Electroosmotically enhanced drying of biomass

DOE Office of Scientific and Technical Information (OSTI.GOV)

Banerjee, S.; Law, S.E.

A laboratory system for experimentally characterizing electroosmotic dewatering of biomass has been developed. The system was used to investigate the dewatering at both constant voltage and constant current of two biomass materials, organic humus with peat and composted wastewater sludge (WWS). The moisture content of humus decreased to 22.5% from an initial value of 44.3% wet basis (wb) after 2 h 10 min of electroosmosis at 50 V across a 2.9-cm-thick bed, whereas that of sludge decreased to 54.5% from an initial value of 68.4% after 2 h 20 min at 40 V across the bed. The electrical energy requiredmore » to remove 1 kg of water by constant-voltage electroosmosis of humus varied from 23% to 61%, in the voltage range of 10--50 V, of the thermal energy required to change the same quantity of free water from liquid to vapor state. For WWS, the energy remained constant at a higher value of 88% over the 20--40-V range studied. The flowrate of liquid water out of the bed at constant voltage linearly increased with the applied electric field, and the electrical energy expended in the constant-current dewatering mode was seen to be a quadratic function of time as predicted by classical electrokinetic theory.« less

PEAK READING VOLTMETER

DOEpatents

Dyer, A.L.

1958-07-29

An improvement in peak reading voltmeters is described, which provides for storing an electrical charge representative of the magnitude of a transient voltage pulse and thereafter measuring the stored charge, drawing oniy negligible energy from the storage element. The incoming voltage is rectified and stored in a condenser. The voltage of the capacitor is applied across a piezoelectric crystal between two parallel plates. Amy change in the voltage of the capacitor is reflected in a change in the dielectric constant of the crystal and the capacitance between a second pair of plates affixed to the crystal is altered. The latter capacitor forms part of the frequency determlning circuit of an oscillator and means is provided for indicating the frequency deviation which is a measure of the peak voltage applied to the voltmeter.

Enhanced electrohydrodynamic force generation in a two-stroke cycle dielectric-barrier-discharge plasma actuator

NASA Astrophysics Data System (ADS)

Sato, Shintaro; Takahashi, Masayuki; Ohnishi, Naofumi

2017-05-01

An approach for electrohydrodynamic (EHD) force production is proposed with a focus on a charge cycle on a dielectric surface. The cycle, consisting of positive-charging and neutralizing strokes, is completely different from the conventional methodology, which involves a negative-charging stroke, in that the dielectric surface charge is constantly positive. The two-stroke charge cycle is realized by applying a DC voltage combined with repetitive pulses. Simulation results indicate that the negative pulse eliminates the surface charge accumulated during constant voltage phase, resulting in repetitive EHD force generation. The time-averaged EHD force increases almost linearly with increasing repetitive pulse frequency and becomes one order of magnitude larger than that driven by the sinusoidal voltage, which has the same peak-to-peak voltage.

Analysis of capacitive force acting on a cantilever tip at solid/liquid interfaces

NASA Astrophysics Data System (ADS)

Umeda, Ken-ichi; Kobayashi, Kei; Oyabu, Noriaki; Hirata, Yoshiki; Matsushige, Kazumi; Yamada, Hirofumi

2013-04-01

Dielectric properties of biomolecules or biomembranes are directly related to their structures and biological activities. Capacitance force microscopy based on the cantilever deflection detection is a useful scanning probe technique that can map local dielectric constant. Here we report measurements and analysis of the capacitive force acting on a cantilever tip at solid/liquid interfaces induced by application of an alternating voltage to explore the feasibility of the measurements of local dielectric constant by the voltage modulation technique in aqueous solutions. The results presented here suggest that the local dielectric constant measurements by the conventional voltage modulation technique are basically possible even in polar liquid media. However, the cantilever deflection is not only induced by the electrostatic force, but also by the surface stress, which does not include the local dielectric information. Moreover, since the voltage applied between the tip and sample are divided by the electric double layer and the bulk polar liquid, the capacitive force acting on the apex of the tip are strongly attenuated. For these reasons, the lateral resolution in the local dielectric constant measurements is expected to be deteriorated in polar liquid media depending on the magnitude of dielectric response. Finally, we present the criteria for local dielectric constant measurements with a high lateral resolution in polar liquid media.

Load characteristics of wireless power transfer system with different resonant types and resonator numbers

NASA Astrophysics Data System (ADS)

Zhang, Yiming; Zhao, Zhengming; Chen, Kainan; Fan, Jun

2017-05-01

Wireless Power Transfer (WPT) has been the research focus and applied in many fields. Normally power is transferred wirelessly to charge the battery, which requires specific load characteristics. The load characteristics are essential for the design and operation of the WPT system. This paper investigates the load characteristics of the WPT system with different resonant types and resonator numbers. It is found that in a WPT system with series or LCL resonance under a constant voltage source, the load characteristic is determined by the number of inductors. Even number of inductors results in a constant current characteristic and odd number constant voltage characteristic. Calculations, simulations, and experiments verify the analysis.

On the Relativistic Correction of Particles Trajectory in Tandem Type Electrostatic Accelerator

NASA Astrophysics Data System (ADS)

Minárik, Stanislav

2015-08-01

A constant potential is applied to the acceleration of the ion-beam in the tandem type electrostatic accelerator. However, not just one voltage is applied, but instead a number of applications can be made in succession by means of the tandem arrangement of high voltage tubes. This number of voltage applications, which is the number of so-called "stages" of a tandem accelerator, may be two, three, or four, depending on the chosen design. Electrostatic field with approximately constant intensity acts on ions in any stage. In general, non-relativistic dynamics is used for the description of the ion transport in tandem accelerator. Energies of accelerated ions are too low and relativistic effects cannot be commonly observed by standard experimental technique. Estimation of possible relativistic correction of ion trajectories is therefore only a matter of calculation. In this note, we briefly present such calculation. Our aim is to show how using the relativistic dynamics modifies the particles trajectory in tandem type accelerator and what parameters determine this modification.

[Study of microorganism sterilization by instant microwave and electromagnetic pulse].

PubMed

Lu, Zhiyuan; Shi, Pinpin; Zhu, Manzuo; Sun, Wenquan; Ding, Hua; Hou, Jianqiang

2008-08-01

The sterilization effects of constant electromagnetic wave and instant pulse on foods and traditional Chinese medical pills are introduced in this paper. From the velum's voltage variation caused by the outward electric filed,the dielectric properties of membranaceous ion and the pass rate of the membranaceous ion, we could analyze the biological heating effect and the biological non-heating effect. The sterilization effect of constant electromagnetic wave is based on the biological heating effect, while the instant electromagnetic pulse is based on the biological non-heating effect. With the applied electronic field, the voltage of membrane could increase, which results in the gates of K+ open, and the flowing out of K+. And the variation of the membranaceous voltage makes the gates of Ca2+ open. The Ca2+ of large consistency could come into the cell by the gradient of voltage. It could induce the death of the cells. The greater the variation of membranaceous voltage becomes, the higher will be the death rate of the cells.

Viscoelastic performance of dielectric elastomer subject to different voltage stimulation

NASA Astrophysics Data System (ADS)

Sheng, Junjie; Zhang, Yuqing; Liu, Lei; Li, Bo; Chen, Hualing

2017-04-01

Dielectric elastomer (DE) is capable of giant deformation subject to an electric field, and demonstrates significant advantages in the potentially application of soft machines with muscle-like characteristics. Due to an inherent property of all macromolecular materials, DE exhibits strong viscoelastic properties. Viscoelasticity could cause a time-dependent deformation and lower the response speed and energy conversion efficiency of DE based actuators, thus strongly affect its electromechanical performance and applications. Combining with the rheological model of viscoelastic relaxation, the viscoelastic performance of a VHB membrane in a circular actuator configuration undergoing separately constant, ramp and sinusoidal voltages are analyzed both theoretically and experimentally. The theoretical results indicated that DE could attain a big deformation under a small constant voltage with a longer time or under a big voltage with a shorter time. The model also showed that a higher critical stretch could be achieved by applying ramping voltage with a lower rate and the stretch magnitude under sinusoidal voltage is much larger at a relatively low frequency. Finally, experiments were designed to validate the simulation and show well consistent with the simulation results.

Disinfection by electrohydraulic treatment.

PubMed

Allen, M; Soike, K

1967-04-28

Electrohydraulic treatment was applied to suspensions of Escherichia coli, spores of Bacillus subtilis var. niger, Saccharomyces cerevisiae, and bacteriophage T2 at an input energy that, in most cases, was below the energy required to sterilize. The input energy was held relatively constant for each of these microorganisms, but the capacitance and voltage were varied. Data are presented which show the degree of disinfection as a function of capacitance and voltage. In all cases, the degree of disinfection for a given input energy increases as both capacitance and voltage are lowered.

Automatic control of finite element models for temperature-controlled radiofrequency ablation.

PubMed

Haemmerich, Dieter; Webster, John G

2005-07-14

The finite element method (FEM) has been used to simulate cardiac and hepatic radiofrequency (RF) ablation. The FEM allows modeling of complex geometries that cannot be solved by analytical methods or finite difference models. In both hepatic and cardiac RF ablation a common control mode is temperature-controlled mode. Commercial FEM packages don't support automating temperature control. Most researchers manually control the applied power by trial and error to keep the tip temperature of the electrodes constant. We implemented a PI controller in a control program written in C++. The program checks the tip temperature after each step and controls the applied voltage to keep temperature constant. We created a closed loop system consisting of a FEM model and the software controlling the applied voltage. The control parameters for the controller were optimized using a closed loop system simulation. We present results of a temperature controlled 3-D FEM model of a RITA model 30 electrode. The control software effectively controlled applied voltage in the FEM model to obtain, and keep electrodes at target temperature of 100 degrees C. The closed loop system simulation output closely correlated with the FEM model, and allowed us to optimize control parameters. The closed loop control of the FEM model allowed us to implement temperature controlled RF ablation with minimal user input.

Gas composition sensing using carbon nanotube arrays

NASA Technical Reports Server (NTRS)

Li, Jing (Inventor); Meyyappan, Meyya (Inventor)

2008-01-01

A method and system for estimating one, two or more unknown components in a gas. A first array of spaced apart carbon nanotubes (''CNTs'') is connected to a variable pulse voltage source at a first end of at least one of the CNTs. A second end of the at least one CNT is provided with a relatively sharp tip and is located at a distance within a selected range of a constant voltage plate. A sequence of voltage pulses {V(t.sub.n)}.sub.n at times t=t.sub.n (n=1, . . . , N1; N1.gtoreq.3) is applied to the at least one CNT, and a pulse discharge breakdown threshold voltage is estimated for one or more gas components, from an analysis of a curve I(t.sub.n) for current or a curve e(t.sub.n) for electric charge transported from the at least one CNT to the constant voltage plate. Each estimated pulse discharge breakdown threshold voltage is compared with known threshold voltages for candidate gas components to estimate whether at least one candidate gas component is present in the gas. The procedure can be repeated at higher pulse voltages to estimate a pulse discharge breakdown threshold voltage for a second component present in the gas.

Systems and methods for providing power to a load based upon a control strategy

DOEpatents

Perisic, Milun; Kajouke, Lateef A; Ransom, Ray M

2013-12-24

Systems and methods are provided for an electrical system. The electrical system includes a load, an interface configured to receive a voltage from a voltage source, and a controller configured to receive the voltage from the voltage source through the interface and to provide a voltage and current to the load. Wherein, when the controller is in a constant voltage mode, the controller provides a constant voltage to the load, when the controller is in a constant current mode, the controller provides a constant current to the load, and when the controller is in a constant power mode, the controller provides a constant power to the load.

Fabrication of one-dimensional alumina photonic crystals by anodization using a modified pulse-voltage method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Shou-Yi; Wang, Jian, E-mail: wangjian@nwnu.edu.cn; Wang, Gang

2015-08-15

Highlights: • The alumina multilayer structure with alternating high and low refractive index is fabricated. • This multilayer shows a strong photonic band gap (PBG) and vivid film colors. • The first PBG could be modulated easily by varying the duration time of constant high or low voltages. • Fabrication of the photonic crystal is obtained by directly electrochemical anodization. • The formation mechanism of multilayer is also discussed. - Abstract: The alumina nanolayer structure with alternating high and low porosities is conveniently fabricated by applying a modified pulse voltage waveform with constant high and low voltage. This structure showsmore » the well-defined layer in a long-range structural periodicity leads to a strong photonic band gap (PBG) from visible to near infrared and brilliant film colors. Compared with the previous reported tuning method, this method is more simple and flexible in tuning the PBG of photonic crystals (PCs). The effect of duration time of high, low and 0 V voltages on PBG is discussed. The first PBG could be modulated easily from the visible to near infrared region by varying the duration time of constant high or low voltages. It is also found that the 0 V lasting for appropriate time is helpful to improve the quality of the PCs. The formation mechanism of multilayer is also discussed.« less

Electric-field-control of magnetic anisotropy of Co0.6Fe0.2B0.2/oxide stacks using reduced voltage

NASA Astrophysics Data System (ADS)

Kita, Koji; Abraham, David W.; Gajek, Martin J.; Worledge, D. C.

2012-08-01

We have demonstrated purely electrical manipulation of the magnetic anisotropy of a Co0.6Fe0.2B0.2 film by applying only 8 V across the CoFeB/oxide stack. A clear transition from in-plane to perpendicular anisotropy was observed. The quantitative relationship between interface anisotropy energy and the applied electric-field was determined from the linear voltage dependence of the saturation field. By comparing the dielectric stacks of MgO/Al2O3 and MgO/HfO2/Al2O3, enhanced voltage control was also demonstrated, due to the higher dielectric constant of the HfO2. These results suggest the feasibility of purely electrical control of magnetization with small voltage bias for spintronics applications.

Generation of a pulsed low-energy electron beam using the channel spark device

DOE Office of Scientific and Technical Information (OSTI.GOV)

Elgarhy, M. A. I., E-mail: elgarhy@azhar.edu.eg; Hassaballa, S. E.; Rashed, U. M.

2015-12-15

For the generation of low-energy electron beam, the design and characteristics of channel spark discharge (CSD) operating at a low voltage are presented in this paper. The discharge voltage, discharge current, X-ray emissions, and electron beam current were experimentally determined. The effects of the applied voltage, working gas pressure, and external capacitance on the CSD and beam parameters were measured. At an applied voltage of 11 kV, an oxygen gas pressure of 25 mTorr, and an external capacitance of 16.45 nF, the maximum measured current was 900 A. The discharge current increased with the increase in the pressure and capacitance,more » while its periodic time decreased with the increase in the pressure. Two types of the discharge were identified and recorded: the hollow cathode discharge and the conduction discharge. A Faraday cup was used to measure the beam current. The maximum measured beam current was 120 A, and the beam signal exhibited two peaks. The increase in both the external capacitance and the applied discharge voltage increased the maximum electron beam current. The electron-beam pulse time decreased with the increase in the gas pressure at a constant voltage and increased with the decrease in the applied discharge voltage. At an applied voltage of 11 kV and an oxygen gas pressure of 15 mTorr, the maximum beam energy was 2.8 keV. The X-ray signal intensity decreased with the increase in the gas pressure and increased with the increase in the capacitance.« less

Precision linear ramp function generator

DOEpatents

Jatko, W.B.; McNeilly, D.R.; Thacker, L.H.

1984-08-01

A ramp function generator is provided which produces a precise linear ramp function which is repeatable and highly stable. A derivative feedback loop is used to stabilize the output of an integrator in the forward loop and control the ramp rate. The ramp may be started from a selected baseline voltage level and the desired ramp rate is selected by applying an appropriate constant voltage to the input of the integrator.

Precision linear ramp function generator

DOEpatents

Jatko, W. Bruce; McNeilly, David R.; Thacker, Louis H.

1986-01-01

A ramp function generator is provided which produces a precise linear ramp unction which is repeatable and highly stable. A derivative feedback loop is used to stabilize the output of an integrator in the forward loop and control the ramp rate. The ramp may be started from a selected baseline voltage level and the desired ramp rate is selected by applying an appropriate constant voltage to the input of the integrator.

Acetylcholine-induced current in perfused rat myoballs

PubMed Central

1980-01-01

Spherical "myoballs" were grown under tissue culture conditions from striated muscle of neonatal rat thighs. The myoballs were examined electrophysiologically with a suction pipette which was used to pass current and perfuse internally. A microelectrode was used to record membrane potential. Experiments were performed with approximately symmetrical (intracellular and extracellular) sodium aspartate solutions. The resting potential, acetylcholine (ACh) reversal potential, and sodium channel reversal potential were all approximately 0 mV. ACh-induced currents were examined by use of both voltage jumps and voltage ramps in the presence of iontophoretically applied agonist. The voltage-jump relaxations had a single exponential time-course. The time constant, tau, was exponentially related to membrane potential, increasing e-fold for 81 mV hyperpolarization. The equilibrium current- voltage relationship was also approximately exponential, from -120 to +81 mV, increasing e-fold for 104 mV hyperpolarization. The data are consistent with a first-order gating process in which the channel opening rate constant is slightly voltage dependent. The instantaneous current-voltage relationship was sublinear in the hyperpolarizing direction. Several models are discussed which can account for the nonlinearity. Evidence is presented that the "selectivity filter" for the ACh channel is located near the intracellular membrane surface. PMID:7381423

Automatic control of finite element models for temperature-controlled radiofrequency ablation

PubMed Central

Haemmerich, Dieter; Webster, John G

2005-01-01

Background The finite element method (FEM) has been used to simulate cardiac and hepatic radiofrequency (RF) ablation. The FEM allows modeling of complex geometries that cannot be solved by analytical methods or finite difference models. In both hepatic and cardiac RF ablation a common control mode is temperature-controlled mode. Commercial FEM packages don't support automating temperature control. Most researchers manually control the applied power by trial and error to keep the tip temperature of the electrodes constant. Methods We implemented a PI controller in a control program written in C++. The program checks the tip temperature after each step and controls the applied voltage to keep temperature constant. We created a closed loop system consisting of a FEM model and the software controlling the applied voltage. The control parameters for the controller were optimized using a closed loop system simulation. Results We present results of a temperature controlled 3-D FEM model of a RITA model 30 electrode. The control software effectively controlled applied voltage in the FEM model to obtain, and keep electrodes at target temperature of 100°C. The closed loop system simulation output closely correlated with the FEM model, and allowed us to optimize control parameters. Discussion The closed loop control of the FEM model allowed us to implement temperature controlled RF ablation with minimal user input. PMID:16018811

Wide-temperature integrated operational amplifier

NASA Technical Reports Server (NTRS)

Mojarradi, Mohammad (Inventor); Levanas, Greg (Inventor); Chen, Yuan (Inventor); Cozy, Raymond S. (Inventor); Greenwell, Robert (Inventor); Terry, Stephen (Inventor); Blalock, Benjamin J. (Inventor)

2009-01-01

The present invention relates to a reference current circuit. The reference circuit comprises a low-level current bias circuit, a voltage proportional-to-absolute temperature generator for creating a proportional-to-absolute temperature voltage (VPTAT), and a MOSFET-based constant-IC regulator circuit. The MOSFET-based constant-IC regulator circuit includes a constant-IC input and constant-IC output. The constant-IC input is electrically connected with the VPTAT generator such that the voltage proportional-to-absolute temperature is the input into the constant-IC regulator circuit. Thus the constant-IC output maintains the constant-IC ratio across any temperature range.

Characterization of chaotic electroconvection near flat electrodes under oscillatory voltages

NASA Astrophysics Data System (ADS)

Kim, Jeonglae; Davidson, Scott; Mani, Ali

2017-11-01

Onset of hydrodynamic instability and chaotic electroconvection in aqueous systems are studied by directly solving the two-dimensional coupled Poisson-Nernst-Planck and Navier-Stokes equations. An aqueous binary electrolyte is bounded by two planar electrodes where time-harmonic voltage is applied at a constant oscillation frequency. The governing equations are solved using a fully-conservative second-order-accurate finite volume discretization and a second-order implicit Euler time advancement. At a sufficiently high amplitude of applied voltage, the system exhibits chaotic behaviors involving strong hydrodynamic mixing and enhanced electroconvection. The system responses are characterized as a function of oscillation frequency, voltage magnitude, and the ratio of diffusivities of two ion species. Our results indicate that electroconvection is most enhanced for frequencies on the order of inverse system RC time scale. We will discuss the dependence of this optimal frequency on the asymmetry of the diffusion coefficients of ionic species. Supported by the Stanford's Precourt Institute.

Closed-loop pulsed helium ionization detector

DOEpatents

Ramsey, Roswitha S.; Todd, Richard A.

1987-01-01

A helium ionization detector for gas chromatography is operated in a constant current, pulse-modulated mode by configuring the detector, electrometer and a high voltage pulser in a closed-loop control system. The detector current is maintained at a fixed level by varying the frequency of fixed-width, high-voltage bias pulses applied to the detector. An output signal proportional to the pulse frequency is produced which is indicative of the charge collected for a detected species.

Description of bipolar charge transport in polyethylene using a fluid model with a constant mobility: model prediction

NASA Astrophysics Data System (ADS)

LeRoy, S.; Segur, P.; Teyssedre, G.; Laurent, C.

2004-01-01

We present a conduction model aimed at describing bipolar transport and space charge phenomena in low density polyethylene under dc stress. In the first part we recall the basic requirements for the description of charge transport and charge storage in disordered media with emphasis on the case of polyethylene. A quick review of available conduction models is presented and our approach is compared with these models. Then, the bases of the model are described and related assumptions are discussed. Finally, results on external current, trapped and free space charge distributions, field distribution and recombination rate are presented and discussed, considering a constant dc voltage, a step-increase of the voltage, and a polarization-depolarization protocol for the applied voltage. It is shown that the model is able to describe the general features reported for external current, electroluminescence and charge distribution in polyethylene.

Motor power factor controller with a reduced voltage starter

NASA Technical Reports Server (NTRS)

Nola, F. J. (Inventor)

1981-01-01

A power factor type motor controller is disclosed in which the conventional power factor constant voltage command signal is replaced during a starting interval with a graduated control voltage. This continuation-impart of a pending patent application (Serial No. 199, 765: Three Phase Factor Controller) provides a means for modifying the operation of the system for a motor start-up interval of 5 to 30 second. Using a ramp generators, an initial ramp-like signal replaces a constant power factor signal supplied by a potentiometer. The ramp-like signal is applied to a 15 terminal where it is summed with an operating power factor signal from phase detectors in order to obtain a control signal for ultimately controlling SCR devices. The SCR devices are turned on at an advancing rate with time responsive to the combination signal described rather than simply a function of a ramp-like signal alone.

SU-F-T-554: Dark Current Effect On CyberKnife Beam Dosimetry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, H; Chang, A

Purpose: All RF linear accelerators produce dark current to varying degrees when an accelerating voltage and RF input is applied in the absence of electron gun injection. This study is to evaluate how dark current from the linear accelerator of CyberKnife affect the dose in the reference dosimetry. Methods: The G4 CyberKnife system with 6MV photon beam was used in this study. Using the ion chamber and the diode detector, the dose was measured in water with varying time delay between acquiring charges and staring beam-on after applying high-voltage into the linear accelerator. The dose was measured after the timemore » delay with over the range of 0 to 120 seconds in the accelerating high-voltage mode without beam-on, applying 0, 10, 50, 100, and 200 MUs. For the measurements, the collimator of 60 mm was used and the detectors were placed at the depths of 10 cm with the source-to-surface distance of 80 cm. Results: The dark current was constant over time regardless of MU. The dose due to the dark current increased over time linearly with the R-squared value of 0.9983 up to 4.4 cGy for the time 120 seconds. In the dose rate setting of 720 MU/min, the relative dose when applying the accelerating voltage without beam-on was increased over time up to 0.6% but it was less than the leakage radiation resulted from the accelerated head. As the reference dosimetry condition, when 100 MU was delivered after 10 seconds time delay, the relative dose increased by 0.7% but 6.7% for the low MU (10 MU). Conclusion: In the dosimetry using CyberKnife system, the constant dark current affected to the dose. Although the time delay in the accelerating high-voltage mode without beam-on is within 10 seconds, the dose less than 100 cGy can be overestimated more than 1%.« less

(In)validity of the constant field and constant currents assumptions in theories of ion transport.

PubMed Central

Syganow, A; von Kitzing, E

1999-01-01

Constant electric fields and constant ion currents are often considered in theories of ion transport. Therefore, it is important to understand the validity of these helpful concepts. The constant field assumption requires that the charge density of permeant ions and flexible polar groups is virtually voltage independent. We present analytic relations that indicate the conditions under which the constant field approximation applies. Barrier models are frequently fitted to experimental current-voltage curves to describe ion transport. These models are based on three fundamental characteristics: a constant electric field, negligible concerted motions of ions inside the channel (an ion can enter only an empty site), and concentration-independent energy profiles. An analysis of those fundamental assumptions of barrier models shows that those approximations require large barriers because the electrostatic interaction is strong and has a long range. In the constant currents assumption, the current of each permeating ion species is considered to be constant throughout the channel; thus ion pairing is explicitly ignored. In inhomogeneous steady-state systems, the association rate constant determines the strength of ion pairing. Among permeable ions, however, the ion association rate constants are not small, according to modern diffusion-limited reaction rate theories. A mathematical formulation of a constant currents condition indicates that ion pairing very likely has an effect but does not dominate ion transport. PMID:9929480

Breakdown phenomena in radio-frequency helium microdischarges

NASA Astrophysics Data System (ADS)

Radmilovic-Radjenovic, M.; Radjenovic, B.; Nina, A.

2008-07-01

In this paper, the Kihara equation has been applied in order to determine the breakdown voltage in helium rf microdischarges. It was found that the Kihara equation, with modified moleculer constants, describes the breakdown process well even for gaps of the order of a few millimeters. A good agreement between numerical solutions of the Kihara equation and the available experimental data reveals that the breakdown voltages depend on the pd product and vary substantially with changes in rf frequencies.

The effect of applied control strategy on the current-voltage correlation of a solid oxide fuel cell stack during dynamic operation

NASA Astrophysics Data System (ADS)

Szmyd, Janusz S.; Komatsu, Yosuke; Brus, Grzegorz; Ghigliazza, Francesco; Kimijima, Shinji; Ściążko, Anna

2014-09-01

This paper discusses the transient characteristics of the planar type SOFC cell stack, of which the standard output is 300 W. The transient response of the voltage to the manipulation of an electric current was investigated. The effects of the response and of the operating condition determined by the operating temperature of the stack were studied by mapping a current-voltage (I-V) correlation. The current-based fuel control (CBFC) was adopted for keeping the fuel utilization factor at constant while the value of the electric current was ramped at the constant rate. The present experimental study shows that the transient characteristics of the cell voltage are determined by primarily the operating temperature caused by the manipulation of the current. Particularly, the slope of the I-V curve and the overshoot found on the voltage was remarkably influenced by the operating temperature. The different values of the fuel utilization factor influence the height of the settled voltages. The CBFC has significance in determining the slope of the I-V characteristic, but the different values ofthe fuel utilization factor does not affect the slope as the operating temperature does. The CBFC essentially does not alter the amplitude of the overshoot on the voltage response, since this is dominated by the operating temperature and its change is caused by manipulating the current.

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Current leakage for low altitude satellites - Modeling applications. [simulation of high voltage solar cell array in ionospheric plasma environment

NASA Technical Reports Server (NTRS)

Konradi, A.; Mccoy, J. E.; Garriott, O. K.

1979-01-01

To simulate the behavior of a high voltage solar cell array in the ionospheric plasma environment, the large (90 ft x 55 ft diameter) vacuum chamber was used to measure the high-voltage plasma interactions of a 3 ft x 30 ft conductive panel. The chamber was filled with Nitrogen and Argon plasma at electron densities of up to 1,000,000 per cu cm. Measurements of current flow to the plasma were made in three configurations: (a) with one end of the panel grounded, (b) with the whole panel floating while a high bias was applied between the ends of the panel, and (c) with the whole panel at high negative voltage with respect to the chamber walls. The results indicate that a simple model with a constant panel conductivity and plasma resistance can adequately describe the voltage distribution along the panel and the plasma current flow. As expected, when a high potential difference is applied to the panel ends more than 95% of the panel floats negative with respect to the plasma.

Design of energy-storage reactors for single-winding constant-frequency dc-to-dc converters operating in the discontinuous-reactor-current mode

NASA Technical Reports Server (NTRS)

Chen, D. Y.; Owen, H. A., Jr.; Wilson, T. G.

1980-01-01

This paper presents an algorithm and equations for designing the energy-storage reactor for dc-to-dc converters which are constrained to operate in the discontinuous-reactor-current mode. This design procedure applied to the three widely used single-winding configurations: the voltage step-up, the current step-up, and the voltage-or-current step-up converters. A numerical design example is given to illustrate the use of the design algorithm and design equations.

Characterization of DBD Plasma Actuators Performance without External Flow . Part I; Thrust-Voltage Quadratic Relationship in Logarithmic Space for Sinusoidal Excitation

NASA Technical Reports Server (NTRS)

Ashpis, David E.; Laun, Matthew C.

2016-01-01

We present results of thrust measurements of Dielectric Barrier Discharge (DBD) plasma actuators. We have used a test setup, measurement, and data processing methodology that we developed in prior work. The tests were conducted with High Density Polyethylene (HDPE) actuators of three thicknesses. The applied voltage driving the actuators was a pure sinusoidal waveform. The test setup was suspended actuators with a partial liquid interface. The tests were conducted at low ambient humidity. The thrust was measured with an analytical balance and the results were corrected for anti-thrust to isolate the plasma generated thrust. Applying this approach resulted in smooth and repeatable data. It also enabled curve fitting that yielded quadratic relations between the plasma thrust and voltage in log-log space at constant frequencies. The results contrast power law relationships developed in literature that appear to be a rough approximation over a limited voltage range.

Method and apparatus for remote tube crevice detection by current and voltage probe resistance measurement

DOEpatents

Kikta, Thomas J.; Mitchell, Ronald D.

1992-01-01

A method and apparatus for determining the extent of contact between an electrically conducting tube and an electrically conductive tubesheet surrounding the tube, based upon the electrical resistance of the tube and tubesheet. A constant current source is applied to the interior of the electrically conducting tube by probes and a voltmeter is connected between other probes to measure the voltage at the point of current injection, which is inversely proportional to the amount of contact between the tube and tubesheet. Namely, the higher the voltage measured by the voltmeter, the less contact between the tube and tubesheet.

Method and apparatus for remote tube crevice detection by current and voltage probe resistance measurement

DOEpatents

Kikta, T.J.; Mitchell, R.D.

1992-11-24

A method and apparatus for determining the extent of contact between an electrically conducting tube and an electrically conductive tubesheet surrounding the tube, based upon the electrical resistance of the tube and tubesheet. A constant current source is applied to the interior of the electrically conducting tube by probes and a voltmeter is connected between other probes to measure the voltage at the point of current injection, which is inversely proportional to the amount of contact between the tube and tubesheet. Namely, the higher the voltage measured by the voltmeter, the less contact between the tube and tubesheet. 4 figs.

State memory in solution gated epitaxial graphene

NASA Astrophysics Data System (ADS)

Butko, A. V.; Butko, V. Y.; Lebedev, S. P.; Lebedev, A. A.; Davydov, V. Y.; Smirnov, A. N.; Eliseyev, I. A.; Dunaevskiy, M. S.; Kumzerov, Y. A.

2018-06-01

We studied electrical transport in transistors fabricated on a surface of high quality epitaxial graphene with density of defects as low as 5·1010 cm-2 and observed quasistatic hysteresis with a time constant in a scale of hours. This constant is in a few orders of magnitude greater than the constant previously reported in CVD graphene. The hysteresis observed here can be described as a shift of ∼+2V of the Dirac point measured during a gate voltage increase from the position of the Dirac point measured during a gate voltage decrease. This hysteresis can be characterized as a nonvolatile quasistatic state memory effect in which the state of the gated graphene is determined by its initial state prior to entering the hysteretic region. Due to this effect the difference in resistance of the gated graphene measured in the hysteretic region at the same applied voltages can be as high as 70%. The observed effect can be explained by assuming that charge carriers in graphene and oppositely charged molecular ions from the solution form quasistable interfacial complexes at the graphene interface. These complexes likely preserve the initial state by preventing charge carriers in graphene from discharging in the hysteretic region.

Effect of DC bias on dielectric properties of nanocrystalline CuAlO2

NASA Astrophysics Data System (ADS)

Prakash, T.; Ramasamy, S.; Murty, B. S.

2013-03-01

Grain boundary effect on the room temperature dielectric behavior in mechanically alloyed nanocrystalline CuAlO2 has been investigated using impedance spectroscopy under the applied DC bias voltages 0 V to 4.8 V in a periodic interval of 0.2 V. Analysis of impedance data confirms the existence of double Schottky potential barrier heights ( Φ b ) between two adjacent grains (left and right side) with grain boundary and its influences in dielectric relaxation time ( τ), dielectric constant ( ɛ') and dielectric loss (tan δ) factor. Also, clear evidence on the suppression of Φ b was demonstrated in the higher applied bias voltages with the parameter τ. At equilibrium state, τ is 0.63 ms and it was reduced to 0.13 ms after the 3.2 V applied DC bias. These observed DC bias voltage effects are obeying `brick layer model' and also elucidates Φ b is playing a crucial role in controlling dielectric properties of nanomaterials.

Oxygen Displacement in Cuprates under Ionic Liquid Field-Effect Gating

PubMed Central

Dubuis, Guy; Yacoby, Yizhak; Zhou, Hua; He, Xi; Bollinger, Anthony T.; Pavuna, Davor; Pindak, Ron; Božović, Ivan

2016-01-01

We studied structural changes in a 5 unit cell thick La1.96Sr0.04CuO4 film, epitaxially grown on a LaSrAlO4 substrate with a single unit cell buffer layer, when ultra-high electric fields were induced in the film by applying a gate voltage between the film (ground) and an ionic liquid in contact with it. Measuring the diffraction intensity along the substrate-defined Bragg rods and analyzing the results using a phase retrieval method we obtained the three-dimensional electron density in the film, buffer layer, and topmost atomic layers of the substrate under different applied gate voltages. The main structural observations were: (i) there were no structural changes when the voltage was negative, holes were injected into the film making it more metallic and screening the electric field; (ii) when the voltage was positive, the film was depleted of holes becoming more insulating, the electric field extended throughout the film, the partial surface monolayer became disordered, and equatorial oxygen atoms were displaced towards the surface; (iii) the changes in surface disorder and the oxygen displacements were both reversed when a negative voltage was applied; and (iv) the c-axis lattice constant of the film did not change in spite of the displacement of equatorial oxygen atoms. PMID:27578237

Active Piezoelectric Diaphragms

NASA Technical Reports Server (NTRS)

Bryant, Robert G.; Effinger, Robert T., IV; Aranda, Isaiah, Jr.; Copeland, Ben M.; Covington, Ed W., III

2002-01-01

Several active piezoelectric diaphragms were fabricated by placing unelectroded piezoelectric disks between copper clad films patterned with Inter-Circulating Electrodes "ICE". When a voltage potential is applied to the electrodes, the result is radially distributed electric field that mechanically strains the piezo-ceramic along the Z-axis (perpendicular to the applied electric field), rather than the expected in-plane (XY-axis) direction. Unlike other out of plane piezoelectric actuators, which are benders, these Radial Field Diaphragms (RFDs) strain concentrically yet afford high displacements while maintaining a constant circumference. This paper covers the fabrication and characterization of these diaphragms as a function of poling field strength, ceramic diameter and line spacing, as well as the surface topography, the resulting strain field and displacement as a function of applied voltage ranging from DC to 10 Hz.

Electrospun poly(methyl methacrylate) fibrous mat showing piezoelectric properties

NASA Astrophysics Data System (ADS)

Nobeshima, Taiki; Ishii, Yuya; Sakai, Heisuke; Uemura, Sei; Yoshida, Manabu

2018-05-01

A piezoelectric effect, such as actuation behavior with voltage application, could be observed from a poly(methyl methacrylate) (PMMA) fibrous mat fabricated by electrospinning. This fibrous mat increased or decreased its thickness in accordance with the polarity of the applied voltage, which appears to be an inverse piezoelectric effect. The appearance d T constant was as large as 8.5 nm/V owing to the softness of the fibrous structure, and the coupling constant K T = 0.31 indicated its efficient piezoelectric property. This piezoelectric behavior was repeatedly observed to be stable at room temperature. In addition, the polarization components of the fibrous mat, which are considered to be the origin of its piezoelectric effect, and its relaxation behavior were confirmed from the results of thermally stimulated current measurements.

Constant voltage electro-slag remelting control

DOEpatents

Schlienger, Max E.

1996-01-01

A system for controlling electrode gap in an electro-slag remelt furnace has a constant regulated voltage and an eletrode which is fed into the slag pool at a constant rate. The impedance of the circuit through the slag pool is directly proportional to the gap distance. Because of the constant voltage, the system current changes are inversely proportional to changes in gap. This negative feedback causes the gap to remain stable.

Using computational modeling to compare X-ray tube Practical Peak Voltage for Dental Radiology

NASA Astrophysics Data System (ADS)

Holanda Cassiano, Deisemar; Arruda Correa, Samanda Cristine; de Souza, Edmilson Monteiro; da Silva, Ademir Xaxier; Pereira Peixoto, José Guilherme; Tadeu Lopes, Ricardo

2014-02-01

The Practical Peak Voltage-PPV has been adopted to measure the voltage applied to an X-ray tube. The PPV was recommended by the IEC document and accepted and published in the TRS no. 457 code of practice. The PPV is defined and applied to all forms of waves and is related to the spectral distribution of X-rays and to the properties of the image. The calibration of X-rays tubes was performed using the MCNPX Monte Carlo code. An X-ray tube for Dental Radiology (operated from a single phase power supply) and an X-ray tube used as a reference (supplied from a constant potential power supply) were used in simulations across the energy range of interest of 40 kV to 100 kV. Results obtained indicated a linear relationship between the tubes involved.

ELECTROCHEMICAL DECHLORINATION OF TRICHLOROETHYLENE USING GRANULAR-GRAPHITE ELECTRODES

EPA Science Inventory

Electrochemical dechlorination of TCE ws conducted in a glass column using granular graphite as electrodes. A constant voltage of 15 volt was applied resulting in 60-62 mA of current. Approximately 4-6% of the TCE was dechlorinated. Among the reduced TCE, more than 95% was comple...

ELECTROCHEMICAL DECHLORINATION OF TRICHLOROETHYLENE USING GRANULAR-GRAPHITE ELECTRODES

EPA Science Inventory

Electrochemical dechlorination of TCE was conducted in a glass column using granular graphite as electrodes. A constant voltage of 15 volt was applied resulting in 60-62 mA of current. Approximately 4-6% of the TCE was dechlorinated. Among the reduced TCE, more than 95% was compl...

Radial Field Piezoelectric Diaphragms

NASA Technical Reports Server (NTRS)

Bryant, R. G.; Effinger, R. T., IV; Copeland, B. M., Jr.

2002-01-01

A series of active piezoelectric diaphragms were fabricated and patterned with several geometrically defined Inter-Circulating Electrodes "ICE" and Interdigitated Ring Electrodes "ICE". When a voltage potential is applied to the electrodes, the result is a radially distributed electric field that mechanically strains the piezoceramic along the Z-axis (perpendicular to the applied electric field). Unlike other piezoelectric bender actuators, these Radial Field Diaphragms (RFDs) strain concentrically yet afford high displacements (several times that of the equivalent Unimorph) while maintaining a constant circumference. One of the more intriguing aspects is that the radial strain field reverses itself along the radius of the RFD while the tangential strain remains relatively constant. The result is a Z-deflection that has a conical profile. This paper covers the fabrication and characterization of the 5 cm. (2 in.) diaphragms as a function of poling field strength, ceramic thickness, electrode type and line spacing, as well as the surface topography, the resulting strain field and displacement as a function of applied voltage at low frequencies. The unique features of these RFDs include the ability to be clamped about their perimeter with little or no change in displacement, the environmentally insulated packaging, and a highly repeatable fabrication process that uses commodity materials.

Variable Frequency Operations of an Offshore Wind Power Plant with HVDC-VSC: Preprint

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gevorgian, V.; Singh, M.; Muljadi, E.

2011-12-01

In this paper, a constant Volt/Hz operation applied to the Type 1 wind turbine generator. Various control aspects of Type 1 generators at the plant level and at the turbine level will be investigated. Based on DOE study, wind power generation may reach 330 GW by 2030 at the level of penetration of 20% of the total energy production. From this amount of wind power, 54 GW of wind power will be generated at offshore wind power plants. The deployment of offshore wind power plants requires power transmission from the plant to the load center inland. Since this power transmissionmore » requires submarine cable, there is a need to use High-Voltage Direct Current (HVDC) transmission. Otherwise, if the power is transmitted via alternating current, the reactive power generated by the cable capacitance may cause an excessive over voltage in the middle of the transmission distance which requires unnecessary oversized cable voltage breakdown capability. The use of HVDC is usually required for transmission distance longer than 50 kilometers of submarine cables to be economical. The use of HVDC brings another advantage; it is capable of operating at variable frequency. The inland substation will be operated to 60 Hz synched with the grid, the offshore substation can be operated at variable frequency, thus allowing the wind power plant to be operated at constant Volt/Hz. In this paper, a constant Volt/Hz operation applied to the Type 1 wind turbine generator. Various control aspects of Type 1 generators at the plant level and at the turbine level will be investigated.« less

Constant voltage electro-slag remelting control

DOEpatents

Schlienger, M.E.

1996-10-22

A system for controlling electrode gap in an electro-slag remelt furnace has a constant regulated voltage and an electrode which is fed into the slag pool at a constant rate. The impedance of the circuit through the slag pool is directly proportional to the gap distance. Because of the constant voltage, the system current changes are inversely proportional to changes in gap. This negative feedback causes the gap to remain stable. 1 fig.

Evaluation of Fuel Cell Operation and Degradation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Williams, Mark; Gemmen, Randall; Richards, George

The concepts of area specific resistance (ASR) and degradation are developed for different fuel cell operating modes. The concepts of exergetic efficiency and entropy production were applied to ASR and degradation. It is shown that exergetic efficiency is a time-dependent function useful describing the thermal efficiency of a fuel cell and the change in thermal efficiency of a degrading fuel cell. Entropy production was evaluated for the cases of constant voltage operation and constant current operation of the fuel cell for a fuel cell undergoing ohmic degradation. It was discovered that the Gaussian hypergeometric function describes the cumulative entropy andmore » electrical work produced by fuel cells operating at constant voltage. The Gaussian hypergeometric function is found in many applications in modern physics. This paper builds from and is an extension of several papers recently published by the authors in the Journal of The Electrochemical Society (ECS), ECS Transactions, Journal of Power Sources, and the Journal of Fuel Cell Science and Technology.« less

An Novel Continuation Power Flow Method Based on Line Voltage Stability Index

NASA Astrophysics Data System (ADS)

Zhou, Jianfang; He, Yuqing; He, Hongbin; Jiang, Zhuohan

2018-01-01

An novel continuation power flow method based on line voltage stability index is proposed in this paper. Line voltage stability index is used to determine the selection of parameterized lines, and constantly updated with the change of load parameterized lines. The calculation stages of the continuation power flow decided by the angle changes of the prediction of development trend equation direction vector are proposed in this paper. And, an adaptive step length control strategy is used to calculate the next prediction direction and value according to different calculation stages. The proposed method is applied clear physical concept, and the high computing speed, also considering the local characteristics of voltage instability which can reflect the weak nodes and weak area in a power system. Due to more fully to calculate the PV curves, the proposed method has certain advantages on analysing the voltage stability margin to large-scale power grid.

Application of constant current, low voltage electrical stimulation systems to pig carcasses and its effects on pork quality.

PubMed

Channon, H A; Walker, P J; Kerr, M G; Baud, S R

2003-12-01

This study examined the effectiveness of a constant current, low voltage electrical stimulation system on improving pork quality when applied to pigs at 2 min post-exsanguination. A total of 48 female Duroc×Large White/Landrace pigs of 85-90 kg liveweight were randomly allocated immediately prior to slaughter to one of four constant current electrical stimulation treatments: control (no electrical stimulation), 50, 200 and 400 mA. Stimulation was applied to pig carcasses at 2 min post-exsanguination for 30 s. No differences (P>0.05) in WB shear force values, muscle lightness or PSE incidence of pork M. longissimus lumborum (LL) was found due to electrical stimulation treatment. Muscle pH of the LL muscle was lower (P<0.001) in carcasses in the 200 and 400 mA treatments compared to those from carcasses in both the 50 mA and control treatment groups, when measured at the various time points from 40 min to 8 h post-slaughter. Although carcasses stimulated with 200 and 400 mA had higher percentage drip loss (P<0.05) and purge (P<0.001), this was not found to impact WB shear force values, muscle lightness or PSE incidence.

Oxygen Displacement in Cuprates under IonicLiquid Field-Effect Gating

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dubuis, Guy; Yacoby, Yizhak; Zhou, Hua

We studied structural changes in a 5 unit cell thick La 1.96Sr 0.04CuO 4 film, epitaxially grown on a LaSrAlO 4 substrate with a single unit cell buffer layer, when ultra-high electric fields were induced in the film by applying a gate voltage between the film and an ionic liquid in contact with it. Measuring the diffraction intensity along the substrate-defined Bragg rods and analyzing the results using a phase retrieval method we obtained the three-dimensional electron density in the film, buffer layer, and topmost atomic layers of the substrate under different applied gate voltages. The main structural observations were:more » (i) there were no structural changes when the voltage was negative, holes were injected into the film making it more metallic and screening the electric field; (ii) when the voltage was positive, the film was depleted of holes becoming more insulating, the electric field extended throughout the film, the partial surface monolayer became disordered, and planar oxygen atoms were displaced towards the sample surface; (iii) the changes in surface disorder and the oxygen displacements were both reversed when a negative voltage was applied; and (iv) the c-axis lattice constant of the film did not change in spite of the displacement of planar oxygen atoms.« less

Oxygen Displacement in Cuprates under IonicLiquid Field-Effect Gating

DOE PAGES

Dubuis, Guy; Yacoby, Yizhak; Zhou, Hua; ...

2016-08-15

We studied structural changes in a 5 unit cell thick La 1.96Sr 0.04CuO 4 film, epitaxially grown on a LaSrAlO 4 substrate with a single unit cell buffer layer, when ultra-high electric fields were induced in the film by applying a gate voltage between the film and an ionic liquid in contact with it. Measuring the diffraction intensity along the substrate-defined Bragg rods and analyzing the results using a phase retrieval method we obtained the three-dimensional electron density in the film, buffer layer, and topmost atomic layers of the substrate under different applied gate voltages. The main structural observations were:more » (i) there were no structural changes when the voltage was negative, holes were injected into the film making it more metallic and screening the electric field; (ii) when the voltage was positive, the film was depleted of holes becoming more insulating, the electric field extended throughout the film, the partial surface monolayer became disordered, and planar oxygen atoms were displaced towards the sample surface; (iii) the changes in surface disorder and the oxygen displacements were both reversed when a negative voltage was applied; and (iv) the c-axis lattice constant of the film did not change in spite of the displacement of planar oxygen atoms.« less

Constant current loop impedance measuring system that is immune to the effects of parasitic impedances

NASA Technical Reports Server (NTRS)

Anderson, Karl F. (Inventor)

1994-01-01

A constant current loop measuring system is provided for measuring a characteristic of an environment. The system comprises a first impedance positionable in the environment, a second impedance coupled in series with said first impedance and a parasitic impedance electrically coupled to the first and second impedances. A current generating device, electrically coupled in series with the first and second impedances, provides a constant current through the first and second impedances to produce first and second voltages across the first and second impedances, respectively, and a parasitic voltage across the parasitic impedance. A high impedance voltage measuring device measures a voltage difference between the first and second voltages independent of the parasitic voltage to produce a characteristic voltage representative of the characteristic of the environment.

Weakly superconducting, thin-film structures as radiation detectors.

NASA Technical Reports Server (NTRS)

Kirschman, R. K.

1972-01-01

Measurements were taken with weakly superconducting quantum structures of the Notarys-Mercereau type, representing a thin superconductor film with a short region that is weakened in the sense that its transition temperature is lower than in the remaining portion of the film. The structure acts as a superconducting relaxation oscillator in which the supercurrent increases with time until the critical current of the weakened section is attained, at which moment the supercurrent decays and the cycle repeats. Under applied radiation, a series of constant-voltage steps appears in the current-voltage curve, and the size of the steps varies periodically with the amplitude of applied radiation. Measurements of the response characteristics were made in the frequency range of 10 to 450 MHz.

Nonlinear magnetoelectric effects in a composite ferromagnetic-piezoelectric structure under harmonic and noise magnetic pumping

NASA Astrophysics Data System (ADS)

Burdin, D. A.; Chashin, D. V.; Ekonomov, N. A.; Fetisov, Y. K.; Stashkevich, A.

2018-03-01

Low-frequency nonlinear magnetoelectric effects in a composite structure comprised of a piezoelectric langatate slab sandwiched between two Metglas amorphous alloy magnetostrictive layers under simultaneous harmonic and noise magnetic pumping have been investigated. It is shown that the frequency fp of harmonic pumping is linearly reproduced in the piezoelectric voltage spectrum accompanied by its higher harmonics. Similarly, narrow-band magnetic noise with a central frequency fN is present in the output piezoelectric voltage along with two noise peaks in the vicinity of a double 2fN and zero frequency. Simultaneous application of harmonic and noise magnetic fields produces a noticeably more complex output voltage spectrum containing additional noise satellite lines at frequencies fp ±fN , 2fp ±fN etc. as well as a noise "pedestal". Amplitudes of voltage spectral components depend on the applied constant bias magnetic field, scaling as magnetostriction derivatives with respect to this field. The effects observed are well described by the theory of magnetic field mixing in magnetoelectric composites with nonlinear dependence of magnetostriction on applied fields.

Jitter compensation circuit

DOEpatents

Sullivan, James S.; Ball, Don G.

1997-01-01

The instantaneous V.sub.co signal on a charging capacitor is sampled and the charge voltage on capacitor C.sub.o is captured just prior to its discharge into the first stage of magnetic modulator. The captured signal is applied to an averaging circuit with a long time constant and to the positive input terminal of a differential amplifier. The averaged V.sub. co signal is split between a gain stage (G=0.975) and a feedback stage that determines the slope of the voltage ramp applied to the high speed comparator. The 97.5% portion of the averaged V.sub.co signal is applied to the negative input of a differential amplifier gain stage (G=10). The differential amplifier produces an error signal by subtracting 97.5% of the averaged V.sub.co signal from the instantaneous value of sampled V.sub.co signal and multiplying the difference by ten. The resulting error signal is applied to the positive input of a high speed comparator. The error signal is then compared to a voltage ramp that is proportional to the averaged V.sub.co values squared divided by the total volt-second product of the magnetic compression circuit.

Jitter compensation circuit

DOEpatents

Sullivan, J.S.; Ball, D.G.

1997-09-09

The instantaneous V{sub co} signal on a charging capacitor is sampled and the charge voltage on capacitor C{sub o} is captured just prior to its discharge into the first stage of magnetic modulator. The captured signal is applied to an averaging circuit with a long time constant and to the positive input terminal of a differential amplifier. The averaged V{sub co} signal is split between a gain stage (G = 0.975) and a feedback stage that determines the slope of the voltage ramp applied to the high speed comparator. The 97.5% portion of the averaged V{sub co} signal is applied to the negative input of a differential amplifier gain stage (G = 10). The differential amplifier produces an error signal by subtracting 97.5% of the averaged V{sub co} signal from the instantaneous value of sampled V{sub co} signal and multiplying the difference by ten. The resulting error signal is applied to the positive input of a high speed comparator. The error signal is then compared to a voltage ramp that is proportional to the averaged V{sub co} values squared divided by the total volt-second product of the magnetic compression circuit. 11 figs.

PEDOT-CNT coated electrodes stimulate retinal neurons at low voltage amplitudes and low charge densities

NASA Astrophysics Data System (ADS)

Samba, R.; Herrmann, T.; Zeck, G.

2015-02-01

Objective. The aim of this study was to compare two different microelectrode materials—the conductive polymer composite poly-3,4-ethylenedioxythiophene (PEDOT)-carbon nanotube(CNT) and titanium nitride (TiN)—at activating spikes in retinal ganglion cells in whole mount rat retina through stimulation of the local retinal network. Stimulation efficacy of the microelectrodes was analyzed by comparing voltage, current and transferred charge at stimulation threshold. Approach. Retinal ganglion cell spikes were recorded by a central electrode (30 μm diameter) in the planar grid of an electrode array. Extracellular stimulation (monophasic, cathodic, 0.1-1.0 ms) of the retinal network was performed using constant voltage pulses applied to the eight surrounding electrodes. The stimulation electrodes were equally spaced on the four sides of a square (400 × 400 μm). Threshold voltage was determined as the pulse amplitude required to evoke network-mediated ganglion cell spiking in a defined post stimulus time window in 50% of identical stimulus repetitions. For the two electrode materials threshold voltage, transferred charge at threshold, maximum current and the residual current at the end of the pulse were compared. Main results. Stimulation of retinal interneurons using PEDOT-CNT electrodes is achieved with lower stimulation voltage and requires lower charge transfer as compared to TiN. The key parameter for effective stimulation is a constant current over at least 0.5 ms, which is obtained by PEDOT-CNT electrodes at lower stimulation voltage due to its faradaic charge transfer mechanism. Significance. In neuroprosthetic implants, PEDOT-CNT may allow for smaller electrodes, effective stimulation in a safe voltage regime and lower energy-consumption. Our study also indicates, that the charge transferred at threshold or the charge injection capacity per se does not determine stimulation efficacy.

Design and simulation of maximum power point tracking (MPPT) system on solar module system using constant voltage (CV) method

NASA Astrophysics Data System (ADS)

Bhatara, Sevty Satria; Iskandar, Reza Fauzi; Kirom, M. Ramdlan

2016-02-01

Solar energy is one of renewable energy resource where needs a photovoltaic module to convert it into electrical energy. One of the problems on solar energy conversion is the process of battery charging. To improve efficiency of energy conversion, PV system needs another control method on battery charging called maximum power point tracking (MPPT). This paper report the study on charging optimation using constant voltage (CV) method. This method has a function of determining output voltage of the PV system on maximal condition, so PV system will always produce a maximal energy. A model represented a PV system with and without MPPT was developed using Simulink. PV system simulation showed a different outcome energy when different solar radiation and numbers of solar module were applied in the model. On the simulation of solar radiation 1000 W/m2, PV system with MPPT produces 252.66 Watt energy and PV system without MPPT produces 252.66 Watt energy. The larger the solar radiation, the greater the energy of PV modules was produced.

Josephson junctions of multiple superconducting wires

NASA Astrophysics Data System (ADS)

Deb, Oindrila; Sengupta, K.; Sen, Diptiman

2018-05-01

We study the spectrum of Andreev bound states and Josephson currents across a junction of N superconducting wires which may have s - or p -wave pairing symmetries and develop a scattering matrix based formalism which allows us to address transport across such junctions. For N ≥3 , it is well known that Berry curvature terms contribute to the Josephson currents; we chart out situations where such terms can have relatively large effects. For a system of three s -wave or three p -wave superconductors, we provide analytic expressions for the Andreev bound-state energies and study the Josephson currents in response to a constant voltage applied across one of the wires; we find that the integrated transconductance at zero temperature is quantized to integer multiples of 4 e2/h , where e is the electron charge and h =2 π ℏ is Planck's constant. For a sinusoidal current with frequency ω applied across one of the wires in the junction, we find that Shapiro plateaus appear in the time-averaged voltage across that wire for any rational fractional multiple (in contrast to only integer multiples in junctions of two wires) of 2 e /(ℏ ω ) . We also use our formalism to study junctions of two p -wave and one s -wave wires. We find that the corresponding Andreev bound-state energies depend on the spin of the Bogoliubov quasiparticles; this produces a net magnetic moment in such junctions. The time variation of these magnetic moments may be controlled by an external voltage applied across the junction. We discuss experiments which may test our theory.

System for improving measurement accuracy of transducer by measuring transducer temperature and resistance change using thermoelectric voltages

NASA Technical Reports Server (NTRS)

Anderson, Karl F. (Inventor); Parker, Allen R., Jr. (Inventor)

1993-01-01

A constant current loop measuring system measures a property including the temperature of a sensor responsive to an external condition being measured. The measuring system includes thermocouple conductors connected to the sensor, sensing first and second induced voltages responsive to the external condition. In addition, the measuring system includes a current generator and reverser generating a constant current, and supplying the constant current to the thermocouple conductors in forward and reverse directions generating first and second measured voltages, and a determining unit receiving the first and second measured voltages from the current generator and reverser, and determining the temperature of the sensor responsive to the first and second measured voltages.

The Modeling and Control of Acoustic/Structure Interaction Problems via Piezoceramic Actuators: 2-D Numerical Examples

DTIC Science & Technology

1992-04-01

the voltage applied to the it" patch, K ’ is a parameter which depends on the geometry and piezoceramic...in the state space II L 2(fQ) x L2 (F0 ). Here L2(Q) is the quotient space of L2 over the constant functions. The use of the quotient space results...form of the problem, we also define the Hilbert space V = fti(Q) x H(F 0 ) where h!(Q) is the quotient space of Il’ over the constant functions

Broadening of Distribution of Trap States in PbS Quantum Dot Field-Effect Transistors with High-k Dielectrics

PubMed Central

2017-01-01

We perform a quantitative analysis of the trap density of states (trap DOS) in PbS quantum dot field-effect transistors (QD-FETs), which utilize several polymer gate insulators with a wide range of dielectric constants. With increasing gate dielectric constant, we observe increasing trap DOS close to the lowest unoccupied molecular orbital (LUMO) of the QDs. In addition, this increase is also consistently followed by broadening of the trap DOS. We rationalize that the increase and broadening of the spectral trap distribution originate from dipolar disorder as well as polaronic interactions, which are appearing at strong dielectric polarization. Interestingly, the increased polaron-induced traps do not show any negative effect on the charge carrier mobility in our QD devices at the highest applied gate voltage, giving the possibility to fabricate efficient low-voltage QD devices without suppressing carrier transport. PMID:28084725

Flow-through electroporation based on constant voltage for large-volume transfection of cells.

PubMed

Geng, Tao; Zhan, Yihong; Wang, Hsiang-Yu; Witting, Scott R; Cornetta, Kenneth G; Lu, Chang

2010-05-21

Genetic modification of cells is a critical step involved in many cell therapy and gene therapy protocols. In these applications, cell samples of large volume (10(8)-10(9)cells) are often processed for transfection. This poses new challenges for current transfection methods and practices. Here we present a novel flow-through electroporation method for delivery of genes into cells at high flow rates (up to approximately 20 mL/min) based on disposable microfluidic chips, a syringe pump, and a low-cost direct current (DC) power supply that provides a constant voltage. By eliminating pulse generators used in conventional electroporation, we dramatically lowered the cost of the apparatus and improved the stability and consistency of the electroporation field for long-time operation. We tested the delivery of pEFGP-C1 plasmids encoding enhanced green fluorescent protein into Chinese hamster ovary (CHO-K1) cells in the devices of various dimensions and geometries. Cells were mixed with plasmids and then flowed through a fluidic channel continuously while a constant voltage was established across the device. Together with the applied voltage, the geometry and dimensions of the fluidic channel determined the electrical parameters of the electroporation. With the optimal design, approximately 75% of the viable CHO cells were transfected after the procedure. We also generalize the guidelines for scaling up these flow-through electroporation devices. We envision that this technique will serve as a generic and low-cost tool for a variety of clinical applications requiring large volume of transfected cells. Copyright 2010 Elsevier B.V. All rights reserved.

Engineer-able optical properties of trilayer graphene nanoribbon

NASA Astrophysics Data System (ADS)

Meshginqalam, Bahar; T, Hamid Toloue A.; Taghi Ahmadi, Mohammad; Sabatyan, Arash

2016-03-01

Graphene with a single atomic layer of carbon indicates two-dimensional behavior which plays an important role in sensor application, because of its high surface-to-volume ratio. Its interesting optical properties lead to low-cost and accurate optical devices as well. In the presented work trilayer graphene nanoribbon (TGN) with focus on its optical property for different incident wave lengths in the presence of applied voltage is explored. In low bias condition the optical conductance is modeled and dielectric constant and refractive index based on the estimated conductance are calculated theoretically; finally the obtained results are investigated numerically. Controllable optical properties supported by applied voltage on TGN are proved. Consequently, the proposed model indicates TGN as a possible candidate on surface plasmon based sensors, which needs to be explored.

Influence of anodization parameters on the morphology of TiO 2 nanotube arrays

NASA Astrophysics Data System (ADS)

Omidvar, Hamid; Goodarzi, Saba; Seif, Ahmad; Azadmehr, Amir R.

2011-07-01

TiO 2 nanotube arrays can be fabricated by electrochemical anodization in organic and inorganic electrolytes. Morphology of these nanotube arrays changes when anodization parameters such as applied voltage, type of electrolyte, time and temperature are varied. Nanotube arrays fabricated by anodization of commercial titanium in electrolytes containing NH 4F solution and either sulfuric or phosphoric acid were studied at room temperature; time of anodization was kept constant. Applied voltage, fluoride ion concentration, and acid concentrations were varied and their influences on TiO 2 nanotubes were investigated. The current density of anodizing was recorded by computer controlled digital multimeter. The surface morphology (top-view) of nanotube arrays were observed by SEM. The nanotube arrays in this study have inner diameters in range of 40-80 nm.

Transition from Townsend to radio-frequency homogeneous dielectric barrier discharge in a roll-to-roll configuration

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bazinette, R.; SIAME, Université de Pau et des Pays de l'Adour, Pau; Paillol, J.

The aim of this paper is to better understand the transition from Townsend to radio-frequency homogeneous dielectric barrier discharge (DBD) at atmospheric pressure. The study is done in an Ar/NH{sub 3} Penning mixture for an electrode configuration adapted to roll-to-roll plasma surface treatment. The study was led in a frequency range running from 50 kHz up to 8.3 MHz leading to different DBD modes with a 1 mm gas gap: Glow (GDBD), Townsend (TDBD), and Radio-frequency (RF-DBD). In the frequency range between TDBD and RF-DBD, from 250 kHz to 2.3 MHz, additional discharges are observed outside the inter-electrode gas gap. Because each high voltagemore » electrode are inside a dielectric barrel, these additional discharges occur on the side of the barrel where the gap is larger. They disappear when the RF-DBD mode is attained in the 1 mm inter-electrode gas gap, i.e., for frequencies equal or higher than 3 MHz. Fast imaging and optical emission spectroscopy show that the additional discharges are radio-frequency DBDs while the inter-electrode discharge is a TDBD. The RF-DBD discharge mode is attained when electrons drift becomes low enough compared to the voltage oscillation frequency to limit electron loss at the anode. To check that the additional discharges are due to a larger gas gap and a lower voltage amplitude, the TDBD/RF-DBD transition is investigated as a function of the gas gap and the applied voltage frequency and amplitude. Results show that the increase in the frequency at constant gas gap or in the gas gap at constant frequency allows to obtain RF-DBD instead of TDBD. At low frequency and large gap, the increase in the applied voltage allows RF-DBD/TDBD transition. As a consequence, an electrode configuration allowing different gap values is a solution to successively have different discharge modes with the same applied voltage.« less

Investigation of voltage source design's for Electrical Impedance Mammography (EIM) Systems.

PubMed

Qureshi, Tabassum R; Chatwin, Chris R; Zhou, Zhou; Li, Nan; Wang, W

2012-01-01

According to Jossient, interesting characteristics of breast tissues mostly lie above 1MHz; therefore a wideband excitation source covering higher frequencies (i.e. above 1MHz) is required. The main objective of this research is to establish a feasible bandwidth envelope that can be used to design a constant EIM voltage source over a wide bandwidth with low output impedance for practical implementation. An excitation source is one of the major components in bio-impedance measurement systems. In any bio-impedance measurement system the excitation source can be achieved either by injecting current and measuring the resulting voltages, or by applying voltages and measuring the current developed. This paper describes three voltage source architectures and based on their bandwidth comparison; a differential voltage controlled voltage source (VCVS) is proposed, which can be used over a wide bandwidth (>15MHz). This paper describes the performance of the designed EIM voltage source for different load conditions and load capacitances reporting signal-to-noise ratio of approx 90dB at 10MHz frequency, signal phase and maximum of 4.75kΩ source output impedance at 10MHz. Optimum data obtained using Pspice® is used to demonstrate the high-bandwidth performance of the source.

Mechanism of formation of subnanosecond current front in high-voltage pulse open discharge

NASA Astrophysics Data System (ADS)

Schweigert, I. V.; Alexandrov, A. L.; Zakrevsky, Dm. E.; Bokhan, P. A.

2014-11-01

The mechanism of subnanosecond current front rise observed previously in the experiment in high-voltage pulse open discharge in helium is studied in kinetic particle-in-cell simulations. The Boltzmann equations for electrons, ions, and fast atoms are solved self-consistently with the Poisson equations for the electrical potential. The partial contributions to the secondary electron emission from the ions, fast atoms, photons, and electrons, bombarding the electrode, are calculated. In simulations, as in the experiment, the discharge glows between two symmetrical cathodes and the anode grid in the midplane at P =6 Torr and the applied voltage of 20 kV. The electron avalanche development is considered for two experimental situations during the last stage of breakdown: (i) with constant voltage and (ii) with decreasing voltage. For case (i), the subnanosecond current front rise is set by photons from the collisional excitation transfer reactions. For the case (ii), the energetic electrons swamp the cathode during voltage drop and provide the secondary electron emission for the subnanosecond current rise, observed in the experiment.

Power-control switch

NASA Technical Reports Server (NTRS)

Kessler, L. L.

1976-01-01

Constant-current source creates drive current independent of input-voltage variations, 50% reduction in power loss in base drive circuitry, maintains essentially constant charge rate, and improves rise-time consistency over input voltage range.

Biosensing in a microelectrofluidic system using optical whispering-gallery mode spectroscopy

PubMed Central

Huang, Lei; Guo, Zhixiong

2011-01-01

Label-free detection of biomolecules using an optical whispering-gallery mode sensor in a microelectrofluidic channel is simulated. Negatively charged bovine serum albumin is considered as the model protein analyte. The analyte transport in aqueous solution is controlled by an externally applied electrical field. The finite element method is employed for solving the equations of the charged species transport, the Poisson equation of electric potential, the equations of conservation of momentum and energy, and the Helmholtz equations of electromagnetic waves. The adsorption process of the protein molecules on the microsensor head surface is monitored by the resonance frequency shifts. Frequency shift caused by temperature variation due to Joule heating is analyzed and found to be negligible. The induced shifts behave in a manner similar to Langmuir-like adsorption kinetics; but the time constant increases due to the presence of the external electrical field. A correlation of the frequency shift, the analyte feed concentration in the solution, and the applied voltage gradient is obtained, in which an excellent linear relationship between the frequency shift and the analyte concentration is revealed. The applied voltage gradient enhances significantly the analyte concentration in the vicinity of the sensor surface; thus, the sensor sensitivity which has a power function of the voltage gradient with exponent 2.85 in the controlled voltage range. Simulated detection of extremely low protein concentration to the pico-molar level is carried out. PMID:22662041

Stress-Dependent Voltage Offsets From Polymer Insulators Used in Rock Mechanics and Material Testing

NASA Technical Reports Server (NTRS)

Carlson, G. G.; Dahlgren, Robert; Gray, Amber; Vanderbilt, V. C.; Freund, F.; Johnston, M. J.; Dunson, C.

2013-01-01

Dielectric insulators are used in a variety of laboratory settings when performing experiments in rock mechanics, petrology, and electromagnetic studies of rocks in the fields of geophysics,material science, and civil engineering. These components may be used to electrically isolate geological samples from the experimental equipment, to perform a mechanical compliance function between brittle samples and the loading equipment, to match ultrasonic transducers, or perform other functions. In manyexperimental configurations the insulators bear the full brunt of force applied to the sample but do not need to withstand high voltages, therefore the insulators are often thin sheets of mechanically tough polymers. From an instrument perspective, transduction from various types of mechanical perturbation has beenqualitatively compared for a number of polymers [1, 2] and these error sources are readily apparent duringhigh-impedance measurements if not mitigated. However even when following best practices, a force dependent voltage signal still remains and its behavior is explored in this presentation. In this experimenttwo thin sheets (0.25 mm) of high-density polyethylene (HDPE) were set up in a stack, held alternatelybetween three aluminum bars; this stack was placed on the platen of a 60T capacity hydraulic testingmachine. The surface area, A, over which the force is applied to the PE sheets in this sandwich is roughly 40 square cm, each sheet forming a parallel-plate capacitor having roughly 320 pF [3], assuming therelative dielectric permittivity of PE is approximately 2.3. The outer two aluminum bars were connected to the LO input ofthe electrometer and the central aluminum bar was connected to the HI input of a Keithley model 617 electrometer. Once the stack is mechanically well-seated with no air gaps, the voltage offset is observed tobe a linear function of the baseline voltage for a given change in applied force. For a periodically appliedforce of 66.7 kN the voltage offsets were measured as a function of initial voltage, and these data were fitwith a linear function that was constrained to pass through the origin. The best fit solution had a correlation coefficient of R=0.85 and a slope of approximately -0.0228 volts/volt. The voltage offset when normalizedis demonstrated to be constant -2.28% for both positive and negative polarities over nearly 3 orders ofbaseline voltage magnitude. From this, the voltage-force coefficient is derived to be -0.34 ppm/N. Thiscorrelates well to a first-order parallel plate capacitor model that assumes constant area, and smalldeformation such that the polymer may be mechanically modeled by a spring that obeys Hookes law. Thissimple model predicts that the coefficient of proportionality is a function of Youngs modulus E= 0.8 GPaand surface area of the insulator, theoretically -1EA= -0.31 ppm/N. The outcome of this work is animproved insulator made from ultra-high molecular weight (UHMW) polyethylene and other approachestoward the minimization of and compensation for these experimental artifacts.

Voltage sensor and dielectric material

DOEpatents

Yakymyshyn, Christopher Paul; Yakymyshyn, Pamela Jane; Brubaker, Michael Allen

2006-10-17

A voltage sensor is described that consists of an arrangement of impedance elements. The sensor is optimized to provide an output ratio that is substantially immune to changes in voltage, temperature variations or aging. Also disclosed is a material with a large and stable dielectric constant. The dielectric constant can be tailored to vary with position or direction in the material.

Energy consumption analysis of constant voltage and constant current operations in capacitive deionization

DOE PAGES

Qu, Yatian; Campbell, Patrick G.; Gu, Lei; ...

2016-09-21

Here we report our studies to compare energy consumption of a CDI cell in constant voltage (CV) and constant current (CC) operations, with a focus on understanding the underlying physics of consumption patterns. The comparison is conducted under conditions that the CV and CC operations result in the same amounts of input charge and within identical charging phase durations. We present two electrical circuit models to simulate energy consumption in charging phase: one is a simple RC circuit model, and the other a transmission line circuit model. We built and tested a CDI cell to validate the transmission line model,more » and performed a series of experiments to compare CV versus CC operation under the condition of equal applied charge and charging duration. The experiments show that CC mode consumes energy at 33.8 kJ per mole of ions removed, which is only 28% of CV mode energy consumption (120.6 kJ/mol), but achieves similar level of salt removals. Lastly, together, the models and experiment support our major conclusion that CC is more energy efficient than CV for equal charge and charging duration. The models also suggest that the lower energy consumption of CC in charging is due to its lower resistive dissipation.« less

Energy consumption analysis of constant voltage and constant current operations in capacitive deionization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qu, Yatian; Campbell, Patrick G.; Gu, Lei

Here we report our studies to compare energy consumption of a CDI cell in constant voltage (CV) and constant current (CC) operations, with a focus on understanding the underlying physics of consumption patterns. The comparison is conducted under conditions that the CV and CC operations result in the same amounts of input charge and within identical charging phase durations. We present two electrical circuit models to simulate energy consumption in charging phase: one is a simple RC circuit model, and the other a transmission line circuit model. We built and tested a CDI cell to validate the transmission line model,more » and performed a series of experiments to compare CV versus CC operation under the condition of equal applied charge and charging duration. The experiments show that CC mode consumes energy at 33.8 kJ per mole of ions removed, which is only 28% of CV mode energy consumption (120.6 kJ/mol), but achieves similar level of salt removals. Lastly, together, the models and experiment support our major conclusion that CC is more energy efficient than CV for equal charge and charging duration. The models also suggest that the lower energy consumption of CC in charging is due to its lower resistive dissipation.« less

Switching synchronization in one-dimensional memristive networks

NASA Astrophysics Data System (ADS)

Slipko, Valeriy A.; Shumovskyi, Mykola; Pershin, Yuriy V.

2015-11-01

We report on a switching synchronization phenomenon in one-dimensional memristive networks, which occurs when several memristive systems with different switching constants are switched from the high- to low-resistance state. Our numerical simulations show that such a collective behavior is especially pronounced when the applied voltage slightly exceeds the combined threshold voltage of memristive systems. Moreover, a finite increase in the network switching time is found compared to the average switching time of individual systems. An analytical model is presented to explain our observations. Using this model, we have derived asymptotic expressions for memory resistances at short and long times, which are in excellent agreement with results of our numerical simulations.

Electrophoretic deposition (EPD): Mechanisms, kinetics, and application to ceramics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sarkar, P.; Nicholson, P.S.

1996-08-01

The mechanisms of electrophoretic deposition (EPD) are discussed and their shortcomings identified. The kinetics of the processes involved are analyzed for constant-current and constant-voltage conditions. A method of determining the Hamaker constant of suspended particles is developed by modeling the relationship between the particle interaction energy and the suspension stability. A three-probe dc technique is used to map the voltage profile around the depositing electrode, and the results are used to explain discrepancies between the calculated and experimentally observed voltage drops during deposition. A mechanism of deposition is proposed based on DLVO theory and particle double-layer distortion/thinning on application ofmore » a dc field to the suspension. Kinetic equations are developed for constant-current and constant-voltage EPD using mass balance conditions; these are verified by experiments. After the phenomenon is introduced and discussed, a critique of the application of EPD to the synthesis of ceramic shapes and coatings is given.« less

A Hybrid Maximum Power Point Tracking Method for Automobile Exhaust Thermoelectric Generator

NASA Astrophysics Data System (ADS)

Quan, Rui; Zhou, Wei; Yang, Guangyou; Quan, Shuhai

2017-05-01

To make full use of the maximum output power of automobile exhaust thermoelectric generator (AETEG) based on Bi2Te3 thermoelectric modules (TEMs), taking into account the advantages and disadvantages of existing maximum power point tracking methods, and according to the output characteristics of TEMs, a hybrid maximum power point tracking method combining perturb and observe (P&O) algorithm, quadratic interpolation and constant voltage tracking method was put forward in this paper. Firstly, it searched the maximum power point with P&O algorithms and a quadratic interpolation method, then, it forced the AETEG to work at its maximum power point with constant voltage tracking. A synchronous buck converter and controller were implemented in the electric bus of the AETEG applied in a military sports utility vehicle, and the whole system was modeled and simulated with a MATLAB/Simulink environment. Simulation results demonstrate that the maximum output power of the AETEG based on the proposed hybrid method is increased by about 3.0% and 3.7% compared with that using only the P&O algorithm and the quadratic interpolation method, respectively. The shorter tracking time is only 1.4 s, which is reduced by half compared with that of the P&O algorithm and quadratic interpolation method, respectively. The experimental results demonstrate that the tracked maximum power is approximately equal to the real value using the proposed hybrid method,and it can preferentially deal with the voltage fluctuation of the AETEG with only P&O algorithm, and resolve the issue that its working point can barely be adjusted only with constant voltage tracking when the operation conditions change.

An investigation on the effects of air on electron energy in atmospheric pressure helium plasma jets

NASA Astrophysics Data System (ADS)

Liu, Yadi; Tan, Zhenyu; Chen, Xinxian; Li, Xiaotong; Zhang, Huimin; Pan, Jie; Wang, Xiaolong

2018-03-01

In this work, the effects of air on electron energy in the atmospheric pressure helium plasma jet produced by a needle-plane discharge system have been investigated by means of the numerical simulation based on a two-dimensional fluid model, and the air concentration dependences of the reactive species densities have also been calculated. In addition, the synergistic effects of the applied voltage and air concentration on electron energy have been explored. The present work gives the following significant results. For a fixed applied voltage, the averaged electron energy is basically a constant at air concentrations below about 0.5%, but it evidently decreases above the concentration of 0.5%. Furthermore, the averaged densities of four main reactive species O, O(1D), O2(1Δg), and N2(A3Σu+) increase with the increasing air concentration, but the increase becomes slow at air concentrations above 0.5%. The air concentration dependences of the averaged electron energy under different voltage amplitudes are similar, and for a given air concentration, the averaged electron energy increases with the increase in the voltage amplitude. For the four reactive species, the effects of the air concentration on their averaged densities are similar for a given voltage amplitude. In addition, the averaged densities of the four reactive species increase with increasing voltage amplitude for a fixed air concentration. The present work suggests that a combination of high voltage amplitude and the characteristic air concentration, 0.5% in the present discharge system, allows an expected electron energy and also generates abundant reactive species.

Spatial orientation and electric-field-driven transport of hypericin inside of bilayer lipid membranes.

PubMed

Strejčková, Alena; Staničová, Jana; Jancura, Daniel; Miškovský, Pavol; Bánó, Gregor

2013-02-07

Fluorescence experiments were carried out to investigate the interaction of hypericin (Hyp), a natural hydrophobic photosensitizer, with artificial bilayer lipid membranes. The spatial orientation of Hyp monomers incorporated in diphytanoyl phosphatidylcholine (DPhPC) membranes was determined by measuring the dependence of the Hyp fluorescence intensity on the angle of incidence of p- and s-polarized excitation laser beams. Inside of the membrane, Hyp monomers are preferentially located in the layers near the membrane/water interface and are oriented with the S(1) ← S(0) transition dipole moments perpendicular to the membrane surface. Transport of Hyp anions between the two opposite sides of the lipid bilayer was induced by applying rectangular electric field pulses to the membrane. The characteristic time for Hyp transport through the membrane center was evaluated by the analysis of the Hyp fluorescence signal during the voltage pulses. In the zero-voltage limit, the transport time approached 70 ms and gradually decreased with higher voltage applied to the membrane. In addition, our measurements indicated an apparent pK(a) constant of 8 for Hyp deprotonation in the membrane.

Processing Ti-25Ta-5Zr Bioalloy via Anodic Oxidation Procedure at High Voltage

NASA Astrophysics Data System (ADS)

Ionita, Daniela; Grecu, Mihaela; Dilea, Mirela; Cojocaru, Vasile Danut; Demetrescu, Ioana

2011-12-01

The current paper reports the processing of Ti-25Ta-5Zr bioalloy via anodic oxidation in NH4BF4 solution under constant potentiostatic conditions at high voltage to obtain more suitable properties for biomedical application. The maximum efficiency of the procedure is reached at highest applied voltage, when the corrosion rate in Hank's solution is decreased approxomately six times. The topography of the anodic layer has been studied using atomic force microscopy (AFM), and the results indicated that the anodic oxidation process increases the surface roughness. The AFM images indicated a different porosity for the anodized surfaces as well. After anodizing, the hydrophilic character of Ti-25Ta-5Zr samples has increased. A good correlation between corrosion rate obtained from potentiodynamic curves and corrosion rate from ions release analysis was obtained.

Impact of magnetite nanoparticle incorporation on optical and electrical properties of nanocomposite LbL assemblies.

PubMed

Yashchenok, Alexey M; Gorin, Dmitry A; Badylevich, Mikhail; Serdobintsev, Alexey A; Bedard, Matthieu; Fedorenko, Yanina G; Khomutov, Gennady B; Grigoriev, Dmitri O; Möhwald, Helmuth

2010-09-21

Optical and electrical properties of polyelectrolyte/iron oxide nanocomposite planar films on silicon substrates were investigated for different amount of iron oxide nanoparticles incorporated in the films. The nanocomposite assemblies prepared by the layer-by-layer assembly technique were characterized by ellipsometry, atomic force microscopy, and secondary ion mass-spectrometry. Absorption spectra of the films reveal a shift of the optical absorption edge to higher energy when the number of deposited layers decreases. Capacitance-voltage and current-voltage measurements were applied to study the electrical properties of metal-oxide-semiconductor structures prepared by thermal evaporation of gold electrodes on nanocomposite films. The capacitance-voltage measurements show that the dielectric constant of the film increases with the number of deposited layers and the fixed charge and the trapped charge densities have a negative sign.

Influence of the piezoelectric parameters on the dynamics of an active rotor

NASA Astrophysics Data System (ADS)

Gawryluk, Jarosław; Mitura, Andrzej; Teter, Andrzej

2018-01-01

The main aim of this paper is an experimental and numerical analysis of the dynamic behavior of an active rotor with three composite blades. The study focuses on developing an effective FE modeling technique of a macro fiber composite element (denoted as MFC or active element) for the dynamic tests of active structures. The active rotor under consideration consists of a hub with a drive shaft, three grips and three glass-epoxy laminate blades with embedded active elements. A simplified FE model of the macro fiber composite element exhibiting the d33 piezoelectric effect is developed using the Abaqus software package. The discussed transducer is modeled as quasi-homogeneous piezoelectric material, and voltage is applied to the opposite faces of the element. In this case, the effective (equivalent) piezoelectric constant d33* is specified. Both static and dynamic tests are performed to verify the proposed model. First, static deflections of the active blade caused by the voltage signal are determined by numerical and experimental analyses. Next, a numerical modal analysis of the active rotor is performed. The eigenmodes and corresponding eigenfrequencies are determined by the Lanczos method. The influence of the model parameters (i.e., the effective piezoelectric constant d33 *, voltage signal, angular velocity) on the dynamics of the active rotor is examined. Finally, selected numerical results are validated in experimental tests. The experimental findings demonstrate that the structural stiffening effect caused by the active element strongly depends on the value of the effective piezoelectric constant.

Pressurised electro-osmotic dewatering of activated and anaerobically digested sludges: electrical variables analysis.

PubMed

Citeau, M; Olivier, J; Mahmoud, A; Vaxelaire, J; Larue, O; Vorobiev, E

2012-09-15

Pressurised electro-osmotic dewatering (PEOD) of two sewage sludges (activated and anaerobically digested) was studied under constant electric current (C.C.) and constant voltage (C.V.) with a laboratory chamber simulating closely an industrial filter. The influence of sludge characteristics, process parameters, and electrode/filter cloth position was investigated. The next parameters were tested: 40 and 80 A/m², 20, 30, and 50 V-for digested sludge dewatering; and 20, 40 and 80 A/m², 20, 30, and 50 V-for activated sludge dewatering. Effects of filter cloth electric resistance and initial cake thickness were also investigated. The application of PEOD provides a gain of 12 points of dry solids content for the digested sludge (47.0% w/w) and for the activated sludge (31.7% w/w). In PEOD processed at C.C. or at C.V., the dewatering flow rate was similar for the same electric field intensity. In C.C. mode, both the electric resistance of cake and voltage increase, causing a temperature rise by ohmic effect. In C.V. mode, a current intensity peak was observed in the earlier dewatering period. Applying at first a constant current and later on a constant voltage, permitted to have better control of ohmic heating effect. The dewatering rate was not significantly affected by the presence of filter cloth on electrodes, but the use of a thin filter cloth reduced remarkably the energy consumption compared to a thicker one: 69% of reduction energy input at 45% w/w of dry solids content. The reduction of the initial cake thickness is advantageous to increase the final dry solids content. Copyright © 2012 Elsevier Ltd. All rights reserved.

Polarization and Fowler-Nordheim tunneling in anodized Al-Al2O3-Au diodes

NASA Astrophysics Data System (ADS)

Hickmott, T. W.

2000-06-01

Polarization in anodic Al2O3 films is measured by using quasi-dc current-voltage (I-V) curves of Al-Al2O3-Au diodes. A reproducible polarization state is established by applying a negative voltage to the Au electrode of a rectifying Al-Al2O3-Au diode. The difference between subsequent I-V curves with Au positive is a measure of polarization in the sample. The magnitude of polarization charge in Al2O3 depends on the anodizing electrolyte. Al2O3 films formed in H2O-based electrolytes have approximately ten times the polarization charge of Al2O3 films formed in ethylene glycol-based electrolyte. Anodizing conditions that produce greater polarizing charge in anodic Al2O3 result in voltage-time curves during anodization under galvanostatic conditions that are nonlinear. Anodic films with greater polarizing charge also have a greater apparent interface capacitance which is independent of Al2O3 thickness. I-V curves of Al-Al2O3-Au diodes for increasing voltage are dominated by polarization. I-V curves for decreasing voltage are reproducible and parallel but depend on the maximum current and voltage reached during the measurement. There is no single current corresponding to a given voltage. I-V curves for decreasing voltage are analyzed assuming that the conduction mechanism is Fowler-Nordheim (FN) tunneling. There is a qualitative difference between the FN tunneling parameters for Al2O3 films formed in H2O-based electrolytes and those formed in ethylene glycol-based electrolyte. For the former the value of the exponential term in the FN analysis increases as the value of maximum voltage and current in an I-V characteristic increases, while the value of the pre-exponential term is nearly constant. For the latter, the exponential term is nearly constant as maximum voltage and current increase, but the pre-exponential term decreases by about 5 decades. Thus polarization charge incorporated during formation of anodized Al2O3 strongly affects the formation of the insulating film, the stability of the films under bias, and their conduction characteristics.

Stress-dependent voltage offsets from polymer insulators used in rock mechanics and material testing

NASA Astrophysics Data System (ADS)

Carlson, G. G.; Dahlgren, R.; Vanderbilt, V. C.; Johnston, M. J.; Dunson, C.; Gray, A.; Freund, F.

2013-12-01

Dielectric insulators are used in a variety of laboratory settings when performing experiments in rock mechanics, petrology, and electromagnetic studies of rocks in the fields of geophysics, material science, and civil engineering. These components may be used to electrically isolate geological samples from the experimental equipment, to perform a mechanical compliance function between brittle samples and the loading equipment, to match ultrasonic transducers, or perform other functions. In many experimental configurations the insulators bear the full brunt of force applied to the sample but do not need to withstand high voltages, therefore the insulators are often thin sheets of mechanically tough polymers. From an instrument perspective, transduction from various types of mechanical perturbation has been qualitatively compared for a number of polymers [1, 2] and these error sources are readily apparent during high-impedance measurements if not mitigated. However even when following best practices, a force-dependent voltage signal still remains and its behavior is explored in this presentation. In this experiment two thin sheets (0.25 mm) of high-density polyethylene (HDPE) were set up in a stack, held alternately between three aluminum bars; this stack was placed on the platen of a 60T capacity hydraulic testing machine. The surface area, A, over which the force is applied to the PE sheets in this sandwich is roughly 40 square cm, each sheet forming a parallel-plate capacitor having roughly 320 pF [3], assuming the relative dielectric permittivity of PE is ~2.3. The outer two aluminum bars were connected to the LO input of the electrometer and the central aluminum bar was connected to the HI input of a Keithley model 617 electrometer. Once the stack is mechanically well-seated with no air gaps, the voltage offset is observed to be a linear function of the baseline voltage for a given change in applied force. For a periodically applied force of 66.7 kN the voltage offsets were measured as a function of initial voltage, and these data were fit with a linear function that was constrained to pass through the origin. The best fit solution had a correlation coefficient of R = 0.85 and a slope of approximately -0.0228 volts/volt. The voltage offset when normalized is demonstrated to be constant -2.28 % for both positive and negative polarities over nearly 3 orders of baseline voltage magnitude. From this, the voltage-force coefficient is derived to be -0.34 ppm/N. This correlates well to a first-order parallel plate capacitor model that assumes constant area, and small deformation such that the polymer may be mechanically modeled by a spring that obeys Hooke's law. This simple model predicts that the coefficient of proportionality is a function of Young's modulus E = 0.8 GPa and surface area of the insulator, theoretically -1/EA = -0.31 ppm/N. The outcome of this work is an improved insulator made from ultra-high molecular weight (UHMW) polyethylene and other approaches toward the minimization of and compensation for these experimental artifacts. References: [1] Keithley Instruments, Low level measurements handbook, 'Choosing the best insulator,' 2-11 (2004). [2] Ibid., 2-26. [3] A. Skumiel, 'How to transform mechanical work into electrical energy using a capacitor,' European Journal of Physics 32, 625-630 (2011).

Highly stable field emission from ZnO nanowire field emitters controlled by an amorphous indium–gallium–zinc-oxide thin film transistor

NASA Astrophysics Data System (ADS)

Li, Xiaojie; Wang, Ying; Zhang, Zhipeng; Ou, Hai; She, Juncong; Deng, Shaozhi; Xu, Ningsheng; Chen, Jun

2018-04-01

Lowering the driving voltage and improving the stability of nanowire field emitters are essential for them to be applied in devices. In this study the characteristics of zinc oxide (ZnO) nanowire field emitter arrays (FEAs) controlled by an amorphous indium–gallium–zinc-oxide thin film transistor (a-IGZO TFT) were studied. A low driving voltage along with stabilization of the field emission current were achieved. Modulation of field emission currents up to three orders of magnitude was achieved at a gate voltage of 0–32 V for a constant anode voltage. Additionally, a-IGZO TFT control can dramatically reduce the emission current fluctuation (i.e., from 46.11 to 1.79% at an emission current of ∼3.7 µA). Both the a-IGZO TFT and ZnO nanowire FEAs were prepared on glass substrates in our research, demonstrating the feasibility of realizing large area a-IGZO TFT-controlled ZnO nanowire FEAs.

Determination of set potential voltages for cucumber mosaic virus detection using screen printed carbon electrode

NASA Astrophysics Data System (ADS)

Uda, M. N. A.; Hasfalina, C. M.; Samsuzana, A. A.; Faridah, S.; Rafidah A., R.; Hashim, U.; Ariffin, Shahrul A. B.; Gopinath, Subash C. B.

2017-03-01

Cucumber Mosaic Virus (CMV) is a most dangerous pathogen among the cucurbit plant which it striking cucumbers, zucchinis, squashes, watermelons but it also striking to non-cucurbit such as peppers, tobaccos, celeries, beans and tomatoes. Symptoms shown by this virus when they starting to strike are very significant and at the end can kill the hosts they infected. In order to detect these viruses, biosensor such as screen-printed carbon electrode (SPCE) is developed and fixes a set potential voltage is defined using Chronoamperometry (CM) immunosensor technique. For short introduction, CM is a process which is a constant applied potential voltage between the working and reference electrode is maintained in order to create an electrons transfer for the oxidation or reduction species taking place at the surface of working electrode is measured and in this manuscript, complete details about measurement were used to finding the stable set potential voltages will be pointed out.

Inverter for Interchangeable Use as Current Source Inverter and Voltage Source Inverter for Interconnecting to Grid

NASA Astrophysics Data System (ADS)

Teruya, Daisuke; Masukawa, Shigeo; Iida, Shoji

We propose a novel inverter that can be operated either as a Current Source Inverter (CSI) or as a Voltage Source Inverter (VSI) by changing only the control signals. It is proper to apply it to the interconnecting system with renewal energy, such as photovoltaic cells or wind generation systems, to a grid. This inverter is usually operated as the CSI connected to the grid. Even if the energy source has a lower voltage than the grid, the energy can be supplied to the grid through the proposed inverter. The power factor can be briefly maintained at almost unity. When power supply from the grid is interrupted, the proposed circuit should be operated as the VSI in the stand-alone operation mode. In this way, the circuit can maintain a constant output voltage to the loads. In this paper, the proposed circuit configuration and the control schemes for both the CSI and the VSI are described. Further, the circuit characteristics for both are discussed experimentally.

Development of new force sensor using super-multilayer alternating laminated film comprising piezoelectric poly(l-lactic acid) and poly(d-lactic acid) films in the shape of a rectangle with round corners

NASA Astrophysics Data System (ADS)

Tajitsu, Yoshiro; Adachi, Yu; Nakatsuji, Takahiro; Tamura, Masataka; Sakamoto, Kousei; Tone, Takaaki; Imoto, Kenji; Kato, Atsuko; Yoshida, Testuo

2017-10-01

A new super-multilayer alternating laminated film in the shape of a rectangle with round corners has been developed. The super-multilayer film, which comprised piezoelectric poly(l-lactic acid) (PLLA) and poly(d-lactic acid) (PDLA) films, was wound with the number of turns on the order of from 100 to 1000 to form piezoelectric rolls. These piezoelectric rolls could generate an induced voltage of more than 95% of the initial voltage for over 10 s when a constant load was applied. The desired duration and magnitude of the piezoelectric response voltage were realized by adjusting the number of turns of the piezoelectric rolls. Similarly to many other conventional piezoelectrics, the piezoelectric rolls enable instantaneous load-dependent voltage generation and attenuation. The piezoelectric rolls are also lighter than conventional piezoelectric ceramics and can be used as a novel pressure sensor.

Characterization of applied fields for ion mobility in traveling wave based structures for lossless ion manipulations (SLIM)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hamid, Ahmed M.; Prabhakaran Nair Syamala Amma, Aneesh; Garimella, Venkata BS

2018-03-21

Ion mobility (IM) is rapidly gaining attention for the analysis of biomolecules due to the ability to distinguish the shapes of ions. However, conventional constant electric field drift tube IM has limited resolving power, constrained by practical limitations on the path length and maximum applied voltage. The implementation of traveling waves (TW) in IM removes the latter limitation, allowing higher resolution to be achieved using extended path lengths. These can be readily obtainable in structures for lossless ion manipulations (SLIM), which are fabricated from electric fields that are generated by appropriate potentials applied to arrays of electrodes patterned on twomore » parallel surfaces. In this work we have investigated the relationship between the various SLIM variables, such as electrode dimensions, inter-surface gap, and the TW applied voltages, that directly impact the fields experienced by ions. Ion simulation and theoretical calculations have been utilized to understand the dependence of SLIM geometry and effective electric field. The variables explored impact both ion confinement and the observed IM resolution in Structures for Lossless Ion Manipulations (SLIM) modules.« less

Characterization of applied fields for ion mobility separations in traveling wave based structures for lossless ion manipulations (SLIM)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hamid, Ahmed M.; Prabhakaran, Aneesh; Garimella, Sandilya V. B.

Ion mobility (IM) is rapidly gaining attention for the analysis of biomolecules due to the ability to distinguish the shapes of ions. However, conventional constant electric field drift tube IM has limited resolving power, constrained by practical limitations on the path length and maximum applied voltage. The implementation of traveling waves (TW) in IM removes the latter limitation, allowing higher resolution to be achieved using extended path lengths. These can be readily obtainable in structures for lossless ion manipulations (SLIM), which are fabricated from electric fields that are generated by appropriate potentials applied to arrays of electrodes patterned on twomore » parallel surfaces. In this work we have investigated the relationship between the various SLIM variables, such as electrode dimensions, inter-surface gap, and the TW applied voltages, that directly impact the fields experienced by ions. Ion simulation and theoretical calculations have been utilized to understand the dependence of SLIM geometry and effective electric field. The variables explored impact both ion confinement and the observed IM resolution in Structures for Lossless Ion Manipulations (SLIM) modules.« less

Noise analysis and relaxation experiments of transport of hydrophobic anions across lipid membranes at equilibrium and nonequilibrium.

PubMed

Junges, R; Kolb, H A

1983-06-01

Under equilibrium and nonequilibrium steady-state conditions, the spectral intensity of current noise SJ(f) generated by the transport of hydrophobic anions across lipid bilayer membranes was investigated. The experimental results were compared with different reaction models. SJ(f) showed a characteristic increase proportional to f2 between frequency-independent tails at low and high frequencies. This gradient was found to be independent of applied voltage which indicates the contribution of a single voltage-dependent reaction step of ion translocation across the membrane. From the shape of SJ(f) at low frequencies the rate constant of ion desorption from the membrane into the aqueous phase could be estimated. Unambiguous evidence for the application of a general model, which includes the coupling of slow ion diffusion in the aqueous phase to ion adsorption/desorption at the membrane interface, could not be obtained from the low-frequency shape of SJ(f). The shot noise of this ion transport determines the amplitude of SJ(f) at high frequencies which decreases with increasing voltage applied. Analysis of voltage-jump current-relaxation experiments and of current noise carried out on one membrane yielded significant differences of the derived ion partition coefficient. This deviation is qualitatively described on the basis of incomplete reaction steps.

Constant-Current Source For Measuring Low Resistances

NASA Technical Reports Server (NTRS)

Toomath, Robert L.

1996-01-01

Constant-current source constructed for measuring electrical resistances up to few ohms in power-supply equipment. By setting current at 1 A and measuring resulting voltage drop across item under test, one obtains voltage reading numerically equal to resistance in ohms.

Characteristics of space charge formed in a laminated LDPE/EVA dielectric under DC stress

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tanaka, Toshikatsu; Kisanuki, Osamu; Sakata, Masataka

1996-12-31

A laser-induced pressure pulse (LIPP) method was used for measuring the space charge distribution of LDPE/EVA laminate dielectrics under dc stress. The constant voltage up to {+-}20 kV was applied to a side of the laminates of 0.5 mm thickness for 30 minutes. The other side is grounded. When the amount of space charge was measured by LIPP, both sides were virtually grounded. Space charge built up in or near the interface between LDPE and EVA was mainly investigated. Positive and negative voltage was applied to the side of LDPE in the laminates. It was clarified that the space chargemore » was larger in case of LDPE negatively biased than in case of LDPE positively biased. The density of the space charge ranged around 1 nC/mm{sup 3}. The formation of interfacial space charge is analyzed.« less

Random pulse generator

NASA Technical Reports Server (NTRS)

Lindsey, R. S., Jr. (Inventor)

1975-01-01

An exemplary embodiment of the present invention provides a source of random width and random spaced rectangular voltage pulses whose mean or average frequency of operation is controllable within prescribed limits of about 10 hertz to 1 megahertz. A pair of thin-film metal resistors are used to provide a differential white noise voltage pulse source. Pulse shaping and amplification circuitry provide relatively short duration pulses of constant amplitude which are applied to anti-bounce logic circuitry to prevent ringing effects. The pulse outputs from the anti-bounce circuits are then used to control two one-shot multivibrators whose output comprises the random length and random spaced rectangular pulses. Means are provided for monitoring, calibrating and evaluating the relative randomness of the generator.

Determining resistivity of a formation adjacent to a borehole having casing by generating constant current flow in portion of casing and using at least two voltage measurement electrodes

DOEpatents

Vail, III, William Banning

2000-01-01

Methods of operation of different types of multiple electrode apparatus vertically disposed in a cased well to measure information related to the resistivity of adjacent geological formations from within the cased well are described. The multiple electrode apparatus has a minimum of two spaced apart voltage measurement electrodes that electrically engage a first portion of the interior of the cased well and that provide at least first voltage information. Current control means are used to control the magnitude of any selected current that flows along a second portion of the interior of the casing to be equal to a predetermined selected constant. The first portion of the interior of the cased well is spaced apart from the second portion of the interior of the cased well. The first voltage information and the predetermined selected constant value of any selected current flowing along the casing are used in part to determine a magnitude related to the formation resistivity adjacent to the first portion of the interior of the cased well. Methods and apparatus having a plurality of voltage measurement electrodes are disclosed that provide voltage related information in the presence of constant currents flowing along the casing which is used to provide formation resistivity.

A method for analyzing electrical impedance spectroscopy data from breast cancer patients

PubMed Central

Kim, Bong Seok; Isaacson, David; Xia, Hongjun; Kao, Tzu-Jen; Newell, Jonathan C; Saulnier, Gary J

2008-01-01

Research on freshly-excised malignant breast tissues and surrounding normal tissues in an in vitro impedance cell has shown that breast tumors have different conductivity and permittivity from normal or non-malignant tissues. This contrast may provide a basis for breast cancer detection using electrical impedance imaging. This paper describes a procedure for collecting electrical impedance spectroscopy data simultaneously and in register with tomosynthesis data from patients. We describe the methods used to analyze the data in order to determine if the electrodes are making contact with the breast of the patient. Canonical voltage patterns are applied and used to synthesize the data that would have resulted from constant voltage patterns applied to each of two parallel mammography plates. A type of Cole–Cole plot is generated and displayed from each of the currents measured on each of the electrodes for each of the frequencies (5, 10, 30, 100 and 300 kHz) of applied voltages. We illustrate the potential usefulness of these displays in distinguishing breast cancer from benign lesions with the Cole–Cole plots for two patients—one having cancer and one having a benign lesion—by comparing these graphs with electrical impedance spectra previously found by Jossinet and Schmitt in tissue samples taken from a variety of patients. PMID:17664638

A method for analyzing electrical impedance spectroscopy data from breast cancer patients.

PubMed

Kim, Bong Seok; Isaacson, David; Xia, Hongjun; Kao, Tzu-Jen; Newell, Jonathan C; Saulnier, Gary J

2007-07-01

Research on freshly-excised malignant breast tissues and surrounding normal tissues in an in vitro impedance cell has shown that breast tumors have different conductivity and permittivity from normal or non-malignant tissues. This contrast may provide a basis for breast cancer detection using electrical impedance imaging. This paper describes a procedure for collecting electrical impedance spectroscopy data simultaneously and in register with tomosynthesis data from patients. We describe the methods used to analyze the data in order to determine if the electrodes are making contact with the breast of the patient. Canonical voltage patterns are applied and used to synthesize the data that would have resulted from constant voltage patterns applied to each of two parallel mammography plates. A type of Cole-Cole plot is generated and displayed from each of the currents measured on each of the electrodes for each of the frequencies (5, 10, 30, 100 and 300 kHz) of applied voltages. We illustrate the potential usefulness of these displays in distinguishing breast cancer from benign lesions with the Cole-Cole plots for two patients--one having cancer and one having a benign lesion--by comparing these graphs with electrical impedance spectra previously found by Jossinet and Schmitt in tissue samples taken from a variety of patients.

Negative differential electrolyte resistance in a solid-state nanopore resulting from electroosmotic flow bistability.

PubMed

Luo, Long; Holden, Deric A; White, Henry S

2014-03-25

A solid-state nanopore separating two aqueous solutions containing different concentrations of KCl is demonstrated to exhibit negative differential resistance (NDR) when a constant pressure is applied across the nanopore. NDR refers to a decrease in electrical current when the voltage applied across the nanopore is increased. NDR results from the interdependence of solution flow (electroosmotic and pressure-engendered) with the distributions of K+ and Cl- within the nanopore. A switch from a high-conductivity state to a low-conductivity state occurs over a very narrow voltage window (<2 mV) that depends on the nanopore geometry, electrolyte concentration, and nanopore surface charge density. Finite element simulations based on a simultaneous solution of the Navier-Stokes, Poisson, and Nernst-Planck equations demonstrate that NDR results from a positive feedback mechanism between the ion distributions and electroosmotic flow, yielding a true bistability in fluid flow and electrical current at a critical applied voltage, i.e., the NDR "switching potential". Solution pH and Ca2+ were separately employed as chemical stimuli to investigate the dependence of the NDR on the surface charge density. The NDR switching potential is remarkably sensitive to the surface charge density, and thus to pH and the presence of Ca2+, suggesting possible applications in chemical sensing.

A weak electric field-assisted ultrafast electrical switching dynamics in In3SbTe2 phase-change memory devices

NASA Astrophysics Data System (ADS)

Pandey, Shivendra Kumar; Manivannan, Anbarasu

2017-07-01

Prefixing a weak electric field (incubation) might enhance the crystallization speed via pre-structural ordering and thereby achieving faster programming of phase change memory (PCM) devices. We employed a weak electric field, equivalent to a constant small voltage (that is incubation voltage, Vi of 0.3 V) to the applied voltage pulse, VA (main pulse) for a systematic understanding of voltage-dependent rapid threshold switching characteristics and crystallization (set) process of In3SbTe2 (IST) PCM devices. Our experimental results on incubation-assisted switching elucidate strikingly one order faster threshold switching, with an extremely small delay time, td of 300 ps, as compared with no incubation voltage (Vi = 0 V) for the same VA. Also, the voltage dependent characteristics of incubation-assisted switching dynamics confirm that the initiation of threshold switching occurs at a lower voltage of 0.82 times of VA. Furthermore, we demonstrate an incubation assisted ultrafast set process of IST device for a low VA of 1.7 V (˜18 % lesser compared to without incubation) within a short pulse-width of 1.5 ns (full width half maximum, FWHM). These findings of ultrafast switching, yet low power set process would immensely be helpful towards designing high speed PCM devices with low power operation.

Design of Edible Oil Degradation Tool by Using Electromagnetic Field Absorbtion Principle which was Characterized to Peroxide Number

NASA Astrophysics Data System (ADS)

Isnen, M.; Nasution, T. I.; Perangin-angin, B.

2016-08-01

The identification of changes in oil quality has been conducted by indicating the change of dielectric constant which was showed by sensor voltage. Sensor was formed from two parallel flats that worked by electromagnetic wave propagation principle. By measuring its amplitude of electromagnetic wave attenuation caused by interaction between edible oil samples and the sensor, dielectric constant could be identified and estimated as well as peroxide number. In this case, the parallel flats were connected to an electric oscillator 700 kHz. Furthermore, sensor system could showed measurable voltage differences for each different samples. The testing carried out to five oil samples after undergoing an oxidation treatment at fix temperature of 235oC for 0, 5, 10, 15 and 20 minutes. Iodometry method testing showed peroxide values about 1.99, 9.95, 5.96, 11.86, and 15.92 meq/kg respectively with rising trend. Besides that, the testing result by sensor system showed voltages values 1.139, 1.147, 1.165, 1.173, and 1.176 volts with rising trend, respectively. It means that the higher sensor voltages showed the higher damage rate of edible oil when the change in sensor voltage was caused by the change in oil dielectric constant in which heating process caused damage in edible oil molecules structure. The more damage of oil structure caused the more difficulties of oil molecules to polarize and it is indicated by smaller dielectric constant. Therefore electric current would be smaller when sensor voltage was higher. On the other side, the higher sensor voltage means the smaller dielectric constant and the higher peroxide number.

Study of imbalanced internal resistance on drop voltage of LiFePO4 battery system connected in parallel

NASA Astrophysics Data System (ADS)

Adie Perdana, Fengky; Supriyanto, Agus; Purwanto, Agus; Jamaluddin, Anif

2017-01-01

The purpose of this research focuses on the effect of imbalanced internal resistance for the drop voltage of LiFePO4 18650 battery system connected in parallel. The battery pack has been assembled consist of two cell battery LiFePO4 18650 that has difference combination of internal resistance. Battery pack was tested with 1/C constant current charging, 3,65V per group sel, 3,65V constant voltage charging, 5 minutes of rest time between charge and discharge process, 1/2C Constant current discharge until 2,2V, 26 cycle of measurement test, and 4320 minutes rest time after the last charge cycle. We can conclude that the difference combination of internal resistance on the battery pack seriously influence the drop voltage of a battery. Theoretical and experimental result show that the imbalance of internal resistance during cycling are mainly responsible for the drop voltage of LiFePO4 parallel batteries. It is thus a good way to avoid drop voltage fade of parallel battery system by suppressing variations of internal resistance.

Logarithmic circuit with wide dynamic range

NASA Technical Reports Server (NTRS)

Wiley, P. H.; Manus, E. A. (Inventor)

1978-01-01

A circuit deriving an output voltage that is proportional to the logarithm of a dc input voltage susceptible to wide variations in amplitude includes a constant current source which forward biases a diode so that the diode operates in the exponential portion of its voltage versus current characteristic, above its saturation current. The constant current source includes first and second, cascaded feedback, dc operational amplifiers connected in negative feedback circuit. An input terminal of the first amplifier is responsive to the input voltage. A circuit shunting the first amplifier output terminal includes a resistor in series with the diode. The voltage across the resistor is sensed at the input of the second dc operational feedback amplifier. The current flowing through the resistor is proportional to the input voltage over the wide range of variations in amplitude of the input voltage.

Steady-state kinetics of solitary batrachotoxin-treated sodium channels. Kinetics on a bounded continuum of polymer conformations.

PubMed Central

Rubinson, K A

1992-01-01

The underlying principles of the kinetics and equilibrium of a solitary sodium channel in the steady state are examined. Both the open and closed kinetics are postulated to result from round-trip excursions from a transition region that separates the openable and closed forms. Exponential behavior of the kinetics can have origins different from small-molecule systems. These differences suggest that the probability density functions (PDFs) that describe the time dependences of the open and closed forms arise from a distribution of rate constants. The distribution is likely to arise from a thermal modulation of the channel structure, and this provides a physical basis for the following three-variable equation: [formula; see text] Here, A0 is a scaling term, k is the mean rate constant, and sigma quantifies the Gaussian spread for the contributions of a range of effective rate constants. The maximum contribution is made by k, with rates faster and slower contributing less. (When sigma, the standard deviation of the spread, goes to zero, then p(f) = A0 e-kt.) The equation is applied to the single-channel steady-state probability density functions for batrachotoxin-treated sodium channels (1986. Keller et al. J. Gen. Physiol. 88: 1-23). The following characteristics are found: (a) The data for both open and closed forms of the channel are fit well with the above equation, which represents a Gaussian distribution of first-order rate processes. (b) The simple relationship [formula; see text] holds for the mean effective rat constants. Or, equivalently stated, the values of P open calculated from the k values closely agree with the P open values found directly from the PDF data. (c) In agreement with the known behavior of voltage-dependent rate constants, the voltage dependences of the mean effective rate constants for the opening and closing of the channel are equal and opposite over the voltage range studied. That is, [formula; see text] "Bursts" are related to the well-known cage effect of solution chemistry. PMID:1312365

Auger-generated hot carrier current in photo-excited forward biased single quantum well blue light emitting diodes

NASA Astrophysics Data System (ADS)

Espenlaub, Andrew C.; Alhassan, Abdullah I.; Nakamura, Shuji; Weisbuch, Claude; Speck, James S.

2018-04-01

We report on measurements of the photo-modulated current-voltage and electroluminescence characteristics of forward biased single quantum well, blue InGaN/GaN light emitting diodes with and without electron blocking layers. Low intensity resonant optical excitation of the quantum well was observed to induce an additional forward current at constant forward diode bias, in contrast to the usual sense of the photocurrent in photodiodes and solar cells, as well as an increased electroluminescence intensity. The presence of an electron blocking layer only slightly decreased the magnitude of the photo-induced current at constant forward bias. Photo-modulation at constant forward diode current resulted in a reduced diode bias under optical excitation. We argue that this decrease in diode bias at constant current and the increase in forward diode current at constant applied bias can only be due to additional hot carriers being ejected from the quantum well as a result of an increased Auger recombination rate within the quantum well.

Evidence for thermally assisted threshold switching behavior in nanoscale phase-change memory cells

NASA Astrophysics Data System (ADS)

Le Gallo, Manuel; Athmanathan, Aravinthan; Krebs, Daniel; Sebastian, Abu

2016-01-01

In spite of decades of research, the details of electrical transport in phase-change materials are still debated. In particular, the so-called threshold switching phenomenon that allows the current density to increase steeply when a sufficiently high voltage is applied is still not well understood, even though there is wide consensus that threshold switching is solely of electronic origin. However, the high thermal efficiency and fast thermal dynamics associated with nanoscale phase-change memory (PCM) devices motivate us to reassess a thermally assisted threshold switching mechanism, at least in these devices. The time/temperature dependence of the threshold switching voltage and current in doped Ge2Sb2Te5 nanoscale PCM cells was measured over 6 decades in time at temperatures ranging from 40 °C to 160 °C. We observe a nearly constant threshold switching power across this wide range of operating conditions. We also measured the transient dynamics associated with threshold switching as a function of the applied voltage. By using a field- and temperature-dependent description of the electrical transport combined with a thermal feedback, quantitative agreement with experimental data of the threshold switching dynamics was obtained using realistic physical parameters.

Disinfection effect of non-thermal atmospheric pressure plasma for foodborne bacteria

NASA Astrophysics Data System (ADS)

Pervez, Mohammad Rasel; Inomata, Takanori; Ishijima, Tatsuo; Kakikawa, Makiko; Uesugi, Yoshihiko; Tanaka, Yasunori; Yano, Toshihiro; Miwa, Shoji; Noguchi, Akinori

2015-09-01

Non-thermal atmospheric pressure plasma (NAPP) exposure can be a suitable alternative for bacteria inactivation in food processing industry. Specimen placed in the enclosure are exposed to various reactive radicals produced within the discharge chamber. It is also exposed to the periodic variation of the electric field strength in the chamber. Dielectric barrier discharge is produced by high voltage pulse (Vpp = 18 kV, pulse width 20 μs, repetition frequency 10 kHz) in a polypropylene box (volume = 350 cm3) using helium as main feed gas. Inactivation efficiency of NAPP depends on the duration of NAPP exposure, applied voltage pulse strength and type, pulse duration, electrode separation and feed gas composition. In this study we have investigated inactivation of Bacillus lichenformis spore as an example of food borne bacteria. Keeping applied voltage, electrode configuration and total gas flow rate constant, spores are exposed to direct NAPP for different time duration while O2 concentration in the feed gas composition is varied. 10 minutes NAPP exposure resulted in ~ 3 log reduction of Bacillus lichenformis spores for 1% O2concentration (initial concentration ~ 106 / specimen). This work is supported by research and development promotion grant provided by the Hokuriku Industrial Advancement Center.

Predictive control strategies for wind turbine system based on permanent magnet synchronous generator.

PubMed

Maaoui-Ben Hassine, Ikram; Naouar, Mohamed Wissem; Mrabet-Bellaaj, Najiba

2016-05-01

In this paper, Model Predictive Control and Dead-beat predictive control strategies are proposed for the control of a PMSG based wind energy system. The proposed MPC considers the model of the converter-based system to forecast the possible future behavior of the controlled variables. It allows selecting the voltage vector to be applied that leads to a minimum error by minimizing a predefined cost function. The main features of the MPC are low current THD and robustness against parameters variations. The Dead-beat predictive control is based on the system model to compute the optimum voltage vector that ensures zero-steady state error. The optimum voltage vector is then applied through Space Vector Modulation (SVM) technique. The main advantages of the Dead-beat predictive control are low current THD and constant switching frequency. The proposed control techniques are presented and detailed for the control of back-to-back converter in a wind turbine system based on PMSG. Simulation results (under Matlab-Simulink software environment tool) and experimental results (under developed prototyping platform) are presented in order to show the performances of the considered control strategies. Copyright © 2015 ISA. Published by Elsevier Ltd. All rights reserved.

Gas Composition Sensing Using Carbon Nanotube Arrays

NASA Technical Reports Server (NTRS)

Li, Jing; Meyyappan, Meyya

2012-01-01

This innovation is a lightweight, small sensor for inert gases that consumes a relatively small amount of power and provides measurements that are as accurate as conventional approaches. The sensing approach is based on generating an electrical discharge and measuring the specific gas breakdown voltage associated with each gas present in a sample. An array of carbon nanotubes (CNTs) in a substrate is connected to a variable-pulse voltage source. The CNT tips are spaced appropriately from the second electrode maintained at a constant voltage. A sequence of voltage pulses is applied and a pulse discharge breakdown threshold voltage is estimated for one or more gas components, from an analysis of the current-voltage characteristics. Each estimated pulse discharge breakdown threshold voltage is compared with known threshold voltages for candidate gas components to estimate whether at least one candidate gas component is present in the gas. The procedure can be repeated at higher pulse voltages to estimate a pulse discharge breakdown threshold voltage for a second component present in the gas. The CNTs in the gas sensor have a sharp (low radius of curvature) tip; they are preferably multi-wall carbon nanotubes (MWCNTs) or carbon nanofibers (CNFs), to generate high-strength electrical fields adjacent to the tips for breakdown of the gas components with lower voltage application and generation of high current. The sensor system can provide a high-sensitivity, low-power-consumption tool that is very specific for identification of one or more gas components. The sensor can be multiplexed to measure current from multiple CNT arrays for simultaneous detection of several gas components.

Dynamics of colloidal particles in electrohydrodynamic convection of nematic liquid crystal.

PubMed

Takahashi, Kentaro; Kimura, Yasuyuki

2014-07-01

We have studied the dynamics of micrometer-sized colloidal particles in electrohydrodynamic convection of nematic liquid crystal. Above the onset voltage of electroconvection, the parallel array of convection rolls appears to be perpendicular to the nematic field at first. The particles are forced to rotate by convection flow and are trapped within a single roll in this voltage regime. A slow glide motion along the roll axis is also observed. The frequency of rotational motion and the glide velocity increase with the applied voltage. Under a much larger voltage where the roll axis temporally fluctuates, the particles occasionally hop to the neighbor rolls. In this voltage regime, the motion of the particles becomes two-dimensional. The motion perpendicular to the roll axis exhibits diffusion behavior at a long time period. The effective diffusion constant is 10(3)-10(4) times larger than the molecular one. The observed behavior is compared with the result obtained by a simple stochastic model for the transport of the particles in convection. The enhancement of diffusion can be quantitatively described well by the rotation frequency in a roll, the width of the roll, and the hopping probability to the neighbor rolls.

Systematic error of diode thermometer.

PubMed

Iskrenovic, Predrag S

2009-08-01

Semiconductor diodes are often used for measuring temperatures. The forward voltage across a diode decreases, approximately linearly, with the increase in temperature. The applied method is mainly the simplest one. A constant direct current flows through the diode, and voltage is measured at diode terminals. The direct current that flows through the diode, putting it into operating mode, heats up the diode. The increase in temperature of the diode-sensor, i.e., the systematic error due to self-heating, depends on the intensity of current predominantly and also on other factors. The results of systematic error measurements due to heating up by the forward-bias current have been presented in this paper. The measurements were made at several diodes over a wide range of bias current intensity.

Power supply and impedance matching to drive technological radio-frequency plasmas with customized voltage waveforms.

PubMed

Franek, James; Brandt, Steven; Berger, Birk; Liese, Martin; Barthel, Matthias; Schüngel, Edmund; Schulze, Julian

2015-05-01

We present a novel radio-frequency (RF) power supply and impedance matching to drive technological plasmas with customized voltage waveforms. It is based on a system of phase-locked RF generators that output single frequency voltage waveforms corresponding to multiple consecutive harmonics of a fundamental frequency. These signals are matched individually and combined to drive a RF plasma. Electrical filters are used to prevent parasitic interactions between the matching branches. By adjusting the harmonics' phases and voltage amplitudes individually, any voltage waveform can be approximated as a customized finite Fourier series. This RF supply system is easily adaptable to any technological plasma for industrial applications and allows the commercial utilization of process optimization based on voltage waveform tailoring for the first time. Here, this system is tested on a capacitive discharge based on three consecutive harmonics of 13.56 MHz. According to the Electrical Asymmetry Effect, tuning the phases between the applied harmonics results in an electrical control of the DC self-bias and the mean ion energy at almost constant ion flux. A comparison with the reference case of an electrically asymmetric dual-frequency discharge reveals that the control range of the mean ion energy can be significantly enlarged by using more than two consecutive harmonics.

Kinetics of Inhibitory Feedback from Horizontal Cells to Photoreceptors: Implications for an Ephaptic Mechanism

PubMed Central

Warren, Ted J.; Van Hook, Matthew J.; Tranchina, Daniel

2016-01-01

Inhibitory feedback from horizontal cells (HCs) to cones generates center-surround receptive fields and color opponency in the retina. Mechanisms of HC feedback remain unsettled, but one hypothesis proposes that an ephaptic mechanism may alter the extracellular electrical field surrounding photoreceptor synaptic terminals, thereby altering Ca2+ channel activity and photoreceptor output. An ephaptic voltage change produced by current flowing through open channels in the HC membrane should occur with no delay. To test for this mechanism, we measured kinetics of inhibitory feedback currents in Ambystoma tigrinum cones and rods evoked by hyperpolarizing steps applied to synaptically coupled HCs. Hyperpolarizing HCs stimulated inward feedback currents in cones that averaged 8–9 pA and exhibited a biexponential time course with time constants averaging 14–17 ms and 120–220 ms. Measurement of feedback-current kinetics was limited by three factors: (1) HC voltage-clamp speed, (2) cone voltage-clamp speed, and (3) kinetics of Ca2+ channel activation or deactivation in the photoreceptor terminal. These factors totaled ∼4–5 ms in cones meaning that the true fast time constants for HC-to-cone feedback currents were 9–13 ms, slower than expected for ephaptic voltage changes. We also compared speed of feedback to feedforward glutamate release measured at the same cone/HC synapses and found a latency for feedback of 11–14 ms. Inhibitory feedback from HCs to rods was also significantly slower than either measurement kinetics or feedforward release. The finding that inhibitory feedback from HCs to photoreceptors involves a significant delay indicates that it is not due to previously proposed ephaptic mechanisms. SIGNIFICANCE STATEMENT Lateral inhibitory feedback from horizontal cells (HCs) to photoreceptors creates center-surround receptive fields and color-opponent interactions. Although underlying mechanisms remain unsettled, a longstanding hypothesis proposes that feedback is due to ephaptic voltage changes that regulate photoreceptor synaptic output by altering Ca2+ channel activity. Ephaptic processes should occur with no delay. We measured kinetics of inhibitory feedback currents evoked in photoreceptors with voltage steps applied to synaptically coupled HCs and found that feedback is too slow to be explained by ephaptic voltage changes generated by current flowing through continuously open channels in HC membranes. By eliminating the proposed ephaptic mechanism for HC feedback regulation of photoreceptor Ca2+ channels, our data support earlier proposals that synaptic cleft pH changes are more likely responsible. PMID:27683904

Constant power speed range extension of surface mounted PM motors

DOEpatents

Lawler, Jack Steward; Bailey, John Milton

2001-01-01

A circuit and method for controlling a rotating machine (11) in the constant horsepower range above base speed uses an inverter (15) having SCR's (T1-T6) connected in series with the primary commutation switches (Q1-Q6) to control turn off of the primary commutation switches and to protect the primary commutation switches from faults. The primary commutation switches (Q1-Q6) are controlled by a controller (14), to fire in advance or after a time when the back emf equals the applied voltage, and then to turn off after a precise dwell time, such that suitable power is developed at speeds up to at least six times base speed.

Stochastic many-particle model for LFP electrodes

NASA Astrophysics Data System (ADS)

Guhlke, Clemens; Gajewski, Paul; Maurelli, Mario; Friz, Peter K.; Dreyer, Wolfgang

2018-02-01

In the framework of non-equilibrium thermodynamics, we derive a new model for many-particle electrodes. The model is applied to LiFePO4 (LFP) electrodes consisting of many LFP particles of nanometer size. The phase transition from a lithium-poor to a lithium-rich phase within LFP electrodes is controlled by both different particle sizes and surface fluctuations leading to a system of stochastic differential equations. An explicit relation between battery voltage and current controlled by the thermodynamic state variables is derived. This voltage-current relation reveals that in thin LFP electrodes lithium intercalation from the particle surfaces into the LFP particles is the principal rate-limiting process. There are only two constant kinetic parameters in the model describing the intercalation rate and the fluctuation strength, respectively. The model correctly predicts several features of LFP electrodes, viz. the phase transition, the observed voltage plateaus, hysteresis and the rate-limiting capacity. Moreover we study the impact of both the particle size distribution and the active surface area on the voltage-charge characteristics of the electrode. Finally we carefully discuss the phase transition for varying charging/discharging rates.

Characterization of applied fields for ion mobility separations in traveling wave based structures for lossless ion manipulations (SLIM)

DOE PAGES

Hamid, Ahmed M.; Prabhakaran, Aneesh; Garimella, Sandilya V. B.; ...

2018-03-26

Ion mobility (IM) is rapidly gaining attention for the separation and analysis of biomolecules due to the ability to distinguish the shapes of ions. However, conventional constant electric field drift tube IM separations have limited resolving power, constrained by practical limitations on the path length and maximum applied voltage. The implementation of traveling waves (TW) in IM removes the latter limitation, allowing higher resolution to be achieved using extended path lengths. Both of these can be readily obtained in Structures for Lossless Ion Manipulations (SLIM), which are fabricated from arrays of electrodes patterned on two parallel surfaces where potentials aremore » applied to generate appropriate electric fields between the surfaces. Here we have investigated the relationship between the primary SLIM variables, such as electrode dimensions, inter-surface gap, and the applied TW voltages, that directly impact the fields experienced by ions. Ion trajectory simulations and theoretical calculations have been utilized to understand the dependence of SLIM geometry and effective electric fields on IM resolution. The variables explored impact both ion confinement and the observed IM resolution using SLIM modules.« less

Characterization of applied fields for ion mobility separations in traveling wave based structures for lossless ion manipulations (SLIM)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hamid, Ahmed M.; Prabhakaran, Aneesh; Garimella, Sandilya V. B.

Ion mobility (IM) is rapidly gaining attention for the separation and analysis of biomolecules due to the ability to distinguish the shapes of ions. However, conventional constant electric field drift tube IM separations have limited resolving power, constrained by practical limitations on the path length and maximum applied voltage. The implementation of traveling waves (TW) in IM removes the latter limitation, allowing higher resolution to be achieved using extended path lengths. Both of these can be readily obtained in Structures for Lossless Ion Manipulations (SLIM), which are fabricated from arrays of electrodes patterned on two parallel surfaces where potentials aremore » applied to generate appropriate electric fields between the surfaces. Here we have investigated the relationship between the primary SLIM variables, such as electrode dimensions, inter-surface gap, and the applied TW voltages, that directly impact the fields experienced by ions. Ion trajectory simulations and theoretical calculations have been utilized to understand the dependence of SLIM geometry and effective electric fields on IM resolution. The variables explored impact both ion confinement and the observed IM resolution using SLIM modules.« less

Scanning Tunneling Optical Resonance Microscopy

NASA Technical Reports Server (NTRS)

Bailey, Sheila; Wilt, Dave; Raffaelle, Ryne; Gennett, Tom; Tin, Padetha; Lau, Janice; Castro, Stephanie; Jenkins, Philip; Scheiman, Dave

2003-01-01

Scanning tunneling optical resonance microscopy (STORM) is a method, now undergoing development, for measuring optoelectronic properties of materials and devices on the nanoscale by means of a combination of (1) traditional scanning tunneling microscopy (STM) with (2) tunable laser spectroscopy. In STORM, an STM tip probing a semiconductor is illuminated with modulated light at a wavelength in the visible-to-near-infrared range and the resulting photoenhancement of the tunneling current is measured as a function of the illuminating wavelength. The photoenhancement of tunneling current occurs when the laser photon energy is sufficient to excite charge carriers into the conduction band of the semiconductor. Figure 1 schematically depicts a proposed STORM apparatus. The light for illuminating the semiconductor specimen at the STM would be generated by a ring laser that would be tunable across the wavelength range of interest. The laser beam would be chopped by an achromatic liquid-crystal modulator. A polarization-maintaining optical fiber would couple the light to the tip/sample junction of a commercial STM. An STM can be operated in one of two modes: constant height or constant current. A STORM apparatus would be operated in the constant-current mode, in which the height of the tip relative to the specimen would be varied in order to keep the tunneling current constant. In this mode, a feedback control circuit adjusts the voltage applied to a piezoelectric actuator in the STM that adjusts the height of the STM tip to keep the tunneling current constant. The exponential relationship between the tunneling current and tip-to-sample distance makes it relatively easy to implement this mode of operation. The choice of method by which the photoenhanced portion of the tunneling current would be measured depends on choice of the frequency at which the input illumination would be modulated (chopped). If the frequency of modulation were low enough (typically < 10 Hz) that the feedback circuit could respond, then the voltage applied to the piezoelectric tip-height actuator could be measured by use of a lock-in amplifier locked to the modulation (chopping) signal. However, at a high modulation frequency (typically in the kilohertz range or higher), the feedback circuit would be unable to respond. In this case, the photoenhanced portion of the tunneling current could be measured directly. For this purpose, the tunneling current would be passed through a precise resistor and the voltage drop would be measured by use of the lock-in amplifier.

Effects of applied electric field during postannealing on the tunable properties of (Ba,Sr)TiO3 thin films

NASA Astrophysics Data System (ADS)

Xia, Yidong; Cheng, Jinbo; Pan, Bai; Wu, Di; Meng, Xiangkang; Liu, Zhiguo

2005-08-01

The impact of postannealing in electric field on the structure, tunability, and dielectric behavior of rf magnetron sputtering derived (Ba,Sr)TiO3 films has been studied. It has been demonstrated that postannealing in the proper electric field can increase the dielectric constant and the tunability remarkably and destroy the symmetry of capacitance-voltage characteristics of the films. The increased out-of-plane lattice constant and the appearance of the hysteresis loops in the electric-annealed films indicated the formation of small polar regions with tetragonal structure, which are responsible for the increased dielectric constant and tunability. It was proposed that the segregation of Ti3+ ions caused by electric annealing could induce the formation of BaTiO3-like regions, which are ferroelectric at room temperature.

Reevaluation of Performance of Electric Double-layer Capacitors from Constant-current Charge/Discharge and Cyclic Voltammetry

PubMed Central

Allagui, Anis; Freeborn, Todd J.; Elwakil, Ahmed S.; Maundy, Brent J.

2016-01-01

The electric characteristics of electric-double layer capacitors (EDLCs) are determined by their capacitance which is usually measured in the time domain from constant-current charging/discharging and cyclic voltammetry tests, and from the frequency domain using nonlinear least-squares fitting of spectral impedance. The time-voltage and current-voltage profiles from the first two techniques are commonly treated by assuming ideal SsC behavior in spite of the nonlinear response of the device, which in turn provides inaccurate values for its characteristic metrics. In this paper we revisit the calculation of capacitance, power and energy of EDLCs from the time domain constant-current step response and linear voltage waveform, under the assumption that the device behaves as an equivalent fractional-order circuit consisting of a resistance Rs in series with a constant phase element (CPE(Q, α), with Q being a pseudocapacitance and α a dispersion coefficient). In particular, we show with the derived (Rs, Q, α)-based expressions, that the corresponding nonlinear effects in voltage-time and current-voltage can be encompassed through nonlinear terms function of the coefficient α, which is not possible with the classical RsC model. We validate our formulae with the experimental measurements of different EDLCs. PMID:27934904

Reevaluation of Performance of Electric Double-layer Capacitors from Constant-current Charge/Discharge and Cyclic Voltammetry

NASA Astrophysics Data System (ADS)

Allagui, Anis; Freeborn, Todd J.; Elwakil, Ahmed S.; Maundy, Brent J.

2016-12-01

The electric characteristics of electric-double layer capacitors (EDLCs) are determined by their capacitance which is usually measured in the time domain from constant-current charging/discharging and cyclic voltammetry tests, and from the frequency domain using nonlinear least-squares fitting of spectral impedance. The time-voltage and current-voltage profiles from the first two techniques are commonly treated by assuming ideal SsC behavior in spite of the nonlinear response of the device, which in turn provides inaccurate values for its characteristic metrics. In this paper we revisit the calculation of capacitance, power and energy of EDLCs from the time domain constant-current step response and linear voltage waveform, under the assumption that the device behaves as an equivalent fractional-order circuit consisting of a resistance Rs in series with a constant phase element (CPE(Q, α), with Q being a pseudocapacitance and α a dispersion coefficient). In particular, we show with the derived (Rs, Q, α)-based expressions, that the corresponding nonlinear effects in voltage-time and current-voltage can be encompassed through nonlinear terms function of the coefficient α, which is not possible with the classical RsC model. We validate our formulae with the experimental measurements of different EDLCs.

Reevaluation of Performance of Electric Double-layer Capacitors from Constant-current Charge/Discharge and Cyclic Voltammetry.

PubMed

Allagui, Anis; Freeborn, Todd J; Elwakil, Ahmed S; Maundy, Brent J

2016-12-09

The electric characteristics of electric-double layer capacitors (EDLCs) are determined by their capacitance which is usually measured in the time domain from constant-current charging/discharging and cyclic voltammetry tests, and from the frequency domain using nonlinear least-squares fitting of spectral impedance. The time-voltage and current-voltage profiles from the first two techniques are commonly treated by assuming ideal R s C behavior in spite of the nonlinear response of the device, which in turn provides inaccurate values for its characteristic metrics [corrected]. In this paper we revisit the calculation of capacitance, power and energy of EDLCs from the time domain constant-current step response and linear voltage waveform, under the assumption that the device behaves as an equivalent fractional-order circuit consisting of a resistance R s in series with a constant phase element (CPE(Q, α), with Q being a pseudocapacitance and α a dispersion coefficient). In particular, we show with the derived (R s , Q, α)-based expressions, that the corresponding nonlinear effects in voltage-time and current-voltage can be encompassed through nonlinear terms function of the coefficient α, which is not possible with the classical R s C model. We validate our formulae with the experimental measurements of different EDLCs.

Experimental investigation of high temperature high voltage thermionic diode for the space power nuclear reactor

NASA Astrophysics Data System (ADS)

Onufriyev, Valery. V.

2001-02-01

It is well known that the rise of arc from the dense glow discharge is connected with the thermion and secondary processes on the cathode surface (Granovsky, 1971; Leob, 1953; Engel, 1935). First model of breakdown of the cathode layer is connected with the increase of the cathode temperature in consequence of the ion bombardment that leads to the grows its thermo-emissive current. Other model shows the main role of the secondary effects on the cathode surface-the increase of the secondary ion emission coefficient-γi with the grows of glow discharge voltage. But the author of this investigation work of breakdown in Cs vapor (a transmission the glow discharge into self-maintaining arc discharge) discovered the next peculiarity: the value of breakdown voltage is constant when the values of vapor temperature (its pressure pcs) and cathode temperature Tk is constant too (Ub=constant with Tk=constant and pcs=constant) and it is not a statistical value (Onufryev, Grishin, 1996) (that was observed in gas glow discharges other authors (Granovsky, 1971; Leob, 1953; Engel, 1935)). The investigations of thermion high voltage high temperature diode (its breakdown characteristics in closed state and voltage-current characteristics in disclosed state) showed that the value of the breakdown voltage is depended on the vapor pressure in inter-electrode gap (IEG)-pcs and cathode temperature-Tk and is independent on IEG length-Δieg. On this base it was settled that the main role in transition of glow discharge to self-maintaining arc discharge plays an ion cathode layer but more exactly-the region of excited atoms-``Aston glow.'' .

Study of Super Dielectric Material for Novel Paradigm Capacitors

DTIC Science & Technology

2018-03-01

maximized. Interestingly, CHD protocol did not have a predictable or notable effect on performance in this study . In fact, in several cases shorter...measurement, such as dark matter and dark energy, the same inductive logic approach has been taken for the present study . In this case , we first applied...indicates the constant voltage hold duration. In two cases , a third term ‘No Weight’ indicates that a weight was not placed on top of the glass-capacitor

Constant voltage and constant current control implementation for electric vehicles (evs) wireless charger

NASA Astrophysics Data System (ADS)

Tampubolon, Marojahan; Pamungkas, Laskar; Hsieh, Yao Ching; Chiu, Huang Jen

2018-04-01

This paper presents the implementation of Constant Voltage (CV) and Constant Current (CC) control for a wireless charger system. A battery charging system needs these control modes to ensure the safety of the battery and the effectiveness of the charging system. Here, the wireless charger system does not employ any post-regulator stage to control the output voltage and output current of the charger. But, it uses a variable frequency control incorporated with a conventional PI control. As a result, the size and the weight of the system are reduced. This paper discusses the brief review of the SS-WPT, control strategy and implementation of the CV and CC control. Experimental hardware with 2kW output power has been performed and tested. The results show that the proposed CV and CC control method works well with the system.

Why Batteries Deliver a Fairly Constant Voltage until Dead

ERIC Educational Resources Information Center

Smith, Garon C.; Hossain, Md. Mainul; MacCarthy, Patrick

2012-01-01

Two characteristics of batteries, their delivery of nearly constant voltage and their rapid failure, are explained through a visual examination of the Nernst equation. Two Galvanic cells are described in detail: (1) a wet cell involving iron and copper salts and (2) a mercury oxide dry cell. A complete description of the wet cell requires a…

The Most Energy Efficient Way to Charge the Capacitor in an RC Circuit

ERIC Educational Resources Information Center

Wang, Dake

2017-01-01

The voltage waveform that minimizes the energy loss in the resistance when charging the capacitor in a resistor-capacitor circuit is investigated using the calculus of variation. A linear voltage ramp gives the best efficiency, which means a constant current source should be used for charging. Comparison between constant current source and…

Interpretation of current-voltage relationships for "active" ion transport systems: I. Steady-state reaction-kinetic analysis of class-I mechanisms.

PubMed

Hansen, U P; Gradmann, D; Sanders, D; Slayman, C L

1981-01-01

This paper develops a simple reaction-kinetic model to describe electrogenic pumping and co- (or counter-) transport of ions. It uses the standard steady-state approach for cyclic enzyme- or carrier-mediated transport, but does not assume rate-limitation by any particular reaction step. Voltage-dependence is introduced, after the suggestion of Läuger and Stark (Biochim. Biophys. Acta 211:458-466, 1970), via a symmetric Eyring barrier, in which the charge-transit reaction constants are written as k12 = ko12 exp(zF delta psi/2RT) and k21 = ko21 exp(-zF delta psi/2RT). For interpretation of current-voltage relationships, all voltage-independent reaction steps are lumped together, so the model in its simplest form can be described as a pseudo-2-state model. It is characterized by the two voltage-dependent reaction constants, two lumped voltage-independent reaction constants (k12, k21), and two reserve factors (ri, ro) which formally take account of carrier states that are indistinguishable in the current-voltage (I-V) analysis. The model generates a wide range of I-V relationships, depending on the relative magnitudes of the four reaction constants, sufficient to describe essentially all I-V datas now available on "active" ion-transport systems. Algebraic and numerical analysis of the reserve factors, by means of expanded pseudo-3-, 4-, and 5-state models, shows them to be bounded and not large for most combinations of reaction constants in the lumped pathway. The most important exception to this rule occurs when carrier decharging immediately follows charge transit of the membrane and is very fast relative to other constituent voltage-independent reactions. Such a circumstance generates kinetic equivalence of chemical and electrical gradients, thus providing a consistent definition of ion-motive forces (e.g., proton-motive force, PMF). With appropriate restrictions, it also yields both linear and log-linear relationships between net transport velocity and either membrane potential or PMF. The model thus accommodates many known properties of proton-transport systems, particularly as observed in "chemiosmotic" or energy-coupling membranes.

Bipolar square-wave current source for transient electromagnetic systems based on constant shutdown time

NASA Astrophysics Data System (ADS)

Wang, Shilong; Yin, Changchun; Lin, Jun; Yang, Yu; Hu, Xueyan

2016-03-01

Cooperative work of multiple magnetic transmitting sources is a new trend in the development of transient electromagnetic system. The key is the bipolar current waves shutdown, concurrently in the inductive load. In the past, it was difficult to use the constant clamping voltage technique to realize the synchronized shutdown of currents with different peak values. Based on clamping voltage technique, we introduce a new controlling method with constant shutdown time. We use the rising time to control shutdown time and use low voltage power source to control peak current. From the viewpoint of the circuit energy loss, by taking the high-voltage capacitor bypass resistance and the capacitor of the passive snubber circuit into account, we establish the relationship between the rising time and the shutdown time. Since the switch is not ideal, we propose a new method to test the shutdown time by the low voltage, the high voltage and the peak current. Experimental results show that adjustment of the current rising time can precisely control the value of the clamp voltage. When the rising time is fixed, the shutdown time is unchanged. The error for shutdown time deduced from the energy consumption is less than 6%. The new controlling method on current shutdown proposed in this paper can be used in the cooperative work of borehole and ground transmitting system.

Bipolar square-wave current source for transient electromagnetic systems based on constant shutdown time.

PubMed

Wang, Shilong; Yin, Changchun; Lin, Jun; Yang, Yu; Hu, Xueyan

2016-03-01

Cooperative work of multiple magnetic transmitting sources is a new trend in the development of transient electromagnetic system. The key is the bipolar current waves shutdown, concurrently in the inductive load. In the past, it was difficult to use the constant clamping voltage technique to realize the synchronized shutdown of currents with different peak values. Based on clamping voltage technique, we introduce a new controlling method with constant shutdown time. We use the rising time to control shutdown time and use low voltage power source to control peak current. From the viewpoint of the circuit energy loss, by taking the high-voltage capacitor bypass resistance and the capacitor of the passive snubber circuit into account, we establish the relationship between the rising time and the shutdown time. Since the switch is not ideal, we propose a new method to test the shutdown time by the low voltage, the high voltage and the peak current. Experimental results show that adjustment of the current rising time can precisely control the value of the clamp voltage. When the rising time is fixed, the shutdown time is unchanged. The error for shutdown time deduced from the energy consumption is less than 6%. The new controlling method on current shutdown proposed in this paper can be used in the cooperative work of borehole and ground transmitting system.

Fabrication of White Light-emitting Electrochemical Cells with Stable Emission from Exciplexes.

PubMed

Uchida, Soichi; Takizawa, Daisuke; Ikeda, Satoru; Takeuchi, Hironori; Nishimura, Suzushi; Nishide, Hiroyuki; Nishikitani, Yoshinori

2016-11-15

The authors present an approach for fabricating stable white light emission from polymer light-emitting electrochemical cells (PLECs) having an active layer which consists of blue-fluorescent poly(9,9-di-n-dodecylfluorenyl-2,7-diyl) (PFD) and π-conjugated triphenylamine molecules. This white light emission originates from exciplexes formed between PFD and amines in electronically excited states. A device containing PFD, 4,4',4''-tris[2-naphthyl(phenyl)amino]triphenylamine (2-TNATA), Poly(ethylene oxide) and K2CF3SO3 showed white light emission with Commission internationale de l'éclairage (CIE) coordinates of (0.33, 0.43) and a Color Rendering Index (CRI) of Ra = 73 at an applied voltage of 3.5 V. Constant voltage measurements showed that the CIE coordinates of (0.27, 0.37), Ra of 67, and the emission color observed immediately after application of a voltage of 5 V were nearly unchanged and stable after 300 sec.

Acoustic Emission Characteristics of Nanocrystalline Porous Silicon Device Driven as an Ultrasonic Speaker

NASA Astrophysics Data System (ADS)

Tsubaki, Kenji; Komoda, Takuya; Koshida, Nobuyoshi

2006-04-01

It is shown that the dc-superimposed driving mode is more useful for the efficient operation of a novel thermally induced ultrasonic emitter based on nanocrystalline porous silicon (nc-PS) than the conventional simple ac-voltage driving mode. The nc-PS device is composed of a patterned heater electrode, an nc-PS layer and a single crystalline silicon (c-Si) substrate. The almost complete thermally insulating property of nc-PS as a quantum-sized system makes it possible to apply the nc-PS device as an ultrasonic generator by efficient thermo acoustic conversion without any mechanical vibrations. In the dc-superimposed driving mode, the output frequency is the same as the input frequency and a stationary temperature rise is kept constant independent of input peak-to-peak voltage. In addition, power efficiency is significantly increases compared with that in the ac-voltage driving mode without affecting on the temperature rise. The present results suggest the further possibility of the nc-PS device being used as a functional speaker.

Electric generation and ratcheted transport of contact-charged drops

NASA Astrophysics Data System (ADS)

Cartier, Charles A.; Graybill, Jason R.; Bishop, Kyle J. M.

2017-10-01

We describe a simple microfluidic system that enables the steady generation and efficient transport of aqueous drops using only a constant voltage input. Drop generation is achieved through an electrohydrodynamic dripping mechanism by which conductive drops grow and detach from a grounded nozzle in response to an electric field. The now-charged drops are transported down a ratcheted channel by contact charge electrophoresis powered by the same voltage input used for drop generation. We investigate how the drop size, generation frequency, and transport velocity depend on system parameters such as the liquid viscosity, interfacial tension, applied voltage, and channel dimensions. The observed trends are well explained by a series of scaling analyses that provide insight into the dominant physical mechanisms underlying drop generation and ratcheted transport. We identify the conditions necessary for achieving reliable operation and discuss the various modes of failure that can arise when these conditions are violated. Our results demonstrate that simple electric inputs can power increasingly complex droplet operations with potential opportunities for inexpensive and portable microfluidic systems.

Electric generation and ratcheted transport of contact-charged drops.

PubMed

Cartier, Charles A; Graybill, Jason R; Bishop, Kyle J M

2017-10-01

We describe a simple microfluidic system that enables the steady generation and efficient transport of aqueous drops using only a constant voltage input. Drop generation is achieved through an electrohydrodynamic dripping mechanism by which conductive drops grow and detach from a grounded nozzle in response to an electric field. The now-charged drops are transported down a ratcheted channel by contact charge electrophoresis powered by the same voltage input used for drop generation. We investigate how the drop size, generation frequency, and transport velocity depend on system parameters such as the liquid viscosity, interfacial tension, applied voltage, and channel dimensions. The observed trends are well explained by a series of scaling analyses that provide insight into the dominant physical mechanisms underlying drop generation and ratcheted transport. We identify the conditions necessary for achieving reliable operation and discuss the various modes of failure that can arise when these conditions are violated. Our results demonstrate that simple electric inputs can power increasingly complex droplet operations with potential opportunities for inexpensive and portable microfluidic systems.

The Redox flow system for solar photovoltaic energy storage

NASA Technical Reports Server (NTRS)

Odonnell, P.; Gahn, R. F.

1976-01-01

A new method of storage was applied to a solar photovoltaic system. The storage method is a redox flow system which utilizes the oxidation-reduction capability of two soluble electrochemical redox couples for its storage capacity. The particular variant described separates the charging and discharging function of the system such that the electrochemical couples are simultaneously charged and discharged in separate parts of the system. The solar array had 12 solar cells; wired in order to give a range of voltages and currents. The system stored the solar energy so that a load could be run continually day and night. The main advantages of the redox system are that it can accept a charge in the low voltage range and produce a relatively constant output regardless of solar activity.

Steady state compact toroidal plasma production

DOEpatents

Turner, William C.

1986-01-01

Apparatus and method for maintaining steady state compact toroidal plasmas. A compact toroidal plasma is formed by a magnetized coaxial plasma gun and held in close proximity to the gun electrodes by applied magnetic fields or magnetic fields produced by image currents in conducting walls. Voltage supply means maintains a constant potential across the electrodes producing an increasing magnetic helicity which drives the plasma away from a minimum energy state. The plasma globally relaxes to a new minimum energy state, conserving helicity according to Taylor's relaxation hypothesis, and injecting net helicity into the core of the compact toroidal plasma. Controlling the voltage so as to inject net helicity at a predetermined rate based on dissipative processes maintains or increases the compact toroidal plasma in a time averaged steady state mode.

Transient Performance Improvement Circuit (TPIC)s for DC-DC converter applications

NASA Astrophysics Data System (ADS)

Lim, Sungkeun

Gordon Moore famously predicted the exponential increase in transistor integration and computing power that has been witnessed in recent decades [1]. In the near future, it is expected that more than one billion transistors will be integrated per chip, and advanced microprocessors will require clock speeds in excess of several GHz. The increasing number of transistors and high clock speeds will necessitate the consumption of more power. By 2014, it is expected that the maximum power consumption of the microprocessor will reach approximately 150W, and the maximum load current will be around 150A. Today's trend in power and thermal management is to reduce supply voltage as low as possible to reduce delivered power. It is anticipated that the Intel cores will operate on 0.8V of supply voltage by 2014 [2]. A significant challenge in Voltage Regulator Module (VRM) development for next generation microprocessors is to regulate the supply voltage within a certain tolerance band during high slew rate load transitions, since the required supply voltage tolerance band will be much narrower than the current requirement. If VR output impedance is maintained at a constant value from DC to high frequency, large output voltage spikes can be avoided during load cur- rent transients. Based on this, the Adaptive Voltage Position (AVP) concept was developed to achieve constant VR output impedance to improve transient response performance [3]. However, the VR output impedance can not be made constant over the entire frequency range with AVP design, because the AVP design makes the VR output impedance constant only at low frequencies. To make the output impedance constant at high frequencies, many bulk capacitors and ceramic capacitors are required. The tight supply voltage tolerance for the next generation of microprocessors during high slew rate load transitions requires fast transient response power supplies. A VRM can not follow the high slew rate load current transients, because of the slow inductor current slew rate which is determined by the input voltage, output voltage, and the inductance. The remaining inductor current in the power delivery path will charge the output capacitors and develop a voltage across the ESR. As a result, large output voltage spikes occur during load current transients. Due to their limited control bandwidth, traditional VRs can not sufficiently respond rapidly to certain load transients. As a result, a large output voltage spike can occur during load transients, hence requiring a large amount of bulk capacitance to decouple the VR from the load [2]. If the remaining inductor current is removed from the power stage or the inductor current slew rate is changed, the output voltage spikes can be clamped, allowing the output capacitance to be reduced. A new design methodology for a Transient Performance Improvement Circuit(TPIC) based on controlling the output impedance of a regulator is presented. The TPIC works in parallel with a voltage regulator (VR)'s ceramic capacitors to achieve faster voltage regulation without the need for a large bulk capacitance, and can serve as a replacement for bulk capacitors. The specific function of the TPIC is to mimic the behavior of the bulk capacitance in a traditional VRM by sinking and sourcing large currents during transients, allowing the VR to respond quickly to current transients without the need for a large bulk capacitance. This will allow fast transient response without the need for a large bulk capacitor. The main challenge in applying the TPIC is creating a design which will not interfere with VR operation. A TPIC for a 4 Switch Buck-Boost (4SBB) converter is presented which functions by con- trolling the inductor current slew rate during load current transients. By increasing the inductor current slew rate, the remaining inductor current can be removed from the 4SBB power delivery path and the output voltage spike can be clamped. A second TPIC is presented which is designed to improve the performance of an LDO regulator during output current transients. A TPIC for a LDO regulator is proposed to reduce the over voltage spike settling time. During a load current step down transient, the only current discharging path is a light load current. However, it takes a long time to discharge the current charged in the output capacitors with the light load current. The proposed TPIC will make an additional current discharging path to reduce the long settling time. By reducing the settling time, the load current transient frequency of the LDO regulator can be increased. A Ripple Cancellation Circuit (RCC) is proposed to reduce the output voltage ripple. The RCC has a very similar concept with the TPIC which is sinking or injecting additional current to the power stage to compensate the inductor ripple current. The proposed TPICs and RCC have been implemented with a 0.6m CMOS process. A single-phase VR, a 4SBB converter, and a LDO regulator have been utilized with the proposed TPIC to evaluate its performance. The theoretical analysis will be confirmed by Cadence simulation results and experimental results.

Behavior of Triple Langmuir Probes in Non-Equilibrium Plasmas

NASA Technical Reports Server (NTRS)

Polzin, Kurt A.; Ratcliffe, Alicia C.

2018-01-01

The triple Langmuir probe is an electrostatic probe in which three probe tips collect current when inserted into a plasma. The triple probe differs from a simple single Langmuir probe in the nature of the voltage applied to the probe tips. In the single probe, a swept voltage is applied to the probe tip to acquire a waveform showing the collected current as a function of applied voltage (I-V curve). In a triple probe three probe tips are electrically coupled to each other with constant voltages applied between each of the tips. The voltages are selected such that they would represent three points on the single Langmuir probe I-V curve. Elimination of the voltage sweep makes it possible to measure time-varying plasma properties in transient plasmas. Under the assumption of a Maxwellian plasma, one can determine the time-varying plasma temperature T(sub e)(t) and number density n(sub e)(t) from the applied voltage levels and the time-histories of the collected currents. In the present paper we examine the theory of triple probe operation, specifically focusing on the assumption of a Maxwellian plasma. Triple probe measurements have been widely employed for a number of pulsed and timevarying plasmas, including pulsed plasma thrusters (PPTs), dense plasma focus devices, plasma flows, and fusion experiments. While the equilibrium assumption may be justified for some applications, it is unlikely that it is fully justifiable for all pulsed and time-varying plasmas or for all times during the pulse of a plasma device. To examine a simple non-equilibrium plasma case, we return to basic governing equations of probe current collection and compute the current to the probes for a distribution function consisting of two Maxwellian distributions with different temperatures (the two-temperature Maxwellian). A variation of this method is also employed, where one of the Maxwellians is offset from zero (in velocity space) to add a suprathermal beam of electrons to the tail of the main Maxwellian distribution (the bump-on-the-tail distribution function). For a range of parameters in these non-Maxwellian distributions, we compute the current collection to the probes. We compare the distribution function that was assumed a priori with the distribution function one would infer when applying standard triple probe theory to analyze the collected currents. For the assumed class of non-Maxwellian distribution functions this serves to illustrate the effect a non-Maxwellian plasma would have on results interpreted using the equilibrium triple probe current collection theory, allowing us to state the magnitudes of these deviations as a function of the assumed distribution function properties.

Electrochemical method of controlling thiolate coverage on a conductive substrate such as gold

NASA Technical Reports Server (NTRS)

Porter, Marc D. (Inventor); Weisshaar, Duane E. (Inventor)

1998-01-01

An electrochemical method for forming a partial monomolecular layer of a predetermined extent of coverage of a thiolate of the formula, XRS--, therein R can be a linear or branched chain hydrocarbon or an aromatic or the like and X can be any compatible end group, e.g., OH, COOH, CH.sub.3 or the like, upon a substrate such as gold, which involves applying in an electrochemical system a constant voltage preselected to yield the desired predetermined extent of coverage.

Electrochemical method of controlling thiolate coverage on a conductive substrate such as gold

DOEpatents

Porter, Marc D.; Weisshaar, Duane E.

1998-10-27

An electrochemical method for forming a partial monomolecular layer of a predetermined extent of coverage of a thiolate of the formula, XRS--, therein R can be a linear or branched chain hydrocarbon or an aromatic or the like and X can be any compatible end group, e.g., OH, COOH, CH.sub.3 or the like, upon a substrate such as gold, which involves applying in an electrochemical system a constant voltage preselected to yield the desired predetermined extent of coverage.

Electrochemical method of controlling thiolate coverage on a conductive substrate such as gold

DOEpatents

Porter, Marc D.; Weisshaar, Duane E.

1997-06-03

An electrochemical method for forming a partial monomolecular layer of a predetermined extent of coverage of a thiolate of the formula, XRS.sup.-, wherein R can be a linear or branched chain hydrocarbon or an aromatic or the like and X can be any compatible end group, e.g., OH, COOH, CH.sub.3 or the like, upon a substrate such as gold, which involves applying in an electrochemical system a constant voltage preselected to yield the desired predetermined extent of coverage.

Glucose and Applied Voltage Accelerated p-Nitrophenol Reduction in Biocathode of Bioelectrochemical Systems

PubMed Central

Wang, Xinyu; Xing, Defeng; Mei, Xiaoxue; Liu, Bingfeng; Ren, Nanqi

2018-01-01

p-Nitrophenol (PNP) is common in the wastewater from many chemical industries. In this study, we investigated the effect of initial concentrations of PNP and glucose and applied voltage on PNP reduction in biocathode BESs and open-circuit biocathode BESs (OC-BES). The PNP degradation efficiency of a biocathode BES with 0.5 V (Bioc-0.5) reached 99.5 ± 0.8%, which was higher than the degradation efficiency of the BES with 0 V (Bioc-0) (62.4 ± 4.5%) and the OC-BES (59.2 ± 12.5%). The PNP degradation rate constant (kPNP) of Bioc-0.5 was 0.13 ± 0.01 h-1, which was higher than the kPNP of Bioc-0 (0.024 ± 0.002 h-1) and OC-BES (0.013 ± 0.0005 h-1). PNP degradation depended on the initial concentrations of glucose and PNP. A glucose concentration of 0.5 g L-1 was best for PNP degradation. The initial PNP increased from 50 to 130 mg L-1 and the kPNP decreased from 0.093 ± 0.008 to 0.027 ± 0.001 h-1. High-throughput sequencing of 16S rRNA gene amplicons indicated differences in microbial community structure between BESs with different voltages and the OC-BES. The predominant populations were affiliated with Streptococcus (42.7%) and Citrobacter (54.1%) in biocathode biofilms of BESs, and Dysgonomonas were the predominant microorganisms in biocathode biofilms of OC-BESs. The predominant populations were different among the cathode biofilms and the suspensions. These results demonstrated that applied voltage and biocathode biofilms play important roles in PNP degradation. PMID:29636747

New charging strategy for lithium-ion batteries based on the integration of Taguchi method and state of charge estimation

NASA Astrophysics Data System (ADS)

Vo, Thanh Tu; Chen, Xiaopeng; Shen, Weixiang; Kapoor, Ajay

2015-01-01

In this paper, a new charging strategy of lithium-polymer batteries (LiPBs) has been proposed based on the integration of Taguchi method (TM) and state of charge estimation. The TM is applied to search an optimal charging current pattern. An adaptive switching gain sliding mode observer (ASGSMO) is adopted to estimate the SOC which controls and terminates the charging process. The experimental results demonstrate that the proposed charging strategy can successfully charge the same types of LiPBs with different capacities and cycle life. The proposed charging strategy also provides much shorter charging time, narrower temperature variation and slightly higher energy efficiency than the equivalent constant current constant voltage charging method.

Recent Developments of Electrochemical Promotion of Catalysis in the Techniques of DeNOx

PubMed Central

Tang, Xiaolong; Yi, Honghong; Chen, Chen; Wang, Chuan

2013-01-01

Electrochemical promotion of catalysis reactions (EPOC) is one of the most significant discoveries in the field of catalytic and environmental protection. The work presented in this paper focuses on the aspects of reaction mechanism, influencing factors, and recent positive results. It has been shown with more than 80 different catalytic systems that the catalytic activity and selectivity of conductive catalysts deposited on solid electrolytes can be altered in the last 30 years. The active ingredient of catalyst can be activated by applying constant voltage or constant current to the catalysts/electrolyte interface. The effect of EPOC can improve greatly the conversion rate of NOx. And it can also improve the lifetime of catalyst by inhibiting its poisoning. PMID:23970835

Mechanism and kinetics of electrophoretic deposition of Al{sub 2}O{sub 3}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sarkar, P.; Nicholson, P.S.

1996-06-01

The four main electrophoretic deposition (EPD) mechanisms are discussed and their shortcomings pointed out. The Hamaker constant for Al{sub 2}O{sub 3} in ethanol suspension is determined by modelling the relationship between particle interaction energy and suspension stability. The Derjagun-Landau-Verwey-Overbeek (DLVO) interaction energy curve for Al{sub 2}O{sub 3} particles in ethanol suspension is calculated and the minimum deposition voltage determined. Three probe dc measurements were conducted to explain discrepancies between the calculated and experimentally-observed voltage. A mechanism proposed is based on the DLVO theory and particle-lyosphere destortion/thinning. Kinetic equations for EPD are developed for constant current and constant voltage deposition usingmore » mass balance conditions and verified by experimental data.« less

Increasing The Electric Field For An Improved Search For Time-Reversal Violation Using Radium-225

NASA Astrophysics Data System (ADS)

Powers, Adam

2017-09-01

Radium-225 atoms, because of their unusual pear-shaped nuclei, have an enhanced sensitivity to the violation of time reversal symmetry. A breakdown of this fundamental symmetry could help explain the apparent scarcity of antimatter in the Universe. Our goal is to improve the statistical sensitivity of an ongoing experiment that precisely measures the EDM of Radium-225. This can be done by increasing the electric field acting on the Radium atoms. We do this by increasing the voltage that can be reliably applied between two electrodes, and narrowing the gap between them. We use a varying high voltage system to condition the electrodes using incremental voltage ramp tests to achieve higher voltage potential differences. Using an adjustable gap mount to change the distance between the electrodes, specific metals for their composition, and a clean room procedure to keep particulates out of the system, we produce a higher and more stable electric field. Progress is marked by measurements of the leakage current between the electrodes during our incremental voltage ramp tests or emulated tests of the actual experiment, with low and constant current showing stability of the field. This project is supported by Michigan State University, and the US DOE, Office of Science, Office of Nuclear Physics, under Contract DE-AC02-06CH11357.

Time-dependent deformation of polymer network in polymer-stabilized cholesteric liquid crystals (Conference Presentation)

NASA Astrophysics Data System (ADS)

Lee, Kyung Min; Tondiglia, Vincent P.; Bunning, Timothy J.; White, Timothy J.

2017-02-01

Recently, we reported direct current (DC) field controllable electro-optic (EO) responses of negative dielectric anisotropy polymer stabilized cholesteric liquid crystals (PSCLCs). A potential mechanism is: Ions in the liquid crystal mixtures are trapped in/on the polymer network during the fast photopolymerization process, and the movement of ions by the application of the DC field distorts polymer network toward the negative electrode, inducing pitch variation through the cell thickness, i.e., pitch compression on the negative electrode side and pitch expansion on positive electrode side. As the DC voltage is directly applied to a target voltage, charged polymer network is deformed and the reflection band is tuned. Interestingly, the polymer network deforms further (red shift of reflection band) with time when constantly applied DC voltage, illustrating DC field induced time dependent deformation of polymer network (creep-like behavior). This time dependent reflection band changes in PSCLCs are investigated by varying the several factors, such as type and concentration of photoinitiators, liquid crystal monomer content, and curing condition (UV intensity and curing time). In addition, simple linear viscoelastic spring-dashpot models, such as 2-parameter Kelvin and 3-parameter linear models, are used to investigate the time-dependent viscoelastic behaviors of polymer networks in PSCLC.

Evidence for thermally assisted threshold switching behavior in nanoscale phase-change memory cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Le Gallo, Manuel; Athmanathan, Aravinthan; Krebs, Daniel

2016-01-14

In spite of decades of research, the details of electrical transport in phase-change materials are still debated. In particular, the so-called threshold switching phenomenon that allows the current density to increase steeply when a sufficiently high voltage is applied is still not well understood, even though there is wide consensus that threshold switching is solely of electronic origin. However, the high thermal efficiency and fast thermal dynamics associated with nanoscale phase-change memory (PCM) devices motivate us to reassess a thermally assisted threshold switching mechanism, at least in these devices. The time/temperature dependence of the threshold switching voltage and current inmore » doped Ge{sub 2}Sb{sub 2}Te{sub 5} nanoscale PCM cells was measured over 6 decades in time at temperatures ranging from 40 °C to 160 °C. We observe a nearly constant threshold switching power across this wide range of operating conditions. We also measured the transient dynamics associated with threshold switching as a function of the applied voltage. By using a field- and temperature-dependent description of the electrical transport combined with a thermal feedback, quantitative agreement with experimental data of the threshold switching dynamics was obtained using realistic physical parameters.« less

Three-dimensional ceramic molding process based on microstereolithography for the production of piezoelectric energy harvesters

NASA Astrophysics Data System (ADS)

Maruo, Shoji; Sugiyama, Kenji; Daicho, Yuya; Monri, Kensaku

2014-03-01

A three-dimensional (3-D) molding process using a master polymer mold produced by microstereolithography has been developed for the production of piezoelectric ceramic elements. In this method, ceramic slurry is injected into a 3-D polymer mold via a centrifugal casting process. The polymer master mold is thermally decomposed so that complex 3-D piezoelectric ceramic elements can be produced. As an example of 3-D piezoelectric ceramic elements, we produced a spiral piezoelectric element that can convert multidirectional loads into a voltage. It was confirmed that a prototype of the spiral piezoelectric element could generate a voltage by applying a load in both parallel and lateral directions in relation to the helical axis. The power output of 123 pW was obtained by applying the maximum load of 2.8N at 2 Hz along the helical axis. In addition, to improve the performance of power generation, we utilized a two-step sintering process to obtain dense piezoelectric elements. As a result, we obtained a sintering body with relative density of 92.8%. Piezoelectric constant d31 of the sintered body attained to -40.0 pC/N. Furthermore we analyzed the open-circuit voltage of the spiral piezoelectric element using COMSOL multiphysics. As a result, it was found that use of patterned electrodes according to the surface potential distribution of the spiral piezoelectric element had a potential to provide high output voltage that was 20 times larger than that of uniform electrodes.

Electron spin resonance observation of charge carrier concentration in organic field-effect transistors during device operation

NASA Astrophysics Data System (ADS)

Tanaka, Hisaaki; Hirate, Masataka; Watanabe, Shun-ichiro; Kaneko, Kazuaki; Marumoto, Kazuhiro; Takenobu, Taishi; Iwasa, Yoshihiro; Kuroda, Shin-ichi

2013-01-01

Charge carrier concentration in operating organic field-effect transistors (OFETs) reflects the electric potential within the channel, acting as a key quantity to clarify the operation mechanism of the device. Here, we demonstrate a direct determination of charge carrier concentration in the operating devices of pentacene and poly(3-hexylthiophene) (P3HT) by field-induced electron spin resonance (FI-ESR) spectroscopy. This method sensitively detects polarons induced by applying gate voltage, giving a clear FI-ESR signal around g=2.003 in both devices. Upon applying drain-source voltage, carrier concentration decreases monotonically in the FET linear region, reaching about 70% of the initial value at the pinch-off point, and stayed constant in the saturation region. The observed results are reproduced well from the theoretical potential profile based on the gradual channel model. In particular, the carrier concentration at the pinch-off point is calculated to be β/(β+1) of the initial value, where β is the power exponent in the gate voltage (Vgs) dependence of the mobility (μ), expressed as μ∝Vgsβ-2, providing detailed information of charge transport. The present devices show β=2.6 for the pentacene and β=2.3 for the P3HT cases, consistent with those determined by transfer characteristics. The gate voltage dependence of the mobility, originating from the charge trapping at the device interface, is confirmed microscopically by the motional narrowing of the FI-ESR spectra.

Identification of the pH sensor and activation by chemical modification of the ClC-2G Cl- channel.

PubMed

Stroffekova, K; Kupert, E Y; Malinowska, D H; Cuppoletti, J

1998-10-01

Rabbit and human ClC-2G Cl- channels are voltage sensitive and activated by protein kinase A and low extracellular pH. The objective of the present study was to investigate the mechanism involved in acid activation of the ClC-2G Cl- channel and to determine which amino acid residues play a role in this acid activation. Channel open probability (Po) at +/-80 mV holding potentials increased fourfold in a concentration-dependent manner with extracellular H+ concentration (that is, extracellular pH, pHtrans), with an apparent acidic dissociation constant of pH 4.95 +/- 0.27. 1-Ethyl-3(3-dimethylaminopropyl)carbodiimide-catalyzed amidation of the channel with glycine methyl ester increased Po threefold at pHtrans 7.4, at which the channel normally exhibits low Po. With extracellular pH reduction (protonation) or amidation, increased Po was due to a significant increase in open time constants and a significant decrease in closed time constants of the channel gating, and this effect was insensitive to applied voltage. With the use of site-directed mutagenesis, the extracellular region EELE (amino acids 416-419) was identified as the pH sensor and amino acid Glu-419 was found to play the key or predominant role in activation of the ClC-2G Cl- channel by extracellular acid.

Characteristics of arc currents on a negatively biased solar cell array in a plasma

NASA Technical Reports Server (NTRS)

Snyder, D. B.

1984-01-01

The time dependence of the emitted currents during arcing on solar cell arrays is being studied. The arcs are characterized using three parameters: the voltage change of the array during the arc (i.e., the charge lost), the peak current during the arc, and the time constant describing the arc current. This paper reports the dependence of these characteristics on two array parameters, the interconnect bias voltage and the array capacitance to ground. It was found that the voltage change of the array during an arc is nearly equal to the bias voltage. The array capacitance, on the other hand, influences both the peak current and the decay time constant of the arc. Both of these characteristics increase with increasing capacitance.

State-plane trajectories used to observe and control the behavior of a voltage step-up dc-to-dc converter

NASA Technical Reports Server (NTRS)

Burns, W. W., III; Wilson, T. G.

1976-01-01

State-plane analysis techniques are employed to study the voltage step up energy storage dc-to-dc converter. Within this framework, an example converter operating under the influence of a constant on time and a constant frequency controller is examined. Qualitative insight gained through this approach is used to develop a conceptual free running control law for the voltage step up converter which can achieve steady state operation in one on/off cycle of control. Digital computer simulation data is presented to illustrate and verify the theoretical discussions presented.

Timing and efficacy of Ca2+ channel activation in hippocampal mossy fiber boutons.

PubMed

Bischofberger, Josef; Geiger, Jörg R P; Jonas, Peter

2002-12-15

The presynaptic Ca2+ signal is a key determinant of transmitter release at chemical synapses. In cortical synaptic terminals, however, little is known about the kinetic properties of the presynaptic Ca2+ channels. To investigate the timing and magnitude of the presynaptic Ca2+ inflow, we performed whole-cell patch-clamp recordings from mossy fiber boutons (MFBs) in rat hippocampus. MFBs showed large high-voltage-activated Ca(2+) currents, with a maximal amplitude of approximately 100 pA at a membrane potential of 0 mV. Both activation and deactivation were fast, with time constants in the submillisecond range at a temperature of approximately 23 degrees C. An MFB action potential (AP) applied as a voltage-clamp command evoked a transient Ca2+ current with an average amplitude of approximately 170 pA and a half-duration of 580 microsec. A prepulse to +40 mV had only minimal effects on the AP-evoked Ca2+ current, indicating that presynaptic APs open the voltage-gated Ca2+ channels very effectively. On the basis of the experimental data, we developed a kinetic model with four closed states and one open state, linked by voltage-dependent rate constants. Simulations of the Ca2+ current could reproduce the experimental data, including the large amplitude and rapid time course of the current evoked by MFB APs. Furthermore, the simulations indicate that the shape of the presynaptic AP and the gating kinetics of the Ca2+ channels are tuned to produce a maximal Ca2+ influx during a minimal period of time. The precise timing and high efficacy of Ca2+ channel activation at this cortical glutamatergic synapse may be important for synchronous transmitter release and temporal information processing.

Tunable dielectric properties of TiO2 thin film based MOS systems for application in microelectronics

NASA Astrophysics Data System (ADS)

Gyanan; Mondal, Sandip; Kumar, Arvind

2016-12-01

Post-deposition annealing (PDA) is an inherent part of a sol-gel fabrication process to achieve the optimum device performance, especially in CMOS applications. Annealing removes the oxygen vacancies and improves the structural order of the dielectric films. The process also reduces the interface related defects and improves the interfacial properties. Here, we applied a sol-gel spin-coating technique to prepare high-k TiO2 films on the p-Si substrate. These films were fired at 400 °C for the duration of 20, 40, 60 and 80 min to know the effects of annealing time on the device characteristics. The current-voltage (I-V) and capacitance-voltage (C-V) characteristics of annealed TiO2 films were examined in Al/TiO2/p-Si device configuration at room temperature. The 60 min annealed film gives the optimum performance and contained 69.5% anatase and 39.5% rutile phase with refractive index 2.40 at 550 nm. The C-V and I-V characteristic showed a significant dependence on annealing time such as variation in dielectric constant and leakage current. This allows us to tune the various electrical properties of MOS systems. The accumulation capacitance (Cox), dielectric constant (κ) and the equivalent oxide thickness (EOT) of the film fired for 60 min were found to be 458 pF, 33, and 4.25 nm, respectively with a low leakage current density (3.13 × 10-7 A/cm2) fired for 80 min at -1 V. The current conduction mechanisms at high bias voltage were dominated by trap-charge limited current (TCLC), while at small voltages, space charge limited current (SCLC) was more prominent.

Nonlinear tuning techniques of plasmonic nano-filters

NASA Astrophysics Data System (ADS)

Kotb, Rehab; Ismail, Yehea; Swillam, Mohamed A.

2015-02-01

In this paper, a fitting model to the propagation constant and the losses of Metal-Insulator-Metal (MIM) plasmonic waveguide is proposed. Using this model, the modal characteristics of MIM plasmonic waveguide can be solved directly without solving Maxwell's equations from scratch. As a consequence, the simulation time and the computational cost that are needed to predict the response of different plasmonic structures can be reduced significantly. This fitting model is used to develop a closed form model that describes the behavior of a plasmonic nano-filter. Easy and accurate mechanisms to tune the filter are investigated and analyzed. The filter tunability is based on using a nonlinear dielectric material with Pockels or Kerr effect. The tunability is achieved by applying an external voltage or through controlling the input light intensity. The proposed nano-filter supports both red and blue shift in the resonance response depending on the type of the used non-linear material. A new approach to control the input light intensity by applying an external voltage to a previous stage is investigated. Therefore, the filter tunability to a stage that has Kerr material can be achieved by applying voltage to a previous stage that has Pockels material. Using this method, the Kerr effect can be achieved electrically instead of varying the intensity of the input source. This technique enhances the ability of the device integration for on-chip applications. Tuning the resonance wavelength with high accuracy, minimum insertion loss and high quality factor is obtained using these approaches.

An attempt to electrically enhance phytoremediation of arsenic contaminated water.

PubMed

Kubiak, Jan J; Khankhane, Premraj J; Kleingeld, Pieter J; Lima, Ana T

2012-04-01

Water polluted with arsenic presents a challenge for remediation. A combination of phyto- and electro-remediation was attempted in this study. Four tanks were setup in order to assess the arsenic removal ability of the two methods separately and in combination. Lemna minor was chosen for As remediation and collected from a ditch in Utrecht, The Netherlands. The tanks were filled with surface water without any pre-cleaning, therefore containing various elements including metals as Mn (2.9 mg L(-1)), Cu (0.05 mg L(-1)), Fe (1.39 mg L(-1)), and Ba (0.13 mg L(-1)). This water was then spiked with As and allocated to a feed container, guaranteeing a continuous flow of 0.12 mL s(-1) to each tank. Two experiments were performed: Exp. 1 with 3 consecutive stages with rising applied voltage and Exp. 2, with a constant voltage over a period of 6 d. Measurements of pH and temperature were taken every working day, as well as water samples from outlets of all tanks including feed container for control. From the present study, there was no evidence that As had been taken up by the plants, but a strong depletion of As was observed in the tanks where current was applied. Preliminary results clearly showed that applying voltage to the electrodes caused 90% removal of As from the spiked surface water. Crown Copyright © 2012. Published by Elsevier Ltd. All rights reserved.

Modeling and simulation performance of photovoltaic system integration battery and supercapacitor paralellization of MPPT prototipe for solar vehicle

NASA Astrophysics Data System (ADS)

Ajiatmo, Dwi; Robandi, Imam

2017-03-01

This paper proposes a control scheme photovoltaic, battery and super capacitor connected in parallel for use in a solar vehicle. Based on the features of battery charging, the control scheme consists of three modes, namely, mode dynamic irradian, constant load mode and constant voltage charging mode. The shift of the three modes can be realized by controlling the duty cycle of the mosffet Boost converter system. Meanwhile, the high voltage which is more suitable for the application can be obtained. Compared with normal charging method with parallel connected current limiting detention and charging method with dynamic irradian mode, constant load mode and constant voltage charging mode, the control scheme is proposed to shorten the charging time and increase the use of power generated from the PV array. From the simulation results and analysis conducted to determine the performance of the system in state transient and steady-state by using simulation software Matlab / Simulink. Response simulation results demonstrate the suitability of the proposed concept.

Progress and opportunities in high-voltage microactuator powering technology towards one-chip MEMS

NASA Astrophysics Data System (ADS)

Mita, Yoshio; Hirakawa, Atsushi; Stefanelli, Bruno; Mori, Isao; Okamoto, Yuki; Morishita, Satoshi; Kubota, Masanori; Lebrasseur, Eric; Kaiser, Andreas

2018-04-01

In this paper, we address issues and solutions for micro-electro-mechanical-systems (MEMS) powering through semiconductor devices towards one-chip MEMS, especially those with microactuators that require high voltage (HV, which is more than 10 V, and is often over 100 V) for operation. We experimentally and theoretically demonstrated that the main reason why MEMS actuators need such HV is the tradeoff between resonant frequency and displacement amplitude. Indeed, the product of frequency and displacement is constant regardless of the MEMS design, but proportional to the input energy, which is the square of applied voltage in an electrostatic actuator. A comprehensive study on the principles of HV device technology and associated circuit technologies, especially voltage shifter circuits, was conducted. From the viewpoint of on-chip energy source, series-connected HV photovoltaic cells have been discussed. Isolation and electrical connection methods were identified to be key enabling technologies. Towards future rapid development of such autonomous devices, a technology to convert standard 5 V CMOS devices into HV circuits using SOI substrate and a MEMS postprocess is presented. HV breakdown experiments demonstrated this technology can hold over 700 to 1000 V, depending on the layout.

Vibration, buckling and smart control of microtubules using piezoelectric nanoshells under electric voltage in thermal environment

NASA Astrophysics Data System (ADS)

Farajpour, A.; Rastgoo, A.; Mohammadi, M.

2017-03-01

Piezoelectric nanomaterials such as zinc oxide (ZnO) are of low toxicity and have many biomedical applications including optical imaging, drug delivery, biosensing and harvesting biomechanical energy using hybrid nanogenerators. In this paper, the vibration, buckling and smart control of microtubules (MTs) embedded in an elastic medium in thermal environment using a piezoelectric nanoshell (PNS) are investigated. The MT and PNS are considered to be coupled by a filament network. The PNS is subjected to thermal loads and an external electric voltage which operates to control the mechanical behavior of the MT. Using the nonlocal continuum mechanics, the governing differential equations are derived. An exact solution is presented for simply supported boundary conditions. The differential quadrature method is also used to solve the governing equations for other boundary conditions. A detailed parametric study is conducted to investigate the effects of the elastic constants of surrounding medium and internal filament matrix, scale coefficient, electric voltage, the radius-to-thickness ratio of PNSs and temperature change on the smart control of MTs. It is found that the applied electric voltage can be used as an effective controlling parameter for the vibration and buckling of MTs.

Adjustable electronic load-alarm relay

DOEpatents

Mason, Charles H.; Sitton, Roy S.

1976-01-01

This invention is an improved electronic alarm relay for monitoring the current drawn by an AC motor or other electrical load. The circuit is designed to measure the load with high accuracy and to have excellent alarm repeatability. Chattering and arcing of the relay contacts are minimal. The operator can adjust the set point easily and can re-set both the high and the low alarm points by means of one simple adjustment. The relay includes means for generating a signal voltage proportional to the motor current. In a preferred form of the invention a first operational amplifier is provided to generate a first constant reference voltage which is higher than a preselected value of the signal voltage. A second operational amplifier is provided to generate a second constant reference voltage which is lower than the aforementioned preselected value of the signal voltage. A circuit comprising a first resistor serially connected to a second resistor is connected across the outputs of the first and second amplifiers, and the junction of the two resistors is connected to the inverting terminal of the second amplifier. Means are provided to compare the aforementioned signal voltage with both the first and second reference voltages and to actuate an alarm if the signal voltage is higher than the first reference voltage or lower than the second reference voltage.

Temperature dependent charge transport studies across thermodynamic glass transition in P3HT:PCBM bulk heterojunction: insight from J-V and impedance spectroscopy

NASA Astrophysics Data System (ADS)

Sarkar, Atri; Rahaman, Abdulla Bin; Banerjee, Debamalya

2018-03-01

Temperature dependent charge transport properties of P3HT:PCBM bulk heterojunction are analysed by dc and ac measurements under dark conditions across a wide temperature range of 110-473 K, which includes the thermodynamic glass transition temperature (Tg ˜320 K) of the system. A change from Ohmic conduction to space charge limited current conduction at higher (⩾1.2 V) applied bias voltages above  ⩾200 K is observed from J-V characteristics. From capacitance-voltage (C-V) measurement at room temperature, the occurrence of a peak near the built-in voltage is observed below the dielectric relaxation frequency, originating from the competition between drift and diffusion driven motions of charges. Carrier concentration (N) is calculated from C-V measurements taken at different temperatures. Room temperature mobility values at various applied bias voltages are in accordance with that obtained from transient charge extraction by linearly increasing voltage measurement. Sample impedance is measured over five decades of frequency across temperature range by using lock-in detection. This data is used to extract temperature dependence of carrier mobility (μ), and dc conductivity (σ_dc ) which is low frequency extrapolation of ac conductivity. An activation energy of  ˜126 meV for the carrier hopping process at the metal-semiconductor interface is estimated from temperature dependence of σ_dc . Above T g, μ levels off to a constant value, whereas σ_dc starts to decrease after a transition knee at T g that can be seen as a combined effect of changes in μ and N. All these observed changes across T g can be correlated to enhanced polymer motion above the glass transition.

Simple programmable voltage reference for low frequency noise measurements

NASA Astrophysics Data System (ADS)

Ivanov, V. E.; Chye, En Un

2018-05-01

The paper presents a circuit design of a low-noise voltage reference based on an electric double-layer capacitor, a microcontroller and a general purpose DAC. A large capacitance value (1F and more) makes it possible to create low-pass filter with a large time constant, effectively reducing low-frequency noise beyond its bandwidth. Choosing the optimum value of the resistor in the RC filter, one can achieve the best ratio between the transient time, the deviation of the output voltage from the set point and the minimum noise cut-off frequency. As experiments have shown, the spectral density of the voltage at a frequency of 1 kHz does not exceed 1.2 nV/√Hz the maximum deviation of the output voltage from the predetermined does not exceed 1.4 % and depends on the holding time of the previous value. Subsequently, this error is reduced to a constant value and can be compensated.

Uniqueness and reconstruction in magnetic resonance-electrical impedance tomography (MR-EIT).

PubMed

Ider, Y Ziya; Onart, Serkan; Lionheart, William R B

2003-05-01

Magnetic resonance-electrical impedance tomography (MR-EIT) was first proposed in 1992. Since then various reconstruction algorithms have been suggested and applied. These algorithms use peripheral voltage measurements and internal current density measurements in different combinations. In this study the problem of MR-EIT is treated as a hyperbolic system of first-order partial differential equations, and three numerical methods are proposed for its solution. This approach is not utilized in any of the algorithms proposed earlier. The numerical solution methods are integration along equipotential surfaces (method of characteristics), integration on a Cartesian grid, and inversion of a system matrix derived by a finite difference formulation. It is shown that if some uniqueness conditions are satisfied, then using at least two injected current patterns, resistivity can be reconstructed apart from a multiplicative constant. This constant can then be identified using a single voltage measurement. The methods proposed are direct, non-iterative, and valid and feasible for 3D reconstructions. They can also be used to easily obtain slice and field-of-view images from a 3D object. 2D simulations are made to illustrate the performance of the algorithms.

Singular perturbation analysis of the steady-state Poisson–Nernst–Planck system: Applications to ion channels

PubMed Central

SINGER, A.; GILLESPIE, D.; NORBURY, J.; EISENBERG, R. S.

2009-01-01

Ion channels are proteins with a narrow hole down their middle that control a wide range of biological function by controlling the flow of spherical ions from one macroscopic region to another. Ion channels do not change their conformation on the biological time scale once they are open, so they can be described by a combination of Poisson and drift-diffusion (Nernst–Planck) equations called PNP in biophysics. We use singular perturbation techniques to analyse the steady-state PNP system for a channel with a general geometry and a piecewise constant permanent charge profile. We construct an outer solution for the case of a constant permanent charge density in three dimensions that is also a valid solution of the one-dimensional system. The asymptotical current–voltage (I–V ) characteristic curve of the device (obtained by the singular perturbation analysis) is shown to be a very good approximation of the numerical I–V curve (obtained by solving the system numerically). The physical constraint of non-negative concentrations implies a unique solution, i.e., for each given applied potential there corresponds a unique electric current (relaxing this constraint yields non-physical multiple solutions for sufficiently large voltages). PMID:19809600

The most energy efficient way to charge the capacitor in a RC circuit

NASA Astrophysics Data System (ADS)

Wang, Dake

2017-11-01

The voltage waveform that minimize the energy loss in the resistance when charging the capacitor in a resistor-capacitor circuit is investigated using the calculus of variation. A linear voltage ramp gives the best efficiency, which means a constant current source should be used for charging. Comparison between constant current source and battery-powered system is made to illustrate the energy advantage of the former.

Method and apparatus for plasma source ion implantation

DOEpatents

Conrad, J.R.

1988-08-16

Ion implantation into surfaces of three-dimensional targets is achieved by forming an ionized plasma about the target within an enclosing chamber and applying a pulse of high voltage between the target and the conductive walls of the chamber. Ions from the plasma are driven into the target object surfaces from all sides simultaneously without the need for manipulation of the target object. Repetitive pulses of high voltage, typically 20 kilovolts or higher, causes the ions to be driven deeply into the target. The plasma may be formed of a neutral gas introduced into the evacuated chamber and ionized therein with ionizing radiation so that a constant source of plasma is provided which surrounds the target object during the implantation process. Significant increases in the surface hardness and wear characteristics of various materials are obtained with ion implantation in this manner. 7 figs.

High voltage isolation transformer

NASA Technical Reports Server (NTRS)

Clatterbuck, C. H.; Ruitberg, A. P. (Inventor)

1985-01-01

A high voltage isolation transformer is provided with primary and secondary coils separated by discrete electrostatic shields from the surfaces of insulating spools on which the coils are wound. The electrostatic shields are formed by coatings of a compound with a low electrical conductivity which completely encase the coils and adhere to the surfaces of the insulating spools adjacent to the coils. Coatings of the compound also line axial bores of the spools, thereby forming electrostatic shields separating the spools from legs of a ferromagnetic core extending through the bores. The transformer is able to isolate a high constant potential applied to one of its coils, without the occurrence of sparking or corona, by coupling the coatings, lining the axial bores to the ferromagnetic core and by coupling one terminal of each coil to the respective coating encasing the coil.

Observing the Heterogeneous Electro-redox of Individual Single-Layer Graphene Sheets.

PubMed

Chen, Tao; Zhang, Yuwei; Xu, Weilin

2016-09-27

Electro-redox-induced heterogeneous fluorescence of an individual single-layer graphene sheet was observed in real time by a total internal reflection fluorescence microscope. It was found that the fluorescence intensity of an individual sheet can be tuned reversibly by applying periodic voltages to control the redox degree of graphene sheets. Accordingly, the oxidation and reduction kinetics of an individual single-layer graphene sheet was studied at different voltages. The electro-redox-induced reversible variation of fluorescence intensity of individual sheets indicates a reversible band gap tuning strategy. Furthermore, correlation analysis of redox rate constants on individual graphene sheets revealed a redox-induced spatiotemporal heterogeneity or dynamics of graphene sheets. The observed controllable redox kinetics can rationally guide the precise band gap tuning of individual graphene sheets and then help their extensive applications in optoelectronics and devices for renewable energy.

High voltage isolation transformer

NASA Astrophysics Data System (ADS)

Clatterbuck, C. H.; Ruitberg, A. P.

1985-04-01

A high voltage isolation transformer is provided with primary and secondary coils separated by discrete electrostatic shields from the surfaces of insulating spools on which the coils are wound. The electrostatic shields are formed by coatings of a compound with a low electrical conductivity which completely encase the coils and adhere to the surfaces of the insulating spools adjacent to the coils. Coatings of the compound also line axial bores of the spools, thereby forming electrostatic shields separating the spools from legs of a ferromagnetic core extending through the bores. The transformer is able to isolate a high constant potential applied to one of its coils, without the occurrence of sparking or corona, by coupling the coatings, lining the axial bores to the ferromagnetic core and by coupling one terminal of each coil to the respective coating encasing the coil.

Method and apparatus for plasma source ion implantation

DOEpatents

Conrad, John R.

1988-01-01

Ion implantation into surfaces of three-dimensional targets is achieved by forming an ionized plasma about the target within an enclosing chamber and applying a pulse of high voltage between the target and the conductive walls of the chamber. Ions from the plasma are driven into the target object surfaces from all sides simultaneously without the need for manipulation of the target object. Repetitive pulses of high voltage, typically 20 kilovolts or higher, causes the ions to be driven deeply into the target. The plasma may be formed of a neutral gas introduced into the evacuated chamber and ionized therein with ionizing radiation so that a constant source of plasma is provided which surrounds the target object during the implantation process. Significant increases in the surface hardness and wear characteristics of various materials are obtained with ion implantation in this manner.

A low-voltage fully balanced CMFF transconductor with improved linearity

NASA Astrophysics Data System (ADS)

Calvo, B.; Celma, S.; Alegre, J. P.; Sanz, M. T.

2007-05-01

This paper presents a new low-voltage pseudo-differential continuous-time CMOS transconductor for wideband applications. The proposed cell is based on a feedforward cancellation of the input common-mode signal and keeps the input common mode voltage constant, while the transconductance is easily tunable through a continuous bias voltage. Linearity is preserved during the tuning process for a moderate range of transconductance values. Simulation results for a 0.35 μm CMOS design show a 1:2 G m tuning range with an almost constant bandwidth over 600 MHz. Total harmonic distortion figures are below -60 dB over the whole range at 10 MHz up to a 200 μA p-p differential output. The proposed cell consumes less than 1.2 mW from a single 2.0 V supply.

Demonstration of Johnson noise thermometry with all-superconducting quantum voltage noise source

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yamada, Takahiro, E-mail: yamada-takahiro@aist.go.jp; Urano, Chiharu; Maezawa, Masaaki

We present a Johnson noise thermometry (JNT) system based on an integrated quantum voltage noise source (IQVNS) that has been fully implemented using superconducting circuit technology. To enable precise measurement of Boltzmann's constant, an IQVNS chip was designed to produce intrinsically calculable pseudo-white noise to calibrate the JNT system. On-chip real-time generation of pseudo-random codes via simple circuits produced pseudo-voltage noise with a harmonic tone interval of less than 1 Hz, which was one order of magnitude finer than the harmonic tone interval of conventional quantum voltage noise sources. We estimated a value for Boltzmann's constant experimentally by performing JNT measurementsmore » at the temperature of the triple point of water using the IQVNS chip.« less

A variable-speed, constant-frequency wind power generation scheme using a slip-ring induction generator

NASA Astrophysics Data System (ADS)

Velayudhan, C.; Bundell, J. H.

This paper investigates a variable-speed, constant-frequency double output induction generator which is capable of absorbing the mechanical energy from a fixed pitch wind turbine and converting it into electrical energy at constant grid voltage and frequency. Rotor power at varying voltage and frequency is either fed to electronically controlled resistances and used as heat energy or is rectified, inverted by a controllable line-commutated inverter and returned to the grid. Optimal power tracking is by means of an adaptive controller which controls the developed torque of the generator by monitoring the shaft speed.

A high-precision voltage source for EIT

PubMed Central

Saulnier, Gary J; Liu, Ning; Ross, Alexander S

2006-01-01

Electrical impedance tomography (EIT) utilizes electrodes placed on the surface of a body to determine the complex conductivity distribution within the body. EIT can be performed by applying currents through the electrodes and measuring the electrode voltages or by applying electrode voltages and measuring the currents. Techniques have also been developed for applying the desired currents using voltage sources. This paper describes a voltage source for use in applied-voltage EIT that includes the capability of measuring both the applied voltage and applied current. A calibration circuit and calibration algorithm are described which enables all voltage sources in an EIT system to be calibrated to a common standard. The calibration minimizes the impact of stray shunt impedance, passive component variability and active component non-ideality. Simulation data obtained using PSpice are used to demonstrate the effectiveness of the circuits and calibration algorithm. PMID:16636413

Distinguishing mechanisms for alternans in cardiac cells using constant-diastolic-interval pacing

NASA Astrophysics Data System (ADS)

Cherry, Elizabeth M.

2017-09-01

Alternans, a proarrhythmic dynamical state in which cardiac action potentials alternate between long and short durations despite a constant pacing period, traditionally has been explained at the cellular level using nonlinear dynamics principles under the assumption that the action potential duration (APD) is determined solely by the time elapsed since the end of the previous action potential, called the diastolic interval (DI). In this scenario, APDs at a steady state should be the same provided that the preceding DIs are the same. Nevertheless, experiments attempting to eliminate alternans by dynamically adjusting the timing of pacing stimuli to keep the DI constant showed that alternans persisted, contradicting the traditional theory. It is now widely known that alternans also can arise from a different mechanism associated with intracellular calcium cycling. Our goal is to determine whether intracellular calcium dynamics can explain the experimental findings regarding the persistence of alternans despite a constant DI. For this, we use mathematical models capable of producing alternans through both voltage- and calcium-mediated mechanisms. We show that for voltage-driven alternans, action potentials elicited from a constant-DI protocol are always the same. However, in the case of calcium-driven alternans, the constant-DI protocol can result in alternans. Reducing the strength of the calcium instability progressively reduces and finally eliminates constant-DI alternans. Our findings suggest that screening for the presence of alternans using a constant-DI protocol has the potential for differentiating between voltage-driven and calcium-driven alternans.

Thermally-induced voltage alteration for analysis of microelectromechanical devices

DOEpatents

Walraven, Jeremy A.; Cole, Jr., Edward I.

2002-01-01

A thermally-induced voltage alteration (TIVA) apparatus and method are disclosed for analyzing a microelectromechanical (MEM) device with or without on-board integrated circuitry. One embodiment of the TIVA apparatus uses constant-current biasing of the MEM device while scanning a focused laser beam over electrically-active members therein to produce localized heating which alters the power demand of the MEM device and thereby changes the voltage of the constant-current source. This changing voltage of the constant-current source can be measured and used in combination with the position of the focused and scanned laser beam to generate an image of any short-circuit defects in the MEM device (e.g. due to stiction or fabrication defects). In another embodiment of the TIVA apparatus, an image can be generated directly from a thermoelectric potential produced by localized laser heating at the location of any short-circuit defects in the MEM device, without any need for supplying power to the MEM device. The TIVA apparatus can be formed, in part, from a scanning optical microscope, and has applications for qualification testing or failure analysis of MEM devices.

Electrophoretic deposition of multi-walled carbon nanotubes on porous anodic aluminum oxide using ionic liquid as a dispersing agent

NASA Astrophysics Data System (ADS)

Hekmat, F.; Sohrabi, B.; Rahmanifar, M. S.; Jalali, A.

2015-06-01

Multi-wall carbon nanotubes (MW-CNTs) have been arranged in nanochannels of anodic aluminum oxide template (AAO) by electrophoretic deposition (EPD) to make a vertically-aligned carbon nanotube (VA-CNT) based electrode. Well ordered AAO templates were prepared by a two-step anodizing process by applying a constant voltage of 45 V in oxalic acid solution. The stabilized CNTs in a water-soluble room temperature ionic liquid (1-methyl-3-octadecylimidazolium bromide), were deposited in the pores of AAO templates which were conductive by deposition of Ni nanoparticles in the bottom of pores. In order to obtain ideal results, different EPD parameters, such as concentration of MWCNTs and ionic liquid on stability of MWCNT suspensions, deposition time and voltage which are applied in EPD process and also optimal conditions for anodizing of template were investigated. The capacitive performance of prepared electrodes was analyzed by measuring the specific capacitance from cyclic voltammograms and the charge-discharge curves. A maximum value of 50 Fg-1 at the scan rate of 20 mV s-1was achieved for the specific capacitance.

The electrical characteristics of the dielectric barrier discharges

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yehia, Ashraf, E-mail: yehia30161@yahoo.com; Department of Physics, Faculty of Science, Assiut University, Assiut 71516

2016-06-15

The electrical characteristics of the dielectric barrier discharges have been studied in this paper under different operating conditions. The dielectric barrier discharges were formed inside two reactors composed of electrodes in the shape of two parallel plates. The dielectric layers inside these reactors were pasted on the surface of one electrode only in the first reactor and on the surfaces of the two electrodes in the second reactor. The reactor under study has been fed by atmospheric air that flowed inside it with a constant rate at the normal temperature and pressure, in parallel with applying a sinusoidal ac voltagemore » between the electrodes of the reactor. The amount of the electric charge that flows from the reactors to the external circuit has been studied experimentally versus the ac peak voltage applied to them. An analytical model has been obtained for calculating the electrical characteristics of the dielectric barrier discharges that were formed inside the reactors during a complete cycle of the ac voltage. The results that were calculated by using this model have agreed well with the experimental results under the different operating conditions.« less

Research on equipment of micro-pressure measure and control in loading experiment of plant cell mechanics

NASA Astrophysics Data System (ADS)

Zhang, Lian; Yu, Chengbo; Tao, Hongyan; Chen, Xuejun; Zhai, Feng

2005-12-01

The equipment is developed to measure and control micro-pressure in loading experiment of plant cell mechanics. The motivation for the development of this equipment was to maintain a stationary micro-pressure on the agar of culturing cells to keep cytoactive in biology experiments. A singlechip controls the stepping motor of this equipment to drive loading equipment in the system, in order to load between 50mN and 250mN under a constant voltage. The accuracy is estimated to be +/-0.4 mN. The structure and control system of this equipment is introduced and described in detail. The experimental results show that the equipment is capable of maintaining a constant, stationary micropressure in cell culturing application and is worth of extending and applying.

Generation and Reduction of NOx on Air-Fed Ozonizers

NASA Astrophysics Data System (ADS)

Ehara, Yoshiyasu; Amemiya, Yusuke; Yamamoto, Toshiaki

A generation and reduction of NOx on air-fed ozonizers using a ferroelectric packed bed reactor have been experimentally investigated. The reactors packed with CaTiO3, SrTiO3 and BaTiO3 pellets are examined for ozone generation. An ac voltage is applied to the reactor to generate partial discharge. Ozone concentration and the different nitrogen oxides at downstream of the packed bed reactor were measured with UV absorption ozone monitor and a Fourier transform infrared spectroscope respectively. The dielectric constant of packed ferroelectric pellets influences the discharge characteristic, ozone and NOx generations are varied by the dielectric constant value. Focusing on a discharge pulse current and maximum discharge magnitude, the ferroelectric packed bed plasma reactors have been evaluated on nitrogen oxide and ozone generated concentrations.

A correlation between extensional displacement and architecture of ionic polymer transducers

NASA Astrophysics Data System (ADS)

Akle, Barbar J.; Duncan, Andrew; Leo, Donald J.

2008-03-01

Ionic polymer transducers (IPT), sometimes referred to as artificial muscles, are known to generate a large bending strain and a moderate stress at low applied voltages (<5V). Bending actuators have limited engineering applications due to the low forcing capabilities and the need for complicated external devices to convert the bending action into rotating or linear motion desired in most devices. Recently Akle and Leo reported extensional actuation in ionic polymer transducers. In this study, extensional IPTs are characterized as a function of transducer architecture. In this study 2 actuators are built and there extensional displacement response is characterized. The transducers have similar electrodes while the middle membrane in the first is a Nafion / ionic liquid and an aluminum oxide - ionic liquid in the second. The first transducer is characterized for constant current input, voltage step input, and sweep voltage input. The model prediction is in agreement in both shape and magnitude for the constant current experiment. The values of α and β used are within the range of values reported in Akle and Leo. Both experiments and model demonstrate that there is a preferred direction of applying the potential so that the transducer will exhibit large deformations. In step response the model well predicted the negative potential and the early part of the step in the positive potential and failed to predict the displacement after approximately 180s has elapsed. The model well predicted the sweep response, and the observed 1st harmonic in the displacement further confirmed the existence of a quadratic in the charge response. Finally the aluminum oxide based transducer is characterized for a step response and compared to the Nafion based transducer. The second actuator demonstrated electromechanical extensional response faster than that in the Nafion based transducer. The Aluminum oxide based transducer is expected to provide larger forces and hence larger energy density.

Thermal latency adds to lesion depth after application of high-power short-duration radiofrequency energy: Results of a computer-modeling study.

PubMed

Irastorza, Ramiro M; d'Avila, Andre; Berjano, Enrique

2018-02-01

The use of ultra-short RF pulses could achieve greater lesion depth immediately after the application of the pulse due to thermal latency. A computer model of irrigated-catheter RF ablation was built to study the impact of thermal latency on the lesion depth. The results showed that the shorter the RF pulse duration (keeping energy constant), the greater the lesion depth during the cooling phase. For instance, after a 10-second pulse, lesion depth grew from 2.05 mm at the end of the pulse to 2.39 mm (17%), while after an ultra-short RF pulse of only 1 second the extra growth was 37% (from 2.22 to 3.05 mm). Importantly, short applications resulted in deeper lesions than long applications (3.05 mm vs. 2.39 mm, for 1- and 10-second pulse, respectively). While shortening the pulse duration produced deeper lesions, the associated increase in applied voltage caused overheating in the tissue: temperatures around 100 °C were reached at a depth of 1 mm in the case of 1- and 5-second pulses. However, since the lesion depth increased during the cooling period, lower values of applied voltage could be applied in short durations in order to obtain lesion depths similar to those in longer durations while avoiding overheating. The thermal latency phenomenon seems to be the cause of significantly greater lesion depth after short-duration high-power RF pulses. Balancing the applied total energy when the voltage and duration are changed is not the optimal strategy since short pulses can also cause overheating. © 2017 Wiley Periodicals, Inc.

Electromechanical conversion efficiency for dielectric elastomer generator in different energy harvesting cycles

NASA Astrophysics Data System (ADS)

Cao, Jian-Bo; E, Shi-Ju; Guo, Zhuang; Gao, Zhao; Luo, Han-Pin

2017-11-01

In order to improve electromechanical conversion efficiency for dielectric elastomer generators (DEG), on the base of studying DEG energy harvesting cycles of constant voltage, constant charge and constant electric field intensity, a new combined cycle mode and optimization theory in terms of the generating mechanism and electromechanical coupling process have been built. By controlling the switching point to achieve the best energy conversion cycle, the energy loss in the energy conversion process is reduced. DEG generating test bench which was used to carry out comparative experiments has been established. Experimental results show that the collected energy in constant voltage cycle, constant charge cycle and constant electric field intensity energy harvesting cycle decreases in turn. Due to the factors such as internal resistance losses, electrical losses and so on, actual energy values are less than the theoretical values. The electric energy conversion efficiency by combining constant electric field intensity cycle with constant charge cycle is larger than that of constant electric field intensity cycle. The relevant conclusions provide a basis for the further applications of DEG.

Design and Implement of Low Ripple and Quasi-digital Power Supply

NASA Astrophysics Data System (ADS)

Xiangli, Li; Yanjun, Wei; Hanhong, Qi; Yan, Ma

A switch linearity hybrid power supply based on single chip microcomputer is designed which merged the merits of the switching and linear power supply. Main circuit includes pre-regulator which works in switching mode and series regulator which works in linear mode. Two-stage regulation mode was adopted in the main circuit of the power. A single chip computer (SCM) and high resolution of series D/A and A/D converters are applied to control and measurement which achieved continuous adjustable and low ripple constant current or voltage power supply

Electrochemical method of controlling thiolate coverage on a conductive substrate such as gold

DOEpatents

Porter, M.D.; Weisshaar, D.E.

1998-10-27

An electrochemical method is described for forming a partial monomolecular layer of a predetermined extent of coverage of a thiolate of the formula, XRS-, therein R can be a linear or branched chain hydrocarbon or an aromatic or the like and X can be any compatible end group, e.g., OH, COOH, CH{sub 3} or the like, upon a substrate such as gold, which involves applying in an electrochemical system a constant voltage preselected to yield the desired predetermined extent of coverage. 13 figs.

Moderately nonlinear diffuse-charge dynamics under an ac voltage.

PubMed

Stout, Robert F; Khair, Aditya S

2015-09-01

The response of a symmetric binary electrolyte between two parallel, blocking electrodes to a moderate amplitude ac voltage is quantified. The diffuse charge dynamics are modeled via the Poisson-Nernst-Planck equations for a dilute solution of point-like ions. The solution to these equations is expressed as a Fourier series with a voltage perturbation expansion for arbitrary Debye layer thickness and ac frequency. Here, the perturbation expansion in voltage proceeds in powers of V_{o}/(k_{B}T/e), where V_{o} is the amplitude of the driving voltage and k_{B}T/e is the thermal voltage with k_{B} as Boltzmann's constant, T as the temperature, and e as the fundamental charge. We show that the response of the electrolyte remains essentially linear in voltage amplitude at frequencies greater than the RC frequency of Debye layer charging, D/λ_{D}L, where D is the ion diffusivity, λ_{D} is the Debye layer thickness, and L is half the cell width. In contrast, nonlinear response is predicted at frequencies below the RC frequency. We find that the ion densities exhibit symmetric deviations from the (uniform) equilibrium density at even orders of the voltage amplitude. This leads to the voltage dependence of the current in the external circuit arising from the odd orders of voltage. For instance, the first nonlinear contribution to the current is O(V_{o}^{3}) which contains the expected third harmonic but also a component oscillating at the applied frequency. We use this to compute a generalized impedance for moderate voltages, the first nonlinear contribution to which is quadratic in V_{o}. This contribution predicts a decrease in the imaginary part of the impedance at low frequency, which is due to the increase in Debye layer capacitance with increasing V_{o}. In contrast, the real part of the impedance increases at low frequency, due to adsorption of neutral salt from the bulk to the Debye layer.

Lithium-Ion Batteries Being Evaluated for Low-Earth-Orbit Applications

NASA Technical Reports Server (NTRS)

McKissock, Barbara I.

2005-01-01

The performance characteristics and long-term cycle life of aerospace lithium-ion (Li-ion) batteries in low-Earth-orbit applications are being investigated. A statistically designed test using Li-ion cells from various manufacturers began in September 2004 to study the effects of temperature, end-of-charge voltage, and depth-of-discharge operating conditions on the cycle life and performance of these cells. Performance degradation with cycling is being evaluated, and performance characteristics and failure modes are being modeled statistically. As technology improvements are incorporated into aerospace Li-ion cells, these new designs can be added to the test to evaluate the effect of the design changes on performance and life. Cells from Lithion and Saft have achieved over 2000 cycles under 10 different test condition combinations and are being evaluated. Cells from Mine Safety Appliances (MSA) and modules made up of commercial-off-the-shelf 18650 Li-ion cells connected in series/parallel combinations are scheduled to be added in the summer of 2005. The test conditions include temperatures of 10, 20, and 30 C, end-of-charge voltages of 3.85, 3.95, and 4.05 V, and depth-of-discharges from 20 to 40 percent. The low-Earth-orbit regime consists of a 55 min charge, at a constant-current rate that is 110 percent of the current required to fully recharge the cells in 55 min until the charge voltage limit is reached, and then at a constant voltage for the remaining charge time. Cells are discharged for 35 min at the current required for their particular depth-of-discharge condition. Cells are being evaluated in four-cell series strings with charge voltage limits being applied to individual cells by the use of charge-control units designed and produced at the NASA Glenn Research Center. These charge-control units clamp the individual cell voltages as each cell reaches its end-of-charge voltage limit, and they bypass the excess current from that cell, while allowing the full current flow to the remaining cells in the pack. The goal of this evaluation is to identify conditions and cell designs for Li-ion technology that can achieve more than 30,000 low-Earth-orbit cycles. Testing is being performed at the Naval Surface Warfare Center, Crane Division, in Crane, Indiana.

Three-phase Power Flow Calculation of Low Voltage Distribution Network Considering Characteristics of Residents Load

NASA Astrophysics Data System (ADS)

Wang, Yaping; Lin, Shunjiang; Yang, Zhibin

2017-05-01

In the traditional three-phase power flow calculation of the low voltage distribution network, the load model is described as constant power. Since this model cannot reflect the characteristics of actual loads, the result of the traditional calculation is always different from the actual situation. In this paper, the load model in which dynamic load represented by air conditioners parallel with static load represented by lighting loads is used to describe characteristics of residents load, and the three-phase power flow calculation model is proposed. The power flow calculation model includes the power balance equations of three-phase (A,B,C), the current balance equations of phase 0, and the torque balancing equations of induction motors in air conditioners. And then an alternating iterative algorithm of induction motor torque balance equations with each node balance equations is proposed to solve the three-phase power flow model. This method is applied to an actual low voltage distribution network of residents load, and by the calculation of three different operating states of air conditioners, the result demonstrates the effectiveness of the proposed model and the algorithm.

Electrically controllable liquid crystal random lasers below the Fréedericksz transition threshold.

PubMed

Lee, Chia-Rong; Lin, Jia-De; Huang, Bo-Yuang; Lin, Shih-Hung; Mo, Ting-Shan; Huang, Shuan-Yu; Kuo, Chie-Tong; Yeh, Hui-Chen

2011-01-31

This investigation elucidates for the first time electrically controllable random lasers below the threshold voltage in dye-doped liquid crystal (DDLC) cells with and without adding an azo-dye. Experimental results show that the lasing intensities and the energy thresholds of the random lasers can be decreased and increased, respectively, by increasing the applied voltage below the Fréedericksz transition threshold. The below-threshold-electric-controllability of the random lasers is attributable to the effective decrease of the spatial fluctuation of the orientational order and thus of the dielectric tensor of LCs by increasing the electric-field-aligned order of LCs below the threshold, thereby increasing the diffusion constant and decreasing the scattering strength of the fluorescence photons in their recurrent multiple scattering. This can result in the decrease in the lasing intensity of the random lasers and the increase in their energy thresholds. Furthermore, the addition of an azo-dye in DDLC cell can induce the range of the working voltage below the threshold for the control of the random laser to reduce.

Model analysis and electrical characterization of atmospheric pressure cold plasma jet in pin electrode configuration

NASA Astrophysics Data System (ADS)

Deepak, G. Divya; Joshi, N. K.; Prakash, Ram

2018-05-01

In this study, both model analysis and electrical characterization of a dielectric barrier discharge based argon plasma jet have been carried at atmospheric pressure in a pin electrode configuration. The plasma and fluid dynamics modules of COMSOL multi-physics code have been used for the modeling of the plasma jet. The plasma parameters, such as, electron density, electron temperature and electrical potential have been analyzed with respect to the electrical parameters, i.e., supply voltage and supply frequency with and without the flow of gas. In all the experiments, gas flow rate has been kept constant at 1 liter per minute. This electrode configuration is subjected to a range of supply frequencies (10-25 kHz) and supply voltages (3.5-6.5 kV). The power consumed by the device has been estimated at different applied combinations (supply voltage & frequency) for optimum power consumption at maximum jet length. The maximum power consumed by the device in this configuration for maximum jet length of ˜26 mm is just ˜1 W.

Dynamic Response in Nanoelectrowetting on a Dielectric.

PubMed

Choudhuri, Jyoti Roy; Vanzo, Davide; Madden, Paul Anthony; Salanne, Mathieu; Bratko, Dusan; Luzar, Alenka

2016-09-27

Droplet spreading at an applied voltage underlies the function of tunable optical devices including adjustable lenses and matrix display elements. Faster response and the enhanced resolution motivate research toward miniaturization of these devices to nanoscale dimensions. The response of an aqueous nanodroplet to an applied field can differ significantly from macroscopic predictions. Understanding these differences requires characterization at the molecular level. We describe the equilibrium and nonequilibrium molecular dynamics simulations of nanosized aqueous droplets on a hydrophobic surface with the embedded concentric electrodes. Constant electrode potential is enforced by a rigorous account of the metal polarization. We demonstrate that the reduction of the equilibrium contact angle is commensurate to, and adjusts reversibly with, the voltage change. For a droplet with O(10) nm diameter, a typical response time to the imposition of the field is of O(10(2)) ps. Drop relaxation is about twice as fast when the field is switched off. The friction coefficient obtained from the rate of the drop relaxation on the nonuniform surface, decreases when the droplet approaches equilibrium from either direction, that is, by spreading or receding. The strong dependence of the friction on the surface hydrophilicity points to the dominance of the liquid-surface friction at the drop's perimeter as described in the molecular kinetic theory. This approach enables correct predictions of trends in dynamic responses associated with varied voltage or substrate material.

Bioelectrochemical BTEX removal at different voltages: assessment of the degradation and characterization of the microbial communities.

PubMed

Daghio, Matteo; Espinoza Tofalos, Anna; Leoni, Barbara; Cristiani, Pierangela; Papacchini, Maddalena; Jalilnejad, Elham; Bestetti, Giuseppina; Franzetti, Andrea

2018-01-05

BTEX compounds (Benzene, Toluene, Ethylbenzene and Xylenes) are toxic hydrocarbons that can be found in groundwater due to accidental spills. Bioelectrochemical systems (BES) are an innovative technology to stimulate the anaerobic degradation of hydrocarbons. In this work, single chamber BESs were used to assess the degradation of a BTEX mixture at different applied voltages (0.8V, 1.0V, 1.2V) between the electrodes. Hydrocarbon degradation was linked to current production and to sulfate reduction, at all the tested potentials. The highest current densities (about 200mA/m 2 with a maximum peak at 480mA/m 2 ) were observed when 0.8V were applied. The application of an external voltage increased the removal of toluene, m-xylene and p-xylene. The highest removal rate constants at 0.8V were: 0.4±0.1days -1 , 0.34±0.09days -1 and 0.16±0.02days -1 , respectively. At the end of the experiment, the microbial communities were characterized by high throughput sequencing of the 16S rRNA gene. Microorganisms belonging to the families Desulfobulbaceae, Desulfuromonadaceae and Geobacteraceae were enriched on the anodes suggesting that both direct electron transfer and sulfur cycling occurred. The cathodic communities were dominated by the family Desulfomicrobiaceae that may be involved in hydrogen production. Copyright © 2017 Elsevier B.V. All rights reserved.

Capacitors in Series: A Laboratory Activity to Promote Critical Thinking.

ERIC Educational Resources Information Center

Noll, Ellis D.; Kowalski, Ludwik

1996-01-01

Describes experiments designed to explore the distribution of potential difference between two uncharged capacitors when they are suddenly connected to a source of constant voltage. Enables students to explore the evolution of a system in which initial voltage distribution depends on capacitor values, and the final voltage distribution depends on…

Associating ground magnetometer observations with current or voltage generators

NASA Astrophysics Data System (ADS)

Hartinger, M. D.; Xu, Z.; Clauer, C. R.; Yu, Y.; Weimer, D. R.; Kim, H.; Pilipenko, V.; Welling, D. T.; Behlke, R.; Willer, A. N.

2017-07-01

A circuit analogy for magnetosphere-ionosphere current systems has two extremes for drivers of ionospheric currents: ionospheric electric fields/voltages constant while current/conductivity vary—the "voltage generator"—and current constant while electric field/conductivity vary—the "current generator." Statistical studies of ground magnetometer observations associated with dayside Transient High Latitude Current Systems (THLCS) driven by similar mechanisms find contradictory results using this paradigm: some studies associate THLCS with voltage generators, others with current generators. We argue that most of this contradiction arises from two assumptions used to interpret ground magnetometer observations: (1) measurements made at fixed position relative to the THLCS field-aligned current and (2) negligible auroral precipitation contributions to ionospheric conductivity. We use observations and simulations to illustrate how these two assumptions substantially alter expectations for magnetic perturbations associated with either a current or a voltage generator. Our results demonstrate that before interpreting ground magnetometer observations of THLCS in the context of current/voltage generators, the location of a ground magnetometer station relative to the THLCS field-aligned current and the location of any auroral zone conductivity enhancements need to be taken into account.

Dual-bridge LLC-SRC with extended voltage range for deeply depleted PEV battery charging

NASA Astrophysics Data System (ADS)

Shahzad, M. Imran; Iqbal, Shahid; Taib, Soib

2017-11-01

This paper proposes a dual-bridge LLC series resonant converter with hybrid-rectifier for achieving extended charging voltage range of 50-420 V for on-board battery charger of plug-in electric vehicle for normal and deeply depleted battery charging. Depending upon the configuration of primary switching network and secondary rectifier, the proposed topology has three operating modes as half-bridge with bridge rectifier (HBBR), full-bridge with bridge rectifier (FBBR) and full-bridge with voltage doubler (FBVD). HBBR, FBBR and FBVD operating modes of converter achieve 50-125, 125-250 and 250-420 V voltage ranges, respectively. For voltage above 62 V, the converter operates below resonance frequency zero voltage switching region with narrow switching frequency range for soft commutation of secondary diodes and low turn-off current of MOSFETs to reduce switching losses. The proposed converter is simulated using MATLAB Simulink and a 1.5 kW laboratory prototype is also built to validate the operation of proposed topology. Simulation and experimental results show that the converter meets all the charging requirements for deeply depleted to fully charged battery using constant current-constant voltage charging method with fixed 400 V DC input and achieves 96.22% peak efficiency.

Liquid Nitrogen as Fast High Voltage Switching Medium

NASA Astrophysics Data System (ADS)

Dickens, J.; Neuber, A.; Haustein, M.; Krile, J.; Krompholz, H.

2002-12-01

Compact pulsed power systems require new switching technologies. For high voltages, liquid nitrogen seems to be a suitable switching medium, with high hold-off voltage, low dielectric constant, and no need for pressurized systems as in high pressure gas switches. The discharge behavior in liquid nitrogen, such as breakdown voltages, formative times, current rise as function of voltage, recovery, etc. are virtually unknown, however. The phenomenology of breakdown in liquid nitrogen is investigated with high speed (temporal resolution < 1 ns) electrical and optical diagnostics, in a coaxial system with 50-Ohm impedance. Discharge current and voltage are determined with transmission line type current sensors and capacitive voltage dividers. The discharge luminosity is measured with photomultiplier tubes. Preliminary results of self-breakdown investigations (gap 1 mm, breakdown voltage 44 kV, non-boiling supercooled nitrogen) show a fast (2 ns) transition from an unknown current level to several mA, a long-duration (100 ns) phase with constant current superimposed by ns-spikes, and a final fast transition to the impedance limited current during several nanoseconds. The optical measurements will be expanded toward spectroscopy and high speed photography with the aim of clarifying the overall breakdown mechanisms, including electronic initiation, bubble formation, bubble dynamics, and their role in breakdown, for different electrode geometries (different macroscopic field enhancements).

Synthesis of self-organized TiO{sub 2} nanotube arrays: Microstructural, stereoscopic, and topographic studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Quiroz, Heiddy P., E-mail: hpquirozg@unal.edu.co; Dussan, A., E-mail: adussanc@unal.edu.co

2016-08-07

In this work, titanium dioxide nanotubes were prepared by using titanium foils via electrochemical anodization in ethylene glycol solutions containing different amounts of water and fluoride in the ranges of 1%–3% and 0.15%–0.5%, respectively, to determine their effects on morphology, optical, and crystalline structure properties. Annealing processes were performed on all samples in the range between 273 and 723 K. Morphology and structure properties of the samples were studied by scanning electron microscopy, X-ray diffraction (XRD), and transmission electron microscopy. Titanium dioxide (TiO{sub 2}) nanotubes, through anodization method, are strongly influenced by conditions, like fluoride concentration and applied voltages. Tube lengthsmore » between 2 and 7 μm were obtained, exhibiting different diameters and wall thicknesses. When alternating voltage was applied, the outer surface of the nanotubes exhibited evenly spaced ring-shaped regions, while smooth tubes were observed when constant voltage was applied. Reflection peaks, corresponding to Brookite, Anatase, and Rutile, of TiO{sub 2} phases, were observed from the XRD pattern. These phases were corroborated via μXRD measurements, and the Ti{sub 3}O{sub 5} phase was also observed in detail. Absorption coefficient (α), optical band gap (Eg), and extinction coefficient (ε) of TiO{sub 2} nanotubes were calculated by transmittance spectra in the UV–Vis range. Strong absorption was noted in the UV region from reflectance and absorbance measurements. A correlation between synthesis parameters and physical properties is presented.« less

[Determination of electric field distribution in dielectric barrier surface glow discharge by spectroscopic method].

PubMed

Li, Xue-chen; Jia, Peng-ying; Liu, Zhi-hui; Li, Li-chun; Dong, Li-fang

2008-12-01

In the present paper, stable glow discharges were obtained in air at low pressure with a dielectric barrier surface discharge device. Light emission from the discharge was detected by photomultiplier tubes and the research results show that the light signal exhibited one discharge pulse per half cycle of the applied voltage. The light pulses were asymmetric between the positive half cycle and the negative one of the applied voltage. The images of the glow surface discharge were processed by Photoshop software and the results indicate that the emission intensity remained almost constant for different places with the same distance from the powered electrode, while the emission intensity decreased with the distance from the powered electrode increasing. In dielectric barrier discharge, net electric field is determined by the applied voltage and the wall charges accumulated on the dielectric layer during the discharge, and consequently, it is important to obtain information about the net electric field distribution. For this purpose, optical emission spectroscopy method was used. The distribution of the net electric field can be deduced from the intensity ratio of spectral line 391.4 nm emitted from the first negative system of N2+ (B 2sigma u+ -->X 2sigma g+) to 337.1 nm emitted from the second positive system of N2 (C 3IIu-B 3IIg). The research results show that the electric field near the powered electric field is higher than at the edge of the discharge. These experimental results are very important for numerical study and industrial application of the surface discharge.

Resistor-logic demultiplexers for nanoelectronics based on constant-weight codes.

PubMed

Kuekes, Philip J; Robinett, Warren; Roth, Ron M; Seroussi, Gadiel; Snider, Gregory S; Stanley Williams, R

2006-02-28

The voltage margin of a resistor-logic demultiplexer can be improved significantly by basing its connection pattern on a constant-weight code. Each distinct code determines a unique demultiplexer, and therefore a large family of circuits is defined. We consider using these demultiplexers for building nanoscale crossbar memories, and determine the voltage margin of the memory system based on a particular code. We determine a purely code-theoretic criterion for selecting codes that will yield memories with large voltage margins, which is to minimize the ratio of the maximum to the minimum Hamming distance between distinct codewords. For the specific example of a 64 × 64 crossbar, we discuss what codes provide optimal performance for a memory.

Single-contact tunneling thermometry

DOEpatents

Maksymovych, Petro

2016-02-23

A single-contact tunneling thermometry circuit includes a tunnel junction formed between two objects. Junction temperature gradient information is determined based on a mathematical relationship between a target alternating voltage applied across the junction and the junction temperature gradient. Total voltage measured across the junction indicates the magnitude of the target alternating voltage. A thermal gradient is induced across the junction. A reference thermovoltage is measured when zero alternating voltage is applied across the junction. An increasing alternating voltage is applied while measuring a thermovoltage component and a DC rectification voltage component created by the applied alternating voltage. The target alternating voltage is reached when the thermovoltage is nullified or doubled by the DC rectification voltage depending on the sign of the reference thermovoltage. Thermoelectric current and current measurements may be utilized in place of the thermovoltage and voltage measurements. The system may be automated with a feedback loop.

Evaluation of Commercial Automotive-Grade BME Capacitors

NASA Technical Reports Server (NTRS)

Liu, Donhang

2014-01-01

Three Ni-BaTiO3 ceramic capacitor lots with the same specification (chip size, capacitance, and rated voltage) and the same reliability level, made by three different manufacturers, were degraded using highly accelerated life stress testing (HALST) with the same temperature and applied voltage conditions. The reliability, as characterized by mean time to failure (MTTF), differed by more than one order of magnitude among the capacitor lots. A theoretical model based on the existence of depletion layers at grain boundaries and the entrapment of oxygen vacancies has been proposed to explain the MTTF difference among these BME capacitors. It is the conclusion of this model that reliability will not be improved simply by increasing the insulation resistance of a BME capacitor. Indeed, Ni-BaTiO3 ceramic capacitors with a smaller degradation rate constant K will always give rise to a longer reliability life.

Evaluation of Commercial Automotive-Grade BME Capacitors

NASA Technical Reports Server (NTRS)

Liu, Donhang

2014-01-01

Three Ni-BaTiO3 ceramic capacitor lots with the same specification (chip size, capacitance, and rated voltage) and the same reliability level, made by three different manufacturers, were degraded using highly accelerated life stress testing (HALST) with the same temperature and applied voltage conditions. The reliability, as characterized by mean time to failure (MTTF), differed by more than one order of magnitude among the capacitor lots. A theoretical model based on the existence of depletion layers at grain boundaries and the entrapment of oxygen vacancies has been proposed to explain the MTTF difference among these BME capacitors. It is the conclusion of this model that reliability will not be improved simply by increasing the insulation resistance of a BME capacitor. Indeed, Ni-BaTiO3 ceramic capacitors with a smaller degradation rate constant K will always give rise to a longer reliability life

A Novel Approach to the Design of Passive Filters in Electric Grids

NASA Astrophysics Data System (ADS)

Filho da Costa Castro, José; Lima, Lucas Ramalho; Belchior, Fernando Nunes; Ribeiro, Paulo Fernando

2016-12-01

The design of shunt passive filters has been a topic of constant research since the 70's. Due to the lower cost, passive shunt filters are still considered a preferred option. This paper presents a novel approach for the placement and sizing of passive filters through ranking solutions based on the minimization of the total harmonic distortion (THDV) of the supply system rather than one specific bus, without neglecting the individual harmonic distortions. The developed method was implemented using Matlab/Simulink and applied to a test system. The results shown that is possible to minimize the total voltage harmonic distortion using a system approach during the filter selection. Additionally, since the method is mainly based on a heurist approach, it avoids the complexity associated with of use of advanced mathematical tools such as artificial intelligence techniques. The analyses contemplate a sinusoidal voltage utility and also the condition with background distortion utility.

A voltage-controlled capacitive discharge method for electrical activation of peripheral nerves.

PubMed

Rosellini, Will M; Yoo, Paul B; Engineer, Navzer; Armstrong, Scott; Weiner, Richard L; Burress, Chester; Cauller, Larry

2011-01-01

A voltage-controlled capacitive discharge (VCCD) method was investigated as an alternative to rectangular stimulus pulses currently used in peripheral nerve stimulation therapies.  In two anesthetized Gottingen mini pigs, the threshold (total charge per phase) for evoking a compound nerve action potential (CNAP) was compared between constant current (CC) and VCCD methods. Electrical pulses were applied to the tibial and posterior cutaneous femoralis nerves using standard and modified versions of the Medtronic 3778 Octad.  In contrast to CC stimulation, the combined application of VCCD pulses with a modified Octad resulted in a marked decrease (-73 ± 7.4%) in the stimulation threshold for evoking a CNAP. This was consistent for different myelinated fiber types and locations of stimulation.  The VCCD method provides a highly charge-efficient means of activating myelinated fibers that could potentially be used within a wireless peripheral nerve stimulator system. © 2011 International Neuromodulation Society.

Carrier-injection studies in GaN-based light-emitting-diodes

NASA Astrophysics Data System (ADS)

Nguyen, Dinh Chuong; Vaufrey, David; Leroux, Mathieu

2015-09-01

Although p-type GaN has been achieved by Mg doping, the low hole-mobility still remains a difficulty for GaN-based light-emitting diodes (LEDs). Due to the lack of field-dependent-velocity model for holes, in GaN-based LED simulations, the hole mobility is usually supposed to remain constant. However, as the p-GaN-layer conductivity is lower than the n-GaN-layer conductivity, a strong electric-field exists in the p-side of an LED when the applied voltage exceeds the LED's built-in voltage. Under the influence of this field, the mobilities of electrons and holes are expected to decrease. Based on a field-dependent-velocity model that is usually used for narrow-bandgap materials, an LED structure is modelled with three arbitrarily chosen hole saturation-velocities. The results show that a hole saturation-velocity lower than 4x106 cm/s can negatively affect the LED's behaviors.

Design and Development of Non-Contact Bio-Potential Electrodes for Pervasive Health Monitoring Applications.

PubMed

Portelli, Anthony J; Nasuto, Slawomir J

2017-01-01

For the advent of pervasive bio-potential monitoring, it will be necessary to utilize a combination of cheap, quick to apply, low-noise electrodes and compact electronics with wireless technologies. Once available, all electrical activity resulting from the processes of the human body could be actively and constantly monitored without the need for cumbersome application and maintenance. This could significantly improve the early diagnosis of a range of different conditions in high-risk individuals, opening the possibility for new treatments and interventions as conditions develop. This paper presents the design and implementation of compact, non-contact capacitive bio-potential electrodes utilising a low impedance current-to-voltage configuration and a bootstrapped voltage follower, demonstrating results applicable to research applications for capacitive electrocardiography and capacitive electromyography. The presented electrodes use few components, have a small surface area and are capable of acquiring a range of bio-potential signals.

Thermally Stable, Piezoelectric and Pyroelectric Polymeric Substrates and Method Relating Thereto

NASA Technical Reports Server (NTRS)

Simpson, Joycelyn O. (Inventor); St.Claire, Terry L. (Inventor)

2002-01-01

A thermally stable, piezoelectric and pyroelectric polymeric substrate was prepared, This thermally stable, piezoelectric and pyroelectric polymeric substrate may be used to prepare electromechanical transducers, thermomechanical transducers, accelerometers, acoustic sensors, infrared sensors, pressure sensors, vibration sensors, impact sensors. in-situ temperature sensors, in-situ stress/strain sensors, micro actuators, switches. adjustable fresnel lenses, speakers, tactile sensors, weather sensors, micro positioners, ultrasonic devices, power generators, tunable reflectors, microphones, and hydrophones. The process for preparing these polymeric substrates includes: providing a polymeric substrate having a softening temperature greater than 100 C; depositing a metal electrode material onto the polymer film; attaching a plurality of electrical leads to the metal electrode coated polymeric substrates; heating the metal electrode coated polymeric substrate in a low dielectric medium; applying a voltage to the heated metal electrode coated polymeric substrate to induce polarization; and cooling the polarized metal electrode coated polymeric electrode while maintaining a constant voltage.

Thermally Stable, Piezoelectric and Pyroelectric Polymeric Substrates

NASA Technical Reports Server (NTRS)

Simpson, Joycely O. (Inventor); St.Clair, Terry L. (Inventor)

1999-01-01

A thermally stable, piezoelectric and pyroelectric polymeric substrate was prepared. This thermally stable, piezoelectric and pyroelectric polymeric substrate may be used to prepare electromechanical transducers, thermomechanical transducers, accelerometers. acoustic sensors, infrared sensors, pressure sensors, vibration sensors, impact sensors, in-situ temperature sensors, in-situ stress/strain sensors, micro actuators, switches, adjustable fresnel lenses, speakers, tactile sensors. weather sensors, micro positioners, ultrasonic devices, power generators, tunable reflectors, microphones, and hydrophones. The process for preparing these polymeric substrates includes: providing a polymeric substrate having a softening temperature greater than 1000 C; depositing a metal electrode material onto the polymer film; attaching a plurality of electrical leads to the metal electrode coated polymeric substrate; heating the metal electrode coated polymeric substrate in a low dielectric medium; applying a voltage to the heated metal electrode coated polymeric substrate to induce polarization; and cooling the polarized metal electrode coated polymeric electrode while maintaining a constant voltage.

Method of Making Thermally Stable, Piezoelectric and Proelectric Polymeric Substrates

NASA Technical Reports Server (NTRS)

Simpson, Joycelyn O. (Inventor); St.Clair, Terry L. (Inventor)

1999-01-01

A thermally stable, piezoelectric and pyroelectric polymeric substrate was prepared. This thermally stable, piezoelectric and pyroelectric polymeric substrate may be used to prepare electromechanical transducers, thermomechanical transducers, accelerometers, acoustic sensors, infrared sensors, pressure sensors, vibration sensors, impact sensors. in-situ temperature sensors, in-situ stress/strain sensors, micro actuators, switches, adjustable fresnel lenses, speakers, tactile sensors, weather sensors, micro positioners, ultrasonic devices, power generators, tunable reflectors, microphones, and hydrophones. The process for preparing these polymeric substrates includes: providing a polymeric substrate having a softening temperature greater than 100 C; depositing a metal electrode material onto the polymer film; attaching a plurality of electrical leads to the metal electrode coated polymeric substrate; heating the metal electrode coated polymeric substrate in a low dielectric medium: applying a voltage to the heated metal electrode coated polymeric substrate to induce polarization; and cooling the polarized metal electrode coated polymeric electrode while maintaining a constant voltage.

Design and Development of Non-Contact Bio-Potential Electrodes for Pervasive Health Monitoring Applications

PubMed Central

Portelli, Anthony J.; Nasuto, Slawomir J.

2017-01-01

For the advent of pervasive bio-potential monitoring, it will be necessary to utilize a combination of cheap, quick to apply, low-noise electrodes and compact electronics with wireless technologies. Once available, all electrical activity resulting from the processes of the human body could be actively and constantly monitored without the need for cumbersome application and maintenance. This could significantly improve the early diagnosis of a range of different conditions in high-risk individuals, opening the possibility for new treatments and interventions as conditions develop. This paper presents the design and implementation of compact, non-contact capacitive bio-potential electrodes utilising a low impedance current-to-voltage configuration and a bootstrapped voltage follower, demonstrating results applicable to research applications for capacitive electrocardiography and capacitive electromyography. The presented electrodes use few components, have a small surface area and are capable of acquiring a range of bio-potential signals. PMID:28045439

A FPGA-based Measurement System for Nonvolatile Semiconductor Memory Characterization

NASA Astrophysics Data System (ADS)

Bu, Jiankang; White, Marvin

2002-03-01

Low voltage, long retention, high density SONOS nonvolatile semiconductor memory (NVSM) devices are ideally suited for PCMCIA, FLASH and 'smart' cards. The SONOS memory transistor requires characterization with an accurate, rapid measurement system with minimum disturbance to the device. The FPGA-based measurement system includes three parts: 1) a pattern generator implemented with XILINX FPGAs and corresponding software, 2) a high-speed, constant-current, threshold voltage detection circuit, 3) and a data evaluation program, implemented with a LABVIEW program. Fig. 1 shows the general block diagram of the FPGA-based measurement system. The function generator is designed and simulated with XILINX Foundation Software. Under the control of the specific erase/write/read pulses, the analog detect circuit applies operational modes to the SONOS device under test (DUT) and determines the change of the memory-state of the SONOS nonvolatile memory transistor. The TEK460 digitizes the analog threshold voltage output and sends to the PC computer. The data is filtered and averaged with a LABVIEWTM program running on the PC computer and displayed on the monitor in real time. We have implemented the pattern generator with XILINX FPGAs. Fig. 2 shows the block diagram of the pattern generator. We realized the logic control by a method of state machine design. Fig. 3 shows a small part of the state machine. The flexibility of the FPGAs enhances the capabilities of this system and allows measurement variations without hardware changes. The characterization of the nonvolatile memory transistor device under test (DUT), as function of programming voltage and time, is achieved by a high-speed, constant-current threshold voltage detection circuit. The analog detection circuit incorporating fast analog switches controlled digitally with the FPGAs. The schematic circuit diagram is shown in Fig. 4. The various operational modes for the DUT are realized with control signals applied to the analog switches (SW) as shown in Fig. 5. A LABVIEWTM program, on a PC platform, collects and processes the data. The data is displayed on the monitor in real time. This time-domain filtering reduces the digitizing error. Fig. 6 shows the data processing. SONOS nonvolatile semiconductor memories are characterized by erase/write, retention and endurance measurements. Fig. 7 shows the erase/write characteristics of an n-Channel, 5V prog-rammable SONOS memory transistor. Fig.8 shows the retention characteristic of the same SONOS transistor. We have used this system to characterize SONOS nonvolatile semiconductor memory transistors. The attractive features of the test system design lies in the cost-effectiveness and flexibility of the test pattern implementation, fast read-out of memory state, low power, high precision determination of the device threshold voltage, and perhaps most importantly, minimum disturbance, which is indispensable for nonvolatile memory characterization.

Electrical quantum standards and their role in the SI

NASA Astrophysics Data System (ADS)

Robinson, Ian; Georgakopoulos, Dimitrios

2012-12-01

The International System of Units, SI, is poised to make a quantum change and become a measurement system based entirely on the fundamental properties of the natural world. In the next version of the SI, the Planck constant h, the elementary charge e, the Avogadro constant NA and the Boltzmann constant k will be fixed, in addition to the already fixed values of the speed of light c and the ground state hyperfine splitting in caesium-133. As a result, six out of the seven base units of the SI will be based directly on true invariants of nature. A major part of this change has been enabled by the ready availability of electrical quantum standards of exquisite precision and mechanisms for using them to make measurements outside the electrical arena. The overall effect will be to eliminate the remaining imprecise definitions of physical units associated with the use of artefact standards and aid direct SI measurements without problems of scaling. Fixing the Planck constant and the elementary charge will have the effect of incorporating the best physical realizations of electrical quantities into the SI, providing a system of units fit for the 21st century. The purpose of this special feature is to review the status of electrical quantum standards and report the latest developments in those areas and their applications to other areas of metrology. The special feature coincides with the 50th anniversary of the seminal paper of Josephson, 'Possible new effects in superconductive tunnelling' [1], which established the basic physical principle upon which the quantum voltage standards are based. Josephson voltage standards are based on the inverse Josephson effect. When a junction of two superconducting electrodes, weakly linked through a thin insulator or a normal metal, is irradiated with a radiofrequency electromagnetic field of frequency f and is biased by a dc current, then the voltage across the junction is quantized (i.e. small changes in either the dc current or the power of the rf irradiation, or both, do not change the voltage). The value of this quantized Josephson voltage is equal to nfh/2e, where n is the quantum step of the current-voltage characteristic curve. In this special feature there are three papers on dc Josephson voltage standards. Solve and Stock review the programme conducted by the Bureau International des Poids et Mesures (BIPM) to perform on-site comparisons of Josephson voltage standards, and give a comprehensive analysis of the possible sources of errors of such comparisons. Behr et al summarize the developments of Josephson voltage standards at Physikalisch-Technische Bundesanstalt (PTB) and their applications in dc voltage and other areas of metrology. Finally, Georgakopoulos et al report a reduction, by a factor of a thousand, in the smallest voltage that can be generated by dc Josephson voltage standards. Although dc voltage standards are well established, significant challenges exist when extending this extremely precise technology to ac. There are two approaches to producing accurate ac voltages using the inverse Josephson effect: the programmable Josephson voltage standard (PJVS) and the pulse-driven ac voltage standard. The PJVS contains an array of Josephson junctions, organized into independently biased segments. By biasing chosen, binary-related, segments on the first quantum step (positive or negative) or zero, the array can be made to behave as a quantum digital to analogue converter. The PJVS approach can produce stepwise approximated sine waves with rms values of some volts, but it suffers from parasitic capacitances and inductances distributed in the different parts of the system and, more importantly, the voltage is not quantized during the finite transition time between successive voltage levels. Hence the output frequency of PJVS-based systems is limited to a few kilohertz. In this special feature, Jeanneret et al review the Josephson locked synthesizer, a PJVS-based system where the effect of transients between successive steps on the output voltage is reduced. This special feature also presents two applications of PJVS-based quantum voltage standards: the evaluation of conventional ac voltage standards based on thermal converters (Budovsky et al) and the measurement of the settling time of a high resolution digital voltmeter (Henderson et al). In the pulse-driven ac voltage standard, arbitrary voltages can be produced by modulating the rf irradiation of an array of Josephson junctions by a series of high frequency pulses, usually by means of Δ-Σ modulation. The output voltage of the array of junctions is a series of quantized voltage pulses that correspond to the desired waveform after the high frequency components are removed. The pulse-driven standard can operate at much higher frequencies than the PJVS. Eliminating the effects of parasitic impedances of the, necessarily long, connecting leads therefore becomes a significant challenge. In this special feature, van den Brom and Houtzager report a voltage lead correction technique. Quantum resistance standards are based on the quantum Hall effect in which the resistance of a two-dimensional electron gas in a strong magnetic field is quantized. The value of the quantized Hall resistance is h/ie2, where i is the number of the quantum step in the resistance-magnetic field curve. Quantum Hall resistance devices can be combined in series to form a resistive voltage divider with low uncertainty in the ratio. In this special feature, Domae et al report the realization of such a resistive voltage divider on a chip. Quantum Hall resistance standards have been routinely used at dc for over two decades. However, the operation of quantum Hall devices at ac is complicated by the flow of current in capacitances around the device, which can compromise measurement of its resistance. Schurr et al review the status of ac quantum Hall resistance standards and their role in the SI. Ohm's law can be applied to quantum realizations of voltage, resistance and current to test their consistency. Active research into this 'metrological triangle' is underway and, at present, there is no evidence to indicate a discrepancy at any level. However, work is continuing on current sources which utilize a countable flow of electrons (the electric current produced is proportional to ef, f being the operating frequency of the device), but the work has some way to go before the question of consistency can be resolved at levels approaching 1 part in 109. In this special feature, Scherer and Camarota review the state-of-the-art of metrological triangle experiments and Devoille et al report on the status of the metrological triangle experiment at the Laboratoire National de Métrologie et d'Essais (LNE), France. The availability of precise representations of the volt and the ohm based on quantum mechanics has enabled the watt balance, an apparatus which relates electrical and mechanical power, to link the kilogram to the Planck constant. This has paved the way for the proposed redefinition of the kilogram, the last artefact standard in the SI, in terms of a fixed value of the Planck constant. In the past few years a number of papers, e.g. [2, 3], have been published describing the working principles of the watt balance and the characteristics of the existing implementations of the experiment. The measurements of the principal quantities—mass, velocity, gravitational acceleration, resistance and voltage—are reasonably well documented but the ultimate precision of the apparatus depends on a number of techniques that are required to eliminate second-order effects. In this special feature, Robinson provides details of these general alignment techniques with special reference to the NPL Mark II watt balance. Acknowledgments We would like to thank the authors for supporting the special feature with their excellent contributions; the guardians of the quality of a scientific paper, the referees, for their valuable comments and suggestions; Professor Wuqiang Yang and the members of the editorial board of Measurement Science and Technology for their support. Finally, we would like to thank Dr Sharon D'Souza, James Dimond and all the editorial and publication staff at Measurement Science and Technology, for their help in making the special feature a reality. References [1] Josephson B D 1962 Possible new effects in superconductive tunnelling Phys. Lett. 1 251-3 [2] Li S, Han B, Li Z and Lan J 2012 Precisely measuring the Planck constant by electromechanical balances Measurement 45 1-13 [3] Stock M 2011 The watt balance: determination of the Planck constant and redefinition of the kilogram Phil. Trans. R. Soc. A 369 3936-53

Functional significance of the pattern of renal sympathetic nerve activation.

PubMed

Dibona, G F; Sawin, L L

1999-08-01

To assess the renal functional significance of the pattern of renal sympathetic nerve activation, computer-generated stimulus patterns (delivered at constant integrated voltage) were applied to the decentralized renal sympathetic nerve bundle and renal hemodynamic and excretory responses determined in anesthetized rats. When delivered at the same integrated voltage, stimulus patterns resembling those observed in in vivo multifiber recordings of renal sympathetic nerve activity (diamond-wave patterns) produced greater renal vasoconstrictor responses than conventional square-wave patterns. Within diamond-wave patterns, increasing integrated voltage by increasing amplitude produced twofold greater renal vasoconstrictor responses than by increasing duration. With similar integrated voltages that were subthreshold for renal vasoconstriction, neither diamond- nor square-wave pattern altered glomerular filtration rate, whereas diamond- but not square-wave pattern reversibly decreased urinary sodium excretion by 25 +/- 3%. At the same number of pulses per second, intermittent stimulation produced faster and greater renal vasoconstriction than continuous stimulation. At the same number of pulses per second, increases in rest period during intermittent stimulation proportionally augmented the renal vasoconstrictor response compared with that observed with continuous stimulation; the maximum augmentation of 55% occurred at a rest period of 500 ms. These results indicate that the pattern of renal sympathetic nerve stimulation (activity) significantly influences the rapidity, magnitude, and selectivity of the renal vascular and tubular responses.

SDVSRM - a new SSRM based technique featuring dynamically adjusted, scanner synchronized sample voltages for measurement of actively operated devices.

PubMed

Doering, Stefan; Wachowiak, Andre; Roetz, Hagen; Eckl, Stefan; Mikolajick, Thomas

2018-06-01

Scanning spreading resistance microscopy (SSRM) with its high spatial resolution and high dynamic signal range is a powerful tool for two-dimensional characterization of semiconductor dopant areas. However, the application of the method is limited to devices in equilibrium condition, as the investigation of actively operated devices would imply potential differences within the device, whereas SSRM relies on a constant voltage difference between sample surface and probe tip. Furthermore, the standard preparation includes short circuiting of all device components, limiting applications to devices in equilibrium condition. In this work scanning dynamic voltage spreading resistance microscopy (SDVSRM), a new SSRM based two pass atomic force microscopy (AFM) technique is introduced, overcoming these limitations. Instead of short circuiting the samples during preparation, wire bond devices are used allowing for active control of the individual device components. SDVSRM consists of two passes. In the first pass the local sample surface voltage dependent on the dc biases applied to the components of the actively driven device is measured as in scanning voltage microscopy (SVM). The local spreading resistance is measured within the second pass, in which the afore obtained local surface voltage is used to dynamically adjust the terminal voltages of the device under test. This is done in a way that the local potential difference across the nano-electrical contact matches the software set SSRM measurement voltage, and at the same time, the internal voltage differences within the device under test are maintained. In this work the proof of the concept could be demonstrated by obtaining spreading resistance data of an actively driven photodiode test device. SDVSRM adds a higher level of flexibility in general to SSRM, as occurring differences in cross section surface voltage are taken into account. These differences are immanent for actively driven devices, but can also be present at standard, short circuited samples. Therefore, SDVSRM could improve the characterization under equilibrium conditions as well. Copyright © 2018. Published by Elsevier B.V.

Low noise constant current source for bias dependent noise measurements

DOE Office of Scientific and Technical Information (OSTI.GOV)

Talukdar, D.; Bose, Suvendu; Bardhan, K. K.

2011-01-15

A low noise constant current source used for measuring the 1/f noise in disordered systems in ohmic as well as nonohmic regime is described. The source can supply low noise constant current starting from as low as 1 {mu}A to a few tens of milliampere with a high voltage compliance limit of around 20 V. The constant current source has several stages, which can work in a standalone manner or together to supply the desired value of load current. The noise contributed by the current source is very low in the entire current range. The fabrication of a low noisemore » voltage preamplifier modified for bias dependent noise measurements and based on the existing design available in the MAT04 data sheet is also described.« less

Effects of an applied voltage on direct interspecies electron transfer via conductive materials for methane production.

PubMed

Lee, Jung-Yeol; Park, Jeong-Hoon; Park, Hee-Deung

2017-10-01

Direct interspecies electron transfer (DIET) between exoelectrogenic bacteria and methanogenic archaea via conductive materials is reported as an efficient method to produce methane in anaerobic organic waste digestion. A voltage can be applied to the conductive materials to accelerate the DIET between two groups of microorganisms to produce methane. To evaluate this hypothesis, two sets of anaerobic serum bottles with and without applied voltage were used with a pair of graphite rods as conductive materials to facilitate DIET. Initially, the methane production rate was similar between the two sets of serum bottles, and later the serum bottles with an applied voltage of 0.39V showed a 168% higher methane production rate than serum bottles without an applied voltage. In cyclic voltammograms, the characteristic redox peaks for hydrogen and acetate oxidation were identified in the serum bottles with an applied voltage. In the microbial community analyses, hydrogenotrophic methanogens (e.g. Methanobacterium) were observed to be abundant in serum bottles with an applied voltage, while methanogens utilizing carbon dioxide (e.g., Methanosaeta and Methanosarcina) were dominant in serum bottles without an applied voltage. Taken together, the applied voltage on conductive materials might not be effective to promote DIET in methane production. Instead, it appeared to generate a condition for hydrogenotrophic methanogenesis. Copyright © 2017 Elsevier Ltd. All rights reserved.

Interfacial morphology of low-voltage anodic aluminium oxide

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hu, Naiping; Dongcinn, Xuecheng; He, Xueying

X-ray reflectivity (XRR) and neutron reflectivity (NR), as well as ultra-smallangle X-ray scattering (USAXS), are used to examine the in-plane and surfacenormal structure of anodic films formed on aluminium alloy AA2024 and pure aluminium. Aluminium and alloy films up to 3500 A thick were deposited on Si wafers by electron beam evaporation of ingots. Porous anodic aluminium oxide (AAO) films are formed by polarizing at constant voltage up to 20 V noble to the open circuit potential. The voltage sweet spot (5 V) appropriate for constant-voltage anodization of such thin films was determined for both alloy and pure Al. Inmore » addition, a new concurrent voltage- and current-control protocol was developed to prepare films with larger pores (voltages higher than 5 V), but formed at a controlled current so that pore growth is slow enough to avoid stripping the aluminium substrate layer. USAXS shows that the pore size and interpore spacing are fixed in the first 10 s after initiation of anodization. Pores then grow linearly in time, at constant radius and interpore spacing. Using a combination of XRR and NR, the film density and degree of hydration of the films were determined from the ratio of scattering length densities. Assuming a chemical formula Al2O3xH2O, it was found that x varies from 0.29 for the native oxide to 1.29 for AAO grown at 20 V under concurrent voltage and current control. The average AAO film density of the porous film at the air surface is 2.45 (20) g cm3. The density of the barrier layer at the metal interface is 2.9 (4) g cm3, which indicates that this layer is also quite porous« less

Kinetics of veratridine action on Na channels of skeletal muscle

PubMed Central

Sutro, JB

1986-01-01

Veratridine bath-applied to frog muscle makes inactivation of INa incomplete during a depolarizing voltage-clamp pulse and leads to a persistent veratridine-induced Na tail current. During repetitive depolarizations, the size of successive tail currents grows to a plateau and then gradually decreases. When pulsing is stopped, the tail current declines to zero with a time constant of approximately 3 s. Higher rates of stimulation result in a faster build-up of the tail current and a larger maximum value. I propose that veratridine binds only to open channels and, when bound, prevents normal fast inactivation and rapid shutting of the channel on return to rest. Veratridine-modified channels are also subject to a "slow" inactivation during long depolarizations or extended pulse trains. At rest, veratridine unbinds with a time constant of approximately 3 s. Three tests confirm these hypotheses: (a) the time course of the development of veratridine-induced tail currents parallels a running time integral of gNa during the pulse; (b) inactivating prepulses reduce the ability to evoke tails, and the voltage dependence of this reduction parallels the voltage dependence of h infinity; (c) chloramine-T, N-bromoacetamide, and scorpion toxin, agents that decrease inactivation in Na channels, each greatly enhance the tail currents and alter the time course of the appearance of the tails as predicted by the hypothesis. Veratridine-modified channels shut during hyperpolarizations from -90 mV and reopen on repolarization to -90 mV, a process that resembles normal activation gating. Veratridine appears to bind more rapidly during larger depolarizations. PMID:2419478

High-voltage isolation transformer for sub-nanosecond rise time pulses constructed with annular parallel-strip transmission lines.

PubMed

Homma, Akira

2011-07-01

A novel annular parallel-strip transmission line was devised to construct high-voltage high-speed pulse isolation transformers. The transmission lines can easily realize stable high-voltage operation and good impedance matching between primary and secondary circuits. The time constant for the step response of the transformer was calculated by introducing a simple low-frequency equivalent circuit model. Results show that the relation between the time constant and low-cut-off frequency of the transformer conforms to the theory of the general first-order linear time-invariant system. Results also show that the test transformer composed of the new transmission lines can transmit about 600 ps rise time pulses across the dc potential difference of more than 150 kV with insertion loss of -2.5 dB. The measured effective time constant of 12 ns agreed exactly with the theoretically predicted value. For practical applications involving the delivery of synchronized trigger signals to a dc high-voltage electron gun station, the transformer described in this paper exhibited advantages over methods using fiber optic cables for the signal transfer system. This transformer has no jitter or breakdown problems that invariably occur in active circuit components.

Analysis of a dc bus system with a nonlinear constant power load and its delayed feedback control.

PubMed

Konishi, Keiji; Sugitani, Yoshiki; Hara, Naoyuki

2014-02-01

This paper tackles a destabilizing problem of a direct-current (dc) bus system with constant power loads, which can be considered a fundamental problem of dc power grid networks. The present paper clarifies scenarios of the destabilization and applies the well-known delayed-feedback control to the stabilization of the destabilized bus system on the basis of nonlinear science. Further, we propose a systematic procedure for designing the delayed feedback controller. This controller can converge the bus voltage exactly on an unstable operating point without accurate information and can track it using tiny control energy even when a system parameter, such as the power consumption of the load, is slowly varied. These features demonstrate that delayed feedback control can be considered a strong candidate for solving the destabilizing problem.

Research on Experiment of Islanding Protection Device of Grid-connected Photovoltaic System Based on RTDS

NASA Astrophysics Data System (ADS)

Zhou, Ning; Yang, Jia; Cheng, Zheng; Chen, Bo; Su, Yong Chun; Shu, Zhan; Zou, Jin

2017-06-01

Solar photovoltaic power generation is the power generation using solar cell module converting sunlight into DC electric energy. In the paper an equivalent model of solar photovoltaic power generation system is built in RTDS. The main circuit structure of the two-stage PV grid-connected system consists of the DC-DC, DC-AC circuit. The MPPT (Maximum Power Point Tracking) control of the PV array is controlled by adjusting the duty ratio of the DC-DC circuit. The proposed control strategy of constant voltage/constant reactive power (V/Q) control is successfully implemented grid-connected control of the inverter when grid-connected operation. The closed-loop experiment of islanding protection device of photovoltaic power plant on RTDS, verifies the correctness of the simulation model, and the experimental verification can be applied to this type of device.

Two-Dimensional Porous Electrode Model for Capacitive Deionization

DOE PAGES

Hemmatifar, Ali; Stadermann, Michael; Santiago, Juan G.

2015-10-28

Here, ion transport in porous conductive materials is of great importance in a variety of electrochemical systems including batteries and supercapacitors. We here analyze the coupling of flow and charge transport and charge capacitance in capacitive deionization (CDI). In CDI, a pair of porous carbon electrodes is employed to electrostatically retain and remove ionic species from aqueous solutions. We here develop and solve a novel unsteady two-dimensional model for capturing the ion adsorption/desorption dynamics in a flow-between CDI system. We use this model to study the complex, nonlinear coupling between electromigration, diffusion, and advection of ions. We also fabricated amore » laboratory-scale CDI cell which we use to measure the near-equilibrium, cumulative adsorbed salt, and electric charge as a function of applied external voltage. We use these integral measures to validate and calibrate this model. We further present a detailed computational study of the spatiotemporal adsorption/desorption dynamics under constant voltage and constant flow conditions. We show results for low (20 mM KCl) and relatively high (200 mM KCl) inlet ion concentrations and identify effects of ion starvation on desalination. We show that in both cases electromigrative transport eventually becomes negligible and diffusive ion transport reduces the desalination rate.« less

Circuits and methods for impedance determination using active measurement cancelation

DOEpatents

Jamison, David K.

2016-12-13

A delta signal and opposite delta signal are generated such that a sum of the two signals is substantially zero. The delta signal is applied across a first set of electrochemical cells. The opposite delta signal is applied across a second set of electrochemical cells series connected to the first set. A first held voltage is established as the voltage across the first set. A second held voltage is established as the voltage across the second set. A first delta signal is added to the first held voltage and applied to the first set. A second delta signal is added to the second held voltage and applied to the second set. The current responses due to the added delta voltages travel only into the set associated with its delta voltage. The delta voltages and the current responses are used to calculate the impedances of their associated cells.

Breakdown in helium in high-voltage open discharge with subnanosecond current front rise

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schweigert, I. V., E-mail: ischweig@itam.nsc.ru; Alexandrov, A. L.; Bokhan, P. A.

Investigations of high-voltage open discharge in helium have shown a possibility of generation of current pulses with subnanosecond front rise, due to ultra-fast breakdown development. The open discharge is ignited between two planar cathodes with mesh anode in the middle between them. For gas pressure 6 Torr and 20 kV applied voltage, the rate of current rise reaches 500 A/(cm{sup 2} ns) for current density 200 A/cm{sup 2} and more. The time of breakdown development was measured for different helium pressures and a kinetic model of breakdown in open discharge is presented, based on elementary reactions for electrons, ions andmore » fast atoms. The model also includes various cathode emission processes due to cathode bombardment by ions, fast atoms, electrons and photons of resonant radiation with Doppler shift of frequency. It is shown, that the dominating emission processes depend on the evolution of the discharge voltage during the breakdown. In the simulations, two cases of voltage behavior were considered: (i) the voltage is kept constant during the breakdown; (ii) the voltage is reduced with the growth of current. For the first case, the exponentially growing current is maintained due to photoemission by the resonant photons with Doppler-shifted frequency. For the second case, the dominating factor of current growth is the secondary electron emission. In both cases, the subnanosecond rise of discharge current was obtained. Also the effect of gas pressure on breakdown development was considered. It was found that for 20 Torr gas pressure the time of current rise decreases to 0.1 ns, which is in agreement with experimental data.« less

CFAVC scheme for high frequency series resonant inverter-fed domestic induction heating system

NASA Astrophysics Data System (ADS)

Nagarajan, Booma; Reddy Sathi, Rama

2016-01-01

This article presents the investigations on the constant frequency asymmetric voltage cancellation control in the AC-AC resonant converter-fed domestic induction heating system. Conventional fixed frequency control techniques used in the high frequency converters lead to non-zero voltage switching operation and reduced output power. The proposed control technique produces higher output power than the conventional fixed-frequency control strategies. In this control technique, zero-voltage-switching operation is maintained during different duty cycle operation for reduction in the switching losses. Complete analysis of the induction heating power supply system with asymmetric voltage cancellation control is discussed in this article. Simulation and experimental study on constant frequency asymmetric voltage cancellation (CFAVC)-controlled full bridge series resonant inverter is performed. Time domain simulation results for the open and closed loop of the system are obtained using MATLAB simulation tool. The simulation results prove the control of voltage and power in a wide range. PID controller-based closed loop control system achieves the voltage regulation of the proposed system for the step change in load. Hardware implementation of the system under CFAVC control is done using the embedded controller. The simulation and experimental results validate the performance of the CFAVC control technique for series resonant-based induction cooking system.

Full-order observer for direct torque control of induction motor based on constant V/F control technique.

PubMed

Pimkumwong, Narongrit; Wang, Ming-Shyan

2018-02-01

This paper presents another control method for the three-phase induction motor that is direct torque control based on constant voltage per frequency control technique. This method uses the magnitude of stator flux and torque errors to generate the stator voltage and phase angle references for controlling the induction motor by using constant voltage per frequency control method. Instead of hysteresis comparators and optimum switching table, the PI controllers and space vector modulation technique are used to reduce torque and stator-flux ripples and achieve constant switching frequency. Moreover, the coordinate transformations are not required. To implement this control method, a full-order observer is used to estimate stator flux and overcome the problems from drift and saturation in using pure integrator. The feedback gains are designed by simple manner to improve the convergence of stator flux estimation, especially in low speed range. Furthermore, the necessary conditions to maintain the stability for feedback gain design are introduced. The simulation and experimental results show accurate and stable operation of the introduced estimator and good dynamic response of the proposed control method. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.

HIT-SI Injector Voltage Measurements Using Injector Langmuir Probes

NASA Astrophysics Data System (ADS)

Aboul Hosn, Rabih; Smith, Roger; Jarboe, Thomas

2006-10-01

A pair of Langmuir probe arrays have been designed and built to measure floating potentials of the plasma at the injector mouth of the HIT-SI device. The Helicity Injected Torus using Steady Inductive Helicity Injection (HIT-SI) [1,2] is a ``bow tie'' spheromak using an electrodeless formation and sustainment concept. HIT-SI is powered by two inductive helicity injectors operated in quadrature to maintain a constant helicity injection rate. The electric probes consist of an array of four floating potential Langmuir probes measuring the voltage distribution in each injector from the shell to midpoint of the injector mouth. The probe measurements combine to determine the part of the injector loop voltage driving the n = 0 spheromak equilibrium region. Preliminary data suggest the spheromak voltage is the loop voltage minus the nearly constant injector voltage of 150-180 volts. These probe data will be used to calculate the helicity decay time of the spheromak. [1] T. R. Jarboe. Steady inductive helicity injection and its application to a high-beta spheromak. Fusion Technology, 36(1):85--91, July 1999. [2] P.E.Sieck et al., ``Demonstration of Steady Inductive Helicity Injection'', Nuc. Fusion, in press (2006).

Electrical system for measurement of breakdown voltage of vacuum and gas-filled tubes using a dynamic method

NASA Astrophysics Data System (ADS)

Pejović, Milić M.; Milosavljević, Čedomir S.; Pejović, Momčilo M.

2003-06-01

This article describes an electrical system aimed at measuring and data acquisition of breakdown voltages of vacuum and gas-filled tubes. The measurements were performed using a nitrogen-filled tube at 4 mbar pressure. Based on the measured breakdown voltage data as a function of the applied voltage increase rate, a static breakdown voltage is estimated for the applied voltage gradient ranging from 0.1 to 1 V s-1 and from 1 to 10 V s-1. The histograms of breakdown voltages versus applied voltage increase rates from 0.1 and 0.5 V s-1 are approximated by the probability density functions using a fitting procedure.

Modeling and characterization of dielectrophoretically structured piezoelectric composites using piezoceramic particle inclusions with high aspect ratios

NASA Astrophysics Data System (ADS)

van den Ende, D. A.; Maier, R. A.; van Neer, P. L. M. J.; van der Zwaag, S.; Randall, C. A.; Groen, W. A.

2013-01-01

In this work, the piezoelectric properties at high electric fields of dielectrophoretically aligned PZT—polymer composites containing high aspect ratio particles (such as short fibers) are presented. Polarization and strain as a function of electric field are evaluated. The properties of the composites are compared to those of PZT-polymer composites with equiaxed particles, continuous PZT fiber-polymer composites, and bulk PZT ceramics. From high-field polarization and strain measurements, the effective field dependent permittivity and piezoelectric charge constant in the poling direction are determined for dielectrophoresis structured PZT-polymer composites, continuous PZT fiber-polymer composites, and bulk PZT ceramics. The changes in dielectric properties of the inclusions and the matrix at high fields influence the dielectric and piezoelectric properties of the composites. It is found that the permittivity and piezoelectric charge constants increase towards a maximum at an applied field of around 2.5-5 kV/mm. The electric field at which the maximum occurs depends on the aspect ratio and degree of alignment of the inclusions. Experimental values of d33 at low and high applied fields are compared to a model describing the composites as a continuous polymer matrix containing PZT particles of various aspect ratios arranged into chains. Thickness mode coupling factors were determined from measured impedance data using fitted equivalent circuit model simulations. The relatively high piezoelectric strain constants, voltage constants, and thickness coupling factors indicate that such aligned short fiber composites could be useful as flexible large area transducers.

How to interpret current-voltage relationships of blocking grain boundaries in oxygen ionic conductors.

PubMed

Kim, Seong K; Khodorov, Sergey; Chen, Chien-Ting; Kim, Sangtae; Lubomirsky, Igor

2013-06-14

A new model based on a linear diffusion equation is proposed to explain the current-voltage characteristics of blocking grain boundaries in Y-doped CeO2 in particular. One can also expect that the model can be applicable to the ionic conductors with blocking grain boundaries, in general. The model considers an infinitely long chain of identical grains separated by grain boundaries, which are treated as regions in which depletion layers of mobile ions are formed due to trapping of immobile charges that do not depend on the applied voltage as well as temperature. The model assumes that (1) the grain boundaries do not represent physical blocking layers, which implies that if there is a second phase at the grain boundaries, then it is too thin to impede ion diffusion and (2) the ions follow Boltzmann distribution throughout the materials. Despite its simplicity, the model successfully reproduces the "power law": current proportional to voltage power n and illustrated with the experimental example of Y-doped ceria. The model also correctly predicts that the product nT, where T is the temperature in K, is constant and is proportional to the grain boundary potential as long as the charge at the grain boundaries remains trapped. The latter allows its direct determination from the current-voltage characteristics and promises considerable simplification in the analysis of the electrical characteristics of the grain boundaries with respect to the models currently in use.

Self-oscillations in field emission nanowire mechanical resonators: a nanometric dc-ac conversion.

PubMed

Ayari, Anthony; Vincent, Pascal; Perisanu, Sorin; Choueib, May; Gouttenoire, Vincent; Bechelany, Mikhael; Cornu, David; Purcell, Stephen T

2007-08-01

We report the observation of self-oscillations in a bottom-up nanoelectromechanical system (NEMS) during field emission driven by a constant applied voltage. An electromechanical model is explored that explains the phenomenon and that can be directly used to develop integrated devices. In this first study, we have already achieved approximately 50% dc/ac (direct to alternating current) conversion. Electrical self-oscillations in NEMS open up a new path for the development of high-speed, autonomous nanoresonators and signal generators and show that field emission (FE) is a powerful tool for building new nanocomponents.

Dissipative dark soliton in a complex plasma.

PubMed

Heidemann, R; Zhdanov, S; Sütterlin, R; Thomas, H M; Morfill, G E

2009-04-03

The observation of a dark soliton in a three-dimensional complex plasma containing monodisperse microparticles is presented. We perform our experiments using neon gas in the bulk plasma of an rf discharge. A gas temperature gradient of 500K/m is applied to balance gravity and to levitate the particles in the bulk plasma. The wave is excited by a short voltage pulse on the electrodes of the radio frequency discharge chamber. It is found that the wave propagates with constant speed. The propagation time of the dark soliton is approximately 20 times longer than the damping time.

Dissipative Dark Soliton in a Complex Plasma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Heidemann, R.; Zhdanov, S.; Suetterlin, R.

2009-04-03

The observation of a dark soliton in a three-dimensional complex plasma containing monodisperse microparticles is presented. We perform our experiments using neon gas in the bulk plasma of an rf discharge. A gas temperature gradient of 500K/m is applied to balance gravity and to levitate the particles in the bulk plasma. The wave is excited by a short voltage pulse on the electrodes of the radio frequency discharge chamber. It is found that the wave propagates with constant speed. The propagation time of the dark soliton is approximately 20 times longer than the damping time.

Baseline tests of the power-train electric delivery van

NASA Technical Reports Server (NTRS)

Lumannick, S.; Dustin, M. O.; Bozek, J. M.

1977-01-01

Vehicle maximum speed, range at constant speed, range over stop-and-go driving schedules, maximum acceleration, gradeability, gradeability limit, road energy consumption, road power, indicated energy consumption, braking capability, battery charger efficiency, and battery characteristics were determined for a modified utility van powered by sixteen 6-volt batteries connected in series. A chopper controller actuated by a foot accelerator pedal changes the voltage applied to the 22-kilowatt (30-hp) series-wound drive motor. In addition to the conventional hydraulic braking system, the vehicle has hydraulic regenerative braking. Cycle tests and acceleration tests were conducted with and without hydraulic regeneration.

Spatial Light Modulators and Applications: Summaries of Papers Presented at the Spatial Light Modulators and Applications Topical Meeting Held on March 15-17, 1993 in Palm Springs, California

DTIC Science & Technology

1993-03-17

modulator: Number of Elements 16 x 16 Pixel Size 1 mmxl mm Area Fill Factor > 90% Reflectance > 90% Phase Shift 900 Frame Rate > 1 kHz Operational Spectral...electro-optic constants. By using reflected light from the second interface a factor of two increase in phase shift is obtained for an applied voltage vs...wavelengths in general require thinner PLZT wafers. One of the objectives of the SLM design was to maximize pixel area fill factor and thereby the

Modeling extracellular electrical stimulation: I. Derivation and interpretation of neurite equations.

PubMed

Meffin, Hamish; Tahayori, Bahman; Grayden, David B; Burkitt, Anthony N

2012-12-01

Neuroprosthetic devices, such as cochlear and retinal implants, work by directly stimulating neurons with extracellular electrodes. This is commonly modeled using the cable equation with an applied extracellular voltage. In this paper a framework for modeling extracellular electrical stimulation is presented. To this end, a cylindrical neurite with confined extracellular space in the subthreshold regime is modeled in three-dimensional space. Through cylindrical harmonic expansion of Laplace's equation, we derive the spatio-temporal equations governing different modes of stimulation, referred to as longitudinal and transverse modes, under types of boundary conditions. The longitudinal mode is described by the well-known cable equation, however, the transverse modes are described by a novel ordinary differential equation. For the longitudinal mode, we find that different electrotonic length constants apply under the two different boundary conditions. Equations connecting current density to voltage boundary conditions are derived that are used to calculate the trans-impedance of the neurite-plus-thin-extracellular-sheath. A detailed explanation on depolarization mechanisms and the dominant current pathway under different modes of stimulation is provided. The analytic results derived here enable the estimation of a neurite's membrane potential under extracellular stimulation, hence bypassing the heavy computational cost of using numerical methods.

Effects of cyclic impacts on the performance of a piezo-composite electricity generating element in a d33 mode energy harvesting.

PubMed

Pham, Van Lai; Ha, Ngoc San; Goo, Nam Seo; Choo, Jinkyo F

2014-10-01

The increasing use of piezoelectric generators to harvest energy from various ambient sources requires the establishment of durability data for piezoelectric materials. In this paper, a d3 mode piezocomposite electricity generating element (PCGE) was tested for its durability under cyclic impact loading. For this purpose, a motor driven lever system was designed to apply constant impact force on PCGEs. To investigate the durability of PCGEs, the output voltage of the PCGEs was observed upon repeated application of an impact force until eventual loss of the generated voltage. The experimental results enabled to determine the number of cycles until which PCGEs can be used without loss of their electricity generation performance with respect to the stress level applied on the PCGEs. At low stress level (around 0.76 MPa or lower), the PCGE showed almost insignificant degradation even after 2 million cycles whereas degradation occurred sooner (after 8 x 10(5) cycles) at higher stress levels (around 0.92 MPa or higher). The effects of impact loading on the durability of the PCGEs were also examined by X-ray photographs of the specimens.

Poloxamer 188 decreases susceptibility of artificial lipid membranes to electroporation.

PubMed Central

Sharma, V; Stebe, K; Murphy, J C; Tung, L

1996-01-01

The effect of a nontoxic, nonionic block co-polymeric surface active agent, poloxamer 188, on electroporation of artificial lipid membranes made of azolectin, was investigated. Two different experimental protocols were used in our study: charge pulse and voltage clamp. For the charge pulse protocol, membranes were pulsed with a 10-micronsecond rectangular voltage waveform, after which membrane voltage decay was observed through an external 1-M omega resistance. For the voltage clamp protocol the membranes were pulsed with a waveform that consisted of an initial 10-microsecond rectangular phase, followed by a negative sloped ramp that decayed to zero in the subsequent 500 microseconds. Several parameters characterizing the electroporation process were measured and compared for the control membranes and membranes treated with 1.0 mM poloxamer 188. For both the charge pulse and voltage clamp experiments, the threshold voltage (amplitude of initial rectangular phase) and latency time (time elapsed between the end of rectangular phase and the onset of membrane electroporation) were measured. Membrane conductance (measured 200 microseconds after the initial rectangular phase) and rise time (tr; the time required for the porated membrane to reach a certain conductance value) were also determined for the voltage clamp experiments, and postelectroporation time constant (PE tau; the time constant for transmembrane voltage decay after onset of electroporation) for the charge pulse experiments. The charge pulse experiments were performed on 23 membranes with 10 control and 13 poloxamer-treated membranes, and voltage pulse experiments on 49 membranes with 26 control and 23 poloxamer-treated membranes. For both charge pulse and voltage clamp experiments, poloxamer 188-treated membranes exhibited a statistically higher threshold voltage (p = 0.1 and p = 0.06, respectively), and longer latency time (p = 0.04 and p = 0.05, respectively). Also, poloxamer 188-treated membranes were found to have a relatively lower conductance (p = 0.001), longer time required for the porated membrane to reach a certain conductance value (p = 0.05), and longer postelectroporation time constant (p = 0.005). Furthermore, addition of poloxamer 188 was found to reduce the membrane capacitance by approximately 4-8% in 5 min. These findings suggest that poloxamer 188 adsorbs into the lipid bilayers, thereby decreasing their susceptibility to electroporation. Images FIGURE 1 PMID:8968593

A mathematical approach for evaluating nickel-hydrogen cells

NASA Technical Reports Server (NTRS)

Leibecki, H. F.

1986-01-01

A mathematical equation is presented which gives a quantitative relationship between time-voltage discharge curves, when a cell's ampere-hour capacity is determined at a constant discharge current. In particular the equation quantifies the initial exponential voltage decay; the rate of voltage decay; the overall voltage shift of the curve and the total capacity of the cell at the given discharge current. The results of 12 nickel-hydrogen boiler plate cells cycled to 80 percent depth-of-discharge (DOD) are discussed in association with these equations.

State of charge modeling of lithium-ion batteries using dual exponential functions

NASA Astrophysics Data System (ADS)

Kuo, Ting-Jung; Lee, Kung-Yen; Huang, Chien-Kang; Chen, Jau-Horng; Chiu, Wei-Li; Huang, Chih-Fang; Wu, Shuen-De

2016-05-01

A mathematical model is developed by fitting the discharging curve of LiFePO4 batteries and used to investigate the relationship between the state of charge and the closed-circuit voltage. The proposed mathematical model consists of dual exponential terms and a constant term which can fit the characteristics of dual equivalent RC circuits closely, representing a LiFePO4 battery. One exponential term presents the stable discharging behavior and the other one presents the unstable discharging behavior and the constant term presents the cut-off voltage.

State trajectories used to observe and control dc-to-dc converters

NASA Technical Reports Server (NTRS)

Burns, W. W., III; Wilson, T. G.

1976-01-01

State-plane analysis techniques are employed to study the voltage stepup energy-storage dc-to-dc converter. Within this framework, an example converter operating under the influence of a constant on-time and a constant frequency controller is examined. Qualitative insight gained through this approach is used to develop a conceptual free-running control law for the voltage stepup converter which can achieve steady-state operation in one on/off cycle of control. Digital computer simulation data are presented to illustrate and verify the theoretical discussions presented.

Numerical study of He/CF{sub 3}I pulsed discharge used to produce iodine atom in chemical oxygen-iodine laser

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang Jiao; Wang Yanhui; Wang Dezhen

2013-04-15

The pulsed discharge for producing iodine atoms from the alkyl and perfluoroalky iodides (CH{sub 3}I, CF{sub 3}I, etc.) is the most efficient method for achieving the pulse operating mode of a chemical oxygen-iodine laser. In this paper, a one-dimensional fluid model is developed to study the characteristics of pulsed discharge in CF{sub 3}I-He mixture. By solving continuity equation, momentum equation, Poisson equation, Boltzmann equation, and an electric circuit equation, the temporal evolution of discharge current density and various discharge products, especially the atomic iodine, are investigated. The dependence of iodine atom density on discharge parameters is also studied. The resultsmore » show that iodine atom density increases with the pulsed width and pulsed voltage amplitude. The mixture ratio of CF{sub 3}I and helium plays a more significant role in iodine atom production. For a constant voltage amplitude, there exists an optimal mixture ratio under which the maximum iodine atom concentration is achieved. The bigger the applied voltage amplitude is, the higher partial pressure of CF{sub 3}I is needed to obtain the maximum iodine atom concentration.« less

Development of external cooling cryo-resistive cable systems. Part 2: Insulation characteristics on 66 kV rated cryo-resistive testing cable

NASA Astrophysics Data System (ADS)

Ishihara, Kaoru; Akita, Shige; Suzuki, Hiroshi; Ogata, Junichi; Nemoto, Minoru

1987-08-01

Cryo-resistive cable system was tested to demonstrate dielectric characteristics. Dielectric characteristics of 66kV cryo-resistive cable at the start of immersion cooling in the liquid nitrogen were 2.25 specific dielectric constant and 0.18 percent dielectric loss which was less than 0.4 percent , the aimed value. Electrostatic capacity and dielectric loss tangent of dielectric characteristics under the applied voltage did not depend on the voltage and the dielectric loss was less than 0.4 percent through the temperature range from -170 to -190C. These values fulfilled the specifications on 275kV class cryo-resistive cable design. The tested cable passed the cable test on 66kV oil-filled cable (ac 90kV, 10 min), but broken down at ac 110kV on the way to endurance testing voltage 130kV. The breakdown occurred due to the mechanical damage of cable insulator by bending and thermal contraction of the cable. It is necessary from these facts to develop flexible cable terminal and joint which can absorb the contraction to realize 275kV cryo-resistive cable. (19 figs, 7 tabs, 15 refs).

The voltage control for self-excited induction generator based on STATCOM

NASA Astrophysics Data System (ADS)

Yan, Dandan; Wang, Feifeng; Pan, Juntao; Long, Weijie

2018-05-01

The small independent induction generator can build up voltage under its remanent magnetizing and excitation capacitance, but it is prone to voltage sag and harmonic increment when running with load. Therefore, the controller for constant voltage is designed based on the natural coordinate system to adjust the static synchronous compensator (STATCOM), which provides two-way dynamic reactive power compensation for power generation system to achieve voltage stability and harmonic suppression. The control strategy is verified on Matlab/Sinmulik, and the results show that the STATCOM under the controller can effectively improve the load capacity and reliability of asynchronous generator.

Modulator for tone and binary signals. [phase of modulation of tone and binary signals on carrier waves in communication systems

NASA Technical Reports Server (NTRS)

Mcchesney, J. R.; Lerner, T.; Fitch, E. J. (Inventor)

1975-01-01

Tones and binary information are transmitted as phase variations on a carrier wave of constant amplitude and frequency. The carrier and tones are applied to a balanced modulator for deriving an output signal including a pair of sidebands relative to the carrier. The carrier is phase modulated by a digital signal so that it is + or - 90 deg out of phase with the predetermined phase of the carrier. The carrier is combined in an algebraic summing device with the phase modulated signal and the balanced modulator output signal. The output of the algebraic summing device is hard limited to derive a constant amplitude and frequency signal having very narrow bandwidth requirements. At a receiver, the tones and binary data are detected with a phase locked loop having a voltage controlled oscillator driving a pair of orthogonal detection channels.

An apparatus for altering the mechanical load of the respiratory system.

PubMed

Younes, M; Bilan, D; Jung, D; Kroker, H

1987-06-01

We describe an apparatus for altering the mechanical load against which the respiratory muscles operate in humans. A closed system incorporates a rolling seal spirometer. The spirometer piston shaft is coupled to a fast-responding linear actuator that develops force in proportion to desired command signals. The command signal may be flow (resistive loading or unloading), volume (elastic loading or unloading), constant voltage (continuous positive or negative pressure), or any external function. Combinations of loads can be applied. Logic circuits permit application of the load at specific times during the respiratory cycle, and the magnitude of the loads is continuously adjustable. Maximum pressure output is +/- 20 cmH2O. The apparatus permits loading or unloading over a range of ventilation extending from resting levels to those observed during high levels of exercise (over 100 l/min). In response to a square-wave input, pressure rises exponentially with a time constant of 20 ms.

Gene delivery by microfluidic flow-through electroporation based on constant DC and AC field.

PubMed

Geng, Tao; Zhan, Yihong; Lu, Chang

2012-01-01

Electroporation is one of the most widely used physical methods to deliver exogenous nucleic acids into cells with high efficiency and low toxicity. Conventional electroporation systems typically require expensive pulse generators to provide short electrical pulses at high voltage. In this work, we demonstrate a flow-through electroporation method for continuous transfection of cells based on disposable chips, a syringe pump, and a low-cost power supply that provides a constant voltage. We successfully transfect cells using either DC or AC voltage with high flow rates (ranging from 40 µl/min to 20 ml/min) and high efficiency (up to 75%). We also enable the entire cell membrane to be uniformly permeabilized and dramatically improve gene delivery by inducing complex migrations of cells during the flow.

A study of Schwarz converters for nuclear powered spacecraft

NASA Technical Reports Server (NTRS)

Stuart, Thomas A.; Schwarze, Gene E.

1987-01-01

High power space systems which use low dc voltage, high current sources such as thermoelectric generators, will most likely require high voltage conversion for transmission purposes. This study considers the use of the Schwarz resonant converter for use as the basic building block to accomplish this low-to-high voltage conversion for either a dc or an ac spacecraft bus. The Schwarz converter has the important assets of both inherent fault tolerance and resonant operation; parallel operation in modular form is possible. A regulated dc spacecraft bus requires only a single stage converter while a constant frequency ac bus requires a cascaded Schwarz converter configuration. If the power system requires constant output power from the dc generator, then a second converter is required to route unneeded power to a ballast load.

Heliocentric interplanetary low thrust trajectory optimization program, supplement 1, part 2

NASA Technical Reports Server (NTRS)

Mann, F. I.; Horsewood, J. L.

1978-01-01

The improvements made to the HILTOP electric propulsion trajectory computer program are described. A more realistic propulsion system model was implemented in which various thrust subsystem efficiencies and specific impulse are modeled as variable functions of power available to the propulsion system. The number of operating thrusters are staged, and the beam voltage is selected from a set of five (or less) constant voltages, based upon the application of variational calculus. The constant beam voltages may be optimized individually or collectively. The propulsion system logic is activated by a single program input key in such a manner as to preserve the HILTOP logic. An analysis describing these features, a complete description of program input quantities, and sample cases of computer output illustrating the program capabilities are presented.

Improvement of the conductive network of positive electrodes and the performance of Ni-MH battery

NASA Astrophysics Data System (ADS)

Morimoto, Katsuya; Nakayama, Kousuke; Maki, Hideshi; Inoue, Hiroshi; Mizuhata, Minoru

2017-06-01

The pretreatment to modify the valence of cobalt by discharging at 0.2 C rate for 7.5 h before the first initial activation charge process is effective in improving the surface electronic conductivity among fine particles of positive electrode active materials. The discharge curves indicate the same locus within 1800 cycles, and the capacity of the pretreated battery is stable for over 4000 cycles. However, in-situ cell pretreatment with constant current has negative influence on other components. During the constant current pretreatment, the cell voltage rapidly falls to -0.5 V in the first 10 s of in-situ pretreatment. Therefore, we investigate the pretreatment by supplying a constant voltage to the battery instead of a constant current, and find the effective condition to improve the electrochemical performance and not to have any influence on other components of the battery.

Developing Fast Fluorescent Protein Voltage Sensors by Optimizing FRET Interactions

PubMed Central

Sung, Uhna; Sepehri-Rad, Masoud; Piao, Hong Hua; Jin, Lei; Hughes, Thomas; Cohen, Lawrence B.; Baker, Bradley J.

2015-01-01

FRET (Förster Resonance Energy Transfer)-based protein voltage sensors can be useful for monitoring neuronal activity in vivo because the ratio of signals between the donor and acceptor pair reduces common sources of noise such as heart beat artifacts. We improved the performance of FRET based genetically encoded Fluorescent Protein (FP) voltage sensors by optimizing the location of donor and acceptor FPs flanking the voltage sensitive domain of the Ciona intestinalis voltage sensitive phosphatase. First, we created 39 different “Nabi1” constructs by positioning the donor FP, UKG, at 8 different locations downstream of the voltage-sensing domain and the acceptor FP, mKO, at 6 positions upstream. Several of these combinations resulted in large voltage dependent signals and relatively fast kinetics. Nabi1 probes responded with signal size up to 11% ΔF/F for a 100 mV depolarization and fast response time constants both for signal activation (~2 ms) and signal decay (~3 ms). We improved expression in neuronal cells by replacing the mKO and UKG FRET pair with Clover (donor FP) and mRuby2 (acceptor FP) to create Nabi2 probes. Nabi2 probes also had large signals and relatively fast time constants in HEK293 cells. In primary neuronal culture, a Nabi2 probe was able to differentiate individual action potentials at 45 Hz. PMID:26587834

Aging and failure mode of electrochemical double layer capacitors during accelerated constant load tests

NASA Astrophysics Data System (ADS)

Kötz, R.; Ruch, P. W.; Cericola, D.

Electrochemical double layer capacitors of the BCAP0350 type (Maxwell Technologies) were tested under constant load conditions at different voltages and temperatures. The aging of the capacitors was monitored during the test in terms of capacitance, internal resistance and leakage current. Aging was significantly accelerated by elevated temperature or increased voltage. Only for extreme conditions at voltages of 3.5 V or temperatures above 70 °C the capacitors failed due to internal pressure build-up. No other failure events such as open circuit or short circuit were detected. Impedance measurements after the tests showed increased high frequency resistance, an increased distributed resistance and most likely an increase in contact resistance between electrode and current collector together with a loss of capacitance. Capacitors aged at elevated voltages (3.3 V) exhibited a tilting of the low frequency component, which implies an increase in the heterogeneity of the electrode surface. This feature was not observed upon aging at elevated temperatures (70 °C).

Activation of Ih and TTX-sensitive sodium current at subthreshold voltages during CA1 pyramidal neuron firing

PubMed Central

Yamada-Hanff, Jason

2015-01-01

We used dynamic clamp and action potential clamp techniques to explore how currents carried by tetrodotoxin-sensitive sodium channels and HCN channels (Ih) regulate the behavior of CA1 pyramidal neurons at resting and subthreshold voltages. Recording from rat CA1 pyramidal neurons in hippocampal slices, we found that the apparent input resistance and membrane time constant were strongly affected by both conductances, with Ih acting to decrease apparent input resistance and time constant and sodium current acting to increase both. We found that both Ih and sodium current were active during subthreshold summation of artificial excitatory postsynaptic potentials (EPSPs) generated by dynamic clamp, with Ih dominating at less depolarized voltages and sodium current at more depolarized voltages. Subthreshold sodium current—which amplifies EPSPs—was most effectively recruited by rapid voltage changes, while Ih—which blunts EPSPs—was maximal for slow voltage changes. The combined effect is to selectively amplify rapid EPSPs. We did similar experiments in mouse CA1 pyramidal neurons, doing voltage-clamp experiments using experimental records of action potential firing of CA1 neurons previously recorded in awake, behaving animals as command voltages to quantify flow of Ih and sodium current at subthreshold voltages. Subthreshold sodium current was larger and subthreshold Ih was smaller in mouse neurons than in rat neurons. Overall, the results show opposing effects of subthreshold sodium current and Ih in regulating subthreshold behavior of CA1 neurons, with subthreshold sodium current prominent in both rat and mouse CA1 pyramidal neurons and additional regulation by Ih in rat neurons. PMID:26289465

Power conversion apparatus and method

DOEpatents

Su, Gui-Jia [Knoxville, TN

2012-02-07

A power conversion apparatus includes an interfacing circuit that enables a current source inverter to operate from a voltage energy storage device (voltage source), such as a battery, ultracapacitor or fuel cell. The interfacing circuit, also referred to as a voltage-to-current converter, transforms the voltage source into a current source that feeds a DC current to a current source inverter. The voltage-to-current converter also provides means for controlling and maintaining a constant DC bus current that supplies the current source inverter. The voltage-to-current converter also enables the current source inverter to charge the voltage energy storage device, such as during dynamic braking of a hybrid electric vehicle, without the need of reversing the direction of the DC bus current.

Experimental investigation of SDBD plasma actuator driven by AC high voltage with a superimposed positive pulse bias voltage

NASA Astrophysics Data System (ADS)

Qi, Xiao-Hua; Yan, Hui-Jie; Yang, Liang; Hua, Yue; Ren, Chun-Sheng

2017-08-01

In this work, a driven voltage consisting of AC high voltage with a superimposed positive pulse bias voltage ("AC+ Positive pulse bias" voltage) is adopted to study the performance of a surface dielectric barrier discharge plasma actuator under atmospheric conditions. To compare the performance of the actuator driven by single-AC voltage and "AC+ Positive pulse bias" voltage, the actuator-induced thrust force and power consumption are measured as a function of the applied AC voltage, and the measured results indicate that the thrust force can be promoted significantly after superimposing the positive pulse bias voltage. The physical mechanism behind the thrust force changes is analyzed by measuring the optical properties, electrical characteristics, and surface potential distribution. Experimental results indicate that the glow-like discharge in the AC voltage half-cycle, next to the cycle where a bias voltage pulse has been applied, is enhanced after applying the positive pulse bias voltage, and this perhaps is the main reason for the thrust force increase. Moreover, surface potential measurement results reveal that the spatial electric field formed by the surface charge accumulation after positive pulse discharge can significantly affect the applied external electric field, and this perhaps can be responsible for the experimental phenomenon that the decrease of thrust force is delayed by pulse bias voltage action after the filament discharge occurs in the glow-like discharge region. The schlieren images further verify that the actuator-induced airflow velocity increases with the positive pulse voltage.

A methodology for constraining power in finite element modeling of radiofrequency ablation.

PubMed

Jiang, Yansheng; Possebon, Ricardo; Mulier, Stefaan; Wang, Chong; Chen, Feng; Feng, Yuanbo; Xia, Qian; Liu, Yewei; Yin, Ting; Oyen, Raymond; Ni, Yicheng

2017-07-01

Radiofrequency ablation (RFA) is a minimally invasive thermal therapy for the treatment of cancer, hyperopia, and cardiac tachyarrhythmia. In RFA, the power delivered to the tissue is a key parameter. The objective of this study was to establish a methodology for the finite element modeling of RFA with constant power. Because of changes in the electric conductivity of tissue with temperature, a nonconventional boundary value problem arises in the mathematic modeling of RFA: neither the voltage (Dirichlet condition) nor the current (Neumann condition), but the power, that is, the product of voltage and current was prescribed on part of boundary. We solved the problem using Lagrange multiplier: the product of the voltage and current on the electrode surface is constrained to be equal to the Joule heating. We theoretically proved the equality between the product of the voltage and current on the surface of the electrode and the Joule heating in the domain. We also proved the well-posedness of the problem of solving the Laplace equation for the electric potential under a constant power constraint prescribed on the electrode surface. The Pennes bioheat transfer equation and the Laplace equation for electric potential augmented with the constraint of constant power were solved simultaneously using the Newton-Raphson algorithm. Three problems for validation were solved. Numerical results were compared either with an analytical solution deduced in this study or with results obtained by ANSYS or experiments. This work provides the finite element modeling of constant power RFA with a firm mathematical basis and opens pathway for achieving the optimal RFA power. Copyright © 2016 John Wiley & Sons, Ltd.

Bivariate quadratic method in quantifying the differential capacitance and energy capacity of supercapacitors under high current operation

NASA Astrophysics Data System (ADS)

Goh, Chin-Teng; Cruden, Andrew

2014-11-01

Capacitance and resistance are the fundamental electrical parameters used to evaluate the electrical characteristics of a supercapacitor, namely the dynamic voltage response, energy capacity, state of charge and health condition. In the British Standards EN62391 and EN62576, the constant capacitance method can be further improved with a differential capacitance that more accurately describes the dynamic voltage response of supercapacitors. This paper presents a novel bivariate quadratic based method to model the dynamic voltage response of supercapacitors under high current charge-discharge cycling, and to enable the derivation of the differential capacitance and energy capacity directly from terminal measurements, i.e. voltage and current, rather than from multiple pulsed-current or excitation signal tests across different bias levels. The estimation results the author achieves are in close agreement with experimental measurements, within a relative error of 0.2%, at various high current levels (25-200 A), more accurate than the constant capacitance method (4-7%). The archival value of this paper is the introduction of an improved quantification method for the electrical characteristics of supercapacitors, and the disclosure of the distinct properties of supercapacitors: the nonlinear capacitance-voltage characteristic, capacitance variation between charging and discharging, and distribution of energy capacity across the operating voltage window.

GaN HEMTs with p-GaN gate: field- and time-dependent degradation

NASA Astrophysics Data System (ADS)

Meneghesso, G.; Meneghini, M.; Rossetto, I.; Canato, E.; Bartholomeus, J.; De Santi, C.; Trivellin, N.; Zanoni, E.

2017-02-01

GaN-HEMTs with p-GaN gate have recently demonstrated to be excellent normally-off devices for application in power conversion systems, thanks to the high and robust threshold voltage (VTH>1 V), the high breakdown voltage, and the low dynamic Ron increase. For this reason, studying the stability and reliability of these devices under high stress conditions is of high importance. This paper reports on our most recent results on the field- and time-dependent degradation of GaN-HEMTs with p-GaN gate submitted to stress with positive gate bias. Based on combined step-stress experiments, constant voltage stress and electroluminescence testing we demonstrated that: (i) when submitted to high/positive gate stress, the transistors may show a negative threshold voltage shift, that is ascribed to the injection of holes from the gate metal towards the p-GaN/AlGaN interface; (ii) in a step-stress experiment, the analyzed commercial devices fail at gate voltages higher than 9-10 V, due to the extremely high electric field over the p-GaN/AlGaN stack; (iii) constant voltage stress tests indicate that the failure is also time-dependent and Weibull distributed. The several processes that can explain the time-dependent failure are discussed in the following.

Revisiting the relevance of using a constant voltage step to improve electrochemical performances of Li-rich lamellar oxides

NASA Astrophysics Data System (ADS)

Pradon, A.; Caldes, M. T.; Petit, P.-E.; La Fontaine, C.; Elkaim, E.; Tessier, C.; Ouvrard, G.; Dumont, E.

2018-03-01

A Li-rich lamellar oxide was cycled at high potential and the relevance of using a constant voltage step (CVS) at the end of the charge, needed for industrial application, was investigated by electrochemical performance, X-ray diffraction (XRD) and high resolution transmission electron microscopy (HRTEM). Electrochemical studies at 4.7 and 4.5 V with and without CVS showed that capacity and voltage fading occurred mostly when cells operated at high potential. After cycling, 3D-type defects involving transition metals trapped in lithium layer were observed by HRTEM into the electrode bulk. These defects are responsible for the voltage fading. XRD microstrain parameter was used to evaluate defects rate in aged materials subjected to a CVS, showing more 3D-type defects when cycled at 4.7 V than at 4.5 V. The time spent at high potential at the end of the charge as well as the value of the upper potential limit, are both relevant parameters to voltage decay. The use of a CVS at the end of the charge needs at the same time, a reduced upper potential window in order to minimize 3D-type defects occurrence. Unfortunately, this approach is still not sufficient to prevent voltage fading.

Independent variations of applied voltage and injection current for controlling the quantum-confined Stark effect in an InGaN/GaN quantum-well light-emitting diode.

PubMed

Chen, Horng-Shyang; Liu, Zhan Hui; Shih, Pei-Ying; Su, Chia-Ying; Chen, Chih-Yen; Lin, Chun-Han; Yao, Yu-Feng; Kiang, Yean-Woei; Yang, C C

2014-04-07

A reverse-biased voltage is applied to either device in the vertical configuration of two light-emitting diodes (LEDs) grown on patterned and flat Si (110) substrates with weak and strong quantum-confined Stark effects (QCSEs), respectively, in the InGaN/GaN quantum wells for independently controlling the applied voltage across and the injection current into the p-i-n junction in the lateral configuration of LED operation. The results show that more carrier supply is needed in the LED of weaker QCSE to produce a carrier screening effect for balancing the potential tilt in increasing the forward-biased voltage, when compared with the LED of stronger QCSE. The small spectral shift range in increasing injection current in the LED of weaker QCSE is attributed not only to the weaker QCSE, but also to its smaller device resistance such that a given increment of applied voltage leads to a larger increment of injection current. From a viewpoint of practical application in LED operation, by applying a reverse-biased voltage in the vertical configuration, the applied voltage and injection current in the lateral configuration can be independently controlled by adjusting the vertical voltage for keeping the emission spectral peak fixed.

Investigation on the Micro-Discharge Characteristics of Dielectric Barrier Discharge in a Needle-Plate Geometry

NASA Astrophysics Data System (ADS)

Li, Xuechen; Niu, Dongying; Jia, Pengying; Zhao, Na; Yuan, Ning

2011-04-01

In this study, a dielectric barrier discharge device with needle-plate electrodes was used to investigate the characteristics of the micro-discharge in argon at one atmospheric pressure by an optical method. The results show that there are two discharge modes in the dielectric barrier discharge, namely corona mode and filamentary mode. The corona discharge only occurs in the vicinity of the needle tip when the applied voltage is very low. However, the filamentary discharge mode can occur, and micro-discharge bridges the two electrodes when the applied voltage reaches a certain value. The extended area of micro-discharge on the dielectric plate becomes larger with the increase in applied voltage or decrease in gas pressure. The variance of the light emission waveforms is studied as a function of the applied voltage. Results show that very narrow discharge pulse only appears at the negative half cycle of the applied voltage in the corona discharge mode. However, broad hump (about several microseconds) can be discerned at both the negative half cycle and the positive half cycle for a high voltage in the filamentary mode. Furthermore, the inception voltage decreases and the width of the discharge hump increases with the increase in applied voltage. These experimental phenomena can be explained qualitatively by analyzing the discharge mechanism.

Fast gray-to-gray switching of a hybrid-aligned liquid crystal cell

NASA Astrophysics Data System (ADS)

Choi, Tae-Hoon; Kim, Jung-Wook; Yoon, Tae-Hoon

2015-03-01

We demonstrate fast gray-to-gray (GTG) switching of a hybrid-aligned liquid crystal cell by applying both vertical and inplane electric fields to liquid crystals (LCs) using a four-terminal electrode structure. The LCs are switched to the bright state through downward tilting and twist deformation initiated by applying an in-plane electric field, whereas they are switched back to the initial dark state through optically hidden relaxation initiated by applying a vertical electric field for a short duration. The top electrode in the proposed device is grounded, which requires a much higher voltage to be applied for in-plane rotation of LCs. Thus, ultrafast turn-on switching of the device is achieved, whereas the turn-off switching of the proposed device is independent of the elastic constants and the viscosity of the LCs so that fast turn-off switching can be achieved. We experimentally obtained a total response time of 0.75 ms. Furthermore, fast GTG response within 3 ms could be achieved.

Reversible superconductor-insulator transition in LiTi2O4 induced by Li-ion electrochemical reaction

PubMed Central

Yoshimatsu, K.; Niwa, M.; Mashiko, H.; Oshima, T.; Ohtomo, A.

2015-01-01

Transition metal oxides display various electronic and magnetic phases such as high-temperature superconductivity. Controlling such exotic properties by applying an external field is one of the biggest continuous challenges in condensed matter physics. Here, we demonstrate clear superconductor-insulator transition of LiTi2O4 films induced by Li-ion electrochemical reaction. A compact electrochemical cell of pseudo-Li-ion battery structure is formed with a superconducting LiTi2O4 film as an anode. Li content in the film is controlled by applying a constant redox voltage. An insulating state is achieved by Li-ion intercalation to the superconducting film by applying reduction potential. In contrast, the superconducting state is reproduced by applying oxidation potential to the Li-ion intercalated film. Moreover, superconducting transition temperature is also recovered after a number of cycles of Li-ion electrochemical reactions. This complete reversible transition originates in difference in potentials required for deintercalation of initially contained and electrochemically intercalated Li+ ions. PMID:26541508

Reversible superconductor-insulator transition in LiTi2O4 induced by Li-ion electrochemical reaction.

PubMed

Yoshimatsu, K; Niwa, M; Mashiko, H; Oshima, T; Ohtomo, A

2015-11-06

Transition metal oxides display various electronic and magnetic phases such as high-temperature superconductivity. Controlling such exotic properties by applying an external field is one of the biggest continuous challenges in condensed matter physics. Here, we demonstrate clear superconductor-insulator transition of LiTi2O4 films induced by Li-ion electrochemical reaction. A compact electrochemical cell of pseudo-Li-ion battery structure is formed with a superconducting LiTi2O4 film as an anode. Li content in the film is controlled by applying a constant redox voltage. An insulating state is achieved by Li-ion intercalation to the superconducting film by applying reduction potential. In contrast, the superconducting state is reproduced by applying oxidation potential to the Li-ion intercalated film. Moreover, superconducting transition temperature is also recovered after a number of cycles of Li-ion electrochemical reactions. This complete reversible transition originates in difference in potentials required for deintercalation of initially contained and electrochemically intercalated Li(+) ions.

Patient size and x-ray technique factors in head computed tomography examinations. II. Image quality.

PubMed

Huda, Walter; Lieberman, Kristin A; Chang, Jack; Roskopf, Marsha L

2004-03-01

We investigated how patient head characteristics, as well as the choice of x-ray technique factors, affect lesion contrast and noise values in computed tomography (CT) images. Head sizes and mean Hounsfield unit (HU) values were obtained from head CT images for five classes of patients ranging from the newborn to adults. X-ray spectra with tube voltages ranging from 80 to 140 kV were used to compute the average photon energy, and energy fluence, transmitted through the heads of patients of varying size. Image contrast, and the corresponding contrast to noise ratios (CNRs), were determined for lesions of fat, muscle, and iodine relative to a uniform water background. Maintaining a constant image CNR for each lesion, the patient energy imparted was also computed to identify the x-ray tube voltage that minimized the radiation dose. For adults, increasing the tube voltage from 80 to 140 kV changed the iodine HU from 2.62 x 10(5) to 1.27 x 10(5), the fat HU from -138 to -108, and the muscle HU from 37.1 to 33.0. Increasing the x-ray tube voltage from 80 to 140 kV increased the percentage energy fluence transmission by up to a factor of 2. For a fixed x-ray tube voltage, the percentage transmitted energy fluence in adults was more than a factor of 4 lower than for newborns. For adults, increasing the x-ray tube voltage from 80 to 140 kV improved the CNR for muscle lesions by 130%, for fat lesions by a factor of 2, and for iodine lesions by 25%. As the size of the patient increased from newborn to adults, lesion CNR was reduced by about a factor of 2. The mAs value can be reduced by 80% when scanning newborns while maintaining the same lesion CNR as for adults. Maintaining the CNR of an iodine lesion at a constant level, use of 140 kV increases the energy imparted to an adult patient by nearly a factor of 3.5 in comparison to 80 kV. For fat and muscle lesions, raising the x-ray tube voltage from 80 to 140 kV at a constant CNR increased the patient dose by 37% and 7%, respectively. Our two key findings are that for head CT examinations performed at a constant CNR, the mAs can be substantially reduced when scanning infants, and that use of the lowest x-ray tube voltage will generally reduce patient doses.

Voltage dependence of the rat chorda tympani response to Na+ salts: implications for the functional organization of taste receptor cells.

PubMed

Ye, Q; Heck, G L; DeSimone, J A

1993-07-01

1. Voltage-clamp and current-clamp data were obtained from a circumscribed region of the anterior rat lingual epithelium while simultaneously monitoring the afferent, stimulus-evoked, neural response from the same receptive field. 2. Chorda tympani (CT) responses at constant Na(+)-salt concentration were enhanced by submucosa negative voltage clamp and suppressed by positive voltage clamp. The complete CT response profile, including the time course of adaptation, was not uniquely determined by NaCl concentration alone. The response could be reproduced at different NaCl concentrations by applying a compensating voltage. 3. The form of the concentration and voltage dependence of the CT response indicates that the complete stimulus energy is the Na+ electrochemical potential difference across receptor cell apical membranes, and not Na+ concentration alone. This is the underlying principal behind the equivalence of chemical and electric taste for Na+ salts. 4. CT responses to sodium gluconate (25 and 200 mM) and 25 mM NaCl produced amiloride-insensitive components (AIC) of low magnitude. NaCl at 200 mM produced a significantly larger AIC. The AIC was voltage-clamp independent. The relative magnitude of the AIC was positively correlated with the transepithelial conductance of each salt. This suggests that the large AIC for 200 mM NaCl results from its relatively high permeability through the paracellular pathway. 5. Analysis of the CT response under voltage clamp revealed two anion effects on Na(+)-salt taste, both of which act through the paracellular shunt. 1) Anions modify the transepithelial potential (TP) across tight junctions and thereby modulate the cell receptor potential. This anion effect can be eliminated by voltage clamping the TP. 2) Sufficiently mobile anions facilitate electroneutral diffusion of Na+ salts through tight junctions. This effect is observed especially when Cl- is the anion and when the stimulus concentration favors NaCl influx, allowing Na+ to stimulate receptor cells from the submucosal side. Because the submucosal intercellular spaces are nearly isopotential regions, this effect is insensitive to voltage clamp of the TP. The large AIC associated with this anion effect is due to the low permeability of amiloride.

Full Piezoelectric Multilayer-Stacked Hybrid Actuation/Transduction Systems

NASA Technical Reports Server (NTRS)

Su, Ji; Jiang, Xiaoning; Zu, Tian-Bing

2011-01-01

The Stacked HYBATS (Hybrid Actuation/Transduction system) demonstrates significantly enhanced electromechanical performance by using the cooperative contributions of the electromechanical responses of multilayer, stacked negative strain components and positive strain components. Both experimental and theoretical studies indicate that, for Stacked HYBATS, the displacement is over three times that of a same-sized conventional flextensional actuator/transducer. The coupled resonance mode between positive strain and negative strain components of Stacked HYBATS is much stronger than the resonance of a single element actuation only when the effective lengths of the two kinds of elements match each other. Compared with the previously invented hybrid actuation system (HYBAS), the multilayer Stacked HYBATS can be designed to provide high mechanical load capability, low voltage driving, and a highly effective piezoelectric constant. The negative strain component will contract, and the positive strain component will expand in the length directions when an electric field is applied on the device. The interaction between the two elements makes an enhanced motion along the Z direction for Stacked-HYBATS. In order to dominate the dynamic length of Stacked-HYBATS by the negative strain component, the area of the cross-section for the negative strain component will be much larger than the total cross-section areas of the two positive strain components. The transverse strain is negative and longitudinal strain positive in inorganic materials, such as ceramics/single crystals. Different piezoelectric multilayer stack configurations can make a piezoelectric ceramic/single-crystal multilayer stack exhibit negative strain or positive strain at a certain direction without increasing the applied voltage. The difference of this innovation from the HYBAS is that all the elements can be made from one-of-a-kind materials. Stacked HYBATS can provide an extremely effective piezoelectric constant at both resonance and off resonance frequencies. The effective piezoelectric constant can be alternated by varying the size of each component, the degree of the pre-curvature of the positive strain components, the thickness of each layer in the multilayer stacks, and the piezoelectric constant of the material used. Because all of the elements are piezoelectric components, Stacked HYBATS can serve as projector and receiver for underwater detection. The performance of this innovation can be enhanced by improving the piezoelectric properties.

Apparatus and method for electrical insulation in plasma discharge systems

DOEpatents

Rhodes, Mark A [Redwood City, CA; Fochs, Scott N [Livermore, CA

2003-08-12

An apparatus and method to contain plasma at optimal fill capacity of a metallic container is disclosed. The invention includes the utilization of anodized layers forming the internal surfaces of the container volume. Bias resistors are calibrated to provide constant current at variable voltage conditions. By choosing the appropriate values of the bias resistors, the voltages of the metallic container relative to the voltage of an anode are adjusted to achieve optimal plasma fill while minimizing the chance of reaching the breakdown voltage of the anodized layer.

Automatic Control Of Length Of Welding Arc

NASA Technical Reports Server (NTRS)

Iceland, William F.

1991-01-01

Nonlinear relationships among current, voltage, and length stored in electronic memory. Conceptual microprocessor-based control subsystem maintains constant length of welding arc in gas/tungsten arc-welding system, even when welding current varied. Uses feedback of current and voltage from welding arc. Directs motor to set position of torch according to previously measured relationships among current, voltage, and length of arc. Signal paths marked "calibration" or "welding" used during those processes only. Other signal paths used during both processes. Control subsystem added to existing manual or automatic welding system equipped with automatic voltage control.

Application of VSC-HVDC with Shunt Connected SMES for Compensation of Power Fluctuation

NASA Astrophysics Data System (ADS)

Linn, Zarchi; Kakigano, Hiroaki; Miura, Yushi; Ise, Toshifumi

This paper describes the application of VSC-HVDC (High Voltage DC Transmission using Voltage Source Converter) with shunt connected SMES (Superconducting Magnetic Energy Storage) for compensation of power fluctuation caused by fluctuating power source such as photovoltaics and wind turbines. The objectives of this proposed system is to smooth out fluctuating power in one terminal side of HVDC in order to avoid causing power system instability and frequency deviation by absorbing or providing power according to the system requirement while another terminal side power is fluctuated. The shunt connected SMES charges and discharges the energy to and from the dc side and it compensates required power of fluctuation to obtain constant power flow in one terminal side of VSC-HVDC system. This system configuration has ability for power system stabilization in the case of power fluctuation from natural energy source. PSCAD/EMTDC simulation is used to evaluate the performance of applied system configuration and control method.

An assessment of the effectiveness and impact of electrokinetic remediation for pyrene-contaminated soil.

PubMed

Xu, Sujuan; Guo, Shuhai; Wu, Bo; Li, Fengmei; Li, Tingting

2014-11-01

The effectiveness of electrokinetic remediation for pyrene-contaminated soil was investigated by an anode-cathode separated system using a salt bridge. The applied constant voltage was 24 V and the electrode gap was 24 cm. Two types of soil (sandy soil and loam soil) were selected because of their different conductive capabilities. The initial concentrations of pyrene in these soil samples were 261.3mg/kg sandy soil and 259.8 mg/kg loam soil. After treatment of the sandy soil and loam soil for seven days, 56.8% and 20.1% of the pyrene had been removed respectively. Under the same power supply voltage, the removal of the pollutant from the sandy soil was greater than that from the loam soil, due to the higher current and lower pH. Further analysis revealed that the effectiveness of electrokinetic remediation was affected by the energy expenditure, and was associated with changes in soil properties. Copyright © 2014. Published by Elsevier B.V.

Efficient Ionization Investigation for Flow Control and Energy Extraction

NASA Technical Reports Server (NTRS)

Schneider, Steven J.; Kamhawi, Hani; Blankson, Isaiah M.

2009-01-01

Nonequilibrium ionization of air by nonthermal means is explored for hypersonic vehicle applications. The method selected for evaluation generates a weakly ionized plasma using pulsed nanosecond, high-voltage discharges sustained by a lower dc voltage. These discharges promise to provide a means of energizing and sustaining electrons in the air while maintaining a nearly constant ion/neutral molecule temperature. This paper explores the use of short approx.5 nsec, high-voltage approx.12 to 22 kV, repetitive (40 to 100 kHz) discharges in generating a weakly ionized gas sustained by a 1 kV dc voltage in dry air at pressures from 10 to 80 torr. Demonstrated lifetimes of the sustainer discharge current approx.10 to 25 msec are over three orders of magnitude longer than the 5 nsec pulse that generates the electrons. This life is adequate for many high speed flows, enabling the possibility of exploiting weakly ionized plasma phenomena in flow-fields such as those in hypersonic inlets, combustors, and nozzles. Results to date are obtained in a volume of plasma between electrodes in a bell jar. The buildup and decay of the visible emission from the pulser excited air is photographed on an ICCD camera with nanosecond resolution and the time constants for visible emission decay are observed to be between 10 to 15 nsec decreasing as pressure increases. The application of the sustainer voltage does not change the visible emission decay time constant. Energy consumption as indicated by power output from the power supplies is 194 to 669 W depending on pulse repetition rate.

Synaptic shot noise and conductance fluctuations affect the membrane voltage with equal significance.

PubMed

Richardson, Magnus J E; Gerstner, Wulfram

2005-04-01

The subthreshold membrane voltage of a neuron in active cortical tissue is a fluctuating quantity with a distribution that reflects the firing statistics of the presynaptic population. It was recently found that conductance-based synaptic drive can lead to distributions with a significant skew. Here it is demonstrated that the underlying shot noise caused by Poissonian spike arrival also skews the membrane distribution, but in the opposite sense. Using a perturbative method, we analyze the effects of shot noise on the distribution of synaptic conductances and calculate the consequent voltage distribution. To first order in the perturbation theory, the voltage distribution is a gaussian modulated by a prefactor that captures the skew. The gaussian component is identical to distributions derived using current-based models with an effective membrane time constant. The well-known effective-time-constant approximation can therefore be identified as the leading-order solution to the full conductance-based model. The higher-order modulatory prefactor containing the skew comprises terms due to both shot noise and conductance fluctuations. The diffusion approximation misses these shot-noise effects implying that analytical approaches such as the Fokker-Planck equation or simulation with filtered white noise cannot be used to improve on the gaussian approximation. It is further demonstrated that quantities used for fitting theory to experiment, such as the voltage mean and variance, are robust against these non-Gaussian effects. The effective-time-constant approximation is therefore relevant to experiment and provides a simple analytic base on which other pertinent biological details may be added.

Generation of constant-amplitude radio-frequency sweeps at a tunnel junction for spin resonance STM

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paul, William; Lutz, Christopher P.; Heinrich, Andreas J.

2016-07-15

We describe the measurement and successful compensation of the radio-frequency transfer function of a scanning tunneling microscope over a wide frequency range (15.5–35.5 GHz) and with high dynamic range (>50 dB). The precise compensation of cabling resonances and attenuations is critical for the production of constant-voltage frequency sweeps for electric-field driven electron spin resonance (ESR) experiments. We also demonstrate that a well-calibrated tunnel junction voltage is necessary to avoid spurious ESR peaks that can arise due to a non-flat transfer function.

VOLTAGE REGULATOR

DOEpatents

Von Eschen, R.L.; Scheele, P.F.

1962-04-24

A transistorized voltage regulator which provides very close voitage regulation up to about 180 deg F is described. A diode in the positive line provides a constant voltage drop from the input to a regulating transistor emitter. An amplifier is coupled to the positive line through a resistor and is connected between a difference circuit and the regulating transistor base which is negative due to the difference in voltage drop across thc diode and the resistor so that a change in the regulator output causes the amplifier to increase or decrease the base voltage and current and incrcase or decrease the transistor impedance to return the regulator output to normal. (AEC)

Ion funnel device

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ibrahim, Yehia M.; Chen, Tsung-Chi; Harrer, Marques B.

2017-11-21

An ion funnel device is disclosed. A first pair of electrodes is positioned in a first direction. A second pair of electrodes is positioned in a second direction. The device includes an RF voltage source and a DC voltage source. A RF voltage with a superimposed DC voltage gradient is applied to the first pair of electrodes, and a DC voltage gradient is applied to the second pair of electrodes.

Through thick and thin: tuning the threshold voltage in organic field-effect transistors.

PubMed

Martínez Hardigree, Josué F; Katz, Howard E

2014-04-15

Organic semiconductors (OSCs) constitute a class of organic materials containing densely packed, overlapping conjugated molecular moieties that enable charge carrier transport. Their unique optical, electrical, and magnetic properties have been investigated for use in next-generation electronic devices, from roll-up displays and radiofrequency identification (RFID) to biological sensors. The organic field-effect transistor (OFET) is the key active element for many of these applications, but the high values, poor definition, and long-term instability of the threshold voltage (V(T)) in OFETs remain barriers to realization of their full potential because the power and control circuitry necessary to compensate for overvoltages and drifting set points decrease OFET practicality. The drifting phenomenon has been widely observed and generally termed "bias stress." Research on the mechanisms responsible for this poor V(T) control has revealed a strong dependence on the physical order and chemical makeup of the interfaces between OSCs and adjacent materials in the OFET architecture. In this Account, we review the state of the art for tuning OFET performance via chemical designs and physical processes that manipulate V(T). This parameter gets to the heart of OFET operation, as it determines the voltage regimes where OFETs are either ON or OFF, the basis for the logical function of the devices. One obvious way to decrease the magnitude and variability of V(T) is to work with thinner and higher permittivity gate dielectrics. From the perspective of interfacial engineering, we evaluate various methods that we and others have developed, from electrostatic poling of gate dielectrics to molecular design of substituted alkyl chains. Corona charging of dielectric surfaces, a method for charging the surface of an insulating material using a constant high-voltage field, is a brute force means of shifting the effective gate voltage applied to a gate dielectric. A gentler and more direct method is to apply surface voltage to dielectric interfaces by direct contact or postprocess biasing; these methods could also be adapted for high throughput printing sequences. Dielectric hydrophobicity is an important chemical property determining the stability of the surface charges. Functional organic monolayers applied to dielectrics, using the surface attachment chemistry made available from "self-assembled" monolayer chemistry, provide local electric fields without any biasing process at all. To the extent that the monolayer molecules can be printed, these are also suitable for high throughput processes. Finally, we briefly consider V(T) control in the context of device integration and reliability, such as the role of contact resistance in affecting this parameter.

Manual. According to the Calculation of Wires and Cables,

DTIC Science & Technology

1980-04-23

Tpezxaaaro TON. As, C Kay: (1). Designation. t2). Designation. (3). Current (permanent. Voltage constant. (4). Currant ivariable/ alternating . Voltage is the...variable/ alternating , general designatior. (5). Current variable/ alternating three-phase 5C Hz. (6). Ez. (7). Zero line (neutral). It is allcwed/assumed...diagrams of powsr supply iz is allowed/assumed high-voltage switch to dapict, as it is shown. (10). iinuings by relay, contactor and magnetic starter. It

Lumped transmission line avalanche pulser

DOEpatents

Booth, R.

1995-07-18

A lumped linear avalanche transistor pulse generator utilizes stacked transistors in parallel within a stage and couples a plurality of said stages, in series with increasing zener diode limited voltages per stage and decreasing balanced capacitance load per stage to yield a high voltage, high and constant current, very short pulse. 8 figs.

Lumped transmission line avalanche pulser

DOEpatents

Booth, Rex

1995-01-01

A lumped linear avalanche transistor pulse generator utilizes stacked transistors in parallel within a stage and couples a plurality of said stages, in series with increasing zener diode limited voltages per stage and decreasing balanced capacitance load per stage to yield a high voltage, high and constant current, very short pulse.

High-throughput formation and control of monodisperse liquid crystals droplets driven by an alternating current electric field in a microfluidic device

NASA Astrophysics Data System (ADS)

Belloul, M.; Bartolo, J.-F.; Ziraoui, B.; Coldren, F.; Taly, V.; El Abed, A. I.

2013-07-01

We investigate the effect of an applied ac high voltage on a confined stable nematic liquid crystal (LC) in a microfluidic device and show that this actuation leads to the formation of highly monodisperse microdroplets with an unexpected constant mean size over a large interval of the forcing frequency F and with a droplets production frequency f ≃2F. We show also that despite the nonlinear feature of the droplets formation mechanism, droplets size, and size distribution are governed simply by the LC flow rate Qd and the forcing frequency F.

Development of a novel configuration for a MEMS transducer for low bias and high resolution imaging applications

NASA Astrophysics Data System (ADS)

Emadi, Tahereh Arezoo; Buchanan, Douglas A.

2014-03-01

A robust capacitive micromachined ultrasonic transducer has been developed. In this novel configuration, a stack of two deflectable membranes are suspended over a fixed bottom electrode. Similar to conventional capacitive ultrasonic transducers, a generated electrostatic force between the electrodes causes the membranes to deflect and vibrate. However, in this new configuration the transducer effective cavity height is reduced due to the deflection of two membranes. Therefore, the transducer spring constant is more susceptible to bias voltage, which in return reduces the required bias voltage. The transducers have been produced employing a MEMS sacrificial technique where two different membrane anchoring (curved- and flat- anchors) structures, with similar membrane radii were fabricated. Highly doped polysilicon was used as the membrane material. The resonant frequencies of the two transducers have been investigated. It was found that the transducers with curved membrane anchors exhibits a larger resonant frequency shift compared to the transducers with flat membranes for a given bias voltage. Comparison has been made between the spring constant of the flat membrane transducer and that of a conventional single membrane transducer. It is shown that the multiple moving membrane transducer exhibits a larger reduction in the spring constant compared to the conventional transducer, when driven with the same bias voltage. This results in a transducer with a higher power generation capability and sensitivity.

DC attenuation meter

DOEpatents

Hargrove, Douglas L.

2004-09-14

A portable, hand-held meter used to measure direct current (DC) attenuation in low impedance electrical signal cables and signal attenuators. A DC voltage is applied to the signal input of the cable and feedback to the control circuit through the signal cable and attenuators. The control circuit adjusts the applied voltage to the cable until the feedback voltage equals the reference voltage. The "units" of applied voltage required at the cable input is the system attenuation value of the cable and attenuators, which makes this meter unique. The meter may be used to calibrate data signal cables, attenuators, and cable-attenuator assemblies.

DC Motor control using motor-generator set with controlled generator field

DOEpatents

Belsterling, Charles A.; Stone, John

1982-01-01

A d.c. generator is connected in series opposed to the polarity of a d.c. power source supplying a d.c. drive motor. The generator is part of a motor-generator set, the motor of which is supplied from the power source connected to the motor. A generator field control means varies the field produced by at least one of the generator windings in order to change the effective voltage output. When the generator voltage is exactly equal to the d.c. voltage supply, no voltage is applied across the drive motor. As the field of the generator is reduced, the drive motor is supplied greater voltage until the full voltage of the d.c. power source is supplied when the generator has zero field applied. Additional voltage may be applied across the drive motor by reversing and increasing the reversed field on the generator. The drive motor may be reversed in direction from standstill by increasing the generator field so that a reverse voltage is applied across the d.c. motor.

Genetically-encoded fluorescent voltage sensors using the voltage-sensing domain of Nematostella and Danio phosphatases exhibit fast kinetics

PubMed Central

Baker, Bradley J.; Jin, Lei; Han, Zhou; Cohen, Lawrence B.; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent

2012-01-01

A substantial increase in the speed of the optical response of genetically-encoded Fluorescent Protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1–S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tauoff <5 msec). However, the signal was small (ΔF/F= 0.6%/200 mV). FP voltage sensors using the D. rerio voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2 msec of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. PMID:22634212

Design techniques for a stable operation of cryogenic field-programmable gate arrays.

PubMed

Homulle, Harald; Visser, Stefan; Patra, Bishnu; Charbon, Edoardo

2018-01-01

In this paper, we show how a deep-submicron field-programmable gate array (FPGA) can be operated more stably at extremely low temperatures through special firmware design techniques. Stability at low temperatures is limited through long power supply wires and reduced performance of various printed circuit board components commonly employed at room temperature. Extensive characterization of these components shows that the majority of decoupling capacitor types and voltage regulators are not well behaved at cryogenic temperatures, asking for an ad hoc solution to stabilize the FPGA supply voltage, especially for sensitive applications. Therefore, we have designed a firmware that enforces a constant power consumption, so as to stabilize the supply voltage in the interior of the FPGA. The FPGA is powered with a supply at several meters distance, causing significant resistive voltage drop and thus fluctuations on the local supply voltage. To achieve the stabilization, the variation in digital logic speed, which directly corresponds to changes in supply voltage, is constantly measured and corrected for through a tunable oscillator farm, implemented on the FPGA. The impact of the stabilization technique is demonstrated together with a reconfigurable analog-to-digital converter (ADC), completely implemented in the FPGA fabric and operating at 15 K. The ADC performance can be improved by at most 1.5 bits (effective number of bits) thanks to the more stable supply voltage. The method is versatile and robust, enabling seamless porting to other FPGA families and configurations.

Design techniques for a stable operation of cryogenic field-programmable gate arrays

NASA Astrophysics Data System (ADS)

Homulle, Harald; Visser, Stefan; Patra, Bishnu; Charbon, Edoardo

2018-01-01

In this paper, we show how a deep-submicron field-programmable gate array (FPGA) can be operated more stably at extremely low temperatures through special firmware design techniques. Stability at low temperatures is limited through long power supply wires and reduced performance of various printed circuit board components commonly employed at room temperature. Extensive characterization of these components shows that the majority of decoupling capacitor types and voltage regulators are not well behaved at cryogenic temperatures, asking for an ad hoc solution to stabilize the FPGA supply voltage, especially for sensitive applications. Therefore, we have designed a firmware that enforces a constant power consumption, so as to stabilize the supply voltage in the interior of the FPGA. The FPGA is powered with a supply at several meters distance, causing significant resistive voltage drop and thus fluctuations on the local supply voltage. To achieve the stabilization, the variation in digital logic speed, which directly corresponds to changes in supply voltage, is constantly measured and corrected for through a tunable oscillator farm, implemented on the FPGA. The impact of the stabilization technique is demonstrated together with a reconfigurable analog-to-digital converter (ADC), completely implemented in the FPGA fabric and operating at 15 K. The ADC performance can be improved by at most 1.5 bits (effective number of bits) thanks to the more stable supply voltage. The method is versatile and robust, enabling seamless porting to other FPGA families and configurations.

Voltage Support Study of Smart PV Inverters on a High-Photovoltaic Penetration Utility Distribution Feeder

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ding, Fei; Pratt, Annabelle; Bialek, Tom

2016-11-21

This paper reports on tools and methodologies developed to study the impact of adding rooftop photovoltaic (PV) systems, with and without the ability to provide voltage support, on the voltage profile of distribution feeders. Simulation results are provided from a study of a specific utility feeder. The simulation model of the utility distribution feeder was built in OpenDSS and verified by comparing the simulated voltages to field measurements. First, we set all PV systems to operate at unity power factor and analyzed the impact on feeder voltages. Then we conducted multiple simulations with voltage support activated for all the smartmore » PV inverters. These included different constant power factor settings and volt/VAR controls.« less

Comparative study of 0° X-cut and Y + 36°-cut lithium niobate high-voltage sensing

NASA Astrophysics Data System (ADS)

Patel, N.; Branch, D. W.; Schamiloglu, E.; Cular, S.

2015-08-01

A comparison study between Y + 36° and 0° X-cut lithium niobate (LiNbO3) was performed to evaluate the influence of crystal cut on the acoustic propagation to realize a piezoelectric high-voltage sensor. The acoustic time-of-flight for each crystal cut was measured when applying direct current (DC), alternating current (AC), and pulsed voltages. Results show that the voltage-induced shift in the acoustic wave propagation time scaled quadratically with voltage for DC and AC voltages applied to X-cut crystals. For the Y + 36° crystal, the voltage-induced shift scales linearly with DC voltages and quadratically with AC voltages. When applying 5 μs voltage pulses to both crystals, the voltage-induced shift scaled linearly with voltage. For the Y + 36° cut, the voltage-induced shift from applying DC voltages ranged from 10 to 54 ps and 35 to 778 ps for AC voltages at 640 V over the frequency range of 100 Hz-100 kHz. Using the same conditions as the Y + 36° cut, the 0° X-cut crystal sensed a shift of 10-273 ps for DC voltages and 189-813 ps for AC voltage application. For 5 μs voltage pulses, the 0° X-cut crystal sensed a voltage induced shift of 0.250-2 ns and the Y + 36°-cut crystal sensed a time shift of 0.115-1.6 ns. This suggests a frequency sensitive response to voltage where the influence of the crystal cut was not a significant contributor under DC, AC, or pulsed voltage conditions. The measured DC data were compared to a 1-D impedance matrix model where the predicted incremental length changed as a function of voltage. When the voltage source error was eliminated through physical modeling from the uncertainty budget, the combined uncertainty of the sensor (within a 95% confidence interval) decreased to 0.0033% using a Y + 36°-cut crystal and 0.0032% using an X-cut crystal for all the voltage conditions used in this experiment.

Comparative study of 0° X-cut and Y + 36°-cut lithium niobate high-voltage sensing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Patel, N.; Department of Electrical and Computer Engineering, MSC01 1100, University of New Mexico, Albuquerque, New Mexico 87131-0001; Branch, D. W.

2015-08-15

A comparison study between Y + 36° and 0° X-cut lithium niobate (LiNbO{sub 3}) was performed to evaluate the influence of crystal cut on the acoustic propagation to realize a piezoelectric high-voltage sensor. The acoustic time-of-flight for each crystal cut was measured when applying direct current (DC), alternating current (AC), and pulsed voltages. Results show that the voltage-induced shift in the acoustic wave propagation time scaled quadratically with voltage for DC and AC voltages applied to X-cut crystals. For the Y + 36° crystal, the voltage-induced shift scales linearly with DC voltages and quadratically with AC voltages. When applying 5more » μs voltage pulses to both crystals, the voltage-induced shift scaled linearly with voltage. For the Y + 36° cut, the voltage-induced shift from applying DC voltages ranged from 10 to 54 ps and 35 to 778 ps for AC voltages at 640 V over the frequency range of 100 Hz–100 kHz. Using the same conditions as the Y + 36° cut, the 0° X-cut crystal sensed a shift of 10–273 ps for DC voltages and 189–813 ps for AC voltage application. For 5 μs voltage pulses, the 0° X-cut crystal sensed a voltage induced shift of 0.250–2 ns and the Y + 36°-cut crystal sensed a time shift of 0.115–1.6 ns. This suggests a frequency sensitive response to voltage where the influence of the crystal cut was not a significant contributor under DC, AC, or pulsed voltage conditions. The measured DC data were compared to a 1-D impedance matrix model where the predicted incremental length changed as a function of voltage. When the voltage source error was eliminated through physical modeling from the uncertainty budget, the combined uncertainty of the sensor (within a 95% confidence interval) decreased to 0.0033% using a Y + 36°-cut crystal and 0.0032% using an X-cut crystal for all the voltage conditions used in this experiment.« less

Comparative study of 0° X-cut and Y+36°-cut lithium niobate high-voltage sensing

DOE PAGES

Patel, N.; Branch, D. W.; Schamiloglu, E.; ...

2015-08-11

A comparison study between Y+36° and 0° X-cut lithium niobate (LiNbO 3) was performed to evaluate the influence of crystal cut on the acoustic propagation to realize a piezoelectric high-voltage sensor. The acoustic time-of-flight for each crystal cut was measured when applying direct current (DC), alternating current (AC), and pulsed voltages. Results show that the voltage-induced shift in the acoustic wave propagation time scaled quadratically with voltage for DC and AC voltages applied to X-cut crystals. For the Y+36° crystal, the voltage-induced shift scales linearly with DC voltages and quadratically with AC voltages. When applying 5 μs voltage pulses tomore » both crystals, the voltage-induced shift scaled linearly with voltage. For the Y+36° cut, the voltage-induced shift from applying DC voltages ranged from 10 to 54 ps and 35 to 778 ps for AC voltages at 640 V over the frequency range of 100 Hz–100 kHz. Using the same conditions as the Y+36° cut, the 0° X-cut crystal sensed a shift of 10–273 ps for DC voltages and 189–813 ps for AC voltage application. For 5 μs voltage pulses, the 0° X-cut crystal sensed a voltage induced shift of 0.250–2 ns and the Y+36°-cut crystal sensed a time shift of 0.115–1.6 ns. This suggests a frequency sensitive response to voltage where the influence of the crystal cut was not a significant contributor under DC, AC, or pulsed voltage conditions. The measured DC data were compared to a 1-D impedance matrix model where the predicted incremental length changed as a function of voltage. Furthermore, when the voltage source error was eliminated through physical modeling from the uncertainty budget, the combined uncertainty of the sensor (within a 95% confidence interval) decreased to 0.0033% using a Y + 36°-cut crystal and 0.0032% using an X-cut crystal for all the voltage conditions used in this experiment.« less

Effect of phase advance on the brushless dc motor torque speed respond

NASA Astrophysics Data System (ADS)

Mohd, M. S.; Karsiti, M. N.; Mohd, M. S.

2015-12-01

Brushless direct current (BLDC) motor is widely used in small and medium sized electric vehicles as it exhibit highest specific power and thermal efficiency as compared to the induction motor. Permanent magnets BLDC rotor create a constant magnetic flux, which limit the motor top speed. As the back electromotive force (EMF) voltage increases proportionally with motor rotational speed and it approaches the amplitude of the input voltage, the phase current amplitude will reach zero. By advancing the phase current, it is possible to extend the maximum speed of the BLDC motor beyond the rated top speed. This will allow smaller BLDC motor to be used in small electric vehicles (EV) and in larger applications will allow the use of BLDC motor without the use of multispeed transmission unit for high speed operation. However, increasing the speed of BLDC will affect the torque speed response. The torque output will decrease as speed increases. Adjusting the phase angle will affect the speed of the motor as each coil is energized earlier than the corresponding rise in the back emf of the coil. This paper discusses the phase advance strategy of Brushless DC motor by phase angle manipulation approaches using external hall sensors. Tests have been performed at different phase advance angles in advance and retard positions for different voltage levels applied. The objective is to create the external hall sensor system to commutate the BLDC motor, to establish the phase advance of the BLDC by varying the phase angle through external hall sensor manipulation, observe the respond of the motor while applying the phase advance by hall sensor adjustment.

Differential comparator cirucit

DOEpatents

Hickling, Ronald M.

1996-01-01

A differential comparator circuit for an Analog-to-Digital Converter (ADC) or other application includes a plurality of differential comparators and a plurality of offset voltage generators. Each comparator includes first and second differentially connected transistor pairs having equal and opposite voltage offsets. First and second offset control transistors are connected in series with the transistor pairs respectively. The offset voltage generators generate offset voltages corresponding to reference voltages which are compared with a differential input voltage by the comparators. Each offset voltage is applied to the offset control transistors of at least one comparator to set the overall voltage offset of the comparator to a value corresponding to the respective reference voltage. The number of offset voltage generators required in an ADC application can be reduced by a factor of approximately two by applying the offset voltage from each offset voltage generator to two comparators with opposite logical sense such that positive and negative offset voltages are produced by each offset voltage generator.

Interacting adiabatic quantum motor

NASA Astrophysics Data System (ADS)

Bruch, Anton; Kusminskiy, Silvia Viola; Refael, Gil; von Oppen, Felix

2018-05-01

We present a field-theoretic treatment of an adiabatic quantum motor. We explicitly discuss a motor called the Thouless motor which is based on a Thouless pump operating in reverse. When a sliding periodic potential is considered to be the motor degree of freedom, a bias voltage applied to the electron channel sets the motor in motion. We investigate a Thouless motor whose electron channel is modeled as a Luttinger liquid. Interactions increase the gap opened by the periodic potential. For an infinite Luttinger liquid the coupling-induced friction is enhanced by electron-electron interactions. When the Luttinger liquid is ultimately coupled to Fermi liquid reservoirs, the dissipation reduces to its value for a noninteracting electron system for a constant motor velocity. Our results can also be applied to a motor based on a nanomagnet coupled to a quantum spin Hall edge.

Grid-connected wind and photovoltaic system

NASA Astrophysics Data System (ADS)

Devabakthuni, Sindhuja

The objective of this thesis is to design a grid connected wind and photovoltaic system. A new model of converter control was designed which maintains the voltage of the bus to grid as constant when combined system of solar and wind is connected to AC bus. The model is designed to track maximum power at each point irrespective of changes in irradiance, temperature and wind speed which affects the power supplied to grid. Solar power from the sun is not constant as it is affected by changes in irradiances and temperature. Even the wind power is affected by wind speed. A MPPT controller was designed for both systems. A boost converter is designed which uses the pulses from MPPT controller to boost the output. Wind system consists of wind turbine block from the MATLAB with a pitch angle controller to maintain optimum pitch angle. The output from wind turbine is connected to a permanent magnet synchronous generator. The unregulated DC output from the photovoltaic system is directly given to boost converter. The AC output from the wind system is given to an uncontrolled rectifier to get a unregulated DC output. The unregulated DC output goes to the boost converter. A voltage source inverter was designed which converts the rectified DC output from the boost converter to AC power. The inverter is designed to maintain constant AC bus voltage irrespective of the disturbances in the power supply. Photovoltaic and wind systems are individually designed for 5KW each in MATLAB-Simulink environment. In this thesis, the models were subjected to changes in irradiance, temperature and wind speed and the results were interpreted. The model was successful in tracking maximum at every instant and the AC bus voltage was maintained constant throughout the simulation.

Performance and Reliability of Electrowetting-on-Dielectric (EWOD) Systems Based on Tantalum Oxide.

PubMed

Mibus, Marcel; Zangari, Giovanni

2017-12-06

The electrowetting-on-dielectric behavior of Cytop/Tantalum oxide (TaOx) bilayers is studied by measuring their response vs applied voltage and under prolonged periodic cycling, below and above the threshold voltage V T corresponding to the breakdown field for the oxide. TaOx exhibits symmetric solid state I-V characteristics, with electronic conduction dominated by Schottky, Poole-Frenkel emission; conduction is attributed to oxygen vacancies (6 × 10 16 cm -3 ), resulting in large currents at low bias. Electrolyte/Metal Oxide/Metal I-V characteristics show oxide degradation at (<5 V) cathodic bias; anodic bias in contrast results in stable characteristics until reaching the anodization voltage, where the oxide thickens, leading eventually to breakdown and oxygen production at the electrode. Electrowetting angle vs applied voltage undergoes three different stages: a parabolic variation of contact angle (CA) with applied voltage, CA saturation, and rebound of the CA to higher values due to degradation of the polymer layer. The contact angle remained stable for several hundred cycles if the applied voltage was less than V T ; degradation in contrast is fast when the voltage is above V T . Degradation of the electrowetting response with time is linked to charge accumulation in the polymer, which inhibits the rebound of the CA when voltage is being applied.

Fully depleted back illuminated CCD

DOEpatents

Holland, Stephen Edward

2001-01-01

A backside illuminated charge coupled device (CCD) is formed of a relatively thick high resistivity photon sensitive silicon substrate, with frontside electronic circuitry, and an optically transparent backside ohmic contact for applying a backside voltage which is at least sufficient to substantially fully deplete the substrate. A greater bias voltage which overdepletes the substrate may also be applied. One way of applying the bias voltage to the substrate is by physically connecting the voltage source to the ohmic contact. An alternate way of applying the bias voltage to the substrate is to physically connect the voltage source to the frontside of the substrate, at a point outside the depletion region. Thus both frontside and backside contacts can be used for backside biasing to fully deplete the substrate. Also, high resistivity gaps around the CCD channels and electrically floating channel stop regions can be provided in the CCD array around the CCD channels. The CCD array forms an imaging sensor useful in astronomy.

Local doping of two-dimensional materials

DOEpatents

Wong, Dillon; Velasco, Jr, Jairo; Ju, Long; Kahn, Salman; Lee, Juwon; Germany, Chad E.; Zettl, Alexander K.; Wang, Feng; Crommie, Michael F.

2016-09-20

This disclosure provides systems, methods, and apparatus related to locally doping two-dimensional (2D) materials. In one aspect, an assembly including a substrate, a first insulator disposed on the substrate, a second insulator disposed on the first insulator, and a 2D material disposed on the second insulator is formed. A first voltage is applied between the 2D material and the substrate. With the first voltage applied between the 2D material and the substrate, a second voltage is applied between the 2D material and a probe positioned proximate the 2D material. The second voltage between the 2D material and the probe is removed. The first voltage between the 2D material and the substrate is removed. A portion of the 2D material proximate the probe when the second voltage was applied has a different electron density compared to a remainder of the 2D material.

Performance of a dual anode nickel-hydrogen cell

NASA Technical Reports Server (NTRS)

Gahn, Randall F.

1991-01-01

An experimental study was conducted to characterize the voltage performance of a nickel hydrogen cell containing a hydrogen electrode on both sides of the nickel electrode. The dual anode cell was compared with a convenient single anode cell using the same nickel electrode. Higher discharge voltages and lower charge voltages were obtained with the dual anode cell during constant current discharges to 10C, pulse discharges to 8C, and polarization measurements at 50 percent of charge.

MULTIPLIER CIRCUIT

DOEpatents

Thomas, R.E.

1959-01-20

An electronic circuit is presented for automatically computing the product of two selected variables by multiplying the voltage pulses proportional to the variables. The multiplier circuit has a plurality of parallel resistors of predetermined values connected through separate gate circults between a first input and the output terminal. One voltage pulse is applied to thc flrst input while the second voltage pulse is applied to control circuitry for the respective gate circuits. Thc magnitude of the second voltage pulse selects the resistors upon which the first voltage pulse is imprcssed, whereby the resultant output voltage is proportional to the product of the input voltage pulses

Proof-of-principle Experiment of a Ferroelectric Tuner for the 1.3 GHz Cavity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Choi,E.M.; Hahn, H.; Shchelkunov, S. V.

2009-01-01

A novel tuner has been developed by the Omega-P company to achieve fast control of the accelerator RF cavity frequency. The tuner is based on the ferroelectric property which has a variable dielectric constant as function of applied voltage. Tests using a Brookhaven National Laboratory (BNL) 1.3 GHz electron gun cavity have been carried out for a proof-of-principle experiment of the ferroelectric tuner. Two different methods were used to determine the frequency change achieved with the ferroelectric tuner (FT). The first method is based on a S11 measurement at the tuner port to find the reactive impedance change when themore » voltage is applied. The reactive impedance change then is used to estimate the cavity frequency shift. The second method is a direct S21 measurement of the frequency shift in the cavity with the tuner connected. The estimated frequency change from the reactive impedance measurement due to 5 kV is in the range between 3.2 kHz and 14 kHz, while 9 kHz is the result from the direct measurement. The two methods are in reasonable agreement. The detail description of the experiment and the analysis are discussed in the paper.« less

Effects of Complex Structured Anodic Oxide Dielectric Layer Grown in Pore Matrix for Aluminum Capacitor.

PubMed

Shin, Jin-Ha; Yun, Sook Young; Lee, Chang Hyoung; Park, Hwa-Sun; Suh, Su-Jeong

2015-11-01

Anodization of aluminum is generally divided up into two types of anodic aluminum oxide structures depending on electrolyte type. In this study, an anodization process was carried out in two steps to obtain high dielectric strength and break down voltage. In the first step, evaporated high purity Al on Si wafer was anodized in oxalic acidic aqueous solution at various times at a constant temperature of 5 degrees C. In the second step, citric acidic aqueous solution was used to obtain a thickly grown sub-barrier layer. During the second anodization process, the anodizing potential of various ranges was applied at room temperature. An increased thickness of the sub-barrier layer in the porous matrix was obtained according to the increment of the applied anodizing potential. The microstructures and the growth of the sub-barrier layer were then observed with an increasing anodizing potential of 40 to 300 V by using a scanning electron microscope (SEM). An impedance analyzer was used to observe the change of electrical properties, including the capacitance, dissipation factor, impedance, and equivalent series resistance (ESR) depending on the thickness increase of the sub-barrier layer. In addition, the breakdown voltage was measured. The results revealed that dielectric strength was improved with the increase of sub-barrier layer thickness.

A Supramolecular Nanofiber-Based Passive Memory Device for Remembering Past Humidity.

PubMed

Mogera, Umesha; Gedda, Murali; George, Subi J; Kulkarni, Giridhar U

2017-09-20

Memorizing the magnitude of a physical parameter such as relative humidity in a consignment may be useful for maintaining recommended conditions over a period of time. In relation to cost and energy considerations, it is important that the memorizing device works in the unpowered passive state. In this article, we report the fabrication of a humidity-responsive device that can memorize the humidity condition it had experienced while being unpowered. The device makes use of supramolecular nanofibers obtained from the self-assembly of donor-acceptor (D-A) molecules, coronene tetracarboxylate salt (CS) and dodecyl methyl viologen (DMV), respectively, from aqueous medium. The fibers, while being highly sensitive to humidity, tend to develop electrically induced disorder under constant voltage, leading to increased resistance with time. The conducting state can be regained via self-assembly by exposing the device to humidity in the absence of applied voltage, the extent of recovery depending on the magnitude of the humidity applied under no bias. This nature of the fibers has been exploited in reading the humidity memory state, which interestingly is independent of the lapsed time since the humidity exposure as well as the duration of exposure. Importantly, the device is capable of differentiating the profiles of varying humidity conditions from its memory. The device finds use in applications requiring stringent condition monitoring.

Multilevel DC link inverter

DOEpatents

Su, Gui-Jia

2003-06-10

A multilevel DC link inverter and method for improving torque response and current regulation in permanent magnet motors and switched reluctance motors having a low inductance includes a plurality of voltage controlled cells connected in series for applying a resulting dc voltage comprised of one or more incremental dc voltages. The cells are provided with switches for increasing the resulting applied dc voltage as speed and back EMF increase, while limiting the voltage that is applied to the commutation switches to perform PWM or dc voltage stepping functions, so as to limit current ripple in the stator windings below an acceptable level, typically 5%. Several embodiments are disclosed including inverters using IGBT's, inverters using thyristors. All of the inverters are operable in both motoring and regenerating modes.

Synthesis of polymer nanostructures with conductance switching properties

DOEpatents

Su, Kai; Nuraje, Nurxat; Zhang, Lingzhi; Matsui, Hiroshi; Yang, Nan Loh

2015-03-03

The present invention is directed to crystalline organic polymer nanoparticles comprising a conductive organic polymer; wherein the crystalline organic polymer nanoparticles have a size of from 10 nm to 200 nm and exhibits two current-voltage states: (1) a high resistance current-voltage state, and (2) a low resistance current-voltage state, wherein when a first positive threshold voltage (V.sub.th1) or higher positive voltage, or a second negative threshold voltage (V.sub.th2) or higher negative voltage is applied to the nanoparticle, the nanoparticle exhibits the low-resistance current-voltage state, and when a voltage less positive than the first positive threshold voltage or a voltage less negative than the second negative threshold voltage is applied to the nanoparticle, the nanoparticle exhibits the high-resistance current-voltage state. The present invention is also directed methods of manufacturing the nanoparticles using novel interfacial oxidative polymerization techniques.

Susceptibility constants of airborne bacteria to dielectric barrier discharge for antibacterial performance evaluation.

PubMed

Park, Chul Woo; Hwang, Jungho

2013-01-15

Dielectric barrier discharge (DBD) is a promising method to remove contaminant bioaerosols. The collection efficiency of a DBD reactor is an important factor for determining a reactor's removal efficiency. Without considering collection, simply defining the inactivation efficiency based on colony counting numbers for DBD as on and off may lead to overestimation of the inactivation efficiency of the DBD reactor. One-pass removal tests of bioaerosols were carried out to deduce the inactivation efficiency of the DBD reactor using both aerosol- and colony-counting methods. Our DBD reactor showed good performance for removing test bioaerosols for an applied voltage of 7.5 kV and a residence time of 0.24s, with η(CFU), η(Number), and η(Inactivation) values of 94%, 64%, and 83%, respectively. Additionally, we introduce the susceptibility constant of bioaerosols to DBD as a quantitative parameter for the performance evaluation of a DBD reactor. The modified susceptibility constant, which is the ratio of the susceptibility constant to the volume of the plasma reactor, has been successfully demonstrated for the performance evaluation of different sized DBD reactors under different DBD operating conditions. Our methodology will be used for design optimization, performance evaluation, and prediction of power consumption of DBD for industrial applications. Copyright © 2012 Elsevier B.V. All rights reserved.

Measurement of the Boltzmann constant by Johnson noise thermometry using a superconducting integrated circuit

NASA Astrophysics Data System (ADS)

Urano, C.; Yamazawa, K.; Kaneko, N.-H.

2017-12-01

We report on our measurement of the Boltzmann constant by Johnson noise thermometry (JNT) using an integrated quantum voltage noise source (IQVNS) that is fully implemented with superconducting integrated circuit technology. The IQVNS generates calculable pseudo white noise voltages to calibrate the JNT system. The thermal noise of a sensing resistor placed at the temperature of the triple point of water was measured precisely by the IQVNS-based JNT. We accumulated data of more than 429 200 s in total (over 6 d) and used the Akaike information criterion to estimate the fitting frequency range for the quadratic model to calculate the Boltzmann constant. Upon detailed evaluation of the uncertainty components, the experimentally obtained Boltzmann constant was k=1.380 6436× {{10}-23} J K-1 with a relative combined uncertainty of 10.22× {{10}-6} . The value of k is relatively -3.56× {{10}-6} lower than the CODATA 2014 value (Mohr et al 2016 Rev. Mod. Phys. 88 035009).

System and method for charging electrochemical cells in series

DOEpatents

DeLuca, William H.; Hornstra, Jr, Fred; Gelb, George H.; Berman, Baruch; Moede, Larry W.

1980-01-01

A battery charging system capable of equalizing the charge of each individual cell at a selected full charge voltage includes means for regulating charger current to first increase current at a constant rate until a bulk charging level is achieved or until any cell reaches a safe reference voltage. A system controller then begins to decrease the charging rate as long as any cell exceeds the reference voltage until an equalization current level is reached. At this point, the system controller activates a plurality of shunt modules to permit shunting of current around any cell having a voltage exceeding the reference voltage. Leads extending between the battery of cells and shunt modules are time shared to permit alternate shunting of current and voltage monitoring without the voltage drop caused by the shunt current. After each cell has at one time exceeded the reference voltage, the charging current is terminated.

Open-circuit voltage improvements in low-resistivity solar cells

NASA Technical Reports Server (NTRS)

Godlewski, M. P.; Klucher, T. M.; Mazaris, G. A.; Weizer, V. G.

1979-01-01

Mechanisms limiting the open-circuit voltage in 0.1 ohm-cm solar cells were investigated. It was found that a rather complicated multistep diffusion process could produce cells with significantly improved voltages. The voltage capabilities of various laboratory cells were compared independent of their absorption and collection efficiencies. This was accomplished by comparing the cells on the basis of their saturation currents or, equivalently, comparing their voltage outputs at a constant current-density level. The results show that for both the Lewis diffused emitter cell and the Spire ion-implanted emitter cell the base component of the saturation current is voltage controlling. The evidence for the University of Florida cells, although not very conclusive, suggests emitter control of the voltage in this device. The data suggest further that the critical voltage-limiting parameter for the Lewis cell is the electron mobility in the cell base.

Radiation Hardened Structured ASIC Platform with Compensation of Delay for Temperature and Voltage Variations for Multiple Redundant Temporal Voting Latch Technology

NASA Technical Reports Server (NTRS)

Ardalan, Sasan (Inventor)

2018-01-01

The invention relates to devices and methods of maintaining the current starved delay at a constant value across variations in voltage and temperature to increase the speed of operation of the sequential logic in the radiation hardened ASIC design.

Measured radial dependence of the peak sheath voltages present in very high frequency capacitive discharges

DOE PAGES

Barnat, E. V.; Miller, P. A.; Hebner, G. A.; ...

2007-05-16

In this paper, the radial distribution of the measured voltage drop across a sheath formed between a 300mm electrode and an argon plasma discharge is shown to depend on the excitation radio frequency, under constant power and pressure conditions. At a lower frequency of 13.56MHz, the voltage drop across the sheath is uniform across the 300mm electrode, while at higher frequencies of 60 and 162MHz the voltage drop becomes radially nonuniform. Finally, the magnitude and spatial extent of the nonuniformity become greater with increasing frequency.

Simulation study on single event burnout in linear doping buffer layer engineered power VDMOSFET

NASA Astrophysics Data System (ADS)

Yunpeng, Jia; Hongyuan, Su; Rui, Jin; Dongqing, Hu; Yu, Wu

2016-02-01

The addition of a buffer layer can improve the device's secondary breakdown voltage, thus, improving the single event burnout (SEB) threshold voltage. In this paper, an N type linear doping buffer layer is proposed. According to quasi-stationary avalanche simulation and heavy ion beam simulation, the results show that an optimized linear doping buffer layer is critical. As SEB is induced by heavy ions impacting, the electric field of an optimized linear doping buffer device is much lower than that with an optimized constant doping buffer layer at a given buffer layer thickness and the same biasing voltages. Secondary breakdown voltage and the parasitic bipolar turn-on current are much higher than those with the optimized constant doping buffer layer. So the linear buffer layer is more advantageous to improving the device's SEB performance. Project supported by the National Natural Science Foundation of China (No. 61176071), the Doctoral Fund of Ministry of Education of China (No. 20111103120016), and the Science and Technology Program of State Grid Corporation of China (No. SGRI-WD-71-13-006).

Preparation of ceramic coating on Ti substrate by Plasma electrolytic oxidation in different electrolytes and evaluation of its corrosion resistance

NASA Astrophysics Data System (ADS)

Shokouhfar, M.; Dehghanian, C.; Baradaran, A.

2011-01-01

Ceramic oxide coatings (titania) were produced on Ti by micro-arc oxidation in different aluminate and carbonate based electrolytes. This process was conducted under constant pulsed DC voltage condition. The effect of KOH and NaF in aluminate based solution was also studied. The surface morphology, growth and phase composition of coatings were investigated using scanning electron microscope and X-ray diffraction. Corrosion behavior of the coatings was also examined by potentiodynamic polarization and electrochemical impedance spectroscopy. It was found that the sparking initiation voltage (spark voltage) had a significant effect on the form and properties of coatings. Coatings obtained from potassium aluminate based solution had a lower spark voltage, higher surface homogeneity and a better corrosion resistance than the carbonate based solution. Addition of NaF instead of KOH had improper effects on the homogeneity and adhesion of coatings which in turn caused a poor corrosion protection behavior of the oxide layer. AC impedance curves showed two time constants which is an indication of the coatings with an outer porous layer and an inner compact layer.

Low-voltage analog front-end processor design for ISFET-based sensor and H+ sensing applications

NASA Astrophysics Data System (ADS)

Chung, Wen-Yaw; Yang, Chung-Huang; Peng, Kang-Chu; Yeh, M. H.

2003-04-01

This paper presents a modular-based low-voltage analog-front-end processor design in a 0.5mm double-poly double-metal CMOS technology for Ion Sensitive Field Effect Transistor (ISFET)-based sensor and H+ sensing applications. To meet the potentiometric response of the ISFET that is proportional to various H+ concentrations, the constant-voltage and constant current (CVCS) testing configuration has been used. Low-voltage design skills such as bulk-driven input pair, folded-cascode amplifier, bootstrap switch control circuits have been designed and integrated for 1.5V supply and nearly rail-to-rail analog to digital signal processing. Core modules consist of an 8-bit two-step analog-digital converter and bulk-driven pre-amplifiers have been developed in this research. The experimental results show that the proposed circuitry has an acceptable linearity to 0.1 pH-H+ sensing conversions with the buffer solution in the range of pH2 to pH12. The processor has a potential usage in battery-operated and portable healthcare devices and environmental monitoring applications.

A High Sensitivity Preamplifier for Quartz Tuning Forks in QEPAS (Quartz Enhanced PhotoAcoustic Spectroscopy) Applications

PubMed Central

Starecki, Tomasz

2017-01-01

All the preamplifiers dedicated for Quartz Enhanced PhotoAcoustic Spectroscopy (QEPAS) applications that have so far been reported in the literature have been based on operational amplifiers working in transimpedance configurations. Taking into consideration that QEPAS sensors are based on quartz tuning forks, and that quartz has a relatively high voltage constant and relatively low charge constant, it seems that a transimpedance amplifier is not an optimal solution. This paper describes the design of a quartz QEPAS sensor preamplifier, implemented with voltage amplifier configuration. Discussion of an electrical model of the circuit and preliminary measurements are presented. Both theoretical analysis and experiments show that use of the voltage configuration allows for a substantial increase of the output signal in comparison to the transimpedance circuit with the same tuning fork working in identical conditions. Assuming that the sensitivity of the QEPAS technique depends directly on the properties of the preamplifier, use of the voltage amplifier configuration should result in an increase of QEPAS sensitivity by one to two orders of magnitude. PMID:29099765

A High Sensitivity Preamplifier for Quartz Tuning Forks in QEPAS (Quartz Enhanced PhotoAcoustic Spectroscopy) Applications.

PubMed

Starecki, Tomasz; Wieczorek, Piotr Z

2017-11-03

All the preamplifiers dedicated for Quartz Enhanced PhotoAcoustic Spectroscopy (QEPAS) applications that have so far been reported in the literature have been based on operational amplifiers working in transimpedance configurations. Taking into consideration that QEPAS sensors are based on quartz tuning forks, and that quartz has a relatively high voltage constant and relatively low charge constant, it seems that a transimpedance amplifier is not an optimal solution. This paper describes the design of a quartz QEPAS sensor preamplifier, implemented with voltage amplifier configuration. Discussion of an electrical model of the circuit and preliminary measurements are presented. Both theoretical analysis and experiments show that use of the voltage configuration allows for a substantial increase of the output signal in comparison to the transimpedance circuit with the same tuning fork working in identical conditions. Assuming that the sensitivity of the QEPAS technique depends directly on the properties of the preamplifier, use of the voltage amplifier configuration should result in an increase of QEPAS sensitivity by one to two orders of magnitude.

Thermally-induced voltage alteration for integrated circuit analysis

DOEpatents

Cole, Jr., Edward I.

2000-01-01

A thermally-induced voltage alteration (TIVA) apparatus and method are disclosed for analyzing an integrated circuit (IC) either from a device side of the IC or through the IC substrate to locate any open-circuit or short-circuit defects therein. The TIVA apparatus uses constant-current biasing of the IC while scanning a focused laser beam over electrical conductors (i.e. a patterned metallization) in the IC to produce localized heating of the conductors. This localized heating produces a thermoelectric potential due to the Seebeck effect in any conductors with open-circuit defects and a resistance change in any conductors with short-circuit defects, both of which alter the power demand by the IC and thereby change the voltage of a source or power supply providing the constant-current biasing. By measuring the change in the supply voltage and the position of the focused and scanned laser beam over time, any open-circuit or short-circuit defects in the IC can be located and imaged. The TIVA apparatus can be formed in part from a scanning optical microscope, and has applications for qualification testing or failure analysis of ICs.

Investigations into the use of energy storage in power system applications

NASA Astrophysics Data System (ADS)

Leung, Ka Kit

This thesis embodies research work on the design and implementation of novel fast responding battery energy storage systems, which, with sufficient capacity and rating, could remove the uncertainty in forecasting the annual peak demand. They would also benefit the day to day operation by curtailing the fastest demand variations, particularly at the daily peak periods. Energy storage that could curtail peak demands, when the most difficult operational problems occur offers a promising approach. Although AC energy cannot be stored, power electronic developments offer a fast responding interface between the AC network and DC energy stored in batteries. The attractive feature of the use of this energy storage could most effectively be located near the source of load variations, i.e. near consumers in the distribution networks. The proposed, three phase multi-purpose, Battery Energy Storage System will provide active and reactive power independent of the supply voltage with excellent power quality in terms of its waveform. Besides the above important functions applied at the distribution side of the utility, several new topologies have been developed to provide both Dynamic Voltage Regulator (DVR) and Unified Power Flow Controller (UPFC) functions for line compensation. These new topologies can provide fast and accurate control of power flow along a distribution corridor. The topologies also provide for fast damping of system oscillation due to transient or dynamic disturbances. Having demonstrated the various functions that the proposed Battery Energy Storage System can provide, the final part of the thesis investigates means of improving the performance of the proposed BESS. First, there is a need to reduce the switching losses by using soft switching instead of hard switching. A soft switching inverter using a parallel resonant dc-link (PRDCL) is proposed for use with the proposed BESS. The proposed PRDCL suppresses the dc-link voltage to zero for a very short time to allow zero voltage switching of inverter main switches without imposing excessive voltage and current stresses. Finally, in practice the battery terminal voltage fluctuates significantly as large current is being drawn or absorbed by the battery bank. When a hysteresis controller is used to control the supply line current, the ripple magnitude and frequency of the controlled current is highly dependent on the battery voltage, line inductance and the band limits of the controller. Even when these parameters are constant, the switching frequency can vary over quite a large range. A novel method is proposed to overcome this problem by controlling the dc voltage level by means of a dc-dc converter to provide a controllable voltage at the inverter dc terminal irrespective of the battery voltage variations. By proper control of the magnitude and frequency of the output of the DC-DC converter, the switching frequency can be made close to constant. A mathematical proof has been formulated and results from the simulation confirm that using the proposed technique, the frequency band has been significantly reduced and for the theoretical case, a single switching frequency is observed. The main disadvantage is the need to have an extra dc-dc converter, but this is relatively cheap and easy to obtain.

High Voltage TAL Performance

NASA Technical Reports Server (NTRS)

Jacobson, David T.; Jankovsky, Robert S.; Rawlin, Vincent K.; Manzella, David H.

2001-01-01

The performance of a two-stage, anode layer Hall thruster was evaluated. Experiments were conducted in single and two-stage configurations. In single-stage configuration, the thruster was operated with discharge voltages ranging from 300 to 1700 V. Discharge specific impulses ranged from 1630 to 4140 sec. Thruster investigations were conducted with input power ranging from 1 to 8.7 kW, corresponding to power throttling of nearly 9: 1. An extensive two-stage performance map was generated. Data taken with total voltage (sum of discharge and accelerating voltage) constant revealed a decrease in thruster efficiency as the discharge voltage was increased. Anode specific impulse values were comparable in the single and two-stage configurations showing no strong advantage for two-stage operation.

High voltage dc--dc converter with dynamic voltage regulation and decoupling during load-generated arcs

DOEpatents

Shimer, D.W.; Lange, A.C.

1995-05-23

A high-power power supply produces a controllable, constant high voltage output under varying and arcing loads. The power supply includes a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, an output rectifier for producing a dc voltage at the output of each module, and a current sensor for sensing output current. The power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle and circuitry is provided for sensing incipient arc currents at the output of the power supply to simultaneously decouple the power supply circuitry from the arcing load. The power supply includes a plurality of discrete switching type dc--dc converter modules. 5 Figs.

High voltage dc-dc converter with dynamic voltage regulation and decoupling during load-generated arcs

DOEpatents

Shimer, Daniel W.; Lange, Arnold C.

1995-01-01

A high-power power supply produces a controllable, constant high voltage output under varying and arcing loads. The power supply includes a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, an output rectifier for producing a dc voltage at the output of each module, and a current sensor for sensing output current. The power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle and circuitry is provided for sensing incipient arc currents at the output of the power supply to simultaneously decouple the power supply circuitry from the arcing load. The power supply includes a plurality of discrete switching type dc--dc converter modules.

Optical fiber voltage sensor based on Michelsion interferometer using Fabry-Perot demodulation interferometer

NASA Astrophysics Data System (ADS)

Chen, Xinwei; He, Shengnan; Li, Dandan; Wang, Kai; Fan, Yan'en; Wu, Shuai

2014-11-01

We present an optical fiber voltage sensor by Michelsion interferometer (MI) employing a Fabry-Perot (F-P) interferometer and the DC phase tracking (DCPT) signal processing method. By mounting a MI fabricated by an optical fiber coupler on a piezoelectric (PZT) transducer bar, a dynamic strain would be generated to change the optical path difference (OPD) of the interferometer when the measured voltage was applied on the PZT. Applying an F-P interferometer to demodulate the optical intensity variation output of the MI, the voltage can be obtained. The experiment results show that the relationship between the optical intensity variation and the voltage applied on the PZT is approximately linear. Furthermore, the phase generate carrier (PGC) algorithm was applied to demodulate the output of the sensor also.

Exploration of the Townsend regime by discharge light emission in a gas discharge device

NASA Astrophysics Data System (ADS)

Hilal Yucel, Kurt

2014-01-01

The Townsend discharge mechanism has been explored in a planar microelectronic gas discharge device (MGDD) with different applied voltages U and interelectrode distance d under various pressures in air. The anode and the cathode of the MGDD are formed by a transparent SnO2 covered glass and a GaAs semiconductor, respectively. In the experiments, the discharge is found to be unstable just below the breakdown voltage Ub, whereas the discharge passes through a homogeneous stable Townsend mode beyond the breakdown voltage. The measurements are made by an electrical circuit and a CCD camera by recording the currents and light emission (LE) intensities. The intensity profiles, which are converted from the 3D light emission images along the semiconductor diameter, have been analysed for different system parameters. Different instantaneous conductivity σt regimes are found below and beyond the Townsend region. These regimes govern the current and spatio-temporal LE stabilities in the plasma system. It has been proven that the stable LE region increases up to 550 Torr as a function of pressure for small d. If the active area of the semiconductor becomes larger and the interlectrode distance d becomes smaller, the stable LE region stays nearly constant with pressure.

Design and Testing of 100 mK High-voltage Electrodes for AEgIS

NASA Astrophysics Data System (ADS)

Derking, J. H.; Liberadzka, J.; Koettig, T.; Bremer, J.

The AEgIS (Antimatter Experiment: Gravity, Interferometry, Spectroscopy) experiment at CERN has as main goal to perform the first direct measurement of the Earth's gravitational acceleration on antihydrogen atoms within 1% precision. To reach this precision, the antihydrogen should be cooled down to about 100 mK to reduce its random vertical velocity. This is obtained by mounting a Penning trap consisting of multiple high-voltage electrodes on the mixing chamber of a dilution refrigerator with cooling capacity of 100 μW at 50 mK. A design of the high-voltage electrodes is made and experimentally tested at operating conditions. The high-voltage electrodes are made of sapphire with four gold sputtered electrode sectors on it. The electrodes have a width of 40 mm, a height of 18 mm and a thickness of 5.8 mm and for performance testing are mountedto the mixing chamber of a dilution refrigerator with a 250 μm thick indium foil sandwiched inbetween the two to increase the thermal contact. A static heat load of 120 nW applied to the top surface of the electrode results in a maximum measured temperature of 100 mK while the mixing chamber is kept at a constant temperature of 50 mK. The measured totalthermal resistivity lies in the range of 210-260 cm2 K4 W-1, which is much higher than expected from literature. Further research needs to be done to investigate this.

Novel Superdielectric Materials: Aqueous Salt Solution Saturated Fabric

PubMed Central

Phillips, Jonathan

2016-01-01

The dielectric constants of nylon fabrics saturated with aqueous NaCl solutions, Fabric-Superdielectric Materials (F-SDM), were measured to be >105 even at the shortest discharge times (>0.001 s) for which reliable data could be obtained using the constant current method, thus demonstrating the existence of a third class of SDM. Hence, the present results support the general theoretical SDM hypothesis, which is also supported by earlier experimental work with powder and anodized foil matrices: Any material composed of liquid containing dissolved, mobile ions, confined in an electrically insulating matrix, will have a very high dielectric constant. Five capacitors, each composed of a different number of layers of salt solution saturated nylon fabric, were studied, using a galvanostat operated in constant current mode. Capacitance, dielectric constant, energy density and power density as a function of discharge time, for discharge times from ~100 s to nearly 0.001 s were recorded. The roll-off rate of the first three parameters was found to be nearly identical for all five capacitors tested. The power density increased in all cases with decreasing discharge time, but again the observed frequency response was nearly identical for all five capacitors. Operational limitations found for F-SDM are the same as those for other aqueous solution SDM, particularly a low maximum operating voltage (~2.3 V), and dielectric “constants” that are a function of voltage, decreasing for voltages higher than ~0.8 V. Extrapolations of the present data set suggest F-SDM could be the key to inexpensive, high energy density (>75 J/cm3) capacitors. PMID:28774037

Investigation of a generator system for generating electrical power, to supply directly to the public network, using a windmill

NASA Technical Reports Server (NTRS)

Tromp, C.

1979-01-01

A windpowered generator system is described which uses a windmill to convert mechanical energy to electrical energy for a three phase (network) voltage of constant amplitude and frequency. The generator system controls the windmill by the number of revolutions so that the power drawn from the wind for a given wind velocity is maximum. A generator revolution which is proportional to wind velocity is achieved. The stator of the generator is linked directly to the network and a feed converter at the rotor takes care of constant voltage and frequency at the stator.

Doubly Fed Induction Generator in an Offshore Wind Power Plant Operated at Rated V/Hz: Preprint

DOE Office of Scientific and Technical Information (OSTI.GOV)

Muljadi, E.; Singh, M.; Gevorgian, V.

2012-06-01

This paper introduces the concept of constant Volt/Hz operation of offshore wind power plants. The deployment of offshore WPPs requires power transmission from the plant to the load center inland. Since this power transmission requires submarine cables, there is a need to use High-Voltage Direct Current transmission, which is economical for transmission distances longer than 50 kilometers. In the concept presented here, the onshore substation is operated at 60 Hz synced with the grid, and the offshore substation is operated at variable frequency and voltage, thus allowing the WPP to be operated at constant Volt/Hz.

Rail-to-rail differential input amplification stage with main and surrogate differential pairs

DOEpatents

Britton, Jr., Charles Lanier; Smith, Stephen Fulton

2007-03-06

An operational amplifier input stage provides a symmetrical rail-to-rail input common-mode voltage without turning off either pair of complementary differential input transistors. Secondary, or surrogate, transistor pairs assume the function of the complementary differential transistors. The circuit also maintains essentially constant transconductance, constant slew rate, and constant signal-path supply current as it provides rail-to-rail operation.

Improved performance of the microbial electrolysis desalination and chemical-production cell with enlarged anode and high applied voltages.

PubMed

Ye, Bo; Luo, Haiping; Lu, Yaobin; Liu, Guangli; Zhang, Renduo; Li, Xiao

2017-11-01

The aim of this study was to improve performance of the microbial electrolysis desalination and chemical-production cell (MEDCC) using enlarged anode and high applied voltages. MEDCCs with anode lengths of 9 and 48cm (i.e., the 9cm-anode MEDCC and 48cm-anode MEDCC, respectively) were tested under different voltages (1.2-3.0V). Our results demonstrated for the first time that the MEDCC could maintain high performance even under the applied voltage higher than that for water dissociation (i.e., 1.8V). Under the applied voltage of 2.5V, the maximum current density in the 48cm-anode MEDCC reached 32.8±2.6A/m 2 , which is one of the highest current densities reported so far in the bioelectrochemical system (BES). The relative abundance of Geobacter was changed along the anode length. Our results show the great potential of the BES with enlarged anode and high applied voltages. Copyright © 2017 Elsevier Ltd. All rights reserved.

E-beam high voltage switching power supply

DOEpatents

Shimer, D.W.; Lange, A.C.

1996-10-15

A high-power power supply produces a controllable, constant high voltage output under varying and arcing loads. The power supply includes a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, an output rectifier for producing a dc voltage at the output of each module, and a current sensor for sensing output current. The power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle and circuitry is provided for sensing incipient arc currents at the output of the power supply to simultaneously decouple the power supply circuitry from the arcing load. The power supply includes a plurality of discrete switching type dc--dc converter modules. 5 figs.

E-beam high voltage switching power supply

DOEpatents

Shimer, Daniel W.; Lange, Arnold C.

1996-01-01

A high-power power supply produces a controllable, constant high voltage put under varying and arcing loads. The power supply includes a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, an output rectifier for producing a dc voltage at the output of each module, and a current sensor for sensing output current. The power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle and circuitry is provided for sensing incipient arc currents at the output of the power supply to simultaneously decouple the power supply circuitry from the arcing load. The power supply includes a plurality of discrete switching type dc--dc converter modules.

Flexible method for monitoring fuel cell voltage

DOEpatents

Mowery, Kenneth D.; Ripley, Eugene V.

2002-01-01

A method for equalizing the measured voltage of each cluster in a fuel cell stack wherein at least one of the clusters has a different number of cells than the identical number of cells in the remaining clusters by creating a pseudo voltage for the different cell numbered cluster. The average cell voltage of the all of the cells in the fuel cell stack is calculated and multiplied by a constant equal to the difference in the number of cells in the identical cell clusters and the number of cells in the different numbered cell cluster. The resultant product is added to the actual voltage measured across the different numbered cell cluster to create a pseudo voltage which is equivalent in cell number to the number of cells in the other identical numbered cell clusters.

48. VIEW LOOKING NORTHEAST AT EXCITER RESISTANCE GRIDS LOCATED UNDER ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

48. VIEW LOOKING NORTHEAST AT EXCITER RESISTANCE GRIDS LOCATED UNDER THE CONTROL ROOM ON SOUTH SIDE OF TURBINE HALL. THE GRIDS WERE AN ESSENTIAL PART OF THE CONTROL SYSTEM THAT MAINTAINED CONSTANT VOLTAGE ON THE RAILROAD POWER LINES. TIRRILL VOLTAGE REGULATORS (SEE CT-142A-100) SENSED VOLTAGE VARIATIONS AND INITIATED SWITCHING SEQUENCES TO REGULATE THE VOLTAGE AND MAINTAIN A SYSTEM STANDARD VOLTAGE. THE RESISTANCE GRIDS WERE SEQUENTIALLY ADDED TO OR REMOVED FROM THE GENERATOR FIELD COIL CIRCUITS. THIS RESISTANCE LOAD DISSIPATED EXCITIR GENERATOR POWER AS HEAT. THIS IN TURN WOULD VARY THE STRENGTH OF THE FIELD MAGNET AND CONSEQUENTLY RAISE OR LOWER THE OUTPUT VOLTAGE FROM THE MAIN GENERATOR ARMATURE. - New York, New Haven & Hartford Railroad, Cos Cob Power Plant, Sound Shore Drive, Greenwich, Fairfield County, CT

Modelling of fluoride removal via batch monopolar electrocoagulation process using aluminium electrodes

NASA Astrophysics Data System (ADS)

Amri, N.; Hashim, M. I.; Ismail, N.; Rohman, F. S.; Bashah, N. A. A.

2017-09-01

Electrocoagulation (EC) is a promising technology that extensively used to remove fluoride ions efficiently from industrial wastewater. However, it has received very little consideration and understanding on mechanism and factors that affecting the fluoride removal process. In order to determine the efficiency of fluoride removal in EC process, the effect of operating parameters such as voltage and electrolysis time were investigated in this study. A batch experiment with monopolar aluminium electrodes was conducted to identify the model of fluoride removal using empirical model equation. The EC process was investigated using several parameters which include voltage (3 - 12 V) and electrolysis time (0 - 60 minutes) at a constant initial fluoride concentration of 25 mg/L. The result shows that the fluoride removal efficiency increased steadily with increasing voltage and electrolysis time. The best fluoride removal efficiency was obtained with 94.8 % removal at 25 mg/L initial fluoride concentration, voltage of 12 V and 60 minutes electrolysis time. The results indicated that the rate constant, k and number of order, n decreased as the voltage increased. The rate of fluoride removal model was developed based on the empirical model equation using the correlation of k and n. Overall, the result showed that EC process can be considered as a potential alternative technology for fluoride removal in wastewater.

Development of a trans-admittance mammography (TAM) using 60×60 electrode array

NASA Astrophysics Data System (ADS)

Zhao, Mingkang; Liu, Qin; In Oh, Tong; Woo, Eung Je; Seo, Jin Keun

2010-04-01

We have developed a trans-admittance mammography (TAM) system as a supplementary or alternative method of the X-ray mammography to diagnose the breast cancer. Mechanical structure of the system is similar to the X-ray mammography with the breast placed between two plates. The pair of plates is movable to accommodate breasts with different sizes and rotatable to provide multiple images with different projection angles. Without using ionizing radiation, it acquires a projection image of tissue admittivity values. One plate is a flat solid electrode where we apply a constant sinusoidal voltage with a variable frequency. The other is equipped with 60×60 array of current-sensing electrodes, of which potentials are kept at the signal reference level. The electrode array is connected to six switching modules and each module routes current signals from 600 electrodes to two ammeter modules. Each ammeter module includes six channels of ammeters and each one of them comprises an independent current-to-voltage converter, voltage amplifier, ADC and digital phase-sensitive demodulator. Each ammeter sequentially measures exit currents from 50 electrodes chosen by the corresponding switching module. An FPGA controls six ammeters to collect real- and imaginary-parts of trans-admittance data from 300 electrodes. A separate FPGA arbitrates data and command exchanges between a DSP-based main controller and ammeter modules. It also generates a sinusoidal voltage signal to be applied to the breast. All the 3600 complex current data from 12 ammeter modules are transferred to the main controller, which is interfaced to a PC through an isolated USB. The system is provided with a program to display real- and imaginary-parts of measured trans-admittance maps. The measured maps at multiple frequencies are incorporated into a frequency-difference anomaly detection algorithm. In this paper, we describe the design and construction of the system.

The study of surface wetting, nanobubbles and boundary slip with an applied voltage: A review

PubMed Central

Pan, Yunlu; Zhao, Xuezeng

2014-01-01

Summary The drag of fluid flow at the solid–liquid interface in the micro/nanoscale is an important issue in micro/nanofluidic systems. Drag depends on the surface wetting, nanobubbles, surface charge and boundary slip. Some researchers have focused on the relationship between these interface properties. In this review, the influence of an applied voltage on the surface wettability, nanobubbles, surface charge density and slip length are discussed. The contact angle (CA) and contact angle hysteresis (CAH) of a droplet of deionized (DI) water on a hydrophobic polystyrene (PS) surface were measured with applied direct current (DC) and alternating current (AC) voltages. The nanobubbles in DI water and three kinds of saline solution on a PS surface were imaged when a voltage was applied. The influence of the surface charge density on the nanobubbles was analyzed. Then the slip length and the electrostatic force on the probe were measured on an octadecyltrichlorosilane (OTS) surface with applied voltage. The influence of the surface charge on the boundary slip and drag of fluid flow has been discussed. Finally, the influence of the applied voltage on the surface wetting, nanobubbles, surface charge, boundary slip and the drag of liquid flow are summarized. With a smaller surface charge density which could be achieved by applying a voltage on the surface, larger and fewer nanobubbles, a larger slip length and a smaller drag of liquid flow could be found. PMID:25161839

The study of surface wetting, nanobubbles and boundary slip with an applied voltage: A review.

PubMed

Pan, Yunlu; Bhushan, Bharat; Zhao, Xuezeng

2014-01-01

The drag of fluid flow at the solid-liquid interface in the micro/nanoscale is an important issue in micro/nanofluidic systems. Drag depends on the surface wetting, nanobubbles, surface charge and boundary slip. Some researchers have focused on the relationship between these interface properties. In this review, the influence of an applied voltage on the surface wettability, nanobubbles, surface charge density and slip length are discussed. The contact angle (CA) and contact angle hysteresis (CAH) of a droplet of deionized (DI) water on a hydrophobic polystyrene (PS) surface were measured with applied direct current (DC) and alternating current (AC) voltages. The nanobubbles in DI water and three kinds of saline solution on a PS surface were imaged when a voltage was applied. The influence of the surface charge density on the nanobubbles was analyzed. Then the slip length and the electrostatic force on the probe were measured on an octadecyltrichlorosilane (OTS) surface with applied voltage. The influence of the surface charge on the boundary slip and drag of fluid flow has been discussed. Finally, the influence of the applied voltage on the surface wetting, nanobubbles, surface charge, boundary slip and the drag of liquid flow are summarized. With a smaller surface charge density which could be achieved by applying a voltage on the surface, larger and fewer nanobubbles, a larger slip length and a smaller drag of liquid flow could be found.

Insulin increases excitability via a dose-dependent dual inhibition of voltage-activated K+ currents in differentiated N1E-115 neuroblastoma cells.

PubMed

Lima, Pedro A; Vicente, M Inês; Alves, Frederico M; Dionísio, José C; Costa, Pedro F

2008-04-01

A role in the control of excitability has been attributed to insulin via modulation of potassium (K(+)) currents. To investigate insulin modulatory effects on voltage-activated potassium currents in a neuronal cell line with origin in the sympathetic system, we performed whole-cell voltage-clamp recordings in differentiated N1E-115 neuroblastoma cells. Two main voltage-activated K(+) currents were identified: (a) a relatively fast inactivating current (I(fast) - time constant 50-300 ms); (b) a slow delayed rectifying K(+) current (I(slow) - time constant 1-4 s). The kinetics of inactivation of I(fast), rather than I(slow), showed clear voltage dependence. I(fast) and I(slow) exhibited different activation and inactivation dependence for voltage, and have different but nevertheless high sensitivities to tetraethylammonium, 4-aminopyridine and quinidine. In differentiated cells - rather than in non-differentiated cells - application of up to 300 nm insulin reduced I(slow) only (IC(50) = 6.7 nm), whereas at higher concentrations I(fast) was also affected (IC(50) = 7.7 microm). The insulin inhibitory effect is not due to a change in the activation or inactivation current-voltage profiles, and the time-dependent inactivation is also not altered; this is not likely to be a result of activation of the insulin-growth-factor-1 (IGF1) receptors, as application of IGF1 did not result in significant current alteration. Results suggest that the current sensitive to low concentrations of insulin is mediated by erg-like channels. Similar observations concerning the insulin inhibitory effect on slow voltage-activated K(+) currents were also made in isolated rat hippocampal pyramidal neurons, suggesting a widespread neuromodulator role of insulin on K(+) channels.

Electrochemical capacitance voltage measurements in highly doped silicon and silicon-germanium alloys

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sermage, B.; Essa, Z.; Taleb, N.

2016-04-21

The electrochemical capacitance voltage technique has been used on highly boron doped SiGe and Si layers. Although the boron concentration is constant over the space charge depth, the 1/C{sup 2} versus voltage curves are not linear. They indeed present a negative curvature. This can be explained by the existence of deep acceptors which ionise under a high electric field (large inverse voltage) and not at a low inverse voltage. The measured doping concentration in the electrochemical capacitance voltage increases strongly as the inverse voltage increases. Thanks to a comparison with the boron concentration measured by secondary ions mass spectrometry, wemore » show that the relevant doping concentrations in device layers are obtained for small inverse voltage in agreement with the existence of deep acceptors. At the large inverse voltage, the measured doping can be more than twice larger than the boron concentration measured with a secondary ion mass spectroscopy.« less

Genetically encoded fluorescent voltage sensors using the voltage-sensing domain of Nematostella and Danio phosphatases exhibit fast kinetics.

PubMed

Baker, Bradley J; Jin, Lei; Han, Zhou; Cohen, Lawrence B; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent

2012-07-15

A substantial increase in the speed of the optical response of genetically encoded fluorescent protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1-S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tau(off)<5ms). However, the signal was small (ΔF/F=0.4%/200mV). FP voltage sensors using the D. rerio voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2ms of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. Copyright © 2012 Elsevier B.V. All rights reserved.

NONDESTRUCTIVE EDDY CURRENT TESTING

DOEpatents

Renken, C.J. Jr.

1961-05-23

An eddy current testing device is described for measuring metal continuity independent of probe-to-sample spacing. An inductance would test probe is made a leg of a variable impedance bridge and the bridge is balanced with the probe away from the sample. An a-c signal is applied across the input terminals of the bridge circuit. As the probe is brought into proximity with the metal sample, the resulting impedance change in the probe gives an output signal from the bridge whose phase angle is proportional to the sample continuity and amplitude is proportional to the probe-tosample spacing. The output signal from the bridge is applied to a compensating network where, responsive to amplitude changes from the bridge output signal, a constant phased voltage output is maintained when the sample is continuous regardless of probe-to-sample spacing. A phase meter calibrated to read changes in resistivity of the metal sample measures the phase shift between the output of the compensating network and the original a-c signal applied to the bridge.

Effect of motor unit recruitment on functional vasodilatation in hamster retractor muscle

PubMed Central

Van Teeffelen, Jurgen W G E; Segal, Steven S

2000-01-01

The effect of motor unit recruitment on functional vasodilatation was investigated in hamster retractor muscle. Recruitment (i.e. peak tension) was controlled with voltage applied to the spinal accessory nerve (high = maximum tension; intermediate = ∼50% maximum; low = ∼25% maximum). Vasodilatory responses (diameter × time integral, DTI) to rhythmic contractions (1 per 2 s for 65 s) were evaluated in first, second and third orderarterioles and in feed arteries. Reciprocal changes in duty cycle (range, 2·5–25 %) effectively maintained the total active tension (tension × time integral, TTI) constant across recruitment levels. With constant TTI and stimulation frequency (40 Hz), DTI in all vessels increased with motor unit recruitment. DTI increased from distal arterioles up through proximal feed arteries. To determine whether the effect of recruitment on DTI was due to increased peak tension, the latter was controlled with stimulation frequency (15, 20 and 40 Hz) during maximum (high) recruitment. With constant TTI, DTI then decreased as peak tension increased. To explore the interaction between recruitment and duty cycle on DTI, each recruitment level was applied at 2.5, 10 and 20 % duty cycle (at 40 Hz). For a given increase in TTI, recruitment had a greater effect on DTI than did duty cycle. Functional vasodilatation in response to rhythmic contractions is facilitated by motor unit recruitment. Thus, vasodilatory responses are determined not only by the total tension produced, but also by the number of active motor units. PMID:10747197

Plasma Actuators for Turbomachinery Flow Control

NASA Technical Reports Server (NTRS)

Miles, Richard, B; Shneider, Mikhail, N.

2012-01-01

This report is Part I of the final report of NASA Cooperative Agreement contract no. NNX07AC02A. The period of performance was January 1, 2007 to December 31, 2010. This report includes the project summary, a list of publications and reprints of the publications that appeared in archival journals. Part II of the final report includes a Ph.D. dissertation and is published separately as NASA/CR-2012-2172655. The research performed under this project was focused on the operation of surface dielectric barrier discharge (DBD) devices driven by high voltage, nanosecond scale pulses plus constant or time varying bias voltages. The main interest was in momentum production and the range of voltages applied eliminated significant heating effects. The approach was experimental supplemented by computational modeling. All the experiments were conducted at Princeton University. The project provided comprehensive understanding of the associated physical phenomena. Limitations on the performance of the devices for the generation of high velocity surface jets were established and various means for overcoming those limitations were proposed and tested. The major limitations included the maximum velocity limit of the jet due to electrical breakdown in air and across the dielectric, the occurrence of backward breakdown during the short pulse causing reverse thrust, the buildup of surface charge in the dielectric offsetting the forward driving potential of the bias voltage, and the interaction of the surface jet with the surface through viscous losses. It was also noted that the best performance occurred when the nanosecond pulse and the bias voltage were of opposite sign. Solutions include the development of partially conducting surface coatings, the development of a semiconductor diode inlaid surface material to suppress the backward breakdown. Extension to long discharge channels was studied and a new ozone imaging method developed for more quantitative determination of surface jet properties.

Frequency and voltage dependent profile of dielectric properties, electric modulus and ac electrical conductivity in the PrBaCoO nanofiber capacitors

NASA Astrophysics Data System (ADS)

Demirezen, S.; Kaya, A.; Yerişkin, S. A.; Balbaşı, M.; Uslu, İ.

In this study, praseodymium barium cobalt oxide nanofiber interfacial layer was sandwiched between Au and n-Si. Frequency and voltage dependence of ε‧, ε‧, tanδ, electric modulus (M‧ and M″) and σac of PrBaCoO nanofiber capacitor have been investigated by using impedance spectroscopy method. The obtained experimental results show that the values of ε‧, ε‧, tanδ, M‧, M″ and σac of the PrBaCoO nanofiber capacitor are strongly dependent on frequency of applied bias voltage. The values of ε‧, ε″ and tanδ show a steep decrease with increasing frequency for each forward bias voltage, whereas the values of σac and the electric modulus increase with increasing frequency. The high dispersion in ε‧ and ε″ values at low frequencies may be attributed to the Maxwell-Wagner and space charge polarization. The high values of ε‧ may be due to the interfacial effects within the material, PrBaCoO nanofibers interfacial layer and electron effect. The values of M‧ and M″ reach a maximum constant value corresponding to M∞ ≈ 1/ε∞ due to the relaxation process at high frequencies, but both the values of M‧ and M″ approach almost to zero at low frequencies. The changes in the dielectric and electrical properties with frequency can be also attributed to the existence of Nss and Rs of the capacitors. As a result, the change in the ε‧, ε″, tanδ, M‧, M″ and ac electric conductivity (σac) is a result of restructuring and reordering of charges at the PrBaCoO/n-Si interface under an external electric field or voltage and interface polarization.

A Fresh Look at the Semiconductor Bandgap Using Constant Current Data

ERIC Educational Resources Information Center

Ocaya, R. O.; Luhanga, P. V. C.

2011-01-01

It is shown that the well-known linear variation of p-n diode terminal voltage with temperature at different fixed forward currents allows easy and accurate determination of the semiconductor ideality factor and bandgap from only two data points. This is possible if the temperature difference required to maintain the same diode voltage drop can be…

Voltage-independent inhibition of Ca(V)2.2 channels is delimited to a specific region of the membrane potential in rat SCG neurons.

PubMed

Vivas, Oscar; Arenas, Isabel; García, David E

2012-06-01

Neurotransmitters and hormones regulate Ca(V)2.2 channels through a voltage-independent pathway which is not well understood. It has been suggested that this voltage-independent inhibition is constant at all membrane voltages. However, changes in the percent of voltage-independent inhibition of Ca(V)2.2 have not been tested within a physiological voltage range. Here, we used a double-pulse protocol to isolate the voltage-independent inhibition of Ca(V)2.2 channels induced by noradrenaline in rat superior cervical ganglion neurons. To assess changes in the percent of the voltage-independent inhibition, the activation voltage of the channels was tested between -40 and +40 mV. We found that the percent of voltage-independent inhibition induced by noradrenaline changed with the activation voltage used. In addition, voltage-independent inhibition induced by oxo-M, a muscarinic agonist, exhibited the same dependence on activation voltage, which supports that this pattern is not exclusive for adrenergic activation. Our results suggested that voltage-independent inhibition of Ca(V)2.2 channels depends on the activation voltage of the channel in a physiological voltage range. This may have relevant implications in the understanding of the mechanism involved in voltage-independent inhibition.

Investigation of operating parameters on CO2 splitting by dielectric barrier discharge plasma

NASA Astrophysics Data System (ADS)

Pan, CHEN; Jun, SHEN; Tangchun, RAN; Tao, YANG; Yongxiang, YIN

2017-12-01

Experiments of CO2 splitting by dielectric barrier discharge (DBD) plasma were carried out, and the influence of CO2 flow rate, plasma power, discharge voltage, discharge frequency on CO2 conversion and process energy efficiency were investigated. It was shown that the absolute quantity of CO2 decomposed was only proportional to the amount of conductive electrons across the discharge gap, and the electron amount was proportional to the discharge power; the energy efficiency of CO2 conversion was almost a constant at a lower level, which was limited by CO2 inherent discharge character that determined a constant gap electric field strength. This was the main reason why CO2 conversion rate decreased as the CO2 flow rate increase and process energy efficiency was decreased a little as applied frequency increased. Therefore, one can improve the CO2 conversion by less feed flow rate or larger discharge power in DBD plasma, but the energy efficiency is difficult to improve.

Probing fast heating in magnetic tunnel junction structures with exchange bias

NASA Astrophysics Data System (ADS)

Papusoi, C.; Sousa, R.; Herault, J.; Prejbeanu, I. L.; Dieny, B.

2008-10-01

Heat diffusion in a magnetic tunnel junction (MTJ) having a ferromagnetic/antiferromagnetic free layer is investigated. The MTJ is heated by an electric current pulse of power PHP, flowing through the junction in current perpendicular to the plane (CPP) geometry, via Joule heat dissipation in the tunnel barrier. According to a proposed one-dimensional (1D) model of heat diffusion, when an electric voltage is applied to the MTJ, the free layer experiences a transient temperature regime, characterized by an exponential increase of its temperature TAF with a time constant τTR, followed by a steady temperature regime characterized by TAF=TRT+αPHP, where TRT is the room temperature and α is a constant. Magnetic transport measurements of exchange bias HEX acting on the free layer allow the determination of α and τTR. The experimental values of α and τTR are in agreement with those calculated using the 1D model and an estimation of the MTJ thermodynamic parameters based on the Dulong-Petit and Widemann-Franz laws.

Ultra-wideband tunable resonator based on varactor-loaded complementary split-ring resonators on a substrate-integrated waveguide for microwave sensor applications.

PubMed

Sam, Somarith; Lim, Sungjoon

2013-04-01

This paper presents the modeling, design, fabrication, and measurement of an ultra-wideband tunable twoport resonator in which the substrate-integrated waveguide, complementary split-ring resonators (CSRRs), and varactors are embedded on the same planar platform. The tuning of the passband frequency is generated by a simple single dc voltage of 0 to 36 V, which is applied to each varactor on the CSRRs. Different capacitance values and resonant frequencies are produced while a nearly constant absolute bandwidth is maintained. The resonant frequency is varied between 0.83 and 1.58 GHz and has a wide tuning ratio of 90%.

Flexible, wearable, and functional graphene-textile composites

NASA Astrophysics Data System (ADS)

Liu, Ying; Zhang, Kun-Ning; Zhang, Ying; Tao, Lu-Qi; Li, Yu-Xing; Wang, Dan-Yang; Yang, Yi; Ren, Tian-Ling

2017-06-01

In this paper, a flexible, wearable, and functional graphene-textile composite is demonstrated. Laser scribing technology is applied to fabricate a graphene film. The thin layer of polydimethylsiloxane is covered on the surface of the graphene-textile film evenly, which would improve the abrasive resistance of the film, enhance the ability to adapt to environmental changes, and extend the service life, while maintaining the device's excellent flexibility and comfort. The graphene-textile composite can achieve constant temperature heating by controlling the input voltage, detect the human movement, and perceive the human pulse signal. The composite presents great commercial prospects and a large value in the medical, daily wear, and other areas that are closely related to human lives.

Batteryless magneto-driven portable radiac

DOEpatents

Waechter, D.A.; Bjarke, G.O.; Trujillo, F.; Wolf, M.A.; Umbarger, C.J.

1984-10-19

A hand-powerd alternator for generating an alternating voltage provides same through a rectifier to a high capacity capacitor which stores the resultant dc voltage and drives a voltage regulator to provide a constant low voltage output for a portable radiation detection instrument. The instrument includes a Geiger-Mueller detector tube whose output is fed to a pulse detector and then through an event counter and LCD driver circuit to an LCD bar graph for visual display. An audio driver and an audio output is also provided. All circuitry used is low power so that the capacitor can be readily charged to a sufficient level to provide power for at least 30 minutes. A low voltage indicator is provided on the LCD display to indicate the need for manual recharging.

Apparatus and method for maximizing power delivered by a photovoltaic array

DOEpatents

Muljadi, Eduard; Taylor, Roger W.

1998-01-01

A method and apparatus for maximizing the electric power output of a photovoltaic array connected to a battery where the voltage across the photovoltaic array is adjusted through a range of voltages to find the voltage across the photovoltaic array that maximizes the electric power generated by the photovoltaic array and then is held constant for a period of time. After the period of time has elapsed, the electric voltage across the photovoltaic array is again adjusted through a range of voltages and the process is repeated. The electric energy and the electric power generated by the photovoltaic array is delivered to the battery which stores the electric energy and the electric power for later delivery to a load.

Apparatus and method for maximizing power delivered by a photovoltaic array

DOEpatents

Muljadi, E.; Taylor, R.W.

1998-05-05

A method and apparatus for maximizing the electric power output of a photovoltaic array connected to a battery where the voltage across the photovoltaic array is adjusted through a range of voltages to find the voltage across the photovoltaic array that maximizes the electric power generated by the photovoltaic array and then is held constant for a period of time. After the period of time has elapsed, the electric voltage across the photovoltaic array is again adjusted through a range of voltages and the process is repeated. The electric energy and the electric power generated by the photovoltaic array is delivered to the battery which stores the electric energy and the electric power for later delivery to a load. 20 figs.

Batteryless magneto-driven portable radiac

DOEpatents

Waechter, David A.; Bjarke, George O.; Trujillo, Faustin; Wolf, Michael A.; Umbarger, C. John

1986-01-01

A hand-powered alternator for generating an alternating voltage provides same through a rectifier to a high capacity capacitor which stores the resultant dc voltage and drives a voltage regulator to provide a constant low voltage output for a portable radiation detection instrument. The instrument includes a Geiger-Muller detector tube whose output is fed to a pulse detector and then through an event counter and LCD driver circuit to an LCD bar graph for visual display. An audio driver and an audio output is also provided. All circuitry used is low power so that the capacitor can be readily charged to a sufficient level to provide power for at least 30 minutes. A low voltage indicator is provided on the LCD display to indicate the need for manual recharging.

Switched-capacitor isolated LED driver

DOEpatents

Sanders, Seth R.; Kline, Mitchell

2016-03-22

A switched-capacitor voltage converter which is particularly well-suited for receiving a line voltage from which to drive current through a series of light emitting diodes (LEDs). Input voltage is rectified in a multi-level rectifier network having switched capacitors in an ascending-bank configuration for passing voltages in uniform steps between zero volts up to full received voltage V.sub.DC. A regulator section, operating on V.sub.DC, comprises switched-capacitor stages of H-bridge switching and flying capacitors. A current controlled oscillator drives the states of the switched-capacitor stages and changes its frequency to maintain a constant current to the load. Embodiments are described for isolating the load from the mains, utilizing an LC tank circuit or a multi-primary-winding transformer.

Hafnium transistor process design for neural interfacing.

PubMed

Parent, David W; Basham, Eric J

2009-01-01

A design methodology is presented that uses 1-D process simulations of Metal Insulator Semiconductor (MIS) structures to design the threshold voltage of hafnium oxide based transistors used for neural recording. The methodology is comprised of 1-D analytical equations for threshold voltage specification, and doping profiles, and 1-D MIS Technical Computer Aided Design (TCAD) to design a process to implement a specific threshold voltage, which minimized simulation time. The process was then verified with a 2-D process/electrical TCAD simulation. Hafnium oxide films (HfO) were grown and characterized for dielectric constant and fixed oxide charge for various annealing temperatures, two important design variables in threshold voltage design.

Real Time Computer Control of Neutral Beam Energy and Current During a DIII-D Tokamak Shot

NASA Astrophysics Data System (ADS)

Pawley, C. J.; Pace, D. C.; Rauch, J. M.; Scoville, J. T.

2017-10-01

A new control system has been implemented on DIII-D neutral beams which has been used during the 2016 and 2017 experimental campaign to directly change the beam acceleration voltage (V) and beam current (I) by the Plasma Control System (PCS) during a shot. Small changes in the beam voltage of 1-2 kV can be made in 1 msec or larger changes of up to 20kV in 0.5 seconds. The beam current can be modified by as much as +/-20% at a fixed beam voltage. Since both can be independently and simultaneously changed it is possible to change beam power (IV) at fixed voltage, keep constant power while sweeping beam voltage, or to maintain minimum beam divergence during a beam voltage sweep by changing I simultaneously to keep a constant beam perveance. The limitations of the variability will be presented with required changes in equipment to extend either the speed or range of the controls. Some of the effects on fast ion plasma instabilities or other plasma mode changes made possible by this control will also be presented (see also D.C. Pace, this conference). Design and changes to the control system was performed under General Atomics Internal Research and Development support, while plasma experiments on DIII-D were supported in part by the US Department of Energy under Award No. DE-FC02-04ER54698.

Nanotube Aerogel Sheet Flutter for Actuation, Power Generation, and Infrasound Detection

PubMed Central

Kang, Tae June; Kim, Taewoo; Jang, Eui Yun; Im, Hyeongwook; Lepro-Chavez, Xavier; Ovalle-Robles, Raquel; Oh, Jiyoung; Kozlov, Mikhail E.; Baughman, Ray H.; Lee, Hong H.; Kim, Yong Hyup

2014-01-01

Electromagnetic induction (EMI) is a mechanism of classical physics that can be utilized to convert mechanical energy to electrical energy or electrical to mechanical energy. This mechanism has not been exploited fully because of lack of a material with a sufficiently low force constant. We here show that carbon nanotube (CNT) aerogel sheets can exploit EMI to provide mechanical actuation at very low applied voltages, to harvest mechanical energy from small air pressure fluctuations, and to detect infrasound at inaudible frequencies below 20 Hz. Using conformal deposition of 100 nm thick aluminum coatings on the nanotubes in the sheets, mechanical actuation can be obtained by applying millivolts, as compared with the thousand volts needed to achieve giant-stroke electrostatic actuation of carbon nanotube aerogel sheets. Device simplicity and performance suggest possible applications as an energy harvester of low energy air fluctuations and as a sensor for infrasound frequencies. PMID:25130708

Influence of pulsed electric field on enzymes, bacteria and volatile flavor compounds of unpasteurized sake

NASA Astrophysics Data System (ADS)

Takamasa, OKUMURA; Taro, YAEGASHI; Takahiro, FUJIWARA; Katsuyuki, TAKAHASHI; Koichi, TAKAKI; Tomo, KUDO

2018-04-01

A pulsed electric field (PEF) was applied to unpasteurized sake at constant temperatures, at which α-amylase was not inactivated. We adjusted the input energy to be identical for the temperatures by changing the number of PEF application, because the current significantly increased with the temperature, even the amplitude of the applied voltage was identical. As a result, the α-amylase was seemed to be inactivated by PEF application, not due to thermal effect. The glucoamylase was significantly inactivated by PEF. Moreover, the acid carboxypeptidase was inactivated by PEF at 4 °C but significantly activated at 25 °C. These results show that the sensitivity of enzyme to PEF application differs depending on the types of enzyme and treatment temperature. On the other hand, the colony number of bacteria was remarkably decreased, but the amount of the volatile flavor compounds was not decreased by PEF application.

Nanotube aerogel sheet flutter for actuation, power generation, and infrasound detection.

PubMed

Kang, Tae June; Kim, Taewoo; Jang, Eui Yun; Im, Hyeongwook; Lepro-Chavez, Xavier; Ovalle-Robles, Raquel; Oh, Jiyoung; Kozlov, Mikhail E; Baughman, Ray H; Lee, Hong H; Kim, Yong Hyup

2014-08-18

Electromagnetic induction (EMI) is a mechanism of classical physics that can be utilized to convert mechanical energy to electrical energy or electrical to mechanical energy. This mechanism has not been exploited fully because of lack of a material with a sufficiently low force constant. We here show that carbon nanotube (CNT) aerogel sheets can exploit EMI to provide mechanical actuation at very low applied voltages, to harvest mechanical energy from small air pressure fluctuations, and to detect infrasound at inaudible frequencies below 20 Hz. Using conformal deposition of 100 nm thick aluminum coatings on the nanotubes in the sheets, mechanical actuation can be obtained by applying millivolts, as compared with the thousand volts needed to achieve giant-stroke electrostatic actuation of carbon nanotube aerogel sheets. Device simplicity and performance suggest possible applications as an energy harvester of low energy air fluctuations and as a sensor for infrasound frequencies.

Synaptic transistor with a reversible and analog conductance modulation using a Pt/HfOx/n-IGZO memcapacitor

NASA Astrophysics Data System (ADS)

Yang, Paul; Kim, Hyung Jun; Zheng, Hong; Beom, Geon Won; Park, Jong-Sung; Kang, Chi Jung; Yoon, Tae-Sik

2017-06-01

A synaptic transistor emulating the biological synaptic motion is demonstrated using the memcapacitance characteristics in a Pt/HfOx/n-indium-gallium-zinc-oxide (IGZO) memcapacitor. First, the metal-oxide-semiconductor (MOS) capacitor with Pt/HfOx/n-IGZO structure exhibits analog, polarity-dependent, and reversible memcapacitance in capacitance-voltage (C-V), capacitance-time (C-t), and voltage-pulse measurements. When a positive voltage is applied repeatedly to the Pt electrode, the accumulation capacitance increases gradually and sequentially. The depletion capacitance also increases consequently. The capacitances are restored by repeatedly applying a negative voltage, confirming the reversible memcapacitance. The analog and reversible memcapacitance emulates the potentiation and depression synaptic motions. The synaptic thin-film transistor (TFT) with this memcapacitor also shows the synaptic motion with gradually increasing drain current by repeatedly applying the positive gate and drain voltages and reversibly decreasing one by applying the negative voltages, representing synaptic weight modulation. The reversible and analog conductance change in the transistor at both the voltage sweep and pulse operations is obtained through the memcapacitance and threshold voltage shift at the same time. These results demonstrate the synaptic transistor operations with a MOS memcapacitor gate stack consisting of Pt/HfOx/n-IGZO.

Synaptic transistor with a reversible and analog conductance modulation using a Pt/HfOx/n-IGZO memcapacitor.

PubMed

Yang, Paul; Jun Kim, Hyung; Zheng, Hong; Won Beom, Geon; Park, Jong-Sung; Jung Kang, Chi; Yoon, Tae-Sik

2017-06-02

A synaptic transistor emulating the biological synaptic motion is demonstrated using the memcapacitance characteristics in a Pt/HfOx/n-indium-gallium-zinc-oxide (IGZO) memcapacitor. First, the metal-oxide-semiconductor (MOS) capacitor with Pt/HfOx/n-IGZO structure exhibits analog, polarity-dependent, and reversible memcapacitance in capacitance-voltage (C-V), capacitance-time (C-t), and voltage-pulse measurements. When a positive voltage is applied repeatedly to the Pt electrode, the accumulation capacitance increases gradually and sequentially. The depletion capacitance also increases consequently. The capacitances are restored by repeatedly applying a negative voltage, confirming the reversible memcapacitance. The analog and reversible memcapacitance emulates the potentiation and depression synaptic motions. The synaptic thin-film transistor (TFT) with this memcapacitor also shows the synaptic motion with gradually increasing drain current by repeatedly applying the positive gate and drain voltages and reversibly decreasing one by applying the negative voltages, representing synaptic weight modulation. The reversible and analog conductance change in the transistor at both the voltage sweep and pulse operations is obtained through the memcapacitance and threshold voltage shift at the same time. These results demonstrate the synaptic transistor operations with a MOS memcapacitor gate stack consisting of Pt/HfOx/n-IGZO.

Effect of applied voltage on surface properties of anodised titanium in mixture of β-glycerophosphate (β-GP) and calcium acetate (CA)

NASA Astrophysics Data System (ADS)

Chuan, Lee Te; Rathi, Muhammad Fareez Mohamad; Abidin, Muhamad Yusuf Zainal; Abdullah, Hasan Zuhudi; Idris, Maizlinda Izwana

2015-07-01

Anodic oxidation is a surface modification method which combines electric field driven metal and oxygen ion diffusion for formation of oxide layer on the anode surface. This method has been widely used to modify the surface morphology of biomaterial especially titanium. This study aimed to investigate the effect of applied voltage on titanium. Specifically, the titanium foil was anodised in mixture of β-glycerophosphate disodium salt pentahydrate (β-GP) and calcium acetate monohydrate (CA) with different applied voltage (50-350 V), electrolyte concentration (0.04 M β-GP + 0.4 M CA), anodising time (10minutes) and current density (50 and 70 mA.cm-2) at room temperature. Surface oxide properties of anodised titanium were characterised by digital single-lens reflex camera (DSLR camera), field emission scanning electron microscope (FESEM) and atomic force microscopy (AFM). At lower applied voltage (≤150 V), surface of titanium foils were relatively smooth. With increasing applied voltage (≥250 V), the oxide layer became more porous and donut-shaped pores were formed on the surface of titanium foils. The AFM results indicated that the surface roughness of anodised titanium increases with increasing of applied voltage. The porous and rough surface is able to promote the osseointegration and reduce the suffering time of patient.

Voltage-Gated Lipid Ion Channels

PubMed Central

Blicher, Andreas; Heimburg, Thomas

2013-01-01

Synthetic lipid membranes can display channel-like ion conduction events even in the absence of proteins. We show here that these events are voltage-gated with a quadratic voltage dependence as expected from electrostatic theory of capacitors. To this end, we recorded channel traces and current histograms in patch-experiments on lipid membranes. We derived a theoretical current-voltage relationship for pores in lipid membranes that describes the experimental data very well when assuming an asymmetric membrane. We determined the equilibrium constant between closed and open state and the open probability as a function of voltage. The voltage-dependence of the lipid pores is found comparable to that of protein channels. Lifetime distributions of open and closed events indicate that the channel open distribution does not follow exponential statistics but rather power law behavior for long open times. PMID:23823188

Domain switching kinetics in ferroelectric-resistive BiFeO3 thin film memories

NASA Astrophysics Data System (ADS)

Meng, Jianwei; Jiang, Jun; Geng, Wenping; Chen, Zhihui; Zhang, Wei; Jiang, Anquan

2015-02-01

We fabricated (00l) BiFeO3 (BFO) thin films in different growth modes on SrRuO3/SrTiO3 substrates using a pulsed laser deposition technique. X-ray diffraction patterns show an out-of-plane lattice constant of 4.03 Å and ferroelectric polarization of 82 µC/cm2 for the BFO thin film in a layer-by-layer growth mode (2D-BFO), larger than 3.96 Å and 51 µC/cm2 for the thin film in the 3D-island formation growth mode (3D-BFO). The 2D-BFO thin film at 300 K shows switchable on/off diode currents upon polarization flipping near a negative coercive voltage, which is nevertheless absent from the above 3D-BFO thin film. From a positive-up-negative-down pulse characterization technique, we measured domain switching current transients as well as polarization-voltage (Pf-Vf) hysteresis loops in both semiconducting thin films. Pf-Vf hysteresis loops after 1 µs-retention time show the preferred domain orientation pointing to bottom electrodes in a 3D-BFO thin film. The poor retention of the domains pointing to top electrodes can be improved considerably in a 2D-BFO thin film. From these measurements, we extracted domain switching time dependence of coercive voltage at temperatures of 78-300 K. From these dependences, we found coercive voltages in semiconducting ferroelectric thin films much higher than those in insulating thin films, disobeying the traditional Merz equation. Finally, an equivalent resistance model in description of free-carrier compensation of the front domain boundary charge is developed to interpret this difference. This equivalent resistance can be coincidently extracted either from domain switching time dependence of coercive voltage or from applied voltage dependence of domain switching current, which drops almost linearly with the temperature until down to 0 in a ferroelectric insulator at 78 K.

Evaluation of beam divergence of a negative hydrogen ion beam using Doppler shift spectroscopy diagnostics

NASA Astrophysics Data System (ADS)

Deka, A. J.; Bharathi, P.; Pandya, K.; Bandyopadhyay, M.; Bhuyan, M.; Yadav, R. K.; Tyagi, H.; Gahlaut, A.; Chakraborty, A.

2018-01-01

The Doppler Shift Spectroscopy (DSS) diagnostic is in the conceptual stage to estimate beam divergence, stripping losses, and beam uniformity of the 100 keV hydrogen Diagnostics Neutral Beam of International Thermonuclear Experimental Reactor. This DSS diagnostic is used to measure the above-mentioned parameters with an error of less than 10%. To aid the design calculations and to establish a methodology for estimation of the beam divergence, DSS measurements were carried out on the existing prototype ion source RF Operated Beam Source in India for Negative ion Research. Emissions of the fast-excited neutrals that are generated from the extracted negative ions were collected in the target tank, and the line broadening of these emissions were used for estimating beam divergence. The observed broadening is a convolution of broadenings due to beam divergence, collection optics, voltage ripple, beam focusing, and instrumental broadening. Hence, for estimating the beam divergence from the observed line broadening, a systematic line profile analysis was performed. To minimize the error in the divergence measurements, a study on error propagation in the beam divergence measurements was carried out and the error was estimated. The measurements of beam divergence were done at a constant RF power of 50 kW and a source pressure of 0.6 Pa by varying the extraction voltage from 4 kV to10 kV and the acceleration voltage from 10 kV to 15 kV. These measurements were then compared with the calorimetric divergence, and the results seemed to agree within 10%. A minimum beam divergence of ˜3° was obtained when the source was operated at an extraction voltage of ˜5 kV and at a ˜10 kV acceleration voltage, i.e., at a total applied voltage of 15 kV. This is in agreement with the values reported in experiments carried out on similar sources elsewhere.

Voltage and Current Clamp Transients with Membrane Dielectric Loss

PubMed Central

Fitzhugh, R.; Cole, K. S.

1973-01-01

Transient responses of a space-clamped squid axon membrane to step changes of voltage or current are often approximated by exponential functions of time, corresponding to a series resistance and a membrane capacity of 1.0 μF/cm2. Curtis and Cole (1938, J. Gen. Physiol. 21:757) found, however, that the membrane had a constant phase angle impedance z = z1(jωτ)-α, with a mean α = 0.85. (α = 1.0 for an ideal capacitor; α < 1.0 may represent dielectric loss.) This result is supported by more recently published experimental data. For comparison with experiments, we have computed functions expressing voltage and current transients with constant phase angle capacitance, a parallel leakage conductance, and a series resistance, at nine values of α from 0.5 to 1.0. A series in powers of tα provided a good approximation for short times; one in powers of t-α, for long times; for intermediate times, a rational approximation matching both series for a finite number of terms was used. These computations may help in determining experimental series resistances and parallel leakage conductances from membrane voltage or current clamp data. PMID:4754194

PSO Based PI Controller Design for a Solar Charger System

PubMed Central

Yau, Her-Terng; Lin, Chih-Jer; Liang, Qin-Cheng

2013-01-01

Due to global energy crisis and severe environmental pollution, the photovoltaic (PV) system has become one of the most important renewable energy sources. Many previous studies on solar charger integrated system only focus on load charge control or switching Maximum Power Point Tracking (MPPT) and charge control modes. This study used two-stage system, which allows the overall portable solar energy charging system to implement MPPT and optimal charge control of Li-ion battery simultaneously. First, this study designs a DC/DC boost converter of solar power generation, which uses variable step size incremental conductance method (VSINC) to enable the solar cell to track the maximum power point at any time. The voltage was exported from the DC/DC boost converter to the DC/DC buck converter, so that the voltage dropped to proper voltage for charging the battery. The charging system uses constant current/constant voltage (CC/CV) method to charge the lithium battery. In order to obtain the optimum PI charge controller parameters, this study used intelligent algorithm to determine the optimum parameters. According to the simulation and experimental results, the control parameters resulted from PSO have better performance than genetic algorithms (GAs). PMID:23766713

PSO based PI controller design for a solar charger system.

PubMed

Yau, Her-Terng; Lin, Chih-Jer; Liang, Qin-Cheng

2013-01-01

Due to global energy crisis and severe environmental pollution, the photovoltaic (PV) system has become one of the most important renewable energy sources. Many previous studies on solar charger integrated system only focus on load charge control or switching Maximum Power Point Tracking (MPPT) and charge control modes. This study used two-stage system, which allows the overall portable solar energy charging system to implement MPPT and optimal charge control of Li-ion battery simultaneously. First, this study designs a DC/DC boost converter of solar power generation, which uses variable step size incremental conductance method (VSINC) to enable the solar cell to track the maximum power point at any time. The voltage was exported from the DC/DC boost converter to the DC/DC buck converter, so that the voltage dropped to proper voltage for charging the battery. The charging system uses constant current/constant voltage (CC/CV) method to charge the lithium battery. In order to obtain the optimum PI charge controller parameters, this study used intelligent algorithm to determine the optimum parameters. According to the simulation and experimental results, the control parameters resulted from PSO have better performance than genetic algorithms (GAs).

Computer acquired performance data from a chemically vapor-deposited-rhenium, niobium planar diode

NASA Technical Reports Server (NTRS)

Manista, E. J.; Morris, J. F.; Smith, A. L.; Lancashire, R. B.

1973-01-01

Performance data from a chemically vapor-deposited-rhenium, niobium thermionic converter are presented. The planar converter has a guard-ringed collector and a nominal fixed spacing of 0.25 mm (10 mils). The data were obtained by using a computerized acquisition system and are available on request to one of the authors on microfiche as individual and composite parametric current, voltage curves. The parameters are the temperatures of the emitter T sub E collector T sub C, and cesium reservoir T sub R. The composite plots have constant T sub E and varying T sub C or T sub R, or both. Current, voltage envelopes having constant T sub E with and without fixed T sub C appear in the present report. The diode was tested at increments between 1600 and 2000 K for the emitter Hohlraum, 800 to 1100 K for the collector, and 540 and 650 K for the reservoir. A total of 312 current, voltage curves were obtained in the present performance evaluation. Current, voltage envelopes from three rhenium emitter converters evaluated in the present program are also given. The data are compared at commom emitter Hohlraum temperatures.

Electromechanical model to predict the movability of liquids in an electrowetting-on-dielectric microfluidic device

NASA Astrophysics Data System (ADS)

Torabinia, Matin; Farzbod, Ali; Moon, Hyejin

2018-04-01

In electrowetting-on-dielectric (EWOD) microfluidics, a motion of a fluid is created by a voltage applied to the fluid/surface interface. Water and aqueous solutions are the most frequently used fluids in EWOD devices. In order for EWOD microfluidics to be a versatile platform for various applications, however, movability of different types of fluids other than aqueous solutions should be understood. An electromechanical model using a simple RC circuit has been used to predict the mechanical force exerted on a liquid droplet upon voltage application. In this present study, two important features missed in previous works are addressed. Energy dissipation by contact line friction is considered in the new model as the form of resistor. The phase angle is taken into account in the analysis of the AC circuit. The new electromechanical model and computation results are validated with experimental measurements of forces on two different liquids. The model is then used to explain influences of contact angle hysteresis, surface tension, conductivity, and dielectric constant of fluids to the mechanical force on a liquid droplet.

Atomic-layer-deposited Al2O3-HfO2-Al2O3 dielectrics for metal-insulator-metal capacitor applications

NASA Astrophysics Data System (ADS)

Ding, Shi-Jin; Zhu, Chunxiang; Li, Ming-Fu; Zhang, David Wei

2005-08-01

Atomic-layer-deposited Al2O3-HfO2-Al2O3 dielectrics have been investigated to replace conventional silicon oxide and nitride for radio frequency and analog metal-insulator-metal capacitors applications. In the case of 1-nm-Al2O3, sufficiently good electrical performances are achieved, including a high dielectric constant of ˜17, a small dissipation factor of 0.018 at 100kHz, an extremely low leakage current of 7.8×10-9A/cm2 at 1MV/cm and 125°C, perfect voltage coefficients of capacitance (74ppm/V2 and 10ppm/V). The quadratic voltage coefficient of capacitance decreases with the applied frequency due to the change of relaxation time with different carrier mobility in insulator, and correlates with the dielectric composition and thickness, which is of intrinsic property owing to electric field polarization. Furthermore, the conduction mechanism of the AHA dielectrics is also discussed, indicating the Schottky emission dominated at room temperature.

Current driven transition from Abrikosov-Josephson to Josephson-like vortex in mesoscopic lateral S/S’/S superconducting weak links

PubMed Central

Carapella, G.; Sabatino, P.; Barone, C.; Pagano, S.; Gombos, M.

2016-01-01

Vortices are topological defects accounting for many important effects in superconductivity, superfluidity, and magnetism. Here we address the stability of a small number of such excitations driven by strong external forces. We focus on Abrikosov-Josephson vortex that appears in lateral superconducting S/S’/S weak links with suppressed superconductivity in S’. In such a system the vortex is nucleated and confined in the narrow S’ region by means of a small magnetic field and moves under the effect of a force proportional to an applied electrical current with a velocity proportional to the measured voltage. Our numerical simulations show that when a slow moving Abrikosov-Josephson vortex is driven by a strong constant current it becomes unstable with respect to a faster moving excitation: the Josephon-like vortex. Such a current-driven transition explains the structured dissipative branches that we observe in the voltage-current curve of the weak link. When vortex matter is strongly confined phenomena as magnetoresistance oscillations and reentrance of superconductivity can possibly occur. We experimentally observe these phenomena in our weak links. PMID:27752137

Theory of noise equivalent power of a high-temperature superconductor far-infrared bolometer in a photo-thermoelectrical mode of operation

NASA Astrophysics Data System (ADS)

Kaila, M. M.; Russell, G. J.

2000-12-01

We present a theory of noise equivalent power (NEP) and related parameters for a high-temperature superconductor (HTSC) bolometer in which temperature and resistance are the noise sources for open circuit operation and phonon and resistance are the noise sources for voltage-biased operation of the bolometer. The bolometer is designed to use a photo-thermoelectrical mode of operation. A mathematical formulation for the open circuit operation is first presented followed by an analysis of the heterodyne case with a bias applied in constant voltage mode. For the first time electrothermal (ET) and thermoelectrical (TE) feedback are treated in the heat balance equation simultaneously. A parallel resistance geometry consisting of thermoelectric and HTSC material legs has been chosen for the device. Computations for the ET-TE feedback show that the response time improves by three orders of magnitude and the responsivity becomes double for the same TE feedback. In the heat balance equation we have included among the heat transfer processes the temperature dependence of the thermal conductance at the bolometer-substrate interface for the dynamic state.

Micro-fabricated flexible PZT cantilever using d33 mode for energy harvesting

NASA Astrophysics Data System (ADS)

Cho, Hyunok; Park, Jongcheol; Park, Jae Yeong

2017-12-01

This paper presents a micro-fabricated flexible and curled PZT [Pb(Zr0.52Ti0.48)O3] cantilever using d33 piezoelectric mode for vibration based energy harvesting applications. The proposed cantilever based energy harvester consists of polyimide, PZT thin film, and inter-digitated IrOx electrodes. The flexible cantilever was formed using bulk-micromachining on a silicon wafer to integrate it with ICs. The d33 piezoelectric mode was applied to achieve a large output voltage by using inter-digitated electrodes, and the PZT thin film on polyimide layer has a remnant polarization and coercive filed of approximately 2 P r = 47.9 μC/cm2 and 2 E c = 78.8 kV/cm, respectively. The relative dielectric constant was 900. The fabricated micro-electromechanical systems energy harvester generated output voltages of 1.2 V and output power of 117 nW at its optimal resistive load of 6.6 MΩ from its resonant frequency of 97.8 Hz with an acceleration of 5 m/s2.

Galvanic Cells and the Determination of Equilibrium Constants

ERIC Educational Resources Information Center

Brosmer, Jonathan L.; Peters, Dennis G.

2012-01-01

Readily assembled mini-galvanic cells can be employed to compare their observed voltages with those predicted from the Nernst equation and to determine solubility products for silver halides and overall formation constants for metal-ammonia complexes. Results obtained by students in both an honors-level first-year course in general chemistry and…

Development of a tester for evaluation of prototype thermal cells and batteries

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guidotti, R.A.

1994-10-01

A tester was developed to evaluate prototype thermal cells and batteries--especially high-voltage units--under a wide range of constant-current and constant-resistance discharge conditions. Programming of the steady-state and pulsing conditions was by software control or by hardware control via an external pulse generator. The tester was assembled from primarily Hewlett-Packard (H-P) instrumentation and was operated under H-P`s Rocky Mountain Basic (RMB). Constant-current electronic loads rated up to 4 kW (400 V at up to 100 A) were successfully used with the setup. For testing under constant-resistance conditions, power metal-oxide field-effect transistors (MOSFETs) controlled by a programmable pulse generator were used tomore » switch between steady-state and pulse loads. The pulses were digitized at up to a 50 kHz rate (20 {mu} s/pt) using high-speed DVMs; steady-state voltages were monitored with standard DVMs. This paper describes several of the test configurations used and discusses the limitations of each. Representative data are presented for a number of the test conditions.« less

Constant Switching Frequency DTC for Matrix Converter Fed Speed Sensorless Induction Motor Drive

NASA Astrophysics Data System (ADS)

Mir, Tabish Nazir; Singh, Bhim; Bhat, Abdul Hamid

2018-05-01

The paper presents a constant switching frequency scheme for speed sensorless Direct Torque Control (DTC) of Matrix Converter fed Induction Motor Drive. The use of matrix converter facilitates improved power quality on input as well as motor side, along with Input Power Factor control, besides eliminating the need for heavy passive elements. Moreover, DTC through Space Vector Modulation helps in achieving a fast control over the torque and flux of the motor, with added benefit of constant switching frequency. A constant switching frequency aids in maintaining desired power quality of AC mains current even at low motor speeds, and simplifies input filter design of the matrix converter, as compared to conventional hysteresis based DTC. Further, stator voltage estimation from sensed input voltage, and subsequent stator (and rotor) flux estimation is done. For speed sensorless operation, a Model Reference Adaptive System is used, which emulates the speed dependent rotor flux equations of the induction motor. The error between conventionally estimated rotor flux (reference model) and the rotor flux estimated through the adaptive observer is processed through PI controller to generate the rotor speed estimate.

Estimating the effects of harmonic voltage fluctuations on the temperature rise of squirrel-cage motors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Emanuel, A.E.

1991-03-01

This article presents a preliminary analysis of the effect of randomly varying harmonic voltages on the temperature rise of squirrel-cage motors. The stochastic process of random variations of harmonic voltages is defined by means of simple statistics (mean, standard deviation, type of distribution). Computational models based on a first-order approximation of the motor losses and on the Monte Carlo method yield results which prove that equipment with large thermal time-constant is capable of withstanding for a short period of time larger distortions than THD = 5%.

Effective screening length of isotropic liquid samples submitted to an applied voltage.

PubMed

Zola, R S; Evangelista, L R; Barbero, G

2006-05-25

A cell of isotropic liquid in the shape of a slab of thickness d and containing ionic impurities is considered. It is shown that the screening effect produced by the ionic charges on the external field is characterized by an effective surface length, lambda(S)(U), depending on the applied voltage U. The analysis indicates that lambda(S)(U)) < lambda(D) when the applied voltage is very large, and lambda(S)(U) --> lambda(D) for very small values of the applied voltage, where lambda(D) is the Debye screening length. The presence of the ions is responsible also for a counterpotential, v, that for small U is such to cancel the effective electric field in the sample, whereas in the opposite limit it is inversely proportional to the applied difference of potential.

Discharging dynamics in an electrolytic cell

NASA Astrophysics Data System (ADS)

Feicht, Sarah E.; Frankel, Alexandra E.; Khair, Aditya S.

2016-07-01

We analyze the dynamics of a discharging electrolytic cell comprised of a binary symmetric electrolyte between two planar, parallel blocking electrodes. When a voltage is initially applied, ions in the electrolyte migrate towards the electrodes, forming electrical double layers. After the system reaches steady state and the external current decays to zero, the applied voltage is switched off and the cell discharges, with the ions eventually returning to a uniform spatial concentration. At voltages on the order of the thermal voltage VT=kBT /q ≃25 mV, where kB is Boltzmann's constant, T is temperature, and q is the charge of a proton, experiments on surfactant-doped nonpolar fluids observe that the temporal evolution of the external current during charging and discharging is not symmetric [V. Novotny and M. A. Hopper, J. Electrochem. Soc. 126, 925 (1979), 10.1149/1.2129195; P. Kornilovitch and Y. Jeon, J. Appl. Phys. 109, 064509 (2011), 10.1063/1.3554445]. In fact, at sufficiently large voltages (several VT), the current during discharging is no longer monotonic: it displays a "reverse peak" before decaying in magnitude to zero. We analyze the dynamics of discharging by solving the Poisson-Nernst-Planck equations governing ion transport via asymptotic and numerical techniques in three regimes. First, in the "linear regime" when the applied voltage V is formally much less than VT, the charging and discharging currents are antisymmetric in time; however, the potential and charge density profiles during charging and discharging are asymmetric. The current evolution is on the R C timescale of the cell, λDL /D , where L is the width of the cell, D is the diffusivity of ions, and λD is the Debye length. Second, in the (experimentally relevant) thin-double-layer limit ɛ =λD/L ≪1 , there is a "weakly nonlinear" regime defined by VT≲V ≲VTln(1 /ɛ ) , where the bulk salt concentration is uniform; thus the R C timescale of the evolution of the current magnitude persists. However, nonlinear, voltage-dependent, capacitance of the double layer is responsible for a break in temporal antisymmetry of the charging and discharging currents. Third, the reverse peak in the discharging current develops in a "strongly nonlinear" regime V ≳VTln(1 /ɛ ) , driven by neutral salt adsorption into the double layers and consequent bulk depletion during charging. The strongly nonlinear regime features current evolution over three timescales. The current decays in magnitude on the double layer relaxation timescale, λD2/D ; then grows exponentially in time towards the reverse peak on the diffusion timescale, L2/D , indicating that the reverse peak is the results of fast diffusion of ions from the double layer layer to the bulk. Following the reverse peak, the current decays exponentially to zero on the R C timescale. Notably, the current at the reverse peak and the time of the reverse peak saturate at large voltages V ≫VTln(1 /ɛ ) . We provide semi-analytic expressions for the saturated reverse peak time and current, which can be used to infer charge carrier diffusivity and concentration from experiments.

A new fast-cycling system for AMS at ANU

NASA Astrophysics Data System (ADS)

De Cesare, M.; Fifield, L. K.; Weisser, D. C.; Tsifakis, D.; Cooper, A.; Lobanov, N. R.; Tunningley, T. B.; Tims, S. G.; Wallner, A.

2015-10-01

In order to perform higher precision measurements, an upgrade of the ANU accelerator is underway. Fast switching times on the low-energy side, with maximum settling times of 30 ms, are achieved by holding the injector magnet field constant while changing the energy of the different isotopes by changing the pre-acceleration voltage after the ion source. Because ions of the different isotopes then have different energies before injection, it is necessary to adjust the strength and steering of the electrostatic quadrupole lens that focusses the beam before entry into the accelerator. First tests of the low-energy system will be reported. At the high energy end, a larger vacuum box in the analyzing magnet has been designed, manufactured and installed to allow the transport of differences in mass as large as 10% at constant terminal voltage. For the cases where more than one isotope must be transported to the detector an additional refinement is necessary. If the accelerator voltage is to be kept constant, then the trajectories of the different isotopes around both the analyzing and switching magnets must be modified. This will be achieved using bounced electrostatic steerers before and after the magnets. Simulations have been performed with the ion optic code COSY Infinity to determine the optimal positions and sizes of these steerers.

Advanced Bode Plot Techniques for Ultrasonic Transducers

NASA Astrophysics Data System (ADS)

DeAngelis, D. A.; Schulze, G. W.

The Bode plot, displayed as either impedance or admittance versus frequency, is the most basic test used by ultrasonic transducer designers. With simplicity and ease-of-use, Bode plots are ideal for baseline comparisons such as spacing of parasitic modes or impedance, but quite often the subtleties that manifest as poor process control are hard to interpret or are nonexistence. In-process testing of transducers is time consuming for quantifying statistical aberrations, and assessments made indirectly via the workpiece are difficult. This research investigates the use of advanced Bode plot techniques to compare ultrasonic transducers with known "good" and known "bad" process performance, with the goal of a-priori process assessment. These advanced techniques expand from the basic constant voltage versus frequency sweep to include constant current and constant velocity interrogated locally on transducer or tool; they also include up and down directional frequency sweeps to quantify hysteresis effects like jumping and dropping phenomena. The investigation focuses solely on the common PZT8 piezoelectric material used with welding transducers for semiconductor wire bonding. Several metrics are investigated such as impedance, displacement/current gain, velocity/current gain, displacement/voltage gain and velocity/voltage gain. The experimental and theoretical research methods include Bode plots, admittance loops, laser vibrometry and coupled-field finite element analysis.

Controllable transition from positive space charge to negative space charge in an inverted cylindrical magnetron

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rane, R., E-mail: ramu@ipr.res.in; Ranjan, M.; Mukherjee, S.

2016-01-15

The combined effect of magnetic field (B), gas pressure (P), and the corresponding discharge voltage on the discharge properties of argon in inverted cylindrical magnetron has been investigated. In the experiment, anode is biased with continuous 10 ms sinusoidal half wave. It is observed that at a comparatively higher magnetic field (i.e., >200 gauss) and lower operating pressure (i.e., <1 × 10{sup −3} mbar), the discharge extinguishes and demands a high voltage to reignite. Discharge current increases with increase in magnetic field and starts reducing at sufficiently higher magnetic field for a particular discharge voltage due to restricted electron diffusion towards the anode.more » It is observed that B/P ratio plays an important role in sustaining the discharge and is constant for a discharge voltage. The discharge is transformed to negative space charge regime from positive space charge regime at certain B/P ratio and this ratio varies linearly with the discharge voltage. The space charge reversal is indicated by the radial profile of the floating potential and plasma potential in between two electrodes for different magnetic fields. At a particular higher magnetic field (beyond 100 gauss), the floating potential increases gradually with the radial distance from cathode, whereas it remains almost constant at lower magnetic field.« less

The protein kinase C inhibitor, bisindolylmaleimide (I), inhibits voltage-dependent K+ channels in coronary arterial smooth muscle cells.

PubMed

Park, Won Sun; Son, Youn Kyoung; Ko, Eun A; Ko, Jae-Hong; Lee, Hyang Ae; Park, Kyoung Sun; Earm, Yung E

2005-06-17

We examined the effects of the protein kinase C (PKC) inhibitor, bisindolylmaleimide (BIM) (I), on voltage-dependent K+ (K(V)) channels in rabbit coronary arterial smooth muscle cells using whole-cell patch clamp technique. BIM (I) reversibly and dose-dependently inhibited the K(V) currents with an apparent Kd value of 0.27 microM. The inhibition of the K(V) current by BIM (I) was highly voltage-dependent between -30 and +10 mV (voltage range of channel activation), and the additive inhibition of the K(V) current by BIM (I) was voltage-dependence in the full activation voltage range. The rate constants of association and dissociation for BIM (I) were 18.4 microM(-1) s(-1) and 4.7 s(-1), respectively. BIM (I) had no effect on the steady-state activation and inactivation of K(V) channels. BIM (I) caused use-dependent inhibition of K(V) current, which was consistent with the slow recovery from inactivation in the presence of BIM (I) (recovery time constants were 856.95 +/- 282.6 ms for control, and 1806.38 +/- 110.0 ms for 300 nM BIM (I)). ATP-sensitive K+ (K(ATP)), inward rectifier K+ (K(IR)), Ca2+-activated K+ (BK(Ca)) channels, which regulate the membrane potential and arterial tone, were not affected by BIM (I). The PKC inhibitor, chelerythrine, and protein kinase A (PKA) inhibitor, PKA-IP, had little effect on the K(V) current and did not significantly alter the inhibitory effects of BIM (I) on the K(V) current. These results suggest that BIM (I) inhibits K(V) channels in a phosphorylation-independent, and voltage-, time- and use-dependent manner.

Parameter estimation of extended free-burning electric arc within 1 kA

NASA Astrophysics Data System (ADS)

Sun, Qiuqin; Liu, Hao; Wang, Feng; Chen, She; Zhai, Yujia

2018-05-01

A long electric arc, as a common phenomenon in the power system, not only damages the electrical equipment but also threatens the safety of the system. In this work, a series of tests on a long electric arc in free air have been conducted. The arc voltage and current data were obtained, and the arc trajectories were captured using a high speed camera. The arc images were digitally processed by means of edge detection, and the length is formulated and achieved. Based on the experimental data, the characteristics of the long arc are discussed. It shows that the arc voltage waveform is close to the square wave with high-frequency components, whereas the current is almost sinusoidal. As the arc length elongates, the arc voltage and the resistance increase sharply. The arc takes a spiral shape with the effect of magnetic forces. The arc length will shorten briefly with the occurrence of the short-circuit phenomenon. Based on the classical Mayr model, the parameters of the long electric arc, including voltage gradient and time constant, with different lengths and current amplitudes are estimated using the linear least-square method. To reduce the computational error, segmentation interpolation is also employed. The results show that the voltage gradient of the long arc is mainly determined by the current amplitude but almost independent of the arc length. However, the time constant is jointly governed by these two variables. The voltage gradient of the arc with the current amplitude at 200-800 A is in the range of 3.9 V/cm-20 V/cm, and the voltage gradient decreases with the increase in current.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bean, Bruce Palmer

The effects of ether and halothane on membrane currents in the voltage clamped crayfish giant axon membrane were investigated. Concentrations of ether up to 300 mM and of halothane up to 32 mM had no effect on resting potential or leakage conductance. Ether and halothane reduced the size of sodium currents without changing the voltage dependence of the peak currents or their reversal potential. Ether and halothane also produced a reversible, dose-dependent speeding of sodium current decay at all membrane potentials. Ether reduced the time constants for inactivation, and also shifted the midpoint of the steady-state inactivation curve in themore » hyperpolarizing direction. Potassium currents were smaller with ether present, with no change in the voltage dependence of steady-state currents. The activation of potassium channels was faster with ether present. There was no apparent change in the capacitance of the crayfish giant axon membrane with ether concentrations of up to 100 mM. Experiments on sodium channel inactivation kinetics were performed using 4-aminopyridine to block potassium currents. Sodium currents decayed with a time course generally fit well by a single exponential. The time constant of decay was a steep function of voltage, especially in the negative resistance region of the peak current vs voltage relation.The time course of inactivation was very similar to that of the decay of the current at the same potential. The measurement of steady-state inactivation curves with different test pulses showed no shifts along the voltage asix. The voltage-dependence of the integral of sodium conductance was measured to test models of sodium channel inactivation in which channels must open before inactivating; the results appear inconsistent with some of the simplest cases of such models.« less

An optical fiber Bragg grating and piezoelectric ceramic voltage sensor

NASA Astrophysics Data System (ADS)

Yang, Qing; He, Yanxiao; Sun, Shangpeng; Luo, Mandan; Han, Rui

2017-10-01

Voltage measurement is essential in many fields like power grids, telecommunications, metallurgy, railways, and oil production. A voltage-sensing unit, consisting of fiber Bragg gratings (FBGs) and piezoelectric ceramics, based on which an optical over-voltage sensor was proposed and fabricated in this paper. No demodulation devices like spectrometer or Fabry-Perot filter were needed to gain the voltage signal, and a relatively large sensing frequency range was acquired in this paper; thus, the cost of the sensing system is more acceptable in engineering application. The voltage to be measured was directly applied to the piezoelectric ceramic, and deformation of the ceramics and the grating would be caused because of the inverse piezoelectric effect. With a reference grating, the output light intensity change will be caused by the FBG center wavelength change; thus, the relationship between the applied voltage and the output light intensity was established. Validation of the sensor was accomplished in the frequency range from 50 Hz to 20 kHz and switching impulse waves with a test platform; good linearity of the input-output characteristic was achieved. A temperature validation test was completed, showing that the sensor maintains good temperature stability. Experimental results show that the optical over-voltage sensor can be used for voltage monitoring, and if applied with a voltage divider, the sensor can be used to measure high voltage.

An optical fiber Bragg grating and piezoelectric ceramic voltage sensor.

PubMed

Yang, Qing; He, Yanxiao; Sun, Shangpeng; Luo, Mandan; Han, Rui

2017-10-01

Voltage measurement is essential in many fields like power grids, telecommunications, metallurgy, railways, and oil production. A voltage-sensing unit, consisting of fiber Bragg gratings (FBGs) and piezoelectric ceramics, based on which an optical over-voltage sensor was proposed and fabricated in this paper. No demodulation devices like spectrometer or Fabry-Perot filter were needed to gain the voltage signal, and a relatively large sensing frequency range was acquired in this paper; thus, the cost of the sensing system is more acceptable in engineering application. The voltage to be measured was directly applied to the piezoelectric ceramic, and deformation of the ceramics and the grating would be caused because of the inverse piezoelectric effect. With a reference grating, the output light intensity change will be caused by the FBG center wavelength change; thus, the relationship between the applied voltage and the output light intensity was established. Validation of the sensor was accomplished in the frequency range from 50 Hz to 20 kHz and switching impulse waves with a test platform; good linearity of the input-output characteristic was achieved. A temperature validation test was completed, showing that the sensor maintains good temperature stability. Experimental results show that the optical over-voltage sensor can be used for voltage monitoring, and if applied with a voltage divider, the sensor can be used to measure high voltage.

Analysis of pre-flight modulator voltage calibration data for the Voyager plasma science experiment

NASA Technical Reports Server (NTRS)

Nastov, Ognen

1988-01-01

The Voyager Plasma Science (PLS) modulator calibration (MVM) data analysis was undertaken in order to check the correctness of the fast A/D converter formulas that connect low voltage monitor signals (MV) with digital outputs (DN), to determine the proportionality constants between the actual modulator grid potential (V) and the monitor voltage (MV), and to establish an algorithm to link the digitized readouts (DN) with the actual grid potential (V). The analysis results are surprising in that the derived conversion constants deviate by fairly significant amounts from their nominal values. However, it must be kept in mind that the test results which were used for analysis may be very imprecise. Even if it is assumed that the test result errors are very large, they do no appear to be capable to account for all discrepancies between the theoretical expectations and the results of the analysis. Measurements with the flight spare instrument appear to be the only means of investigating these effects further.

A Constant Energy-Per-Cycle Ring Oscillator Over a Wide Frequency Range for Wireless Sensor Nodes

PubMed Central

Lee, Inhee; Sylvester, Dennis; Blaauw, David

2016-01-01

This paper presents an energy-efficient oscillator for wireless sensor nodes (WSNs). It avoids short-circuit current by minimizing the time spent in the input voltage range from Vthn to [Vdd − |Vthp|]. A current-feeding scheme with gate voltage control enables the oscillator to operate over a wide frequency range. A test chip is fabricated in a 0.18 μm CMOS process. The measurements show that the proposed oscillator achieves a constant energy-per-cycle (EpC) of 0.8 pJ/cycle over the 21–60 MHz frequency range and is more efficient than a conventional current-starved ring oscillator (CSRO) below 300 kHz at 1.8 V supply voltage. As an application example, the proposed oscillator is implemented in a switched-capacitor DC–DC converter. The converter is 11%–56% more efficient for load power values ranging from 583 pW to 2.9 nW than a converter using a conventional CSRO. PMID:27546899

A Constant Energy-Per-Cycle Ring Oscillator Over a Wide Frequency Range for Wireless Sensor Nodes.

PubMed

Lee, Inhee; Sylvester, Dennis; Blaauw, David

2016-03-01

This paper presents an energy-efficient oscillator for wireless sensor nodes (WSNs). It avoids short-circuit current by minimizing the time spent in the input voltage range from V thn to [ V dd - | V thp |]. A current-feeding scheme with gate voltage control enables the oscillator to operate over a wide frequency range. A test chip is fabricated in a 0.18 μm CMOS process. The measurements show that the proposed oscillator achieves a constant energy-per-cycle (EpC) of 0.8 pJ/cycle over the 21-60 MHz frequency range and is more efficient than a conventional current-starved ring oscillator (CSRO) below 300 kHz at 1.8 V supply voltage. As an application example, the proposed oscillator is implemented in a switched-capacitor DC-DC converter. The converter is 11%-56% more efficient for load power values ranging from 583 pW to 2.9 nW than a converter using a conventional CSRO.

Study on Control Scheme for the Inverters in Low Voltage Microgrid with Nonlinear Loads

NASA Astrophysics Data System (ADS)

Xu, Jiqiang; Lu, Wenzhou; Wu, Lei

2017-05-01

There are a lot of nonlinear loads in real low voltage microgrid system. It will cause serious output voltage and grid current harmonic distortions problems in island and grid-connected modes, respectively. To solve this problem, this paper proposes a droop control scheme with quasi-proportion and resonant (quasi-PR) controller based on αβ stationary reference frame to make microgrid smoothly switch between grid-connected and island modes without changing control method. Moreover, in island mode, not only stable output voltage and frequency, but also reduced output voltage harmonics with added nonlinear loads can be achieved; In grid-connected mode, not only constant power, but also reduced grid current harmonics can be achieved. Simulation results verify the effectiveness of the proposed control scheme.

The Electrolytic Effect on the Catalytic Degradation of Dye and Nitrate Ion by New Ceramic Beads of Natural Minerals and TiO2

NASA Astrophysics Data System (ADS)

Sata, Akiyoshi; Sakai, Takako; Goto, Yusuke; Ohta, Toshiyuki; Hayakawa, Katumitu

2007-05-01

We have developed a new hybrid ceramic material "Taiyo" as a water processing catalyst. The porous ceramic has a core-shell structure. It decolorized completely the dye solutions as well as the wastewater output after primary water processing by microorganism in a pig farm. This new material showed the acceleration of water purification by applying electric voltage. The degradation of dyes and pig urine output from the primary treatments was accelerated by applying voltage. Nitrate in underground water was also decomposed only by applying voltage, while it was not decomposed without voltage.

A Study on the Effect of Electrodeposition Parameters on the Morphology of Porous Nickel Electrodeposits

NASA Astrophysics Data System (ADS)

Sengupta, Srijan; Patra, Arghya; Jena, Sambedan; Das, Karabi; Das, Siddhartha

2018-03-01

In this study, the electrodeposition of nickel foam by dynamic hydrogen bubble-template method is optimized, and the effects of key deposition parameters (applied voltage and deposition time) and bath composition (concentration of Ni2+, pH of the bath, and roles of Cl- and SO4 2- ions) on pore size, distribution, and morphology and crystal structure are studied. Nickel deposit from 0.1 M NiCl2 bath concentration is able to produce the honeycomb-like structure with regular-sized holes. Honeycomb-like structure with cauliflower morphology is deposited at higher applied voltages of 7, 8, and 9 V; and a critical time (>3 minutes) is required for the development of the foamy structure. Compressive residual stresses are developed in the porous electrodeposits after 30 seconds of deposition time (-189.0 MPa), and the nature of the residual stress remains compressive upto 10 minutes of deposition time (-1098.6 MPa). Effect of pH is more pronounced in a chloride bath compared with a sulfate bath. The increasing nature of pore size in nickel electrodeposits plated from a chloride bath (varying from 21 to 48 μm), and the constant pore size (in the range of 22 to 24 μm) in deposits plated from a sulfate bath, can be ascribed to the striking difference in the magnitude of the corresponding current-time profiles.

Ion manipulation device to prevent loss of ions

DOEpatents

Tolmachev, Aleksey; Smith, Richard D; Ibrahim, Yehia M; Anderson, Gordon A; Baker, Erin M

2015-03-03

An ion manipulation method and device to prevent loss of ions is disclosed. The device includes a pair of surfaces. An inner array of electrodes is coupled to the surfaces. A RF voltage and a DC voltage are alternately applied to the inner array of electrodes. The applied RF voltage is alternately positive and negative so that immediately adjacent or nearest neighbor RF applied electrodes are supplied with RF signals that are approximately 180 degrees out of phase.

Effect of applied voltage on surface properties of anodised titanium in mixture of β-glycerophosphate (β-GP) and calcium acetate (CA)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chuan, Lee Te, E-mail: gd130079@siswa.uthm.edu.my; Rathi, Muhammad Fareez Mohamad, E-mail: cd110238@siswa.uthm.edu.my; Abidin, Muhamad Yusuf Zainal, E-mail: cd110221@siswa.uthm.edu.my

Anodic oxidation is a surface modification method which combines electric field driven metal and oxygen ion diffusion for formation of oxide layer on the anode surface. This method has been widely used to modify the surface morphology of biomaterial especially titanium. This study aimed to investigate the effect of applied voltage on titanium. Specifically, the titanium foil was anodised in mixture of β-glycerophosphate disodium salt pentahydrate (β-GP) and calcium acetate monohydrate (CA) with different applied voltage (50-350 V), electrolyte concentration (0.04 M β-GP + 0.4 M CA), anodising time (10minutes) and current density (50 and 70 mA.cm{sup −2}) at room temperature. Surfacemore » oxide properties of anodised titanium were characterised by digital single-lens reflex camera (DSLR camera), field emission scanning electron microscope (FESEM) and atomic force microscopy (AFM). At lower applied voltage (≤150 V), surface of titanium foils were relatively smooth. With increasing applied voltage (≥250 V), the oxide layer became more porous and donut-shaped pores were formed on the surface of titanium foils. The AFM results indicated that the surface roughness of anodised titanium increases with increasing of applied voltage. The porous and rough surface is able to promote the osseointegration and reduce the suffering time of patient.« less

Absolute Determination of High DC Voltages by Means of Frequency Measurement

NASA Astrophysics Data System (ADS)

Peier, Dirk; Schulz, Bernd

1983-01-01

A novel absolute measuring procedure is presented for the definition of fixed points of the voltage in the 100 kV range. The method is based on transit time measurements with accelerated electrons. By utilizing the selective interaction of a monoenergetic electron beam with the electromagnetic field of a special cavity resonator, the voltage is referred to fundamental constants and the base unit second. Possible balance voltages are indicated by a current detector. Experimental investigations are carried out with resonators in the normal conducting range. With a copper resonator operating at the temperature of boiling nitrogen (77 K), the relative uncertainty of the voltage points is estimated to be +/- 4 × 10-4. The technically realizable uncertainty can be reduced to +/- 1 × 10-5 by the proposed application of a superconducting niobium resonator. Thus this measuring device becomes suitable as a primary standard for the high-voltage range.

Load insensitive electrical device. [power converters for supplying direct current at one voltage from a source at another voltage

NASA Technical Reports Server (NTRS)

Schwarz, F. C. (Inventor)

1974-01-01

A class of power converters is described for supplying direct current at one voltage from a source at another voltage. It includes a simple passive circuit arrangement of solid-state switches, inductors, and capacitors by which the output voltage of the converter tends to remain constant in spite of changes in load. The switches are sensitive to the current flowing in the circuit and are employed to permit the charging of capacitance devices in accordance with the load requirements. Because solid-state switches (such as SCR's) may be used with relatively high voltage and because of the inherent efficiency of the invention that permits relatively high switching frequencies, power supplies built in accordance with the invention, together with their associated cabling, can be substantially lighter in weight for a given output power level and efficiency of operation than systems of the prior art.

Interactions of high-affinity cationic blockers with the translocation pores of B. anthracis, C. botulinum, and C. perfringens binary toxins.

PubMed

Bezrukov, Sergey M; Liu, Xian; Karginov, Vladimir A; Wein, Alexander N; Leppla, Stephen H; Popoff, Michel R; Barth, Holger; Nestorovich, Ekaterina M

2012-09-19

Cationic β-cyclodextrin derivatives were recently introduced as highly effective, potentially universal blockers of three binary bacterial toxins: anthrax toxin of Bacillus anthracis, C2 toxin of Clostridium botulinum, and iota toxin of Clostridium perfringens. The binary toxins are made of two separate components: the enzymatic A component, which acts on certain intracellular targets, and the binding/translocation B component, which forms oligomeric channels in the target cell membrane. Here we studied the voltage and salt dependence of the rate constants of binding and dissociation reactions of two structurally different β-cyclodextrins (AmPrβCD and AMBnTβCD) in the PA(63), C2IIa, and Ib channels (B components of anthrax, C2, and iota toxins, respectively). With all three channels, the blocker carrying extra hydrophobic aromatic groups on the thio-alkyl linkers of positively charged amino groups, AMBnTβCD, demonstrated significantly stronger binding compared with AmPrβCD. This effect is seen as an increased residence time of the blocker in the channels, whereas the time between blockages characterizing the binding reaction on-rate stays practically unchanged. Surprisingly, the voltage sensitivity, expressed as a slope of the logarithm of the blocker residence time as a function of voltage, turned out to be practically the same for all six cases studied, suggesting structural similarities among the three channels. Also, the more-effective AMBnTβCD blocker shows weaker salt dependence of the binding and dissociation rate constants compared with AmPrβCD. By estimating the relative contributions of the applied transmembrane field, long-range Coulomb, and salt-concentration-independent, short-range forces, we found that the latter represent the leading interaction, which accounts for the high efficiency of blockage. In a search for the putative groups in the channel lumen that are responsible for the short-range forces, we performed measurements with the F427A mutant of PA(63), which lacks the functionally important phenylalanine clamp. We found that the on-rates of the blockage were virtually conserved, but the residence times and, correspondingly, the binding constants dropped by more than an order of magnitude, which also reduced the difference between the efficiencies of the two blockers. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Synthesis and properties of hydroxyapatite-containing coating on AZ31 magnesium alloy by micro-arc oxidation

NASA Astrophysics Data System (ADS)

Tang, Hui; Han, Yu; Wu, Tao; Tao, Wei; Jian, Xian; Wu, Yunfeng; Xu, Fangjun

2017-04-01

In this study, hydroxyapatite-containing coatings were prepared by microarc oxidation on AZ31 magnesium alloy surface to improve its biodegradation performance. Five applied voltages were chosen to prepare the MAO coatings. The results demonstrate that the number of micropores in the films increases but their dimensions decrease after higher voltage is applied. As the surface roughness of the MAO coatings increases with the applied voltage, the wettability of the coatings improves continuously. The MAO coatings were mainly composed of magnesium oxide (MgO) and hydroxyapatite. The amount of hydroxyapatite phase increased with increasing voltage that was applied. The bonding strength became slightly weaker after a higher voltage was applied. But the bonding strengths of all the coatings were consistently higher than 37 MPa, which met the requirement of implant biomaterials. All coatings exhibited higher corrosion resistances and lower hydrogen evolution rate than the bare AZ31 Mg substrate, implying that the degradation rate of the AZ31 Mg alloy was enhanced by the hydroxyapatite-containing coatings. The results indicate that the present treatment of applying hydroxyapatite-containing coatings is a promising technique for the degradable Mg-based biomaterials for orthopedic applications.

Reactive power and voltage control strategy based on dynamic and adaptive segment for DG inverter

NASA Astrophysics Data System (ADS)

Zhai, Jianwei; Lin, Xiaoming; Zhang, Yongjun

2018-03-01

The inverter of distributed generation (DG) can support reactive power to help solve the problem of out-of-limit voltage in active distribution network (ADN). Therefore, a reactive voltage control strategy based on dynamic and adaptive segment for DG inverter is put forward to actively control voltage in this paper. The proposed strategy adjusts the segmented voltage threshold of Q(U) droop curve dynamically and adaptively according to the voltage of grid-connected point and the power direction of adjacent downstream line. And then the reactive power reference of DG inverter can be got through modified Q(U) control strategy. The reactive power of inverter is controlled to trace the reference value. The proposed control strategy can not only control the local voltage of grid-connected point but also help to maintain voltage within qualified range considering the terminal voltage of distribution feeder and the reactive support for adjacent downstream DG. The scheme using the proposed strategy is compared with the scheme without the reactive support of DG inverter and the scheme using the Q(U) control strategy with constant segmented voltage threshold. The simulation results suggest that the proposed method has a significant improvement on solving the problem of out-of-limit voltage, restraining voltage variation and improving voltage quality.

Efficiency Analysis of a High-Specific Impulse Hall Thruster

NASA Technical Reports Server (NTRS)

Jacobson, David (Technical Monitor); Hofer, Richard R.; Gallimore, Alec D.

2004-01-01

Performance and plasma measurements of the high-specific impulse NASA-173Mv2 Hall thruster were analyzed using a phenomenological performance model that accounts for a partially-ionized plasma containing multiply-charged ions. Between discharge voltages of 300 to 900 V, the results showed that although the net decrease of efficiency due to multiply-charged ions was only 1.5 to 3.0 percent, the effects of multiply-charged ions on the ion and electron currents could not be neglected. Between 300 to 900 V, the increase of the discharge current was attributed to the increasing fraction of multiply-charged ions, while the maximum deviation of the electron current from its average value was only +5/-14 percent. These findings revealed how efficient operation at high-specific impulse was enabled through the regulation of the electron current with the applied magnetic field. Between 300 to 900 V, the voltage utilization ranged from 89 to 97 percent, the mass utilization from 86 to 90 percent, and the current utilization from 77 to 81 percent. Therefore, the anode efficiency was largely determined by the current utilization. The electron Hall parameter was nearly constant with voltage, decreasing from an average of 210 at 300 V to an average of 160 between 400 to 900 V. These results confirmed our claim that efficient operation can be achieved only over a limited range of Hall parameters.

ELECTRONIC MULTIPLIER CIRCUIT

DOEpatents

Thomas, R.E.

1959-08-25

An electronic multiplier circuit is described in which an output voltage having an amplitude proportional to the product or quotient of the input signals is accomplished in a novel manner which facilitates simplicity of circuit construction and a high degree of accuracy in accomplishing the multiplying and dividing function. The circuit broadly comprises a multiplier tube in which the plate current is proportional to the voltage applied to a first control grid multiplied by the difference between voltage applied to a second control grid and the voltage applied to the first control grid. Means are provided to apply a first signal to be multiplied to the first control grid together with means for applying the sum of the first signal to be multiplied and a second signal to be multiplied to the second control grid whereby the plate current of the multiplier tube is proportional to the product of the first and second signals to be multiplied.

Effect of a longitudinally applied voltage upon the growth of Zea mays seedlings

NASA Technical Reports Server (NTRS)

Desrosiers, M. F.; Bandurski, R. S.

1988-01-01

The electrical parameters that affect young seedling growth were investigated. Voltages ranging from 5 to 40 volts were applied longitudinally along the mesocotyl region of 4-day old Zea mays L. (cv Silver Queen) seedlings for periods of 3 or 4 hours. It was determined that: (a) making the tips of the seedlings electrically positive relative to the base strongly inhibited shoot growth at 5 volts, whereas the reverse polarity had no effect; (b) at higher voltages, making the tip of the seedlings negative caused less growth inhibition than the reverse polarity at each voltage level; (c) the higher the applied voltage the greater the degree of inhibition; and, (d) the more growth inhibition experienced by the plants the poorer, and slower, their recovery. Previous observations of a relationship between the amount of free indole-3-acetic acid in the mesocotyl cortex and the growth rate of the mesocotyl and of gravitropism-induced movement of labeled indole-3-acetic acid from the seed to the shoot lead to the prediction of a voltage-dependent gating of the movement of indole-3-acetic acid from the stele to the cortex. This provided the basis for attempting to alter the growth rate of seedlings by means of an applied voltage.

Effect of a longitudinally applied voltage upon the growth of Zea mays seedlings.

PubMed

Desrosiers, M F; Bandurski, R S

1988-01-01

The electrical parameters that affect young seedling growth were investigated. Voltages ranging from 5 to 40 volts were applied longitudinally along the mesocotyl region of 4-day old Zea mays L. (cv Silver Queen) seedlings for periods of 3 or 4 hours. It was determined that: (a) making the tips of the seedlings electrically positive relative to the base strongly inhibited shoot growth at 5 volts, whereas the reverse polarity had no effect; (b) at higher voltages, making the tip of the seedlings negative caused less growth inhibition than the reverse polarity at each voltage level; (c) the higher the applied voltage the greater the degree of inhibition; and, (d) the more growth inhibition experienced by the plants the poorer, and slower, their recovery. Previous observations of a relationship between the amount of free indole-3-acetic acid in the mesocotyl cortex and the growth rate of the mesocotyl and of gravitropism-induced movement of labeled indole-3-acetic acid from the seed to the shoot lead to the prediction of a voltage-dependent gating of the movement of indole-3-acetic acid from the stele to the cortex. This provided the basis for attempting to alter the growth rate of seedlings by means of an applied voltage.

Effect of a Longitudinally Applied Voltage Upon the Growth of Zea mays Seedlings 1

PubMed Central

Desrosiers, Mark F.; Bandurski, Robert S.

1988-01-01

The electrical parameters that affect young seedling growth were investigated. Voltages ranging from 5 to 40 volts were applied longitudinally along the mesocotyl region of 4-day old Zea mays L. (cv Silver Queen) seedlings for periods of 3 or 4 hours. It was determined that: (a) making the tips of the seedlings electrically positive relative to the base strongly inhibited shoot growth at 5 volts, whereas the reverse polarity had no effect; (b) at higher voltages, making the tip of the seedlings negative caused less growth inhibition than the reverse polarity at each voltage level; (c) the higher the applied voltage the greater the degree of inhibition; and, (d) the more growth inhibition experienced by the plants the poorer, and slower, their recovery. Previous observations of a relationship between the amount of free indole-3-acetic acid in the mesocotyl cortex and the growth rate of the mesocotyl and of gravitropism-induced movement of labeled indole-3-acetic acid from the seed to the shoot lead to the prediction of a voltage-dependent gating of the movement of indole-3-acetic acid from the stele to the cortex. This provided the basis for attempting to alter the growth rate of seedlings by means of an applied voltage. Images Fig. 1 PMID:11537877

Components of gating charge movement and S4 voltage-sensor exposure during activation of hERG channels.

PubMed

Wang, Zhuren; Dou, Ying; Goodchild, Samuel J; Es-Salah-Lamoureux, Zeineb; Fedida, David

2013-04-01

The human ether-á-go-go-related gene (hERG) K(+) channel encodes the pore-forming α subunit of the rapid delayed rectifier current, IKr, and has unique activation gating kinetics, in that the α subunit of the channel activates and deactivates very slowly, which focuses the role of IKr current to a critical period during action potential repolarization in the heart. Despite its physiological importance, fundamental mechanistic properties of hERG channel activation gating remain unclear, including how voltage-sensor movement rate limits pore opening. Here, we study this directly by recording voltage-sensor domain currents in mammalian cells for the first time and measuring the rates of voltage-sensor modification by [2-(trimethylammonium)ethyl] methanethiosulfonate chloride (MTSET). Gating currents recorded from hERG channels expressed in mammalian tsA201 cells using low resistance pipettes show two charge systems, defined as Q(1) and Q(2), with V(1/2)'s of -55.7 (equivalent charge, z = 1.60) and -54.2 mV (z = 1.30), respectively, with the Q(2) charge system carrying approximately two thirds of the overall gating charge. The time constants for charge movement at 0 mV were 2.5 and 36.2 ms for Q(1) and Q(2), decreasing to 4.3 ms for Q(2) at +60 mV, an order of magnitude faster than the time constants of ionic current appearance at these potentials. The voltage and time dependence of Q2 movement closely correlated with the rate of MTSET modification of I521C in the outermost region of the S4 segment, which had a V(1/2) of -64 mV and time constants of 36 ± 8.5 ms and 11.6 ± 6.3 ms at 0 and +60 mV, respectively. Modeling of Q(1) and Q(2) charge systems showed that a minimal scheme of three transitions is sufficient to account for the experimental findings. These data point to activation steps further downstream of voltage-sensor movement that provide the major delays to pore opening in hERG channels.

A novel electro-driven membrane for removal of chromium ions using polymer inclusion membrane under constant D.C. electric current.

PubMed

Kaya, Ahmet; Onac, Canan; Alpoguz, H Korkmaz

2016-11-05

In this study, the use of polymer inclusion membrane under constant electric current for the removal of Cr(VI) from water has investigated for the first time. Transport of Cr(VI) is performed by an electric current from the donor phase to the acceptor phase with a constant electric current of 0.5A. The optimized membrane includes of 12.1% 2-nitrophenyl octyl ether (2-NPOE), 77.6% cellulose triacetate (CTA), 10.3% tricapryl-methylammonium chloride (Aliquat 336) as a carrier. We tested the applicability of the selected membrane for Cr(VI) removal in real environmental water samples and evaluated its reusability. Electro membrane experiments were carried out under various parameters, such as the effect of electro membrane voltage at constant DC electric current; electro membrane current at constant voltage, acceptor phase pH, and stable electro membrane; and a comparison of polymer inclusion membrane and electro membrane transport studies. The Cr(VI) transport was achieved 98.33% after 40min under optimized conditions. An alternative method has been employed that eliminates the changing of electrical current by the application of constant electric current for higher reproducibility of electro membrane extraction experiments by combining the excellent selective and long-term use features of polymer inclusion membrane. Copyright © 2016 Elsevier B.V. All rights reserved.

The Effect of Electrokinetic Controlled Wettability on Externally Measured Pressures for a Micro-Fluidic Channel

NASA Astrophysics Data System (ADS)

Zhou, X.; Nolte, D. D.; Pyrak-Nolte, L. J.

2017-12-01

The hysteretic relationship between capillary pressure (Pc) on saturation (S) has been shown to be a projection of a higher-dimensional surface that depends on interfacial area per volume (IAV) as the additional state variable. Most studies that validate the capillary-pressure-saturation-IAV relationship are performed on 2D micro-models or cores where scanning is performed in pressure and not in saturation. We have developed an EWOD technique (electro-wetting on dielectric) to internally manipulate fluid saturation to determine the effect on externally measured pressures. Applying electric fields to electrolytic fluids changes the contact angle among the fluids and the solid. For a parallel-plate electro-wetting set-up, the pressure difference is given by gsl (cosq'EW - cosqEW )/d', where d' is the aperture, qEQ and q'EW are the contact angles before and after the application of voltage, V, and gsl is the interfacial tension between the solid and liquid phases. This pressure difference enables direct control over internal fluid distributions. The contact angle reverts to the original value when V = 0. A sealed micro-model with Electro-Wetting on Dielectric (EWOD) electrodes was fabricated using a PDMS wedge-shaped channel with an entrance width of 1 mm and an exit width of 2 mm. The channel length was 2 mm, and had a depth of 0.9 mm. The PDMS channel was attached to an aluminum plate that served as the ground electrode. An ITO slide coated with PDMS formed the high voltage electrode and was used to seal the micro-model. X-ray Micro-CT scans showed that the contact angle between electrodes changes from from 110˚ (non-wetting) to 70˚ (wetting) for an applied voltage of 318 V AC. By applying voltage to the wedge-shaped micromodel, with the inlet and the outlet opened to the atmosphere, the externally measured capillary pressure remained constant even though the fluid-air interface moved and the saturation increased. For a closed system, the externally measured change in capillary pressure was 30 Pa and the saturation in the channel increased. EWOD provides method to assess the contributions of wettability to the fundamental physics of immiscible fluids in analog porous media. Acknowledgment: This research was supported by the National Science Foundation (1314663-EAR).

Collection of ultrafine diesel particulate matter (DPM) in cylindrical single-stage wet electrostatic precipitators.

PubMed

Saiyasitpanich, Phirun; Keener, Tim C; Lu, Mingming; Khang, Soon-Jai; Evans, Douglas E

2006-12-15

Long-term exposures to diesel particulate matter (DPM) emissions are linked to increasing adverse human health effects due to the potential association of DPM with carcinogenicity. Current diesel vehicular particulate emission regulations are based solely upon total mass concentration, albeit it is the submicrometer particles that are highly respirable and the most detrimental to human health. In this study, experiments were performed with a tubular single-stage wet electrostatic precipitator (wESP) to evaluate its performance for the removal of number-based DPM emissions. A nonroad diesel generator utilizing a low sulfur diesel fuel (500 ppmw) operating under varying load conditions was used as a stationary DPM emission source. An electrical low-pressure impactor (ELPI) was used to quantify the number concentration distributions of diesel particles in the diluted exhaust gas at each tested condition. The wESP was evaluated with respect to different operational control parameters such as applied voltage, gas residence time, etc., to determine their effect on overall collection efficiency, as well as particle size dependent collection efficiency. The results show that the total DPM number concentrations in the untreated diesel exhaust are in the magnitude of approximately108/cm(3) at all engine loads with the particle diameter modes between 20 and 40 nm. The measured collection efficiency of the wESP operating at 70 kV based on total particle numbers was 86% at 0 kW engine load and the efficiency decreased to 67% at 75 kW due to a decrease in gas residence time and an increase in particle concentrations. At a constant wESP voltage of 70 kV and at 75 kW engine load, the variation of gas residence time within the wESP from approximately 0.1 to approximately 0.4 s led to a substantial increase in the collection efficiency from 67% to 96%. In addition, collection efficiency was found to be directly related to the applied voltage, with increasing collection efficiency measured for increases in applied voltage. The collection efficiency based on particle size had a minimum for sizes between 20 and 50 nm, but at optimal wESP operating conditions it was possible to remove over 90% of all particle sizes. A comparison of measured and calculated collection efficiencies reveals that the measured values are significantly higher than the predicted values based on the well-known Deutsch equation.

Effect of voltage waveform on dielectric barrier discharge ozone production efficiency

NASA Astrophysics Data System (ADS)

Mericam-Bourdet, N.; Kirkpatrick, M. J.; Tuvache, F.; Frochot, D.; Odic, E.

2012-03-01

Dielectric barrier discharges (DBDs) are commonly used for gas effluent cleanup and ozone generation. For these applications, the energy efficiency of the discharge is a major concern. This paper reports on investigations carried out on the voltage shape applied to DBD reactor electrodes, aiming to evaluate a possible energy efficiency improvement for ozone production. Two DBD reactor geometries were used: pin-to-pin and cylinder-to-cylinder, both driven either by a bi-directional power supply (voltage rise rate 1 kV/μs) or by a pulsed power supply (voltage rise rate 1 kV/ns). Ozone formed in dry air was measured at the reactor outlet. Special attention was paid to discharge input power evaluation using different methods including instantaneous current-voltage product and transferred charge-applied voltage figures. The charge transferred by the discharges was also correlated to the ozone production. It is shown that, in the case of the DBD reactors under investigation, the applied voltage shape has no influence on the ozone production efficiency. For the considered voltage rise rate, the charge deposit on the dielectric inserted inside the discharge gap is the important factor (as opposed to the voltage shape) governing the efficiency of the discharge - it does this by tailoring the duration of the current peak into the tens of nanosecond range.

PVA:LiClO4: a robust, high Tg polymer electrolyte for adjustable ion gating of 2D materials

NASA Astrophysics Data System (ADS)

Kinder, Erich; Fullerton, Susan; CenterLow Energy Systems Technology Team

2015-03-01

Polymer electrolytes are an effective way to gate organic semiconductors and nanomaterials, such as nanotubes and 2D materials, by establishing an electrostatic double layer with large capacitance. Widely used solid electrolytes, such as those based on polyethylene oxide, have a glass transition temperature below room temperature. This permits relatively fast ion mobility at T = 23 °C, but requires a constant applied field to maintain a doping profile. Moreover, PEO-based electrolytes cannot withstand a variety of solvents, limiting its use. Here, we demonstrate a polymer electrolyte using polyvinyl alcohol (PVA) with Tg >23 °C, through which a doping profile can be defined by a potential applied when the polymer is heated above Tg, then ``locked-in'' by cooling the electrolyte to room temperature (

Giant voltage-induced deformation of a dielectric elastomer under a constant pressure

NASA Astrophysics Data System (ADS)

Godaba, Hareesh; Foo, Choon Chiang; Zhang, Zhi Qian; Khoo, Boo Cheong; Zhu, Jian

2014-09-01

Dielectric elastomer actuators coupled with liquid have recently been developed as soft pumps, soft lenses, Braille displays, etc. In this paper, we investigate the performance of a dielectric elastomer actuator, which is coupled with water. The experiments demonstrate that the membrane of a dielectric elastomer can achieve a giant voltage-induced area strain of 1165%, when subject to a constant pressure. Both theory and experiment show that the pressure plays an important role in determining the electromechanical behaviour. The experiments also suggest that the dielectric elastomer actuators, when coupled with liquid, may suffer mechanical instability and collapse after a large amount of liquid is enclosed by the membrane. This failure mode needs to be taken into account in designing soft actuators.

Gating kinetics of batrachotoxin-modified Na+ channels in the squid giant axon. Voltage and temperature effects.

PubMed Central

Correa, A M; Bezanilla, F; Latorre, R

1992-01-01

The gating kinetics of batrachotoxin-modified Na+ channels were studied in outside-out patches of axolemma from the squid giant axon by means of the cut-open axon technique. Single channel kinetics were characterized at different membrane voltages and temperatures. The probability of channel opening (Po) as a function of voltage was well described by a Boltzmann distribution with an equivalent number of gating particles of 3.58. The voltage at which the channel was open 50% of the time was a function of [Na+] and temperature. A decrease in the internal [Na+] induced a shift to the right of the Po vs. V curve, suggesting the presence of an integral negative fixed charge near the activation gate. An increase in temperature decreased Po, indicating a stabilization of the closed configuration of the channel and also a decrease in entropy upon channel opening. Probability density analysis of dwell times in the closed and open states of the channel at 0 degrees C revealed the presence of three closed and three open states. The slowest open kinetic component constituted only a small fraction of the total number of transitions and became negligible at voltages greater than -65 mV. Adjacent interval analysis showed that there is no correlation in the duration of successive open and closed events. Consistent with this analysis, maximum likelihood estimation of the rate constants for nine different single-channel models produced a preferred model (model 1) having a linear sequence of closed states and two open states emerging from the last closed state. The effect of temperature on the rate constants of model 1 was studied. An increase in temperature increased all rate constants; the shift in Po would be the result of an increase in the closing rates predominant over the change in the opening rates. The temperature study also provided the basis for building an energy diagram for the transitions between channel states. PMID:1318096

Constant fields and constant gradients in open ionic channels.

PubMed Central

Chen, D P; Barcilon, V; Eisenberg, R S

1992-01-01

Ions enter cells through pores in proteins that are holes in dielectrics. The energy of interaction between ion and charge induced on the dielectric is many kT, and so the dielectric properties of channel and pore are important. We describe ionic movement by (three-dimensional) Nemst-Planck equations (including flux and net charge). Potential is described by Poisson's equation in the pore and Laplace's equation in the channel wall, allowing induced but not permanent charge. Asymptotic expansions are constructed exploiting the long narrow shape of the pore and the relatively high dielectric constant of the pore's contents. The resulting one-dimensional equations can be integrated numerically; they can be analyzed when channels are short or long (compared with the Debye length). Traditional constant field equations are derived if the induced charge is small, e.g., if the channel is short or if the total concentration gradient is zero. A constant gradient of concentration is derived if the channel is long. Plots directly comparable to experiments are given of current vs voltage, reversal potential vs. concentration, and slope conductance vs. concentration. This dielectric theory can easily be tested: its parameters can be determined by traditional constant field measurements. The dielectric theory then predicts current-voltage relations quite different from constant field, usually more linear, when gradients of total concentration are imposed. Numerical analysis shows that the interaction of ion and channel can be described by a mean potential if, but only if, the induced charge is negligible, that is to say, the electric field is spatially constant. Images FIGURE 1 PMID:1376159

Dynamical characterization of inactivation path in voltage-gated Na+ ion channel by non-equilibrium response spectroscopy

PubMed Central

Pal, Krishnendu; Gangopadhyay, Gautam

2016-01-01

ABSTRACT Inactivation path of voltage gated sodium channel has been studied here under various voltage protocols as it is the main governing factor for the periodic occurrence and shape of the action potential. These voltage protocols actually serve as non-equilibrium response spectroscopic tools to study the ion channel in non-equilibrium environment. In contrast to a lot of effort in finding the crystal structure based molecular mechanism of closed-state(CSI) and open-state inactivation(OSI); here our approach is to understand the dynamical characterization of inactivation. The kinetic flux as well as energetic contribution of the closed and open- state inactivation path is compared here for voltage protocols, namely constant, pulsed and oscillating. The non-equilibrium thermodynamic quantities used in response to these voltage protocols serve as improved characterization tools for theoretical understanding which not only agrees with the previously known kinetic measurements but also predict the energetically optimum processes to sustain the auto-regulatory mechanism of action potential and the consequent inactivation steps needed. The time dependent voltage pattern governs the population of the conformational states which when couple with characteristic rate parameters, the CSI and OSI selectivity arise dynamically to control the inactivation path. Using constant, pulsed and continuous oscillating voltage protocols we have shown that during depolarization the OSI path is more favored path of inactivation however, in the hyper-polarized situation the CSI is favored. It is also shown that the re-factorisation of inactivated sodium channel to resting state occurs via CSI path. Here we have shown how the subtle energetic and entropic cost due to the change in the depolarization magnitude determines the optimum path of inactivation. It is shown that an efficient CSI and OSI dynamical profile in principle can characterize the open-state drug blocking phenomena. PMID:27367642

Characterization of polymer, DNA-based, and silk thin film resistivities and of DNA-based films prepared for enhanced electrical conductivity

NASA Astrophysics Data System (ADS)

Yaney, Perry P.; Ouchen, Fahima; Grote, James G.

2009-08-01

DC resistivity studies were carried out on biopolymer films of DNA-CTMA and silk fibroin, and on selected traditional polymer films, including PMMA and APC. Films of DNA-CTMA versus molecular weight and with conductive dopants PCBM, BAYTRON P and ammonium tetrachloroplatinate are reported. The films were spin coated on glass slides configured for measurements of volume dc resistance. The measurements used the alternating polarity method to record the applied voltage-dependent current independent of charging and background currents. The Arrhenius equation plus a constant was fitted to the conductivity versus temperature data of the polymers and the non-doped DNA-based biopolymers with activation energies ranging from 0.8 to 1.4 eV.

Characterization of silicon photomultipliers and validation of the electrical model

NASA Astrophysics Data System (ADS)

Peng, Peng; Qiang, Yi; Ross, Steve; Burr, Kent

2018-04-01

This paper introduces a systematic way to measure most features of the silicon photomultipliers (SiPM). We implement an efficient two-laser procedure to measure the recovery time. Avalanche probability was found to play an important role in explaining the right behavior of the SiPM recovery process. Also, we demonstrate how equivalent circuit parameters measured by optical tests can be used in SPICE modeling to predict details of the time constants relevant to the pulse shape. The SiPM properties measured include breakdown voltage, gain, diode capacitor, quench resistor, quench capacitor, dark count rate, photodetection efficiency, cross-talk and after-pulsing probability, and recovery time. We apply these techniques on the SiPMs from two companies: Hamamatsu and SensL.

Influence of the deposition conditions on radiofrequency magnetron sputtered MoS2 films

NASA Technical Reports Server (NTRS)

Steinmann, Pierre A.; Spalvins, Talivaldis

1990-01-01

By varying the radiofrequency (RF) power, the Ar pressure, and the potential on the substrates, MoS(x) films of various stoichiometry, density, adhesion, and morphology were produced. An increase of RF power increased the deposition rate and density of the MoS2 films as well as improved adhesion. However, the stoichiometry remained constant. An increase of Ar pressure increased the deposition rate but decreased the density, wheras both stoichiometry and adhesion were maximized at around 20 mtorr Ar pressure. Furthermore, a transition from compact film growth to columnar film growth was observed when the pressure was varied from 5 to 15 mtorr. Substoichiometric films were grown when a negative (bias) voltage was applied to the substrates.

Different roles of electron beam in two stream instability in an elliptical waveguide for generation and amplification of THz electromagnetic waves

DOE Office of Scientific and Technical Information (OSTI.GOV)

Safari, S.; Jazi, B., E-mail: jaziada@kashanu.ac.ir; Jahanbakht, S.

2016-08-15

In this work, two stream instability in a metallic waveguide with elliptical cross-section and with a hollow annular dielectric layer is studied for generation and amplification of THz electromagnetic waves. Dispersion relation of waves and their dependents to geometric dimensions and characteristics of the electron beam are analyzed. In continuation, the diagrams of growth rate for some operating frequencies are presented, so that effective factors on the growth rates, such as geometrical dimensions, dielectric constant of dielectric layer, accelerating voltage, and applied current intensity are analyzed. It is shown that while an electron beam is responsible for instability, another electronmore » beam plays a stabilizing role.« less

Nonlinear Raman spectroscopy of liquid crystals: orientational alignment and switching behaviour in a ferroelectric liquid crystal mixture

NASA Astrophysics Data System (ADS)

Grofcsik, Andras

Picosecond inverse Raman spectroscopy has been employed to probe the alignment behaviour and switching characteristics of a 6 mum thick ferroelectric liquid crystal based on a host mixture of fluorinated phenyl biphenylcarboxylates and a chiral dopant. Optical bistability is observed in the Raman signal on application of dc electric fields of opposite polarity. For particular polarities of the applied field, the Raman signals display a cos4theta dependence on the angle of rotation around the beam direction. Reorientational rate constants of 300 mus and 590 mus are observed for the aromatic core at the high-voltage limit for the rise and decay of the 1600 cm-1 Raman signal on application of a switching ac electric field.

Rotation relaxation splitting for optimizing parallel RF excitation pulses with T1 - and T2 -relaxations in MRI

NASA Astrophysics Data System (ADS)

Majewski, Kurt

2018-03-01

Exact solutions of the Bloch equations with T1 - and T2 -relaxation terms for piecewise constant magnetic fields are numerically challenging. We therefore investigate an approximation for the achieved magnetization in which rotations and relaxations are split into separate operations. We develop an estimate for its accuracy and explicit first and second order derivatives with respect to the complex excitation radio frequency voltages. In practice, the deviation between an exact solution of the Bloch equations and this rotation relaxation splitting approximation seems negligible. Its computation times are similar to exact solutions without relaxation terms. We apply the developed theory to numerically optimize radio frequency excitation waveforms with T1 - and T2 -relaxations in several examples.

The effect of voltage waveform and tube diameter on transporting cold plasma strings through a flexible dielectric tube

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sohbatzadeh, Farshad, E-mail: f.sohbat@umz.ac.ir; Nano and Biotechnology Research Group, Faculty of Basic Sciences, University of Mazandaran, Babolsar 47416-95447, Mazandaran; Omran, Azadeh Valinataj

2014-11-15

In this work, we developed transporting atmospheric pressure cold plasma using single electrode configuration through a sub-millimetre flexible dielectric tube beyond 100 cm. It was shown that the waveform of the applied high voltage is essential for controlling upstream and downstream plasma inside the tube. In this regard, sawtooth waveform enabled the transport of plasma with less applied high voltage compared to sinusoidal and pulsed form voltages. A cold plasma string as long as 130 cm was obtained by only 4 kV peak-to-peak sawtooth high voltage waveform. Optical emission spectroscopy revealed that reactive chemical species, such as atomic oxygen and hydroxyl, are generatedmore » at the tube exit. The effect of tube diameter on the transported plasma was also examined: the smaller the diameter, the higher the applied voltage. The device is likely to be used for sterilization, decontamination, and therapeutic endoscopy as already suggested by other groups in recent past years.« less

DLC Film Formation Technologies by Applying Pulse Voltage Coupled with RF Voltage to Complicated 3-dimensional Substrates and Industrial Application

NASA Astrophysics Data System (ADS)

Suzuki, Yasuo

A uniform plasma-based ion implantation and DLC film formation technologies on the surface of complicated 3-dimensional substrates have been developed by applying pulse voltage coupled with RF voltage to the substrates such as plastics, rubber as well as metals with the similar deposition rate. These technologies are widely applicable to both ion implantation and DLC film formation onto the automobile parts, mechanical parts and metal molds. A problem to be solved is reducing cost. The deposition rate of DLC films is expected to increase to around 10μm/hr, which is ten times larger than that of the conventional method, by hybridizing the ICP (Induction Coupling Plasma) with a plus-minus voltage source. This epoch-making technology will be able to substitute for the electro-plating method in the near future. In this paper, the DLC film formation technology by applying both RF and pulse voltage, its applications and its prospect are presented.

Forecasting of high voltage insulation performance: Testing of recommended potting materials and of capacitors

NASA Technical Reports Server (NTRS)

Bever, R. S.

1984-01-01

Nondestructive high voltage test techniques (mostly electrical methods) are studied to prevent total or catastrophic breakdown of insulation systems under applied high voltage in space. Emphasis is on the phenomenon of partial breakdown or partial discharge (P.D.) as a symptom of insulation quality, notably partial discharge testing under D.C. applied voltage. Many of the electronic parts and high voltage instruments in space experience D.C. applied stress in service, and application of A.C. voltage to any portion thereof would be prohibited. Suggestions include: investigation of the ramp test method for D.C. partial discharge measurements; testing of actual flight-type insulation specimen; perfect plotting resin samples with controlled defects for test; several types of plotting resins and recommendations of the better ones from the electrical characteristics; thermal and elastic properties are also considered; testing of commercial capaciters; and approximate acceptance/rejection/rerating criteria for sample test elements for space use, based on D.C. partial discharge.

Ultrananocrystalline Diamond Cantilever Wide Dynamic Range Acceleration/Vibration /Pressure Sensor

DOEpatents

Krauss, Alan R.; Gruen, Dieter M.; Pellin, Michael J.; Auciello, Orlando

2003-09-02

An ultrananocrystalline diamond (UNCD) element formed in a cantilever configuration is used in a highly sensitive, ultra-small sensor for measuring acceleration, shock, vibration and static pressure over a wide dynamic range. The cantilever UNCD element may be used in combination with a single anode, with measurements made either optically or by capacitance. In another embodiment, the cantilever UNCD element is disposed between two anodes, with DC voltages applied to the two anodes. With a small AC modulated voltage applied to the UNCD cantilever element and because of the symmetry of the applied voltage and the anode-cathode gap distance in the Fowler-Nordheim equation, any change in the anode voltage ratio V1/V2 required to maintain a specified current ratio precisely matches any displacement of the UNCD cantilever element from equilibrium. By measuring changes in the anode voltage ratio required to maintain a specified current ratio, the deflection of the UNCD cantilever can be precisely determined. By appropriately modulating the voltages applied between the UNCD cantilever and the two anodes, or limit electrodes, precise independent measurements of pressure, uniaxial acceleration, vibration and shock can be made. This invention also contemplates a method for fabricating the cantilever UNCD structure for the sensor.

Ultrananocrystalline diamond cantilever wide dynamic range acceleration/vibration/pressure sensor

DOEpatents

Krauss, Alan R [Naperville, IL; Gruen, Dieter M [Downers Grove, IL; Pellin, Michael J [Naperville, IL; Auciello, Orlando [Bolingbrook, IL

2002-07-23

An ultrananocrystalline diamond (UNCD) element formed in a cantilever configuration is used in a highly sensitive, ultra-small sensor for measuring acceleration, shock, vibration and static pressure over a wide dynamic range. The cantilever UNCD element may be used in combination with a single anode, with measurements made either optically or by capacitance. In another embodiment, the cantilever UNCD element is disposed between two anodes, with DC voltages applied to the two anodes. With a small AC modulated voltage applied to the UNCD cantilever element and because of the symmetry of the applied voltage and the anode-cathode gap distance in the Fowler-Nordheim equation, any change in the anode voltage ratio V1/N2 required to maintain a specified current ratio precisely matches any displacement of the UNCD cantilever element from equilibrium. By measuring changes in the anode voltage ratio required to maintain a specified current ratio, the deflection of the UNCD cantilever can be precisely determined. By appropriately modulating the voltages applied between the UNCD cantilever and the two anodes, or limit electrodes, precise independent measurements of pressure, uniaxial acceleration, vibration and shock can be made. This invention also contemplates a method for fabricating the cantilever UNCD structure for the sensor.

Conservation voltage regulation (CVR) applied to energy savings by voltage-adjusting equipment through AMI

NASA Astrophysics Data System (ADS)

Lan, B.-R.; Chang, C.-A.; Huang, P.-Y.; Kuo, C.-H.; Ye, Z.-J.; Shen, B.-C.; Chen, B.-K.

2017-11-01

Conservation voltage reduction (CVR) includes peak demand reduction, energy conservation, carbon emission reduction, and electricity bill reduction. This paper analyzes the energy-reduction of Siwei Feeders with applying CVR, which are situated in Penghu region and equipped with smart meters. Furthermore, the applicable voltage reduction range for the feeders will be explored. This study will also investigate how the CVR effect and energy conservation are improved with the voltage control devices integrated. The results of this study can serve as a reference for the Taiwan Power Company to promote and implement voltage reduction and energy conservation techniques. This study is expected to enhance the energy-reduction performance of the Penghu Low Carbon Island Project.

Selective Dirac voltage engineering of individual graphene field-effect transistors for digital inverter and frequency multiplier integrations

NASA Astrophysics Data System (ADS)

Sul, Onejae; Kim, Kyumin; Jung, Yungwoo; Choi, Eunsuk; Lee, Seung-Beck

2017-09-01

The ambipolar band structure of graphene presents unique opportunities for novel electronic device applications. A cycle of gate voltage sweep in a conventional graphene transistor produces a frequency-doubled output current. To increase the frequency further, we used various graphene doping control techniques to produce Dirac voltage engineered graphene channels. The various surface treatments and substrate conditions produced differently doped graphene channels that were integrated on a single substrate and multiple Dirac voltages were observed by applying a single gate voltage sweep. We applied the Dirac voltage engineering techniques to graphene field-effect transistors on a single chip for the fabrication of a frequency multiplier and a logic inverter demonstrating analog and digital circuit application possibilities.

Selective Dirac voltage engineering of individual graphene field-effect transistors for digital inverter and frequency multiplier integrations.

PubMed

Sul, Onejae; Kim, Kyumin; Jung, Yungwoo; Choi, Eunsuk; Lee, Seung-Beck

2017-09-15

The ambipolar band structure of graphene presents unique opportunities for novel electronic device applications. A cycle of gate voltage sweep in a conventional graphene transistor produces a frequency-doubled output current. To increase the frequency further, we used various graphene doping control techniques to produce Dirac voltage engineered graphene channels. The various surface treatments and substrate conditions produced differently doped graphene channels that were integrated on a single substrate and multiple Dirac voltages were observed by applying a single gate voltage sweep. We applied the Dirac voltage engineering techniques to graphene field-effect transistors on a single chip for the fabrication of a frequency multiplier and a logic inverter demonstrating analog and digital circuit application possibilities.

High voltage power supply

NASA Technical Reports Server (NTRS)

Ruitberg, A. P.; Young, K. M. (Inventor)

1985-01-01

A high voltage power supply is formed by three discrete circuits energized by a battery to provide a plurality of concurrent output signals floating at a high output voltage on the order of several tens of kilovolts. In the first two circuits, the regulator stages are pulse width modulated and include adjustable ressistances for varying the duty cycles of pulse trains provided to corresponding oscillator stages while the third regulator stage includes an adjustable resistance for varying the amplitude of a steady signal provided to a third oscillator stage. In the first circuit, the oscillator, formed by a constant current drive network and a tuned resonant network included a step up transformer, is coupled to a second step up transformer which, in turn, supplies an amplified sinusoidal signal to a parallel pair of complementary poled rectifying, voltage multiplier stages to generate the high output voltage.

Hydroelectric voltage generation based on water-filled single-walled carbon nanotubes.

PubMed

Yuan, Quanzi; Zhao, Ya-Pu

2009-05-13

A DFT/MD mutual iterative method was employed to give insights into the mechanism of voltage generation based on water-filled single-walled carbon nanotubes (SWCNTs). Our calculations showed that a constant voltage difference of several mV would generate between the two ends of a carbon nanotube, due to interactions between the water dipole chains and charge carriers in the tube. Our work validates this structure of a water-filled SWCNT as a promising candidate for a synthetic nanoscale power cell, as well as a practical nanopower harvesting device at the atomic level.

The effects of cathodic micro-voltage combined with hydrothermal pretreatment on methane fermentation of lignocellulose substrate

NASA Astrophysics Data System (ADS)

Liu, Dianxin; Ning, Ping; Qu, Guangfei; Huang, Xi; Liu, Yuhuan; Zhang, Jian

2017-05-01

The methane fermentation study assisted with cathodic micro-voltage was carried out to investigate the electric field effects on the fermentation of hydrothermally pretreated lignocellulose substrate. It was illustrated that a 0.25V cathode voltage and hydrothermal pretreatment could improve the biogas production, biogas quality and lignocellulose degradation ratio significantly. The cumulative biogas productions in the fermentation of hydrothermally pretreated cow dungs at 50°C, 150°C and 200°C with a 0.25V cathode voltage were observed in a total of 6640mL, 9218mL and 9456mL respectively over a detention time of 33 days. In comparison with the fermentation pretreated at 200°C without any voltage, nearly doubled of cumulative biogas production was obtained in the process of cathode-assisted fermentation. It was also observed that the daily methane content greater than or equal to 70% in the biogas generated with cathode voltage were clearly greater than that without voltages. Furthermore, the fermentation applied with a 0.25V cathode voltage had resulted into significant increases of 12.64% and 9.44% in lignin and cellulose degradation ratio relative to voltage free fermentation. And in the process of fermentation applied with cathode voltage, the final lignocellulose degradation ratio increased with the hydrothermal pretreatment temperature. Thus, the hydrothermal pretreatment and assisting fermentation with low cathode voltage can effectively promote the lignocellulose degradation. All results revealed that cathodic micro-voltage combined with hydrothermal pretreatment can remarkably improve the fermentation of lignocellulosic materials, indicating that a more effective fermentation technology can be developed by applying with cathodic micro-voltage.

Research on the response characteristics of solenoid valve of the air-jet loom by simulation

NASA Astrophysics Data System (ADS)

Jin, Yuzhen; Deng, Ruoyu; Jin, Yingzi; Hu, Xudong

2013-12-01

Solenoid valve is one of the executive parts of weft insertion control system. According to the response characteristics of the solenoid valve, an improved design becomes a necessity. Firstly, the numerical model was established after analyzing the solenoid valve during its start-up and shut-down. Comparing the simulation data with the practical data, it is verified that the numerical simulation model has a high feasibility. Secondly, excitation voltage and spring pre-compression were adjusted respectively, and the response rules after adjusting were investigated. The research of the study shows: the response time tends to be inverse proportional to the excitation voltage during start-up, and it becomes a constant value with the increase of the excitation voltage; the response time is proportional to the spring pre-compression when the solenoid valve starts up, it is inverse proportional to spring pre-compression when the solenoid valve shuts down. And the total response time is a constant value with the increase of the spring pre-compression. Therefore, the value of the excitation voltage and the spring pre-compression should be selected when the curve is becoming flatten. The results of the research can provide the reference to the further development of the solenoid valve.

Investigation of Dielectric Breakdown Characteristics for Double-break Vacuum Interrupter and Dielectric Breakdown Probability Distribution in Vacuum Interrupter

NASA Astrophysics Data System (ADS)

Shioiri, Tetsu; Asari, Naoki; Sato, Junichi; Sasage, Kosuke; Yokokura, Kunio; Homma, Mitsutaka; Suzuki, Katsumi

To investigate the reliability of equipment of vacuum insulation, a study was carried out to clarify breakdown probability distributions in vacuum gap. Further, a double-break vacuum circuit breaker was investigated for breakdown probability distribution. The test results show that the breakdown probability distribution of the vacuum gap can be represented by a Weibull distribution using a location parameter, which shows the voltage that permits a zero breakdown probability. The location parameter obtained from Weibull plot depends on electrode area. The shape parameter obtained from Weibull plot of vacuum gap was 10∼14, and is constant irrespective non-uniform field factor. The breakdown probability distribution after no-load switching can be represented by Weibull distribution using a location parameter. The shape parameter after no-load switching was 6∼8.5, and is constant, irrespective of gap length. This indicates that the scatter of breakdown voltage was increased by no-load switching. If the vacuum circuit breaker uses a double break, breakdown probability at low voltage becomes lower than single-break probability. Although potential distribution is a concern in the double-break vacuum cuicuit breaker, its insulation reliability is better than that of the single-break vacuum interrupter even if the bias of the vacuum interrupter's sharing voltage is taken into account.

Three-Level 48-Pulse STATCOM with Pulse Width Modulation

NASA Astrophysics Data System (ADS)

Singh, Bhim; Srinivas, Kadagala Venkata

2016-03-01

In this paper, a new control strategy of a three-level 48-pulse static synchronous compensator (STATCOM) is proposed with a constant dc link voltage and pulse width modulation at fundamental frequency switching. The proposed STATCOM is realized using eight units of three-level voltage source converters (VSCs) to form a three-level 48-pulse STATCOM. The conduction angle of each three-level VSC is modulated to control the ac converter output voltage, which controls the reactive power of the STATCOM. A fuzzy logic controller is used to control the STATCOM. The dynamic performance of the STATCOM is studied for the control of the reference reactive power, the reference terminal voltage and under the switching of inductive and capacitive loads.

Method for the depth corrected detection of ionizing events from a co-planar grids sensor

DOEpatents

De Geronimo, Gianluigi [Syosset, NY; Bolotnikov, Aleksey E [South Setauket, NY; Carini, Gabriella [Port Jefferson, NY

2009-05-12

A method for the detection of ionizing events utilizing a co-planar grids sensor comprising a semiconductor substrate, cathode electrode, collecting grid and non-collecting grid. The semiconductor substrate is sensitive to ionizing radiation. A voltage less than 0 Volts is applied to the cathode electrode. A voltage greater than the voltage applied to the cathode is applied to the non-collecting grid. A voltage greater than the voltage applied to the non-collecting grid is applied to the collecting grid. The collecting grid and the non-collecting grid are summed and subtracted creating a sum and difference respectively. The difference and sum are divided creating a ratio. A gain coefficient factor for each depth (distance between the ionizing event and the collecting grid) is determined, whereby the difference between the collecting electrode and the non-collecting electrode multiplied by the corresponding gain coefficient is the depth corrected energy of an ionizing event. Therefore, the energy of each ionizing event is the difference between the collecting grid and the non-collecting grid multiplied by the corresponding gain coefficient. The depth of the ionizing event can also be determined from the ratio.

Self-tuning bandpass filter

NASA Technical Reports Server (NTRS)

Deboo, G. J.; Hedlund, R. C. (Inventor)

1973-01-01

An electronic filter is described which simultaneously maintains a constant bandwidth and a constant center frequency gain as the input signal frequency varies, and remains self-tuning to that center frequency over a decade range. The filter utilizes a field effect transistor (FET) as a voltage variable resistance in the bandpass frequency determining circuit. The FET is responsive to a phase detector to achieve self-tuning.

Spin-valve giant magneto-resistance film with magnetostrictive FeSiB amorphous layer and its application to strain sensors

NASA Astrophysics Data System (ADS)

Hashimoto, Y.; Yamamoto, N.; Kato, T.; Oshima, D.; Iwata, S.

2018-03-01

Giant magneto-resistance (GMR) spin-valve films with an FeSiB/CoFeB free layer were fabricated to detect applied strain in a GMR device. The magnetostriction constant of FeSiB was experimentally determined to have 32 ppm, which was one order of magnitude larger than that of CoFeB. In order to detect the strain sensitively and robustly against magnetic field fluctuation, the magnetic field modulation technique was applied to the GMR device. It was confirmed that the output voltage of the GMR device depends on the strain, and the gauge factor K = 46 was obtained by adjusting the applied DC field intensity and direction. We carried out the simulation based on a macro-spin model assuming uniaxial anisotropy, interlayer coupling between the free and pin layers, strain-induced anisotropy, and Zeeman energy, and succeeded in reproducing the experimental results. The simulation predicts that improving the magnetic properties of GMR films, especially reducing interlayer coupling, will be effective for increasing the output, i.e., the gauge factor, of the GMR strain sensors.

Applicability of the Child-Langmuir laws versions for describing the glow discharge cathode sheath in CO2

NASA Astrophysics Data System (ADS)

Lisovskiy, Valeriy; Krol, Hennadii; Osmayev, Ruslan; Yegorenkov, Vladimir

2016-09-01

This work is devoted to the determination of the law that may be applicable to the description of the cathode sheath in CO2. To this end three versions of the Child-Langmuir law have been considered - a collision free one (for the ions moving through a cathode sheath without collisions with gas molecules) as well as two collision- related versions- one for a constant mean free path of positive ions and one for a constant mobility of positive ions. The current-voltage characteristics and the cathode sheath thickness of the glow discharge in carbon oxide have been simultaneously measured in the pressure range from 0.05 to 1 Torr and with the discharge current values up to 80 mA. The inter-electrode distance has been chosen such that the discharge consists only of the cathode sheath and a small portion of the negative glow, i.e. the experiments have been performed in short tubes. In this case the voltage drop across the cathode sheath is equal approximately to the voltage drop across the electrodes. In the whole range of the discharge conditions we have studied the cathode sheath characteristics are found to obey correctly only to the Child-Langmuir law version with a constant ion mobility. The reason for this phenomenon may be related with a significant conversion of carbon dioxide molecules.

Optical and Electrical Performance of MOS-Structure Silicon Solar Cells with Antireflective Transparent ITO and Plasmonic Indium Nanoparticles under Applied Bias Voltage.

PubMed

Ho, Wen-Jeng; Sue, Ruei-Siang; Lin, Jian-Cheng; Syu, Hong-Jang; Lin, Ching-Fuh

2016-08-10

This paper reports impressive improvements in the optical and electrical performance of metal-oxide-semiconductor (MOS)-structure silicon solar cells through the incorporation of plasmonic indium nanoparticles (In-NPs) and an indium-tin-oxide (ITO) electrode with periodic holes (perforations) under applied bias voltage. Samples were prepared using a plain ITO electrode or perforated ITO electrode with and without In-NPs. The samples were characterized according to optical reflectance, dark current voltage, induced capacitance voltage, external quantum efficiency, and photovoltaic current voltage. Our results indicate that induced capacitance voltage and photovoltaic current voltage both depend on bias voltage, regardless of the type of ITO electrode. Under a bias voltage of 4.0 V, MOS cells with perforated ITO and plain ITO, respectively, presented conversion efficiencies of 17.53% and 15.80%. Under a bias voltage of 4.0 V, the inclusion of In-NPs increased the efficiency of cells with perforated ITO and plain ITO to 17.80% and 16.87%, respectively.

Optical and Electrical Performance of MOS-Structure Silicon Solar Cells with Antireflective Transparent ITO and Plasmonic Indium Nanoparticles under Applied Bias Voltage

PubMed Central

Ho, Wen-Jeng; Sue, Ruei-Siang; Lin, Jian-Cheng; Syu, Hong-Jang; Lin, Ching-Fuh

2016-01-01

This paper reports impressive improvements in the optical and electrical performance of metal-oxide-semiconductor (MOS)-structure silicon solar cells through the incorporation of plasmonic indium nanoparticles (In-NPs) and an indium-tin-oxide (ITO) electrode with periodic holes (perforations) under applied bias voltage. Samples were prepared using a plain ITO electrode or perforated ITO electrode with and without In-NPs. The samples were characterized according to optical reflectance, dark current voltage, induced capacitance voltage, external quantum efficiency, and photovoltaic current voltage. Our results indicate that induced capacitance voltage and photovoltaic current voltage both depend on bias voltage, regardless of the type of ITO electrode. Under a bias voltage of 4.0 V, MOS cells with perforated ITO and plain ITO, respectively, presented conversion efficiencies of 17.53% and 15.80%. Under a bias voltage of 4.0 V, the inclusion of In-NPs increased the efficiency of cells with perforated ITO and plain ITO to 17.80% and 16.87%, respectively. PMID:28773801

High-Efficiency Power Module

NASA Technical Reports Server (NTRS)

Simons, Rainee N (Inventor); Wintucky, Edwin G (Inventor)

2013-01-01

One or more embodiments of the present invention pertain to an all solid-state microwave power module. The module includes a plurality of solid-state amplifiers configured to amplify a signal using a low power stage, a medium power stage, and a high power stage. The module also includes a power conditioner configured to activate a voltage sequencer (e.g., bias controller) when power is received from a power source. The voltage sequencer is configured to sequentially apply voltage to a gate of each amplifier and sequentially apply voltage to a drain of each amplifier.

High-Efficiency Power Module

NASA Technical Reports Server (NTRS)

Simons, Rainee N. (Inventor); Wintucky, Edwin G. (Inventor)

2015-01-01

One or more embodiments of the present invention pertain to an all solid-state microwave power module. The module includes a plurality of solid-state amplifiers configured to amplify a signal using a low power stage, a medium power stage, and a high power stage. The module also includes a power conditioner configured to activate a voltage sequencer (e.g., bias controller) when power is received from a power source. The voltage sequencer is configured to sequentially apply voltage to a gate of each amplifier and sequentially apply voltage to a drain of each amplifier.

Observation of electric potential in organic thin-film transistor by bias-applied hard X-ray photoemission spectroscopy

NASA Astrophysics Data System (ADS)

Watanabe, Takeshi; Tada, Keisuke; Yasuno, Satoshi; Oji, Hiroshi; Yoshimoto, Noriyuki; Hirosawa, Ichiro

2016-03-01

The effect of gate voltage on electric potential in a pentacene (PEN) layer was studied by hard X-ray photoelectron spectroscopy under a bias voltage. It was observed that applying a negative gate voltage substantially increases the width of a C 1s peak. This suggested that injected and accumulated carriers in an organic thin film transistor channel modified the potential depth profile in PEN. It was also observed that the C 1s kinetic energy tends to increase monotonically with threshold voltage.

High-voltage crowbar circuit with cascade-triggered series ignitrons

DOEpatents

Baker, William R. [Orinda, CA

1980-11-04

A series string of ignitrons for switching a large current at high voltage to ground. Switching is initiated by means of a negative trigger pulse applied to the cathode of the lowest voltage level ignitron next to ground to draw ground current through diodes in the ignitor circuit. The trigger pulse is applied thereby to the next higher ignitron cathode and sequentially to the remainder of the ignitrons in the string through diodes in respective ignitor circuits. Full line voltage is held off of nonconducting diodes and ignitrons by means of varistors.

High-voltage crowbar circuit with cascade-triggered series ignitrons

DOEpatents

Baker, W.R.

A series string of ignitrons for switching a large current at high voltage to ground is discussed. Switching is initiated by means of a negative trigger pulse applied to the cathode of the lowest voltage level ignitron next to ground to draw ground current through diodes in the ignitor circuit. The trigger pulse is applied thereby to the next higher ignitron cathode and sequentially to the remainder of the ignitrons in the string through diodes in respective ignitor circuits. Full line voltage is held off of nonconducting diodes and ignitrons by means of varistors.

High-voltage crowbar circuit with cascade-triggered series ignitrons

DOEpatents

Baker, W.R.

1980-11-04

A series string of ignitrons for switching a large current at high voltage to ground. Switching is initiated by means of a negative trigger pulse applied to the cathode of the lowest voltage level ignitron next to ground to draw ground current through diodes in the ignitor circuit. The trigger pulse is applied thereby to the next higher ignitron cathode and sequentially to the remainder of the ignitrons in the string through diodes in respective ignitor circuits. Full line voltage is held off of nonconducting diodes and ignitrons by means of varistors. 1 fig.

Macro Fiber Piezocomposite Actuator Poling Study

NASA Technical Reports Server (NTRS)

Werlink, Rudy J.; Bryant, Robert G.; Manos, Dennis

2002-01-01

The performance and advantages of Piezocomposite Actuators are to provide a low cost, in-situ actuator/sensor that is flexible, low profile and high strain per volt performance in the same plane of poled voltage. This paper extends reported data for the performance of these Macrofiber Composite (MFC) Actuators to include 4 progressively narrower Intedigitized electrode configurations with several line widths and spacing ratios. Data is reported for max free strain, average strain per applied volt, poling (alignment of the electric dipoles of the PZT ceramic) voltage vs. strain and capacitance, time to poling voltage 95% saturation. The output strain per volt progressively increases as electrode spacing decreases, with saturation occurring at lower poling voltages. The narrowest spacing ratio becomes prone to voltage breakdown or short circuits limiting the spacing width with current fabrication methods. The capacitance generally increases with increasing poling voltage level but has high sensitivity to factors such as temperature, moisture and time from poling which limit its usefulness as a simple indicator. The total time of applied poling voltage to saturate or fully line up the dipoles in the piezoceramic was generally on the order of 5-20 seconds. Less sensitivity to poling due to the applied rate of voltage increase over a 25 to 500 volt/second rate range was observed.

Gating by Cyclic Gmp and Voltage in the α Subunit of the Cyclic Gmp–Gated Channel from Rod Photoreceptors

PubMed Central

Benndorf, Klaus; Koopmann, Rolf; Eismann, Elisabeth; Kaupp, U. Benjamin

1999-01-01

Gating by cGMP and voltage of the α subunit of the cGMP-gated channel from rod photoreceptor was examined with a patch-clamp technique. The channels were expressed in Xenopus oocytes. At low [cGMP] (<20 μM), the current displayed strong outward rectification. At low and high (700 μM) [cGMP], the channel activity was dominated by only one conductance level. Therefore, the outward rectification at low [cGMP] results solely from an increase in the open probability, P o. Kinetic analysis of single-channel openings revealed two exponential distributions. At low [cGMP], the larger P o at positive voltages with respect to negative voltages is caused by an increased frequency of openings in both components of the open-time distribution. In macroscopic currents, depolarizing voltage steps, starting from −100 mV, generated a time-dependent current that increased with the step size (activation). At low [cGMP] (20 μM), the degree of activation was large and the time course was slow, whereas at saturating [cGMP] (7 mM) the respective changes were small and fast. The dose–response relation at −100 mV was shifted to the right and saturated at significantly lower P o values with respect to that at +100 mV (0.77 vs. 0.96). P o was determined as function of the [cGMP] (at +100 and −100 mV) and voltage (at 20, 70, and 700 μM, and 7 mM cGMP). Both relations could be fitted with an allosteric state model consisting of four independent cGMP-binding reactions and one voltage-dependent allosteric opening reaction. At saturating [cGMP] (7 mM), the activation time course was monoexponential, which allowed us to determine the individual rate constants for the allosteric reaction. For the rapid rate constants of cGMP binding and unbinding, lower limits are determined. It is concluded that an allosteric model consisting of four independent cGMP-binding reactions and one voltage-dependent allosteric reaction, describes the cGMP- and voltage-dependent gating of cGMP-gated channels adequately. PMID:10498668

Constant Current versus Constant Voltage Subthalamic Nucleus Deep Brain Stimulation in Parkinson's Disease.

PubMed

Ramirez de Noriega, Fernando; Eitan, Renana; Marmor, Odeya; Lavi, Adi; Linetzky, Eduard; Bergman, Hagai; Israel, Zvi

2015-02-18

Background: Subthalamic nucleus (STN) deep brain stimulation (DBS) is an established therapy for advanced Parkinson's disease (PD). Motor efficacy and safety have been established for constant voltage (CV) devices and more recently for constant current (CC) devices. CC devices adjust output voltage to provide CC stimulation irrespective of impedance fluctuation, while the current applied by CV stimulation depends on the impedance that may change over time. No study has directly compared the clinical effects of these two stimulation modalities. Objective: To compare the safety and clinical impact of CC STN DBS to CV STN DBS in patients with advanced PD 2 years after surgery. Methods: Patients were eligible for inclusion if they had undergone STN DBS surgery for idiopathic PD, had been implanted with a Medtronic Activa PC and if their stimulation program and medication had been stable for at least 1 year. This single-center trial was designed as a double-blind, randomized, prospective study with crossover after 2 weeks. Motor equivalence of the 2 modalities was confirmed utilizing part III of the Unified Parkinson's Disease Rating Scale (UPDRS). PD diaries and multiple subjective and objective evaluations of quality of life, depression, cognition and emotional processing were evaluated on both CV and on CC stimulation. Analysis using the paired t test with Bonferroni correction for multiple comparisons was performed to identify any significant difference between the stimulation modalities. Results: 8 patients were recruited (6 men, 2 women); 1 patient did not complete the study. The average age at surgery was 56.7 years (range 47-63). Disease duration at the time of surgery was 7.5 years (range 3-12). Patients were recruited 23.8 months (range 22.5-24) after surgery. At the postoperative study baseline, this patient group showed an average motor improvement of 69% (range 51-97) as measured by the change in UPDRS part III with stimulation alone. Levodopa equivalent medication was reduced on average by 67% (range 15-88). Patients were poorly compliant with PD diaries, and these did not yield useful information. The minor deterioration in quality-of-life scores (Parkinson's Disease Questionnaire-39, Quality of Life Enjoyment and Satisfaction Questionnaire) with CC stimulation were not statistically significant. Two measures of depression (Hamilton Rating Scale D17, Quick Inventory of Depressive Symptomatology - Self-Report) showed a nonsignificant lower score (less depression) with CC stimulation, but a third (Beck Depression Inventory) showed equivalence. Cognitive testing (Mini Mental State Examination) and emotional processing (Montreal Affective Voices) were equivalent for CC and CV. Conclusion: CC STN DBS is safe. For equivalent motor efficacy, no significant difference could be identified between CC and CV stimulation for nonmotor evaluations in PD patients 2 years after surgery. © 2015 S. Karger AG, Basel.

Nanosecond liquid crystalline optical modulator

DOE Office of Scientific and Technical Information (OSTI.GOV)

Borshch, Volodymyr; Shiyanovskii, Sergij V.; Lavrentovich, Oleg D.

2016-07-26

An optical modulator includes a liquid crystal cell containing liquid crystal material having liquid crystal molecules oriented along a quiescent director direction in the unbiased state, and a voltage source configured to apply an electric field to the liquid crystal material wherein the direction of the applied electric field does not cause the quiescent director direction to change. An optical source is arranged to transmit light through or reflect light off the liquid crystal cell with the light passing through the liquid crystal material at an angle effective to undergo phase retardation in response to the voltage source applying themore » electric field. The liquid crystal material may have negative dielectric anisotropy, and the voltage source configured to apply an electric field to the liquid crystal material whose electric field vector is transverse to the quiescent director direction. Alternatively, the liquid crystal material may have positive dielectric anisotropy and the voltage source configured to apply an electric field to the liquid crystal material whose electric field vector is parallel with the quiescent director direction.« less

The Sheath-less Planar Langmuir Probe

NASA Astrophysics Data System (ADS)

Cooke, D. L.

2017-12-01

The Langmuir probe is one of the oldest plasma diagnostics, provided the plasma density and species temperature from analysis of a current-voltage curve as the voltage is swept over a practically chosen range. The analysis depends on a knowledge or theory of the many factors that influence the current-voltage curve including, probe shape, size, nearby perturbations, and the voltage reference. For applications in Low Earth Orbit, the Planar Langmuir Probe, PLP, is an attractive geometry because the ram ion current is very constant over many Volts of a sweep, allowing the ion density and electron temperature to be determined independently with the same instrument, at different points on the sweep. However, when the physical voltage reference is itself small and electrically floating as with a small spacecraft, the spacecraft and probe system become a double probe where the current collection theory depends on the interaction of the spacecraft with the plasma which is generally not as simple as the probe itself. The Sheath-less PLP, SPLP, interlaces on a single ram facing surface, two variably biased probe elements, broken into many small and intertwined segments on a scale smaller than the plasma Debye length. The SPLP is electrically isolated from the rest of the spacecraft. For relative bias potentials of a few volts, the ion current to all segments of each element will be constant, while the electron currents will vary as a function of the element potential and the electron temperature. Because the segments are small, intertwined, and floating, the assembly will always present the same floating potential to the plasma, with minimal growth as a function of voltage, thus sheath-less and still planar. This concept has been modelled with Nascap, and tested with a physical model inserted into a Low Earth Orbit-like chamber plasma. Results will be presented.

Computer-aided control of electrolysis of solid Nb2O5 in molten CaCl2.

PubMed

Wu, Tian; Xiao, Wei; Jin, Xianbo; Liu, Chao; Wang, Dihua; Chen, George Z

2008-04-07

Low energy production of Nb powders via computer-aided control (CAC) of two-electrode electrolysis of porous Nb2O5 pellets (ca. 1.0 g) has been successfully demonstrated in molten CaCl2 at 1123 K. It was observed that potentiostatic electrolysis of the oxide in a three-electrode cell led to a cell voltage, i.e. the potential difference between the working (cathode) and counter (anode) electrodes, that decreased to a low and stable value within 1-2 h of the potential application until the end of the electrolysis (up to 12 h in this work). The cell voltage varied closely according to the current change. The stabilised cell voltage was below 2.5 V when the cathode potential was more positive than that for the reduction of Ca2+, leading to much lower energy consumption than that of constant voltage (>3.0 V) two-electrode electrolysis, as previously reported. Using a computer to program the variation of the cell voltage of two-electrode electrolysis according to that observed in the potentiostatic three-electrode electrolysis (0.05 V vs. Ca/Ca2+), a Nb powder with ca. 3900 ppm oxygen was produced in 12 h, with the energy consumption being 37.4% less than that of constant voltage two-electrode electrolysis at 3.0 V. Transmission electron microscopy revealed thin oxide layers (4-6 nm) on individual nodular particles (1-5 microm) of the obtained Nb powder. The oxide layer was likely formed in post-electrolysis processing operations, including washing in water, and contributed largely to the oxygen content in the obtained Nb powder.

Trace Impurity Analysis in Ta Films Using Glow Discharge Mass Spectrometry: Concentration Change of Impurities by Applying Negative Substrate Bias Voltage

NASA Astrophysics Data System (ADS)

Lim, Jae-Won; Mimura, Kouji; Isshiki, Minoru

2004-12-01

Glow discharge mass spectrometry (GDMS) was used to analyze a Ta target and Ta films for trace impurities. The Ta films were deposited on Si (100) substrate at substrate bias voltages of 0 V and -125 V using a non-mass separated ion beam deposition system. Although both Ta films were contaminated by impurities during the deposition, the Ta film deposited at a substrate bias voltage of -125 V showed lower impurity content than the Ta film deposited without the substrate bias voltage, which means that applying a negative bias voltage to the substrate decreased the total concentration of impurities. Furthermore, the concentration change of individual impurities in the Ta film is related to their ionization ratio in the argon discharge plasma. Considering the effect of the ionization potential of an individual impurity on the ionization ratio, purification by applying a negative bias voltage to the substrate results from Penning ionization and an ionization mechanism proposed in this study, as well as from the difference between the kinetic energies of Ta neutral atoms and Ta+ ions accelerated toward the substrate with/without a negative substrate bias voltage.

Sodium-sulfur technology evaluation at Argonne National Laboratory

NASA Astrophysics Data System (ADS)

Mulcahey, T. P.; Tummillo, A. F.; Hogrefe, R. L.; Christianson, C. C.; Biwer, R.; Webster, C. E.; Lee, J.; Miller, J. F.; Marr, J. J.; Smaga, J. A.

The Analysis and Diagnostics Laboratory (ADL) at Argonne National Laboratory has completed evaluation of the Ford Aerospace and Communication Corp. (FACC) technology in the form of four load-levelling (LL) cells, five electric vehicle (EV) cells, and a sub-battery of 89 series connected EV cells. The ADL also has initiated evaluation of the Chloride Silent Power Limited (CSPL) sodium-sulfur (PB) battery technology in the form of 8 individual cells. The evaluation of the FACC-LL cells consisted of an abbreviated performance characterization followed by life-cycle tests on two individual cells and life-cycle tests only on the two other individual cells. The evaluation indicated that the technology was improving, but long-term (life) reliability was not yet adequate for utility applications. The cells exhibited individual cycle lives ranging from 659 to over 1366 cycles, which is equivalent to 2 1/2 to 5 1/2 years in utility use. It was also found that full-cell capacity could only be maintained by applying a special charge regime, regularly or periodically, that consisted of a constant-current followed by a constant-voltage.

Hollandites as a new class of multiferroics

PubMed Central

Liu, Shuangyi; Akbashev, Andrew R.; Yang, Xiaohao; Liu, Xiaohua; Li, Wanlu; Zhao, Lukas; Li, Xue; Couzis, Alexander; Han, Myung-Geun; Zhu, Yimei; Krusin-Elbaum, Lia; Li, Jackie; Huang, Limin; Billinge, Simon J. L.; Spanier, Jonathan E.; O'Brien, Stephen

2014-01-01

Discovery of new complex oxides that exhibit both magnetic and ferroelectric properties is of great interest for the design of functional magnetoelectrics, in which research is driven by the technologically exciting prospect of controlling charges by magnetic fields and spins by applied voltages, for sensors, 4-state logic, and spintronics. Motivated by the notion of a tool-kit for complex oxide design, we developed a chemical synthesis strategy for single-phase multifunctional lattices. Here, we introduce a new class of multiferroic hollandite Ba-Mn-Ti oxides not apparent in nature. BaMn3Ti4O14.25, designated BMT-134, possesses the signature channel-like hollandite structure, contains Mn4+ and Mn3+ in a 1:1 ratio, exhibits an antiferromagnetic phase transition (TN ~ 120 K) with a weak ferromagnetic ordering at lower temperatures, ferroelectricity, a giant dielectric constant at low frequency and a stable intrinsic dielectric constant of ~200 (1-100 MHz). With evidence of correlated antiferromagnetic and ferroelectric order, the findings point to an unexplored family of structures belonging to the hollandite supergroup with multifunctional properties, and high potential for developing new magnetoelectric materials. PMID:25160888

Automatic oscillator frequency control system

NASA Technical Reports Server (NTRS)

Smith, S. F. (Inventor)

1985-01-01

A frequency control system makes an initial correction of the frequency of its own timing circuit after comparison against a frequency of known accuracy and then sequentially checks and corrects the frequencies of several voltage controlled local oscillator circuits. The timing circuit initiates the machine cycles of a central processing unit which applies a frequency index to an input register in a modulo-sum frequency divider stage and enables a multiplexer to clock an accumulator register in the divider stage with a cyclical signal derived from the oscillator circuit being checked. Upon expiration of the interval, the processing unit compares the remainder held as the contents of the accumulator against a stored zero error constant and applies an appropriate correction word to a correction stage to shift the frequency of the oscillator being checked. A signal from the accumulator register may be used to drive a phase plane ROM and, with periodic shifts in the applied frequency index, to provide frequency shift keying of the resultant output signal. Interposition of a phase adder between the accumulator register and phase plane ROM permits phase shift keying of the output signal by periodic variation in the value of a phase index applied to one input of the phase adder.

Two-stage electrostatic precipitator using induction charging

NASA Astrophysics Data System (ADS)

Takashima, Kazunori; Kohno, Hiromu; Katatani, Atsushi; Kurita, Hirofumi; Mizuno, Akira

2018-05-01

An electrostatic precipitator (ESP) without using corona discharge was investigated herein. The ESP employed a two-stage configuration, consisting of an induction charging-based particle charger and a parallel plate type particle collector. By applying a high voltage of several kV, under which no corona discharge was generated in the charger, particles were charged by induction due to contact with charger electrodes. The amount of charge on the charged particles increased with the applied voltage and turbulent air flow in the charger. Performance of the ESP equipped with the induction charger was investigated using ambient air. The removal efficiency for particles ranging 0.3 µm to 5 µm in diameter increased with applied voltage and turbulence intensity of gas flow in the charger when the applied voltage was sufficiently low not to generate corona discharge. This suggests that induction charging can be used for electrostatic precipitation, which can reduce ozone generation and power consumption significantly.

METHOD AND APPARATUS FOR DETERMINING AMALGAM DECOMPOSITION RATE

DOEpatents

Johnson, R.W.; Wright, C.C.

1962-04-24

A method and apparatus for measuring the rate at which an amalgam decomposes in contact with aqueous solutions are described. The amalgam and an aqueous hydroxide solution are disposed in an electrolytic cell. The amalgam is used as the cathode of the cell, and an electrode and anode are disposed in the aqueous solution. A variable source of plating potential is connected across the cell. The difference in voltage between the amalgam cathode and a calibrated source of reference potential is used to control the variable source to null the difference in voltage and at the same time to maintain the concentration of the amalgam at some predetermined constant value. The value of the current required to maintain this concentration constant is indicative of the decomposition rate of the amalgam. (AEC)

Method for sensing and measuring a concentration or partial pressure of a reactant used in a redox reaction

DOEpatents

Findl, E.

1984-12-21

A method for sensing or measuring the partial pressure or concentration of an electroactive species used in conjunction with an electrolyte, the method being characterized by providing a constant current between an anode and a cathode of an electrolyte-containing cell, while measuring changes in voltage that occur between either the anode and cathode or between a reference electrode and one of the main electrodes of the cell, thereby to determine the concentration or partial pressure of the electro-active species as a function of said measured voltage changes. The method of the invention can be practiced using either a cell having only an anode and a cathode, or using a cell having an anode and a cathode in combination with a reference electrode. Accurate measurements of small concentrations or partial pressures of electro-active species are obtainable with the method of the invention, by using constant currents of only a few microamperes between the anode and cathode of the cell, while the concentration-determining voltage is measured.

Structural changes in a commercial lithium-ion battery during electrochemical cycling: An in situ neutron diffraction study

NASA Astrophysics Data System (ADS)

Sharma, Neeraj; Peterson, Vanessa K.; Elcombe, Margaret M.; Avdeev, Maxim; Studer, Andrew J.; Blagojevic, Ned; Yusoff, Rozila; Kamarulzaman, Norlida

The structural response to electrochemical cycling of the components within a commercial Li-ion battery (LiCoO 2 cathode, graphite anode) is shown through in situ neutron diffraction. Lithuim insertion and extraction is observed in both the cathode and anode. In particular, reversible Li incorporation into both layered and spinel-type LiCoO 2 phases that comprise the cathode is shown and each of these components features several phase transitions attributed to Li content and correlated with the state-of-charge of the battery. At the anode, a constant cell voltage correlates with a stable lithiated graphite phase. Transformation to de-lithiated graphite at the discharged state is characterised by a sharp decrease in both structural cell parameters and cell voltage. In the charged state, a two-phase region exists and is composed of the lithiated graphite phase and about 64% LiC 6. It is postulated that trapping Li in the solid|electrolyte interface layer results in minimal structural changes to the lithiated graphite anode across the constant cell voltage regions of the electrochemical cycle.

Flight Demonstration of a Shock Location Sensor Using Constant Voltage Hot-Film Anemometry

NASA Technical Reports Server (NTRS)

Moes, Timothy R.; Sarma, Garimella R.; Mangalam, Siva M.

1997-01-01

Flight tests have demonstrated the effectiveness of an array of hot-film sensors using constant voltage anemometry to determine shock position on a wing or aircraft surface at transonic speeds. Flights were conducted at the NASA Dryden Flight Research Center using the F-15B aircraft and Flight Test Fixture (FTF). A modified NACA 0021 airfoil was attached to the side of the FTF, and its upper surface was instrumented to correlate shock position with pressure and hot-film sensors. In the vicinity of the shock-induced pressure rise, test results consistently showed the presence of a minimum voltage in the hot-film anemometer outputs. Comparing these results with previous investigations indicate that hot-film anemometry can identify the location of the shock-induced boundary layer separation. The flow separation occurred slightly forward of the shock- induced pressure rise for a laminar boundary layer and slightly aft of the start of the pressure rise when the boundary layer was tripped near the airfoil leading edge. Both minimum mean output and phase reversal analyses were used to identify the shock location.

Rotating flux-focusing eddy current probe for flaw detection

NASA Technical Reports Server (NTRS)

Wincheski, Russell A. (Inventor); Fulton, James P. (Inventor); Nath, Shridhar C. (Inventor); Simpson, John W. (Inventor); Namkung, Min (Inventor)

1997-01-01

A flux-focusing electromagnetic sensor which uses a ferromagnetic flux-focusing lens simplifies inspections and increases detectability of fatigue cracks about circular fasteners and other circular inhomogeneities in high conductivity material. The unique feature of the device is the ferrous shield isolating a high-turn pick-up coil from an excitation coil, The use of the magnetic shield is shown to produce a null voltage output across the receiving coil in the presence of an unflawed sample. A redistribution of the current flow in the sample caused by the presence of flaws, however, eliminates the shielding condition and a large output voltage is produced, yielding a clear unambiguous flaw signal. By rotating the probe in a path around a circular fastener such as a rivet while maintaining a constant distance between the probe and the center of a rivet, the signal due to current flow about the rivet can be held constant. Any further changes in the current distribution, such as due to a fatigue crack at the rivet joint, can be detected as an increase in the output voltage above that due to the flow about the rivet head.

Investigation of nanosecond pulsed dielectric barrier discharge using plate-to-plate electrode with asymmetric dielectric arrangement in airflow

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qi, Haicheng; School of Physics Science and Technology, Anshan Normal University, Anshan 114005; Fan, Zhihui

Atmospheric pressure dielectric barrier discharge plasma is produced in airflow by applying nanosecond high voltage pulses with peak voltage about 35 kV and rising time about 40 ns on a plate-to-plate electrode arrangement. The effects of airflow rate (0–50 m/s) on the discharge characteristics are investigated under different barrier conditions (the bare anode case and the bare cathode case). For both cases, the breakdown voltage and the time lag increase distinctly and the discharge intensity decreases sharply when the airflow rate increases from 0 to 30 m/s, and then keep almost constant until the airflow rate is further increased to 50 m/s. For the baremore » anode case (the cathode is covered by dielectric plate), the discharge mode transforms gradually from filamentary to diffuse discharge with the increasing airflow rate. While for the bare cathode case, some micro-discharge channels are still excited, though the discharge becomes more diffuse when the airflow rate is higher than 30 m/s. By acquiring the time-resolved images of the discharge, it is proved that it is the primary discharge which becomes diffuse when airflow is introduced and the following two discharges of the same voltage pulse occur principally at the positions where the primary discharge is more intense. And in both cases, the plasma temperatures are reduced, but the degree is different. All the phenomena can be explained mainly by the variation of the space charge distribution when the airflow is introduced into the discharge gap. And it is indicated that the bare anode case has an advantage in obtaining diffuse discharge.« less

Determination of electrostatic force and its characteristics based on phase difference by amplitude modulation atomic force microscopy

NASA Astrophysics Data System (ADS)

Wang, Kesheng; Cheng, Jia; Yao, Shiji; Lu, Yijia; Ji, Linhong; Xu, Dengfeng

2016-12-01

Electrostatic force measurement at the micro/nano scale is of great significance in science and engineering. In this paper, a reasonable way of applying voltage is put forward by taking an electrostatic chuck in a real integrated circuit manufacturing process as a sample, applying voltage in the probe and the sample electrode, respectively, and comparing the measurement effect of the probe oscillation phase difference by amplitude modulation atomic force microscopy. Based on the phase difference obtained from the experiment, the quantitative dependence of the absolute magnitude of the electrostatic force on the tip-sample distance and applied voltage is established by means of theoretical analysis and numerical simulation. The results show that the varying characteristics of the electrostatic force with the distance and voltage at the micro/nano scale are similar to those at the macroscopic scale. Electrostatic force gradually decays with increasing distance. Electrostatic force is basically proportional to the square of applied voltage. Meanwhile, the applicable conditions of the above laws are discussed. In addition, a comparison of the results in this paper with the results of the energy dissipation method shows the two are consistent in general. The error decreases with increasing distance, and the effect of voltage on the error is small.

Variable-speed wind power system with improved energy capture via multilevel conversion

DOEpatents

Erickson, Robert W.; Al-Naseem, Osama A.; Fingersh, Lee Jay

2005-05-31

A system and method for efficiently capturing electrical energy from a variable-speed generator are disclosed. The system includes a matrix converter using full-bridge, multilevel switch cells, in which semiconductor devices are clamped to a known constant DC voltage of a capacitor. The multilevel matrix converter is capable of generating multilevel voltage wave waveform of arbitrary magnitude and frequencies. The matrix converter can be controlled by using space vector modulation.

A multi-GHz chaotic optoelectronic oscillator based on laser terminal voltage

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chang, C. Y., E-mail: cychang@gatech.edu; UMI 2958 Georgia Tech-CNRS, Georgia Tech Lorraine, 2 Rue Marconi, F-57070 Metz; Choi, Daeyoung

2016-05-09

A multi-GHz chaotic optoelectronic oscillator based on an external cavity semiconductor laser (ECL) is demonstrated. Unlike the standard optoelectronic oscillators for microwave applications, we do not employ the dynamic light output incident on a photodiode to generate the microwave signal, but instead generate the microwave signal directly by measuring the terminal voltage V(t) of the laser diode of the ECL under constant-current operation, thus obviating the photodiode entirely.

Active voltage contrast imaging of cross-sectional surface of multilayer ceramic capacitor using helium ion microscopy

NASA Astrophysics Data System (ADS)

Sakai, C.; Ishida, N.; Masuda, H.; Nagano, S.; Kitahara, M.; Ogata, Y.; Fujita, D.

2016-08-01

We studied active voltage contrast (AVC) imaging using helium ion microscopy (HIM). We observed secondary electron (SE) images of the cross-sectional surface of multilayer ceramic capacitors (MLCCs) with and without a voltage applied to the internal electrodes. When no voltage was applied, we obtained an image reflecting the material contrast between the Ni internal electrode region and the BaTiO3 dielectric region of the cross-sectional surface of the MLCC. When a voltage was applied, the electrical potential difference between the grounded and the positively biased internal electrodes affected the contrast (voltage contrast). Moreover, attenuation of the SE intensity from the grounded to the positively biased internal electrodes was observed in the dielectric region. Kelvin probe force microscopy (KPFM) measurements of the contact potential difference (CPD) were performed on the same sample. By using the AVC image from the HIM observation and the CPD image from the KPFM measurement, we could quantitatively evaluate the electrical potential. We think that the results of this study will lead to an expansion in the number of applications of HIM.

The effect of the geomagnetic field on negative voltage spheres in the ionospheric plasma: Fluid simulation

NASA Astrophysics Data System (ADS)

Ma, T.-Z.; Schunk, R. W.

1994-07-01

Experiments involving the interaction of spherical conducting objects biases with hight voltages in the Low-Earth-Orbit (LEO) environment have been conducted and designed. In these experiments, both positive and negative voltages have been applied to the spheres. Previously, there have been theoretical and numerical studies of positive voltage spheres in plasmas with and without magnetic fields. There also have been studies of negative voltage objects in unmagnetized plasmas. Here, we used a fluid model to study the plasma response to a negative voltage sphere immersed in a magnetized plasma. Our main purpose was to investigate the role of the magnetic field during the early-time interaction between the negative voltage sphere and the ambient plasma in the LEO environment. In this study, different applied voltages, magnetic field strengths, and rise-times of the applied voltages were considered. It was found that with the strength of the geomagnetic field the ions are basically not affected by the magnetic field on the time scale of hundreds of plasma periods considered in this study. The ion density distribution around the sphere and the collected ion flux by the sphere are basically the same as in the case without the magnetic field. The electron motion is strongly affected by the magnetic field. One effect is to change the nature of the electron over-shoot oscillation from regular to somewhat turbulent. Although the electrons move along the magnetic field much more easily than across the magnetic field, some redirection effect causes the electron density to distribute as if the magnetic field effect is minimal. The sheath struture and the electric field around the sphere tend to be spherical. A finite rise-time of the applied voltage reduces the oscillatory activities and delays the ion acceleration. However, the effect of the rise-time depends on both the duration of the rise-time and the ion plasma period.

Surface streamer propagations on an alumina bead: experimental observation and numerical modeling

NASA Astrophysics Data System (ADS)

Kang, Woo Seok; Kim, Hyun-Ha; Teramoto, Yoshiyuki; Ogata, Atsushi; Lee, Jin Young; Kim, Dae-Woong; Hur, Min; Song, Young-Hoon

2018-01-01

A surface streamer in a simplified packed-bed reactor has been studied both experimentally (through time-resolved ICCD imaging) and theoretically (through two-dimensional numerical modeling). The propagation of streamers on an alumina spherical bead without catalytic coating shows three distinct phases—the generation and propagation of a primary streamer (PS) with a moderate velocity and electric field, fast PS acceleration with an enhanced electric field, and slow secondary streamer (SS) propagation. The velocity of the streamer is less than that of propagation in a gaseous media. The electric field and velocity at the streamer front are maximized when a PS propagates during the interval from the midpoint of the bead to the bottom electrode. The SS exhibits a much lower velocity and electric field compared with the PS. The PS velocity is affected by an external applied voltage, especially when it approaches the ground electrode. However, that of the SS remains constant regardless of the voltage change. The simulation shows that the PS exhibits a high electric field mainly created by the space charge induced by electrons, whereas the SS relies on ion movement with electron decay in a charge-filled thin streamer body.

Analysis of real-time numerical integration methods applied to dynamic clamp experiments.

PubMed

Butera, Robert J; McCarthy, Maeve L

2004-12-01

Real-time systems are frequently used as an experimental tool, whereby simulated models interact in real time with neurophysiological experiments. The most demanding of these techniques is known as the dynamic clamp, where simulated ion channel conductances are artificially injected into a neuron via intracellular electrodes for measurement and stimulation. Methodologies for implementing the numerical integration of the gating variables in real time typically employ first-order numerical methods, either Euler or exponential Euler (EE). EE is often used for rapidly integrating ion channel gating variables. We find via simulation studies that for small time steps, both methods are comparable, but at larger time steps, EE performs worse than Euler. We derive error bounds for both methods, and find that the error can be characterized in terms of two ratios: time step over time constant, and voltage measurement error over the slope factor of the steady-state activation curve of the voltage-dependent gating variable. These ratios reliably bound the simulation error and yield results consistent with the simulation analysis. Our bounds quantitatively illustrate how measurement error restricts the accuracy that can be obtained by using smaller step sizes. Finally, we demonstrate that Euler can be computed with identical computational efficiency as EE.

Exploratory study and application of the angular wavelet analysis for assessing the spatial distribution of breakdown spots in Pt/HfO2/Pt structures

NASA Astrophysics Data System (ADS)

Muñoz-Gorriz, J.; Monaghan, S.; Cherkaoui, K.; Suñé, J.; Hurley, P. K.; Miranda, E.

2017-12-01

The angular wavelet analysis is applied for assessing the spatial distribution of breakdown spots in Pt/HfO2/Pt capacitors with areas ranging from 104 to 105 μm2. The breakdown spot lateral sizes are in the range from 1 to 3 μm, and they appear distributed on the top metal electrode as a point pattern. The spots are generated by ramped and constant voltage stresses and are the consequence of microexplosions caused by the formation of shorts spanning the dielectric film. This kind of pattern was analyzed in the past using the conventional spatial analysis tools such as intensity plots, distance histograms, pair correlation function, and nearest neighbours. Here, we show that the wavelet analysis offers an alternative and complementary method for testing whether or not the failure site distribution departs from a complete spatial randomness process in the angular domain. The effect of using different wavelet functions, such as the Haar, Sine, French top hat, Mexican hat, and Morlet, as well as the roles played by the process intensity, the location of the voltage probe, and the aspect ratio of the device, are all discussed.

Instability analysis of charges trapped in the oxide of metal-ultra thin oxide-semiconductor structures

NASA Astrophysics Data System (ADS)

Aziz, A.; Kassmi, K.; Maimouni, R.; Olivié, F.; Sarrabayrouse, G.; Martinez, A.

2005-09-01

In this paper, we present the theoretical and experimental results of the influence of a charge trapped in ultra-thin oxide of metal/ultra-thin oxide/semiconductor structures (MOS) on the I(Vg) current-voltage characteristics when the conduction is of the Fowler-Nordheim (FN) tunneling type. The charge, which is negative, is trapped near the cathode (metal/oxide interface) after constant current injection by the metal (Vg<0). Of particular interest is the influence on the Δ Vg(Vg) shift over the whole I(Vg) characteristic at high field (greater than the injection field (>12.5 MV/cm)). It is shown that the charge centroid varies linearly with respect to the voltage Vg. The behavior at low field (<12.5 MV/cm) is analyzed in référence A. Aziz, K. Kassmi, Ka. Kassmi, F. Olivié, Semicond. Sci. Technol. 19, 877 (2004) and considers that the trapped charge centroid is fixed. The results obtained make it possible to analyze the influence of the injected charge and the applied field on the centroid position of the trapped charge, and to highlight the charge instability in the ultra-thin oxide of MOS structures.

Improvement in the performance of graphene nanoribbon p-i-n tunneling field effect transistors by applying lightly doped profile on drain region

NASA Astrophysics Data System (ADS)

Naderi, Ali

2017-12-01

In this paper, an efficient structure with lightly doped drain region is proposed for p-i-n graphene nanoribbon field effect transistors (LD-PIN-GNRFET). Self-consistent solution of Poisson and Schrödinger equation within Nonequilibrium Green’s function (NEGF) formalism has been employed to simulate the quantum transport of the devices. In proposed structure, source region is doped by constant doping density, channel is an intrinsic GNR, and drain region contains two parts with lightly and heavily doped doping distributions. The important challenge in tunneling devices is obtaining higher current ratio. Our simulations demonstrate that LD-PIN-GNRFET is a steep slope device which not only reduces the leakage current and current ratio but also enhances delay, power delay product, and cutoff frequency in comparison with conventional PIN GNRFETs with uniform distribution of impurity and with linear doping profile in drain region. Also, the device is able to operate in higher drain-source voltages due to the effectively reduced electric field at drain side. Briefly, the proposed structure can be considered as a more reliable device for low standby-power logic applications operating at higher voltages and upper cutoff frequencies.

Separation of plant hormones from biofertilizer by capillary electrophoresis using a capillary coated dynamically with polycationic polymers.

PubMed

Jiang, Ting-Fu; Lv, Zhi-Hua; Wang, Yuan-Hong; Yue, Mei-E

2006-06-01

A new, simple and rapid capillary electrophoresis (CE) method, using hexadimethrine bromide (HDB) as electroosmotic flow (EOF) modifier, was developed for the identification and quantitative determination of four plant hormones, including gibberellin A3 (GA3), indole-3-acetic acid (IAA), alpha-naphthaleneacetic acid (NAA) and 4-chlorophenoxyacetic acid (4-CA). The optimum separation was achieved with 20 mM borate buffer at pH 10.00 containing 0.005% (w/v) of HDB. The applied voltage was -25 kV and the capillary temperature was kept constant at 25 degrees C. Salicylic acid was used as internal standard for quantification. The calibration dependencies exhibited good linearity within the ratios of the concentrations of standard samples and internal standard and the ratios of the peak areas of samples and internal standard. The correlation coefficients were from 0.9952 to 0.9997. The relative standard deviations of migration times and peak areas were < 1.93 and 6.84%, respectively. The effects of buffer pH, the concentration of HDB and the voltage on the resolution were studied systematically. By this method, the contents of plant hormone in biofertilizer were successfully determined within 7 min, with satisfactory repeatability and recovery.

Feasibility study: Atmospheric general circulation experiment, volume 1

NASA Technical Reports Server (NTRS)

Homsey, R. J. (Editor)

1981-01-01

The atmospheric general circulation experiment (AGCE) uses a rotating fluid flow cell assembly. The key technical areas affecting the feasibility of the design and operation of the AGCE are investigated. The areas investigated include materials for the flow cell assembly, thermal design, high voltage power supply design, effective retrieval and handling of experiment data and apparatus configuration. Several materials, DMSO and m-tolunitrile, were selected as candidate fluids for the flow cell principally for their high dielectric constant which permits the high voltage power supply design to be held to 15 kV and still simulate terrestrial gravity. Achievement of a low dissipation factor in the fluid to minimize internal heating from the applied electrical field depends strongly on purification and handling procedures. The use of sapphire as the outer hemisphere for the flow cell provides excellent viewing conditions without a significant impact on attaining the desired thermal gradients. Birefringent effects from sapphire can be held to acceptably low limits. Visualization of flow fluid is achieved through the motion of a dot matrix formed by photochromic dyes. Two dyes found compatible with the candidate fluids are spiropyran and triarylmethane. The observation of the dot motion is accomplished using a flying spot scanner.

Measurement of insulation integrity of IUE camera tube facsimiles by partial discharges method and diffusion of gases through various silicone rubbers

NASA Technical Reports Server (NTRS)

Bever, R. S.

1977-01-01

Several dummy tubes imitating the IUE Camera System design were encapsulated with Solithane 2, Conathane EN-11, Green and Black Hysols and SMRD 432. Various flaws were purposefully placed in some of these. Partial discharge testing in vacuum under direct voltage conditions was carried once a week for 12 weeks, 15 kv dc being applied during normal working hours for 40 hours duration per week. None of the units showed much damage during this time judging by the P.D. energy histograms. A more complete mathematical presentation is given on diffusion and permeation than previously. Measurements of diffusion constants for various silicone rubbers are carried out by the Time-Lag method and compared to other determinations in the literature. Calculations of the time required for diffusion through a thick wall are demonstrated in the long time approximation and for dimensions pertaining to void and wall sizes of a delamination problem in the LANDSAT-C vidicon tubes. An actual delaminated LANDSAT-C tube and some facsimiles are immersed in vacuum for long periods and tested for catastrophic breakdown due to diffusion of gas, by application of high voltage.