity, which may culminate in invasive squamous cell carcinoma (ISCC). As a consequence of the difficulty in isolating cancerous cells from biopsies, the molecular pathology that underlies their histological variability remains largely unknown. To address this issue, we have employed microdissection to isolate normal bronchial epithelia and cancerous cells from low- and high-grade PSCC and ISCC, from paraffin embedded (FFPE) biopsies and determined gene expression using Affymetric Human Exon 1.0 ST arrays. Tests for differential gene expression were performed using the Bioconductor package limma followed by functional analyses of differentially expressed genes in IPA. Examination of differential gene expression showed small differences between low- and high-grade PSCC but substantial changes between PSCC and ISCC samples (184 vs 1200 p-value <0.05, fc ±1.75). However, the majority of the differentially expressed PSCC genes (142 genes: 77%) were shared with those in ISCC samples. Pathway analysis showed that these shared genes are associated with DNA damage response, DNA/RNA metabolism and inflammation as major biological themes. Cluster analysis identified 12 distinct patterns of gene expression including progressive up or down-regulation across PSCC and ISCC. Pathway analysis of incrementally up-regulated genes revealed again significant enrichment of terms related to DNA damage response, DNA/RNA metabolism, inflammation, survival and proliferation. Altered expression of selected genes was confirmed using RT-PCR, as well as immunohistochemistry in an independent set of 45 ISCCs. Gene expression profiles in PSCC and ISCC differ greatly in terms of numbers of genes with altered transcriptional activity. However, altered gene expression in PSCC affects canonical pathways and cellular and biological processes, such as inflammation and DNA damage response, which are highly consistent with hallmarks of cancer.

  1. Real-time recording of circadian liver gene expression in freely moving mice reveals the phase-setting behavior of hepatocyte clocks

    PubMed Central

    Saini, Camille; Liani, André; Curie, Thomas; Gos, Pascal; Kreppel, Florian; Emmenegger, Yann; Bonacina, Luigi; Wolf, Jean-Pierre; Poget, Yves-Alain; Franken, Paul; Schibler, Ueli

    2013-01-01

    The mammalian circadian timing system consists of a master pacemaker in the suprachiasmatic nucleus (SCN) in the hypothalamus, which is thought to set the phase of slave oscillators in virtually all body cells. However, due to the lack of appropriate in vivo recording technologies, it has been difficult to study how the SCN synchronizes oscillators in peripheral tissues. Here we describe the real-time recording of bioluminescence emitted by hepatocytes expressing circadian luciferase reporter genes in freely moving mice. The technology employs a device dubbed RT-Biolumicorder, which consists of a cylindrical cage with reflecting conical walls that channel photons toward a photomultiplier tube. The monitoring of circadian liver gene expression revealed that hepatocyte oscillators of SCN-lesioned mice synchronized more rapidly to feeding cycles than hepatocyte clocks of intact mice. Hence, the SCN uses signaling pathways that counteract those of feeding rhythms when their phase is in conflict with its own phase. PMID:23824542

  2. Evaluating between-pathway models with expression data.

    PubMed

    Hescott, B J; Leiserson, M D M; Cowen, L J; Slonim, D K

    2010-03-01

    Between-pathway models (BPMs) are network motifs consisting of pairs of putative redundant pathways. In this article, we show how adding another source of high-throughput data--microarray gene expression data from knockout experiments--allows us to identify a compensatory functional relationship between genes from the two BPM pathways. We evaluate the quality of the BPMs from four different studies, and we describe how our methods might be extended to refine pathways.

  3. Major cellular and physiological impacts of ocean acidification on a reef building coral.

    PubMed

    Kaniewska, Paulina; Campbell, Paul R; Kline, David I; Rodriguez-Lanetty, Mauricio; Miller, David J; Dove, Sophie; Hoegh-Guldberg, Ove

    2012-01-01

    As atmospheric levels of CO(2) increase, reef-building corals are under greater stress from both increased sea surface temperatures and declining sea water pH. To date, most studies have focused on either coral bleaching due to warming oceans or declining calcification due to decreasing oceanic carbonate ion concentrations. Here, through the use of physiology measurements and cDNA microarrays, we show that changes in pH and ocean chemistry consistent with two scenarios put forward by the Intergovernmental Panel on Climate Change (IPCC) drive major changes in gene expression, respiration, photosynthesis and symbiosis of the coral, Acropora millepora, before affects on biomineralisation are apparent at the phenotype level. Under high CO(2) conditions corals at the phenotype level lost over half their Symbiodinium populations, and had a decrease in both photosynthesis and respiration. Changes in gene expression were consistent with metabolic suppression, an increase in oxidative stress, apoptosis and symbiont loss. Other expression patterns demonstrate upregulation of membrane transporters, as well as the regulation of genes involved in membrane cytoskeletal interactions and cytoskeletal remodeling. These widespread changes in gene expression emphasize the need to expand future studies of ocean acidification to include a wider spectrum of cellular processes, many of which may occur before impacts on calcification.

  4. Major Cellular and Physiological Impacts of Ocean Acidification on a Reef Building Coral

    PubMed Central

    Kaniewska, Paulina; Campbell, Paul R.; Kline, David I.; Rodriguez-Lanetty, Mauricio; Miller, David J.

    2012-01-01

    As atmospheric levels of CO2 increase, reef-building corals are under greater stress from both increased sea surface temperatures and declining sea water pH. To date, most studies have focused on either coral bleaching due to warming oceans or declining calcification due to decreasing oceanic carbonate ion concentrations. Here, through the use of physiology measurements and cDNA microarrays, we show that changes in pH and ocean chemistry consistent with two scenarios put forward by the Intergovernmental Panel on Climate Change (IPCC) drive major changes in gene expression, respiration, photosynthesis and symbiosis of the coral, Acropora millepora, before affects on biomineralisation are apparent at the phenotype level. Under high CO2 conditions corals at the phenotype level lost over half their Symbiodinium populations, and had a decrease in both photosynthesis and respiration. Changes in gene expression were consistent with metabolic suppression, an increase in oxidative stress, apoptosis and symbiont loss. Other expression patterns demonstrate upregulation of membrane transporters, as well as the regulation of genes involved in membrane cytoskeletal interactions and cytoskeletal remodeling. These widespread changes in gene expression emphasize the need to expand future studies of ocean acidification to include a wider spectrum of cellular processes, many of which may occur before impacts on calcification. PMID:22509341

  5. Epigenetic dysregulation of the dopamine system in diet-induced obesity.

    PubMed

    Vucetic, Zivjena; Carlin, Jesse Lea; Totoki, Kathy; Reyes, Teresa M

    2012-03-01

    Chronic intake of high-fat (HF) diet is known to alter brain neurotransmitter systems that participate in the central regulation of food intake. Dopamine (DA) system changes in response to HF diet have been observed in the hypothalamus, important in the homeostatic control of food intake, as well as within the central reward circuitry [ventral tegmental area (VTA), nucleus accumbens (NAc), and pre-frontal cortex (PFC)], critical for coding the rewarding properties of palatable food and important in hedonically driven feeding behavior. Using a mouse model of diet-induced obesity (DIO), significant alterations in the expression of DA-related genes were documented in adult animals, and the general pattern of gene expression changes was opposite within the hypothalamus versus the reward circuitry (increased vs. decreased, respectively). Differential DNA methylation was identified within the promoter regions of tyrosine hydroxylase (TH) and dopamine transporter (DAT), and the pattern of this response was consistent with the pattern of gene expression. Behaviors consistent with increased hypothalamic DA and decreased reward circuitry DA were observed. These data identify differential DNA methylation as an epigenetic mechanism linking the chronic intake of HF diet with altered DA-related gene expression, and this response varies by brain region and DNA sequence. © 2012 The Authors. Journal of Neurochemistry © 2012 International Society for Neurochemistry.

  6. Inter- and intra-species variation in genome-wide gene expression of Drosophila in response to parasitoid wasp attack.

    PubMed

    Salazar-Jaramillo, Laura; Jalvingh, Kirsten M; de Haan, Ammerins; Kraaijeveld, Ken; Buermans, Henk; Wertheim, Bregje

    2017-04-27

    Parasitoid resistance in Drosophila varies considerably, among and within species. An immune response, lamellocyte-mediated encapsulation, evolved in a subclade of Drosophila and was subsequently lost in at least one species within this subclade. While the mechanisms of resistance are fairly well documented in D. melanogaster, much less is known for closely related species. Here, we studied the inter- and intra-species variation in gene expression after parasitoid attack in Drosophila. We used RNA-seq after parasitization of four closely related Drosophila species of the melanogaster subgroup and replicated lines of D. melanogaster experimentally selected for increased resistance to gain insights into short- and long-term evolutionary changes. We found a core set of genes that are consistently up-regulated after parasitoid attack in the species and lines tested, regardless of their level of resistance. Another set of genes showed no up-regulation or expression in D. sechellia, the species unable to raise an immune response against parasitoids. This set consists largely of genes that are lineage-restricted to the melanogaster subgroup. Artificially selected lines did not show significant differences in gene expression with respect to non-selected lines in their responses to parasitoid attack, but several genes showed differential exon usage. We showed substantial similarities, but also notable differences, in the transcriptional responses to parasitoid attack among four closely related Drosophila species. In contrast, within D. melanogaster, the responses were remarkably similar. We confirmed that in the short-term, selection does not act on a pre-activation of the immune response. Instead it may target alternative mechanisms such as differential exon usage. In the long-term, we found support for the hypothesis that the ability to immunologically resist parasitoid attack is contingent on new genes that are restricted to the melanogaster subgroup.

  7. Gene Network Rewiring to Study Melanoma Stage Progression and Elements Essential for Driving Melanoma

    PubMed Central

    Kaushik, Abhinav; Bhatia, Yashuma; Ali, Shakir; Gupta, Dinesh

    2015-01-01

    Metastatic melanoma patients have a poor prognosis, mainly attributable to the underlying heterogeneity in melanoma driver genes and altered gene expression profiles. These characteristics of melanoma also make the development of drugs and identification of novel drug targets for metastatic melanoma a daunting task. Systems biology offers an alternative approach to re-explore the genes or gene sets that display dysregulated behaviour without being differentially expressed. In this study, we have performed systems biology studies to enhance our knowledge about the conserved property of disease genes or gene sets among mutually exclusive datasets representing melanoma progression. We meta-analysed 642 microarray samples to generate melanoma reconstructed networks representing four different stages of melanoma progression to extract genes with altered molecular circuitry wiring as compared to a normal cellular state. Intriguingly, a majority of the melanoma network-rewired genes are not differentially expressed and the disease genes involved in melanoma progression consistently modulate its activity by rewiring network connections. We found that the shortlisted disease genes in the study show strong and abnormal network connectivity, which enhances with the disease progression. Moreover, the deviated network properties of the disease gene sets allow ranking/prioritization of different enriched, dysregulated and conserved pathway terms in metastatic melanoma, in agreement with previous findings. Our analysis also reveals presence of distinct network hubs in different stages of metastasizing tumor for the same set of pathways in the statistically conserved gene sets. The study results are also presented as a freely available database at http://bioinfo.icgeb.res.in/m3db/. The web-based database resource consists of results from the analysis presented here, integrated with cytoscape web and user-friendly tools for visualization, retrieval and further analysis. PMID:26558755

  8. Evaluation of reference genes for quantitative real-time PCR in oil palm elite planting materials propagated by tissue culture.

    PubMed

    Chan, Pek-Lan; Rose, Ray J; Abdul Murad, Abdul Munir; Zainal, Zamri; Low, Eng-Ti Leslie; Ooi, Leslie Cheng-Li; Ooi, Siew-Eng; Yahya, Suzaini; Singh, Rajinder

    2014-01-01

    The somatic embryogenesis tissue culture process has been utilized to propagate high yielding oil palm. Due to the low callogenesis and embryogenesis rates, molecular studies were initiated to identify genes regulating the process, and their expression levels are usually quantified using reverse transcription quantitative real-time PCR (RT-qPCR). With the recent release of oil palm genome sequences, it is crucial to establish a proper strategy for gene analysis using RT-qPCR. Selection of the most suitable reference genes should be performed for accurate quantification of gene expression levels. In this study, eight candidate reference genes selected from cDNA microarray study and literature review were evaluated comprehensively across 26 tissue culture samples using RT-qPCR. These samples were collected from two tissue culture lines and media treatments, which consisted of leaf explants cultures, callus and embryoids from consecutive developmental stages. Three statistical algorithms (geNorm, NormFinder and BestKeeper) confirmed that the expression stability of novel reference genes (pOP-EA01332, PD00380 and PD00569) outperformed classical housekeeping genes (GAPDH, NAD5, TUBULIN, UBIQUITIN and ACTIN). PD00380 and PD00569 were identified as the most stably expressed genes in total samples, MA2 and MA8 tissue culture lines. Their applicability to validate the expression profiles of a putative ethylene-responsive transcription factor 3-like gene demonstrated the importance of using the geometric mean of two genes for normalization. Systematic selection of the most stably expressed reference genes for RT-qPCR was established in oil palm tissue culture samples. PD00380 and PD00569 were selected for accurate and reliable normalization of gene expression data from RT-qPCR. These data will be valuable to the research associated with the tissue culture process. Also, the method described here will facilitate the selection of appropriate reference genes in other oil palm tissues and in the expression profiling of genes relating to yield, biotic and abiotic stresses.

  9. A mesh generation and machine learning framework for Drosophila gene expression pattern image analysis

    PubMed Central

    2013-01-01

    Background Multicellular organisms consist of cells of many different types that are established during development. Each type of cell is characterized by the unique combination of expressed gene products as a result of spatiotemporal gene regulation. Currently, a fundamental challenge in regulatory biology is to elucidate the gene expression controls that generate the complex body plans during development. Recent advances in high-throughput biotechnologies have generated spatiotemporal expression patterns for thousands of genes in the model organism fruit fly Drosophila melanogaster. Existing qualitative methods enhanced by a quantitative analysis based on computational tools we present in this paper would provide promising ways for addressing key scientific questions. Results We develop a set of computational methods and open source tools for identifying co-expressed embryonic domains and the associated genes simultaneously. To map the expression patterns of many genes into the same coordinate space and account for the embryonic shape variations, we develop a mesh generation method to deform a meshed generic ellipse to each individual embryo. We then develop a co-clustering formulation to cluster the genes and the mesh elements, thereby identifying co-expressed embryonic domains and the associated genes simultaneously. Experimental results indicate that the gene and mesh co-clusters can be correlated to key developmental events during the stages of embryogenesis we study. The open source software tool has been made available at http://compbio.cs.odu.edu/fly/. Conclusions Our mesh generation and machine learning methods and tools improve upon the flexibility, ease-of-use and accuracy of existing methods. PMID:24373308

  10. Sox genes in the coral Acropora millepora: divergent expression patterns reflect differences in developmental mechanisms within the Anthozoa

    PubMed Central

    2008-01-01

    Background Sox genes encode transcription factors that function in a wide range of developmental processes across the animal kingdom. To better understand both the evolution of the Sox family and the roles of these genes in cnidarians, we are studying the Sox gene complement of the coral, Acropora millepora (Class Anthozoa). Results Based on overall domain structures and HMG box sequences, the Acropora Sox genes considered here clearly fall into four of the five major Sox classes. AmSoxC is expressed in the ectoderm during development, in cells whose morphology is consistent with their assignment as sensory neurons. The expression pattern of the Nematostella ortholog of this gene is broadly similar to that of AmSoxC, but there are subtle differences – for example, expression begins significantly earlier in Acropora than in Nematostella. During gastrulation, AmSoxBb and AmSoxB1 transcripts are detected only in the presumptive ectoderm while AmSoxE1 transcription is restricted to the presumptive endoderm, suggesting that these Sox genes might play roles in germ layer specification. A third type B Sox gene, AmSoxBa, and a Sox F gene AmSoxF also have complex and specific expression patterns during early development. Each of these genes has a clear Nematostella ortholog, but in several cases the expression pattern observed in Acropora differs significantly from that reported in Nematostella. Conclusion These differences in expression patterns between Acropora and Nematostella largely reflect fundamental differences in developmental processes, underscoring the diversity of mechanisms within the anthozoan Sub-Class Hexacorallia (Zoantharia). PMID:19014479

  11. Concordant integrative gene set enrichment analysis of multiple large-scale two-sample expression data sets.

    PubMed

    Lai, Yinglei; Zhang, Fanni; Nayak, Tapan K; Modarres, Reza; Lee, Norman H; McCaffrey, Timothy A

    2014-01-01

    Gene set enrichment analysis (GSEA) is an important approach to the analysis of coordinate expression changes at a pathway level. Although many statistical and computational methods have been proposed for GSEA, the issue of a concordant integrative GSEA of multiple expression data sets has not been well addressed. Among different related data sets collected for the same or similar study purposes, it is important to identify pathways or gene sets with concordant enrichment. We categorize the underlying true states of differential expression into three representative categories: no change, positive change and negative change. Due to data noise, what we observe from experiments may not indicate the underlying truth. Although these categories are not observed in practice, they can be considered in a mixture model framework. Then, we define the mathematical concept of concordant gene set enrichment and calculate its related probability based on a three-component multivariate normal mixture model. The related false discovery rate can be calculated and used to rank different gene sets. We used three published lung cancer microarray gene expression data sets to illustrate our proposed method. One analysis based on the first two data sets was conducted to compare our result with a previous published result based on a GSEA conducted separately for each individual data set. This comparison illustrates the advantage of our proposed concordant integrative gene set enrichment analysis. Then, with a relatively new and larger pathway collection, we used our method to conduct an integrative analysis of the first two data sets and also all three data sets. Both results showed that many gene sets could be identified with low false discovery rates. A consistency between both results was also observed. A further exploration based on the KEGG cancer pathway collection showed that a majority of these pathways could be identified by our proposed method. This study illustrates that we can improve detection power and discovery consistency through a concordant integrative analysis of multiple large-scale two-sample gene expression data sets.

  12. Specific Tandem 3'UTR Patterns and Gene Expression Profiles in Mouse Thy1+ Germline Stem Cells

    PubMed Central

    Lin, Zhuoheng; Feng, Xuyang; Jiang, Xue; Songyang, Zhou; Huang, Junjiu

    2015-01-01

    A recently developed strategy of sequencing alternative polyadenylation (APA) sites (SAPAS) with second-generation sequencing technology can be used to explore complete genome-wide patterns of tandem APA sites and global gene expression profiles. spermatogonial stem cells (SSCs) maintain long-term reproductive abilities in male mammals. The detailed mechanisms by which SSCs self-renew and generate mature spermatozoa are not clear. To understand the specific alternative polyadenylation pattern and global gene expression profile of male germline stem cells (GSCs, mainly referred to SSCs here), we isolated and purified mouse Thy1+ cells from testis by magnetic-activated cell sorting (MACS) and then used the SAPAS method for analysis, using pluripotent embryonic stem cells (ESCs) and differentiated mouse embryonic fibroblast cells (MEFs) as controls. As a result, we obtained 99,944 poly(A) sites, approximately 40% of which were newly detected in our experiments. These poly(A) sites originated from three mouse cell types and covered 17,499 genes, including 831 long non-coding RNA (lncRNA) genes. We observed that GSCs tend to have shorter 3'UTR lengths while MEFs tend towards longer 3'UTR lengths. We also identified 1337 genes that were highly expressed in GSCs, and these genes were highly consistent with the functional characteristics of GSCs. Our detailed bioinformatics analysis identified APA site-switching events at 3'UTRs and many new specifically expressed genes in GSCs, which we experimentally confirmed. Furthermore, qRT-PCR was performed to validate several events of the 334 genes with distal-to-proximal poly(A) switch in GSCs. Consistently APA reporter assay confirmed the total 3'UTR shortening in GSCs compared to MEFs. We also analyzed the cis elements around the proximal poly(A) site preferentially used in GSCs and found C-rich elements may contribute to this regulation. Overall, our results identified the expression level and polyadenylation site profiles and these data provide new insights into the processes potentially involved in the GSC life cycle and spermatogenesis. PMID:26713853

  13. Both a PKS and a PPTase are involved in melanin biosynthesis and regulation of Aureobasidium melanogenum XJ5-1 isolated from the Taklimakan desert.

    PubMed

    Jiang, Hong; Liu, Guang-Lei; Chi, Zhe; Wang, Jian-Ming; Zhang, Ly-Ly; Chi, Zhen-Ming

    2017-02-20

    A PKS1 gene responsible for the melanin biosynthesis and a NPG1 gene in Aureobasidium melanogenum XJ5-1 were cloned and characterized. An ORF of the PKS1 gene encoding a protein with 2165 amino acids contained 6495bp while an ORF of the NPG1 gene encoding a protein with 340 amino acids had 1076bp. After analysis of their promoters, it was found that expression of both the PKS1 gene and the NPG1 gene was repressed by nitrogen sources and glucose, respectively. The PKS deduced from the cloned gene consisted of one ketosynthase, one acyl transferase, two acyl carrier proteins, one thioesterase and one cyclase while the PPTase belonged to the family Sfp-type. After disruption of the PKS1 gene and the NPG1 gene, expression of the PKS1 gene and the NPG1 gene and the melanin biosynthesis in the disruptants K5 and DP107 disappeared and expression of the PKS1 gene in the disruptant DP107 was also negatively influenced. However, after the NPG1 gene was complemented in the disruptant DP107, the melanin biosynthesis in the complementary strain BP17 was restored and expression of the PKS1 gene and the NPG1 gene was greatly enhanced, suggesting that the PKS was indeed activated and regulated by the PPTase and expression of the PKS1 gene and the NPG1 gene had a coordinate regulation. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Coordinated gene expression for pheromone biosynthesis in the pine engraver beetle, Ips pini (Coleoptera: Scolytidae)

    NASA Astrophysics Data System (ADS)

    Keeling, Christopher I.; Blomquist, Gary J.; Tittiger, Claus

    In several pine bark beetle species, phloem feeding induces aggregation pheromone production to coordinate a mass attack on the host tree. Male pine engraver beetles, Ips pini (Say) (Coleoptera: Scolytidae), produce the monoterpenoid pheromone component ipsdienol de novo via the mevalonate pathway in the anterior midgut upon feeding. To understand how pheromone production is regulated in this tissue, we used quantitative real-time PCR to examine feeding-induced changes in gene expression of seven mevalonate pathway genes: acetoacetyl-coenzyme A thiolase, 3-hydroxy-3-methylglutaryl coenzyme A synthase, 3-hydroxy-3-methylglutaryl coenzyme A reductase, mevalonate 5-diphosphate decarboxylase, isopentenyl-diphosphate isomerase, geranyl-diphosphate synthase (GPPS), and farnesyl-diphosphate synthase (FPPS). In males, expression of all these genes significantly increased upon feeding. In females, the expression of the early mevalonate pathway genes (up to and including the isomerase) increased significantly, but the expression of the later genes (GPPS and FPPS) was unaffected or decreased upon feeding. Thus, feeding coordinately regulates expression of the mevalonate pathway genes necessary for pheromone biosynthesis in male, but not female, midguts. Furthermore, basal mRNA levels were 5- to 41-fold more abundant in male midguts compared to female midguts. This is the first report of coordinated regulation of mevalonate pathway genes in an invertebrate model consistent with their sex-specific role in de novo pheromone biosynthesis.

  15. Expression Profiling of R Gene-Mediated Host Defense Against Aphid Feeding in Wheat

    USDA-ARS?s Scientific Manuscript database

    The greenbug, Schizaphis graminum (Rondani), is an important aphid pest of wheat in the southern High Plains of the U.S. The single dominant gene, Gb3 confers consistent and durable resistance against prevailing greenbug biotypes in wheat fields. However, molecular mechanisms of R gene mediated host...

  16. Long-Range Chromosome Interactions Mediated by Cohesin Shape Circadian Gene Expression

    PubMed Central

    Xu, Yichi; Guo, Weimin; Li, Ping; Zhang, Yan; Zhao, Meng; Fan, Zenghua; Zhao, Zhihu; Yan, Jun

    2016-01-01

    Mammalian circadian rhythm is established by the negative feedback loops consisting of a set of clock genes, which lead to the circadian expression of thousands of downstream genes in vivo. As genome-wide transcription is organized under the high-order chromosome structure, it is largely uncharted how circadian gene expression is influenced by chromosome architecture. We focus on the function of chromatin structure proteins cohesin as well as CTCF (CCCTC-binding factor) in circadian rhythm. Using circular chromosome conformation capture sequencing, we systematically examined the interacting loci of a Bmal1-bound super-enhancer upstream of a clock gene Nr1d1 in mouse liver. These interactions are largely stable in the circadian cycle and cohesin binding sites are enriched in the interactome. Global analysis showed that cohesin-CTCF co-binding sites tend to insulate the phases of circadian oscillating genes while cohesin-non-CTCF sites are associated with high circadian rhythmicity of transcription. A model integrating the effects of cohesin and CTCF markedly improved the mechanistic understanding of circadian gene expression. Further experiments in cohesin knockout cells demonstrated that cohesin is required at least in part for driving the circadian gene expression by facilitating the enhancer-promoter looping. This study provided a novel insight into the relationship between circadian transcriptome and the high-order chromosome structure. PMID:27135601

  17. Effects of temperature on gene expression in embryos of the coral Montastraea faveolata

    PubMed Central

    2009-01-01

    Background Coral reefs are expected to be severely impacted by rising seawater temperatures associated with climate change. This study used cDNA microarrays to investigate transcriptional effects of thermal stress in embryos of the coral Montastraea faveolata. Embryos were exposed to 27.5°C, 29.0°C, and 31.5°C directly after fertilization. Differences in gene expression were measured after 12 and 48 hours. Results Analysis of differentially expressed genes indicated that increased temperatures may lead to oxidative stress, apoptosis, and a structural reconfiguration of the cytoskeletal network. Metabolic processes were downregulated, and the action of histones and zinc finger-containing proteins may have played a role in the long-term regulation upon heat stress. Conclusions Embryos responded differently depending on exposure time and temperature level. Embryos showed expression of stress-related genes already at a temperature of 29.0°C, but seemed to be able to counteract the initial response over time. By contrast, embryos at 31.5°C displayed continuous expression of stress genes. The genes that played a role in the response to elevated temperatures consisted of both highly conserved and coral-specific genes. These genes might serve as a basis for research into coral-specific adaptations to stress responses and global climate change. PMID:20030803

  18. Construction and application of a bovine immune-endocrine cDNA microarray.

    PubMed

    Tao, Wenjing; Mallard, Bonnie; Karrow, Niel; Bridle, Byram

    2004-09-01

    A variety of commercial DNA arrays specific for humans and rodents are widely available; however, microarrays containing well-characterized genes to study pathway-specific gene expression are not as accessible for domestic animals, such as cattle, sheep and pigs. Therefore, a small-scale application-targeted bovine immune-endocrine cDNA array was developed to evaluate genetic pathways involved in the immune-endocrine axis of cattle during periods of altered homeostasis provoked by physiological or environmental stressors, such as infection, vaccination or disease. For this purpose, 167 cDNA sequences corresponding to immune, endocrine and inflammatory response genes were collected and categorized. Positive controls included 5 housekeeping genes (glyceraldehydes-3-phosphate dehydrogenase, hypoxanthine phosphoribosyltransferase, ribosomal protein L19, beta-actin, beta2-microglobulin) and bovine genomic DNA. Negative controls were a bacterial gene (Rhodococcus equi 17-kDa virulence-associated protein) and a partial sequence of the plasmid pACYC177. In addition, RNA extracted from un-stimulated, as well as superantigen (Staphylococcus aureus enterotoxin-A, S. aureus Cowan Pansorbin Cells) and mitogen-stimulated (LPS, ConA) bovine blood leukocytes was mixed, reverse transcribed and PCR amplified using gene-specific primers. The endocrine-associated genes were amplified from cDNA derived from un-stimulated bovine hypothalamus, pituitary, adrenal and thyroid gland tissues. The array was constructed in 4 repeating grids of 180 duplicated spots by coupling the PCR amplified 213-630 bp gene fragments onto poly-l-lysine coated glass slides. The bovine immune-endocrine arrays were standardized and preliminary gene expression profiles generated using Cy3 and Cy5 labelled cDNA from un-stimulated and ConA (5 microg/ml) stimulated PBMC of 4 healthy Holstein cows (2-4 replicate arrays/cow) in a time course study. Mononuclear cell-derived cytokine and chemokine (IL-2, IL-1alpha, TNFalpha, IFN-gamma, TGFbeta-1, MCP-1, MCP-2 and MIP-3alpha) mRNA exhibited a repeatable and consistently low expression in un-stimulated cells and at least a two-fold increased expression following 6 and 24 h ConA stimulation as compared to 0 h un-stimulated controls. In contrast, expression of antigen presenting molecules, MHC-DR, MHC-DQ and MHC-DY, were consistently at least two-fold lower following 6 and 24 h ConA stimulation. The only endocrine gene with differential expression following ConA stimulation was prolactin. Additionally, due to the high level of genetic homology between ovine, swine and bovine genes, RNA similarly acquired from sheep and pigs was evaluated and similar gene expression patterns were noted. These data demonstrate that this application-targeted array containing a set of well characterized genes can be used to determine the relative gene expression corresponding to immune-endocrine responses of cattle and related species, sheep and pigs.

  19. The Arabidopsis translatome cell-specific mRNA atlas: Mining suberin and cutin lipid monomer biosynthesis genes as an example for data application.

    PubMed

    Mustroph, Angelika; Bailey-Serres, Julia

    2010-03-01

    Plants consist of distinct cell types distinguished by position, morphological features and metabolic activities. We recently developed a method to extract cell-type specific mRNA populations by immunopurification of ribosome-associated mRNAs. Microarray profiles of 21 cell-specific mRNA populations from seedling roots and shoots comprise the Arabidopsis Translatome dataset. This gene expression atlas provides a new tool for the study of cell-specific processes. Here we provide an example of how genes involved in a pathway limited to one or few cell-types can be further characterized and new candidate genes can be predicted. Cells of the root endodermis produce suberin as an inner barrier between the cortex and stele, whereas the shoot epidermal cells form cutin as a barrier to the external environment. Both polymers consist of fatty acid derivates, and share biosynthetic origins. We use the Arabidopsis Translatome dataset to demonstrate the significant cell-specific expression patterns of genes involved in those biosynthetic processes and suggest new candidate genes in the biosynthesis of suberin and cutin.

  20. Transcriptome analysis of WRKY gene family in Oryza officinalis Wall ex Watt and WRKY genes involved in responses to Xanthomonas oryzae pv. oryzae stress

    PubMed Central

    Jiang, Chunmiao; Shen, Qingxi J.; Wang, Bo; He, Bin; Xiao, Suqin; Chen, Ling; Yu, Tengqiong; Ke, Xue; Zhong, Qiaofang; Fu, Jian; Chen, Yue; Wang, Lingxian; Yin, Fuyou; Zhang, Dunyu; Ghidan, Walid; Huang, Xingqi; Cheng, Zaiquan

    2017-01-01

    Oryza officinalis Wall ex Watt, a very important and special wild rice species, shows abundant genetic diversity and disease resistance features, especially high resistance to bacterial blight. The molecular mechanisms of bacterial blight resistance in O. officinalis have not yet been elucidated. The WRKY transcription factor family is one of the largest gene families involved in plant growth, development and stress response. However, little is known about the numbers, structure, molecular phylogenetics, and expression of the WRKY genes under Xanthomonas oryzae pv. oryzae (Xoo) stress in O. officinalis due to lacking of O. officinalis genome. Therefore, based on the RNA-sequencing data of O. officinalis, we performed a comprehensive study of WRKY genes in O. officinalis and identified 89 OoWRKY genes. Then 89 OoWRKY genes were classified into three groups based on the WRKY domains and zinc finger motifs. Phylogenetic analysis strongly supported that the evolution of OoWRKY genes were consistent with previous studies of WRKYs, and subgroup IIc OoWRKY genes were the original ancestors of some group II and group III OoWRKYs. Among the 89 OoWRKY genes, eight OoWRKYs displayed significantly different expression (>2-fold, p<0.01) in the O. officinalis transcriptome under Xoo strains PXO99 and C5 stress 48 h, suggesting these genes might play important role in PXO99 and C5 stress responses in O. officinalis. QRT-PCR analysis and confirmation of eight OoWRKYs expression patterns revealed that they responded strongly to PXO99 and C5 stress 24 h, 48 h, and 72 h, and the trends of these genes displaying marked changes were consistent with the 48 h RNA-sequencing data, demonstrated these genes played important roles in response to biotic stress and might even involved in the bacterial blight resistance. Tissue expression profiles of eight OoWRKY genes revealed that they were highly expressed in root, stem, leaf, and flower, especially in leaf (except OoWRKY71), suggesting these genes might be also important for plant growth and organ development. In this study, we analyzed the WRKY family of transcription factors in O.officinalis. Insight was gained into the classification, evolution, and function of the OoWRKY genes, revealing the putative roles of eight significantly different expression OoWRKYs in Xoo strains PXO99 and C5 stress responses in O.officinalis. This study provided a better understanding of the evolution and functions of O. officinalis WRKY genes, and suggested that manipulating eight significantly different expression OoWRKYs would enhance resistance to bacterial blight. PMID:29190793

  1. Transcriptome analysis of WRKY gene family in Oryza officinalis Wall ex Watt and WRKY genes involved in responses to Xanthomonas oryzae pv. oryzae stress.

    PubMed

    Jiang, Chunmiao; Shen, Qingxi J; Wang, Bo; He, Bin; Xiao, Suqin; Chen, Ling; Yu, Tengqiong; Ke, Xue; Zhong, Qiaofang; Fu, Jian; Chen, Yue; Wang, Lingxian; Yin, Fuyou; Zhang, Dunyu; Ghidan, Walid; Huang, Xingqi; Cheng, Zaiquan

    2017-01-01

    Oryza officinalis Wall ex Watt, a very important and special wild rice species, shows abundant genetic diversity and disease resistance features, especially high resistance to bacterial blight. The molecular mechanisms of bacterial blight resistance in O. officinalis have not yet been elucidated. The WRKY transcription factor family is one of the largest gene families involved in plant growth, development and stress response. However, little is known about the numbers, structure, molecular phylogenetics, and expression of the WRKY genes under Xanthomonas oryzae pv. oryzae (Xoo) stress in O. officinalis due to lacking of O. officinalis genome. Therefore, based on the RNA-sequencing data of O. officinalis, we performed a comprehensive study of WRKY genes in O. officinalis and identified 89 OoWRKY genes. Then 89 OoWRKY genes were classified into three groups based on the WRKY domains and zinc finger motifs. Phylogenetic analysis strongly supported that the evolution of OoWRKY genes were consistent with previous studies of WRKYs, and subgroup IIc OoWRKY genes were the original ancestors of some group II and group III OoWRKYs. Among the 89 OoWRKY genes, eight OoWRKYs displayed significantly different expression (>2-fold, p<0.01) in the O. officinalis transcriptome under Xoo strains PXO99 and C5 stress 48 h, suggesting these genes might play important role in PXO99 and C5 stress responses in O. officinalis. QRT-PCR analysis and confirmation of eight OoWRKYs expression patterns revealed that they responded strongly to PXO99 and C5 stress 24 h, 48 h, and 72 h, and the trends of these genes displaying marked changes were consistent with the 48 h RNA-sequencing data, demonstrated these genes played important roles in response to biotic stress and might even involved in the bacterial blight resistance. Tissue expression profiles of eight OoWRKY genes revealed that they were highly expressed in root, stem, leaf, and flower, especially in leaf (except OoWRKY71), suggesting these genes might be also important for plant growth and organ development. In this study, we analyzed the WRKY family of transcription factors in O.officinalis. Insight was gained into the classification, evolution, and function of the OoWRKY genes, revealing the putative roles of eight significantly different expression OoWRKYs in Xoo strains PXO99 and C5 stress responses in O.officinalis. This study provided a better understanding of the evolution and functions of O. officinalis WRKY genes, and suggested that manipulating eight significantly different expression OoWRKYs would enhance resistance to bacterial blight.

  2. [Screening of virulence gene in golden hamster cheek pouch mucosa carcinomatous change induced by 9,10-dimethylene-1,2-benzanthracene].

    PubMed

    Zhang, Guo-dong; Yang, Kai; Mei, Jie

    2010-05-01

    To examine and analyze the global gene expression at the different stages of golden hamster cheek pouch mucosa carcinomatous change induced by 9,10-dimethylene-1,2 benzanthracene (DMBA). The model of golden hamster cheek pouch squamous cell carcinoma was induced by DMBA. The RNA of normal mucosa, precancerous lesions and squamous cell carcinoma of fresh tissue of golden hamsters was extracted and purified and the cRNA labeled by fluorescent Cy3 synthesized, which respectively hybridized with the agilent rat cDNA microarray containing 41 000 genes-expressed sequence tags, scanning with Agilent G2565AA fluorescence scanner. The Ratio>or=2 and Ratio

  3. Inflammatory gene expression in whole blood cells after EPA vs. DHA supplementation: Results from the ComparED study.

    PubMed

    Vors, Cécile; Allaire, Janie; Marin, Johanne; Lépine, Marie-Claude; Charest, Amélie; Tchernof, André; Couture, Patrick; Lamarche, Benoît

    2017-02-01

    Whether EPA and DHA exert similar anti-inflammatory effects through modulation of gene expression in immune cells remains unclear. The aim of the study was to compare the impact of EPA and DHA supplementation on inflammatory gene expression in subjects at risk for cardiometabolic diseases. In this randomized double-blind crossover trial, 154 men and women with abdominal obesity and low-grade inflammation were subjected to three 10-wk supplementation phases: 1) EPA (2.7 g/d); 2) DHA (2.7 g/d); 3) corn oil (3 g/d), separated by a 9-wk washout. Pro- and anti-inflammatory gene expression was assessed in whole blood cells by RT-qPCR after each treatment in a representative sample of 44 participants. No significant difference was observed between EPA and DHA in the expression of any of the genes investigated. Compared with control, EPA enhanced TRAF3 and PPARA expression and lowered CD14 expression (p < 0.01) whereas DHA increased expression of PPARA and TNFA and decreased CD14 expression (p < 0.05). Variations in gene expression after EPA and after DHA were strongly correlated for PPARA (r = 0.73, p < 0.0001) and TRAF3 (r = 0.66, p < 0.0001) and less for TNFA (r = 0.46, p < 0.005) and CD14 (r = 0.16, p = 0.30). High-dose supplementation with either EPA or DHA has similar effects on the expression of many inflammation-related genes in immune cells of men and women at risk for cardiometabolic diseases. The effects of EPA and of DHA on anti-inflammatory gene expression may be more consistent than their effects on expression of pro-inflammatory genes in whole blood cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Gene expression links functional networks across cortex and striatum.

    PubMed

    Anderson, Kevin M; Krienen, Fenna M; Choi, Eun Young; Reinen, Jenna M; Yeo, B T Thomas; Holmes, Avram J

    2018-04-12

    The human brain is comprised of a complex web of functional networks that link anatomically distinct regions. However, the biological mechanisms supporting network organization remain elusive, particularly across cortical and subcortical territories with vastly divergent cellular and molecular properties. Here, using human and primate brain transcriptional atlases, we demonstrate that spatial patterns of gene expression show strong correspondence with limbic and somato/motor cortico-striatal functional networks. Network-associated expression is consistent across independent human datasets and evolutionarily conserved in non-human primates. Genes preferentially expressed within the limbic network (encompassing nucleus accumbens, orbital/ventromedial prefrontal cortex, and temporal pole) relate to risk for psychiatric illness, chloride channel complexes, and markers of somatostatin neurons. Somato/motor associated genes are enriched for oligodendrocytes and markers of parvalbumin neurons. These analyses indicate that parallel cortico-striatal processing channels possess dissociable genetic signatures that recapitulate distributed functional networks, and nominate molecular mechanisms supporting cortico-striatal circuitry in health and disease.

  5. Artificial selection on brain-expressed genes during the domestication of dog.

    PubMed

    Li, Yan; Vonholdt, Bridgett M; Reynolds, Andy; Boyko, Adam R; Wayne, Robert K; Wu, Dong-Dong; Zhang, Ya-Ping

    2013-08-01

    Domesticated dogs have many unique behaviors not found in gray wolves that have augmented their interaction and communication with humans. The genetic basis of such unique behaviors in dogs remains poorly understood. We found that genes within regions highly differentiated between outbred Chinese native dogs (CNs) and wolves show high bias for expression localized to brain tissues, particularly the prefrontal cortex, a specific region responsible for complex cognitive behaviors. In contrast, candidate genes showing high population differentiation between CNs and German Shepherd dogs (GSs) did not demonstrate significant expression bias. These observations indicate that these candidate genes highly expressed in the brain have rapidly evolved. This rapid evolution was probably driven by artificial selection during the primary transition from wolves to ancient dogs and was consistent with the evolution of dog-specific characteristics, such as behavior transformation, for thousands of years.

  6. Abnormal gene expression profiles in human ovaries from polycystic ovary syndrome patients.

    PubMed

    Jansen, Erik; Laven, Joop S E; Dommerholt, Henri B R; Polman, Jan; van Rijt, Cindy; van den Hurk, Caroline; Westland, Jolanda; Mosselman, Sietse; Fauser, Bart C J M

    2004-12-01

    Polycystic ovary syndrome (PCOS) represents the most common cause of anovulatory infertility and affects 5-10% of women of reproductive age. The etiology of PCOS is still unknown. The current study is the first to describe consistent differences in gene expression profiles in human ovaries comparing PCOS patients vs. healthy normoovulatory individuals. The microarray analysis of PCOS vs. normal ovaries identifies dysregulated expression of genes encoding components of several biological pathways or systems such as Wnt signaling, extracellular matrix components, and immunological factors. Resulting data may provide novel clues for ovarian dysfunction in PCOS. Intriguingly, the gene expression profiles of ovaries from (long-term) androgen-treated female-to-male transsexuals (TSX) show considerable overlap with PCOS. This observation provides supportive evidence that androgens play a key role in the pathogenesis of PCOS. Presented data may contribute to a better understanding of dysregulated pathways in PCOS, which might ultimately reveal novel leads for therapeutic intervention.

  7. Gene expression and molecular phylogenetic analyses of beta-glucosidase in the termite Reticulitermes speratus (Isoptera: Rhinotermitidae).

    PubMed

    Shimada, Keisuke; Maekawa, Kiyoto

    2014-06-01

    Beta-glucosidase (BG) is known as a multifunctional enzyme for social maintenance in terms of both cellulose digestion and social communication in termites. However, the expression profiles of each BG gene and their evolutionary history are not well understood. First, we cloned two types of BG homologs (RsBGI and RsBGII) from the termite Reticulitermes speratus (Kolbe). Gene expression analyses showed that RsBGI expression levels of primary queens and kings from 30 to 100 days after colony foundation were high, but those of reproductives dropped after day 400. Extremely low gene expression levels of RsBGI were observed in eggs, whereas workers had significantly higher expression levels than those of soldiers and other colony members. Consequently, RsBGI gene expression levels changed among each developmental stage, and RsBGI was shown to be involved in cellulose digestion. On the other hand, the RsBGII gene was consistently expressed in all castes and developmental stages examined, and notable expression changes were not observed among them, including in eggs. It was indicated that RsBGII is a main component involved in social communication, for example, the egg-recognition pheromone shown in this species previously. Finally, we obtained partial gene homologs from other termite and cockroach species, including the woodroach (genus Cryptocercus), which is the sister group to termites, and performed molecular phylogenetic analyses. The results showed that the origin of the BG gene homologs preceded the divergence of termites and cockroaches, suggesting that the acquisition of multifunctionality of the BG gene also occurred in cockroach lineages. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. Transcriptional profiles of supragranular-enriched genes associate with corticocortical network architecture in the human brain

    PubMed Central

    Krienen, Fenna M.; Yeo, B. T. Thomas; Ge, Tian; Buckner, Randy L.; Sherwood, Chet C.

    2016-01-01

    The human brain is patterned with disproportionately large, distributed cerebral networks that connect multiple association zones in the frontal, temporal, and parietal lobes. The expansion of the cortical surface, along with the emergence of long-range connectivity networks, may be reflected in changes to the underlying molecular architecture. Using the Allen Institute’s human brain transcriptional atlas, we demonstrate that genes particularly enriched in supragranular layers of the human cerebral cortex relative to mouse distinguish major cortical classes. The topography of transcriptional expression reflects large-scale brain network organization consistent with estimates from functional connectivity MRI and anatomical tracing in nonhuman primates. Microarray expression data for genes preferentially expressed in human upper layers (II/III), but enriched only in lower layers (V/VI) of mouse, were cross-correlated to identify molecular profiles across the cerebral cortex of postmortem human brains (n = 6). Unimodal sensory and motor zones have similar molecular profiles, despite being distributed across the cortical mantle. Sensory/motor profiles were anticorrelated with paralimbic and certain distributed association network profiles. Tests of alternative gene sets did not consistently distinguish sensory and motor regions from paralimbic and association regions: (i) genes enriched in supragranular layers in both humans and mice, (ii) genes cortically enriched in humans relative to nonhuman primates, (iii) genes related to connectivity in rodents, (iv) genes associated with human and mouse connectivity, and (v) 1,454 gene sets curated from known gene ontologies. Molecular innovations of upper cortical layers may be an important component in the evolution of long-range corticocortical projections. PMID:26739559

  9. Transcriptional profiles of supragranular-enriched genes associate with corticocortical network architecture in the human brain.

    PubMed

    Krienen, Fenna M; Yeo, B T Thomas; Ge, Tian; Buckner, Randy L; Sherwood, Chet C

    2016-01-26

    The human brain is patterned with disproportionately large, distributed cerebral networks that connect multiple association zones in the frontal, temporal, and parietal lobes. The expansion of the cortical surface, along with the emergence of long-range connectivity networks, may be reflected in changes to the underlying molecular architecture. Using the Allen Institute's human brain transcriptional atlas, we demonstrate that genes particularly enriched in supragranular layers of the human cerebral cortex relative to mouse distinguish major cortical classes. The topography of transcriptional expression reflects large-scale brain network organization consistent with estimates from functional connectivity MRI and anatomical tracing in nonhuman primates. Microarray expression data for genes preferentially expressed in human upper layers (II/III), but enriched only in lower layers (V/VI) of mouse, were cross-correlated to identify molecular profiles across the cerebral cortex of postmortem human brains (n = 6). Unimodal sensory and motor zones have similar molecular profiles, despite being distributed across the cortical mantle. Sensory/motor profiles were anticorrelated with paralimbic and certain distributed association network profiles. Tests of alternative gene sets did not consistently distinguish sensory and motor regions from paralimbic and association regions: (i) genes enriched in supragranular layers in both humans and mice, (ii) genes cortically enriched in humans relative to nonhuman primates, (iii) genes related to connectivity in rodents, (iv) genes associated with human and mouse connectivity, and (v) 1,454 gene sets curated from known gene ontologies. Molecular innovations of upper cortical layers may be an important component in the evolution of long-range corticocortical projections.

  10. Sex-biased transcriptome divergence along a latitudinal gradient.

    PubMed

    Allen, Scott L; Bonduriansky, Russell; Sgro, Carla M; Chenoweth, Stephen F

    2017-03-01

    Sex-dependent gene expression is likely an important genomic mechanism that allows sex-specific adaptation to environmental changes. Among Drosophila species, sex-biased genes display remarkably consistent evolutionary patterns; male-biased genes evolve faster than unbiased genes in both coding sequence and expression level, suggesting sex differences in selection through time. However, comparatively little is known of the evolutionary process shaping sex-biased expression within species. Latitudinal clines offer an opportunity to examine how changes in key ecological parameters also influence sex-specific selection and the evolution of sex-biased gene expression. We assayed male and female gene expression in Drosophila serrata along a latitudinal gradient in eastern Australia spanning most of its endemic distribution. Analysis of 11 631 genes across eight populations revealed strong sex differences in the frequency, mode and strength of divergence. Divergence was far stronger in males than females and while latitudinal clines were evident in both sexes, male divergence was often population specific, suggesting responses to localized selection pressures that do not covary predictably with latitude. While divergence was enriched for male-biased genes, there was no overrepresentation of X-linked genes in males. By contrast, X-linked divergence was elevated in females, especially for female-biased genes. Many genes that diverged in D. serrata have homologs also showing latitudinal divergence in Drosophila simulans and Drosophila melanogaster on other continents, likely indicating parallel adaptation in these distantly related species. Our results suggest that sex differences in selection play an important role in shaping the evolution of gene expression over macro- and micro-ecological spatial scales. © 2017 John Wiley & Sons Ltd.

  11. Roles of polypyrimidine tract binding proteins in major immediate-early gene expression and viral replication of human cytomegalovirus.

    PubMed

    Cosme, Ruth S Cruz; Yamamura, Yasuhiro; Tang, Qiyi

    2009-04-01

    Human cytomegalovirus (HCMV), a member of the beta subgroup of the family Herpesviridae, causes serious health problems worldwide. HCMV gene expression in host cells is a well-defined sequential process: immediate-early (IE) gene expression, early-gene expression, DNA replication, and late-gene expression. The most abundant IE gene, major IE (MIE) gene pre-mRNA, needs to be spliced before being exported to the cytoplasm for translation. In this study, the regulation of MIE gene splicing was investigated; in so doing, we found that polypyrimidine tract binding proteins (PTBs) strongly repressed MIE gene production in cotransfection assays. In addition, we discovered that the repressive effects of PTB could be rescued by splicing factor U2AF. Taken together, the results suggest that PTBs inhibit MIE gene splicing by competing with U2AF65 for binding to the polypyrimidine tract in pre-mRNA. In intron deletion mutation assays and RNA detection experiments (reverse transcription [RT]-PCR and real-time RT-PCR), we further observed that PTBs target all the introns of the MIE gene, especially intron 2, and affect gene splicing, which was reflected in the variation in the ratio of pre-mRNA to mRNA. Using transfection assays, we demonstrated that PTB knockdown cells induce a higher degree of MIE gene splicing/expression. Consistently, HCMV can produce more viral proteins and viral particles in PTB knockdown cells after infection. We conclude that PTB inhibits HCMV replication by interfering with MIE gene splicing through competition with U2AF for binding to the polypyrimidine tract in MIE gene introns.

  12. Roles of Polypyrimidine Tract Binding Proteins in Major Immediate-Early Gene Expression and Viral Replication of Human Cytomegalovirus▿

    PubMed Central

    Cosme, Ruth S. Cruz; Yamamura, Yasuhiro; Tang, Qiyi

    2009-01-01

    Human cytomegalovirus (HCMV), a member of the β subgroup of the family Herpesviridae, causes serious health problems worldwide. HCMV gene expression in host cells is a well-defined sequential process: immediate-early (IE) gene expression, early-gene expression, DNA replication, and late-gene expression. The most abundant IE gene, major IE (MIE) gene pre-mRNA, needs to be spliced before being exported to the cytoplasm for translation. In this study, the regulation of MIE gene splicing was investigated; in so doing, we found that polypyrimidine tract binding proteins (PTBs) strongly repressed MIE gene production in cotransfection assays. In addition, we discovered that the repressive effects of PTB could be rescued by splicing factor U2AF. Taken together, the results suggest that PTBs inhibit MIE gene splicing by competing with U2AF65 for binding to the polypyrimidine tract in pre-mRNA. In intron deletion mutation assays and RNA detection experiments (reverse transcription [RT]-PCR and real-time RT-PCR), we further observed that PTBs target all the introns of the MIE gene, especially intron 2, and affect gene splicing, which was reflected in the variation in the ratio of pre-mRNA to mRNA. Using transfection assays, we demonstrated that PTB knockdown cells induce a higher degree of MIE gene splicing/expression. Consistently, HCMV can produce more viral proteins and viral particles in PTB knockdown cells after infection. We conclude that PTB inhibits HCMV replication by interfering with MIE gene splicing through competition with U2AF for binding to the polypyrimidine tract in MIE gene introns. PMID:19144709

  13. Expression of POEM, a positive regulator of osteoblast differentiation, is suppressed by TNF-{alpha}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tsukasaki, Masayuki; Yamada, Atsushi, E-mail: yamadaa@dent.showa-u.ac.jp; Suzuki, Dai

    2011-07-15

    Highlights: {yields} TNF-{alpha} inhibits POEM gene expression. {yields} Inhibition of POEM gene expression is caused by NF-{kappa}B activation by TNF-{alpha}. {yields} Over-expression of POEM recovers inhibition of osteoblast differentiation by TNF-{alpha}. -- Abstract: POEM, also known as nephronectin, is an extracellular matrix protein considered to be a positive regulator of osteoblast differentiation. In the present study, we found that tumor necrosis factor-{alpha} (TNF-{alpha}), a key regulator of bone matrix properties and composition that also inhibits terminal osteoblast differentiation, strongly inhibited POEM expression in the mouse osteoblastic cell line MC3T3-E1. TNF-{alpha}-induced down-regulation of POEM gene expression occurred in both time- andmore » dose-dependent manners through the nuclear factor kappa B (NF-{kappa}B) pathway. In addition, expressions of marker genes in differentiated osteoblasts were down-regulated by TNF-{alpha} in a manner consistent with our findings for POEM, while over-expression of POEM recovered TNF-{alpha}-induced inhibition of osteoblast differentiation. These results suggest that TNF-{alpha} inhibits POEM expression through the NF-{kappa}B signaling pathway and down-regulation of POEM influences the inhibition of osteoblast differentiation by TNF-{alpha}.« less

  14. Id expression in amphioxus and lamprey highlights the role of gene cooption during neural crest evolution

    NASA Technical Reports Server (NTRS)

    Meulemans, Daniel; McCauley, David; Bronner-Fraser, Marianne

    2003-01-01

    Neural crest cells are unique to vertebrates and generate many of the adult structures that differentiate them from their closest invertebrate relatives, the cephalochordates. Id genes are robust markers of neural crest cells at all stages of development. We compared Id gene expression in amphioxus and lamprey to ask if cephalochordates deploy Id genes at the neural plate border and dorsal neural tube in a manner similar to vertebrates. Furthermore, we examined whether Id expression in these cells is a basal vertebrate trait or a derived feature of gnathostomes. We found that while expression of Id genes in the mesoderm and endoderm is conserved between amphioxus and vertebrates, expression in the lateral neural plate border and dorsal neural tube is a vertebrate novelty. Furthermore, expression of lamprey Id implies that recruitment of Id genes to these cells occurred very early in the vertebrate lineage. Based on expression in amphioxus we postulate that Id cooption conferred sensory cell progenitor-like properties upon the lateral neurectoderm, and pharyngeal mesoderm-like properties upon cranial neural crest. Amphioxus Id expression is also consistent with homology between the anterior neurectoderm of amphioxus and the presumptive placodal ectoderm of vertebrates. These observations support the idea that neural crest evolution was driven in large part by cooption of multipurpose transcriptional regulators from other tissues and cell types.

  15. Seasonal Changes in Bacterial and Archaeal Gene Expression Patterns across Salinity Gradients in the Columbia River Coastal Margin

    PubMed Central

    Smith, Maria W.; Herfort, Lydie; Tyrol, Kaitlin; Suciu, Dominic; Campbell, Victoria; Crump, Byron C.; Peterson, Tawnya D.; Zuber, Peter; Baptista, Antonio M.; Simon, Holly M.

    2010-01-01

    Through their metabolic activities, microbial populations mediate the impact of high gradient regions on ecological function and productivity of the highly dynamic Columbia River coastal margin (CRCM). A 2226-probe oligonucleotide DNA microarray was developed to investigate expression patterns for microbial genes involved in nitrogen and carbon metabolism in the CRCM. Initial experiments with the environmental microarrays were directed toward validation of the platform and yielded high reproducibility in multiple tests. Bioinformatic and experimental validation also indicated that >85% of the microarray probes were specific for their corresponding target genes and for a few homologs within the same microbial family. The validated probe set was used to query gene expression responses by microbial assemblages to environmental variability. Sixty-four samples from the river, estuary, plume, and adjacent ocean were collected in different seasons and analyzed to correlate the measured variability in chemical, physical and biological water parameters to differences in global gene expression profiles. The method produced robust seasonal profiles corresponding to pre-freshet spring (April) and late summer (August). Overall relative gene expression was high in both seasons and was consistent with high microbial abundance measured by total RNA, heterotrophic bacterial production, and chlorophyll a. Both seasonal patterns involved large numbers of genes that were highly expressed relative to background, yet each produced very different gene expression profiles. April patterns revealed high differential gene expression in the coastal margin samples (estuary, plume and adjacent ocean) relative to freshwater, while little differential gene expression was observed along the river-to-ocean transition in August. Microbial gene expression profiles appeared to relate, in part, to seasonal differences in nutrient availability and potential resource competition. Furthermore, our results suggest that highly-active particle-attached microbiota in the Columbia River water column may perform dissimilatory nitrate reduction (both dentrification and DNRA) within anoxic particle microniches. PMID:20967204

  16. Analysis of Epstein-Barr Virus Genomes and Expression Profiles in Gastric Adenocarcinoma.

    PubMed

    Borozan, Ivan; Zapatka, Marc; Frappier, Lori; Ferretti, Vincent

    2018-01-15

    Epstein-Barr virus (EBV) is a causative agent of a variety of lymphomas, nasopharyngeal carcinoma (NPC), and ∼9% of gastric carcinomas (GCs). An important question is whether particular EBV variants are more oncogenic than others, but conclusions are currently hampered by the lack of sequenced EBV genomes. Here, we contribute to this question by mining whole-genome sequences of 201 GCs to identify 13 EBV-positive GCs and by assembling 13 new EBV genome sequences, almost doubling the number of available GC-derived EBV genome sequences and providing the first non-Asian EBV genome sequences from GC. Whole-genome sequence comparisons of all EBV isolates sequenced to date (85 from tumors and 57 from healthy individuals) showed that most GC and NPC EBV isolates were closely related although American Caucasian GC samples were more distant, suggesting a geographical component. However, EBV GC isolates were found to contain some consistent changes in protein sequences regardless of geographical origin. In addition, transcriptome data available for eight of the EBV-positive GCs were analyzed to determine which EBV genes are expressed in GC. In addition to the expected latency proteins (EBNA1, LMP1, and LMP2A), specific subsets of lytic genes were consistently expressed that did not reflect a typical lytic or abortive lytic infection, suggesting a novel mechanism of EBV gene regulation in the context of GC. These results are consistent with a model in which a combination of specific latent and lytic EBV proteins promotes tumorigenesis. IMPORTANCE Epstein-Barr virus (EBV) is a widespread virus that causes cancer, including gastric carcinoma (GC), in a small subset of individuals. An important question is whether particular EBV variants are more cancer associated than others, but more EBV sequences are required to address this question. Here, we have generated 13 new EBV genome sequences from GC, almost doubling the number of EBV sequences from GC isolates and providing the first EBV sequences from non-Asian GC. We further identify sequence changes in some EBV proteins common to GC isolates. In addition, gene expression analysis of eight of the EBV-positive GCs showed consistent expression of both the expected latency proteins and a subset of lytic proteins that was not consistent with typical lytic or abortive lytic expression. These results suggest that novel mechanisms activate expression of some EBV lytic proteins and that their expression may contribute to oncogenesis. Copyright © 2018 American Society for Microbiology.

  17. Gene Expression in Human Accessory Lacrimal Glands of Wolfring

    PubMed Central

    Ubels, John L.; Gipson, Ilene K.; Spurr-Michaud, Sandra J.; Tisdale, Ann S.; Van Dyken, Rachel E.; Hatton, Mark P.

    2012-01-01

    Purpose. The accessory lacrimal glands are assumed to contribute to the production of tear fluid, but little is known about their function. The goal of this study was to conduct an analysis of gene expression by glands of Wolfring that would provide a more complete picture of the function of these glands. Methods. Glands of Wolfring were isolated from frozen sections of human eyelids by laser microdissection. RNA was extracted from the cells and hybridized to gene expression arrays. The expression of several of the major genes was confirmed by immunohistochemistry. Results. Of the 24 most highly expressed genes, 9 were of direct relevance to lacrimal function. These included lysozyme, lactoferrin, tear lipocalin, and lacritin. The glands of Wolfring are enriched in genes related to protein synthesis, targeting, and secretion, and a large number of genes for proteins with antimicrobial activity were detected. Ion channels and transporters, carbonic anhydrase, and aquaporins were abundantly expressed. Genes for control of lacrimal function, including cholinergic, adrenergic, vasoactive intestinal polypeptide, purinergic, androgen, and prolactin receptors were also expressed in gland of Wolfring. Conclusions. The data suggest that the function of glands of Wolfring is similar to that of main lacrimal glands and are consistent with secretion electrolytes, fluid, and protein under nervous and hormonal control. Since these glands secrete directly onto the ocular surface, their location may allow rapid response to exogenous stimuli and makes them readily accessible to topical drugs. PMID:22956620

  18. Molecular cloning, polymorphisms, and expression analysis of the RERG gene in indigenous Chinese goats.

    PubMed

    Sui, M X; Wang, H H; Wang, Z W

    2015-11-24

    The current study aimed to investigate the coding sequence, polymorphisms, and expression of the RERG gene in indigenous Chinese goats. cDNA of RERG, obtained through reverse transcription PCR was analyzed using bioinformatic techniques. Polymorphisms in the exon regions of the RERG gene were identified and their associations with growth traits in three varieties of indigenous Chinese goats were investigated. Expression of the RERG gene in three goat breeds of the same age was detected using real-time quantitative PCR. The results revealed that the cDNA of RERG, which contained a complete open reading frame of 20-620 bp, was 629 bp in length. The associated accession numbers in GenBank are JN672576, JQ917222, and JN580309 for the QianBei Ma goat, the GuiZhou white goat, and the GuiZhou black goat, respectively. Four consistent SNP sites were found in the exon regions of the RERG gene for the three goat breeds. mRNA expression of the RERG gene differed between different tissues in adult goats of same age. The highest expression was observed in lung and spleen tissues, while the lowest expression was recorded in thymus gland tissue. In addition, the expression of the RERG gene in the muscle of Guizhou white goat, GuiZhou black goat, and QianBei Ma goat decreased sequentially. Our results lay the foundations for further investigation into the role of the RERG gene in goat growth traits.

  19. Identification of Differentially Expressed IGFBP5-Related Genes in Breast Cancer Tumor Tissues Using cDNA Microarray Experiments.

    PubMed

    Akkiprik, Mustafa; Peker, İrem; Özmen, Tolga; Amuran, Gökçe Güllü; Güllüoğlu, Bahadır M; Kaya, Handan; Özer, Ayşe

    2015-11-10

    IGFBP5 is an important regulatory protein in breast cancer progression. We tried to identify differentially expressed genes (DEGs) between breast tumor tissues with IGFBP5 overexpression and their adjacent normal tissues. In this study, thirty-eight breast cancer and adjacent normal breast tissue samples were used to determine IGFBP5 expression by qPCR. cDNA microarrays were applied to the highest IGFBP5 overexpressed tumor samples compared to their adjacent normal breast tissue. Microarray analysis revealed that a total of 186 genes were differentially expressed in breast cancer compared with normal breast tissues. Of the 186 genes, 169 genes were downregulated and 17 genes were upregulated in the tumor samples. KEGG pathway analyses showed that protein digestion and absorption, focal adhesion, salivary secretion, drug metabolism-cytochrome P450, and phenylalanine metabolism pathways are involved. Among these DEGs, the prominent top two genes (MMP11 and COL1A1) which potentially correlated with IGFBP5 were selected for validation using real time RT-qPCR. Only COL1A1 expression showed a consistent upregulation with IGFBP5 expression and COL1A1 and MMP11 were significantly positively correlated. We concluded that the discovery of coordinately expressed genes related with IGFBP5 might contribute to understanding of the molecular mechanism of the function of IGFBP5 in breast cancer. Further functional studies on DEGs and association with IGFBP5 may identify novel biomarkers for clinical applications in breast cancer.

  20. Transcriptional regulation of development in heterocyst-forming cyanobacteria.

    PubMed

    Flores, Enrique; Picossi, Silvia; Valladares, Ana; Herrero, Antonia

    2018-04-30

    Filamentous, heterocyst-forming cyanobacteria are among the simplest multicellular systems in Nature. In the absence of combined nitrogen, the filaments consist of vegetative cells that fix CO 2 through oxygenic photosynthesis and micro-oxic heterocysts specialized for the fixation of N 2 in a proportion of about 10 to 1. The development of a heterocyst-containing filament involves differentiation of vegetative cells into heterocysts in a process that requires a distinct gene expression program. Two transcription factors are strictly required, NtcA and HetR. The CRP-family protein NtcA directly activates the expression of multiple genes during heterocyst differentiation - in some cases assisted by coactivators including HetR - and in mature heterocysts, whereas HetR is needed to build high NtcA levels in differentiating heterocysts and directly activates some particular genes. A few other regulators of gene expression participate at specific differentiation steps, and a specific transcription factor, CnfR, activates nif gene expression under the micro-oxic conditions of the heterocyst. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Effects Of Gravitational Perturbation On The Expression Of Genes Regulating Metabolism In Jurkat Cells

    PubMed Central

    Singh, Kanika; Cubano, Luis; Lewis, Marian

    2015-01-01

    Gravitational perturbation altered gene expression and increased glucose consumption in spaceflown Jurkat cells. The purpose of this study was to determine if the acceleration experienced during launch was responsible for these changes. In ground-based studies, cells were subjected to typical launch centrifugal acceleration (3g of force for eight minutes) and centrifugal force of 90g for five minutes (commonly used to sediment cells) in a laboratory centrifuge. Controls consisted of static cultures. Gene expression was analyzed by RT-PCR. pH and glucose concentrations were evaluated to monitor metabolic changes. Comparison with controls indicated no significant change in pH or glucose use. Gene expression of Jurkat cells subjected to 3g or 90g of force was altered for only two genes out of seven tested. This research suggests that the changes observed in Jurkat cells flown on STS-95 were not a result of launch acceleration but to other conditions experienced during space flight. PMID:23875517

  2. Identification of a spatially specific enhancer element in the chicken Msx-2 gene that regulates its expression in the apical ectodermal ridge of the developing limb buds of transgenic mice.

    PubMed

    Sumoy, L; Wang, C K; Lichtler, A C; Pierro, L J; Kosher, R A; Upholt, W B

    1995-07-01

    Msx-2 is a member of the Msx family of homeobox-containing genes expressed in a variety of embryonic tissues involved in epithelial-mesenchymal interactions and pattern formation. In the developing chick limb bud, Msx-2 is expressed in the apical ectodermal ridge, which plays a crucial role in directing the growth and patterning of limb mesoderm. In addition, Msx-2 is expressed in the anterior nonskeletal-forming mesoderm of the limb bud, in the posterior necrotic zone, and in the interdigital mesenchyme. Studies of the altered expression patterns of Msx-2 in amelic and polydactylous mutant chick limbs have suggested that the apical ectodermal ridge and mesodermal domains of Msx-2 expression are independently regulated and that there might be separate cis-regulatory elements in the Msx-2 gene controlling its spatially distinct domains of expression. To test this hypothesis, we have isolated the chicken Msx-2 gene and have tested the ability of various regions of the gene to target expression of LacZ reporter gene to specific regions of the limbs of transgenic mice. A variety of these constructs are consistently expressed only in the apical ectodermal ridge and the ectoderm of the genital tubercle and are not expressed in the mesoderm of the limb bud or in other regions of the embryo where the endogenous Msx-2 gene is expressed. These results suggest the presence of spatially specific cis-regulatory elements in the Msx-2 gene. We identified a 348-bp region in the 5' flanking region of the Msx-2 gene which can act as an apical ectodermal ridge enhancer element when placed in reverse orientation in front of the reporter gene with transcription initiation directed by the minimal hsp68 promoter.

  3. Genomic organization and expression of the human MSH3 gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Watanabe, Atsushi; Ikejima, Miyoko; Suzuki, Noriko

    1996-02-01

    We have studied the expression and genomic organization of the human MSH3 gene, which encodes a human homologue of the bacterial DNA mismatch repair protein MutS. This gene is located upstream of the dihydrofolate reductase (DHFR) gene. Northern analysis has demonstrated that the hMSH3 gene is expressed in a variety of human tissues at low levels, like the DHFR gene. Characterization of cosmid clones has shown that the hMSH3 gene consists of 24 exons spanning at least 160 kb. All exon-intron junction sequences match the classical GT/AG rule, except that intron 6 has AT and AA at the ends. Twomore » major transcripts of 5.0 and 3.8 kb have been shown to be derived from the differential use of two polyadenylation sites. Elucidation of the complete genomic organization and the nucleotide sequences of the introns of the hMSH3 gene should be useful for studying the function of this gene and the possible involvement of specific mutations of the hMSH3 gene in some diseases. 34 refs., 5 figs., 1 tab.« less

  4. Metabolic Adaptation to Nutrients Involves Coregulation of Gene Expression by the RNA Helicase Dbp2 and the Cyc8 Corepressor in Saccharomyces cerevisiae.

    PubMed

    Wang, Siwen; Xing, Zheng; Pascuzzi, Pete E; Tran, Elizabeth J

    2017-07-05

    Cells fine-tune their metabolic programs according to nutrient availability in order to maintain homeostasis. This is achieved largely through integrating signaling pathways and the gene expression program, allowing cells to adapt to nutritional change. Dbp2, a member of the DEAD-box RNA helicase family in Saccharomyces cerevisiae , has been proposed to integrate gene expression with cellular metabolism. Prior work from our laboratory has reported the necessity of DBP2 in proper gene expression, particularly for genes involved in glucose-dependent regulation. Here, by comparing differentially expressed genes in dbp2 ∆ to those of 700 other deletion strains from other studies, we find that CYC8 and TUP1 , which form a complex and inhibit transcription of numerous genes, corepress a common set of genes with DBP2 Gene ontology (GO) annotations reveal that these corepressed genes are related to cellular metabolism, including respiration, gluconeogenesis, and alternative carbon-source utilization genes. Consistent with a direct role in metabolic gene regulation, loss of either DBP2 or CYC8 results in increased cellular respiration rates. Furthermore, we find that corepressed genes have a propensity to be associated with overlapping long noncoding RNAs and that upregulation of these genes in the absence of DBP2 correlates with decreased binding of Cyc8 to these gene promoters. Taken together, this suggests that Dbp2 integrates nutrient availability with energy homeostasis by maintaining repression of glucose-repressed, Cyc8-targeted genes across the genome. Copyright © 2017 Wang et al.

  5. Osteosarcoma tissues and cell lines from patients with differing serum alkaline phosphatase concentrations display minimal differences in gene expression patterns

    PubMed Central

    de Sá Rodrigues, L. C.; Holmes, K. E.; Thompson, V.; Piskun, C. M.; Lana, S. E.; Newton, M. A.; Stein, T. J.

    2016-01-01

    Serum alkaline phosphatase (ALP) concentration is a prognostic factor for osteosarcoma in multiple studies, although its biological significance remains incompletely understood. To determine whether gene expression patterns differed in osteosarcoma from patients with differing serum ALP concentrations, microarray analysis was performed on 18 primary osteosarcoma samples and six osteosarcoma cell lines from dogs with normal and increased serum ALP concentration. No differences in gene expression patterns were noted between tumours or cell lines with differing serum ALP concentration using a gene-specific two-sample t-test. Using a more sensitive empirical Bayes procedure, defective in cullin neddylation 1 domain containing 1 (DCUN1D1) was increased in both the tissue and cell lines of the normal ALP group. Using quantitative PCR (qPCR), differences in DCUN1D1 expression between the two groups failed to reach significance. The homogeneity of gene expression patterns of osteosarcoma associated differing serum ALP concentrations are consistent with previous studies suggesting serum ALP concentration is not associated with intrinsic differences of osteosarcoma cells. PMID:25643733

  6. Functional relevance of three proopiomelanocortin (POMC) genes in darkening camouflage, blind-side hypermelanosis, and appetite of Paralichthys olivaceus.

    PubMed

    Kang, Duk-Young; Kim, Hyo-Chan

    2015-01-01

    To determine whether proopiomelanocortin (POMC) genes are involved in darkening color camouflage, blind-side hypermelanosis, and appetite in flatfish, we isolated and cloned three POMC genes from the pituitary of the olive flounder (Paralichthys olivaceus) and compared their amino acid (aa) structures to those of POMC genes from other animals. Next, we examined the relationship of these pituitary POMC genes to camouflage color change, blind-side hypermelanosis, and appetite by quantifying mRNA expression. Olive flounder (of)-POMC1, 2, and 3 cDNAs consisted of 648-bp, 582-bp, and 693-bp open reading frames (ORF) encoding 216 aa, 194 aa, and 231 aa residues, respectively. Structurally, the three of-POMC cDNAs consisted of seven peptides (signal peptide, N-POMC, α-MSH, CLIP, N-β-LPH, β-MSH and β-END [or END-like peptide]) that are similar to those of other fish POMC cDNAs. α-MSH encoded a protein composed of 13 aa and β-MSH encoded a protein composed of 17 aa. The three POMC genes were predominantly expressed in the pituitary gland, but they were also expressed in a variety of tissues, including brain, eye, kidney, heart, testis, and skin. of-POMC2 exhibited the highest expression, while of-POMC3 displayed the lowest expression. The relative levels of of-POMC1 and 3 mRNAs were not influenced by background color and feeding (or fasting), but the relative level of of-POMC2 mRNA significantly increased in response to a dark background and fasting. The relative levels of of-POMC1 and 2 mRNAs were significantly higher in hypermelanic fish; however, we did not determine a direct anorexigenic or orexigenic relationship for the three POMC genes. These results indicate that pituitary POMC genes are related to darkening color change and the differentiation of pigment cells, but they are not directly related to appetite. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. Bayesian Inference of Allele-Specific Gene Expression Indicates Abundant Cis-Regulatory Variation in Natural Flycatcher Populations

    PubMed Central

    Wang, Mi

    2017-01-01

    Abstract Polymorphism in cis-regulatory sequences can lead to different levels of expression for the two alleles of a gene, providing a starting point for the evolution of gene expression. Little is known about the genome-wide abundance of genetic variation in gene regulation in natural populations but analysis of allele-specific expression (ASE) provides a means for investigating such variation. We performed RNA-seq of multiple tissues from population samples of two closely related flycatcher species and developed a Bayesian algorithm that maximizes data usage by borrowing information from the whole data set and combines several SNPs per transcript to detect ASE. Of 2,576 transcripts analyzed in collared flycatcher, ASE was detected in 185 (7.2%) and a similar frequency was seen in the pied flycatcher. Transcripts with statistically significant ASE commonly showed the major allele in >90% of the reads, reflecting that power was highest when expression was heavily biased toward one of the alleles. This would suggest that the observed frequencies of ASE likely are underestimates. The proportion of ASE transcripts varied among tissues, being lowest in testis and highest in muscle. Individuals often showed ASE of particular transcripts in more than one tissue (73.4%), consistent with a genetic basis for regulation of gene expression. The results suggest that genetic variation in regulatory sequences commonly affects gene expression in natural populations and that it provides a seedbed for phenotypic evolution via divergence in gene expression. PMID:28453623

  8. Global gene expression and systems biology analysis of bovine monocyte-derived macrophages in response to in vitro challenge with Mycobacterium bovis.

    PubMed

    Magee, David A; Taraktsoglou, Maria; Killick, Kate E; Nalpas, Nicolas C; Browne, John A; Park, Stephen D E; Conlon, Kevin M; Lynn, David J; Hokamp, Karsten; Gordon, Stephen V; Gormley, Eamonn; MacHugh, David E

    2012-01-01

    Mycobacterium bovis, the causative agent of bovine tuberculosis, is a major cause of mortality in global cattle populations. Macrophages are among the first cell types to encounter M. bovis following exposure and the response elicited by these cells is pivotal in determining the outcome of infection. Here, a functional genomics approach was undertaken to investigate global gene expression profiles in bovine monocyte-derived macrophages (MDM) purified from seven age-matched non-related females, in response to in vitro challenge with M. bovis (multiplicity of infection 2:1). Total cellular RNA was extracted from non-challenged control and M. bovis-challenged MDM for all animals at intervals of 2 hours, 6 hours and 24 hours post-challenge and prepared for global gene expression analysis using the Affymetrix® GeneChip® Bovine Genome Array. Comparison of M. bovis-challenged MDM gene expression profiles with those from the non-challenged MDM controls at each time point identified 3,064 differentially expressed genes 2 hours post-challenge, with 4,451 and 5,267 differentially expressed genes detected at the 6 hour and 24 hour time points, respectively (adjusted P-value threshold ≤ 0.05). Notably, the number of downregulated genes exceeded the number of upregulated genes in the M. bovis-challenged MDM across all time points; however, the fold-change in expression for the upregulated genes was markedly higher than that for the downregulated genes. Systems analysis revealed enrichment for genes involved in: (1) the inflammatory response; (2) cell signalling pathways, including Toll-like receptors and intracellular pathogen recognition receptors; and (3) apoptosis. The increased number of downregulated genes is consistent with previous studies showing that M. bovis infection is associated with the repression of host gene expression. The results also support roles for MyD88-independent signalling and intracellular PRRs in mediating the host response to M. bovis.

  9. Transcriptome analysis of the Tan sheep testes: Differential expression of antioxidant enzyme-related genes and proteins in response to dietary vitamin E supplementation.

    PubMed

    Xu, Chenchen; Zuo, Zhaoyun; Liu, Kun; Jia, Huina; Zhang, Yuwei; Luo, Hailing

    2016-03-15

    Gene-chip technology was employed to study the effect of dietary vitamin E on gene expression in sheep testes based on our previous research. Thirty-five male Tan sheep (20-30 days after weaning) with similar body weight were randomly allocated into five groups and supplemented 0, 20, 100, 200 and 2,000 IU sheep(-1)day(-1) vitamin E (treatments denoted as E0, E20, E100, E200, and E2000, respectively) for 120 days. At the end of the study the sheep were slaughtered and the testis samples were immediately collected and stored in liquid nitrogen. Differences in gene expression between different treated groups were identified. Based on GO enrichment analysis and the KEGG database to evaluate the gene expression data we found that vitamin E might affect genes in the testes by modulating the oxidation level, by affecting the expression of various receptors and transcription factors in biological pathways, and by regulating the expression of metabolism-associated genes. The effect of vitamin E supplementation on the expression of oxidative enzyme-related genes was detected by quantitative real-time PCR (qRT-PCR) and Western blot. The results show that dietary vitamin E, at various doses, can significantly increase (P<0.05) the mRNA and protein expression of Glutathione peroxidase 3 and Glutathione S-transferase alpha 1. In addition, the results of qRT-PCR of the antioxidant enzyme genes were consistent with those obtained using the gene chip microarray analysis. In summary, the dietary vitamin E treatment altered the expression of a number of genes in sheep testes. The increase in the mRNA and protein levels of antioxidant enzyme genes, coupled with the elevation in the activity of the antioxidant enzymes were primarily responsible for the improved reproductive performance promoted by dietary vitamin E. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Hepatic Leukemia Factor Promotes Resistance To Cell Death: Implications For Therapeutics and Chronotherapy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Waters, Katrina M.; Sontag, Ryan L.; Weber, Thomas J.

    Physiological variation related to circadian rhythms and aberrant gene expression patterns are believed to modulate therapeutic efficacy, but the precise molecular determinants remain unclear. Here we examine the regulation of cell death by hepatic leukemia factor (HLF), which is an output regulator of circadian rhythms and is aberrantly expressed in human cancers, using an ectopic expression strategy in JB6 mouse epidermal cells and human keratinocytes. Ectopic HLF expression inhibited cell death in both JB6 cells and human keratinocytes, as induced by serum-starvation, tumor necrosis factor alpha and ionizing radiation. Microarray analysis indicates that HLF regulates a complex multi-gene transcriptional programmore » encompassing upregulation of anti-apoptotic genes, downregulation of pro-apoptotic genes, and many additional changes that are consistent with an anti-death program. Collectively, our results demonstrate that ectopic expression of HLF, an established transcription factor that cycles with circadian rhythms, can recapitulate many features associated with circadian-dependent physiological variation.« less

  11. Use of an activated beta-catenin to identify Wnt pathway target genes in caenorhabditis elegans, including a subset of collagen genes expressed in late larval development.

    PubMed

    Jackson, Belinda M; Abete-Luzi, Patricia; Krause, Michael W; Eisenmann, David M

    2014-04-16

    The Wnt signaling pathway plays a fundamental role during metazoan development, where it regulates diverse processes, including cell fate specification, cell migration, and stem cell renewal. Activation of the beta-catenin-dependent/canonical Wnt pathway up-regulates expression of Wnt target genes to mediate a cellular response. In the nematode Caenorhabditis elegans, a canonical Wnt signaling pathway regulates several processes during larval development; however, few target genes of this pathway have been identified. To address this deficit, we used a novel approach of conditionally activated Wnt signaling during a defined stage of larval life by overexpressing an activated beta-catenin protein, then used microarray analysis to identify genes showing altered expression compared with control animals. We identified 166 differentially expressed genes, of which 104 were up-regulated. A subset of the up-regulated genes was shown to have altered expression in mutants with decreased or increased Wnt signaling; we consider these genes to be bona fide C. elegans Wnt pathway targets. Among these was a group of six genes, including the cuticular collagen genes, bli-1 col-38, col-49, and col-71. These genes show a peak of expression in the mid L4 stage during normal development, suggesting a role in adult cuticle formation. Consistent with this finding, reduction of function for several of the genes causes phenotypes suggestive of defects in cuticle function or integrity. Therefore, this work has identified a large number of putative Wnt pathway target genes during larval life, including a small subset of Wnt-regulated collagen genes that may function in synthesis of the adult cuticle.

  12. Canonical Genetic Signatures of the Adult Human Brain

    PubMed Central

    Hawrylycz, Michael; Miller, Jeremy A.; Menon, Vilas; Feng, David; Dolbeare, Tim; Guillozet-Bongaarts, Angela L.; Jegga, Anil G.; Aronow, Bruce J.; Lee, Chang-Kyu; Bernard, Amy; Glasser, Matthew F.; Dierker, Donna L.; Menche, Jörge; Szafer, Aaron; Collman, Forrest; Grange, Pascal; Berman, Kenneth A.; Mihalas, Stefan; Yao, Zizhen; Stewart, Lance; Barabási, Albert-László; Schulkin, Jay; Phillips, John; Ng, Lydia; Dang, Chinh; Haynor, David R.; Jones, Allan; Van Essen, David C.; Koch, Christof; Lein, Ed

    2015-01-01

    The structure and function of the human brain are highly stereotyped, implying a conserved molecular program responsible for its development, cellular structure, and function. We applied a correlation-based metric of “differential stability” (DS) to assess reproducibility of gene expression patterning across 132 structures in six individual brains, revealing meso-scale genetic organization. The highest DS genes are highly biologically relevant, with enrichment for brain-related biological annotations, disease associations, drug targets, and literature citations. Using high DS genes we identified 32 anatomically diverse and reproducible gene expression signatures, which represent distinct cell types, intracellular components, and/or associations with neurodevelopmental and neurodegenerative disorders. Genes in neuron-associated compared to non-neuronal networks showed higher preservation between human and mouse; however, many diversely-patterned genes displayed dramatic shifts in regulation between species. Finally, highly consistent transcriptional architecture in neocortex is correlated with resting state functional connectivity, suggesting a link between conserved gene expression and functionally relevant circuitry. PMID:26571460

  13. Differentially expressed genes in healthy and plum pox virus-infected Nicotiana benthamiana plants.

    PubMed

    Vozárová, Z; Žilová, M; Šubr, Z

    2015-12-01

    Viruses use both material and energy sources of their hosts and redirect the production of disposable compounds in order to make viral replication more efficient. Metabolism of infected organisms is modified by these enhanced requirements as well by their own defense response. Resulting complex story consists of many regulation events on various gene expression levels. Elucidating these processes may contribute to the knowledge on virus-host interactions and to evolving new antiviral strategies. In our work we applied a subtractive cloning technique to compare the transcriptomes of healthy and plum pox virus (PPV)-infected Nicotiana benthamiana plants. Several genes were found to be induced or repressed by the PPV infection. The induced genes were mainly related to general stress response or photosynthesis, several repressed genes could be connected with growth defects evoked by the infection. Interestingly, some genes usually up-regulated by fungal or bacterial infection were found repressed in PPV-infected plants. Potential involvement of particular differently expressed genes in the process of PPV infection is discussed.

  14. Developmental and Spatial Expression of sir2 Genes in the Cellular Slime Mold Dictyostelium discoideum.

    PubMed

    Katayama, Takahiro; Yasukawa, Hiro

    2008-01-01

    The cellular slime mold Dictyostelium discoideum grows as unicellular free-living amoebae in the presence of nutrients. Upon starvation, the amoebae aggregate and form multicellular structures that each consist of a stalk and spores. D. discoideum encodes at least four proteins (Sir2A, Sir2B, Sir2C, and Sir2D) homologous to human SIRT. RT-PCR and WISH analyses showed that the genes for Sir2A, Sir2C, and Sir2D were expressed at high levels in growing cells but at decreased levels in developing cells, whereas the gene encoding Sir2B was expressed in the prestalk-cell region in the developmental phase.

  15. Cooperative Adaptive Responses in Gene Regulatory Networks with Many Degrees of Freedom

    PubMed Central

    Inoue, Masayo; Kaneko, Kunihiko

    2013-01-01

    Cells generally adapt to environmental changes by first exhibiting an immediate response and then gradually returning to their original state to achieve homeostasis. Although simple network motifs consisting of a few genes have been shown to exhibit such adaptive dynamics, they do not reflect the complexity of real cells, where the expression of a large number of genes activates or represses other genes, permitting adaptive behaviors. Here, we investigated the responses of gene regulatory networks containing many genes that have undergone numerical evolution to achieve high fitness due to the adaptive response of only a single target gene; this single target gene responds to changes in external inputs and later returns to basal levels. Despite setting a single target, most genes showed adaptive responses after evolution. Such adaptive dynamics were not due to common motifs within a few genes; even without such motifs, almost all genes showed adaptation, albeit sometimes partial adaptation, in the sense that expression levels did not always return to original levels. The genes split into two groups: genes in the first group exhibited an initial increase in expression and then returned to basal levels, while genes in the second group exhibited the opposite changes in expression. From this model, genes in the first group received positive input from other genes within the first group, but negative input from genes in the second group, and vice versa. Thus, the adaptation dynamics of genes from both groups were consolidated. This cooperative adaptive behavior was commonly observed if the number of genes involved was larger than the order of ten. These results have implications in the collective responses of gene expression networks in microarray measurements of yeast Saccharomyces cerevisiae and the significance to the biological homeostasis of systems with many components. PMID:23592959

  16. A cross-species bi-clustering approach to identifying conserved co-regulated genes.

    PubMed

    Sun, Jiangwen; Jiang, Zongliang; Tian, Xiuchun; Bi, Jinbo

    2016-06-15

    A growing number of studies have explored the process of pre-implantation embryonic development of multiple mammalian species. However, the conservation and variation among different species in their developmental programming are poorly defined due to the lack of effective computational methods for detecting co-regularized genes that are conserved across species. The most sophisticated method to date for identifying conserved co-regulated genes is a two-step approach. This approach first identifies gene clusters for each species by a cluster analysis of gene expression data, and subsequently computes the overlaps of clusters identified from different species to reveal common subgroups. This approach is ineffective to deal with the noise in the expression data introduced by the complicated procedures in quantifying gene expression. Furthermore, due to the sequential nature of the approach, the gene clusters identified in the first step may have little overlap among different species in the second step, thus difficult to detect conserved co-regulated genes. We propose a cross-species bi-clustering approach which first denoises the gene expression data of each species into a data matrix. The rows of the data matrices of different species represent the same set of genes that are characterized by their expression patterns over the developmental stages of each species as columns. A novel bi-clustering method is then developed to cluster genes into subgroups by a joint sparse rank-one factorization of all the data matrices. This method decomposes a data matrix into a product of a column vector and a row vector where the column vector is a consistent indicator across the matrices (species) to identify the same gene cluster and the row vector specifies for each species the developmental stages that the clustered genes co-regulate. Efficient optimization algorithm has been developed with convergence analysis. This approach was first validated on synthetic data and compared to the two-step method and several recent joint clustering methods. We then applied this approach to two real world datasets of gene expression during the pre-implantation embryonic development of the human and mouse. Co-regulated genes consistent between the human and mouse were identified, offering insights into conserved functions, as well as similarities and differences in genome activation timing between the human and mouse embryos. The R package containing the implementation of the proposed method in C ++ is available at: https://github.com/JavonSun/mvbc.git and also at the R platform https://www.r-project.org/ jinbo@engr.uconn.edu. © The Author 2016. Published by Oxford University Press.

  17. Identification of differentially regulated genes in human patent ductus arteriosus

    PubMed Central

    Parikh, Pratik; Bai, Haiqing; Swartz, Michael F; Alfieris, George M

    2016-01-01

    In order to identify differentially expressed genes that are specific to the ductus arteriosus, 18 candidate genes were evaluated in matched ductus arteriosus and aortic samples from infants with coarctation of the aorta. The cell specificity of the gene's promoters was assessed by performing transient transfection studies in primary cells derived from several patients. Segments of ductus arteriosus and aorta were isolated from infants requiring repair for coarctation of the aorta and used for mRNA quantitation and culturing of cells. Differences in expression were determined by quantitative PCR using the ΔΔCt method. Promoter regions of six of these genes were cloned into luciferase reporter plasmids for transient transfection studies in matched human ductus arteriosus and aorta cells. Transcription factor AP-2b and phospholipase A2 were significantly up-regulated in ductus arteriosus compared to aorta in whole tissues and cultured cells, respectively. In transient transfection experiments, Angiotensin II type 1 receptor and Prostaglandin E receptor 4 promoters consistently gave higher expression in matched ductus arteriosus versus aorta cells from multiple patients. Taken together, these results demonstrate that several genes are differentially expressed in ductus arteriosus and that their promoters may be used to drive ductus arteriosus-enriched transgene expression. PMID:27465141

  18. Transcriptomic insights into the genetic basis of mammalian limb diversity.

    PubMed

    Maier, Jennifer A; Rivas-Astroza, Marcelo; Deng, Jenny; Dowling, Anna; Oboikovitz, Paige; Cao, Xiaoyi; Behringer, Richard R; Cretekos, Chris J; Rasweiler, John J; Zhong, Sheng; Sears, Karen E

    2017-03-23

    From bat wings to whale flippers, limb diversification has been crucial to the evolutionary success of mammals. We performed the first transcriptome-wide study of limb development in multiple species to explore the hypothesis that mammalian limb diversification has proceeded through the differential expression of conserved shared genes, rather than by major changes to limb patterning. Specifically, we investigated the manner in which the expression of shared genes has evolved within and among mammalian species. We assembled and compared transcriptomes of bat, mouse, opossum, and pig fore- and hind limbs at the ridge, bud, and paddle stages of development. Results suggest that gene expression patterns exhibit larger variation among species during later than earlier stages of limb development, while within species results are more mixed. Consistent with the former, results also suggest that genes expressed at later developmental stages tend to have a younger evolutionary age than genes expressed at earlier stages. A suite of key limb-patterning genes was identified as being differentially expressed among the homologous limbs of all species. However, only a small subset of shared genes is differentially expressed in the fore- and hind limbs of all examined species. Similarly, a small subset of shared genes is differentially expressed within the fore- and hind limb of a single species and among the forelimbs of different species. Taken together, results of this study do not support the existence of a phylotypic period of limb development ending at chondrogenesis, but do support the hypothesis that the hierarchical nature of development translates into increasing variation among species as development progresses.

  19. The Transcription Factors Islet and Lim3 Combinatorially Regulate Ion Channel Gene Expression

    PubMed Central

    Wolfram, Verena; Southall, Tony D.; Günay, Cengiz; Prinz, Astrid A.; Brand, Andrea H.

    2014-01-01

    Expression of appropriate ion channels is essential to allow developing neurons to form functional networks. Our previous studies have identified LIM-homeodomain (HD) transcription factors (TFs), expressed by developing neurons, that are specifically able to regulate ion channel gene expression. In this study, we use the technique of DNA adenine methyltransferase identification (DamID) to identify putative gene targets of four such TFs that are differentially expressed in Drosophila motoneurons. Analysis of targets for Islet (Isl), Lim3, Hb9, and Even-skipped (Eve) identifies both ion channel genes and genes predicted to regulate aspects of dendritic and axonal morphology. Significantly, some ion channel genes are bound by more than one TF, consistent with the possibility of combinatorial regulation. One such gene is Shaker (Sh), which encodes a voltage-dependent fast K+ channel (Kv1.1). DamID reveals that Sh is bound by both Isl and Lim3. We used body wall muscle as a test tissue because in conditions of low Ca2+, the fast K+ current is carried solely by Sh channels (unlike neurons in which a second fast K+ current, Shal, also contributes). Ectopic expression of isl, but not Lim3, is sufficient to reduce both Sh transcript and Sh current level. By contrast, coexpression of both TFs is additive, resulting in a significantly greater reduction in both Sh transcript and current compared with isl expression alone. These observations provide evidence for combinatorial activity of Isl and Lim3 in regulating ion channel gene expression. PMID:24523544

  20. Immuno-Navigator, a batch-corrected coexpression database, reveals cell type-specific gene networks in the immune system

    PubMed Central

    Vandenbon, Alexis; Dinh, Viet H.; Mikami, Norihisa; Kitagawa, Yohko; Teraguchi, Shunsuke; Ohkura, Naganari; Sakaguchi, Shimon

    2016-01-01

    High-throughput gene expression data are one of the primary resources for exploring complex intracellular dynamics in modern biology. The integration of large amounts of public data may allow us to examine general dynamical relationships between regulators and target genes. However, obstacles for such analyses are study-specific biases or batch effects in the original data. Here we present Immuno-Navigator, a batch-corrected gene expression and coexpression database for 24 cell types of the mouse immune system. We systematically removed batch effects from the underlying gene expression data and showed that this removal considerably improved the consistency between inferred correlations and prior knowledge. The data revealed widespread cell type-specific correlation of expression. Integrated analysis tools allow users to use this correlation of expression for the generation of hypotheses about biological networks and candidate regulators in specific cell types. We show several applications of Immuno-Navigator as examples. In one application we successfully predicted known regulators of importance in naturally occurring Treg cells from their expression correlation with a set of Treg-specific genes. For one high-scoring gene, integrin β8 (Itgb8), we confirmed an association between Itgb8 expression in forkhead box P3 (Foxp3)-positive T cells and Treg-specific epigenetic remodeling. Our results also suggest that the regulation of Treg-specific genes within Treg cells is relatively independent of Foxp3 expression, supporting recent results pointing to a Foxp3-independent component in the development of Treg cells. PMID:27078110

  1. Flowery odor formation revealed by differential expression of monoterpene biosynthetic genes and monoterpene accumulation in rose (Rosa rugosa Thunb.).

    PubMed

    Feng, Liguo; Chen, Chen; Li, Tinglin; Wang, Meng; Tao, Jun; Zhao, Daqiu; Sheng, Lixia

    2014-02-01

    Rosa rugosa is an important ornamental and economical plant. In this paper, four genes encoding 1-deoxy-D-xylulose-5-phosphate synthase (DXS), 1-deoxy-d-xylulose-5-phosphate reductoisomerase (DXR), alcohol acyltransferase (AAT) and linalool synthase (LIS) involved in the monoterpene biosynthesis pathways were isolated from R. rugosa 'Tangzi', and the expression patterns of these genes in different flower development stages and different parts of floral organs were determined by real-time quantitative fluorescence PCR. Furthermore, a comprehensive analysis was carried out into the relationship between expression of four monoterpene synthesis genes and accumulation of main volatile monoterpenes and their acetic acid ester derivatives. The results showed that the genes RrDXS, RrDXR and RrLIS showed consistent expressions during the development process for R. rugosa flower from budding to withering stage, the overall expression levels of gene RrDXS and RrLIS were obviously lower as compared with those of gene RrDXR and RrAAT. Although the gene RrDXS, RrDXR, RrAAT and RrLIS were expressed in all parts of R. rugosa floral organs, the expression levels varied significantly. The variations in the constituent and content of volatile monoterpenes including citronellol, geraniol, nerol, linalool, citronellyl acetate, geranyl acetate and neryl acetate at different development stages and parts of floral organs were significantly different. On this basis, we concluded that the gene RrDXR and RrAAT might play a key role in the biosynthesis of volatile monoterpenes in R. rugosa flowers, and the two genes are important candidate genes for the regulation of secondary metabolism for rose aromatic components. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  2. Genomics Analysis of Genes Expressed in Maize Endosperm Identifies Novel Seed Proteins and Clarifies Patterns of Zein Gene Expression

    PubMed Central

    Woo, Young-Min; Hu, David Wang-Nan; Larkins, Brian A.; Jung, Rudolf

    2001-01-01

    We analyzed cDNA libraries from developing endosperm of the B73 maize inbred line to evaluate the expression of storage protein genes. This study showed that zeins are by far the most highly expressed genes in the endosperm, but we found an inverse relationship between the number of zein genes and the relative amount of specific mRNAs. Although α-zeins are encoded by large multigene families, only a few of these genes are transcribed at high or detectable levels. In contrast, relatively small gene families encode the γ- and δ-zeins, and members of these gene families, especially the γ-zeins, are highly expressed. Knowledge of expressed storage protein genes allowed the development of DNA and antibody probes that distinguish between closely related gene family members. Using in situ hybridization, we found differences in the temporal and spatial expression of the α-, γ-, and δ-zein gene families, which provides evidence that γ-zeins are synthesized throughout the endosperm before α- and δ-zeins. This observation is consistent with earlier studies that suggested that γ-zeins play an important role in prolamin protein body assembly. Analysis of endosperm cDNAs also revealed several previously unidentified proteins, including a 50-kD γ-zein, an 18-kD α-globulin, and a legumin-related protein. Immunolocalization of the 50-kD γ-zein showed this protein to be located at the surface of prolamin-containing protein bodies, similar to other γ-zeins. The 18-kD α-globulin, however, is deposited in novel, vacuole-like organelles that were not described previously in maize endosperm. PMID:11595803

  3. MyoD and Myf6 gene expression patterns in skeletal muscle during embryonic and posthatch development in the domestic duck (Anas platyrhynchos domestica).

    PubMed

    Li, H; Zhu, C; Tao, Z; Xu, W; Song, W; Hu, Y; Zhu, W; Song, C

    2014-06-01

    The MyoD and Myf6 genes, which are muscle regulatory factors (MRFs), play major roles in muscle growth and development and initiate muscle fibre formation via the regulation of muscle-specific gene translation. Therefore, MyoD and Myf6 are potential candidate genes for meat production traits in animals and poultry. The objective of this study was to evaluate MyoD and Myf6 gene expression patterns in the skeletal muscle during early developmental stage of ducks. Gene expression levels were detected using the quantitative RT-PCR method in the breast muscle (BM) and leg muscle (LM) at embryonic days 13, 17, 21, 25, 27, as well as at 1 week posthatching in Gaoyou and Jinding ducks (Anas platyrhynchos domestica). The MyoD and Myf6 gene profiles in the two duck breeds were consistent during early development, and MyoD gene expression showed a 'wave' trend in BM and an approximate 'anti-√' trend in LM. Myf6 gene expression in BM showed the highest level at embryonic day 21, which subsequently decreased, although remained relatively high, while levels at embryonic days 13, 17 and 21 were higher in LM. The results of correlation analysis showed that MyoD and Myf6 gene expression levels were more strongly correlated in LM than in BM in both duck breeds. These results indicated that different expression patterns of the MyoD and Myf6 genes in BM and LM may be related to muscle development and differentiation, suggesting that MyoD and Myf6 are integral to skeletal muscle development. © 2013 Blackwell Verlag GmbH.

  4. Gene expression profiling reveals distinct molecular signatures associated with the rupture of intracranial aneurysm.

    PubMed

    Nakaoka, Hirofumi; Tajima, Atsushi; Yoneyama, Taku; Hosomichi, Kazuyoshi; Kasuya, Hidetoshi; Mizutani, Tohru; Inoue, Ituro

    2014-08-01

    The rupture of intracranial aneurysm (IA) causes subarachnoid hemorrhage associated with high morbidity and mortality. We compared gene expression profiles in aneurysmal domes between unruptured IAs and ruptured IAs (RIAs) to elucidate biological mechanisms predisposing to the rupture of IA. We determined gene expression levels of 8 RIAs, 5 unruptured IAs, and 10 superficial temporal arteries with the Agilent microarrays. To explore biological heterogeneity of IAs, we classified the samples into subgroups showing similar gene expression patterns, using clustering methods. The clustering analysis identified 4 groups: superficial temporal arteries and unruptured IAs were aggregated into their own clusters, whereas RIAs segregated into 2 distinct subgroups (early and late RIAs). Comparing gene expression levels between early RIAs and unruptured IAs, we identified 430 upregulated and 617 downregulated genes in early RIAs. The upregulated genes were associated with inflammatory and immune responses and phagocytosis including S100/calgranulin genes (S100A8, S100A9, and S100A12). The downregulated genes suggest mechanical weakness of aneurysm walls. The expressions of Krüppel-like family of transcription factors (KLF2, KLF12, and KLF15), which were anti-inflammatory regulators, and CDKN2A, which was located on chromosome 9p21 that was the most consistently replicated locus in genome-wide association studies of IA, were also downregulated. We demonstrate that gene expression patterns of RIAs were different according to the age of patients. The results suggest that macrophage-mediated inflammation is a key biological pathway for IA rupture. The identified genes can be good candidates for molecular markers of rupture-prone IAs and therapeutic targets. © 2014 American Heart Association, Inc.

  5. Expression and RNA interference of salivary polygalacturonase genes in the tarnished plant bug, Lygus lineolaris.

    PubMed

    Walker, William B; Allen, Margaret L

    2010-01-01

    Three genes encoding polygalacturonase (PG) have been identified in Lygus lineolaris (Palisot de Beauvois) (Miridae: Hemiptera). Earlier studies showed that the three PG gene transcripts are exclusively expressed in the feeding stages of L. lineolaris. In this report, it is shown that all three transcripts are specifically expressed in salivary glands indicating that PGs are salivary enzymes. Transcriptional profiles of the three PGs were evaluated with respect to diet, comparing live cotton plant material to artificial diet. PG2 transcript levels were consistently lower in cotton-fed insects than those reared on artificial diet. RNA interference was used to knock down expression of PG1 mRNA in adult salivary glands providing the first demonstration of the use of this method in the non-model insect, L. lineolaris.

  6. Isoflurane is a suitable alternative to ether for anesthetizing rats prior to euthanasia for gene expression analysis.

    PubMed

    Nakatsu, Noriyuki; Igarashi, Yoshinobu; Aoshi, Taiki; Hamaguchi, Isao; Saito, Masumichi; Mizukami, Takuo; Momose, Haruka; Ishii, Ken J; Yamada, Hiroshi

    2017-01-01

    Diethyl ether (ether) had been widely used in Japan for anesthesia, despite its explosive properties and toxicity to both humans and animals. We also had used ether as an anesthetic for euthanizing rats for research in the Toxicogenomics Project (TGP). Because the use of ether for these purposes will likely cease, it is required to select an alternative anesthetic which is validated for consistency with existing TGP data acquired under ether anesthesia. We therefore compared two alternative anesthetic candidates, isoflurane and pentobarbital, with ether in terms of hematological findings, serum biochemical parameters, and gene expressions. As a result, few differences among the three agents were observed. In hematological and serum biochemistry analysis, no significant changes were found. In gene expression analysis, four known genes were extracted as differentially expressed genes in the liver of rats anesthetized with ether, isoflurane, or pentobarbital. However, no significant relationships were detected using gene ontology, pathway, or gene enrichment analyses by DAVID and TargetMine. Surprisingly, although it was expected that the lung would be affected by administration via inhalation, only one differentially expressed gene was extracted in the lung. Taken together, our data indicate that there are no significant differences among ether, isoflurane, and pentobarbital with respect to effects on hematological parameters, serum biochemistry parameters, and gene expression. Based on its smallest affect to existing data and its safety profile for humans and animals, we suggest isoflurane as a suitable alternative anesthetic for use in rat euthanasia in toxicogenomics analysis.

  7. Alternative dominance of the parental genomes in hybrid cells generated through the fusion of mouse embryonic stem cells with fibroblasts.

    PubMed

    Matveeva, Natalia M; Fishman, Veniamin S; Zakharova, Irina S; Shevchenko, Alexander I; Pristyazhnyuk, Inna E; Menzorov, Aleksei G; Serov, Oleg L

    2017-12-22

    For the first time, two types of hybrid cells with embryonic stem (ES) cell-like and fibroblast-like phenotypes were produced through the fusion of mouse ES cells with fibroblasts. Transcriptome analysis of 2,848 genes differentially expressed in the parental cells demonstrated that 34-43% of these genes are expressed in hybrid cells, consistent with their phenotypes; 25-29% of these genes display intermediate levels of expression, and 12-16% of these genes maintained expression at the parental cell level, inconsistent with the phenotype of the hybrid cell. Approximately 20% of the analyzed genes displayed unexpected expression patterns that differ from both parents. An unusual phenomenon was observed, namely, the illegitimate activation of Xist expression and the inactivation of one of two X-chromosomes in the near-tetraploid fibroblast-like hybrid cells, whereas both Xs were active before and after in vitro differentiation of the ES cell-like hybrid cells. These results and previous data obtained on heterokaryons suggest that the appearance of hybrid cells with a fibroblast-like phenotype reflects the reprogramming, rather than the induced differentiation, of the ES cell genome under the influence of a somatic partner.

  8. Gene-expression signatures can distinguish gastric cancer grades and stages.

    PubMed

    Cui, Juan; Li, Fan; Wang, Guoqing; Fang, Xuedong; Puett, J David; Xu, Ying

    2011-03-18

    Microarray gene-expression data of 54 paired gastric cancer and adjacent noncancerous gastric tissues were analyzed, with the aim to establish gene signatures for cancer grades (well-, moderately-, poorly- or un-differentiated) and stages (I, II, III and IV), which have been determined by pathologists. Our statistical analysis led to the identification of a number of gene combinations whose expression patterns serve well as signatures of different grades and different stages of gastric cancer. A 19-gene signature was found to have discerning power between high- and low-grade gastric cancers in general, with overall classification accuracy at 79.6%. An expanded 198-gene panel allows the stratification of cancers into four grades and control, giving rise to an overall classification agreement of 74.2% between each grade designated by the pathologists and our prediction. Two signatures for cancer staging, consisting of 10 genes and 9 genes, respectively, provide high classification accuracies at 90.0% and 84.0%, among early-, advanced-stage cancer and control. Functional and pathway analyses on these signature genes reveal the significant relevance of the derived signatures to cancer grades and progression. To the best of our knowledge, this represents the first study on identification of genes whose expression patterns can serve as markers for cancer grades and stages.

  9. Selection of reference genes for quantitative real time RT-PCR during dimorphism in the zygomycete Mucor circinelloides.

    PubMed

    Valle-Maldonado, Marco I; Jácome-Galarza, Irvin E; Gutiérrez-Corona, Félix; Ramírez-Díaz, Martha I; Campos-García, Jesús; Meza-Carmen, Víctor

    2015-03-01

    Mucor circinelloides is a dimorphic fungal model for studying several biological processes including cell differentiation (yeast-mold transitions) as well as biodiesel and carotene production. The recent release of the first draft sequence of the M. circinelloides genome, combined with the availability of analytical methods to determine patterns of gene expression, such as quantitative Reverse transcription-Polymerase chain reaction (qRT-PCR), and the development of molecular genetic tools for the manipulation of the fungus, may help identify M. circinelloides gene products and analyze their relevance in different biological processes. However, no information is available on M. circinelloides genes of stable expression that could serve as internal references in qRT-PCR analyses. One approach to solve this problem consists in the use of housekeeping genes as internal references. However, validation of the usability of these reference genes is a fundamental step prior to initiating qRT-PCR assays. This work evaluates expression of several constitutive genes by qRT-PCR throughout the morphological differentiation stages of M. circinelloides; our results indicate that tfc-1 and ef-1 are the most stable genes for qRT-PCR assays during differentiation studies and they are proposed as reference genes to carry out gene expression studies in this fungus.

  10. The mature anther-preferentially expressed genes are associated with pollen fertility, pollen germination and anther dehiscence in rice.

    PubMed

    Ling, Sheng; Chen, Caisheng; Wang, Yang; Sun, Xiaocong; Lu, Zhanhua; Ouyang, Yidan; Yao, Jialing

    2015-02-19

    The anthers and pollen grains are critical for male fertility and hybrid rice breeding. The development of rice mature anther and pollen consists of multiple continuous stages. However, molecular mechanisms regulating mature anther development were poorly understood. In this study, we have identified 291 mature anther-preferentially expressed genes (OsSTA) in rice based on Affymetrix microarray data. Gene Ontology (GO) analysis indicated that OsSTA genes mainly participated in metabolic and cellular processes that are likely important for rice anther and pollen development. The expression patterns of OsSTA genes were validated using real-time PCR and mRNA in situ hybridizations. Cis-element identification showed that most of the OsSTA genes had the cis-elements responsive to phytohormone regulation. Co-expression analysis of OsSTA genes showed that genes annotated with pectinesterase and calcium ion binding activities were rich in the network, suggesting that OsSTA genes could be involved in pollen germination and anther dehiscence. Furthermore, OsSTA RNAi transgenic lines showed male-sterility and pollen germination defects. The results suggested that OsSTA genes function in rice male fertility, pollen germination and anther dehiscence and established molecular regulating networks that lay the foundation for further functional studies.

  11. Duplicated growth hormone genes in a passerine bird, the jungle crow (Corvus macrorhynchos).

    PubMed

    Arai, Natsumi; Iigo, Masayuki

    2010-07-02

    Molecular cloning, molecular phylogeny, gene structure and expression analyses of growth hormone (GH) were performed in a passerine bird, the jungle crow (Corvus macrorhynchos). Unexpectedly, duplicated GH cDNA and genes were identified and designated as GH1A and GH1B. In silico analyses identified the zebra finch orthologs. Both GH genes encode 217 amino acid residues and consist of five exons and four introns, spanning 5.2 kbp in GH1A and 4.2 kbp in GH1B. Predicted GH proteins of the jungle crow and zebra finch contain four conserved cysteine residues, suggesting duplicated GH genes are functional. Molecular phylogenetic analysis revealed that duplication of GH genes occur after divergence of the passerine lineage from the other avian orders as has been suggested from partial genomic DNA sequences of passerine GH genes. RT-PCR analyses confirmed expression of GH1A and GH1B in the pituitary gland. In addition, GH1A gene is expressed in all the tissues examined. However, expression of GH1B is confined to several brain areas and blood cells. These results indicate that the regulatory mechanisms of duplicated GH genes are different and that duplicated GH genes exert both endocrine and autocrine/paracrine functions. Copyright 2010 Elsevier Inc. All rights reserved.

  12. The evolutionary dynamics of variant antigen genes in Babesia reveal a history of genomic innovation underlying host–parasite interaction

    PubMed Central

    Jackson, Andrew P.; Otto, Thomas D.; Darby, Alistair; Ramaprasad, Abhinay; Xia, Dong; Echaide, Ignacio Eduardo; Farber, Marisa; Gahlot, Sunayna; Gamble, John; Gupta, Dinesh; Gupta, Yask; Jackson, Louise; Malandrin, Laurence; Malas, Tareq B.; Moussa, Ehab; Nair, Mridul; Reid, Adam J.; Sanders, Mandy; Sharma, Jyotsna; Tracey, Alan; Quail, Mike A.; Weir, William; Wastling, Jonathan M.; Hall, Neil; Willadsen, Peter; Lingelbach, Klaus; Shiels, Brian; Tait, Andy; Berriman, Matt; Allred, David R.; Pain, Arnab

    2014-01-01

    Babesia spp. are tick-borne, intraerythrocytic hemoparasites that use antigenic variation to resist host immunity, through sequential modification of the parasite-derived variant erythrocyte surface antigen (VESA) expressed on the infected red blood cell surface. We identified the genomic processes driving antigenic diversity in genes encoding VESA (ves1) through comparative analysis within and between three Babesia species, (B. bigemina, B. divergens and B. bovis). Ves1 structure diverges rapidly after speciation, notably through the evolution of shortened forms (ves2) from 5′ ends of canonical ves1 genes. Phylogenetic analyses show that ves1 genes are transposed between loci routinely, whereas ves2 genes are not. Similarly, analysis of sequence mosaicism shows that recombination drives variation in ves1 sequences, but less so for ves2, indicating the adoption of different mechanisms for variation of the two families. Proteomic analysis of the B. bigemina PR isolate shows that two dominant VESA1 proteins are expressed in the population, whereas numerous VESA2 proteins are co-expressed, consistent with differential transcriptional regulation of each family. Hence, VESA2 proteins are abundant and previously unrecognized elements of Babesia biology, with evolutionary dynamics consistently different to those of VESA1, suggesting that their functions are distinct. PMID:24799432

  13. A Compendium of Canine Normal Tissue Gene Expression

    PubMed Central

    Chen, Qing-Rong; Wen, Xinyu; Khan, Javed; Khanna, Chand

    2011-01-01

    Background Our understanding of disease is increasingly informed by changes in gene expression between normal and abnormal tissues. The release of the canine genome sequence in 2005 provided an opportunity to better understand human health and disease using the dog as clinically relevant model. Accordingly, we now present the first genome-wide, canine normal tissue gene expression compendium with corresponding human cross-species analysis. Methodology/Principal Findings The Affymetrix platform was utilized to catalogue gene expression signatures of 10 normal canine tissues including: liver, kidney, heart, lung, cerebrum, lymph node, spleen, jejunum, pancreas and skeletal muscle. The quality of the database was assessed in several ways. Organ defining gene sets were identified for each tissue and functional enrichment analysis revealed themes consistent with known physio-anatomic functions for each organ. In addition, a comparison of orthologous gene expression between matched canine and human normal tissues uncovered remarkable similarity. To demonstrate the utility of this dataset, novel canine gene annotations were established based on comparative analysis of dog and human tissue selective gene expression and manual curation of canine probeset mapping. Public access, using infrastructure identical to that currently in use for human normal tissues, has been established and allows for additional comparisons across species. Conclusions/Significance These data advance our understanding of the canine genome through a comprehensive analysis of gene expression in a diverse set of tissues, contributing to improved functional annotation that has been lacking. Importantly, it will be used to inform future studies of disease in the dog as a model for human translational research and provides a novel resource to the community at large. PMID:21655323

  14. Midbrain dopamine neurons in Parkinson's disease exhibit a dysregulated miRNA and target-gene network.

    PubMed

    Briggs, Christine E; Wang, Yulei; Kong, Benjamin; Woo, Tsung-Ung W; Iyer, Lakshmanan K; Sonntag, Kai C

    2015-08-27

    The degeneration of substantia nigra (SN) dopamine (DA) neurons in sporadic Parkinson׳s disease (PD) is characterized by disturbed gene expression networks. Micro(mi)RNAs are post-transcriptional regulators of gene expression and we recently provided evidence that these molecules may play a functional role in the pathogenesis of PD. Here, we document a comprehensive analysis of miRNAs in SN DA neurons and PD, including sex differences. Our data show that miRNAs are dysregulated in disease-affected neurons and differentially expressed between male and female samples with a trend of more up-regulated miRNAs in males and more down-regulated miRNAs in females. Unbiased Ingenuity Pathway Analysis (IPA) revealed a network of miRNA/target-gene associations that is consistent with dysfunctional gene and signaling pathways in PD pathology. Our study provides evidence for a general association of miRNAs with the cellular function and identity of SN DA neurons, and with deregulated gene expression networks and signaling pathways related to PD pathogenesis that may be sex-specific. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Mindfulness-Based Stress Reduction training reduces loneliness and pro-inflammatory gene expression in older adults: a small randomized controlled trial.

    PubMed

    Creswell, J David; Irwin, Michael R; Burklund, Lisa J; Lieberman, Matthew D; Arevalo, Jesusa M G; Ma, Jeffrey; Breen, Elizabeth Crabb; Cole, Steven W

    2012-10-01

    Lonely older adults have increased expression of pro-inflammatory genes as well as increased risk for morbidity and mortality. Previous behavioral treatments have attempted to reduce loneliness and its concomitant health risks, but have had limited success. The present study tested whether the 8-week Mindfulness-Based Stress Reduction (MBSR) program (compared to a Wait-List control group) reduces loneliness and downregulates loneliness-related pro-inflammatory gene expression in older adults (N = 40). Consistent with study predictions, mixed effect linear models indicated that the MBSR program reduced loneliness, compared to small increases in loneliness in the control group (treatment condition × time interaction: F(1,35) = 7.86, p = .008). Moreover, at baseline, there was an association between reported loneliness and upregulated pro-inflammatory NF-κB-related gene expression in circulating leukocytes, and MBSR downregulated this NF-κB-associated gene expression profile at post-treatment. Finally, there was a trend for MBSR to reduce C Reactive Protein (treatment condition × time interaction: (F(1,33) = 3.39, p = .075). This work provides an initial indication that MBSR may be a novel treatment approach for reducing loneliness and related pro-inflammatory gene expression in older adults. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Mindfulness-Based Stress Reduction Training Reduces Loneliness and Pro-Inflammatory Gene Expression in Older Adults: A Small Randomized Controlled Trial

    PubMed Central

    Creswell, J. David; Irwin, Michael R.; Burklund, Lisa J.; Lieberman, Matthew D.; Arevalo, Jesusa M. G.; Ma, Jeffrey; Breen, Elizabeth Crabb; Cole, Steven W.

    2013-01-01

    Lonely older adults have increased expression of pro-inflammatory genes as well as increased risk for morbidity and mortality. Previous behavioral treatments have attempted to reduce loneliness and its concomitant health risks, but have had limited success. The present study tested whether the 8-week Mindfulness-Based Stress Reduction (MBSR) program (compared to a Wait-List control group) reduces loneliness and downregulates loneliness-related pro-inflammatory gene expression in older adults (N=40). Consistent with study predictions, mixed effect linear models indicated that the MBSR program reduced loneliness, compared to small increases in loneliness in the control group (treatment condition × time interaction: F(1,35)=7.86, p=.008). Moreover, at baseline, there was an association between reported loneliness and upregulated pro-inflammatory NF-κB-related gene expression in circulating leukocytes, and MBSR downregulated this NF-κB-associated gene expression profile at post-treatment. Finally, there was a trend for MBSR to reduce C Reactive Protein (treatment condition × time interaction: (F(1,33)=3.39, p=.075). This work provides an initial indication that MBSR may be a novel treatment approach for reducing loneliness and related pro-inflammatory gene expression in older adults. PMID:22820409

  17. Evaluating Between-Pathway Models with Expression Data

    PubMed Central

    Leiserson, M.D.M.; Cowen, L.J.; Slonim, D.K.

    2010-01-01

    Abstract Between-pathway models (BPMs) are network motifs consisting of pairs of putative redundant pathways. In this article, we show how adding another source of high-throughput data—microarray gene expression data from knockout experiments—allows us to identify a compensatory functional relationship between genes from the two BPM pathways. We evaluate the quality of the BPMs from four different studies, and we describe how our methods might be extended to refine pathways. PMID:20377458

  18. Long-range evolutionary constraints reveal cis-regulatory interactions on the human X chromosome

    PubMed Central

    Naville, Magali; Ishibashi, Minaka; Ferg, Marco; Bengani, Hemant; Rinkwitz, Silke; Krecsmarik, Monika; Hawkins, Thomas A.; Wilson, Stephen W.; Manning, Elizabeth; Chilamakuri, Chandra S. R.; Wilson, David I.; Louis, Alexandra; Lucy Raymond, F.; Rastegar, Sepand; Strähle, Uwe; Lenhard, Boris; Bally-Cuif, Laure; van Heyningen, Veronica; FitzPatrick, David R.; Becker, Thomas S.; Roest Crollius, Hugues

    2015-01-01

    Enhancers can regulate the transcription of genes over long genomic distances. This is thought to lead to selection against genomic rearrangements within such regions that may disrupt this functional linkage. Here we test this concept experimentally using the human X chromosome. We describe a scoring method to identify evolutionary maintenance of linkage between conserved noncoding elements and neighbouring genes. Chromatin marks associated with enhancer function are strongly correlated with this linkage score. We test >1,000 putative enhancers by transgenesis assays in zebrafish to ascertain the identity of the target gene. The majority of active enhancers drive a transgenic expression in a pattern consistent with the known expression of a linked gene. These results show that evolutionary maintenance of linkage is a reliable predictor of an enhancer's function, and provide new information to discover the genetic basis of diseases caused by the mis-regulation of gene expression. PMID:25908307

  19. Genome-wide identification of the potato WRKY transcription factor family.

    PubMed

    Zhang, Chao; Wang, Dongdong; Yang, Chenghui; Kong, Nana; Shi, Zheng; Zhao, Peng; Nan, Yunyou; Nie, Tengkun; Wang, Ruoqiu; Ma, Haoli; Chen, Qin

    2017-01-01

    WRKY transcription factors play pivotal roles in regulation of stress responses. This study identified 79 WRKY genes in potato (Solanum tuberosum). Based on multiple sequence alignment and phylogenetic relationships, WRKY genes were classified into three major groups. The majority of WRKY genes belonged to Group II (52 StWRKYs), Group III had 14 and Group I consisted of 13. The phylogenetic tree further classified Group II into five sub-groups. All StWRKY genes except StWRKY79 were mapped on potato chromosomes, with eight tandem duplication gene pairs and seven segmental duplication gene pairs found from StWRKY family genes. The expression analysis of 22 StWRKYs showed their differential expression levels under various stress conditions. Cis-element prediction showed that a large number of elements related to drought, heat and salicylic acid were present in the promotor regions of StWRKY genes. The expression analysis indicated that seven StWRKYs seemed to respond to stress (heat, drought and salinity) and salicylic acid treatment. These genes are candidates for abiotic stress signaling for further research.

  20. Genome-wide identification of the potato WRKY transcription factor family

    PubMed Central

    Kong, Nana; Shi, Zheng; Zhao, Peng; Nan, Yunyou; Nie, Tengkun; Wang, Ruoqiu; Ma, Haoli

    2017-01-01

    WRKY transcription factors play pivotal roles in regulation of stress responses. This study identified 79 WRKY genes in potato (Solanum tuberosum). Based on multiple sequence alignment and phylogenetic relationships, WRKY genes were classified into three major groups. The majority of WRKY genes belonged to Group II (52 StWRKYs), Group III had 14 and Group I consisted of 13. The phylogenetic tree further classified Group II into five sub-groups. All StWRKY genes except StWRKY79 were mapped on potato chromosomes, with eight tandem duplication gene pairs and seven segmental duplication gene pairs found from StWRKY family genes. The expression analysis of 22 StWRKYs showed their differential expression levels under various stress conditions. Cis-element prediction showed that a large number of elements related to drought, heat and salicylic acid were present in the promotor regions of StWRKY genes. The expression analysis indicated that seven StWRKYs seemed to respond to stress (heat, drought and salinity) and salicylic acid treatment. These genes are candidates for abiotic stress signaling for further research. PMID:28727761

  1. Conditioned taste aversion dependent regulation of amygdala gene expression.

    PubMed

    Panguluri, Siva K; Kuwabara, Nobuyuki; Kang, Yi; Cooper, Nigel; Lundy, Robert F

    2012-02-28

    The present experiments investigated gene expression in the amygdala following contingent taste/LiCl treatment that supports development of conditioned taste aversion (CTA). The use of whole genome chips and stringent data set filtering led to the identification of 168 genes regulated by CTA compared to non-contingent LiCl treatment that does not support CTA learning. Seventy-six of these genes were eligible for network analysis. Such analysis identified "behavior" as the top biological function, which was represented by 15 of the 76 genes. These genes included several neuropeptides, G protein-coupled receptors, ion channels, kinases, and phosphatases. Subsequent qRT-PCR analyses confirmed changes in mRNA expression for 5 of 7 selected genes. We were able to demonstrate directionally consistent changes in protein level for 3 of these genes; insulin 1, oxytocin, and major histocompatibility complex class I-C. Behavioral analyses demonstrated that blockade of central insulin receptors produced a weaker CTA that was less resistant to extinction. Together, these results support the notion that we have identified downstream genes in the amygdala that contribute to CTA learning. Copyright © 2011 Elsevier Inc. All rights reserved.

  2. Escherichia coli global gene expression in urine from women with urinary tract infection.

    PubMed

    Hagan, Erin C; Lloyd, Amanda L; Rasko, David A; Faerber, Gary J; Mobley, Harry L T

    2010-11-11

    Murine models of urinary tract infection (UTI) have provided substantial data identifying uropathogenic E. coli (UPEC) virulence factors and assessing their expression in vivo. However, it is unclear how gene expression in these animal models compares to UPEC gene expression during UTI in humans. To address this, we used a UPEC strain CFT073-specific microarray to measure global gene expression in eight E. coli isolates monitored directly from the urine of eight women presenting at a clinic with bacteriuria. The resulting gene expression profiles were compared to those of the same E. coli isolates cultured statically to exponential phase in pooled, sterilized human urine ex vivo. Known fitness factors, including iron acquisition and peptide transport systems, were highly expressed during human UTI and support a model in which UPEC replicates rapidly in vivo. While these findings were often consistent with previous data obtained from the murine UTI model, host-specific differences were observed. Most strikingly, expression of type 1 fimbrial genes, which are among the most highly expressed genes during murine experimental UTI and encode an essential virulence factor for this experimental model, was undetectable in six of the eight E. coli strains from women with UTI. Despite the lack of type 1 fimbrial expression in the urine samples, these E. coli isolates were generally capable of expressing type 1 fimbriae in vitro and highly upregulated fimA upon experimental murine infection. The findings presented here provide insight into the metabolic and pathogenic profile of UPEC in urine from women with UTI and represent the first transcriptome analysis for any pathogenic E. coli during a naturally occurring infection in humans.

  3. Cloning and Expression Analysis of Phenylalanine Ammonia-Lyase Gene in the Mycelium and Fruit Body of the Edible Mushroom Flammulina velutipes

    PubMed Central

    Yun, Yeo Hong; Koo, Ja Sun

    2015-01-01

    Phenylalanine ammonia-lyase (PAL) gene is known to be expressed in plants, and is involved in the differentiation, growth and synthesis of secondary metabolites. However, its expression in fungi remains to be explored. To understand its expression in mushroom fungi, the PAL gene of the edible mushroom Flammulina velutipes (Fvpal) was cloned and characterized. The cloned Fvpal consists of 2,175 bp, coding for a polypeptide containing 724 amino acids and having 11 introns. The translated amino acid sequence of Fvpal shares a high identity (66%) with that of ectomycorrhizal fungus Tricholoma matsutake. Distinctively, the Fvpal expression in the mycelium was higher in minimal medium supplemented with L-tyrosine than with other aromatic amino acids. During cultivation of the mushroom on sawdust medium, Fvpal expression in the fruit body correspondingly increased as the mushroom grew. In the fruiting body, Fvpal was expressed more in the stipe than in the pileus. These results suggest that F. velutipes PAL activity differs in the different organs of the mushroom. Overall, this is first report to show that the PAL gene expression is associated with mushroom growth in fungi. PMID:26539050

  4. ARNetMiT R Package: association rules based gene co-expression networks of miRNA targets.

    PubMed

    Özgür Cingiz, M; Biricik, G; Diri, B

    2017-03-31

    miRNAs are key regulators that bind to target genes to suppress their gene expression level. The relations between miRNA-target genes enable users to derive co-expressed genes that may be involved in similar biological processes and functions in cells. We hypothesize that target genes of miRNAs are co-expressed, when they are regulated by multiple miRNAs. With the usage of these co-expressed genes, we can theoretically construct co-expression networks (GCNs) related to 152 diseases. In this study, we introduce ARNetMiT that utilize a hash based association rule algorithm in a novel way to infer the GCNs on miRNA-target genes data. We also present R package of ARNetMiT, which infers and visualizes GCNs of diseases that are selected by users. Our approach assumes miRNAs as transactions and target genes as their items. Support and confidence values are used to prune association rules on miRNA-target genes data to construct support based GCNs (sGCNs) along with support and confidence based GCNs (scGCNs). We use overlap analysis and the topological features for the performance analysis of GCNs. We also infer GCNs with popular GNI algorithms for comparison with the GCNs of ARNetMiT. Overlap analysis results show that ARNetMiT outperforms the compared GNI algorithms. We see that using high confidence values in scGCNs increase the ratio of the overlapped gene-gene interactions between the compared methods. According to the evaluation of the topological features of ARNetMiT based GCNs, the degrees of nodes have power-law distribution. The hub genes discovered by ARNetMiT based GCNs are consistent with the literature.

  5. Induction of cardiac Angptl4 by dietary fatty acids is mediated by peroxisome proliferator-activated receptor beta/delta and protects against fatty acid-induced oxidative stress.

    PubMed

    Georgiadi, Anastasia; Lichtenstein, Laeticia; Degenhardt, Tatjana; Boekschoten, Mark V; van Bilsen, Marc; Desvergne, Beatrice; Müller, Michael; Kersten, Sander

    2010-06-11

    Although dietary fatty acids are a major fuel for the heart, little is known about the direct effects of dietary fatty acids on gene regulation in the intact heart. To study the effect of dietary fatty acids on cardiac gene expression and explore the functional consequences. Oral administration of synthetic triglycerides composed of one single fatty acid altered cardiac expression of numerous genes, many of which are involved in the oxidative stress response. The gene most significantly and consistently upregulated by dietary fatty acids encoded Angiopoietin-like protein (Angptl)4, a circulating inhibitor of lipoprotein lipase expressed by cardiomyocytes. Induction of Angptl4 by the fatty acid linolenic acid was specifically abolished in peroxisome proliferator-activated receptor (PPAR)beta/delta(-/-) and not PPARalpha(-/-) mice and was blunted on siRNA-mediated PPARbeta/delta knockdown in cultured cardiomyocytes. Consistent with these data, linolenic acid stimulated binding of PPARbeta/delta but not PPARalpha to the Angptl4 gene. Upregulation of Angptl4 resulted in decreased cardiac uptake of plasma triglyceride-derived fatty acids and decreased fatty acid-induced oxidative stress and lipid peroxidation. In contrast, Angptl4 deletion led to enhanced oxidative stress in the heart, both after an acute oral fat load and after prolonged high fat feeding. Stimulation of cardiac Angptl4 gene expression by dietary fatty acids and via PPARbeta/delta is part of a feedback mechanism aimed at protecting the heart against lipid overload and consequently fatty acid-induced oxidative stress.

  6. Co-expression network analysis identified six hub genes in association with metastasis risk and prognosis in hepatocellular carcinoma

    PubMed Central

    Feng, Juerong; Zhou, Rui; Chang, Ying; Liu, Jing; Zhao, Qiu

    2017-01-01

    Hepatocellular carcinoma (HCC) has a high incidence and mortality worldwide, and its carcinogenesis and progression are influenced by a complex network of gene interactions. A weighted gene co-expression network was constructed to identify gene modules associated with the clinical traits in HCC (n = 214). Among the 13 modules, high correlation was only found between the red module and metastasis risk (classified by the HCC metastasis gene signature) (R2 = −0.74). Moreover, in the red module, 34 network hub genes for metastasis risk were identified, six of which (ABAT, AGXT, ALDH6A1, CYP4A11, DAO and EHHADH) were also hub nodes in the protein-protein interaction network of the module genes. Thus, a total of six hub genes were identified. In validation, all hub genes showed a negative correlation with the four-stage HCC progression (P for trend < 0.05) in the test set. Furthermore, in the training set, HCC samples with any hub gene lowly expressed demonstrated a higher recurrence rate and poorer survival rate (hazard ratios with 95% confidence intervals > 1). RNA-sequencing data of 142 HCC samples showed consistent results in the prognosis. Gene set enrichment analysis (GSEA) demonstrated that in the samples with any hub gene highly expressed, a total of 24 functional gene sets were enriched, most of which focused on amino acid metabolism and oxidation. In conclusion, co-expression network analysis identified six hub genes in association with HCC metastasis risk and prognosis, which might improve the prognosis by influencing amino acid metabolism and oxidation. PMID:28430663

  7. Tissue-specific impact of FADS cluster variants on FADS1 and FADS2 gene expression.

    PubMed

    Reynolds, Lindsay M; Howard, Timothy D; Ruczinski, Ingo; Kanchan, Kanika; Seeds, Michael C; Mathias, Rasika A; Chilton, Floyd H

    2018-01-01

    Omega-6 (n-6) and omega-3 (n-3) long (≥ 20 carbon) chain polyunsaturated fatty acids (LC-PUFAs) play a critical role in human health and disease. Biosynthesis of LC-PUFAs from dietary 18 carbon PUFAs in tissues such as the liver is highly associated with genetic variation within the fatty acid desaturase (FADS) gene cluster, containing FADS1 and FADS2 that encode the rate-limiting desaturation enzymes in the LC-PUFA biosynthesis pathway. However, the molecular mechanisms by which FADS genetic variants affect LC-PUFA biosynthesis, and in which tissues, are unclear. The current study examined associations between common single nucleotide polymorphisms (SNPs) within the FADS gene cluster and FADS1 and FADS2 gene expression in 44 different human tissues (sample sizes ranging 70-361) from the Genotype-Tissue Expression (GTEx) Project. FADS1 and FADS2 expression were detected in all 44 tissues. Significant cis-eQTLs (within 1 megabase of each gene, False Discovery Rate, FDR<0.05, as defined by GTEx) were identified in 12 tissues for FADS1 gene expression and 23 tissues for FADS2 gene expression. Six tissues had significant (FDR< 0.05) eQTLs associated with both FADS1 and FADS2 (including artery, esophagus, heart, muscle, nerve, and thyroid). Interestingly, the identified eQTLs were consistently found to be associated in opposite directions for FADS1 and FADS2 expression. Taken together, findings from this study suggest common SNPs within the FADS gene cluster impact the transcription of FADS1 and FADS2 in numerous tissues and raise important questions about how the inverse expression of these two genes impact intermediate molecular (such a LC-PUFA and LC-PUFA-containing glycerolipid levels) and ultimately clinical phenotypes associated with inflammatory diseases and brain health.

  8. Remote Ischemic Preconditioning Enhances the Expression of Genes Encoding Antioxidant Enzymes and Endoplasmic Reticulum Stress-Related Proteins in Rat Skeletal Muscle.

    PubMed

    Park, Ui Jun; Kim, Hyoung Tae; Cho, Won Hyun; Park, Jae Hyoung; Jung, Hye Ra; Kim, Min Young

    2016-12-01

    Ischemic preconditioning (IPC), including remote IPC (rIPC) and direct IPC (dIPC), is a promising method to decrease ischemia-reperfusion (IR) injury. This study tested the effect of both rIPC and dIPC on the genes for antioxidant enzymes and endoplasmic reticulum (ER) stress-related proteins. Twenty rats were randomly divided into the control and study groups. In the control group (n=10), the right hind limb was sham-operated. The left hind limb (IscR) of the control group underwent IR injury without IPC. In the study group (n=10), the right hind limb received IR injury after 3 cycles of rIPC. The IscR received IR injury after 3 cycles of dIPC. Gene expression was analyzed by Quantitative real-time polymerase chain reaction from the anterior tibialis muscle. The expression of the antioxidant enzyme genes including glutathione peroxidase (GPx), superoxide dismutase (SOD) 1 and catalase (CAT) were significantly reduced in IscR compared with sham treatment. In comparison with IscR, rIPC enhanced the expression of GPx, SOD2, and CAT genes. dIPC enhanced the expression of SOD2 and CAT genes. The expression of SOD2 genes was consistently higher in rIPC than in dIPC, but the difference was only significant for SOD2. The expression of genes for ER stress-related proteins tended to be reduced in IscR in comparison with sham treatment. However, the difference was only significant for C/EBP homologous protein (CHOP). In comparison with IscR, rIPC significantly up-regulated activating transcription factor 4 and CHOP, whereas dIPC up-regulated CHOP. Both rIPC and dIPC enhanced expression of genes for antioxidant enzymes and ER stress-related proteins.

  9. Genome-wide analysis reveals divergent patterns of gene expression during zygotic and somatic embryo maturation of Theobroma cacao L., the chocolate tree.

    PubMed

    Maximova, Siela N; Florez, Sergio; Shen, Xiangling; Niemenak, Nicolas; Zhang, Yufan; Curtis, Wayne; Guiltinan, Mark J

    2014-07-16

    Theobroma cacao L. is a tropical fruit tree, the seeds of which are used to create chocolate. In vitro somatic embryogenesis (SE) of cacao is a propagation system useful for rapid mass-multiplication to accelerate breeding programs and to provide plants directly to farmers. Two major limitations of cacao SE remain: the efficiency of embryo production is highly genotype dependent and the lack of full cotyledon development results in low embryo to plant conversion rates. With the goal to better understand SE development and to improve the efficiency of SE conversion we examined gene expression differences between zygotic and somatic embryos using a whole genome microarray. The expression of 28,752 genes was determined at 4 developmental time points during zygotic embryogenesis (ZE) and 2 time points during cacao somatic embryogenesis (SE). Within the ZE time course, 10,288 differentially expressed genes were enriched for functions related to responses to abiotic and biotic stimulus, metabolic and cellular processes. A comparison ZE and SE expression profiles identified 10,175 differentially expressed genes. Many TF genes, putatively involved in ethylene metabolism and response, were more strongly expressed in SEs as compared to ZEs. Expression levels of genes involved in fatty acid metabolism, flavonoid biosynthesis and seed storage protein genes were also differentially expressed in the two types of embryos. Large numbers of genes were differentially regulated during various stages of both ZE and SE development in cacao. The relatively higher expression of ethylene and flavonoid related genes during SE suggests that the developing tissues may be experiencing high levels of stress during SE maturation caused by the in vitro environment. The expression of genes involved in the synthesis of auxin, polyunsaturated fatty acids and secondary metabolites was higher in SEs relative to ZEs despite lack of lipid and metabolite accumulation. These differences in gene transcript levels associated with critical processes during seed development are consistent with the fact that somatic embryos do not fully develop the large storage cotyledons found in zygotic embryos. These results provide insight towards design of improved protocols for cacao somatic embryogenesis.

  10. Genome-wide analysis reveals divergent patterns of gene expression during zygotic and somatic embryo maturation of Theobroma cacao L., the chocolate tree

    PubMed Central

    2014-01-01

    Background Theobroma cacao L. is a tropical fruit tree, the seeds of which are used to create chocolate. In vitro somatic embryogenesis (SE) of cacao is a propagation system useful for rapid mass-multiplication to accelerate breeding programs and to provide plants directly to farmers. Two major limitations of cacao SE remain: the efficiency of embryo production is highly genotype dependent and the lack of full cotyledon development results in low embryo to plant conversion rates. With the goal to better understand SE development and to improve the efficiency of SE conversion we examined gene expression differences between zygotic and somatic embryos using a whole genome microarray. Results The expression of 28,752 genes was determined at 4 developmental time points during zygotic embryogenesis (ZE) and 2 time points during cacao somatic embryogenesis (SE). Within the ZE time course, 10,288 differentially expressed genes were enriched for functions related to responses to abiotic and biotic stimulus, metabolic and cellular processes. A comparison ZE and SE expression profiles identified 10,175 differentially expressed genes. Many TF genes, putatively involved in ethylene metabolism and response, were more strongly expressed in SEs as compared to ZEs. Expression levels of genes involved in fatty acid metabolism, flavonoid biosynthesis and seed storage protein genes were also differentially expressed in the two types of embryos. Conclusions Large numbers of genes were differentially regulated during various stages of both ZE and SE development in cacao. The relatively higher expression of ethylene and flavonoid related genes during SE suggests that the developing tissues may be experiencing high levels of stress during SE maturation caused by the in vitro environment. The expression of genes involved in the synthesis of auxin, polyunsaturated fatty acids and secondary metabolites was higher in SEs relative to ZEs despite lack of lipid and metabolite accumulation. These differences in gene transcript levels associated with critical processes during seed development are consistent with the fact that somatic embryos do not fully develop the large storage cotyledons found in zygotic embryos. These results provide insight towards design of improved protocols for cacao somatic embryogenesis. PMID:25030026

  11. Expression of stanniocalcin 1 in thyroid side population cells and thyroid cancer cells.

    PubMed

    Hayase, Suguru; Sasaki, Yoshihito; Matsubara, Tsutomu; Seo, Daekwan; Miyakoshi, Masaaki; Murata, Tsubasa; Ozaki, Takashi; Kakudo, Kennichi; Kumamoto, Kensuke; Ylaya, Kris; Cheng, Sheue-yann; Thorgeirsson, Snorri S; Hewitt, Stephen M; Ward, Jerrold M; Kimura, Shioko

    2015-04-01

    Mouse thyroid side population (SP) cells consist of a minor population of mouse thyroid cells that may have multipotent thyroid stem cell characteristics. However the nature of thyroid SP cells remains elusive, particularly in relation to thyroid cancer. Stanniocalcin (STC) 1 and 2 are secreted glycoproteins known to regulate serum calcium and phosphate homeostasis. In recent years, the relationship of STC1/2 expression to cancer has been described in various tissues. Microarray analysis was carried out to determine genes up- and down-regulated in thyroid SP cells as compared with non-SP cells. Among genes up-regulated, stanniocalcin 1 (STC1) was chosen for study because of its expression in various thyroid cells by Western blotting and immunohistochemistry. Gene expression analysis revealed that genes known to be highly expressed in cancer cells and/or involved in cancer invasion/metastasis were markedly up-regulated in SP cells from both intact as well as partial thyroidectomized thyroids. Among these genes, expression of STC1 was found in five human thyroid carcinoma-derived cell lines as revealed by analysis of mRNA and protein, and its expression was inversely correlated with the differentiation status of the cells. Immunohistochemical analysis demonstrated higher expression of STC1 in the thyroid tumor cell line and thyroid tumor tissues from humans and mice. These results suggest that SP cells contain a population of cells that express genes also highly expressed in cancer cells including Stc1, which warrants further study on the role of SP cells and/or STC1 expression in thyroid cancer.

  12. Expression of Stanniocalcin 1 in Thyroid Side Population Cells and Thyroid Cancer Cells

    PubMed Central

    Hayase, Suguru; Sasaki, Yoshihito; Matsubara, Tsutomu; Seo, Daekwan; Miyakoshi, Masaaki; Murata, Tsubasa; Ozaki, Takashi; Kakudo, Kennichi; Kumamoto, Kensuke; Ylaya, Kris; Cheng, Sheue-yann; Thorgeirsson, Snorri S.; Hewitt, Stephen M.; Ward, Jerrold M.

    2015-01-01

    Background: Mouse thyroid side population (SP) cells consist of a minor population of mouse thyroid cells that may have multipotent thyroid stem cell characteristics. However the nature of thyroid SP cells remains elusive, particularly in relation to thyroid cancer. Stanniocalcin (STC) 1 and 2 are secreted glycoproteins known to regulate serum calcium and phosphate homeostasis. In recent years, the relationship of STC1/2 expression to cancer has been described in various tissues. Method: Microarray analysis was carried out to determine genes up- and down-regulated in thyroid SP cells as compared with non-SP cells. Among genes up-regulated, stanniocalcin 1 (STC1) was chosen for study because of its expression in various thyroid cells by Western blotting and immunohistochemistry. Results: Gene expression analysis revealed that genes known to be highly expressed in cancer cells and/or involved in cancer invasion/metastasis were markedly up-regulated in SP cells from both intact as well as partial thyroidectomized thyroids. Among these genes, expression of STC1 was found in five human thyroid carcinoma–derived cell lines as revealed by analysis of mRNA and protein, and its expression was inversely correlated with the differentiation status of the cells. Immunohistochemical analysis demonstrated higher expression of STC1 in the thyroid tumor cell line and thyroid tumor tissues from humans and mice. Conclusion: These results suggest that SP cells contain a population of cells that express genes also highly expressed in cancer cells including Stc1, which warrants further study on the role of SP cells and/or STC1 expression in thyroid cancer. PMID:25647164

  13. Medium-throughput processing of whole mount in situ hybridisation experiments into gene expression domains.

    PubMed

    Crombach, Anton; Cicin-Sain, Damjan; Wotton, Karl R; Jaeger, Johannes

    2012-01-01

    Understanding the function and evolution of developmental regulatory networks requires the characterisation and quantification of spatio-temporal gene expression patterns across a range of systems and species. However, most high-throughput methods to measure the dynamics of gene expression do not preserve the detailed spatial information needed in this context. For this reason, quantification methods based on image bioinformatics have become increasingly important over the past few years. Most available approaches in this field either focus on the detailed and accurate quantification of a small set of gene expression patterns, or attempt high-throughput analysis of spatial expression through binary pattern extraction and large-scale analysis of the resulting datasets. Here we present a robust, "medium-throughput" pipeline to process in situ hybridisation patterns from embryos of different species of flies. It bridges the gap between high-resolution, and high-throughput image processing methods, enabling us to quantify graded expression patterns along the antero-posterior axis of the embryo in an efficient and straightforward manner. Our method is based on a robust enzymatic (colorimetric) in situ hybridisation protocol and rapid data acquisition through wide-field microscopy. Data processing consists of image segmentation, profile extraction, and determination of expression domain boundary positions using a spline approximation. It results in sets of measured boundaries sorted by gene and developmental time point, which are analysed in terms of expression variability or spatio-temporal dynamics. Our method yields integrated time series of spatial gene expression, which can be used to reverse-engineer developmental gene regulatory networks across species. It is easily adaptable to other processes and species, enabling the in silico reconstitution of gene regulatory networks in a wide range of developmental contexts.

  14. Genetic element from human surfactant protein SP-C gene confers bronchiolar-alveolar cell specificity in transgenic mice.

    PubMed

    Glasser, S W; Korfhagen, T R; Wert, S E; Bruno, M D; McWilliams, K M; Vorbroker, D K; Whitsett, J A

    1991-10-01

    Transgenic mice bearing chimeric genes consisting of 5'-sequences derived from the human surfactant protein C (SP-C) gene and the bacterial chloramphenicol acetyltransferase (CAT) gene were generated. Analysis of CAT activity was utilized to demonstrate tissue-specific and developmental expression of chimeric genes containing 3.7 kb of sequences from the human SP-C gene. Lung-specific expression of the 3.7 SP-C-CAT transgene was observed in eight distinct transgenic mouse lines. Expression of the 3.7 SP-C-CAT transgene was first detected in fetal lung on day 11 of gestation and increased dramatically with advancing gestational age, reaching adult levels of activity before birth. In situ hybridization demonstrated that expression of 3.7 SP-C-CAT mRNA was confined to the distal respiratory epithelium. Antisense CAT hybridization was detected in bronchiolar and type II epithelial cells in the adult lung of the 3.7 SP-C-CAT transgenic mice. In situ hybridization of four distinct 3.7 SP-C-CAT transgenic mouse lines demonstrated bronchiolar-alveolar expression of the chimeric CAT gene, although the relative intensity of expression at each site varied within the lines studied. Glucocorticoids increased murine SP-C mRNA in fetal lung organ culture. Likewise, expression of 3.7 SP-C-CAT transgene increased during fetal lung organ or explant culture and was further enhanced by glucocorticoid in vitro. The 5'-regions of human SP-C conferred developmental, lung epithelial, and glucocorticoid-enhanced expression of bacterial CAT in transgenic mice. The increased expression of SP-C accompanying prenatal lung development and exposure to glucocorticoid is mediated, at least in part, at the transcriptional level, being influenced by cis-active elements contained within the 5'-flanking region of the human SP-C gene.

  15. A resource for characterizing genome-wide binding and putative target genes of transcription factors expressed during secondary growth and wood formation in Populus

    Treesearch

    Lijun Liu; Trevor Ramsay; Matthew S. Zinkgraf; David Sundell; Nathaniel Robert Street; Vladimir Filkov; Andrew Groover

    2015-01-01

    Identifying transcription factor target genes is essential for modeling the transcriptional networks underlying developmental processes. Here we report a chromatin immunoprecipitation sequencing (ChIP-seq) resource consisting of genome-wide binding regions and associated putative target genes for four Populus homeodomain transcription factors...

  16. Gene-specific cell labeling using MiMIC transposons.

    PubMed

    Gnerer, Joshua P; Venken, Koen J T; Dierick, Herman A

    2015-04-30

    Binary expression systems such as GAL4/UAS, LexA/LexAop and QF/QUAS have greatly enhanced the power of Drosophila as a model organism by allowing spatio-temporal manipulation of gene function as well as cell and neural circuit function. Tissue-specific expression of these heterologous transcription factors relies on random transposon integration near enhancers or promoters that drive the binary transcription factor embedded in the transposon. Alternatively, gene-specific promoter elements are directly fused to the binary factor within the transposon followed by random or site-specific integration. However, such insertions do not consistently recapitulate endogenous expression. We used Minos-Mediated Integration Cassette (MiMIC) transposons to convert host loci into reliable gene-specific binary effectors. MiMIC transposons allow recombinase-mediated cassette exchange to modify the transposon content. We developed novel exchange cassettes to convert coding intronic MiMIC insertions into gene-specific binary factor protein-traps. In addition, we expanded the set of binary factor exchange cassettes available for non-coding intronic MiMIC insertions. We show that binary factor conversions of different insertions in the same locus have indistinguishable expression patterns, suggesting that they reliably reflect endogenous gene expression. We show the efficacy and broad applicability of these new tools by dissecting the cellular expression patterns of the Drosophila serotonin receptor gene family. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Gene expression profiling in whole blood of patients with coronary artery disease

    PubMed Central

    Taurino, Chiara; Miller, William H.; McBride, Martin W.; McClure, John D.; Khanin, Raya; Moreno, María U.; Dymott, Jane A.; Delles, Christian; Dominiczak, Anna F.

    2010-01-01

    Owing to the dynamic nature of the transcriptome, gene expression profiling is a promising tool for discovery of disease-related genes and biological pathways. In the present study, we examined gene expression in whole blood of 12 patients with CAD (coronary artery disease) and 12 healthy control subjects. Furthermore, ten patients with CAD underwent whole-blood gene expression analysis before and after the completion of a cardiac rehabilitation programme following surgical coronary revascularization. mRNA and miRNA (microRNA) were isolated for expression profiling. Gene expression analysis identified 365 differentially expressed genes in patients with CAD compared with healthy controls (175 up- and 190 down-regulated in CAD), and 645 in CAD rehabilitation patients (196 up- and 449 down-regulated post-rehabilitation). Biological pathway analysis identified a number of canonical pathways, including oxidative phosphorylation and mitochondrial function, as being significantly and consistently modulated across the groups. Analysis of miRNA expression revealed a number of differentially expressed miRNAs, including hsa-miR-140-3p (control compared with CAD, P=0.017), hsa-miR-182 (control compared with CAD, P=0.093), hsa-miR-92a and hsa-miR-92b (post- compared with pre-exercise, P<0.01). Global analysis of predicted miRNA targets found significantly reduced expression of genes with target regions compared with those without: hsa-miR-140-3p (P=0.002), hsa-miR-182 (P=0.001), hsa-miR-92a and hsa-miR-92b (P=2.2×10−16). In conclusion, using whole blood as a ‘surrogate tissue’ in patients with CAD, we have identified differentially expressed miRNAs, differentially regulated genes and modulated pathways which warrant further investigation in the setting of cardiovascular function. This approach may represent a novel non-invasive strategy to unravel potentially modifiable pathways and possible therapeutic targets in cardiovascular disease. PMID:20528768

  18. Transcriptome profiling of Kentucky bluegrass (Poa pratensis L.) accessions in response to salt stress.

    PubMed

    Bushman, B Shaun; Amundsen, Keenan L; Warnke, Scott E; Robins, Joseph G; Johnson, Paul G

    2016-01-13

    Kentucky bluegrass (Poa pratensis L.) is a prominent turfgrass in the cool-season regions, but it is sensitive to salt stress. Previously, a relatively salt tolerant Kentucky bluegrass accession was identified that maintained green colour under consistent salt applications. In this study, a transcriptome study between the tolerant (PI 372742) accession and a salt susceptible (PI 368233) accession was conducted, under control and salt treatments, and in shoot and root tissues. Sample replicates grouped tightly by tissue and treatment, and fewer differentially expressed transcripts were detected in the tolerant PI 372742 samples compared to the susceptible PI 368233 samples, and in root tissues compared to shoot tissues. A de novo assembly resulted in 388,764 transcripts, with 36,587 detected as differentially expressed. Approximately 75 % of transcripts had homology based annotations, with several differences in GO terms enriched between the PI 368233 and PI 372742 samples. Gene expression profiling identified salt-responsive gene families that were consistently down-regulated in PI 372742 and unlikely to contribute to salt tolerance in Kentucky bluegrass. Gene expression profiling also identified sets of transcripts relating to transcription factors, ion and water transport genes, and oxidation-reduction process genes with likely roles in salt tolerance. The transcript assembly represents the first such assembly in the highly polyploidy, facultative apomictic Kentucky bluegrass. The transcripts identified provide genetic information on how this plant responds to and tolerates salt stress in both shoot and root tissues, and can be used for further genetic testing and introgression.

  19. Gene expression patterns in rainbow trout, Oncorhynchus mykiss, exposed to a suite of model toxicants

    PubMed Central

    Hook, Sharon E.; Skillman, Ann D.; Small, Jack A.; Schultz, Irvin R.

    2008-01-01

    The increased availability and use of DNA microarrays has allowed the characterization of gene expression patterns associated with exposure to different toxicants. An important question is whether toxicant induced changes in gene expression in fish are sufficiently diverse to allow for identification of specific modes of action and/or specific contaminants. In theory, each class of toxicant may generate a gene expression profile unique to its mode of toxic action. In this study, isogenic (cloned) rainbow trout Oncorhynchus mykiss were exposed to sublethal levels of a series of model toxicants with varying modes of action, including ethynylestradiol (xeno-estrogen), 2,2,4,4′-tetrabromodiphenyl ether (BDE-47, thyroid active), diquat (oxidant stressor), chromium VI, and benzo[a]pyrene (BaP) for a period of 1–3 weeks. An additional experiment measured trenbolone (anabolic steroid; model androgen) induced gene expression changes in sexually mature female trout. Following exposure, fish were euthanized, livers removed and RNA extracted. Fluorescently labeled cDNA were generated and hybridized against a commercially available Atlantic Salmon/Trout array (GRASP project, University of Victoria) spotted with 16,000 cDNA’s. The slides were scanned to measure abundance of a given transcript in each sample relative to controls. Data were analyzed via Genespring (Silicon Genetics) to identify a list of up- and downregulated genes, as well as to determine gene clustering patterns that can be used as “expression signatures”. The results indicate each toxicant exposure caused between 64 and 222 genes to be significantly altered in expression. Most genes exhibiting altered expression responded to only one of the toxicants and relatively few were co-expressed in multiple treatments. For example, BaP and Diquat, both of which exert toxicity via oxidative stress, upregulated 28 of the same genes, of over 100 genes altered by either treatment. Other genes associated with steroidogenesis, p450 and estrogen responsive genes appear to be useful for selectively identifying toxicant mode of action in fish, suggesting a link between gene expression profile and mode of toxicity. Our array results showed good agreement with quantitative real time polymerase chain reaction (qRT PCR), which demonstrates that the arrays are an accurate measure of gene expression. The specificity of the gene expression profile in response to a model toxicant, the link between genes with altered expression and mode of toxic action, and the consistency between array and qRT PCR results all suggest that cDNA microarrays have the potential to screen environmental contaminants for biomarkers and mode of toxic action. PMID:16488489

  20. Gene expression patterns in rainbow trout, Oncorhynchus mykiss, exposed to a suite of model toxicants.

    PubMed

    Hook, Sharon E; Skillman, Ann D; Small, Jack A; Schultz, Irvin R

    2006-05-25

    The increased availability and use of DNA microarrays has allowed the characterization of gene expression patterns associated with exposure to different toxicants. An important question is whether toxicant induced changes in gene expression in fish are sufficiently diverse to allow for identification of specific modes of action and/or specific contaminants. In theory, each class of toxicant may generate a gene expression profile unique to its mode of toxic action. In this study, isogenic (cloned) rainbow trout Oncorhynchus mykiss were exposed to sublethal levels of a series of model toxicants with varying modes of action, including ethynylestradiol (xeno-estrogen), 2,2,4,4'-tetrabromodiphenyl ether (BDE-47, thyroid active), diquat (oxidant stressor), chromium VI, and benzo[a]pyrene (BaP) for a period of 1-3 weeks. An additional experiment measured trenbolone (anabolic steroid; model androgen) induced gene expression changes in sexually mature female trout. Following exposure, fish were euthanized, livers removed and RNA extracted. Fluorescently labeled cDNA were generated and hybridized against a commercially available Atlantic Salmon/Trout array (GRASP project, University of Victoria) spotted with 16,000 cDNA's. The slides were scanned to measure abundance of a given transcript in each sample relative to controls. Data were analyzed via Genespring (Silicon Genetics) to identify a list of up- and downregulated genes, as well as to determine gene clustering patterns that can be used as "expression signatures". The results indicate each toxicant exposure caused between 64 and 222 genes to be significantly altered in expression. Most genes exhibiting altered expression responded to only one of the toxicants and relatively few were co-expressed in multiple treatments. For example, BaP and Diquat, both of which exert toxicity via oxidative stress, upregulated 28 of the same genes, of over 100 genes altered by either treatment. Other genes associated with steroidogenesis, p450 and estrogen responsive genes appear to be useful for selectively identifying toxicant mode of action in fish, suggesting a link between gene expression profile and mode of toxicity. Our array results showed good agreement with quantitative real time polymerase chain reaction (qRT PCR), which demonstrates that the arrays are an accurate measure of gene expression. The specificity of the gene expression profile in response to a model toxicant, the link between genes with altered expression and mode of toxic action, and the consistency between array and qRT PCR results all suggest that cDNA microarrays have the potential to screen environmental contaminants for biomarkers and mode of toxic action.

  1. Gene function in early mouse embryonic stem cell differentiation

    PubMed Central

    Sene, Kagnew Hailesellasse; Porter, Christopher J; Palidwor, Gareth; Perez-Iratxeta, Carolina; Muro, Enrique M; Campbell, Pearl A; Rudnicki, Michael A; Andrade-Navarro, Miguel A

    2007-01-01

    Background Little is known about the genes that drive embryonic stem cell differentiation. However, such knowledge is necessary if we are to exploit the therapeutic potential of stem cells. To uncover the genetic determinants of mouse embryonic stem cell (mESC) differentiation, we have generated and analyzed 11-point time-series of DNA microarray data for three biologically equivalent but genetically distinct mESC lines (R1, J1, and V6.5) undergoing undirected differentiation into embryoid bodies (EBs) over a period of two weeks. Results We identified the initial 12 hour period as reflecting the early stages of mESC differentiation and studied probe sets showing consistent changes of gene expression in that period. Gene function analysis indicated significant up-regulation of genes related to regulation of transcription and mRNA splicing, and down-regulation of genes related to intracellular signaling. Phylogenetic analysis indicated that the genes showing the largest expression changes were more likely to have originated in metazoans. The probe sets with the most consistent gene changes in the three cell lines represented 24 down-regulated and 12 up-regulated genes, all with closely related human homologues. Whereas some of these genes are known to be involved in embryonic developmental processes (e.g. Klf4, Otx2, Smn1, Socs3, Tagln, Tdgf1), our analysis points to others (such as transcription factor Phf21a, extracellular matrix related Lama1 and Cyr61, or endoplasmic reticulum related Sc4mol and Scd2) that have not been previously related to mESC function. The majority of identified functions were related to transcriptional regulation, intracellular signaling, and cytoskeleton. Genes involved in other cellular functions important in ESC differentiation such as chromatin remodeling and transmembrane receptors were not observed in this set. Conclusion Our analysis profiles for the first time gene expression at a very early stage of mESC differentiation, and identifies a functional and phylogenetic signature for the genes involved. The data generated constitute a valuable resource for further studies. All DNA microarray data used in this study are available in the StemBase database of stem cell gene expression data [1] and in the NCBI's GEO database. PMID:17394647

  2. Genome-wide identification of physically clustered genes suggests chromatin-level co-regulation in male reproductive development in Arabidopsis thaliana

    PubMed Central

    Reimegård, Johan; Kundu, Snehangshu; Pendle, Ali; Irish, Vivian F.; Shaw, Peter

    2017-01-01

    Abstract Co-expression of physically linked genes occurs surprisingly frequently in eukaryotes. Such chromosomal clustering may confer a selective advantage as it enables coordinated gene regulation at the chromatin level. We studied the chromosomal organization of genes involved in male reproductive development in Arabidopsis thaliana. We developed an in-silico tool to identify physical clusters of co-regulated genes from gene expression data. We identified 17 clusters (96 genes) involved in stamen development and acting downstream of the transcriptional activator MS1 (MALE STERILITY 1), which contains a PHD domain associated with chromatin re-organization. The clusters exhibited little gene homology or promoter element similarity, and largely overlapped with reported repressive histone marks. Experiments on a subset of the clusters suggested a link between expression activation and chromatin conformation: qRT-PCR and mRNA in situ hybridization showed that the clustered genes were up-regulated within 48 h after MS1 induction; out of 14 chromatin-remodeling mutants studied, expression of clustered genes was consistently down-regulated only in hta9/hta11, previously associated with metabolic cluster activation; DNA fluorescence in situ hybridization confirmed that transcriptional activation of the clustered genes was correlated with open chromatin conformation. Stamen development thus appears to involve transcriptional activation of physically clustered genes through chromatin de-condensation. PMID:28175342

  3. Co-expression of interleukin 12 enhances antitumor effects of a novel chimeric promoter-mediated suicide gene therapy in an immunocompetent mouse model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xu, Yu, E-mail: xuyu1001@gmail.com; Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071; Liu, Zhengchun, E-mail: l135027@126.com

    Highlights: {yields} A novel chimeric promoter consisting of CArG element and hTERT promoter was developed. {yields} The promoter was characterized with radiation-inducibility and tumor-specificity. {yields} Suicide gene system driven by the promoter showed remarkable cytotoxicity in vitro. {yields} Co-expression of IL12 enhanced the promoter mediated suicide gene therapy in vivo. -- Abstract: The human telomerase reverse transcriptase (hTERT) promoter has been widely used in target gene therapy of cancer. However, low transcriptional activity limited its clinical application. Here, we designed a novel dual radiation-inducible and tumor-specific promoter system consisting of CArG elements and the hTERT promoter, resulting in increased expressionmore » of reporter genes after gamma-irradiation. Therapeutic and side effects of adenovirus-mediated horseradish peroxidase (HRP)/indole-3-acetic (IAA) system downstream of the chimeric promoter were evaluated in mice bearing Lewis lung carcinoma, combining with or without adenovirus-mediated interleukin 12 (IL12) gene driven by the cytomegalovirus promoter. The combination treatment showed more effective suppression of tumor growth than those with single agent alone, being associated with pronounced intratumoral T-lymphocyte infiltration and minor side effects. Our results suggest that the combination treatment with HRP/IAA system driven by the novel chimeric promoter and the co-expression of IL12 might be an effective and safe target gene therapy strategy of cancer.« less

  4. Gene expression signatures of energetic acclimatisation in the reef building coral Acropora millepora.

    PubMed

    Bay, Line K; Guérécheau, Aurélie; Andreakis, Nikos; Ulstrup, Karin E; Matz, Mikhail V

    2013-01-01

    Understanding the mechanisms by which natural populations cope with environmental stress is paramount to predict their persistence in the face of escalating anthropogenic impacts. Reef-building corals are increasingly exposed to local and global stressors that alter nutritional status causing reduced fitness and mortality, however, these responses can vary considerably across species and populations. We compare the expression of 22 coral host genes in individuals from an inshore and an offshore reef location using quantitative Reverse Transcription-PCR (qRT-PCR) over the course of 26 days following translocation into a shaded, filtered seawater environment. Declines in lipid content and PSII activity of the algal endosymbionts (Symbiodinium ITS-1 type C2) over the course of the experiment indicated that heterotrophic uptake and photosynthesis were limited, creating nutritional deprivation conditions. Regulation of coral host genes involved in metabolism, CO2 transport and oxidative stress could be detected already after five days, whereas PSII activity took twice as long to respond. Opposing expression trajectories of Tgl, which releases fatty acids from the triacylglycerol storage, and Dgat1, which catalyses the formation of triglycerides, indicate that the decline in lipid content can be attributed, at least in part, by mobilisation of triacylglycerol stores. Corals from the inshore location had initially higher lipid content and showed consistently elevated expression levels of two genes involved in metabolism (aldehyde dehydrogenase) and calcification (carbonic anhydrase). Coral host gene expression adjusts rapidly upon change in nutritional conditions, and therefore can serve as an early signature of imminent coral stress. Consistent gene expression differences between populations indicate that corals acclimatize and/or adapt to local environments. Our results set the stage for analysis of these processes in natural coral populations, to better understand the responses of coral communities to global climate change and to develop more efficient management strategies.

  5. Epigenetic Modification of TLRs in Leukocytes Is Associated with Increased Susceptibility to Salmonella enteritidis in Chickens

    PubMed Central

    Zhao, Guiping; Zheng, Maiqing; Li, Peng; Wang, Huihua; Zhu, Yun; Chen, Jilan; Wen, Jie

    2012-01-01

    Toll-like receptors (TLRs) signaling pathways are the first lines in defense against Salmonella enteritidis (S. enteritidis) infection but the molecular mechanism underlying susceptibility to S. enteritidis infection in chicken remains unclear. SPF chickens injected with S. enteritidis were partitioned into two groups, one consisted of those from Salmonella-susceptible chickens (died within 5 d after injection, n = 6), the other consisted of six Salmonella-resistant chickens that survived for 15 d after injection. The present study shows that the bacterial load in susceptible chickens was significantly higher than that in resistant chickens and TLR4, TLR2-1 and TLR21 expression was strongly diminished in the leukocytes of susceptible chickens compared with those of resistant chickens. The induction of expression of pro-inflammatory cytokine genes, IL-6 and IFN-β, was greatly enhanced in the resistant but not in susceptible chickens. Contrasting with the reduced expression of TLR genes, those of the zinc finger protein 493 (ZNF493) gene and Toll-interacting protein (TOLLIP) gene were enhanced in the susceptible chickens. Finally, the expression of TLR4 in peripheral blood mononuclear cells (PBMCs) infected in vitro with S. enteritidis increased significantly as a result of treatment with 5-Aza-2-deoxycytidine (5-Aza-dc) while either 5-Aza-dc or trichostatin A was effective in up-regulating the expression of TLR21 and TLR2-1. DNA methylation, in the predicted promoter region of TLR4 and TLR21 genes, and an exonic CpG island of the TLR2-1 gene was significantly higher in the susceptible chickens than in resistant chickens. Taken together, the results demonstrate that ZNF493-related epigenetic modification in leukocytes probably accounts for increased susceptibility to S. enteritidis in chickens by diminishing the expression and response of TLR4, TLR21 and TLR2-1. PMID:22438967

  6. Chemical and Hormonal Effects on STAT5b-Dependent Sexual Dimorphism of the Liver Transcriptome

    PubMed Central

    Oshida, Keiyu; Waxman, David J.; Corton, J. Christopher

    2016-01-01

    The growth hormone (GH)-activated transcription factor signal transducer and activator of transcription 5b (STAT5b) is a key regulator of sexually dimorphic gene expression in the liver. Suppression of hepatic STAT5b signaling is associated with lipid metabolic dysfunction leading to steatosis and liver cancer. In the companion publication, a STAT5b biomarker gene set was identified and used in a rank-based test to predict both increases and decreases in liver STAT5b activation status/function with high (≥ 97%) accuracy. Here, this computational approach was used to identify chemicals and hormones that activate (masculinize) or suppress (feminize) STAT5b function in a large, annotated mouse liver and primary hepatocyte gene expression compendium. Exposure to dihydrotestosterone and thyroid hormone caused liver masculinization, whereas glucocorticoids, fibroblast growth factor 15, and angiotensin II caused liver feminization. In mouse models of diabetes and obesity, liver feminization was consistently observed and was at least partially reversed by leptin or resveratrol exposure. Chemical-induced feminization of male mouse liver gene expression profiles was a relatively frequent phenomenon: of 156 gene expression biosets from chemically-treated male mice, 29% showed feminization of liver STAT5b function, while <1% showed masculinization. Most (93%) of the biosets that exhibited feminization of male liver were also associated with activation of one or more xenobiotic-responsive receptors, most commonly constitutive activated receptor (CAR) or peroxisome proliferator-activated receptor alpha (PPARα). Feminization was consistently associated with increased expression of peroxisome proliferator-activated receptor gamma (Pparg) but not other lipogenic transcription factors linked to steatosis. GH-activated STAT5b signaling in mouse liver is thus commonly altered by diverse chemicals, and provides a linkage between chemical exposure and dysregulated gene expression associated with adverse effects on the liver. PMID:26959237

  7. A lincRNA connected to cell mortality and epigenetically-silenced in most common human cancers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vrba, Lukas; Garbe, James C.; Stampfer, Martha R.

    Immortality is an essential characteristic of human carcinoma cells. We recently developed an efficient, reproducible method that immortalizes human mammary epithelial cells (HMEC) in the absence of gross genomic changes by targeting 2 critical senescence barriers. Consistent transcriptomic changes associated with immortality were identified using microarray analysis of isogenic normal finite pre-stasis, abnormal finite post-stasis, and immortal HMECs from 4 individuals. A total of 277 genes consistently changed in cells that transitioned from post-stasis to immortal. Gene ontology analysis of affected genes revealed biological processes significantly altered in the immortalization process. These immortalization-associated changes showed striking similarity to the genemore » expression changes seen in The Cancer Genome Atlas (TCGA) clinical breast cancer data. The most dramatic change in gene expression seen during the immortalization step was the downregulation of an unnamed, incompletely annotated transcript that we called MORT, for mortality, since its expression was closely associated with the mortal, finite lifespan phenotype. We show here that MORT (ZNF667-AS1) is expressed in all normal finite lifespan human cells examined to date and is lost in immortalized HMEC. MORT gene silencing at the mortal/immortal boundary was due to DNA hypermethylation of its CpG island promoter. This epigenetic silencing is also seen in human breast cancer cell lines and in a majority of human breast tumor tissues. The functional importance of DNA hypermethylation in MORT gene silencing is supported by the ability of 5-aza-2'- deoxycytidine to reactivate MORT expression. Analysis of TCGA data revealed deregulation of MORT expression due to DNA hypermethylation in 15 out of the 17 most common human cancers. In conclusion, the epigenetic silencing of MORT in a large majority of the common human cancers suggests a potential fundamental role in cellular immortalization during human carcinogenesis.« less

  8. A lincRNA connected to cell mortality and epigenetically-silenced in most common human cancers

    DOE PAGES

    Vrba, Lukas; Garbe, James C.; Stampfer, Martha R.; ...

    2015-10-19

    Immortality is an essential characteristic of human carcinoma cells. We recently developed an efficient, reproducible method that immortalizes human mammary epithelial cells (HMEC) in the absence of gross genomic changes by targeting 2 critical senescence barriers. Consistent transcriptomic changes associated with immortality were identified using microarray analysis of isogenic normal finite pre-stasis, abnormal finite post-stasis, and immortal HMECs from 4 individuals. A total of 277 genes consistently changed in cells that transitioned from post-stasis to immortal. Gene ontology analysis of affected genes revealed biological processes significantly altered in the immortalization process. These immortalization-associated changes showed striking similarity to the genemore » expression changes seen in The Cancer Genome Atlas (TCGA) clinical breast cancer data. The most dramatic change in gene expression seen during the immortalization step was the downregulation of an unnamed, incompletely annotated transcript that we called MORT, for mortality, since its expression was closely associated with the mortal, finite lifespan phenotype. We show here that MORT (ZNF667-AS1) is expressed in all normal finite lifespan human cells examined to date and is lost in immortalized HMEC. MORT gene silencing at the mortal/immortal boundary was due to DNA hypermethylation of its CpG island promoter. This epigenetic silencing is also seen in human breast cancer cell lines and in a majority of human breast tumor tissues. The functional importance of DNA hypermethylation in MORT gene silencing is supported by the ability of 5-aza-2'- deoxycytidine to reactivate MORT expression. Analysis of TCGA data revealed deregulation of MORT expression due to DNA hypermethylation in 15 out of the 17 most common human cancers. In conclusion, the epigenetic silencing of MORT in a large majority of the common human cancers suggests a potential fundamental role in cellular immortalization during human carcinogenesis.« less

  9. Eos Negatively Regulates Human γ-globin Gene Transcription during Erythroid Differentiation

    PubMed Central

    Yu, Hai-Chuan; Zhao, Hua-Lu; Wu, Zhi-Kui; Zhang, Jun-Wu

    2011-01-01

    Background Human globin gene expression is precisely regulated by a complicated network of transcription factors and chromatin modifying activities during development and erythropoiesis. Eos (Ikaros family zinc finger 4, IKZF4), a member of the zinc finger transcription factor Ikaros family, plays a pivotal role as a repressor of gene expression. The aim of this study was to examine the role of Eos in globin gene regulation. Methodology/Principal Findings Western blot and quantitative real-time PCR detected a gradual decrease in Eos expression during erythroid differentiation of hemin-induced K562 cells and Epo-induced CD34+ hematopoietic stem/progenitor cells (HPCs). DNA transfection and lentivirus-mediated gene transfer demonstrated that the enforced expression of Eos significantly represses the expression of γ-globin, but not other globin genes, in K562 cells and CD34+ HPCs. Consistent with a direct role of Eos in globin gene regulation, chromatin immunoprecipitaion and dual-luciferase reporter assays identified three discrete sites located in the DNase I hypersensitivity site 3 (HS3) of the β-globin locus control region (LCR), the promoter regions of the Gγ- and Aγ- globin genes, as functional binding sites of Eos protein. A chromosome conformation capture (3C) assay indicated that Eos may repress the interaction between the LCR and the γ-globin gene promoter. In addition, erythroid differentiation was inhibited by enforced expression of Eos in K562 cells and CD34+ HPCs. Conclusions/Significance Our results demonstrate that Eos plays an important role in the transcriptional regulation of the γ-globin gene during erythroid differentiation. PMID:21829552

  10. Placental protection of the fetal brain during short-term food deprivation.

    PubMed

    Broad, Kevin D; Keverne, Eric B

    2011-09-13

    The fetal genome regulates maternal physiology and behavior via its placenta, which produces hormones that act on the maternal hypothalamus. At the same time, the fetus itself develops a hypothalamus. In this study we show that many of the genes that regulate placental development also regulate the developing hypothalamus, and in mouse the coexpression of these genes is particularly high on embryonic days 12 and 13 (days E12-13). Such synchronized expression is regulated, in part, by the maternally imprinted gene, paternally expressed gene 3 (Peg3), which also is developmentally coexpressed in the hypothalamus and placenta at days E12-13. We further show that challenging this genomic linkage of hypothalamus and placenta with 24-h food deprivation results in disruption to coexpressed genes, primarily by affecting placental gene expression. Food deprivation also produces a significant decrease in Peg3 gene expression in the placenta, with consequences similar to many of the placental gene changes induced by Peg3 mutation. Such genomic dysregulation does not occur in the hypothalamus, where Peg3 expression increases with food deprivation. Thus, changes in gene expression brought about by food deprivation are consistent with the fetal genome's maintaining hypothalamic development at a cost to its placenta. This biased change to gene dysregulation in the placenta is linked to autophagy and ribosomal turnover, which sustain, in the short term, nutrient supply for the developing hypothalamus. Thus, the fetus controls its own destiny in times of acute starvation by short-term sacrifice of the placenta to preserve brain development.

  11. Gene expression profiling reveals different molecular patterns in G-protein coupled receptor signaling pathways between early- and late-onset preeclampsia.

    PubMed

    Liang, Mengmeng; Niu, Jianmin; Zhang, Liang; Deng, Hua; Ma, Jian; Zhou, Weiping; Duan, Dongmei; Zhou, Yuheng; Xu, Huikun; Chen, Longding

    2016-04-01

    Early-onset preeclampsia and late-onset preeclampsia have been regarded as two different phenotypes with heterogeneous manifestations; To gain insights into the pathogenesis of the two traits, we analyzed the gene expression profiles in preeclamptic placentas. A whole genome-wide microarray was used to determine the gene expression profiles in placental tissues from patients with early-onset (n = 7; <34 weeks), and late-onset (n = 8; >36 weeks) preeclampsia and their controls who delivered preterm (n = 5; <34 weeks) or at term (n = 5; >36 weeks). Genes were termed differentially expressed if they showed a fold-change ≥ 2 and q-value < 0.05. Quantitative real-time reverse transcriptase PCR was used to verify the results. Western blotting was performed to verify the expressions of secreted genes at the protein level. Six hundred twenty-seven genes were differentially expressed in early-compared with late-onset preeclampsia (177 genes were up-regulated and 450 were down-regulated). Gene ontology analysis identified significant alterations in several biological processes; the top two were immune response and cell surface receptor linked signal transduction. Among the cell surface receptor linked signal transduction-related, differentially expressed genes, those involved in the G-protein coupled receptor protein signaling pathway were significantly enriched. G-protein coupled receptor signaling pathway related genes, such as GPR124 and MRGPRF, were both found to be down-regulated in early-onset preeclampsia. The results were consistent with those of western blotting that the abundance of GPR124 was lower in early-onset compared with late-onset preeclampsia. The different gene expression profiles reflect the different levels of transcription regulation between the two conditions and supported the hypothesis that they are separate disease entities. Moreover, the G-protein coupled receptor signaling pathway related genes may contribute to the mechanism underlying early- and late-onset preeclampsia. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Repair genes expression profile of MLH1, MSH2 and ATM in the normal oral mucosa of chronic smokers.

    PubMed

    Alves, Mônica Ghislaine Oliveira; Carta, Celina Faig Lima; de Barros, Patrícia Pimentel; Issa, Jaqueline Scholz; Nunes, Fábio Daumas; Almeida, Janete Dias

    2017-01-01

    The aim of this study was to evaluate the effect of chronic smoking on the expression profile of the repair genes MLH1, MSH2 and ATM in the normal oral mucosa of chronic smokers and never smokers. The sample consisted of thirty exfoliative cytology smears per group obtained from Smokers and Never Smokers. Total RNA was extracted and expression of the MLH1, MSH2 and ATM genes were evaluated by quantitative real-time and immunocytochemistry. The gene and protein expression data were correlated to the clinical data. Gene expression was analyzed statistically using the Student t-test and Pearson's correlation coefficient, with p<0.05. MLH1, MSH2 and ATM genes were downregulated in the smoking group compared to the control with significant values for MLH1 (p=0.006), MSH2 (p=0.0001) and ATM (p=0.0001). Immunocytochemical staining for anti-MLH1, anti-MSH2 and anti-ATM was negative in Never Smokers; in Smokers it was rarely positive. No significant correlation was observed among the expression of MLH1, MSH2, ATM and age, number of cigarettes consumed per day, time of smoking during life, smoking history or levels of CO in expired air. The expression of genes and proteins related to DNA repair mechanism MLH1, MSH2 and ATM in the normal oral mucosa of chronic smokers was reduced. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Gene expression profile of steroid-induced necrosis of femoral head of rats.

    PubMed

    Tong, Peijian; Wu, Chengliang; Jin, Hongting; Mao, Qiang; Yu, Nanze; Holz, Jonathan D; Shan, Letian; Liu, Hui; Xiao, Luwei

    2011-10-01

    The key to treating steroid-induced necrosis of femoral heads (SINFH) is early diagnosis. Dramatic improvements in diagnosis could be made if the pathogenesis of SINFH was more fully understood; however, the underlying mechanism of this disease is currently unknown. To explore the potential mechanism of SINFH, we performed gene array analysis on a rat model of the disease and compare the expression profile with that of normal rats. A quantitative RT-PCR and immunohistochemistry (IHC) assays were used to confirm the microarray results. Compared to the control group, 190 genes in the experimental group were differentially expressed, with 52 up-regulated and 138 down-regulated. Of these genes, 102 are known (deposited in GenBank), while 88 of them are unknown. The known genes can be divided into several families according to their biological functions, such as oxidative stress, apoptosis, signal transduction, angiogenesis, extracellular matrix, lipid metabolism, and transcription related genes. The results of quantitative RT-PCR and IHC were consistent with gene chip results. Our findings indicate that many genes involved in diverse signaling pathways were differentially expressed between SINFH rats and normal rats. Furthermore, our findings suggest that the development of SINFH is a complicated and dynamic process affected by multiple factors and signaling pathways and regulated by various genes.

  14. Molecular and Bioenergetic Differences between Cells with African versus European Inherited Mitochondrial DNA Haplogroups: Implications for Population Susceptibility to Diseases

    PubMed Central

    Kenney, M. Cristina; Chwa, Marilyn; Atilano, Shari R.; Falatoonzadeh, Payam; Ramirez, Claudio; Malik, Deepika; Tarek, Mohamed; Cáceres del Carpio, Javier; Nesburn, Anthony B.; Boyer, David S.; Kuppermann, Baruch D.; Vawter, Marquis P.; Jazwinski, S. Michal; Miceli, Michael V.; Wallace, Douglas C.; Udar, Nitin

    2015-01-01

    The geographic origins of populations can be identified by their maternally inherited mitochondrial DNA (mtDNA) haplogroups. This study compared human cybrids (cytoplasmic hybrids), which are cell lines with identical nuclei but mitochondria from different individuals with mtDNA from either the H haplogroup or L haplogroup backgrounds. The most common European haplogroup is H while individuals of maternal African origin are of the L haplogroup. Despite lower mtDNA copy numbers, L cybrids had higher expression levels for nine mtDNA-encoded respiratory complex genes, decreased ATP turnover rates and lower levels of ROS production, parameters which are consistent with more efficient oxidative phosphorylation. Surprisingly, GeneChip arrays showed that the L and H cybrids had major differences in expression of genes of the canonical complement system (5 genes), dermatan/chondroitin sulfate biosynthesis (5 genes) and CCR3 signaling (9 genes). Quantitative nuclear gene expression studies confirmed that L cybrids had (a) lower expression levels of complement pathway and innate immunity genes and (b) increased levels of inflammation-related signaling genes, which are critical in human diseases. Our data support the hypothesis that mtDNA haplogroups representing populations from different geographic origins may play a role in differential susceptibilities to diseases. PMID:24200652

  15. [Construction of eukaryotic recombinant vector and expression in COS7 cell of LipL32-HlyX fusion gene from Leptospira serovar Lai].

    PubMed

    Huang, Bi; Bao, Lang; Zhong, Qi; Zhang, Huidong; Zhang, Ying

    2009-04-01

    This study was conducted to construct eukaryotic recombinant vector of LipL32-HlyX fusion gene from Leptospira serovar Lai and express it in mammalian cell. Both of LipL32 gene and HlyX gene were amplified from Leptospira strain O17 genomic DNA by PCR. Then with the two genes as template, LipL32-HlyX fusion gene was obtained by SOE PCR (gene splicing by overlap extension PCR). The fusion gene was then cloned into pcDNA3.1 by restriction nuclease digestion. Having been transformed into E. coli DH5alpha, the recombiant plasmid was identified by restriction nuclease digestion, PCR analysis and sequencing. The recombinant plasmid was then transfected into COS7 cell whose expression was detected by RT-PCR and Western blotting analysis. RT-PCR amplified a fragment about 2000 bp and Western blotting analysis found a specific band about 75 KD which was consistent with the expected fusion protein size. In conclusion, the successful construction of eukaryotic recombinant vector containing LipL32-HlyX fusion gene and the effective expression in mammalian have laid a foundation for the application of Leptospira DNA vaccine.

  16. Constitutional downregulation of SEMA5A expression in autism.

    PubMed

    Melin, M; Carlsson, B; Anckarsater, H; Rastam, M; Betancur, C; Isaksson, A; Gillberg, C; Dahl, N

    2006-01-01

    There is strong evidence for the importance of genetic factors in idiopathic autism. The results from independent twin and family studies suggest that the disorder is caused by the action of several genes, possibly acting epistatically. We have used cDNA microarray technology for the identification of constitutional changes in the gene expression profile associated with idiopathic autism. Samples were obtained and analyzed from 6 affected subjects belonging to multiplex autism families and from 6 healthy controls. We assessed the expression levels for approximately 7,700 genes by cDNA microarrays using mRNA derived from Epstein-Barr virus-transformed B lymphocytes. The microarray data were analyzed in order to identify up- or downregulation of specific genes. A common pattern with nine downregulated genes was identified among samples derived from individuals with autism when compared to controls. Four of these nine genes encode proteins involved in biological processes associated with brain function or the immune system, and are consequently considered as candidates for genes associated with autism. Quantitative real-time PCR confirms the downregulation of the gene encoding SEMA5A, a protein involved in axonal guidance. Epstein-Barr virus should be considered as a possible source for altered expression, but our consistent results make us suggest SEMA5A as a candidate gene in the etiology of idiopathic autism.

  17. Constitutional downregulation of SEMA5A expression in autism

    PubMed Central

    Melin, Malin; Carlsson, Birgit; Anckarsäter, Henrik; Rastam, Maria; Betancur, Catalina; Isaksson, Anders; Gillberg, Christopher; Dahl, Niklas

    2006-01-01

    There is strong evidence for the importance of genetic factors in idiopathic autism. The results from independent twin and family studies suggest that the disorder is caused by the action of several genes, possibly acting epistatically. We have used cDNA microarray technology for the identification of constitutional changes in the gene expression profile associated with idiopathic autism. Samples were obtained and analyzed from six affected subjects belonging to multiplex autism families and from six healthy controls. We assessed the expression levels for approximately 7,700 genes by cDNA microarrays using mRNA derived from Epstein Barr virus (EBV)-transformed B-lymphocytes. The microarray data was analyzed in order to identify up- or down-regulation of specific genes. A common pattern with nine down-regulated genes was identified among samples derived from individuals with autism when compared to controls. Four of these nine genes encode proteins involved in biological processes associated with brain function or the immune system, and are consequently considered as candidates for genes associated with autism. Quantitative realtime PCR confirms the down-regulation of the gene encoding SEMA5A, a protein involved in axonal guidance. EBV should be considered as a possible source for altered expression but our consistent results make us suggest SEMA5A a candidate gene in the etiology of idiopathic autism. PMID:17028446

  18. Identification of reference genes for RT-qPCR in ovine mammary tissue during late pregnancy and lactation and in response to maternal nutritional programming.

    PubMed

    Paten, A M; Pain, S J; Peterson, S W; Blair, H T; Kenyon, P R; Dearden, P K; Duncan, E J

    2014-08-01

    The mammary gland is a complex tissue consisting of multiple cell types which, over the lifetime of an animal, go through repeated cycles of development associated with pregnancy, lactation and involution. The mammary gland is also known to be sensitive to maternal programming by environmental stimuli such as nutrition. The molecular basis of these adaptations is of significant interest, but requires robust methods to measure gene expression. Reverse-transcription quantitative PCR (RT-qPCR) is commonly used to measure gene expression, and is currently the method of choice for validating genome-wide expression studies. RT-qPCR requires the selection of reference genes that are stably expressed over physiological states and treatments. In this study we identify suitable reference genes to normalize RT-qPCR data for the ovine mammary gland in two physiological states; late pregnancy and lactation. Biopsies were collected from offspring of ewes that had been subjected to different nutritional paradigms during pregnancy to examine effects of maternal programming on the mammary gland of the offspring. We evaluated eight candidate reference genes and found that two reference genes (PRPF3 and CUL1) are required for normalising RT-qPCR data from pooled RNA samples, but five reference genes are required for analyzing gene expression in individual animals (SENP2, EIF6, MRPL39, ATP1A1, CUL1). Using these stable reference genes, we showed that TET1, a key regulator of DNA methylation, is responsive to maternal programming and physiological state. The identification of these novel reference genes will be of utility to future studies of gene expression in the ovine mammary gland. Copyright © 2014 the American Physiological Society.

  19. Time-Course Analysis of Gene Expression During the Saccharomyces cerevisiae Hypoxic Response.

    PubMed

    Bendjilali, Nasrine; MacLeon, Samuel; Kalra, Gurmannat; Willis, Stephen D; Hossian, A K M Nawshad; Avery, Erica; Wojtowicz, Olivia; Hickman, Mark J

    2017-01-05

    Many cells experience hypoxia, or low oxygen, and respond by dramatically altering gene expression. In the yeast Saccharomyces cerevisiae, genes that respond are required for many oxygen-dependent cellular processes, such as respiration, biosynthesis, and redox regulation. To more fully characterize the global response to hypoxia, we exposed yeast to hypoxic conditions, extracted RNA at different times, and performed RNA sequencing (RNA-seq) analysis. Time-course statistical analysis revealed hundreds of genes that changed expression by up to 550-fold. The genes responded with varying kinetics suggesting that multiple regulatory pathways are involved. We identified most known oxygen-regulated genes and also uncovered new regulated genes. Reverse transcription-quantitative PCR (RT-qPCR) analysis confirmed that the lysine methyltransferase EFM6 and the recombinase DMC1, both conserved in humans, are indeed oxygen-responsive. Looking more broadly, oxygen-regulated genes participate in expected processes like respiration and lipid metabolism, but also in unexpected processes like amino acid and vitamin metabolism. Using principle component analysis, we discovered that the hypoxic response largely occurs during the first 2 hr and then a new steady-state expression state is achieved. Moreover, we show that the oxygen-dependent genes are not part of the previously described environmental stress response (ESR) consisting of genes that respond to diverse types of stress. While hypoxia appears to cause a transient stress, the hypoxic response is mostly characterized by a transition to a new state of gene expression. In summary, our results reveal that hypoxia causes widespread and complex changes in gene expression to prepare the cell to function with little or no oxygen. Copyright © 2017 Bendjilali et al.

  20. Pattern Genes Suggest Functional Connectivity of Organs

    NASA Astrophysics Data System (ADS)

    Qin, Yangmei; Pan, Jianbo; Cai, Meichun; Yao, Lixia; Ji, Zhiliang

    2016-05-01

    Human organ, as the basic structural and functional unit in human body, is made of a large community of different cell types that organically bound together. Each organ usually exerts highly specified physiological function; while several related organs work smartly together to perform complicated body functions. In this study, we present a computational effort to understand the roles of genes in building functional connection between organs. More specifically, we mined multiple transcriptome datasets sampled from 36 human organs and tissues, and quantitatively identified 3,149 genes whose expressions showed consensus modularly patterns: specific to one organ/tissue, selectively expressed in several functionally related tissues and ubiquitously expressed. These pattern genes imply intrinsic connections between organs. According to the expression abundance of the 766 selective genes, we consistently cluster the 36 human organs/tissues into seven functional groups: adipose & gland, brain, muscle, immune, metabolism, mucoid and nerve conduction. The organs and tissues in each group either work together to form organ systems or coordinate to perform particular body functions. The particular roles of specific genes and selective genes suggest that they could not only be used to mechanistically explore organ functions, but also be designed for selective biomarkers and therapeutic targets.

  1. Validation of endogenous internal real-time PCR controls in renal tissues.

    PubMed

    Cui, Xiangqin; Zhou, Juling; Qiu, Jing; Johnson, Martin R; Mrug, Michal

    2009-01-01

    Endogenous internal controls ('reference' or 'housekeeping' genes) are widely used in real-time PCR (RT-PCR) analyses. Their use relies on the premise of consistently stable expression across studied experimental conditions. Unfortunately, none of these controls fulfills this premise across a wide range of experimental conditions; consequently, none of them can be recommended for universal use. To determine which endogenous RT-PCR controls are suitable for analyses of renal tissues altered by kidney disease, we studied the expression of 16 commonly used 'reference genes' in 7 mildly and 7 severely affected whole kidney tissues from a well-characterized cystic kidney disease model. Expression levels of these 16 genes, determined by TaqMan RT-PCR analyses and Affymetrix GeneChip arrays, were normalized and tested for overall variance and equivalence of the means. Both statistical approaches and both TaqMan- and GeneChip-based methods converged on 3 out of the 4 top-ranked genes (Ppia, Gapdh and Pgk1) that had the most constant expression levels across the studied phenotypes. A combination of the top-ranked genes will provide a suitable endogenous internal control for similar studies of kidney tissues across a wide range of disease severity. Copyright 2009 S. Karger AG, Basel.

  2. Gene expression profiling of long-lived dwarf mice: longevity-associated genes and relationships with diet, gender and aging

    PubMed Central

    Swindell, William R

    2007-01-01

    Background Long-lived strains of dwarf mice carry mutations that suppress growth hormone (GH) and insulin-like growth factor I (IGF-I) signaling. The downstream effects of these endocrine abnormalities, however, are not well understood and it is unclear how these processes interact with aging mechanisms. This study presents a comparative analysis of microarray experiments that have measured hepatic gene expression levels in long-lived strains carrying one of four mutations (Prop1df/df, Pit1dw/dw, Ghrhrlit/lit, GHR-KO) and describes how the effects of these mutations relate to one another at the transcriptional level. Points of overlap with the effects of calorie restriction (CR), CR mimetic compounds, low fat diets, gender dimorphism and aging were also examined. Results All dwarf mutations had larger and more consistent effects on IGF-I expression than dietary treatments. In comparison to dwarf mutations, however, the transcriptional effects of CR (and some CR mimetics) overlapped more strongly with those of aging. Surprisingly, the Ghrhrlit/lit mutation had much larger effects on gene expression than the GHR-KO mutation, even though both mutations affect the same endocrine pathway. Several genes potentially regulated or co-regulated with the IGF-I transcript in liver tissue were identified, including a DNA repair gene (Snm1) that is upregulated in proportion to IGF-I inhibition. A total of 13 genes exhibiting parallel differential expression patterns among all four strains of long-lived dwarf mice were identified, in addition to 30 genes with matching differential expression patterns in multiple long-lived dwarf strains and under CR. Conclusion Comparative analysis of microarray datasets can identify patterns and consistencies not discernable from any one dataset individually. This study implements new analytical approaches to provide a detailed comparison among the effects of life-extending mutations, dietary treatments, gender and aging. This comparison provides insight into a broad range of issues relevant to the study of mammalian aging. In this context, 43 longevity-associated genes are identified and individual genes with the highest level of support among all microarray experiments are highlighted. These results provide promising targets for future experimental investigation as well as potential clues for understanding the functional basis of lifespan extension in mammalian systems. PMID:17915019

  3. Expression profiling of genes modulated by minocycline in a rat model of neuropathic pain

    PubMed Central

    2014-01-01

    Background The molecular mechanisms underlying neuropathic pain are constantly being studied to create new opportunities to prevent or alleviate neuropathic pain. The aim of our study was to determine the gene expression changes induced by sciatic nerve chronic constriction injury (CCI) that are modulated by minocycline, which can effectively diminish neuropathic pain in animal studies. The genes associated with minocycline efficacy in neuropathic pain should provide insight into the etiology of neuropathic pain and identify novel therapeutic targets. Results We screened the ipsilateral dorsal part of the lumbar spinal cord of the rat CCI model for differentially expressed genes. Out of 22,500 studied transcripts, the abundance levels of 93 transcripts were altered following sciatic nerve ligation. Percentage analysis revealed that 54 transcripts were not affected by the repeated administration of minocycline (30 mg/kg, i.p.), but the levels of 39 transcripts were modulated following minocycline treatment. We then selected two gene expression patterns, B1 and B2. The first transcription pattern, B1, consisted of 10 mRNA transcripts that increased in abundance after injury, and minocycline treatment reversed or inhibited the effect of the injury; the B2 transcription pattern consisted of 7 mRNA transcripts whose abundance decreased following sciatic nerve ligation, and minocycline treatment reversed the effect of the injury. Based on the literature, we selected seven genes for further analysis: Cd40, Clec7a, Apobec3b, Slc7a7, and Fam22f from pattern B1 and Rwdd3 and Gimap5 from pattern B2. Additionally, these genes were analyzed using quantitative PCR to determine the transcriptional changes strongly related to the development of neuropathic pain; the ipsilateral DRGs (L4-L6) were also collected and analyzed in these rats using qPCR. Conclusion In this work, we confirmed gene expression alterations previously identified by microarray analysis in the spinal cord and analyzed the expression of selected genes in the DRG. Moreover, we reviewed the literature to illustrate the relevance of these findings for neuropathic pain development and therapy. Further studies are needed to elucidate the roles of the individual genes in neuropathic pain and to determine the therapeutic role of minocycline in the rat neuropathic pain model. PMID:25038616

  4. Gene expression profiles reveal key genes for early diagnosis and treatment of adamantinomatous craniopharyngioma.

    PubMed

    Yang, Jun; Hou, Ziming; Wang, Changjiang; Wang, Hao; Zhang, Hongbing

    2018-04-23

    Adamantinomatous craniopharyngioma (ACP) is an aggressive brain tumor that occurs predominantly in the pediatric population. Conventional diagnosis method and standard therapy cannot treat ACPs effectively. In this paper, we aimed to identify key genes for ACP early diagnosis and treatment. Datasets GSE94349 and GSE68015 were obtained from Gene Expression Omnibus database. Consensus clustering was applied to discover the gene clusters in the expression data of GSE94349 and functional enrichment analysis was performed on gene set in each cluster. The protein-protein interaction (PPI) network was built by the Search Tool for the Retrieval of Interacting Genes, and hubs were selected. Support vector machine (SVM) model was built based on the signature genes identified from enrichment analysis and PPI network. Dataset GSE94349 was used for training and testing, and GSE68015 was used for validation. Besides, RT-qPCR analysis was performed to analyze the expression of signature genes in ACP samples compared with normal controls. Seven gene clusters were discovered in the differentially expressed genes identified from GSE94349 dataset. Enrichment analysis of each cluster identified 25 pathways that highly associated with ACP. PPI network was built and 46 hubs were determined. Twenty-five pathway-related genes that overlapped with the hubs in PPI network were used as signatures to establish the SVM diagnosis model for ACP. The prediction accuracy of SVM model for training, testing, and validation data were 94, 85, and 74%, respectively. The expression of CDH1, CCL2, ITGA2, COL8A1, COL6A2, and COL6A3 were significantly upregulated in ACP tumor samples, while CAMK2A, RIMS1, NEFL, SYT1, and STX1A were significantly downregulated, which were consistent with the differentially expressed gene analysis. SVM model is a promising classification tool for screening and early diagnosis of ACP. The ACP-related pathways and signature genes will advance our knowledge of ACP pathogenesis and benefit the therapy improvement.

  5. An integrated -omics analysis of the epigenetic landscape of gene expression in human blood cells.

    PubMed

    Kennedy, Elizabeth M; Goehring, George N; Nichols, Michael H; Robins, Chloe; Mehta, Divya; Klengel, Torsten; Eskin, Eleazar; Smith, Alicia K; Conneely, Karen N

    2018-06-19

    Gene expression can be influenced by DNA methylation 1) distally, at regulatory elements such as enhancers, as well as 2) proximally, at promoters. Our current understanding of the influence of distal DNA methylation changes on gene expression patterns is incomplete. Here, we characterize genome-wide methylation and expression patterns for ~ 13 k genes to explore how DNA methylation interacts with gene expression, throughout the genome. We used a linear mixed model framework to assess the correlation of DNA methylation at ~ 400 k CpGs with gene expression changes at ~ 13 k transcripts in two independent datasets from human blood cells. Among CpGs at which methylation significantly associates with transcription (eCpGs), > 50% are distal (> 50 kb) or trans (different chromosome) to the correlated gene. Many eCpG-transcript pairs are consistent between studies and ~ 90% of neighboring eCpGs associate with the same gene, within studies. We find that enhancers (P < 5e-18) and microRNA genes (P = 9e-3) are overrepresented among trans eCpGs, and insulators and long intergenic non-coding RNAs are enriched among cis and distal eCpGs. Intragenic-eCpG-transcript correlations are negative in 60-70% of occurrences and are enriched for annotated gene promoters and enhancers (P < 0.002), highlighting the importance of intragenic regulation. Gene Ontology analysis indicates that trans eCpGs are enriched for transcription factor genes and chromatin modifiers, suggesting that some trans eCpGs represent the influence of gene networks and higher-order transcriptional control. This work sheds new light on the interplay between epigenetic changes and gene expression, and provides useful data for mining biologically-relevant results from epigenome-wide association studies.

  6. A LEAFY co-regulator encoded by UNUSUAL FLORAL ORGANS.

    PubMed

    Lee, I; Wolfe, D S; Nilsson, O; Weigel, D

    1997-02-01

    . Development of petals and stamens in Arabidopsis flowers requires the function of the organ-identity gene APETALA3 (AP3), whose RNA is expressed specifically in petal and stamen primordia. AP3 expression is positively regulated by the meristem-identity gene LEAFY (LFY), which is expressed ubiquitously in young flowers. It is unknown how the transition from ubiquitous expression of LFY to region-specific expression of AP3 is made. It has previously been proposed for Antirrhinum that another gene, FIMBRIATA (FIM), mediates between the LFY and AP3 orthologs, with the three genes acting in a simple regulatory hierarchy. FIM is activated later than the LFY ortholog, and its expression is more restricted than that of the LFY ortholog. . We have tested whether the model proposed for Antirrhinum applies to Arabidopsis, by creating transgenic plants in which the FIM ortholog UNUSUAL FLORAL ORGANS (UFO) was expressed constitutively from the promoter of the cauliflower mosaic virus 35S gene. In 35S::UFO flowers, AP3 was expressed precociously and ectopically, confirming that UFO is an upstream regulator of AP3. However, 35S::UFO could not restore petal and stamen development in lfy mutants, indicating that UFO can only function in the presence of LFY activity. The failure of 35S::UFO to rescue lfy mutants is consistent with our observation that UFO expression levels are not markedly changed in lfy mutants. . We conclude that UFO is not a simple mediator between meristem- and organ-identity genes, but is likely to be a partially dispensable co-regulator that acts together with LFY. The interplay between LFY and UFO provides a paradigm for how a global regulator such as LFY activates selected target genes only in restricted regions within its expression domain.

  7. MicroRNAs hsa-miR-99b, hsa-miR-330, hsa-miR-126 and hsa-miR-30c: Potential Diagnostic Biomarkers in Natural Killer (NK) Cells of Patients with Chronic Fatigue Syndrome (CFS)/ Myalgic Encephalomyelitis (ME).

    PubMed

    Petty, Robert D; McCarthy, Neil E; Le Dieu, Rifca; Kerr, Jonathan R

    2016-01-01

    Chronic Fatigue Syndrome (CFS/ME) is a complex multisystem disease of unknown aetiology which causes debilitating symptoms in up to 1% of the global population. Although a large cohort of genes have been shown to exhibit altered expression in CFS/ME patients, it is currently unknown whether microRNA (miRNA) molecules which regulate gene translation contribute to disease pathogenesis. We hypothesized that changes in microRNA expression in patient leukocytes contribute to CFS/ME pathology, and may therefore represent useful diagnostic biomarkers that can be detected in the peripheral blood of CFS/ME patients. miRNA expression in peripheral blood mononuclear cells (PBMC) from CFS/ME patients and healthy controls was analysed using the Ambion Bioarray V1. miRNA demonstrating differential expression were validated by qRT-PCR and then replicated in fractionated blood leukocyte subsets from an independent patient cohort. The CFS/ME associated miRNA identified by these experiments were then transfected into primary NK cells and gene expression analyses conducted to identify their gene targets. Microarray analysis identified differential expression of 34 miRNA, all of which were up-regulated. Four of the 34 miRNA had confirmed expression changes by qRT-PCR. Fractionating PBMC samples by cell type from an independent patient cohort identified changes in miRNA expression in NK-cells, B-cells and monocytes with the most significant abnormalities occurring in NK cells. Transfecting primary NK cells with hsa-miR-99b or hsa-miR-330-3p, resulted in gene expression changes consistent with NK cell activation but diminished cytotoxicity, suggesting that defective NK cell function contributes to CFS/ME pathology. This study demonstrates altered microRNA expression in the peripheral blood mononuclear cells of CFS/ME patients, which are potential diagnostic biomarkers. The greatest degree of miRNA deregulation was identified in NK cells with targets consistent with cellular activation and altered effector function.

  8. MicroRNAs hsa-miR-99b, hsa-miR-330, hsa-miR-126 and hsa-miR-30c: Potential Diagnostic Biomarkers in Natural Killer (NK) Cells of Patients with Chronic Fatigue Syndrome (CFS)/ Myalgic Encephalomyelitis (ME)

    PubMed Central

    Petty, Robert D.; McCarthy, Neil E.; Le Dieu, Rifca; Kerr, Jonathan R.

    2016-01-01

    Background Chronic Fatigue Syndrome (CFS/ME) is a complex multisystem disease of unknown aetiology which causes debilitating symptoms in up to 1% of the global population. Although a large cohort of genes have been shown to exhibit altered expression in CFS/ME patients, it is currently unknown whether microRNA (miRNA) molecules which regulate gene translation contribute to disease pathogenesis. We hypothesized that changes in microRNA expression in patient leukocytes contribute to CFS/ME pathology, and may therefore represent useful diagnostic biomarkers that can be detected in the peripheral blood of CFS/ME patients. Methods miRNA expression in peripheral blood mononuclear cells (PBMC) from CFS/ME patients and healthy controls was analysed using the Ambion Bioarray V1. miRNA demonstrating differential expression were validated by qRT-PCR and then replicated in fractionated blood leukocyte subsets from an independent patient cohort. The CFS/ME associated miRNA identified by these experiments were then transfected into primary NK cells and gene expression analyses conducted to identify their gene targets. Results Microarray analysis identified differential expression of 34 miRNA, all of which were up-regulated. Four of the 34 miRNA had confirmed expression changes by qRT-PCR. Fractionating PBMC samples by cell type from an independent patient cohort identified changes in miRNA expression in NK-cells, B-cells and monocytes with the most significant abnormalities occurring in NK cells. Transfecting primary NK cells with hsa-miR-99b or hsa-miR-330-3p, resulted in gene expression changes consistent with NK cell activation but diminished cytotoxicity, suggesting that defective NK cell function contributes to CFS/ME pathology. Conclusion This study demonstrates altered microRNA expression in the peripheral blood mononuclear cells of CFS/ME patients, which are potential diagnostic biomarkers. The greatest degree of miRNA deregulation was identified in NK cells with targets consistent with cellular activation and altered effector function. PMID:26967895

  9. Co-expression analysis identifies CRC and AP1 the regulator of Arabidopsis fatty acid biosynthesis.

    PubMed

    Han, Xinxin; Yin, Linlin; Xue, Hongwei

    2012-07-01

    Fatty acids (FAs) play crucial rules in signal transduction and plant development, however, the regulation of FA metabolism is still poorly understood. To study the relevant regulatory network, fifty-eight FA biosynthesis genes including de novo synthases, desaturases and elongases were selected as "guide genes" to construct the co-expression network. Calculation of the correlation between all Arabidopsis thaliana (L.) genes with each guide gene by Arabidopsis co-expression dating mining tools (ACT) identifies 797 candidate FA-correlated genes. Gene ontology (GO) analysis of these co-expressed genes showed they are tightly correlated to photosynthesis and carbohydrate metabolism, and function in many processes. Interestingly, 63 transcription factors (TFs) were identified as candidate FA biosynthesis regulators and 8 TF families are enriched. Two TF genes, CRC and AP1, both correlating with 8 FA guide genes, were further characterized. Analyses of the ap1 and crc mutant showed the altered total FA composition of mature seeds. The contents of palmitoleic acid, stearic acid, arachidic acid and eicosadienoic acid are decreased, whereas that of oleic acid is increased in ap1 and crc seeds, which is consistent with the qRT-PCR analysis revealing the suppressed expression of the corresponding guide genes. In addition, yeast one-hybrid analysis and electrophoretic mobility shift assay (EMSA) revealed that CRC can bind to the promoter regions of KCS7 and KCS15, indicating that CRC may directly regulate FA biosynthesis. © 2012 Institute of Botany, Chinese Academy of Sciences.

  10. Co-Option and De Novo Gene Evolution Underlie Molluscan Shell Diversity

    PubMed Central

    Aguilera, Felipe; McDougall, Carmel

    2017-01-01

    Abstract Molluscs fabricate shells of incredible diversity and complexity by localized secretions from the dorsal epithelium of the mantle. Although distantly related molluscs express remarkably different secreted gene products, it remains unclear if the evolution of shell structure and pattern is underpinned by the differential co-option of conserved genes or the integration of lineage-specific genes into the mantle regulatory program. To address this, we compare the mantle transcriptomes of 11 bivalves and gastropods of varying relatedness. We find that each species, including four Pinctada (pearl oyster) species that diverged within the last 20 Ma, expresses a unique mantle secretome. Lineage- or species-specific genes comprise a large proportion of each species’ mantle secretome. A majority of these secreted proteins have unique domain architectures that include repetitive, low complexity domains (RLCDs), which evolve rapidly, and have a proclivity to expand, contract and rearrange in the genome. There are also a large number of secretome genes expressed in the mantle that arose before the origin of gastropods and bivalves. Each species expresses a unique set of these more ancient genes consistent with their independent co-option into these mantle gene regulatory networks. From this analysis, we infer lineage-specific secretomes underlie shell diversity, and include both rapidly evolving RLCD-containing proteins, and the continual recruitment and loss of both ancient and recently evolved genes into the periphery of the regulatory network controlling gene expression in the mantle epithelium. PMID:28053006

  11. Comparative prion disease gene expression profiling using the prion disease mimetic, cuprizone

    PubMed Central

    Moody, Laura R; Herbst, Allen J; Yoo, Han Sang; Vanderloo, Joshua P

    2009-01-01

    Identification of genes expressed in response to prion infection may elucidate biomarkers for disease, identify factors involved in agent replication, mechanisms of neuropathology and therapeutic targets. Although several groups have sought to identify gene expression changes specific to prion disease, expression profiles rife with cell population changes have consistently been identified. Cuprizone, a neurotoxicant, qualitatively mimics the cell population changes observed in prion disease, resulting in both spongiform change and astrocytosis. The use of cuprizone-treated animals as an experimental control during comparative expression profiling allows for the identification of transcripts whose expression increases during prion disease and remains unchanged during cuprizone-triggered neuropathology. In this study, expression profiles from the brains of mice preclinically and clinically infected with Rocky Mountain Laboratory (RML) mouse-adapted scrapie agent and age-matched controls were profiled using Affymetrix gene arrays. In total, 164 genes were differentially regulated during prion infection. Eighty-three of these transcripts have been previously undescribed as differentially regulated during prion disease. A 0.4% cuprizone diet was utilized as a control for comparative expression profiling. Cuprizone treatment induced spongiosis and astrocyte proliferation as indicated by glial fibrillary acidic protein (Gfap) transcriptional activation and immunohistochemistry. Gene expression profiles from brain tissue obtained from cuprizone-treated mice identified 307 differentially regulated transcript changes. After comparative analysis, 17 transcripts unaffected by cuprizone treatment but increasing in expression from preclinical to clinical prion infection were identified. Here we describe the novel use of the prion disease mimetic, cuprizone, to control for cell population changes in the brain during prion infection. PMID:19535908

  12. Expression of fox-related genes in the skin follicles of Inner Mongolia cashmere goat.

    PubMed

    Han, Wenjing; Li, Xiaoyan; Wang, Lele; Wang, Honghao; Yang, Kun; Wang, Zhixin; Wang, Ruijun; Su, Rui; Liu, Zhihong; Zhao, Yanhong; Zhang, Yanjun; Li, Jinquan

    2018-03-01

    This study investigated the expression of genes in cashmere goats at different periods of their fetal development. Bioinformatics analysis was used to evaluate data obtained by transcriptome sequencing of fetus skin samples collected from Inner Mongolia cashmere goats on days 45, 55, and 65 of fetal age. We found that FoxN1 , FoxE1 , and FoxI3 genes of the Fox gene family were probably involved in the growth and development of the follicle and the formation of hair, which is consistent with previous findings. Real-time quantitative polymerase chain reaction detecting system and Western blot analysis were employed to study the relative differentially expressed genes FoxN1 , FoxE1 , and FoxI3 in the body skin of cashmere goat fetuses and adult individuals. This study provided new fundamental information for further investigation of the genes related to follicle development and exploration of their roles in hair follicle initiation, growth, and development.

  13. Genome-wide RNAi screening identifies protein damage as a regulator of osmoprotective gene expression.

    PubMed

    Lamitina, Todd; Huang, Chunyi George; Strange, Kevin

    2006-08-08

    The detection, stabilization, and repair of stress-induced damage are essential requirements for cellular life. All cells respond to osmotic stress-induced water loss with increased expression of genes that mediate accumulation of organic osmolytes, solutes that function as chemical chaperones and restore osmotic homeostasis. The signals and signaling mechanisms that regulate osmoprotective gene expression in animal cells are poorly understood. Here, we show that gpdh-1 and gpdh-2, genes that mediate the accumulation of the organic osmolyte glycerol, are essential for survival of the nematode Caenorhabditis elegans during osmotic stress. Expression of GFP driven by the gpdh-1 promoter (P(gpdh-1)::GFP) is detected only during hypertonic stress but is not induced by other stressors. Using P(gpdh-1)::GFP expression as a phenotype, we screened approximately 16,000 genes by RNAi feeding and identified 122 that cause constitutive activation of gpdh-1 expression and glycerol accumulation. Many of these genes function to regulate protein translation and cotranslational protein folding and to target and degrade denatured proteins, suggesting that the accumulation of misfolded proteins functions as a signal to activate osmoprotective gene expression and organic osmolyte accumulation in animal cells. Consistent with this hypothesis, 73% of these protein-homeostasis genes have been shown to slow age-dependent protein aggregation in C. elegans. Because diverse environmental stressors and numerous disease states result in protein misfolding, mechanisms must exist that discriminate between osmotically induced and other forms of stress-induced protein damage. Our findings provide a foundation for understanding how these damage-selectivity mechanisms function.

  14. Genome-wide RNAi screening identifies protein damage as a regulator of osmoprotective gene expression

    PubMed Central

    Lamitina, Todd; Huang, Chunyi George; Strange, Kevin

    2006-01-01

    The detection, stabilization, and repair of stress-induced damage are essential requirements for cellular life. All cells respond to osmotic stress-induced water loss with increased expression of genes that mediate accumulation of organic osmolytes, solutes that function as chemical chaperones and restore osmotic homeostasis. The signals and signaling mechanisms that regulate osmoprotective gene expression in animal cells are poorly understood. Here, we show that gpdh-1 and gpdh-2, genes that mediate the accumulation of the organic osmolyte glycerol, are essential for survival of the nematode Caenorhabditis elegans during osmotic stress. Expression of GFP driven by the gpdh-1 promoter (Pgpdh-1::GFP) is detected only during hypertonic stress but is not induced by other stressors. Using Pgpdh-1::GFP expression as a phenotype, we screened ≈16,000 genes by RNAi feeding and identified 122 that cause constitutive activation of gpdh-1 expression and glycerol accumulation. Many of these genes function to regulate protein translation and cotranslational protein folding and to target and degrade denatured proteins, suggesting that the accumulation of misfolded proteins functions as a signal to activate osmoprotective gene expression and organic osmolyte accumulation in animal cells. Consistent with this hypothesis, 73% of these protein-homeostasis genes have been shown to slow age-dependent protein aggregation in C. elegans. Because diverse environmental stressors and numerous disease states result in protein misfolding, mechanisms must exist that discriminate between osmotically induced and other forms of stress-induced protein damage. Our findings provide a foundation for understanding how these damage-selectivity mechanisms function. PMID:16880390

  15. Differential reconstructed gene interaction networks for deriving toxicity threshold in chemical risk assessment.

    PubMed

    Yang, Yi; Maxwell, Andrew; Zhang, Xiaowei; Wang, Nan; Perkins, Edward J; Zhang, Chaoyang; Gong, Ping

    2013-01-01

    Pathway alterations reflected as changes in gene expression regulation and gene interaction can result from cellular exposure to toxicants. Such information is often used to elucidate toxicological modes of action. From a risk assessment perspective, alterations in biological pathways are a rich resource for setting toxicant thresholds, which may be more sensitive and mechanism-informed than traditional toxicity endpoints. Here we developed a novel differential networks (DNs) approach to connect pathway perturbation with toxicity threshold setting. Our DNs approach consists of 6 steps: time-series gene expression data collection, identification of altered genes, gene interaction network reconstruction, differential edge inference, mapping of genes with differential edges to pathways, and establishment of causal relationships between chemical concentration and perturbed pathways. A one-sample Gaussian process model and a linear regression model were used to identify genes that exhibited significant profile changes across an entire time course and between treatments, respectively. Interaction networks of differentially expressed (DE) genes were reconstructed for different treatments using a state space model and then compared to infer differential edges/interactions. DE genes possessing differential edges were mapped to biological pathways in databases such as KEGG pathways. Using the DNs approach, we analyzed a time-series Escherichia coli live cell gene expression dataset consisting of 4 treatments (control, 10, 100, 1000 mg/L naphthenic acids, NAs) and 18 time points. Through comparison of reconstructed networks and construction of differential networks, 80 genes were identified as DE genes with a significant number of differential edges, and 22 KEGG pathways were altered in a concentration-dependent manner. Some of these pathways were perturbed to a degree as high as 70% even at the lowest exposure concentration, implying a high sensitivity of our DNs approach. Findings from this proof-of-concept study suggest that our approach has a great potential in providing a novel and sensitive tool for threshold setting in chemical risk assessment. In future work, we plan to analyze more time-series datasets with a full spectrum of concentrations and sufficient replications per treatment. The pathway alteration-derived thresholds will also be compared with those derived from apical endpoints such as cell growth rate.

  16. Identification of differentially expressed genes in childhood asthma.

    PubMed

    Zhang, Nian-Zhen; Chen, Xiu-Juan; Mu, Yu-Hua; Wang, Hewen

    2018-05-01

    Asthma has been the most common chronic disease in children that places a major burden for affected people and their families.An integrated analysis of microarrays studies was performed to identify differentially expressed genes (DEGs) in childhood asthma compared with normal control. We also obtained the differentially methylated genes (DMGs) in childhood asthma according to GEO. The genes that were both differentially expressed and differentially methylated were identified. Functional annotation and protein-protein interaction network construction were performed to interpret biological functions of DEGs. We performed q-RT-PCR to verify the expression of selected DEGs.One DNA methylation and 3 gene expression datasets were obtained. Four hundred forty-one DEGs and 1209 DMGs in childhood asthma were identified. Among which, 16 genes were both differentially expressed and differentially methylated in childhood asthma. Natural killer cell mediated cytotoxicity pathway, Jak-STAT signaling pathway, and Wnt signaling pathway were 3 significantly enriched pathways in childhood asthma according to our KEGG enrichment analysis. The PPI network of top 20 up- and downregulated DEGs consisted of 822 nodes and 904 edges and 2 hub proteins (UBQLN4 and MID2) were identified. The expression of 8 DEGs (GZMB, FGFBP2, CLC, TBX21, ALOX15, IL12RB2, UBQLN4) was verified by qRT-PCR and only the expression of GZMB and FGFBP2 was inconsistent with our integrated analysis.Our finding was helpful to elucidate the underlying mechanism of childhood asthma and develop new potential diagnostic biomarker and provide clues for drug design.

  17. Fungal Gene Expression on Demand: an Inducible, Tunable, and Metabolism-Independent Expression System for Aspergillus niger▿†

    PubMed Central

    Meyer, Vera; Wanka, Franziska; van Gent, Janneke; Arentshorst, Mark; van den Hondel, Cees A. M. J. J.; Ram, Arthur F. J.

    2011-01-01

    Filamentous fungi are the cause of serious human and plant diseases but are also exploited in biotechnology as production platforms. Comparative genomics has documented their genetic diversity, and functional genomics and systems biology approaches are under way to understand the functions and interaction of fungal genes and proteins. In these approaches, gene functions are usually inferred from deletion or overexpression mutants. However, studies at these extreme points give only limited information. Moreover, many overexpression studies use metabolism-dependent promoters, often causing pleiotropic effects and thus limitations in their significance. We therefore established and systematically evaluated a tunable expression system for Aspergillus niger that is independent of carbon and nitrogen metabolism and silent under noninduced conditions. The system consists of two expression modules jointly targeted to a defined genomic locus. One module ensures constitutive expression of the tetracycline-dependent transactivator rtTA2S-M2, and one module harbors the rtTA2S-M2-dependent promoter that controls expression of the gene of interest (the Tet-on system). We show here that the system is tight, responds within minutes after inducer addition, and allows fine-tuning based on the inducer concentration or gene copy number up to expression levels higher than the expression levels of the gpdA promoter. We also validate the Tet-on system for the generation of conditional overexpression mutants and demonstrate its power when combined with a gene deletion approach. Finally, we show that the system is especially suitable when the functions of essential genes must be examined. PMID:21378046

  18. Unique gene expression profiles of donor-matched human retinal and choroidal vascular endothelial cells.

    PubMed

    Smith, Justine R; Choi, Dongseok; Chipps, Timothy J; Pan, Yuzhen; Zamora, David O; Davies, Michael H; Babra, Bobby; Powers, Michael R; Planck, Stephen R; Rosenbaum, James T

    2007-06-01

    Consistent with clinical observations that posterior uveitis frequently involves the retinal vasculature and recent recognition of vascular heterogeneity, the hypothesis for this study was that retinal vascular endothelium was a cell population of unique molecular phenotype. Donor-matched cultures of primary retinal and choroidal endothelial cells from six human cadavers were incubated with either Toxoplasma gondii tachyzoites (10:1, parasites per cell) or Escherichia coli lipopolysaccharide (100 ng/mL); control cultures were simultaneously incubated with medium. Gene expression profiling of endothelial cells was performed using oligonucleotide arrays containing probes designed to detect 8746 human transcripts. After normalization, differential gene expression was assessed by the significance analysis of microarrays, with the false-discovery rate set at 5%. For selected genes, differences in the level of expression between retinal and choroidal cells were evaluated by real-time RT-PCR. Graphic descriptive analysis demonstrated a strong correlation between gene expression of unstimulated retinal and choroidal endothelial cells, but also highlighted distinctly different patterns of expression that were greater than differences noted between donors or between unstimulated and stimulated cells. Overall, 779 (8.9%) of 8746 transcripts were differentially represented. Of note, the 330 transcripts that were present at higher levels in retinal cells included a larger percentage of transcripts encoding molecules involved in the immune response. Differential gene expression was confirmed for 12 transcripts by RT-PCR. Retinal and choroidal vascular endothelial cells display distinctive gene expression profiles. The findings suggest the possibility of treating posterior uveitis by targeting specific interactions between the retinal endothelial cell and an infiltrating leukocyte.

  19. Lineage-specific evolution of cnidarian Wnt ligands.

    PubMed

    Hensel, Katrin; Lotan, Tamar; Sanders, Steve M; Cartwright, Paulyn; Frank, Uri

    2014-09-01

    We have studied the evolution of Wnt genes in cnidarians and the expression pattern of all Wnt ligands in the hydrozoan Hydractinia echinata. Current views favor a scenario in which 12 Wnt sub-families were jointly inherited by cnidarians and bilaterians from their last common ancestor. Our phylogenetic analyses clustered all medusozoan genes in distinct, well-supported clades, but many orthologous relationships between medusozoan Wnts and anthozoan and bilaterian Wnt genes were poorly supported. Only seven anthozoan genes, Wnt2, Wnt4, Wnt5, Wnt6, Wnt 10, Wnt11, and Wnt16 were recovered with strong support with bilaterian genes and of those, only the Wnt2, Wnt5, Wnt11, and Wnt16 clades also included medusozoan genes. Although medusozoan Wnt8 genes clustered with anthozoan and bilaterian genes, this was not well supported. In situ hybridization studies revealed poor conservation of expression patterns of putative Wnt orthologs within Cnidaria. In polyps, only Wnt1, Wnt3, and Wnt7 were expressed at the same position in the studied cnidarian models Hydra, Hydractinia, and Nematostella. Different expression patterns are consistent with divergent functions. Our data do not fully support previous assertions regarding Wnt gene homology, and suggest a more complex history of Wnt family genes than previously suggested. This includes high rates of sequence divergence and lineage-specific duplications of Wnt genes within medusozoans, followed by functional divergence over evolutionary time scales. © 2014 Wiley Periodicals, Inc.

  20. Aspen phenylpropanoid genes' expression levels correlate with genets' tannin richness and vary both in responses to soil nitrogen and associations with phenolic profiles.

    PubMed

    Decker, Vicki H G; Bandau, Franziska; Gundale, Michael J; Cole, Christopher T; Albrectsen, Benedicte R

    2017-02-01

    Condensed tannin (CT) contents of European aspen (Populus tremula L.) vary among genotypes, and increases in nitrogen (N) availability generally reduce plants' tannin production in favor of growth, through poorly understood mechanisms. We hypothesized that intrinsic tannin production rates may co-vary with gene expression responses to soil N and resource allocation within the phenylpropanoid pathway (PPP). Thus, we examined correlations between soil N levels and both expression patterns of eight PPP genes (measured by quantitative-reverse transcription PCR) and foliar phenolic compounds (measured by liquid chromatography-mass spectrometry) in young aspen genets with intrinsically extreme CT levels. Monitored phenolics included salicinoids, lignins, flavones, flavonols, CT precursors and CTs. The PPP genes were consistently expressed more strongly in high-CT trees. Low N supplements reduced expression of genes throughout the PPP in all genets, while high N doses restored expression of genes at the beginning and end of the pathway. These PPP changes were not reflected in pools of tannin precursors, but varying correlations between gene expression and foliar phenolic pools were detected in young and mature leaves, suggesting that processes linking gene expression and the resulting phenolics vary spatially and temporally. Precursor fluxes suggested that CT-related metabolic rate or sink controls are linked to intrinsic carbon allocation strategies associated with N responses. Overall, we found more negative correlations (indicative of allocation trade-offs) between PPP gene expression and phenolic products following N additions in low-CT plants than in high-CT plants. The tannin-related expression dynamics suggest that, in addition to defense, relative tannin levels may also be indicative of intraspecific variations in the way aspen genets respond to soil fertility. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  1. Differential Responses to Wnt and PCP Disruption Predict Expression and Developmental Function of Conserved and Novel Genes in a Cnidarian

    PubMed Central

    Lapébie, Pascal; Ruggiero, Antonella; Barreau, Carine; Chevalier, Sandra; Chang, Patrick; Dru, Philippe; Houliston, Evelyn; Momose, Tsuyoshi

    2014-01-01

    We have used Digital Gene Expression analysis to identify, without bilaterian bias, regulators of cnidarian embryonic patterning. Transcriptome comparison between un-manipulated Clytia early gastrula embryos and ones in which the key polarity regulator Wnt3 was inhibited using morpholino antisense oligonucleotides (Wnt3-MO) identified a set of significantly over and under-expressed transcripts. These code for candidate Wnt signaling modulators, orthologs of other transcription factors, secreted and transmembrane proteins known as developmental regulators in bilaterian models or previously uncharacterized, and also many cnidarian-restricted proteins. Comparisons between embryos injected with morpholinos targeting Wnt3 and its receptor Fz1 defined four transcript classes showing remarkable correlation with spatiotemporal expression profiles. Class 1 and 3 transcripts tended to show sustained expression at “oral” and “aboral” poles respectively of the developing planula larva, class 2 transcripts in cells ingressing into the endodermal region during gastrulation, while class 4 gene expression was repressed at the early gastrula stage. The preferential effect of Fz1-MO on expression of class 2 and 4 transcripts can be attributed to Planar Cell Polarity (PCP) disruption, since it was closely matched by morpholino knockdown of the specific PCP protein Strabismus. We conclude that endoderm and post gastrula-specific gene expression is particularly sensitive to PCP disruption while Wnt-/β-catenin signaling dominates gene regulation along the oral-aboral axis. Phenotype analysis using morpholinos targeting a subset of transcripts indicated developmental roles consistent with expression profiles for both conserved and cnidarian-restricted genes. Overall our unbiased screen allowed systematic identification of regionally expressed genes and provided functional support for a shared eumetazoan developmental regulatory gene set with both predicted and previously unexplored members, but also demonstrated that fundamental developmental processes including axial patterning and endoderm formation in cnidarians can involve newly evolved (or highly diverged) genes. PMID:25233086

  2. Differential responses to Wnt and PCP disruption predict expression and developmental function of conserved and novel genes in a cnidarian.

    PubMed

    Lapébie, Pascal; Ruggiero, Antonella; Barreau, Carine; Chevalier, Sandra; Chang, Patrick; Dru, Philippe; Houliston, Evelyn; Momose, Tsuyoshi

    2014-09-01

    We have used Digital Gene Expression analysis to identify, without bilaterian bias, regulators of cnidarian embryonic patterning. Transcriptome comparison between un-manipulated Clytia early gastrula embryos and ones in which the key polarity regulator Wnt3 was inhibited using morpholino antisense oligonucleotides (Wnt3-MO) identified a set of significantly over and under-expressed transcripts. These code for candidate Wnt signaling modulators, orthologs of other transcription factors, secreted and transmembrane proteins known as developmental regulators in bilaterian models or previously uncharacterized, and also many cnidarian-restricted proteins. Comparisons between embryos injected with morpholinos targeting Wnt3 and its receptor Fz1 defined four transcript classes showing remarkable correlation with spatiotemporal expression profiles. Class 1 and 3 transcripts tended to show sustained expression at "oral" and "aboral" poles respectively of the developing planula larva, class 2 transcripts in cells ingressing into the endodermal region during gastrulation, while class 4 gene expression was repressed at the early gastrula stage. The preferential effect of Fz1-MO on expression of class 2 and 4 transcripts can be attributed to Planar Cell Polarity (PCP) disruption, since it was closely matched by morpholino knockdown of the specific PCP protein Strabismus. We conclude that endoderm and post gastrula-specific gene expression is particularly sensitive to PCP disruption while Wnt-/β-catenin signaling dominates gene regulation along the oral-aboral axis. Phenotype analysis using morpholinos targeting a subset of transcripts indicated developmental roles consistent with expression profiles for both conserved and cnidarian-restricted genes. Overall our unbiased screen allowed systematic identification of regionally expressed genes and provided functional support for a shared eumetazoan developmental regulatory gene set with both predicted and previously unexplored members, but also demonstrated that fundamental developmental processes including axial patterning and endoderm formation in cnidarians can involve newly evolved (or highly diverged) genes.

  3. P-TEFb, the Super Elongation Complex and Mediator Regulate a Subset of Non-paused Genes during Early Drosophila Embryo Development

    PubMed Central

    Dahlberg, Olle; Shilkova, Olga; Tang, Min; Holmqvist, Per-Henrik; Mannervik, Mattias

    2015-01-01

    Positive Transcription Elongation Factor b (P-TEFb) is a kinase consisting of Cdk9 and Cyclin T that releases RNA Polymerase II (Pol II) into active elongation. It can assemble into a larger Super Elongation Complex (SEC) consisting of additional elongation factors. Here, we use a miRNA-based approach to knock down the maternal contribution of P-TEFb and SEC components in early Drosophila embryos. P-TEFb or SEC depletion results in loss of cells from the embryo posterior and in cellularization defects. Interestingly, the expression of many patterning genes containing promoter-proximal paused Pol II is relatively normal in P-TEFb embryos. Instead, P-TEFb and SEC are required for expression of some non-paused, rapidly transcribed genes in pre-cellular embryos, including the cellularization gene Serendipity-α. We also demonstrate that another P-TEFb regulated gene, terminus, has an essential function in embryo development. Similar morphological and gene expression phenotypes were observed upon knock down of Mediator subunits, providing in vivo evidence that P-TEFb, the SEC and Mediator collaborate in transcription control. Surprisingly, P-TEFb depletion does not affect the ratio of Pol II at the promoter versus the 3’ end, despite affecting global Pol II Ser2 phosphorylation levels. Instead, Pol II occupancy is reduced at P-TEFb down-regulated genes. We conclude that a subset of non-paused, pre-cellular genes are among the most susceptible to reduced P-TEFb, SEC and Mediator levels in Drosophila embryos. PMID:25679530

  4. A gene expression biomarker accurately predicts estrogen ...

    EPA Pesticide Factsheets

    The EPA’s vision for the Endocrine Disruptor Screening Program (EDSP) in the 21st Century (EDSP21) includes utilization of high-throughput screening (HTS) assays coupled with computational modeling to prioritize chemicals with the goal of eventually replacing current Tier 1 screening tests. The ToxCast program currently includes 18 HTS in vitro assays that evaluate the ability of chemicals to modulate estrogen receptor α (ERα), an important endocrine target. We propose microarray-based gene expression profiling as a complementary approach to predict ERα modulation and have developed computational methods to identify ERα modulators in an existing database of whole-genome microarray data. The ERα biomarker consisted of 46 ERα-regulated genes with consistent expression patterns across 7 known ER agonists and 3 known ER antagonists. The biomarker was evaluated as a predictive tool using the fold-change rank-based Running Fisher algorithm by comparison to annotated gene expression data sets from experiments in MCF-7 cells. Using 141 comparisons from chemical- and hormone-treated cells, the biomarker gave a balanced accuracy for prediction of ERα activation or suppression of 94% or 93%, respectively. The biomarker was able to correctly classify 18 out of 21 (86%) OECD ER reference chemicals including “very weak” agonists and replicated predictions based on 18 in vitro ER-associated HTS assays. For 114 chemicals present in both the HTS data and the MCF-7 c

  5. Expression of the Fanconi anemia group A gene (Fanca) during mouse embryogenesis.

    PubMed

    Abu-Issa, R; Eichele, G; Youssoufian, H

    1999-07-15

    About 80% of all cases of Fanconi anemia (FA) can be accounted for by complementation groups A and C. To understand the relationship between these groups, we analyzed the expression pattern of the mouse FA group-A gene (Fanca) during embryogenesis and compared it with the known pattern of the group-C gene (Fancc). Northern analysis of RNA from mouse embryos at embryonic days 7, 11, 15, and 17 showed a predominant 4.5 kb band in all stages. By in situ hybridization, Fanca transcripts were found in the whisker follicles, teeth, brain, retina, kidney, liver, and limbs. There was also stage-specific variation in Fanca expression, particularly within the developing whiskers and the brain. Some tissues known to express Fancc (eg, gut) failed to show Fanca expression. These observations show that (1) Fanca is under both tissue- and stage-specific regulation in several tissues; (2) the expression pattern of Fanca is consistent with the phenotype of the human disease; and (3) Fanca expression is not necessarily coupled to that of Fancc. The presence of distinct tissue targets for FA genes suggests that some of the variability in the clinical phenotype can be attributed to the complementation group assignment.

  6. Influence of socioeconomic status on the whole blood transcriptome in African Americans.

    PubMed

    Gaye, Amadou; Gibbons, Gary H; Barry, Charles; Quarells, Rakale; Davis, Sharon K

    2017-01-01

    The correlation between low socioeconomic status (SES) and poor health outcome or higher risk of disease has been consistently reported by many epidemiological studies across various race/ancestry groups. However, the biological mechanisms linking low SES to disease and/or disease risk factors are not well understood and remain relatively under-studied. The analysis of the blood transcriptome is a promising window for elucidating how social and environmental factors influence the molecular networks governing health and disease. To further define the mechanistic pathways between social determinants and health, this study examined the impact of SES on the blood transcriptome in a sample of African-Americans. An integrative approach leveraging three complementary methods (Weighted Gene Co-expression Network Analysis, Random Forest and Differential Expression) was adopted to identify the most predictive and robust transcriptome pathways associated with SES. We analyzed the expression of 15079 genes (RNA-seq) from whole blood across 36 samples. The results revealed a cluster of 141 co-expressed genes over-expressed in the low SES group. Three pro-inflammatory pathways (IL-8 Signaling, NF-κB Signaling and Dendritic Cell Maturation) are activated in this module and over-expressed in low SES. Random Forest analysis revealed 55 of the 141 genes that, collectively, predict SES with an area under the curve of 0.85. One third of the 141 genes are significantly over-expressed in the low SES group. Lower SES has consistently been linked to many social and environmental conditions acting as stressors and known to be correlated with vulnerability to chronic illnesses (e.g. asthma, diabetes) associated with a chronic inflammatory state. Our unbiased analysis of the blood transcriptome in African-Americans revealed evidence of a robust molecular signature of increased inflammation associated with low SES. The results provide a plausible link between the social factors and chronic inflammation.

  7. Expression and RNA Interference of Salivary Polygalacturonase Genes in the Tarnished Plant Bug, Lygus lineolaris

    PubMed Central

    Walker, William B.; Allen, Margaret L.

    2010-01-01

    Three genes encoding polygalacturonase (PG) have been identified in Lygus lineolaris (Palisot de Beauvois) (Miridae: Hemiptera). Earlier studies showed that the three PG gene transcripts are exclusively expressed in the feeding stages of L. lineolaris. In this report, it is shown that all three transcripts are specifically expressed in salivary glands indicating that PGs are salivary enzymes. Transcriptional profiles of the three PGs were evaluated with respect to diet, comparing live cotton plant material to artificial diet. PG2 transcript levels were consistently lower in cotton-fed insects than those reared on artificial diet. RNA interference was used to knock down expression of PG1 mRNA in adult salivary glands providing the first demonstration of the use of this method in the non-model insect, L. lineolaris. PMID:21062205

  8. Gene expression changes in response to aging compared to heat stress, oxidative stress and ionizing radiation in Drosophila melanogaster.

    PubMed

    Landis, Gary; Shen, Jie; Tower, John

    2012-11-01

    Gene expression changes in response to aging, heat stress, hyperoxia, hydrogen peroxide, and ionizing radiation were compared using microarrays. A set of 18 genes were up-regulated across all conditions, indicating a general stress response shared with aging, including the heat shock protein (Hsp) genes Hsp70, Hsp83 and l(2)efl, the glutathione-S-transferase gene GstD2, and the mitochondrial unfolded protein response (mUPR) gene ref(2)P. Selected gene expression changes were confirmed using quantitative PCR, Northern analysis and GstD-GFP reporter constructs. Certain genes were altered in only a subset of the conditions, for example, up-regulation of numerous developmental pathway and signaling genes in response to hydrogen peroxide. While aging shared features with each stress, aging was more similar to the stresses most associated with oxidative stress (hyperoxia, hydrogen peroxide, ionizing radiation) than to heat stress. Aging is associated with down-regulation of numerous mitochondrial genes, including electron-transport-chain (ETC) genes and mitochondrial metabolism genes, and a sub-set of these changes was also observed upon hydrogen peroxide stress and ionizing radiation stress. Aging shared the largest number of gene expression changes with hyperoxia. The extensive down-regulation of mitochondrial and ETC genes during aging is consistent with an aging-associated failure in mitochondrial maintenance, which may underlie the oxidative stress-like and proteotoxic stress-like responses observed during aging.

  9. Gene expression changes in response to aging compared to heat stress, oxidative stress and ionizing radiation in Drosophila melanogaster

    PubMed Central

    Landis, Gary; Shen, Jie; Tower, John

    2012-01-01

    Gene expression changes in response to aging, heat stress, hyperoxia, hydrogen peroxide, and ionizing radiation were compared using microarrays. A set of 18 genes were up-regulated across all conditions, indicating a general stress response shared with aging, including the heat shock protein (Hsp) genes Hsp70, Hsp83 and l(2)efl, the glutathione-S-transferase gene GstD2, and the mitochondrial unfolded protein response (mUPR) gene ref(2)P. Selected gene expression changes were confirmed using quantitative PCR, Northern analysis and GstD-GFP reporter constructs. Certain genes were altered in only a subset of the conditions, for example, up-regulation of numerous developmental pathway and signaling genes in response to hydrogen peroxide. While aging shared features with each stress, aging was more similar to the stresses most associated with oxidative stress (hyperoxia, hydrogen peroxide, ionizing radiation) than to heat stress. Aging is associated with down-regulation of numerous mitochondrial genes, including electron-transport-chain (ETC) genes and mitochondrial metabolism genes, and a sub-set of these changes was also observed upon hydrogen peroxide stress and ionizing radiation stress. Aging shared the largest number of gene expression changes with hyperoxia. The extensive down-regulation of mitochondrial and ETC genes during aging is consistent with an aging-associated failure in mitochondrial maintenance, which may underlie the oxidative stress-like and proteotoxic stress-like responses observed during aging. PMID:23211361

  10. Gene Circuit Analysis of the Terminal Gap Gene huckebein

    PubMed Central

    Ashyraliyev, Maksat; Siggens, Ken; Janssens, Hilde; Blom, Joke; Akam, Michael; Jaeger, Johannes

    2009-01-01

    The early embryo of Drosophila melanogaster provides a powerful model system to study the role of genes in pattern formation. The gap gene network constitutes the first zygotic regulatory tier in the hierarchy of the segmentation genes involved in specifying the position of body segments. Here, we use an integrative, systems-level approach to investigate the regulatory effect of the terminal gap gene huckebein (hkb) on gap gene expression. We present quantitative expression data for the Hkb protein, which enable us to include hkb in gap gene circuit models. Gap gene circuits are mathematical models of gene networks used as computational tools to extract regulatory information from spatial expression data. This is achieved by fitting the model to gap gene expression patterns, in order to obtain estimates for regulatory parameters which predict a specific network topology. We show how considering variability in the data combined with analysis of parameter determinability significantly improves the biological relevance and consistency of the approach. Our models are in agreement with earlier results, which they extend in two important respects: First, we show that Hkb is involved in the regulation of the posterior hunchback (hb) domain, but does not have any other essential function. Specifically, Hkb is required for the anterior shift in the posterior border of this domain, which is now reproduced correctly in our models. Second, gap gene circuits presented here are able to reproduce mutants of terminal gap genes, while previously published models were unable to reproduce any null mutants correctly. As a consequence, our models now capture the expression dynamics of all posterior gap genes and some variational properties of the system correctly. This is an important step towards a better, quantitative understanding of the developmental and evolutionary dynamics of the gap gene network. PMID:19876378

  11. Gene circuit analysis of the terminal gap gene huckebein.

    PubMed

    Ashyraliyev, Maksat; Siggens, Ken; Janssens, Hilde; Blom, Joke; Akam, Michael; Jaeger, Johannes

    2009-10-01

    The early embryo of Drosophila melanogaster provides a powerful model system to study the role of genes in pattern formation. The gap gene network constitutes the first zygotic regulatory tier in the hierarchy of the segmentation genes involved in specifying the position of body segments. Here, we use an integrative, systems-level approach to investigate the regulatory effect of the terminal gap gene huckebein (hkb) on gap gene expression. We present quantitative expression data for the Hkb protein, which enable us to include hkb in gap gene circuit models. Gap gene circuits are mathematical models of gene networks used as computational tools to extract regulatory information from spatial expression data. This is achieved by fitting the model to gap gene expression patterns, in order to obtain estimates for regulatory parameters which predict a specific network topology. We show how considering variability in the data combined with analysis of parameter determinability significantly improves the biological relevance and consistency of the approach. Our models are in agreement with earlier results, which they extend in two important respects: First, we show that Hkb is involved in the regulation of the posterior hunchback (hb) domain, but does not have any other essential function. Specifically, Hkb is required for the anterior shift in the posterior border of this domain, which is now reproduced correctly in our models. Second, gap gene circuits presented here are able to reproduce mutants of terminal gap genes, while previously published models were unable to reproduce any null mutants correctly. As a consequence, our models now capture the expression dynamics of all posterior gap genes and some variational properties of the system correctly. This is an important step towards a better, quantitative understanding of the developmental and evolutionary dynamics of the gap gene network.

  12. Discovery of functional non-coding conserved regions in the α-synuclein gene locus

    PubMed Central

    Sterling, Lori; Walter, Michael; Ting, Dennis; Schüle, Birgitt

    2014-01-01

    Several single nucleotide polymorphisms (SNPs) and the Rep-1 microsatellite marker of the α-synuclein ( SNCA) gene have consistently been shown to be associated with Parkinson’s disease, but the functional relevance is unclear. Based on these findings we hypothesized that conserved cis-regulatory elements in the SNCA genomic region regulate expression of SNCA, and that SNPs in these regions could be functionally modulating the expression of SNCA, thus contributing to neuronal demise and predisposing to Parkinson’s disease. In a pair-wise comparison of a 206kb genomic region encompassing the SNCA gene, we revealed 34 evolutionary conserved DNA sequences between human and mouse. All elements were cloned into reporter vectors and assessed for expression modulation in dual luciferase reporter assays.  We found that 12 out of 34 elements exhibited either an enhancement or reduction of the expression of the reporter gene. Three elements upstream of the SNCA gene displayed an approximately 1.5 fold (p<0.009) increase in expression. Of the intronic regions, three showed a 1.5 fold increase and two others indicated a 2 and 2.5 fold increase in expression (p<0.002). Three elements downstream of the SNCA gene showed 1.5 fold and 2.5 fold increase (p<0.0009). One element downstream of SNCA had a reduced expression of the reporter gene of 0.35 fold (p<0.0009) of normal activity. Our results demonstrate that the SNCA gene contains cis-regulatory regions that might regulate the transcription and expression of SNCA. Further studies in disease-relevant tissue types will be important to understand the functional impact of regulatory regions and specific Parkinson’s disease-associated SNPs and its function in the disease process. PMID:25566351

  13. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    PubMed

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  14. Contribution of transposable elements in the plant's genome.

    PubMed

    Sahebi, Mahbod; Hanafi, Mohamed M; van Wijnen, Andre J; Rice, David; Rafii, M Y; Azizi, Parisa; Osman, Mohamad; Taheri, Sima; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat; Noor, Yusuf Muhammad

    2018-07-30

    Plants maintain extensive growth flexibility under different environmental conditions, allowing them to continuously and rapidly adapt to alterations in their environment. A large portion of many plant genomes consists of transposable elements (TEs) that create new genetic variations within plant species. Different types of mutations may be created by TEs in plants. Many TEs can avoid the host's defense mechanisms and survive alterations in transposition activity, internal sequence and target site. Thus, plant genomes are expected to utilize a variety of mechanisms to tolerate TEs that are near or within genes. TEs affect the expression of not only nearby genes but also unlinked inserted genes. TEs can create new promoters, leading to novel expression patterns or alternative coding regions to generate alternate transcripts in plant species. TEs can also provide novel cis-acting regulatory elements that act as enhancers or inserts within original enhancers that are required for transcription. Thus, the regulation of plant gene expression is strongly managed by the insertion of TEs into nearby genes. TEs can also lead to chromatin modifications and thereby affect gene expression in plants. TEs are able to generate new genes and modify existing gene structures by duplicating, mobilizing and recombining gene fragments. They can also facilitate cellular functions by sharing their transposase-coding regions. Hence, TE insertions can not only act as simple mutagens but can also alter the elementary functions of the plant genome. Here, we review recent discoveries concerning the contribution of TEs to gene expression in plant genomes and discuss the different mechanisms by which TEs can affect plant gene expression and reduce host defense mechanisms. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. Using gene chips to identify organ-specific, smooth muscle responses to experimental diabetes: potential applications to urological diseases.

    PubMed

    Hipp, Jason D; Davies, Kelvin P; Tar, Moses; Valcic, Mira; Knoll, Abraham; Melman, Arnold; Christ, George J

    2007-02-01

    To identify early diabetes-related alterations in gene expression in bladder and erectile tissue that would provide novel diagnostic and therapeutic treatment targets to prevent, delay or ameliorate the ensuing bladder and erectile dysfunction. The RG-U34A rat GeneChip (Affymetrix Inc., Sunnyvale, CA, USA) oligonucleotide microarray (containing approximately 8799 genes) was used to evaluate gene expression in corporal and male bladder tissue excised from rats 1 week after confirmation of a diabetic state, but before demonstrable changes in organ function in vivo. A conservative analytical approach was used to detect alterations in gene expression, and gene ontology (GO) classifications were used to identify biological themes/pathways involved in the aetiology of the organ dysfunction. In all, 320 and 313 genes were differentially expressed in bladder and corporal tissue, respectively. GO analysis in bladder tissue showed prominent increases in biological pathways involved in cell proliferation, metabolism, actin cytoskeleton and myosin, as well as decreases in cell motility, and regulation of muscle contraction. GO analysis in corpora showed increases in pathways related to ion channel transport and ion channel activity, while there were decreases in collagen I and actin genes. The changes in gene expression in these initial experiments are consistent with the pathophysiological characteristics of the bladder and erectile dysfunction seen later in the diabetic disease process. Thus, the observed changes in gene expression might be harbingers or biomarkers of impending organ dysfunction, and could provide useful diagnostic and therapeutic targets for a variety of progressive urological diseases/conditions (i.e. lower urinary tract symptoms related to benign prostatic hyperplasia, erectile dysfunction, etc.).

  16. Neuron-Enriched Gene Expression Patterns are Regionally Anti-Correlated with Oligodendrocyte-Enriched Patterns in the Adult Mouse and Human Brain

    PubMed Central

    Tan, Powell Patrick Cheng; French, Leon; Pavlidis, Paul

    2013-01-01

    An important goal in neuroscience is to understand gene expression patterns in the brain. The recent availability of comprehensive and detailed expression atlases for mouse and human creates opportunities to discover global patterns and perform cross-species comparisons. Recently we reported that the major source of variation in gene transcript expression in the adult normal mouse brain can be parsimoniously explained as reflecting regional variation in glia to neuron ratios, and is correlated with degree of connectivity and location in the brain along the anterior-posterior axis. Here we extend this investigation to two gene expression assays of adult normal human brains that consisted of over 300 brain region samples, and perform comparative analyses of brain-wide expression patterns to the mouse. We performed principal components analysis (PCA) on the regional gene expression of the adult human brain to identify the expression pattern that has the largest variance. As in the mouse, we observed that the first principal component is composed of two anti-correlated patterns enriched in oligodendrocyte and neuron markers respectively. However, we also observed interesting discordant patterns between the two species. For example, a few mouse neuron markers show expression patterns that are more correlated with the human oligodendrocyte-enriched pattern and vice-versa. In conclusion, our work provides insights into human brain function and evolution by probing global relationships between regional cell type marker expression patterns in the human and mouse brain. PMID:23440889

  17. Neuron-Enriched Gene Expression Patterns are Regionally Anti-Correlated with Oligodendrocyte-Enriched Patterns in the Adult Mouse and Human Brain.

    PubMed

    Tan, Powell Patrick Cheng; French, Leon; Pavlidis, Paul

    2013-01-01

    An important goal in neuroscience is to understand gene expression patterns in the brain. The recent availability of comprehensive and detailed expression atlases for mouse and human creates opportunities to discover global patterns and perform cross-species comparisons. Recently we reported that the major source of variation in gene transcript expression in the adult normal mouse brain can be parsimoniously explained as reflecting regional variation in glia to neuron ratios, and is correlated with degree of connectivity and location in the brain along the anterior-posterior axis. Here we extend this investigation to two gene expression assays of adult normal human brains that consisted of over 300 brain region samples, and perform comparative analyses of brain-wide expression patterns to the mouse. We performed principal components analysis (PCA) on the regional gene expression of the adult human brain to identify the expression pattern that has the largest variance. As in the mouse, we observed that the first principal component is composed of two anti-correlated patterns enriched in oligodendrocyte and neuron markers respectively. However, we also observed interesting discordant patterns between the two species. For example, a few mouse neuron markers show expression patterns that are more correlated with the human oligodendrocyte-enriched pattern and vice-versa. In conclusion, our work provides insights into human brain function and evolution by probing global relationships between regional cell type marker expression patterns in the human and mouse brain.

  18. Evaluation of Reference Genes for Quantitative Real-Time PCR in Oil Palm Elite Planting Materials Propagated by Tissue Culture

    PubMed Central

    Chan, Pek-Lan; Rose, Ray J.; Abdul Murad, Abdul Munir; Zainal, Zamri; Leslie Low, Eng-Ti; Ooi, Leslie Cheng-Li; Ooi, Siew-Eng; Yahya, Suzaini; Singh, Rajinder

    2014-01-01

    Background The somatic embryogenesis tissue culture process has been utilized to propagate high yielding oil palm. Due to the low callogenesis and embryogenesis rates, molecular studies were initiated to identify genes regulating the process, and their expression levels are usually quantified using reverse transcription quantitative real-time PCR (RT-qPCR). With the recent release of oil palm genome sequences, it is crucial to establish a proper strategy for gene analysis using RT-qPCR. Selection of the most suitable reference genes should be performed for accurate quantification of gene expression levels. Results In this study, eight candidate reference genes selected from cDNA microarray study and literature review were evaluated comprehensively across 26 tissue culture samples using RT-qPCR. These samples were collected from two tissue culture lines and media treatments, which consisted of leaf explants cultures, callus and embryoids from consecutive developmental stages. Three statistical algorithms (geNorm, NormFinder and BestKeeper) confirmed that the expression stability of novel reference genes (pOP-EA01332, PD00380 and PD00569) outperformed classical housekeeping genes (GAPDH, NAD5, TUBULIN, UBIQUITIN and ACTIN). PD00380 and PD00569 were identified as the most stably expressed genes in total samples, MA2 and MA8 tissue culture lines. Their applicability to validate the expression profiles of a putative ethylene-responsive transcription factor 3-like gene demonstrated the importance of using the geometric mean of two genes for normalization. Conclusions Systematic selection of the most stably expressed reference genes for RT-qPCR was established in oil palm tissue culture samples. PD00380 and PD00569 were selected for accurate and reliable normalization of gene expression data from RT-qPCR. These data will be valuable to the research associated with the tissue culture process. Also, the method described here will facilitate the selection of appropriate reference genes in other oil palm tissues and in the expression profiling of genes relating to yield, biotic and abiotic stresses. PMID:24927412

  19. Hybrid sterility and evolution in Hawaiian Drosophila: differential gene and allele-specific expression analysis of backcross males.

    PubMed

    Brill, E; Kang, L; Michalak, K; Michalak, P; Price, D K

    2016-08-01

    The Hawaiian Drosophila are an iconic example of sequential colonization, adaptive radiation and speciation on islands. Genetic and phenotypic analysis of closely related species pairs that exhibit incomplete reproductive isolation can provide insights into the mechanisms of speciation. Drosophila silvestris from Hawai'i Island and Drosophila planitibia from Maui are two closely related allopatric Hawaiian picture-winged Drosophila that produce sterile F1 males but fertile F1 females, a pattern consistent with Haldane's rule. Backcrossing F1 hybrid females between these two species to parental species gives rise to recombinant males with three distinct sperm phenotypes despite a similar genomic background: motile sperm, no sperm (sterile), and immotile sperm. We found that these three reproductive morphologies of backcross hybrid males produce divergent gene expression profiles in testes, as measured with RNA sequencing. There were a total of 71 genes significantly differentially expressed between backcross males with no sperm compared with those backcross males with motile sperm and immotile sperm, but no significant differential gene expression between backcross males with motile sperm and backcross males with immotile sperm. All of these genes were underexpressed in males with no sperm, including a number of genes with previously known activities in adult testis. An allele-specific expression analysis showed overwhelmingly more cis-divergent than trans-divergent genes, with no significant difference in the ratio of cis- and trans-divergent genes among the sperm phenotypes. Overall, the results indicate that the regulation of gene expression involved in sperm production likely diverged relatively rapidly between these two closely related species.

  20. IL-17A Mediates a Selective Gene Expression Profile in Asthmatic Human Airway Smooth Muscle Cells

    PubMed Central

    Dragon, Stéphane; Hirst, Stuart J.; Lee, Tak H.

    2014-01-01

    Airway smooth muscle (ASM) cells are thought to contribute to the pathogenesis of allergic asthma by orchestrating and perpetuating airway inflammation and remodeling responses. In this study, we evaluated the IL-17RA signal transduction and gene expression profile in ASM cells from subjects with mild asthma and healthy individuals. Human primary ASM cells were treated with IL-17A and probed by the Affymetrix GeneChip array, and gene targets were validated by real-time quantitative RT-PCR. Genomic analysis underlined the proinflammatory nature of IL-17A, as multiple NF-κB regulatory factors and chemokines were induced in ASM cells. Transcriptional regulators consisting of primary response genes were overrepresented and displayed dynamic expression profiles. IL-17A poorly enhanced IL-1β or IL-22 gene responses in ASM cells from both subjects with mild asthma and healthy donors. Interestingly, protein modifications to the NF-κB regulatory network were not observed after IL-17A stimulation, although oscillations in IκBε expression were detected. ASM cells from subjects with mild asthma up-regulated more genes with greater overall variability in response to IL-17A than from healthy donors. Finally, in response to IL-17A, ASM cells displayed rapid activation of the extracellular signal–regulated kinase/ribosomal S6 kinase signaling pathway and increased nuclear levels of phosphorylated extracellular signal–regulated kinase. Taken together, our results suggest that IL-17A mediated modest gene expression response, which, in cooperation with the NF-κB signaling network, may regulate the gene expression profile in ASM cells. PMID:24393021

  1. Transcriptional alterations in the left ventricle of three hypertensive rat models.

    PubMed

    Cerutti, Catherine; Kurdi, Mazen; Bricca, Giampiero; Hodroj, Wassim; Paultre, Christian; Randon, Jacques; Gustin, Marie-Paule

    2006-11-27

    Left ventricular hypertrophy (LVH) is commonly associated with hypertension and represents an independent cardiovascular risk factor. The aim of this study was to test the hypothesis that the cardiac overload related to hypertension is associated to a specific gene expression pattern independently of genetic background. Gene expression levels were obtained with microarrays for 15,866 transcripts from RNA of left ventricles from 12-wk-old rats of three hypertensive models [spontaneously hypertensive rat (SHR), Lyon hypertensive rat (LH), and heterozygous TGR(mRen2)27 rat] and their respective controls. More than 60% of the detected transcripts displayed significant changes between the three groups of normotensive rats, showing large interstrain variability. Expression data were analyzed with respect to hypertension, LVH, and chromosomal distribution. Only four genes had significantly modified expression in the three hypertensive models among which a single gene, coding for sialyltransferase 7A, was consistently overexpressed. Correlation analysis between expression data and left ventricular mass index (LVMI) over all rats identified a larger set of genes whose expression was continuously related with LVMI, including known genes associated with cardiac remodeling. Positioning the detected transcripts along the chromosomes pointed out high-density regions mostly located within blood pressure and cardiac mass quantitative trait loci. Although our study could not detect a unique reprogramming of cardiac cells involving specific genes at early stage of LVH, it allowed the identification of some genes associated with LVH regardless of genetic background. This study thus provides a set of potentially important genes contained within restricted chromosomal regions involved in cardiovascular diseases.

  2. Regulation of bacterial photosynthesis genes by the small noncoding RNA PcrZ

    PubMed Central

    Mank, Nils N.; Berghoff, Bork A.; Hermanns, Yannick N.; Klug, Gabriele

    2012-01-01

    The small RNA PcrZ (photosynthesis control RNA Z) of the facultative phototrophic bacterium Rhodobacter sphaeroides is induced upon a drop of oxygen tension with similar kinetics to those of genes for components of photosynthetic complexes. High expression of PcrZ depends on PrrA, the response regulator of the PrrB/PrrA two-component system with a central role in redox regulation in R. sphaeroides. In addition the FnrL protein, an activator of some photosynthesis genes at low oxygen tension, is involved in redox-dependent expression of this small (s)RNA. Overexpression of full-length PcrZ in R. sphaeroides affects expression of a small subset of genes, most of them with a function in photosynthesis. Some mRNAs from the photosynthetic gene cluster were predicted to be putative PcrZ targets and results from an in vivo reporter system support these predictions. Our data reveal a negative effect of PcrZ on expression of its target mRNAs. Thus, PcrZ counteracts the redox-dependent induction of photosynthesis genes, which is mediated by protein regulators. Because PrrA directly activates photosynthesis genes and at the same time PcrZ, which negatively affects photosynthesis gene expression, this is one of the rare cases of an incoherent feed-forward loop including an sRNA. Our data identified PcrZ as a trans acting sRNA with a direct regulatory function in formation of photosynthetic complexes and provide a model for the control of photosynthesis gene expression by a regulatory network consisting of proteins and a small noncoding RNA. PMID:22988125

  3. Regulation of bacterial photosynthesis genes by the small noncoding RNA PcrZ.

    PubMed

    Mank, Nils N; Berghoff, Bork A; Hermanns, Yannick N; Klug, Gabriele

    2012-10-02

    The small RNA PcrZ (photosynthesis control RNA Z) of the facultative phototrophic bacterium Rhodobacter sphaeroides is induced upon a drop of oxygen tension with similar kinetics to those of genes for components of photosynthetic complexes. High expression of PcrZ depends on PrrA, the response regulator of the PrrB/PrrA two-component system with a central role in redox regulation in R. sphaeroides. In addition the FnrL protein, an activator of some photosynthesis genes at low oxygen tension, is involved in redox-dependent expression of this small (s)RNA. Overexpression of full-length PcrZ in R. sphaeroides affects expression of a small subset of genes, most of them with a function in photosynthesis. Some mRNAs from the photosynthetic gene cluster were predicted to be putative PcrZ targets and results from an in vivo reporter system support these predictions. Our data reveal a negative effect of PcrZ on expression of its target mRNAs. Thus, PcrZ counteracts the redox-dependent induction of photosynthesis genes, which is mediated by protein regulators. Because PrrA directly activates photosynthesis genes and at the same time PcrZ, which negatively affects photosynthesis gene expression, this is one of the rare cases of an incoherent feed-forward loop including an sRNA. Our data identified PcrZ as a trans acting sRNA with a direct regulatory function in formation of photosynthetic complexes and provide a model for the control of photosynthesis gene expression by a regulatory network consisting of proteins and a small noncoding RNA.

  4. Decreased expression level of BER genes in Alzheimer's disease patients is not derivative of their DNA methylation status.

    PubMed

    Sliwinska, Agnieszka; Sitarek, Przemysław; Toma, Monika; Czarny, Piotr; Synowiec, Ewelina; Krupa, Renata; Wigner, Paulina; Bialek, Katarzyna; Kwiatkowski, Dominik; Korycinska, Anna; Majsterek, Ireneusz; Szemraj, Janusz; Galecki, Piotr; Sliwinski, Tomasz

    2017-10-03

    Neurodegeneration in Alzheimer's disease can be caused by accumulation of oxidative DNA damage resulting from altered expression of genes involved in the base excision repair system (BER). Promoter methylation can affect the profile of BER genes expression. Decreased expression of BER genes was observed in the brains of AD patients. The aim of our study was to compare the expression and methylation profiles of six genes coding for proteins involved in BER, namely: hOGG1, APE1, MUTYH, NEIL1, PARP1 and XRCC1, in the peripheral blood cells of AD patients and healthy volunteers. The study consisted of 100 persons diagnosed with Alzheimer's disease according to DSM-IV criteria, and 110 healthy volunteers. DNA and total RNA were isolated from venous blood cells. Promoter methylation profiles were obtained by High Resolution Melting (HRM) analysis of bisulfide converted DNA samples. Real-time PCR with TaqMan probes was employed for gene expression analysis. APE1, hOGG1, MUTYH, PARP1 and NEIL1 were significantly (p<0.001) down-regulated in the lymphocytes of AD patients, as compared to healthy volunteers. Expression of XRCC1 didn't differ significantly between both groups. We did not find any differences in the methylation pattern of any of the investigated BER genes. The methylation status of promoters is not associated with downregulation of BER genes. Our results show that downregulation of BER genes detected in peripheral blood samples could reflect the changes occurring in the brain of patients with AD, and may be a useful biomarker of this disease. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. E-cigarette use results in suppression of immune and inflammatory-response genes in nasal epithelial cells similar to cigarette smoke.

    PubMed

    Martin, Elizabeth M; Clapp, Phillip W; Rebuli, Meghan E; Pawlak, Erica A; Glista-Baker, Ellen; Benowitz, Neal L; Fry, Rebecca C; Jaspers, Ilona

    2016-07-01

    Exposure to cigarette smoke is known to result in impaired host defense responses and immune suppressive effects. However, the effects of new and emerging tobacco products, such as e-cigarettes, on the immune status of the respiratory epithelium are largely unknown. We conducted a clinical study collecting superficial nasal scrape biopsies, nasal lavage, urine, and serum from nonsmokers, cigarette smokers, and e-cigarette users and assessed them for changes in immune gene expression profiles. Smoking status was determined based on a smoking history and a 3- to 4-wk smoking diary and confirmed using serum cotinine and urine 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanol (NNAL) levels. Total RNA from nasal scrape biopsies was analyzed using the nCounter Human Immunology v2 Expression panel. Smoking cigarettes or vaping e-cigarettes resulted in decreased expression of immune-related genes. All genes with decreased expression in cigarette smokers (n = 53) were also decreased in e-cigarette smokers. Additionally, vaping e-cigarettes was associated with suppression of a large number of unique genes (n = 305). Furthermore, the e-cigarette users showed a greater suppression of genes common with those changed in cigarette smokers. This was particularly apparent for suppressed expression of transcription factors, such as EGR1, which was functionally associated with decreased expression of 5 target genes in cigarette smokers and 18 target genes in e-cigarette users. Taken together, these data indicate that vaping e-cigarettes is associated with decreased expression of a large number of immune-related genes, which are consistent with immune suppression at the level of the nasal mucosa. Copyright © 2016 the American Physiological Society.

  6. Lentivirus-mediated bifunctional cell labeling for in vivo melanoma study

    PubMed Central

    Day, Chi-Ping; Carter, John; Bonomi, Carrie; Esposito, Dominic; Crise, Bruce; Ortiz-Conde, Betty; Hollingshead, Melinda; Merlino, Glenn

    2009-01-01

    SUMMARY Lentiviral vectors (LVs) are capable of labeling a broad spectrum of cell types, achieving stable expression of transgenes. However, for in vivo studies, the duration of marker gene expression has been highly variable. We have developed a series of LVs harboring different promoters for expressing reporter gene in mouse cells. Long-term culture and colony formation of several LV-labeled mouse melanoma cells showed that promoters derived from mammalian house-keeping genes, especially those encoding RNA polymerase II (Pol2) and ferritin (FerH), provided the highest consistency for reporter expression. For in vivo studies, primary B16BL6 mouse melanoma were infected with LVs whose luciferase-GFP fusion gene (Luc/GFP) was driven by either Pol2 or FerH promoters. When transplanted into syngeneic C57BL/6 mice, Luc/GFP-labeled B16BL6 mouse melanoma cells can be monitored by bioluminescence imaging in vivo, and GFP-positive cells can be isolated from the tumors by FACS. Pol2-Luc/GFP labeling, while lower in activity, was more sustainable than FerH-Luc/GFP labeling in B16BL6 over consecutive passages into mice. We conclude that Pol-2-Luc/GFP labeling allows long-term in vivo monitoring and tumor cell isolation in immunocompetent mouse melanoma models. SIGNIFICANCE In this study we have developed and identified lentiviral vectors that allow labeled mouse melanoma cells to maintain long-term and consistent expression of a bifunctional luciferase-GFP marker gene, even in syngeneic mice with an intact immune function. This cell-labeling system can be used to build immunocompetent mouse melanoma models that permit both tumor monitoring and FACS-based tumor cell isolation from tissues, greatly facilitating the in vivo study of melanoma. PMID:19175523

  7. The Trophic Life Cycle Stage of the Opportunistic Fungal Pathogen Pneumocystis murina Hinders the Ability of Dendritic Cells To Stimulate CD4+ T Cell Responses

    PubMed Central

    Evans, Heather M.; Simpson, Andrew; Shen, Shu; Stromberg, Arnold J.; Pickett, Carol L.

    2017-01-01

    ABSTRACT The life cycle of the opportunistic fungal pathogen Pneumocystis murina consists of a trophic stage and an ascus-like cystic stage. Infection with the cyst stage induces proinflammatory immune responses, while trophic forms suppress the cytokine response to multiple pathogen-associated molecular patterns (PAMPs), including β-glucan. A targeted gene expression assay was used to evaluate the dendritic cell response following stimulation with trophic forms alone, with a normal mixture of trophic forms and cysts, or with β-glucan. We demonstrate that stimulation with trophic forms downregulated the expression of multiple genes normally associated with the response to infection, including genes encoding transcription factors. Trophic forms also suppressed the expression of genes related to antigen processing and presentation, including the gene encoding the major histocompatibility complex (MHC) class II transactivator, CIITA. Stimulation of dendritic cells with trophic forms, but not a mixture of trophic forms and cysts, reduced the expression of MHC class II and the costimulatory molecule CD40 on the surface of the cells. These defects in the expression of MHC class II and costimulatory molecules corresponded with a reduced capacity for trophic form-loaded dendritic cells to stimulate CD4+ T cell proliferation and polarization. These data are consistent with the delayed innate and adaptive responses previously observed in immunocompetent mice inoculated with trophic forms compared to responses in mice inoculated with a mixture of trophic forms and cysts. We propose that trophic forms broadly inhibit the ability of dendritic cells to fulfill their role as antigen-presenting cells. PMID:28694293

  8. Effect of monochromatic light on circadian rhythmic expression of clock genes in the hypothalamus of chick.

    PubMed

    Jiang, Nan; Wang, Zixu; Cao, Jing; Dong, Yulan; Chen, Yaoxing

    2017-08-01

    To clarify the effect of monochromatic light on circadian clock gene expression in chick hypothalamus, a total 240 newly hatched chickens were reared under blue light (BL), green light (GL), red light (RL) and white light (WL), respectively. On the post-hatched day 14, 24-h profiles of seven core clock genes (cClock, cBmal1, cBmal2, cCry1, cCry2, cPer2 and cPer3) were measured at six time points (CT 0, CT 4, CT 8, CT 12, CT 16, CT 20, circadian time). We found all these clock genes expressed with a significant rhythmicity in different light wavelength groups. Meanwhile, cClock and cBmal1 showed a high level under GL, and followed a corresponding high expression of cCry1. However, RL decreased the expression levels of these genes. Be consistent with the mRNA level, CLOCK and BMAL1 proteins also showed a high level under GL. The CLOCK-like immunoreactive neurons were observed not only in the SCN, but also in the non-SCN brain region such as the nucleus anterior medialis hypothalami, the periventricularis nucleus, the paraventricular nucleus and the median eminence. All these results are consistent with the auto-regulatory circadian feedback loop, and indicate that GL may play an important role on the circadian time generation and development in the chick hypothalamus. Our results also suggest that the circadian clock in the chick hypothalamus such as non-SCN brain region were involved in the regulation of photo information. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Universal light-switchable gene promoter system

    DOEpatents

    Quail, Peter H.; Huq, Enamul; Tepperman, James; Sato, Sae

    2005-02-22

    An artificial promoter system that can be fused upstream of any desired gene enabling reversible induction or repression of the expression of the gene at will in any suitable host cell or organisms by light is described. The design of the system is such that a molecule of the plant photoreceptor phytochrome is targeted to the specific DNA binding site in the promoter by a protein domain that is fused to the phytochrome and that specifically recognizes this binding site. This bound phytochrome, upon activation by light, recruits a second fusion protein consisting of a protein that binds to phytochrome only upon light activation and a transcriptional activation domain that activates expression of the gene downstream of the promoter.

  10. Validation of reference genes for RT-qPCR studies of gene expression in banana fruit under different experimental conditions.

    PubMed

    Chen, Lei; Zhong, Hai-ying; Kuang, Jian-fei; Li, Jian-guo; Lu, Wang-jin; Chen, Jian-ye

    2011-08-01

    Reverse transcription quantitative real-time PCR (RT-qPCR) is a sensitive technique for quantifying gene expression, but its success depends on the stability of the reference gene(s) used for data normalization. Only a few studies on validation of reference genes have been conducted in fruit trees and none in banana yet. In the present work, 20 candidate reference genes were selected, and their expression stability in 144 banana samples were evaluated and analyzed using two algorithms, geNorm and NormFinder. The samples consisted of eight sample sets collected under different experimental conditions, including various tissues, developmental stages, postharvest ripening, stresses (chilling, high temperature, and pathogen), and hormone treatments. Our results showed that different suitable reference gene(s) or combination of reference genes for normalization should be selected depending on the experimental conditions. The RPS2 and UBQ2 genes were validated as the most suitable reference genes across all tested samples. More importantly, our data further showed that the widely used reference genes, ACT and GAPDH, were not the most suitable reference genes in many banana sample sets. In addition, the expression of MaEBF1, a gene of interest that plays an important role in regulating fruit ripening, under different experimental conditions was used to further confirm the validated reference genes. Taken together, our results provide guidelines for reference gene(s) selection under different experimental conditions and a foundation for more accurate and widespread use of RT-qPCR in banana.

  11. MultiSite Gateway-Compatible Cell Type-Specific Gene-Inducible System for Plants1[OPEN

    PubMed Central

    Siligato, Riccardo; Wang, Xin; Yadav, Shri Ram; Lehesranta, Satu; Ma, Guojie; Ursache, Robertas; Sevilem, Iris; Zhang, Jing; Gorte, Maartje; Prasad, Kalika; Heidstra, Renze

    2016-01-01

    A powerful method to study gene function is expression or overexpression in an inducible, cell type-specific system followed by observation of consequent phenotypic changes and visualization of linked reporters in the target tissue. Multiple inducible gene overexpression systems have been developed for plants, but very few of these combine plant selection markers, control of expression domains, access to multiple promoters and protein fusion reporters, chemical induction, and high-throughput cloning capabilities. Here, we introduce a MultiSite Gateway-compatible inducible system for Arabidopsis (Arabidopsis thaliana) plants that provides the capability to generate such constructs in a single cloning step. The system is based on the tightly controlled, estrogen-inducible XVE system. We demonstrate that the transformants generated with this system exhibit the expected cell type-specific expression, similar to what is observed with constitutively expressed native promoters. With this new system, cloning of inducible constructs is no longer limited to a few special cases but can be used as a standard approach when gene function is studied. In addition, we present a set of entry clones consisting of histochemical and fluorescent reporter variants designed for gene and promoter expression studies. PMID:26644504

  12. Levetiracetam attenuates hippocampal expression of synaptic plasticity-related immediate early and late response genes in amygdala-kindled rats

    PubMed Central

    2010-01-01

    Background The amygdala-kindled rat is a model for human temporal lobe epilepsy and activity-dependent synaptic plasticity. Hippocampal RNA isolated from amygdala-kindled rats at different kindling stages was analyzed to identify kindling-induced genes. Furthermore, effects of the anti-epileptic drug levetiracetam on kindling-induced gene expression were examined. Results Cyclooxygenase-2 (Cox-2), Protocadherin-8 (Pcdh8) and TGF-beta-inducible early response gene-1 (TIEG1) were identified and verified as differentially expressed transcripts in the hippocampus of kindled rats by in situ hybridization and quantitative RT-PCR. In addition, we identified a panel of 16 additional transcripts which included Arc, Egr3/Pilot, Homer1a, Ania-3, MMP9, Narp, c-fos, NGF, BDNF, NT-3, Synaptopodin, Pim1 kinase, TNF-α, RGS2, Egr2/krox-20 and β-A activin that were differentially expressed in the hippocampus of amygdala-kindled rats. The list consists of many synaptic plasticity-related immediate early genes (IEGs) as well as some late response genes encoding transcription factors, neurotrophic factors and proteins that are known to regulate synaptic remodelling. In the hippocampus, induction of IEG expression was dependent on the afterdischarge (AD) duration. Levetiracetam, 40 mg/kg, suppressed the development of kindling measured as severity of seizures and AD duration. In addition, single animal profiling also showed that levetiracetam attenuated the observed kindling-induced IEG expression; an effect that paralleled the anti-epileptic effect of the drug on AD duration. Conclusions The present study provides mRNA expression data that suggest that levetiracetam attenuates expression of genes known to regulate synaptic remodelling. In the kindled rat, levetiracetam does so by shortening the AD duration thereby reducing the seizure-induced changes in mRNA expression in the hippocampus. PMID:20105316

  13. Methylomics of gene expression in human monocytes

    PubMed Central

    Liu, Yongmei; Ding, Jingzhong; Reynolds, Lindsay M.; Lohman, Kurt; Register, Thomas C.; De La Fuente, Alberto; Howard, Timothy D.; Hawkins, Greg A.; Cui, Wei; Morris, Jessica; Smith, Shelly G.; Barr, R. Graham; Kaufman, Joel D.; Burke, Gregory L.; Post, Wendy; Shea, Steven; Mccall, Charles E.; Siscovick, David; Jacobs, David R.; Tracy, Russell P.; Herrington, David M.; Hoeschele, Ina

    2013-01-01

    DNA methylation is one of several epigenetic mechanisms that contribute to the regulation of gene expression; however, the extent to which methylation of CpG dinucleotides correlates with gene expression at the genome-wide level is still largely unknown. Using purified primary monocytes from subjects in a large community-based cohort (n = 1264), we characterized methylation (>485 000 CpG sites) and mRNA expression (>48K transcripts) and carried out genome-wide association analyses of 8370 expression phenotypes. We identified 11 203 potential cis-acting CpG loci whose degree of methylation was associated with gene expression (eMS) at a false discovery rate threshold of 0.001. Most of the associations were consistent in effect size and direction of effect across sex and three ethnicities. Contrary to expectation, these eMS were not predominately enriched in promoter regions, or CpG islands, but rather in the 3′ UTR, gene bodies, CpG shores or ‘offshore’ sites, and both positive and negative correlations between methylation and expression were observed across all locations. eMS were enriched for regions predicted to be regulatory by ENCODE (Encyclopedia of DNA Elements) data in multiple cell types, particularly enhancers. One of the strongest association signals detected (P < 2.2 × 10−308) was a methylation probe (cg17005068) in the promoter/enhancer region of the glutathione S-transferase theta 1 gene (GSTT1, encoding the detoxification enzyme) with GSTT1 mRNA expression. Our study provides a detailed description of the epigenetic architecture in human monocytes and its relationship to gene expression. These data may help prioritize interrogation of biologically relevant methylation loci and provide new insights into the epigenetic basis of human health and diseases. PMID:23900078

  14. Combined protein construct and synthetic gene engineering for heterologous protein expression and crystallization using Gene Composer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Raymond, Amy; Lovell, Scott; Lorimer, Don

    2009-12-01

    With the goal of improving yield and success rates of heterologous protein production for structural studies we have developed the database and algorithm software package Gene Composer. This freely available electronic tool facilitates the information-rich design of protein constructs and their engineered synthetic gene sequences, as detailed in the accompanying manuscript. In this report, we compare heterologous protein expression levels from native sequences to that of codon engineered synthetic gene constructs designed by Gene Composer. A test set of proteins including a human kinase (P38{alpha}), viral polymerase (HCV NS5B), and bacterial structural protein (FtsZ) were expressed in both E. colimore » and a cell-free wheat germ translation system. We also compare the protein expression levels in E. coli for a set of 11 different proteins with greatly varied G:C content and codon bias. The results consistently demonstrate that protein yields from codon engineered Gene Composer designs are as good as or better than those achieved from the synonymous native genes. Moreover, structure guided N- and C-terminal deletion constructs designed with the aid of Gene Composer can lead to greater success in gene to structure work as exemplified by the X-ray crystallographic structure determination of FtsZ from Bacillus subtilis. These results validate the Gene Composer algorithms, and suggest that using a combination of synthetic gene and protein construct engineering tools can improve the economics of gene to structure research.« less

  15. Improved transcription and translation with L-leucine stimulation of mTORC1 in Roberts syndrome.

    PubMed

    Xu, Baoshan; Gogol, Madelaine; Gaudenz, Karin; Gerton, Jennifer L

    2016-01-05

    Roberts syndrome (RBS) is a human developmental disorder caused by mutations in the cohesin acetyltransferase ESCO2. We previously reported that mTORC1 signaling was depressed and overall translation was reduced in RBS cells and zebrafish models for RBS. Treatment of RBS cells and zebrafish RBS models with L-leucine partially rescued mTOR function and protein synthesis, correlating with increased cell division and improved development. In this study, we use RBS cells to model mTORC1 repression and analyze transcription and translation with ribosome profiling to determine gene-level effects of L-leucine. L-leucine treatment partially rescued translational efficiency of ribosomal subunits, translation initiation factors, snoRNA production, and mitochondrial function in RBS cells, consistent with these processes being mTORC1 controlled. In contrast, other genes are differentially expressed independent of L-leucine treatment, including imprinted genes such as H19 and GTL2, miRNAs regulated by GTL2, HOX genes, and genes in nucleolar associated domains. Our study distinguishes between gene expression changes in RBS cells that are TOR dependent and those that are independent. Some of the TOR independent gene expression changes likely reflect the architectural role of cohesin in chromatin looping and gene expression. This study reveals the dramatic rescue effects of L-leucine stimulation of mTORC1 in RBS cells and supports that normal gene expression and translation requires ESCO2 function.

  16. Transcriptome analyses of the Dof-like gene family in grapevine reveal its involvement in berry, flower and seed development.

    PubMed

    da Silva, Danielle Costenaro; da Silveira Falavigna, Vítor; Fasoli, Marianna; Buffon, Vanessa; Porto, Diogo Denardi; Pappas, Georgios Joannis; Pezzotti, Mario; Pasquali, Giancarlo; Revers, Luís Fernando

    2016-01-01

    The Dof (DNA-binding with one finger) protein family spans a group of plant transcription factors involved in the regulation of several functions, such as plant responses to stress, hormones and light, phytochrome signaling and seed germination. Here we describe the Dof-like gene family in grapevine (Vitis vinifera L.), which consists of 25 genes coding for Dof. An extensive in silico characterization of the VviDofL gene family was performed. Additionally, the expression of the entire gene family was assessed in 54 grapevine tissues and organs using an integrated approach with microarray (cv Corvina) and real-time PCR (cv Pinot Noir) analyses. The phylogenetic analysis comparing grapevine sequences with those of Arabidopsis, tomato, poplar and already described Dof genes in other species allowed us to identify several duplicated genes. The diversification of grapevine DofL genes during evolution likely resulted in a broader range of biological roles. Furthermore, distinct expression patterns were identified between samples analyzed, corroborating such hypothesis. Our expression results indicate that several VviDofL genes perform their functional roles mainly during flower, berry and seed development, highlighting their importance for grapevine growth and production. The identification of similar expression profiles between both approaches strongly suggests that these genes have important regulatory roles that are evolutionally conserved between grapevine cvs Corvina and Pinot Noir.

  17. CORNAS: coverage-dependent RNA-Seq analysis of gene expression data without biological replicates.

    PubMed

    Low, Joel Z B; Khang, Tsung Fei; Tammi, Martti T

    2017-12-28

    In current statistical methods for calling differentially expressed genes in RNA-Seq experiments, the assumption is that an adjusted observed gene count represents an unknown true gene count. This adjustment usually consists of a normalization step to account for heterogeneous sample library sizes, and then the resulting normalized gene counts are used as input for parametric or non-parametric differential gene expression tests. A distribution of true gene counts, each with a different probability, can result in the same observed gene count. Importantly, sequencing coverage information is currently not explicitly incorporated into any of the statistical models used for RNA-Seq analysis. We developed a fast Bayesian method which uses the sequencing coverage information determined from the concentration of an RNA sample to estimate the posterior distribution of a true gene count. Our method has better or comparable performance compared to NOISeq and GFOLD, according to the results from simulations and experiments with real unreplicated data. We incorporated a previously unused sequencing coverage parameter into a procedure for differential gene expression analysis with RNA-Seq data. Our results suggest that our method can be used to overcome analytical bottlenecks in experiments with limited number of replicates and low sequencing coverage. The method is implemented in CORNAS (Coverage-dependent RNA-Seq), and is available at https://github.com/joel-lzb/CORNAS .

  18. Identification of differentially expressed genes in human lung squamous cell carcinoma using suppression subtractive hybridization.

    PubMed

    Sun, Wenyue; Zhang, Kaitai; Zhang, Xinyu; Lei, Wendong; Xiao, Ting; Ma, Jinfang; Guo, Suping; Shao, Shujuan; Zhang, Husheng; Liu, Yan; Yuan, Jinsong; Hu, Zhi; Ma, Ying; Feng, Xiaoli; Hu, Songnian; Zhou, Jun; Cheng, Shujun; Gao, Yanning

    2004-08-20

    Lung cancer is one of the major causes of cancer-related deaths. Over the past decade, much has been known about the molecular changes associated with lung carcinogenesis; however, our understanding to lung tumorigenesis is still incomplete. To identify genes that are differentially expressed in squamous cell carcinoma (SCC) of the lung, we compared the expression profiles between primarily cultured SCC tumor cells and bronchial epithelial cells derived from morphologically normal bronchial epithelium of the same patient. Using suppression subtractive hybridization (SSH), two cDNA libraries containing up- and down-regulated genes in the tumor cells were constructed, named as LCTP and LCBP. The two libraries comprise 258 known genes and 133 unknown genes in total. The known up-regulated genes in the library LCTP represented a variety of functional groups; including metabolism-, cell adhesion and migration-, signal transduction-, and anti-apoptosis-related genes. Using semi-quantitative reverse transcription-polymerase chain reaction, seven genes chosen randomly from the LCTP were analyzed in the tumor tissue paired with its corresponding adjacent normal lung tissue derived from 16 cases of the SCC. Among them, the IQGAP1, RAP1GDS1, PAICS, MLF1, and MARK1 genes showed a consistent expression pattern with that of the SSH analysis. Identification and further characterization of these genes may allow a better understanding of lung carcinogenesis.

  19. Transcriptome analyses of the Dof-like gene family in grapevine reveal its involvement in berry, flower and seed development

    PubMed Central

    da Silva, Danielle Costenaro; da Silveira Falavigna, Vítor; Fasoli, Marianna; Buffon, Vanessa; Porto, Diogo Denardi; Pappas, Georgios Joannis; Pezzotti, Mario; Pasquali, Giancarlo; Revers, Luís Fernando

    2016-01-01

    The Dof (DNA-binding with one finger) protein family spans a group of plant transcription factors involved in the regulation of several functions, such as plant responses to stress, hormones and light, phytochrome signaling and seed germination. Here we describe the Dof-like gene family in grapevine (Vitis vinifera L.), which consists of 25 genes coding for Dof. An extensive in silico characterization of the VviDofL gene family was performed. Additionally, the expression of the entire gene family was assessed in 54 grapevine tissues and organs using an integrated approach with microarray (cv Corvina) and real-time PCR (cv Pinot Noir) analyses. The phylogenetic analysis comparing grapevine sequences with those of Arabidopsis, tomato, poplar and already described Dof genes in other species allowed us to identify several duplicated genes. The diversification of grapevine DofL genes during evolution likely resulted in a broader range of biological roles. Furthermore, distinct expression patterns were identified between samples analyzed, corroborating such hypothesis. Our expression results indicate that several VviDofL genes perform their functional roles mainly during flower, berry and seed development, highlighting their importance for grapevine growth and production. The identification of similar expression profiles between both approaches strongly suggests that these genes have important regulatory roles that are evolutionally conserved between grapevine cvs Corvina and Pinot Noir. PMID:27610237

  20. Coordinate changes in gene expression and triacylglycerol composition in the developing seeds of oilseed rape (Brassica napus) and turnip rape (Brassica rapa).

    PubMed

    Vuorinen, Anssi L; Kalpio, Marika; Linderborg, Kaisa M; Kortesniemi, Maaria; Lehto, Kirsi; Niemi, Jarmo; Yang, Baoru; Kallio, Heikki P

    2014-02-15

    Crop production for vegetable oil in the northern latitudes utilises oilseed rape (Brassica napus subsp. oleifera) and turnip rape (B. rapa subsp. oleifera), having similar oil compositions. The oil consists mostly of triacylglycerols, which are synthesised during seed development. In this study, we characterised the oil composition and the expression levels of genes involved in triacylglycerol biosynthesis in the developing seeds in optimal, low temperature (15 °C) and short day (12-h day length) conditions. Gene expression levels of several genes were altered during seed development. Low temperature and short day treatments increased the level of 9,12,15-octadecatrienoic acid (18:3n-3) in turnip rape and short day treatment decreased the total oil content in both species. This study gives a novel view on seed oil biosynthesis under different growth conditions, bringing together gene expression levels of the triacylglycerol biosynthesis pathway and oil composition over a time series in two related oilseed species. Copyright © 2013 Elsevier Ltd. All rights reserved.

  1. Super-delta: a new differential gene expression analysis procedure with robust data normalization.

    PubMed

    Liu, Yuhang; Zhang, Jinfeng; Qiu, Xing

    2017-12-21

    Normalization is an important data preparation step in gene expression analyses, designed to remove various systematic noise. Sample variance is greatly reduced after normalization, hence the power of subsequent statistical analyses is likely to increase. On the other hand, variance reduction is made possible by borrowing information across all genes, including differentially expressed genes (DEGs) and outliers, which will inevitably introduce some bias. This bias typically inflates type I error; and can reduce statistical power in certain situations. In this study we propose a new differential expression analysis pipeline, dubbed as super-delta, that consists of a multivariate extension of the global normalization and a modified t-test. A robust procedure is designed to minimize the bias introduced by DEGs in the normalization step. The modified t-test is derived based on asymptotic theory for hypothesis testing that suitably pairs with the proposed robust normalization. We first compared super-delta with four commonly used normalization methods: global, median-IQR, quantile, and cyclic loess normalization in simulation studies. Super-delta was shown to have better statistical power with tighter control of type I error rate than its competitors. In many cases, the performance of super-delta is close to that of an oracle test in which datasets without technical noise were used. We then applied all methods to a collection of gene expression datasets on breast cancer patients who received neoadjuvant chemotherapy. While there is a substantial overlap of the DEGs identified by all of them, super-delta were able to identify comparatively more DEGs than its competitors. Downstream gene set enrichment analysis confirmed that all these methods selected largely consistent pathways. Detailed investigations on the relatively small differences showed that pathways identified by super-delta have better connections to breast cancer than other methods. As a new pipeline, super-delta provides new insights to the area of differential gene expression analysis. Solid theoretical foundation supports its asymptotic unbiasedness and technical noise-free properties. Implementation on real and simulated datasets demonstrates its decent performance compared with state-of-art procedures. It also has the potential of expansion to be incorporated with other data type and/or more general between-group comparison problems.

  2. Possible molecular mechanism underlying cadmium-induced circadian rhythms disruption in zebrafish

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xiao, Bo; Chen, Tian-Ming; Zhong, Yingbin

    This study was aimed to explore the mechanisms underlying cadmium-induced circadian rhythms disruption. Two groups of zebrafish larvae treated with or without 5 ppm CdCl{sub 2} were incubated in a photoperiod of 14-h light/10-h dark conditions. The mRNA levels of clock1a, bmal1b, per2 and per1b in two groups were determined. Microarray data were generated in two group of samples. Differential expression of genes were identified and the changes in expression level for some genes were validated by RT-PCR. Finally, Gene Ontology functional and KEGG pathway enrichment analysis of differentially expressed genes (DEGs) were performed. In comparison with normal group, the mRNAmore » levels of clock1a, bmal1b, and per2 were significantly changed and varied over the circadian cycle in CdCl2-treated group. DEGs were obtained from the light (84 h, ZT12) and dark (88 h, ZT16) phase. In addition, G-protein coupled receptor protein signaling pathway and immune response were both enriched by DEGs in both groups. While, proteolysis and amino acid metabolism were found associated with DEGs in light phase, and Neuroactive ligand-receptor interaction and oxidation-reduction process were significantly enriched by DEGs in dark phase. Besides, the expression pattern of genes including hsp70l and or115-11 obtained by RT-PCR were consistent with those obtained by microarray analysis. As a consequence, cadmium could make significant effects on circadian rhythms through immune response and G protein-coupled receptor signaling pathway. Besides, between the dark and the light phase, the mechanism by which cadmium inducing disruption of circadian rhythms were different to some extent. - Highlights: • Cadmium could affect the expression levels of circadian rhythm-related genes. • Genes expression in microarray data were consistent with those in RT-PCR analysis. • Immune response and G protein-coupled receptor signaling pathway were identified. • Cadmium induces circadian rhythm disruption by different mechanism in day and night.« less

  3. The genesis of an exceptionally lethal venom in the timber rattlesnake (Crotalus horridus) revealed through comparative venom-gland transcriptomics

    PubMed Central

    2013-01-01

    Background Snake venoms generally show sequence and quantitative variation within and between species, but some rattlesnakes have undergone exceptionally rapid, dramatic shifts in the composition, lethality, and pharmacological effects of their venoms. Such shifts have occurred within species, most notably in Mojave (Crotalus scutulatus), South American (C. durissus), and timber (C. horridus) rattlesnakes, resulting in some populations with extremely potent, neurotoxic venoms without the hemorrhagic effects typical of rattlesnake bites. Results To better understand the evolutionary changes that resulted in the potent venom of a population of C. horridus from northern Florida, we sequenced the venom-gland transcriptome of an animal from this population for comparison with the previously described transcriptome of the eastern diamondback rattlesnake (C. adamanteus), a congener with a more typical rattlesnake venom. Relative to the toxin transcription of C. adamanteus, which consisted primarily of snake-venom metalloproteinases, C-type lectins, snake-venom serine proteinases, and myotoxin-A, the toxin transcription of C. horridus was far simpler in composition and consisted almost entirely of snake-venom serine proteinases, phospholipases A2, and bradykinin-potentiating and C-type natriuretic peptides. Crotalus horridus lacked significant expression of the hemorrhagic snake-venom metalloproteinases and C-type lectins. Evolution of shared toxin families involved differential expansion and loss of toxin clades within each species and pronounced differences in the highly expressed toxin paralogs. Toxin genes showed significantly higher rates of nonsynonymous substitution than nontoxin genes. The expression patterns of nontoxin genes were conserved between species, despite the vast differences in toxin expression. Conclusions Our results represent the first complete, sequence-based comparison between the venoms of closely related snake species and reveal in unprecedented detail the rapid evolution of snake venoms. We found that the difference in venom properties resulted from major changes in expression levels of toxin gene families, differential gene-family expansion and loss, changes in which paralogs within gene families were expressed at high levels, and higher nonsynonymous substitution rates in the toxin genes relative to nontoxins. These massive alterations in the genetics of the venom phenotype emphasize the evolutionary lability and flexibility of this ecologically critical trait. PMID:23758969

  4. DiRE: identifying distant regulatory elements of co-expressed genes

    PubMed Central

    Gotea, Valer; Ovcharenko, Ivan

    2008-01-01

    Regulation of gene expression in eukaryotic genomes is established through a complex cooperative activity of proximal promoters and distant regulatory elements (REs) such as enhancers, repressors and silencers. We have developed a web server named DiRE, based on the Enhancer Identification (EI) method, for predicting distant regulatory elements in higher eukaryotic genomes, namely for determining their chromosomal location and functional characteristics. The server uses gene co-expression data, comparative genomics and profiles of transcription factor binding sites (TFBSs) to determine TFBS-association signatures that can be used for discriminating specific regulatory functions. DiRE's unique feature is its ability to detect REs outside of proximal promoter regions, as it takes advantage of the full gene locus to conduct the search. DiRE can predict common REs for any set of input genes for which the user has prior knowledge of co-expression, co-function or other biologically meaningful grouping. The server predicts function-specific REs consisting of clusters of specifically-associated TFBSs and it also scores the association of individual transcription factors (TFs) with the biological function shared by the group of input genes. Its integration with the Array2BIO server allows users to start their analysis with raw microarray expression data. The DiRE web server is freely available at http://dire.dcode.org. PMID:18487623

  5. Transcriptional regulation of brain gene expression in response to a territorial intrusion

    PubMed Central

    Sanogo, Yibayiri O.; Band, Mark; Blatti, Charles; Sinha, Saurabh; Bell, Alison M.

    2012-01-01

    Aggressive behaviour associated with territorial defence is widespread and has fitness consequences. However, excess aggression can interfere with other important biological functions such as immunity and energy homeostasis. How the expression of complex behaviours such as aggression is regulated in the brain has long intrigued ethologists, but has only recently become amenable for molecular dissection in non-model organisms. We investigated the transcriptomic response to territorial intrusion in four brain regions in breeding male threespined sticklebacks using expression microarrays and quantitative polymerase chain reaction (qPCR). Each region of the brain had a distinct genomic response to a territorial challenge. We identified a set of genes that were upregulated in the diencephalon and downregulated in the cerebellum and the brain stem. Cis-regulatory network analysis suggested transcription factors that regulated or co-regulated genes that were consistently regulated in all brain regions and others that regulated gene expression in opposing directions across brain regions. Our results support the hypothesis that territorial animals respond to social challenges via transcriptional regulation of genes in different brain regions. Finally, we found a remarkably close association between gene expression and aggressive behaviour at the individual level. This study sheds light on the molecular mechanisms in the brain that underlie the response to social challenges. PMID:23097509

  6. Integrative functional transcriptomic analyses implicate specific molecular pathways in pulmonary toxicity from exposure to aluminum oxide nanoparticles.

    PubMed

    Li, Xiaobo; Zhang, Chengcheng; Bian, Qian; Gao, Na; Zhang, Xin; Meng, Qingtao; Wu, Shenshen; Wang, Shizhi; Xia, Yankai; Chen, Rui

    2016-09-01

    Gene expression profiling has developed rapidly in recent years and it can predict and define mechanisms underlying chemical toxicity. Here, RNA microarray and computational technology were used to show that aluminum oxide nanoparticles (Al2O3 NPs) were capable of triggering up-regulation of genes related to the cell cycle and cell death in a human A549 lung adenocarcinoma cell line. Gene expression levels were validated in Al2O3 NPs exposed A549 cells and mice lung tissues, most of which showed consistent trends in regulation. Gene-transcription factor network analysis coupled with cell- and animal-based assays demonstrated that the genes encoding PTPN6, RTN4, BAX and IER play a role in the biological responses induced by the nanoparticle exposure, which caused cell death and cell cycle arrest in the G2/S phase. Further, down-regulated PTPN6 expression demonstrated a core role in the network, thus expression level of PTPN6 was rescued by plasmid transfection, which showed ameliorative effects of A549 cells against cell death and cell cycle arrest. These results demonstrate the feasibility of using gene expression profiling to predict cellular responses induced by nanomaterials, which could be used to develop a comprehensive knowledge of nanotoxicity.

  7. Alternative life histories shape brain gene expression profiles in males of the same population

    USGS Publications Warehouse

    Aubin-Horth, N.; Landry, C.R.; Letcher, B.H.; Hofmann, H.A.

    2005-01-01

    Atlantic salmon (Salmo salar) undergo spectacular marine migrations before homing to spawn in natal rivers. However, males that grow fastest early in life can adopt an alternative 'sneaker' tactic by maturing earlier at greatly reduced size without leaving freshwater. While the ultimate evolutionary causes have been well studied, virtually nothing is known about the molecular bases of this developmental plasticity. We investigate the nature and extent of coordinated molecular changes that accompany such a fundamental transformation by comparing the brain transcription profiles of wild mature sneaker males to age-matched immature males (future large anadromous males) and immature females. Of the ca. 3000 genes surveyed, 15% are differentially expressed in the brains of the two male types. These genes are involved in a wide range of processes, including growth, reproduction and neural plasticity. Interestingly, despite the potential for wide variation in gene expression profiles among individuals sampled in nature, consistent patterns of gene expression were found for individuals of the same reproductive tactic. Notably, gene expression patterns in immature males were different both from immature females and sneakers, indicating that delayed maturation and sea migration by immature males, the 'default' life cycle, may actually result from an active inhibition of development into a sneaker. ?? 2005 The Royal Society.

  8. Alternative life histories shape brain gene expression profiles in males of the same population

    PubMed Central

    Aubin-Horth, Nadia; Landry, Christian R; Letcher, Benjamin H; Hofmann, Hans A

    2005-01-01

    Atlantic salmon (Salmo salar) undergo spectacular marine migrations before homing to spawn in natal rivers. However, males that grow fastest early in life can adopt an alternative ‘sneaker’ tactic by maturing earlier at greatly reduced size without leaving freshwater. While the ultimate evolutionary causes have been well studied, virtually nothing is known about the molecular bases of this developmental plasticity. We investigate the nature and extent of coordinated molecular changes that accompany such a fundamental transformation by comparing the brain transcription profiles of wild mature sneaker males to age-matched immature males (future large anadromous males) and immature females. Of the ca. 3000 genes surveyed, 15% are differentially expressed in the brains of the two male types. These genes are involved in a wide range of processes, including growth, reproduction and neural plasticity. Interestingly, despite the potential for wide variation in gene expression profiles among individuals sampled in nature, consistent patterns of gene expression were found for individuals of the same reproductive tactic. Notably, gene expression patterns in immature males were different both from immature females and sneakers, indicating that delayed maturation and sea migration by immature males, the ‘default’ life cycle, may actually result from an active inhibition of development into a sneaker. PMID:16087419

  9. Alternative life histories shape brain gene expression profiles in males of the same population.

    PubMed

    Aubin-Horth, Nadia; Landry, Christian R; Letcher, Benjamin H; Hofmann, Hans A

    2005-08-22

    Atlantic salmon (Salmo salar) undergo spectacular marine migrations before homing to spawn in natal rivers. However, males that grow fastest early in life can adopt an alternative 'sneaker' tactic by maturing earlier at greatly reduced size without leaving freshwater. While the ultimate evolutionary causes have been well studied, virtually nothing is known about the molecular bases of this developmental plasticity. We investigate the nature and extent of coordinated molecular changes that accompany such a fundamental transformation by comparing the brain transcription profiles of wild mature sneaker males to age-matched immature males (future large anadromous males) and immature females. Of the ca. 3000 genes surveyed, 15% are differentially expressed in the brains of the two male types. These genes are involved in a wide range of processes, including growth, reproduction and neural plasticity. Interestingly, despite the potential for wide variation in gene expression profiles among individuals sampled in nature, consistent patterns of gene expression were found for individuals of the same reproductive tactic. Notably, gene expression patterns in immature males were different both from immature females and sneakers, indicating that delayed maturation and sea migration by immature males, the 'default' life cycle, may actually result from an active inhibition of development into a sneaker.

  10. Distribution and regulation of stochasticity and plasticity in Saccharomyces cerevisiae

    DOE PAGES

    Dar, R. D.; Karig, D. K.; Cooke, J. F.; ...

    2010-09-01

    Stochasticity is an inherent feature of complex systems with nanoscale structure. In such systems information is represented by small collections of elements (e.g. a few electrons on a quantum dot), and small variations in the populations of these elements may lead to big uncertainties in the information. Unfortunately, little is known about how to work within this inherently noisy environment to design robust functionality into complex nanoscale systems. Here, we look to the biological cell as an intriguing model system where evolution has mediated the trade-offs between fluctuations and function, and in particular we look at the relationships and trade-offsmore » between stochastic and deterministic responses in the gene expression of budding yeast (Saccharomyces cerevisiae). We find gene regulatory arrangements that control the stochastic and deterministic components of expression, and show that genes that have evolved to respond to stimuli (stress) in the most strongly deterministic way exhibit the most noise in the absence of the stimuli. We show that this relationship is consistent with a bursty 2-state model of gene expression, and demonstrate that this regulatory motif generates the most uncertainty in gene expression when there is the greatest uncertainty in the optimal level of gene expression.« less

  11. MusTRD can regulate postnatal fiber-specific expression.

    PubMed

    Issa, Laura L; Palmer, Stephen J; Guven, Kim L; Santucci, Nicole; Hodgson, Vanessa R M; Popovic, Kata; Joya, Josephine E; Hardeman, Edna C

    2006-05-01

    Human MusTRD1alpha1 was isolated as a result of its ability to bind a critical element within the Troponin I slow upstream enhancer (TnIslow USE) and was predicted to be a regulator of slow fiber-specific genes. To test this hypothesis in vivo, we generated transgenic mice expressing hMusTRD1alpha1 in skeletal muscle. Adult transgenic mice show a complete loss of slow fibers and a concomitant replacement by fast IIA fibers, resulting in postural muscle weakness. However, developmental analysis demonstrates that transgene expression has no impact on embryonic patterning of slow fibers but causes a gradual postnatal slow to fast fiber conversion. This conversion was underpinned by a demonstrable repression of many slow fiber-specific genes, whereas fast fiber-specific gene expression was either unchanged or enhanced. These data are consistent with our initial predictions for hMusTRD1alpha1 and suggest that slow fiber genes contain a specific common regulatory element that can be targeted by MusTRD proteins.

  12. Transfection of small RNAs globally perturbs gene regulation by endogenous microRNAs.

    PubMed

    Khan, Aly A; Betel, Doron; Miller, Martin L; Sander, Chris; Leslie, Christina S; Marks, Debora S

    2009-06-01

    Transfection of small RNAs (such as small interfering RNAs (siRNAs) and microRNAs (miRNAs)) into cells typically lowers expression of many genes. Unexpectedly, increased expression of genes also occurs. We investigated whether this upregulation results from a saturation effect--that is, competition among the transfected small RNAs and the endogenous pool of miRNAs for the intracellular machinery that processes small RNAs. To test this hypothesis, we analyzed genome-wide transcript responses from 151 published transfection experiments in seven different human cell types. We show that targets of endogenous miRNAs are expressed at significantly higher levels after transfection, consistent with impaired effectiveness of endogenous miRNA repression. This effect exhibited concentration and temporal dependence. Notably, the profile of endogenous miRNAs can be largely inferred by correlating miRNA sites with gene expression changes after transfections. The competition and saturation effects have practical implications for miRNA target prediction, the design of siRNA and short hairpin RNA (shRNA) genomic screens and siRNA therapeutics.

  13. Revisiting inconsistency in large pharmacogenomic studies

    PubMed Central

    Safikhani, Zhaleh; Smirnov, Petr; Freeman, Mark; El-Hachem, Nehme; She, Adrian; Rene, Quevedo; Goldenberg, Anna; Birkbak, Nicolai J.; Hatzis, Christos; Shi, Leming; Beck, Andrew H.; Aerts, Hugo J.W.L.; Quackenbush, John; Haibe-Kains, Benjamin

    2017-01-01

    In 2013, we published a comparative analysis of mutation and gene expression profiles and drug sensitivity measurements for 15 drugs characterized in the 471 cancer cell lines screened in the Genomics of Drug Sensitivity in Cancer (GDSC) and Cancer Cell Line Encyclopedia (CCLE). While we found good concordance in gene expression profiles, there was substantial inconsistency in the drug responses reported by the GDSC and CCLE projects. We received extensive feedback on the comparisons that we performed. This feedback, along with the release of new data, prompted us to revisit our initial analysis. We present a new analysis using these expanded data, where we address the most significant suggestions for improvements on our published analysis — that targeted therapies and broad cytotoxic drugs should have been treated differently in assessing consistency, that consistency of both molecular profiles and drug sensitivity measurements should be compared across cell lines, and that the software analysis tools provided should have been easier to run, particularly as the GDSC and CCLE released additional data. Our re-analysis supports our previous finding that gene expression data are significantly more consistent than drug sensitivity measurements. Using new statistics to assess data consistency allowed identification of two broad effect drugs and three targeted drugs with moderate to good consistency in drug sensitivity data between GDSC and CCLE. For three other targeted drugs, there were not enough sensitive cell lines to assess the consistency of the pharmacological profiles. We found evidence of inconsistencies in pharmacological phenotypes for the remaining eight drugs. Overall, our findings suggest that the drug sensitivity data in GDSC and CCLE continue to present challenges for robust biomarker discovery. This re-analysis provides additional support for the argument that experimental standardization and validation of pharmacogenomic response will be necessary to advance the broad use of large pharmacogenomic screens. PMID:28928933

  14. [Construction and functional identification of eukaryotic expression vector carrying Sprague-Dawley rat MSX-2 gene].

    PubMed

    Yang, Xian-Xian; Zhang, Mei; Yan, Zhao-Wen; Zhang, Ru-Hong; Mu, Xiong-Zheng

    2008-01-01

    To construct a high effective eukaryotic expressing plasmid PcDNA 3.1-MSX-2 encoding Sprague-Dawley rat MSX-2 gene for the further study of MSX-2 gene function. The full length SD rat MSX-2 gene was amplified by PCR, and the full length DNA was inserted in the PMD1 8-T vector. It was isolated by restriction enzyme digest with BamHI and Xhol, then ligated into the cloning site of the PcDNA3.1 expression plasmid. The positive recombinant was identified by PCR analysis, restriction endonudease analysis and sequence analysis. Expression of RNA and protein was detected by RT-PCR and Western blot analysis in PcDNA3.1-MSX-2 transfected HEK293 cells. Sequence analysis and restriction endonudease analysis of PcDNA3.1-MSX-2 demonstrated that the position and size of MSX-2 cDNA insertion were consistent with the design. RT-PCR and Western blot analysis showed specific expression of mRNA and protein of MSX-2 in the transfected HEK293 cells. The high effective eukaryotic expression plasmid PcDNA3.1-MSX-2 encoding Sprague-Dawley Rat MSX-2 gene which is related to craniofacial development can be successfully reconstructed. It may serve as the basis for the further study of MSX-2 gene function.

  15. Isolation and expression of scabrous, a gene regulating neurogenesis in Drosophila.

    PubMed

    Mlodzik, M; Baker, N E; Rubin, G M

    1990-11-01

    Mutations in the Drosophila scabrous (sca) gene affect eye and bristle development, leading to irregular spacing of ommatidia and bristle duplications in the adult fly. We have cloned the sca gene by P-element tagging. The sca transcription unit is 12 kb and consists of four exons that are joined in a 3.2-kb mRNA. In an enhancer trap screen we have isolated several P[lacZ] insertions close to the sca transcription start site. We have examined the expression pattern of sca by in situ hybridization to sca transcripts, by beta-galactosidase localization in the P[lacZ] lines, and by immunocytochemistry with an anti-sca antiserum. During embryogenesis, sca is expressed in a dynamic pattern associated with neural development. During imaginal development, sca is mainly expressed in the R8 photoreceptor precursor cells in the eye imaginal disc and in sensory organ precursor cells in other discs. In the wing disc, sca expression is coextensive with the anlagen for bristles and is controlled by genes of the achaete-scute complex. Based on its loss-of-function phenotype, expression pattern, and the predicted structure of its product, a secreted peptide with homology to the fibrinogen gene family, we propose that sca encodes a signal involved in lateral inhibition within individual domains of the developing nervous system.

  16. Genomic Imprinting Was Evolutionarily Conserved during Wheat Polyploidization[OPEN

    PubMed Central

    Yang, Guanghui; Liu, Zhenshan; Gao, Lulu; Yu, Kuohai; Feng, Man; Peng, Huiru; Sun, Qixin; Ni, Zhongfu

    2018-01-01

    Genomic imprinting is an epigenetic phenomenon that causes genes to be differentially expressed depending on their parent of origin. To evaluate the evolutionary conservation of genomic imprinting and the effects of ploidy on this process, we investigated parent-of-origin-specific gene expression patterns in the endosperm of diploid (Aegilops spp), tetraploid, and hexaploid wheat (Triticum spp) at various stages of development via high-throughput transcriptome sequencing. We identified 91, 135, and 146 maternally or paternally expressed genes (MEGs or PEGs, respectively) in diploid, tetraploid, and hexaploid wheat, respectively, 52.7% of which exhibited dynamic expression patterns at different developmental stages. Gene Ontology enrichment analysis suggested that MEGs and PEGs were involved in metabolic processes and DNA-dependent transcription, respectively. Nearly half of the imprinted genes exhibited conserved expression patterns during wheat hexaploidization. In addition, 40% of the homoeolog pairs originating from whole-genome duplication were consistently maternally or paternally biased in the different subgenomes of hexaploid wheat. Furthermore, imprinted expression was found for 41.2% and 50.0% of homolog pairs that evolved by tandem duplication after genome duplication in tetraploid and hexaploid wheat, respectively. These results suggest that genomic imprinting was evolutionarily conserved between closely related Triticum and Aegilops species and in the face of polyploid hybridization between species in these genera. PMID:29298834

  17. Differential Gene Expression in Primary Human Skin Keratinocytes and Fibroblasts in Response to Ionizing Radiation

    PubMed Central

    Warters, Raymond L.; Packard, Ann T.; Kramer, Gwen F.; Gaffney, David K.; Moos, Philip J.

    2009-01-01

    Although skin is usually exposed during human exposures to ionizing radiation, there have been no thorough examinations of the transcriptional response of skin fibroblasts and keratinocytes to radiation. The transcriptional response of quiescent primary fibroblasts and keratinocytes exposed to from 10 cGy to 5 Gy and collected 4 h after treatment was examined. RNA was isolated and examined by microarray analysis for changes in the levels of gene expression. Exposure to ionizing radiation altered the expression of 279 genes across both cell types. Changes in RNA expression could be arranged into three main categories: (1) changes in keratinocytes but not in fibroblasts, (2) changes in fibroblasts but not in keratinocytes, and (3) changes in both. All of these changes were primarily of p53 target genes. Similar radiation-induced changes were induced in immortalized fibroblasts or keratinocytes. In separate experiments, protein was collected and analyzed by Western blotting for expression of proteins observed in microarray experiments to be overexpressed at the mRNA level. Both Q-PCR and Western blot analysis experiments validated these transcription changes. Our results are consistent with changes in the expression of p53 target genes as indicating the magnitude of cell responses to ionizing radiation. PMID:19580510

  18. Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.

    PubMed

    Loging, W T; Reisman, D

    1999-11-01

    The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.

  19. Transcriptome analysis of cattle muscle identifies potential markers for skeletal muscle growth rate and major cell types.

    PubMed

    Guo, Bing; Greenwood, Paul L; Cafe, Linda M; Zhou, Guanghong; Zhang, Wangang; Dalrymple, Brian P

    2015-03-13

    This study aimed to identify markers for muscle growth rate and the different cellular contributors to cattle muscle and to link the muscle growth rate markers to specific cell types. The expression of two groups of genes in the longissimus muscle (LM) of 48 Brahman steers of similar age, significantly enriched for "cell cycle" and "ECM (extracellular matrix) organization" Gene Ontology (GO) terms was correlated with average daily gain/kg liveweight (ADG/kg) of the animals. However, expression of the same genes was only partly related to growth rate across a time course of postnatal LM development in two cattle genotypes, Piedmontese x Hereford (high muscling) and Wagyu x Hereford (high marbling). The deposition of intramuscular fat (IMF) altered the relationship between the expression of these genes and growth rate. K-means clustering across the development time course with a large set of genes (5,596) with similar expression profiles to the ECM genes was undertaken. The locations in the clusters of published markers of different cell types in muscle were identified and used to link clusters of genes to the cell type most likely to be expressing them. Overall correspondence between published cell type expression of markers and predicted major cell types of expression in cattle LM was high. However, some exceptions were identified: expression of SOX8 previously attributed to muscle satellite cells was correlated with angiogenesis. Analysis of the clusters and cell types suggested that the "cell cycle" and "ECM" signals were from the fibro/adipogenic lineage. Significant contributions to these signals from the muscle satellite cells, angiogenic cells and adipocytes themselves were not as strongly supported. Based on the clusters and cell type markers, sets of five genes predicted to be representative of fibro/adipogenic precursors (FAPs) and endothelial cells, and/or ECM remodelling and angiogenesis were identified. Gene sets and gene markers for the analysis of many of the major processes/cell populations contributing to muscle composition and growth have been proposed, enabling a consistent interpretation of gene expression datasets from cattle LM. The same gene sets are likely to be applicable in other cattle muscles and in other species.

  20. Genomic Comparison of the P-ATPase Gene Family in Four Cotton Species and Their Expression Patterns in Gossypium hirsutum.

    PubMed

    Chen, Wen; Si, Guo-Yang; Zhao, Gang; Abdullah, Muhammad; Guo, Ning; Li, Da-Hui; Sun, Xu; Cai, Yong-Ping; Lin, Yi; Gao, Jun-Shan

    2018-05-05

    Plant P-type H⁺-ATPase (P-ATPase) is a membrane protein existing in the plasma membrane that plays an important role in the transmembrane transport of plant cells. To understand the variety and quantity of P-ATPase proteins in different cotton species, we combined four databases from two diploid cotton species ( Gossypium raimondii and G. arboreum ) and two tetraploid cotton species ( G. hirsutum and G. barbadense ) to screen the P-ATPase gene family and resolved the evolutionary relationships between the former cotton species. We identified 53, 51, 99 and 98 P-ATPase genes from G. arboretum, G. raimondii , G. barbadense and G. hirsutum , respectively. The structural and phylogenetic analyses revealed that the gene structure was consistent between P-ATPase genes, with a close evolutionary relationship. The expression analysis of P-ATPase genes showed that many P-ATPase genes were highly expressed in various tissues and at different fiber developmental stages in G. hirsutum , suggesting that they have potential functions during growth and fiber development in cotton.

  1. Developmental expression of "germline"- and "sex determination"-related genes in the ctenophore Mnemiopsis leidyi.

    PubMed

    Reitzel, Adam M; Pang, Kevin; Martindale, Mark Q

    2016-01-01

    An essential developmental pathway in sexually reproducing animals is the specification of germ cells and the differentiation of mature gametes, sperm and oocytes. The "germline" genes vasa, nanos and piwi are commonly identified in primordial germ cells, suggesting a molecular signature for the germline throughout animals. However, these genes are also expressed in a diverse set of somatic stem cells throughout the animal kingdom leaving open significant questions for whether they are required for germline specification. Similarly, members of the Dmrt gene family are essential components regulating sex determination and differentiation in bilaterian animals, but the functions of these transcription factors, including potential roles in sex determination, in early diverging animals remain unknown. The phylogenetic position of ctenophores and the genome sequence of the lobate Mnemiopsis leidyi motivated us to determine the compliment of these gene families in this species and determine expression patterns during development. Our phylogenetic analyses of the vasa, piwi and nanos gene families show that Mnemiopsis has multiple genes in each family with multiple lineage-specific paralogs. Expression domains of Mnemiopsis nanos, vasa and piwi, during embryogenesis from fertilization to the cydippid stage, were diverse, with little overlapping expression and no or little expression in what we think are the germ cells or gametogenic regions. piwi paralogs in Mnemiopsis had distinct expression domains in the ectoderm during development. We observed overlapping expression domains in the apical organ and tentacle apparatus of the cydippid for a subset of "germline genes," which are areas of high cell proliferation, suggesting that these genes are involved with "stem cell" specification and maintenance. Similarly, the five Dmrt genes show diverse non-overlapping expression domains, with no clear evidence for expression in future gametogenic regions of the adult. We also report on splice variants for two Mnemiopsis Dmrt genes that impact the presence and composition of the DM DNA binding domain for these transcription factors. Our results are consistent with a potential role for vasa, piwi and nanos genes in the specification or maintenance of somatic stem cell populations during development in Mnemiopsis. These results are similar to previous results in the tentaculate ctenophore Pleurobrachia, with the exception that these genes were also expressed in gonads and developing gametes of adult Pleurobrachia. These differences suggest that the Mnemiopsis germline is either specified later in development than hypothesized, the germline undergoes extensive migration, or the germline does not express these classic molecular markers. Our results highlight the utility of comparing expression of orthologous genes across multiple species. We provide the first description of Dmrt expression in a ctenophore, which indicates that Dmrt genes are expressed in distinct structures and regions during development but not in future gametogenic regions, the only sex-specific structure for this hermaphroditic species.

  2. Altered gene expression in tree shrew retina and retinal pigment epithelium produced by short periods of minus-lens wear.

    PubMed

    He, Li; Frost, Michael R; Siegwart, John T; Norton, Thomas T

    2018-03-01

    Hyperopic refractive error is detected by retinal neurons, which generate GO signals through a direct emmetropization signaling cascade: retinal pigment epithelium (RPE) into choroid and then into sclera, thereby increasing axial elongation. To examine signaling early in this cascade, we measured gene expression in the retina and RPE after short exposure to hyperopia produced by minus-lens wear. Gene expression in each tissue was compared with gene expression in combined retina + RPE. Starting 24 days after normal eye opening, three groups of juvenile tree shrews (n = 7 each) wore a monocular -5 D lens. The untreated fellow eye served as a control. The "6h" group wore the lens for 6 h; the "24h" group wore the lens for 24 h; each group provided separate retina and RPE tissues. Group "24hC" wore the lens for 24 h and provided combined retina + RPE tissue. Quantitative PCR was used to measure the relative differences (treated eye vs. control eye) in mRNA levels for 66 candidate genes. In the retina after 6 h, mRNA levels for seven genes were significantly regulated: EGR1 and FOS (early intermediate genes) were down-regulated in the treated eyes. Genes with secreted protein products, BMP2 and CTGF, were down-regulated, whilst FGF10, IL18, and SST were up-regulated. After 24 h the pattern changed; only one of the seven genes still showed differential expression; BMP2 was still down-regulated. Two new genes with secreted protein products, IGF2 and VIP, were up-regulated. In the RPE, consistent with its role in receiving, processing, and transmitting GO signaling, differential expression was found for genes whose protein products are at the cell surface, intracellular, in the nucleus, and are secreted. After 6 h, mRNA levels for 17 genes were down-regulated in the treated eyes, whilst four genes (GJA1, IGF2R, LRP2, and IL18) were up-regulated. After 24 h the pattern was similar; mRNA levels for 14 of the same genes were still down-regulated; only LRP2 remained up-regulated. mRNA levels for six genes no longer showed differential expression, whilst nine genes, not differentially expressed at 6 h, now showed differential expression. In the combined retina + RPE after 24 h, mRNA levels for only seven genes were differentially regulated despite the differential expression of many genes in the RPE. Four genes showed the same expression in combined tissue as in retina alone, including up-regulation of VIP despite significant VIP down-regulation in RPE. Thus, hyperopia-induced GO signaling, as measured by differential gene expression, differs in the retina and the RPE. Retinal gene expression changed between 6 h and 24 h of treatment, suggesting evolution of the retinal response. Gene expression in the RPE was similar at both time points, suggesting sustained signaling. The combined retina + RPE does not accurately represent gene expression in either retina or, especially, RPE. When gene expression signatures were compared with those in choroid and sclera, GO signaling, as encoded by differential gene expression, differs in each compartment of the direct emmetropization signaling cascade. Copyright © 2018 Elsevier Ltd. All rights reserved.

  3. Unusual Gene Order and Organization of the Sea Urchin Hox Cluster

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cameron, R A; Rowen, L; Nesbitt, R

    2005-10-11

    The highly consistent gene order and axial colinear expression patterns found in vertebrate hox gene clusters are less well conserved across the rest of bilaterians. We report the first deuterostome instance of an intact hox cluster with a unique gene order where the paralog groups are not expressed in a sequential manner. The finished sequence from BAC clones from the genome of the sea urchin, Strongylocentrotus purpuratus, reveals a gene order wherein the anterior genes (Hox1, Hox2 and Hox3) lie nearest the posterior genes in the cluster such that the most 3 gene is Hox5. (The gene order is :more » 5-Hox1, 2, 3, 11/13c, 11/13b, 11/13a, 9/10, 8, 7, 6, 5 - 3). The finished sequence result is corroborated by restriction mapping evidence and BAC-end scaffold analyses. Comparisons with a putative ancestral deuterostome Hox gene cluster suggest that the rearrangements leading to the sea urchin gene order were many and complex.« less

  4. Unusual Gene Order and Organization of the Sea Urchin HoxCluster

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Richardson, Paul M.; Lucas, Susan; Cameron, R. Andrew

    2005-05-10

    The highly consistent gene order and axial colinear expression patterns found in vertebrate hox gene clusters are less well conserved across the rest of bilaterians. We report the first deuterostome instance of an intact hox cluster with a unique gene order where the paralog groups are not expressed in a sequential manner. The finished sequence from BAC clones from the genome of the sea urchin, Strongylocentrotus purpuratus, reveals a gene order wherein the anterior genes (Hox1, Hox2 and Hox3) lie nearest the posterior genes in the cluster such that the most 3' gene is Hox5. (The gene order is :more » 5'-Hox1,2, 3, 11/13c, 11/13b, '11/13a, 9/10, 8, 7, 6, 5 - 3)'. The finished sequence result is corroborated by restriction mapping evidence and BAC-end scaffold analyses. Comparisons with a putative ancestral deuterostome Hox gene cluster suggest that the rearrangements leading to the sea urchin gene order were many and complex.« less

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bowyer, John F., E-mail: john.bowyer@fda.hhs.go; Latendresse, John R.; Delongchamp, Robert R.

    A study was undertaken to determine whether alterations in the gene expression or overt histological signs of neurotoxicity in selected regions of the forebrain might occur from acrylamide exposure via drinking water. Gene expression at the mRNA level was evaluated by cDNA array and/or RT-PCR analysis in the striatum, substantia nigra and parietal cortex of rat after a 2-week acrylamide exposure. The highest dose tested (maximally tolerated) of approximately 44 mg/kg/day resulted in a significant decreased body weight, sluggishness, and locomotor activity reduction. These physiological effects were not accompanied by prominent changes in gene expression in the forebrain. All themore » expression changes seen in the 1200 genes that were evaluated in the three brain regions were <= 1.5-fold, and most not significant. Very few, if any, statistically significant changes were seen in mRNA levels of the more than 50 genes directly related to the cholinergic, noradrenergic, GABAergic or glutamatergic neurotransmitter systems in the striatum, substantia nigra or parietal cortex. All the expression changes observed in genes related to dopaminergic function were less than 1.5-fold and not statistically significant and the 5HT1b receptor was the only serotonin-related gene affected. Therefore, gene expression changes were few and modest in basal ganglia and sensory cortex at a time when the behavioral manifestations of acrylamide toxicity had become prominent. No histological evidence of axonal, dendritic or neuronal cell body damage was found in the forebrain due to the acrylamide exposure. As well, microglial activation was not present. These findings are consistent with the absence of expression changes in genes related to changes in neuroinflammation or neurotoxicity. Over all, these data suggest that oral ingestion of acrylamide in drinking water or food, even at maximally tolerable levels, induced neither marked changes in gene expression nor neurotoxicity in the motor and somatosensory areas of the central nervous system.« less

  6. Identifying key genes associated with acute myocardial infarction.

    PubMed

    Cheng, Ming; An, Shoukuan; Li, Junquan

    2017-10-01

    This study aimed to identify key genes associated with acute myocardial infarction (AMI) by reanalyzing microarray data. Three gene expression profile datasets GSE66360, GSE34198, and GSE48060 were downloaded from GEO database. After data preprocessing, genes without heterogeneity across different platforms were subjected to differential expression analysis between the AMI group and the control group using metaDE package. P < .05 was used as the cutoff for a differentially expressed gene (DEG). The expression data matrices of DEGs were imported in ReactomeFIViz to construct a gene functional interaction (FI) network. Then, DEGs in each module were subjected to pathway enrichment analysis using DAVID. MiRNAs and transcription factors predicted to regulate target DEGs were identified. Quantitative real-time polymerase chain reaction (RT-PCR) was applied to verify the expression of genes. A total of 913 upregulated genes and 1060 downregulated genes were identified in the AMI group. A FI network consists of 21 modules and DEGs in 12 modules were significantly enriched in pathways. The transcription factor-miRNA-gene network contains 2 transcription factors FOXO3 and MYBL2, and 2 miRNAs hsa-miR-21-5p and hsa-miR-30c-5p. RT-PCR validations showed that expression levels of FOXO3 and MYBL2 were significantly increased in AMI, and expression levels of hsa-miR-21-5p and hsa-miR-30c-5p were obviously decreased in AMI. A total of 41 DEGs, such as SOCS3, VAPA, and COL5A2, are speculated to have roles in the pathogenesis of AMI; 2 transcription factors FOXO3 and MYBL2, and 2 miRNAs hsa-miR-21-5p and hsa-miR-30c-5p may be involved in the regulation of the expression of these DEGs.

  7. Identifying key genes associated with acute myocardial infarction

    PubMed Central

    Cheng, Ming; An, Shoukuan; Li, Junquan

    2017-01-01

    Abstract Background: This study aimed to identify key genes associated with acute myocardial infarction (AMI) by reanalyzing microarray data. Methods: Three gene expression profile datasets GSE66360, GSE34198, and GSE48060 were downloaded from GEO database. After data preprocessing, genes without heterogeneity across different platforms were subjected to differential expression analysis between the AMI group and the control group using metaDE package. P < .05 was used as the cutoff for a differentially expressed gene (DEG). The expression data matrices of DEGs were imported in ReactomeFIViz to construct a gene functional interaction (FI) network. Then, DEGs in each module were subjected to pathway enrichment analysis using DAVID. MiRNAs and transcription factors predicted to regulate target DEGs were identified. Quantitative real-time polymerase chain reaction (RT-PCR) was applied to verify the expression of genes. Result: A total of 913 upregulated genes and 1060 downregulated genes were identified in the AMI group. A FI network consists of 21 modules and DEGs in 12 modules were significantly enriched in pathways. The transcription factor-miRNA-gene network contains 2 transcription factors FOXO3 and MYBL2, and 2 miRNAs hsa-miR-21-5p and hsa-miR-30c-5p. RT-PCR validations showed that expression levels of FOXO3 and MYBL2 were significantly increased in AMI, and expression levels of hsa-miR-21–5p and hsa-miR-30c-5p were obviously decreased in AMI. Conclusion: A total of 41 DEGs, such as SOCS3, VAPA, and COL5A2, are speculated to have roles in the pathogenesis of AMI; 2 transcription factors FOXO3 and MYBL2, and 2 miRNAs hsa-miR-21-5p and hsa-miR-30c-5p may be involved in the regulation of the expression of these DEGs. PMID:29049183

  8. Differential expression of copper-zinc superoxide dismutase gene of Polygonum sibiricum leaves, stems and underground stems, subjected to high-salt stress.

    PubMed

    Qu, Chun-Pu; Xu, Zhi-Ru; Liu, Guan-Jun; Liu, Chun; Li, Yang; Wei, Zhi-Gang; Liu, Gui-Feng

    2010-01-01

    In aerobic organisms, protection against oxidative damage involves the combined action of highly specialized antioxidant enzymes, such as copper-zinc superoxide dismutase. In this work, a cDNA clone which encodes a copper-zinc superoxide dismutase gene, named PS-CuZnSOD, has been identified from P. sibiricum Laxm. by the rapid amplification of cDNA ends method (RACE). Analysis of the nucleotide sequence reveals that the PS-CuZnSOD gene cDNA clone consists of 669 bp, containing 87 bp in the 5' untranslated region; 459 bp in the open reading frame (ORF) encoding 152 amino acids; and 123 bp in 3' untranslated region. The gene accession nucleotide sequence number in GenBank is GQ472846. Sequence analysis indicates that the protein, like most plant superoxide dismutases (SOD), includes two conserved ecCuZnSOD signatures that are from the amino acids 43 to 51, and from the amino acids 137 to 148, and it has a signal peptide extension in the front of the N-terminus (1-16 aa). Expression analysis by real-time quantitative PCR reveals that the PS-CuZnSOD gene is expressed in leaves, stems and underground stems. PS-CuZnSOD gene expression can be induced by 3% NaHCO(3). The different mRNA levels' expression of PS-CuZnSOD show the gene's different expression modes in leaves, stems and underground stems under the salinity-alkalinity stress.

  9. Paradoxical Role of DNA Methylation in Activation of FoxA2 Gene Expression during Endoderm Development*

    PubMed Central

    Bahar Halpern, Keren; Vana, Tal; Walker, Michael D.

    2014-01-01

    The transcription factor FoxA2 is a master regulator of endoderm development and pancreatic beta cell gene expression. To elucidate the mechanisms underlying the activation of the FoxA2 gene during differentiation, we have compared the epigenetic status of undifferentiated human embryonic stem cells (hESCs), hESC-derived early endoderm stage cells (CXCR4+ cells), and pancreatic islet cells. Unexpectedly, a CpG island in the promoter region of the FoxA2 gene displayed paradoxically high levels of DNA methylation in expressing tissues (CXCR4+, islets) and low levels in nonexpressing tissues. This CpG island region was found to repress reporter gene expression and bind the Polycomb group protein SUZ12 and the DNA methyltransferase (DNMT)3b preferentially in undifferentiated hESCs as compared with CXCR4+ or islets cells. Consistent with this, activation of FoxA2 gene expression, but not CXCR4 or SOX17, was strongly inhibited by 5-aza-2′-deoxycytidine and by knockdown of DNMT3b. We hypothesize that in nonexpressing tissues, the lack of DNA methylation allows the binding of DNA methyltransferases and repressing proteins, such as Polycomb group proteins; upon differentiation, DNMT activation leads to CpG island methylation, causing loss of repressor protein binding. These results suggest a novel and unexpected role for DNA methylation in the activation of FoxA2 gene expression during differentiation. PMID:25016019

  10. The evolutionary dynamics of variant antigen genes in Babesia reveal a history of genomic innovation underlying host-parasite interaction.

    PubMed

    Jackson, Andrew P; Otto, Thomas D; Darby, Alistair; Ramaprasad, Abhinay; Xia, Dong; Echaide, Ignacio Eduardo; Farber, Marisa; Gahlot, Sunayna; Gamble, John; Gupta, Dinesh; Gupta, Yask; Jackson, Louise; Malandrin, Laurence; Malas, Tareq B; Moussa, Ehab; Nair, Mridul; Reid, Adam J; Sanders, Mandy; Sharma, Jyotsna; Tracey, Alan; Quail, Mike A; Weir, William; Wastling, Jonathan M; Hall, Neil; Willadsen, Peter; Lingelbach, Klaus; Shiels, Brian; Tait, Andy; Berriman, Matt; Allred, David R; Pain, Arnab

    2014-06-01

    Babesia spp. are tick-borne, intraerythrocytic hemoparasites that use antigenic variation to resist host immunity, through sequential modification of the parasite-derived variant erythrocyte surface antigen (VESA) expressed on the infected red blood cell surface. We identified the genomic processes driving antigenic diversity in genes encoding VESA (ves1) through comparative analysis within and between three Babesia species, (B. bigemina, B. divergens and B. bovis). Ves1 structure diverges rapidly after speciation, notably through the evolution of shortened forms (ves2) from 5' ends of canonical ves1 genes. Phylogenetic analyses show that ves1 genes are transposed between loci routinely, whereas ves2 genes are not. Similarly, analysis of sequence mosaicism shows that recombination drives variation in ves1 sequences, but less so for ves2, indicating the adoption of different mechanisms for variation of the two families. Proteomic analysis of the B. bigemina PR isolate shows that two dominant VESA1 proteins are expressed in the population, whereas numerous VESA2 proteins are co-expressed, consistent with differential transcriptional regulation of each family. Hence, VESA2 proteins are abundant and previously unrecognized elements of Babesia biology, with evolutionary dynamics consistently different to those of VESA1, suggesting that their functions are distinct. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Modularity and evolutionary constraints in a baculovirus gene regulatory network

    PubMed Central

    2013-01-01

    Background The structure of regulatory networks remains an open question in our understanding of complex biological systems. Interactions during complete viral life cycles present unique opportunities to understand how host-parasite network take shape and behave. The Anticarsia gemmatalis multiple nucleopolyhedrovirus (AgMNPV) is a large double-stranded DNA virus, whose genome may encode for 152 open reading frames (ORFs). Here we present the analysis of the ordered cascade of the AgMNPV gene expression. Results We observed an earlier onset of the expression than previously reported for other baculoviruses, especially for genes involved in DNA replication. Most ORFs were expressed at higher levels in a more permissive host cell line. Genes with more than one copy in the genome had distinct expression profiles, which could indicate the acquisition of new functionalities. The transcription gene regulatory network (GRN) for 149 ORFs had a modular topology comprising five communities of highly interconnected nodes that separated key genes that are functionally related on different communities, possibly maximizing redundancy and GRN robustness by compartmentalization of important functions. Core conserved functions showed expression synchronicity, distinct GRN features and significantly less genetic diversity, consistent with evolutionary constraints imposed in key elements of biological systems. This reduced genetic diversity also had a positive correlation with the importance of the gene in our estimated GRN, supporting a relationship between phylogenetic data of baculovirus genes and network features inferred from expression data. We also observed that gene arrangement in overlapping transcripts was conserved among related baculoviruses, suggesting a principle of genome organization. Conclusions Albeit with a reduced number of nodes (149), the AgMNPV GRN had a topology and key characteristics similar to those observed in complex cellular organisms, which indicates that modularity may be a general feature of biological gene regulatory networks. PMID:24006890

  12. Comparative Analysis of AhR-Mediated TCDD-Elicited Gene Expression in Human Liver Adult Stem Cells

    PubMed Central

    Kim, Suntae; Dere, Edward; Burgoon, Lyle D.; Chang, Chia-Cheng; Zacharewski, Timothy R.

    2009-01-01

    Time course and dose-response studies were conducted in HL1-1 cells, a human liver cell line with stem cell–like characteristics, to assess the differential gene expression elicited by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) compared with other established models. Cells were treated with 0.001, 0.01, 0.1, 1, 10, or 100nM TCDD or dimethyl sulfoxide vehicle control for 12 h for the dose-response study, or with 10nM TCDD or vehicle for 1, 2, 4, 8, 12, 24, or 48 h for the time course study. Elicited changes were monitored using a human cDNA microarray with 6995 represented genes. Empirical Bayes analysis identified 144 genes differentially expressed at one or more time points following treatment. Most genes exhibited dose-dependent responses including CYP1A1, CYP1B1, ALDH1A3, and SLC7A5 genes. Comparative analysis of HL1-1 differential gene expression to human HepG2 data identified 74 genes with comparable temporal expression profiles including 12 putative primary responses. HL1-1–specific changes were related to lipid metabolism and immune responses, consistent with effects elicited in vivo. Furthermore, comparative analysis of HL1-1 cells with mouse Hepa1c1c7 hepatoma cell lines and C57BL/6 hepatic tissue identified 18 and 32 commonly regulated orthologous genes, respectively, with functions associated with signal transduction, transcriptional regulation, metabolism and transport. Although some common pathways are affected, the results suggest that TCDD elicits species- and model-specific gene expression profiles. PMID:19684285

  13. Microarray Data Mining for Potential Selenium Targets in Chemoprevention of Prostate Cancer

    PubMed Central

    ZHANG, HAITAO; DONG, YAN; ZHAO, HONGJUAN; BROOKS, JAMES D.; HAWTHORN, LESLEYANN; NOWAK, NORMA; MARSHALL, JAMES R.; GAO, ALLEN C.; IP, CLEMENT

    2008-01-01

    Background A previous clinical trial showed that selenium supplementation significantly reduced the incidence of prostate cancer. We report here a bioinformatics approach to gain new insights into selenium molecular targets that might be relevant to prostate cancer chemoprevention. Materials and Methods We first performed data mining analysis to identify genes which are consistently dysregulated in prostate cancer using published datasets from gene expression profiling of clinical prostate specimens. We then devised a method to systematically analyze three selenium microarray datasets from the LNCaP human prostate cancer cells, and to match the analysis to the cohort of genes implicated in prostate carcinogenesis. Moreover, we compared the selenium datasets with two datasets obtained from expression profiling of androgen-stimulated LNCaP cells. Results We found that selenium reverses the expression of genes implicated in prostate carcinogenesis. In addition, we found that selenium could counteract the effect of androgen on the expression of a subset obtained from androgen-regulated genes. Conclusions The above information provides us with a treasure of new clues to investigate the mechanism of selenium chemoprevention of prostate cancer. Furthermore, these selenium target genes could also serve as biomarkers in future clinical trials to gauge the efficacy of selenium intervention. PMID:18548127

  14. Functional Characterization of a Bidirectional Plant Promoter from Cotton Leaf Curl Burewala Virus Using an Agrobacterium-Mediated Transient Assay

    PubMed Central

    Ashraf, Muhammad Aleem; Shahid, Ahmad Ali; Rao, Abdul Qayyum; Bajwa, Kamran Shehzad; Husnain, Tayyab

    2014-01-01

    The C1 promoter expressing the AC1 gene, and V1 promoter expressing the AV1 gene are located in opposite orientations in the large intergenic region of the Cotton leaf curl Burewala virus (CLCuBuV) genome. Agro-infiltration was used to transiently express putative promoter constructs in Nicotiana tabacum and Gossypium hirsutum leaves, which was monitored by a GUS reporter gene, and revealed that the bidirectional promoter of CLCuBuV transcriptionally regulates both the AC1 and AV1 genes. The CLCuBuV C1 gene promoter showed a strong, consistent transient expression of the reporter gene (GUS) in N. tabacum and G. hirsutum leaves and exhibited GUS activity two- to three-fold higher than the CaMV 35S promoter. The CLCuBuV bidirectional genepromoter is a nearly constitutive promoter that contains basic conserved elements. Many cis-regulatory elements (CREs) were also analyzed within the bidirectional plant promoters of CLCuBuV and closely related geminiviruses, which may be helpful in understanding the transcriptional regulation of both the virus and host plant. PMID:24424501

  15. Comparative analysis of temporal gene expression patterns in the developing ovary of the embryonic chicken

    PubMed Central

    YU, Minli; XU, Yali; YU, Defu; YU, Debing; DU, Wenxing

    2015-01-01

    Many genes participate in the process of ovarian germ cell development, while the combined action mechanisms of these molecular regulators still need clarification. The present study was focused on determination of differentially expressed genes and gene functions at four critical time points in chicken ovarian development. Comparative transcriptional profiling of ovaries from embryonic day 5.5 (E5.5), E12.5, E15.5 and E18.5 was performed using an Affymetrix GeneChip chicken genome microarray. Differential expression patterns for genes specifically depleted and enriched in each stage were identified. The results showed that most of the up- and downregulated genes were involved in the metabolism of retinoic acid (RA) and synthesis of hormones. Among them, a higher number of up- and downregulated genes in the E15.5 ovary were identified as being involved in steroid biosynthesis and retinol metabolism, respectively. To validate gene changes, expressions of twelve candidate genes related to germ cell development were examined by real-time PCR and found to be consistent with the of GeneChip data. Moreover, the immunostaining results suggested that ovarian development during different stages was regulated by different genes. Furthermore, a Raldh2 knockdown chicken model was produced to investigate the fundamental role of Raldh2 in meiosis initiation. It was found that meiosis occurred abnormally in Raldh2 knockdown ovaries, but the inhibitory effect on meiosis was reversed by the addition of exogenous RA. This study offers insights into the profile of gene expression and mechanisms regulating ovarian development, especially the notable role of Raldh2 in meiosis initiation in the chicken. PMID:25736178

  16. Still acting green: continued expression of photosynthetic genes in the heterotrophic Dinoflagellate Pfiesteria piscicida (Peridiniales, Alveolata).

    PubMed

    Kim, Gwang Hoon; Jeong, Hae Jin; Yoo, Yeong Du; Kim, Sunju; Han, Ji Hee; Han, Jong Won; Zuccarello, Giuseppe C

    2013-01-01

    The loss of photosynthetic function should lead to the cessation of expression and finally loss of photosynthetic genes in the new heterotroph. Dinoflagellates are known to have lost their photosynthetic ability several times. Dinoflagellates have also acquired photosynthesis from other organisms, either on a long-term basis or as "kleptoplastids" multiple times. The fate of photosynthetic gene expression in heterotrophs can be informative into evolution of gene expression patterns after functional loss, and the dinoflagellates ability to acquire new photosynthetic function through additional endosymbiosis. To explore this we analyzed a large-scale EST database consisting of 151,091 unique sequences (29,170 contigs, 120,921 singletons) obtained from 454 pyrosequencing of the heterotrophic dinoflagellate Pfiesteria piscicida. About 597 contigs from P. piscicida showed significant homology (E-value

  17. A biomarker-based screen of a gene expression compendium ...

    EPA Pesticide Factsheets

    Computational approaches were developed to identify factors that regulate Nrf2 in a large gene expression compendium of microarray profiles including >2000 comparisons which queried the effects of chemicals, genes, diets, and infectious agents on gene expression in the mouse liver. A gene expression biomarker of 48 genes which accurately predicted Nrf2 activation was used to identify factors which resulted in a gene expression profile with significant correlation to the biomarker. A number of novel insights were made. Chemicals that activated the xenosensor constitutive activated receptor (CAR) consistently activated Nrf2 across hundreds of profiles, possibly downstream of Cyp-induced increases in oxidative stress. Nrf2 activation was also found to be negatively regulated by the growth hormone (GH)- and androgen-regulated transcription factor STAT5b, a transcription factor suppressed by CAR. Nrf2 was activated when STAT5b was suppressed in female mice vs. male mice, after exposure to estrogens, or in genetic mutants in which GH signaling was disrupted. A subset of the mutants that show STAT5b suppression and Nrf2 activation result in increased resistance to environmental stressors and increased longevity. This study describes a novel approach for understanding the network of factors that regulate the Nrf2 pathway and highlights novel interactions between Nrf2, CAR and STAT5b transcription factors. (This abstract does not represent EPA policy.) Computational appr

  18. A promoter polymorphism in the monoamine oxidase A gene is associated with the pineal MAOA activity in Alzheimer's disease patients.

    PubMed

    Wu, Ying-Hui; Fischer, David F; Swaab, Dick F

    2007-09-05

    Monoamine oxidase A (MAOA) is involved in the pathogenesis of mood disorders and Alzheimer's disease (AD). MAOA activity and gene expression have been found to be up-regulated in different brain areas of AD patients, including the pineal gland. Increased pineal MAOA activity might contribute to the reduced pineal melatonin production in AD. A promoter polymorphism of a variable number tandem repeats (VNTR) in the MAOA gene shows to affect MAOA transcriptional activity in vitro. Here we examined in 63 aged controls and 44 AD patients the effects of the MAOA-VNTR on MAOA gene expression and activity in the pineal gland as endophenotypes, and on melatonin production. AD patients carrying long MAOA-VNTR genotype (consisting of 3.5- or 4-repeat alleles) showed higher MAOA gene expression and activity than the short-genotyped (i.e., 3-repeat allele) AD patients. Moreover, the AD-related up-regulation of MAOA showed up only among long-genotype bearing subjects. There was no significant effect of the MAOA-VNTR on MAOA activity or gene expression in controls, or on melatonin production in both controls and AD patients. Our data suggest that the MAOA-VNTR affects the activity and gene expression of MAOA in the brain of AD patients, and is involved in the changes of monoamine metabolism.

  19. The bromodomain protein LEX-1 acts with TAM-1 to modulate gene expression in C. elegans.

    PubMed

    Tseng, Rong-Jeng; Armstrong, Kristin R; Wang, Xiaodong; Chamberlin, Helen M

    2007-11-01

    In many organisms, repetitive DNA serves as a trigger for gene silencing. However, some gene expression is observed from repetitive genomic regions such as heterochromatin, suggesting mechanisms exist to modulate the silencing effects. From a genetic screen in C. elegans, we have identified mutations in two genes important for expression of repetitive sequences: lex-1 and tam-1. Here we show that lex-1 encodes a protein containing an ATPase domain and a bromodomain. LEX-1 is similar to the yeast Yta7 protein, which maintains boundaries between silenced and active chromatin. tam-1 has previously been shown to encode a RING finger/B-box protein that modulates gene expression from repetitive DNA. We find that lex-1, like tam-1, acts as a class B synthetic multivulva (synMuv) gene. However, since lex-1 and tam-1 mutants have normal P granule localization, it suggests they act through a mechanism distinct from other class B synMuvs. We observe intragenic (interallelic) complementation with lex-1 and a genetic interaction between lex-1 and tam-1, data consistent with the idea that the gene products function in the same biological process, perhaps as part of a protein complex. We propose that LEX-1 and TAM-1 function together to influence chromatin structure and to promote expression from repetitive sequences.

  20. Gene cloning and heterologous expression of pyranose 2-oxidase from the brown-rot fungus, Gloeophyllum trabeum

    Treesearch

    Diane Dietrich; Casey Crooks

    2009-01-01

    A pyranose 2-oxidase gene from the brown-rot basidiomycete Gloeophyllum trabeum was isolated using homology-based degenerate PCR. The gene structure was determined and compared to that of several pyranose 2-oxidases cloned from white-rot fungi. The G. trabeum pyranose 2-oxidase gene consists of 16 coding exons with canonical promoter CAAT and TATA elements in the 5’UTR...

Top